Datasets:

xNoper

/

pubmed-test-sections-sents

like 0

[ [ "in orthodontics , it is important to employ a suitable adhesive technique and methods that not only promote satisfactory bond strength during treatment , but also have a simplified protocol for clinical use , thereby reducing procedural errors and minimizing damage to the dental structure.1 self - etching adhesive systems have acidic components in their composition , thus reducing the number of operative procedures and the inconvenience arising from excessive demineralization of the tooth structure , as occurs in the total acid etching technique.1,2 at present , erbium : yttrium aluminum garnet laser laser ( er : yag ) has been used in dentistry for performing cavity preparations , carious tissue removal , decontamination of cavities and tooth surface conditioning.35 er : yag laser is one of the types most used for hard dental tissue conditioning,5 because it allows the formation of rougher surfaces .", "when it is used on dentin , it removes the tissue with the absence of a smear layer .", "irradiation with erbium laser promotes structural and morphological changes in dental hard tissues.4,6,7 when the tooth surface is conditioned with er : yag laser , a tissue becomes more resistant to acid dissolution around the bracket,4,7 and it appears to be effective for the prevention of caries during orthodontic treatment.8 some studies3,5,911 have pointed out increased retention of the resinous material to enamel irradiated with er : yag laser . however , further studies need to be conducted in order to prove the efficacy of erbium laser for increasing the bond strength of orthodontic adhesives , since these data are controversial in the literature.6,7 a large portion of the studies has evaluated the bond strength of orthodontic brackets immediately after they have been bonded,1,2 but a long - term evaluation deserves emphasis , because once these brackets have been bonded , they have to remain in position throughout the entire orthodontic treatment .", "therefore , studies evaluating accelerated artificial aging / thermal cycling have been suggested in the literature.12 thus , while the self - etching system reduces the inconvenience of excessive demineralization of the tooth,1,2 the association of the er : yag laser with the conventional adhesive system should be evaluated , enamel resistance to acid dissolution after irradiation with er : yag is shown in the literature.4,8 in view of the questions raised , the aim of this study was to evaluate the in vitro bond strength of orthodontic brackets bonded with : total etch , total etch with previous application of er : yag laser and the self - etching adhesive systems after thermal - mechanical cycling , simulating 1 year of treatment .", "the null hypothesis tested was that there would be no statistically significant difference among the bond strength values when the adhesive systems and laser for orthodontic bracket bonding were used ." ], [ "the research project was approved by the ethics commission on animal experimentation of ceuma university ( protocol no .", "073/2013 ) . the research followed the guidelines of national council of control of animal experimentation ( concea ) .", "the experimental procedures were performed on 48 recently extracted deciduous bovine incisors obtained from discarded jaws after slaughter of the animals.13 the teeth were extracted following the procedures of a minimum of trauma .", "the inclusion criteria used for selecting the teeth were tooth enamel without cracks / fractures and without previous application of chemical agents such as thymol , hydrogen peroxide , alcohol or formol .", "wallis test power equal to 75% . a sample size of ( n ) 16 elements in each group was found ( pass 11 , ncss , llc , kaysville , ut , usa ) .", "after this , the coronal pulp was removed with a dentin curette ( duflex lucas no .", "86 , ss white , rio de janeiro , brazil ) and the pulp chamber was cleaned and obliterated with utility wax .", "the teeth were placed in pvc tubes measuring 25 mm20 mm ( tigre , joinville , brazil ) with the vestibular surface positioned at the bottom of the base , and then they were embedded in acrylic resin ( vipi , so paulo , brazil ) .", "the surface was abraded with water and abrasived paper of 200 , 400 , 600 and 1200 grits ( 3 m , sumar , brazil ) with the aid of a polishing machine ( panambra tcnica imp .", "ltda , so paulo , brazil ) , under irrigation and uniform , constant pressure in order to obtain a flat vestibular surface . to prepare the experimental groups ,", "a total of 48 stainless steel orthodontic brackets for maxillary central incisors were used , with a mesh base of 1.5 mm height4.0 mm wide ( roth 0.022 0.030 kirium abzil indstria e comrcio ltda . ,", "prophylaxis of the tooth enamel on the vestibular surface of all the teeth was performed with pumice stone , without fluoride ( ss white ) and water for 10 seconds . in the groups ,", "the following adhesive systems were used : transbond xt ( xt ) , transbond plus self etch primer system ( sep ) and er : yag laser associated with the adhesive system transbond xt ( er : yag / xt ) as specified in table 1 . in the group in which previous irradiation with er : yag laser ( kavo key iii , kavo , kirchdorf biberach , germany ) was performed ,", "the wavelength of 2.94 m was used with a # 2051 handpiece and spot diameter of 0.63 mm ( table 1 ) .", "for all the groups , the brackets were positioned with transbond xt resin ( 3 m ) on the base , excess was removed and light polymerization was performed for 10 seconds on each surface of the bracket ( mesial , distal , cervical and incisal ) .", "maximum pressure was applied during bracket bonding in order to standardize the force exerted and the thickness of the resin pellicle , as soon as they were placed on the teeth .", "all the procedures were carried out by one single , duly trained and calibrated operator .", "light polymerization of the adhesive system and resin was performed with a fast - curing cordless led light ( 3 m espe dental , landsberg am lech , germany ) polymerizing apparatus , with light intensity of approximately 800 mw / cm , checked with a radiometer ( gnatus , ribeiro preto , brazil ) .", "the experimental groups were submitted to varying thermal - mechanical cycles , using a fatigue simulator appliance ( er 11000 , erios , so paulo , brazil ) . in order to simulate 1 year of clinical treatment", ", 100,000 mechanical cycles and 500 thermal cycles were performed , which ranged between 5c and 55c ( iso 11405).14,15 a universal test machine ( emic , so jos dos pinhais , brazil ) was used , with a 50 kg load applied parallel to the vestibular enamel surface , in the incisor - cervical direction close to the enamel / adhesive interface , at 0.5 mm / min until fracture occurred.15,16 the force required to remove the brackets was measured in newton ( n ) and the shear strength in megapascals ( mpa ) .", "the results were obtained with the aid of the computer software program ( tesc ) connected to the emic universal test machine . after the shear bond test", ", the samples were analyzed under a stereomicroscope lens ( kozo optical and electronical instrumental , nanjing - jiangsu , people s republic of china ) , at 20 magnification to determine the adhesive remnant index ( ari ) .", "this measurement was made in accordance with the scores that ranged from 0 to 3 : 0 no composite resin adhered to enamel ; 1 less than half percent of composite resin on enamel ; 2 more than half percent of composite resin on enamel ; and 3 all composite resin on enamel , showing the bracket mesh impression.17,18 afterward , the samples were prepared and submitted to analysis by sem in order to visualize the adhesive remnant and/or the enamel condition after bracket removal .", "images were captured by means of a specific software program coupled to the sem ( inspect 550 , fei ) , allowing photomicrographs to be obtained .", "the data obtained were statistically analyzed by means of kruskal wallis and mann whitney tests with bonferroni correction to verify differences between the studied groups , since the distribution of data was not considered normal , according to the shapiro wilk test .", "the ari data , which were presented as an ordinal qualitative variable , were statistically analyzed with kruskal wallis and dunn tests .", "the analyses were performed using the statistical software program statistical package for the social sciences ( spss ) statistics version 20.0 ( ibm , armonk , ny , usa ) ." ], [ "the research project was approved by the ethics commission on animal experimentation of ceuma university ( protocol no .", "073/2013 ) . the research followed the guidelines of national council of control of animal experimentation ( concea ) .", "the experimental procedures were performed on 48 recently extracted deciduous bovine incisors obtained from discarded jaws after slaughter of the animals.13 the teeth were extracted following the procedures of a minimum of trauma .", "the inclusion criteria used for selecting the teeth were tooth enamel without cracks / fractures and without previous application of chemical agents such as thymol , hydrogen peroxide , alcohol or formol .", "wallis test power equal to 75% . a sample size of ( n ) 16 elements in each group was found ( pass 11 , ncss , llc , kaysville , ut , usa ) .", "after this , the coronal pulp was removed with a dentin curette ( duflex lucas no .", "86 , ss white , rio de janeiro , brazil ) and the pulp chamber was cleaned and obliterated with utility wax .", "the teeth were placed in pvc tubes measuring 25 mm20 mm ( tigre , joinville , brazil ) with the vestibular surface positioned at the bottom of the base , and then they were embedded in acrylic resin ( vipi , so paulo , brazil ) .", "the surface was abraded with water and abrasived paper of 200 , 400 , 600 and 1200 grits ( 3 m , sumar , brazil ) with the aid of a polishing machine ( panambra tcnica imp .", "ltda , so paulo , brazil ) , under irrigation and uniform , constant pressure in order to obtain a flat vestibular surface . to prepare the experimental groups ," ], [ "a total of 48 stainless steel orthodontic brackets for maxillary central incisors were used , with a mesh base of 1.5 mm height4.0 mm wide ( roth 0.022 0.030 kirium abzil indstria e comrcio ltda .", "prophylaxis of the tooth enamel on the vestibular surface of all the teeth was performed with pumice stone , without fluoride ( ss white ) and water for 10 seconds . in the groups ,", "the following adhesive systems were used : transbond xt ( xt ) , transbond plus self etch primer system ( sep ) and er : yag laser associated with the adhesive system transbond xt ( er : yag / xt ) as specified in table 1 . in the group in which previous irradiation with er : yag laser ( kavo key iii , kavo , kirchdorf biberach , germany ) was performed ,", "the wavelength of 2.94 m was used with a # 2051 handpiece and spot diameter of 0.63 mm ( table 1 ) .", "for all the groups , the brackets were positioned with transbond xt resin ( 3 m ) on the base , excess was removed and light polymerization was performed for 10 seconds on each surface of the bracket ( mesial , distal , cervical and incisal ) .", "maximum pressure was applied during bracket bonding in order to standardize the force exerted and the thickness of the resin pellicle , as soon as they were placed on the teeth .", "all the procedures were carried out by one single , duly trained and calibrated operator .", "light polymerization of the adhesive system and resin was performed with a fast - curing cordless led light ( 3 m espe dental , landsberg am lech , germany ) polymerizing apparatus , with light intensity of approximately 800 mw / cm , checked with a radiometer ( gnatus , ribeiro preto , brazil ) ." ], [ "the experimental groups were submitted to varying thermal - mechanical cycles , using a fatigue simulator appliance ( er 11000 , erios , so paulo , brazil ) . in order to simulate 1 year of clinical treatment ,", "100,000 mechanical cycles and 500 thermal cycles were performed , which ranged between 5c and 55c ( iso 11405).14,15" ], [ "a universal test machine ( emic , so jos dos pinhais , brazil ) was used , with a 50 kg load applied parallel to the vestibular enamel surface , in the incisor - cervical direction close to the enamel / adhesive interface , at 0.5 mm / min until fracture occurred.15,16 the force required to remove the brackets was measured in newton ( n ) and the shear strength in megapascals ( mpa ) .", "the results were obtained with the aid of the computer software program ( tesc ) connected to the emic universal test machine ." ], [ "after the shear bond test , the samples were analyzed under a stereomicroscope lens ( kozo optical and electronical instrumental , nanjing - jiangsu , people s republic of china ) , at 20 magnification to determine the adhesive remnant index ( ari ) .", "this measurement was made in accordance with the scores that ranged from 0 to 3 : 0 no composite resin adhered to enamel ; 1 less than half percent of composite resin on enamel ; 2 more than half percent of composite resin on enamel ; and 3 all composite resin on enamel , showing the bracket mesh impression.17,18 afterward , the samples were prepared and submitted to analysis by sem in order to visualize the adhesive remnant and/or the enamel condition after bracket removal .", "images were captured by means of a specific software program coupled to the sem ( inspect 550 , fei ) , allowing photomicrographs to be obtained ." ], [ "the data obtained were statistically analyzed by means of kruskal wallis and mann whitney tests with bonferroni correction to verify differences between the studied groups , since the distribution of data was not considered normal , according to the shapiro ", "the ari data , which were presented as an ordinal qualitative variable , were statistically analyzed with kruskal wallis and dunn tests .", "the analyses were performed using the statistical software program statistical package for the social sciences ( spss ) statistics version 20.0 ( ibm , armonk , ny , usa ) ." ], [ "the inferential and descriptive statistics of the bond strength of the groups are shown in table 2 .", "after simulation of 1 year of treatment , it was observed that xt and sep groups presented the highest shear bond strength values , without statistical differences between them .", "however xt / er : yag group showed a reduction in mean bond strength values ( table 2 ) .", "the condition in which there was greatest predominance of ari=0 was that of group xt / er : yag . the score 0 was the most found in the groups , representing adhesive failures .", "the exception was group sep , in which there was predominance of ari=3 ( all the adhesive remnant on the enamel surface with the impression of the bracket base ) ( table 3 ) . in group", "xt / er : yag , it was observed that the dental ablation performed by er : yag laser promoted the formation of craters and imperfections in the enamel , which were restricted to the ablated area , without the occurrence of fractures or cracks ( figure 1 ) . in groups xt and sep , by means of sem ," ], [ "the inferential and descriptive statistics of the bond strength of the groups are shown in table 2 .", "after simulation of 1 year of treatment , it was observed that xt and sep groups presented the highest shear bond strength values , without statistical differences between them .", "however xt / er : yag group showed a reduction in mean bond strength values ( table 2 ) ." ], [ "the condition in which there was greatest predominance of ari=0 was that of group xt / er : yag .", "the exception was group sep , in which there was predominance of ari=3 ( all the adhesive remnant on the enamel surface with the impression of the bracket base ) ( table 3 ) ." ], [ "in group xt / er : yag , it was observed that the dental ablation performed by er : yag laser promoted the formation of craters and imperfections in the enamel , which were restricted to the ablated area , without the occurrence of fractures or cracks ( figure 1 ) . in groups xt and sep , by means of sem ," ], [ "the constant development of materials and techniques for dental bonding offers various clinical options for bonding orthodontic accessories . in this study , after simulation of 1 year of orthodontic treatment , the conventional and self - etching adhesive systems were found to show adequate bond strength ; however , previous enamel treatment with er : yag laser ( 60 mj , energy density 19.24 j / cm ) reduced the bond strength of brackets bonded to enamel .", "the bond strength of orthodontic brackets is usually verified 24 hours after they were bonded.16,18 however , not only the primary stability of orthodontic brackets but also their longevity are extremely important ; nevertheless , most of the in vitro studies16,18 do not use artificial fatigue tests before evaluating the bond strength .", "it is proposed in the literature that thermal or thermal - mechanical cycling12 should be performed before the bond strength test , as was done in the present study .", "after simulation of 1 year of orthodontic treatment , groups sep ( self - etching adhesive\\10.3 mpa ) and xt ( total etch adhesive\\10.8 mpa ) were statistically similar between them,1,12 and presented mean bond strength values corroborating the findings in the literature.1,6 the group treated with er : yag laser / xt ( 7.4 mpa ) showed the lowest bond strength values , and these findings do not differ from those of studies that observed the bond strength 24 hours after bracket bonding to enamel previously treated with er : yag laser.6 however , it is reported in the literature19 that the variation between 5 and 50 mpa indicates the ideal values of bond strength , contributing to the findings of the present study .", "previous studies14,2022 have suggested the use of enamel conditioning with er : yag laser before orthodontic bracket bonding , with the intention of obtaining a tissue that was more resistant to acid dissolution around the brackets .", "however , it is difficult to compare the results , because various experimental conditions are used ; while some combined the use of laser with acid,8,10 others used laser only to promote conditioning.6,21,22 enamel conditioning performed with laser parameters similar to those used for cavity preparations23 has also been suggested,11 and although adequate bond strength was obtained , severe and permanent damage to tooth enamel was generated.10 it has been reported that er : yag laser is a potentially adequate method for conditioning enamel,3,10,11 but it generates lower bond strength values when compared with the conventional acid etching technique.8,24 a low energy level of er : yag laser ( 60 mj ) was used in this study for previous conditioning of the enamel as described25,26 because it has been proposed that low energy levels ( 6080 mj ) are capable of promoting demineralization without causing severe changes in enamel.25 a reduction of bond strength was observed , as has been pointed out in studies,25 in which different adhesive systems have been used , and the laser with the same parameters as those used in this study .", "however , even with the use of 150 mj and an energy density similar to that used in our study ( 19.1 j / cm ) , the study by contreras - bulnes et al,6 who verified this parameter for conditioning enamel with the use of er : yag laser , also presented a significant reduction in bond strength , while other studies found adequate bond strength values after the use of these parameters.21,22 conditioning with er : yag laser promotes lower tensile stress and demineralization when compared with phosphoric acid.8 the reduction in bond strength may also be related to the fact that the microhardness and modulus of elasticity of enamel are increased after irradiation with er : yag laser , when compared with enamel etched with phosphoric acid , which promotes a reduction in microhardness and modulus of elasticity.7 the application of er : yag laser has also been correlated with the presence of micro - fractures in the enamel subsurface and dentin , which are unfavorable to the bonding process.6,24 after treatment with phosphoric acid , a typical etching pattern is formed with mixed areas of removal of nucleus or peripheral portion of the core of the enamel prism.6 er : yag laser increases the free surface energy and roughness of enamel and dentin ; however , it does not produce a desirable morphology for the bonding process.27 the bond strength of orthodontic brackets bonded to enamel previously treated with er : yag laser is still controversial , probably due to the difference in the methodologies used , and mainly in the variation of the energy and frequency parameters.10,28 the highest frequency of failures was verified at the adhesive / enamel interface .", "the exception was group sep , whose bond failure occurred with greater frequency at the adhesive / bracket interface , corroborating the findings in the literature.1 the use of self - etching adhesive appears to favor this condition , which in practice may mean less risk of unpredictable damage to the enamel surface at the time of bracket removal by the professional , however , with the need to remove the adhesive remnant on the tooth surface after debonding . according to the observations by sem , the conventional and self - etching adhesives did not present damage to enamel after debonding . the er : yag laser promoted permanent irregularities in tooth enamel , even when using a low level of energy ( 60 mj ) and may generate an increase in enamel roughness and microfissures.6 in vitro studies have limitations because they do not reproduce the oral environment in all its complexity . however , laboratory studies are important because preliminary evaluations are necessary to indicate the feasibility of the clinical application of dental techniques and materials .", "therefore , in vitro studies require further investigation to elucidate the influence of these resinous materials and the behavior of the er : yag laser ( associated to different irradiation parameters and/or subjected to erosive cycles ) on the surface of the dental enamel , contributing to the improvement of longevity of the adhesive techniques of brackets and their clinical applicability ." ], [ "within the limitations of this study , after simulation of 1 year of orthodontic treatment , by means of thermal - mechanical cycling , it was possible to observe that : \n the conventional ( xt ) and self - etching ( sep ) adhesive systems presented similar mean bond strength values between them.the previous application of er : yag laser , within the parameters used , associated with the use of the conventional adhesive system ( xt ) promoted the lowest bond strength values.with exception of the group treated with self - etching adhesive , a large portion of the failures occurred at the enamel / adhesive interface . the conventional ( xt ) and self - etching ( sep ) adhesive systems presented similar mean bond strength values between them .", "the previous application of er : yag laser , within the parameters used , associated with the use of the conventional adhesive system ( xt ) promoted the lowest bond strength values .", "with exception of the group treated with self - etching adhesive , a large portion of the failures occurred at the enamel / adhesive interface ." ] ]

[ [ "methylmalonic acidemia ( mma ) encompasses a heterogeneous group of disorders that is characterized by impaired metabolism of methylmalonic acid that is generated during the metabolism of certain amino acids ( isoleucine , methionine , threonine , or valine ) .", "the incidence rate of mma is 1 in 50,00080,000 newborns but it is more common in countries with high amount of consanguinity and countries with no systematic newborn screening , like developing countries .", "patients typically presents at the age of 1-month to 1-year with varied presentations of symptoms ranging from poor feeding , vomiting , dehydration , shock , hypoglycemia , hyperammonemia and hyperglycemias with high anion gap ( ag ) metabolic acidosis if left untreated can lead coma or even death .", "mma may present suddenly in older infants without initial apparent symptoms , which may mimic septic shock and diabetic ketoacidosis ( dka ) and without early recognition can lead fatal consequences .", "here we are reporting two cases of mma in infants presented with severe high ag metabolic acidosis mimicking as dka in one case and septic shock in an another case even without any initial apparent symptoms ." ], [ "we report an 8-month - old male child presented in an emergency department with hypotensive shock , respiratory failure and disseminated intravascular coagulation with a short history of nonspecific low grade fever associated with upper respiratory infection and vomiting since 1-day .", "his initial investigation showed : hemoglobin ( hb)-6.0 g / dl , total leukocyte count ( tlc)-4500 with 55% neutrophil , platelet counts 65/nl , c - reactive protein ( crp)-10 mg / dl , protein thiolation index / activated partial thromboplastin time - no clot , international normalized ratio-9 , serum glutamic - oxaloacetic transaminase / prothrombin time - 65/42 and arterial blood gas was ph-7.0 , hco3 - 2.4 , lactate-2.2 , ag-28 , blood sugar-122 mg / dl , urine analysis 4 + ketones .", "blood culture was sterile and cerebrospinal fluid ( csf ) examination done after stabilization came normal .", "ketoacidosis remain persisted even after the 24 h of reversal of shock requiring sodium bicarbonate infusion .", "the child was conservatively managed with fluids , inotropes , fresh frozen plasma , pack cell transfusion , sodium bicarbonate , antibiotics , low protein diet , methylcobalamin , and carnitine .", "the child responded well to treatment and was extubated after 72 h of admission was shifted out of pediatric intensive care unit ( picu ) on 5 day .", "the child was discharged on 10 day on oral b12 supplementation and low protein diet .", "we report a 2 case of previously healthy 1-year - old male child with altered sensorium with a short history of vomiting and low grade fever with no history of seizures . on examination child", "was comatose with glasgow coma scale score 9 , kussmaul breathing with signs of dehydration .", "his initial investigation showed hb-8.4 g / dl , tlc-15,200/cmm with 70% neutrophils , platelet counts - 720/nl , crp - 12 mg / dl , blood gas ph - 7.119 , hco3 - 3.7 , ag - 44 , lactate 1.04 , blood sugar - 485 mg / dl , urine 4 + ketones .", "an initial diagnosis of dka was made , and stranded treatment with fluids and insulin infusion was started .", "other causes of poor response to insulin e.g. ; dose , administration , and infection were ruled out .", "persistence of severe high ag metabolic acidosis after 24 h of admission with hemoglobin a1c 4.9% , underlying metabolic disorder was suspected and was investigated to rule out organic acidemia and had high levels of methyl malonic acid .", "insulin was discontinued and started on b12 , carnitine , low protein diet and sodium bicarbonate and the child responded well to treatment , acidosis was corrected after 24 h and he was shifted out of picu on 5 day ." ], [ "we report an 8-month - old male child presented in an emergency department with hypotensive shock , respiratory failure and disseminated intravascular coagulation with a short history of nonspecific low grade fever associated with upper respiratory infection and vomiting since 1-day .", "his initial investigation showed : hemoglobin ( hb)-6.0 g / dl , total leukocyte count ( tlc)-4500 with 55% neutrophil , platelet counts 65/nl , c - reactive protein ( crp)-10 mg / dl , protein thiolation index / activated partial thromboplastin time - no clot , international normalized ratio-9 , serum glutamic - oxaloacetic transaminase / prothrombin time - 65/42 and arterial blood gas was ph-7.0 , hco3 - 2.4 , lactate-2.2 , ag-28 , blood sugar-122 mg / dl , urine analysis 4 + ketones .", "blood culture was sterile and cerebrospinal fluid ( csf ) examination done after stabilization came normal .", "ketoacidosis remain persisted even after the 24 h of reversal of shock requiring sodium bicarbonate infusion .", "the child was conservatively managed with fluids , inotropes , fresh frozen plasma , pack cell transfusion , sodium bicarbonate , antibiotics , low protein diet , methylcobalamin , and carnitine .", "the child responded well to treatment and was extubated after 72 h of admission was shifted out of pediatric intensive care unit ( picu ) on 5 day .", "the child was discharged on 10 day on oral b12 supplementation and low protein diet .", "we report a 2 case of previously healthy 1-year - old male child with altered sensorium with a short history of vomiting and low grade fever with no history of seizures . on examination child", "was comatose with glasgow coma scale score 9 , kussmaul breathing with signs of dehydration .", "his initial investigation showed hb-8.4 g / dl , tlc-15,200/cmm with 70% neutrophils , platelet counts - 720/nl , crp - 12 mg / dl , blood gas ph - 7.119 , hco3 - 3.7 , ag - 44 , lactate 1.04 , blood sugar - 485 mg / dl , urine 4 + ketones .", "an initial diagnosis of dka was made , and stranded treatment with fluids and insulin infusion was started .", "other causes of poor response to insulin e.g. ; dose , administration , and infection were ruled out .", "persistence of severe high ag metabolic acidosis after 24 h of admission with hemoglobin a1c 4.9% , underlying metabolic disorder was suspected and was investigated to rule out organic acidemia and had high levels of methyl malonic acid .", "insulin was discontinued and started on b12 , carnitine , low protein diet and sodium bicarbonate and the child responded well to treatment , acidosis was corrected after 24 h and he was shifted out of picu on 5 day ." ], [ "we report an 8-month - old male child presented in an emergency department with hypotensive shock , respiratory failure and disseminated intravascular coagulation with a short history of nonspecific low grade fever associated with upper respiratory infection and vomiting since 1-day .", "his initial investigation showed : hemoglobin ( hb)-6.0 g / dl , total leukocyte count ( tlc)-4500 with 55% neutrophil , platelet counts 65/nl , c - reactive protein ( crp)-10 mg / dl , protein thiolation index / activated partial thromboplastin time - no clot , international normalized ratio-9 , serum glutamic - oxaloacetic transaminase / prothrombin time - 65/42 and arterial blood gas was ph-7.0 , hco3 - 2.4 , lactate-2.2 , ag-28 , blood sugar-122 mg / dl , urine analysis 4 + ketones .", "blood culture was sterile and cerebrospinal fluid ( csf ) examination done after stabilization came normal .", "ketoacidosis remain persisted even after the 24 h of reversal of shock requiring sodium bicarbonate infusion .", "the child was conservatively managed with fluids , inotropes , fresh frozen plasma , pack cell transfusion , sodium bicarbonate , antibiotics , low protein diet , methylcobalamin , and carnitine .", "the child responded well to treatment and was extubated after 72 h of admission was shifted out of pediatric intensive care unit ( picu ) on 5 day .", "the child was discharged on 10 day on oral b12 supplementation and low protein diet ." ], [ "we report a 2 case of previously healthy 1-year - old male child with altered sensorium with a short history of vomiting and low grade fever with no history of seizures . on examination child", "was comatose with glasgow coma scale score 9 , kussmaul breathing with signs of dehydration .", "his initial investigation showed hb-8.4 g / dl , tlc-15,200/cmm with 70% neutrophils , platelet counts - 720/nl , crp - 12 mg / dl , blood gas ph - 7.119 , hco3 - 3.7 , ag - 44 , lactate 1.04 , blood sugar - 485 mg / dl , urine 4 + ketones .", "an initial diagnosis of dka was made , and stranded treatment with fluids and insulin infusion was started .", "other causes of poor response to insulin e.g. ; dose , administration , and infection were ruled out .", "persistence of severe high ag metabolic acidosis after 24 h of admission with hemoglobin a1c 4.9% , underlying metabolic disorder was suspected and was investigated to rule out organic acidemia and had high levels of methyl malonic acid .", "insulin was discontinued and started on b12 , carnitine , low protein diet and sodium bicarbonate and the child responded well to treatment , acidosis was corrected after 24 h and he was shifted out of picu on 5 day ." ], [ "methylmalonic acidemia is a rare autosomal recessive disease in which there is a deficiency in conversion of methylmalonic coenzyme a ( coa ) to succinyl coa .", "mma appears to be more common than other organic academia perhaps because it has several underlying causes .", "affected infants present in the first few days of life with vomiting , respiratory distress , feeding intolerance , lethargy , and severe ketoacidosis , which , if not aggressively treated , often progresses rapidly to coma and death .", "it occurs in older children who usually have low levels of methyl malonic acid in blood and urine and have normal growth and development .", "these children present intermittently with acidotic crises and are otherwise normal during crisis - free periods . increased levels of organic acids including", "metabolic disease must always be considered as possible diagnosis when an infant presents with a severe metabolic acidosis accompanied by an increased ag and other causes of increased ag metabolic acidosis with increased osmolar gap , e.g. drug ingestion should be ruled out .", "we report two cases of infants with mma with sudden decompensation associated with high ag severe metabolic acidosis without any initial signs and symptoms . in first case infant with presented as mimic septic shock responded well to fluid management , but ketoacidosis was persisted even after the shock was corrected .", "an underlying metabolic disorder was suspected and had very high levels of methylmalonic acids in urine . in another case", "infant presented with hyperglycemic ketoacidosis with poor response to insulin . because of persistence of ketoacidosis an underlying metabolic disorder was considered .", "although hyperglycemia is an unusual presentation for mma , boeckx and hicks , guven et al . and", "kumar and suthar reported cases with severe and persistent metabolic acidosis and hyperglycemia , despite large doses of insulin .", "dka is most common cause of ketoacidosis , but it shows excellent response to standard treatment ; therefore other etiologies of acidosis / hyperglycemia should be investigated in poor responders .", "organic acidurias ( oas ) should be included in the differential diagnosis especially in countries where national newborn screening is not implemented .", "determining the etiology of hyperglycemic ketoacidosis is important and can lead to a good outcome .", "the unusual presentation of our patients , mimicking dka and septic shock reminds us of the wide spectrum of clinical signs of organic acidemia . in very young patients with severe acidosis and metabolic decompensation , or", "with atypical clinical course should lead a suspicion of a less common diagnosis such as organic academia to prevent severe morbidities and even death ." ] ]

[ [ "reactivation of latent tuberculosis ( tb ) is a serious hindrance to continuation of therapy .", "we present here a case of pleural tb in a patient on infliximab for ankylosing spondylitis ." ], [ "a 36-year - old male presented to our hospital in 2006 with low back ache inflammatory type with symmetric joint pains involving large joints such as shoulder joints , hip joints , knee joints , and small joints such as metacarpophalangeal joints , elbow joints , and metatarsophalangeal joints .", "there was associated early morning stiffness for over an hour . on examination , synovitis was present in peripheral joints with restriction of movement in all joints . modified schober 's test was positive , and the chest expansion ( <3 cm ) was restricted . on evaluation , he had anemia and elevated erythrocyte sedimentation rate ( esr ) ( 46 mm / h ) and c - reactive protein ( crp ) ( 18 mg / l ) .", "imaging revealed kyphoscoliosis of thoracic spine , syndesmophytes at multiple levels giving the appearance of bamboo spine [ figure 1 ] .", "diffuse ossification of interspinous and paraspinal ligaments with fusion of thoracic and lower cervical vertebra was present .", "radiograph showing bamboo spine in view of hla - b27 , more than 2 spa features and typical radiological features , ankylosing spondylitis was considered .", "he was started on nonsteroidal anti - inflammatory drugs ( nsaids ) and dose escalated for symptomatic relief . in view of persisting symptoms and elevated esr and crp in spite of optimal nsaids ,", "following three doses of infliximab and 10 months after initiation of therapy , patient came with complaints of fever and cough for 1 week . on examination ,", "breath sounds were reduced over the right side , and there was dullness on percussion .", "diagnostic thoracocentesis showed lymphocytic ( total leukocyte count - 4800 cells / cumm , lymphocytes - 90% ) exudative type of effusion with high adenosine deaminase ( ada ) ( 114", "iu / l ) . according to light 's criteria ( effusion protein - 6 g / dl , serum protein - 3.37 g / dl , effusion lactate dehydrogenase ( ldh ) - 575" ], [ "ankylosing spondylitis is a chronic , systemic , inflammatory disease that affects primarily the sacroiliac joints and spine . it is a spondyloarthropathy with a prevalence of 0.1%0.4% globally .", "data from india are sparse . its more commonly seen among males under 30 years of age . diagnosis is made after thorough clinical examination and radiography .", "infliximab is one such biologic which acts by inhibiting a pro - inflammatory cytokine tnf- and reducing inflammation .", "target - related adverse effects with tnf inhibitors are infections , opportunistic infections , malignancies , demyelinating conditions , hematologic abnormalities , congestive heart failure , autoantibodies ( antinuclear antibody and anti - double - stranded dna ) , hepatotoxicity , dermatologic reactions , and lupus - like syndromes , whereas the agent - related adverse effects are administration reactions and immunogenicity .", "tnf- is a cytokine that plays an important role in the mediation of inflammation and immune regulation .", "they are required for inflammatory response against intracellular organisms . in experimental models , fungal and bacterial infections", "pneumocystis carinii and histoplasma capsulatum are some of the fungal pathogens , whereas the bacterial agents are listeria monocytogene , mycobacterium tuberculosis , and mycobacterium avium .", "upper and lower respiratory tract infections are the most commonly seen ones . there was also an increased risk of serious infections compared with controls ( 3.6% vs. 1.7% ) .", "registries of rheumatoid arthritis patients have shown that the relative risk for infection ( 3.34.1 ) as well as serious infection ( 2.72.8 ) was significantly higher among patients receiving tnf inhibitors .", "to conclude , severity of disease , use of other medications such as corticosteroids , and the presence of comorbidities also contribute to infections in addition to tnf inhibitors alone .", "opportunistic infections following tnf inhibitor therapy include disseminated m. tuberculosis . in a study of seventy cases of tb following infliximab therapy ,", "thirty were pulmonary tb and of forty were extrapulmonary disease , only two were cases of pleural tb . around a quarter of the cases were disseminated disease .", "the majority of cases of tb were observed within a median period of 12 weeks after initiation of therapy and is likely due to reactivation of latent tb .", "a study by grover et al . in india has shown a high incidence of tb ( 21% ) following biologic therapy .", "it was also seen that among those who received low doses of infliximab ( 3 mg / kg body weight ) did not develop tb .", "another study by malaviya et al . has found a lower incidence ( 9.4% ) of tb among those on tnf inhibitors .", "the rate of development of active tb among rheumatoid arthritis patients on anti - tnf therapy has dropped by 83% with the help of screening .", "suppressing the action of tnf- can help in relieving the symptoms of ankylosing spondylitis by reducing the inflammatory process , but at the same time , it weakens immune response to microbes such as tubercle bacilli .", "hence , meticulous screening and close monitoring of patients on infliximab for any symptoms and signs of tb are important as there is a risk even though the screening tests have come out be negative ." ], [ "" ], [ "" ] ]

[ [ "myoepithelial carcinoma ( mc ) is a rare tumor with an incidence of 0.2% of all salivary gland tumors . most of the reported cases of mc arise in the parotid gland ( 4875% ) , followed by minor salivary glands , and the submandibular gland .", "the first case was described by higashiyama et al . , in 1998 . since then , only seven cases have been reported in literature ." ], [ "a mentally retarded 13-year - old girl , with a history of congenital hypothyroidism and cystic lymphangioma in the left dorsal region , operated in 2004 , had consulted for cough and dyspnea in september 2010 .", "physical examination showed a decrease in vesicular breath sounds at the basal areas of chest bilaterally , without fever .", "pulmonary computed tomography ( ct ) showed bilateral pleural masses measuring 6.3 cm and 7.4 cm at the right and left bases , respectively , with lymph node metastases [ figure 2 ] .", "( a ) bilateral pulmonary opacities ( b ) disappearance of pulmonary opacities pulmonary computed tomography ( ct ) : bilateral pulmonary masses a histopathological study of the left pleural biopsy revealed a monomorphic proliferation of round cells with clear cytoplasm and a weak , mitotic hyperchromatic oval nucleus [ figure 3 ] .", "there were some cohesive layers , separated by bands of sclerosis ; the stroma was sparse with foci of necrosis .", "the immunohistochemistry ( ihc ) study was focally positive for vimentin , cd99 , and ps100 .", "the abdominal ultrasound , bone scan , and metaiodobenzylguanidine ( mibg ) scintigraphy were normal .", "the histopathological and the ihc review at the institut bergoni in france concluded the diagnosis of myoepithelial carcinoma of the soft tissues with intermediate malignancy .", "ihc was positive for pancytokeratin ( ae1/ae3 ) and ps100 , and negative for ema , cd34 , desmin , and cd99 .", "the progression was marked by the disappearance of the pulmonary opacities [ figure 1 ] ." ], [ "they include mucoepidermoid carcinoma , adenoid cystic carcinoma , acinic cell carcinoma , oncocytoma , epithelial ", "it arises from the submucosal bronchial glands of the lower respiratory tract . in the world health organization classification , published in 2004 ,", "mc was cited as being synonymous with epithelial myoepithelial carcinoma . as mc and epithelial ", "myoepithelial carcinoma of the salivary gland are distinguished by the presence or absence of ductal cells , their pulmonary counterparts must also be differentiated .", "myoepithelial tumors are low - grade lesions without recurrences or metastasis described after resection , whereas , the rate of metastasis in mc is high , as seen in our case .", "our patient represents the first pediatric case , described in the literature , having primitive pulmonary mc .", "the tumor was peripheral and bilateral , measuring 6 cm and 7 cm , which was in agreement with the literature .", "in fact , the size of the mc ranged from 15 mm to 130 mm ( mean 50.7 mm ) [ table 1 ] . characteristics of pulmonary mc in our case , the histopathological study oriented to the diagnosis of a primitive neuroectodermal tumor or neuroblastoma .", "the pathological review , with further ihc analysis in france , had concluded the diagnosis of mc .", "the following markers were found to be useful in myoepithelial carcinoma : cytokeratins ( ae1/ae3 ) and vimentin ( reported to be positive in neoplastic myoepithelial cells and negative in normal myoepithelial cells ) .", "other variable markers , such as , ps100 , calponin , smooth muscle actin ( sma ) , muscle - specific actin ( msa ) , smooth muscle myosin , and p63 protein , could be positive .", "however , neoplastic transformation of myoepithelial cells could result in a loss or a modification of their smooth muscle phenotype . in our case ,", "although the eight patients reported in literature were treated with optimal surgery , metastases were reported in seven of them ( 87.5% ) ( contralateral lung , forearm , liver , and brain ) .", "it was significant that a patient who had not developed metastasis , had the lowest tumor mitotic rate of 5/10 hpfs .", "this fact reasoned that the mitotic rate could be an important prognostic factor of the clinical outcome and survival in primary myoepithelial carcinoma of the lung .", "given the rarity of these tumors , recommendations regarding chemotherapy or radiation , either pre- or postoperatively , are difficult to formulate .", "the originality of our case is the disappearance of the pulmonary opacity spontaneously , without any treatment ." ], [ "our case represents , to the best of our knowledge , the first pediatric case having primitive pulmonary mc .", "the histopathological study familiarizes the diagnosis , but a further ihc study is needed to confirm the diagnosis and to eliminate other etiologies .", "surgery represents the main treatment for the operable forms . to the best of our knowledge ,", "we have reported the first case , with spontaneous regression of this tumor , without any treatment ." ] ]

[ [ "as environmental and personal sanitation improves , the incidence of typhoidal salmonellosis tends to decrease , while the incidence of non - typhoidal salmonellosis markedly increases , .", "the most common clinical manifestation of nts is gastroenteritis , and the condition includes bacteremia , focal infection , and an asymptomatic carrier state . of the manifestations , urinary tract infection ( uti ) is unusual and rare , , and occurs in immunocompromised individuals , including patients with a malignancy , human immunodeficiency virus infection , or diabetes mellitus and patients receiving corticosteroid therapy or treatment with other immunotherapeutic agents , .", "uti caused by nts presents as either pyelonephritis or cystitis , , ; cases of hemorrhagic cystitis are extremely rare .", "we report a case of severe hemorrhagic cystitis caused by nts that resulted in shock and syncope in a patient with uncontrolled diabetes ." ], [ "a 41-year - old man came to the emergency room for a fever that had developed 10 days earlier , and was accompanied by pus - like urine .", "the patient had watery diarrhea and had lost five kilograms of weight in one month .", "he had been diagnosed with diabetes mellitus 5 years earlier and his blood sugar level was not well controlled .", "the patient was a baker , did not have any pets , and did not have a history of recent travel . on admission ,", "his temperature was 38 c , his blood pressure was 110/60 mm hg , and his heart rate was 102 beats / min .", "platelets were 209,000/mm , hemoglobin was 13.6 g / dl , hematocrit was 40.9% , bun / creatinine was 34.0/1.0 mg / dl , fasting / postprandial two - hour blood sugar was 330/482 mg / dl , and hba1c was 11.1% .", "a widal test showed a typhoid o titer of 1:1280 and typhoid h titer of 1:640 , and a urine culture grew nts ( group d ) .", "no bacteria were isolated from the stool or blood culture . on abdomen - pelvis ultrasonography ,", "the urinary bladder was filled with pus , the bladder wall was thickened diffusely ( fig .", "1a ) , and hydronephrosis and hydroureter were observed on both sides of the bladder ( fig .", "the level of serum creatinine and urine output remained a consistent level during this period .", "after 10 days in the hospital , the patient 's urine output decreased suddenly and he developed severe lower abdominal distension and syncope .", "the patient 's systolic blood pressure fell to 80 mm hg and hemoglobin to 7.9 g / dl .", "an emergency ct scan showed that the urinary bladder was severely distended and filled with a mass suspicious of hematoma ( fig .", "3 ) . however , there was no stone , mass or focal mechanical injury , i.e foley catheter injury .", "blood pressure was stabilized after transfusion of three packs of rbc and hemoglobin was elevated to 10.2 g / dl .", "he responded well to treatment and was discharged in good condition with oral antibiotics and oral hypoglycemic agents ." ], [ "despite improvements in individual and collective sanitation as well as the careful monitoring of food processing , sporadic episodes and outbreaks of salmonellosis continue to occur in industrialized countries .", "the overall incidence of typhoidal salmonellosis has decreased , whereas that of non - typhoidal salmonellosis has increased , .", "non - typhoidal salmonellosis is a disease of great public health importance . unlike s. typhi and s. paratyphi ,", "the main mode of transmission is from food products contaminated with animal products or waste , most commonly eggs and poultry , but also undercooked meat , unpasteurized dairy products , seafood , and fresh produce .", "nts is an enteroinvasive bacterium and causes infections that may have one of four different clinical presentations .", "however , invasion beyond the gastrointestinal tract occurs in approximately 5% of patients with nts gastroenteritis , resulting in bacteremia .", "extraintestinal manifestations , which have a rare incidence of about 28% , include endocarditis , pericarditis , arteritis , soft tissue infection , uti and pneumonia .", "the gastrointestinal carrier state is the fourth clinical presentation and is defined as the excretion of nts for months or years after the initial onset of disease .", "uti caused by nts is so rare that it comprises only 0.01%3% of positive urinary cultures , , and 3% of nts infections .", "nts has been postulated to enter the urinary tract either hematogenously or by direct invasion of fecal flora to the bladder via the urethra .", "the risk factors of uti caused by nts include old age , chronic illness , immunosuppressive therapy and structural abnormality of the urinary tract .", "uti related to nts presents as cystitis , pyelonephritis , renal abscess , or asymptomatic pyuria , .", "a retrospective analysis of 28 cases of bacteriuria due to nts showed that twenty - one patient ( 75% ) had symptoms of uti ( 16 , cystitis ; 3 , pyelonephritis ; and 2 , renal abscess ) .", "another review of nineteen patients with bacteriuria due to nts showed that the frequency of uti due to nts was 0.07% ( proportion of positive urine cultures ) .", "eighteen patients ( 94.7% ) had symptoms of uti ( 12 , cystitis ; 6 , pyelonephritis ) , and 1 remained asymptomatic . however , case of hemorrhagic cystitis due to nts was very rare . furthermore , severe hemorrhagic cystitis caused by nts with massive bleeding that resulted in shock and syncope was extremely rare .", "uti from salmonella does not differ clinically from uti caused by other members of the enterobacteriaceae \n .", "our patient had uncontrolled diabetes for 5 years and had worked at a job in food handling for a long time .", "we are not sure of the mode of transmission in our patient 's case ; however , we propose that he might have been a salmonella carrier or that his illness was caused by bacteremia from a previous gastrointestinal infection . in uncomplicated salmonella gastroenteritis , antibiotic therapy is not recommended because it does not shorten the disease duration .", "however , in cases of sepsis or local extraintestinal infection , prompt antibiotic administration is needed .", "traditionally , antibiotics such as ampicillin , amoxicillin , chloramphenicol , and trimethoprim - sulfamethoxazole are used , but currently the frequency of antimicrobial resistance in salmonella isolates is increasing , .", "in korea , according to recent reports , group b salmonella is the most common drug - resistant serotype , while the group d serotype has relatively low drug resistance .", "the treatment of focal extraintestinal salmonella infection often requires both surgical drainage and antibiotic therapy in cases associated with structural abnormality of the urinary tract .", "early surgical intervention might be combined with more prolonged therapy to eradicate uti caused by nts , . in this report", ", we describe a case of hemorrhagic cystitis due to nts , which caused massive bleeding , shock , and syncope in a patient with uncontrolled diabetes ." ], [ "" ] ]

[ [ "binaries composed of neutron stars ( nss ) and black holes ( bhs ) have long been of interest to astrophysicists .", "they provide many important constraints for models of massive star evolution and compact object formation , and are among the leading potential sources for detection by gravitational - wave ( gw ) observatories . while it remains uncertain whether mergers of compact binaries are an important contributor to the production of r - process elements , they are now thought to be the leading candidate to explain short - duration , hard - spectrum gamma - ray bursts ( often abbreviated to short - hard grbs , or merely sgrbs ) .", "the first neutron star - neutron star ( ns - ns ) binary to be observed was psr b1913 + 16 , in which a radio pulsar was found to be in close orbit around another ns . in the decades since its discovery ,", "the decay of the orbit of psr b1913 + 16 at exactly the rate predicted by einstein s general theory of relativity ( see , e.g. , [ 306 , 325 ] ) has provided strong indirect evidence that gravitational radiation exists and is indeed correctly described by general relativity ( gr ) .", "this measurement led to the 1993 nobel prize in physics for hulse and taylor . according to the lowest - order dissipative contribution from gr , which arises at the 2.5pn level ( post - newtonian ; where the digit indicates the expansion order in [ /c ] in the taylor expansion term ) , and assuming that both nss may be approximated as point masses", ", a circular binary orbit decays at a rate da / dt = a/gw where a is the binary separation and the gravitational radiation merger timescale gw is given by 1\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$\\begin{array}{*{20}c } { { \\tau _ { { \\rm{gw } } } } = { 5 \\over { 64}}{{{a^4 } } \\over { \\mu { m^2 } } } = { 5 \\over { 64}}{{{a^4 } } \\over { q(1 + q)m_1 ^ 3}}}\\quad\\quad\\quad\\quad\\quad\\quad\\quad\\quad\\\\ { = 2.2 \\times { { 10}^8}{q^{- 1}}{{(1 + q)}^{- 1}}{{\\left({{a \\over { { r _ \\odot } } } } \\right)}^4}{{\\left({{{{m_1 } } \\over { 1.4{m _ \\odot } } } } \\right)}^{- 3}}{\\rm{yr}},}\\\\ \\end{array}$$\\end{document } where m1 , m2 , and m m1 + m2 are the individual ns masses and the total mass of the binary , = m1m2/m is the reduced mass , q = m2/m1 is the binary mass ratio , and we assume geometrized units where g = c = 1 ( as we do throughout this paper , unless otherwise noted ) .", "the timescale for an elliptical orbit is shorter , and it can be shown that eccentricity is reduced over time by gw emission , leading to a circularization of orbits as they decay .", "a quick integration shows that the time until merger is given by merge = gw/4 .", "the luminosity of such systems in gravitational radiation is 2\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$\\begin{array}{*{20}c } { { l_{{\\rm{gw } } } } = - { { d{e_{{\\rm{gw } } } } } \\over { dt } } = { { 32 } \\over 5}{{{\\mu ^2}{m^3 } } \\over { { a^5 } } } = { { 32 } \\over 5}{{m_1 ^ 2m_2 ^ 2({m_1 } + { m_2 } ) } \\over { { a^5}}}}\\quad\\quad\\quad\\quad\\\\ { = 5.34 \\times { { 10}^{32}}{q^2}(1 + q){{\\left({{{{m_1 } } \\over { 1.4{m _ \\odot } } } } \\right)}^5}{{\\left({{a \\over { { r _ \\odot } } } } \\right)}^{- 5}}{\\rm{erg}}/{\\rm{s}}}\\quad\\;\\;\\\\ { = 8.73 \\times { { 10}^{51}}{q^2}(1 + q){{\\left({{{{m_1 } } \\over { 1.4{m _ \\odot } } } } \\right)}^5}{{\\left({{a \\over { 100\\;{\\rm{km } } } } } \\right)}^{- 5}}{\\rm{erg}}/{\\rm{s,}}}\\\\ \\end{array}$$\\end{document } which , at the end of a binary s lifetime , when the components have approached to within a few ns radii of each other , is comparable to the luminosity of all the visible matter in the universe ( 10", "the resulting strain amplitude observed at a distance d from the source ( assumed to be oriented face - on ) is given approximately by 3\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$h = { { 4{m_1}{m_2 } } \\over { ad } } = 5.53 \\times { 10^{- 23}}q{\\left({{{{m_1 } } \\over { 1.4{m _ \\odot } } } } \\right)^2}{\\left({{a \\over { 100\\;{\\rm{km } } } } } \\right)^{- 1}}{\\left({{d \\over { 100\\;{\\rm{mpc } } } } } \\right)^{- 1}},$$\\end{document } at a characteristic frequency 4\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$${f_{gw } } = 2{f_{{\\rm{orb } } } } = { 1 \\over \\pi}\\sqrt { { m \\over { { a^3 } } } } = 194{\\left({{m \\over { 2.8{m _ \\odot } } } } \\right)^{1/2}}{\\left({{a \\over { 100\\;{\\rm{km } } } } } \\right)^{- 3/2}}{\\rm{hz}}.$$\\end{document } the first measurement that will likely be made with direct gw observations is the orbital decay rate , with the period evolving ( for the circular case ) according to the relation 5\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$${{dt } \\over { dt } } = - { { 192\\pi } \\over 5}{({{\\mathcal m}_c}\\omega)^{5/3}},$$\\end{document } where t is the orbital period and the angular frequency , and thus the chirp mass , ", "6\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$${{\\mathcal m}_c } \\equiv { \\mu ^{3/5}}{m^{2/5 } } = m_1^{3/5}m_2^{3/5}{({m_1 } + { m_2})^{- 1/5}},$$\\end{document } is likely to be the easiest parameter to determine from gw observations .", "several ns - ns systems are now known , including psr j0737 - 3039 , a binary consisting of two observed pulsars , which allows for the prospect of even more stringent tests of gr . even with the handful of observed sources to date", ", one may use this sample to place empirical limits on the expected rate of ns - ns mergers and to constrain the many parameters that enter into population synthesis calculations .", "with regard to the former , the very short merger timescale for j0737 , merge = 85 myr , makes it especially important for estimating the overall rate of ns - ns mergers since it is a priori very unlikely to detect a system with such a short lifetime .", "although black hole - neutron star ( bh - ns ) binaries are expected to form through the same processes as ns - ns binaries , none has been detected to date .", "this is generally thought to reflect their lower probability of detection in current surveys , in addition to intrinsically smaller numbers compared to ns - ns systems .", "bh - ns systems are an expected byproduct of binary stellar evolution , and properties of the population may be inferred from population synthesis studies calibrated to the observed ns - ns sample ( see , e.g. , ) . in this review", ", we will summarize the current state of research on relativistic mergers , beginning in section 2 with a description of the astrophysical processes that produce merging binaries and the expected parameters of these systems .", "the phases of the merger are briefly described in section 3 . in section 4 , we discuss the numerical techniques used to generate quasi - equilibrium ( qe ) sequences of ns - ns configurations , and we summarize the qe calculations that have been performed", ". these sequences yield a lot of information about ns physics , particularly with regard to the nuclear matter equation of state ( eos ) .", "they also serve as initial data for dynamical merger calculations , which we discuss next , focusing in turn on the numerical hydrodynamics techniques used to compute mergers and the large body of results that has been generated , in sections 5 and 6 , respectively .", "we pay particular attention to how numerical studies have taken steps toward answering a number of questions about the expected gw and electromagnetic ( em ) emission from merging binaries , and we discuss briefly the possibility that they may be the progenitors of sgrbs and a source of r - process elements .", "while most of this review focuses on ns - ns mergers , many of the methods used to study ns - ns binaries are also used to evolve bh - ns binaries , and it has become clear that both merger types may produce similar observational signatures as well . for a review focusing on bh - ns merger calculations ," ], [ "merging ns - ns and bh - ns binaries , i.e. , those for which the merger timescale is smaller than the hubble time , are typically formed through similar evolutionary channels in stellar field populations of galaxies ( both may also be formed through dynamical processes in the high - density cores of some star clusters , but the overall populations are smaller and more poorly constrained ; see for a review ) .", "it is difficult to describe the evolutionary pathways that form ns - ns binaries without discussing bh - ns binaries as well , and it is important to note that the joint distribution of parameters such as merger rates and component masses that we could derive from simultaneous gw and em observations will constrain the underlying physics of binary stellar evolution much more tightly than observing either source alone .", "population synthesis calculations for both merging ns - ns and bh - ns binaries typically favor the standard channel in which the first - born compact object goes through a common - envelope ( ce ) phase , although other models have been proposed , including recent ones where the progenitor binary is assumed to have very nearly - equal mass components that leave the main sequence and enter a ce phase prior to either undergoing a supernova [ 42 , 54 ] . simulations of this latter process have shown that close ns - ns systems could indeed be produced by twin giant stars with core masses 0.15 m , though twin main sequence stars typically merge during the contact phase . in the standard channel ( see , e.g. , [ 44 , 178 ] , and figure 1 for an illustration of the process ) , the progenitor system is a high - mass binary ( with both stars of mass m 810 m to ensure a pair of supernovae ) .", "the more massive primary evolves over just a few million years before it leaves the main sequence , passes through its giant phase , and undergoes a type ib , ic , or ii supernova , leaving behind what will become the heavier compact object ( co ) : the bh in a bh - ns binary or the more massive ns in an ns - ns binary .", "the secondary then evolves off the main sequence in turn , triggering a ce phase when it reaches the giant phase and overflows its roche lobe .", "dynamical friction shrinks the binary separation dramatically , until sufficient energy is released to expel the envelope . without this step , binaries would remain too wide to merge through the emission of gws within a hubble time . eventually , the exposed , helium - rich core of the secondary undergoes a supernova , either unbinding the system or leaving behind a tight binary , depending on the magnitude and orientation of the supernova kick . \n", "figure 1cartoon showing standard formation channels for close ns - ns binaries through binary stellar evolution .", "cartoon showing standard formation channels for close ns - ns binaries through binary stellar evolution .", "this evolutionary pathway has important effects on the physical parameters of ns - ns and bh - ns binaries , leading to preferred regions in phase space .", "the primary , which can accrete some matter during the ce phase , or during an episode of stable mass transfer from the companion helium star , should be spun up to rapid rotation ( see for a review ) . in ns - ns binaries", ", we expect that this process will also reduce the magnetic field of the primary down to levels seen in recycled ", "pulsars , typically up to four orders of magnitude lower than for young pulsars [ 180 , 73 ] .", "the secondary ns , which never undergoes accretion , is likely to spin down rapidly from its nascent value , but is likelier to maintain a stronger magnetic field .", "while this evolutionary scenario has been well studied for several decades , many aspects remain highly uncertain . in particular", ": \n the ce efficiency , which helps to determine the expected range of binary separations and the mass of the primary compact object after its accretion phase , remains very poorly constrained [ 229 , 37 , 78 , 338 ] .", "if too much matter is accreted by the ns , it may undergo accretion - induced collapse to a bh , though the growing body of observed ns - ns systems does help place constraints on the allowed range of accretion - related parameters.the exact relation between a star s initial mass and the eventual compact object mass is better understood , but significant theoretical uncertainties remain , and the relation is sensitive to the metallicity ( often unknown ) , mainly through the effects of mass loss in stellar winds , and to the details of the explosion itself [ 336 , 205].the maximum allowed ns mass will affect whether the primary remains a ns or undergoes accretion - induced collapse to a bh ; its value is dependent upon the as - yet undetermined nuclear matter eos . at present , the strongest limit is set by the binary millisecond pulsar psr j1614 - 2230 , for which a mass of mns = 1.97 0.04 m was determined by shapiro time delay measurements .", "determining the ns eos from gw observations may eventually provide stronger constraints [ 237 , 221 , 184 ] , including a determination of whether supernova remnants are indeed classical hadronic ns or instead have cores consisting of some form of strange quark matter or other elementary particle condensate [ 223 , 119 , 230 , 120 , 23 , 5].the supernova kick velocity distribution is only partially understood , leading to uncertainties as to which systems will become unbound after the second explosion [ 133 , 324 , 219 , 152 ] . the ce efficiency , which helps to determine the expected range of binary separations and the mass of the primary compact object after its accretion phase , remains very poorly constrained [ 229 , 37 , 78 , 338 ] .", "if too much matter is accreted by the ns , it may undergo accretion - induced collapse to a bh , though the growing body of observed ns - ns systems does help place constraints on the allowed range of accretion - related parameters .", "the exact relation between a star s initial mass and the eventual compact object mass is better understood , but significant theoretical uncertainties remain , and the relation is sensitive to the metallicity ( often unknown ) , mainly through the effects of mass loss in stellar winds , and to the details of the explosion itself [ 336 , 205 ] .", "the maximum allowed ns mass will affect whether the primary remains a ns or undergoes accretion - induced collapse to a bh ; its value is dependent upon the as - yet undetermined nuclear matter eos .", "at present , the strongest limit is set by the binary millisecond pulsar psr j1614 - 2230 , for which a mass of mns = 1.97 0.04 m was determined by shapiro time delay measurements . determining the ns eos from gw observations may eventually provide stronger constraints [ 237 , 221 , 184 ] , including a determination of whether supernova remnants are indeed classical hadronic ns or instead have cores consisting of some form of strange quark matter or other elementary particle condensate [ 223 , 119 , 230 , 120 , 23 , 5 ] .", "the supernova kick velocity distribution is only partially understood , leading to uncertainties as to which systems will become unbound after the second explosion [ 133 , 324 , 219 , 152 ] .", "given all these uncertainties , it is reassuring that most estimates of the ns - ns and bh - ns merger rate , expressed either as a rate of mergers per myr per milky way equivalent galaxy or as a predicted detection rate for ligo ( the laser interferometer gravitational - wave observatory ) and virgo ( see section 5.5 below ) , agree to within 12 orders of magnitude , which is comparable to the typical uncertainties that remain once all possible sources of error are folded into a population synthesis model . in table 1 , we show the predicted detection rates of ns - ns and bh - ns mergers for both the first generation ligo detectors ( ligo ) , which ran at essentially their design specifications , and the advanced ligo ( adligo ) configuration due to go online in 2015 .", ", the authors used the observed parameters of close binary pulsar systems to estimate the galactic ns - ns merger rate empirically ( such results do not constrain the bh - ns merger rate ) . in [ 198 , 128 ] , the two groups independently estimated the binary merger rate from the observed statistics of sgrbs . in these cases , one does not get an independent prediction for the ns - ns and bh - ns merger rate , but rather some linear combination of the two . in both cases , the authors estimated that , if ns - ns and bh - ns mergers are roughly equal contributors to the observed sgrb sample , ligo will detect about an order of magnitude more bh - ns mergers since their higher mass allows them to be seen over a much larger volume of the universe", ". as they both noted , should either type of system dominate the sgrb sample , we would expect a doubling of ligo detections for that class , and lose our ability to constrain the rate of the other using this method .", "many population synthesis models have attempted to understand binary evolution within our galaxy by starting from a basic parameter survey of the various assumptions made about ce evolution , supernova kick distributions , and other free parameters . in [ 323 , 79 ] ,", "population synthesis models are normalized by estimates of the star formation history of the milky way . in [ 140 ,", "218 ] , parameter choices are judged based on their ability to reproduce the observed galactic binary pulsar sample , which allows posterior probabilities to be applied to each model in a bayesian framework . a review by the ligo collaboration of this issue may be found in . \n", "table 1estimated initial and advanced ligo rates for bh - ns and ns - ns mergers from population synthesis calculations and other methods .", "the methods used are , in order , empirical constraints from the observed sample of binary pulsars ( empirical ) , constraints on the combined ns - ns / bh - ns merger rate assuming that they are the progenitors of short - hard gamma - ray bursts ( sgrbs ) , population synthesis models calibrated to the star formation rate in the milky way ( pop . synth . ", "sfr ) , and population synthesis calibrated against the observed galactic binary pulsar sample ( pop . synth . ns - ns ) .", "we note that observations of binary pulsars do not yield constraints for bh - ns binaries .", "sgrb observations may produce constraints on ns - ns merger rates , bh - ns , merger rates , or both , depending on which sources are the true progenitors , but this remains unclear .", "the official review of these results and their implications by the ligo / virgo scientific collaborations may be found in .authorns - nsbh - nsmethodligoadligoligoadligokim et al .", " ns - ns estimated initial and advanced ligo rates for bh - ns and ns - ns mergers from population synthesis calculations and other methods .", "the methods used are , in order , empirical constraints from the observed sample of binary pulsars ( empirical ) , constraints on the combined ns - ns / bh - ns merger rate assuming that they are the progenitors of short - hard gamma - ray bursts ( sgrbs ) , population synthesis models calibrated to the star formation rate in the milky way ( pop . synth . ", "sfr ) , and population synthesis calibrated against the observed galactic binary pulsar sample ( pop", "we note that observations of binary pulsars do not yield constraints for bh - ns binaries .", "sgrb observations may produce constraints on ns - ns merger rates , bh - ns , merger rates , or both , depending on which sources are the true progenitors , but this remains unclear . therefore , the table quotes results assuming a roughly equal split between the two", ". the official review of these results and their implications by the ligo / virgo scientific collaborations may be found in . should the next generation of gw interferometers begin to detect a statistically significant number of merger events including nss", ", it should be possible to constrain several astrophysical parameters describing binary evolution much more accurately .", "these include \n the relative numbers of bh - ns and ns - ns mergers : interferometric detections are sensitive to a binary s chirp mass ( see eq .", "6 ) , and to the binary mass ratio as well [ 57 , 11 , 321 , 320 ] if the signal - to - noise ratio is sufficiently high .", "even if the merger signal takes place at frequencies too high to fall within the ligo band , it should still be possible in most cases to determine whether the primary s mass exceeds the maximum mass of a ns.the mass ratio probability distribution for merging binary systems : if both binary components masses are determined , we will be able to constrain both the bh mass distribution in merging binaries and the ns mass ratio distribution .", "knowledge of the former would determine , e.g. , whether the current low estimates for the mass accreted onto the primary co core during the ce phase are correct , as this model predicts that bh masses in close bh - ns binaries should cluster narrowly around mbh = 10 m. previous calculations assuming larger accreted masses typically favored mass ratios closer to unity , since the primaries often began as nss and underwent accretion - induced collapse to a bh during the ce phase .", "whose zero - age main sequence ( or zams ) masses are so close that they both leave the main sequence before either undergoes a supernova , play a significant role in the merging ns - ns population .", "the relative numbers of bh - ns and ns - ns mergers : interferometric detections are sensitive to a binary s chirp mass ( see eq .", "6 ) , and to the binary mass ratio as well [ 57 , 11 , 321 , 320 ] if the signal - to - noise ratio is sufficiently high .", "even if the merger signal takes place at frequencies too high to fall within the ligo band , it should still be possible in most cases to determine whether the primary s mass exceeds the maximum mass of a ns .", "the mass ratio probability distribution for merging binary systems : if both binary components masses are determined , we will be able to constrain both the bh mass distribution in merging binaries and the ns mass ratio distribution .", "knowledge of the former would determine , e.g. , whether the current low estimates for the mass accreted onto the primary co core during the ce phase are correct , as this model predicts that bh masses in close bh - ns binaries should cluster narrowly around mbh = 10 m. previous calculations assuming larger accreted masses typically favored mass ratios closer to unity , since the primaries often began as nss and underwent accretion - induced collapse to a bh during the ce phase . the ns - ns mass distribution will allow for tests of whether twins ", ", i.e. , systems whose zero - age main sequence ( or zams ) masses are so close that they both leave the main sequence before either undergoes a supernova , play a significant role in the merging ns - ns population .", "while advanced ligo or another interferometer will likely be required to make the first direct observations of ns - ns mergers and their immediate aftermath , it is possible that more than just the high - energy prompt emission from mergers may be observable using em telescopes . although the particular candidate source they identified resulted from a pointing error , nakar and piran suggest that the mass ejection from mergers should yield an observable radio afterglow , although the afterglows may be too faint to be seen by current telescopes at the observed distances of existing localized sgrbs .", "while such outbursts could also result from a supernova , the luminosity required would be an order of magnitude larger than those previously observed .", "given the length and timescales characterizing radio bursts , no ns - ns simulation has been able to address the model directly , but it certainly seems plausible that the time - variable magnetic fields within a stable hypermassive remnant could generate enough em energy to power the resulting radio burst .", "if mergers produce sufficiently large ejecta masses , mej 10 \n m , r - process nuclear reactions may produce a kilonova ", "afterglow one day after a merger with a v - band optical luminosity 10 erg / s ( roughly 1000 times brighter than a classical nova ) .", "these potential em observations of mergers are likely to spur further research into the amount and velocity of merger ejecta , which could then be coupled to a larger - scale astrophysical simulation of the potential optical and radio afterglows ." ], [ "the qualitative evolution of ns - ns mergers , or indeed any compact binary merger , has long been understood , and may be divided roughly into inspiral , merger , and ringdown phases , each of which presents a distinct set of challenges for numerical modeling and detection . as a visual aid", ", we include a cartoon summary in figure 2 , originally intended to describe black hole - black hole ( bh - bh ) mergers , and attributed to kip thorne .", "drawn before the advent of the supercomputer simulations it envisions , we note that merger waveforms for all compact binary mergers have proven to be much smoother and simpler than shown here . to adapt it to ns - ns mergers", ", we note that nss are generally assumed to be essentially non - spinning , and that the ringdown phase may describe either a newly formed bh or a ns that survives against gravitational collapse . \n", "figure 2cartoon picture of a compact binary coalescence , drawn for a bh - bh merger but applicable to ns - ns mergers as well ( although nss are generally assumed to be non - spinning ) .", "cartoon picture of a compact binary coalescence , drawn for a bh - bh merger but applicable to ns - ns mergers as well ( although nss are generally assumed to be non - spinning ) .", "image adapted from kip thorne . summarizing the evolution of the system through the three phases : \n", "after a pair of supernovae yields a relatively tight ns - ns binary , the orbital separation decays over long timescales through gw emission , a phase that takes up virtually all of the lifetime of the binary except the last few milliseconds . during the inspiral phase", ", binary systems may be accurately described by qe formalisms , up until the point where the gravitational radiation timescale becomes comparable to the dynamical timescale .", "the evolution in time is well - described by pn expansions , currently including all terms to 3pn , though small deviations can arise because of finite - size effects , especially at smaller separations ( see eqs .", "16 for the lowest - order 2.5pn expressions for circular inspirals).once the binary separation becomes no more than a few times the radii of the two nss , binaries rapidly become unstable .", "the stars plunge together , following the onset of dynamical instability , and enter the merger phase , requiring full gr simulations to understand the complicated hydrodynamics that ensues . according to all simulations to date ,", "if the ns masses are nearly equal , the merger resembles a slow collision , while if the primary is substantially more massive than the secondary the latter will be tidally disrupted during the plunge and will essentially accrete onto the primary . since the nss are most likely", "irrotational just prior to merging , there is a substantial velocity discontinuity at the surface of contact , leading to rapid production of vortices .", "meanwhile , some fraction of the mass may be lost through the outer lagrange points of the system to form a disk around the central remnant .", "this phase yields the maximum gw amplitude predicted by numerical simulations , but with a signal much simpler and more quasi - periodic than in the original cartoon version .", "gw emission during the merger encodes important information about the ns eos , particularly the gw frequency fcut at which the binary orbit becomes unstable ( see eq .", "meanwhile , the merger itself may generate the thermal energy that eventually powers a sgrb , which occurs when the neutrinos and anti - neutrinos produced by shock - heated material annihilate around the remnant to produce high - energy photons.finally , the system will eventually settle into a new , dynamically stable configuration through a phase of ringdown , with a particular form for the gw signal that depends on the remnant s mass and rotational profile . if the remnant is massive enough , it will be gravitationally unstable and collapse promptly to form a spinning bh .", "should the remnant mass be less than the maximum mass miso supported by the nuclear matter eos for an isolated , non - rotating configuration , it will clearly remain stable forever . instead a remnant that is supramassive , i.e. , with a mass above the isolated stationary mass limit but below that allowed for a uniformly rotating ns ( typically 1.2 miso , with very weak dependence on the eos ; see , e.g. , [ 147 , 70 , 71 ] , and references therein ) may become unstable .", "supramassive remnants are stable against gravitational collapse unless angular momentum losses , either via pulsar - type emission or magnetic coupling to the outer disk , can drive the angular velocity below the critical value for stability .", "if the remnant has a mass above the supramassive limit , it may fall into the hypermassive regime , where it is supported against gravitational collapse by rapid differential rotation .", "hypermassive ns ( hmns ) remnants can have significantly larger masses , depending on the eos ( see , e.g. , [ 31 , 275 , 86 , 293 , 114 ] ) , and will survive for timescales much longer than the dynamical time , undergoing a wide variety of oscillation modes .", "they can emit gws should a triaxial configuration yield a significant quadrupole moment , and potentially eject mass into a disk around the remnant .", "eventually , some combination of radiation reaction and magnetic and viscous dissipation will dampen the differential rotation and lead the hmns to collapse to a spinning bh , again with the possibility that it may be surrounded by a massive disk that could eventually accrete .", "the energy release during hmns collapse provides the possibility for a delayed sgrb , in which the peak gw emission occurs during the initial merger event , but the gamma - ray emission , powered by the collapse of the hmns to a bh , occurs significantly later.most calculations indicate that a geometrically thick , lower - density , gravitationally bound disk of material will surround whatever remnant is formed . such disks , which are geometrically thick , are widely referred to as", " tori throughout the literature , though there is no clear distinction between the two terms , and we will use disk throughout this paper to describe generically the bound material outside a central merger remnant .", "such disks are expected to heat up significantly , and much of the material will eventually accrete onto the central remnant , possibly yielding observable em emission . given the low densities and relatively axisymmetric configuration expected , disks are not significant gw emitters .", "there may be gravitationally unbound outflow from mergers as well , though dynamical simulations neither confirm nor deny this possibility yet .", "such outflows , which can be the sites of exotic nuclear reactions , are frequently discussed in the context of r - process element formation , but their inherently low densities make them difficult phenomena to model numerically with high accuracy . after a pair of supernovae yields a relatively tight ns - ns binary , the orbital separation decays over long timescales through gw emission , a phase that takes up virtually all of the lifetime of the binary except the last few milliseconds . during the inspiral phase , binary systems may be accurately described by qe formalisms , up until the point where the gravitational radiation timescale becomes comparable to the dynamical timescale .", "the evolution in time is well - described by pn expansions , currently including all terms to 3pn , though small deviations can arise because of finite - size effects , especially at smaller separations ( see eqs .", "once the binary separation becomes no more than a few times the radii of the two nss , binaries rapidly become unstable .", "the stars plunge together , following the onset of dynamical instability , and enter the merger phase , requiring full gr simulations to understand the complicated hydrodynamics that ensues . according to all simulations to date ,", "if the ns masses are nearly equal , the merger resembles a slow collision , while if the primary is substantially more massive than the secondary the latter will be tidally disrupted during the plunge and will essentially accrete onto the primary . since the nss are most likely", "irrotational just prior to merging , there is a substantial velocity discontinuity at the surface of contact , leading to rapid production of vortices .", "meanwhile , some fraction of the mass may be lost through the outer lagrange points of the system to form a disk around the central remnant .", "this phase yields the maximum gw amplitude predicted by numerical simulations , but with a signal much simpler and more quasi - periodic than in the original cartoon version .", "gw emission during the merger encodes important information about the ns eos , particularly the gw frequency fcut at which the binary orbit becomes unstable ( see eq .", "meanwhile , the merger itself may generate the thermal energy that eventually powers a sgrb , which occurs when the neutrinos and anti - neutrinos produced by shock - heated material annihilate around the remnant to produce high - energy photons .", "finally , the system will eventually settle into a new , dynamically stable configuration through a phase of ringdown , with a particular form for the gw signal that depends on the remnant s mass and rotational profile .", "if the remnant is massive enough , it will be gravitationally unstable and collapse promptly to form a spinning bh .", "should the remnant mass be less than the maximum mass miso supported by the nuclear matter eos for an isolated , non - rotating configuration , it will clearly remain stable forever . instead a remnant that is supramassive ", ", i.e. , with a mass above the isolated stationary mass limit but below that allowed for a uniformly rotating ns ( typically 1.2 miso , with very weak dependence on the eos ; see , e.g. , [ 147 , 70 , 71 ] , and references therein ) may become unstable .", "supramassive remnants are stable against gravitational collapse unless angular momentum losses , either via pulsar - type emission or magnetic coupling to the outer disk , can drive the angular velocity below the critical value for stability .", "if the remnant has a mass above the supramassive limit , it may fall into the hypermassive regime , where it is supported against gravitational collapse by rapid differential rotation .", "hypermassive ns ( hmns ) remnants can have significantly larger masses , depending on the eos ( see , e.g. , [ 31 , 275 , 86 , 293 , 114 ] ) , and will survive for timescales much longer than the dynamical time , undergoing a wide variety of oscillation modes .", "they can emit gws should a triaxial configuration yield a significant quadrupole moment , and potentially eject mass into a disk around the remnant .", "eventually , some combination of radiation reaction and magnetic and viscous dissipation will dampen the differential rotation and lead the hmns to collapse to a spinning bh , again with the possibility that it may be surrounded by a massive disk that could eventually accrete .", "the energy release during hmns collapse provides the possibility for a delayed sgrb , in which the peak gw emission occurs during the initial merger event , but the gamma - ray emission , powered by the collapse of the hmns to a bh , occurs significantly later .", "most calculations indicate that a geometrically thick , lower - density , gravitationally bound disk of material will surround whatever remnant is formed .", "tori throughout the literature , though there is no clear distinction between the two terms , and we will use disk throughout this paper to describe generically the bound material outside a central merger remnant .", "such disks are expected to heat up significantly , and much of the material will eventually accrete onto the central remnant , possibly yielding observable em emission . given the low densities and relatively axisymmetric configuration expected , disks are not significant gw emitters .", "there may be gravitationally unbound outflow from mergers as well , though dynamical simulations neither confirm nor deny this possibility yet .", "such outflows , which can be the sites of exotic nuclear reactions , are frequently discussed in the context of r - process element formation , but their inherently low densities make them difficult phenomena to model numerically with high accuracy . since this three - phase picture is applicable to bh - ns mergers as well , it is worthwhile to compare the two merger processes at a qualitative level to understand the key similarities and differences .", "inspiral for bh - ns mergers is also well - described by pn expansions up until shortly before the merger , but the parameter space is fundamentally different .", "first , since bhs are heavier than nss , the dynamics can be quite different . also ,", "since bhs may be rapidly - spinning ( i.e. , have dimensionless spin angular momenta as large as j / m 1 ) , spin - orbit couplings can play a very important role in the orbital dynamics of the binary , imprinting a large number of oscillation modes into the gw signal ( see , e.g. , [ 126 , 57 ] ) . from a practical standpoint", ", the onset of instability in bh - ns mergers should be easier to detect for ligo , virgo , and other interferometers , since the larger mass of bh - ns binaries implies that instability occurs at lower gw frequencies ( see eq .", "4 , noting that the separation a at which mass - transfer begins scales roughly proportionally to the bh mass ) .", "the onset of instability of a bh - ns binary is determined by the interplay of the binary mass - ratio , ns compactness , and bh spin , with the first of these playing the largest role ( see figures 1315 of and the summary in )", ". in general , systems with high bh masses and/or more compact nss tend to reach a minimum in the binding energy as the radius increases , leading to a dynamical orbital instability that occurs near the classical innermost stable circular orbit ( isco ) . in these cases ,", "the ns plunges toward the bh before the onset of tidal disruption , and is typically swallowed whole .", "leaving behind almost no material to form a disk . the gw emission from such systems", "is sharply curtailed after the merger event , yielding only a low - amplitude , high - frequency , rapidly - decaying ringdown signal ( see , e.g. , ) .", "numerical calculations have shown that even in borderline cases between dynamical instability and mass - shedding the ns is essentially swallowed whole , especially in cases where the bh in either non - spinning or spinning in the retrograde direction , which pushes the isco out to larger radii ( see , e.g. , [ 290 , 289 , 283 , 91 , 94 ] )", ". a richer set of phenomena occurs when the bh - ns mass ratio is closer to unity , the ns is less compact , the bh has a prograde spin direction , or more generally , some combination of those factors . in such cases", ", the ns will reach the mass - shedding limit prior to dynamical instability , and be tidally disrupted .", "unlike what was described in semi - analytic newtonian models ( see , e.g. , [ 68 , 228 , 77 ] ) and seen in some early newtonian and quasi - relativistic simulations ( see , e.g. , [ 165 , 166 , 138 ] , stable mass transfer , in which angular momentum transfer via mass - shedding halts the inspiral , has never been seen in full gr calculations , nor even in approximate gr models ( see the discussion in ) .", "even so , unstable mass transfer can produce a substantial disk around the bh , though in every gr simulation to data the substantial majority of the ns matter is accreted promptly by the bh ( see for a detailed summary of all current results ) .", "the exact structure of the disk and its projected lifetime depend on the binary system parameters , with the binary mass ratio and spin both important in determining the disk mass and the bh spin orientation critical for determining both the disk s vertical structure and its thermodynamic state given the shock heating that occurs during the ns disruption .", "in general , the mass and temperature of the post - merger disks are comparable to those seen in some ns - ns mergers , and inasmuch as either is a plausible sgrb progenitor candidate then both need to be viewed as such . to date , no calculation performed in full gr has found any bound and self - gravitating ns remnant left over after the merger , including both ns cores that survive the initial onset of mass transfer by recoiling outward ( predicted for cases in which stable mass transfer was thought possible , as noted above ) or those in which bound objects form through fragmentation of the circum - bh disk .", "motivated by observations of wide - ranging timescales for x - ray flares in both long and short grbs , the latter channel has been suggested to occur in collapsars and mentioned in the context of mergers , possibly on longer timescales than current simulations permit .", "even so , there is no analogue to the hmns state that may result from ns - ns mergers , nor any mechanism for a delayed sgrb as provided by hmns collapse .", "constructing qe sequences for a given set of ns parameters requires sophisticated numerical schemes , but not supercomputer - scale resources , as we discuss in section 4 below , focusing first on the numerical techniques used to construct qe binary data in gr , and the astrophysical information contained in the gw emission during the inspiral phase .", "merger and ringdown , on the other hand , typically require large - scale numerical simulations , including some of the largest calculations performed at major supercomputer centers , as we discuss in detail section 5 and 6 below . to illustrate the various physical processes that occur during ns - ns mergers , we show the evolution of three different ns - ns merger simulations in figures 3 , 4 , and 5 , taken from figures 46 of . in figure 3", ", we see the merger of two equal - mass nss , each of mass mns = 1.4 m , described by the apr ( akmal - pandharipande - ravenhall ) eos . in the second panel , clear evidence of tidal lags is visible shortly after first contact , leading to a slightly off - center collision pattern . by the third panel ,", "an ellipsoidal hmns has been formed , surrounded by a disk of material of lower density , which gradually relaxes to form a more equilibrated hmns by the final panel . in figure 4 , we see a merger of two slightly heavier equal - mass nss with mns = 1.5 m. in this case , the deeper gravitational potential limits the amount of mass that goes into the disk , and once a bh is formed ( with a horizon indicated by the dashed blue circle in the final panel ) it accretes virtually all of the rest mass initially present in the two nss , with only 0.004% of the total remaining outside the horizon . \n", "figure 3isodensity contours and velocity profile in the equatorial plane for a merger of two equal - mass nss with mns = 1.4 m assumed to follow the apr model for the ns eos .", "figure 4isodensity contours and velocity profile in the equatorial plane for a merger of two equal - mass nss with mns = 1.5 m assumed to follow the apr model for the ns eos . with a higher mass than the remnant shown in figure 3 ,", "the remnant depicted here collapses promptly to form a bh , its horizon shown by the dashed blue circle , absorbing all but 0.004% of the total rest mass from the original system .", "figure 5isodensity contours and velocity profile in the equatorial plane for a merger of two unequal - mass nss with m1 = 1.3 m and m2 = 1.6 m , with both assumed to follow the apr model for the ns eos . in unequal - mass mergers ,", "the lower mass ns is tidally disrupted during the merger , forming a disk - like structure around the heavier ns . in this case , the total mass of the remnant is sufficiently high for prompt collapse to a bh , but 0.85% of the total mass remains outside the bh horizon at the end of the simulation , which is substantially larger than for equal - mass mergers with prompt collapse ( see figure 4 ) .", "/ m0 vs. dimensionless orbital frequency m0 , where m0 is the total adm ( arnowitt - deser - misner ) mass of the two components at infinite separation , for two qe ns - ns sequences that assume a piecewise polytropic ns eos .", "the equal - mass case assumes mns = 1.35 m for both nss , while the unequal - mass case assumes m1 = 1.15 m and m2 = 1.55 m. the thick curves are the numerical results , while the thin curves show the results from the 3pn approximation .", "the lack of any minimum suggests that instability for these configurations occurs at the onset of mass shedding , and not through a secular orbital instability .", "isodensity contours and velocity profile in the equatorial plane for a merger of two equal - mass nss with mns = 1.4 m assumed to follow the apr model for the ns eos .", "isodensity contours and velocity profile in the equatorial plane for a merger of two equal - mass nss with mns = 1.5 m assumed to follow the apr model for the ns eos . with a higher mass than the remnant shown in figure 3 , the remnant depicted here collapses promptly to form a bh , its horizon shown by the dashed blue circle , absorbing all but 0.004% of the total rest mass from the original system .", "isodensity contours and velocity profile in the equatorial plane for a merger of two unequal - mass nss with m1 = 1.3 m and m2 = 1.6 m , with both assumed to follow the apr model for the ns eos . in unequal - mass mergers ,", "the lower mass ns is tidally disrupted during the merger , forming a disk - like structure around the heavier ns . in this case , the total mass of the remnant is sufficiently high for prompt collapse to a bh , but 0.85% of the total mass remains outside the bh horizon at the end of the simulation , which is substantially larger than for equal - mass mergers with prompt collapse ( see figure 4 ) .", "dimensionless binding energy eb / m0 vs. dimensionless orbital frequency m0 , where m0 is the total adm ( arnowitt - deser - misner ) mass of the two components at infinite separation , for two qe ns - ns sequences that assume a piecewise polytropic ns eos .", "while the unequal - mass case assumes m1 = 1.15 m and m2 = 1.55 m. the thick curves are the numerical results , while the thin curves show the results from the 3pn approximation .", "the lack of any minimum suggests that instability for these configurations occurs at the onset of mass shedding , and not through a secular orbital instability .", "image reproduced by permission from figure 16 of , copyright by aas . in figure 5 , we see the merger of an unequal - mass binary , with masses m1 = 1.3 m and m2 = 1.6 m. in this case , the heavier ns partially disrupts the lighter ns prior to merger , leading to the secondary ns being accreted onto the primary . in this case , a much more massive disk is formed and , even after a bh forms in the center of the remnant , a substantial amount of matter , representing 0.85% of the total mass , remains outside the horizon . later accretion of this material could potentially release the energy required to power a sgrb ." ], [ "while dynamical calculations are required to understand the gw and em emission from bh - ns and ns - ns mergers , some of the main qualitative features of the signals may be derived directly from qe sequences . from the variation of total system energy with binary angular velocity along a given sequence , it is possible to construct an approximate gw energy spectrum degw / df immediately from qe results , essentially by performing a numerical derivative ( see figure 6 ) .", "doing so for a number of different sequences makes it possible to identify key frequencies where tidal effects may become measurable and to identify these with binary parameters such as the system mass ratio and ns radius .", "similarly , since qe sequences should indicate whether a binary begins to shed mass prior to passage through the isco ( see figure 7 ) , one may be able to classify observed signals into mass - shedding and non - mass - shedding events , and to use the critical point dividing those cases to help constrain the ns eos .", "single - parameter estimates have been derived for ns - ns binaries using qe sequences ( and for bh - ns binaries using qe and dynamical calculations ) .", "ns - ns binaries typically approach instability at frequencies fgw 1 khz , where laser shot noise is severely degrading the sensitivity of an interferometer detector . to observe isco - related effects with higher signal - to - noise , it may be necessary to operate gw observatories using narrow - band signal recycling modes , in which the sensitivity in a narrow range of frequencies is enhanced at the cost of lower sensitivity to broadband signals . \n", "figure 7mass - shedding indicator \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$\\chi \\equiv { \\left({{{\\partial ( \\ln \\,h ) } \\over { \\partial r } } } \\right)_{{\\rm{eq}}}}/{\\left({{{\\partial ( \\ln \\,h ) } \\over { \\partial r } } } \\right)_{{\\rm{pole}}}}$\\end{document } vs. orbital frequency m0 , where h is the fluid enthalpy and the derivative is measured at the ns surface in the equatorial plane toward the companion and toward the pole in the direction of the angular momentum vector , for a series of qe ns - ns sequences assuming equal - mass components . here", ", = 1 corresponds to a spherical ns , while = 0 indicates the onset of mass shedding .", "more massive nss are more compact , and thus able to reach smaller separations and higher angular frequencies before mass shedding gets underway .", "mass - shedding indicator \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$\\chi \\equiv { \\left({{{\\partial ( \\ln \\,h ) } \\over { \\partial r } } } \\right)_{{\\rm{eq}}}}/{\\left({{{\\partial ( \\ln \\,h ) } \\over { \\partial r } } } \\right)_{{\\rm{pole}}}}$\\end{document } vs. orbital frequency m0 , where h is the fluid enthalpy and the derivative is measured at the ns surface in the equatorial plane toward the companion and toward the pole in the direction of the angular momentum vector , for a series of qe ns - ns sequences assuming equal - mass components . here", ", = 1 corresponds to a spherical ns , while = 0 indicates the onset of mass shedding .", "more massive nss are more compact , and thus able to reach smaller separations and higher angular frequencies before mass shedding gets underway .", "it is important to note that , while the potential parameter space for ns eos models is still very large , a much smaller set may serve to classify models for comparison with the first generation of gw detections . indeed , by breaking up the eos into piecewise polytropic segments", ", one may use as few as four parameters to roughly approximate all known eos models , including standard nuclear models as well as models with kaon or other condensates . to illustrate this ,", "we show in figure 8 four different qe models for ns - ns configurations with different eos , taken from ; all have m1 = 1.15 m and m2 = 1.55 m , and they correspond to the closest separation for which the qe code still finds a convergent result . \n", "figure 8isodensity contours for qe models of ns - ns binaries . in each case , the two nss have masses m1 = 1.15 m ( left ) and m2 = 1.55 m ( right ) , and the center - of - mass separation is as small as the qe numerical methods allow while able to find a convergent result .", ", the two nss have masses m1 = 1.15 m ( left ) and m2 = 1.55 m ( right ) , and the center - of - mass separation is as small as the qe numerical methods allow while able to find a convergent result .", "the inspiral of ns - ns binaries may yield complementary information about the ns structure beyond what can be gleaned from qe studies of tidal disruption .", "nss have a wide variety of oscillation modes , including f - modes , g - modes , and r - modes , any of which may be excited by resonances with the orbital frequency as the latter sweeps upward .", "should a particular oscillation mode be excited resonantly , it can then serve briefly as an energy sink for the system , potentially changing the phase evolution of the binary .", "for example , in a rapidly spinning ns , excitation of the m = 1 r - mode can be significant , yielding a change of over 100 radians for the pre - merger gw signal phase in the case of a millisecond spin period . for ns - ns mergers in the field", ", this would require one of the nss to be a young pulsar that has not yet spun down significantly , which is unlikely because of the difficulty in obtaining such an extremely small binary separation after the second supernova .", "other modes , such as the l = 2 f - mode , may be excited in less extreme circumstances , also yielding information about ns structure parameters .", "it has long been known that the gw emission from eccentric binaries is very efficient at radiating away angular momentum relative to the radiated energy ; as a result , the orbital eccentricity decreases as a binary inspirals , so that orbits should be very nearly circular long before they enter the detection range of ground - based interferometers .", "the only exception could be from a dynamical capture process that would create a binary with a significant eccentricity and very small orbital separation .", "such eccentric binaries have been predicted to form in the nuclear cluster of our galaxy ( see , e.g. , ) and in core - collapsed globular clusters [ 127 , 167 ] .", "however , at present , no formalism exists to construct initial data for such systems , besides superposing the individual components with sufficiently large initial separations to minimize constraint violations . using this circularity of primordial binaries as a starting point", ", one may use the constraint equations of gr , along with an assumption of quasi - circularity , to derive sets of elliptic equations describing compact binary configurations .", "for both qe and dynamical calculations , most groups typically make use of the arnowitt - deser - misner ( adm ) 3 + 1 splitting of the metric , which foliates the metric into a set of three - dimensional hypersurfaces by introducing a time coordinate .", "the resulting form of the metric , which is completely general , is written 7\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$${g_{\\mu \\nu } } \\equiv ( - { \\alpha ^2 } + { \\beta _ i}{\\beta ^i})d{t^2 } + 2{\\beta _ i}dt\\;d{x^i } + { \\gamma _ { ij}}d{x^i}d{x^j},$$\\end{document } where is known as the lapse function , i the shift vector , and ij the spatial three - metric intrinsic to the hypersurface .", "we are following the standard relativistic notation here where greek indices correspond to four - dimensional quantities and latin indices to spatial three - dimensional quantities .", "thus , the shift vector is a 3-vector , raised and lowered with the spatial 3-metric ij rather than the spacetime 4-metric g. to simplify matters , one typically defines a conformal factor that factors out the determinant of the 3-metric , such that 8\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$\\psi \\equiv { [ \\det ( { \\gamma _ { ij}})]^{1/12}},$$\\end{document } introducing the conformal 3-metric \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\tilde \\gamma _ { ij } } \\equiv { \\psi ^{- 4}}{\\gamma _ { ij}}$\\end{document } with unit determinant .", "while the 3-metric is a fundamental component of the geometric structure of the spacetime , the lapse function and shift vector are gauge quantities that simply reflect our choice of coordinates .", "thus , while one often determines the lapse and shift in order to construct a appropriately stationary solution in the relevant coordinates between neighboring time slices , their values are often replaced to initialize dynamical runs with more convenient choices and thus different assumptions about coordinate evolution in time .", "the field equations of general relativity take the deceptively simple form 9\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$${g_{\\mu \\nu } } \\equiv { r_{\\mu \\nu } } - { 1 \\over 2}{g_{\\mu \\nu}}r = 8\\pi { t_{\\mu \\nu}},$$\\end{document } where g is the einstein tensor , r and r the ricci curvature tensor and the curvature scalar , and t the stress - energy tensor that accounts for the presence of matter , electromagnetic fields , and other physical effects that contribute to the mass - energy of the spacetime .", "since gr is a second - order formulation , valid initial data must include not only the metric but also its first time derivative .", "it generally proves most convenient to introduce the time derivative of the metric after subtracting away the lie derivative with respect to the shift , yielding a quantity known as the extrinsic curvature , kij : 10\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$({\\partial _ t } - { { \\mathcal l}_\\beta}){\\gamma _ { ij } } \\equiv - 2\\alpha { k_{ij}}.$$\\end{document } both the 3-metric and extrinsic curvature are symmetric tensors with six free parameters . for systems containing nss", ", one must consider the effects of nuclear matter through its presence in the stress - energy tensor t. it is common to assume that the matter has the eos describing a perfect , isotropic fluid , for which the stress energy tensor is given by 11\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$${t^{\\mu \\nu } } \\equiv ( { \\rho _ 0 } + { \\rho _ 0}\\varepsilon + p){u^\\mu}{u^\\nu } + p{g^{\\mu \\nu}},$$\\end{document } where 0 , , p and u are the fluid s rest - mass density , specific internal energy , pressure , and 4-velocity , respectively .", "many calculations further assume that the ns eos is described by an adiabatic polytrope , for which 12\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$p = ( \\gamma - 1){\\rho _", "0}\\varepsilon = k\\rho _ 0^\\gamma,$$\\end{document } where is the adiabatic index of the gas and k a constant , though a number of models designed to incorporate nuclear physics and/or strange matter condensates have also been constructed and studied ( see sections 4.4 and 6 below ) .", "the problem in constructing initial data is not so much producing solutions that are self - consistent within gr , but rather to specify a sufficient number of assumptions to fully constrain a solution . indeed", ", there are only four constraints imposed by the equations of gr , known as the hamiltonian and momentum constraints .", "the hamiltonian constraint is found by projecting einstein s equations twice along the direction defined by a normal observer , and describes the way stress - energy leads to curvature in the metric ( see , e.g. , for a thorough review ) : 13\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$r + { k^2 } - { k_{ij}}{k^{ij } } = 16\\pi \\rho,$$\\end{document } where r is the scalar curvature of the 4-metric , \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$k = k_i^i$\\end{document } is the trace of the extrinsic curvature , and 14\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$\\rho \\equiv { \\bf{n}}\\cdot{\\bf{t}}\\cdot{\\bf{n } } = { \\alpha ^2}{t^{00 } } = \\rho h{(\\alpha { u^0})^2 } - p$$\\end{document } is the total energy density seen by a normal observer .", "the third term indicates that the total energy density is found by projecting the stress - energy tensor in the direction of the unit - length timelike normal vector n , whose components are given by 15\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$${n_\\mu } = ( - \\alpha,0,0,0){.}$$\\end{document } in the final expression h 1 + + p/0 is the specific enthalpy of the fluid , and the combination n u represents the lorentz factor of the matter seen by an inertial observer .", "the notation here makes use of the standard summation convention , in which repeated indices are summed over .", "projecting einstein s equations in the space and time directions leads to the vectorial momentum constraint 16\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$${d_i}k_j^i - { d_i}k = 8\\pi { j_i},$$\\end{document } where di represents a three - dimensional covariant derivative and ji", " 0hnui is the total momentum seen by a normal observer . in order to specify all the free variables that remain once the hamiltonian and momentum constraints are satisfied ,", "one , known as the conformal transverse - traceless ( ctt ) decomposition , underlies the bowen - york solution for black holes with known spin and/or linear momentum that is widely used in the moving puncture approach . to date , however , the ctt formalism has not been used to generate ns - ns initial data , and we refer readers to [ 284 , 63 ] for descriptions of the ctt formalism applied to bh - ns and bh - bh initial data , respectively . to date , most groups have used the conformal thin sandwich ( cts ) formalism to generate qe ns - ns data ( see for a review , [ 13 , 137 ] for the initial steps in the formulation , and [ 326 , 327 , 333 , 69 ] for derivations of the form in which it is typically used today ) .", "one first specifies that the conformal 3-metric is spatially flat , i.e. , \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${{\\tilde \\gamma}_{ij } } = { \\delta _ { ij}}$\\end{document } , where ij is the kronecker delta function . under this assumption , the only remaining parameter defining the spatial metric is the conformal factor , which serves the role of a gravitational potential .", "indeed , in the limit of weak sources , it is linearly related to the standard newtonian potential .", "next , one specifies that there exists a helical killing vector , so that , as the configuration advances forward in time , all quantities remain unchanged when properly rotated at constant angular velocity in the azimuthal direction .", "this is sufficient to fix all but the trace of the extrinsic curvature , with the other components forced to satisfy the relation 17\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$${k^{ij } } = - { 1 \\over { 2\\alpha { \\psi ^4}}}\\left [ { { \\nabla ^i}{\\beta ^j } + { \\nabla ^j}{\\beta ^i } - { 2 \\over 3}{\\gamma ^{ij}}{\\nabla _", "k}{\\beta ^k } } \\right].$$\\end{document } the trace of the extrinsic curvature k remains a free parameter in this approach . while one may choose arbitrary prescriptions to fix it , most implementations choose a maximal slicing of the spatial hypersurfaces by setting k = tk = 0 . under these assumptions", "the hamiltonian and momentum constraints , along with the trace of the einstein equations , yield five elliptic equations for the lapse , shift vector , and conformal factor : 18\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$${\\nabla ^2}\\psi = - { \\psi ^5}\\left({{1 \\over 8}{k^{ij}}{k_{ij } } - 2\\pi \\rho } \\right),$$\\end{document } \n 19\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$${\\nabla ^2}(\\alpha \\psi ) = \\alpha { \\psi ^5}({7 \\over 8}{\\psi ^4}{k_{ij}}{k^{ij } } + 2\\pi { \\psi ^4}(\\rho + 2s),$$\\end{document } \n 20\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$${\\nabla ^2}{\\beta ^i } + { 1 \\over 3}{\\nabla ^j}{\\nabla _ j}{\\beta ^i } = 2\\alpha { \\psi ^4}{k^{ij}}{\\nabla _ j}(\\alpha { \\psi ^{- 6 } } ) + 16\\alpha { \\psi ^4}{j^i},$$\\end{document } where 21\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$s = ( { g_{\\mu \\nu } } + { n_\\mu}{n_\\nu}){t^{\\mu \\nu } } = s_j^j = 3p + ( \\rho + p)[1 - \\gamma _", "n^{- 2}]$$\\end{document } is the trace of the stress - energy tensor projected twice in the spatial direction . while these five equations are linked and the right - hand sides are nonlinear , they are amenable to solution using iterative methods .", "boundary conditions are set by assuming asymptotic flatness : at large radii , the metric takes on the minkowski form so 1 , 1 , and \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$\\beta _ { { \\rm{rot}}}^i \\rightarrow \\omega \\times \\vec r$\\end{document}. we note that a purely corotating shift term yields zero when we apply the left - hand side of eq . 20 , so we may subtract it away and solve the equation with a boundary condition of zero instead . the breakdown in eqs . 18 , 19 , and 20 is not unique .", "the meudon group [ 125 , 124 ] , to pick one example , has often chosen to define ln and ln( ) , and replace eqs . 18 and 19 with the equivalent pair \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t", "\\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$\\begin{array}{*{20}c } { { \\nabla ^2}\\nu = { \\psi ^4}{k^{ij}}{k_{ij } } - { \\nabla _ i}\\nu { \\nabla ^i}\\beta + 4\\pi { \\psi ^4}(\\rho + s),}\\quad\\quad\\quad\\quad\\\\ { { \\nabla ^2}\\beta = { 3 \\over 4}{\\psi ^4}{k^{ij}}{k_{ij } } - { 1 \\over 2}({\\nabla _ i}\\nu { \\nabla ^i}\\nu + { \\nabla _ i}\\beta { \\nabla ^i}\\beta ) + 4\\pi { \\psi ^4}s.}\\\\ \\end{array}$$\\end{document } this approach is sufficient to define the field component of the configuration , but one still needs to solve for the matter quantities as well .", "one starts by assuming that there is a known prescription for reconstructing the density , internal energy , and pressure from the enthalpy h. next , one has to assume some model for the spin of the ns . while corotation is often a simpler choice , since the velocity field of the matter is zero in the corotating frame , the more physically reasonable condition is irrotational flow . indeed", "a realistic ns viscosity is never sufficiently large to tidally lock the ns to its companion during inspiral [ 45 , 146 ] .", "if we define the co - momentum vector wi = hui , irrotational flow implies the vanishing of its curl : 22\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$\\nabla \\times w = { \\nabla _ \\mu}{w_\\nu } - { \\nabla _ \\nu}{w_\\mu } = { \\partial _ \\mu}{w_\\nu } - { \\partial _ \\nu}{w_\\mu } = 0,$$\\end{document } which allows us to define a velocity potential such that w . using these quantities , one may write down the integrated euler equation 23\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$h\\alpha { \\gamma _ n}/(1 - { \\gamma _ { ij}}{u^i}u_0^j ) = { \\rm{const}}{.},$$\\end{document } where the 3-velocity u of the fluid with respect to an eulerian observer is given by 24\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$${u^i } \\equiv { { { u^i } + { \\beta ^i}{u^0 } } \\over { { \\gamma _ n}}},$$\\end{document } and the orbital 3-velocity \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$u_0^i$\\end{document } with respect to the same observer by \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$u_0^i = { \\beta ^i}/\\alpha$\\end{document}. for details on the ways in which one may construct an elliptic equation for the velocity potential , we refer to the derivation in . to date , all qe sequences and dynamical runs in the literature have assumed that nss are either irrotational or synchronized , but it is possible to construct the equations for arbitrary ns spins so long as they are aligned [ 29 , 309 ] . while suggestions are also given there on how to construct qe sequences with intermediate spins using the new formalism", "similarly , a formalism to add magnetic fields self - consistently to qe sequences has been constructed , as current dynamical simulations typically begin from data assuming either zero magnetic fields or those that only contribute via magnetic pressure .", "the primary drawback of the cts system is the lack of generality in assuming the spatial metric to be conformally flat , which introduces several problems .", "the kerr metric , for example , is known not to be conformally flat , and conformally flat attempts to model kerr bhs inevitably include spurious gw content .", "the same problem affects binary initial data : in order to achieve a configuration that is instantaneously time - symmetric , one actually introduces spurious gravitational radiation into the system , which can affect both the measured parameters of the initial system as well as any resulting evolution .", "other numerical formalisms to specify initial data configurations in gr have been derived using different assumptions .", "usui and collaborators derived an elliptic set of equations by allowing the azimuthal component of the 3-metric to independently vary from the radial and longitudinal components [ 319 , 318 ] , finding good agreement with the other methods discussed above .", "a number of techniques have been developed to construct helically symmetric spacetimes in which one actually solves einstein s equations to evaluate the non - conformally - flat component of the metric , which are typically referred to as waveless or ", " formalisms [ 260 , 50 , 291 ] . in terms of the fundamental variables , rather than specifying the components of the conformal spatial metric by ansatz , one specifies instead the time derivative of the extrinsic curvature using a physically motivated prescription .", "these methods are designed to match the proper asymptotic behavior of the metric at large distances , and may be combined with techniques designed to enforce helical symmetry of the metric and gauge in the near zone the near zone helical symmetry , or ", "nhs formalism ) to produce a global solution [ 315 , 334 , 316 ] .", "qe sequences generated using this formalism have shown that the resulting conformal metric is indeed non - flat , with deviations of approximately 1% for the metric components , and similar differences in the system s binding energy when compared to equivalent cts results .", "they suggest that underestimates in the quadrupole deformations of ns prior to merger may result in total phase accumulation errors of a full cycle , especially for more compact ns models .", "qe formalisms reflect the assumption that binaries will be very nearly circular , since gw emission acting over very long timescales damps orbital eccentricity to negligible values for primordial ns - ns binaries between their formation and final merger .", "binaries formed by tidal capture and other dynamical processes , which may be created with much smaller initial separations , are more likely to maintain significant eccentricities all the way to merger ( see , e.g. , for a discussion of such processes for bh - bh binaries ) and it has been suggested based on simple analytical models that such mergers , likely occurring in or near dense star clusters , may account for a significant fraction of the observed sgrb sample . however , more detailed modeling is required to work out accurate estimates of merger rates given the complex interplay between dynamics and binary star evolution that determines the evolution of dense star clusters , and given the large uncertainties in the distributions of star cluster properties in galaxies throughout the universe .", "no initial data have ever been constructed in full gr for merging ns - ns binaries with eccentric orbits since the systems are then highly time - dependent , while the calculations performed to evolve them generally use a superposition of two stationary ns configurations .", "there are a number of numerical techniques that have been used to solve these elliptic systems .", "the first calculations of ns - ns qe sequences , in both cases for synchronized binaries , were performed by wilson , mathews , and marronetti [ 327 , 328 , 189 ] and baumgarte et al . [ 25 , 26 ] .", "the former used a finite differencing scheme , and centered different quantities at cells , vertices , and faces in order to construct a system of equations that was solved using fast matrix inversion techniques , while the latter used a cartesian multigrid scheme , restricted to an octant to increase computational efficiency .", "after a formalism for evaluating qe irrotational ns - ns sequences was developed [ 51 , 313 ] , some of the first results were obtained by ury and eriguchi , who developed a finite - differencing code in spherical coordinates allowing for the solution of relativistic ns - ns binaries using green s functions[313 , 317 ] .", "their method extended the self - consistent field ( scf ) work of , which had previously been applied to axisymmetric configurations .", "irrotational configurations were also generated by marronetti et al . , using the same finite difference scheme as found in the work on synchronized binaries .", "the most widely used direct grid - based solver in numerical relativity is the bam_elliptic solver , which solves elliptic equations on single rectangular grids or multigrid configurations .", "it is included within the cactus code , which is widely used in 3-d numerical relativity . in particular", "it has been used to initiate a number of single and binary bh simulations , including one of the original breakthrough binary puncture works .", "lagrangian methods , typically based on smoothed particle hydrodynamics ( sph ) [ 181 , 118 , 194 ] ) have been used to generate both synchronized and irrotational configurations for pn [ 10 , 99 , 101 , 100 ] and conformally flat ( cf ) [ 211 , 210 , 97 , 212 , 207 , 209 , 208 , 34 , 35 , 33 ] calculations of ns - ns mergers , but they have not yet been extended to fully gr calculations , in part because of the difficulties in evolving the global spacetime metric .", "the most widely used data for numerical calculations are those generated by the meudon group ( see section 4.4 below for details on their calculations and for a detailed description of their methods ) .", "the code they developed , lorene , uses multidomain spectral methods to solve elliptic equations ( while the code has been used primarily for relativistic stellar and binary configurations , it can be used as a more general solver ) . around each star ,", "one creates a set of nested , contiguous grids , with points arrayed in the radial and angular directions .", "the outermost grid may be allowed to extend to spatial infinity through a compactification transformation of the radial coordinate .", "to solve elliptic equations for various field quantities , one breaks each into a sum of two components , each of whose source terms are concentrated in one ns or the other .", "similarly , the source terms themselves are split into two pieces , ideally , so each component is well - described by spheroidal spectral coefficients centered around each star . using the spectral expansion", ", one may pass values from one star to the other and then recalculate spectral coefficients for the other grid configuration .", "this scheme has several efficiency advantages over direct grid - based methods , which helps to explain its popularity .", "first , the domain geometry may be chosen to fit to a ns surface , which eliminates gibbs phenomenon - related errors and allows for exponential convergence with respect to the number of grid points , rather than the geometric convergence that characterizes finite difference - based grid codes .", "second , the use of spectral methods requires much less computer memory than grid - based codes , and , as a result , lorene is a serial code that can run easily on any off - the - shelf pc , rather than requiring a supercomputer platform .", "ns - ns binaries may be well approximated by qe configurations up until they reach separations comparable to the sizes of the binary components themselves , that latter phase lasting a fraction of a second after an inspiral of millions of years or more .", "the eventual merger will occur after the binary undergoes one of two possible orbital instabilities .", "if the total binary energy and angular momenta reach a minimum at some separation , which defines the isco , the binary becomes dynamically unstable and plunges toward merger .", "alternately , if the ns fills its roche lobe ( typically the lower density ns ) mass will transfer onto the primary and the secondary will be tidally disrupted .", "the parameters of some ns - ns systems could technically allow for stable mass transfer , in which mass loss from a lighter object to a heavier one leads to a widening of the binary separation .", "this does occur for some binaries containing white dwarfs , but every dynamical calculation to date using full gr or even approximate gr has found that the rapid inspiral rate leads to inevitably unstable mass transfer and the prompt merger of a binary .", "many of the results later confirmed using relativistic qe sequences were originally derived in newtonian and pn calculations , particularly as explicit extensions of chandrasekhar s body of work ( see ) .", "chandrasekhar s studies of incompressible fluids were first extended to compressible binaries by lai , rasio , and shapiro [ 156 , 155 , 158 , 157 , 159 ] , who used an energy variational method with an ellipsoidal treatment for polytropic nss .", "they established , among other results , the magnitude of the rapid inspiral velocity near the dynamical stability limit , the existence of a critical polytropic index ( n 2 ) separating binary sequences undergoing the two different terminal instabilities , the role played by the ns spin and viscosity and magnitude of finite - size effects in relation to 1pn terms [ 158 , 157 ] , and the development of tidal lag angles as the binary approaches merger .", "they also determined that for most reasonable eos models and nonextreme mass ratios , as would pertain to ns - ns mergers , an energy minimum is inevitably reached before the onset of mass transfer through roche lobe overflow .", "the general results found in those works were later confirmed by , who used a scf technique [ 131 , 132 ] , finding similar locations for instability points as a function of the adiabatic index of polytropes , but a small positive offset in the radius at which instability occurred .", "similar results were also found by [ 311 , 312 ] , but with a slight modification in the total system energy and decrease in the orbital frequency at the onset of instability .", "the first pn ellipsoidal treatments were developed by shibata and collaborators using self - consistent fields [ 270 , 269 , 279 , 281 , 299 ] and by lombardi , rasio , and shapiro . both groups found that the nonlinear gravitational effects imply a decrease in the orbital separation ( increase in the orbital frequency ) at the instability point for more compact ns .", "this result reflects a fairly universal principle in relativistic binary simulations : as gravitational formalisms incorporate more relativistic effects , moving from newtonian gravity to 1pn and on to cf approximations and finally full gr , the strength of the gravitational interaction inevitably becomes stronger .", "the effects seen in fully dynamical calculations will be discussed in section 6 , below .", "the first fully relativistic cts qe data for synchronized ns - ns binaries were constructed by baumgarte et al . [ 26 , 25 ] , using a grid - based elliptic solver .", "their results demonstrated that the maximum allowed mass of nss in close binaries was larger than that of isolated nss with the same ( polytropic ) eos , clearly disfavoring the star - crushing scenario that had been suggested by [ 327 , 187 ] using a similar cts formalism ( but see also the error in these latter works addressed in , discussed in section 6.3 below ) .", "also identified how varying the ns radius affects the isco frequency , and thus might be constrained by gw observations . using a multigrid method , miller et al", ". showed that while conformal flatness remained valid until relatively near the isco , the assumption of syncronized rotation broke down much earlier .", "usui et al . used the green s function approach with a slightly different formalism to compute relativistic sequences and determined that the cts conditions were valid up until extremely relativistic binaries were considered .", "the first relativistic models of physically realistic irrotational ns - ns binaries were constructed by the meudon group using the lorene multi - domain pseudo - spectral method code . since then , the meudon group and collaborators have constructed a wide array of ns - ns initial data , including polytropic ns models [ 125 , 303 , 304 ] , as well as physically motivated ns eos models or quark matter condensates .", "irrotational models have also been constructed by ury and collaborators [ 313 , 317 ] for use in dynamical calculations , and nuclear / quark matter configurations have been generated by oechslin and collaborators [ 212 , 209 ] .", "a large compilation of qe cts sequences constructed using physically motivated eos models including fps ( friedman - pandharipande ) , sly ( skyrme lyon ) , and apr models , along with piecewise polytropes designed to model more general potential cases ( see ) , was published in .", "the most extensive set of results calculated using the waveless / near - zone helical symmetry condition appear in , with equal - mass ns - ns binary models constructed for the fps , sly , and apr eos in addition to = 3 polytropes .", ". please refer to section 6 for a discussion of papers that focus on dynamical simulations instead .", "gravitational schemes include newtonian gravity ( newt. ) , lowest - order post - newtonian theory ( pn ) , conformal thin sandwich ( cts ) including modified forms of the spatial metric ( mod .", "numerical methods include ellipsoidal formalisms ( ellips. ) , self - consistent fields ( scf ) , numerical grids ( grid ) , multigrids , and multipatch , green s function techniques ( greens ) , spectral methods ( spectral ) , or sph relaxation ( sph ) . with regard to eos models , ", "physical eos models include the fps , sly , and apr nuclear eos models , along with their parameterized approximations and other physically motivated models .", "the compactness \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\mathcal c } = m / r$\\end{document } refers to the value for a ns in isolation before it is placed in a binary , and plays no role in newtonian physics .", "the mass ratio q = m2/m1 is defined to be less than unity , and ", "\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$\\gamma = { 7 \\over 5},\\,{5 \\over 3},\\,2,\\,\\infty$\\end{document } \n n / a1.0syn.lainewt.ellips . \n", "\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$\\gamma = { 5 \\over 3},\\,2,\\,3$\\end{document } \n n / a1.0syn./irr.lainewt.ellips . \n", "\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$\\gamma = { 7 \\over 5},\\,{5 \\over 3},\\,3,\\,\\infty$\\end{document } \n", "n / a0.21.0syn./irr.newnewt.scf \n \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$\\gamma = { 5 \\over 3},\\,2,\\,3,\\,{\\rm{wd}}$\\end{document } \n n / a1.0syn.urynewt.scf \n \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$\\gamma = { 5 \\over 3},\\,2,\\,{{17 } \\over 2},\\,2,\\,3,\\,\\infty$\\end{document } \n n / a1.0irr.shibatapngrid = 2 \n \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\mathcal c } = 0.08 - 0.12$\\end{document } \n 1.0syn.shibatapngrid = 3 \n \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\mathcal c } = 0.03$\\end{document } \n 1.0syn.shibatapnellips . \n", "\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$\\gamma = { 5 \\over 3},\\,2,\\,{7 \\over 3},\\,3,\\,5,\\,\\infty$\\end{document } \n\n \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\mathcal c } = 0 - 0.03$\\end{document } \n 1.0syn.lombardipnellips. = 2,3 \n \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\mathcal c } = 0.12 - 0.25$\\end{document } \n 1.0syn./irr.baumgartectsmultigrid = 2 \n \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\mathcal c } = 0.05 - 0.2$\\end{document } \n 1.0syn.usuimod .", "ctsgreens = 2,3, \n \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\mathcal c } = 0.05 - 0.25$\\end{document } \n 1.0syn.uryctsgreens = 2 \n \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\mathcal c } = 0.1 - 0.19$\\end{document } \n 1.0syn./irr.uryctsgreen s \n \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$\\gamma = { 9 \\over 5},\\,2,\\,2.25,\\,2.5,\\,3$\\end{document } \n\n \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\mathcal c } = 0.1 - 0.19$\\end{document } \n 1.0irr.bonazzolactsspectral = 2 \n \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\mathcal c } = 0.14$\\end{document } \n 1.0syn / irr.taniguchictsspectral = 2 \n \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\mathcal c } = 0.12 - 0.18$\\end{document } \n 0.91.0syn./irr.taniguchictsspectral = 1.8,2.25,2.5 \n \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\mathcal c } = 0.08 - 0.18$\\end{document } \n 0.831.0syn./irr.millerctsmultigrid = 2 \n \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\mathcal c } = 0.15$\\end{document } \n 1.0syn.bejgerctsspectralphys . \n", "\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\mathcal c } = 0.14 - 0.19$\\end{document } \n 1.0irr.limousinctsspectralquark \n \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\mathcal c } = 0.19$\\end{document } \n 1.0syn./irr.oechslinctssphquark \n \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\mathcal c } = 0.12 - 0.20$\\end{document } \n 1.0irr.taniguchictsspectralphysical \n \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\mathcal c } = 0.1 - 0.3$\\end{document } \n 0.71.0irr.urywl/nhsmultipatch = 3 , physical \n \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\mathcal c } = 0.13 - 0.22$\\end{document } \n 1.0irr . a summary of various studies focusing on qe sequences of ns - ns binaries", ". please refer to section 6 for a discussion of papers that focus on dynamical simulations instead .", "gravitational schemes include newtonian gravity ( newt. ) , lowest - order post - newtonian theory ( pn ) , conformal thin sandwich ( cts ) including modified forms of the spatial metric ( mod .", "numerical methods include ellipsoidal formalisms ( ellips. ) , self - consistent fields ( scf ) , numerical grids ( grid ) , multigrids , and multipatch , green s function techniques ( greens ) , spectral methods ( spectral ) , or sph relaxation ( sph ) . with regard to eos models , ", "physical eos models include the fps , sly , and apr nuclear eos models , along with their parameterized approximations and other physically motivated models .", "the compactness \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\mathcal c } = m / r$\\end{document } refers to the value for a ns in isolation before it is placed in a binary , and plays no role in newtonian physics .", "the mass ratio q = m2/m1 is defined to be less than unity , and " ], [ "ns - ns binaries are highly relativistic systems , numerous groups now run codes that evolve both gr metric fields and fluids self - consistently , with some groups also incorporating an ideal magnetohydrodynamic evolution scheme that assumes infinite conductivity . the codes that evolve the gr hydrodynamics or magnetohydrodynamics ( grhd and grmhd , respectively ) equations are many and varied , incorporating different spatial meshes , relativistic formalisms , and numerical techniques , and we will summarize the leading variants here .", "all full gr codes now make use of the significant insight gained from bh - bh merger calculations , but much work on these systems predates the three 2005 breakthrough papers by pretorius , goddard , and the group then at ut brownsville ( now at rit ) , with the first successful ns - ns merger calculations announced already in 1999 .", "a list of the groups that have performed ns - ns merger calculations using full gr is presented below ; note that many of these groups have also performed bh - ns simulations , as discussed in the review by shibata and taniguchi .", "of the full gr codes used to evolve ns - ns binaries , almost all are grid - based and make use of some form of adaptive mesh refinement .", "the one exception is the spec code developed by the sxs collaboration , formed originally by caltech and cornell , which has used a hybrid spectral - method field solver with grid - based hydrodynamics .", "most make use of the bssn formalism for evolving einstein s equations ( see section 5.2.1 below ) , while the had code uses the alternate generalized harmonic gauge ( ghg ) approach .", "this technique is also used by the sxs collaboration and the princeton group , who have both performed simulations of merging bh - ns binaries ( see section 6.6 ) but have yet to report any results on ns - ns mergers .", "three groups have reported results for ns - ns mergers including mhd ( had , whisky , and uiuc ) , while the kt ( kyoto / tokyo ) group has reported magnetized evolutions of hmns remnants ( see and references therein for a discussion of their work and that of other numerical relativity groups ) , but have yet to use that code for a ns - ns merger calculation . while full gr codes were being developed to study ns - ns binaries , a parallel and rather independent track developed to study detailed microphysical effects in binary mergers using approximate relativistic schemes .", "this includes codes like that developed by the mpg group that accurately track the production of neutrinos and antineutrinos and their annihilation during a merger , as well as post - processing routines that use extensive nuclear chains to track the production of rare high - atomic number r - process elements in merger ejecta .", "meanwhile , the bremen group s sph code includes variable - temperature physically motivated equations of state and magnetohydrodynamics , and has been used with a multi - group flux - limited diffusion neutrino code to generate expected neutrino signatures from merger calculations .", "a summary of groups performing ns - ns merger calculations is presented in table 3 . \n", "the asterisk for the kt collaboration s mhd column indicates that they have used an mhd - based code for other projects , but not yet for ns - ns merger simulations .", "gravitational formalisms include full gr , assumed to be implemented using the bssn decomposition except for the had collaborations s ghg approach , the cf approximation , or newtonian gravity .", "microphysical treatments include physically motivated eos models or quark - matter eos and neutrino leakage schemes.abbrev.refs.grav.mhdmicrophysicskt[134 , 144 , 145 , 265 , 264 , 287 , 288][285 , 286 , 282 , 332]gr*phys .", "eos , -leakagehad[7 , 6]gr ( ghg)ynwhisky[17 , 18 , 14 , 15 , 116 , 117 , 240 , 241]grynuiucgrynjenagrnnmpg[34 , 35 , 33 , 32 , 123 , 209 , 208 , 296]cfnquark , phys .", "the asterisk for the kt collaboration s mhd column indicates that they have used an mhd - based code for other projects , but not yet for ns - ns merger simulations .", "gravitational formalisms include full gr , assumed to be implemented using the bssn decomposition except for the had collaborations s ghg approach , the cf approximation , or newtonian gravity .", "microphysical treatments include physically motivated eos models or quark - matter eos and neutrino leakage schemes .", "there are two distinct schemes used in all binary merger calculations performed to date , the bssn ( baumgarte - shapiro - shibata - nakamura ) [ 277 , 27 ] and generalized harmonic formalisms . for general reviews of these formalisms , as well as other developments in numerical relativity", ", we refer readers to two recent books on numerical relativity [ 4 , 30 ] . here", "the bssn formalism was adapted from the 3 + 1 adm approach , with quantities defined as in eqs . 7 and 8 . while the original adm scheme proved to be numerically unstable , defining the auxiliary quantities \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${{\\tilde \\gamma}^i } = - \\tilde \\gamma _ { , j}^{ij}$\\end{document } and treating these expressions as independent variables stabilized the system and allowed for long - term evolutions . while slight variants exist , the 19 evolved variables are typically either the conformal factor or its logarithm , the conformal 3-metric , the trace k of the extrinsic curvature , the trace free extrinsic curvature aij and the conformal connection functions \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${{\\tilde \\gamma}^i}$\\end{document } the evolution equations themselves are given in appendix a. the bssn scheme was used in the binary merger calculations of the kt collaboration [ 287 , 288 , 285 , 286 ] , the first completely successful ns - ns calculations ever performed in full gr . ever since the utb / rit and goddard groups showed simultaneously that a careful choice of gauge allows bhs to be evolved in bssn schemes without the need to excise the singularity , these puncture gauges have gained widespread hold , and have been used to evolve ns - ns binaries ( and in some cases , bh - ns binaries ) by the kt collaboration , uiuc , and whisky . the generalized harmonic formalism , developed over about two decades from initial theoretical suggestions up to its current numerical implementation [ 112 , 115 ,", "232 , 130 , 231 ] was used to perform the first calculations of merging bh - bh binaries by pretorius , and has since been applied to ns - ns binaries by the had collaboration and to bh - ns mergers by had , sxs [ 85 , 84 , 108 ] , and the princeton group [ 294 , 88 ] .", "it involves introducing a set of auxiliary quantities denoted h representing the action of the wave operator on the spacetime coordinates themselves 25\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$${h^\\mu } \\equiv { \\gamma ^\\mu } \\equiv { g^{\\alpha \\beta}}\\gamma _ { \\alpha \\beta}^\\mu = - { 1 \\over { \\sqrt { - g}}}{\\partial _", "{ - g } { g^{\\mu \\nu } } ) = { g^{\\alpha \\beta}}{\\nabla _ \\alpha}{\\nabla _ \\beta}{x^\\mu } = \\square{x^\\mu},$$\\end{document } which are treated as independent gauge variables whose evolution equation must be specified .", "current first - order formulations [ 171 , 6 ] evolve equations for the spacetime metric g along with its spatial derivative , i = ig and projected time derivative = ng , subject to consistency constraints on the spatial derivatives .", "the first bh - ns merger calculations in the gh formalism used a first - order reduction of the einstein equations and specified the source functions to damp to zero exponentially in time , while the first binary ns merger work used a similar first - order reduction and chose harmonic coordinates with h = 0 . in both formalisms , most groups employ grid - based finite differencing to evaluate spatial derivatives . while finite differencing operators may be easily written down to arbitrary orders of accuracy ,", "there is a trade - off between the computational efficiency achievable by using smaller , second - order stencils and the higher accuracy that can be attained using larger , higher - order ones . for the moment", ", many groups are now moving to at least fourth - order accurate differencing techniques , with a high likelihood that at least the field sector of ns - ns merger calculations will soon be performed at comparable order to bh - bh calculations , at either sixth or eighth - order accuracy , if not higher .", "the main limitation to date involves the complexity of shock capturing using higher - order schemes , as we discuss in section 5.2.3 below .", "ideally , one wishes to impose boundary conditions at large distances that preserve the gr constraints and yield a well - posed initial - boundary value problem . on physical grounds ,", "the boundary should only permit outgoing waves , preventing the reflection of spurious waves back into the numerical grid .", "otherwise , reflections may be avoided by placing the outer boundaries so far away from the matter that they remain causally disconnected from the merging objects for the full duration of the simulation .", "building upon previous work ( see , e.g. , [ 113 , 151 , 12 , 150 , 256 , 242 ] , winicour derived boundary conditions that satisfy all of the desired conditions for the generalized harmonic formalism .", "no such conditions have been derived for the full bssn formalism , though progress has been made ( see , e.g. , [ 43 , 129 ] ) so that we may now construct well - posed boundary conditions in the weak - gravity linearized limit of bssn and for related first - order gravitational formalisms .", "while unigrid schemes are extremely convenient , they tend to be extremely inefficient , since one must resolve small - scale features in the central regions of a merger but also extend grids out to the point where the gw signal has taken on its roughly asymptotic form .", "thus , nearly every code incorporates some means of focusing resolution on the high - density regions via some form of mesh refinement .", "coordinates that represent a continuous radial deformation of a grid , a technique that had previously been used successfully , e.g. , for bh - bh mergers [ 21 , 62 ] .", "while fixed mesh refinement offers the chance for greater computational efficiency and accuracy , much current work focuses on adaptive mesh refinement , in which the level of refinement of the grid is allowed to evolve dynamically to react to the evolving binary configuration .", "the publicly available carpet computational toolkit [ 263 , 262 ] , which is distributed to the community as part of the open source einstein [ 90 , 175 ] uses a moving boxes ", "approach , and has been designed to be compatible with the widely used and publicly available cactus framework .", "it has been successfully implemented by the whisky group to perform ns - ns mergers , by uiuc for their bh - ns mergers , and a host of other groups for bh - bh mergers and additional problems .", "the kt code sacra also implements an adaptive mesh refinement ( amr ) scheme for ns - ns and bh - ns mergers , as does the most recent version of the had collaboration s code , which is based on the publicly available infrastructure of the same name [ 169 , 8 ] , and the bam code employed by the jena group [ 308 , 41 , 122 ] .", "the princeton group also has an amr code , which has been used to perform bh - ns mergers to date [ 294 , 88 , 89 ] one drawback of employing rectangular grids is that memory costs scale like n , where n is the number of grid cells across a side , and total computational effort like n once one accounts for the reduction in the timestep due to the courant - friedrich - levy criterion .", "since one does not necessarily need high angular resolution at large radii , there is great current interest in developing schemes that use some form of spheroidal grid , for which the memory scaling is merely n. a group at lsu has implemented a multi - patch method , in which space is broken up into a number of non - overlapping domains in such a way that the six outermost regions ( projections of the faces of a cube onto spheres of constant radius ) , maintain constant angular resolution and thus produce linear dependence of the total number of grid points on the number of radial points . to date", ", it has been used primarily for vacuum spacetimes and hydrodynamics on a fixed background .", "the sxs collaboration , begun at caltech and cornell and now including members at cita and washington state , has used a spectral evolution code with multiple domains to evolve bh - ns binaries , which achieves the same scaling by expanding the metric fields in modes rather than in position space .", "their first published results on ns - ns binaries are currently in preparation ( see for a brief summary of work to date ) .", "while all of these grid techniques produce tremendous advantages in computational efficiency , each required careful study since deformations of a grid or the introduction of multiple domains can introduce inaccuracies and non - conservative effects .", "as an example , in amr schemes , one must deal with the same reflection issues at refinement boundaries that are present at the physical boundaries of the grid , as discussed above , though the interior nature of the boundaries allows for additional techniques , such as tapered grid boundaries , to be used to minimize reflections there .", "the study of how to minimize spurious effects in these schemes continues , and will represent an important topic for years to come , especially as evolution schemes become more complicated by including more physical effects .", "fluids can not be treated in the same way as the spacetime metric because finite differencing operators do not return meaningful results when placed across discontinuities induced by shocks . instead", ", gr(m)hd calculations must include some form of shock - capturing that accounts for these jumps .", "these are typically implemented in conservative schemes , in which the fluid variables are transformed from the standard primitive set \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\vec p}$\\end{document } , which includes the fluid density , pressure , and velocity ( and magnetic field in mhd evolutions ) , into a new set \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\vec u}$\\end{document } so that the evolution equations may be written in the form 26\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$${\\partial _", "t}(\\vec u ) = \\nabla \\cdot \\vec f + \\vec s,$$\\end{document } where the flux functions \n \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$\\vec f(\\vec p)$\\end{document } and source terms \n \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$\\vec s(\\vec p)$\\end{document } can be expressed in terms of the primitive variables but not their derivatives .", "these schemes allow one to evolve the resulting mhd set of equations so that numerical fluxes are conserved to numerical precision across cell walls as the fluid evolves in time .", "one widely used scheme , often referred to as the valencia formulation , is described in appendix b .. there are important mathematical reasons for casting the grhd / grmhd system in conservative form , primarily since the mathematical techniques describing godunov methods may be called into play . in such methods , we assume that the evolution of the quantities \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\vec u}$\\end{document } may be expressed in the form 27\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$\\vec u(x = { x_i},t = { t_{n + 1 } } ) = \\vec u(x = { x_i},t = { t_n } ) + { { \\delta t } \\over { \\delta x}}\\left({\\vec f(x = { x_{i - 1/2 } } ) - \\vec f(x = { x_{i + 1/2 } } ) } \\right),$$\\end{document } where the points have spatial coordinates xi x0 + ix and the timesteps satisfy tn = t0 + nt . the fluxes must be determined by solving the riemann problem at each cell face ( thus the half - integer indices ) , either exactly or approximately .", "it can be shown that solutions constructed this way , when convergent , must converge to a solution of the original problem , even when shocks are present .", "first one reconstructs the primitives from the conserved variables on both sides of an interface , using interpolation schemes designed to respect the presence of shocks .", "simple schemes involving limiters yield second - order accuracy in general but first - order accuracy at shocks , while higher - order methods such as ppm ( piecewise parabolic method ) and essentially non - oscillatory ( eno ) schemes such as ceno ( central eno ) and weno ( weighted eno ) yield higher accuracy but at much higher computational cost .", "once primitives are interpolated to the cell interfaces , flux terms are evaluated there and one solves the riemann problem describing the evolution of two distinct fluid configurations placed on either side of a membrane ( see for a description ) . while complete solutions of the riemann problem are painstaking to evolve , a number of approximation techniques exist and do not reduce the order of accuracy of the code .", "finally , one must take the conservative solution , now advanced forward in time , and recover the underlying primitive variables , a process that requires solving as many as eight simultaneous equations in the case of grmhd or five for grhd systems .", "a number of methods to do this have been widely studied , and simplifying techniques are known for specific cases ( for the case of polytropic eoss in grhd evolutions , one need only invert a single non - analytic expression and the remaining variables can then be derived analytically ) .", "the inclusion of magnetic fields in hydrodynamic calculations adds another layer of complexity beyond shock capturing .", "magnetic fields must be evolved in such a way that they remain divergence - free , much in the same way that relativistic evolutions must satisfy the hamiltonian and momentum constraints .", "brute force attempts to subtract away any spurious divergence often lead to instabilities , so more intricate schemes have been developed . ", "schemes typically introduce a new field representing the magnetic field divergence and use parabolic / hyperbolic equations to damp the divergence away while moving it off the computational domain ; the approach is relatively simple to implement but prone to small - scale numerical errors . ", "constrained transport schemes stagger the grids on which different physical terms are calculated to enforce the constraints ( see , e.g. , for a particular implementation ) , and have been applied widely to many different physical configurations . recently", ", a new scheme in which the vector potential is used rather than the magnetic field was introduced by etienne , liu , and shapiro [ 93 , 95 ] , and found to yield successful results for a variety of physical configurations including nss and bhs .", "one of the largest uncertainties in the input physics of ns - ns merger simulations is the true behavior of the nuclear matter eos . to date ,", "em observations have yielded relatively weak constraints on the ns mass - radius relation , with the most precise simultaneous measurement of both as of now resulting from observations of type 1 x - ray bursts from accreting nss in three different sources . in each case", ", the ns mass was found to lie in the range 1.3 m mns 2 m and the radius 8 km rns \n 12 km , implying a ns compactness 28\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$${\\mathcal c } \\equiv { { g{m_{{\\rm{ns } } } } } \\over { { r_{{\\rm{ns}}}}{c^2 } } } = 0.1476\\left({{{{m_{{\\rm{ns } } } } } \\over { { n _ \\odot } } } } \\right){\\left({{{{r_{{\\rm{ns } } } } } \\over { 10\\,{\\rm{km } } } } } \\right)^{- 1 } } \\approx 0{.}16 - 0{.}37.$$\\end{document } a more stringent constraint on the ns eos is provided by observations of the shapiro time delay in the binary millisecond pulsar psr j1614 - 2230 , which was found to have a mass mns = 1.97 0.04 m , which would rule out extremely soft eos models incapable of supporting such a massive ns against collapse . as we discuss in more detail below , gw observations are likely to eventually yield tighter constraints than our current em - based ones , though bh - ns mergers , which can undergo stronger tidal disruptions than ns - ns mergers at frequencies closer to ligo and other gw observatories maximum frequency sensitivity band , may prove to be more useful for the task than ns - ns mergers . given the large theoretical uncertainties in describing the proper physical ns eos , many groups have chosen the simplest possible parameterization : a polytrope ( see eq .", "the enthalpy h takes the particularly simple form 29\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$h \\equiv 1 + \\varepsilon + p/\\rho = 1 + \\gamma \\varepsilon.$$\\end{document } initial data are generally assumed to follow the relation 30\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$p = k{\\rho ^\\gamma},$$\\end{document } where k is constant across the fluid . in the presence of shocks , the value of k for a particular fluid element will increase with time .", "we note that the whisky group [ 17 , 18 ] uses the term polytropic to refer to simulations in which eq .", "30 is enforced throughout , which implies adiabatic evolution without shock heating , and use the term ideal fluid to describe an eos that includes the effects of shock heating and enforces eq .", "since the temperatures of nss typically yield thermal energies per baryon substantially below the fermi energy , one may treat nearly all nss as effectively cold , except for the most recently born ones . during the merger process for ns - ns binaries ,", "the matter will remain cold until the two nss are tidally disrupted and a disk forms , at which point the thermal energy input and substantially reduced fluid densities require a temperature evolution model to properly model the underlying physics . in light of these results , some groups adopt a two - phase model for the ns eos ( see , e.g. , ) , where a cold , zero - temperature eos , evaluated as a function of the density only , encodes as much information about as we possess about the ns eos , and the hot phase depends on both the density and internal energy , typically in a polytropic way , 31\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$p(\\rho , \\varepsilon ) = { p_{{\\rm{cold}}}}(\\rho ) + { p_{{\\rm{hot}}}}(\\rho , \\varepsilon)\\quad [ { p_{{\\rm{hot}}}}(\\rho , \\varepsilon ) = ( \\gamma - 1)\\rho ( \\varepsilon - { \\varepsilon _ { { \\rm{cold}}}})].$$\\end{document } there are a number of physically motivated eos models that have been implemented for merger simulations , whose exact properties vary depending on the assumptions of the underlying model . these include models for which the pressure is tabulated as a function of the density only : fps , sly , and apr ; as well as models including a temperature dependence : shen [ 268 , 267 ] and lattimer - swesty . a variety of models have been used to study the effects of quarks , kaons , and other condensates , which typically serve to soften the eos , leading to reduced maximum masses and more compact nss [ 223 , 119 , 230 , 120 , 23 , 5 ] . given the variance among even the physically motivated eos models ,", "it has proven useful to parameterize known eos models with a much more restricted set of parameters . in a series of works ,", "a milwaukee / tokyo collaboration determined that essentially all current eos models could be fit using four parameters , so that their imprint on gw signal properties could be easily analyzed [ 237 , 238 , 184 ] .", "their method assumes that the sly eos describes ns matter at low densities , and that the eos at higher densities can be described by a piecewise polytropic fit with breaks at = 10 and 10 g / cm .", "the four resulting parameters are p1 = p ( = 10 ) , the pressure at the first breakpoint density , which normalizes the overall density scale , as well as 1 , 2 , 3 , the adiabatic exponents in the three regions .", "their results indicate that advanced ligo should be able to determine the ns radius to approximately 1 km at an effective distance of 100 mpc , which would place tight constraints on the value of p1 in particular .", "motivated by the evidence that sgrbs frequently appear in galaxies with very low star formation rates [ 40 , 109 ] , astronomers have suggested that their progenitors are likely to be mergers of either ns - ns and/or bh - ns binaries .", "while soft - gamma repeaters ( sgrs ) have been confirmed as an sgrb source from observations of the system sgr 1806 - 20 , they make up no more than approximately 15% of the total observed sgrb fraction according to the leading population estimates [ 164 , 199 ] .", "there has been much interest in predicting the em signatures of ns - ns and bh - ns mergers , along with the associated neutrino emission .", "the simplest models estimate a local radiation cooling rate for the matter but do not attempt to follow the paths of the photons and/or neutrinos after they are emitted , instead calculating the time - dependent luminosity assuming free streaming .", "such models have been used in non - gr simulations of binary mergers going back more than a decade [ 253 , 246 ] , and recently such schemes have been used to perform full gr ns - ns mergers , including a self - consistent evolution of the electron fraction of the material ye , rather than a passive advection approach .", "more complicated flux - limited diffusion schemes , in which the neutrino fluxes for given species and energies are given by explicit formulae that limit to the correct values for zero optical depth ( free - streaming ) and very large optical depth ( diffusion ) , have been used as a post - processing tool to investigate the merger remnants in newtonian ns - ns mergers , but have yet to be applied to full gr simulations . finally , radiation transport schemes to evolve em and neutrino fluxes passing through fluid configurations have been implemented in numerical gr codes [ 80 , 103 ] , but have yet to be used in binary merger simulations .", "one must determine , using a method unaffected by gauge effects , the perturbations at asymptotically large distances from a source by extrapolating various quantities measured at large but finite distances from the merger itself .", "in the early days of numerical merger simulations , most groups typically assumed newtonian and/or quasi - newtonian gravitation , for which there is no well - defined dynamical spacetime metric .", "gw signals were typically calculated using the quadrupole formalism , which technically only applies for slow - moving , non - relativistic sources ( see for a thorough review of the theory ) . temporarily reintroducing physical constants , the strains of the two polarizations for signals emitted in the z - direction are \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$\\begin{array}{*{20}c } h_{+ } = { g \\over rc^{4}}(\\ddot{\\rlap{\\!-}\\bf{i}}_{xx } - \\ddot { \\rlap{\\!-}\\bf{i}}_{yy } ) , \\\\ h _ { \\times } = { 2 g \\over rc^{4 } } \\ddot{\\rlap{\\!-}\\bf{i}}_{xy } , \\qquad\\quad \\end{array}$$\\end{document } where r is the distance from the source to the observer and \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\ddot{{\\rlap{\\!-}{\\bf i}}}_{ij}}$\\end{document } it the traceless quadrupole moment of the system .", "the energy and angular momentum loss rates of the system due to gw emission are given , respectively , by \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$$\\begin{array}{*{20}c } { - { { \\left({{{de } \\over { dt } } } \\right)}_{{\\rm{gw } } } } = { g \\over { 5{c^5}}}{{\\overset{\\ldots}{{\\rlap{\\!-}{\\mathbf i}}}}_{ij}}{{\\overset{\\ldots}{{\\rlap{\\!-}{\\mathbf i}}}}_{ij}},}\\quad\\\\ { - { { \\left({{{d{l_k } } \\over { dt } } } \\right)}_{{\\rm{gw } } } } = { { 2 g } \\over { 5{c^5}}}{\\epsilon _ { ijk}}{\\ddot{{\\rlap{\\!-}\\mathbf{i}}}_{il}}{{\\overset{\\ldots}{{\\rlap{\\!-}{\\mathbf i}}}}_{lj}}.}\\\\ \\end{array}$$\\end{document } while only approximate , the quadrupole formulae do yield equations that are extremely straightforward to implement in both grid and particle - based codes using standard integration techniques .", "quadrupole methods were adopted for later pn and cf simulations , again because the metric was assumed either to be static or artificially constrained in such a way that made self - consistent determination of the gw signal impossible .", "one important development from this period was the introduction of a simple method to calculate the gw energy spectrum de / df from the gw time - series through fourier transforming into the frequency domain .", "gw signals analyzed in the frequency domain allowed for direct comparison with the ligo noise curve , making it much easier to determine approximate distances at which various gw sources would be detectable and the potential signal - to - noise ratio that would result from a template search . to constrain the nuclear matter eos , one can examine where a gw merger spectrum deviates in a measurable way from the quadrupole point - mass form , 32\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$${\\left({{{de } \\over { df } } } \\right)_{{\\rm{gw } } } } = { { \\pi g{m_1}{m_2 } } \\over 3}{(\\pi g({m_1 } + { m_2}){f_{{\\rm{gw}}}})^{- 1/3}};\\quad { f_{{\\rm{gw } } } } \\equiv 2{f_{{\\rm{orb } } } } = { { { \\omega _ { { \\rm{orb } } } } } \\over \\pi},$$\\end{document } because of finite - size effects , and then link the deviation to the properties of the ns , as we show in figure 9 . \n", "figure 9approximate energy spectrum degw / df derived from qe sequences of equal - mass ns - ns binaries with isolated adm masses mns = 1.35 m and a = 2 eos , but varying compactnesses ( denoted m / r here ) , originally described in .", "the diagonal lines show the energy spectrum corresponding to a point - mass binary , as well as values with 90% , 75% , and 50% of the power at a given frequency .", "asterisks indicate the onset of mass - shedding , beyond which qe results are no longer valid .", "approximate energy spectrum degw / df derived from qe sequences of equal - mass ns - ns binaries with isolated adm masses mns = 1.35 m and a = 2 eos , but varying compactnesses ( denoted m / r here ) , originally described in .", "the diagonal lines show the energy spectrum corresponding to a point - mass binary , as well as values with 90% , 75% , and 50% of the power at a given frequency .", "asterisks indicate the onset of mass - shedding , beyond which qe results are no longer valid .", "full gr dynamical calculations , in which the metric is evolved according to the einstein equations , generally use one of two approaches to calculate the gw signal from the merger , if not both .", "the first method , developed first by by regge and wheeler and zerilli and written down in a gauge - invariant way by moncrief involves analyzing perturbations of the metric away from a schwarzschild background .", "the second uses the newman - penrose formalism to calculate the weyl scalar 4 , a contraction of the weyl curvature tensor , to represent the outgoing wave content on a specially constructed null tetrad that may be calculated approximately .", "the two methods are complementary since they incorporate different metric information and require different numerical integrations to produce a gw time series .", "regardless of the method used to calculate the gw signal , results are often presented by calculating the dominant s = 2 spin - weighted spherical harmonic mode . for circular binaries , the l = 2 , m = 2 mode generally carries the most energy , followed by other harmonics ; in cases where the components of the binary have nearly equal masses and the orbit is circular , the falloff is typically quite rapid , while extreme mass ratios can pump a significant amount of the total energy into other harmonics . for elliptical orbits , other modes can dominate the signal , e.g. , a 3:1 ratio in power for the l = 2 , m = 0 mode to the l = 2 , m = 2 mode observed for high - ellipticity close orbits in ." ], [ "ns - ns merger simulations address a broad set of questions , which can be roughly summarized as follows ( note the same questions apply to bh - ns mergers as well ) : \n what is the final fate of the system , assuming a given set of initial parameters ?", "do we get a prompt collapse to a bh or the formation of a hmns supported against collapse by differential rotation ?", "other outcomes are disfavored , at least for pre - merger nss with masses mns 1.4 m since the supramassive limit is at most 20% larger than that of a non - rotating ns [ 70 , 71 ] , and even for the stiffest eos these values are typically less than 2.8 m.what is the gw signal from the merger , and how does it inform us about the initial pre - merger parameters of the system?what fraction of the system mass is left in a disk around the central bh or hmns ? while deriving exact em emission profiles from a hydrodynamical configuration remains a challenge for the future , minimum conditions that would allow for the energy release observed in sgrbs have been established based on scaling arguments.what is the neutrino and em emission from the system , in both the time and energy domains ?", "obviously , the answer to this question and those that follow depend critically on the answers above.what role do b - fields play in the gw , em , and neutrino emission , and how does that tie in with other models suspected of having the same disk / jet geometry and gamma - ray emission like active galactic nuclei , pre - main sequence stars , etc.?do mergers produce a cosmologically significant quantity of r - process elements , or do those likely get produced by other astrophysical events instead ? \n what is the final fate of the system , assuming a given set of initial parameters ?", "do we get a prompt collapse to a bh or the formation of a hmns supported against collapse by differential rotation ?", "other outcomes are disfavored , at least for pre - merger nss with masses mns 1.4 m since the supramassive limit is at most 20% larger than that of a non - rotating ns [ 70 , 71 ] , and even for the stiffest eos these values are typically less than 2.8 m. what is the gw signal from the merger , and how does it inform us about the initial pre - merger parameters of the system ? what fraction of the system mass is left in a disk around the central bh or hmns ? while deriving exact em emission profiles from a hydrodynamical configuration remains a challenge for the future , minimum conditions that would allow for the energy release observed in sgrbs have been established based on scaling arguments .", "what is the neutrino and em emission from the system , in both the time and energy domains ?", "obviously , the answer to this question and those that follow depend critically on the answers above .", "what role do b - fields play in the gw , em , and neutrino emission , and how does that tie in with other models suspected of having the same disk / jet geometry and gamma - ray emission like active galactic nuclei , pre - main sequence stars , etc . ?", "do mergers produce a cosmologically significant quantity of r - process elements , or do those likely get produced by other astrophysical events instead ?", "the influence of the gravitational formalism used in a numerical simulation on the answer one finds for the questions above differs item by item . determining", "the final fate of a merging system is highly dependent on the gravitational formalism ; ns - ns merger remnants only undergo collapse in quasi - relativistic and fully gr schemes .", "moreover , orbital dynamics at separations comparable to the isco and even somewhat larger depend strongly on the gravitational scheme . in particular , mass loss rates into a disk are often suppressed by orders of magnitude in gr calculations when compared to cf simulations , and even more so in comparison to pn and newtonian calculations .", "em emission profiles from a disk are difficult to calculate accurately without the use of full gr for this reason . on the other hand , while gr is required to calculate the exact gw signal from a merger , even early newtonian simulations predicted many of the qualitative gw emission features correctly , and pn and cf schemes yielded results with some degree of quantitative accuracy about the full wavetrain .", "b - fields have only begun to be explored , but it already seems clear that they will affect the hydrodynamical evolution primarily after the merger in cases where differential rotation in a hmns or disk winds up magnetic field strengths up to energy equipartition levels , vastly stronger than those found in pre - merger nss . for such configurations , non - relativistic calculations can often reproduce the basic physical scenario but full gr is required to properly understand the underlying dynamics .", "finally , the production of r - process elements , which depends sensitively on the thermodynamic evolution of the merger , seems to generally disfavor binary mergers as a significant source of the observed stellar abundances since the temperature and thus the electron fraction of the fluid remains too small , regardless of the nature of the gravitational treatment used in the calculations . this picture may need to be revised if significant mass loss occurs from the hot accretion disk that forms around the central post - merger object , possibly due to energy release from the r - process itself , but numerical calculations do not currently predict sufficient mass loss to match observations .", "since the first ns - ns merger calculations , there have been two main directions for improvements : more accurate relativistic gravitation , resulting in the current codes that operate using a self - consistent fully gr approach , and the addition of microphysical effects , which now include treatments of magnetic fields and neutrino / em radiation . noting that several of the following developments overlapped in time , e.g. , the first full gr simulations by shibata and ury are coincident with the first pn sph calculations , and predate the first cf sph calculations , we consider in turn the original newtonian calculations , those performed using approximate relativistic schemes , the calculations performed using full gr , and finally those that have included more advanced microphysical treatments . before reviewing fully dynamical calculations of ns - ns mergers , it is worthwhile to ask how much information can already be deduced from qe calculations , which may be performed at much smaller computational cost , as well as from semi - analytic pn treatments and related approximate techniques", "clearly , the details of the merger and ringdown phases fall outside the qe regime , so only dynamical calculations can yield reliable information about the stability of remnants , properties of ejecta , or other processes that arise during the merger itself or in its aftermath .", "thus , the primary point of comparison is the gw signal just prior to merger , which is also easier to detect ( for first and second generation interferometers ) .", "the strength of qe calculations lies in their ability to model self - consistently finite - size effects not captured in pn treatments ( which always assume two orbiting point masses ) .", "the increased tidal interaction between the objects typically results in a more rapid phase advance of the binary orbit , which is important for constructing template waveforms that cover the entire ns - ns inspiral , merger , and ringdown .", "while qe sequences potentially offer a wealth of information about well - separated binaries and can help fix the phase evolution of the inspiraling binary , they do have two weaknesses arising as the binary approaches the stability limit .", "first , most qe methods , including the cts formalism described in section 4.2.1 , are time - symmetric , and assume that the ns possess a symmetry plane perpendicular to the direction of motion ( i.e. , a front - back symmetry whose axis is perpendicular to the orbital angular momentum and the binary separation vector ) .", "in reality , tidal lags develop prior to final plunge , with the innermost edge of each ns rotating forward and the outer edge backwards .", "this effect has been captured in analytic and semi - analytic approaches ( see , e.g. , for an early example ) , and is clearly seen in dynamical calculations ( see figure 3 ) , but is not captured in cts - based schemes ( tidal lags also develop in bh - ns merger calculations when the bh has a non - zero spin , since this breaks the front - back symmetry ; see for an example ) .", "a second weakness of qe methods is the treatment of the isco , particularly its importance as a characteristic point along an evolutionary sequence that , in theory , could encode information about the ns eos .", "simple estimates of the infall trajectory derived solely from qe sequences predict a very sudden and rapid infall near the isco , i.e. , the point where the binding energy reaches a minimum along the sequence ( see , e.g. , the argument in ) .", ", binaries transition more gradually to the merger phase , and the inward plunge may occur significantly before reaching the formal isco ; this in turns leads to more rapidly growing deviations from the qe approximation .", "looking at the gw energy spectrum , one typically sees minor deviations from the point - mass predictions at frequencies below those characterizing the isco , but substantially more power at frequencies above it .", "equivalently , the cutoff frequency for gw emission fcut , where the spectrum starts deviating strongly from the point - mass prediction , is usually higher than the qe frequency near the isco , fisco , while simple qe estimates assume these two frequencies to coincide . to date , most attempts to generate waveforms extended back to arbitrarily early starting points involve numerically matching pn signals , typically generated using the taylor t4 approach , onto the early stages of numerically generated waveforms , with some form of maximum overlap method used to provide the most physical transition from one to the other .", "these approaches may be improved by adding tidal effects to the evolution , typically parameterized by the tidal love numbers that describe how tidal gravity fields induce quadrupole deformations .", "tidal effects can be placed into a relativistic framework [ 46 , 74 ] , which may be included within the effective one - body ( eob ) formalism to produce high - accuracy waveforms . in the eob approach", ", resummation methods are used to include higher - order pn effects , though some otherwise unfixed parameters need to be set by comparing to numerical simulations .", "work is in its early stages to compare directly the gw spectra inferred from qe sequences of ns - ns binaries with those generated in numerical relativity simulations , but this comparison has been discussed at some length with regard to bh - ns mergers . noting that ns - ns mergers generally correspond more closely to the bh - ns cases in which an isco is reached prior to the onset of tidal disruption , the kt collaboration [ 283 , 276 ] concluded that the cutoff frequency marking significant deviations from pn point - mass behavior is roughly 30% higher than that marking emission near the classical isco for bh - ns systems ( fcut 1.3 fisco ) .", "a more detailed study has now been performed comparing eob methods to numerical evolutions . by comparing to long - term simulations of ns - ns mergers , baiotti et al . ", "find that eob models may be tuned , via careful choices of their unfixed parameters , to reproduce the gw phases and amplitudes seen in nr evolutions up until the onset of merger .", "they further suggest that the eob approach seems to cover a wider range of phase space than the taylor t4 approach , presumable because of a more consistent representation of tidal effects , and offers the best route forward for construction of more accurate ns - ns inspiral templates .", "the earliest ns - ns merger calculations were performed in newtonian gravity , sometimes with the addition of lowest - order 2.5pn radiation reaction forces , and typically assumed that the ns eos was polytropic .", "both eulerian grid codes [ 214 , 196 , 215 , 197 , 278 , 255 , 201 , 298 ] and lagrangian sph codes [ 234 , 235 , 236 , 76 , 330 , 331 ] were employed , and gw signals were derived under the assumptions of the quadrupole formalism .", "configurations in newtonian gravity can not collapse , so a stable ( possibly hypermassive ) remnant was always formed . for polytropic eos models with adiabatic indices larger than the classical minimum for production of a jacobi ellipsoid , 2.6 , remnants were typically triaxial and maintained a significant - amplitude gw signal until the end of the simulation . for simulations using smaller values of ", ", remnants rapidly relaxed to spheroidal configurations , quickly damping away the resulting gw signal .", "mass loss from the central remnant was often quite significant , with thick accretion disks or completely unbound material comprising up to 1020% of the total system mass mass loss was suppressed in numerical simulations by constructing irrotational , rather than synchronized , initial data .", "irrotational flow is widely thought to be the more physically realistic case , since viscous forces are much too weak to synchronize a ns prior to merger [ 45 , 146 ] .", "when irrotational nss ( which are counter - rotating in the corotating frame of the binary ) first make contact , a vortex sheet forms .", "since the low - density fluid layers at the contact surface are surrounded at first contact by the denser fluid layers located originally within each ns , the configuration is well understood to be kelvin - helmholtz unstable , resulting in rapid mixing through vortex production .", "meanwhile , mass loss through the outer lagrange points is hampered by the reduced rotational velocity along the outer halves of each ns .", "chirp , increasing in frequency and amplitude as the nss spiral inward , followed by a ringdown signal once the stars collide and merge . in [ 330 ,", "331 ] , a procedure to calculate the energy spectrum in the frequency band was laid out , with the resulting signal following the quadrupole , point - mass power - law form up to gw frequencies characterizing the beginning of the plunge . above the plunge frequency ,", "a sharp drop in the gw energy was seen , followed in some cases by spikes at khz frequencies representing coherent emission during the ringdown phase .", "the first steps toward approximating the effects of gr included the use of 1pn dynamics or the cf approximation . using a formalism derived by blanchet , damour , and schfer , the 1pn equations of motion require the solution of eight poisson - like equations in the form 33\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$${\\nabla ^2}\\psi = f(\\vec x),$$\\end{document } where the source terms \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$f(\\vec x)$\\end{document } are compactly supported , and thus the fields may be determined using the same techniques already in place to find the newtonian potential .", "adding in the lowest - order dissipative radiation reaction effects requires solution of a ninth poisson equation for a reaction potential .", "the 1pn formalism was implemented in both grid - based and sph codes [ 10 , 99 , 101 , 100 ] .", "unfortunately , physically realistic nss are difficult to model using a pn expansion , since the characteristic ns compactness \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\mathcal c}\\gtrsim 0.15$\\end{document } , leads to first order corrections that often rival newtonian terms in magnitude . to deal with this problem ayal et al . ", "considered large ( r 30 km ) , low - mass ( < 1 m ) nss , allowing them to study relativistic effects but making results more difficult to interpret for physically realistic mergers . in", "[ 99 , 101 , 100 ] , a dual speed of light approach was used , in which all 1pn effects were scaled down by a constant factor to yield smaller quantities while newtonian and radiation reaction terms were included at full - strength .", "both sph groups found that the gw signal in pn mergers is strongly modulated , whereas newtonian merger calculations typically yielded smooth , either monotonically decreasing or nearly constant - amplitude ringdown signals .", "even reduced 1pn effects were shown to suppress mass loss by a factor of 25 for initially synchronized cases , and disk formation was seen to be virtually non - existent for initially irrotational , equal - mass nss with a stiff ( = 3 polytropic ) eos . moving beyond the linearized regime , several groups explored the cf approximation , which incorporates many of the nonlinear effects of gr into an elliptic , rather than hyperbolic , evolution scheme . while nonlinear elliptic solvers are expensive computationally , they typically yield stable evolution schemes since field solutions are always calculated instantaneously from the given matter configuration .", "18 , 19 , and 20 , at every timestep , and evolving the matter configuration forward in time .", "the metric fields act like potentials , with various gradients appearing in the euler and energy equations .", "while the cts formalism remains the most widely used method to construct ns - ns ( and bh - ns ) initial data , it does not provide a completely consistent dynamical solution to the gr field equations .", "in particular , while it reproduces spherically symmetric configurations like the schwarzschild solution exactly , it can not describe more complicated configurations , including kerr bhs .", "moreover , because the cf approximation is time - symmetric , it also does not allow one to consistently predict the gw signal from a merging configuration . as a result , most dynamical calculations are performed by adding the lowest - order dissipative radiation reaction terms , either in the quadrupole limit or via the radiation reaction potential introduced in .", "the cts equations themselves were originally written down in essentially complete form by isenberg in the 1970s , but his paper was rejected and only published after a delay of nearly 30 years . in the intervening years , wilson , mathews , and marronetti [ 327 , 328 , 188 , 187 ] independently re - derived the entire formalism and used it to perform the first nonlinear calculations of ns - ns mergers ( as a result , the formalism is often referred to as the wilson - mathews or isenberg - wilson - mathews formalism ) . the key result in [ 327 , 328", ", 188 , 187 ] was the existence of a collapse instability , in which the deeper gravitational wells experienced by the nss as they approached each other prior to merger could force one or both to collapse to bhs prior to the orbit itself becoming unstable .", "unfortunately , their results were affected by an error , pointed out in , which meant that much of the observed compression was spurious .", "while their later calculations still found some increase in the central density as the nss approached each other , these results have been contradicted by other qe sequence calculations ( see , e.g. , ) .", "furthermore , using a cf - like formalism in which the nonlinear source terms for the field equations are ignored , dynamical calculations demonstrated the maximum allowed mass for a ns actually increases in response to the growing tidal stress .", "the cf approach was adapted into a lagrangian scheme for sph calculations by the same groups that had investigated pn ns - ns mergers , with oechslin , rosswog , and thielemann using a multigrid scheme and faber , grandclment , and rasio a spectral solver based on the lorene libraries .", "the effects of nonlinear gravity were immediately evident in both sets of calculations . in ,", "ns - ns binaries consisting of initially synchronized nss merged without appreciable mass loss , with no more that 10 of the total system mass ejected , strikingly different from previous newtonian and pn simulations . when evolving initially irrotational systems , found no appreciable developments of spiral arms whatsoever , indicating a complete lack of mass loss through the outer lagrange points .", "both groups also found strong emission from remnants for a stiff eos , as the triaxial merger remnant produced an extended period of strong ringdown emission .", "neither set of calculations indicated that the remnant should collapse promptly to form a bh , but given the high spin of the remnant it was noted that conformal flatness would have already broken down for those systems .", "a summary of full gr calculations of ns - ns mergers is presented in table 4 .", "the kt collaboration was responsible for the only full gr calculations of ns - ns mergers that predate the breakthrough calculations of numerically stable binary bh evolutions [ 231 , 22 , 61 ] , which have since transformed the field of gr hydrodynamics and mhd in addition to vacuum relativistic evolutions ( miller et al . ", "performed ns - ns inspiral calculations in full gr , but were not able to follow binaries through to merger ) .", "the first calculations of ns - ns mergers using a completely self - consistent treatment of gr were performed by shibata and collaborators in the kt collaboration using a grid based code and the bssn formalism .", "cts initial data consisting of equal - mass nss described by a = 2 polytropic eos were constructed via scf techniques , for both synchronized and irrotational configurations .", "the hyperbolic system was evolved on a grid , with an approximate maximal slicing condition that results in a parabolic equation for the lapse and an approximate minimal distortion condition for the shift vector requiring the solution of an elliptic equation at every time step .", "the shift vector gauge condition was found to fail when bhs were produced in the merger remnant , a well - known problem that had long bedeviled simulations involving binary and even single bh evolutions , so modifications were introduced to extend the stability of the algorithm as far as possible . among the key results from this early work was a clear differentiation between mergers of moderately low - compactness nss \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t", "\\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$({\\mathcal c } \\gtrsim 0.11)$\\end{document } , where the remnant collapsed promptly to a bh , and very low - compactness models , which yielded hypermassive remnants stabilized against gravitational collapse by differential rotation .", "virtually all the ns matter was contained within the remnant for initially irrotational models , which served as evidence against equal - mass nss mergers being a leading source of r - process elements in the universe through ejection .", "the lack of significant mass loss in equal - mass mergers , together with insignificant shock - heating of the material , also argued against the likelihood of such mergers as progenitors for sgrbs if the gamma - ray emission was assumed to be coincident with the gw burst ; instead a delayed burst following the collapse of a hmns to a bh appeared more likely . \n", "eos models include polytropes , piecewise polytropes ( pp ) , as well as physically motivated models including cold sly , fps , and apr models to which one adds an ideal - gas hot component to reflect shock heating , as well as the shen [ 268 , 267 ] finite temperature model and eos that include hyperonic contributions . co / ir indicates that both corotating and irrotational models were considered ; bhb indicates that bh binary mergers were also presented , including both bh - bh and bh - ns types , -leak", " indicates a neutrino leakage scheme was included in the calculation , gh indicates calculations were performed using the ghg formalism rather than bssn , non - qe", " indicates superposition initial data were used , including cases where eccentric configurations were studied ( eccen . ) ; mhd indicates mhd was used to evolve the system.groupref.ns eosmass rationoteskt=210.090.15co / ir- = 2 , 2.250.8910.10.17-=20.8510.10.12-sly , fps+hot0.9210.10.13-sly , apr+hot0.6410.110.13- = 20.8510.140.16bhb - apr+hot0.810.140.18-apr , sly , fps+hot0.81.00.160.2-shen10.140.16-leak - pp+hot10.120.17-shen , hyp1.00.140.16-leakhad = 21.00.08gh , non - qe- = 21.00.08gh , non - qe , mhdwhisky = 21.00.140.18- = 21.00.20- = 21.00.140.18mhd- = 21.00.140.18mhd-=20.701.00.090.17-[14 , 15] = 21.00.120.14- = 21.00.18mhduiuc = 20.8510.140.18mhdjena[308 , 41] = 21.00.14- = 21.01.4eccen . a summary of full gr ns - ns merger calculations .", "eos models include polytropes , piecewise polytropes ( pp ) , as well as physically motivated models including cold sly , fps , and apr models to which one adds an ideal - gas hot component to reflect shock heating , as well as the shen [ 268 , 267 ] finite temperature model and eos that include hyperonic contributions . co / ir indicates that both corotating and irrotational models were considered ; bhb indicates that bh binary mergers were also presented , including both bh - bh and bh - ns types , -leak", " indicates a neutrino leakage scheme was included in the calculation , gh indicates calculations were performed using the ghg formalism rather than bssn , non - qe", " indicates superposition initial data were used , including cases where eccentric configurations were studied ( eccen . ) ; mhd indicates mhd was used to evolve the system .", "later works , in particular a paper by shibata , taniguchi , and ury , introduced several new techniques to perform dynamical calculations that most codes at present still include in nearly the same or lightly modified form .", "these included the use of a high - resolution shock - capturing scheme for the hydrodynamics , as well as a gamma - driver shift condition closely resembling the moving puncture gauge conditions that later proved instrumental in allowing for long - term bh evolution calculations . in the series of papers that followed their original calculations , the kt group established a number of results about ns - ns mergers that form the basis for much of our thinking about their hydrodynamic evolution : \n by varying the eos model for the ns as well as the mass ratio , it was possible to constrain the binary parameters separating cases that form a hmns rather than producing prompt collapse to a bh , and it was quickly determined that the total system mass as a proportion of the maximum allowed mass for an isolated ns is the key parameter , with only weak dependence on the binary mass ratio.for polytropic eos models , the critical compactness values leading to prompt collapse for equal - mass binary mergers were found to be \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\mathcal c } = 0.14$\\end{document } for = 2 and \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\mathcal c } = 0.16$\\end{document } for = 2.25 .", "as a rough rule , collapse occurred for polytropic eos when the total system rest - mass was at least 1.7 mmax , where mmax is the maximum mass of an isolated non - rotating ns for the given eos . for physically motivated eos models ,", "the critical mass was significantly smaller ; indeed , the critical ns mass was found to be 1.35 mmax for the sly eos ( i.e. , collapse for mtot 2.7 m with mmax = 2.04 m ) and 1.39 mmax for the fps eos ( collapse for mtot 2.5 m with mmax = 1.8 m ) .", "this was not a complete surprise , since for the physically motivated eos the ns radius is nearly independent of the mass across much of the parameter space , limiting the ability of the hmns to expand in response to the extra mass absorbed during the merger.the mass ratio was found to play a critical role in the evolution of the remnant / disk configuration , since unequal - mass cases are better characterized as disruptions of the smaller secondary followed by its accretion onto the primary , rather than a true merger between the two nss .", "disk masses from full gr calculations are generically smaller than those predicted from non - gr calculations . for polytropic eos , disks contain approximately 4% of the total system mass for mass ratios q 0.8 , varying roughly ( 1 q ) for a fixed total mass , with the disk mass decreasing for heavier binaries ( and thus larger compactnesses ) given the stronger gravity of the central remnant . using the stiffer apr eos , the dependence on the mass ratio was seen to be much steeper for a physical eos than for polytropes , scaling like ( 1 qp ) , where p 34 .with respect to gw emission , it was determined in that in low - mass cases in which a hmns was formed , stiffer polytropic eos models were able to support the development of a bar - mode instability , leading to transient spiral arm formation from the remnant and an extended period of strong gw emission , in the characteristic modulated form that results from differentially rotating ellipsoids ( see , e.g. , [ 160 , 274 , 259 , 16 , 183 , 72 ] ) .", "unequal - mass cases typically yielded one high - frequency peak at roughly gw 2 khz corresponding to non - axisymmetric oscillations , and equal - mass cases yielded multiple peaks including those associated with quasi - radial oscillations as well . for physical eos models , mass loss into a disk is reduced relative to the polytropic case given the higher compactness of the central region , and gw oscillation peaks , while very strong , occur at correspondingly higher frequencies .", "by contrast , prompt formation of a bh led to a ringdown signal with rapidly decreasing amplitude becoming negligible within a few dynamical times.the gw signals were evaluated under the gauge - dependent assumption of transverse tracelessness , and energy and angular momentum loss rates into each spherical harmonic mode were computed using the gauge - invariant zerilli - moncrief formalism [ 239 , 335 , 195 ] in much the same way that is used by some groups in numerical relativity today ( many bh - bh and hydrodynamics simulations report gw signals derived from the alternate 4 weyl scalar formulation [ 202 , 60 ] , or use both methods).in , it was concluded that mergers of nss with comparable masses made poor sgrb progenitor candidates , assuming prompt emission ( because of the lack of energy available for neutrino annihilation ) , but that the energy budget in the hmns case is orders of magnitude larger .", "remarkably , this discussion from 2005 predates the first identifications of sgrbs with older populations , which greatly improved our theoretical understanding of compact object mergers as their likely progenitors . in the first work that followed the initial localizations of sgrbs , mergers of binaries with relatively small mass ratios , q 0.7 , were seen to form sufficiently hot and massive disk to power a sgrb , albeit a relatively brief , low - luminosity one .", "it was suggested that the more likely sgrb progenitor is indeed a hmns , since dissipative effects within the remnant can boost temperatures up to 10 k.further approximate relativistic investigations of ns - ns mergers , along with bh - ns mergers , as potential sgrb sources quickly swept through the community after the initial localizations of sgrbs , with several groups using a wide variety of methods all concluding that mergers were plausible progenitors , but finding it extremely difficult to constrain the scenario in quantitative ways given the extremely complicated microphysics ultimately responsible for powering the burst ( see , e.g. , [ 207 , 206 ] who investigated potential disk energies ; , who modeled the fallback accretion phase onto a bh ; and , who considered the thermodynamic and nuclear evolution of disks around newly - formed bhs produced by mergers ) .", "we will return to this topic below in light of recent grmhd simulations . by varying the eos model for the ns as well as the mass ratio , it was possible to constrain the binary parameters separating cases that form a hmns rather than producing prompt collapse to a bh , and it was quickly determined that the total system mass as a proportion of the maximum allowed mass for an isolated ns is the key parameter , with only weak dependence on the binary mass ratio . for polytropic eos models , the critical compactness values leading to prompt collapse for equal - mass binary mergers were found to be \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\mathcal c } = 0.14$\\end{document } for = 2 and \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${\\mathcal c } = 0.16$\\end{document } for = 2.25 . as a rough rule , collapse occurred for polytropic eos when the total system rest - mass was at least 1.7 mmax , where mmax is the maximum mass of an isolated non - rotating ns for the given eos .", "for physically motivated eos models , the critical mass was significantly smaller ; indeed , the critical ns mass was found to be 1.35 mmax for the sly eos ( i.e. , collapse for mtot 2.7 m with mmax = 2.04 m ) and 1.39 mmax for the fps eos ( collapse for mtot 2.5 m with mmax = 1.8 m ) .", "this was not a complete surprise , since for the physically motivated eos the ns radius is nearly independent of the mass across much of the parameter space , limiting the ability of the hmns to expand in response to the extra mass absorbed during the merger .", "the mass ratio was found to play a critical role in the evolution of the remnant / disk configuration , since unequal - mass cases are better characterized as disruptions of the smaller secondary followed by its accretion onto the primary , rather than a true merger between the two nss .", "disk masses from full gr calculations are generically smaller than those predicted from non - gr calculations . for polytropic eos , disks contain approximately 4% of the total system mass for mass ratios q 0.8 , varying roughly ( 1 q ) for a fixed total mass , with the disk mass decreasing for heavier binaries ( and thus larger compactnesses ) given the stronger gravity of the central remnant .", "using the stiffer apr eos , the dependence on the mass ratio was seen to be much steeper for a physical eos than for polytropes , scaling like ( 1 qp ) , where p 34 . with respect to gw emission", ", it was determined in that in low - mass cases in which a hmns was formed , stiffer polytropic eos models were able to support the development of a bar - mode instability , leading to transient spiral arm formation from the remnant and an extended period of strong gw emission , in the characteristic modulated form that results from differentially rotating ellipsoids ( see , e.g. , [ 160 , 274 , 259 , 16 , 183 , 72 ] ) .", "unequal - mass cases typically yielded one high - frequency peak at roughly gw 2 khz corresponding to non - axisymmetric oscillations , and equal - mass cases yielded multiple peaks including those associated with quasi - radial oscillations as well . for physical eos models , mass loss into a disk is reduced relative to the polytropic case given the higher compactness of the central region , and gw oscillation peaks , while very strong , occur at correspondingly higher frequencies . by contrast , prompt formation of a bh led to a ringdown signal with rapidly decreasing amplitude becoming negligible within a few dynamical times .", "the gw signals were evaluated under the gauge - dependent assumption of transverse tracelessness , and energy and angular momentum loss rates into each spherical harmonic mode were computed using the gauge - invariant zerilli - moncrief formalism [ 239 , 335 , 195 ] in much the same way that is used by some groups in numerical relativity today ( many bh - bh and hydrodynamics simulations report gw signals derived from the alternate 4 weyl scalar formulation [ 202 , 60 ] , or use both methods ) . in , it was concluded that mergers of nss with comparable masses made poor sgrb progenitor candidates , assuming prompt emission ( because of the lack of energy available for neutrino annihilation ) , but that the energy budget in the hmns case is orders of magnitude larger .", "remarkably , this discussion from 2005 predates the first identifications of sgrbs with older populations , which greatly improved our theoretical understanding of compact object mergers as their likely progenitors . in the first work that followed the initial localizations of sgrbs , mergers of binaries with relatively small mass ratios , q 0.7 , were seen to form sufficiently hot and massive disk to power a sgrb , albeit a relatively brief , low - luminosity one .", "it was suggested that the more likely sgrb progenitor is indeed a hmns , since dissipative effects within the remnant can boost temperatures up to 10 k. further approximate relativistic investigations of ns - ns mergers , along with bh - ns mergers , as potential sgrb sources quickly swept through the community after the initial localizations of sgrbs , with several groups using a wide variety of methods all concluding that mergers were plausible progenitors , but finding it extremely difficult to constrain the scenario in quantitative ways given the extremely complicated microphysics ultimately responsible for powering the burst ( see , e.g. , [ 207 , 206 ] who investigated potential disk energies ; , who modeled the fallback accretion phase onto a bh ; and , who considered the thermodynamic and nuclear evolution of disks around newly - formed bhs produced by mergers ) .", "we will return to this topic below in light of recent grmhd simulations . in the past few years", ", five groups have reported results from ns - ns mergers in full gr ; kt , had , whisky , uiuc , and jena .", "much of the work of the had and whisky groups , developers respectively of the code of those names , began at louisiana state university ( had ) and the albert einstein institute in potsdam ( whisky ) , though both efforts now include several other collaborating institutions .", "two other groups , the sxs collaboration that originated at caltech and cornell , and the princeton group , have reported bh - ns merger results and are actively studying ns - ns mergers as well , but have yet to publish their initial papers about the latter .", "all of the current groups use amr - based eulerian grid codes , with four evolving einstein s equations using the bssn formalism and the had collaboration making use of the ghg method instead . had , whisky , and uiuc have all reported results about magnetized ns - ns mergers", "( the kt collaboration has used a grmhd code to study the evolution of magnetized hmns , but not complete ns - ns mergers ) .", "the kt collaboration has considered a wide range of eos models , including finite - temperature physical models such as the shen eos , and have also implemented a neutrino leakage scheme , while all other results reported to date have assumed a = 2 polytropic eos model . given the similarities of the various codes used to study ns - ns mergers , it is worthwhile to ask whether they do produce consistent results . a comparison paper between the whisky code and the kt collaboration s sacra codes found that both codes performed well for conservative global quantities , with global extrema such as the maximum rest - mass density in agreement to within 1% and waveform amplitudes and frequencies differing by no more than 10% throughout a full simulation , and typically much less .", "several of the the groups listed above have also been leaders in the field of bh - ns simulations : the kt , had , and uiuc groups have all presented bh - ns merger results , as have the sxs collaboration [ 85 , 84 , 108 ] , and princeton group [ 294 , 88 ] ( see for a thorough review ) .", "we discuss the current understanding of ns - ns mergers in light of all these calculations below . using their newly developed sacra code ,", "the kt group , found that when a hybrid eos is used to model the ns , in which the cold part is described by the apr eos and the thermal component as a = 2 ideal gas , the critical total binary mass for prompt collapse to a bh is mtot = 2.82.9 m , independent of the initial binary mass ratio , a result consistent with previous explorations of other polytropic and physically motivated ns eos models ( see above ) . in all cases ,", "the bh was formed with a spin parameter a 0.78 depending very weakly on the total system mass and mass ratio .", "they further classified the critical masses for a number of other physical eos in , finding that binaries with total masses mtot 2.7 m should yield long - lived hmnss ( > 10 ms ) and substantial disk masses with mdisk > 0.04 m assuming that the current limit on the heaviest observed ns , m = 1.97 m is correct . in figure 10", ", we show the final fate of the merger remnant as a function of the total pre - merger mass of the binary .", " type i indicates a prompt collapse of the merger remnant to a bh , type ii a short - lived hmns , which lasts for less than 5 ms after the merger until its collapse , and type iii a long - lived hmns which survives for at least 5 ms .", "the horizontal axis shows the eoss together with the corresponding ns radii for mns = 1.4 m. image reproduced by permission from figure 3 of , copyright by aps .", "the horizontal axis shows the eoss together with the corresponding ns radii for mns = 1.4 m. image reproduced by permission from figure 3 of , copyright by aps . while all of the above results incorporated shock heating , the addition of both finite - temperature effects in the eos and neutrino emission modifies the numerically determined critical masses separating hmns formation from prompt collapse .", "adding in a neutrino leakage scheme for a ns - ns merger performed using the relatively stiff finite - temperature shen eos , the kt collaboration reports in that hmnss will form generically for binary masses 3.2 m , not because they are centrifugally - supported but rather because they are pressure - supported , with a remnant temperature in the range 3070 mev . since they are not supported by differential rotation , these hmnss were predicted to be stable until neutrino cooling , with luminosities of 310 10 erg / s , can remove the pressure support . even for cases where the physical effects of hyperons were included , which effectively soften the eos and reduce", "the maximum allowed mass for an isolated ns to 1.8 m , the kt collaboration still finds that thermal support can stabilize hmns with masses up to 2.7 m. using a carpet / cactus - based hydrodynamics code called whisky that works within the bssn formalism ( a version of which has been publicly released as grhydro within the einstein ) , the whisky collaboration has analyzed the dependence of disk masses on binary parameters in some detail . for mass ratios", "q = 0.71.0 , they found that bound disks with masses of up to 0.2 m can be formed , with the disk mass following the approximate form 34\\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$${m_{{\\rm{disk } } } } = 0{.}039({m_{\\max } } - { m_{{\\rm{tot } } } } ) + 1{.}115(1 - q)({m_{\\max } } - { m_{{\\rm{tot}}}});\\quad { m_{\\max } } = 1{.}139(1 + q){m_\\ast},$$\\end{document } where mmax the maximum mass of a binary system for a given eos ( = 2 ideal gas for these calculations ) , m * is the maximum mass of an isolated non - rotating ns for the eos , and mtot the mass of the binary , with all masses here defined as baryonic .", "the evolution of the total rest mass present in the computational domain for a number of simulations is shown in figure 11 . \n", "figure 11evolution of the total rest mass mtot of the remnant disk ( outside the bh horizon ) normalized to the initial value for ns - ns mergers using a = 2 polytropic eos with differing mass ratios and total masses .", "the order of magnitude of the mass fraction in the disk can be read off the logarithmic mass scale on the vertical axis . the curves referring to different models", "evolution of the total rest mass mtot of the remnant disk ( outside the bh horizon ) normalized to the initial value for ns - ns mergers using a = 2 polytropic eos with differing mass ratios and total masses .", "the order of magnitude of the mass fraction in the disk can be read off the logarithmic mass scale on the vertical axis . the curves referring to different models", "image reproduced by permisison from figure 5 of , copyright by iop . using the had code described in that evolves the ghg system on an amr - based grid with ceno reconstruction techniques , anderson et al . performed the first study of magnetic effects in full gr ns - ns mergers .", "beginning from spherical nss with extremely strong poloidal magnetic fields ( 9.6 10 g , as is found in magnetars ) , their merger simulations showed that magnetic repulsion can delay merger by 12 orbits and lead to the formation of magnetically buoyant cavities at the trailing end of each ns as contact is made ( see figure 12 ) , although the latter may be affected by the non - equilibrium initial data .", "both effects would have been greatly reduced if more realistic magnetic fields strengths had been considered .", "magnetic fields in the hmns remnant , which can be amplified through dynamo effects regardless of their initial strengths , helped to distribute angular momentum outward via the magnetorotational instability ( mri ) , leading to a less differentially rotating velocity profile and a more axisymmetric remnant .", "the gw emission in the magnetized case was seen to occur at lower characteristic frequencies and amplitudes as a result . \n", "figure 12fluid density isocontours and magnetic field distribution ( in a plane slightly above the equator ) immediately after first contact for a magnetized merger simulation .", "fluid density isocontours and magnetic field distribution ( in a plane slightly above the equator ) immediately after first contact for a magnetized merger simulation .", "the uiuc group was among the first to produce fully self - consistent grmhd results . using a newly developed cactus - based code", ", they performed the first studies of unequal - mass magnetized ns - ns mergers . using poloidal , magnetar - level initial magnetic fields , liu et al . found that magnetic effects are essentially negligible prior to merger , but can increase the mass in a disk around a newly formed bh moderately , from 1.3% to 1.8% of the total system mass for mass ratios of q = 0.85 and = 2 .", "they point out that mhd effects can efficiently channel outflows away from the system s center after collapse , and may be important for the late - stage evolution of the system . in", ", the whisky group performed simulations of magnetized mergers with field strengths ranging from 10 to 10 g. agreeing with the uiuc work that magnetic field strengths would have essentially no effect on the gw emission during inspiral , they note that magnetic effects become significant for the hmns , since differential rotation can amplify b - fields , with marked deviations in the gw spectrum appearing at frequencies of gw 2 khz .", "they also point out that high - order mhd reconstruction schemes , such as third - order ppm , can produce significantly more accurate results that second - order limiter - based schemes .", "a follow - up paper showed that a plausible way to detect the effect of physically realistic magnetic fields on the gw signal from a merger was through a significant shortening of the timescale for a hmns to collapse , though a third - generation gw detector could perhaps observe differences in the khz emission of the hmns as well .", "more recently , they have used very long - term simulations to focus attention on the magnetic field strength and geometry found after the remnant collapses to a bh .", "they find that the large , turbulent magnetic fields ( b 10 g ) present in the initial binary configuration are boosted exponentially in time up to a poloidal field of strength 10 g in the remnant disk , with the field lines maintaining a half - opening angle of 30 along the bh spin axis , a configuration thought to be extremely promising for producing a sgrb .", "the resulting evolution , shown in figure 13 , is perhaps the most definitive result indicating that ns - ns mergers should produce sgrbs for some plausible range of initial parameters . \n", "figure 13evolution of the density in a ns - ns merger , with magnetic field lines superposed .", "the first panel shows the binary shortly after contact , while the second shows the short - lived hmns remnant shortly before it collapses . in the latter two panels ,", "a bh has already formed , and the disk around it winds up the magnetic field to a poloidal geometry of extremely large strength , 10 g , with an half - opening angle of 30 , consistent with theoretical sgrb models .", "evolution of the density in a ns - ns merger , with magnetic field lines superposed .", "the first panel shows the binary shortly after contact , while the second shows the short - lived hmns remnant shortly before it collapses . in the latter two panels ,", "a bh has already formed , and the disk around it winds up the magnetic field to a poloidal geometry of extremely large strength , 10 g , with an half - opening angle of 30 , consistent with theoretical sgrb models .", "it is worth noting that all magnetized ns - ns merger calculations that have been attempted to date have made use of unphysically large magnetic fields .", "this is not merely a convenience designed to enhance the role of magnetic effects during the merger , though it does have that effect .", "rather , magnetic fields are boosted in hmns remnants by the mri , whose fastest growing unstable mode depends roughly linearly on the alfvn speed , and thus the magnetic field strength . in order to move to physically reasonable magnetic field values , one would have to resolve the hmns at least a factor of 100 times better in each of three dimensions , which is beyond the capability of even the largest supercomputers at present , and likely will be for some time to come . in , the kt collaboration found a nearly linear relationship between the gw spectrum cutoff frequency fcut and the ns compactness , independent of the eos , as well as a relationship between the disk mass and the width of the khz hump seen in the gw energy spectrum . while fcut is a somewhat crude measure of the ns compactness , it occurs at substantially lower frequencies than any emission process associated with merger remnants , and thus is the parameter most likely to be accessible to gw observations with a second generation detector .", "the qualitative form of the high - frequency components of the gw spectrum is primarily determined by the type of remnant formed . in figures 14 and 15", ", we show h(t ) and \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}$\\tilde h(f)$\\end{document } , respectively , for four of the runs calculated by the kt collaboration and described in .", "type i collapses are characterized by a rapid decrease in the gw amplitude immediately after the merger , yielding relatively low power at frequencies above the cutoff frequency .", "type ii and iii mergers yield longer periods of gw emission after the merger , especially the latter , with the remnant oscillation modes leading to clear peaks at gw frequencies fgw = 24 khz that should someday be detectable by third generation detectors like the einstein telescope , or possibly even by advanced ligo should the source be sufficiently close ( d 20 mpc ) and the high - frequency peak of sufficiently high quality . \n", "dh / m0 , where d is the distance to the source and m0 the total mass of the binary , versus time for four different ns - ns merger calculations .", "the different merger types become apparent in the post - merger gw signal , clearly indicating how bh formation rapidly drives the gw signal down to negligible amplitudes .", "image reproduced by permission from figures 5 and 6 of , copyright by aps . \n figure 15effective strain at a distance of 100 mpc shown as a function of the gw frequency ( solid red curve ) for the same four merger calculations depicted in figure 14 .", "post - merger quasi - periodic oscillations are seen as broad peaks in the gw spectrum at frequencies fgw = 24 khz .", "the blue curve shows the taylor t4 result , which represents a particular method of deducing the signal from a 3pn evolution .", "the thick green dashed curve and orange dot - dashed curves depict the sensitivities of the second - generation advanced ligo and lcgt ( large scale cryogenic gravitational wave telescope ) detectors , respectively , while the maroon dashed curve shows the sensitivity of a hypothetical third - generation einstein telescope .", "dimensionless gw strain dh / m0 , where d is the distance to the source and m0 the total mass of the binary , versus time for four different ns - ns merger calculations .", "the different merger types become apparent in the post - merger gw signal , clearly indicating how bh formation rapidly drives the gw signal down to negligible amplitudes .", "effective strain at a distance of 100 mpc shown as a function of the gw frequency ( solid red curve ) for the same four merger calculations depicted in figure 14 .", "post - merger quasi - periodic oscillations are seen as broad peaks in the gw spectrum at frequencies fgw = 24 khz .", "the blue curve shows the taylor t4 result , which represents a particular method of deducing the signal from a 3pn evolution .", "the thick green dashed curve and orange dot - dashed curves depict the sensitivities of the second - generation advanced ligo and lcgt ( large scale cryogenic gravitational wave telescope ) detectors , respectively , while the maroon dashed curve shows the sensitivity of a hypothetical third - generation einstein telescope .", "image reproduced by permission from figures 5 and 6 of , copyright by aps . using new multi - orbit simulations of ns - ns mergers ,", "[ 14 , 15 ] showed that the semi - analytic effective one - body ( eob ) formalism severely underestimates high - order relativistic corrections even when lowest - order finite - size tidal effects were included . as a result , phase errors of almost a quarter of a radian can develop , although these may be virtually eliminated by introducing a second - order next - to - next - to - leading order ( nnlo ) correction term and fixing the coefficient to match numerical results", "the excellent agreement between pre - merger numerical waveforms and the revised semi - analytic eob approximant is shown in figure 16 . \n", "figure 16comparison between numerical waveforms , shown as a solid black line , and semi - analytic nnlo eob waveforms , shown as a red dashed line ( top panel ) .", "the top panels show the real parts of the eob and numerical relativity waveforms , and the middle panels display the corresponding phase differences between waveforms generated with the two methods .", "there is excellent agreement between with the numerical waveform almost up to the time of the merger as shown by the match of the orbital frequencies ( bottom panel ) .", "comparison between numerical waveforms , shown as a solid black line , and semi - analytic nnlo eob waveforms , shown as a red dashed line ( top panel ) .", "the top panels show the real parts of the eob and numerical relativity waveforms , and the middle panels display the corresponding phase differences between waveforms generated with the two methods .", "there is excellent agreement between with the numerical waveform almost up to the time of the merger as shown by the match of the orbital frequencies ( bottom panel ) .", "the effects of binary eccentricity on ns - ns mergers was recently studied by the jena group .", "such systems , which would indicate dynamical formation processes rather than the long - term evolution of primordial binaries , evolve differently in several fundamental ways from binaries that merge from circular orbits . for nearly head - on collisions", ", they found prompt bh formation and negligible disk mass production , with only a single gw burst at frequencies comparable to the quasi - normal mode of the newly formed bh .", "for a collision in which mass transfer occurred at the first passage but two orbits were required to complete the merger and form a bh , a massive disk was formed , containing 8% of the total system mass even at time t = 100 mtot 280 m after the formation of the bh . during that time , the black hole accreted an even larger amount of mass , representing over twice the mass of the remaining disk . between the first close passage and the second ,", "during which the two ns merged , the gw signal was seen to be quasi - periodic , and a a frequency comparable to the fundamental oscillation mode of the two ns , a result that was duplicated in a calculation for which the periastron fell outside the roche limit and the eccentric binary survived for the full duration of the run , comprising several orbits . in parallel to efforts in full gr , there has also been great progress in numerical simulations that include approximate relativistic treatments but a more detailed approach to microphysical issues .", "the first simulations to use a realistic eos for ns - ns mergers were performed by ruffert , janka , and collaborators [ 253 , 139 , 254 ] , who assumed the lattimer - swesty eos for their newtonian ppm - based eulerian calculations .", "they were able to determine a physically meaningful temperature for ns - ns merger remnants of 3050 mev , an overall neutrino luminosity of roughly 10 erg / s for tens of milliseconds , and a corresponding annihilation rate of 25 10 erg / s given the computed annihilation efficiencies of a few parts in a thousand .", "this resulted in an energy loss of 24 10 erg over the lifetime of the remnant , a value later confirmed in multigrid simulations that replaced the newly formed hmns by a newtonian or quasi - relativistic bh surrounded by the bound material making up a disk .", "the temperatures in the resulting neutron - rich ( ye 0.050.2 ) remnant were thought to be encouraging for the production of r - process elements , although numerical resolution of the low - density ejecta limited the ability to make quantitatively accurate estimates of its exact chemical distribution .", "further calculations , some of which involved unequal - mass binaries , indicated that the temperatures and electron fractions in the ejecta were likely not sufficient to produce solar abundances of r - process elements , with electron fractions in particular smaller than those set by hand in the r - process production model that appears in [ 111 , 245 ] .", "more recently , it was suggested that the decompression of matter originally located in the inner crust of a ns and ejected during a merger has a nearly solar elemental distribution for heavy r - process elements ( a > 140 ) .", "this indicates that ns - ns mergers may be the source of the observed cosmic r - process elements should there be sufficient mass loss per merger event , mej 35 10 \n m , although these amounts have yet to be observed in full gr simulations which have often admittedly been performed using cruder microphysical treatments .", "in , rosswog and davies included a detailed neutrino leakage scheme in their calculations and also adopted the shen eos for several calculations , finding in a later paper that the gamma - ray energy release is roughly 10 erg , in line with previous results from other groups , but noting that the values would be significantly higher if temperatures in the remnant were higher , since the neutrino luminosity scales like a very high power of the temperature .", "these calculations also identified ns - ns mergers as likely sgrb candidates given the favorable geometry , and the possibility that the mri in a hmns remnant could dramatically boost magnetic fields on the sub - second timescales characterizing sgrbs .", "rosswog and liebendrfer found that electron antineutrinos \\documentclass[12pt]{minimal } \n\t\t\t\t \\usepackage{amsmath } \n\t\t\t\t \\usepackage{wasysym } \n\t\t\t\t \\usepackage{amsfonts } \n\t\t\t\t \\usepackage{amssymb } \n\t\t\t\t \\usepackage{amsbsy } \n\t\t\t\t \\usepackage{mathrsfs } \n\t\t\t\t \\usepackage{upgreek } \n\t\t\t\t \\setlength{\\oddsidemargin}{-69pt } \n\t\t\t\t \\begin{document}${{\\bar \\nu}_e}$\\end{document } dominate the emission , as had ruffert and janka , though the exact thermodynamic and nuclear profiles were found to be somewhat sensitive to the properties of the eos model .", "more recently , using the vulcan 2-dimensional multi - group flux - limited - diffusion radiation hydrodynamics code to evaluate slices taken from sph calculations , dessart et al . found that neutrino heating of the remnant material will eject roug hly 10 \n m from the system .", "price and rosswog [ 233 , 247 ] performed the first mhd simulation of merging ns - ns binaries using an sph code that included magnetic field effects , finding that the kelvin - helmholtz unstable vortices formed at the contact surface between the two nss could boost magnetic fields rapidly up to 10 g. these results were not seen in grmhd simulations , where gains in the magnetic field strength generated by dynamos were limited by the swamping of the vortex sheet at the surface of contact by rapidly infalling ns material that went on to form the eventual hmns or bh .", "longer - term simulations did note that shearing instabilities were able to support power - law , or perhaps even exponential , growth of the magnetic fields on longer timescales ( 10 s of ms ) , which augurs well for ns - ns mergers as the central engines of sgrbs .", "an effort to identify potential observational differences between nss and cos with quark - matter interiors has been led by oechslin and collaborators . using an sph code with cf gravity , oechslin et al .", "[ 210 , 212 ] considered mergers of nss with quark cores described by the mit bag model [ 67 , 102 , 142 ] , which have significantly smaller maximum masses than traditional nss .", "they found the hybrid nuclear - quark eos yielded higher isco frequencies for nss with masses 1.5 m and slightly larger gw oscillation frequencies for any resulting merger remnant compared to purely hadronic eos .", ". followed up this work by investigating whether strangelets , or small lumps of strange quark matter , would be ejected in sufficient amounts throughout the interstellar medium to begin the phase transition that would convert traditional hadronic nss into strange stars .", "they determined that the total rate of strange matter ejection in ns - ns mergers could be as much as 10 \n m per year per galaxy or essentially zero depending on the parameters input into the mit bag model , with the upper values clearly detectable by orbiting magnetic spectrometers such as the ams-02 detector that was recently installed on the international space station [ 182 , 148 ] .", "further calculations concluded that the mergers of strange stars produce a much more tenuous halo than traditional ns mergers , more rapid formation of a bh , and higher frequency ringdown emission , as we show in figure 17 . \n", "the spiral arms representing mass loss through the outer lagrange points of the system are substantially narrower than those typically seen in cf calculations of ns - ns mergers with typical nuclear eos models .", "the spiral arms representing mass loss through the outer lagrange points of the system are substantially narrower than those typically seen in cf calculations of ns - ns mergers with typical nuclear eos models .", "oechslin , janka , and marek also analyzed a wide range of eos models using their cf sph code , finding that matter in spiral arms was typically cold and that the dynamics of the disk formed around a post - merger bh depends on the initial temperature assumed for the pre - merger ns .", "they also determined that the khz gw emission peaks produced by hmnss may help to constrain various parameters of the original ns eos , especially its high - density behavior , with further updates to the prediction provided by bauswein and janka .", "most recently , stergioulas et al . studied the effect of nonlinear mode couplings in hmns oscillations , leading to the prediction of a triplet peak of frequencies being present or low mass ( mns = 1.21.35 m ) systems in the khz range .", "while there is a history of newtonian , quasi - relativistic , post - newtonian , and cf gravitational formalisms being used to perform bh - ns merger simulations , their results are nearly always quantitatively , if not qualitatively , different than full gr simulations , and we focus here on the latter ( see for a more thorough historical review ) .", "most of the groups that have performed full gr ns - ns merger calculations have also published results on bh - ns mergers , including whisky ( for head - on collisions ) , kt [ 290 , 289 , 283 , 332 , 276 , 154 , 153 ] , uiuc [ 91 , 94 , 92 ] , had , as well as the sxs collaboration [ 85 , 84 , 108 , 107 ] and princeton ( for elliptical mergers ) [ 294 , 88 ] .", "summarizing the results of these works , we get a rather coherent picture , which we describe below .", "the gw signal from bh - ns mergers is somewhat cleaner than that from ns - ns mergers , since the disruption of the ns and its accretion by the bh rapidly terminate the gw emission . in general ,", "the more compact the ns , the higher the dimensionless cutoff frequency mtotfcut at which the gw energy spectrum plummets , with direct plunges in which the ns is swallowed whole typically yielding excess power near the frequency maximum from the final pre - merger burst . for increasingly prograde bh spins , there is more excess power over the 3pn prediction at lower frequencies , but also a lower cutoff frequency marking the plunge ( see the discussion in ) . from an observational standpoint ,", "the deviations from point - mass form become more visible for a higher mass bh - ns system , because frequencies scale characteristically like the inverse of the total mass .", "the distinction is particularly important for advanced ligo , as systems with bh 3 m typically yield cutoff frequencies within the advanced ligo band at source distances of d 100 mpc , while for lower - mass systems the cutoff occurs at or just above the upper end of the frequency band .", "this is significantly different than the situation for ns - ns mergers , in which the characteristic frequencies corresponding to the merger itself typically fall at frequencies above the advanced ligo high - frequency sensitivity limit , and those corresponding to remnant oscillations in the range 24 khz , which will prove a challenge even for third - generation gw detectors .", "disk masses for bh - ns mergers were found to be extremely small in the first calculations , all performed using non - spinning bhs [ 290 , 289 , 91 ] , but have since been corrected to larger values once more sophisticated grid - based schemes and atmosphere treatments were added to those codes .", "more recent results indicate disk masses for reasonable physical parameters can be as large as 0 .", "4 m , for highly - spinning ( abh / m = 0.9 ) mergers , with values of 0.0350.05 m characterizing non - spinning models with mass ratios q 1/5 .", "mass loss into a disk is suppressed by misaligned spins , especially for highly - inclined bhs , so the aligned cases should currently be interpreted as upper limits for the disk mass when alignment is varied .", "overall , disk masses for bh - ns merger remnants are comparable to those from ns - ns merger remnants , and may not be clearly distinguishable from them based solely on the emission properties of the disk . for bh - ns mergers with mass ratios", "q = 1/3 and prograde spins of dimensionless magnitude abh / m = 0.5 , the disk parameters found after a run performed with the inclusion of a finite - temperature ns eos indicated that the neutrino luminosity from the disk might be as high as 10 erg / s .", "while ns - ns merger simulations have led to predictions of neutrino luminosities a few times larger than this , the result does indicate that bh - ns mergers are also plausible sgrb progenitor candidates , possibly with lower characteristic luminosities than bursts resulting from ns - ns mergers .", "the role of magnetic fields in bh - ns mergers has only been investigated recently [ 66 , 92 ] , in simulations that apply an initially poloidal magnetic field to the nss in the binary .", "magnetic fields were found to have very little effect on the resulting gw signal and the mass accretion rate for the bh for physically reasonable magnetic field strengths , with visible divergences appearing only for b 10 g , which is not particularly surprising .", "just as in ns - ns mergers , magnetic fields play very little role during inspiral , and unlike the case of ns - ns mergers there is no opportunity to boost fields at a vortex sheet that forms when the binary makes contact , nor in a hmns via differential rotation . while the mri may be important in determining the thermal evolution and mass accretion rate in a post - merger disk , such effects will likely be observable primarily on longer timescales . just as full - gr ns - ns simulations do not indicate that such mergers are likely sources of the r - process elements we observe in the universe , bh - ns simulations in full gr make the same prediction : no detectable mass loss from the system whatsoever , at least in the calculations performed to date .", "the picture may change when even larger prograde spins are modeled , since this should lead to maximal disk production , or if more detailed microphysical treatments indicate that a significant wind can be generated from either a hmns or bh disk and unbind astrophysically interesting amounts of material , but neither has been seen in the numerical results to date . as is seen in ns - ns mergers ,", "the pericenter distance plays a critical role in the evolution of eccentric bh - ns mergers as well .", "large disk masses containing up to 0.3 m , with an unbound fraction of roughly 0.15 m , can occur when the periastron separation is located just outside the classical isco , with gw signals taking on the characteristic zoom - whirl form predicted for elliptical orbits . in between pericenter passages , radial oscillations of the neutron star", "produce gw emission at frequencies corresponding to the f - mode for the ns as well ." ], [ "returning to the questions posed in section 6 , we can now provide the current state of the field s best answers , though this remains a very active area of research and new results will certainly continue to modify this picture . \n with regard to the final fate of the merger remnant , calculations using full gr are required , but the details of the microphysics do not seem to play a very strong role .", "it is now possible to determine whether or not a pair of nss with given parameters and specified eos will form a bh or hmns promptly after merger , and to estimate whether a hmns will collapse on a dynamical timescale or one of the longer dissipative timescales ( see , e.g. , ) . for ns - ns binaries with sufficiently small masses", ", it is also possible to determine quickly whether the remnant mass is below the supramassive limit for which a ns is stabilized against collapse by uniform rotation alone , and thus would be unlikely to collapse , barring a significant amount of fallback accretion , unless pulsar emission or magnetic field coupling to the outer disk reduced the rotation rate below the critical value .", "this scenario likely applies only for mergers where the total system mass is relatively small mtot 2.52.6 m , even taking into account the current maximum observed ns mass of mns = 1.97 m . based on the wide arrays of eos models", "already considered , it is entirely possible to infer the likely fate for sets of parameters and/or eos models that have not yet been simulated , although no one has yet published a ", "master equation that summarizes all of the current work into a single global form .", "while magnetic fields with realistic magnitudes are unlikely to affect the bh versus hmns question [ 172 , 117 ] , finite - temperature effects might play a nontrivial role should nss be sufficiently hot prior to merger ( and see also ) . in the end , by the time the second generation of gw detectors make the first observations of mergers , the high - frequency shot - noise cutoff will prove to be a bigger obstacle to determining the fate of the remnant than any numerical uncertainty .", "a schematic diagram showing the possible final fates for a ns - ns merger along with the potential em emission ( see figure 21 of ) is shown in figure 18.gw emission during merger is also well - understood , though there are a few gaps that need to be filled , with full gr again a vital requirement .", "while the pn inspiral signal prior to merger is very well understood , finite - size tidal effects introduce complications beyond those seen in bh - bh mergers , yet the longest calculations performed to date encompass fewer orbits prior to merger than the longest bh - bh runs . as noted in and elsewhere", ", longer calculations will likely appear over time , helping to refine the prediction for the ns - ns merger gw signal as the binary transitions from a pn phase into one that can only be simulated using full gr , and teasing out the ns physics encoded in the gw signal .", "it seems clear from the published work that the emission during the onset of the merger is well - understood , as is the very rapid decay that occurs once the remnant collapses to a bh , either promptly or following some delay .", "gw emission from hmnss has been investigated widely , and there have been correlations established between properties of the initial binary and the late - stage high - frequency emission ( see , e.g. , [ 145 , 117 ] ) , but given that magnetic fields , neutrino cooling , and other microphysical effects seem to be important , a great deal of work remains to be done .", "perhaps more importantly , since hmnss emit radiation at frequencies well beyond the shot - noise limit of even second - generation gw detectors , while the final inspiral occurs near peak sensitivity , it is likely that the first observations of nss will constrain the nuclear eos ( or perhaps the quark matter eos ) primarily via the detection of small finite - size effects during inspiral .", "since qe calculations are computationally inexpensive compared to numerical merger simulations , there should be much more numerical data available about the inspiral stage than other phases of ns - ns mergers , which should help optimize the inferences to be drawn from future observations.determining the mass of the thick disk that forms around a ns - ns merger remnant remains a very difficult challenge , since its density is much lower and harder to resolve using either grid - based or particle - based simulations .", "34 is generally consistent with the gr calculations of other groups ( see , e.g. , ) , and seems to reflect a current consensus .", "it is also clear that disk masses around hmnss ( up to 0.2 m ) are significantly larger than those forming around prompt collapses , which are limited to about 0.05 m.it is likely that several orders of magnitude more mass - energy are present in the remnant disk than is observed in em radiation from a sgrb .", "modeling the emission from the disk ( and possibly a hmns ) remains extremely challenging .", "neutrino leakage schemes have been applied in both approximate relativistic calculations [ 252 , 246 ] and full gr , and a more complex flux - limited diffusion scheme has been applied to the former as a post - processing step , but there are no calculations that follow in detail the neutrinos as they flow outward , annihilate , and produce observable em emission . at present , nuclear reactions are typically not followed in detail ; rather , the electron fraction of the nuclear material , ye , is evolved , and used to calculate neutrino emission and absorption rates.magnetic fields , on the other hand , are starting to be much better understood .", "b - fields do seem to grow quite large through winding effects , even during the limited amount of physical time that can currently be modeled numerically [ 6 , 172 , 332 , 241 ] , with some calculations indicating exponential growth rates .", "the resulting geometries seem likely to produce the disk / jet structure observed throughout astrophysics when magnetized objects accrete material , which span scales from stellar bhs or pre - main sequence stars all the way up to active galactic nuclei .while recent numerical simulations have strengthened the case for ns - ns mergers as sgrb progenitors , full gr calculations have not generated much support for the same events yielding significant amounts of r - process elements . noting the standard caveat that low - density ejecta are difficult to model , and that nuclear reactions are rarely treated self - consistently", ", there is still tension between cf calculations producing ejecta with the proper temperatures and masses to reproduce the observed cosmic r - process abundances ( see , e.g. , ) , and full gr calculations that produce almost no measurable unbound material whatsoever . \n", "figure 18summary of potential outcomes from ns - ns mergers . here , mthr is the threshold mass ( given the eos ) for collapse of a hmns to a bh , and qm is the binary mass ratio .", "heavy disks imply total disk masses mdisk 0.01 m , 0.01 m mdisk 0.03 m , and mdisk 0.05 m , respectively . b - field and ", "j - transport indicate potential mechanisms for the hmns to eventually lose its differential rotation support and collapse : magnetic damping and angular momentum transport outward into the disk .", "spheroids are likely formed only for the apr and other stiff eos models that can support remnants with relatively low rotational kinetic energies against collapse .", "image reproduced by permission from , copyright by aps . with regard to the final fate of the merger remnant , calculations using full gr are required , but the details of the microphysics do not seem to play a very strong role .", "it is now possible to determine whether or not a pair of nss with given parameters and specified eos will form a bh or hmns promptly after merger , and to estimate whether a hmns will collapse on a dynamical timescale or one of the longer dissipative timescales ( see , e.g. , ) . for ns - ns binaries with sufficiently small masses", ", it is also possible to determine quickly whether the remnant mass is below the supramassive limit for which a ns is stabilized against collapse by uniform rotation alone , and thus would be unlikely to collapse , barring a significant amount of fallback accretion , unless pulsar emission or magnetic field coupling to the outer disk reduced the rotation rate below the critical value .", "this scenario likely applies only for mergers where the total system mass is relatively small mtot 2.52.6 m , even taking into account the current maximum observed ns mass of mns = 1.97 m .", "based on the wide arrays of eos models already considered , it is entirely possible to infer the likely fate for sets of parameters and/or eos models that have not yet been simulated , although no one has yet published a ", "master equation that summarizes all of the current work into a single global form .", "while magnetic fields with realistic magnitudes are unlikely to affect the bh versus hmns question [ 172 , 117 ] , finite - temperature effects might play a nontrivial role should nss be sufficiently hot prior to merger ( and see also ) . in the end , by the time the second generation of gw detectors make the first observations of mergers , the high - frequency shot - noise cutoff will prove to be a bigger obstacle to determining the fate of the remnant than any numerical uncertainty . a schematic diagram showing the possible final fates for a ns - ns merger along with the potential em emission ( see figure 21 of ) is shown in figure 18 .", "gw emission during merger is also well - understood , though there are a few gaps that need to be filled , with full gr again a vital requirement .", "while the pn inspiral signal prior to merger is very well understood , finite - size tidal effects introduce complications beyond those seen in bh - bh mergers , yet the longest calculations performed to date encompass fewer orbits prior to merger than the longest bh - bh runs . as noted in and elsewhere , longer calculations will likely appear over time , helping to refine the prediction for the ns - ns merger gw signal as the binary transitions from a pn phase into one that can only be simulated using full gr , and teasing out the ns physics encoded in the gw signal .", "it seems clear from the published work that the emission during the onset of the merger is well - understood , as is the very rapid decay that occurs once the remnant collapses to a bh , either promptly or following some delay .", "gw emission from hmnss has been investigated widely , and there have been correlations established between properties of the initial binary and the late - stage high - frequency emission ( see , e.g. , [ 145 , 117 ] ) , but given that magnetic fields , neutrino cooling , and other microphysical effects seem to be important , a great deal of work remains to be done .", "perhaps more importantly , since hmnss emit radiation at frequencies well beyond the shot - noise limit of even second - generation gw detectors , while the final inspiral occurs near peak sensitivity , it is likely that the first observations of nss will constrain the nuclear eos ( or perhaps the quark matter eos ) primarily via the detection of small finite - size effects during inspiral .", "since qe calculations are computationally inexpensive compared to numerical merger simulations , there should be much more numerical data available about the inspiral stage than other phases of ns - ns mergers , which should help optimize the inferences to be drawn from future observations .", "determining the mass of the thick disk that forms around a ns - ns merger remnant remains a very difficult challenge , since its density is much lower and harder to resolve using either grid - based or particle - based simulations .", "34 is generally consistent with the gr calculations of other groups ( see , e.g. , ) , and seems to reflect a current consensus .", "it is also clear that disk masses around hmnss ( up to 0.2 m ) are significantly larger than those forming around prompt collapses , which are limited to about 0.05 m. it is likely that several orders of magnitude more mass - energy are present in the remnant disk than is observed in em radiation from a sgrb .", "modeling the emission from the disk ( and possibly a hmns ) remains extremely challenging .", "neutrino leakage schemes have been applied in both approximate relativistic calculations [ 252 , 246 ] and full gr , and a more complex flux - limited diffusion scheme has been applied to the former as a post - processing step , but there are no calculations that follow in detail the neutrinos as they flow outward , annihilate , and produce observable em emission . at present , nuclear reactions are typically not followed in detail ; rather , the electron fraction of the nuclear material , ye , is evolved , and used to calculate neutrino emission and absorption rates .", "magnetic fields , on the other hand , are starting to be much better understood .", "b - fields do seem to grow quite large through winding effects , even during the limited amount of physical time that can currently be modeled numerically [ 6 , 172 , 332 , 241 ] , with some calculations indicating exponential growth rates .", "the resulting geometries seem likely to produce the disk / jet structure observed throughout astrophysics when magnetized objects accrete material , which span scales from stellar bhs or pre - main sequence stars all the way up to active galactic nuclei . while recent numerical simulations have strengthened the case for ns - ns mergers as sgrb progenitors , full gr calculations have not generated much support for the same events yielding significant amounts of r - process elements . noting the standard caveat that low - density ejecta are difficult to model , and that nuclear reactions are rarely treated self - consistently", ", there is still tension between cf calculations producing ejecta with the proper temperatures and masses to reproduce the observed cosmic r - process abundances ( see , e.g. , ) , and full gr calculations that produce almost no measurable unbound material whatsoever .", "summary of potential outcomes from ns - ns mergers . here , mthr is the threshold mass ( given the eos ) for collapse of a hmns to a bh , and qm is the binary mass ratio .", "heavy disks imply total disk masses mdisk 0.01 m , 0.01 m mdisk 0.03 m , and mdisk 0.05 m , respectively . ", "b - field and j - transport indicate potential mechanisms for the hmns to eventually lose its differential rotation support and collapse : magnetic damping and angular momentum transport outward into the disk .", "spheroids are likely formed only for the apr and other stiff eos models that can support remnants with relatively low rotational kinetic energies against collapse .", "image reproduced by permission from , copyright by aps . while ns - ns merger calculations have seen tremendous progress in the past decade , the future remains extremely exciting . between the addition of more accurate and realistic physical treatments , the exploration of the full phase space of models , and the linking of numerical relativity to astrophysical observations and gw detection ,", "there remain many unsolved problems that will be attacked over the course of the next decade and beyond ." ] ]

[ [ "glutamate functions as the major excitatory neurotransmitter by binding to n - methyl - d - aspartate receptors ( nmdars ) that are widespread in the central nervous system .", "the nmdars constitute a major class of ionotropic glutamate receptors and play an essential role in synaptic transmission , plasticity , and memory .", "activation of nmdars results in cell membrane depolarization with an equilibrium potential near 0 mv , producing the excitatory postsynaptic potential ( epsp ) and leading to an increase of ca influx into the cell .", "the intracellular ca can in turn function as a second messenger , mediating a variety of signaling cascades .", "excessive activation of nmdars by glutamate mediates neuronal damage in many neurological disorders including ischemia and neurodegenerative diseases ( choi et al .", "the nmdars have long been considered the main target for the treatment of excitotoxicity - related neuronal injury , and a variety of antagonists or blockers of nmdars have been developed .", "unfortunately , the results of clinical trials have been disappointing because of the obvious side effects associated with blocking the physiological roles of nmdars ( chen and lipton , 2006 ) .", "therefore , a better understanding of the mechanism of how nmdars can be modulated by regulatory proteins should help in the development of new therapeutic agents to counteract overactive nmda receptor function , and may represent an alternative to treating nmdar - mediated excitotoxic injury .", "this short review focuses on the specific negative modulation of nmdars by a neuronal calcium sensor ( ncs ) protein , dream / calsenilin / kchip3 ." ], [ "nmdars are believed to be heterotetrameric complexes composed of combinations of the obligatory nr1 subunit and nr2 and/or nr3 subunits ( chazot and stephenson , 1997 ; laube et al .", ", 1998 ; schorge and colquhoun , 2003 ; furukawa et al . , 2005 ) .", "the nr1 subunit is encoded by a single gene but exists as eight functional splice variants , while the nr2 ( nr2a - b ) and nr3 ( nr3a - b ) subunits are encoded by four and two different genes , respectively .", "the nmdar subunits form a central ion conductance pathway selective for cations such as na , k , and ca , and share a common membrane topology , with each subunit consisting of four transmembrane ( tm ) domains ( m1m4 ) .", "the long extracellular n - terminal regions of nmdar subunits are organized as a tandem of two domains .", "the first domain , called the n - terminal domain ( ntd ) that includes the first 380 amino acids , is involved in tetrameric assembly ( mayer , 2006 ; paoletti and neyton , 2007 ; stroebel et al . ,", "the second domain of about 300 amino acids is known as the agonist - binding domain ( abd ) that precedes the tm1 domain .", "the abd binds glycine ( or d - serine ) in the nr1 and nr3 subunits , whereas the nr2 abd binds glutamate ( furukawa et al .", ", 2005 ; yao and mayer , 2006 ) . the pore loop ( p loop ) , or the m2 region , forms the narrowest constriction of the channel ion conductance pathway and determines the permeation properties of nmdars .", "the nmdars feature an intracellular c - terminal tail of about 400600 residues that has a strong diversity in its amino acid sequence .", "the c - terminal tails of nmdar subunits contain a series of short motifs that interact with intracellular factors or binding partners involved in receptor trafficking , anchoring and signaling ( skeberdis et al .", "activation of nmdars requires a simultaneous binding of two co - agonists , glutamate , and glycine with different biophysical properties of ion permeation .", "the typical nmdars contain nr2 subunits with properties of high permeability to ca and extracellular mg block at hyperpolarized membrane potentials ( wrighton et al .", "different from conventional nr1/nr2 heterotetramers , nr3-containing nmdars have unique properties with a five to tenfold decrease of ca permeability , insensitivity to mg block , and reduced single - channel conductance and open probability , functioning as a negative modulator for nmda receptor channel function ( das et al . , 1998 ;", "2009 ; cavara et al . , 2010 ; henson et al . , 2010 ) ." ], [ "nmda receptors are also regulated by other intracellular signals and proteins , including calcium , protein kinases , protein phosphatase calcineurin , and calcium - sensitive proteins such as calmodulin ( legendre et al . , 1993 ; vyklicky , 1993 ; lieberman and mody , 1994 ; tong et al . , 1995 ; ehlers et al . , 1996 ) .", "calcium - dependent nmda receptor desensitization and inactivation provides a feedback mechanism capable of regulating subsequent ca entry into the postsynaptic cell through nmda channels ( figure 1 ) .", "schematic representation for inhibitory effect of dream / calsenilin / kchip3 on nmdars in a ca - sensitive manner . upon activation of nmdars by glutamate", "binding , ca influx through nmdars increases the association between dream and nr1 subunits , resulting in reduced surface expression of nmdars , and subsequent inhibition of nmdars - mediated ca influx and excitotoxicity .", "dream functions as a ca - sensitive modulator for the negative feedback control of nmdar function .", "so far , a number of nr1 or nr2 subunit binding partners have been identified in the postsynaptic density .", "the nr1 binding proteins include calmodulin ( cam ) ( ehlers et al . , 1996 ; akyol et al . , 2004", ") , ca / cam - dependent protein kinase ii ( camkii ) ( leonard et al . , 2002 ) , -actinin ( wyszynski et al . , 1997 ; merrill et al . , 2007 ) ,", "tubulin ( van rossum et al . , 1999 ) , spectrin ( wechsler and teichberg , 1998 ) , neurofilament ( ehlers et al . ,", "calmodulin binding to the nr1 subunit is ca dependent and occurs with homomeric nr1 complexes , heteromeric nr1/nr2 subunit complexes from expression systems , and nmda receptors from the brain .", "calmodulin binding to nr1 causes a fourfold reduction in nmda channel open probability , mediating the negative modulation of nmdar function ( ehlers et al . , 1998 ) ." ], [ "the downstream regulatory element antagonist modulator ( dream ) protein , first identified in the nucleus as a ca - regulated transcriptional repressor through its binding to dna at specific regulatory elements , contains four ca - binding ef - hand domains and belongs to the ncs family ( carrion et al . , 1999 ; burgoyne , 2007 ) .", "dream was named for its ability to block gene expression in its ca - free form via direct binding with the downstream regulatory element ( dre ) sequence in target genes such as preprodynorphin ( ppd ) , c - fos , hrk , na , and ca exchanger ncx3 ( carrion et al .", ", 1999 ; sanz et al . , 2001 ; gomez - villafuertes et al . ,", "dream was also named calsenilin or kv channel interacting protein 3 ( kchip3 ) ( buxbaum et al . , 1998 ; an et al . , 2000", ") , indicating that dream / calsenilin / kchip3 has multifunctional properties . in the nucleus", "the dream protein functions as a dimer , whereas outside the nucleus kchip3 is a monomer and regulates the surface expression and gating kinetics of kv4 channels ( an et al . , 2000 ;", "kim and sheng , 2004 ; scannevin et al . , 2004 ; pioletti et al .", "dream / calsenilin / kchip3 is preferentially expressed in the central nervous system , as well as in non - neuronal tissues ( link et al .", "dream / calsenilin / kchip3 knock - out mice display a hypoalgesic phenotype , suggesting a critical role of dream / calsenilin / kchip3 in pain modulation ( cheng et al . ,", "in addition , emerging evidence reveals the role of dream / calsenilin / kchip3 in long - term potentiation ( ltp ) ( lilliehook et al . , 2003 ) and learning and memory ( alexander et al . , 2009 ; fontan - lozano et al . , 2009 ) , suggesting a possible connection between dream and nmda function .", "kchip13 were initially identified from a rat brain library in yeast two - hybrid ( yth ) screens using the cytoplasmic n - terminal domain ( amino acids 1180 ) of rat kv4.3 as a bait ( an et al . , 2000 ) .", "similarly , kchip4 from mouse and human was accidentally cloned using the c - terminal 43 amino acid residues of presenilin 2 ( ps2 , amino acids 406448 ) as a bait in the yth system ( morohashi et al . , 2002 ) .", "kchip4 , also known as calsenilin - like protein ( calp ) , binds to ps2 which is known to facilitate intramembranous -cleavage of -amyloid protein precursor ( app ) ( morohashi et al . , 2002 ) .", "kchip14 ( 216 256 amino acids ) can co - immunoprecipitate and co - localize with either kv4 from co - transfected cells or kv4 -subunits from tissues , and thus constitute integral components of native kv4 channel complexes ( wang , 2008 ) . kchip14", "all share a conserved carboxy - terminal core region that contains four ef - hand - like calcium binding motifs , but have a variable amino - terminal region that causes diverse modulation of kv4 trafficking and channel function ( an et al .", ", 2000 ; holmqvist et al . , 2002 ; scannevin et al . , 2004 ;" ], [ "findings from co - immunoprecipitation experiments show that dream antibody can immunoprecipitate endogenous nr1 subunit and dream protein from rat hippocampal tissue ( zhang et al . , 2010 ) .", "in the reciprocal co - ip studies in hek 293 cells expressing dream and nr1 - 1a ( nr1a ) proteins , nr1 antibody can also immunoprecipitate dream along with the nr1 subunit .", "gst pull - down assays reveal that the n - terminus of dream directly interacts with the nr1a c - terminus , and that the dream - nr1 interaction is sensitive to ca and depends on the ef hand domains of dream ( zhang et al . , 2010 ) .", "psd-95 is a major scaffolding protein in the postsynaptic density , tethering nmdars to signaling proteins , and is critical for nmda receptor function ( kim and sheng , 2004 ) .", "wu et al . generated a line of transgenic mice ( tgdream ) overexpressing a dominant active dream mutant , and compared nmda receptor - mediated epscs in tgdream and wild - type mice under conditions of various stimulation intensities ( wu et al .", "they found that the amplitude of nmda receptor - mediated epscs in tgdream mice is significantly reduced compared to that in wild - type mice ( wu et al . , 2010 ) .", "in addition , ltd is significantly reduced in tgdream mice whereas ltp is not affected by dream , demonstrating that dream interacts with psd-95 , and that the interaction is negatively regulated by calcium ( wu et al . ,", "2010 ) . in xenopus oocytes expressing nr2b - containing nmdars alone or together with dream ,", "two - electrode voltage clamp recordings show that , in the absence of dream , the peak currents of nmda channels activated by glutamate ( plus glycine ) are suppressed by dream , and the current decrease is caused by a reduction in the density of nmdars at the cell surface ( figure 1 ; zhang et al . , 2010 ) .", "fontan - lozano et al . recently provided another piece of evidence that dream negatively regulates the function of nmda receptors ( fontan - lozano et al . , 2011 ) .", "by taking advantage of mice lacking the dream protein , they demonstrated that the facilitated learning induced by decreased expression of kv4.2 in dream mice requires the activation of nmda receptors containing the nr2b subunit ( fontan - lozano et al . , 2011 ) .", "this study not only indicates the significance of the balance between kv4 channel function and nmdar activity , but also suggests the formation of a functional complex between dream / kv4.2/nmdars that regulates the synaptic efficacy mediating synaptic plasticity and learning ." ], [ "excitotoxicity is caused by overactivation of nmda receptor function , and inhibition of nmdars can reverse the neuronal toxicity .", "the data available so far support both the pro - apoptotic and anti - apoptotic roles of dream .", "in general , the pro - apoptotic role of dream closely correlates with its interaction with presenilins , the production of amyloid beta ( a ) and the modulation in ca signaling , whereas the anti - apoptotic role of dream is conferred by its transcriptional repressor activity on the apoptotic protein hrk .", "jo et al . reported that hela cells transiently transfected with dream exhibit the morphological and biochemical features of apoptosis and that expression of presenilin potentiates dream - induced apoptosis ( jo et al . , 2001 ) .", "jo et al . also reported that dream expression increases in either human neuroblastoma sk - n - be2(c ) cells or rat neuroblastoma b103 cells after exposure to a , but no other apoptotic inducers such as staurosporine , thapsigargin , and calcium ionophore a23187 .", "the pro - apoptotic role of dream is selectively induced during ab toxicity . because of the involvement of presenilins/-secretase in a formation and neuronal death , dream coordinates with presenilin activity to play a crucial role in these processes through binding with the c - terminus of presenilins ( jo et al . , 2003 , 2004 ) .", "stably expressed dream in h4 neuroglioma cells which showed no initiation of apoptosis in the absence of apoptosis triggers , and the apoptosis - associated caspase and calpain activities were not affected by dream ( lilliehook et al .", "on the other hand , binding of the transcriptional repressor dream to the hrk gene avoids inappropriate hrk expression and apoptosis in hematopoietic progenitor cell lines ( sanz et al . , 2001 , 2002 ) .", "nevertheless , the precise function of dream in pro - apoptosis and anti - apoptosis remains to be explored . from our previous observations", ", we noticed that cell viability is affected by the amount of exogenous dream gene and the method of transfection .", "however , we could not observe any obvious morphological changes associated with cell death after the transfection of dream . to prove the cytoprotective role of dream , we utilized cell lines and primary cultured hippocampal neurons with dream overexpression or sirna - mediated knockdown , and evaluated lactate dehydrogenase ( ldh ) leakage and propidium iodide ( pi ) uptake both in nmda and oxygen - glucose deprivation ( ogd ) -induced excitotoxic injury models ( zhang et al . , 2010 ) .", "administration of nmda markedly increases the number of pi - positive cells ( dead cells ) in nmdar - transfected cho cells , whereas co - expression of dream greatly reduces pi - positive cells ( zhang et al . , 2010 ) .", "ogd is commonly used in vitro to mimic ischemia - reperfusion insult to the brain , and ogd treatment induces a significant increase of ldh release ( dawson et al . , 1994 ) .", "with over - expression of dream , however , ogd treatment induces a smaller increase in ldh release .", "these results indicate that the over - expression of dream attenuates nmdar - mediated excitotoxicity ( zhang et al . , 2010 ) . we have previously tested the effect of dream sirna on nmda - induced current and excitotoxic injury in hippocampal neurons ( zhang et al . , 2010 ) .", "knockdown of endogenous dream with sirna results in an increased amplitude of nmda current recorded by whole - cell patch - clamp assays .", "after nmda exposure , pi - positive cells in the dream sirna group increase compared with control sirna , indicating the inhibitory effect of dream on nmdar - mediated current and excitotoxic injury ( zhang et al . , 2010 ) ." ], [ "the ncs protein dream / calsenilin / kchip3 acts as an auxiliary subunit and suppresses nmda receptor channel function .", "this negative modulation of nmda receptor function by dream likely provides a feedback mechanism by which overactive nmda receptors are inhibited .", "therefore , targeting regulatory proteins of nmdars may represent an alternative approach to treating nmdar - mediated excitotoxic damage and providing neuroprotection .", "the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest ." ], [ "the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest ." ] ]

[ [ "amisulpride came into the indian market a few years back with hypes and hopes in the management of schizophrenia .", "its broad spectrum effectiveness with lower chances of extrapyramidal symptoms ( eps ) and metabolic syndrome did help psychiatrists to treat schizophrenia and related disorders more effectively .", "although this antipsychotic does not block serotonin receptors at all , it is a high - affinity and highly selective d3/d2 receptor antagonist with atypical properties .", "its selective affinity for dopamine receptors in the limbic structures , but not in the striatum , leads to a low risk of extrapyramidal side effects .", "all available reports suggest that chance of eps is very less with amisulpride at doses < 400 mg / day .", "however , there are sporadic reports of drug - induced eps including dystonia and akathisia even in patients receiving low doses of amisulpride . here" ], [ "a 30-year - old male with schizophrenia for the past 10 years now presented with predominantly negative symptoms .", "he was on olanzapine 15 mg / day for more than 6 months without much improvement .", "hence , amisulpride was instituted with a starting dose of 50 mg / day with a gradual increment up to 300 mg / day within 14 days .", "the patient came after 14 days to the casualty with features of parkinsonian syndrome such as slowed gait , mild rigidity , salivation , and bradykinesia .", "he was hospitalized , amisulpride was immediately stopped , and trihexyphenidyl 4 mg / day was given to manage the side effect .", "his eps gradually subsided and for negative symptoms , clozapine was introduced at a small dose of 25 mg / day and gradually increased to 200 mg / day over a period of 10 days . at the time of discharge , on the 14 day , he was free from parkinsonian symptoms .", "subsequent follow - up showed no parkinsonian symptoms and he had modest improvement in negative symptoms . a 48-year - old male with schizophrenia for the last 20 years", "was treated with various antipsychotics without much improvement . since the last 6 months , he was on olanzapine 15 mg / day .", "as there was no significant improvement , his olanzapine dose was gradually tapered and stopped over a period of 14 days and was started on amisulpride 100 mg / day and was increased to 200 mg / day over a period of 3 weeks .", "the patient returned on the 24 day with severe parkinsonian symptoms . in this patient also , there was no prior history of parkinsonism .", "we managed him with injection promethazine 25 mg intramuscular bid first 3 days along with trihexyphenidyl 2 mg bid after stopping amisulpride .", "after 7 days , parkinsonian symptoms improved considerably and clozapine was introduced at a dose of 25 mg / day which was subsequently increased to 100 mg / day on the 10 day and the patient was discharged ." ], [ "since the discovery that clozapine induces fewer eps and is more effective for negative symptoms than conventional antipsychotics for the treatment of schizophrenia , psychopharmacological research has focused on the development of drugs that block central 5-ht2 receptors more than d2 receptors .", "combined 5-ht2/d2 receptor antagonism is the most current explanation for the so - called atypical profile of some antipsychotics .", "amisulpride at low doses binds selectively to dopamine d2 , d3 autoreceptors , thereby enhancing dopaminergic transmission and thus might be effective for negative symptoms .", "it has no affinity for d1 , d4 , and d5 receptor subtypes . at higher doses", ", it blocks postsynaptic receptors , thus inhibiting dopaminergic hyperactivity . at the same time , amisulpride has greater specificity for the limbic system and thus has low incidence of eps .", "amisulpride binds more loosely than dopamine to the dopamine d2 receptor and is rapidly dissociated from the dopamine d2 receptor .", "low - dose therapy with amisulpride is associated with a significantly lower blockade of striatal dopamine d2 receptors than is seen during high - dose treatment . however , a significant striatal d2 blockade was demonstrated at therapeutically effective dose ranges , and a good relationship between the degree of striatal dopamine d2 receptor occupancy and the amisulpride plasma concentration or the administered dose was shown . in general , asians are slow metabolizers .", "low body weight and slow metabolism may increase the plasma concentration of drugs causing side effects .", "reported a low postsynaptic d2 occupancy in the striatum at low doses of amisulpride ( 50100 mg / day ) .", "it has also been suggested that extrastriatal binding could mediate the effect on negative symptoms .", "the probable causes of eps with low doses of amisulpride could be that it blocks postsynaptic d2 receptors significantly in striatum without much effect in the mesolimbic pathway .", ", the lower incidence of eps which is claimed by western researchers as well as pharmaceutical companies should be studied well in the indian context .", "we should at least keep this side effect in our minds while starting or increasing the doses ." ], [ "" ], [ "" ] ]

[ [ "the world health organization has defined health literacy ( hl ) as the cognitive and social abilities which determine the incentive and ability of individuals to increase access to understand and use information in ways , which promote and preserve good health . ", "the hl of patients has obtained more attention as a risk factor for poor adherence to treatment and adverse outcomes in chronic disease 's management particular in diabetes care .", "diabetes is the most common metabolic disease with a dramatic increase rate of prevalence throughout the world , which has an important impact on the public health and quality of life of the patients .", "there is a developing frame of the literature that discovers the association between hl and health outcomes in people with diabetes .", "older studies of low hl reported adverse effects on diabetes - related health outcomes ; however , more recent studies showed no association between hl levels and intensity , frequency or incidence of outcomes , and thus the effect of hl on the health of people with diabetes is yet unclear .", "based on national reports , the prevalence of diabetes has been raised during three decades in iran and also a recent national survey about hl has shown that majority of people has inadequate knowledge .", "however , there are different tools to measure hl and numeracy skills in general population in different languages , only diabetes numeracy test-15 ( dnt-15 ) has been developed specifically to measure numeracy skills in patients with diabetes as first scale by huizinga et al .", ", in english language . with regard to lacking of appropriate measurement tool for patients with diabetes in persian ( farsi ) language , this study aimed to provide evidence for the psychometric properties of the iranian ( persian language ) version of dnt-15 ." ], [ "the dnt was designed to evaluate nutrition , exercise , glucose monitoring , oral medication , and insulin skills that patients may encounter during daily diabetes self - management .", "blood - glucose monitoring skills are evaluated by three items about number hierarchy , glaciated hemoglobin , and calculating supplies needed .", "eight items assess the oral medication use and insulin use . oral medication ( one question )", "use refill patterns and dates , and oral titration schemes and insulin use ( seven questions ) including interpretation of syringes , correction or sliding - scale insulin use , insulin adjustment for carbohydrate intake , and titration instructions [ table 1 ] .", "items are scored as binary outcomes correct or incorrect and no partial credit is given .", "many patients with diabetes use calculators ; therefore , participants were allowed to use calculators during the administration of the dnt to emulate real - life circumstances .", "dnt scores are reported as percent correct ( with a possible range of 0% to be 100% ) .", "description of diabetes numeracy test items in this phase , the original questionnaire was translated by two independent health professionals from english to persian .", "after translation , by consultation with the principal investigators , the results were rechecked . finally , they achieved a precision translation for the questionnaire . in this phase ,", "the questionnaire that translated in the previous step , gave to two professional translators whose native language were english , and they are sufficient dominance in persian language .", "the translators did not communicate with one another and did not know the original english version .", "translated versions by consultation with the principal investigators of conversion backward translation were combined . in this phase ,", "a group of experts was reviewed , all phases , including verification and cross - cultural equivalent ( cross - cultural equivalence ) .", "cultural equivalent to the word ( semantic ) , a term equivalent ( idiomatic ) , and equivalent experience ( experiential ) , and conceptually equivalent ( conceptual ) were performed by an expert panel .", "this group included experts in diabetes , certified diabetes educators , methodologist , primary care providers , and registered dietitians , behavioral researchers in diabetes , and literacy and numeracy experts . finally , the dnt was to address the clarity of items for patients with diabetes .", "interviewees were asked specific questions about each item to evaluate the understandability of the wording .", "if an item was unclear , the interviewee was told the purpose of the item and then encouraged to suggest a different format or wording . in response to the interviews , the scale was reformatted and slightly reduced to the final 15-items .", "reliability was evaluated by internal consistency ( kuder - richardson 20 ) , and validity was evaluated through content validity ratio ( cvr ) and content validity index ( cvi ) .", "a convenience sample of 120 patients with diabetes was interviewed in the diabetes clinic affiliated to institute of endocrinology and metabolismof an item at clinic visits . any person diagnosed with type 1 and or type 2 diabetes which was able to read ( at least eight grades ) and speak persian language .", "potential participants were excluded if they corrected visual acuity was > 20/50 using a rosenbaum pocket vision screener , or if they had a diagnosis of significant dementia , psychosis , or blindness ." ], [ "the dnt was designed to evaluate nutrition , exercise , glucose monitoring , oral medication , and insulin skills that patients may encounter during daily diabetes self - management .", "blood - glucose monitoring skills are evaluated by three items about number hierarchy , glaciated hemoglobin , and calculating supplies needed .", "eight items assess the oral medication use and insulin use . oral medication ( one question )", "use refill patterns and dates , and oral titration schemes and insulin use ( seven questions ) including interpretation of syringes , correction or sliding - scale insulin use , insulin adjustment for carbohydrate intake , and titration instructions [ table 1 ] .", "items are scored as binary outcomes correct or incorrect and no partial credit is given .", "many patients with diabetes use calculators ; therefore , participants were allowed to use calculators during the administration of the dnt to emulate real - life circumstances .", "dnt scores are reported as percent correct ( with a possible range of 0% to be 100% ) ." ], [ "in this phase , the original questionnaire was translated by two independent health professionals from english to persian ." ], [ "in this phase , the questionnaire that translated in the previous step , gave to two professional translators whose native language were english , and they are sufficient dominance in persian language .", "the translators did not communicate with one another and did not know the original english version ." ], [ "in this phase , a group of experts was reviewed , all phases , including verification and cross - cultural equivalent ( cross - cultural equivalence ) .", "cultural equivalent to the word ( semantic ) , a term equivalent ( idiomatic ) , and equivalent experience ( experiential ) , and conceptually equivalent ( conceptual ) were performed by an expert panel .", "this group included experts in diabetes , certified diabetes educators , methodologist , primary care providers , and registered dietitians , behavioral researchers in diabetes , and literacy and numeracy experts . finally , the dnt was to address the clarity of items for patients with diabetes .", "interviewees were asked specific questions about each item to evaluate the understandability of the wording . if an item was unclear , the interviewee was told the purpose of the item and then encouraged to suggest a different format or wording . in response to the interviews , the scale was reformatted and slightly reduced to the final 15-items .", "reliability was evaluated by internal consistency ( kuder - richardson 20 ) , and validity was evaluated through content validity ratio ( cvr ) and content validity index ( cvi ) ." ], [ "a convenience sample of 120 patients with diabetes was interviewed in the diabetes clinic affiliated to institute of endocrinology and metabolismof an item at clinic visits . any person diagnosed with type 1 and or type 2 diabetes which was able to read ( at least eight grades ) and speak persian language .", "potential participants were excluded if they corrected visual acuity was > 20/50 using a rosenbaum pocket vision screener , or if they had a diagnosis of significant dementia , psychosis , or blindness ." ], [ "difficult issues for participants included titration schemas , food label interpretation , insulin adjustment instructions , and items that required multi - step math ( e.g. , calculating insulin dosage based on carbohydrate intake and glucose level ) .", "questions 2 , 5 , 6 , 7 , 8 , 9 , and 11 were answered accurately respectively by 89.1% , 78.2% , 87.4% , 72.3% , 85.7% , 84% , and 83% of participants for this study .", "however , questions 14 and 15 , which required patients to interpret a word problem and apply multiple numerical steps to determine their insulin dosage , was only answered correctly , respectively by 41% , 54% of the participants .", "the 15-item persian version of the dnt has highly reliable , as determined by internal consistency kuder - richardson ( kr-20 = 0.90 ) .", "content validity was examined by the expert panel ( cvr : 089 and cvi : 0.86 ) ." ], [ "the short version of the dnt-15 demonstrated internal consistency and construct validity in relation to reading skills in persian ( farsi ) language in iranian population .", "scores on the dnt-15 showed a direct correlation with level of education in this study which is consistent with other reports .", "although there have been some reports about hl in iran they were not specific about diabetes in iran .", "other studies have identified the role of hl techniques in the improvement of health outcomes in diabetes and congestive heart failure .", "patients with low hl may benefit from interventions that address numeracy , particularly in the setting of diabetes management .", "the dnt-15 can provide a measurement of diabetes - specific numeracy and provide more information on the role of disease - specific numeracy in future studies .", "more studies are needed to further understand the role of numeracy tailored interventions for the management of diabetes .", "for example , study participants had a difficult time with the multi - step math required to calculate a correction dosage of insulin when instructions were presented as a sequence of sentences .", "this item was encompassed to mirror clinical practice regarding how patients are currently instructed to take their insulin .", "this example provides an important lesson for health care providers and educators in effective communication styles for all clinical care recommendations ." ], [ "the persion ( farsi ) version of dnt-15 is a reliable and valid tool to measure of diabetes - specific numeracy skills for patients with diabetes ." ] ]

[ [ "\n pulmonary hypertension ( ph ) encompasses a diverse group of disorders , all characterized by an elevation in pulmonary arterial pressure and pulmonary vascular resistance ( pvr ) .", "pediatric ph is associated with significant morbidity and mortality , and differs from ph as manifest in adults in several important ways , such as the development of ph in a growing lung .", "medical treatment of pediatric ph has been challenging due to a lack of accessible , noninvasive , objective measures that can aid in managing these patients .", "specifically , there is a need for better tools for prognosis and assessment of the progression of the disease [ 1 , 3 , 4 ] . ", "outcomes of most interest to clinicians and ph patients include death , hospitalization for ph - related events , right ventricular failure , initiation of intravenous prostanoid therapy , and lung transplantation .", "although definitive , these end points are often difficult to study in pediatric ph due to their infrequent occurrences and the requirement for long - term followup . currently , disease progression is most commonly assessed through a 6-minute walk distance and hemodynamic assessments , but both of these suffer from practical drawbacks and neither is thoroughly validated in the pediatric population .", "these limitations in current outcomes and prognostic variables have spurred our search for reliable , noninvasive , objective , and cost - effective alternatives that are easily measured in children [ 1 , 4 ] .", "circulating protein biomarkers have the potential to meet these objectives . the role of inflammation in the pathobiology of ph has recently been emphasized [ 69 ] .", "cytokine- and growth factor - dependent mechanisms lead to inflammatory cell recruitment and are prominent in ph [ 911 ] . of these factors ,", "for example , il-6 administration in rats induces ph , and il-6 augments hypoxia - induced ph .", "in addition , it has been reported recently that transgenic mice overexpressing il-6 display ph , vascular remodeling , and an exaggerated response to hypoxia .", "further , circulating levels of cytokines are reportedly important in the pathogenesis of a wide range of other conditions including chronic heart failure , acute renal failure , and sepsis .", "recent developments in protein array technology allow high throughput , multiplex analysis with excellent sensitivity , precision , and specificity .", "the approach is also cost effective and uses minimal sample because all the analytes are measured on a single chip simultaneously .", "the requirement for low sample volumes is of special interest in the management of pediatric patients .", "we therefore applied a protein array approach that provides accurate and precise quantification of twelve proteins with known lung or vascular effects in a cohort of pediatric patients with ph .", "our objective was to determine whether there is a clinically relevant association between any of the panel constituents , individually or combined , with hemodynamic parameters , disease prognosis , and relevant adverse outcomes ." ], [ "prior approval for these studies was obtained from the colorado multiple institutional review board ( comirb , approval # 05 - 0551 ) . written informed consent", "was obtained from the parents or guardians of all children who served as subjects of the investigation , and when appropriate , from the subjects themselves .", "plasma samples were collected from 70 pediatric patients with ph ranging in age from newborn to 21.3 years old .", "all patients were being treated with appropriate therapies to manage their ph during sample collection ( table 1 ) .", "patients were classified as idiopathic pediatric pulmonary arterial hypertension ( ipah ) or associated pulmonary arterial hypertension ( apah ) according to published criteria . in this study , disease prognosis / severity was determined using hemodynamic parameters measured in the cardiac catheterization laboratory during a routine pulmonary hypertension visit .", "the data were obtained with the patient breathing room air , prior to testing pulmonary reactivity with the use of vasodilator therapy . for right - heart catheterization", ", we used a swan - ganz catheter in the femoral vein or internal jugular vein to determine mean right atrial pressure ( rap ) , mean pulmonary artery pressure ( pap ) , pulmonary capillary wedge pressure ( pcwp ) , cardiac index ( ci ) , and pulmonary vascular resistance index ( pvri ) .", "invasive arterial monitoring was used to measure the systemic vascular resistance index ( svri ) .", "we used fick with assumed oxygen consumption in those patients with shunts and thermodilution in all others to measure cardiac output and then calculate cardiac index .", "most subjects were ventilated because they were children . in addition , the reactivity to inhaled nitric oxide was calculated by taking the difference in mean pap between room air and with nitric oxide . the adverse outcome used in the predictive models", "was defined as initiation of intravenous prostanoids ( epoprostenol or treprostinil ) , transplantation , and/or death occurring within 12 months from the collection of the blood sample .", "admission for right heart failure is a rare event in children and was not included in the adverse outcome definition . ", "blood ( 5 ml ) was drawn , plasma isolated , and this was frozen at 70c until analysis .", "protein determinations were performed on an evidence analyzer ( randox laboratories , northern ireland ) according to the manufacturer 's protocol for the simultaneous quantification of the following analytes : interleukin-1alpha ( il-1 ) , interleukin-1beta ( il-1 ) , interleukin-2 ( il-2 ) , interleukin-4 ( il-4 ) , interleukin-6 ( il-6 ) , interleukin-8 ( il-8 ) , interleukin-10 ( il-10 ) , tumor necrosis factor alpha ( tnf ) , gamma interferon cytokine ( ifn ) , monocyte chemotactic protein-1 ( mcp-1 ) , endothelial growth factor ( egf ) , and vascular endothelial growth factor ( vegf ) .", "values for individual proteins measured by this multiplexed protein array technology have been shown to correlate with single elisa measurements .", "further , intra- and interassay coefficients of variation of less than 10% are typical for most protein measured by this multiplexed approach with this system .", "determinations were made in duplicate and all calculations were based on the average of the two measurements for each sample .", "descriptive statistics were calculated using mean standard deviations or medians and the interquartile range ( iqr ) for continuous variables and percentages for categorical variables .", "comparisons across groups were made by wilcoxon rank sum or chi - squared tests , as appropriate .", "spearman rank correlation coefficients were used to estimate the association between the hemodynamic variables and protein markers .", "logistic regressions were fit to investigate the association between the dichotomous adverse outcome variable ( outcome observed within 12 months ) and the protein measurements .", "mean standardization and principal component analysis ( pca ) were performed for dimension reduction across the protein measurements , resulting in a single value representing a weighted combination of all twelve markers .", "a score statistic was used to select the principal component ( pc ) most associated with the outcome and the best subset of two pcs and clinical variables in a multivariate logistic regression .", "the predictive ability of the model was investigated using a c - index ( area under the roc curve ) .", "the improvement in risk prediction associated with the addition of the protein biomarker pc was assessed by calculation of a net reclassification improvement ( nri ) measure .", "to estimate the predictive ability of the logistic regressions to an independent set of observations , c - indices were calculated using the leave - out - one cross - validation approach .", "all analyses were performed using sas version 9.2 software ( sas institute inc . , cary , nc , usa , 2008 ) ." ], [ "the study population consisted of 70 pediatric patients with ph : 36% ipah and 64% with apah . of these ,", "the median pap was elevated at 34 mm hg ( the interquartile range ( iqr ) was 2356 mm hg ) with a median rap value of 5 mm hg ( iqr , 37 mm hg ) .", "nine ( 13% ) patients experienced an adverse event within 12 months of sample collection .", "these patients had worse mpap levels ranging from 30 to 76 with a median of 65.5 mm hg as well as a median pvri of 15.5 wood units m ranging from 5.120.4 .", "only 39 of the 48 patients with vasoreactivity tests had complete data in order to assess the responder status based on the pediatric definition .", "based on these data 2 ( 5% ) were classified as responders and neither of these patients experienced an adverse event .", "there were no significant differences between the ipah and apah groups for any of the protein levels . ", "thereafter , only 59 ( 84% ) of the patients had a catheterization performed on the same day as blood collection for the correlation analysis , and of these , 48 individuals also had a vasoreactivity test in response to inhaled nitric oxide ( no ) .", "the following pairs of hemodynamic and circulating protein markers had correlation coefficients ( r ) significantly different from zero : il-1 and ci ( r = 0.31 , cl = 0.53 to 0.04 ) ; egf and mpap ( r = 0.45 , cl = 0.63 to 0.21 ) ; egf and pvri ( r = 0.37 , cl = 0.57 to 0.12 ) ; egf and pvr / svr ( r = 0.42 , cl = 0.62 to 0.17 ) ; il-6 and mpap ( r = 0.27 , cl = 0.01 to 0.49 ) ; il-6 and pvri ( r = 0.32 , cl = 0.06 to 0.53 ) .", "none of the biomarkers correlated with the change in mean pap in response to inhaled no . to assess the potential additive predictive ability of the proteins we measured ,", "the first of these were univariate models that were estimated to determine the association of each protein individually with the adverse outcome variable .", "vegf and il-6 were significantly associated with the adverse outcome : ( or ( 95% ci ) were as follows : 0.56 ( 0.330.98 ) and 1.69 ( 1.032.77 ) , respectively .", "in addition to vegf , il-1 , il-2 , il-4 , mcp1 , and egf also had negative associations , indicating that lower values of these proteins were associated with the adverse event outcome .", "pca was performed on the protein marker data to condense the 12 measurements to a few orthogonal components .", "the 3rd component was significantly associated with the outcome , with higher values corresponding to an increased risk of an adverse event .", "the risk associated with this protein index was weighted by higher values of il-1 and il-6 and lower vegf values ( figure 2 ) .", "this finding corresponds well with the results from the univariate analyses and gave a c - index of 0.81 .", "score statistics were used to identify the top predictive clinical markers and determine the added value of a protein marker index over the top clinical predictor . the resulting clinical model identified pap as the top predictor . using this model as a base model , the pcs of the protein measurements were added as predictors and the selection process was repeated .", "after mpap , the 4th pc was the top predictor indicating it contains information orthogonal to the hemodynamic variable .", "the risk associated with the 4th pc was weighted by higher values of mcp1 and il-6 and lower il-10 values . to evaluate the added predictive value of the protein measurements in addition to mpap , roc curves , corresponding c - indices , and nri measures were utilized ( figure 3 ) .", "the inclusion of these two proteins increased the c - index from 0.81 to 0.90 .", "significant improvement was seen with the addition of the protein measurements ( nri p value = 0.01 ) indicating that their inclusion enhanced the models ability to correctly classify patients .", "this result was verified with a resampling approach used to estimate the models predictive ability when applied to an independent set of observations .", "the estimated c - indices for the model with mpap alone , and with mpap and the protein measurements , were 0.69 and 0.82 , respectively ." ], [ "our data ( table 1 ) indicate a surprisingly high morbidity and mortality , even in children with mild pulmonary hypertension , and they underscore the fact that this is a very high - risk group .", "this observation stimulated our efforts to develop a practical and noninvasive approach to the management of pediatric pulmonary hypertension that can be used in a routine setting .", "of interest and clinical relevance is the fact that we have shown that by simply adding the quantification of a set of plasma proteins , it is possible to markedly improve our ability to predict outcomes in children with ph .", "specifically , the addition of a protein index , weighted mostly by il-6 , il-10 , and mcp-1 concentrations , significantly increased the probabilities for those patients with an adverse event compared to hemodynamic measurements alone .", "when investigating the plasma proteins univariately , vegf and il-6 were associated with occurrence of an adverse event and egf and il-6 were correlated with mean pap and pvri .", "in addition , we identified a combination of all twelve proteins which associated well with adverse events and had similar predictive ability compared to the top hemodynamic predictor . ", "interest in the role of cytokines and growth factors in the development of ph has grown .", "recent evidence is consistent with the view that circulating factors and inflammatory cells contribute to remodeling in chronic ph [ 11 , 24 , 25 ] .", "circulating and lung levels of the proinflammatory cytokine il-6 are increased in patients with idiopathic ph and ph associated with inflammatory diseases [ 1215 ] .", "il-6 may also be a mediator of disease in ph because overexpression of il-6 in a mouse model exacerbated ph by both proproliferative and antiapoptotic mechanisms .", "for example , il-6 treated mice are prone to develop hypoxia - induced pulmonary hypertension which may be mediated in part by an inflammatory process . in our study", ", we found that increased levels of circulating il-6 were significantly associated with an increased risk of an adverse event but when considered multivariately with pap , ci , and vegf , it was replaced with an anti - inflammatory cytokine , il-10 .", "recently there has also been increased interest in the role of vegf in pulmonary arterial hypertension .", "vegf is responsible for angiogenesis and vasculogenesis , and animal models indicate that when vegf signaling is impaired , this contributes to the pathogenesis of ph [ 28 , 29 ] .", "alternatively , growth factors may be important for the maintenance of continued lung growth in patients with pulmonary arterial hypertension , and a favorable phenotype may be associated with increased vegf and egf .", "farkas et al . found a similar inverse relationship between vegf and pap in rats and lassus et al . ", "the search for biomarkers that are useful in the management of pediatric ph is in its infancy , but the ideal marker would be obtained noninvasively , easily measured , and would offer high sensitivity and specificity . currently , the brain natriuretic peptide system and neurohumoral markers have been evaluated in children with ph [ 3234 ] . ", "our study demonstrates that quantification of a panel of cytokines and growth factors has potential applications in clinical trial design by identifying patients at risk for an adverse event .", "in addition , patients at higher risk for an adverse event may need to be treated more aggressively with continuous intravenous therapy or listed for lung transplantation ." ], [ "this study adds to the growing body of literature indicating that inflammation is important in pediatric ph and that circulating ( blood ) biomarkers can be important tools in prediction and prognostic evaluation of pediatric patients with ph .", "the potential for growth factors , egf and vegf , to aid in the management of ph is important and novel .", "serial sampling and assessment of longitudinal changes might provide important additional insights , but these findings indicate that even a single point in time determination can predict the future clinical course .", "we intentionally examined a heterogeneous group of patients in this study in order to explore patterns of biomarker expression .", "it is clear that the next step is to validate these findings in a larger scale study including several groups of well - characterized subjects .", "we suggest that , based on our findings , additional evaluation of cytokines and growth factors is warranted because there is growing evidence that these determinations may be relevant for disease management ." ] ]

[ [ "t1d is a chronic autoimmune disease where cd4 + and cd8 + t cells recognizing islet autoantigens are likely the mediators of selective destruction of pancreatic islet beta cells .", "although direct demonstration of the prominent role of t cells in the disease progression is provided only in animal models , the preclinical period of the disease in humans is marked by the presence of circulating islet - related autoantibodies to beta cell antigens including insulin , glutamic acid decarboxylase ( gad ) , isoforms gad65 and gad67 , the insulinoma - associated antigen ( ia2)/tyrosine phosphatase - like molecule , ia-2 or phogrin , and proinsulin . from the 1990s", "onwards several laboratories produced an increasing number of reports regarding the detection of t cells directed against these antigens in the peripheral blood . ", "the first attempts employed [ h]thymidine incorporation / proliferation assays setup with pbmc of t1d patients ( at onset or long - standing ) and their high - risk ", "subsequently , elispot assays were implemented for measuring cell - mediated immune ( cmi ) responses in t1d [ 35 ] and immunoblot assays .", "costimulatory anti - cd28 antibodies were shown to enhance autoreactive t cell responses to gad65 peptides in t1d patients , while , in a previous set of experiments , the expansion of the gad65 ( whole molecule ) reactive t cells was costimulation dependent in healthy controls , as opposed to t1d patients . nevertheless , t cell results were largely inconclusive because autoantigen - specific t cells in an in vitro expansion could indeed be grown both from patients and controls , as evidenced by 4 international workshops of the immunology diabetes society and by multicenter - blinded control trials , organized under the auspices of the immune tolerance network ", "several explanations were put forward for justifying these difficulties including their low precursor frequency , the inhability to identify them from the vast excess of t cells , and their low to moderate affinity to self - antigens .", "cytotoxicity assays , set in vitro , offered proofs that t lymphocytes are potentially able to kill target cells also in vivo . to this end", "hla - a*0201 restricted cd8 + cytotoxic t lymphocytes , specific for a gad65 decapeptide ( 114123 ) , were first detected in pbmc of recent onset t1d patients and in high - risk ( ica+ ) individuals by using the classical [ cr ] release cytotoxicity assay . in more recent investigations elispot assays revealed ifn- production when pbmc from t1d patients were challenged with proinsulin peptides ( 3039 ; 3442 ; 4150 ) and the amyloid polypeptide precursor protein ( ppiapp513 ) peptides .", "the nonapeptides ppiapp917 , igrp152160 , and igrp215223 from the islet - specific glucose-6-phosphatase catalytic subunit related protein and nonapeptides 172180 and 482490 from the islet autoantigen ia-2 that would bind to and stabilize the hla - a2 molecules were also identified .", "mhc tetramer technology was initially introduced to target antigen - specific cd4 + t cells in patients with viral , bacterial infections , tumors . in reference to human autoimmunity class ii tetramers", "successfully detected gad65 , proinsulin , ia-2 , and preproinsulin reactive cd4 + t cells in pbmc of t1d patients , low percentages of cd4 + t cells autoreactive to gad65 , the melanocyte differentiation antigen tyrosinase and the testis tumor antigen ny - eso-1 ( epitope 120131 ) in pbmc of healthy individuals , and cd4 + gluten - specific t cells in pbmc of celiac disease patients . ", "the hla class i tetramer technology successfully detected circulating cd8 + t lymphocytes autoreactive to the melan a autoantigen in patients with vitiligo , the pbc - e2 autoantigen in patients with primary biliary cirrhosis ( pbc ) , vimentin in patients who were heart transplanted , and insulin beta chain nonapeptide ( insb10 - 18 ) . in a recent investigation hla - a*0201 gad65 ( 114122 ) pentamers detected an increased percentage of autoreactive t cells in the cd45ro+ subset in t1d patients as compared with controls . in long - standing t1d patients who , after islet transplantation , have a loss of islet allograft and recurrent autoimmunity a high frequency of gad65-specific t cell clones was found within the expanded autoreactive memory t cell compartment . in the light of all the aforegoing , we attempted in this preliminary study to device a more sensitive methodology than those currently available for measuring cmi responses and , in particular , gad65 autoreactive t cells in t1d .", "preliminary data indicate that it is possible to implement an assay that still will require appropriate standardization before being used in large scale screening programs . in our protocol , after stimulation of the cells with the gad65 114 - 122 epitope , we successfully detected a percentage of cd8 + gad autoreactive t cells in a sample population including 15 t1d patients ( 9 newly diagnosed and 6 long - standing ) by using hla class i tetramers ." ], [ "9 hla - a*0201 positive pediatric patients ( 4 males and 5 females , age of onset range 9.2 years to 16.4 years , mean 12.8 years ) were recruited from lazio region at the onset of t1d at the unit of pediatric endocrine autoimmune diseases at the children 's hospital bambino ges , rome ( table 1 ) .", "we also included 6 long - term hla - a*0201 positive pediatric t1d patients ( between 8 months to 4 years and 5 months after diagnosis ) .", "the control population was recruited at the blood transfusion center of our hospital including 10 hla - a*0201 positive nondiabetic healthy blood donors . ", "they had no history of autoimmunity and no islet - related autoantibodies were detected in their serum . after obtaining informed consent from parents of childrens and normal controls ,", "pbmc were separated by ficoll - hypaque ( histopaque , sigma - aldrich chemical c , st louis , mo , usa ) from 510 ml sodium - heparinized venous blood samples , washed twice in pbs , and then frozen down in liquid nitrogen .", "hla - a2 typing was initially performed by flow cytometry analysis and subsequently confirmed by standard allele - specific pcr . in the initial screening , 1 10 cells were incubated , for 30 minutes in ice , with an anti - hla - a2 mouse mab ( 1 : 10 dilution , one lambda , inc , canoga park , ca , usa ) .", "after washing by centrifugation at 1500 rpm for 5 minutes at room temperature ( rt ) in wash buffer [ 0,1% sodium azide , 2% fetal bovine serum ( fbs , hyclone , south logan , ut , usa ) in pbs ] , cells were resuspended in the residual volume ( approximately 50 l )", ". 1 l of fluorescent- ( fitc- ) conjugated goat anti - mouse igg ( fc fragment specific antibody ) ( jackson immunoresearch laboratories inc , west grove , pa , usa ) was added .", "cells were then incubated in ice for 30 minutes in the dark , washed in wash buffer , and acquired for the analysis in a becton & dickinson facscalibur flow cytometer equipped with the cell quest software program .", "hla - a2 subtyping was carried out using a molecular system ( genovision inc . ,", "west chester , pa , usa ) ; high - resolution dna - based hla typing of polymorphic class i loci hla - a , -b , and -c was also carried out according to a reverse line blot system . at the time of tetramer assay , cells were thawed and resuspended , at a density of 1 10/ml , in rpmi-1640 ( gibco / brl , invitrogen , gaithersburg , ca , usa ) , supplemented with 2 ", "mmol / l l - glutamine , 100 g / ml penicillin / streptomycin , and 10% v / v fbs ; cells were then cultured in the presence of the gad65 peptide aa 114122 ( vmnillqyv ) at a concentration of 30 g / ml , for 4 days in 24-well round - bottomed plates ( falcon , labware bd biosciences , oxnard , ca , usa ) ( 1 10 cells / well ) . ", "the gad65 nonapeptide had been selected for its high affinity binding to hla a*0201 in an hla peptide motif search database ( http://www-bimas.cit.nih.gov/molbio/hla_bind ) . ", "in parallel experiments control cell cultures were set up by incubating pbmc from the same individual with il-2 ( 25 iu / ml , sigma ) for 4 days , in place of the gad65 peptide , in order to ensure that pbmc would live for the entire culture period prior to the flow cytometry analysis ( vide infra ) . at the end of the 4 days ,", "pbmc , either stimulated with the gad65 peptide or incubated with il-2 , were washed in calcium - magnesium free dulbecco 's phosphate - buffered saline 1x ( euroclone , wethersby , west york , uk ) , by centrifugation at 1500 rpm for 5 minutes at rt . ", "this washing was introduced to remove the excess of gad65 peptide and il-2 from the culture , so to maximally reduce the risk of nonspecific binding , when pbmc will subsequently be stained with labeled tetramers .", "the two sets of pbmc were cultured for additional two days with il-2 ( 25 iu / ml ) in the same medium ( rpmi-1640 , 2 mmol / l l - glutamine , 100 g / ml penicillin / streptomycin , 10% v / v fbs ) .", "phycoerythrin ( pe ) labeled tetramers were generated , using either the gad65 peptide ( vmnillqyv ) or the flu peptide ( gilgfvftl ) , known to have a high - affinity binding with hla - a*0201 ( purchased from proimmune limited , oxford , uk ) . on day 6 ,", "approximately 5 10 cells , stimulated with the gad65 peptide or cultured with il-2 , were allocated for staining conditions .", "cells were washed by centrifugation at 1500 rpm for 5 minutes at rt in wash buffer ( 0.1% sodium azide , 2% fbs in pbs ) and resuspended in the residual volume ( approximately 50 l ) . 1 l of phycoerithrin ( pe ) labeled gad65 peptide ( vmnillqyv ) tetramer was added to each cell preparation and incubated in ice for 30 minutes in the dark , then washed in wash buffer .", "1 l of mab anti - human cd8 ( fitc labelled ( becton & dickinson , pharmingen , san diego , ca , usa ) ) and 5 l of mab anti - human cd3 [ allophycocyanin ( apc ) labelled ( becton & dickinson ) ] were added for further staining the different cell preparations . in alternative for cd8 staining ,", "1 l of biotinylated mab anti - human cd8 ( 1 : 10 , becton dickinson ) was used followed by streptavidin cychrome ( cys5 ) conjugate ( 1 : 10 , southern biotechnology , birmingham , al , usa ) . ", "cells were incubated in ice for at least 30 minutes in the dark , washed twice in wash buffer , and then immediately acquired for the analysis in a beckton & dickinson facscalibur flow cytometer and cellquest software program . in order to verify the sensitivity of the hla - a*0201 tetramer assay , the flu nonapeptide ( gilgfvftl ) was used to stimulate pbmc of one hla - a*0201 normal individual .", "this test was performed in order to verify that we could obtain an increased sensitivity of the flu tetramer staining after flu peptide stimulation .", "the staining with the flu tetramer was carried out either by direct assay ex vivo or after stimulation of the same pbmc first with the flu peptide ( 3.5 g / ml ) for 4 days followed , after washing the cells , by an incubation with il-2 for 2 days .", "a positive control of stimulation was introduced in all the experiments in order to prove that in vitro stimulation worked in all subjects , including those from whom no gad specific t cells were detected . ", "the presence of flu tetramer positive cells was assessed in randomly selected samples by staining after flu peptide stimulation . in order to verify the specificity of the reactivity of the gad65 hla a*0201 tetramer in the detection of gad65 nonapeptide reactive t cells and as control of nonspecific", "binding , pbmc of randomly selected t1d patients and controls were cultured separately with the gad65 nonapeptide , the flu nonapeptide , and il-2 .", "the flu and gad65 nonapeptides were used at the same concentration ( 1030 g / ml ) . after 4 days , pbmc , cultured in the 3 different conditions , were washed and subsequently incubated with il-2 alone for an additional 2 days .", "cells were then recovered , washed , and stained with the gad65 nonapeptide hla a*0201 tetramers and analyzed by flow cytometry .", "differences in the percentages of cd3+/cd8+/gad65 reactive t cells between normal controls and t1d patients in each ( il-2 and gad65 peptide ) stimulated pbmc populations were assessed by mann - whitney - u test . ", "variations in the response of pbmc , either treated with il-2 or stimulated with the gad65 peptide within each group ( i.e. , controls versus t1d patients ) , were evaluated by wilcoxon 's test . " ], [ "it is well known that hla class i molecules bind peptides 810 aminoacids long , but preferentially nonapeptides [ 35 , 36 ] . after database search for nonamers of the gad65 protein sequence ( p48320 , ncbi database ) , we selected peptide gad65 114 - 122 , on the basis of its high score of affinity binding ( 1080.239 ) to hla - a*0201 .", "direct staining ex vivo with hla a*0201 flu peptide tetramers of pbmc of a normal hla a*0201 positive individual detected 0.03% of cd3+/cd8+/flu reactive t cells . ", "the percentage increased to 0.23% , when pbmc of the same individual were first stimulated for 4 days with the same flu peptide ( data not shown ) .", "normal controlsin pbmc of normal individuals no significant variations were found in the percentage of cd3/cd8/gad65 reactive t cells between pbmc cultured with either il-2 or the gad65 peptide ( mann - withney test versus pbmc il-2 treated p = .05 , figure 1 ) . in pbmc of normal individuals", "no significant variations were found in the percentage of cd3/cd8/gad65 reactive t cells between pbmc cultured with either il-2 or the gad65 peptide ( mann - withney test versus pbmc il-2 treated p = .05 , figure 1 ) .", "td patientsin pbmc of t1d patients the percentage of cd3+/cd8+/gad65 reactive t cells were significantly more pronounced in comparison to those registered with pbmc of controls after stimulation with the same gad65 peptide ( p = .001 t1d versus controls , figures 1 and 2 ) . \n", "figure 2 shows pbmc of a representative t1d patient treated with il-2 ( panel ( a ) , ( b ) , ( c ) ) and with gad65 peptide ( panel ( d ) , ( e ) , ( f ) ) . the analysis was conducted only in r1 region ( living cells as evidenced by morphological parameters ) and in the r2 region ( cd3+/cd8 + cells ) . ", "the population of cd3+/cd8+/gad65 reactive cells was shown in panel ( f ) ( 4.04% of total cell population).il-2 treatment affected differentially the detection of cd3+/cd8+/gad65 reactive t cells in t1d patients versus control ( p = .07 t1d patients versus controls ) ( figure 1 ) . in pbmc of t1d patients the percentage of cd3+/cd8+/gad65 reactive t cells were significantly more pronounced in comparison to those registered with pbmc of controls after stimulation with the same gad65 peptide ( p = .001 t1d versus controls , figures 1 and 2 ) . \n", "figure 2 shows pbmc of a representative t1d patient treated with il-2 ( panel ( a ) , ( b ) , ( c ) ) and with gad65 peptide ( panel ( d ) , ( e ) , ( f ) ) . ", "the analysis was conducted only in r1 region ( living cells as evidenced by morphological parameters ) and in the r2 region ( cd3+/cd8 + cells ) . ", "the population of cd3+/cd8+/gad65 reactive cells was shown in panel ( f ) ( 4.04% of total cell population ) .", "il-2 treatment affected differentially the detection of cd3+/cd8+/gad65 reactive t cells in t1d patients versus control ( p = .07 t1d patients versus controls ) ( figure 1 ) .", "specificity of the gad65 peptide responsethe percentage of cd3+/cd8+/gad65 reactive t cells estimated in pbmc of single patients after gad65 peptide stimulation was higher than after flu peptide stimulation or when cultured with il-2 alone ( data not shown ) . ", "with pbmc of the normal controls , the percentage of cd3/cd8/gad65 reactive t cells was comparable in the 3 stimulation conditions . in principle , we assume that the specific reactivity could be detectable in each single sample only after gad65 peptide stimulation . ", "this test is an alternative to control the nonspecific binding of tetramer to t cells with the use of an irrelevant peptide .", "the percentage of cd3+/cd8+/gad65 reactive t cells estimated in pbmc of single patients after gad65 peptide stimulation was higher than after flu peptide stimulation or when cultured with il-2 alone ( data not shown ) . ", "with pbmc of the normal controls , the percentage of cd3/cd8/gad65 reactive t cells was comparable in the 3 stimulation conditions . in principle , we assume that the specific reactivity could be detectable in each single sample only after gad65 peptide stimulation . ", "this test is an alternative to control the nonspecific binding of tetramer to t cells with the use of an irrelevant peptide ." ], [ "tetramers containing autoantigenic peptides have clinical utility in autoimmunity for diagnostic and , potentially , therapeutic applications [ 1929 ] . ", "previous studies [ 19 , 20 ] clearly demonstrated that mhc class ii tetramers can efficiently detect gad65 reactive cd4 + t cells in pbmc of t1d patients . ", "gad65-specific hla dr0401-restricted clones could be even derived from a diabetic patient using tetramers as stimulating agent . ", "these encouraging data prompted us to trace gad65 autoreactive t cells in t1d ; in the present investigation hla - a*0201 tetramers were therefore constructed with a ", "natural peptide ( gad65 ( aa114122 ) , half - time disassociation 1080,239 ) .", "this peptide has been used in previous class i tetramer investigations [ 28 , 29 ] and now employed to establish a more sensitive assay .", "we could have chosen the gad65 decamer ( aa114123 ) but the peptide ranked low in the affinity binding scale ( half time disassociation , 35.012 ) . ", "in addition , the terminal valine in position 122 seems to be relevant for the antigenic presentation of the motif , as the very low - affinity binding of the nonapeptide 115123 to hla a*0201 ( half time disassociation , 0.316 ) demonstrates .", "peptides for assembling tetramers employed in previous investigations in order to increase their affinity binding to the tetramer .", "the first is by direct ex vivo staining with labeled peptide / tetramer complexes ; in the second method pbmc are preincubated and stimulated with the peptide and then stained with the labeled peptide / tetramer or pentamer complexes [ 2529 ] .", "we have chosen the second approach , because we believe that preincubation with the peptide might induce a limited specific t cell expansion in vitro and , therefore , may increase the chance to awake autoreactive cd8 + t cells .", "novel steps in the experimental procedure were designed as follows : ( 1 ) a reduced period of antigen - specific cell expansion ( 4 days rather than 21 days , 28 days , 10 days , time course selected in other hla class i tetramer assays ) ; ( 2 ) an intermediate washing step after cells were stimulated with the gad65 nonapeptide ; ( 3 ) a 2-day incubation with il-2 in the absence of the gad65 nonapeptide ; and ( 4 ) a final washing step , before staining the cells with the labeled tetramers .", "in addition , we relied only on the autologous apcs , present in the pool of the pbmc , not prepulsed with the nonapeptide , as it was done in previous assays , and we set up parallel pbmc cultures either with il-2 alone , an internal cell culture control . ", "the short period of peptide stimulation has the advantage that cultures are terminated before clonal expansion and/or in vitro ", "we need also to underline that the possibility of testing frozen / defrosted pbmc is of paramount importance when planning large retrospective epidemiological investigations . by applying these novel experimental conditions , the recovery of cd3+/cd8+/gad65 reactive t cells in t1d patients ranged from 0.5% to 15.6% after gad65 peptide stimulation of pbmc . to our knowledge , this is the highest percentage of autoreactive cd8 t cells ever captured by hla class i tetramers in pbmc of patients with a human autoimmune disease ( 0,1% to 1% in vitiligo 4,2% in heart transplantation ; up to 0.4% of cd8 + cd45ro+ t cells in newly diagnosed t1d patients ; between 2.6% and 8.3% within the ki-67+cd8 + cell fraction ( 1.65% + /0.25% of the total cd8 + lymphocytes ) in islet transplanted t1d patients ) ." ], [ "this can be achieved by testing pbmc of a large number of t1d patients , normal controls , and especially prediabetic high - risk individuals .", "a valid statistical evaluation of results will help to establish an appropriate cutoff value of positivity in the assay ." ] ]

[ [ "transcription factors are a class of proteins that regulate gene expression by binding to specific dna sequences within the regulatory regions of genes ( 1 ) . due to their important role in the regulation of gene expression ,", "transcription factors are vital for cell development , differentiation and growth in biological systems ( 24 ) .", "typically , transcription factors exist in the cell in an inactive state and become activated by the presence of a specific ligand , leading to the expression of target gene(s ) . as a result , the inhibition or undesired activation of transcription factors can lead to a number of diseases which include developmental disorders ( 58 ) , abnormal hormone responses ( 911 ) , inflammation ( 12,13 ) and cancer ( 1416 ) .", "therefore , the rapid and convenient detection of transcription factor activity is important for the development of inhibitors for the treatment or prevention of these diseases .", "current methods for the detection of transcription factor activity include dna footprinting , western blotting , the gel mobility shift assay , affinity chromatography and visual microscopy ( 1719 ) . however , the aforementioned methods are generally tedious , laborious and expensive for the routine detection of transcription factor activity in the laboratory ( 20 ) .", "fluorescence methodologies are an attractive alternative to the traditional methods of transcription factor activity detection due to their simplicity , low cost , high sensitivity and most importantly , amenability to high - throughput screening ( 21 ) .", "current fluorescence - based methods for the detection of transcription factors require labeled oligonucleotides containing the sequence recognized by the appropriate transcription factor ( 2225 ) .", "the basic principle behind this molecular beacon approach for the detection of transcription factors involves monitoring the conformational change of the oligonucleotide upon binding by a transcription factor .", "this conformational change leads to the fluorophore and the quencher being brought closer together or further apart , leading to a switch - off or switch - on fluorescence effect , respectively . in 2000 ,", "tan and co - workers ( 22 ) described a switch - on probe for the escherichia coli single - stranded binding protein using a classical stem loop , doubly labeled with dabcyl and tamra at the 3- and 5-terminus . in 2002 , heyduk and heyduk ( 23 ) developed a switch - off detection platform that utilized two independently labeled dna fragments each containing one - half of the transcription factor binding site .", "recently , mirkin and co - workers ( 25 ) described a fluorescence recovery assay for the detection of protein dna binding , utilizing a doubly labeled short dna duplex and an exonuclease .", "while these fluorescence approaches to the detection of transcription factor activity are more convenient compared to the traditional methods , they are still limited by the high cost of the labeled oligonucleotides .", "luminescent transition metal complexes have received increasing attention in photochemistry , organic optoelectronics and luminescent sensors ( 2633 ) .", "we previously developed oligonucleotide - based , label - free detection methods for nanomolar quantities of hg and ag ions by employing luminescent platinum(ii ) metallointercalators ( 34,35 ) , as well as for assaying exonuclease activity by using crystal violet as a g - quadruplex probe ( 36 ) .", "consequently , we were interested in developing a label - free alternative to the molecular beacon approach through modification of the fluorescence recovery assay developed by mirkin and coworkers by utilizing unmodified oligonucleotides and a luminescent transition metal complex as a dna probe .", "luminescent transition metal complexes typically contain a metal center bound to by organic ligands arranged in a precise 3d arrangement .", "the 3d nature of transition metal complexes allows selective interactions with biomolecules ( 36 ) .", "in addition , the photophysical ( i.e. emission wavelength ) , physical ( i.e. solubility and stability ) and selectivity ( duplex dna versus single - stranded dna ) of these complexes can be modulated through ligand modifications .", "examples of luminescent metallointercalators used for the detection of dna include ruthenium ( 3741 ) , osmium ( 4244 ) , iridium ( 4547 ) and platinum complexes ( 4851 ) that bear planar aromatic ligands suitable for intercalation .", "we chose the classical molecular light switch complex [ ru(phen)2(dppz ) ] ( phen = 1,10-phenanthroline ; dppz ", "= dihydro[3,2-a:2,3-c]phenazine ) as a probe due to its avid dna binding affinity ( > 10 m ) .", "in addition , this complex possesses a strong luminescence response when bound to duplex dna but is only weakly emissive when free in aqueous solution or in the presence of single - stranded dna .", "the complex [ ru(phen)2(dppz ) ] has also been employed for the detection of aptamer / protein binding using unlabeled oligonucleotides ( 52 ) . based on our past experience in the design of label - free oligonucleotide - based luminescent assays for metal ions ( 34,35 ) ,", "we were interested to see if we could develop a label - free detection method for the p50 subunit of the transcription factor nf-b .", "the transcription factor nf-b has been identified as an important regulator for key pro - inflammatory mediators such as tnf- , which is involved in the immune response , apoptosis and cell cycle regulation ( 53 ) .", "the deregulation of tnf- has been linked with inflammatory and autoimmune diseases such as rheumatoid arthritis and osteoarthritis ( 54 ) .", "the ability to screen a large library of compounds against an important protein target such as nf-b using aluminescence assay amenable to high - throughput screening would be invaluable in developing new treatments and diagnostic tools for inflammation and autoimmune diseases ." ], [ "all reagents were purchased and used as received unless otherwise stated . the p50 protein was expressed and purified based on a modified procedure from leung et al . ( 55 ) .", "the cells were grown at 37c in a shaking incubator until the absorbance of the culture at 600 nm was 0.6 .", "expression of the p50 protein from the t7 promoter was induced for 5 h at 30c by the addition of 0.1 mm isopropyl-1-thio--d - galactopyranoside ( final concentration ) .", "the cells were then harvested in lysis buffer ( 25 mm tris , ph 7.4 , 150 mm nacl , 1 mm edta , -mercaptoethanol , phenylmethylsulfonyl fluoride ) and lysed by sonication .", "the cell debris was pelleted by ultracentrifugation ( 27 500 rpm , 4c and 40 min ) .", "the supernatant was diluted with binding buffer ( 25 mm , tris ph 7.4 , 500 mm nacl and 20 mm imidazole ) and loaded onto a his - bind quick columns ( novagen , madison , wi , usa ) and washed with washing buffer ( 25 mm tris ph 7.4 , 500 mm nacl and 40 mm imidazole ) , then eluted with elution buffer ( 25 mm tris ph 7.4 , 500 mm nacl and 200 mm imidazole ) .", "the fractions containing the p50 protein were combined and dialyzed against 10 mm tris buffer solution ( ph 7.9 , 10% glycerol , 1 mm edta , 50 mm nacl and -mercaptoethanol ) . the purity of the expressed p50 proteins were estimated to be > 90% pure using electrophoresis on sds ", "( hp ) containing one nf-b binding site : \n 5-agttgaggggactttcccaggccagaaggagcctgggaaagtcccctcaact-3 5-agttgaggggactttcccaggccagaaggagcctgggaaagtcccctcaact-3 double - strand containing one nf-b binding site : \n 5-agttgaggggactttcccaggc-33-tcaactcccctgaaagggtccg-5 5-agttgaggggactttcccaggc-3 3-tcaactcccctgaaagggtccg-5 double - strand containing two nf-b binding site : \n 5-ttgagggactttccgaacatgcaggcaagctggggactttccagg-33-aactccctgaaaggcttgtacgtccgttcgacccctgaaaggtcc-5 5-ttgagggactttccgaacatgcaggcaagctggggactttccagg-3 3-aactccctgaaaggcttgtacgtccgttcgacccctgaaaggtcc-5 double - strand without nf-b binding site : \n 5-ttgttacaactcactttccgctgctcactttccagggaggcgtgg-33-aacaatgttgagtgaaaggcgacgagtgaaaggtccctccgcacc-5 5-ttgttacaactcactttccgctgctcactttccagggaggcgtgg-3 3-aacaatgttgagtgaaaggcgacgagtgaaaggtccctccgcacc-5 the appropriate oligonucleotide ( 0.02 m ) was first annealed in tris buffer solution ( 10 mm , ph 7.4 , 100 mm nacl , 1 mm edta , final concentration ) by incubating at 95c for 5 min , followed by gradual cooling to room temperature over a period of 1 h. the p50 subunit and the annealed oligonucleotide mixture in tf buffer ( 10 mm tris , ph 7.4 , 50 mm kcl , 1 mm dtt , 1 mm mgcl2 , 10% glycerol ) were incubated for 20 min at 37c , after which 40 units of exoiii ( neb ) were added and the mixture was incubated for an additional 50 min at 37c .", "the digestion reaction was quenched by the addition of 25 mm edta and diluted to 1 ml with a solution of the ruthenium complex ( 1 m , final concentration ) and [ fe(cn)6 ] ( 600 m , final concentration ) in tf buffer ( 10 mm tris , ph 7.4 , 50 mm kcl , 1 mm dtt , 1 mm mgcl2 , 10% glycerol ) . the solution was then allowed to stand for 10 min and the luminescence spectrum was measured using an excitation wavelength of 450 nm ." ], [ "the cells were grown at 37c in a shaking incubator until the absorbance of the culture at 600 nm was 0.6 .", "expression of the p50 protein from the t7 promoter was induced for 5 h at 30c by the addition of 0.1 mm isopropyl-1-thio--d - galactopyranoside ( final concentration ) .", "the cells were then harvested in lysis buffer ( 25 mm tris , ph 7.4 , 150 mm nacl , 1 mm edta , -mercaptoethanol , phenylmethylsulfonyl fluoride ) and lysed by sonication .", "the cell debris was pelleted by ultracentrifugation ( 27 500 rpm , 4c and 40 min ) .", "the supernatant was diluted with binding buffer ( 25 mm , tris ph 7.4 , 500 mm nacl and 20 mm imidazole ) and loaded onto a his - bind quick columns ( novagen , madison , wi , usa ) and washed with washing buffer ( 25 mm tris ph 7.4 , 500 mm nacl and 40 mm imidazole ) , then eluted with elution buffer ( 25 mm tris ph 7.4 , 500 mm nacl and 200 mm imidazole ) .", "the fractions containing the p50 protein were combined and dialyzed against 10 mm tris buffer solution ( ph 7.9 , 10% glycerol , 1 mm edta , 50 mm nacl and -mercaptoethanol ) . the purity of the expressed p50 proteins were estimated to be > 90% pure using electrophoresis on sds " ], [ "hairpin ( hp ) containing one nf-b binding site : \n 5-agttgaggggactttcccaggccagaaggagcctgggaaagtcccctcaact-3 5-agttgaggggactttcccaggccagaaggagcctgggaaagtcccctcaact-3 double - strand containing one nf-b binding site : \n 5-agttgaggggactttcccaggc-33-tcaactcccctgaaagggtccg-5 5-agttgaggggactttcccaggc-3 3-tcaactcccctgaaagggtccg-5 double - strand containing two nf-b binding site : \n 5-ttgagggactttccgaacatgcaggcaagctggggactttccagg-33-aactccctgaaaggcttgtacgtccgttcgacccctgaaaggtcc-5 5-ttgagggactttccgaacatgcaggcaagctggggactttccagg-3 3-aactccctgaaaggcttgtacgtccgttcgacccctgaaaggtcc-5 double - strand without nf-b binding site : \n 5-ttgttacaactcactttccgctgctcactttccagggaggcgtgg-33-aacaatgttgagtgaaaggcgacgagtgaaaggtccctccgcacc-5 5-ttgttacaactcactttccgctgctcactttccagggaggcgtgg-3 3-aacaatgttgagtgaaaggcgacgagtgaaaggtccctccgcacc-5" ], [ "the appropriate oligonucleotide ( 0.02 m ) was first annealed in tris buffer solution ( 10 mm , ph 7.4 , 100 mm nacl , 1 mm edta , final concentration ) by incubating at 95c for 5 min , followed by gradual cooling to room temperature over a period of 1 h. the p50 subunit and the annealed oligonucleotide mixture in tf buffer ( 10 mm tris , ph 7.4 , 50 mm kcl , 1 mm dtt , 1 mm mgcl2 , 10% glycerol ) were incubated for 20 min at 37c , after which 40 units of exoiii ( neb ) were added and the mixture was incubated for an additional 50 min at 37c .", "the digestion reaction was quenched by the addition of 25 mm edta and diluted to 1 ml with a solution of the ruthenium complex ( 1 m , final concentration ) and [ fe(cn)6 ] ( 600 m , final concentration ) in tf buffer ( 10 mm tris , ph 7.4 , 50 mm kcl , 1 mm dtt , 1 mm mgcl2 , 10% glycerol ) . the solution was then allowed to stand for 10 min and the luminescence spectrum was measured using an excitation wavelength of 450 nm ." ], [ "the principle behind our assay for the detection of transcription factor activity is based on the 35 activity of exoiii and a luminescent transition metal complex which is switched - on in the presence of double - stranded dna ( scheme 1 ) . in the presence of double - stranded dna , the ruthenium complex [ ru(phen)2(dppz ) ] ( scheme 1 ) intercalates into the double - stranded dna and is emissive , presumably through suppression of non - radiative decay by solvent interactions .", "a 35 exoiii is added to the reaction mixture and digests the double - stranded oligonucleotide from the 3-end , leading to the formation of single - stranded fragments .", "due to the weak binding affinity of the ruthenium complex to single - stranded dna , the luminescence response of the complex is reduced ( scheme 1a ) . in the presence of a transcription factor that binds to the double - stranded substrate with the cognate binding site ,", "the digestion of the oligonucleotide is blocked , allowing the oligonucleotide to retain its double - stranded structure in the presence of exoiii ( scheme 1b ) .", "the intercalation of the ruthenium complex into the double - stranded dna substrate leads to a strong luminescence response . \n", "scheme 1.the principle of the label - free detection of transcription factor activity using a combination of a luminescent ruthenium - based metallointercalator [ ru(phen)2(dppz ) ] and 35 exoiii .", "the principle of the label - free detection of transcription factor activity using a combination of a luminescent ruthenium - based metallointercalator [ ru(phen)2(dppz ) ] and 35 exoiii . to validate our label - free detection assay for transcription factors", ", we designed a hairpin oligonucleotide that contained the nf-b binding site [ -gggactttc- ] ( 56 ) .", "the hairpin substrate was incubated at 95c for 5 min , followed by gradual cooling to room temperature to ensure the formation of the double - stranded structure .", "the luminescence response of the ruthenium complex in the presence of the hairpin substrate was enhanced by 4.6-fold due to intercalation of the ruthenium complex into the dna ( figure 1 ) .", "the addition of exoiii leads to the digestion of the oligonucleotide , converting the hairpin structure into short single - stranded dna fragments . due to the weak binding of the ruthenium complex with the single - stranded dna , emission intensity", "potassium ferrocyanide k3[fe(cn)6 ] was used to quench the background emission of the ruthenium complex in aqueous solution or when bound to single - stranded dna .", "a ferrocyanide concentration of 600 m was found to give the highest degree of discrimination between double - stranded and single - stranded dna . \n", "figure 1.the luminescence response of [ ru ] ( 1 m ) in tf buffer solution containing k3[fe(cn)6 ] ( 600 m ) in the presence of ( a ) the hairpin dna ( 0.02 m ) ; and ( b ) the hairpin dna ( 0.02 m ) and exoiii ( 40 u ) . the luminescence response of [ ru ] ( 1 m ) in tf buffer solution containing k3[fe(cn)6 ] ( 600 m ) in the presence of ( a ) the hairpin dna ( 0.02 m ) ; and ( b ) the hairpin dna ( 0.02 m ) and exoiii ( 40 u ) . after confirming the activity of the exonuclease , we next investigated the effect of adding the transcription factor .", "when the hairpin substrate was incubated with the nf-b subunit p50 before the addition of exoiii , a luminescence enhancement of 3.6 was observed relative to the control ( no transcription factor added ) ( figure 2 ) . presumably , the p50 subunit bound the hairpin substrate and inhibited the digestion of the oligonucleotide , allowing the ruthenium metallointercalator to bind to the intact double - stranded dna . \n", "figure 2.the fold change luminescence response of [ ru ] ( 1 m ) in tf buffer solution containing k3[fe(cn)6 ] ( 600 m ) in the presence of the digestion mixture containing the hairpin dna substrate ( 0.02 m ) and 40 u of exoiii as a function of the concentration of the p50 subunit ( 0 , 0.06 , 0.20 and 0.40 m ) . the fold change luminescence response of [ ru ] ( 1 m ) in tf buffer solution containing k3[fe(cn)6 ] ( 600 m ) in the presence of the digestion mixture containing the hairpin dna substrate ( 0.02 m ) and 40 u of exoiii as a function of the concentration of the p50 subunit ( 0 , 0.06 , 0.20 and 0.40 m ) .", "it has been previously shown that the structure of the oligonucleotide substrate can influence the digestion rate of exoiii ( 57 ) . to examine the effect of a double - stranded dna substrate on the performance of this label - free assay", ", we annealed a duplex dna sequence containing the nf-b binding site . in the absence of the p50 subunit , a weak luminescence response", "as the concentration of the p50 subunit was increased , there was a corresponding enhancement in the luminescence response of the ruthenium complex , with saturation occurring at about 160 nm ( figure 3 ) . a maximum fold change of 4.5 was observed . \n", "figure 3.the fold change luminescence response of [ ru ] ( 1 m ) in tf buffer solution containing k3[fe(cn)6 ] ( 600 m ) in the presence of the digestion mixture containing the double - stranded dna substrate ( 0.02 m ) and 40 u of exoiii as a function of the concentration of the p50 subunit ( 0 , 0.04 , 0.08 , 0.12 , 0.16 , 0.20 m ) . the fold change luminescence response of [ ru ] ( 1 m ) in tf buffer solution containing k3[fe(cn)6 ] ( 600 m ) in the presence of the digestion mixture containing the double - stranded dna substrate ( 0.02 m ) and 40 u of exoiii as a function of the concentration of the p50 subunit ( 0 , 0.04 , 0.08 , 0.12 , 0.16 , 0.20 m ) .", "we next investigated the effect of introducing two binding sites on the double - stranded oligonucleotide substrate .", "the luminescence spectrum of the ruthenium complex in the presence of the double - stranded substrate containing two binding sites after digestion is shown in figure 4 .", "when this oligonucleotide was incubated in the presence of the p50 subunit and subjected to exo iii digestion , a maximal 8-fold increase in the luminescence response was observed , compared to only 4.5-fold for the oligonucleotide containing one binding site .", "we postulate that in the case of the double - stranded substrate containing one binding site , complete digestion by exo iii from the 3 would be expected to generate long 5-overhangs with limited duplex regions ( figure 5a ) .", "thus , even though digestion was inhibited relative to the control , the luminescence response of the ruthenium complex would still be reduced . however , when two p50 subunit binding sites are present , the complete digestion of the double - stranded substrate from the two 3-termini does not occur ( figure 5b ) , preserving the duplex structure of the substrate and allowing the intercalation of the ruthenium complex . using the double - stranded substrate with two p50 subunit binding sites , we observed a linear luminescence response ( up to 8-fold intensity enhancement ) to changes in the concentration of the p50 subunit in the concentration range of 30220 nm with a detection limit of 30 nm . \n", "figure 4.the fold change luminescence response of [ ru ] ( 1 m ) in tf buffer solution containing k3[fe(cn)6 ] ( 600 m ) in the presence of the digestion mixture containing the double - stranded dna substrate with two nf-b binding sites ( 0.02 m ) and 40 u of exoiii as a function of the concentration of the p50 subunit ( 0 , 0.03 , 0.05 , 0.06 , 0.11 , 0.18 , 0.20 , 0.22 , 0.28 , 0.30 and 0.38 m ) . \n", "figure 5.a schematic representation of the digestion products for oligonucleotides containing one ( a ) and two ( b ) nf-b subunit binding sites .", "the fold change luminescence response of [ ru ] ( 1 m ) in tf buffer solution containing k3[fe(cn)6 ] ( 600 m ) in the presence of the digestion mixture containing the double - stranded dna substrate with two nf-b binding sites ( 0.02 m ) and 40 u of exoiii as a function of the concentration of the p50 subunit ( 0 , 0.03 , 0.05 , 0.06 , 0.11 , 0.18 , 0.20 , 0.22 , 0.28 , 0.30 and 0.38 m ) . a schematic representation of the digestion products for oligonucleotides containing one ( a ) and two ( b ) nf-b subunit binding sites . in the original report by heyduk and heyduk ( 23 )", ", the molecular beacon approach could effectively sense down to 10 nm of catabolite activator protein , a bacterial transcription factor . the fluorescence recovery assay developed by mirkin and co - workers ( 25 ) gave a 32% decrease in the fluorescence intensity upon addition of 130 nm of estrogen receptor-. thus ,", "the sensitivity of our assay for transcription factor activity is at least comparable to that of previously reported methods .", "furthermore , a significant advantage of the method presented here is its label - free nature , which obviates the requirement for the expensive labeling of oligonucleotides , contrasting favorably with previous methods .", "reducing the cost of the assay is important for potential adaptation into a high - throughput format .", "finally , both literature methods were switch - off with respect to transcription factors , which may suffer from false positives due to non - specific quenching by environmental samples .", "the switch - on detection mode reported here is advantageous and is generally preferable for analytical purposes .", "this label - free assay is based on the inhibition of exoiii catalyzed digestion of the oligonucleotide by the binding of the p50 subunit . to validate the mechanism of this method", ", we replaced the p50 subunit with the non - dna binding protein bovine serum albumin ( bsa ) .", "the luminescence response of the ruthenium complex in the presence of the oligonucleotide containing the double p50 binding site and bsa after exoiii digestion is shown in figure 6 . \n", "figure 6.the fold change luminescence response of [ ru ] ( 1 m ) in tf buffer solution containing k3[fe(cn)6 ] ( 600 m ) in the presence of the digestion mixture containing the double - stranded dna substrate with two nf-b binding sites ( 0.02 m ) and 40 u of exoiii as a function of the concentration of bsa ( 0 , 0.08 , 0.20 and 0.40 m ) . the fold change luminescence response of [ ru ] ( 1 m ) in tf buffer solution containing k3[fe(cn)6 ] ( 600 m ) in the presence of the digestion mixture containing the double - stranded dna substrate with two nf-b binding sites ( 0.02 m ) and 40 u of exoiii as a function of the concentration of bsa ( 0 , 0.08 , 0.20 and 0.40 m ) .", "the emission spectrum in figure 6 shows that incubation of the oligonucleotide substrate with bsa did not produce the same emission enhancement ( fold change of 1.1 ) as observed for the p50 subunit . to further provide evidence", "that the inhibition of exoiii digestion was due to the selective binding of the p50 subunit , we replaced the oligonucleotide substrate with a dna sequence that can not bind to the p50 subunit .", "the non - nf-b - binding substrate was incubated in the presence of the p50 subunit and the luminescence spectrum of the ruthenium complex in the presence of the digestion mixture was measured ( figure 7 ) . in the presence of 0.4 m p50 subunit ,", "a fold change of 2.4 was observed , which was significantly lower than the 8-fold enhancement observed with the wild - type sequence . \n", "figure 7.the fold change luminescence response of [ ru ] ( 1 m ) in tf buffer solution containing k3[fe(cn)6 ] ( 600 m ) in the presence of the digestion mixture containing double - stranded non - nf-b - binding substrate ( 0.02 m ) and 40 u of exoiii as a function of the concentration of the p50 subunit ( 0 , 0.10 , 0.20 and 0.40 m ) . the fold change luminescence response of [ ru ] ( 1 m ) in tf buffer solution containing k3[fe(cn)6 ] ( 600 m ) in the presence of the digestion mixture containing double - stranded non - nf-b - binding substrate ( 0.02 m ) and 40 u of exoiii as a function of the concentration of the p50 subunit ( 0 , 0.10 , 0.20 and 0.40 m ) . to provide additional evidence that the selective binding of the p50 subunit is responsible for the inhibition of exoiii catalyzed digestion of the double - stranded substrate , we repeated the luminescence measurements in the presence of oridonin , a known inhibitor of nf-b dna binding activity ( 58 ) . in the presence of the nf-b inhibitor ( figure 8 , orange ) , a significant reduction in the luminescence response of the ruthenium complex", "was observed compared to the sample that does not contain the inhibitor ( figure 8 , purple ) .", "oridonin is presumed to inhibit binding of p50 to the double - stranded substrate and exoiii is able to digest the dna into short single - stranded fragments resulting in a reduced luminescence response .", "taken together , these series of negative control experiments demonstrate that the luminescence enhancement observed in the presence of the p50 subunit is probably due to the binding of the transcription factor to the oligonucleotide , inhibiting the exoiii catalyzed digestion of the double - stranded substrate . \n", "figure 8.the luminescence response of [ ru ] ( 1 m ) in tf buffer solution containing k3[fe(cn)6 ] ( 600 m ) in the presence of the digestion mixture with the double - stranded dna substrate ( 0.02 m ) containing two nf-b binding sites incubated with p50 ( 0.12 m ) with or without oridonin ( 20 m ) . the luminescence response of [ ru ] ( 1 m ) in tf buffer solution containing k3[fe(cn)6 ] ( 600 m ) in the presence of the digestion mixture with the double - stranded dna substrate ( 0.02 m ) containing two nf-b binding sites incubated with p50 ( 0.12 m ) with or without oridonin ( 20 m )", ". the above results also highlight the amenability of this assay to the high - throughput screening of small molecules as inhibitors of the p50 subunit of nf-b .", "nf-b is found in the cytoplasm bound to the inhibitory protein ib ( 59 ) . in the presence of activators , such as ultraviolet irradiation , cytokines , bacterial and viral products", "the overactivation of nf-b has been associated number of autoimmune and inflammatory diseases and it is thus considered an important drug target ( 53,54 ) . the label - free assay described herein can be readily applied to a high - throughput format using 96-well plates .", "wells showing a reduction in luminescence intensity of the ruthenium complex contain a potential inhibitor of the p50 subunit .", "due to the low cost of the label - free oligonucleotides and the ruthenium metallointercalator , large chemical libraries can be screened in an inexpensive and high - throughput manner , allowing the identification of small molecule nf-b inhibitors for treating autoimmune and inflammatory diseases ." ], [ "in conclusion , we have described the first label - free luminescence detection method for transcription factor activity .", "our method is based on the principle that the binding of the transcription factor prevents the exoiii catalyzed digestion of a double - stranded substrate .", "a luminescent ruthenium metallointercalator is used to probe the double - stranded substrate leading to a switch - on effect in the presence of the transcription factor .", "the luminescence enhancement was shown to be proportional to the concentration of the transcription factor nf-b subunit p50 .", "this method allows the detection of transcription factor activity without the need for time - consuming experiments such as gel mobility shift assays or dna footprinting .", "we have also demonstrated that in the presence of a known nf-b inhibitor oridonin , the luminescence response of the ruthenium complex was decreased .", "therefore , this assay can be used to identify modulators that can activate or inhibit transcription factor dna binding , for the diagnosis and treatment of diseases linked with irregular transcription factor activity .", "furthermore , this technique is readily amenable to high - throughput screening , allowing rapid and economical identification of the target compounds .", "we anticipate that this assay can be adapted to selectively detect any transcription factor simply by changing the binding site sequences . due to the modular synthesis of the transition metal complexes", ", we envisage that there is considerable scope to adjust the selectivity of the complexes toward particular dna structures which would further improve this assay for transcription factor detection ." ], [ "funding for open access charge : the hong kong baptist university ( frg2/09 - 10/070 ) ." ] ]

[ [ "although considered the gold standard for evaluating treatment effectiveness , randomized clinical trials ( rcts ) have important limitations .", "because randomization removes potential bias from unknown and unmeasured confounders , observed differences in measured outcomes can be reasonably attributed to the treatment alone.1 for valid experimental reasons , however , rcts frequently restrict enrollment based on existing comorbidities , treatment history , and disease severity , among other criteria . as a result", ", outcomes observed in rcts can not necessarily be generalized to the real world of clinical practice , where patients present with varying degrees of disease severity and a range of comorbidity profiles . while there has been a call for increasing the number of pragmatic clinical trials , trials that examine outcomes among diverse populations of patients in typical practice settings are still rare.2 retrospective , observational studies are valuable because they contribute pragmatic knowledge about treatment risk , effectiveness , and cost in clinical practice settings knowledge that is critical to health care decision makers .", "in addition , observational studies are less costly and more quickly accomplished than rcts , and can utilize large databases , permitting analysis of infrequent events . because observational studies do nt involve randomization of patients to treatment groups , however", ", selection bias can occur , and unmeasured variables can confound the associations between treatments and outcomes .", "multivariable regression ( mr ) methods are commonly used to control for confounding factors in observational studies .", "it can be done at the individual level , as in case control matching , or at the group or frequency level , as in stratified random sampling .", "the matching process involves diagnostic checks regarding the balance of covariates across groups and provides information about the quality of the inferences that can be drawn from the subsequent analysis.3 propensity score matching ( psm ) has been increasingly used in epidemiologic studies of medical treatment effectiveness.1 a propensity score represents the propensity of a particular subject to receive a particular treatment , based on the subject s pre - treatment characteristics.1,4,5 the score combines many covariates into a single variable and enables individuals from each treatment group with similar covariate values to be matched , as a quasi - randomization method.3 subjects who can not be matched are excluded from the analysis .", "an advantage of psm is that matched sets with comparable covariate distributions can be created without the need for exact matches of each variable , which is problematic when there are more than a few covariates.3 propensity matching works best if there is a fairly large overlap between the groups in terms of propensity to be given a treatment .", "when there is not , underlying selection bias may exist.3 despite this method s theoretical benefits , in studies where both mr and psm analysis methods have been used , only a small percentage of results ( 10% in one review and 13% in another ) have been markedly different.1,6 disease exacerbations are important events in the course of copd .", "moderate and severe exacerbations adversely affect lung function , potentially accelerating disease progression.7,8 frequency of exacerbations is a significant factor in deteriorating health.9,10 exacerbations also contribute substantially to health care utilization and costs . in the united states in 2010 ,", "direct medical costs were estimated to be $ 29.5 billion , including $ 13.2 billion for copd - related hospital care.11 reducing exacerbations is thus a singularly important goal of copd management , both to improve patient quality of life and to reduce the indirect and direct medical costs of the disease .", "as pharmacotherapy is a primary means for reducing exacerbations , data concerning real world treatment effectiveness is of interest to health care providers , health care organizations , and health plans .", "agents for the relief and prevention of symptoms in copd include short- and long - acting beta - agonists ( including albuterol and salmeterol ) , short - and long - acting anticholinergics ( including ipratropium bromide [ ipr ] , tiotropium [ tio ] ) , and inhaled corticosteroids ( ics).12 fluticasone propionate 250 g / salmeterol 50 g combination therapy ( fsc ) is an ics plus long - acting beta - agonist used for treatment of airflow obstruction and reduction of exacerbations .", "previously , we reported cost and utilization outcomes following initiation of copd maintenance therapy with tio , ipr ( with or without albuterol ) , or fsc , using mr as the analysis method.13 to our knowledge , this was the first observational study to directly compare these three maintenance therapies . compared to tio and ipr , fsc was associated with lower copd - related costs and utilization ( hospitalizations , emergency department [ ed ] visits , and outpatient visits associated with an antibiotic or oral corticosteroid prescription ) .", "the objective of the present study was to perform a parallel analysis employing psm to investigate the equivalency of results with those obtained in the prior mr analysis ." ], [ "using psm methods , we conducted a parallel analysis of copd - related health care utilization and costs in patients with copd receiving initial maintenance therapy ( imt ) with fsc , tio , or ipr , and we compared the results to those of a previous mr analysis .", "the term imt refers to the patient s first instance of a pharmacy claim for a copd maintenance medication ; prior to this point , the patient s records indicated that he / she had not received maintenance therapy , only reliever medications or no medication .", "we assessed exacerbations using claims data to measure health care utilization events related to exacerbations .", "there is no universally accepted definition of exacerbation . in clinical research , exacerbations generally are defined in terms of worsening symptoms , unscheduled medical attention , and courses of antibiotics and/or oral corticosteroids . 14 in observational studies such as ours ,", "in which clinical and laboratory data are absent , exacerbations typically have been defined in terms of copd - related health care utilization events , including hospitalizations , ed visits , physician visits , and outpatient pharmacy fills for oral corticosteroids / antibiotics .", "administrative data were obtained from the ims lifelink health plan claims database ( ims health , watertown , wa ) , which contains enrollment and demographic data , and health care and outpatient pharmacy claims from more than 40 million members of more than 70 us health plans .", "calculated costs were based on allowed amounts , which most closely resemble the direct health care cost burden of illness .", "this is typically the amount the health plan pays , plus any member liability ( eg , co - payment , deductible , or coinsurance amount ) . for claims with missing charges due to capitation arrangements ,", "the dataset included patient demographic and enrollment data , outpatient pharmacy claims , and medical services claims ( outpatient , ed , and inpatient claims , including both facility claims and professional services claims ) for january , 2004 to june , 2009 .", "the specific content of the dataset has been described previously.13 in the prior retrospective , observational cohort study , copd - related clinical and economic outcomes were evaluated in patients who received one of three imt medications for copd ( fsc , tio , or ipr).13 the study perspective was that of the health plan provider organization , and only direct costs were considered .", "the study population included health plan members with diagnosed copd who were new to maintenance therapy with fsc 250 g/50 g , tio , or ipr ( alone or in fixed dose combination with albuterol ) .", "the members were age 40 years and older , had a primary or secondary diagnosis of copd ( at least one ed visit , one hospitalization , or two outpatient visits with a primary or secondary international classification of disease , 9th edition , clinical modification [ icd-9-cm ] diagnosis code of 491.xx , 492.xx , or 496.xx ) , had an imt pharmacy claim between july 1 , 2004 and june 30 , 2008 ( the date of the first identified prescription claim was the index date ) , had at least 6 months of continuous health plan enrollment prior to the index date ( the baseline period ) , and at least 12 months of continuous enrollment following the index date ( the follow - up period ) .", "patients were excluded if they had a prescription drug fill for a copd maintenance medication ( fsc , ipr , tio , budesonide / formoterol , inhaled corticosteroid alone , or long - acting beta - agonist alone ) during the baseline period , or a pharmacy fill for an alternate study imt medication ( fsc , tio , or ipr ) within 60 days of the index date .", "patients were excluded if they had a primary or secondary diagnosis of respiratory tract cancer ( larynx , trachea , or pleura [ icd-9-cm codes of 161 , 161.x , 162 , 163 , 163.x , 231 , 231.x ] ) during the baseline period .", "the patient eligibility criteria and selection process have been described in detail previously.13 the primary utilization outcomes were incidence and mean number of copd - related outpatient visits , outpatient visits associated with an antibiotic prescription fill , outpatient visits associated with an oral corticosteroid fill , hospitalizations , ed visits , and hospitalization and/or ed visits ( combined endpoint ) .", "encounters with a primary diagnosis code of 491.xx , 492.xx , or 496 were defined as copd - related .", "the primary cost outcomes were mean copd - related medical services costs , outpatient pharmacy costs ( copd controller and relief medications , oral corticosteroids , and antibiotics ) , and total costs ( the sum of the two ) .", "medical services costs comprised inpatient , outpatient , and ed care ( including facility charges and professional service fees ) .", "costs were inflated to 2009 dollars on a monthly basis using the medical care portion of the us consumer price index.15 as outcomes were evaluated over a 12-month follow - up period , no discounting was applied to events or costs .", "bivariate analyses were used to compare differences between treatment cohorts in health care utilization and cost outcomes for the 12-month follow - up period .", "multivariable logistic regression was used to model the risk for any health care utilization event as an odds ratio ( or ) .", "negative binomial and poisson regression were used to calculate incidence rate ratios ( irrs ) . because of the right - skewed nature of the cost distribution , a generalized linear model using a gamma distribution was used to estimate differences in treatment costs .", "estimates of mean differences and 95% confidence intervals ( cis ) were calculated from the predicted cost values .", "the multivariable models controlled for age , sex , treatment , comorbidities ( including asthma and heart disease ) , and copd - related health care utilization at baseline . starting with the original patient sample identified for the mr analysis , we created matched cohorts for the psm analysis .", "the tio patients and ipr patients were separately matched to fsc patients based on propensity score ; that is , patients initiating therapy with tio were matched to patients initiating with fsc , and patients initiating therapy with ipr were matched to patients initiating with fsc .", "the matched samples were created based on each patient s predicted probability ( propensity ) of assignment to the case treatment ( tio or ipr ) .", "the propensity to be a patient whose initial maintenance therapy was tio ( or alternatively , ipr ) incorporated the following baseline factors in the logistic regression equation : sex , age category , geographic region , comorbidities , copd - related health care utilization , non - copd - related health care utilization , copd medication use , and copd - related medical services costs .", "the utilization factors were hospitalization count and binary variables for outpatient visit , outpatient visit associated with an oral corticosteroid fill , outpatient visit associated with an antibiotic fill , ed visit , and hospitalization and/or ed visit ( combined endpoint ) .", "medication use was included using binary variables for short - acting beta - agonist ( sabas ) , oral corticosteroid , oral antibiotic , leukotriene modifier , and methylxanthine .", "the greedy match algorithm was used , which performs matching using as much information as possible through the ", "nearest available pair ( or nearest - neighbor ) matching method with a caliper component.1618 once a match is made , the greedy algorithm does not reconsider the match . because no available matches could be identified for some patients in the original cohorts , the patient sample for the psm analysis was a smaller subset of the sample used in the mr analysis .", "bivariate analyses were used to compare differences in outcomes in the 12-month period following initiation of maintenance therapy for the fsc - tio and fsc - ipr matched cohorts .", "logistic regression was used to model the risk for any health care utilization event ( or ) , and negative binomial and poisson regression were used to calculate irrs .", "mean cost differences and 95% cis were assessed using least squares estimates from generalized linear models using a gamma distribution . since the psm treatment groups were already matched for baseline characteristics , and our interest was only in the treatment effect , the psm regression models contained only a factor for case imt ( tio or ipr ) , with fsc used as the reference medication .", "for both the mr and psm analyses , statistical tests were two - sided , with an -level of 0.05 for statistical significance .", "demographic , clinical , and health care utilization characteristics were assessed as counts and percentages for categorical variables , and as standard measures ( mean and sd ) for continuous variables . both unpaired and paired t - tests", "the chi - square test and mcnemar s test were used to test paired proportion differences because significance tests that do not consider the non - independence of matched data have been found to be more conservative than tests for paired comparisons.19,20 adequacy of matching was assessed using p values for comparison tests and standardized percentage differences.4,21 all analyses were conducted using sas software ( v 9.2 for windows ; sas institute , cary , nc ) ." ], [ "administrative data were obtained from the ims lifelink health plan claims database ( ims health , watertown , wa ) , which contains enrollment and demographic data , and health care and outpatient pharmacy claims from more than 40 million members of more than 70 us health plans .", "calculated costs were based on allowed amounts , which most closely resemble the direct health care cost burden of illness .", "this is typically the amount the health plan pays , plus any member liability ( eg , co - payment , deductible , or coinsurance amount ) . for claims with missing charges due to capitation arrangements ,", "the dataset included patient demographic and enrollment data , outpatient pharmacy claims , and medical services claims ( outpatient , ed , and inpatient claims , including both facility claims and professional services claims ) for january , 2004 to june , 2009 ." ], [ "in the prior retrospective , observational cohort study , copd - related clinical and economic outcomes were evaluated in patients who received one of three imt medications for copd ( fsc , tio , or ipr).13 the study perspective was that of the health plan provider organization , and only direct costs were considered .", "the study population included health plan members with diagnosed copd who were new to maintenance therapy with fsc 250 g/50 g , tio , or ipr ( alone or in fixed dose combination with albuterol ) .", "the members were age 40 years and older , had a primary or secondary diagnosis of copd ( at least one ed visit , one hospitalization , or two outpatient visits with a primary or secondary international classification of disease , 9th edition , clinical modification [ icd-9-cm ] diagnosis code of 491.xx , 492.xx , or 496.xx ) , had an imt pharmacy claim between july 1 , 2004 and june 30 , 2008 ( the date of the first identified prescription claim was the index date ) , had at least 6 months of continuous health plan enrollment prior to the index date ( the baseline period ) , and at least 12 months of continuous enrollment following the index date ( the follow - up period ) .", "patients were excluded if they had a prescription drug fill for a copd maintenance medication ( fsc , ipr , tio , budesonide / formoterol , inhaled corticosteroid alone , or long - acting beta - agonist alone ) during the baseline period , or a pharmacy fill for an alternate study imt medication ( fsc , tio , or ipr ) within 60 days of the index date .", "patients were excluded if they had a primary or secondary diagnosis of respiratory tract cancer ( larynx , trachea , or pleura [ icd-9-cm codes of 161 , 161.x , 162 , 163 , 163.x , 231 , 231.x ] ) during the baseline period .", "the patient eligibility criteria and selection process have been described in detail previously.13 the primary utilization outcomes were incidence and mean number of copd - related outpatient visits , outpatient visits associated with an antibiotic prescription fill , outpatient visits associated with an oral corticosteroid fill , hospitalizations , ed visits , and hospitalization and/or ed visits ( combined endpoint ) .", "encounters with a primary diagnosis code of 491.xx , 492.xx , or 496 were defined as copd - related .", "the primary cost outcomes were mean copd - related medical services costs , outpatient pharmacy costs ( copd controller and relief medications , oral corticosteroids , and antibiotics ) , and total costs ( the sum of the two ) .", "medical services costs comprised inpatient , outpatient , and ed care ( including facility charges and professional service fees ) .", "costs were inflated to 2009 dollars on a monthly basis using the medical care portion of the us consumer price index.15 as outcomes were evaluated over a 12-month follow - up period , no discounting was applied to events or costs .", "bivariate analyses were used to compare differences between treatment cohorts in health care utilization and cost outcomes for the 12-month follow - up period .", "multivariable logistic regression was used to model the risk for any health care utilization event as an odds ratio ( or ) .", "negative binomial and poisson regression were used to calculate incidence rate ratios ( irrs ) .", "because of the right - skewed nature of the cost distribution , a generalized linear model using a gamma distribution was used to estimate differences in treatment costs .", "estimates of mean differences and 95% confidence intervals ( cis ) were calculated from the predicted cost values .", "the multivariable models controlled for age , sex , treatment , comorbidities ( including asthma and heart disease ) , and copd - related health care utilization at baseline ." ], [ "starting with the original patient sample identified for the mr analysis , we created matched cohorts for the psm analysis .", "the tio patients and ipr patients were separately matched to fsc patients based on propensity score ; that is , patients initiating therapy with tio were matched to patients initiating with fsc , and patients initiating therapy with ipr were matched to patients initiating with fsc .", "the matched samples were created based on each patient s predicted probability ( propensity ) of assignment to the case treatment ( tio or ipr ) .", "the propensity to be a patient whose initial maintenance therapy was tio ( or alternatively , ipr ) incorporated the following baseline factors in the logistic regression equation : sex , age category , geographic region , comorbidities , copd - related health care utilization , non - copd - related health care utilization , copd medication use , and copd - related medical services costs .", "the utilization factors were hospitalization count and binary variables for outpatient visit , outpatient visit associated with an oral corticosteroid fill , outpatient visit associated with an antibiotic fill , ed visit , and hospitalization and/or ed visit ( combined endpoint ) .", "medication use was included using binary variables for short - acting beta - agonist ( sabas ) , oral corticosteroid , oral antibiotic , leukotriene modifier , and methylxanthine .", "the greedy match algorithm was used , which performs matching using as much information as possible through the ", "nearest available pair ( or nearest - neighbor ) matching method with a caliper component.1618 once a match is made , the greedy algorithm does not reconsider the match . because no available matches could be identified for some patients in the original cohorts , the patient sample for the psm analysis was a smaller subset of the sample used in the mr analysis .", "bivariate analyses were used to compare differences in outcomes in the 12-month period following initiation of maintenance therapy for the fsc - tio and fsc - ipr matched cohorts .", "logistic regression was used to model the risk for any health care utilization event ( or ) , and negative binomial and poisson regression were used to calculate irrs .", "mean cost differences and 95% cis were assessed using least squares estimates from generalized linear models using a gamma distribution .", "since the psm treatment groups were already matched for baseline characteristics , and our interest was only in the treatment effect , the psm regression models contained only a factor for case imt ( tio or ipr ) , with fsc used as the reference medication .", "for both the mr and psm analyses , statistical tests were two - sided , with an -level of 0.05 for statistical significance .", "demographic , clinical , and health care utilization characteristics were assessed as counts and percentages for categorical variables , and as standard measures ( mean and sd ) for continuous variables .", "both unpaired and paired t - tests were used for determining significant differences in mean measures .", "the chi - square test and mcnemar s test were used to test paired proportion differences because significance tests that do not consider the non - independence of matched data have been found to be more conservative than tests for paired comparisons.19,20 adequacy of matching was assessed using p values for comparison tests and standardized percentage differences.4,21 all analyses were conducted using sas software ( v 9.2 for windows ; sas institute , cary , nc ) ." ], [ "a total of 32,338 patients met patient selection criteria in the mr analysis : 12,595 fsc patients , 9126 tio patients , and 10,617 ipr patients . for the psm analysis , 89.1% ( 8135 ) of the tio patients", "were matched to fsc patients ( 64.6% of the original fsc cohort ) and 80.2% ( 8514 ) of the ipr patients were matched to similar fsc patients ( 67.6% of the original fsc cohort ) .", "there was a large degree of overlap in the populations and good balance was achieved between the matched groups .", "baseline demographic , clinical , and utilization characteristics of the cohorts after matching on propensity score are shown in table 1 ( tio - fsc ) and table 2 ( ipr - fsc ) , along with p values for unpaired significance tests .", "paired significance tests showed similar results although the p values were almost always lower ( data not shown ) . after matching ,", "the tio and fsc groups were well balanced with respect to baseline characteristics ; the groups were different only in mean copd - related outpatient visits ( p < 0.001 ) . matching between the ipr and fsc patients", "involved more factors . after matching , differences were present for some baseline characteristics : mean copd - related outpatient visits ( p = 0.02 ) , mean all - cause outpatient visits ( p < 0.001 ) , and mean days supply of sabas ( p = 0.007 ) .", "figures 2 and 3 show absolute standardized difference percentages for baseline characteristics prior to and after matching .", "these graphs further illustrate that , while some significant differences remained after matching , they were small from a clinical standpoint .", "absolute standardized percentage differences were less than 10% for all assessed baseline characteristics in both groups , supporting an assessment of balance between groups.22 we compared differences in baseline characteristics between excluded patients and matched patients ( figures 2 and 3 ) .", "characteristics with large differences between excluded and matched patients tended to be the same characteristics as those associated with large standardized differences prior to matching .", "the excluded tio and ipr patients were older , and had more comorbidities and higher health care utilization .", "the excluded tio patients , when compared to fsc patients who were not matched to tio patients , were older ( mean , 66.9 vs 60.1 years , p < 0.001 ) and more likely to be male ( 68.7% vs 39.8% , p < 0.001 ) , not to have asthma ( 4.4% vs 46.8% , p < 0.001 ) , to have lower use of leukotriene modifiers ( 2.4% vs 12.6% , p < 0.001 ) , and sabas ( 15.4% vs 32.9% , p < 0.001 ) , and to have significantly higher copd - related medical service costs ( us$3734 vs $ 365 , p < 0.001 ) . similarly , excluded ipr patients , when compared to fsc patients not matched to ipr patients , were older ( 68.6 vs 60.4 years , p < 0.001 ) and more likely to be male ( 58.4% vs 37.0% , p < 0.001 ) , not to have asthma ( 6.6% vs 45.3% , p < 0.001 ) , to have lower use of leukotriene modifiers ( 1.5% vs 14.6% , p < 0.001 ) and sabas ( 6.2% vs 45.1% , p < 0.001 ) , and to have significantly higher copd - related medical service costs ( $ 5437 vs $ 220 , p < 0.001 ) .", "utilization and cost outcomes in the 12 months following initiation of maintenance therapy are shown in table 3 and figure 4 , respectively . for the utilization comparisons ,", "as described above , some subjects in the original mr cohorts were excluded from the psm cohorts during the matching process .", "those excluded were predominantly older ( and costlier ) tio and ipr patients , and younger fsc patients .", "this resulted in changes in the frequencies and means for outcomes in all treatment groups in the psm analysis .", "for example , in the mr analysis , 3.6% of fsc patients , 4.7% of tio patients , and 7.3% of ipr patients had one or more ed visit ( p < 0.001 for all differences between tio and fsc and between ipr and fsc).19 in the tio - fsc psm analysis ,", "3.4% of fsc patients and 4.5% of tio patients had one or more ed visit . in the ipr - fsc psm analysis , 3.8% of fsc patients and", "6.6% of ipr patients had one or more ed visit ( p < 0.001 for both comparisons ) .", "thus , in both analysis methods , the incidence of ed visits was lower in the fsc group , and differences between treatment groups were similar in magnitude .", "the excluded fsc patients had almost no impact on mean cost estimates for patients treated with fsc .", "however , for patients treated with tio and ipr , the exclusion of older and sicker patients resulted in lower cost estimates for copd - related medical services and total copd - related costs ( figure 4 ) .", "several significant differences between the tio and fsc groups seen in the mr analysis were also seen in the psm analysis .", "the fsc group had a lower percentage of patients with an outpatient visit , outpatient visit associated with an oral corticosteroid , ed visit , or hospitalization / ed visit .", "in contrast to the mr analysis , the psm analysis found no difference in the percentage of patients with a hospitalization ( p = 0.25 ) or outpatient visit associated with an oral corticosteroid ( p = 0.08 ) .", "for each outcome measure , the percentage of patients with an encounter was lower in the fsc cohort than in the tio and ipr cohorts , although , in the psm analysis , because of the excluded younger fsc and older tio patients , the fsc percentages increased slightly and the tio percentages decreased slightly , diminishing the absolute differences between the two groups . with the exception of pharmacy costs , differences in costs that were significant in the mr analysis were also significant in the psm analyses .", "fsc was associated with lower medical services costs ( fsc , us$1085 [ 95% ci : $ 10611108 ] ; tio , us$1316 [ 95% ci : $ 12881345 ] ) , and total health care costs compared to tio ( fsc , $ 2037 [ 95% ci : $ 19932081 ] ; tio , us$2267 [ 95% ci : $ 22182316 ] ) .", "the original mr analysis found that , in each of the five categories of utilization events , a lower percentage of fsc patients compared to ipr patients experienced events .", "these findings were essentially duplicated in the psm analysis , despite the exclusion of 20% of the ipr patients .", "( p values for all differences were < 0.001 in the mr analysis , and ranged from < 0.001 to 0.03 in the psm analysis ) .", "differences in copd - related costs that were significant in the mr analysis were also significant in the psm analysis .", "fsc was associated with higher pharmacy costs ( fsc , $ 917 [ 95% ci : $ 897936 ] ; ipr , us$614 [ 95% ci : $ 601627 ] ) , but lower medical service costs ( fsc , $ 1122 [ 95% ci : $ 10991146 ] ; ipr , us$1746 [ 95% ci : $ 17091784 ] ) , and total costs compared to ipr ( fsc , us$2039 [ 95% ci : $ 19962083 ] ; ipr , us$2360 [ 95% ci : $ 23112411 ] ) .", "the mr and psm analyses produced fairly similar ors for various categories of health care utilization , with ors produced by the psm analysis being slightly lower .", "for example , in the mr analysis , the statistically significant hospitalization / ed visit ors for tio and ipr ( with respect to fsc ) are 1.28 and 1.72 , respectively ; these values are 1.21 and 1.67 in the psm analysis , respectively .", "nonetheless , both analyses show that tio and ipr patients have higher ors , compared to fsc patients , for outpatient visit , outpatient visit with oral corticosteroid , ed visit , and hospitalization / ed visit .", "the ipr and fsc comparison also showed higher ors for hospitalization and for an outpatient visit with an antibiotic .", "however , while the mr analysis calculated slightly higher odds for hospitalization for tio ( or : 1.19 [ 95% ci : 1.041.37 ] ) compared to fsc , the psm analysis found no difference ( or : 1.10 [ 95% ci : 0.941.28 ] ) , nor was any difference in risk found between tio and fsc for an outpatient visit with an antibiotic ( or : 1.14 [ 95% ci : 0.981.32 ] ) .", "the irrs for health care utilization events in the tio and ipr groups with reference to the fsc group are shown in figure 5 .", "again , both analytic methods yielded fairly similar irrs , with the psm analysis producing slightly lower irrs for all categories of utilization . in all comparisons in the psm analysis , as in the mr analysis , ipr patients were found to be at significantly higher risk for events , compared to fsc patients .", "for the tio group compared to the fsc group , all irrs in the mr analysis were significantly higher .", "however , in the psm analysis , irrs for outpatient visits with oral corticosteroid and for hospitalizations were no longer significant ." ], [ "baseline demographic , clinical , and utilization characteristics of the cohorts after matching on propensity score are shown in table 1 ( tio - fsc ) and table 2 ( ipr - fsc ) , along with p values for unpaired significance tests . paired", "significance tests showed similar results although the p values were almost always lower ( data not shown ) . after matching ,", "the tio and fsc groups were well balanced with respect to baseline characteristics ; the groups were different only in mean copd - related outpatient visits ( p < 0.001 ) .", "matching between the ipr and fsc patients involved more factors . after matching , differences were present for some baseline characteristics : mean copd - related outpatient visits ( p = 0.02 ) , mean all - cause outpatient visits ( p < 0.001 ) , and mean days supply of sabas ( p = 0.007 ) .", "figures 2 and 3 show absolute standardized difference percentages for baseline characteristics prior to and after matching .", "these graphs further illustrate that , while some significant differences remained after matching , they were small from a clinical standpoint .", "absolute standardized percentage differences were less than 10% for all assessed baseline characteristics in both groups , supporting an assessment of balance between groups.22 we compared differences in baseline characteristics between excluded patients and matched patients ( figures 2 and 3 ) . characteristics with large differences between excluded and matched patients tended to be the same characteristics as those associated with large standardized differences prior to matching .", "the excluded tio and ipr patients were older , and had more comorbidities and higher health care utilization .", "the excluded tio patients , when compared to fsc patients who were not matched to tio patients , were older ( mean , 66.9 vs 60.1 years , p < 0.001 ) and more likely to be male ( 68.7% vs 39.8% , p", "< 0.001 ) , not to have asthma ( 4.4% vs 46.8% , p < 0.001 ) , to have lower use of leukotriene modifiers ( 2.4% vs 12.6% , p < 0.001 ) , and sabas ( 15.4% vs 32.9% , p < 0.001 ) , and to have significantly higher copd - related medical service costs ( us$3734 vs $ 365 , p < 0.001 ) .", "similarly , excluded ipr patients , when compared to fsc patients not matched to ipr patients , were older ( 68.6 vs 60.4 years , p < 0.001 ) and more likely to be male ( 58.4% vs 37.0% , p < 0.001 ) , not to have asthma ( 6.6% vs 45.3% , p < 0.001 ) , to have lower use of leukotriene modifiers ( 1.5% vs 14.6% , p < 0.001 ) and sabas ( 6.2% vs 45.1% , p < 0.001 ) , and to have significantly higher copd - related medical service costs ( $ 5437 vs $ 220 , p < 0.001 ) ." ], [ "utilization and cost outcomes in the 12 months following initiation of maintenance therapy are shown in table 3 and figure 4 , respectively . for the utilization comparisons ,", "as described above , some subjects in the original mr cohorts were excluded from the psm cohorts during the matching process .", "those excluded were predominantly older ( and costlier ) tio and ipr patients , and younger fsc patients .", "this resulted in changes in the frequencies and means for outcomes in all treatment groups in the psm analysis .", "for example , in the mr analysis , 3.6% of fsc patients , 4.7% of tio patients , and 7.3% of ipr patients had one or more ed visit ( p < 0.001 for all differences between tio and fsc and between ipr and fsc).19 in the tio - fsc psm analysis ,", "3.4% of fsc patients and 4.5% of tio patients had one or more ed visit . in the ipr - fsc psm analysis ,", "3.8% of fsc patients and 6.6% of ipr patients had one or more ed visit ( p < 0.001 for both comparisons ) .", "thus , in both analysis methods , the incidence of ed visits was lower in the fsc group , and differences between treatment groups were similar in magnitude .", "the excluded fsc patients had almost no impact on mean cost estimates for patients treated with fsc .", "however , for patients treated with tio and ipr , the exclusion of older and sicker patients resulted in lower cost estimates for copd - related medical services and total copd - related costs ( figure 4 ) .", "several significant differences between the tio and fsc groups seen in the mr analysis were also seen in the psm analysis .", "the fsc group had a lower percentage of patients with an outpatient visit , outpatient visit associated with an oral corticosteroid , ed visit , or hospitalization / ed visit .", "in contrast to the mr analysis , the psm analysis found no difference in the percentage of patients with a hospitalization ( p = 0.25 ) or outpatient visit associated with an oral corticosteroid ( p = 0.08 ) .", "for each outcome measure , the percentage of patients with an encounter was lower in the fsc cohort than in the tio and ipr cohorts , although , in the psm analysis , because of the excluded younger fsc and older tio patients , the fsc percentages increased slightly and the tio percentages decreased slightly , diminishing the absolute differences between the two groups . with the exception of pharmacy costs , differences in costs that were significant in the mr analysis were also significant in the psm analyses .", "fsc was associated with lower medical services costs ( fsc , us$1085 [ 95% ci : $ 10611108 ] ; tio , us$1316 [ 95% ci : $ 12881345 ] ) , and total health care costs compared to tio ( fsc , $ 2037 [ 95% ci : $ 19932081 ] ; tio , us$2267 [ 95% ci : $ 22182316 ] ) .", "the original mr analysis found that , in each of the five categories of utilization events , a lower percentage of fsc patients compared to ipr patients experienced events .", "these findings were essentially duplicated in the psm analysis , despite the exclusion of 20% of the ipr patients .", "( p values for all differences were < 0.001 in the mr analysis , and ranged from < 0.001 to 0.03 in the psm analysis ) .", "differences in copd - related costs that were significant in the mr analysis were also significant in the psm analysis .", "fsc was associated with higher pharmacy costs ( fsc , $ 917 [ 95% ci : $ 897936 ] ; ipr , us$614 [ 95% ci : $ 601627 ] ) , but lower medical service costs ( fsc , $ 1122 [ 95% ci : $ 10991146 ] ; ipr , us$1746 [ 95% ci : $ 17091784 ] ) , and total costs compared to ipr ( fsc , us$2039 [ 95% ci : $ 19962083 ] ; ipr , us$2360 [ 95% ci : $ 23112411 ] ) ." ], [ "several significant differences between the tio and fsc groups seen in the mr analysis were also seen in the psm analysis .", "the fsc group had a lower percentage of patients with an outpatient visit , outpatient visit associated with an oral corticosteroid , ed visit , or hospitalization / ed visit .", "in contrast to the mr analysis , the psm analysis found no difference in the percentage of patients with a hospitalization ( p = 0.25 ) or outpatient visit associated with an oral corticosteroid ( p = 0.08 ) .", "for each outcome measure , the percentage of patients with an encounter was lower in the fsc cohort than in the tio and ipr cohorts , although , in the psm analysis , because of the excluded younger fsc and older tio patients , the fsc percentages increased slightly and the tio percentages decreased slightly , diminishing the absolute differences between the two groups . with the exception of pharmacy costs , differences in costs that were significant in the mr analysis were also significant in the psm analyses .", "fsc was associated with lower medical services costs ( fsc , us$1085 [ 95% ci : $ 10611108 ] ; tio , us$1316 [ 95% ci : $ 12881345 ] ) , and total health care costs compared to tio ( fsc , $ 2037 [ 95% ci : $ 19932081 ] ; tio , us$2267 [ 95% ci : $ 22182316 ] ) ." ], [ "the original mr analysis found that , in each of the five categories of utilization events , a lower percentage of fsc patients compared to ipr patients experienced events .", "these findings were essentially duplicated in the psm analysis , despite the exclusion of 20% of the ipr patients .", "( p values for all differences were < 0.001 in the mr analysis , and ranged from < 0.001 to 0.03 in the psm analysis ) .", "differences in copd - related costs that were significant in the mr analysis were also significant in the psm analysis . fsc was associated with higher pharmacy costs ( fsc , $ 917 [ 95% ci : $ 897936 ] ; ipr , us$614 [ 95% ci : $ 601627 ] ) , but lower medical service costs ( fsc , $ 1122 [ 95% ci : $ 10991146 ] ; ipr , us$1746 [ 95% ci : $ 17091784 ] ) , and total costs compared to ipr ( fsc , us$2039 [ 95% ci : $ 19962083 ] ; ipr , us$2360 [ 95% ci : $ 23112411 ] ) ." ], [ "the mr and psm analyses produced fairly similar ors for various categories of health care utilization , with ors produced by the psm analysis being slightly lower .", "for example , in the mr analysis , the statistically significant hospitalization / ed visit ors for tio and ipr ( with respect to fsc ) are 1.28 and 1.72 , respectively ; these values are 1.21 and 1.67 in the psm analysis , respectively .", "nonetheless , both analyses show that tio and ipr patients have higher ors , compared to fsc patients , for outpatient visit , outpatient visit with oral corticosteroid , ed visit , and hospitalization / ed visit .", "the ipr and fsc comparison also showed higher ors for hospitalization and for an outpatient visit with an antibiotic .", "however , while the mr analysis calculated slightly higher odds for hospitalization for tio ( or : 1.19 [ 95% ci : 1.041.37 ] ) compared to fsc , the psm analysis found no difference ( or : 1.10 [ 95% ci : 0.941.28 ] ) , nor was any difference in risk found between tio and fsc for an outpatient visit with an antibiotic ( or : 1.14 [ 95% ci : 0.981.32 ] ) ." ], [ "the irrs for health care utilization events in the tio and ipr groups with reference to the fsc group are shown in figure 5 .", "again , both analytic methods yielded fairly similar irrs , with the psm analysis producing slightly lower irrs for all categories of utilization . in all comparisons in the psm analysis , as in the mr analysis , ipr patients were found to be at significantly higher risk for events , compared to fsc patients . for the tio group compared to the fsc group ,", "however , in the psm analysis , irrs for outpatient visits with oral corticosteroid and for hospitalizations were no longer significant ." ], [ "in this analysis of data from an observational , retrospective cohort study of initial maintenance therapies for copd , we demonstrated the similarity of results using two analytic approaches to observational research .", "specifically , we compared results from a psm analysis with those from a previously published , parallel mr analysis.13 we found that both methods yielded similar health care utilization and cost outcomes .", "general agreement between mr and psm methods has been found in other studies . in a review of 177 comparative method studies", ", sturmer concluded that substantial changes in treatment effects were seen when point estimates were calculated with and without adjustment for covariates , but that the method of adjustment itself mr or psm made little difference.1 in psm , a high degree of propensity score overlap after matching is desirable in terms of internal validity . when overlap is minimal ,", "unmeasured confounding bias in treatment groups probably can not be resolved using either mr or psm techniques.1 in the present psm analysis , large proportions of patients in both the tio and ipr cohorts ( 89.1% and 80.2% , respectively ) were matched to fsc patients , and there was substantial overlap in propensity scores between groups . in other words , matching produced cohorts with similar baseline characteristics . in general , the few statistically significant differences remaining after matching were minor in terms of effect size and practical significance , and had small absolute standardized differences .", "characteristics that would be expected to considerably skew utilization outcomes , such as comorbid cardiovascular disease , were not different between matched groups .", "some differences may be due to the smaller psm sample size , since the excluded patients were a contributing explanatory factor for the lower psm utilization and cost estimates . while the mr analysis was a population - based study , the psm analysis , as a result of the matching process , excluded some younger individuals , with minimal comorbidities , who were treated with fsc , and some older , sicker individuals who were treated with ipr or tio .", "exclusion of the older and sicker individuals resulted in lower mean costs for ipr and tio patients , while costs for fsc patients were quite similar in both analyses .", "event frequency also may be a factor in the differences in findings between analysis methods .", "multivariable logistic regression and propensity matching have been found to produce similar results when events are not infrequent.2325 through simulations , cepeda and colleagues found that the use of propensity scores yielded less biased estimates than multivariable logistic regression only when there were eight or fewer modeled events per covariate.26 when the ratio of modeled events was higher , multivariable logistic regression was the better method .", "other studies have determined that ten events per covariate is a desired ratio when using maximum likelihood methods.27 the main outcomes in our analyses , ( copd - related outpatient visits associated with an antibiotic or oral corticosteroid , ed visits , and hospitalizations ) , although of great concern clinically , occur relatively infrequently , from a statistical standpoint , when averaged across a large population of copd patients that is unrestricted in terms of disease severity .", "the outcome of outpatient visit with an oral corticosteroid had the smallest number of events per covariate modeled , with 877 of 32,338 patients having at least one event , which translates to 20 events per covariate in the multivariate logistic regression analysis .", "this compares to 65 events per covariate for the combined endpoint of hospitalization / ed visit", ". the lower ratios of events per covariate for some outcomes may have been a factor in the different findings of the two analyses for ors and irrs . on the other hand , costs ( copd - related medical service costs and pharmacy costs )", "were universally incurred , and both analyses found that , compared to fsc , tio and ipr were associated with higher costs for copd - related medical services , and higher total costs , even though costs associated with tio and ipr were reduced in the psm analyses .", "both mr and psm methods adjust associations between treatment effects and outcomes to reduce potential bias from observed covariates .", "other researchers have reported that results from the two methods appear to be consistent when there is large overlap between groups in propensity for a given treatment , which ensures minimal loss of observations , and when outcomes can be modeled with a relatively large number of events per covariate.1,4,24 our findings support this view and suggest that , with regard to less frequent events , in particular when effect sizes may be small , consideration should be given to analyzing outcomes using both methods , assuming a large proportion of subjects can be matched . while psm is a more transparent method , in the sense that it allows one to see the degree of equality between groups after matching , in this study , psm provided little advantage over mr in terms of the validity of the results . because of the inevitable reduction in sample size and change in overall composition of treatment groups being compared , the choice of whether to use psm or mr will depend on the question being investigated , whether a population effect is being measured , and whether review of a non - representative population of patients receiving treatment is acceptable ( or even preferred ) .", "this point is addressed by dagostino , who recommended that when patients are excluded in matched analyses , researchers need to be particularly clear in their descriptions of the included and excluded patients , and of the populations to which study results are applicable.28 strengths of this study include the large sample sizes of both analyses and the high degree of propensity matching , with approximately 80% and 89% of the original ipr and tio cohorts matched , respectively , to fsc patients .", "the exclusion of some original subjects from the psm cohorts due to lack of a match does mean , however , that any additional information these subjects might have provided was lost , and statistical power affected .", "we measured exacerbations using claims data , defining exacerbations as copd - related health care events . using an alternative definition of exacerbation based on symptoms , lung function , or other clinical parameters could influence observed effect sizes.14 however , we would not expect a different definition of exacerbations to influence effect sizes differently for mr than for psm , or for it to change the overall findings of this study .", "since both mr and propensity matched analyses attempt to reduce bias through adjustment using covariates , the ability to do this is dependent on the capture of all relevant factors . in this analysis", "was an observational study utilizing administrative claims data , information about patients clinical status was not available .", "we could not ascertain lung function status , disease severity , or other clinical characteristics .", "however , we did control for two key characteristics of interest disease severity and exacerbation frequency by using prior copd - related health care and pharmacy utilization ( particularly oral corticosteroids / antibiotics ) as proxy measures ." ], [ "results obtained in our analysis suggest that both mr and psm methods are appropriate analytic techniques for addressing and mitigating bias in observational research . in this example of an observational study of maintenance therapy for copd ,", "more than 80% of the original treatment groups used in the mr analysis were matched to a comparison group for the psm analysis .", "while some sample size was lost in the psm analysis , results from both methods were similar in direction and statistical significance .", "further , this analysis underscores the need for researchers to have a good understanding of the populations undergoing treatment and the factors associated with both receipt of treatment and occurrence of the measured outcomes ." ] ]

[ [ "in spite of the relatively high accuracy of endoscopic ultrasound - assisted fine - needle aspiration ( eus - fna ) in diagnosing lymphomas , inadequate sampling by eus - fna often makes it difficult to perform immunohistochemical analysis , thus limiting its application in the classification of lymphoma .", "natural orifice transluminal endoscopic surgery ( notes ) is a surgical technique by which procedures such as exploration , biopsy , organ resection , and anastomosis can be performed using an endoscope passed through a natural orifice [ such as the mouth , stomach , colon ( or rectum ) , vagina , bladder , or esophagus ] and then entered into the abdominal cavity , mediastinum , or thoracic cavity through an internal incision .", "the advantages of notes include reduced trauma , faster recovery , absence of scarring , and painlessness , and such procedures have been regarded as third - generation surgery . here", "we report an eus - assisted retroperitoneal lymph node biopsy performed in a patient who had developed enlarged retroperitoneal lymph nodes with an unknown cause .", "this procedure was carried out on november 10 , 2014 , after obtaining the approval of the ethics committee and informed consent documents signed by the patient ." ], [ "a 60-year - old male patient was admitted to our hospital complaining of epigastric discomfort , which had persisted for 1 month . a computerized tomography ( ct ) scan suggested the presence of multiple soft - tissue density masses in the patient 's abdominal cavity , the largest of which was 7.7 cm 7.2 cm [ figure 1a and b ] .", "positron emission tomography - ct ( pet - ct ) showed that these masses had abnormal f - fdg uptake [ figure 2a and b ] .", "the patient then underwent eus examination ; multiple enlarged retroperitoneal lymph nodes were found between the body of the pancreas and the gastric wall .", "we then performed eus - fna [ figure 3 ] to obtain a tissue sample for biopsy .", "pathological examination revealed only a few heterotypic cells [ figure 4 ] . because of the lack of definite pathological evidence , diagnosis of the patient 's condition was extremely difficult .", "ct scan showing multiple , enlarged soft tissue - density images in the abdominal cavity pet - ct showing the accumulation o f abnormal radioactivity in soft tissue - density images in the abdominal cavity eus - fna of a lymph node eus - fna showing a few heterotypic cells to obtain adequate tissue samples of the enlarged lymph nodes for immunohistochemical analysis , we performed eus - assisted retroperitoneal lymph node biopsy .", "a standard single - channel gastroscope ( epk - i , pentax , tokyo , japan ) was used throughout the endoscopic procedure ; a linear array ultrasonic endoscope ( eg3830ur ; pentax precision instrument corporation , orangeburg , ny , usa ) was used to evaluate the size of the lymph nodes , their echo characteristics , and localization . a triangle - tip knife and an insulated - tip ( it ) knife ( both from olympus corporation , tokyo , japan )", "were used for resection of the gastric wall and enucleation of the lymph node . a pair of hot forceps ( fd-410lr , olympus corporation , tokyo , japan ) was used for gastric wall hemostasis .", "adequate preoperative communication with the patient and his family was performed and associated issues including the necessity , feasibility , safety , and probable complications of the operation were explained thoroughly .", "for the procedure , the patient was placed in a supine position and he received standard intravenous anesthesia with propofol .", "the site nearest to the retroperitoneal lymph nodes in the posterior wall of the gastric body was chosen for puncture .", "a methylthioninium chloride and saline compound solution was injected into the puncture channel for labeling when the needle was retrieved .", "the lymph node was also marked by a triangle tip knife with the cautery under eus - guidance .", "then , the ultrasound transducer was pulled out ; therapeutic gastroscopy with a transparent cap was then performed .", "a triangle - tip knife was used to incise the full thickness of the gastric wall along the labeled site .", "the triangle - tip knife was used to separate the tissues surrounding the stomach wall sufficiently until the targeted lymph node capsule was exposed .", "then , enucleation of the targeted lymph node was performed using an it knife [ figure 5 ] .", "after tissue samples were obtained , the hot forceps were used to stop the bleeding .", "the endoscope was retrieved from the stomach and the procedure was completed by closing the incision in the stomach wall using metal clips [ video 1 ] .", "the results showed : cd3(large cell- ) ; vimentin(+ ) ; pax-5(- ) ; cd15(- ) ; cd20(large cell+ ) ; cd21(+ ) ; ki-67(large cell8%+ ) ; cd30(- ) ; cd68(partly+ ) ; ck(- ) ; mum-1(- ) ; cd10(- ) ; bcl-6(+ ) ; bcl-2(+ ) .", "the diagnosis was : non - hodgkin lymphoma , germinal center b - cell - like diffuse large b - cell lymphoma [ figure 6 ] .", "( a ) the gastroscope entered into the abdominal cavity after incision of the full thickness of the gastric wall .", "the prelabeled lymph node was found , ( b ) the removed lymph node tissues immunohistochemical staining : cd3(large cell- ) ; vimentin(+ ) ; pax-5(- ) ; cd15(- ) ; cd20(large cell+ ) ; cd21(+ ) ; ki-67(large cell8%+ ) ; cd30(- ) ; cd68(partly+ ) ; ck(- ) ; mum-1(- ) ; cd10(- ) ; bcl-6(+ ) ; bcl-2(+ ) .", "the diagnosis was non - hodgkin lymphoma , germinal center b - cell - like diffuse large b - cell lymphoma the patient was given standard postoperative treatments and nursing care including ecg monitoring , ceftazidime as prophylaxis against infection , proton pump inhibitors , and nutritional support .", "the patient 's highest temperature after the procedure was 37.2c and he only felt mild epigastralgia .", "the blood test results after the procedure were : white blood cell ( wbc ) count 12.8 10/l and percentage of neutrophils 80.3% .", "the wbc count decreased to 6.5 10/l and the percentage of neutrophils decreased to 61.8% , 4 days after the procedure .", "the patient gradually returned to a normal diet and normal physical activities by 3 days after the procedure .", "the patient was then transferred to the department of hematology to undergo further therapy . the r - chop regimen (" ], [ "pathological evidence is an indispensable part of the diagnosis and differential diagnosis of lymphoma and is significant for the classification of lymphomas .", "precise pathological classification is critical for the choice of chemotherapeutic regimen in cases of lymphoma . in the early 1990s ,", "eus - fna was first used for tissue biopsy of tumors around the gastrointestinal tract . in spite of its high accuracy", ", the lack of sufficient tissue material obtained using this technique often renders immunohistochemical staining inconclusive and limits its application in the classification of lymphomas . how to obtain an adequate sample that can be used for immunohistochemical testing is a primary problem in need of a solution . in a study by mohamad et al .", ", the results of eus - fna of two patients who had suspected lymphoma were negative .", "however , positive results were obtained by use of eus - guided trucut biopsy ( eus - tcb ) .", "the authors suggested that the use of eus - tcb with 19 g needle could permit more tissue materials to be obtained in those who had a negative eus - fna result .", "this minimally invasive procedure can be used for the preoperative diagnoses of some difficult cases .", "analyzed and compared the efficacies of eus - fna and eus - tcb in the diagnosis and classification of lymphoma . among the 24 included patients , 23 patients underwent eus - fna .", "only one patient received eus - tcb alone , while the other 22 patients received both eus - fna and eus - tcb .", "the results showed that the accurate diagnostic rate of eus - guided biopsy was 79% ( 19/24 ) and the accurate rate of eus - guided biopsy for classification was just 66.6% ( 16/24 ) .", "this indicated that eus - guided biopsy was of limited value in the classification of lymphoma .", "there have been more than 300 reports of notes clinical applications from around the world . over 50 cases of cholecystostomy and endectomy by transvaginal notes", "have been performed in germany , and 116 notes surgeries ( including 77 transgastric cholecystotomy cases ) have been reported in brazil . however , there are few case reports regarding the clinical application of notes in china .", "wang et al . presented a case of laparoscopy - assisted transgastric endoscopic biopsy of a retroperitoneal lymph node . in this case ,", "an endoscopic full - thickness resection ( eftr ) with the aid of laparoscopy was used to extirpate an enlarged retroperitoneal lymph node .", "pathological and immunohistochemical tests confirmed the diagnosis of retroperitoneal b - cell lymphoma ( diffuse large b - cell lymphoma ) . in recent years ,", "these studies showed that eus was very useful for creating transgastric access and locating the targets . in this study , we successfully used eus - assisted notes to perform enucleation of a retroperitoneal enlarged lymph node without laparoscopic assistance .", "the use of a minimally invasive procedure not only enables more tissue materials to be obtained but also causes less trauma than a laparoscopy - assisted approach . in this patient", ", blood test results recovered to normal levels by 4 days after the procedure and the highest postoperative body temperature was just 37.2c .", "he was also able to return to a normal diet 3 days after the procedure .", "our experience suggests that this is an alternative and minimally invasive approach for the biopsy of retroperitoneal lymph nodes ." ], [ "" ] ]

[ [ "periodontitis is a local inflammatory process mediating destruction of periodontal tissues triggered by bacterial insults periodontal subgingival pathogens affect local and systemic immune and inflammatory response . local inflammatory response to these gram - negative bacteria and bacterial products is characterized by the infiltration of periodontal tissues of the inflammatory cells , including polymorphonuclear leucocytes , macrophages , lymphocytes , and plasma cells .", "activated macrophages release cytokines and some individuals respond to microbial challenge with an abnormally high delivery of such mediators as pge2 , il-1 , and tnf-. these cytokines are involved in the destruction of periodontal connective tissue and alveolar bone they can also initiate a systemic acute phase response . during the acute phase of many diseases , a characteristic group of changes occur in the plasma cells and of blood", "termed acute phase response and the substances undergoing characteristic alteration of serum levels are termed acute phase reactants .", "systemic acute phase response is characterized by features , such as fever , neutrophilia , changes in lipid metabolism , and induction of various acute phase proteins , such as c - reactive protein ( crp ) , fibrinogen , and serum amyloid .", "crp is a type i acute phase protein that is produced by the liver in response to diverse inflammatory stimuli .", "crp levels are found in trace amounts , that is , < 0.3 mg / l serum of crp could exceed 100", "mg / l in the presence of overwhelming systemic infection , which provides a useful marker for tracking the course of infection .", "recent investigations suggested that even a moderate increase in crp levels , such as those found in periodontitis patients , may predict a risk for atherosclerosis and cardiovascular disease(cvd ) the mechanism by which crp participates in cvd is not clear ; however , crp may activate the complement system and be involved in foam cell formation in atheromas .", "recent studies showed that crp is a strong predictor of future coronary artery disease in healthy men and women the purpose of the present study is to quantitatively evaluate the serum levels of crp in both male and female subjects with various degrees of periodontitis ( chronic and aggressive form ) and compare them with controls who have a clinically healthy periodontium ." ], [ "this was a retrospective clinical study conducted in the department of periodontics , peoples dental college , bhopal , india .", "the nature and purpose of the study was explained to the patients and an informed consent was obtained .", "a detailed case history was recorded in a specially prepared form , which included information regarding the patients overall medical status / general health and wellbeing .", "mouth mirror , williams periodontal probe , explorer , tweezer , disposable 5cc syringe , spirit cotton swab , handcuff , and edta - coated glass test tube .", "patients aged between 25 and 50 years , they should not have received any antibiotic therapy in the previous 3 months .", "they should not have undergone any extractions or periodontal therapy in the previous 3 months .", "patients with known systemic diseases and presence of other chronic infections , patients taking contraceptive pills , pregnant or lactating females . based on the periodontal status ,", "group i : ( control group ) 15 subjects with attachment loss ( al ) 2 mm and pocket depth ( pd ) < 3 mm were included .", "group ii : ( generalized aggressive periodontitis ) 15 subjects with generalized pattern of severe periodontal destruction with al of at least 5 mm on 8 or more teeth .", "group iii : ( chronic periodontitis ) 15 subjects diagnosed with moderate and severe forms of chronic periodontitis were included .", "moderate periodontitis : subjects with a minimum of 20 natural teeth , at least 1 molar tooth in each quadrant and at least 4 sites with al > 2 mm and < 4 mm and pd > 5 mm and < 7 mm .", "severe periodontitis : subjects with a minimum of 20 natural teeth , at least , 1 molar tooth in each quadrant and at least 4 sites with al > 5 mm and pd > 7 mm . after the selection of subjects a detailed case history was taken and the following clinical parameters were recorded .", "clinical parameters for the study were plaque index , gingival index , bleeding index , probing pd , and clinical attachment level .", "these parameters were assessed for subjects in all the 3 groups . for the crp assessment ,", "plaque index ( silness and loe ) scoring was done for 6 surfaces of all the teeth distobuccal , buccal , mesiobuccal , mesiolingual , lingual , and distolingual .", "criteria for the plaque index : \n 0:no plaque in the gingival area.1:a film of plaque adhering to the free gingival margin and adjacent area of the tooth . the plaque may be recognized only by running a probe across the surface.2:moderate accumulation of soft deposits within the gingival pocket and on the gingival margin and/or on the adjacent tooth surface that can be seen by the naked eye.3:abundance of soft matter within the gingival pocket and/or on the gingival margin and adjacent tooth surface . \n ", "a film of plaque adhering to the free gingival margin and adjacent area of the tooth . the plaque may be recognized only by running a probe across the surface .", "moderate accumulation of soft deposits within the gingival pocket and on the gingival margin and/or on the adjacent tooth surface that can be seen by the naked eye .", "abundance of soft matter within the gingival pocket and/or on the gingival margin and adjacent tooth surface .", "bleeding index ( ainamo and bay ) : \n 0:absence of bleeding.1:presence of bleeding . \n ", "gingival index ( loe and silness ) ; \n 0:normal gingiva.1:mild inflammation , slight change in color , slight edema , and no bleeding on palpation.2:moderate inflammation , redness and edema , ulceration , and tendency to spontaneous bleeding.3:severe inflammation , marked redness and edema , ulceration , and tendency to spontaneous bleeding . \n ", "mild inflammation , slight change in color , slight edema , and no bleeding on palpation .", "severe inflammation , marked redness and edema , ulceration , and tendency to spontaneous bleeding .", "probing pd was measured from the gingival margin to the probable pd at the mesiobuccal , midbuccal , distobuccal , mesiolingual , midlingual , and distolingual surface of all the teeth and clinical attachment level was measured from the cementoenamel junction , to the probable pd of all the teeth on the same surfaces , using the williams periodontal probe to the nearest millimeter .", "about 45 ml of blood sample was collected from each of the subjects from the brachial vein , by aseptic technique using a 5 cc syringe and transferred to an appropriately labeled tube and allowed to clot , centrifuged , and the smear layer removed carefully .", "the serum thus obtained was stored at 20c for the analyses at a later date .", "serum crp levels were assessed by means of a commercially available high - sensitivity crp ( hs - crp ) enzyme immunoassay .", "( diagnostics biochem canada inc elisa kit the eiasy way ) mean and standard deviation are calculated for all the groups and periodontal parameters .", "mean values of each parameter were compared between the groups using one - way analysis of variance with post hoc test of least significant difference method .", "pearson 's correlation was used to assess the correlation between severity of periodontitis and serum crp levels . in the present study ,", "p value of 0.05 was considered as significant . statistical package for social science ( spss ) version 15", "analysis of covariance was used for comparison of mean values between the groups to adjust the age ." ], [ "mouth mirror , williams periodontal probe , explorer , tweezer , disposable 5cc syringe , spirit cotton swab , handcuff , and edta - coated glass test tube ." ], [ "patients aged between 25 and 50 years , they should not have received any antibiotic therapy in the previous 3 months .", "they should not have undergone any extractions or periodontal therapy in the previous 3 months ." ], [ "patients with known systemic diseases and presence of other chronic infections , patients taking contraceptive pills , pregnant or lactating females . based on the periodontal status ,", "group i : ( control group ) 15 subjects with attachment loss ( al ) 2 mm and pocket depth ( pd ) < 3 mm were included .", "group ii : ( generalized aggressive periodontitis ) 15 subjects with generalized pattern of severe periodontal destruction with al of at least 5 mm on 8 or more teeth .", "group iii : ( chronic periodontitis ) 15 subjects diagnosed with moderate and severe forms of chronic periodontitis were included .", "moderate periodontitis : subjects with a minimum of 20 natural teeth , at least 1 molar tooth in each quadrant and at least 4 sites with al > 2 mm and < 4 mm and pd > 5 mm and < 7 mm .", "severe periodontitis : subjects with a minimum of 20 natural teeth , at least , 1 molar tooth in each quadrant and at least 4 sites with al > 5 mm and pd > 7 mm ." ], [ "after the selection of subjects a detailed case history was taken and the following clinical parameters were recorded .", "clinical parameters for the study were plaque index , gingival index , bleeding index , probing pd , and clinical attachment level .", "these parameters were assessed for subjects in all the 3 groups . for the crp assessment ,", "plaque index ( silness and loe ) scoring was done for 6 surfaces of all the teeth distobuccal , buccal , mesiobuccal , mesiolingual , lingual , and distolingual .", "criteria for the plaque index : \n 0:no plaque in the gingival area.1:a film of plaque adhering to the free gingival margin and adjacent area of the tooth . the plaque may be recognized only by running a probe across the surface.2:moderate accumulation of soft deposits within the gingival pocket and on the gingival margin and/or on the adjacent tooth surface that can be seen by the naked eye.3:abundance of soft matter within the gingival pocket and/or on the gingival margin and adjacent tooth surface . \n ", "a film of plaque adhering to the free gingival margin and adjacent area of the tooth . the plaque may be recognized only by running a probe across the surface .", "moderate accumulation of soft deposits within the gingival pocket and on the gingival margin and/or on the adjacent tooth surface that can be seen by the naked eye .", "abundance of soft matter within the gingival pocket and/or on the gingival margin and adjacent tooth surface .", "bleeding index ( ainamo and bay ) : \n 0:absence of bleeding.1:presence of bleeding . \n ", "gingival index ( loe and silness ) ; \n 0:normal gingiva.1:mild inflammation , slight change in color , slight edema , and no bleeding on palpation.2:moderate inflammation , redness and edema , ulceration , and tendency to spontaneous bleeding.3:severe inflammation , marked redness and edema , ulceration , and tendency to spontaneous bleeding . \n ", "mild inflammation , slight change in color , slight edema , and no bleeding on palpation .", "severe inflammation , marked redness and edema , ulceration , and tendency to spontaneous bleeding .", "probing pd was measured from the gingival margin to the probable pd at the mesiobuccal , midbuccal , distobuccal , mesiolingual , midlingual , and distolingual surface of all the teeth and clinical attachment level was measured from the cementoenamel junction , to the probable pd of all the teeth on the same surfaces , using the williams periodontal probe to the nearest millimeter ." ], [ "about 45 ml of blood sample was collected from each of the subjects from the brachial vein , by aseptic technique using a 5 cc syringe and transferred to an appropriately labeled tube and allowed to clot , centrifuged , and the smear layer removed carefully .", "the serum thus obtained was stored at 20c for the analyses at a later date ." ], [ "serum crp levels were assessed by means of a commercially available high - sensitivity crp ( hs - crp ) enzyme immunoassay ." ], [ "mean values of each parameter were compared between the groups using one - way analysis of variance with post hoc test of least significant difference method .", "pearson 's correlation was used to assess the correlation between severity of periodontitis and serum crp levels . in the present study ,", "statistical package for social science ( spss ) version 15 was used for statistical analysis .", "analysis of covariance was used for comparison of mean values between the groups to adjust the age ." ], [ "a total number of 45 male and female subjects with the age range between 25 and 50 years participated in the study .", "all the patients who participated in the study were systemically healthy and were adjusted for factors known to elevate crp levels .", "the mean crp concentration in the groups i , ii , and iii were calculated . a statistically significant difference ( p = 0.012 )", "was found in the crp level between groups i and ii and between groups ii and iii and between groups i and iii [ table 1 ] .", "comparison of c - reactive protein levels among all the groups the results of the present study indicated an increase in serum crp levels in subjects with generalized aggressive periodontitis and chronic periodontitis compared with controls .", "clinical parameters , such as bleeding on probing , showed a positive correlation with crp levels in aggressive periodontitis group and a positive correlation was also seen for probing pd , clinical attachment level , and crp in chronic periodontitis group of subjects .", "of particular concern could be the elevation in crp levels in younger individuals as represented by aggressive periodontitis patients that may contribute to an early cvd in susceptible patients ." ], [ "earlier it was considered simply as a chronic localized infection ; however , a growing body of evidence suggests that the pathology of periodontitis may affect the outcome of several systemic diseases , such as myocardial infarction , stroke , or preterm low birth weight babies gram - negative anaerobes present in large numbers in subgingival dental plaque in periodontal pockets affect the local and systemic inflammatory response .", "endotoxins derived from gram - negative microorganisms interact with toll - like receptors expressed on the surface of neutrophils , macrophages , lymphocytes , and plasma cell , which are abundant in periodontal inflammation .", "toll - like receptors - ligand complexes activate single transduction pathways in both the innate and adaptive immune systems leading to the production of cytokines , which coordinate the local and systemic inflammatory responses .", "some individuals respond to microbial challenge with an abnormally high delivery of such inflammatory mediators as pge-2 , il-1 , and tnf .", "crp is a very strong acute phase protein . in healthy young subjects and resting situations", "plasma crp is produced only by hepatocytes , predominantly under transcriptional control by the cytokine il - 6 , although other sites of local crp synthesis and possibly secretions have been suggested .", "crp has been known to be present in monocyte - derived macrophages , in atherosclerotic plaques , lymphocytes , and alveolar macrophages .", "acute phase proteins not only appear in acute and severe disease processes , but also in longstanding , chronic conditions .", "for example , crp has often been found at relatively low levels ( range , 0.33.0 mg / l ) in subjects with chronic stomach ulcers associated with helicobacter pylori , in persons with chronic lung infections , such as chlamydia pneumonia , and in individuals with a chronic cytomegalovirus infection .", "simultaneously , it has been established that crp in particular showed a strong association with cvd .", "slightly elevated ( > 0.33 mg / l ) and chronically present levels of crp were determined to have a predictive value for the occurrence of a cardiovascular event .", "both periodontal and cvds share several risk factors , including smoking , diabetes mellitus , age , socioeconomic status , obesity , and psychologic stress . the epidemiologic evidence to date show a significant but modest relationship between periodontitis and cvd .", "crp production is part of the nonspecific acute phase response to most forms of inflammation , infection , and tissue damage and was therefore considered to provide clinically useful information .", "a high sensitivity assay for measuring crp levels has been developed to detect the levels of crp below what was previously considered the normal range .", "in healthy individuals , crp levels are found in trace amounts with levels < 0.3 mg / l , in acute inflammation crp could exceed 100 mg / l , and the level decreases in chronic inflammation .", "accumulating evidence suggests that small elevation of serum crp within the range of 110 mg /", "l is a significant indicator of risk of atherosclerosis , cvd , and type 2 diabetes .", "positive crp may indicate any of a number of possibilities , rheumatoid arthritis , rheumatic fever , cancer , tuberculosis , pneumococcal pneumonia , myocardial infarction , systemic lupus erythematosus .", "positive crp results also occur during the last half of pregnancy or with the use of oral contraceptive pills , increase with aging , obesity , high blood pressure , alcohol use , smoking , low levels of physical activity , chronic fatigue , coffee consumption , elevated triglycerides , insulin resistance and diabetes , a high protein diet , suffering sleep disturbances , and depression .", "alcohol can cause inflammation and raise crp . the best way we know to reduce crp levels are exercise and a diet that includes omega-3 fatty acids as statins appear to protect against inflammation as well as cholesterol .", "recent studies have indicated that serum crp of patients with periodontal diseases is elevated with deep periodontal pockets , severe attachments loss , subgingival microflora , and alveolar bone loss .", "treatment of periodontal infection , whether by intensive mechanical therapy , drug therapy , or extraction significantly lowers the serum crp levels .", "reported an increase in crp levels even in generalized aggressive periodontitis patients ( 3.72 mg / l ) , which is similar to the findings of the present study ( 4.54 mg / l ) . in the present study , although the crp levels were found to be elevated in aggressive periodontitis group of subjects , the mean levels were found to be lower than in the chronic periodontitis group .", "the reason for this difference in crp levels between aggressive and chronic periodontitis groups is not exactly understood at this point in time but could be attributable to the longstanding nature and chronic course of the disease process of chronic periodontitis , thus exerting its systemic influence over a long period of time compared with aggressive periodontitis , which runs a shorter course .", "also the mean age values of chronic periodontitis subjects and aggressive periodontitis subjects in the present study were in accordance with the prevalence studies of aggressive periodontitis and chronic periodontitis , which have shown an increased prevalence for the occurrence of aggressive periodontitis in younger age groups and occurrence of chronic periodontitis in older age groups . in the present study , clinical parameters such as bleeding on probing showed a positive correlation with crp level in aggressive periodontitis group and a positive correlation was also seen for probing pd , clinical attachment level , and crp in chronic periodontitis group of subjects .", "this is similar to the results of earlier studies , which revealed increased bleeding on probing depth and al to be significantly associated with elevated crp concentrations ." ], [ "the results of the present study indicated an increase in serum crp levels in subjects with generalized aggressive periodontitis and chronic periodontitis as compared with controls , which was statistically significant .", "clinical parameters such as bleeding on probing showed a positive correlation with crp levels in aggressive periodontitis group and a positive correlation was also seen for probing pd , clinical attachment level , and crp in chronic periodontitis group subjects .", "however , the result of the present study can not be used to determine the causality of the associations between periodontitis and crp due to some limitations , one being the small sample size and the other is that the study is only cross - sectional . moreover", ", the subjects might have undiagnosed systemic factors that could influence the crp levels . but keeping in view the results of the earlier studies and that of the present study , it would be appropriate if large sample based , well - controlled , longitudinal trials are performed to determine the relationship between periodontitis and elevated crp levels and the effect of periodontal therapy on serum crp concentration ." ] ]

[ [ "therapeutic plasma exchange ( tpe ) is used for many indications in patients presenting to a variety of medical disciplines .", "the efficacy and safety of tpe is the subject of recent reviews and guidelines from professional bodies including the american society for apheresis and the american academy of neurology .", "however , strong recommendations on practical aspects of the delivery of tpe are not available .", "membrane therapeutic plasma exchange ( mtpe ) and centrifugal therapeutic plasma exchange ( ctpe ) are both well - established techniques . in", "both , plasma is selectively removed and replaced typically with human serum albumin or fresh frozen plasma , chosen on the basis of the indication for tpe and patient clinical parameters .", "one uncontrolled comparison carried out > 25 years ago used a ctpe device that is no longer available . in another study ,", "although apheresis registry data have been published , these do not include details of practical differences between mtpe and ctpe or the advantages of each method . between november 2010 and march 2011 , we had the opportunity to evaluate mtpe and ctpe techniques at our institution .", "here we describe three patients with unequivocal indications for therapeutic plasma exchange who were all treated with both mtpe and ctpe .", "we report practical aspects of their treatment with emphasis on reliability and safety of the techniques ." ], [ "in the autumn of 2011 , we had made access to both membrane tpe and a centrifugal tpe system .", "our established treatment system was mtpe , but during this period we had arranged for a trial of a ctpe system . as a consequence ,", "exchange volumes , anticoagulation , replacement fluid employed and additional calcium supplementation used in tpe are prescribed in our unit on the basis of a written protocol ( see figure 1 ) . \n", "many of the elements of this protocol of the unit were employed with the ctpe device .", "the main change was that exchange volumes for mtpe procedures were estimated by the prescribing physician , whereas the ctpe device calculated exchange volumes precisely according to patient parameters .", "the mtpe device required a blood flow of 100150 ml / min for efficient treatment but a higher blood flow did not shorten treatment duration .", "the ctpe device could operate with a blood flow of up to 140 ml / min , but could run as low as 5 ml / min if necessary .", "higher blood flow had an immediate effect on treatment duration , as with higher flows treatment time was shortened considerably .", "we were advised by the manufacturer that platelet losses would be minimized ( to < 1% ) at a blood flow of 65 ml / min , therefore we included this flow rate in our procedure protocol .", "table 1.patient characteristicspatient ( age , gender , weight)diagnosistreatmentpre - treatment result ( date)date of last tpepost - treatment result ( date)1 ( 50 , f , 75)crescentic glomerulonephritis with anti - gbm antibodiescyp , mp , 12 tpeanti - gbm 747 iu / ml ( 20 november 2010)14 december 2010anti - gbm 67 iu / ml ( 17 december 2010)2 ( 23 , m , 94)crescentic glomerulonephritis with anti - gbm antibodiescyp , mp , 17 tpe , anti - gbm > 600 iu / ml ( 27 january 2011)18 february 2011anti - gbm 36 iu / ml ( 22 february 2011)3 ( 57 , m , 81)anca - associated small vessel vasculitiscyp , mp , 7 tpe,10.1 iu / ml ( 14 december 2010)30 december 2010<1.3 iu / ml ( 30 december 2010)cyp , cyclophosphamide ; mp , methylprednisolone ; aav , anca - associated vasculitis ; tpe , therapeutic plasma exchange ; hd , haemodialysis anti - gbm .", "patient characteristics cyp , cyclophosphamide ; mp , methylprednisolone ; aav , anca - associated vasculitis ; tpe , therapeutic plasma exchange ; hd , haemodialysis anti - gbm .", "the first patient was a 50-year - old woman ( 75 kg ) with acute kidney injury .", "plasma exchange treatments ( table 2 ) were started with membrane filtration technology ( mtpe ) , using the gambro prisma system with a tpe 2000 set ( gambro ) .", "the set was routinely primed as per policy and manufacturer 's instructions with 4 l of sodium chloride 0.9% , with 5000 iu unfractionated heparin added to the last litre of fluid .", "table 2.plasma exchange procedurespatienttype of tpentotal heparin used during procedure ( iu)total acd - a infused to patient ( ml)procedure time ( min)time to exchange 1 l of plasma ( min)1mtpe57290 3171143 6144 14ctpe649 21104 3629 52mtpe37750 750138 3234 13ctpe1362 13116 1328 43mtpe1630016040ctpe681 25112 628 4all patientsmtpe97333 2317144 940 12ctpe2563 21112 2028 4 plasma exchange procedures during the first treatment , an initial heparin bolus of 1000 iu was used and the heparin infusion rate was 1000 iu / h . these doses were with 13 iu / kg lower than per protocol ( 33 iu / kg ) , as the patient had a renal biopsy the day before the exchange . at 55", "min into the procedure , a rise in transmembrane pressure suggested imminent filter clotting and a further 1000 iu heparin bolus was given . despite this , the filter clotted shortly after .", "the set was changed and the patient received a further bolus of 2000 iu heparin in addition to a continued heparin infusion of 1000 iu / h . two hours after the second bolus ( time 115 min ) , the filter clotted again and the set was replaced for a second time .", "the patient received a fourth bolus of heparin ( 2000 iu ) at 190 min and the heparin infusion rate was increased to 1500 iu / h . the third attempt to complete the exchange was uneventful but the total cumulative dose of heparin was 8750 iu .", "the procedure took 237 min to complete of which only 124 min were spent performing the exchange .", "the patient underwent mtpe daily on the next 3 days and completion of these procedures required large heparin doses .", "altogether , four mtpe procedures were performed with one prematurely terminated because of severe clotting in the filter before the prescribed plasma exchange had been delivered .", "in addition , seven disposable sets were required to complete four tpe procedures . as per our treatment guidelines ,", "the patient should have received on average of 5500 iu of heparin for a 4 l exchange but we had to use up to 9000 iu to complete tpe .", "we feared that the administration of such high doses of heparin could lead to systemic anticoagulation in a patient at risk of pulmonary haemorrhage .", "we therefore decided to use the ctpe ( spectra optia apheresis ) device with regional citrate anticoagulation of the extracorporeal circuit .", "citrate ( acid citrate dextrose formula a , acd - a solution , 0.113 mm citrate ) was infused at a rate dependent on the patient 's total blood volume ( tbv ) . in our setting , we used a rate of 0.8 ml acd - a / min / l tbv which corresponds to between 0.0047 and 0.0068 mmol citrate", "a total of seven additional centrifugal plasma exchange procedures were performed with an average procedure time of 104 min .", "all seven ctpe procedures were uneventful and the prescribed dose was delivered on each occasion . in addition , the average lapsed time it took to exchange 1 l of plasma using ctpe was 29 min in contrast with 44 min using mtpe ( gambro prisma system device ) .", "treatment 9 was performed with a mixture of human albumin 4.5% and ffp and cryoprecipitate using the ctpe device .", "this proceeded without difficulties and contrasts with our experience of mtpe where this type of exchange prescription would have proved problematic .", "the patient 's final tpe was delivered using mtpe and there were further difficulties with filter clotting . in total ,", "the patient 's tpe was delivered using an un - tunnelled right internal jugular ( rij ) central venous catheter ( cvc ) during sessions 16 and a tunnelled rij cvc for sessions 712 .", "unfortunately , the patient 's renal function could not be salvaged and she required long - term maintenance haemodialysis until her unrelated death at home 14 months after starting dialysis .", "the second patient was a 24-year - old male ( 94 kg ) with a crescentic glomerulonephritis at renal biopsy , haemoptysis and anti - gbm antibodies .", "significant problems with filter clotting were encountered despite high doses of heparin used . during the first session of mtpe , tmp started to rise after 1 h and the set clotted 25 min later .", "the prescribed session was completed , but a total of 7750 iu heparin was used .", "a second mtpe procedure was carried out successfully without clotting but 8500 iu of heparin was needed in a patient who should have only received 6000 iu according to the local protocol .", "following these two sessions , we changed the delivery method to ctpe and 14 further procedures were carried out without problems . during the 15th procedure", "the patient briefly felt unwell and complained of having a metallic taste in his mouth .", "blood flow was decreased to 40 ml / min and an additional 20 ml of calcium gluconate was given . a normal blood flow of 65 ml / min was resumed shortly after symptoms had subsided .", "a final plasma exchange was delivered using mtpe , requiring a total heparin dose of 7000 iu .", "the patient 's tpe was delivered using an un - tunnelled rij cvc for sessions 15 and a tunnelled cvc for sessions 617 .", "the patient 's renal function did not recover and he received maintenance dialysis until a successful transplant 23 months after presentation .", "the third patient was a 57-year - old man ( 81 kg ) with anca - associated vasculitis , presenting with constitutional symptoms , skin , neurological and renal manifestations and bloody diarrhoea .", "he was treated with cyclophosphamide and corticosteroids initially and , in the absence of response to these interventions , tpe was prescribed .", "the fourth plasma exchange was an mtpe procedure where clotting occurred 30 min into the procedure ( heparin infusion : 1000 iu / h ; bolus : 1500 iu ) .", "heparin infusion rate was increased to 1500 iu / h , two additional boluses of 2000 iu and later on a 1000 iu bolus were given and the prescribed tpe was completed without further clotting using a new disposable set . in total ,", "subsequently , his renal function declined and he started on peritoneal dialysis 15 months after his initial presentation ." ], [ "the first patient was a 50-year - old woman ( 75 kg ) with acute kidney injury .", "plasma exchange treatments ( table 2 ) were started with membrane filtration technology ( mtpe ) , using the gambro prisma system with a tpe 2000 set ( gambro ) .", "the set was routinely primed as per policy and manufacturer 's instructions with 4 l of sodium chloride 0.9% , with 5000 iu unfractionated heparin added to the last litre of fluid . set - up and priming usually took 40 min . \n table 2.plasma exchange procedurespatienttype of tpentotal heparin used during procedure ( iu)total acd - a infused to patient ( ml)procedure time ( min)time to exchange 1 l of plasma ( min)1mtpe57290 3171143 6144 14ctpe649 21104 3629 52mtpe37750 750138 3234 13ctpe1362 13116 1328 43mtpe1630016040ctpe681 25112 628 4all patientsmtpe97333 ", "2317144 940 12ctpe2563 21112 2028 4 plasma exchange procedures during the first treatment , an initial heparin bolus of 1000 iu was used and the heparin infusion rate was 1000 iu / h . these doses were with 13 iu / kg lower than per protocol ( 33 iu / kg ) , as the patient had a renal biopsy the day before the exchange . at 55 min into the procedure ,", "a rise in transmembrane pressure suggested imminent filter clotting and a further 1000 iu heparin bolus was given . despite this , the filter clotted shortly after .", "the set was changed and the patient received a further bolus of 2000 iu heparin in addition to a continued heparin infusion of 1000 iu / h . two hours after the second bolus ( time 115 min ) , the filter clotted again and the set was replaced for a second time .", "the patient received a fourth bolus of heparin ( 2000 iu ) at 190 min and the heparin infusion rate was increased to 1500 iu / h . the third attempt to complete the exchange was uneventful but the total cumulative dose of heparin was 8750 iu .", "the procedure took 237 min to complete of which only 124 min were spent performing the exchange .", "the patient underwent mtpe daily on the next 3 days and completion of these procedures required large heparin doses .", "altogether , four mtpe procedures were performed with one prematurely terminated because of severe clotting in the filter before the prescribed plasma exchange had been delivered .", "as per our treatment guidelines , the patient should have received on average of 5500 iu of heparin for a 4 l exchange but we had to use up to 9000 iu to complete tpe .", "we feared that the administration of such high doses of heparin could lead to systemic anticoagulation in a patient at risk of pulmonary haemorrhage .", "we therefore decided to use the ctpe ( spectra optia apheresis ) device with regional citrate anticoagulation of the extracorporeal circuit .", "citrate ( acid citrate dextrose formula a , acd - a solution , 0.113 mm citrate ) was infused at a rate dependent on the patient 's total blood volume ( tbv ) . in our setting , we used a rate of 0.8 ml acd - a / min / l tbv which corresponds to between 0.0047 and 0.0068 mmol citrate / kg / min . at this rate ,", "a total of seven additional centrifugal plasma exchange procedures were performed with an average procedure time of 104 min .", "all seven ctpe procedures were uneventful and the prescribed dose was delivered on each occasion . in addition , the average lapsed time it took to exchange 1 l of plasma using ctpe was 29 min in contrast with 44 min using mtpe ( gambro prisma system device ) .", "treatment 9 was performed with a mixture of human albumin 4.5% and ffp and cryoprecipitate using the ctpe device .", "this proceeded without difficulties and contrasts with our experience of mtpe where this type of exchange prescription would have proved problematic .", "the patient 's final tpe was delivered using mtpe and there were further difficulties with filter clotting . in total ,", "the patient 's tpe was delivered using an un - tunnelled right internal jugular ( rij ) central venous catheter ( cvc ) during sessions 16 and a tunnelled rij cvc for sessions 712 .", "unfortunately , the patient 's renal function could not be salvaged and she required long - term maintenance haemodialysis until her unrelated death at home 14 months after starting dialysis ." ], [ "the second patient was a 24-year - old male ( 94 kg ) with a crescentic glomerulonephritis at renal biopsy , haemoptysis and anti - gbm antibodies .", "significant problems with filter clotting were encountered despite high doses of heparin used . during the first session of mtpe ,", "the prescribed session was completed , but a total of 7750 iu heparin was used .", "a second mtpe procedure was carried out successfully without clotting but 8500 iu of heparin was needed in a patient who should have only received 6000 iu according to the local protocol .", "following these two sessions , we changed the delivery method to ctpe and 14 further procedures were carried out without problems . during the 15th procedure", "the patient briefly felt unwell and complained of having a metallic taste in his mouth .", "blood flow was decreased to 40 ml / min and an additional 20 ml of calcium gluconate was given .", "a normal blood flow of 65 ml / min was resumed shortly after symptoms had subsided .", "a final plasma exchange was delivered using mtpe , requiring a total heparin dose of 7000 iu .", "the patient 's tpe was delivered using an un - tunnelled rij cvc for sessions 15 and a tunnelled cvc for sessions 617 .", "the patient 's renal function did not recover and he received maintenance dialysis until a successful transplant 23 months after presentation ." ], [ "the third patient was a 57-year - old man ( 81 kg ) with anca - associated vasculitis , presenting with constitutional symptoms , skin , neurological and renal manifestations and bloody diarrhoea .", "he was treated with cyclophosphamide and corticosteroids initially and , in the absence of response to these interventions , tpe was prescribed .", "the fourth plasma exchange was an mtpe procedure where clotting occurred 30 min into the procedure ( heparin infusion : 1000 iu / h ; bolus : 1500 iu ) . heparin infusion rate was increased to 1500 iu / h , two additional boluses of 2000 iu and later on a 1000 iu bolus were given and the prescribed tpe was completed without further clotting using a new disposable set . in total ,", "subsequently , his renal function declined and he started on peritoneal dialysis 15 months after his initial presentation ." ], [ "therapeutic plasma exchange is a well - established treatment for renal diseases . over a 5-month period , we had the opportunity to compare the ease of use , safety and reliability of mtpe and ctpe methods in three patients with severe renal disease .", "we performed 36 plasma exchange procedures on these patients , 9 using mtpe and 27 using ctpe .", "the most significant observation in our study was the high frequency with which the filter clotted using mtpe with conventional heparin anticoagulation despite doses of heparin larger than advocated in our local mtpe protocol . on occasions ,", "multiple disposable sets had to be used to complete the plasma exchange procedure , increasing procedure cost .", "in addition to the requirement for larger than expected doses of heparin , the mtpe procedures in this small cohort were very time consuming .", "mtpe took longer to set up and was more frequently complicated by the time and resource consuming need to change the extracorporeal circuit .", "this is problematic when expensive ffp with a limited shelf life is required for the exchange .", "a heparin bolus of 50 iu / kg and an infusion rate of 10002000 iu / h has been used in tpe without excess clotting .", "the protocol is also similar to that used in the canadian series [ 7 , 8 ] where a bolus of 40 iu / kg ( 2800 iu ) and a constant infusion rate of 20 iu / kg / h were used successfully . in our study , the heparin bolus was somewhat higher in mtpe procedures with clotting ( median : 73 iu / kg ; range : 4893 iu / kg ) and without clotting ( median : 48 iu / kg ; range : 3267 iu / kg ) .", "this difference was not statistically significant ( mann whitney u - test ; p = 0.37 ) .", "the heparin infusion rate was similar with clotting ( median : 19 iu / kg / h ; range : 1333 iu / kg / h ) and without clotting ( median : 21 iu / kg / h ; range : 2127", "iu / kg / h ; p = 0.12 ) . we can therefore conclude that clotting was not due to underdosing of heparin in these cases .", ". suggest that every unit of heparin administered increased the risk for complications by 0.3% . however , the heparin dose used in the bramlage study at which complications started to decline , was significantly lower than that in our observations .", "it is highly likely that the circuit used contributes to the heparin requirement in the published observations .", "we also need to point out that during mtpe , antithrombin iii is removed from the circuit . as a result , heparin will therefore be less effective . in figure 2", ", all findings regarding clotting are summarized . with a heparin bolus at or below 2000 iu", ", clotting occurred in 67% of treatments , dropping to 25% with a bolus of > 2000 iu .", "below 2000 iu / h , 83% of mtpe procedures clotted . at or > 2000", "iu / ml , this proportion dropped to 13% . in our experience of centrifugal tpe", "transient hypocalcaemia effects can be counteracted by giving a bolus of calcium gluconate . to prevent hypocalcaemia", ", we used a continuous calcium gluconate 10% infusion , based on pre - tpe serum calcium levels . \n", "proportion of clotting in mtpe and ctpe procedures . in two out of three patients ,", "it is unclear to what extent a decline in platelet counts during a course of tpe is related to heparin exposure , bone marrow suppression secondary to therapeutic immunosuppression , platelet consumption or possibly heparin - induced thrombocytopenia . in patients with diseases which may be associated with pulmonary haemorrhage as was the case for patients 1 and 2 , it seems intuitive to avoid unnecessary heparin and reduce the risk of residual systemic anticoagulation .", "no clotting was observed in the ctpe sessions where the extracorporeal circuit was anticoagulated with acd - a . in this respect ,", "we confirm the results of previous studies using the spectra optia apheresis device [ 10 , 11 ] .", "overall , the main differences in our limited clinical comparison between mtpe and ctpe are related to anticoagulation and ease of use . however , other adverse effects may be more common with mtpe .", "hypotension , fever , haemolysis and chills [ 4 , 13 ] are described in the mtpe series in the literature .", "a retrospective comparison of complement activation using different techniques suggested that less complement activation is seen using centrifugal methods .", "when considering the extra costs of machine purchase and consumables for ctpe , it is worth considering the lower likelihood of clotting of the extracorporeal circuit and therefore having to use fewer consumables and expensive replacement fluids with limited shelf life after thawing . having taken all this into account , we have established for our unit a cost saving of consumables of 8254.40 per year when using ctpe rather than mtpe .", "the impact of increased procedure time , set - up time and treatment duration on nursing resources should also be taken into account ( table 2 and figure 3 ) . \n", "in addition , even though we used central access on the patients reported , the centrifugal device also has the advantage that it can be used with peripheral access and also operates in single needle mode .", "blood flow was somewhat slower with 4060 ml / min and procedure time accordingly somewhat longer , but we could not have treated this patient with our membrane device , as this needed a blood flow of at least 100 ml / min ." ], [ "\n centrifugal tpe with citrate anticoagulation is an alternative to membrane - based tpe and heparin anticoagulation.membrane-based tpe may require substantial doses of heparin to anticoagulate the extracorporeal circuit .", "centrifugal tpe with citrate anticoagulation is an alternative to membrane - based tpe and heparin anticoagulation .", "membrane - based tpe may require substantial doses of heparin to anticoagulate the extracorporeal circuit ." ] ]

[ [ "clinical histories and condition of host dogs : in total , 173 cotton rectal \n swabs were collected from 93 dogs treated at rakuno gakuen university ( rgu ) veterinary \n teaching hospital ( ebetsu , japan ; university hospital ) and from 80 dogs treated at 8 \n companion animal clinics ( 10 samples per clinic , from different dogs ) in the community of \n ebetsu ( community clinics ) from june to december 2005 ( regardless of the clinical condition \n seen for the animal ) .", "all dogs admitted to the university hospital had also visited the \n community clinics previously .", "university hospital cases ( 15 male and 20 female dogs ) included those with tumor , cataract , \n glaucoma , keratitis , hip dysplasia , cushing syndrome and herniated intervertebral discs . \n", "community clinic cases ( 27 male and 24 female dogs ) included those undergoing castration , \n panovario - hysterectomy or treatment for urinary tract infections , cystitis , chronic \n diarrhea , dermatitis , otitis externa , gingivitis , pharyngitis and keratitis .", "dogs were aged \n 016 years ( university dogs : 8.2 3.7 y [ mean sd ] ; community dogs : 5.5 4.2 y ) .", "the \n 6-month history of antimicrobial use prior to sampling was also compared for the 54 dogs \n admitted to the university hospital and the 56 dogs admitted to the community clinics .", "samples were streaked on deoxycholate hydrogen sulfide lactose ( dhl ) \n agar ( nissui , tokyo , japan ) and incubated for 24 hr at 37c .", "colonies of suspected \n e. coli growing on these dhl agar plates were picked and subcultured on \n nutrient agar ( nissui ) .", "after incubation , the biochemical properties of these colonies were \n assessed using triple sugar iron agar ( nissui ) , lysine indole motility medium ( nissui ) and \n cytochrome oxidase tests .", "final identification of e. coli was performed \n using api20e codes ( biomrieux , tokyo , japan ) .", "the 173 canine samples were also assessed on \n dhl agar supplemented with 4 g / ml of enrofloxacin ( enr ; \n bayer , osaka , japan ) .", "susceptibility testing : susceptibilities to a panel of antimicrobials were \n examined using the agar dilution method , according to the guidelines of the clinical and \n laboratory standards institute ( clsi ) . \n", "mueller hinton ( mh ) agar was obtained from oxoid ( basingstoke , u.k . ) .", "ampicillin ( amp ) , \n amoxicillin ( amx ) , cefazolin ( cfz ) , cephalexin ( lex ) , gentamicin ( gen ) , kanamycin ( kan ) , \n dihydrostreptomycin ( dsm ) , oxytetracycline ( otc ) and chloramphenicol ( chl ) were obtained \n from sigma - aldrich ( st . louis , mo , u.s.a . ) , and cefpodoxime ( cpd ) was purchased from daiichi \n sankyo co. , ltd .", "staphylococcus aureus atcc29213 , \n enterococcus faecalis atcc29212 , e. coli atcc25922 and \n pseudomonas aeruginosa atcc27853 were used as controls .", "resistance to dsm ( 32 \n g / ml ) and otc ( 16 \n g / ml ) was microbiologically defined as described in the \n japanese veterinary antimicrobial - resistance monitoring system .", "intermediate interpretations for dsm and otc were defined as having \n two - fold lower minimum inhibitory concentration ( mic ) than those of the resistance category . \n", "phe - arg--naphthylamide ( pan ; sigma - aldrich ; final concentration : 20 \n g / ml ) was used as an efflux - pump inhibitor . organic solvent tolerance :", "organic solvent tolerance ( ost ) was \n investigated as previously described with slight \n modifications .", "an overnight culture of e. coli was diluted with 0.9% nacl \n ( approximately 1 10 cells / ml ) .", "a drop of cell suspension ( 5 \n l ) was spotted onto mh agar medium to form a circle with a diameter of 8 \n mm .", "the surface of the agar was overlaid with a mixture ( 3:1 , 1:1 , or 1:3 [ vol / vol ] ) of \n n - hexane ( 96.0% pure ; kishida chemical co. , ltd .", ", osaka , japan ) and \n cyclohexane ( > 99% pure ; merck kgaa , darmstadt , germany ) to a depth of 3 mm .", "cyclohexane \n is an organic solvent known to be a more effective agent against e. coli \n than n - hexane .", "bacterial growth \n was assessed after the plates were incubated at 37c for 1618 hr in a sealed vessel . \n", "confluent growth of the cells ( confluent ) was considered to be indicative of tolerance to \n the solvent tested .", "when only a few colonies ( < 10 ) grew on the plate or when no growth \n was observed , the cells were considered to be sensitive to the solvent tested \n ( non - confluent ) .", "determination of qrdr mutations , pmqrs , -lactamases and chl - resistance \n genes : mutations in qrdrs of gyra , parc , \n pare and gyrb were examined by direct dna sequencing of \n pcr products , as described by everett et al . .", "pmqr genes ( qnra , qnrb , \n qnrs , aac ( 6 ) ib - cr and qepa ) were \n detected by pcr using specific primers ( table \n 1table 1.sequences of oligonucleotides and fluorescence - labeled oligonucleotides used for \n pcr , direct sequencing and real - time rt - pcr in this studygeneforward primer ( 53)reverse primer ( 53)fluorescent probe ( 53)purposereferencegyraacgtactaggcaatgactggagaagtcgc cgtcgatagaacpcr and sequencinggyrbtgtatgcgatgtctgaactgctcaatagcagctcggaatapcr and sequencingparctgtatgcgatgtc tgaactgctcaatagcagctcggaatapcr and sequencingparetaccgag ctgttccttgtggggcaatgtgcagaccat cagpcr and sequencingqnraagaggatttctcacgccaggtgccaggcacagatcttgacpcrqnrbggmathgaaattcgccactgtttgcygyycgccagtcgaapcrqnrsgcaagttcattgaacagggttctaaaccgtcgagttcggcgpcraac ( 6)-ibttgcgatgctctatgagtggctactcgaatgcctggcgtgtttpcr and sequencingqepaaactgcttgagcccgtagatgtctacgccatggacctcacpcrblatematgagtattcaacattttcgttaccaatgcttaatcagtgpcr and sequencingblashvatgcgttatattcgcctgtgttagcgttgccagtgctcgapcrcata1agttgctcaatgtacctataaccttgtaattcattaagcattctgccpcrcata2acactttgccctttatcgtctgaaagccatcacatactgcpcrcata3ttcgccgtgagcattttgtcggatgagtatgggcaacpcrflorcgccgtcattcctcaccttcgatcacgggccacgctgtgtcpcrcmlattgcaacagtacgtgacatacacaacgtgtacaaccagpcracractatcaccctacgctctatcttcgcgcgcacgaacatacccgaacccggatcacactctrt - pcracrbgcggtcgtgtgaagaaagtttaactcccaacgagaagaggagaatgaccatcagcagcacgaacataccagtrt - pcrthis studytolcggtacgttgaacgagcaggatcccatcagcaatagcattctgttccctggcactgaacaatgcgctgagcaart - pcrthis studygapaaaaggcgctaacttcgacaagaacggtggtcatcagacctcaacgataacttcggcatcart - pcrthis studya ) m , a , or c ; h , a , or c or t ; y , c , or t. ) and direct dna sequencing [ 4 , 15 , 21 ] . to \n identify the amp - resistance mechanism , -lactamase genes , viz .", ", \n blatem and blashv , were detected \n by pcr and direct dna sequencing .", ", cata1 , cata2 , cata3 , \n flor and cmla , were detected by pcr as described in \n previous studies [ 17 , 27 ] .", "nucleotide sequences were determined using a bigdye terminator v3.1 cycle \n sequencing kit with a 3130 genetic analyzer ( applied biosystems , foster city , ca , \n u.s.a . ) .", "a ) m , a , or c ; h , a , or c or t ; y , c , or t. real - time reverse transcription - pcr : overnight cultures of e. \n coli isolates were diluted 1:100 in lb broth and grown to the mid - logarithmic \n phase .", "rna was isolated using an rneasy mini kit ( qiagen , hilden , germany ) according to the \n manufacturer s instructions and stored at 80c until used .", "the concentration of rna was \n determined spectrophotometrically ( biospectrometer , eppendorf , hamburg , germany ) .", "gene \n expression ( acra , acrb and tolc ) was \n estimated by quantitative reverse transcription ( rt ) taqman - pcr .", "the respective primer pairs \n and probes ( table 1 ) used for \n acrb , tolc and gapa in this study were \n designed according to the sequence of e. coli strain k12 substrain mg1655 , \n which is deposited in genbank ( accession number u00096 ) .", "the probes were labeled by the \n manufacturer ( sigma - aldrich ) with the reporter dye 6-carboxyfluorescein ( 6-fam ) at the \n 5-end and with the quencher dye 6-carboxytetramethylrhodamine ( tamra ) at the 3-end . \n", "purified rna ( 2.5 ng ) was used in one - step rt and real - time pcr \n amplification .", "rt - pcr amplification mixtures ( 20 l ) contained purified \n rna , 2 quantitect probe rt - pcr master mix , 0.2 l of quantitect rt mix \n ( quantitect probe rt - pcr kit , qiagen ) , 0.2 m of probe and 0.5 \n m forward and reverse primers .", "the cycle conditions comprised 20-min \n reverse transcription at 50c ; a 15-min initial activation step at 95c ; and 45 cycles each \n of 55c for 1 min and at 60c for 30 sec in a lightcycler 480 ( roche , mannheim , germany ) . \n", "e. \n coli strain ag100 ( k-12 arge3 thi-1 rpsl xyl mtl d \n ( gal - uvrb)supe44 ) was kindly donated by dr helen i. \n zgurskaya ( university of oklahoma , norman , ok , u.s.a . ) and used as a reference strain .", "statistical analysis : statistical significance of differences between the \n isolates obtained from dogs admitted to the 2 types of treatment facilities was determined \n by student s t - test and fisher s exact test ." ], [ "antimicrobial - resistance profile of canine e. coli isolates : there was a \n significant difference in the ages ( p<0.05 ) , but not in the gender \n distribution of the dogs admitted to the university hospital or the community clinics .", "seventy - four e. coli isolates were obtained from 93 rectal samples from \n dogs admitted to the university hospital ( 79.6% ) and 66 isolates from 80 rectal samples \n obtained from dogs admitted to the community clinics ( 82.5% ) , after culture on dhl agar \n plates that had not been supplemented with enr .", "there was no significant difference in the \n frequency of e. coli isolation between dogs admitted to the 2 types of \n treatment facilities ( p>0.05 ) .", "of all the canine e. coli isolates , 44.3% ( 62 of 140 isolates ) were \n resistant to at least 1 antimicrobial agent tested with aminopenicillin resistance being the \n most frequent ( approximately 30% ) ; approximately 50% of aminopenicillin - resistant isolates \n were also resistant to cephalosporins ( cfz and cpd ) .", "although there was no significant \n difference in the rate of resistance to amp or amx between isolates derived from university \n hospital cases and isolates derived from community clinics cases , when considering isolates \n with resistance as well as those with an intermediate interpretation to amp and amx , this \n rate was significantly more prevalent in the university hospital than in the community \n clinics samples ( p<0.05 , table \n 2table 2.antimicrobial susceptibility of e. coli strains derived from \n dogs attending rakuno gakuen university veterinary teaching hospital ( rgu ; university ) \n and animal clinics in the community ( community)antimicrobial(break point , \n g / ml)groupsrange(g / ml)mic50(g / ml)mic90(g / ml)number of strains ( % ) siri + ramp(32)university2>1284>12844 ( 59.5)*4 ( 5.4)26 ( 35.1)30 ( 40.5)*community0.5>1284>12850 ( 75.8)016 ( 24.2)16 ( 24.2)amx(32)university1>12816>12832 ( 43.2)**15 ( 20.3)**27 ( 36.5)42 ( 56.8)**community4>1284>12850 ( 75.8)016 ( 24.2)16 ( 24.2)cfz(32)university1>1282>12861 ( 82.4)1 ( 1.4)12 ( 16.2)13 ( 17.6)community1>1282>12857 ( 86.3)09 ( 13.6)9 ( 13.6)lex(32)university8>1288>12854 ( 73.0)5 ( 6.8)15 ( 20.3)20 ( 27.0)community4>1288>12847 ( 71.2)9 ( 13.6)10 ( 15.1)19 ( 28.8)cpd(8)university<0.125>1280.512862 ( 83.8)012 ( 16.2)12 ( 16.2)community0.25>1280.512857 ( 86.4)09 ( 13.6)9 ( 13.6)kan(64)university1>12823266 ( 89.2)1 ( 1.4)7 ( 9.5)8 ( 10.8)community2>1282>12859 ( 89.4)07 ( 10.6)7 ( 10.6)gen(16)university0.5>1281867 ( 90.5)07 ( 9.5)7 ( 9.5)community0.5641262 ( 93.9)04 ( 6.1)4 ( 6.1)dsm(32)university2>1284>12855 ( 74.3)1 ( 1.4)18 ( 24.3)19 ( 25.7)community2>1284>12848 ( 72.7)1 ( 1.5)17 ( 25.8)18 ( 27.3)otc(16)university2>1282>12856 ( 75.7)3 ( 4.1)15 ( 20.3)18 ( 24.3)community1>1282>12850 ( 75.8)016 ( 24.2)16 ( 24.2)chl(32)university4>12886454 ( 73.0)*9 ( 12.2)11 ( 14.9)*20 ( 27.0)*community4>1288861 ( 92.4)3 ( 4.5)2 ( 3.0)5 ( 7.6)enr(4)university0.011280.036459 ( 79.7)*015 ( 20.3)*15 ( 20.3)*community0.01640.031661 ( 92.4)05 ( 7.5)5 ( 7.6)amp : ampicillin , amx : amoxicillin , cfz : cefazolin , chl : chloramphenicol , cpd : \n cefpodoxime , dsm : dihydrostreptomycin , enr : enrofloxacin , gen : gentamicin , kan : \n kanamycin , lex : cephalexin , otc : oxytetracycline .", "the prevalence of chl - resistant and enr - resistant isolates was also \n significantly higher in the university hospital than in the community clinics samples ( table 2 ) .", "amp : ampicillin , amx : amoxicillin , cfz : cefazolin , chl : chloramphenicol , cpd : \n cefpodoxime , dsm : dihydrostreptomycin , enr : enrofloxacin , gen : gentamicin , kan : \n kanamycin , lex : cephalexin , otc : oxytetracycline .", "p<0.05 , * * p<0.01 ; difference \n versus community . in terms of susceptibilities to aminopenicillin and chl among the 15 enr - resistant isolates \n derived from the university hospital samples , 7 isolates showed resistance and/or \n intermediate interpretation to aminopenicillin , as well as resistance to chl .", "six of these \n isolates showed resistance and/or intermediate interpretation to aminopenicillin , but \n susceptibility to chl , while the remaining 2 isolates showed susceptibility to both \n aminopenicillin and chl ( data not shown ) . among the 5", "enr - resistant isolates derived from \n the community clinics samples , 1 isolate showed both resistance to aminopenicillin and chl , \n and 4 isolates showed resistance and/or an intermediate interpretation to aminopenicillin , \n but susceptibility to chl ( data not shown ) .", "the prevalence of resistance to aminoglycosides \n ( kan , gen and dsm ) and otc was not significantly different between isolates derived from the \n university hospital cases and from the community clinics cases .", "enr - resistant isolates \n frequently demonstrated concomitant resistance to aminopenicillins , cephalosporins , gen , dsm \n and chl ( table 3table 3.prevalence of concomitant antimicrobial resistance on enr - resistant e. \n coli isolates derived from non - supplemented agarisolatesprevalence of concomitant resistance ( % ) ampamxcezlexcpdkangendsmotcchlenr - resistant ( 20)90.0**90.0**75.0**80.0**70.0**15.030.0**65.0**35.040.0**enr - susceptible ( 120)20.020.85.07.55.89.24.218.320.02.5amp : ampicillin , amx : amoxicillin , cfz : cefazolin , chl : chloramphenicol , cpd : \n cefpodoxime , dsm : dihydrostreptomycin , enr : enrofloxacin , gen : gentamicin , \n kan,:kanamycin , lex : cephalexin , otc : oxytetracycline . \n *", "prevalence of ost was significantly higher in isolates from the university \n hospital cases than from the community clinics cases ( table 4table 4.organic solvent tolerance ( ost ) of e. coli strains derived from \n dogs in attending rakuno gakuen university veterinary teaching hospital ( rgu ; \n university ) and animal clinics in the community ( community)ost(n - hexane : cyclohexane)groupsnon - confluentconfluent3:1university32 ( 43.2)**42 ( 56.8)**community55 ( 83.3)11 ( 16.7)1:1university60 ( 81.1)**14 ( 18.9)**community63 ( 95.5)3 ( 4.5)1:3university67 ( 90.5)7 ( 9.5)*community65 ( 98.5)1 ( 1.5)values indicate the number of e. coli isolates and ( percentage of \n the total ) . *", "amp : ampicillin , amx : amoxicillin , cfz : cefazolin , chl : chloramphenicol , cpd : \n cefpodoxime , dsm : dihydrostreptomycin , enr : enrofloxacin , gen : gentamicin , \n kan,:kanamycin , lex : cephalexin , otc : oxytetracycline . \n *", "values indicate the number of e. coli isolates and ( percentage of \n the total ) .", "the average number of antimicrobials used for each dog was significantly higher in the \n university hospital than in the community clinics cases ( table 5table 5.status of antimicrobial use in dogs attending rakuno gakuen university veterinary \n teaching hospital ( rgu ; university ) and animal clinics in the community \n ( community)antimicrobial useuniversitycommunityaverage number of antimicrobialsused for each dog1.4**0.8frequency of dogs treatedby fluoroquinolone24.1%**14.3%frequency of dogs treatedby all antimicrobials74.1%**50.0%we could obtain antimicrobial use history for 6 months prior to sampling from 54 dogs \n in the university and 56 dogs in the community .", "the frequencies of dogs treated with any antimicrobials and with \n fluoroquinolones were also significantly higher in the university hospital than in the \n community clinics cases ( table 5 ) .", "in addition , \n prevalence of fluoroquinolone - resistant isolates was significantly higher in dogs that had \n been treated with fluoroquinolones compared with that in dogs that had not been treated with \n this agent ( p<0.05 ; data not shown ) .", "we could obtain antimicrobial use history for 6 months prior to sampling from 54 dogs \n in the university and 56 dogs in the community . *", "isolation of fluoroquinolone - resistant e. coli using enr - supplemented dhl agar \n plates : to investigate fluoroquinolone - resistance mechanisms and the occurrence \n of multidrug resistance involving fluoroquinolone , we selected enr - resistant e. \n coli on enr - supplemented dhl agar plates ( fig . \n 1fig .", "1.influence of enrofloxacin selection on isolation frequencies of e. \n coli isolated from canine rectal samples .", "amp , ampicillin ; amx , \n amoxicillin ; cfz , cefazolin ; chl , chloramphenicol ; cpd , cefpodoxime ; dsm , \n dihydrostreptomycin ; enr , enrofloxacin ; gen , gentamicin ; kan , kanamycin ; lex , \n cephalexin ; otc , oxytetracycline . * statistical difference for isolation with \n deoxycholate hydrogen sulfide lactose ( dhl ) medium without antimicrobials ; \n p<0.05 . ) .", "rate of resistance to aminopenicillins , cephalosporins , gen , dsm , otc and chl was \n significantly higher in isolates obtained from enr - supplemented dhl agar plates than those \n obtained from dhl agar plates that had not been supplemented with enr .", "isolates obtained \n from enr - supplemented dhl agar plates were most frequently amp resistant .", "influence of enrofloxacin selection on isolation frequencies of e. \n coli isolated from canine rectal samples .", "amp , ampicillin ; amx , \n amoxicillin ; cfz , cefazolin ; chl , chloramphenicol ; cpd , cefpodoxime ; dsm , \n dihydrostreptomycin ; enr , enrofloxacin ; gen , gentamicin ; kan , kanamycin ; lex , \n cephalexin ; otc , oxytetracycline . * statistical difference for isolation with \n deoxycholate hydrogen sulfide lactose ( dhl ) medium without antimicrobials ; \n p<0.05 .", "we further characterized the 31 e. coli isolates derived from \n enr - supplemented dhl agar plates ( table \n 6table 6.characterization of antimicrobial and organic solvent susceptibility , qrdr \n mutations , existence of resistant genes and expression levels of acrab in e. \n coli isolates derived by enr - supplemented agarstraincanine case historyantimicrobial usefor 6 monthsbefore samplingqrdr mutationsmic ( g / ml)-lactamasegenepmqrcp - resistancegeneexpression levelgyraparcpareampcpdenrchlacraacrbtolcs83d87s80e84a108university groupre18mastocytomacfz , lexlnig-->128>128128 ( 16)32 ( 16)n.d.n.d.n.d.2.623.763.27re21abdominal tumoramp , cfz , lex , enrlnig-->128>128128 ( 32)>128n.d.n.d.cata12.313.774.65re28rhabdomyosarcomacfz , lexlnig-->128>128128 ( 32)64 ( 16)blatem-1n.d.n.d2.177.133.46re33mastocytomacfz , lex , ofxlnig-->128>128128 ( 32)>128blatem-1n.d.cata12.8114.295.88re61herniated intervertebral discslexlnig-->1280.564 ( 8)16 ( 8)blatem-1n.d.n.d.1.432.343.21re63unknownamplnig--16 ( 8)264 ( 8)16 ( 8)n.d.n.d.n.d.0.752.681.87re20lung tumoramc , cfz , enrlniv-->128>12832 ( 4)16 ( 8)blatem-1n.d.n.d.2.162.93.95re2tumor of the breastgen , frmlni - t->128>128128 ( 16)32 ( 16)n.d.n.d.n.d.2.82.874.07re72glaucomacfz , ofx , orblni - t->128164 ( 8)16 ( 8)blatem-1n.d.n.d.0.890.961.77re80oral tumornonelni - t->128164 ( 8)16 ( 8)blatem-1n.d.n.d.1.021.011.72re4osteosarcomaamp , amx , frmlni -- e460a>128>12864 ( 16)>128blatem-1n.d.cata11.361.52re64oral tumorcfzlni -- e460a>1280.564 ( 16)>128blatem-1n.d.cata10.761.081.7re65unknownnonelni -- e460a>1280.564 ( 16)>128blatem-1n.d.cata10.81.041.29re22multiple myelomaenr , minlni -- s458a>1284128 ( 16)16 ( 8)blatem-1n.d.n.d.1.941.672.55re26unknowncfz , lexlni---4 ( 4)0.2516 ( 8)8 ( 4)n.d.n.d.n.d.1.11.582.36re50keratitisofx , orblni--->128>128128 ( 16)16 ( 8)blatem-1n.d.n.d.1.321.652.74re54biopsy of vertebral bodycfzlni--->128232 ( 16)>128blatem-1n.d.cata11.542.674.09re17cushing syndromecfzlwig--16 ( 8)164 ( 8)16 ( 8)n.d.n.d.n.d.1.362.763.87re39herniated intervertebral discsamplwig-->128>128256 ( 16)>128blatem-1n.d.cata11.183.283.74total ( % ) r84.263.110052.6 * 1.83 * 3.48**3.06**i + r94.752.610094.7**(13.9)(8.6*)community groupce7otitis externalex , genlnia-->128>128128 ( 16)>128n.d.n.d.cata10.881.42.01ce5unknownnonelnig-->1282128 ( 16)16 ( 8)blatem-1n.d.n.d.1.441.631.22ce6unknownlex , cfz , genlnig-->128>12864 ( 4)8 ( 4)n.d.n.d.n.d.0.250.370.43ce10diarrheanonelniv--4 ( 4)0.564 ( 8)4 ( 2)n.d.n.d.n.d.0.632.122.02ce14unknownnonelniv-->1280.5128 ( 16)4 ( 2)blatem-1n.d.n.d.0.841.261.6ce1unknownnonelni - t->128>12864 ( 8)16 ( 8)blatem-1n.d.n.d.0.91.271.32ce9otitis externalex , gen , lvxlni -- e460a>128>12832 ( 8)16 ( 8)blatem-1n.d.n.d.1.71.891.72ce12gingivitisclilni -- s458t>1280.532 ( 4)4 ( 4)blatem-1n.d.n.d.1.341.711.52ce13diarrheasxtlni -- s458a>1282128 ( 8)8 ( 4)n.d.aac ( 6)-ib - crn.d.0.240.460.56ce3pharyngitisamp , lex , ofxlgr--->1283232 ( 8)8 ( 4)blatem-1n.d.n.d.0.911.61.82ce4unknownnonelgr--->1283232 ( 4)8 ( 8)blatem-1n.d.n.d.0.50.91.25ce8keratitislex , lvxlgi--->128>12832 ( 8)8 ( 4)n.d.n.d.n.d.0.951.511.7total ( % ) r91.758.31008.30.971.341.43i + r91.766.710033.3(8.0)(4.6)amc : amoxicillin - clavulanic acid , cli : clindamycin , frm : fradiomycin , lvx : \n levofloxacin , min : minocycline , ofx : ofloxacin , orb : orbifloxacin , sxt : \n trimethoprim - sulfamethoxazole .", "b ) \n wild - type c ) fold - reduction of mic by pan .", "e ) mrna expression \n levels derived from real - time rt - pcr ( relative amount of ag100 ) . \n", "* p<0.05 , * * p<0.01 ; statistical difference \n versus community group . ) .", "all enr - resistant isolates had nucleotide substitutions in qrdrs accompanied \n by changes in 3 or 4 amino acids in qrdrs .", "the aac ( 6 ) ib - cr , one of the \n genes encoding pmqrs , was detected in only 1 strain . in total , more than 70% of the \n enr - resistant isolates had resistance or intermediate interpretation to amp and/or chl , and \n 74% of isolates with an amp mic of>128 g / ml possessed \n blatem-1 , and 100% of isolates with a chl mic of>128 \n g / ml possessed cata1(table 6 ) .", "expression levels of \n acra , acrb and tolc and the effect of \n pan were higher in chl resistance and chl intermediate interpretable isolates than in \n chl - susceptible isolates ( table 6 ) . isolates \n exhibiting ost had high acrb expression , while isolates with an \n intermediate interpretation to amp also exhibited ost and had higher acrb \n expression than did isolates that were amp - susceptible ( data not shown ) .", "amc : amoxicillin - clavulanic acid , cli : clindamycin , frm : fradiomycin , lvx : \n levofloxacin , min : minocycline , ofx : ofloxacin , orb : orbifloxacin , sxt : \n trimethoprim - sulfamethoxazole .", "b ) \n wild - type c ) fold - reduction of mic by pan .", "e ) mrna expression \n levels derived from real - time rt - pcr ( relative amount of ag100 ) . \n", "* p<0.05 , * * p<0.01 ; statistical difference \n versus community group . among dogs from which we isolated e. coli on enr - supplemented dhl agar \n plates ,", "the frequency of dogs treated with any antimicrobials was significantly higher in \n the university hospital ( 89.5% ) than in the community clinics ( 58.3% ) cases ( table 6 ) .", "in contrast , the frequency of dogs treated \n with fluoroquinolones was not significantly different between the university hospital \n ( 31.6% ) and community clinics ( 25.0% ) cases .", "twenty - seven of 31 e. coli \n isolates obtained on enr - supplemented dhl agar plates showed resistance or an intermediate \n interpretation to amp and/or chl . among the 27 dogs from which we isolated e. \n coli with resistant or an intermediate interpretation to amp and/or chl on \n enr - supplemented dhl agar plates ,", "18 dogs had been treated with fluoroquinolone and/or \n -lactam antimicrobials ( table 6 ) ." ], [ "in this study , e. coli isolates with resistant or an intermediate \n interpretation to aminopenicillins , chl or fluoroquinolone were more frequently obtained \n from dogs admitted to the universal hospital than from those admitted to the community \n clinics . remarkably , isolates with resistance to fluoroquinolones", "more frequently showed \n resistance to aminopenicillins , cephalosporins , gen , dsm and chl , as compared with \n fluoroquinolone - susceptible isolates .", "this result suggested that the difficulty of providing \n effective antimicrobial treatment increases in secondary medical care .", "it indicated a need \n to investigate the mechanism underlying the emergence of this multidrug - resistance \n phenotype . to characterize in detail the fluoroquinolone - resistant isolates obtained from the \n university hospital and community clinics studied here , we investigated \n antimicrobial - resistance mechanisms of e. coli isolates derived from dogs \n using enr - supplemented dhl agar plates .", "all enr - resistant isolates obtained from \n enr - supplemented dhl agar plates possessed 3 or 4 mutations in qrdrs .", "a previous study \n showed that in vitro exposure to fluoroquinolone caused mutations in qrdrs \n and acrab ", "this may indicate \n that in vivo fluoroquinolone exposure can also cause an increase in \n fluoroquinolone - resistant e. coli possessing multiple mutations in qrdrs \n and acrab tolc overexpression .", "indeed , prevalence of fluoroquinolone - resistant isolates was \n significantly higher in dogs that had been treated with fluoroquinolones compared with that \n in dogs that had not been treated with this agent , as determined using on dhl agar plates \n that had not been supplemented with enr .", "moreover , fluoroquinolone - resistant isolates \n derived from the university hospital had higher levels of acra , \n acrb and tolc expression than did such isolates obtained \n from the community clinics , as determined using enr - supplemented dhl agar plates .", "these \n findings suggested that the high prevalence of fluoroquinolone - resistant e. \n coli isolates derived from the university hospital may have been caused by \n frequent fluoroquinolone use in the university hospital and/or continuous fluoroquinolone \n use in the community clinics and the university hospital .", "this may have resulted in \n development of a mechanism that decreased fluoroquinolone susceptibility , viz . , \n overexpression of acrab tolc . in this study ,", "chl , in addition to enr was another agent to which isolates derived from the \n university hospital showed a significantly higher prevalence of resistance than did those \n derived from the community clinics .", "all enr - resistant isolates with a chl mic of > 128 \n g / ml that had been derived from enr - supplemented dhl \n agar plates possessed cata1 .", "however , other resistant isolates with a chl \n mic of 32 and 64 g / ml and an intermediate interpretation \n isolates with a chl mic of 16 g / ml did not possess any \n specific chl - resistance gene . among all antimicrobial agents that we tested , isolates with \n enr resistance were most frequently co - resistant to aminopenicillins , and all the isolates \n showing resistance to amp , but not to cepharosporins , possessed \n blatem-1 .", "however , isolates with intermediate interpretation \n to amp did not possess any of the -lactamase genes for which we tested .", "these results \n indicated that the main resistance mechanisms for fluoroquinolones , amp and chl involved by \n acquisition of mutations in qrdrs and a resistance - associated gene , e.g. , \n blatem-1 or cata1 , although there may also be \n other mechanisms that decreased their susceptibilities and conferred co - resistance to these \n agents . to evaluate the mechanism underlying decreased susceptibilities and co - resistance to \n fluoroquinolone , aminopenicillins and chl , we investigated acrab tolc function , because \n acrab tolc is a major resistance nodulation division ( rnd ) family - type efflux pump that \n excretes several antimicrobials [ 14 , 19 , 20 ] .", "acrab \n overexpression increases the mics of aminopenicillins and chl to an intermediate \n interpretation ( 16 g / ml ) or resistance ( 32 or 64 \n g / ml ) level , and its effect is not limited to \n fluoroquinolone resistance [ 13 , 21 ] .", "tolc is also known to cause the efflux of several organic \n solvents , which cause cell death by breaking down microbial membranes ; therefore , investigation of ost is useful for identifying e. \n coli isolates that have active acrab tolc .", "we observed that ost isolates with higher acrb expression \n and isolates with an intermediate interpretation to aminopenicillins and chl , as well as \n isolates resistant to aminopenicillins and/or with chl mics of 32 and 64 \n g / ml , also exhibited ost and higher \n acrb expression than did susceptible isolates , as seen by analysis using \n enr - supplemented dhl agar plates", ". a higher prevalence of isolates with ost , decreased \n aminopenicillin susceptibility and decreased chl susceptibility , was observed in isolates \n obtained from university hospital compared to those from community clinics cases , as seen on \n agar plates without enr supplementation .", "tolc function contributes to a decrease in susceptibility to aminopenicillins and chl \n mics in some e. coli isolates obtained from dogs .", "our study revealed that the frequency of total antimicrobial treatment as well as \n fluoroquinolone use was significantly higher in the university hospital than in the \n community clinics .", "this evidence suggested that the frequent use of antimicrobials in dogs \n admitted to the university hospital and/or their continuous use in dogs moving from the \n community clinics to the university hospital facilitate selection of antimicrobial resistant \n e. coli strains with qrdr mutations , beta - lactamase gene and \n cata1 .", "in addition , our study also revealed that dogs admitted to the \n university hospital tend to be treated with multiple antimicrobials .", "indeed , our \n results showed that enr - resistant e. coli isolates had higher rates of \n resistance to several antimicrobials compared with enr - susceptible e. coli \n isolates , and enr - resistant isolates derived from the university hospital cases on \n enr - supplemented dhl agar showed a stronger development of the acrab ", "tolc than did \n enr - resistant e. coli isolates derived from the community clinics cases .", "we \n considered that these findings substantially reflect the situation in japanese companion \n animal medicine , because the samples in this study were successively .", "in addition , a \n previous study also showed that amp or enr treatment led to the emergence of \n aminopenicillin enr chl - resistant e. coli isolates in dogs in the united \n states [ 2 , 8 ] . \n", "moreover , fluoroquinolone aminopenicillin chl - resistant e. coli isolates \n with overexpression of acrab tolc were frequently isolated from humans in university \n hospitals .", "these findings indicate that the \n emergence of this multidrug - resistant phenotype may mirror the same phenomenon in human and \n companion animal clinical fields in several countries in some cases . in these cases , a \n clearer strategy for choice and use of antimicrobials suitable to treatments is required in \n order to prevent the emergence and spread of these fluoroquinolone - resistant e. \n coli with decreased susceptibilities to several other antimicrobials . in \n particular", ", we suggest that it may be important to share the history of antimicrobials usage \n across the first and secondary medical care settings of companion animals to avoid treatment \n with several antimicrobials in the same period and to avoid extensive , continuous treatment \n with the same class antimicrobial . in conclusion , this study revealed that the higher prevalence of concomitant resistant and \n intermediate interpretations to fluoroquinolones , aminopenicillins and chl in isolates from \n the university hospital than in isolates from the community clinics was due not only to the \n acquisition of specific resistance mechanisms , such as -lactamases , cata1 \n and qrdr mutations , but also to overexpression of the acrab tolc efflux pump in canine \n e. coli ." ] ]

[ [ "when you hear hoofbeats , think of horses not zebras , the art of medicine is based on soundness : the higher the pretest probability , the sounder the diagnosis .", "the problem with this medical aphorism is that it actively encourages the clinician to turn a deaf ear ( and a blind eye ) to the possibility of lesser known and , therefore , more easily overlooked disease states that mimic or ", "this report presents a case in point : a 47-year - old woman with triple - negative breast cancer on a clinical trial called primetime ( nct02518958 ) who received the anti - pd-1 inhibitor nivolumab and the experimental anticancer agent rrx-001 for 18 weeks ; initially treated for pneumonitis , an ", "expected autoimmune complication of nivolumab , based on the development of dyspnea and ct abnormalities . the overall clinical picture , nevertheless , was atypical , which prompted the investigating team to aggressively pursue alternate possibilities , ultimately leading to the correct diagnosis : pulmonary tumor thrombotic microangiopathy or pttm .", "this example highlights the importance of exercising due diligence and not automatically jumping to conclusions with regard to the diagnosis of immune - related adverse events ( iraes ) such as pneumonitis during treatment with pd-1 or ctla-4 inhibitors .", "analogous to another pulmonary medical aphorism , all that wheezes is not asthma , the differential diagnosis for breathlessness in the context of immune checkpoint inhibition is broader than only pneumonitis and should involve a systematic investigation for other etiologies , including the rare and rapidly progressive disorder pttm . a case history and review of the literature", "are presented for pttm , which we propose to define as a paraneoplastic syndrome ( pns ) . in addition , a potential treatment option based on its pathophysiology is discussed .", "the goal of cytotoxic t - lymphocyte antigen-4 ( ctla-4 ) and programmed death-1 ( pd-1 ) pathway blockade , including nivolumab approved for the treatment of melanoma , squamous - cell lung cancer and renal cell carcinoma , is to overcome the t - cell suppression mediated by these inhibitory receptors ( fig .", "1 ) ; a potential side effect of revving up the immune system to attack malignant tumors is the breaking of self - tolerance and the induction of iraes , which include rash , colitis , hepatotoxicities , endocrinopathies , and interstitial pneumonitis . as the most serious irae ,", "reportedly responsible for 5 total fatalities across the spectrum of nivolumab - treated patients , the incidence of pneumonitis increased from 3.4% on a melanoma trial to 6% on a nsclc clinical trial , according to a recent bristol myers squibb press release ; this increase in incidence should raise the suspicion that increased awareness of and , consequently , narrowed focus on pneumonitis by oncologists has resulted in erroneous overdiagnosis .", "the clinical manifestations of pneumonitis are protean and include fever , chills , malaise , cough , chest tightness , hypoxia , and dyspnea , while the nonspecific radiological characteristics of ground glass opacities ( i.e. , lung opacities that do not obscure the associated vessels ) , consolidations ( i.e. , lung opacities that do obscure the associated vessels ) , and effusions also overlap with multiple other disease entities including acute respiratory distress syndrome , pneumonia , pulmonary embolism ( pe ) , congestive heart failure , and the subject of this case report , pttm .", "pttm is a rare and possibly underdiagnosed extrapulmonary sequella of metastatic cancer , specifically adenocarcinomas , formally described in 1990 by von herbay et al . ", "that presents as acute cor pulmonale , a maladaptive response to pulmonary hypertension , resulting in dyspnea and hypoxemia as well as ground - glass opacity ( or diffuse consolidation ) and pulmonary edema on ct [ 12 , 13 ] .", "the available literature on pttm is sparse , existing mostly as case reports or small case series from japan , with a lack of higher - order treatment studies .", "adenocarcinomas , and gastric cancer in particular , have been linked with pttm in these japanese case reports , which is not surprising , given the high incidence rate of gastric cancer in japan .", "the etiologic mechanism of pttm is related to the intravasation of circulating tumor cells in the pulmonary vasculature ; these circulating tumor cells release a plethora of vascular remodeling factors including vascular endothelial growth factor ( vegf ) , fibroblast growth factor , osteopontin , and platelet derived growth factor ( pdgf ) associated with abnormal endothelial proliferation , the local activation of the coagulation cascade , and the development of pulmonary hypertension from resultant stenosis of the pulmonary capillaries and arterioles ( fig .", "which is only rarely diagnosed antemortem , due to a nearly uniform fatality rate , ( almost all reported patients have died within 2 weeks of dyspnea onset ) , may be suspected in cancer patients ruled out for pe who develop acute or subacute right - sided heart failure , pulmonary hypertension , and abnormal coagulation parameters .", "our nivolumab - treated patient with metastatic triple - negative breast cancer who is the subject of this case report recapitulated these clinical and laboratory abnormalities almost to a t , including , unfortunately , the time interval between onset of first symptoms and death .", "while the term textbook example is not applicable in the context of pttm , since no textbooks on it have been written ( only case reports ) , this patient 's clinical course and trajectory were indeed ", "textbook for pttm , even though a default diagnosis of nivolumab - induced pneumonitis was initially made .", "however , in light of the atypical presentation , discussed below , and findings that did not quite ", "add up , the team , suspecting that pneumonitis was a red herring , decided to trust their intuition , and pursued a further work - up , which ultimately led to the diagnosis of pttm ." ], [ "a 47-year - old female with rapidly progressive refractory triple - negative metastatic breast cancer , metastatic to the lungs , was treated at walter reed on a clinical trial called primetime ( nct02518958 ) where she received the anti - pd-1 inhibitor nivolumab , 3 mg / kg , every other week in combination with weekly rrx-001 , an experimental epi - immunologic agent . during her week 18 infusion on december 3 , 2015 ,", "she developed fever ( 101f , 38.3c ) , headache , palpitations , and diaphoresis ; the presence of fever prompted a sepsis work - up consisting of complete blood count , routine blood culture , urinalysis , and chest x - ray in the hospital to determine the source of the fever and rule out an infection .", "her labs were otherwise significant only for anemia ( hemoglobin 9.4 g / dl and hematocrit 30.6% ) and a normal leukocyte count ( 5.8 10/l ) with a high percentage of segmented neutrophils on the differential ( normal 4373% ) and no bandemia . as part of the work - up for sinus tachycardia ,", "thyroid function tests were performed but thyroid - stimulating hormone ( tsh ) and free t4 were within normal limits .", "her symptoms progressed to dyspnea and hypoxia the next day ( on december 4 , 2015 ) after administration of isotonic normal saline to restore volume .", "chest ct , which had been clear on admission , revealed interlobular septal thickening , diffuse ground - glass attenuation , and bilateral effusions ( fig .", "3 ) . a shortened list of differential diagnoses included atypical viral or bacterial pneumonia , cardiogenic pulmonary edema ( since the patient had received doxorubicin in the past ) , and treatment - induced pneumonitis . on that basis ,", "fluids were withheld , the patient was discontinued from the trial and combination treatment with broad - spectrum empiric antibiotics ( vancomycin , zosyn and levaquin ) and 1 mg / kg prednisone was started .", "however , the antibiotics and corticosteroids were withdrawn a week later due to worsening dyspnea and hypoxia .", "a ventilation - perfusion scan was performed on december 14 , 2015 and read as low probability for pe ( no perfusion defects ) . to identify the cause of the edema ,", "a transthoracic echocardiography was ordered , which revealed a normal left ventricular ejection fraction with right ventricular dilatation and severely reduced right ventricular function secondary to pulmonary hypertension ( a pressure > 50 mm hg is generally accepted as severe and her estimated right ventricular systolic pressure exceeded 65 mm hg ) .", "probnp was also drawn ; it was elevated at 3,226.0 pg / ml , indicative of heart failure ( 5125 nl range ) .", "the presence of acute cor pulmonale pointed away from pneumonitis and strongly suggested three rare possibilities : ( 1 ) occlusion of the pulmonary vessels from microscopic tumor emboli ( also known as pulmonary tumor embolism ) , leading to pulmonary arterial hypertension ( pah ) ; ( 2 ) pttm , a related but even rarer pulmonary vasculopathy , associated with adenocarcinomas of the stomach , pancreas , breast , lung , and liver , in which minute tumor emboli in the peripheral pulmonary arteries damage the vascular endothelium , leading to accelerated coagulation and pah , and ( 3 ) pulmonary venous occlusive disease , the venous form of pah [ 19 , 20 ] , due to fibrous occlusion of the post - capillary vessels , which may or may not be associated with an autoimmune process ( the association is only anecdotal ) . the pulmonary hypertension was managed with diuretics ( furosemide 40 mg i.v . ) , bosentan 62.5 mg , and oxygen ( 2 liters by nasal cannula ) as well as intravenous epoprostenol , norepinephrine , and dobutamine ; however , no improvement was observed .", "since a lung biopsy carried too much risk , the patient was catheterized ; pulmonary artery catheter - derived blood samples were negative for the presence of tumor emboli .", "blood was also drawn for the measurement of coagulation parameters , since pttm is associated with coagulopathy .", "the results were as follows : elevated d - dimer ( or serum fibrin degradation products ) of 1.04 g / ml ( normal < 0.5 g / ml ) and a prolonged prothrombin time of 16.5 s ( normal 1114 s ) .", "platelets were never outside of the normal range . the partial thromboplastin time and thrombin time", "were both prolonged at 67.2 s ( normal 2535 s ) and 48 s ( normal 1420 s ) , respectively , due to treatment with a heparin gtt for potential venous clots . in the setting of adenocarcinoma , pulmonary hypertension , and a negative ct and ventilation - perfusion scan for pe ,", "pttm is distinct from simple embolic obstruction because it is characterized by ( 1 ) the systemic activation of coagulation with the generation of intravascular fibrin and the consumption of procoagulants , leading to a disseminated intravascular coagulation - like picture , present in this case and ( 2 ) remodeling of the pulmonary vasculature due to expression of vegf and pdgf from embolic tumor cells ( see fig .", "2 ) . based on the proposed involvement of vegf and pdgf in the pathogenesis of pttm , the primary investigator planned to treat the patient with sunitinib , which dually inhibits vegf and pdgf pathways" ], [ "the observations in this case study strongly suggest that pd-1-induced pneumonitis should be a diagnosis of exclusion rather than a diagnosis by default , requiring a thorough work - up to rule out conditions that may mimic it , including pe , atypical pneumonia , pulmonary venous occlusive disease , congestive heart failure , and pttm . in the case of this acutely dyspneic patient , who initially received a", " pneumonitis by default diagnosis , pttm was only identified when her shortness of breath deteriorated despite treatment with high dose steroids , alerting the principal investigator to the possibility of heart failure , which led to further investigation .", "the treating oncologist must be alert to the development or presence of pns , defined as a pathology caused by tumor cells , which systematically produce a large amount of hormones , growth factors , cytokines and a variety of specific symptoms .", "these include : cushing syndrome , carcinoid syndrome , dermatomyositis - polymyositis , myasthenia gravis and syndrome of inappropriate antidiuretic hormone . to this list", ", we would add pttm , since its pathogenesis is related to the local release of mitogenic factors associated with vascular remodeling and coagulopathy . as a heretofore unrecognized pns", ", pttm requires background knowledge and a high index of clinical suspicion . in the absence of a biopsy ,", "even though the case under discussion was refractory to standard therapies and the patient died before sunitinib , the multitargeted tyrosine kinase selective for vegf and pdgf receptors , could be started , it is reasonable to assume that early diagnosis and treatment would have resulted in a better outcome ." ], [ "the patient described in this case report has given his informed consent as part of the primetime clinical study ( nct02518958 ) .", "this study protocol has been approved by the walter reed national military medical center institutional review board ." ], [ "" ] ]

[ [ "the new global initiative for chronic obstructive lung disease ( gold ) 2011 system for copd severity assessment added chronic symptoms and exacerbation history to the traditional system of rating the degree of airflow obstruction by spirometry .", "it has been studied in a variety of research cohorts , but its impact in primary care is uncertain . in this analysis of 445 patients with spirometry", "proven copd managed in primary care practices from across the us , we find that the new gold system does reclassify substantial proportions of copd patients as compared to just spirometry alone , but how they are reclassified varies greatly by which symptoms questionnaire is chosen .", "furthermore , the new reclassifications do not have any better agreement with physician s or patient s own impressions about copd severity than the traditional system .", "clinicians and clinical scientists are interested in assessing copd severity to have objective measures of lung impairment , prognostic information , and parameters on which to guide treatment .", "traditionally , copd severity has been solely based on the degree of airflow obstruction , in terms of percent of predicted forced expiratory volume in 1 second ( fev1 ) , as measured by spirometry .", "the use of fev1 to classify the severity of copd was used in drs charles fletcher and richard peto s studies of the natural history of copd in the west london cohort of a half - century ago,1 and spirometry - based severity systems have proven to be valid predictors of survival in many copd cohorts worldwide since then.13 traditional systems that use spirometry to describe copd progression , such as that recommended by the gold committee in its original 2001 guidelines , have also been shown in prospective studies to be predictive of a variety of other clinical outcomes including health - related quality of life,4,5 and the risk for episodes of acute deterioration in lung function known as copd exacerbations.6,7 however , traditional spirometry - based copd severity scales capture only one dimension of respiratory impairment , airflow , and neglect the multiple health dimensions negatively impacted by copd , such as chronic symptoms and comorbidities . the correlations between fev1 and most patient - reported clinical outcomes are not very strong , even in prospective studies comparing changes in lung function to symptoms scores or multi - dimensional measures.810 in the average pulmonary clinic , it is not difficult to find patients who have severe copd by spirometry but are minimally symptomatic , while others with only moderate ", "traditional severity classification systems also do not address how to classify the large number of current and ex - smokers with restrictive spirometry characteristics , whose survival prognosis is at least as poor as those with moderate airflow obstruction.11,12 the limits of using spirometry measures to define copd are also highlighted by the persistent debate about the problem of potential over - diagnosis of copd when the traditional definition of obstruction as an fev1/forced vital capacity ( fvc ) ratio of less than 0.70 is applied to older populations.13 in 2011 the gold committee recommended a new copd assessment system that combines spirometry testing with measures of chronic respiratory symptoms , namely , the copd assessment test ( cat ) or modified british medical research council dyspnea scale ( mmrc),14,15 along with an estimation of the future risk for adverse outcomes , as determined by either the recent history of acute copd exacerbations or the percent of predicted fev1.16 the tiered treatment recommendations that were based on the old spirometry paradigm were also revised to correspond to the new paradigm .", "the goal of these changes was to improve the clinical assessment and management of copd.17 since the introduction of the new gold assessment system there has been interest in understanding how it compares to the traditional spirometry - based staging system , but most studies to date have been conducted with copd patients recruited from university specialty clinics or research cohorts enrolled in longitudinal studies.1829 very few studies have been based on primary care copd populations.30 understanding how the new gold copd assessment system relates to the older spirometry - based severity system is a practical problem for primary care practitioners ( pcps ) who need to be able to rate the severity of their patient s lung disease and communicate that to the patient and to other health care providers.31 the primary objective of this analysis is to examine in a primary - care - based cohort how copd patients staged by the traditional gold spirometry - based severity system are reclassified by the new gold 2011 assessment systems . because the history of exacerbations is an important component of the new gold system , the severity stages and assessment groups are further stratified by exacerbation history .", "we also examine how old and new classification systems align with patients and their pcps perceptions of copd severity ." ], [ "this was a cross - sectional observational study of 899 copd patients treated in individual primary care practices from across the us .", "a total of 95 pcps ( general internal medicine or family practice ) were recruited to participate in the study , and 83 pcps enrolled at least one patient .", "their practice characteristics are described in an earlier report.32 investigators identified potential subjects in electronic records using a stratified random sampling approach ( ie , selection of each nth patient ) to ensure unbiased selection .", "patients aged 40 or older with english language ability and documented care for at least 1 year at the pcp s clinic were included in the study .", "patients were excluded if they had conditions that contraindicated the forced expiratory maneuver needed for spirometry , or were unable to complete study procedures , or had participated in a clinical trial within the prior 12 months . for this analysis , we only included patients who met the american thoracic society ( ats ) definition of spirometry proven copd ( ie , fev1/fvc ratio < 0.70 on tests meeting ats quality standards ) , and who provided all information needed for gold staging and appropriate self - assessment . of the 899 enrolled in the study , eight withdrew before completing spirometry testing , leaving 891 who completed the spirometry phase . of these , only 666 performed spirometry meeting ats quality standards , and provided complete clinical information needed to calculate the new gold stage .", "four hundred and fifty - three of these were confirmed to have spirometry confirmed copd , and of these , only 445 properly completed the self - assessment questionnaire , and thus are the cohort included in these analyses .", "data collection was performed by investigators during a scheduled office visit . during the visit , physicians recorded the patient s clinical history , spirometry results obtained during the visit , and health care resource utilization in a web - based case report form .", "prior to spirometry testing , investigators recorded their global assessment of the patient s copd severity at the time of the study visit on a 5-point scale , ranging from 1 ( no clinical symptoms or disease impact ) to 5 ( very severe ) .", "the 5-point scale was intended to correspond to the original gold copd staging system , which ranged from stage 0 for persons with risk factors or symptoms but no airflow obstruction , and stages 14 ( mild , moderate , severe , and very severe ) for those proven to have airflow obstruction .", "patients completed a paper questionnaire to collect standardized assessments including the cat , mmrc , and a general assessment of severity at the time of the study visit on a 5-point scale , ranging from 1 ( very mild ) to 5 ( very severe ) .", "data were collected from february 2012 to november 2012 . this study was approved and overseen by sterling institutional review board ( atlanta , georgia ) , study number 3,872 .", "sites were provided an electronic , hand - held , microloop portable spirometer and associated spirometry pc software for the study .", "following ats guidelines , relaxed spirometry testing was first used to capture three slow vital capacity results , and then forced spirometry testing was used to capture technically acceptable results for fvc and fev1 .", "up to eight efforts were required from each patient to obtain up to three acceptable tests per ats guidelines .", "all spirometry measurements are reported pre - bronchodilator because it was not feasible to do pre- and post - bronchodilator testing in all clinics .", "patients were asked not to use their copd medications on the morning of the test . predicted values and the percentage of predicted fev1 ( % pfev1 )", "were calculated using national health and nutrition examination survey iii reference values.33 prior to patient enrollment , investigators and study site staff completed real - time , study - specific training via an online meeting platform .", "training addressed study procedures , including standard ats spirometry procedures and use of the microloop spirometer . following enrollment of the first three patients at each study site ,", "spirometry results were sent to an independent respiratory therapist experienced and certified in pulmonary function testing for quality control review .", "patients were classified into their traditional obstruction severity stage ( stages 14 , described as mild , moderate , severe , and very severe , respectively ) based on their % pfev1 using gold guidelines.16 patients were classified into their new gold mmrc grade ( abcd ) , and their gold cat grade ( abcd ) , by stratifying them by their % pfev1 and their mmrc or cat scores , as per the new gold recommendations . finally , we also classified patients by their pcps recorded history of exacerbations within the last 12 months .", "pcp and patient s self - assessed overall severity ratings were also used for classification .", "very few patients were self - described as very mild or physician - described as no clinical symptoms or disease impact ", ", so these were combined with the mild or stage 1 category for all comparisons .", "statistical comparisons of continuous variables were made with student s t - tests and analysis of variance , as appropriate .", "counts and percentages were compared using chi - square analyses . to compare agreement between perceived severity measures and the spirometry - based severity results ,", "this approach evaluates disagreement between levels of severity and provides a summary result ranging from 0 ( no agreement ) to 1 ( perfect agreement ) .", "all analyses utilized a two - sided p of 0.05 for significance and were performed using sas 9.2 ." ], [ "this was a cross - sectional observational study of 899 copd patients treated in individual primary care practices from across the us .", "a total of 95 pcps ( general internal medicine or family practice ) were recruited to participate in the study , and 83 pcps enrolled at least one patient .", "their practice characteristics are described in an earlier report.32 investigators identified potential subjects in electronic records using a stratified random sampling approach ( ie , selection of each nth patient ) to ensure unbiased selection .", "patients aged 40 or older with english language ability and documented care for at least 1 year at the pcp s clinic were included in the study .", "patients were excluded if they had conditions that contraindicated the forced expiratory maneuver needed for spirometry , or were unable to complete study procedures , or had participated in a clinical trial within the prior 12 months . for this analysis , we only included patients who met the american thoracic society ( ats ) definition of spirometry proven copd ( ie , fev1/fvc ratio < 0.70 on tests meeting ats quality standards ) , and who provided all information needed for gold staging and appropriate self - assessment . of the 899 enrolled in the study , eight withdrew before completing spirometry testing , leaving 891 who completed the spirometry phase . of these , only 666 performed spirometry meeting ats quality standards , and provided complete clinical information needed to calculate the new gold stage .", "four hundred and fifty - three of these were confirmed to have spirometry confirmed copd , and of these , only 445 properly completed the self - assessment questionnaire , and thus are the cohort included in these analyses ." ], [ "data collection was performed by investigators during a scheduled office visit . during the visit , physicians recorded the patient s clinical history , spirometry results obtained during the visit , and health care resource utilization in a web - based case report form . prior to spirometry testing , investigators recorded their global assessment of the patient s copd severity at the time of the study visit on a 5-point scale , ranging from 1 ( no clinical symptoms or disease impact ) to 5 ( very severe ) .", "the 5-point scale was intended to correspond to the original gold copd staging system , which ranged from stage 0 for persons with risk factors or symptoms but no airflow obstruction , and stages 14 ( mild , moderate , severe , and very severe ) for those proven to have airflow obstruction .", "patients completed a paper questionnaire to collect standardized assessments including the cat , mmrc , and a general assessment of severity at the time of the study visit on a 5-point scale , ranging from 1 ( very mild ) to 5 ( very severe ) .", "data were collected from february 2012 to november 2012 . this study was approved and overseen by sterling institutional review board ( atlanta , georgia ) , study number 3,872 ." ], [ "sites were provided an electronic , hand - held , microloop portable spirometer and associated spirometry pc software for the study .", "following ats guidelines , relaxed spirometry testing was first used to capture three slow vital capacity results , and then forced spirometry testing was used to capture technically acceptable results for fvc and fev1 .", "up to eight efforts were required from each patient to obtain up to three acceptable tests per ats guidelines .", "all spirometry measurements are reported pre - bronchodilator because it was not feasible to do pre- and post - bronchodilator testing in all clinics .", "patients were asked not to use their copd medications on the morning of the test . predicted values and the percentage of predicted fev1 ( % pfev1 )", "were calculated using national health and nutrition examination survey iii reference values.33 prior to patient enrollment , investigators and study site staff completed real - time , study - specific training via an online meeting platform .", "training addressed study procedures , including standard ats spirometry procedures and use of the microloop spirometer .", "following enrollment of the first three patients at each study site , spirometry results were sent to an independent respiratory therapist experienced and certified in pulmonary function testing for quality control review ." ], [ "patients were classified into their traditional obstruction severity stage ( stages 14 , described as mild , moderate , severe , and very severe , respectively ) based on their % pfev1 using gold guidelines.16 patients were classified into their new gold mmrc grade ( abcd ) , and their gold cat grade ( abcd ) , by stratifying them by their % pfev1 and their mmrc or cat scores , as per the new gold recommendations . finally , we also classified patients by their pcps recorded history of exacerbations within the last 12 months .", "pcp and patient s self - assessed overall severity ratings were also used for classification .", "very few patients were self - described as very mild or physician - described as no clinical symptoms or disease impact , so these were combined with the mild or stage 1 category for all comparisons ." ], [ "statistical comparisons of continuous variables were made with student s t - tests and analysis of variance , as appropriate .", "counts and percentages were compared using chi - square analyses . to compare agreement between perceived severity measures and the spirometry - based severity results , a cohen s kappa coefficient was used .", "this approach evaluates disagreement between levels of severity and provides a summary result ranging from 0 ( no agreement ) to 1 ( perfect agreement ) .", "all analyses utilized a two - sided p of 0.05 for significance and were performed using sas 9.2 ." ], [ "the demographic characteristics of the 445 copd patients included in the analysis are presented in table 1 .", "most were older ( mean age 68 years ) and well - established patients of the participating pcp , with a mean attendance in their clinic of 11 years .", "most were current ( 38% ) or former smokers ( 56% ) , with mean lifetime smoking histories of 39 and 52 pack - years , respectively .", "approximately two thirds were overweight or obese , and 95% were being treated for at least one other chronic comorbidity .", "the majority of patients in this cohort had moderate or severe airflow obstruction according to the traditional spirometry stage system ( table 2 ) .", "patients self - assessments of their copd severity were poorly congruent with their spirometry - based stage ( =0.13 ) , and more were wrong about their severity stage than correct ( 46% underestimated and 13% overestimated ) ( figure 1 ) .", "the pcp s severity ratings were also inconsistent and tended to underestimate their patient s severity ; 34% were accurate as compared to the traditional spirometry stage , with 57% underestimated and 9% overestimated , for an overall kappa of 0.11 ( figure 2 ) .", "agreement between patient and their physician s assessments was also poor , with doctor s impressions tending to be less severe than the patient s ( figure 2 ) .", "patients were then reclassified by the new gold system using their mmrc or cat scores ( table 3 ) .", "substantial proportions of patients from the old severity system are reclassified , but how they are reclassified varies greatly by whether the mmrc or cat system is selected .", "after application of the new gold mmrc system , 48% ( n=206 ) of the patients are re - stratified higher or lower than their spirometry level when distributed into the gold a , b , c , or d groups ( table 3 ) . among persons with mild airflow obstruction ( stage 1 ) ,", "81% are allocated to group a , and the remainder to group b. at the other end of the spectrum , patients with the most severe airflow obstruction ( stage 4 ) tend to be in group d ( 70% vs 30% in group c ) .", "patients with moderate airflow obstruction ( stage 2 ) are relatively evenly distributed between groups a and b , and patients with severe obstruction ( stage 3 ) are relatively evenly distributed between c and d. therefore , the mmrc system is re - stratifying patients in the middle ranges of airflow obstruction according to their chronic symptoms , while those with the highest and lowest degrees of obstruction tend to stay in the highest ( a ) and lowest ( d ) groups .", "however , the agreement between the gold mmrc level and either the physician s global impression of severity or the patients self - perception of severity is still poor ( =0.17 and 0.13 , respectively ) ( figures 1 and 2 ) .", "after reclassification by the new gold system using the cat scores , 41% ( n=179 ) of patients were re - stratified into a level higher or lower than their spirometry - based severity , but the distributions were much different than the mmrc results ( table 3 ) . among patients with the mildest obstruction ( stage 1 ) , only 38% are in group a ; among those with moderate obstruction ( stage 2 ) , 88% are in group b ; and among those with severe obstruction ( stage 3 ) , 90% are found in group d ; thus the ability of the cat to discriminate patients in the middle ranges of airflow obstruction by their chronic symptoms is very limited .", "furthermore , the agreements between gold cat severity level and either physician impression or patient self - assessment are even worse than by spirometry grade alone ( =0.07 and 0.09 , respectively ) ( figures 1 and 2 ) .", "we then stratified the history of exacerbations within the last 12 months by the gold spirometry , gold mmrc , and gold cat systems ( table 4 ) .", "we noted that physicians identified 14.8% of patients as frequent exacerbators ( two or more exacerbations requiring steroids in the previous 12 months ) while only 13.3% of patients self - reported two or more exacerbations requiring steroids , creating a possible misclassification error due to recall bias if patient history alone is used ( data for patient - reported exacerbations not shown ) . as expected , the incidence of exacerbations within the last year increased with the severity of airflow obstruction ( gold fev1 stages 14 ) ( table 4 ) .", "the percentage of patients who had one exacerbation or frequent exacerbations also increased linearly by gold mmrc group ( gold mmrc groups a to d , table 4 ) .", "of the 433 patients who were reclassified under gold mmrc , seven of these group a patients and 12 group b patients would be promoted to groups c and d , respectively , because of their high risk for exacerbations .", "therefore , after adjusting the copd mmrc system by exacerbation history according to the physician , 33% were in group a , 22% in group b , 19% in group c , and 26% in group d. the exacerbation history by gold cat group did not increase steadily with severity ( gold cat groups a to d , table 4 ) .", "none of the 40 gold cat group a patients were frequent exacerbators , so all would stay in group a. of the 199 patients in gold cat group b , 20 were frequent exacerbators and would therefore be upgraded to group d. therefore , after adjusting the gold cat system by exacerbation history according to the physician , 9% were in group a , 45% in group b , 4% in group c , and 42% in group d." ], [ "the majority of patients in this cohort had moderate or severe airflow obstruction according to the traditional spirometry stage system ( table 2 ) .", "patients self - assessments of their copd severity were poorly congruent with their spirometry - based stage ( =0.13 ) , and more were wrong about their severity stage than correct ( 46% underestimated and 13% overestimated ) ( figure 1 ) .", "the pcp s severity ratings were also inconsistent and tended to underestimate their patient s severity ; 34% were accurate as compared to the traditional spirometry stage , with 57% underestimated and 9% overestimated , for an overall kappa of 0.11 ( figure 2 ) .", "agreement between patient and their physician s assessments was also poor , with doctor s impressions tending to be less severe than the patient s ( figure 2 ) ." ], [ "patients were then reclassified by the new gold system using their mmrc or cat scores ( table 3 ) .", "substantial proportions of patients from the old severity system are reclassified , but how they are reclassified varies greatly by whether the mmrc or cat system is selected . after application of the new gold mmrc system , 48% ( n=206 ) of the patients are re - stratified higher or lower than their spirometry level when distributed into the gold a , b , c , or d groups ( table 3 ) . among persons with mild airflow obstruction ( stage 1 ) ,", "81% are allocated to group a , and the remainder to group b. at the other end of the spectrum , patients with the most severe airflow obstruction ( stage 4 ) tend to be in group d ( 70% vs 30% in group c ) .", "patients with moderate airflow obstruction ( stage 2 ) are relatively evenly distributed between groups a and b , and patients with severe obstruction ( stage 3 ) are relatively evenly distributed between c and d. therefore , the mmrc system is re - stratifying patients in the middle ranges of airflow obstruction according to their chronic symptoms , while those with the highest and lowest degrees of obstruction tend to stay in the highest ( a ) and lowest ( d ) groups .", "however , the agreement between the gold mmrc level and either the physician s global impression of severity or the patients self - perception of severity is still poor ( =0.17 and 0.13 , respectively ) ( figures 1 and 2 ) .", "after reclassification by the new gold system using the cat scores , 41% ( n=179 ) of patients were re - stratified into a level higher or lower than their spirometry - based severity , but the distributions were much different than the mmrc results ( table 3 ) . among patients with the mildest obstruction ( stage 1 ) ,", "only 38% are in group a ; among those with moderate obstruction ( stage 2 ) , 88% are in group b ; and among those with severe obstruction ( stage 3 ) , 90% are found in group d ; thus the ability of the cat to discriminate patients in the middle ranges of airflow obstruction by their chronic symptoms is very limited .", "furthermore , the agreements between gold cat severity level and either physician impression or patient self - assessment are even worse than by spirometry grade alone ( =0.07 and 0.09 , respectively ) ( figures 1 and 2 ) ." ], [ "we then stratified the history of exacerbations within the last 12 months by the gold spirometry , gold mmrc , and gold cat systems ( table 4 ) .", "we noted that physicians identified 14.8% of patients as frequent exacerbators ( two or more exacerbations requiring steroids in the previous 12 months ) while only 13.3% of patients self - reported two or more exacerbations requiring steroids , creating a possible misclassification error due to recall bias if patient history alone is used ( data for patient - reported exacerbations not shown ) .", "as expected , the incidence of exacerbations within the last year increased with the severity of airflow obstruction ( gold fev1 stages 14 ) ( table 4 ) .", "the percentage of patients who had one exacerbation or frequent exacerbations also increased linearly by gold mmrc group ( gold mmrc groups a to d , table 4 ) .", "of the 433 patients who were reclassified under gold mmrc , seven of these group a patients and 12 group b patients would be promoted to groups c and d , respectively , because of their high risk for exacerbations . therefore , after adjusting the copd mmrc system by exacerbation history according to the physician , 33% were in group a , 22% in group b , 19% in group c , and 26% in group d. the exacerbation history by gold cat group did not increase steadily with severity ( gold cat groups a to d , table 4 ) .", "none of the 40 gold cat group a patients were frequent exacerbators , so all would stay in group a. of the 199 patients in gold cat group b , 20 were frequent exacerbators and would therefore be upgraded to group d. therefore , after adjusting the gold cat system by exacerbation history according to the physician , 9% were in group a , 45% in group b , 4% in group c , and 42% in group d." ], [ "the new gold copd assessment system adds chronic respiratory symptoms information and recent exacerbation history to reclassify persons into a two - dimensional matrix that should better characterize the disease impact on chronic symptoms and risk for exacerbations and be a more accurate guide for therapy.16,17 in this study of primary care copd patients , we found as expected that the traditional copd severity system based solely on spirometry did not correlate well with either patient or physician perception of severity , although there was a weak correlation between exacerbation history and degree of airflow obstruction .", "the new gold system using the mmrc questionnaire does reclassify relatively equal proportions of patients with stage 2 ( moderate ) and stage 3 ( severe ) airflow obstruction based on their chronic dyspnea , so it appears to at least have the potential to characterize these patients in a clinically useful way .", "the history of exacerbations also increases steadily by mmrc level , which helps validate that the system is working as expected .", "however , the distributions by the cat scores are so heavily skewed toward the b and d groups that only 13% of the cohort are left in either a or c , making it unlikely that the cat questionnaire will add much to the spirometry assessment of any given patient .", "adding exacerbation history to either the mmrc or cat stratification reclassifies only an additional 4% of all patients , and the exacerbation histories are variable depending on whether they come from the physician or the patient .", "finally , the agreement between physician and patient assessments of copd severity and the gold mmrc and cat levels are not substantially better than those of the traditional spirometry - based system , and may be worse . in summary ,", "the results of reclassifying primary care copd patients by the new gold assessment system varies greatly by whether the cat or mmrc system is chosen , and it is not clear that either adds much practical benefit to the traditional spirometry - based system .", "a key motivation to move away from the traditional spirometry - only copd assessment was the poor correlation between the degree of airflow obstruction and other clinical outcomes , which made the basis for treatment recommendations unstable.16,17 it was presumed that adding the additional dimensions of chronic respiratory symptoms and exacerbation history would result in a more practical tool that would stratify patients into groups with similar characteristics that merit specific treatments . for example , among patients with increased chronic respiratory symptoms , those with stage 1 or stage 2 airflow obstruction would have indication for use of long - acting bronchodilators , and those with stage 3 or stage 4 airflow obstruction might merit triple therapy ( inhaled corticosteroid + long - acting 2-agonist and long - acting anticholinergic ) .", "however , if a score of 10 is used as the cut - point for the cat questionnaire , then the effect in a primary care population is to put approximately nine out of ten patients into a more aggressive treatment group , and one might reasonably ask whether it is worth the effort of giving the questionnaire to ten patients to find the one who does not merit additional medication .", "the mmrc does has the advantage of differentiating the patients with moderate or severe obstruction into more balanced groups , and thus it has the potential of differentiating more patients into clinically relevant treatment groups , but prospective analyses will be needed to confirm this .", "an interesting finding in this project is that the agreement between patient or physician assessment of copd severity and the objective measures of severity were not improved by the new gold assessment systems .", "an important feature of qualitative clinical assessment tools is the face validity , which is the transparency or relevance of a test as it appears to participants.34,35 the copd assessment systems that were only based on spirometry were lacking in face validity because too often the measure ( mild , moderate , or severe stage ) did not correspond well with the patient s experience of symptoms and other disease consequences .", "if it works as expected , then the face validity of the new gold system should be improved as compared to the spirometry - only system because of the addition of the symptoms questionnaires .", "unfortunately , our data suggest that face validity is not substantially improved by the gold mmrc system , and possibly worsened by the gold cat system . therefore , it is likely that the new gold system will also be limited by one of the main criticisms of the traditional spirometry - based system , that being a poor correlation with clinical perceptions about disease severity and health status .", "furthermore , to become practical tools for primary care , severity assessment systems will need to be validated as accurate prognostic measures , such as in their ability to predict morbidity ( eg , risk for copd exacerbations ) and mortality .", "patients were well - established copd patients who had been seeing their pcps an average of 11 years .", "it is not known whether results would be similar in newly diagnosed copd patients or among patients in other countries .", "there are also likely to be selection biases based on patients willingness to participate in research that could affect survey responses .", "we used standardized questionnaires that were administered by staff specifically trained for this study , and it is possible that patients participating in clinical research will behave and answer questions differently than they would in normal clinical conditions .", "another limitation is the problem of language how does one define mild , moderate , or severe copd ?", "there are several problems introduced by defining severity by a simple linear 1-to-4 system based on spirometry that are further complicated by converting it to a 2-by-2 matrix that combines spirometry , either the mmrc or the cat score , and exacerbation history .", "for example , the matrix scheme does not follow the usual progression of disease in that persons in group b ( increased chronic symptoms but low risk of future adverse events ) are more likely to progress to group d ( increased chronic symptoms and future adverse events ) than to group c ( minimal chronic symptoms but high risk of adverse events ) . in a study of 6,628 copd patients from the copenhagen heart study ,", "gold mmrc - derived group b patients had significantly worse 3-year all - cause hospitalization rates and survival than group c patients.18 to compare how well the new gold system compares to the traditional gold severity scale in terms of how well it matches patients self - assessments and their physicians global assessment , we have assumed that group b equates to moderate and group c equates to severe , but acknowledge that this is not a very stable assumption .", "our results were similar to those found in a study of copd patients derived from general practices from the united kingdom.30 haughney et al performed a retrospective survey of 6,283 copd patients who had fev1 and mmrc data . by the new gold system 36% were a , 19% b , 20% c , and 25% d , as compared to the spirometry grades of 17% stage 1 , 52% stage 2 , 26% stage 3 , and 5% stage 4 .", "they also found some degree of gradation in exacerbation risk by category , but their system for identifying exacerbations was based on chart review , and direct comparison between their exacerbation data and ours is not feasible from the published data .", "the studies that have compared gold mmrc and cat classification in non - primary care populations also found wide discrepancies between them.2225,28,29" ], [ "we found that the new gold copd system reclassifies a substantial number of primary care patients as compared to the traditional spirometry - based severity system , but the reclassification is highly variable depending on whether the mmrc or cat system is chosen .", "furthermore , the poor agreement between the patients and physicians global assessments of severity scales even by the gold mmrc system makes it doubtful that this new system is capturing the major determinates that affect their perceptions about their disease progression or current status .", "it remains to be seen whether the new system improves pcps decisions about treatment or helps patients understand their lung disease ." ] ]

[ [ "it is usually the result of leakage from the thoracic duct or one of its main draining lymphatic vessels .", "the most common causes of chylothorax in children are lymphoma and trauma caused by thoracic surgery .", "the effusion can be identified by its white and milky appearance which is due to its high levels of triglycerides and lymphocytes .", "postoperative chylothorax occurs in less than 1% of thoracic procedures with a prevalence ranging from 0.5% to 2% .", "postoperative chylothorax is a serious complication with a high mortality , which can approach 50% in untreated patients .", "it causes nutritional deficiencies , respiratory dysfunction , dehydration , immunosuppression , and increased vulnerability to infections .", "the initial management consists of indwelling pleural drainage and feeding with a milk formula rich in medium chain triglyceride ( mct ) along with total parenteral nutrition if required .", "in resistant cases , ligation of thoracic duct or placement of pleuroperitoneal shunts may be considered .", "somatostatin , or its analog octeriotide , has recently been used with success in a number of pediatric cases of postoperative and iatrogenic chylothorax . in pediatric patients", "the reported effective doses of intravenous somatostatin ranges from 3.5 to 12 mcg / kg / h .", "we report two cases of successful management of postoperative chylothorax , following surgery for congenital diaphragmatic hernia , both in full - term newborn babies , using an escalating regimen of octeriotide infusion ." ], [ "a term female 3.5-kg infant , diagnosed with left diaphragmatic hernia on antenatal ultrasound scan done at 19 week of gestation , was born by spontaneous vaginal delivery in a very good condition .", "she was electively intubated and stabilized for surgical repair of diaphragmatic hernia which was done uneventfully on third day of life [ figures 1 and 2 ] . during surgery", "left diaphragm was found to be very vascular , which is a known risk factor for postoperative chylothorax .", "she developed left pleural effusion on third postoperative day requiring ongoing ventilation and an indwelling chest drain .", "the amount of fluid drained was high ( 130 ml / day).the initial pleural fluid was serosanguinous with a protein content of 26 g / dl and normal triglyceride level ( during this time the baby was only on tpn with no oral feeds ) .", "the oral feeds were gradually built up over the next 8 days . by the age of 13 days the pleural fluid developed classic consistency of chylothorax : milky appearance with high lymphocyte and triglyceride ( protein 28 g / dl and wbc 8000 with 98% lymphocyte ) .", "the condition was initially managed with enteral feeding with medium chain triglyceride formula ( monogen ) and total parenteral nutrition .", "there was no reduction in the amount of chylothorax drainage over a period of 1 week ( day 20 of life ) [ figure 3 ] . on day 21 of life", "intravenous octeriotide infusion was started at a dose of 3 mcg / kg / hr . the enteral feeds were stopped because of reports of high risk of necrotizing enterocolitis with octeriotide infusion .", "the dose of octeriotide was gradually increased by 1 mcg / kg / hr everyday till we reached a dose of 9 mcg / kg / hour after 8 days .", "there was a sudden drop in the chylothorax output once the dose octeriotide dose reached 9 mcg / kg / hr . the infusion was maintained at the same level ( 9 mcg / kg / hr ) for 11 days . during this period ,", "the chyle drainage per 24 hours reduced gradually to a minimal amount with significant response noted 2 days after reaching 216 mcg / kg / day ( 9 mcg / kg / hr ) .", "the infant was extubated successfully to nasal cannula and then to room air within 3 days after administration of octeriotide infusion ( day 20 postsurgical repair ) .", "this resulted in transient increase in chylothorax drain which resolved spontaneously [ figure 4 ] .", "the octeriotide infusion was weaned over 5 days by decreasing the dose at a rate of 2 mcg / kg / hr everyday till the infusion was discontinued . during octeriotide therapy", "the baby was monitored closely , on daily basis , for any evidence of glucose intolerance , liver and renal impairment .", "no side effects were noted . left diaphragmatic hernia before surgery chest x - ray of our patient immediately after surgery left chylothorax with chest tube drainage chylothorax drainage ( pink line ) , octeriotide", "dose mcg / kg / hr ( blue line ) , gray zone reflect days of enteral feed , white zone reflects days of exclusive tpn with no oral feeds the infant was discharged home self - ventilating in room air after 1 week on monogen formula .", "medium chain triglyceride ( mct ) oil and oral polycose were added to the feed to increase her caloric intake and promote weight gain .", "on postdischarge follow - up in neonatal and dietetic clinics she had symptomatic of massive gastroesophageal reflux which required antireflux medication .", "a term male 3.5 kg infant was born by spontaneous vaginal delivery in a good condition .", "the chest drain placed during surgery - drained blood - stained fluid which decreased gradually and chest tube was removed on 7 post - op day .", "oral feeding with breast milk was started on 9 post - op day . the next day baby developed respiratory distress requiring reintubation and ventilation .", "the initial pleural fluid was serosanguinous with a protein of 26 g / dl and normal triglyceride level . during this time", "the baby was only on tpn with expressed breast milk feeds . over the next few days", "the contents became typical of chylothorax with triglyceride level of 4 mmol / l and lymphocytes count of > 91% .", "management with formula feed containing medium chain triglycerides ( monogen ) and total parenteral nutrition did not reduce the amount of chylothorax drainage .", "1 mcg / kg / hr everyday till we reached 10 mcg / kg / hr on post - op day 24 [ figure 5 ] . a dramatic response in terms of reduction of pleural drainage was noted once a dose of 10 mcg / kg / hr was reached .", "the baby was extubated successfully to nasal cannula and then room air within 3 days .", "the octeriotide infusion was kept at the same dose ( 10 mcg / kg / hr ) for 5 days and then gradually reduced at a rate of 2 mcg / kg / hr every day over the next 5 days . within three days the baby was discharged home self - ventilating in room air and on full enteral feeding with monogen formula . during the phase of high pleural drainage the baby was also supported with i.v .", "the baby was monitored closely for any evidence of glucose intolerance , liver and renal impairment ." ], [ "a term female 3.5-kg infant , diagnosed with left diaphragmatic hernia on antenatal ultrasound scan done at 19 week of gestation , was born by spontaneous vaginal delivery in a very good condition .", "she was electively intubated and stabilized for surgical repair of diaphragmatic hernia which was done uneventfully on third day of life [ figures 1 and 2 ] . during surgery", "left diaphragm was found to be very vascular , which is a known risk factor for postoperative chylothorax .", "she developed left pleural effusion on third postoperative day requiring ongoing ventilation and an indwelling chest drain .", "the amount of fluid drained was high ( 130 ml / day).the initial pleural fluid was serosanguinous with a protein content of 26 g / dl and normal triglyceride level ( during this time the baby was only on tpn with no oral feeds ) .", "the oral feeds were gradually built up over the next 8 days . by the age of 13 days the pleural fluid developed classic consistency of chylothorax : milky appearance with high lymphocyte and triglyceride ( protein 28 g / dl and wbc 8000 with 98% lymphocyte ) .", "the condition was initially managed with enteral feeding with medium chain triglyceride formula ( monogen ) and total parenteral nutrition .", "there was no reduction in the amount of chylothorax drainage over a period of 1 week ( day 20 of life ) [ figure 3 ] . on day 21 of life", "intravenous octeriotide infusion was started at a dose of 3 mcg / kg / hr . the enteral feeds were stopped because of reports of high risk of necrotizing enterocolitis with octeriotide infusion .", "the dose of octeriotide was gradually increased by 1 mcg / kg / hr everyday till we reached a dose of 9 mcg / kg / hour after 8 days .", "there was a sudden drop in the chylothorax output once the dose octeriotide dose reached 9 mcg / kg / hr . the infusion was maintained at the same level ( 9 mcg / kg / hr ) for 11 days . during this period ,", "the chyle drainage per 24 hours reduced gradually to a minimal amount with significant response noted 2 days after reaching 216 mcg / kg / day ( 9 mcg / kg / hr ) .", "the infant was extubated successfully to nasal cannula and then to room air within 3 days after administration of octeriotide infusion ( day 20 postsurgical repair ) .", "this resulted in transient increase in chylothorax drain which resolved spontaneously [ figure 4 ] .", "the octeriotide infusion was weaned over 5 days by decreasing the dose at a rate of 2 mcg / kg / hr everyday till the infusion was discontinued . during octeriotide therapy", "the baby was monitored closely , on daily basis , for any evidence of glucose intolerance , liver and renal impairment .", "no side effects were noted . left diaphragmatic hernia before surgery chest x - ray of our patient immediately after surgery left chylothorax with chest tube drainage chylothorax drainage ( pink line ) , octeriotide", "dose mcg / kg / hr ( blue line ) , gray zone reflect days of enteral feed , white zone reflects days of exclusive tpn with no oral feeds the infant was discharged home self - ventilating in room air after 1 week on monogen formula .", "medium chain triglyceride ( mct ) oil and oral polycose were added to the feed to increase her caloric intake and promote weight gain .", "on postdischarge follow - up in neonatal and dietetic clinics she had symptomatic of massive gastroesophageal reflux which required antireflux medication ." ], [ "a term male 3.5 kg infant was born by spontaneous vaginal delivery in a good condition .", "the chest drain placed during surgery - drained blood - stained fluid which decreased gradually and chest tube was removed on 7 post - op day .", "the initial pleural fluid was serosanguinous with a protein of 26 g / dl and normal triglyceride level . during this time", "the baby was only on tpn with expressed breast milk feeds . over the next few days", "the contents became typical of chylothorax with triglyceride level of 4 mmol / l and lymphocytes count of > 91% .", "management with formula feed containing medium chain triglycerides ( monogen ) and total parenteral nutrition did not reduce the amount of chylothorax drainage .", "octeriotide infusion was started at 2 mcg / kg / hr and increased gradually by 1 mcg / kg / hr everyday till we reached 10 mcg / kg / hr on post - op day 24 [ figure 5 ] . a dramatic response in terms of reduction of pleural drainage", "the baby was extubated successfully to nasal cannula and then room air within 3 days .", "the octeriotide infusion was kept at the same dose ( 10 mcg / kg / hr ) for 5 days and then gradually reduced at a rate of 2 mcg / kg / hr every day over the next 5 days . within three days", "the baby was discharged home self - ventilating in room air and on full enteral feeding with monogen formula . during the phase of high pleural drainage the baby was also supported with i.v .", "the baby was monitored closely for any evidence of glucose intolerance , liver and renal impairment ." ], [ "chylothorax may occur spontaneously in the neonatal population e.g. , due to abnormal congenital lymphatic malformations or in the postoperative setting after thoracic duct injury or disruption of lymphatic channels .", "the incidence of chylothorax following surgery for congenital diaphragmatic hernia ranges from 7 to 28% .", "a number of therapeutic interventions have been used to reduce chyle production and promote resolution of chylothorax .", "milk feeds , high in medium - chain triglycerides ( mct ) , or parenteral nutrition may be used .", "mct is transported directly into the portal system , bypassing the lymphatic pathways , thus diminishing lymphatic flow through the thoracic duct .", "mct formulas have been shown to produce resolution of chylothorax in approximately one - third of patients after two weeks , while parenteral nutrition typically results in resolution in 75 - 80% of cases by that time .", "in resistant cases , pleurodesis , ligation of thoracic duct , or placement of drains and pleuroperitoneal shunts may be considered .", "however , the failure rate with these options is high and only pleurodesis works in severe cases .", "recently , octreotide has emerged as an alternative option for management of patients with chylothorax resistant to conventional therapies .", ", it is a potent inhibitor of growth hormone , glucagon , insulin and thyroid stimulating hormone .", "moreover , by increasing splanchnic arteriolar resistance and decreasing gastrointestinal blood flow , octeriotide indirectly reduces lymphatic duct flow .", "some authors have mentioned another mechanism : octeriotide blocks pancreatic and biliary secretion by inhibition of serotonin and other gastrointestinal peptides .", "potential adverse effects of octeriotide therapy are bradycardia , stomachache , headache , hypo or hyperglycemia , hypothyroidism , nausea and vomiting .", "one published report mentions an association between the use of octeriotide and necrotizing enterocolitis in a baby who had postoperative chylothorax .", "although infusions of octreotide appear physically stable when mixed with parenteral nutrition solutions , the mixture may result in the formation of a glycosyl octreotide conjugate , resulting in reduced efficacy .", "combined tpn and octeriotide increase the speed of chylothorax resolution in children and avoid later surgical intervention , which can have up to 10% perioperative mortality rate .", "it is almost always used as a second line therapy following failure of initial management with no oral feeds , tpn and or mct feeds .", "there is significant heterogeneity in dosing regimens , therapeutic duration , and time to start octeriotide .", "most authors began treatment with a lower dose and progressively raised it to achieve a response .", "the exact maximum dose at which significant reduction of chylous drainage can be achieved has been variable . in our two cases ,", "we started octeriotide infusion at a rate of 2 mcg / kg / hr which was gradually increased by 1 mcg / kg / hr every day till we reached a maximum dose of 10 mcg / kg / hr . after being at this dose for 48 hours , we observed a dramatic reduction of chylous drainage which kept on decreasing gradually over the next few days .", "similarly there is no established protocol for weaning the octeriotide infusion once chylothorax has resolved . in our two cases we weaned octeriotide by reducing the infusion at a rate 2 mcg / kg / hr every day .", "we reviewed the literature to find out the most effective dose or regimen of octeriotide infusion in the management of chylothorax following repair of congenital diaphragmatic hernia .", "the results , as expected , were very variable . based on these studies we constructed table 1 which shows a summary of therapeutic regimens of octeriotide in postoperative chylothorax following surgery for congenital diaphragmatic hernia .", "the chyle drainage was significantly reduced within 48 - 72 hours once a maximum dose was reached .", "previously published studies on the use of octeriotide in postoperative chylothorax following repair of \n diaphragmatic hernia" ], [ "octeriotide is a relatively safe second line therapy in the management of chylothorax secondary to surgery for congenital diaphragmatic hernia .", "a trial of octeriotide therapy can prevent potential permanent surgical procedures like pleurodesis or pleuroperitoneal shunts ." ] ]

[ [ "thirty patients with zygomatic complex fractures were treated with one point fixation [ figures 13 ] .", "preoperative peripheral nerve stimulation x - ray preoperative computed tomography scan under general anesthesia , nasoendotracheal intubation was done .", "the incision can be made from anterior to posterior or from medial to lateral and should extend through mucosa , submucosa , and any buccinators muscle fibers [ figure 4 ] .", "rowe 's zygomatic elevator was then inserted behind the infra temporal surface of the zygoma , and bone was reduced into its correct anatomical position using superior , lateral and anterior force . an audible click and fullness of the cheek together with palpation for normal contour of the zygomatic bone and orbital rim gave an idea about the adequacy of the reduction .", "one hand over the side of the face was used to assist in the reduction .", "a four hole plate with a gap was fixed with 4 mm 2.5 mm screws on the zygomatic buttress [ figure 5 ] .", "immediate post operative immediate peripheral nerve stimulation x - ray six months postoperative and peripheral nerve stimulation x - ray" ], [ "for all the patients , immediate postoperative and 6 months postoperative peripheral nerve stimulation x - rays were taken , and the x - rays review successful reduction .", "none of the patients complained of any paresthesia , bony movements or pain in the frontozygomatic or zygomatic buttress region .", "since intraoral approach was used , all the patients had an aesthetic facial profile without any unsightly scars ." ], [ "the integrity of the zygoma bone is critical in maintaining normal facial width and prominence of the cheek .", "the zygomatic bone is a major contributor to the orbit and plays an important role in protecting the eyes .", "zygomatic bone alone is rarely involved in fractures ; usually its articulating surfaces which are maxilla , temporal , frontal and sphenoid bones are also involved .", "the fractured fragments of a tripod or tetrapod zygomatic complex fracture near these suture lines needs to be restabilized by open reduction followed by fixation .", "studies suggest that two point gives a considerable stabilization , and three point fixation gives the maximum stabilization .", "however other studies suggest that one point fixation for zymatic complex fractures gives an excellent results considering the esthetics and stabilization for simple tripod fractures without any comminution of the zygomatic bone or the lateral orbital wall one point fixation with a single mini plate in the frontozygomatic area through the lateral eyebrow incision have been suggested by many authors .", "i n these cases it was found that when a tripod fracture without any comminution or mild or no displacement can be stabilized very well with a single point fixation in the frontozygomatic area without any complications of diplopia or enopthalmos .", "however , zygoma provides the attachment point for muscles of mastication and facial animation , but amongst these , it is the masseter that provides the most significant intrinsic deforming force on the zygomatic body and arch .", "the integrity of zygomatic buttress is necessary for withstanding the contraction force of the masseter muscle . in 2002", "fujioka et al . \n in vivo studies successfully proved that one point fixation at the zygomaticomaxillary complex gives three point alignment and sufficient rigidity when the fractures are not comminuted . in 2011", "kim et al . found out that lateral eyebrow incision for mini plate fixation at the frontozygomatic area led to unaesthetic scar and few patients underwent plate removal through a second surgical re - entry through the existing scar of the lateral eyebrow incision which further enhanced the unsightly scars and compromised facial esthetics . since the skin over the lateral eyebrow region is thin there are more chances of palapation of the mini plates after fixation , and it may lead to pain . as early as in 1994 tarabichi et al .", "proved that in vitro studies are misleading regarding the mini plate fixation along the orbital margins and successfully applied transsinus reduction through anterior comminuted sinus wall . in 2012 kim et al .", "successfully reduced the zygomatic complex fractured fragments through intraoral approach and gained sufficient rigidity and excellent esthetics with one point fixation at the zygomatic buttress region .", "we also found that one point fixation with a single mini plate at the zygomatic buttress through intraoral incision provided excellent stability and esthetics in the selected cases of simple zygomatic complex fractures without any comminution of the zygoma or the lateral orbital rim without or with minimal displacement and none of our patient complained of pain or palpation or bony movements in the postoperative study period of 6 months rather they were happy to get operated without any unaesthetic facial scars ." ] ]

[ [ "sotos syndrome is a dysmorphic syndrome characterized by early overgrowth , developmental delay , advanced bone age and characteristic craniofacial appearance .", "sotos syndrome results from mutation involving the nuclear receptor set - domain - containing protein ( nsd1 ) gene , located on chromosome 5q .", "the mutational mechanism can be a point mutation in the nsd1 gene or a microdeletion that includes nsd1 .", "fluorescence in situ hybridization ( fish ) did not detect microdeletion of 5q35 in this patient .", "nsd1 gene mutations are also found in weaver syndrome where camptodactyly is a common feature .", "this report describes camptodactyly for the first time in a girl with sotos syndrome and provides further evidence that sotos and weaver syndrome are allelic disorders ." ], [ "we describe a two and half years old girl born of non - consanguineous tamilian parents .", "milestones were delayed with head holding at 6 months , walking at 2 years and delayed speech .", "family history was unremarkable . at two and a half years she weighed 15 kg ,", "height was 97 cm and head circumference was 52.5 cm ( all above 90 centile ) .", "she had a high forehead with frontal bossing , dolichocephaly , large ears , pre - auricular pits , down - slanting palpebral fissures , high arched palate , pointed chin and pectus carinatum [ figure 1 ] .", "she had three caf au lait spots distributed on the chest and trunk , large hands and camptodactyly of the left hand [ figure 2 ] .", "fish studies carried out using probe rp11 - 265k23 did not reveal a microdeletion of the 5q35 region .", "face showing the facial features of sotos syndrome left hand showing camptodactly a clinical diagnosis of sotos syndrome was made based on the criteria comprising of rapid early growth , advanced bone age , developmental delay and characteristic facial appearance .", "camptodactyly in sotos syndrome has not been previously described in literature to the best of our knowledge .", "a high frequency of congenital heart defects has been reported in patients with intragenic mutations of the nsd1 gene and phenotypic overlap with other overgrowth syndromes , in particular with weaver syndrome is seen . though this sotos patient is likely to have a point mutation of the nsd1 gene , this could not be confirmed due to lack of facilities ." ], [ "sotos syndrome was first recognized as a distinct clinical syndrome in new england in 1964 .", "the diagnosis is based on the clinical criteria of rapid early growth ( pre and post natal ) , advanced bone age , developmental delay and characteristic facial appearance .", "growth is rapid in the first years of life but final height may not be excessive . intellectually , the iq ranges from 21 to 103 with a mean of 74 and almost half of affected children achieve normal schooling .", "behavioral issues are common and are one of the key areas that can influence the outcome .", "hypotonia is usually present from birth and although this improves during childhood , subtle evidence may remain even in adults .", "congenital heart disease is not very common in this condition and overall incidence of cardiac defects is approximately 8% .", "an association of sotos syndrome with tumor development was documented over 30 years ago and has been a point of debate ever since .", "gorlin et al . estimated a risk of 3.9% of benign or malignant tumors in sotos syndrome .", "handicaps in sotos syndrome are fewer than previously believed and tend to improve with age . in patients with sotos syndrome harboring a chromosomal translocation kurotaki et al", ". isolated the nuclear receptor set - domain - containing protein ( nsd1 ) gene from the 5q35 breakpoint .", "added noted a large difference between japanese and non - japanese patients in the frequency of microdeletions , which occurred in 49 ( 52% ) of the 95 japanese but in only 1 ( 6% ) of the 17 non - japanese .", "there was a strong correlation between presence of an nsd1 alteration and clinical phenotype , in that 28 of 37 ( 76% ) patients with typical sotos or sotos - like phenotype had nsd1 mutations or deletions .", "studied nsd1 gene in a series of typical sotos patients ( 23/39 ) , sotos - like patients ( lacking one major criteria , 10/39 ) and weaver patients ( 6/39 ) .", "they conclude that nsd1 mutations account for most cases of sotos syndrome and a significant number of weaver syndrome cases . comparing the clinical phenotype of children carrying either a deletion or a mutation , rio et al . failed to detect distinctive features except for the severity of mental retardation .", "they reported , 4/6 children carrying a nsd1 deletion were extremely severely mentally retarded with no language at all , major delay in motor milestones and autistic features .", "by contrast , in patients carrying nsd1 mutations , mental retardation was usually mild to moderate with verbal skills being more affected .", "the major differential diagnoses for sotos syndrome are other conditions with overgrowth including beckwith - weidemann , weaver , nevo and simpson golabi behmel syndromes .", ". however nsd1 gene mutations have been found in beckwith - weidemann syndrome , weaver syndrome and the 11p15 abnormalities seen in beckwith - wiedemann syndrome have been found in some cases of sotos syndrome . camptodactly has not been previously described in literature to the best of our knowledge with sotos syndrome but is seen in weaver syndrome where nsd1 mutations have been described .", "these could be due to , allelic heterogeneity , effect of other modifying genes ethnic background and nutritional status adding to the overall expression of a syndrome .", "microdeletions of chromosome 5 were not detected in our case suggesting a likely point mutation in the nsd1 gene and further evidence of that weaver and sotos syndrome are allelic .", "further delineation of the phenotype with molecular studies will provide correct genotype - phenotype correlations ." ] ]

[ [ "in march 2013 , cases infected with a novel reassortant avian - origin influenza a ( h7n9 ) virus emerged in china and had high mortality . that month", ", a patient with h7n9 influenza was admitted to our hospital , and daily lung ultrasound was performed . a 54-year - old woman , who ran a convenience store beside a poultry market , complained of cough and high fever for 4 days .", "her temperature was 38.6c , and she had a heart rate of 113 beats per minute and a respiratory rate of 26 breaths per minute .", "her white blood cell count was 2.7 10/l , and neutrophil , lymphocyte , and monocyte levels were 72.4% , 22% , and 5.2% , respectively .", "her partial pressure of oxygen in arterial blood was 72 mm hg , and her fraction of inspiratory oxygen ( fio2 ) was 40% .", "avian - origin influenza a ( h7n9 ) virus was confirmed from the pharyngeal swabs by real - time reverse transcriptase - polymerase chain reaction .", "treatment with oseltamivir ( 150-mg capsule taken by mouth twice a day ) was initiated , and she was admitted to an isolated room in the infectious diseases department .", "bothell , wa , usa ) with c60 convex probe ( 2 to 5 mhz ) was performed , and the lung ultrasound score ( lus ) was recorded , and both effectively reflected the progression of pneumonia ( figure 1 ) .", "dynamic changes of chest computed tomography ( ct ) , radiography , and lung ultrasound in a patient with h7n9 influenza .", "( a - c ) ct showed pneumonia in the left upper lung , with partial consolidation on admission .", "( d - f ) lung ultrasound corresponding to ct in ( a - c ) showed multiple abutting b2 lines , and some regions presented a tissue pattern ( arrow ) .", "( g - i ) ct on day 6 after admission showed that the pneumonia was partially absorbed .", "( j - l ) lung ultrasound corresponding to ct in ( g - i ) showed that the number of b lines was obviously decreased , and the consolidation disappeared .", "( m - o ) ct on day 9 after admission showed that the size of the lesion was obviously reduced .", "( p - r ) lung ultrasound corresponding to ct in ( m - o ) indicated that only the a line and few b lines were visible .", "( s - u ) chest radiography on days 1 , 3 , and 6 after admission showed no obvious change of the pneumonia .", "( v ) dynamic changes of lung ultrasound score ( lus ) ( total of 48 for normal lung ) .", "the onset of h7n9 influenza in this case was manifested by hyperpyrexia and flu - like symptoms and progressed to lobar pneumonia 4 days later .", "chest radiograph is the routine tool for assessment of pneumonia , but its sensitivity and accuracy were not so good .", "ct is regarded as the gold standard , but its application is limited in cases with this new emerging virus since strict protection should be followed to avoid person - to - person transmission .", "ultrasound has many advantages , including convenience , rapidness , non - invasiveness , availability for repeated examination , and absence of radiation .", "the right lung presented an a line with few isolated b lines , whereas the left lung presented multiple abutting b lines and consolidation . when the patient improved , both b lines and the area of consolidation were decreased and the lus was synchronously increased .", "this case highlights that ultrasound can be an adjutant to chest radiography and ct in caring for patients with h7n9 influenza ." ], [ "" ], [ "" ], [ "written informed consent was obtained from the patient for publication of this letter and accompanying images ." ] ]

[ [ "the need for categorization of anomalies and congenital aberrancies formed due to developmental vascular defects produce identifiable birthmarks of the skin and mucosa and a variable degree of underlying soft tissue abnormalities .", "presently a surge in the knowledge of criterias to classify these various anomalies has put forth classifications purely with respect to histopathological features of the disease .", "these lesions predominantly occur within the head and neck and affect approximately 1 in 22 children .", "involvement of the oral cavity is common but frequently requires unconventional treatment strategies for its management .", "though previously termed angiomas or vascular birthmarks , vascular anomalies are divided into two main categories : vascular tumors and vascular malformations .", "infantile hemangiomas comprise the majority of vascular anomalies and are considered the predominant vascular tumor type composed of rapidly proliferating endothelial cells .", "blood vessel architecture is incomplete and surrounded by hyperplastic cells in hemangiomas and other vascular tumors . in contrast , vascular malformations do not contain hyperplastic cells but consist of progressively enlarging aberrant and ectatic vessels composed of a particular vascular architecture such as veins , lymphatic vessels , venules , capillaries , arteries or mixed vessel type .", "the latter comprises lymphangiomas or lymphatic malformations which are congenital collections of ectatic lymph vessels that form endothelial lined cystic spaces .", "the pathogenesis of these tumors could be of importance in thoroughly understanding the mode of these varying histopathological presentations .", "they represent about 6% of the total number of benign tumors of the soft tissue in patients aged less than 20 years .", "regarding gender distribution of lymphangioma , it is equally divided between males and females , with about 50% of the lesions being noted at birth and 90% developing by 2 years of age .", "oral lesions may occur at various sites but they form most frequently on the anterior two thirds of tongue", ". they may increase in size , producing macroglossia which may lead to difficulties in mastication , deglutition , and speech ; and displacement of the teeth , with a resulting malocclusion .", "they may interfere with normal breathing , particularly during sleep , produce sleep apnea , and in certain instances , produce a life - threatening upper airway compromise .", "they can also be present in the palate , buccal mucosa , gingiva and lip .", "the tumor is superficial in location and demonstrates a white pebbly surface that resembles a cluster of translucent vesicles . the deeper lesions could mimic various soft tissue tumors since the color which is classically used for diagnosing such tumors would seem to be irrelevant .", "they appear as a nodule or masses without significant change in surface texture or color ." ], [ "a 9-year - old female patient reported to the department of oral & maxillofacial pathology , i.t.s cdsr , with a complaint of a painless growth with respect to left side of tongue .", "patient had given a history of trauma due to tongue bite around 3 months back and was enlarging slowly in size the swelling was initially small , peanut sized , which increased to the present size .", "on examination of the swelling a growth of 2 1 cm on the anterior part of the dorsal surface of tongue .", "the lesion was pale pink in color and oval in shape with well - defined margins [ figure 1 ] .", "intraoral photograph showing nodular swelling resembling cluster of vesicles on the left side of dorsum of tongue an incisional biopsy was performed and the tissue was histopathologically diagnosed as lymphangioma , since large lymphatic vessels lined by flattened endothelial cells pushing into the overlying epithelium were seen [ figure 2 ] .", "patient was recalled after 4 days and a total excision of the lesion was performed under local anesthesia ( la ) .", "photomicrograph of incisional biopsy showing large lymphatic vessels ( h and e , 10 ) examination of gross macroscopic appearance revealed the excised tissue to be oval shaped , measuring 1.5 1 cm in size and was creamish brown in color with a pebbly surface .", "microscopic examination of the excised lesion showed numerous large , dilated lymphatic channels of irregular shape , lined by flattened endothelial cells , of which some of the vessels were filled with lymph .", "numerous large- to medium - sized channels with thin endothelial lining , engorged with rbcs , were also present in the deeper area of the connective tissue [ figure 3 , inset ] ." ], [ "lymphangioma was first described by virchow in 1854 , and in 1872 , krester hypothesized that hygromas were derived from lymphatic tissue .", "the origin of lesion is considered to be congenital abnormality of lymphatic system rather than true neoplasm .", "a portion of the jugular lymphatic sac is thought to sequestrate from the primary sacs during fetal development with failure to establish communications with other lymphatic system .", "the fact that most lymphangiomas manifest clinically during early childhood and develop in areas where the primitive lymph sacs occur ( neck , axilla ) provides presumptive evidence for this hypothesis . on the contrary", ", it is argued that instead of being a congenital malformation , lymphangioma is a true neoplasm resulting from transformed lymphatic endothelial cells and/or stromal cells .", "the classic sequence of events in embryology and development of vasculogenesis falls into three stages : the undifferentiated capillary network stage , the retiform developmental stage and the final developmental stage .", "the first theory is that the lymphatic system develops from five primitive sacs arising from venous system .", "concerning the head and neck , endothelial outpouchings from the jugular sacs spread centrifugally to form the lymphatic systems .", "another theory proposes that the lymphatic system develops from mesenchymal clefts in the venous plexus reticulum and spreads centripetally toward the jugular sacs .", "several studies have been published regarding possible lymphangiogenic growth factor involvement in the etiology of lymphatic malformations .", "these factors include vascular endothelial growth factor ( vegf)-c , vascular endothelial growth factor receptor 3 ( vegfr-3 ) , and transcription factor prox-1 .", "vegf - c and vegfr-3 have been shown to be upregulated in lymphatic malformed tissue , and both are involved in lymphatic tissue proliferation .", "the tumor may be localized in a small area of tongue or floor of mouth or it may diffusely infiltrate these areas . if the tumor is located in a deeper area , it may present as submucosal mass .", "cervical lesions in a child cause dysphagia and airway obstruction which is rare in adults .", "the misunderstanding on the nosologic distinction between oral hemangiomas and vascular malformations leads to diagnostic mistakes .", "hemangiomas are differentiated from vascular malformations by their clinical appearance , histopathological features , and biologic features", ". the natural history of hemangiomas involves rapid proliferations for the first several months of life with subsequent spontaneous regression .", "vascular malformations are often recognized at birth and grow proportionately with the child , with many becoming more prominent at puberty .", "histologically , hemangiomas in the proliferating phase show endothelial hyperplasia and large number of mast cells .", "in contrast , vascular malformations show normal number of mast cells , and consist of mature , often combined , capillary , arterial , venous , and lymphatic elements .", "lymphatic malformations / lymphangiomas are classified microscopically into four categories : lymphangioma simplex ( lymphangioma circumscriptum ) composed of small , thin - walled lymphatics ; cavernous lymphangioma comprising dilated lymphatic vessels with surrounding adventitia ; cystic lymphangioma ( cystic hygroma ) consisting of huge , macroscopic lymphatic spaces with surrounding fibrovascular tissues and smooth muscle ; and benign lymphangioendothelioma ( acquired progressive lymphangioma ) , in which lymphatic channel dissects through dense collagen bundles .", "occasionally , channels may be filled with blood , a mixed hemangiolymphangioma , an uncommon developmental anomaly with a propensity to invade underlying tissues and to recur locally , distinguishing it from the simple lymphangioma or hemangioma .", "although histologically it is a benign disorder , local invasion into the muscle , bone , and underlying tissue can lead to severe deformity . in the present case ,", "numerous large - sized lymphatic channels along with medium- to large - sized channels entrapped with rbcs , lined by endothelium , were seen and hence it was subcategorized as hemangiolymphangioma .", "we reviewed the archival cases of lymphatic malformations in our department , the demographical information , location and histopathological features of which are shown in table 1 .", "the only significant difference in the three archival cases and the present case was in the histopathological features of lymphangioma and hemangiolymphangioma .", "the demographic information , location and histopathological features these anomalies present the necessity for sound discretion with regards to their approach therapeutically.although spontaneous regression of lesions is rarely encountered , the treatment seems to weigh heavily on individual assessments of the observer .", "sclerosing agents are ineffective , probably as a result of the discontinuous basement membrane of the lymphatic vessels .", "nd - yag laser surgery has been widely preferred because of its advantages of less bleeding and edema .", "due to a rate of recurrence of nearly 21% , long - term follow - up is essential of these tumorigenic anomalies ." ], [ "the vascular lesions consist of both blood vessels and lymphatic vessels . whether these can be termed as hemangiolymphangioma or just vascular malformation is still confusing .", "thus through the present article we would like to highlight the complexities which can arise from the terminal categorization of the large group of tumors called vascular neoplasms when based on their histopathological representation .", "further detailed analysis of a larger case series would be imperative in the correct classification and diagnosis which could enormously help to accurately ascertain prognosis and direct treatment ." ] ]

[ [ "\n study population and sampling - this study was conducted between \n august - december 2011 and the women were recruited from central laboratory municipal \n campo grande , state of mato grosso do sul , brazil , when they were forwarded to \n gynaecological exams in the public health system .", "women were eligible to participate if \n they were 18 years of age and had not undergone a hysterectomy .", "a total of 171 women \n provided written informed consent and completed the questionnaire at the time of \n enrollment .", "participating women underwent two interventions for hpv dna detection : with \n verbal and diagrammatic instruction , they self - collected a vaginal specimen ; afterward , \n a health professional used a speculum and collected an endocervical specimen . \n dna isolation and hpv testing -", "the endocervical and vaginal dna were \n extracted using a wizard genomic dna purification kit ( promega , \n corporation , madison , wi , usa ) .", "hpv dna detection was performed by polymerase chain \n reaction ( pcr ) amplification with the use of the pgmy09/11 primers ( gravitt et al .", "samples \n that amplified the pgmy09/11 primers were genotyped by type - specific pcr using primers \n for high - risk hpv ( hr - hpv ) , hpv16 , 18 , 31 , 33 , 45 ( guo et \n al . 2007 ) and low - risk hpv ( lr - hpv ) , hpv6 , 11 ( silva et al . 2003 ) .", "the pcr products were analysed using 1.5% agarose gel \n electrophoresis with ethidium bromide staining to visualise the dna under ultraviolet \n light .", "statistical analysis - agreement between the self and \n clinician - collected samples was measured using kappa ( ) statistics .", "the chi - square test \n was used to analyse frequency data obtained on the questionnaire ." ], [ "of the samples collected from the 170 participants , only one was excluded because \n -globin could not be amplified .", "a total of 30% ( 51/170 ) of the \n samples were hpv dna - positive .", "the women in this study were 18 - 65 years of age ( median , \n 35 years ) , while the average age at first sexual intercourse was 17 years ( range , 11 - 30 \n years ) .", "we found a lower frequency of hpv infection in women 30 years ( p = 0.009 ) .", "hpv tests results showed that there was 84.6% concordance between the self and \n clinician - collected samples ( = 0.72 ) , which indicates good agreement .", "six women tested \n hpv - positive on clinician - collected samples , but hpv - negative on self - collected samples . \n", "twelve women tested hpv - positive on self - collected samples ( table i ) .", "hpv of any type was detected in 22.9% ( 39/170 ) of the \n clinician - collected samples and 26.5% ( 45/170 ) of the self - collected samples . \n", "table i concordance between human papillomavirus ( hpv ) dna detected by self and \n clinician - collected \n clinician - collectedself - collected n ( % ) \n total \n n ( % ) kappaconcordance ( % ) negativepositive negative119 ( 70)12 ( 7.1)131 ( 77.1)--positive6 ( 3.5)33 ( 19.4)39 ( 22.9)0.720.84 \n\n total125 ( 73.5)45 ( 26.5)170 ( 100)-- \n a : concordance between methods . \n \n a : concordance between methods .", "hpv16 , the most frequently detected hr - hpv type , was present in six samples obtained by \n both methods .", "the specific hpv types identified in the self and clinician - collected \n samples are shown in table ii . \n", "table ii specific human papillomavirus ( hpv ) types detected by self and \n clinician - collectedhpv types ( n)clinician - collected n ( % ) self - collected n ( % ) high - risk 453 ( 7.7)3 ( 6.7 ) 184 ( 10.2)3 ( 6.7 ) 314 ( 10.2)4 ( 8.9 ) 335 ( 12.8)3 ( 6.7 ) 166 ( 15.4)6 ( 13.3)low - risk 6/118 ( 20.6)12 ( 26.7 ) undetermined9 ( 23.1)14 ( 31 ) \n\n total39 ( 100)45 ( 100 ) \n lr - hpv types were detected at a higher frequency in the self - collected samples than in \n the clinician - collected samples ( 23.5% and 15.7% , respectively ; p = 0.78 ) .", "however , \n hr - hpv types were identified more frequently in the clinician - collected samples than in \n the self - collected samples ( 33.3% and 27.4% , respectively ; p = 0.55 ) .", "the concordance of \n the specific hpv type results between the collection methods demonstrated that 27.4% of \n the samples had complete agreement for hr - hpv types and 13.7% had complete agreement for \n lr - hpv types ( table iii ) . \n", "table iii concordance between low - risk ( lr ) human papillomavirus ( hpv ) and high - risk \n ( hr ) hpv dna detection in self and clinician - collected \n hpv ( n)clinician / self n ( % ) clinician / self n ( % ) clinician / self n ( % ) clinician / self n ( % ) concordance ( % ) kappalr517 ( 13.7)1 ( 1.9)5 ( 9.8)38 ( 74.5)88.20.6hr5114 ( 27.4)3 ( 5.9)-34 ( 66.7)94.10.9 \n a : positive ; b : negative ; \n c : concordance between methods . \n \n", "a : positive ; b : negative ; \n c : concordance between methods . hpv infection with multiple types was detected in 20.5% ( 8/51 ) of the \n clinician - collected samples and 15.5% ( 7/51 ) of the self - collected samples .", "one sample \n tested positive for hpv16 , 18 , 31 , 6 and 11 using both methods ." ], [ "herein , we evaluated the hpv dna detection agreement between self and \n clinician - collected samples .", "studies have found that the use of self - collected samples \n can enable the identification of the hpv types that infect the cervix ( gravitt et al .", "our results demonstrated that self - collection sampling \n generates comparable amounts of material for hpv testing to those of clinician samples \n ( both amplified 99.4% of the -globin gene ) .", "moreover , the concordance \n between the methods was satisfactory ( 84.6% , = 0.72 ) .", "studies reported a concordance \n of 87% between the two methods ( brink et al . \n", "a recent study showed agreement ( 93% ; 0.849 ) between self - sampling and the \n reference smears in regards to hr - hpv detected by real - time pcr with a modified gp5+/6 + \n primer mix ( jentschke et al .", "one explanation for the high concordance is that the self - collected specimens represent \n an admixture of vaginal and cervical cells and the sampling order ( self - collection \n first ) may increase the number of positive samples owing to a higher number of \n exfoliated cells ( gravitt et al .", "in addition , hpv testing using \n pgmy09/11 primers has higher hpv dna detection accuracy than other tests ( bhatla & moda 2009 ) .", "similarly , we found that the frequencies of hpv dna detection in self and \n clinician - collected samples were similar ( 26.5% vs. 22.9% , respectively ) and that hpv \n infection could be detected in both the vaginal and endocervical epithelia .", "hr - hpv types \n were well detected in both methods and the concordance between the methods was higher \n for the detection of hr - hpv dna than that for that of lr - hpv .", "the hypothesis that sample self - collection may be suitable as a novel method of cervical \n cancer screening by molecular tests was supported by other studies ( jentschke et al .", "( 2013 ) recently reported that the positive predictive value of this test \n decreased when the sample was self - collected , with better predictive outcomes associated \n with high - grade lesions . \n", "( 2013 ) detected a positive rate of \n 12.3% for hr - hpv using care hpv ( qiagen , usa ) for detection in self and professionally \n collected samples .", "these authors also observed a slightly higher frequency of hr - hpv \n positive results in the self - sampling group than in the professionally sampled group \n ( 13.5% vs. 11% , respectively ) , although the results obtained by other authors ( castle et al .", "2007 , petignat et al . 2007 ) . in the present study , women were recruited from the public health system after they were \n referred to a gynaecologist and this may explain the high positive rate of hpv dna ( 30% ) \n in our samples .", "the type of test used in the analysis of hpv dna is another relevant variable to \n consider when determining the efficiency of both collection methods .", "the more sensitive \n the detection method , smaller the amount of sample required for successful detection ( de \n sanjos et al .", "another factor to \n consider is the type of instrument used to collect the cells ( liquid - based , swab or \n endocervical cytobrush ) , which may affect the amount of sample collected ( lorenzato et al .", "compared to other hpv types , hpv16 and hpv18 confer a higher risk of cervical cancer \n ( koutsky et al .", "hr - hpv16 was the most frequently detected type in both the self and clinician - collected \n samples and thus , self - collected samples show promise as an alternative diagnostic tool , \n as well as for epidemiologic studies and vaccine trials .", "the type - specific primers used \n in this study are considered the most prevalent viral types worldwide ( walboomers et al .", "1999 ) . regarding hpv types obtained from different samples , the detection of high - risk \n oncogenic hpv was more common in the clinical collection group .", "a study comparing the \n detection of hpv types in samples of cervical and vaginal origin found that low - risk \n oncogenic hpv was more prevalent in the vaginal epithelium .", "hence , it is likely that the \n oncogenic hpv types have different survival mechanisms and viral production compared to \n lr - hpv types , which rarely produce cytological abnormalities and prefer to infect cells \n in the vagina , where the tissue is keratinised ( castle et \n al .", "this fact may be associated with the restricted choice using only the primers to lr - hpv6 \n and 11 types .", "in addition to oncogenic hpv , we verified that sample self - collection has the potential \n to detect multiple hpv infections .", "it is remarkable that infections with multiple hpv \n types were frequently found in a study of brazilian women ( tozetti et al .", "multiple hpv infections increase a woman s \n risk of developing cervical neoplasia , even if the co - infections is with an lr - hpv , \n since it could influence the development of low - grade squamous intraepithelial lesions \n ( trottier et al .", "another risk factor of hpv infection is age , as one study of sample self - collection by \n adolescents showed that hpv infection is more common in sexually active younger women \n ( silva et al .", "1998 ) . in our study , we \n found lower frequency of infection in women 30 years of age .", "these results were \n consistent with those of other studies ( lindell et al . \n 2002 ) , that reported that hpv prevalence differs by age and is less common in \n women over age .", "it was suggested that screening using hpv - dna tests is more appropriate \n in women > 30 years of age since hpv infection is less likely to be transient in this \n age group unlike in younger women ( franco \n 2003 ) .", "hpv dna testing has the potential to improve the efficacy of cervical cancer screening \n and is a more cost - effective solution . using this strategy ,", "the screening interval can \n be extended to every three years compared to the use of annual pap smears ( chow et al . 2010 ) .", "recognising this , women who are \n underserved in terms of cervical cancer screening , mainly those in remote areas of large \n countries such as brazil , can justify the use of this self - collected method to the \n public health service . in this study", ", we demonstrated that the results of the self - collected sampling method \n are in good agreement with those of the clinician - collected sampling method for the \n detection and typing of hpv dna .", "use of the self - collected sampling method as a primary \n prevention strategy in countries with few resources could effectively identify those \n women with hr - hpv .", "the self - collection method is better accepted among women ; therefore , \n it could enhance cervical cancer screening program coverage and contribute significantly \n to reducing the incidence of cervical cancer ." ] ]

[ [ "paola ricciardi - castagnoli ( university of milano , italy ) and were grown in rpmi 1640 medium ( paa , linz , austria ) supplemented with 2 mm glutamine and 10% ( heat - inactivated ) fcs ( life technologies ltd . ,", "paisley , scotland ) , 100 u / ml penicillin , and 100 g / ml streptomycin as described previously ( 2 ) .", "human monocytes were isolated from buffy coats by one - step gradient ( percoll ; pharmacia biotech spa , cologno monzese , italy ) or by adherence on plastic petri dishes . ", "after isolation , cells were kept in culture for 5 d in rpmi medium containing 2 mm glutamine , 5% human serum , 100 u / ml penicillin , and 100 g / ml streptomycin . il-1 and il-6 in the supernatant of lps ( sigma chemical co. ,", "st . louis , mo ) treated cells were measured with the intertext-1x mouse il-1 elisa kit and intertext-6x mouse il-6 elisa kit , respectively ( genzyme srl , cinisello balsamo , italy ) .", "all reagents used were dissolved in endotoxin - free water ( sigma ) and checked for endotoxin contamination .", "microglial cells ( 25 10/ well ) were plated in microtiter plastic wells in culture medium and incubated in a co2 incubator at 37c in the absence or presence of lps for 24 h. at the end of this incubation , the monolayers were thoroughly rinsed with saline solution and supplemented with 100 l of a special diluent buffer ( firezyme ltd .", ", san diego , ca ) to stabilize extracellular atp and directly placed in the test chamber of a luminometer ( firezyme ) .", "then , 100 l of luciferin - luciferase solution ( firezyme ) was added , and light emission was recorded . as a control ," ], [ "paola ricciardi - castagnoli ( university of milano , italy ) and were grown in rpmi 1640 medium ( paa , linz , austria ) supplemented with 2 mm glutamine and 10% ( heat - inactivated ) fcs ( life technologies ltd . ,", "paisley , scotland ) , 100 u / ml penicillin , and 100 g / ml streptomycin as described previously ( 2 ) .", "human monocytes were isolated from buffy coats by one - step gradient ( percoll ; pharmacia biotech spa , cologno monzese , italy ) or by adherence on plastic petri dishes . ", "after isolation , cells were kept in culture for 5 d in rpmi medium containing 2 mm glutamine , 5% human serum , 100 u / ml penicillin , and 100 g / ml streptomycin . il-1 and il-6 in the supernatant of lps ( sigma chemical co. ,", "st . louis , mo ) treated cells were measured with the intertext-1x mouse il-1 elisa kit and intertext-6x mouse il-6 elisa kit , respectively ( genzyme srl , cinisello balsamo , italy ) .", "all reagents used were dissolved in endotoxin - free water ( sigma ) and checked for endotoxin contamination ." ], [ "microglial cells ( 25 10/ well ) were plated in microtiter plastic wells in culture medium and incubated in a co2 incubator at 37c in the absence or presence of lps for 24 h. at the end of this incubation , the monolayers were thoroughly rinsed with saline solution and supplemented with 100 l of a special diluent buffer ( firezyme ltd . , san diego , ca ) to stabilize extracellular atp and directly placed in the test chamber of a luminometer ( firezyme ) . then", ", 100 l of luciferin - luciferase solution ( firezyme ) was added , and light emission was recorded . as a control ," ], [ "1 shows that a 24-h incubation in the presence of 10 g / ml lps triggers release of il-1 and that this is blocked by pretreatment with the selective p2z / p2x7 inhibitor ( 13 ) oatp . to show that the effect of oatp is not due to a nonspecific inhibition of cell responses , we have also monitored il-6 release , which is much less affected . as further proof that oatp does not have nonspecific effects ,", "we show that il-1 release is restored in lps - treated , oatpinhibited cells by the k ionophore nigericin , an agent known to cause il-1 release through a receptor - independent pathway ( 4 , 10 ) .", "autocrine / paracrine stimulation of purinergic receptors can also in principle be prevented by exogenously added atp - consuming enzymes such as apyrase or hexokinase . ", "2 a shows that apyrase completely inhibits lps - dependent il-1 release ( the inactivated enzyme has no such effect ) .", "the main difference between apyrase and hexokinase is that the first hydrolyzes atp and adp , thus generating amp , whereas hexokinase uses atp as phosphorus donor to phosphorylate glucose , thus generating glucose 6 phosphate and adp .", "it is known that adp is an agonist at p2z / p2x7 receptor , though less potent than atp ( 12 ) .", "thus we checked whether the potentiating effect of hexokinase is mediated by stimulation of the p2z/ p2x7 receptor by accumulated adp .", "this seems to be the case because pretreatment with oatp blocks il-1 secretion due to the combined addition of lps and hexokinase ( fig .", "2 a ) , and more importantly , exogenous adp ( adpe ) is a much more potent stimulus than atp ( fig .", "these experiments suggest that il-1 release could be modulated by atpe and adpe , probably released by the inflammatory cells themselves under lps stimulation .", "an obvious sine qua non of this hypothesis is that microglial cells must release atp in response to lps .", "3 a shows that microglial cells chronically stimulated with lps release atp . because the incubation medium is changed right before atp determination , extracellular atp measured in this experiment is very likely not accumulated in the bulk phase but continuously generated by the microglial cells . in support of this interpretation , we consistently found very little extracellular atp in the cell - free supernatant ( not shown ) . ", "the lps dose response curve for atp release closely matched that for il-1 release , as shown in fig .", "3 b. it has been shown previously that atp is a powerful stimulus for il-1 secretion from macrophages ( 10 , 11 ) , thus suggesting that this nucleotide might also have a role in autocrine / paracrine stimulation of these cells . in support of this hypothesis ,", "4 shows that atp is released by human macrophages isolated from three different subjects after stimulation with lps .", "the mechanism of il-1 processing and release is a key issue in immunology ( 59 , 15 ) .", "rather surprisingly , recent evidence points to a decrease in cytoplasmic k as a pivotal stimulus for ice activation and il-1 maturation ( 4 , 10 ) . ", "however , lps itself does not directly activate plasma membrane k channels , and mouse microglial cells express inwardly but not outwardly rectifying k channels ( 16 ) , thus raising the issue of the mechanism responsible for lowering the cytoplasmic k concentration .", "it has been suggested that this might be achieved by a lps - dependent increase in the number of voltage - dependent k channels in the macrophage plasma membrane ( 4 ) , but typical k channel inhibitors blocked il-1 release only at concentrations far above those necessary to inhibit these channels ( 4 ) .", "the p2z / p2x7 receptor is a good candidate to mediate cytoplasmic k depletion .", "this receptor is typically expressed in macrophages and macrophage - like cells ( 2 , 17 , 18 ) , and it is modulated by inflammatory cytokines ( 17 , 19 ) .", "a brief stimulation with atpe triggers massive k efflux ( 12 ) and release of processed il-1 ( 2 , 10 , 11 ) , whereas a sustained activation causes cell death ( 1 , 17 , 20 ) . our data suggest that il-1 release from microglial cells requires a double stimulation : first , lps - dependent transcription of the il-1 gene and cytoplasmic accumulation of proil-1 ; second , paracrine / autocrine activation of the p2z / p2x7 receptor that causes release of the mature cytokine .", "adenine nucleotides can originate from many different sources : ( a ) the microglial cells themselves can release atpe , either spontaneously or under lps stimulation ; ( b ) injured or damaged cells certainly release significant amounts of this nucleotide , a process likely to occur in vivo at sites of inflammation ; ( c ) in the central nervous system , atpe can be released by neurons that establish close contact with the microglial cells .", "it might seem paradoxical that adp is a better il-1 releasing agent than atp , although notoriously it is a less potent stimulus at the p2z / p2x7 receptor .", "however , this is not unexpected because adp , in contrast with atp , is devoid of cytotoxic activity , and data from our laboratory show that release of il-1 is optimal in response to a submaximal , noncytotoxic stimulation of the p2z / p2x7 receptor , such as that due to adpe ( d. ferrari and f. di virgilio , manuscript in preparation ) .", "involvement of the p2z / p2x7 purinergic receptor in lps - dependent il-1 release may allow the development of new pharmacological antagonists ( i.e. , oatp and derivatives ) to modulate the in vivo production of this cytokine in pathological conditions such as septic shock or chronic inflammatory diseases ." ], [ "oxidized atp inhibits lps - dependent release of il-1. n13 microglial cells were incubated in 24-well plates in rpmi medium supplemented with 10% fcs at a concentration of 2 10 and incubated 24 h in the presence or absence ( controls ) of 10 g / ml lps . in the experiments with oatp , cells were treated with this inhibitor ( 300 m ) for 2 h and then rinsed before addition of lps . stimulation with nigericin ( 20 m ) was performed for 30 min after removal of oatp .", "data are averages of duplicate determinations from a single experiment repeated on three separate occasions .", "( a ) where indicated , cells were incubated in the presence of apyrase ( apy , 0.4 u / ml ) or hexokinase ( hex , 100 g / ml ) throughout lps treatment ( 10 g for 24 h ) . as a control ,", "the enzymes were boiled for 30 min ( b apy and b hex ) before being added to the cell monolayers .", "pretreatment with oatp ( 300 m ) was peformed for 2 h ; then the monolayers were rinsed and challenged with the different stimuli .", "( b ) cells were first stimulated for 2 h with lps ( 10 g / ml ) , and then stimulated with either 1 mm atp or adp for 30 min .", "microglial cells were plated in 24-well plates as described in fig . 1 for il-1 secretion or microtiter plastic wells as described in materials and methods for atp release and stimulated with lps for 24 h in a co2 incubator at 37c .", "for measurement of atp , release samples were processed as follows : monolayers were rinsed and 100 l of diluent buffer ( firezyme ) were added ( see materials and methods ) .", "data for il-1 release are duplicates from a single experiment repeated with similar results with three different batches of microglial cells .", "data for atp release are means of quadruplicate determinations sd from a single experiment repeated in three different occasions .", "macrophages were isolated from three different donors ( a c ) as described in materials and methods and plated in microtiter plastic wells at a concentration of 50 10/well . after plating ,", "cells were stimulated for 24 h with lps and atp release measured as detailed in fig ." ] ]

[ [ "a 23-year - old engineering graduate presented with primary palmoplantar hyperhidrosis , for which he was advised an alternate day schedule of tap water iontophoresis ." ], [ "on his next visit , he presented with a very simple iontophoresis device that he devised on his own .", "the device was constructed with a rechargeable 12 volt battery , two aluminum trays and copper wires , and connecting clamps [ figure 1 ] .", "hence , using his engineering background he constructed this simple device based on basic mechanism behind iontophoresis .", "he followed an alternate day schedule of 20 min utes immersion for initial 4 weeks , followed by once a week for next 8 weeks .", "he achieved an excellent reduction in palmoplantar sweating without any adverse effect , within 3 months of starting iontophoresis . a simple user - made iontophoresis device" ], [ "iontophoresis is defined as passing of an ionized substance through intact skin by application of direct current ( dc ) .", "tap water iontophoresis is a reliable and effective method for the treatment of palmar and plantar hyperhidrosis , when practiced with appropriate technique and timing .", "many dermatologists consider simple tap water iontophoresis to be first line therapy for primary focal palmar and plantar hyperhidrosis .", "the mechanism of production of anhidrosis is not completely understood ; however , obstruction of sweat duct has been suggested as a possible cause .", "few brands of iontophoresis devices are commercially available ; however , they are expensive and are not readily available . commercially available", "construction of an iontophoresis device has been described by levit , in which output of the 115 volt isolation transformer is rectified by the full wave selenium rectifier and then filtered by the choke and capacitors , and the potentiometer acts as a voltage divider .", "levit had suggested that such devices can be constructed at home , and circuit diagram could be found in his original report , but we feel that the procedure for assembling such a device will be difficult for a layperson . for tap water iontophoresis , patients are instructed to apply petroleum jelly with a cotton swab to cover any cuts over the treated area before the session .", "the trays should be filled with tap water , then , the affected areas should be immersed in the tap water .", "a monday - wednesday - friday schedule should be followed until the condition improves ; subsequently , the treatment should be tapered once a week for 8 weeks and then once a month for maintenance .", "additionally , the patient should wear rubber or plastic footwear and should keep himself from directly touching the floor . burning and pin pricking sensations are very common and", "erythema and vesiculation are transient ; topical corticosteroids cream can be applied for persistent erythema and vesiculation .", "pregnant women , people with pacemaker or metal implants , cardiac conditions , or epilepsy are contradictions for the use of iontophoresis machine .", "once a home device is obtained and the patient has received adequate education and training , the maintenance cost and effort are minimal for the patient and health care provider alike .", "iontophoresis machines basically produce a voltage sufficient to drive a dc of 15 - 20 ma through the hands of patients .", "an ampere - meter could be used to measure the output current of such user - made devices and can upgrade the voltage of the battery , provided the output is low in terms of current .", "simple user - made devices such as this one would make the process of iontophoresis very easy , safe , and cost - effective . there are no conflicts of interest ." ], [ "" ], [ "" ] ]

[ [ "intertrochanteric femoral fractures ( iffs ) , also called proximal femoral fractures , usually occur between trochanter major and trochanter minor and these fractures are observed in old people in a quite common way , since they are prone to decline in bone density and strength due to aging . apart from old people , young people can also experience these types of fractures as a result of sudden excessive force or stress .", "stable and unstable fractures are the two types of proximal femoral fractures . in order to fix these two different types of fractures , either extramedullary implants such as dynamic hip screw ( dhs ) or", "implant selection is vital for the treatment of stable and unstable trochanteric femoral fracture types . in", "stable iff , extramedullary implants should be selected and intramedullary implants should be preferred for unstable iff according to the recent studies [ 1 , 2 ] .", "in addition to these studies , parker and handoll who compared intramedullary and extramedullary implants for iff concluded that dhs should still be considered as the gold standard device for stable and unstable iff .", "nevertheless , there are several common problems in the treatment of iff with dhs such as implant failure and the cut - out of lag screw due to trabecular bone failure .", "the mechanical role of the lag screw is to stabilize the fracture line preventing the slide and separation of fracture fragments .", "the force due to the body weight is transferred to distal femur via the dhs lag screw . on some occasions", "the cut - out can be defined as the scission of the implant from the inner region of the femoral head or a movement of the femoral head towards the varus direction .", "multiple factors such as implant positions , bone quality , fracture types , and implant designs play a role in the cut - out risk .", "most of the clinical and biomechanical studies focused on the lag screw positions in the femoral head . however , which positions of the lag screw in the femoral head increase the cut - out risk and implant failure is still a controversial subject .", "some researchers recommend the central placement , but others suggest the inferior and inferior posterior region in the lateral view [ 3 , 6 , 7 ] .", "some authors believe that the cut - out risk in posterior ( p ) region is lower compared to the other region .", "there is no unanimous agreement on the ideal position of the lag screw in the femoral head . besides these recommendations", ", called tip - apex distance ( tad ) , the length of the distance from the tip of the lag screw to the apex of the femoral head on an anteroposterior and lateral radiograph , to estimate the cut - out risk .", "this method has been used as a reliable method in most clinical practices [ 1 , 5 , 1012 ] . nonetheless , according to a recent study ,", "another factor of the cut - out risk and implant failure is the fracture type of femur trochanteric region .", "therefore , the implant selection and position in the femoral head are of paramount importance for different iff types in terms of the cut - out of the lag screw and implant failure . in this study , the effects of three factors ( lag screw positions , fracture types , and tad ) in the cut - out risk were evaluated using finite element analysis ( fea ) in a patient - specific femur .", "the aim of the fea study was to assess how the different positions of the lag screw and fracture types can influence the risk of cut - out systematically ." ], [ " 3d femur cortical and trabecular models were modelled via computerized tomography ( ct ) images obtained from a male patient aged 57 using a toshiba aquilion ct scanner in the department of radiology of the medicine faculty at the university of kocaeli .", "ct images consist of parallel layers having a pixel size of 0.774 0.774 mm at the lateral position and a voxel resolution of 473 473 235 .", "the images were recorded in the digital imaging and communications in medicine ( dicom ) format .", "these images were then transferred to the mimics 12.1 ( materialise , leuven , belgium ) 3d image - processing software .", "the surface errors ( spike , intersection , etc . ) of the models of femur cortical and femur trabecular bones were corrected with the help of geomagic studio 10 software ( raindrop inc .", "after the correction of the surface roughness of the model , 3d smooth solid models were developed and imported into solidworks program ( dassault systmes solidworks corp .", "two- and three - part trochanteric fractures were formed as 31-a1.1 ( stable fracture type ) and 31-a2.1 ( unstable fracture type ) in the muller ao classification accompanied with and without medial support at the level of the lesser trochanter in solidworks program .", "the angle of the fracture line with the femoral anatomic axis was assumed to be 30 and the proportion of the intrusion distance of the medial fragment to the distance of the fracture complex was assumed to be 30% that is mostly encountered ( figure 1 ) .", "the geometrical dimensions of the dhs with a 130 four - hole standard barrel plate were obtained from the implant manufacturer catalogue [ tipsan co. inc . ] .", "the femoral head was schematically divided into nine different positions as shown in figure 2 .", "the models of dhs and fractured femur were combined with different lag screw positions in accordance with clinical practice .", "tad values were measured in both ap and lateral views in solidworks program as suggested by baumgaertner et al . and were illustrated as a gauge bar in the femoral head ( figure 3 ) .", "finally , the femur models with dhs implants positioned as mentioned above were imported into ansys workbench software ( ansys inc . , canonsburg , pa ) in iges file format for fea .", "it was assumed that the material properties of the bones and dhs models are linear elastic and isotropic .", "the material of dhs was considered to be made of 316l stainless steel which is commonly utilized in the treatment of iff .", "the material property values that were obtained from the literature were determined as shown in table 1 .", "mesh convergence was tested by refining the element size from 6 to 3 at 1 mm interval on the femur and 4 to 1 at 0.5 mm interval on the dhs plate .", "the most suitable element size for the optimum results was determined as 4 mm and 1.5 mm for the whole femur and dhs plate , respectively .", "the element types of solid 186 ( hexahedron - dominant ) and solid 187 ( tetrahedron ) were used in the whole finite element model . in fea , several mesh sizes for the additional refinement were defined at some critical locations such as the screw threads and the corner of the dhs model in order to get convergence .", "the number of elements and nodes changed from 65.000 and 150.000 to 75.000 and 245.000 , in a successive way .", "the interactions of all contact surfaces were presumed as a frictional contact except the interactions between trabecular and cortical bone .", "friction coefficients were defined as 0.42 for the interactions between the bone and the implant , 0.2 for the interactions between the implant and the fragment of the implant itself , and 0.46 for the interactions of the fragments of the fractured bone .", "the fractured femur models fixed with dhs were subjected to a static load obtained from the literature in accordance with the value reported for a person walking at a normal speed .", "the coordinate system for the femur was defined based on the definition by bergmann et al . .", "considering body weight , the maximum forces resulting from walking were applied to the femoral head surfaces in ansys workbench for x - y - z force vectors , as shown in figure 4 .", "the force of the abductor muscle was applied as presented by duda et al . .", "the distal ends of the fractured femur models were constrained taking into consideration the contact surface of the knee joint as shown in figure 4 .", "the compressive strain criterion was selected to predict the cut - out risk of the femoral head models in the trabecular bone according to schileo et al . .", "expected femur trabecular bone failure is supposed to occur when the strain level exceeds the trabecular bone yield strain equaling to 1% of the compressive strain of the trabecular bone [ 22 , 23 ] .", "the volume percentages of the trabecular bone exceeding the yield strength of the compressive strain for each position were calculated and compared to each other .", "the best lag screw location was determined according to the amount of minimum volume percentage ." ], [ "the contour plots in figures 5 and 6 illustrate the minimum principal strain ( compressive ) results in a cross section of the trabecular femur head for nine different models with both fracture types .", "furthermore , the volume percentages of the compressive strain level on the trabecular femur are shown as a pie chart in figures 5 and 6 .", "the gauge bar in figures 5 and 6 indicating strain levels was divided by strain bands .", "the maximum value in the gauge bar was accepted as 1% of the compressive strain of the trabecular bone . based upon the compressive strain criterion ,", "posterior regions ( p , pi ) of 31-a1.1 fracture type models had the largest failure regions on the trabecular bone which is close to dhs - femur neck region as shown in figure 5 .", "the lowest cut - out risk was specified in the middle region with reference to the trabecular bone failure criterion .", "the as , s , and i regions had a lower cut - out risk compared to the pi and p regions in a comparison with the percentages surmounting the compressive strain at a rate of 1% .", "as expected , higher compressive strain values were predicted for the 31-a2.1 compared to 31-a1.1 fracture types owing to the load transfer pathway of the femur .", "the values of all a2.1 fractured femur models surpassed the value of the compressive strain at 1% .", "accordingly , all regions for both fracture types were at the risk of a cut - out in defined loads and boundary conditions .", "the values in excess of the strain values at 1% were detected at the upper side region of the lag screw and at the intersection region between the lag screw and fracture surfaces for all models .", "pertaining to the results , as the most suitable region for the cut - out risk , the middle placement of the lag screw was determined with reference to the yield strain criterion of the trabecular bone .", "the higher cut - out risk regions were the pi , ai , and a regions as shown in figure 6 .", "all tad values as to the lag screw positions were fewer than 30 mm except the tad value of ai position having the maximum values at 30 mm as shown in figure 3 .", "the results demonstrated that the pi and ai regions had the higher risk and also the higher tad values .", "although the ps and s regions had higher tad values compared to the as , a , p , and i regions , the volume percentages of the trabecular failure in the ps and s regions were less than in as , a , p , and i regions .", "hence , the results of tad proved incompatible in the regions of ps and s in a2.1 fracture type ." ], [ "the cut - out risk of the lag screw in two iff types can be estimated by utilizing the technique of the fe simulations .", "biomechanical studies on the lag screw positions usually evaluate only the positions of s , m , and i regions [ 7 , 24 ] as shown in figure 3 contrary to many clinical studies [ 5 , 1012 ] .", "there is no biomechanical or clinical study about how fracture types affect the cut - out risk in different lag screw positions according to our literature search . in this study", ", the effects of the varieties of the lag screw positions observed in clinical practices on the cut - out risk were evaluated using fe method in two types of the femur trochanteric fractures .", "the forces of the abductor muscle were applied in fea and the other muscles were ignored in this study .", "reported that the muscle forces had no significant effect on the strains of the intramedullary nail used for the treatment of femur trochanteric fractures .", "besides , konstantinidis et al . concluded that the muscle forces have little effect on the fracture displacement for trochanteric fractures .", "indeed , particularly the force of the abductor muscle has a fundamental effect on the strain values of the femur [ 26 , 27 ] . in the light of these studies", ", we arrived at a decision that only the force of the abductor muscle should be added to fea .", "the critical strain value was exceeded in all positions of both fracture types . comparing the volume percentages of the strain between each other in all positions", ", we found that the lag screw placements of p regions ( p , p - i , and p - s ) and i regions ( a - i , i , and p - i ) of the femoral head increased the failure risk of the trabecular bone .", "in contrast , the placement of the lag screw in the middle region leads to a lower risk compared to other placements .", "these incompatible results originated from several reasons such as the type of fixation , femur fracture type models [ 5 , 6 ] , boundary conditions [ 613 , 15 ] , and different tad values [ 3 , 58 , 28 ] .", "another reason for incompatibility between this study and clinical studies [ 8 , 28 ] is the complex structures of the trabecular bone . in reality , the material structure of the proximal part of the trabecular bone is very complex and it is very difficult to represent this complex structure of the bone material in fea .", "it was assumed that the femur consisted of isotropic material and homogeneous trabecular bone density . upon taking a glance at studies about bone density", ", we realized that the central region of the femoral head had the strongest trabecular bone , whereas the superior regions of the head had the weakest trabecular bone [ 29 , 30 ] . under these circumstances", ", the cut - out risk may increase at the superior region and decrease at the center and inferior regions . as to these factors", ", even though the superior regions seem to be safer than the other regions except the region of m in our study , the possibility of the cut - out in superior regions is higher than expected . on the other hand , the possibility of the cut - out at the ai , i , pi , a , and p regions is lower than expected .", "fundamentally , the assumptions of the homogeneous isotropic properties for the trabecular bone simplify the models and thus weaken the conclusions . therefore , with our study", "the fact that the density distribution of the trabecular bone is a more efficient factor compared to the positions of the lag screw in the cut - out risk considering the clinical study outcomes [ 5 , 6 , 8 ] can be presumably stated .", "further studies can be conducted about how the elasticity of different trabecular bone regions affects the strain results of the patient 's femoral head .", "the highest compressive region was found at the upper region of the lag screw threads on the trabecular bone as illustrated in figures 5 and 6 .", "however , according to the recent study , a critical region was determined in different places most of which were near the intersection between the fracture line and the lag screw unlike our finding .", "the main reason for this discrepancy can be originated from modelling taking into consideration the bone density of the femoral head and the tad values .", "in addition , the loads are transferred to the knee via the lag screw in a2.1 fracture type .", "nonetheless , the transferring path of loads in a1.1 fracture type is via both the lag screw and the fracture surfaces with the medial support .", "while the load is transferred to the distal femur , the fragments of the femoral head are enforced to be separated from each other in the superior region of the fracture line .", "conversely , the fracture surfaces in the inferior region of the fracture line are pressed against each other .", "thus , the critical regions of the trabecular bone are observed at the tip of the lag screw and at the intersection region between the lag screw and the fracture line .", "tad depends on the placement of the lag screw into the femoral head and thereby affects the strain on the trabecular bone .", "a significant number of clinical studies have been carried out for the relation between tad and the cut - out .", "these studies regard tad as the best predictor for the cut - out risk [ 5 , 912 , 30 ] .", "nevertheless , it is not an accurate predictor in that it can not reflect the inhomogeneous distribution of the bone in femoral head regions .", "if just tad is used to determine risk , it may cause a higher risk of failure due to the placement of superior regions .", "based on our results , the risk of the cut - out is predicted by tad except the s and ps placements in 31a2.1 fracture type regarding the volume percentages of strain exceeding the yield point .", "one reason for not being predicted in s and ps placements can be explained by the fact that the volume of the trabecular bone at the tip of the lag screw is less than that of other regions .", "other reasons can be explained by the ignorance of the distribution of the bone density and the selection of volume percentages regardless of the maximum strain values as an evaluation method .", "consequently , there is a compatible relation between the cut - out risk and tad values as the other numerical and clinical studies have found [ 5 , 6 , 8 , 1012 , 28 ] .", "these are usually assumed to be the linear , homogeneous , and isotropic material properties in many fea studies [ 6 , 24 ] such as in this study . however , these tissues have anisotropic and heterogeneous material properties .", "one other limitation is that the behaviour of muscle and tendon tissues surrounding the fracture location was not included .", "another limitation of the study is that the only normal walking loading case which did not create the worst loading case for the models was used .", "the other limitation is that the femur - implant interfaces were assumed to be ideally contacted with each other . in reality ,", "contact ratio is changeable from patient to patient according to application of surgeon and bone porosity .", "the validation of the fe model is crucial to take accurate results . in this study", "furthermore , the resulting comparisons of the eighteen models give the idea that the results are accurate .", "the fea results showed that femur trochanteric fracture types are crucial for the treatment of the femur fractures .", "in other words , fracture types affect the cut - out risk in different lag screw positions .", "some obvious distinctions were recorded between the stable ( 31-a1.1 ) and unstable ( 31-a2.1 ) fracture types in terms of the minimum principal strain distributions .", "the unstable fracture increasing the strain levels of the femoral head caused a higher cut - out risk of the lag screw .", "for this reason , there is a possibility of the trabecular bone yielding at the tip of the lag screw in the unstable fracture models ." ], [ "the bone density and the location of the lag screw at the femoral head are fundamental factors for the cut - out risk . in addition", "furthermore , the method of tad used for the determination of the cut - out risk in clinical practices also proves to be useful as a predictor in our study .", "all in all , we can supposedly say that the density distribution of the trabecular bone is a more efficient factor compared to the positions of the lag screw in the cut - out risk ." ] ]

[ [ "the order siluriformes is the most diverse and well - distributed within the ostariophysi , and includes 3093 species , 478 genera and 36 families ( ferraris jr , 2007 ) . in the neotropical region", ", there are 1648 nominal species grouped in 15 families ( reis et al . , 2003 ) .", "the distribution of neotropical siluriformes appears to be limited by temperature since most of the species live in tropical areas , with few reaching the southern portion of south america or the northern edge of north america ( nelson , 2006 ) .", "many species of this order occur in small headwater streams with clear water , strong currents and a high oxygen content , while others have adapted to stagnant and often polluted waters in which oxygen levels are extremely low ( burgess , 1989 ; m.r .", "britto , 2002 , doctoral thesis , universidade de so paulo , so paulo , brazil ) . among the headwater fishes of the southeastern region of south america , representatives of the subfamily neoplecostominae are the most prominent .", "there is controversy regarding which genera belong to the neoplecostominae , although important progress has been made through the phylogenetic contributions of montoya - burgos et al .", ", representatives of the genus neoplecostomus occur in the headwater streams of southern and southeastern brazil .", "langeani ( 1990 ) , who reviewed the genus neoplecostomus , recognized n. microps and n. granosus , and described n. paranensis , n. espiritosantensis , n. ribeirensis and n. franciscoensis .", "bizerril ( 1995 ) subsequently described n. variipictus from the paraba do sul river basin , and zawadzki et al .", "( 2008a ) recently described three new species of neoplecostomus ( n. corumba , n. selenae and n. yapo ) from the upper paran river basin .", "neoplecostomus species are morphologically very similar ( langeani , 1990 ) , although some can be very different genetically , as shown by zawadzki et al .", "( 2004a ) , who compared neoplecostomus corumba ( neoplecostomus sp . in that work ) and n. paranensis using allozyme electrophoresis . in view of the difficulty in identifying species of this genus , in the present study , two populations of neoplecostomus , one from so domingos stream of the grande river in the municipality of muzambinho , in minas gerais state , and another from paraitiguinha stream of the tiet river basin in the municipality of salespolis , so paulo state ( both in the upper paran river basin ) were compared using allozyme gel electrophoresis in order to improve our understanding of the biodiversity within this genus" ], [ "twenty - nine specimens of neoplecostomus sp . 1 ( figure 1a ) were collected in paraitinguinha stream ( tiet river basin ) at 233039,84 ", "s/455132,22 w and an altitude of 786 meters in the municipality of salespolis , so paulo state ( figure 2 ) .", "2 ( figure 1b ) were collected in so domingos stream ( grande river basin ) , 212047,22 ", "s/462800,79 w and an altitude of 1021 meters in the municipality of muzambinho , minas gerais state ( figure 2 ) .", "specimens of the two populations reported here differed morphologically from the four species of neoplecostomus described for the upper paran river basin by the following characters : ( 1 ) a well - developed adipose fin distinguished them from n. corumba and n. paranensis that have a reduced / absent adipose fin or no adipose fin , respectively , and ( 2 ) homogeneously dispersed hypertrophied odontodes in the dorsal region of the head and not bordered by swollen skin vs. more hypertrophied odontodes in front of the eyes and the lateral margin of the snout surrounded by swollen skin in n. selenae , and more hypertrophied odontodes bordered by hypertrophied skin only on the lateral margin of the snout in n. yapo .", "the fish were frozen in liquid nitrogen and transported to the universidade estadual de maring .", "voucher specimens were deposited in the ichthyological collection of the ncleo de pesquisas em limnologia , ictiologia e aquicultura ( nuplia ) of the universidade estadual de maring ( neoplecostomus sp . 1 under accession number nup 6102 and neoplecostomus sp . 2 under accession number nup 6103 ) .", "samples of liver and white muscle were homogenized with a plastic pestle in polypropylene tubes ( 1.5 ml ) containing 100 l of 0.02 m tris - hcl , ph 7.5 . to the liver samples 100 l of carbon tetrachloride ( ccl4 ) was added to facilitate homogenization of this fatty tissue ( pasteur et al . ,", "aliquots of the protein extracts were applied to 15% corn starch ( penetrose 50 ) gels ( val et al . , 1981 ) by using small ( 4 mm x 8 mm ) whatman 3 mm filter paper strips soaked in the samples followed by horizontal electrophoresis under refrigeration .", "two buffer solutions were used : 0.135 m tris/0.043 m citric acid , ph 7.0 ( tc ) , diluted 15 times during preparation of the gel , and 0.18 m tris/0.1 m boric acid/0.004 m edta , ph 8.6 ( tbe ) , diluted four times during preparation of the gel .", "the gels were run for 17 h ( current of 50 v at the ends of the gel ) .", "after electrophoresis , the gels were cut horizontally into two slices that were then incubated with specific histochemical solutions to detect the bands of enzyme activity in each system , according to standard protocols ( murphy et al . , 1996 ) .", "the genetic interpretation of the electrophoretic profiles was based on the structure of each enzyme , according to ward et al .", "genetic variability was estimated by calculating the expected ( he ) and observed ( ho ) heterozygosities , according to nei ( 1978 ) , as well as genetic identity ( i ) and distance ( d ) , which were calculated from the allele frequencies .", "all analyses were done using the software genepop 1.31 ( yeh et al . , 1997 ) ." ], [ "we analyzed 12 enzyme systems ( table 1 ) in two populations of neoplecostomus and obtained 19 loci ( table 2 ) with a total of 29 alleles . of the 49 individuals analyzed , 29 belonged to the morphotype neoplecostomus sp . 1 , collected in paraitinguinha stream , and 20 to neoplecostomus sp", "the electrophoretic patterns of the 12 enzyme systems obtained in this study were similar to those reported by zawadzki et al .", "the two populations differed at nine ( aat , acp , adh , gdh , idh , mdh - c , pgm and sorb-1 - 2 ) of the 19 loci .", "these loci were diagnostic , i.e. , they possessed alleles for each morphotype with a frequency of 100% .", "2 ( from muzambinho ) was monomorphic at all 19 loci , whereas neoplecostomus sp .", "1 ( from salespolis ) was monomorphic at all but one locus ( 5.26% polymorphism ; only the idh loci showed allelic variation ) .", "based on the gene frequencies , the genetic identity ( i ) and distance ( d ) were 0.5281 and 0.6384 , respectively .", "the nei ( 1978 ) genetic distance represents the average number of nucleotide substitutions per locus ( detectable by electrophoresis ) that have accumulated in populations since they diverged from a common ancestor , i.e. , the substitution is proportional to evolutionary time ( dobzhansky et al .", ", 1977 ; thorpe , 1982 ; thorpe and sol - cava , 1994 ) .", "the negative value of fis ( 0.0741 ) indicated an excess of heterozygotes for the idh locus in the neoplecostomus sp . 1 population .", "on the other hand , the mean fit value ( 0.9844 ) indicated an excess of homozygotes for both species . according to wright ( 1978 ) ,", "the average fst score for the loci analyzed was 0.9855 , indicating marked genetic differentiation between the two samples ; for nine loci ( aat , acp , adh , gdh , mdhc , pgm , sorb-1 and sorb- 2 ) the fst value was 1.00 ." ], [ "according to thorpe and sol - cava ( 1994 ) , populations belonging to the same species have genetic identity values ( i ) > 0.85 , whereas those belonging to different genera have i < 0.35 and species belonging to the same genus have i values of 0.350.85 . the i value for neoplecostomus sp . 1 and neoplecostomus sp", ". 2 was 0.5281 ( with d = 0.6384 ) , indicating that these populations belong to two species of the same genus .", "neoplecostomus species are morphologically very similar ( langeani , 1990 ) , but very different genetically , as shown by zawadzki et al . ( 2004a ) .", "the detection of fixed divergent alleles in syntopic populations of diploid organisms generally reflects a restricted gene flow and , consequently , the existence of different biological species ( richardson et al . , 1986 ; murphy et al . , 1996", "as shown here , nine of the 19 loci surveyed were diagnostic ( table 2 ) , leading us to conclude that the two populations studied represented different species .", "in contrast to the marked genetic divergence seen here between the two populations , other studies based on allozyme characters in allopatric populations of loricariid fishes have found no diagnostic markers .", "( 2008b ) found no fixed diagnostic markers for three populations of hypostomus regani from the corumb river , itaipu reservoir ( both in the upper paran river basin ) and manso river ( in the paraguay river basin ) .", "( 2009 ) found no fixed markers in two populations of rineloricaria pentamaculata above and below an 80 m high waterfall on the iva river .", "( 2009 ) also found no fixed markers for four populations of n. yapo along tributaries of the tibagi and pirap rivers .", "the lack of genetic divergence in these loricariid populations highlights the relevance of the marked differentiation seen between neoplecostomus sp . 1 and neoplecostomus sp", "the finding that almost half of the surveyed loci were fixed to different alleles in each population suggests that there are strong geographic barriers to neoplecostomus fish that try to move from the headwaters of the tiet river basin to the headwaters of the grande river basin , or vice versa .", "since specimens of neoplecostomus occur only in medium to small headwater streams , we believe that the main channel of large rivers such as the tiet , paran and grande acts as a barrier to free dispersion .", "1 was polymorphic at only a single locus ( idh ) contrasted with other studies in which the percentage of polymorphic loci in loricariids was generally greater than that observed here .", "( 2004a ) reported that several loci ( gpi - b , ldh - b and pgm - a ) were polymorphic in a population of neoplecostomus sp . (= n. corumba ) whereas no polymorphism was observed in n. paranensis .", "( 1999 ) found that the percentage of polymorphic loci in three populations of hypostomus from the iguau river basin ranged from 20 to 40% , whereas paiva et al .", "( 2005 ) detected 20% polymorphic loci in h. strigaticeps and hypostomus sp . 1 and no polymorphism in hypostomus sp . 2 from ribeiro maring .", "( 1999 ) found low he values of 0.011 in hypostomus derbyi and 0.017 in h. myersi from the iguau river basin , but an extremely high value ( he = 0.107 ) for another species of hypostomus ( hypostomus sp . ) from the itaipu reservoir in the paran river basin ( zawadzki et al . , 2005 ) .", "1 in the present study was 0.0069 , a low value when compared to that observed by zawadzki et al .", "( 2004a ) for neoplecostomus sp . ( he = 0.030 ) and also low in relation to other loricariids from the paran - paraguay river basin ( zawadzki et al . , 2002 , 2004b ; paiva et al . , 2005 ; renesto et al . , 2007", "2 was zero , as also reported for n. paranensis from hortel stream ( zawadzki et al . , 2004a ) .", "2 is low when compared to the average he of 0.051 estimated for 195 species of different fish species around the world ( ward et al . , 1992 ) . according to zawadzki et al .", "( 2004a ) , the unusual absence of allozyme genetic variability in n. paranensis from hortel stream could be explained by the endogamic process and ecological restrictions imposed by geographical or environmental barriers to species of neoplecostomus .", "likewise , in the present study , the low levels of genetic variability for the two populations of neoplecostomus may indicate that they are mainly sedentary and probably restricted to small areas .", "loricariids are generally non - migratory ( burgess , 1989 ; montoya - burgos , 2003 ) . moreover , the short length of most neoplecostomus species and the currently restricted distribution of their populations ( limited to head - waters ) point towards a low rate of migration ( chiachio et al . , 2008 ) .", "the sedentary nature of these fish leads to mating within the same family group and results in low genetic variability .", "these characteristics suggest a possible restricted range and reduced gene flow among neoplecostomus species compared to other fish species .", "a reduction in gene flow and genetic events , such as inbreeding , may favor rapid speciation and endemism ( strieder et al . , 2009 ) .", "for example , stochastic events such as genetic drift could lead to the fixation of alternative alleles ( kerr and wright , 1954 ) in these presumably small populations and may provide a reasonable explanation for the low intraspecific and high interspecific variation in neoplecostomus species .", "our findings suggest that other genetically - differentiated populations may be revealed as more headwater streams in southeastern brazil are sampled ." ] ]

[ [ "the incidence of animal bites in the world is estimated at 250 out of 1000 people . in iran", ", 180 people in 100,000 , and the incidence of rabies < 1 in a million is calculated . according to statistics published by the who , this disease causes between 1.3 and 2.6 million dally in a year .", "although rabies is preventable with safe and effective vaccines , it is still a health problem so that approximately 60,000 deaths occur annually in the world , and most cases occur in asia and africa .", "annually , in different parts of the world , more than 15 million people due to animal bites refer to special centers to treat .", "the real number of cases is probably higher than the figures reported due to the lack of advanced care system .", "in addition to the public human health , the incidence of the disease in animals causes significant economic losses .", "the growing cases of stray dogs and also the increasing number of animal bites and rabies distribution in many provinces has caused massive annual costs to prepare vaccines , serum , and preventive actions . and that more attention needs to be paid to control the disease and research about its different aspects . furthermore , wide geographical distribution , ecological diversity , and dependency of the risk factors of rabies to wildlife species , and also different levels of health knowledge , indicate that separate investigations should be conducted in different regions of the country .", "being aware of the epidemiology , prevalence , and at risk age groups , we can provide the officials with good ways to prevent this health problem in the health systems .", "this study aimed to evaluate the incidence of animal bites in the lorestan province in the west of iran , its distribution , and human rabies deaths from the disease over a period of eleven years from 2004 to 2014 to prevent its growing in future planning ." ], [ "this was a descriptive cross sectional study performed in lorestan province , west of iran .", "the population of this study were comprised those bitten by animals from the beginning of 2004 to the end of 2014 .", "they had referred to all medical science units in province belonging to lorestan university , to get rabies prevention treatment .", "is called one bitten by an animal and refers to the rabies prevention centers due to animal bites and fear of rabies .", "a person is said rabies case whose infection is confirmed by the pasteur institute . during the study , the required information in all cases of animal bites and human rabies were collected by questionnaire .", "questions included age , sex , the bitten organ , place of occurrence , the bite time , and the kind of aggressive animal .", "the collected data were entered into the spss statistical software version 20 ( ibm corp . released 2011 .", "armonk , ny : ibm corp . ) and were analyzed by descriptive statistics such as frequency distribution and percentage . to calculate the incidence rate ,", "the population of lorestan province was obtained from management and planning organization of the province , and the calculations were conducted based on them ." ], [ "during 2004 till 2014 , the number of animal bite cases in the province which has received preventive treatment care was 43,892 .", "the incidence of animal bites during this period was an average 223.23 in 100,000 inhabitants [ table 1 ] .", "seventy - eight percent of all cases of animal bites in rural areas and 22% in urban areas , respectively .", "totally , 33,230 ( 76% ) were men , and 10,662 ( 24% ) occurred in women , respectively ; the incidence of most animal bites 21.1% occurred between the ages of 29 and 20 and 19 and 10 years with a 20.3% of cases .", "frequency distribution and incidence rate of animal bite cases in lorestan province , west of iran ( 2004 - 2014 ) most cases of lower limb for limb bites ( feet ) , with 24,861 ( 57% ) followed by the upper extremities ( hands ) with 14,716 ( 33% ) , trunk with 3079 ( 7% ) , and head and neck with 1236 ( 3% ) , respectively .", "the report included dogs with the most bites , 36,222 cases ( 82.5% ) , followed by cats with 5894 cases ( 13.4% ) , and other animals in 1776 ( 1.4% ) [ table 2 ] .", "distribution of animal bite cases based on month and gender indicated that most cases of animal bites occurred in spring and summer [ table 3 ] .", "distribution of animal bite cases in lorestan province , west of iran ( 2004 - 2014 ) based on gender , residency , age , bite site , type of biting animal and job frequency distribution of animal bite cases in lorestan province , west of iran ( 2004 - 2014 ) based on month and gender human rabies infections which were observed in four of all cases were confirmed by the pasteur institute of iran .", "two of them were females ( 3 and 18-year - old ) who had been affected by a fox , and two were males ( 16 and 50-year - old ) .", "four cases , respectively , happened in the years 2009 , 2010 , 2012 , and 2013 ." ], [ "findings of this study showed that 43,892 people in the years 20042014 in lorestan province had been bitten by the animals . during this time , the animal bite was 223.23 out of 100,000 that in comparison to the same period all over iran was ( an average of 180/10,000 ) higher . increasing the incidence can lead to permanent educational programs in urban and rural health centers and health homes to prevent the occurrence of rabies in humans and raising awareness of the risk caused by the biting animals in the province . on the other hand , inaction and inadequacy of the measures taken by the animal", "( stray dogs ) rabies control committee , especially in the rural areas in most cities and the lack of widespread implementation of the vaccination of domestic dogs and cattle can increase the incidence of rabies .", "the incidence of the disease is higher than the study conducted by riahi et al . in tabas sabouri ghannad et al . in ilam ,", "saghafipour et al . in qom , and sadeghi et al . in the west of azarbayejan", "however , it is nearer to the reports by kassiri et al . in kermanshah and khuzestan , amiri and khosravi in shahrood and sheikholeslami", "et al . in rafsanjan . in studies conducted by khazaei et al . in hamedan ,", "qala in the north of iran , the amount of reported cases , respectively , is 423 , 7773 and 1222 in 100,000 people .", "higher incidence of animal rabies in the mentioned areas is due to the climatic conditions where the presence of the main reservoirs of the disease including wolf - likes , and other wild animals are higher than lorestan province . in this study ,", "the result of the observed cases of animal rabies is the same as the results taken in different provinces of iran . it is higher in men in comparison to women , because men have more exposure to animals , and also spend most of their time outside the home environment and also sense of adventure in men is more exposure than women", "maybe , due to the social and climate conditions , both of them are equally at risk of animal bites .", "for example , in ethiopia ramos study shows that animal bite is almost equal in both sexes . according to the results of this study , high percentage of people bitten by animals was under 20 years in 17,125 ( 39% ) , and most of the observed cases were students in 11,765 ( 26.8% ) .", "the reason of high percentage of bite among the students is that the students and those who are in the same range are more willing to play with animals , or hurt them .", "the results show that on this age and work group , training at schools about rabies , and its transmission should be done more .", "it can especially be effective in reducing the incidence of animal bites . in all other reported studies ,", "the most cases have occurred in the 1019 age group , at least 23% in dehghani 's study and up to 49.3% in bahonar et al .", "anatomically , most of the bites were related to feet ( 56.7% ) . in a study conducted by charkazi et al . in aq qala 69.4% ,", "haratynejad and khanjani in rashtkhar in khorasan province 63.9% , dadypour et al . in kalaleh 67% ,", "amiri and khosravi in shahrood 60% , and alavi and alavi in khuzestan 58% were cases related to the feet .", "kassiri 's study in khuzestan 61.4% , yalcin et al . in turkey 53% , and erfanian et al . in mashhad 43.4% showed that the most bites happened in upper limbs . in naghibi", "the differences between the results of studies may be related to the ways of facing the animal . in taller adults and in cases where an animal attacks a person fleeing , feet are more exposed to bites . however , in cases where a person is playing with or harassing an animal or has shorter stature ( like children ) , it is more likely to bite upper limbs , head , and face . in this study , most people injured were rural ( 79% ) , which is consistent with most of the studies .", "animal bites occur more in rural areas , because in most villages , livestock or agriculture is the main occupation of the people , especially in forests and mountainous areas , it is more likely for the people to face stray dogs and wild animals .", "however , studies conducted in the centers of province or city , for instance saghafipour et al . in qom ,", "apart from the study conducted by kassiri et al . in which the animal bite has happened more slightly in fall and winter , in other studies , most cases have occurred in spring .", "higher exposure to animals , especially in rural areas , is due to agricultural activity and contact with the animals and the increase in leisure travels to areas of good weather in spring by travelers . in terms of spices , respectively , 83% was related to dogs and 13% to cats , which shows the same results conducted in iran or abroad .", "dogs face wild animals more , especially wolves and canines , which statistically are the main source of disease .", "most observed cases of animal bites and human rabies result from dog and canine bites .", "therefore , vaccination , containment of domestic dogs and cattle ( at least during the day ) and enable the special committee to lose the stray dogs , seem necessary .", "none of these people had referred for preventive services . in bahonar 's study in ilam province , where conditions are similar to lorestan province , four fatal cases were reported .", "this shows that despite the efforts made , and providing prevention services , lack of awareness of disease risks , and also poor information do not let all the people who are attacked by animals refer to the centers to get services ." ], [ "due to the rather high rate of human rabies and animal rabies in the province , we can conclude that wildlife of the province is infected with the virus that causes disease in domestic animals , owner dogs or some cases , with human bites carry rabies to people . according to the results of this study and other studies , students and residents of villages are more at risk .", "hence , training the people at risk about hurting and mistreatment of dangerous animals , ways of transmitting the disease , convincing the owners of sheep dogs and domestic dogs to go to the veterinary , and vaccination offices to vaccinate and collar their dogs and their dogs can play an important role in reducing the incidence of animal bites and rabies cause death ." ], [ "" ], [ "" ] ]

[ [ "the protein folding problem , or the protein structure prediction problem , is one of the most interesting problems in biological science .", "studies have indicated that proteins biological functions are determined by their dimensional folding structures . because the structure of a protein is strongly correlated with the sequence of amino acid residues , predicting the native conformation of a protein from its given sequence", "since the problem is too difficult to be approached with fully realistic potentials , the theoretical community has introduced and examined several highly simplified models .", "one of them is the hp model of dill et al . 1 . , 2 . , 3 . where each amino acid is treated as a point particle on a regular ( quadratic or cubic ) lattice , and only two types of amino acids", "although the hp model is extremely simple , it still captures the essence of the important components of the protein folding problem ( 4 ) .", "the protein folding problem in the hp model has been shown to be np - complete , and hence unlikely to be solvable in polynomial time 5 .", ".. for relatively short chains , an exact enumeration of all the conformations is possible . in dealing with longer chains ,", "the methods used to find low energy structures of the hp model include genetic algorithm ( ga ; ref . 8 . , 9 .", "these algorithms can find optimal or near - optimal energy structures for most benchmark sequences , however , their computation time is rather long . in this paper ,", "a branch and bound algorithm is proposed to find the native conformation for the two - dimensional ( 2d ) hp model .", "the experimental results have shown that our algorithm is very efficient , which can find optimal or near - optimal conformations in a very short time for a number of sequences with lengths ranging from 20 to 100 monomers ." ], [ "the monomers are numbered consecutively from 1 to n along the chain , which is folded on the square lattice , and each monomer occupies one site with the center on the lattice point .", "note that each monomer should be connected to its chain neighbors and is unable to occupy a site filled by other monomers .", "if monomer i is placed on the square lattice , then the coordinates of its location are denoted by ( xi , yi ) .", "the hp model is based on the assumption that the hydrophobic interaction is one of the fundamental principles in the protein folding .", "an attractive hydrophobic interaction provides for the main driving force for the formation of a hydrophobic core that is screened from the aqueous environment by a shell of polar monomers .", "therefore , the energy function of the hp model is defined as:(1)e=-i , j < i-1ij where i = 1 if the i monomer in the chain is hydrophobic , otherwise i = 0 . in other words ,", "the energy of a conformation can be obtained by counting the number of adjacent pairs of hydrophobic monomers ( h h ) that are not consecutively numbered , and multiplying by 1 .", "the goal of the protein folding problem is to find the conformation with the minimal energy .", "it can be seen that each monomer occupies one lattice site connected to its chain neighbors .", "the energy of this conformation is 4 , which is the lowest energy state of the sequence ." ], [ "in our algorithm , a conformation is built by adding a new monomer at an allowed neighbor site of the last placed monomer on the square lattice . in order to obtain a self - avoiding conformation ,", "the monomers are placed consecutively until all the n ( the length of the chain ) monomers are placed , that is , our algorithm is a growth algorithm .", "if k 1 ( 1 k n ) monomers have been placed on the square lattice , the k monomer may have three possible locations : turn 90 right , turn 90 left , or continue ahead .", "figure 2 gives a partial conformation where four monomers have been placed on the square lattice .", "the next monomer , namely monomer 5 , can be placed at any one of these unoccupied positions , resulting in three different partial conformations accordingly . in this way", "as shown in figure 3 , a search tree representation can be used to denote all possible folding conformations , with three descendants at most for each node .", "each node in the search tree corresponds to a partial conformation , and a line between two nodes represents a placement choice of a new monomer to the existing partial conformation .", "consequently , leaf nodes at the end of the tree correspond to the complete conformation . from figure 3 , it is obvious that the conformational space grows exponentially when the length of the protein chain increases .", "as mentioned by unger and moult ( 12 ) , the number of possible ( self - avoiding ) conformations for an l - long sequence on a 2d square lattice is al , where 2.63 and 0.333 .", "accordingly , for a protein chain of not too short length , the search space is too huge to find the lowest energy conformation within a reasonable running time . to reduce the computational cost ,", "a so - called branch and bound method is introduced in this paper . in this search method , only the promising nodes are kept for further branching and the remaining nodes are pruned off permanently . since a large part of the search tree is pruned off aggressively to obtain a solution , its running time is polynomial in the size of the problems . in our algorithm , we treat h monomers and p monomers differently . for a partial conformation where", "k1 monomers have been placed on the square lattice , if the k monomer is p , then all possible branches should be kept .", "otherwise , if the k monomer is h , then the benefit of all possible branches of the k monomer will be evaluated and some branches may be pruned .", "that is to say , the main part of our algorithm is centered on the evaluation and pruning of the h monomers .", "this strategy maintains the diversity of the conformations and eliminates the hopeless partial conformation at the same time .", "the details are as follows : we set two variables , uk and zk , as the thresholds to evaluate the benefit of all branches for monomer k. here , uk is defined as the lowest energy of the partial conformation with length k that has ever been generated so far , and zk is the arithmetic average energy of the partial conformation with length k so far . after pseudo - placing monomer k at a possible location , we calculate ek , which is defined as the energy of the current partial conformation with k monomers placed .", "it should be pointed out that the term pseudo - place means that it is just a test and the placing process can be reverted .", "then we compare ek with thresholds uk and zk : if ek uk , it means that this partial conformation is very promising and this branch should be kept .", "if ek > zk , that means the benefit of the partial conformation is below the average , so this conformation is discarded with probability 1 otherwise , if zk ek > uk , the partial conformation is discarded with probability 2 .", "the pseudo - code of this subroutine is presented in figure 4 , including the details of evaluation criterion and the pruning mechanism , which is the main part of our algorithm .", "the above process is implemented in a recursive way until all the conformations are either pruned or hit length n. from the conformations hitting length n , we choose one with the lowest energy as the output of the algorithm .", "it should be mentioned that the search could be implemented by depth - first or breadth - first , where the two results are identical . in this paper ,", "our algorithm is implemented by depth - first . here , emin is the minimal energy of the complete conformations ever built .", "note that the first two monomers of a chain can be placed on the square lattice randomly .", "the initial values of the two thresholds uk and zk are both 0 . obviously ,", "if 1 = 0 and 2 = 0 , the search space will be the complete tree ( no node be pruned ) and it will take a prohibitively long time to search for the lowest energy conformation . if 1 = 1 and 2 = 1 , it takes a very little time to search the entire search space because the thresholds are so high that many promising nodes may be discarded . that is to say , the higher the value of the probabilities , the more difficult a branch is to be kept .", "therefore , choosing the value of 1 and 2 is an essential factor affecting the speed and efficiency of this approach . in this paper", "the probability 2 is chosen to be less than 1 because a partial conformation with energy below average is more promising than a high energy partial conformation . in this way , ek , the energy of the partial conformation , can be viewed as the energy expectation of the partial conformation after looking one step ahead and zk is expressed as the mean energy of the already generated partial conformations of length k. zk keeps a historical record , which is , to a large extent , conducive to the formulation of promising conformations .", "for any partial conformation , it would have more opportunities to procreate if holding higher individual quality ( ek ) , which is in accordance with the law of natural selection ." ], [ "to test the performance of the branch and bound algorithm , we compared it with the mc , ga , and mixed search ( ms ; ref . 13 ) algorithms by using 10 benchmark sequences for evaluation ( table 1 ) .", "table 2 presents the results obtained by the four methods on the 10 different sequences .", "as shown in the table , our branch and bound algorithm can find the optimal lowest energy conformations for six sequences .", "it is noteworthy that our algorithm can find one native state for the sequence of length 60 , whereas the other three methods failed .", "for the two long sequences of length 85 and 100 , respectively , our algorithm can find near - optimal energy conformations .", "it should be pointed out that predicting the longest sequence of length 100 is a hard problem , whose native state can only be obtained by a few methods such as the perm algorithm 14 .", ", 15 . and the guided simulated annealing method ( 7 ) . we did not compare the speed with other methods directly because the machines were different .", "moreover , the running time of the other three methods was presented in terms of number of steps while the exact cpu time was used in our test .", "all the computations in this study were carried on a 2.4 ghz pc with 512 m memory .", "the cpu time for all sequences was less than 10 s except the sequence of length 64 , for which the cpu time was 39.46 s. it can be seen from unger and moult ( 12 ) that the number of steps of mc and ga methods increases badly with the increase of sequence lengths , therefore , it is imaginable that the computational speed of mc and ga methods in unger and moult ( 12 ) for practical applications is unacceptable .", "the resulting folding conformations for sequences with 24 , 36 , 60 , 85 , and 100 monomers are given in figure 5 , respectively .", "for sequences with 24 , 36 , and 60 monomers , the corresponding conformations are all of the lowest energy . for the other two sequences with longer lengths , the corresponding conformations are also of near - optimal energy .", "it can be seen that the conformation has a single compact hydrophobic core for all sequences , which is analogous to the real protein structure ." ], [ "the branch and bound algorithm proposed in this paper is a novel and effective tool for the conformational search in the low - energy regions of the protein folding problem in the 2d hp model .", "the experimental results on 10 benchmark sequences demonstrate that our algorithm outperforms other three methods in terms of speed and efficiency .", "our algorithm is similar to the population control scheme ( 15 ) where individuals would have more opportunities to procreate if holding higher individual quality , and the pruning mechanism reduces considerably the computational burden of search .", "we should point out that , the coding of this algorithm is very simple and hence it can be easily implemented by practitioners ." ] ]

[ [ "standard radiation therapy for cervical carcinoma patients undergoing primary chemosensitized radiation therapy usually consists of external beam therapy followed by an intracavitary brachytherapy boost ( eifel et al . , 2004 ) .", "using this approach , the brachytherapy serves to provide a tumorical dose to the cervix while limiting the dose to surrounding anatomy , such as the bladder and rectum , which have a lower dose tolerance .", "typically , external beam radiation delivers a dose of approximately 45 gy to encompass the primary tumor and regional pelvic lymph nodes .", "the brachytherapy boost results in a total dose ranging from 70 to 95 gy to the primary tumor ( assuming an alpha / beta ratio of 10 gy ) , depending on tumor stage and anatomy . in certain circumstances", ", the brachytherapy boost may not be feasible due to coexisting medical conditions , unfavorable anatomy , or patient refusal to undergo the procedure . in these cases , a higher dose of external beam radiation ( ebrt ) may be given , but the total dose delivered is usually less than when a brachytherapy procedure is performed .", "predictably , the results when brachytherapy is not performed are inferior . for instance , barraclough et al . delivered a total dose of 5470 gy through the addition of an ebrt boost to patients unable to receive the brachytherapy boost .", "the majority of patients developed a central recurrence in less than 5 years and had a 5-year overall survival rate of 49.3% ( barraclough et al .", "this compares unfavorably to combined external beam therapy with a brachytherapy boost where 5-year local control and survival are in the 6070% range ( rose et al .", "brachytherapy takes advantage of the inverse square law in that high doses of radiation are given to the target ( cervix in this case ) and low doses are given to the normal anatomy by moving them out of the way with packing material exploiting the rapid dose fall - off and inhomogeneous dose distribution seen with brachytherapy .", "stereotactic body radiotherapy ( sbrt ) provides a potential alternative method to boost the cervix in those cases where brachytherapy is not performed .", "sbrt emulates brachytherapy by having multiple non - coplanar beams intersecting at the target ( cervix ) delivering a high therapeutic dose while minimizing beam traversal through normal anatomy reducing dose to these areas . by prescribing to a specific isodose line ( i.e. , the dose line that covers the volume of interest ) , the tumor receives an inhomogeneous dose similar to that delivered with brachytherapy .", "technological advances using the cyberknife ( accuray incorporated , sunnyvale , ca , usa ) , a robotic radiation delivery system , allow more precise targeting and delivery of radiation to the cervix while sparing normal anatomy compared to conventional radiation .", "this potentially allows dose escalation to the cervix to a dose comparable to the brachytherapy boost while respecting the normal tissue tolerance of the bladder and rectum .", "the cyberknife s use of a large number of small radiation beams also allows delivery of an inhomogeneous dose distribution similar to that of brachytherapy ( fuller et al . , 2008 ) .", "the cervix is not a fixed pelvic organ , rather one that is subject to movement during treatment .", "for example , a study from the university of california at san diego showed that the cervix can move as much as 18 mm during intensity - modulated radiation therapy ( imrt ) treatment ( haripotepornkul et al . , 2011 ) ;", "other studies of cervical motion have shown similar movement ( hombaiah et al . , 2006 ; taylor and powell , 2008 ) . given the large movement possible , continuous tracking of the cervix during treatment is imperative in ensuring proper delivery of dose to the tumor particularly when giving larger than conventional daily doses of radiation as is the case with the sbrt .", "lastly , since sbrt is given in a week , the total treatment time frame is comparable to external beam therapy with a brachytherapy boost thus limiting the deleterious effect observed in prolonged treatments extending beyond 7 weeks ( fyles et al .", ", 1992 ; girinsky et al . , 1993 ; lanciano et al . , 1993 ; perez et al . , 1995 ; petereit et al . ,", ", we present preliminary local control results on the treatment of six patients with cervical cancer who did not have a brachytherapy boost and were treated with an sbrt boost resulting in a total dose of 7785 gy to the cervix ." ], [ "this is a retrospective chart review of cervical cancer patients treated with combined external beam radiation and sbrt boost to the cervix at winthrop - university hospital from 3/2009 to 8/2011 .", "all patients received a series of conventionally fractionated radiation therapy followed by an sbrt dose .", "one of two dose schemes was used . early in our program of treating cervical cancer patients with an sbrt", "boost the conventionally fractionated treatment consisted of a 45 gy dose to the pelvis using 15 mv photons followed by an imrt boost to the cervix and uterus to a total delivered conventionally fractionated radiation therapy dose of 50.4 gy .", "subsequently , we modified our treatment so that the conventionally fractionated treatment began with a dose of 45 gy to the pelvis using 15 mv photons followed by two imrt boosts , one to the uterus and cervix that increased the delivered dose to 50.4 gy and a second imrt boost to the cervix alone resulting in a total delivered conventionally fractionated radiation therapy dose of 61.2 gy .", "the bladder and rectum dose constraints required no more than 5% of their volume to receive 70 gy ( i.e. , v70 gy 5% ) .", "however , in cases where the tumor s anatomical location necessitated a high dose to the bladder and/or rectum a point dose of up to 75 gy was allowed . following conventionally fractionated radiation therapy , patients had three to four gold fiducial markers placed into the cervix and upper vagina .", "fiducial placement began with a lidocaine gel and a betadine prep and proceeded under direct visualization in the lithotomy position .", "the fiducials were placed into the cervix at the 3 and 9 oclock position and superiorly into the vaginal fornices in an orientation to prevent overlap in the plane of the x - ray imaging .", "treatment planning ct scans at a slice thickness of 1.25 mm and an mri scan using a slice thickness of 12 mm were performed 1 week after fiducial placement .", "all pretreatment imaging was performed with the patient in the same position used for sbrt delivery .", "the pulse sequence used for mri acquisition was gradient echo which maximized the signal void attributable to the fiducials and allowed for clear visualization of the fiducials in the mr image .", "this allowed for the fusion of the mr and ct data sets using the fiducials .", "the gross tumor volume ( gtv ) was contoured by the attending radiation oncologist using both ct and mri images to accurately delineate the cervical anatomy and to define the interface between the cervix and anterior wall of the rectum .", "all patients received sbrt boost using the cyberknife system ( accuray incorporated , sunnyvale , ca , usa ) which consists of a 6-mv linear accelerator mounted on a robotic arm . using this system two orthogonal kilovoltage", "x - ray imagers provide real - time image guidance and automatic correction for movement of the cervix throughout the treatment .", "target tracking and patient positioning were accomplished by registering the location of the fiducial markers in the real - time images to their planning ct location .", "the robotic delivery system automatically changes the linear accelerator s position to correct for both rotational and translational movement of the patient and cervix during treatment . the total clinical accuracy for treatment is less than 1 mm ( kilby et al . , 2010 ) .", "patients had a bowel prep including dulcolax ( boehringer , germany ) and a fleet enema on the morning of each treatment .", "additionally , patients received 1500 mg of amifostine ( medimmune , llc , gaithersburg , md , usa ) mixed in saline as a rectal suppository at least 1520 min prior to each treatment as a radioprotectant . for the lower conventionally fractionated dose ( 50.4 gy ) the sbrt boost to the cervix was 19.5 gy in three fractions of 6.5 gy each . for later patients who received a conventionally fractionated dose of 61.2 gy", "the sbrt boost to the cervix was 20 gy in five fractions of 4 gy each . in all cases ,", "the margins were 3 mm anteriorly and posteriorly to limit dose to the bladder and rectum .", "four of the six patients received systemic chemotherapy during their radiation consisting of cisplatin at a dose of 40 mg / m .", "patients were followed at 3 weeks after treatment and every 3 months thereafter .", "follow - up assessments were based on physical examination by the radiation oncologist and treating gynecologic oncologist .", "toxicities were scored based on radiation therapy oncology group ( rtog ) rectal and urinary toxicity criteria ." ], [ "six consecutive cervical cancer patients were treated with combined external beam radiation and sbrt boost to the cervix at winthrop - university hospital from 3/2009 to 8/2011 .", "the median patient age was 80 years ( range , 7194 years ) .", "one patient refused brachytherapy ; all other patients were unable to receive a tandem and ovoid brachytherapy boost because of either anatomic ( n = 3 ) or medical ( n = 2 ) conditions .", "the first patient treated received a conventionally fractionated total dose of 50.4 gy followed by an sbrt cervix boost of 19.5 gy delivered in three fractions .", "the five subsequent patients received a conventionally fractionated total dose of 61.2 gy followed by an sbrt cervix boost of 20 gy delivered in four fractions .", "five percent volumes of the bladder and rectum were kept to 70 gy ( i.e. , v75 gy 5% ) with the exception of maximal post doses up to 75 gy when necessary based on tumor location ( table 2 ) figure 1 shows a sample treatment plan and dose volume histogram for a patient receiving an sbrt boost of 20 gy . observed cervix motion during treatment consisted of drift in the anterior posterior or superior inferior axes ; sporadic movement in the anterior posterior , superior ", "in addition , table 2 summarizes the maximal rectal and bladder doses for each patient .", "( a ) representative treatment plan for a patient receiving an sbrt boost of 20 gy delivered in four fractions .", "( b ) dose volume histogram showing the bladder ( yellow ) rectum ( green ) , cervix ( red ) , and ptv ( purple ) .", "all patients tolerated the treatment well with no grade 3 or higher urinary or rectal toxicities .", "grade 1/2 urinary and bowel toxicities occurred in four patients following conventional external beam radiation .", "all of these symptoms resolved by the time of sbrt boost . at a median follow - up of 14 months ( range , 128 months ) from completion of the sbrt boost", "in addition , for the five patients with a minimum of 12 months follow - up all ( 100% ) remain locally and distantly controlled with no evidence of disease ." ], [ "this report demonstrates the feasibility of using robotic sbrt as an alternative to brachytherapy in cervical cancer patients unable to undergo brachytherapy . the motivation for this series stems from the markedly inferior reported outcomes for treatment of such patients with a conventionally fractionated radiation boost compared to brachytherapy .", "( 2008 ) report on the treatment of 44 patients with a conventional external beam boost to a total dose of 5470 gy when intracavity therapy could not be performed . at a median 2.3 years follow - up ,", "recurrent disease was seen in 48% of patients with a median time to recurrence of 2.3 years .", "in addition , they observed late grade 3 toxicity in 2% of patients and late grade 1 and 2 bowel and bladder toxicities in 41% of patients ( barraclough et al . , 2008 ) .", "the poor outcomes in these studies are likely explained by the low doses given to the paracervical region in order to respect tissue tolerance of the surrounding anatomy such as the bladder and rectum .", "indeed , most institutions do not exceed 7580 gy ( combined external beam and ldr brachytherapy dose ) to the international commission on radiological units ( icru ) and measurements bladder reference point and 7075 gy to the rectal reference point ( fletcher and hamberger , 1980 ; eifel et al . , 2004 ) .", "other studies using a conventional linear accelerator have reported on a stereotactic boost for gynecologic cancers . in a case study ,", "hsieh et al . ( 2010 ) reported on a patient who was unable to undergo a brachytherapy boost due to multiple uterine myomas .", "this patient received conventionally fractionated treatment to 54 gy followed by a helical tomotherapy boost of 24 gy and concurrent chemoradiotherapy . at 14 months", "( 2005 ) reported on a mixed population of 23 patients with either endometrial ( n = 9 ) or cervical ( n = 7 ) cancer including two patients with local relapse .", "the patients received a 14 gy boost delivered with a linac - based micromultileaf collimator in two fractions at 47 days intervals . at a median 12.6 months", "follow - up one previously irradiated relapse patient had a grade 3 rectal bleed ; no other patients developed severe urinary or intestinal toxicity .", "one recurrence occurred 12 months following treatment for a cervical cancer patient ; no other failures occurred .", "following a treatment planning comparison the authors concluded that sbrt improved dose homogeneity to the ptv and reduced rectal dose compared to brachytherapy . in a follow - up publication , jorcano et al .", "( 2010 ) reported on 17 endometrial and 9 cervical cancer patients treated with 4550.4 gy ebrt followed by a sbrt boost of 14 gy delivered in two fractions .", "acute toxicities consisted of 23 and 25% rtog grade 3 or less urinary and lower - gastrointestinal toxicities , respectively . at a median 47 months follow - up , the 3-year locoregional failure rate was 96% for both endometrial and cervical patients .", "the authors conclude that sbrt is feasible , well tolerated , and could be considered an acceptable alternative to brachytherapy .", "the university of north carolina reported on treatment with a cyberknife sbrt boost of 25 gy in five fractions for a cervical cancer patient unable to undergo brachytherapy . at a follow - up of 10 months", "the patient exhibited no rtog toxicities , however , the patient died from progression of liver metastases . in the present series , one patient received 50.4 gy with a 19.5 gy sbrt boost and the later five patients received 60 gy with 20 gy sbrt boosts delivered using robotic sbrt with real - time motion tracking .", "the inclusion of motion tracking with cyberknife delivered sbrt offers a more accurate dose delivery to the target potentially accounting for the lack of significant toxicity in this patient population despite a higher delivered dose than the conventional linear accelerator delivered sbrt boost results ( molla et al . , 2005 ; jorcano et al . , 2010 )", "in addition , the lack of any failure for the five patients with a minimum of 12 months follow - up is highly promising compared to the ebrt boost results for which the cancer - specific overall survival at 1 year was already only 80% ( barraclough" ], [ "this paper is the among the first to report on using robotic sbrt in patients with real - time motion tracking for the treatment of locally advanced cervical cancer in patients who are unable to undergo brachytherapy .", "these preliminary results suggest that cyberknife robotic sbrt is a safe and effective modality in the treatment of cervix cancer for those patients unable to undergo brachytherapy .", "additional confirmatory prospective studies with larger numbers of patients and longer follow - up are required to validate the durability of these results ." ], [ "dr . haas has received speaker s honoraria from accuray inc . , sunnyvale , ca , usa ." ] ]

[ [ "\n subjects and sampling - the study was carried out in porto velho , ro , \n an unstable malaria - endemic area , where p. vivax accounts for more than 75% of all \n malaria cases ( oliveira - ferreira et al .", "symptomatic patients diagnosed with malaria infection by a thick blood smear in an \n outpatient clinic in porto velho were asked to participate in the study .", "a total of 71 \n patients were enrolled for the study , 47 and 24 of whom were infected with p. vivax and \n p. falciparum , respectively .", "blood samples were collected by venipuncture from each \n patient at the day of diagnosis ( d0 - in the acute phase ) and , after collection , all \n patients were treated with the regimen recommended by the brazilian ministry of health \n ( ms 2010 ) .", "patients returned 15 days later ( d15 - in the convalescent stage ) for \n follow - up examinations and paired blood samples were collected from 40 p. vivax and 15 \n p. falciparum infected patients .", "all patients were symptomatic and had clinical symptoms \n ranging from very mild illness to full - blown paroxysms , but there were no severe or \n complicated malaria cases .", "the patients were positive for either p. falciparum or p. \n vivax parasites as determined by microscopy using thick and thin blood smears at d0 . \n", "asexual blood forms of p. falciparum or p. vivax were cleared from the peripheral blood \n of all patients included in the study following therapy and no parasite reappearance was \n observed during follow - up .", "the control group ( n = 12 ) was composed of apparently healthy \n individuals who lived in the same area , but were negative for malaria parasites as \n determined thick blood smear and had not reported any malaria episodes for at least one \n year .", "ethical approval for the study was granted by the oswaldo cruz foundation ethical \n committee and by the national ethical committee of brazil and informed consent was given \n by the patients . \n", "laboratory tests - thick and thin blood films were stained with giemsa \n and the plasmodium species were identified and parasitaemia was determined by \n microscopic examination at d0 and d15 .", "parasitaemia levels were estimated by counting \n the number of parasites ( all species and stages ) per 200 white blood cells ( wbc ) on \n blood films .", "if fewer than nine parasites were detected , 300 additional leucocytes were \n counted to obtain more precise results .", "complete blood cell counts , including \n haematologic indices , were performed at d0 and d15 using an automatic haematology \n analyser ( pentra abx ) and peripheral blood smears were performed for routine \n differential blood cellular quantification .", "the cell counters provided data on wbc \n counts and red blood cell ( rbc ) counts , haemoglobin ( hb ) levels , haematocrit and \n reticulocyte , platelet , lymphocyte , eosinophil , segmented neutrophil , band cell , \n monocyte and basophil counts .", "the \n patients were considered anaemic when their hb levels were 13 g / dl blood in males and \n 12 g / dl of blood in females .", "multiplex microsphere cytokine immunoassay - the levels of 16 cytokines \n and chemokines were detected in plasma samples using luminex technology ( luminex \n corporation , austin , tx , usa ) .", "thirteen cytokines [ il-1 , il-2 , il-4 , il-5 , il-6 , il7 , \n il-10 , il-12 p70 , il-17 , ifn- , tnf- , g - csf , granulocyte - macrophage colony - stimulating \n factor ( gm - csf ) ] and three chemokines ( il-8 , mcp-1 and mip-1 ) were analysed using a \n bioplex - kit assay ( bio - rad laboratories , hercules , ca , usa ) .", "the assay was performed \n according to the manufacturer s instructions using a bioplex - kit in combination with the \n luminex system .", "briefly , 50 l of standard or test sample along with 50 l of mixed \n beads were added into the wells of a pre - wetted 96-well microtitre plate .", "after 1 h of \n incubation and washing , 25 l of detection antibody mixture was added and the samples \n were incubated for 30c min and then washed .", "finally , 50 l of streptavidin - pe was added \n and after 10c min of incubation and washing , the beads were resuspended in 125 l assay \n buffer and analysed using a bioplex suspension array system ( bio - rad laboratories ) and \n the bio - plex manager software ( v.3.0 ) .", "a curve fit was applied to each standard curve according to the manufacturer s manual \n and sample concentrations were interpolated from the standard curves .", "the limit of \n cytokine detection using this method was 2 pg / ml for all cytokines and chemokines .", "the \n median cytokine and chemokine levels in 12 healthy controls were 2 pg / ml for il-1 , \n il-2 , il-4 , il-5 , il-6 , il-7 , il-10 , il-12 p70 , il-10 and gm - csf , 15.53 pg / ml for ifn- , \n 12.58 ml for tnf- , 4.3 pg / ml for gcs - f , 495 pg / ml for mcp-1 and 594.5 pg / ml for \n mip-1. \n statistical analysis - survey data were recorded and entered into a \n database created with epi info 2007 ( centers for disease control and prevention , \n atlanta , ga , usa ) .", "analyses were performed using predictive analytics software v.17.0 \n ( spss inc , chicago , il , usa ) and prism v.5 ( graphpad software inc , san diego , ca , usa ) . \n", "differences in median haematological parameters and cytokine levels were expressed as \n medians and interquartile ranges ( ir ) and compared using bonferroni s multiple \n comparison test .", "when this test indicated a significant difference ( p < 0.05 ) among \n pairwise groups , a mann - whitney u test was used . to evaluate the significant differences \n in haematological and cytokine parameters between the acute and convalescent phases from \n the same patient ,", "finally , the correlations between \n parasitaemia , blood cells and cytokine levels were calculated using spearman s rank \n correlation coefficient and p < 0.05 were considered statistically significant ." ], [ "\n study subjects - seventy - one patients infected with malaria were \n enrolled in the study .", "there were no differences \n in mean age , time of residence in the endemic area and number of past malaria episodes \n between p. vivax ( n = 47 ) and p. falciparum ( n = 24 ) infected patients . all patients \n presented general clinical symptoms such as history of fever and headache at the time of \n enrolment independent of plasmodium species .", "the time elapsed between the appearance of \n the first symptoms and malaria diagnosis was similar between patients with p. vivax ( 3 \n days ) and p. falciparum ( 3.5 days ) . although the mean parasitaemia was higher in p. \n falciparum - infected individuals than p. vivax - infected individuals , this difference was \n not statistically significant .", "all patients were parasitaemia - negative by day 15 of \n follow up after receiving effective drug treatment .", "the characteristics of the \n participants are presented in table i. \n table iepidemiological and parasitological data of plasmodium vivax and plasmodium \n falciparum infected - patients \n p. vivax p. falciparum \n ( n = 47 ) ( n = 24)male [ n ( % ) ] 35 ( 74.5)19 ( 79.2)age [ n ( % ) ] 28 ( 22 - 38)28.5 ( 23 - 41)years of residence in malaria endemic area [ n \n ( % ) ] 24 ( 21 - 36)27 ( 19 - 38)years of residence in the state of rondnia [ n \n ( % ) ] 23 ( 16 - 28)23 ( 16 - 28)total number of past malaria episodes [ n \n ( % ) ] 3 ( 1 - 8)3.5 ( 1 - 10)months since last malaria episodes [ n ( % ) ] 10 ( 2.2 - 24)12.5 ( 2 - 102)parasitaemia ( number of parasites/l)2,293 ( 874 - 17,933)1,328 ( 793 - 12,623)days since the symptoms began [ n ( % ) ] 3 ( 1 - 8)3.5 ( 1.5 - 10)symptoms", "[ n ( % ) ] fever39/8322/92chills32/6820/83headache39/8321/87vomiting23/4920/83myalgia31/6621/87the values on table indicate median ( interquartile range ) .", "frequency of \n symptoms and gender were compared between p. vivax and p. falciparum \n infected - patients by chi - squared test .", "mann - whitney u test were used to \n compare parasitaemia , days since the symptoms began , time since the last \n malaria infection , number of previously malaria episodes and time in malaria \n endemic area .", "there were not statistical differences on epidemiological , \n clinical and parasitological data between patients infected by p. falciparum \n and p. vivax . \n ", "frequency of \n symptoms and gender were compared between p. vivax and p. falciparum \n infected - patients by chi - squared test .", "mann - whitney u test were used to \n compare parasitaemia , days since the symptoms began , time since the last \n malaria infection , number of previously malaria episodes and time in malaria \n endemic area .", "there were not statistical differences on epidemiological , \n clinical and parasitological data between patients infected by p. falciparum \n and p. vivax . \n", "haematological results - to investigate haematological changes during \n malaria infection , differential haematological parameters during the acute and \n convalescent phases , expressed as the median ( ir ) , are shown in table ii .", "the median lymphocyte and platelet counts in p. falciparum \n and p. vivax patients during acute disease were lower than in the control subjects and \n returned to control reference levels during the convalescent stage .", "in contrast , the \n median band cell counts were elevated in both p. vivax and p. falciparum - infected \n patients during the acute phase ( p = 0.0041 and p = 0.0001 , respectively ) and returned \n to normal levels during the convalescent stage .", "we also found that patients with acute \n p. vivax infection had low eosinophil counts ( p = 0.013 , control values 153/l ) that \n increased during the convalescent stage .", "all other haematological values were similar \n among p. falciparum - infected , p. vivax - infected and control subjects .", "although no \n differences in hb levels were observed between p. vivax and p. falciparum patients \n during the acute phase , anaemia was detected in 29.2% of p. falciparum and in 55.3% of \n p. vivax patients . however , these frequencies were not significantly different from \n those of control subjects , 38.9% and they remained similar during the convalescent \n phase , during which 60% of patients previously infected by p. vivax and", "table iicomparison of haematological profiles of control group and patients \n infected by plasmodium vivax and plasmodium falciparum on acute and \n convalescent phase of infection \n p. vivaxp .", "falciparum \n\n acute phaseconvalescent phaseacute phaseconvalescent phasecontrol(n = 47)(n = 40)(n = 24)(n = 15)(n = 12)erythrogramrbc ( x106/l)4.6 ( 4.3 - 5.1)4.3 ( 4 - 4.7)4.9 ( 4.5 - 5.4)4.9 ( 4.7 - 5.3)4.6 ( 4.2 - 5)haematocrit ( % ) 41 ( 38 - 45)39 ( 35.5 - 42)44 ( 39 - 45)39 ( 38 - 43)39 ( 38 - 43)haemoglobin ( g / dl)14 ( 12.5 - 15.5)12.6 ( 11.7 - 13.9)14.5 ( 13.9 - 15.2)13.8 ( 11.9 - 14)13.8 ( 13 - 15)reticulocyte ( % ) 0.5 ( 0.3 - 0.8)0.3 ( 0.25 - 0.5)0.35 ( 0.27 - 0.45)0.4 ( 0.3 - 0.55)0.35 ( 0.25 - 0.50)platelet ( x103/l)156 ( 105 - 182)a , b277 ( 234.5 - 342.5)135 ( 96.25 - 135)a , b261 ( 195 - 365)275 ( 231 - 315)leucogram ( /l)wbc5,100 ( 4,000 - 6,600)5,550 ( 5,125 - 7,000)4,650 ( 3,825 - 6,375)5,900 ( 5,000 - 7,300)6,400", "( 5,650 - 7,550)lymphocyte1,020 ( 780 - 1,406)a , b2,062 ( 1,625 - 2,389)1,038 ( 571.5 - 1,536)a , b2,000 ( 1,770 - 2,920)2,250 ( 1,872 - 2,570)basophil0 ( 0 - 0)0 ( 0 - 0)0 ( 0 - 0)0 ( 0 - 0)0 ( 0 - 0)eosinophil67 ( 33 - 168)b , c288.5 ( 162.8 - 418.5)82 ( 34 - 255)288", "( 108 - 629)153 ( 82.5 - 265.5)band cell63 ( 0 - 282)d0 ( 0 - 0)118 ( 36 - 369.5)d0 ( 0 - 0)0 ( 0 - 0)neutrophil3,468 ( 2,240 - 4,480)3,048 ( 2,377 - 3,558)3,432", "( 2,060 - 4,212)2,911 ( 2,031 - 3,650)3,830 ( 3,075 - 4,654)monocyte360 ( 214.5 - 470.5)360 ( 214.5 - 470.5)350.5 ( 215 - 527.3)292 ( 216 - 426)351.5 ( 250.5 - 547.5)a : p <", "0.001 between indicated infected group and control ; b : p < \n 0.0001 between acute and convalescent phase of indicated group ; c : p < \n 0.05 between indicated infected group and control ; d : p < 0.01 between \n indicated infected group and control .", "comparison between control group and patients \n infected by p. vivax and infected by p. falciparum were evaluated by \n bonferroni s multiple comparison test .", "when the test indicated a significant \n difference ( p < 0.05 ) between groups pairwise , mann - whitney u test were \n used . to assess the significant differences in haematological parameters \n between acute and convalescent phase from the same patient ,", "no statistical differences were observed between \n p. vivax and p. falciparum - infected patients on acute or convalescent phase . \n acute phase : day of diagnosis ; convalescent phase : 15 days after diagnosis ; \n rbc : red blood cell ; wbc : white blood cell . \n ", "a : p < 0.001 between indicated infected group and control ; b : p < \n 0.0001 between acute and convalescent phase of indicated group ; c : p < \n 0.05 between indicated infected group and control ; d : p < 0.01 between \n indicated infected group and control .", "comparison between control group and patients \n infected by p. vivax and infected by p. falciparum were evaluated by \n bonferroni s multiple comparison test .", "when the test indicated a significant \n difference ( p < 0.05 ) between groups pairwise , mann - whitney u test were \n used . to assess the significant differences in haematological parameters \n between acute and convalescent phase from the same patient , non parametric \n paired t tests were used .", "no statistical differences were observed between \n p. vivax and p. falciparum - infected patients on acute or convalescent phase . \n acute phase : day of diagnosis ; convalescent phase : 15 days after diagnosis ; \n rbc : red blood cell ; wbc : white blood cell . \n circulating cytokine and chemokine levels during the acute and convalescent \n phases of a malaria episode - the data in fig .", "1 compare circulating cytokine and chemokine levels in patients infected \n with p. vivax and p. falciparum .", "first , the cytokines il-5 , il-7 and gm - csf were not \n detectable in most plasma samples and no differences were observed in mcp-1 levels \n compared with controls . during the acute phase , p. vivax and p. falciparum patients had \n significantly higher il-6 , il-8 , il-17 , ifn- , tnf- , mip-1 and g - csf plasma \n concentrations than controls . to investigate changes in cytokine levels during \n infection , we compared cytokine levels in the sera from the same patient during the \n acute and convalescent phases and plasma levels of il-6 , il-8 , il-17 , ifn- , tnf- \n mip-1 and g - csf were higher during the convalescent phase .", "although p. falciparum and \n p. vivax malaria patients have similar cytokine profiles during infection , p. falciparum \n patients presented higher levels of il-6 , il-8 , il-17 , ifn- , mip-1 and g - csf than p. \n vivax patients during the convalescent phase .", "in contrast , only p. vivax patients \n presented higher levels of tnf- during the convalescent phase than during the acute \n phase of infection .", "il-10 levels were detected at high concentrations in the majority of \n p. falciparum and p. vivax patients during the acute phase and returned to completely \n normal levels during the convalescent phase .", "the median il-10 concentration during the \n acute phase was 1,175 pg / ml ( ir = 155 - 3,135 ) at d0 and 2 pg / ml ( ir = 2 - 2 ) at d15 and \n 1,187 pg / ml ( ir = 502.5 - 3049 ) at d0 and 2 pg / ml ( ir = 2 - 149.8 ) at d15 in p. vivax and p. \n falciparum - infected patients , respectively . \n", "1 : comparison of serum cytokines and chemokines levels between control , \n plasmodium vivax and plasmodium falciparum patients in acute and convalescent \n phase of infection .", "the control group was indicated by white bars , while acute \n and convalescent phase of infection were indicated by light and dark gray bars , \n respectively .", "the boxes represent the values between 25 - 75% quartile and the \n line indicates the median .", "comparison between control group and patients infected by p. vivax and infected \n by p. falciparum were evaluated by compared by bonferroni s multiple comparison \n test .", "when the test indicated a significant difference ( p < 0.05 ) between \n groups pairwise , mann - whitney u test were used . to assess", "the significant \n differences between acute and convalescent phase in p. vivax and p. falciparum \n infected - patients non parametric paired t tests were used .", "g - csf : \n granulocyte - colony stimulating factor ; ifn : interferon ; il : interleukin ; mip : \n macrophage inflammatory protein ; tnf : tumour necrosis factor . \n the levels of il-1 , il-4 and il-12 were similar to those of the controls during the \n acute phase for both p. falciparum and p. vivax patients and were higher during the \n convalescent phase , with the exception of il-12 , which was higher only in the p. \n falciparum group .", "the plasma il-2 concentration was determined only during the acute \n phase in p. falciparum patients . although the median il-2 levels were higher during the \n convalescent phase , these differences were not statistically significant . \n relationship between parasitaemia and other variables - spearman s \n correlation coefficient values and p values are shown in fig .", "vivax patients , we found a statistically significant \n negative correlation between platelet count and parasitaemia during the acute phase \n ( fig .", "the acute phase plasma il-10 \n concentration was positively correlated with parasitaemia in p. vivax ( fig .", "the same was true for the tnf- \n concentration in p. falciparum - infected patients ( fig . \n", "no relationship was found between parasitaemia and the other blood cell \n counts or the concentration of others cytokines assayed ( data not shown ) . \n", "associations \n between parasitaemia , blood cells and cytokines level were investigated by \n spearman s rank correlation coefficient and p values < 0.05 were considered \n statistically significant ." ], [ "haematological changes , such as alterations in total and differential wbc counts , are \n widely used to differentiate between several types of infections and to monitor the \n course of diseases ( ventura et al .", "malaria - induced changes in the differential \n white cell counts are very diverse and contradictory and include leucopoenia , \n lymphopaenia , lymphocytosis , the presence of atypical lymphocytes , monocytosis , \n neutropaenia , neutrophilia , immature neutrophils ( band cells ) , eosinopaenia , \n eosinophilia and leukemoid reactions ( wickramasinghe \n & abdalla 2000 , price et al .", "the findings of our study show that increased \n band cells and low lymphocyte and eosinophil counts are common during acute p. \n falciparum and p. vivax malaria .", "the decreased lymphocyte levels during malaria \n infection have been attributed to the reallocation of cells to deep lymphoid organs or \n by parasite induced apoptosis of human mononuclear cells ( hviid et al .", "fifteen days following treatment , when no parasites were detected in either p. \n falciparum and p. vivax patients , the lymphocyte counts were similar to those in the \n control subjects , indicating that this period of time was sufficient for the patients to \n achieve lymphocyte homeostasis .", "with respect to eosinopaenia during the acute phase , it \n has been suggested that malaria either suppresses eosinophil production and release from \n the bone marrow or enhances the peripheral removal of these cells ( davis et al .", "the \n increased eosinophil counts we observed post - treatment have been observed in previous \n studies ( kurtzhals et al .", "the \n induction of eosinophils was attributed to various factors such as higher release of \n eosinophils after temporary bone marrow suppression caused by plasmodium , a direct \n response to the parasite or a response to antimalarial drugs .", "the transitory increase in band cells that was observed in both infections indicates a \n stronger stimulus for neutrophil production during the acute phase . in this case ,", "early \n or premature release of neutrophils from the bone marrow occurs , resulting in an \n increased proportion of younger , less well - differentiated neutrophils into the \n circulation .", "though this alteration is common knowledge in other acute diseases , very \n few studies evaluating these disturbances have been conducted for this cell type in \n malaria patients ( hanscheid et al .", "erythrogram abnormalities are also very common in malaria patients and the most \n prominent alterations are anaemia and thrombocytopaenia ( collins et al .", ", the absence of marked anaemia in malaria patients may be due to the early \n diagnosis and prompt treatment , free of charge , provided by the malaria control program \n in brazil .", "although \n some authors have described more intense thrombocytopaenia during acute falciparum \n malaria compared to vivax malaria whereas others have described the opposite , no \n difference in thrombocytopaenia was observed between these types of malaria in our study \n ( ghosh 2007 , taylor et al .", "however , we did observe a negative correlation between \n platelet counts and parasitaemia during acute p. vivax infection only .", "these \n inconsistent relationships may reflect differences in epidemiology , the immune status of \n malaria patients and many others factors ( casals - pascual \n et al .", ". \n disseminated intravascular coagulation , immune mechanisms , dysmyelopoiesis and \n hypersplenism are some examples of mechanisms that could be related to platelet \n reduction in malaria patients ( patel et al .", "2011 ) . the role of cytokine signalling during malaria episodes is still far from being \n understood .", "the most famous inflammatory marker of severe malaria is tnf- , which is \n closely associated with fever , paroxysms , anaemia , ce- rebral malaria and many other \n systemic infection symptoms ( karunaweera et al . \n", "2005 ) . in our study , \n the cytokine and chemokine profiles in acute p. vivax and p.", "the acute phase was characterised by the presence of pro - inflammatory cytokines \n ( il-1 , il-2 , il-6 , il-17 , ifn- , tnf- ) , anti - inflammatory cytokines ( il-4 and il-10 ) , \n chemokines ( il-8 , mip-1 ) and g - csf in most malaria patients . during the convalescent \n phase ( d15 ) ,", "the levels of all these cytokines increased compared with d0 , except for \n il-10 levels , which were elevated only during the acute phase and were associated with \n parasite density .", "we and others have shown a marked il-10 response during symptomatic \n uncomplicated p. vivax malaria infection and a significant positive correlation between \n plasma il-10 levels and parasite density during p. vivax and p. falciparum infection . \n", "the discordant results regarding cytokine production during the convalescent phase in \n our study suggests different regulatory mechanisms for early parasite clearance . whether \n the differences in serum cytokine levels noted in our study are biologically significant \n is also unclear .", "it is tempting to speculate that the phagocytic cells are committed to \n a more th1-biased phenotype during drug - induced clearance of parasitaemia and release of \n parasite metabolites , such as haemozoin , which is a known inducer of pro - inflammatory \n responses via signalling through toll - like receptors 9 ( coban et al . 2005 ) .", "nonetheless , before the initiation of antimalarial \n treatment , a notably high il-10 concentration that markedly decreased with the \n resolution of parasitaemia was observed and this down regulation of the th2 response \n discriminated the successfully treated malaria patients .", "il-10 has a number of effects \n and il-10 inhibited il-6 , ifn- and tnf- secretion and function in an in vitro malaria \n model when anti - il-10 antibody was produced .", "another plausible cause for the increase in \n several cytokine levels between the acute and convalescent phases could be the \n diminished suppressive effect by il-10 on other cytokines such as pro - inflammatory \n cytokines , as well as a reduced systemic inflammatory response due to all haematological \n alterations returning to references values . il-10 perturbations appear to have the most \n significant inhibitory effect on other cytokine concentrations . in this endemic area ,", "we \n were unable to rule out concomitant intestinal parasite infections with organisms such \n as helminths , which potentially influenced the results ( hartgers & yazdanbakhsh 2006 ) .", "an association of il-10 levels with \n parasitaemia has also been reported in plasmodium knowlesi and p. vivax infections . \n", "moreover , il-10 levels in both p. vivax and p. knowlesi patients were elevated , but were \n not associated with markers of disease severity ( cox - singh et al .", "in contrast , the ifn/il-10 ratio has been \n successfully used as a marker for pathological inflammatory activity in p. vivax \n patients with varying disease severity ( andrade et al . \n", "several studies report that il-10 has been implicated in malaria \n pathophysiology ( dodoo et al .", ", il-10 predominated in the \n early anti - inflammatory response in p. falciparum and p. vivax - infected patients and \n dropped drastically during the convalescent phase when malaria had been cured in all \n patients . in conclusion ,", "a complex array of cytokines is released in adult patients with \n uncomplicated malaria infection with apparent feedback inhibition and cross - regulatory \n functions .", "il-10 appears to be involved during the acute phase of the disease and its \n decrease correlates with recovery as biological and clinical malaria features disappear . \n", "further studies are required to determine whether these elevated il-10 levels play a \n beneficial role by reducing the parasite - induced inflammatory response", ". additionally , there are no reports of cytokine concentrations in humans 15 days after \n the beginning of treatment ; therefore , the data presented here could for the first time \n indicate a shift from a th1/th2 balanced response to a more pronounced th1-regulated \n immune response during the first 15 days of uncomplicated malaria treatment in brazilian \n endemic areas .", "differences in epidemiology , nutritional status , demographic factors and \n the presence of co - infections are factors that could be related to the ambiguous \n findings of previous studies ." ] ]

[ [ "a 61-year male presented to the emergency department with a history of road traffic accident .", "he arrived hemodynamically stable with a blood pressure of 126/76 mmhg and a heart rate of 78 beats per minute . on plain radiograph ( fig .", "1a ) anteroposterior and two judet 45 oblique view1 ) and computed tomography ( ct ) scan of pelvis ( fig .", "1b ) , the findings revealed both column fracture of acetabulum without hip dislocation , but no presence of femoral head fracture or onfh .", "buttress plating through ilioinguinal approach was performed using a reconstruction plate , which was supplemented by a compact hand plate .", "the patient was transfused 8 units of whole blood , 3 units of fresh frozen plasma and 8 units of packed red blood cells .", "intra - operative hb was 9.7 gm% ; the average mean arterial pressure was 91.82 mmhg during the operative procedure .", "post - operatively the patient was transfused 2 units of whole blood and 1 unit of fresh frozen plasma .", "the hb postoperatively was 10.3 gm% , the patient was shifted to intensive care unit for a day , later was transferred to the ward .", "the post - operative x - ray ( fig . 2a ) and ct scan revealed an acceptable reduction of the fracture fragments and a concentric hip .", "sitting up was performed on the first postoperative day ; the patient subsequently began formal physical therapy and active range of motion exercises .", "partial toe touch weight bearing ( 20 to 30 lb ; 9 to 13.6 kg ) with a walker was maintained for 6 - 8 weeks .", "progression to full weight bearing was started on the basis of the follow - up radiographs .", "the patient 's 4-month postoperative x - ray revealed a radiolucent lesion in the superolateral part of femoral head , crescent sign , and sclerosis .", "2b ) showed collapse and sclerosis , findings consistent with onfh . a ct scan ( fig .", "on was diagnosed only when the radiographic findings provided a clear differentiation from wear of the femoral head2 ) . the joint pain increased due to the onfh", ", we performed a total hip replacement ( fig . 3b ) 12 months after the index surgery ." ], [ "late complications of acetabulum fractures include heterotopic ossification and onfh , which are present in less than 10% of the population3 ) .", "the incidence of onfh is known to be high in transverse and posterior wall fractures associated with posterior dislocation6 ) . on", "also occurs in conjunction with approximately 3% of anterior hip dislocations and in more than 13% of posterior hip dislocations . in a recent meta analysis of 3,670", "surgically treated displaced acetabular fractures the incidence of onfh showed an overall incidence of 5.6%3 ) , suggesting that it is grossly overestimated and that most of the observed changes in the head of the femur are probably due to osteoarthritis5 ) .", "onfh is caused by inadequate blood supply to the affected segment of the subchondral bone .", "when posterior surgical approaches have been used , on rates as high as 42% within the first year after surgery have been reported7 ) .", "many systemic conditions are associated with on , but 25% of all cases are described as idiopathic and can contributes as a cause9 ) .", "trauma is one of the most common causes of on , interruption of the blood supply to the affected segment of the bone being the cause of ischemia . in this case", "the exact cause of onfh eludes us , especially in the absence of any patient related predisposing risk factors , except presence of fracture without hip dislocation and subsequent intervention by an ilio - inguinal approach .", "a probable theory of etiology could be the intra - operative hypovolaemia , low mean arterial pressure , causing compromised flow to the femoral head being so as to act as the final blow .", "alteration of the blood supply to vital organs during hypovolaemia is well established . with mean arterial pressure usually in the range of 50 to 60 mmhg ,", "the flow to the femoral head is potentially compromised10 ) so as to act in an accumulative stress theory , as suggested by kenzora and glimcher9 ) .", "it is questionable as to whether this alone would be enough to explain the development of on ." ] ]

[ [ "pericardiocentesis is an invasive procedure which is usually performed in a patient who has pericardial effusion to resolve the pressure in the pericardial sac . in 1653 , riolanus ( 1 ) first described as a trephination of the sternum to relieve fluid surrounding the heart . due to frequent complications this procedure was out of interest until ultrasound guided technique emerged ( 2 ) .", "herein , we report a case of iatrogenic tension pneumopericardium , which exhibit impending cardiac arrest ." ], [ "a 70-year - old male presented with severe dyspnea and general weakness on march 8 , 2013 .", "he was referred from a local hospital for pericardiocentesis and further work - up due to a large pericardial effusion .", "he had a past medical history of ischemic stroke 15 years prior to his visit to the hospital and of syncope a day before his visit to the hospital .", "the vital signs of the patient in the emergency room ( er ) were as follows : blood pressure of 163/93 , heart rate of 135 beats per minute , respiratory rate of 30 breaths per minute , body temperature of 37.0c , and oxygen saturation of 91% .", "the patient had distended neck veins and muffled heart sounds but did not have low blood pressure .", "echocardiography was performed by an emergency physician , and a right ventricle ( rv ) free wall collapse in was observed in the diastolic phase .", "an emergency pericardiocentesis was indicated , and it was performed by a subxiphoid approach . approximately 700 ml of serous effusion was drained through a catheter ; the patient s heart rate dropped to 110 and his blood pressure was maintained above 130 .", "a water - sealed chest tube bottle was connected at the end of the catheter for further drainage .", "the patient was transferred to a computerized tomography ( ct ) room for a chest ct to examine the cause of his pericardial effusion . before he left", "after the patient returned to the er from the ct room , his heart rate fell to 30 , and he exhibited impending cardiac arrest .", "an intravenous dose of 0.5 mg atropine was given , and the patient was hydrated with crystalloid solution .", "the patient s chest ct confirmed tension pneumopericardium , and imaging showed that pericardial air was compressing the right ventricle and that the catheter tip was placed behind the left ventricle ( lv ) ( fig .", "1 ) . approximated 500 ml of pericardial air was evacuated rapidly through the previously implanted catheter , and the patient s vital sign became stable .", "the patient was admitted to the intensive care unit and subsequently transferred to a long - term care hospital . a contrast - enhanced computed tomography scan of the chest . ( a ) axial view showed the air compressing the right ventricle ( arrows ) and tip of the catheter inside pericardium ( arrow head ) ." ], [ "pneumopericardium is defined as the presence of air inside the pericardial space . in 1910 , wenkebach first described the x - ray findings of pneumopericardium , and in 1967 , cimmino ( 6 ) described the diagnostic features of pneumopericardium . in a review of the literature , toledo et al .", "( 7 ) classified the etiology of pneumopericardium into four categories : iatrogenic , pericarditis , fistula formation between the pericardium and an adjacent air - containing organ , and trauma .", "( 8) reported that trauma and positive pressure ventilation are the major causes of pneumopericardium .", "iatrogenic cases of pneumopericardium associated with various procedures , such as thoracentesis , paracentesis , poststernal bone marrow aspiration , postcauterization of esophageal webs , pericardiocentesis , radiofrequency ablation , and pacemaker insertion , have been reported ( 7910 ) .", "if the patient has tension pneumopericardium , physical examination may show tachycardia , distended neck veins , and hypotension . in 1844 , bricheteau was the first to describe the mill wheel murmur in auscultation , which is a characteristic churning or splashing auscultatory sound due to blood mixing with air in the pericardial sac . a chest x - ray showing air surrounding the heart and the small heart sign", "pericardial air can be mistaken for mediastinal air , but the air in the pericardial sac does not rise above the pericardial reflection of the proximal great vessels . also a chest x - ray taken from the decubitus position may show a shift of air if the air is in the pericardium , but mediastinal air does not shift ( 12 ) .", "a small amount of air in the pericardial sac is indistinguishable by plain chest x - ray but can be detected by ct scan .", "bedside echocardiography in the er is an alternative method for detecting air in the pericardial sac , but a large amount of air may hinder the penetration of the ultrasound beam , so diagnosis by this method may be challenging .", "the needle should be placed 1 cm inferior to the left xiphocostal angle at a 30-degree angle to the skin .", "it should be aimed toward the left shoulder and advanced while maintaining negative pressure ( 13 ) .", "after the insertion of the catheter , a drainage tube is connected to a water sealed device . in our case , a conventional chest tube bottle was used , and during transportation to the ct room , the drainage device was not clamped .", ", the water in the bottom of the bottle could have swung back and forth .", "originally , the tube connected to the catheter would have been sealed with water , but this swinging motion would have provided the opportunity for air to enter the catheter and , subsequently , the pericardial sac .", "iatrogenic pneumopericardium is rarely reported after pericardiocentesis , but it can lead to tension pneumopericardium , which is a life threatening condition .", "physicians should be aware of this serious complication of pericardiocentesis and take extra precautions in handling drainage devices because this iatrogenic complication can lead to cardiac arrest and a medical dispute ." ] ]

[ [ "vehicles , which are characteristics of civilization have turned into a big problem in different social and public health respects due to increasing the number of the road and city accidents and high mortality rate . the most important factor behind death of those who are between one to forty", "is injuries caused by the variety of accidents that includes 12% of illness being ; furthermore , this one is a third factor behind the total mortality .", "meanwhile , causes of injuries are including road accidents and findings of world health organization ( who ) show that 25% of losses due to injuries throughout the world .", "it is predicted that until 2020 , the number of death cases due to driving accidents increase up to 65% throughout the world and up to 80% in developing countries .", "the vital point is to the extent that who suggested the motto of safe road in 2004 .", "the organization has put the responsibility upon the health department for collecting information , investigating about driving accidents , and interfering in traffic safety .", "iran has one of the highest rates of road traffic crashes mortality rates in the world ; furthermore , driving accidents , after heart maladies , is nationally regarded as the second factor behind death in iran .", "the road traffic crashes mortality rate in iran was 30/100,000 people in which is 23 and 14 times higher in comparison with the world and eastern mediterranean respectively .", "according to the statistics of iranian legal medicine organization , from the perspective of losses rate , the number of dead people due to accidents had 10% growth in the year .", "the index of the number of death to one hundred thousand persons has had an ascending trend over the last decade and has increased from 5.20 in 1996 to 5.40 in 2006 .", "growth rate of the index has almost been stopped due to reduced birth rate and measures adopted in the safety area , to an extent that the number has reached 31.2 in 2009 , which reduced 25% in comparison with 2006 . however , according to the statistics of road maintenance and transportation organization of iran , the number of accidents , injuries and its losses is still increasing every year .", "traffic accidents are a complex phenomenon , which is caused by the non - linear combination and interaction of homogeneous agents .", "vital factors involved in occurrence of incidents are man , vehicles , road and environment from which contribution of man factor has been calculated 95% , the road and environment 28% and of vehicles 8% . analyzing the road accidents in iran shows that from the four factors , man is accounted as the most important agent of accidents . among these factors , drivers errors , risky behaviors of some professionals in the roads and a large portion of the public are the biggest contributors to the incidents .", "risky driving , defined as those patterns of driving behavior that place drivers at risk for morbidity and mortality involving legal violations but not alcohol or drug use , is a main risk factor for traffic crashes .", "risky driving has been consistently recognized as a key contributor to road crashes , and many studies have observed an association between several risky driving behaviors and road crashes , particularly for younger drivers .", "risky driving behaviors such as speeding , passing violations , tailgating , lane - usage violations , right - of - way violations , illegal turns , and control signal violations happen most frequently .", "therefore , attempt to change the behaviors has a great impact upon reduction of accidents and their consequences .", "changing risky driving behaviors like other risky behaviors , requires a concept basis for helping to explain how the behavior occurs , how health education is conducted and how health education affects this ongoing behavior .", " driving will be dangerous especially if the driver is willing to take the risk in the roads .", "many people engage in driving behaviors that are risky , either inadvertently or with the intention to take the risk . perhaps because they tend to be inexperienced and lack the skills needed to negotiate difficult on - road driving situations or having positive attitudes to taking risks .", "risk taking has been identified as an important contributor to occurrence of many health problems like accidents .", "classic definition of risk is incidence as well as consequences that follow necessarily . whereas , the definition of risk in incidence is what is engaged in behaviors , which includes potential negative outcome .", "the relationship between risk taking attitude and risky driving behaviors has been proved . in recent years", ", our country has been turned into a center of crisis , moreover ; recent studies and investigations of world bank have officially considered the state of iran traffic safety critical .", "based on the reports of the legal medical organization and road maintenance and transportation organization of iran , 241240 of people have been killed on roads over 1380 's .", "drivers , and the highest mortality rate in vehicle accidents was related to motorcars .", "many factors have a role in incidents ; the outcome of every unsafe action is an incident which will result in death or injury of drivers and passengers .", "due to this matter that individuals must avoid risks intrinsically , and saving themselves and others lives is a religious and intellectual duty it is questionable that why risk taking and doing risky behaviors are in high levels ?" ], [ "the most widely method used to investigate risky driving behaviors is based on self - reports which is the best method to collect information .", "risk taking can be measured by a questionnaire having two items of risk taking behaviors and risk taking attitudes .", "hence , in the present study , data collection tool is a questionnaire that measuring risk taking by two items of risky driving behaviors and risk taking attitudes . to design the questionnaire ,", "the first part includes demographic information and accident records and the second part includes risky driving behaviors and risk taking attitudes , in which respondents show every deviation in driving by likert scale from 1 ( never ) to 5 ( almost always ) .", "risky driving behaviors include speeding , distraction while driving , aggressive driving , violation of the road laws , not using the seat belts and incautious driving .", "risk taking attitudes include attitudes toward rule violation and speeding , attitude toward the careless driving of others and concern for others [ figure 1 ] .", "this cross - sectional study was carried out in the center and west of iran ( isfahan and kermanshah ) upon 540 ordinary and taxi drivers who were driving regularly from bus terminals and travel agencies to other cities . because an overwhelming majority of inter - urban drivers consists of men , therefore", "then data were analyzed by the spss v.18 software by using the pearson correlation , and logistic regression .", "after devising the questionnaire , to assess its validity , experts were asked to judge .", "in fact , the questionnaire was given to experts and chief of road police officer in isfahan to modify questions . in a pilot study , to assess reliability , 30 professional drivers were asked to answer questions and mark the ones which were unclear .", "data obtained were analyzed by the spss v.18 software to assess the validity and reliability ." ], [ "to assess the stability of indices , cronbach 's alpha test was used , which was equal to 0.863 . as it can be seen in table 1 , the amount of cronbach 's alpha is at a high level in most cases .", "number of items , mean scores and cronbach 's alpha for all measures the mean age of drivers with driving experience of 17.62 12.61 was 41.39 13.21 ; also 15.6% had bsc and upper degree , 55% had diploma degree , and 29.4% had degree under diploma .", "51.5% of drivers had the experience of accidents ( in the last year had at least one accident ) and in 47.8% of the accidents occurred , driver had driving offense .", "11.5% of these accidents have resulted in physical injuries . from these persons , 1.9% has reported their skill level of driving weak , 54.4% good , 34.4% very good , and 18.3% excellent .", "there is a high correlation between risk taking attitudes and risky driving behaviors ( p < 0.001 , r = 0.442 ) . in table 2 , the relationship between different variables has been displayed .", "there is a positive significant relationship between most variables and just between distraction while driving , and concern for others a reverse relationship was noticed .", "intercorrelations ( pearson 's r ) between factors measuring risk taking ( n=540 ) the results of logistic regression test showed that both independent variables of risky driving behaviors and risk taking attitudes are important for predicting the amount of individual 's risk taking ( p < 0.001 ) . however , risky driving behaviors had the highest regression coefficient ( = 0.73 for risky driving behaviors and = 0.43 for risk taking attitude ) which shows that risky driving behaviors have an important impact upon the rate of drivers risk taking .", "the logistic regression test also shows that risky driving behaviors can be a predictor driving accidents due to individuals risk taking ( p = 0.014 ) .", "aggressive driving , violation of the road laws and distraction are predictors of high risky driving behaviors , and attitude toward rule violation and speeding are predictors of risk taking attitudes ( p < 0.001 ) . among all of these variables ,", "attitude toward rule violations and speeding , aggressive driving and violation of the road laws respectively are most important predictors of drivers risk taking ( p < 0.0010 ) [ figure 2 ] .", "estimated model ( n = 540 ) total mean of all risky driving behaviors was 2.01 0.38 and total average of risk taking attitudes was 1.98 0.46 . it has also been specified that among risky driving behaviors , the following behaviors have allocated the highest percents to themselves respectively : wrong and improper overtaking , not giving up against other drivers behaviors , talking with other passengers while driving and not reducing the speed while drivers behind are trying to overtake .", "given risk taking attitudes of drivers , a majority of them agree that rule violation is not an indicator of a bad driver . on the contrary , they believe that driving with high speed is exciting , and a good driver is a person who can drive faster than others . finally , it was clarified that there is a reverse relationship between rate of drivers risk taking and age ( p < 0.001 ) ; namely , by aging , the rate of risk taking has been reduced [ chart 1 ] .", "there is a significant relationship between the rate of risk taking and educations ( p < 0.001 ) .", "in fact , risk taking in those who have bsc and upper degree is significantly more than that of those who are under diploma [ chart 2 ] .", "correlation between age and risk - taking variables correlation between education and risk - taking variables there was also a reverse relationship between rate of risk taking and driving experience ( p = 0.037 ) .", "there is a significant relationship between the rate of risk taking and number of accidents .", "in other words , those who had more accidents had more rate of risk taking ( p = 0.037 ) . totally , the rate of drivers risk taking was more moderate ( 83.1% ) and none of the individuals of the population had high - risk taking [ chart 3 ] ." ], [ "most of studies have used interview , questionnaire and polls to analyze driving accidents or they benefited from an observational study methods to determine different errors of drivers and the errors , which create existing conditions in road accidents .", "self - reports of driving accidents can be an indicator of individual 's driving behaviors in future , also one of the major motivations of man for a driving offense is their risk taking . in the present study , which has been carried out about aiming at measuring the amount of risk taking , a questionnaire has been designed as much as possible according to the islamic culture of iran .", "because drivers behaviors are different from that of other countries such as using alcoholic drinks , which is a normal matter in other countries but in our country is opposite to our religion and rule , it is not possible to use the questionnaire designed in other countries .", "however , the questionnaire had high validity and reliability to measure the amount of risk taking in iranian drivers . in studies which have done to measure risk taking ,", "respondents were asked to show how they take risks in a variety of actions ( with responses from never too often ) .", "the average score in every scale was made based on existing items inside each scale .", "high score in the scale showed that driving is highly dangerous . in the questionnaire ,", "risk taking was also measured by likert scale and the average score has been made up of existing items .", "like other studies , a significant relationship was noticed between two variables of risk taking attitude and risky driving behaviors , it is unlike other studies carried out upon this respect which showed that attitude is predictive of risk taking , in the present study , risky driving behaviors are a stronger predictors of risk taking in iranian drivers .", "however , in these studies it has been mentioned because attitude and behavior are measured simultaneously , it is difficult to claim that attitude is predictive of risk taking .", "the results show that in iran although attitude toward risk taking has been located at a low level by different ways , a desired result was not obtained from the reduction of those high risky behaviors ; in fact , high rate of accidents and traffic incidences in iran indicate this matter well .", "furthermore , between these two variables , just risky driving behaviors are predictive of accidents due to risk taking of iranian drivers , which is congruent with other studies . moreover , from among a variety of variables have been mentioned in the study , attitude toward rule violation and speeding are the strongest predictive for risk taking of iranian drivers , which absolutely match the findings of a study carried out by shams in iran and iversen .", "the results of the present study showed that there is a reverse relationship between the rate of drivers risk taking and age ; which means , by increasing the age , the amount of risk taking has been reduced .", "this is congruent with most studies carried out in this field like the studies carried out by fernandes et al .", ", tronsmoen . when drivers are young , they are willing to speed and do high risky behaviors due to lack of sufficient skills and internal excitement . by aging and increasing", "the results also showed that there is a reverse relationship between the amount of risk taking and driving experience as a study carried out by lin in taiwan showed that risk taking is reduced by increasing the experience .", "educational level is an effective agent upon drivers perception while driving in traffic flows . if a person had a suitable education , their perception from environmental conditions and dangerous factors would grow , and they would pay more attention to road signs and barriers . in the present study , there is a relationship between the amount of risk taking and education .", "in fact , risk taking of those who have bachelors or higher degree is significantly more than those who are under diploma .", "similar results were reported by tuokko , that is , congruent with a study carried out by almadani . in the present study ,", "in other words , those who had more accidents have obtained a higher risk taking score . in the study carried out by lin et al . upon the impact of accident experience on risk taking in young persons", ", they concluded that those who have accident experience have obtained a higher risk taking score based on risk taking factors ." ], [ "the current study shows that more evaluation is required concerning the impact of traffic safety interventions on attitudes and behaviors of iranian drivers . to reduce the amount of risk taking , the first important factor is increasing police control , reforming the penalties and effectiveness of driving fines .", "one of ways for effectively of driving fines is making the deadline of fines payments in a short time .", "another factor is culture building in a way that driving laws be institutionalized . in the driving test in iran ,", "attention is paid to the driver celerity more than any other factors . whereas , in countries which have more organized driving laws , compliance with laws is noticed more and training needed is provided in this respect .", "insurance policies need to be modified in our country . to increase the amount of the risk aversion and need to be arranged , according to the driver 's character and records ." ] ]

[ [ "" ], [ "she was referred to saitama hospital due to severe headache and nausea on october 2008 .", "brain mri detected a 1.5 cm abscess mass with extensive edema in the right frontal lobe .", "we performed intensive therapy using some antibiotics that included cefotaxime and meropenem and depressants for intracranial pressure for six weeks .", "there was a good prognosis for the woman and her fetus without any sign of neurological abnormalities ." ], [ "early medical intervention is required before it is too late for brain abscess in pregnancy ." ], [ "brain abscess caused by bacterial infection has extremely low incidence , and a high mortality rate of 30% .", "it causes poor prognosis for both mother and fetus , regardless of the state of pregnancy . unlike non - pregnant women" ], [ "a 24-year - old woman who lived in saitama , japan had three pregnancies , two childbirths , body mass index ( bmi ) of 22.3 , and unremarkable past medical and family histories .", "she also had an uneventful first trimester , but developed a fever of > 39c at 22nd week , 1st day of pregnancy .", "because of prolonged headache and nausea , she was referred to our hospital in saitama for complete physical examination on october 2008 . on admission , she had blood pressure of 103/51 mmhg , heart rate of 100 beats per min ( bpm ) , body temperature of 39.0c , mild stiffness in the neck , and cold extremities .", "however , brain computed tomography ( ct ) for the prolonged headache revealed a 1.5 cm mass in the right frontal lobe , while hematological analysis showed an elevated white blood cell count of 12,400 cells/l ( neutrophils , 87.7% ) .", "cerebrospinal fluid findings were positive for gram - positive bacteria , an increased cell count ( especially for neutrophils ) of 2,332 cells/l , and a low glucose concentration of 30 mg / dl .", "brain mri revealed a 1.5 cm mass with a high intensity signal inside and a low intensity t2 signal on the margin in the deep white matter of the right frontal lobe .", "based on the above findings and a high intensity zone surrounding the mass on diffusion - weighted images , she was immediately placed on intensive therapy with concurrent administration of antibiotics cefotaxime ( 2 g / day ) and meropenem ( 3 g / day ) , as well as glycerin 20 g / day to reduce intracranial pressure .", "table 1 shows a list of examinations performed in search of causal factors , while the results show the isolation of methicillin - sensitive staphylococcus aureus ( mssa ) from the throat . on the other hand , she had no dental problems . because of unremarkable upper gastrointestinal endoscopy findings and a negative fecal occult blood test result , the possibility of brain metastasis of a malignant tumor was ruled out .", "after six weeks of intensive therapy with concurrent administration of two antibiotics and glycerin , the headache and nausea disappeared along with a reduction in the number of white blood cells .", "subsequent brain mri at 28th week , 4th day of pregnancy showed no enlargement of the abscess and disappearance of the surrounding edema , with no indication of puncture drainage . at this point , she was switched to oral administration of amoxicillin 750 mg / day for four weeks and was discharged at 29th week , 3rd day of pregnancy .", "body temperature slowed down after the day 7 causes of brain abscess mssa : methicillin - sensitive staphylococcus aureus , cns : coaglese negative staphylococcus she vaginally delivered a 2,890 g girl baby at 38th week , 5th day of pregnancy , with no abnormalities .", "no neurological abnormalities were evident during a five - year follow - up observation conducted over the phone .", "mri findings at the 22nd and 28th week of pregnancy are shown in figure 2 .", "a : axial image at 22ne week of pregnancy shows the large right frontal abscess with severe edema .", "b : axial image at 28th week of pregnancy shows no enlargement of the abscess and disappearance of the surrounding edema" ], [ "despite the extremely low incidence , brain abscess caused by bacterial infection has a high mortality rate of 30% and is therefore a disease with poor prognosis for both mother and fetus , regardless of the state of pregnancy .", "although we listed previous reports on brain abscess during pregnancy ( table 2 ) , it should be noted that the number is extremely small ( 16 ) .", "approximately , 7% of the previous cases were related to dental treatment ( 7 ) , but no dental abnormalities were observed in the present case . during the pregnancy , maternal immunity is reduced due to a hormonal imbalance , and according to lanciers et al .", ", 26.6% of pregnant women , as opposed to 11.0% of non - pregnant women , are significantly infected with helicobacter pylori ( 8) .", "it goes without saying that organisms with low pathogenicity under normal circumstances can cause serious infection during pregnancy . in this case , the clear source of infection was not identified .", "it seems that the pregnant woman whose immunity was diminished is vulnerable to mssa , which was extremely rare and considered as a serious case . \n ", "brain abacess in pregnancy ( literature review ) the symptoms of brain abscess include headache , nausea , and localized neurological abnormalities ( 9 ) .", "headache is the most common symptom , occurring in 75% of pregnant women , followed by 67% of neurological abnormalities and 58% of altered consciousness ( 10 ) .", "although no adverse effects of mri have been reported ( 11 , 12 ) , the ct should be avoided as much as possible because there are some problems about the degree of radiation exposure in pregnant women .", "therefore , mri may be a safer and is a highly sensitive diagnostic imaging modality for use in pregnancy ( 13 ) .", "yet , because of potential thermal tissue damage due to the high magnetic field , the national radiological protection board recommends that pregnant women avoid mri examination during the first trimester . to treat a brain abscess ,", "it is necessary to select antibiotics capable of effectively crossing the blood brain barrier and their sensitivity should be proven in bacterial culture .", "the use of steroidal drug is also recommended to prevent an increase in intracranial pressure and the development of brain edema ( 13 ) .", "however , because intensive therapy for a brain abscess with antibiotics and steroidal drugs takes somewhere between six to eight weeks , its effect on the fetus is a huge concern .", "betamethasone and dexamethasone , which are transported via the placenta , should be avoided because they may affect the development of the fetal central nervous system .", "furthermore , the early administration of antiepileptic drugs is recommended because 70% of patients with a brain abscess develop epilepsy ( 13 ) ." ], [ "even infection by vulnerable bacteria becomes serious and early treatment intervention is desirable because immunity power diminishes during the pregnancy ." ], [ "our treatment obtained ethics approval from the regional ethics committee responsible for human experimentation and conformed to the provisions of the declaration of helsinki ." ] ]

[ [ "caustic esophageal injury in infants is a devastating insult to the gastrointestinal tract and will often require major reconstructive surgery to replace the damaged esophagus . esophageal replacement with colonic", "interposition has been utilized since dale and sherman performed the first retrosternal colonic interposition in 1955 . up to 80% of patients with colonic interposition", "endoscopic dilation is relatively safe and effective for the initial treatment of anastomotic strictures , but surgical management is indicated in refractory cases . when surgery is required , graft revision utilizing both a thoracotomy and laparotomy is common .", "we report a case of cologastric stricture treated with resection and reconstruction of the anastomosis solely through an abdominal approach , which can offer less morbidity and mortality ." ], [ "a 31-year - old male developed a caustic esophageal injury after ingestion of an alkaline solution when he was 2 years old .", "he required emergent esophagectomy , proximal gastrectomy and reconstruction with a colonic interposition graft from the cervical esophagus to the stomach .", "the patient also had a pyloric stricture , for which a gastrojejunostomy was performed . over the next three decades , he required frequent hospital admissions for abdominal pain and dysphagia , and had multiple endoscopic dilations performed for a severe cologastric anastomotic stricture ( fig .", "the patient had severe malnourishment , with a body mass index of 14 kg / m .", "he had a jejunostomy feeding tube for nutritional support , which had been removed due to abdominal pain a few months prior to presentation . \n", "endoscopic evaluation revealed the severe cologastric stricture , severe inflammation just proximal to the cologastric anastomosis , and significant ulcerative disease at his gastrojejunal anastomosis .", "the patient underwent resection of the cologastric anastomosis and the gastrojejunal anastomosis with ulcerated stomach , neo - cologastric anastomosis and neo - gastrojejunal anastomosis via a transabdominal approach without a thoracotomy .", "intraoperative endoscopy was utilized during the case to ensure that the cologastric anastomotic stricture was entirely resected . \n", "figure 2:preoperative cologastric and pyloric strictures ( a ) and post - operative changes including new cologastric , gastrojejunal , duodenojejunal anastomoses ( b ) .", "preoperative cologastric and pyloric strictures ( a ) and post - operative changes including new cologastric , gastrojejunal , duodenojejunal anastomoses ( b ) .", "the patient tolerated the procedure well and was transferred to the intensive care unit . on post - operative day 2 , he was transferred to the floor .", "his post - operative course was remarkable for development of an intra - abdominal fluid collection , which required percutaneous drainage , but was otherwise uncomplicated ." ], [ "severe esophageal damage may require resection with creation of a neo - esophagus . because these operations occur in children , complications in regards to the colonic interposition graft", "classically , a transthoracic approach has been used to resect the entire colonic graft . in this situation", ", a repeat colon graft may be needed , which carries high morbidity and mortality .", "in particular , the majority of the proximal colon graft , which was functional , was able to be spared .", "given our patient 's preoperative nutritional status , he would be at a predisposed risk for wound healing complications . via transabdominal approach ,", "to the best of our knowledge , this is the first written report of using a completely transabdominal approach for revision of the colonic graft .", "our patient had previously been refused surgery by multiple surgeons . if this relatively less complex surgical management was used , perhaps he would have had definitive treatment much earlier .", "our patient did well with our transabdominal approach given the chronicity of his symptoms . in light of his clinical dilemma of continued non - operative versus operative intervention , his symptoms were relieved immediately .", "this surgical approach should be considered in patients with history of colonic interposition requiring reoperation for complications of the colonic graft ." ] ]

[ [ "panic disorder ( pd ) is characterized by unexpected recurrent panic attacks that lead to distressing thoughts about future episodes , physical harm , and maladaptive preventive behaviors.1 the main characteristic , lack of objective triggers or clues , is helpful to distinguish pd from panic attacks that occur in the context of other psychiatric disorders .", "a panic attack is defined as a rapid and intense peak of fear presenting with physical impairments , such as accelerated heart rate and excessive sweating , and also cognitive symptoms , including fear of death or losing control .", "pd is one of the major anxiety disorders to be managed by several genetic factors.2 the red cell distribution width ( rdw ) , which is a measure of heterogeneity in the size of circulating red blood cells , is a component of the complete blood count .", "it is calculated as a percentage of the standard deviation of the red cell volume divided by the mean corpuscular volume .", "the rdw is commonly used to distinguish iron deficiency - induced microcytic anemia and thalassemia , or hemoglobinopathies - related anemia .", "increased rdw levels are often caused by impaired erythropoiesis or erythrocyte degradation.3 recent studies have suggested a relationship between increased rdw levels and certain diseases , such as cardiovascular disease ( cvd).4 moreover , there is a growing amount of evidence showing that inflammation has a key role in the pathogenesis .", "the rdw has been also shown to be associated with inflammatory markers in many disorders.5,6 platelets , which are useful to study the intracellular signal transduction , have been extensively used in psychiatry as a peripheral model of the serotonergic system , since they express the 5-hydroxytryptamine ( ht ) 2a receptors and 5-ht transporters identical to those present in the brain.7,8 the uptake of the 5-ht platelet from the plasma is mainly dependent on the 5-ht transporter .", "platelets may indicate biochemical alterations happening in the brain under several psychiatric conditions.9 current studies have suggested that platelets may be affected by diverse stressors , including psychological ones .", "platelets offer an interesting vantage point for understanding the neurophysiology of various psychiatric disorders.9 the mean platelet volume ( mpv ) , which is the measure of the platelet size , is the main determinant of the platelet function.10 although previous studies have investigated the role of mpv levels in pd , many have shown limited and controversial findings . on the other hand , to the best of our knowledge ,", "therefore , we aimed to evaluate , for the first time , the rdw levels combined with mpv levels in patients with pd ." ], [ "this retrospective study included a total of 30 treatment - nave patients who were diagnosed with pd ( study group ) and 25 age- and sex - matched healthy volunteers ( control group ) between 18 and 59 years of age in the emergency medicine department of harran university .", "the patients with pd were diagnosed by a psychiatrist , according to the diagnostic and statistical manual of mental disorders , fifth edition criteria .", "patients with hypertension , iron deficiency anemia , liver disease , coronary artery or heart valve disease , neurological deficits , pulmonary diseases , endocrine disorders , and urinary tract infections were excluded .", "the control group consisted of a total of 25 healthy asymptomatic subjects with a nonspecific medical history and normal physical examination findings .", "none of the control subjects were on any medication or antioxidant vitamin supplementation , such as vitamins e and c. they were all free of acute or chronic diseases .", "the study was conducted in accordance with the principles of the revised 2000 declaration of helsinki .", "the white blood cell count ( wbc ) , mpv , and rdw levels were measured in both groups using the same devices and kits .", "abbott cell - dynruby cell - dyn 3200 system device ( abbott laboratories , santa clara , ca , usa ) was used for the analysis of complete blood count ." ], [ "this retrospective study included a total of 30 treatment - nave patients who were diagnosed with pd ( study group ) and 25 age- and sex - matched healthy volunteers ( control group ) between 18 and 59 years of age in the emergency medicine department of harran university .", "the patients with pd were diagnosed by a psychiatrist , according to the diagnostic and statistical manual of mental disorders , fifth edition criteria .", "patients with hypertension , iron deficiency anemia , liver disease , coronary artery or heart valve disease , neurological deficits , pulmonary diseases , endocrine disorders , and urinary tract infections were excluded .", "the control group consisted of a total of 25 healthy asymptomatic subjects with a nonspecific medical history and normal physical examination findings .", "none of the control subjects were on any medication or antioxidant vitamin supplementation , such as vitamins e and c. they were all free of acute or chronic diseases .", "the study was conducted in accordance with the principles of the revised 2000 declaration of helsinki .", "the white blood cell count ( wbc ) , mpv , and rdw levels were measured in both groups using the same devices and kits .", "abbott cell - dynruby cell - dyn 3200 system device ( abbott laboratories , santa clara , ca , usa ) was used for the analysis of complete blood count ." ], [ "" ], [ "there were no statistically significant differences in the age and sex between the two groups ( p>0.05 ) .", "the mean wbc , mpv , and rdw levels were 9,173.032,400.31/mm , 8.191.13 fl , and 12.471.14% , respectively , in the study group .", "these values were found to be 7,090.241,032.61 , 6.850.67 , and 11.630.85 , respectively , in the healthy controls .", "the wbc , mpv , and rdw levels were significantly higher in the patients with pd , compared to healthy controls ( p=0.001 , p=0.001 , and p=0.003 , respectively ) .", "there was no significant difference in the platelet number between the study and control groups ( p>0.05 ) ." ], [ "this study is the first to demonstrate that patients with pd have significantly higher rdw levels , compared to the healthy controls . in addition , wbc , mpv , and rdw levels were significantly higher in the patient group , compared to the control group .", "several study findings have demonstrated that there is a blood brain relationship between platelets and the neuronal 5-ht transporter.11 previous studies have shown that is a correlation between platelets and synaptosomal re - uptake .", "parallel similar changes can be found in the human blood , brain and cerebrospinal fluid 5-ht levels , following the administration of 5-ht - releasing agents .", "furthermore , some authors have suggested an association between depression and an increased risk of vascular events due to the platelet dysfunction .", "in addition , a meta - analysis confirmed the previous reports , suggesting a correlation between platelet 5-ht uptake and depression.11 depression and anxiety disorders have been suggested to be the main risk factors in the etiology of mortality in cvd.12 anxiety disorders have been demonstrated to increase the risk of myocardial infarction,13 and cvd.14 pd is one of the most common anxiety disorders .", "some authors have also shown an association between pd and cvd.15 at pathophysiological levels it has been hypothesized that biological mechanisms may be affected by stress - related conditions , resulting in worsening of cardiovascular functions .", "platelet activity increases with the emotional stress , and coronary events such as myocardial infarction can be induced .", "furthermore , increased mpv levels may indicate either increased platelet activation or an increased number of large and hyperaggregated platelets.16 our results showed that this increase may reflect the abnormality of platelets rather than increase in their counts . although previous studies have investigated the mpv levels in pd , these results are limited and controversial .", "kokacya et al17 found increased mpv levels in the patients with pd , compared to the mpv levels of the control group .", "on the other hand , gogcegoz gul et al10 reported reduced mpv levels in the patients with pd , compared to the mpv levels of the control group . in this study , we found significantly higher mpv levels in the patients with pd , compared to the mpv levels of the control group .", "therefore , we conclude that an abnormal 5-ht metabolism in platelets may indicate the abnormal function of platelets and increased mpv levels .", "furthermore , anxiety , depression , or disruptive behavior disorder have been shown to be associated with increased catecholamine levels , sympathetic activity , and cortisol secretion.18 in a study , vizioli et al19 reported that increased sympathetic activity could result in increased mpv values .", "also , anxiety and depressive disorders have been demonstrated to be associated with increased inflammatory cytokine levels , endothelial dysfunction , and platelet reactivation .", "some authors reported that platelets were stimulated by the sympathoadrenal activation through 2-adrenoreceptor activation.20 the activation of the platelets was shown to induce shape changes and increase mpv levels.21 in a study , ataoglu and canan reported increased mpv levels in patients with major depression.22 the authors also reported that mpv levels were statistically signifi - cantly lower compared to the baseline following treatment . in another study ,", "aschbacher et al23 found a varying degree of alteration in platelets in patients with anxiety disorder .", "moreover , another study reported that mpv levels could be increased due to the increased sympathetic activity.19 as a result , the increased mpv levels in patients with depression can be attributed to the increased sympathetic activity.25 the rdw is used as a predictor of mortality in the overall population.26 there are studies that reported increased rdw levels , despite being within normal reference ranges , were associated with adverse events in patients with heart failure , coronary artery disease , pulmonary hypertension , diabetes mellitus , alzheimer s disease , and stroke.27 however , the pathophysiology remains to be elucidated . on the other hand , to the best of our knowledge , the rdw levels of pd have not been reported , yet . in our study , we found a statistically significant difference in the rdw levels in the study group , compared to the rdw levels of the control group .", "our study findings show that the mpv and rdw levels can be used in pd .", "we recommend these simple and relatively inexpensive methods for the initial examination and prognosis of the disease in these patients ." ], [ "in conclusion , this study is the first to demonstrate that the rdw levels combined with mpv levels significantly increase in patients with pd . we think that the increase in rdw and mpv levels can be attributed to the increase in sympathetic activity .", "we believe that increase in rdw and mpv levels can be used as a novel marker for pd . however , further prospective clinical studies are required to confirm these findings ." ] ]

[ [ "\n peritoneal dialysis ( pd ) is a form of home - based renal replacement therapy for patients with end - stage kidney disease ( eskd ) that uses a patient 's peritoneum as a dialysis membrane across which water and solutes ( e.g. , electrolytes and glucose ) are exchanged between dialysis fluid and blood .", "pd has several advantages including greater ease of technique to master , greater preservation of residual renal function ( rrf ) , early survival advantage , and superior cost effectiveness compared to haemodialysis [ 13 ] .", "greater preservation of rrf is significant as it leads to a better technique survival by enhancing pd adequacy and ultrafiltration capacity . despite these benefits ,", "the outcome of pd patients remains poor and cardiovascular events ( cve ) continue to be the leading cause of death in pd patients .", "higher cve burden in chronic kidney disease ( ckd ) patients compared to those without ckd is astounding ( proportion of patients without cve 38.7% versus 61.7% ) . moreover", ", the relative risk of death is paradoxically higher in ckd patients identified as the ", "lower risk group ( i.e. , younger patients or those with a lower prevalence of cve ) , supported by data from the united states renal data system .", "in contrast to the general population , advances in medical therapy for patients with cve ( e.g. , aspirin , lipid - lowering agents ) have not decreased the cve - related burden in patients with eskd .", "an increase in the delivery of dialysis dose has not translated into a mortality benefit in pd patients .", "additional risks have been attributed to the presence of nontraditional risk factors , such as inflammation , which have been shown to promote proliferation and infiltration of inflammatory cells into the tunica intima of small arteries , leading to the development of atherosclerosis and stenosis .", "an association between a decline in rrf in patients with ckd and progressively increased level of systemic inflammatory burden which is most marked in those receiving renal replacement therapy , such as haemodialysis , has been well established [ 11 , 12 ] . at present , there is no clear evidence to suggest any significant difference in the systemic inflammatory burden based on the type of dialysis modality received ( i.e. , haemodialysis versus peritoneal dialysis ) ." ], [ "inflammation can be defined as a localised protective response elicited by injury or destruction of tissues that serves to destroy , dilute , or sequester both the injurious agent and injured tissue .", "hence , it is a physiological response and in the form of an acute response to infections , trauma , or toxic injury , it helps the body to defend against pathophysiological insults .", "however , if inflammation becomes prolonged and persistent in the form of the so called chronic acute - phase reaction , it may lead to adverse consequences , such as decline in appetite , increased rate of protein depletion in skeletal muscle , hypercatabolism , endothelial damage , and atherosclerosis [ 1419 ] ( figure 1 ) .", "there are several markers that can be measured to gauge the level of inflammatory burden , such as c - reactive protein ( crp ) .", "crp levels can rise rapidly and markedly in response to acute inflammatory stimulus from increased synthesis by hepatocytes to contribute to host defense and innate immune response .", "its induction in hepatocytes in turn is regulated by cytokines such as interleukin-6 ( il-6 ) , which is a pleiotropic immunomodulatory cytokine that plays a critical role in many innate and acquired inflammatory processes .", "dysregulation of il-6 signalling has been implicated in a variety of chronic disease pathologies and in immune and inflammatory diseases . however , the activities of these proinflammatory cytokines depend on the involved cell types and its microenvironment . for example , after an acute injury , tumor necrosis factor - like weak inducer of apoptosis ( tweak ) promotes tissue regeneration by stimulating progenitor cells but in chronic diseases where tweak is persistently activated it alters tissue repair by inhibiting differentiation of the same progenitor cells [ 22 , 23 ] .", "the inflammatory pathways are clearly complex and dependent on many conditions ( e.g. , acute versus chronic , microenvironment ) and therefore are often difficult to clearly characterise ." ], [ "in pd patients , inflammation can be broadly compartmentalised into two types , systemic and local intraperitoneal inflammation .", "as recently reported by the global fluid study , these two represent distinct underlying processes that likely require different preventative or therapeutic approaches .", "the reported prevalence of systemic inflammation measured using crp ranges between 12% and 65% in pd patients , depending on the cut - off value used to define the level of inflammation [ 25 , 26 ] .", "a number of longitudinal studies have also been reported increasing burden of inflammation measured using interleukin-6 ( il-6 ) with longer time on pd at both systemic and intraperitoneal levels [ 2729 ] .", "interest in inflammatory markers as targets of therapeutic intervention has been considerable as they are recognised as predictors of poor patient outcomes ( e.g. , mortality ) . however , prior to embarking on strategies to reduce inflammatory burden , it would be of paramount importance to define the underlying causes that drive the chronically inflamed state .", "the present review aims to comprehensively describe clinical causes of inflammation in pd patients at which potential future therapeutic targets may be aimed ." ], [ "a number of studies have reported an association between lowered rrf and higher systemic inflammatory burden in predialysis and dialysis patients [ 30 , 31 ] .", "it remains uncertain as to whether these associations are primarily a result of an impaired renal clearance of inflammatory cytokines , direct stimulation of cytokine generation by uraemic milieu , or simply a consequence of adverse effect of inflammation on rrf .", "the importance of renal elimination of proinflammatory cytokines was described using animal models where the half - lives of injected interleukin-1 ( il-1 ) and tumour necrosis factor ( tnf ) were increased after nephrectomy . in addition , preclinical studies have demonstrated pathogenic mechanisms of uraemic toxins on inducing proinflammatory cytokine production and renal tubular cell injury via nuclear factor - kappa ( nf- ) and oxidative stress pathways , respectively .", "the direct stimulation of systemic inflammatory burden by uraemic toxins was further supported by the findings from a recent cross - sectional observational study of 149 chronic kidney disease ( ckd ) patients ( mean egfr 40 9 ml / min/1.73 m ; range 2559 ml / min/1.73 m ) which showed that serum uraemic toxin levels ( i.e. , indoxyl sulphate ) were significantly and independently associated with serum il-6 , tnf- , and interferon- ( ifn- ) concentrations ( unpublished ) .", "nonetheless , the relationship between rrf and inflammation becomes less clear once patients commence dialysis due to the presence of dialysis - specific factors ( e.g. , peritonitis ) that can stimulate systemic inflammatory cytokine production independent of the background rrf decline .", "in fact , the global fluid observational study involving 959 pd patients from 10 centres in korea , canada , and the united kingdom did not observe any significant association between patients ' residual urine volume and systemic il-6 concentrations in their prevalent ( p = 0.7 ) or incident cohorts ( p = 0.3 ) .", "similarly , a biomarker substudy of the balanz trial was not able to demonstrate the presence of any statistically significant association between the loss of rrf and serum il-6 concentrations over the 24 months of follow - up period in the 175 incident pd patients ( p = 0.27 ) .", "in contrast to these reports , chung and colleagues described an association between a greater loss in rrf and higher serum crp concentrations ( 10 mg / l ) after 12 months of pd in incident patients ( p < 0.05 ) . some of the differences in observed outcomes could have resulted from dissimilar statistical analysis techniques ( e.g. , continuous versus categorical data analyses ) and the inflammatory marker measured ( il-6 versus crp ) .", "similarly , the impact of rrf on intraperitoneal inflammation remains unclear due to conflicting reports from published literature .", "a previous peritoneal biopsy study has observed significantly worse peritoneal membrane injury in patients with uraemia ( predialysis ) compared to those with normal renal function ( p = 0.01 ) .", "therefore , it is plausible that the uraemic milieu itself may promote the extent of peritoneal injury and better preserved rrf may lower the intraperitoneal inflammatory burden associated with peritoneal injury .", "the global fluid study reported significantly lower levels of dialysate il-6 with a higher urine volume in their prevalent cohort ( coefficient 0.1 per litre , p = 0.01 ) but not in incident cohort ( coefficient 0.03 per litre , p = 0.2 ) , whereas the balanz trial observed no significant association between rate of rrf decline with dialysate il-6 concentrations ( n = 88 , p = 0.67 ) .", "conclusions that can be drawn from these studies were however limited by the absence of longitudinal data and relatively small sample size [ 28 , 29 ] which could have lowered the statistical power to detect differences in outcome .", "therefore , at present , it remains uncertain as to what the true implication of rrf loss is , for systemic and local inflammatory burdens in pd patients .", "it is likely that rrf has some role in influencing these levels , but its impact may be overshadowed by the presence of other competing factors , such as infections or repeated exposures to pd solutions . perhaps some of these questions can be better answered through future studies evaluating the relationship between presence of uraemic toxin levels and inflammatory markers in pd patients", ". the cumulative and progressive nature of peritoneal membrane injury with longer pd duration has been well documented .", "conventional pd solutions are characterised by their acidic ph ( 5.05.8 ) , high lactate concentrations ( 75.5214 ", "mmol / l ) , high osmolality ( 320520 mosm / kg ) , and contamination by glucose degradation products ( gdp ) and have been shown to contribute to adverse outcomes demonstrated in preclinical studies [ 3941 ] .", "repeated exposures to conventional pd solutions and peritonitis episodes contribute to peritoneal injury , which in turn is an important cause of local inflammation with resultant adverse functional outcomes , such as higher peritoneal solute transport rate ( pstr ) [ 4345 ] .", "indeed , dialysate il-6 concentration has been identified as the most reliable predictor of pstr by a number of single centre studies and has now been substantiated by the large multicentre global fluid study [ 24 , 27 , 46 ] .", "il-6 is secreted in large quantities by peritoneal mesothelial cells in response to inflammatory stimuli and is modulated by exposure to pd solutions .", "an increase in intraperitoneal il-6 concentrations with longer pd duration ( i.e. , at 24 months ) was consistently demonstrated by extension studies of the balnet trial ( biocompatible 57.6 54.5 pg / ml versus 143 69.6 pg / ml , p < 0.001 ; standard 47 31.2 pg / ml versus 121 69 pg / ml , p < 0.001 ) and the balanz trial ( median 7.22 pg / ml versus 31.35 pg / ml , p < 0.001 ) .", "in contrast to these consistent results pertaining to the relationship between pd duration and intraperitoneal inflammation , there are contradicting reports about the impact of pd duration on systemic il-6 concentrations . in a single - centre , retrospective observational study of incident pd patients", "( n = 31 ) receiving treatment using conventional pd solutions , pecoits - filho and colleagues described a significant increase in plasma il-6 concentrations from baseline to one year ( median 3.7 pg / ml versus 6.5 pg / ml , p < 0.05 ) .", "similar results were observed from a substudy of the balanz trial ( n = 175 ) at 24 months ( p = 0.006 ) .", "the global fluid study however described a longer pd duration as a significant predictor of a random plasma il-6 level in prevalent ( coefficient 0.02 per year ;", "p = 0.04 ) but not in incident pd patients ( coefficient 0.2 per year ; p = 0.4 ) .", "furthermore , a prospective observational study ( n = 109 ) reported a lack of significant change in serum il-6 concentrations over twelve months .", "although the reasons for such discrepant findings are unclear , some of the differences may stem from variations in the study design , differences in assay techniques and samples ( serum versus plasma ) used to measure il-6 levels , and the duration over which these changes were measured . furthermore , whereas intraperitoneal inflammation is mainly driven by pd - related factors , such as repeated exposures to pd solution or peritonitis , systemic inflammation can be additionally influenced by many ", "pd - independent factors such as systemic infection that could have affected the observed outcomes .", "a recent report by ayuzawa and colleagues suggests that some of peritoneal membrane injury from pd can be minimised by using pd solutions that are more ", "minimisation of gdp formation has been achieved through development of the multicompartment bag system , which allows for heat sterilisation and storage to occur at a lower ph . moreover , a bicarbonate - buffer system has been used to lower exposure to lactate .", "several preclinical studies have demonstrated that use of these solutions has resulted in improved cytokine profiles and cellular function , including the host immune system [ 5156 ] .", "therefore , the use of these biocompatible pd solutions may lead to changes in the intraperitoneal environment with the potential benefits of decreasing the level of intraperitoneal inflammatory burden and improving peritoneal membrane function ( i.e. , pstr ) .", "indeed , cho and colleagues in their prospective observational study involving 187 incident pd patients described an increase in pstr in patients receiving standard solutions over 12 months unlike those treated using biocompatible solutions who maintained a stable pstr .", "however , this study suffered from a relatively high proportion of patient drop - outs ( 41.1% ) and the choice of therapy ( biocompatible versus standard ) was at the discretion of each patient 's treating physician , thereby introducing a risk of selection bias .", "more importantly , the study did not report whether there were any differences in the dialysate il-6 concentrations between patients who received standard versus biocompatible pd solutions . over the past few years", ", several rcts conducted to examine differences in clinical outcomes from the use of biocompatible pd solutions have not been able to demonstrate a reduction in dialysate il-6 levels with its use [ 5759 ] . to date , only one study conducted by the bicarbonate / lactate study group reported a significant decrease in dialysate levels of il-6 in patients who received biocompatible pd solutions ( n = 61 ) compared to conventional pd solutions ( n = 31 ) over 6 months ( p = 0.01 ) .", "however , the strength of conclusions that can be drawn from these studies was restricted by large drop - out rates ( > 20% ) , risk of carry - over effects due to cross - over design , and a lack of accounting for the confounding effect of peritonitis [ 5760 ] .", "more recently , the global fluid study and a substudy of the balanz trial explored the impact of biocompatible pd solutions use on dialysate il-6 concentrations and found no significant difference based on the type of pd solutions received [ 24 , 28 ] .", "comparable results were yielded when analyses were repeated in the peritonitis - free cohort ( n = 56 ) .", "the results from these studies were also however challenged by several limitations including lack of detailed examination of the history of biocompatible pd solutions exposure in the study participants ( i.e. , patients indicated as using biocompatible pd solutions could have been treated with conventional pd solutions prior to study entry ) , analysing data in a cross - sectional manner , the risk of selection bias , and a small sample size ( n = 88 ) . therefore , at present , based on a generally suboptimal level of evidence , there is no convincing effect of biocompatible pd solutions use on decreasing the level of dialysate il-6 .", "the use of biocompatible pd solutions may theoretically decrease the inflammatory burden at a systemic level by lowering the extent of peritoneal injury and gdp - mediated nephrotoxicity leading to residual renal function decline .", "n = 50 ) were the first to present the data demonstrating an improvement in systemic inflammation levels , as evidenced by lower serum crp measurements , in patients using biocompatible pd solutions at 12 months ( 1.77 0.42 mg / l versus 7.73 2.42 ", "however , several rcts comparing the effect of biocompatible pd solutions to standard pd solutions on systemic il-6 concentrations have not been able to demonstrate any differences between patients receiving biocompatible or standard solutions [ 29 , 48 , 58 , 59 , 63 ] .", "although the lack of difference observed between the two groups could have resulted from relatively short follow - up ( i.e. , < 12 months ) , cross - over study design , inclusion of biocompatible pd solutions with higher gdp content [ 59 , 63 ] , small sample size , or a large drop - out rate , it could be a real phenomenon .", "therefore at present , based on the best available evidence , in spite of a demonstrated beneficial effect on maintaining stability of pstr , the use of biocompatible pd solutions does not appear to lower the burden of inflammation at both systemic and intraperitoneal levels .", "whilst the majority of the literature has attributed morphologic and functional changes of the peritoneal membrane to pd solutions and peritonitis , the pd catheter itself can also induce peritoneal inflammation independently with associated disruption of peritoneal membrane integrity [ 64 , 65 ] .", "certainly , the development of biofilm bacterial growth in pd catheters due to skin bacteria and pd peritonitis episodes is well acknowledged and can lead to dissemination of bacteria into the pd fluid with resultant peritonitis . however , there are reports of proinflammatory responses associated with the use of pd catheters independent of bacteria - related biofilm . for instance , flessner and colleagues described amplification in the peritoneal inflammatory response and peritoneal membrane injury in rodent models when they administered low - gdp bicarbonate - buffered solution via catheters compared to needle - injection over a 20-week study period .", "they also observed formation of a sterile inflammatory cell layer ( i.e. , biofilm ) within the catheter lumen , which they proposed as a source of proinflammatory cascade .", "although the applicability of their findings to humans remains questionable , these results raise questions about the role of pd catheters in promoting inflammation in pd patients .", "pd - related peritonitis is an important source of inflammation at both intraperitoneal [ 70 , 71 ] and systemic levels [ 72 , 73 ] and contributes to approximately 20% of pd technique failures and 26% of deaths [ 75 , 76 ] .", "pd peritonitis can lead to excessive peritoneal inflammatory responses leading to mesothelial cell injury and thickening of the submesothelium compartment , resulting in peritoneal fibrosis and sclerosis .", "the severity and extent of peritoneal membrane damage correlate with the number and severity of peritonitis episodes .", "an elevation in proinflammatory cytokines from pd dialysate samples ( e.g. , il-1 and il-6 ) is evident from the time of clinical presentation with acute peritonitis and their levels remain significantly elevated for at least 6 weeks after the initial presentation ( compared to control patients , p < 0.001 ) .", "furthermore , lack of a decrease in dialysate il-6 concentrations with treatment of acute peritonitis has been shown to predict relapsing peritonitis .", "similarly , the onset of peritonitis is associated with an increase in serum crp levels [ 72 , 73 ] and higher crp levels have been associated with worse short - term outcomes ( e.g. , transfer to haemodialysis ) and long - term patient outcomes ( e.g. , subsequent peritonitis event , all - cause mortality ) . although the adoption of several preventative strategies , such as the use of disconnect ( twin - bag and y - set ) systems [ 79 , 80 ] and preoperative administration of intravenous antibiotics prior to pd catheter insertions [ 81 , 82 ] , has decreased overall peritonitis rates , there remains significant room for further improvement .", "peritoneal membrane dysfunction can be clinically manifested as inadequate small solute clearance and ultrafiltration failure .", "loss of ultrafiltration can in turn lead to the development of volume overloaded state , including the risk of bowel oedema , which can precipitate endotoxemia by promoting translocation of macromolecules from the gut .", "other factors that are thought to promote endotoxin translocation in ckd patients include uraemia [ 84 , 85 ] , malnutrition leading to atrophy of intestinal mucosa , and constipation through bacterial overgrowth .", "bacterial endotoxin is a lipopolysaccharide which makes up the majority of the outer membrane of gram - negative bacteria found in the gut . in ckd patients ,", "significantly higher endotoxin levels were observed amongst patients classified as fluid - overloaded ( defined by inferior vena cava diameter adjusted for body surface area > 11.5 mm / m ) when compared with patients with normal fluid status ( 0.85 0.11 ng / l versus 0.61 0.05 ng / l , p < 0.05 ) .", "more importantly , endotoxin is a strong proinflammatory stimulus and endotoxemia has been consistently associated with an increase in the level of systemic inflammation in ckd , hd , and pd patients . at present , it remains uncertain whether interventions , such as improvement in fluid status or the level of uraemia , can result in a decrease in endotoxemia and systemic inflammation in humans and should be studied in future ." ], [ "beyond the aforementioned possible interventions for reducing inflammation in pd patients ( table 1 ) , there have only been a limited number of studies on treating the chronic inflammatory state in patients receiving pd .", "these include the use of agents known to possess anti - inflammatory ( e.g. , statins ) or antioxidant properties ( e.g. , n - acetylcysteine ) that resulted in a decreased level of systemic inflammation burden .", "others have proceeded with targeted treatment in those diagnosed with clinical significant periodontitis with similar results .", "although these outcomes are encouraging , they need to be interpreted with caution as they were relatively small sized studies ( largest study n = 76 ) from single - centres and their results have not been validated by others ." ], [ "inflammation is a common complication of pd patients at both systemic and local ( i.e. , intraperitoneal ) levels .", "chronic inflammatory status is associated with a number of clinically significant adverse patient outcomes , including malnutrition , peritoneal membrane dysfunction , and cardiovascular events .", "although there are a number of potentially modifiable clinical causes of inflammation , a limited number of intervention studies to date have not been able to successfully identify effective strategies to lower inflammatory burden in this patient group .", "future studies should focus on better defining of the pathogenic mechanisms underlying peritoneal and systemic inflammatory cascade in pd patients and evaluating the efficacy of interventions targeting these identified factors ." ] ]

[ [ "\n study sites - north sinai is located in the northeastern part of egypt \n ( 30.5n 33.6e ) , marking the point of connection between asia and africa .", "north sinai is \n bordered by the gulf of suez , the red sea and the mediterranean sea and is inhabited \n mainly by bedouins .", "the regions comprise the following districts : el - hassana , beer el \n abd , nekhel , sheikh zuweid , beer lehfen and rafah ( fig . \n 1 ) .", "the study sites were selected based on the distribution of cl cases in \n sinai to understand the potential role of both the sandfly and rodent in the dynamics of \n leishmania transmission ( samy \n 2009 , ministry of health of egypt , unpublished observations ) .", "the \n weather in north sinai is characterised as hot and dry , with marked differences in \n temperature between day and night .", "dramatic weather - related changes , as presented by the \n annual averages of environmental factors during the study period from january \n 2005-december 2011 , are listed in supplementary data and some habitats are illustrated \n in fig .", "2 . \n fig . 1 : regional and local map of the study sites in north sinai .", "the six \n districts of north sinai are denoted by black dots and egypt with the black \n solid line .", "2 : sampling localities showing different habitat types . a : wire - box rodent \n traps used during the study with an individual rodent collected during the \n study ;", "b : rodent burrows ; c : habitat of low hygiene support rodent and sandfly \n populations ; d : a sample of the outdoor habitats sampled in the study . \n \n", "sandfly collection and processing - sandfly collection was carried out \n using sticky paper traps and cdc light traps ( lt ) ( john w hock , gainesville , fl , usa ) \n for eight nights / year .", "five collection sites were selected randomly to represent each \n district in the study ; 10 cdc lt and 50 sticky traps ( st ) were used for each study \n district ( 2 cdc and 10 st / collection site ) .", "the collection sites were chosen to \n represent the most productive ones for fly capture based on our preliminary studies \n conducted in different sites of sinai .", "the recovered st were placed in labelled plastic bags , transported to \n a temporary field laboratory and then sent to the research and training centre \n laboratory ( rtc ) of ain shams university , cairo for processing .", "the live flies captured by the cdc traps were \n collected with a mechanical aspirator and dissected in saline with 50 u / ml of amikacin \n sulphate on a glass slide .", "the digestive tract was examined under an optical microscope \n with 400x magnification to identify flies harbouring parasites in their gut and for \n species identification via morphological keys ( lane 1986 ) .", "female digestive tracts that had flagellates were transferred to an \n eppendorf tube with saline containing 50 u / ml of amikacin sulphate and then inoculated \n into novy mac neal nicolle ( nnn ) culture medium . \n", "rodent trapping and processing - rodents were trapped using wire - box \n rodent traps ( morsy et al .", "each district \n was represented by five - eight collection sites where 10 - 18 traps each were used ; the \n traps were set before sunset and recovered the next morning .", "the rodents were identified \n using regional taxonomic keys ( osborn & helmy \n 1980 ) and then transported to the ain shams animal facility where they were \n maintained for at least six months to observe the development of any characteristic \n leishmania lesions .", "full - thickness punch - biopsies were removed from \n the border of suspected lesions and processed for parasite isolation in nnn medium . \n", "giemsa - stained impression smears were also performed for the lesions and examined for \n the presence of leishmania amastigotes ( soliman 2006 ) .", "all care and use of animals was conducted in compliance with \n the animal welfare act and in accordance with the principles set forth in the guide for \n the care and use of laboratory animals , institute of laboratory guiding principles for \n biomedical research involving animals ( cioms \n 1985 ) . \n", "molecular characterisation of leishmania cultures - isolates from \n rodents and sandflies with suspected leishmania parasites were \n initially inoculated from tissue samples and maintained in culture medium through \n subculture passages in nnn culture medium with 500 iu penicillin g / ml of blood . \n", "promastigotes from positive cultures were transferred to glass vials containing \n schneider s drosophila cell culture medium supplemented with 10% fetal calf serum \n ( sigma , saint louis , mo , usa and gibco - brl , gaithersburg , md , usa ) for mass rearing .", "one millilitre of each high - density ( ~1 x 10 cells ml ) \n leishmania culture was concentrated by centrifugation at 12,000 \n g for 10 min .", "dna was extracted from the pellet using the qiagen dna \n mini kit ( qiagen , valencia , ca , usa ) .", "approximately 25 l of the culture pellet was \n transferred to a sterile 1.5 ml tube , extracted as per the protocol instructions and \n eluted in 100 l elution buffer .", "the ribosomal its-1 was amplified using the primer pair l5.8s and litsr ( el tai et al .", "amplicons were analysed on 1.5% \n agarose gels by electrophoresis and visualised by ultraviolet light .", "a reaction was \n considered positive when a band of the correct size ( 300 - 350 bp ) was observed .", "the \n polymerase chain reaction ( pcr ) product was digested with the restriction endonuclease \n haeiii .", "the restriction fragment length polymorphism - pcr approach \n was applied for the detection and identification of leishmania \n parasites in the rodent and sandfly isolates .", "fragments were separated by \n electrophoresis on 2.5% agarose gels and compared with those of reference strains of \n l. major ( mhom / eg/06/rtc-63 ) and l. tropica \n ( mger / eg/06/rtc-74 ) using distilled water as a negative control . \n", ". 1997 ) was used to estimate the \n biodiversity index for both the sandfly and rodent populations .", "the bray - curtis \n similarity was used in cluster analysis to estimate the similarity between the sandfly \n or rodent populations across different districts of north sinai , egypt .", "chi - squared \n analysis was used to test the deviation of the resulting fly sex ratios ( female : male ) \n from the expected 1:1 ratio . \n", "ethics - verbal informed consent was obtained from the heads of the \n households from which sandflies were collected .", "we provided detailed information about \n the vector - borne diseases with a special focus on leishmaniasis risk , vectors and \n reservoirs in language understandable to the local bedouins communities .", "we also \n provided information for community - based control measures to help the communities to \n protect themselves against disease risk .", "the views expressed in this article are those of the authors and do not necessarily \n reflect the official policy or position of the egyptian or the united states of america \n government . the experiments reported herein were conducted in compliance with the animal \n welfare act and in accordance with the principles set forth in the guide for the care \n and use of laboratory animals , institute of laboratory animals resources , national \n research council , national academy press and council for international organizations of \n medical sciences ." ], [ "\n sandfly species composition - a total of 9,849 sandflies were collected \n from different districts during the study ( table \n i ) on 56 nights using 480 cdc and 2,800 st .", "males comprised 62.8% ( n = 6184 ) \n of the catch ( female : male ratio of 0.6 ) .", "a total of 23.3% ( 404 males , 1,892 females ) of \n the collected flies were caught indoors and the rest of the flies were caught outdoors \n and from around the rodent burrows .", "these flies represented six species of two genera : \n p. ( phlebotomus ) papatasi ( scopoli ) , phlebotomus \n ( paraphlebotomus ) kazeruni ( theodor & mesghali ) , p. \n ( paraphlebotomus ) sergenti ( parrot ) , phlebotomus ( paraphlebotomus ) \n ale- xandri ( sinton ) , sergentomyia ( sergentomyia ) antennata \n ( newst . ) and sergentomyia ( sintonius ) clydei ( sinton ) .", "the \n predominant species was p. papatasi ( 83.5 % , 8,221 flies ) , \n whereas p. sergenti and p. kazeruni represented 9% \n and 3.3% of the total , respectively .", "p. alexandri , the vl vector , represented only 1% and was found in \n limited distribution in nekhel . \n", "table iphlebotomine sandflies collected by cdc light traps ( lt ) and sticky paper \n traps ( st ) from six districts of north sinai , egypt , from january 2005-december \n 2011 number of collected flies ( f : m ) speciescollection methodel \n hassananekhelrafahbeer \n el abdbeer \n lehfenseikh \n zuweidtotalratio \n ( f : m ) \n phlebotomus papatasi \n lt383/142813/156966/23117/44546/35831/172,756/9482.9:1st141/1,069121/85585/1,33625/6988/6634/61464/4,0531:8.7 \n phlebotomus kazeruni \n ltna", "/ na29/17na / nana / nana / nana / na29/171.7:1stna / na52/225na / nana / nana / nana / na52/2251:4.3 \n phlebotomus sergenti \n lt24/2345/12614/73na / na5/17na / na88/2391:2.7st2/9881/22177/43na / na2/37na / na162/3991:2.4 \n phlebotomus alexandri \n ltna / na26/43na / nana / nana / nana / na26/431:1.6stna / na0/33na / nana / nana / nana / na0/330 \n sergentomyia antennata \n lt3/14/40/23/70/1na / na10/151:1.5st1/2027/331/44/190/12na / na33/881:2.7 \n sergentomyia clydei \n lt1/2na / nana / na3/6na / nana / na4/81:2st10/2118/292/1510/471/4na / na41/1161:2.8 \n\n totallt411/168917/346980/30623/57551/37631/172,913/1,2702.3:1st154/1,208299/1,396165/1,39839/13591/7164/61752/4,9141:6.5f : female ; m : male ; na : not available . \n ", "sandfly sex ratios - sex ratios ( females : males ) showed that males were \n overall approximately twice as common , with an overall sex ratio of 1:1.7 . there was a \n difference between the sex ratios of different sandfly species using both trapping \n methods ; the cdc traps collected more females than males for both the p. \n papatasi and p. kazeruni collections , but more males were \n collected from both species when the sticky paper traps were used ( table i ) . both trapping methods collected more \n males of p. sergenti , p. alexandri , s. \n antennata and s. clydei .", "the chi - squared analysis revealed \n a significant difference ( p = 0.00 ) between the overall sex ratio ( female : male ) and the \n equilibrium 1:1 sex ratio for all species , except with regard to the cdc collection of \n p. kazeruni ( p = 0.08 ) , s. antennata ( p = 0.32 ) and \n s. clydei ( p = 0.25 ) . \n", "sandfly natural infection - the results of sandfly dissections revealed \n the presence of leishmania - like flagellates in 15 p. \n papatasi specimens ( 0.5% of 3,008 dissected females ) .", "none of the p. \n kazeruni , p. sergenti and p. alexandri \n individuals were infected ( table ii ) .", "there was \n a significant difference in the infection rate between the different districts ( p < \n 0.05 ) ; the highest infection rates were in beer lehfen ( 0.73% ) and rafah ( 0.72% ) , \n whereas the infection rates in nekhel and el - hassana were low ( 0.37% and 0.26% , \n respectively ) .", "all the females collected from beer el abd and sheikh zuweid were \n negative for infection .", "the leishmania - like flagellates were inoculated \n into nnn medium and the parasites survived in only six out of 15 culture passages . \n", "table iinumber and species of phlebotomus ( ) dissected and \n naturally infected with leishmania major in different \n districts of north sinai , egypt , from 2005 - 2011speciesel \n hassana n ( % ) nekhel n ( % ) rafah \n n ( % ) beer \n el abd n ( % ) beer \n lehfen n ( % ) sheikh zuweid n ( % ) \n phlebotomus papatasi \n 383 ( 0.26)813 ( 0.37)966 ( 0.72)17 ( 0)546 ( 0.73)31 ( 0 ) \n phlebotomus kazeruni \n 0 ( 0)29 ( 0)0 ( 0)0 ( 0)0 ( 0)0 ( 0 ) \n phlebotomus sergenti \n 24 ( 0)126 ( 0)73 ( 0)0 ( 0)5 ( 0)0 ( 0 ) \n phlebotomus alexandri \n 0 ( 0)26 ( 0)0 ( 0)0 ( 0)0 ( 0)0 ( 0 ) \n\n total407 ( 0.24)994 ( 0.30)1,039 ( 0.67)17 ( 0)551 ( 0.72)31 ( 0 ) \n \n rodent species composition and natural infections - a total of 159 \n individual rodents were collected from different districts ( table iii ) .", "these rodents represented eight species : rattus \n norvegicus ( n = 39 ) , rattus rattus frugivorous ( n = \n 13 ) , rattus rattus alexandrinus ( n = 4 ) , gerbillus pyramidum \n floweri ( n = 38 ) , gerbillus andersoni ( n = 28 ) , mus \n musculus ( n = 5 ) , meriones sacramenti ( n = 22 ) and \n meriones crassus ( n = 10 ) .", "thirty - two rodents were found to be positive for \n infection by amastigote impression smear testing : g. p. floweri ( n = \n 16 ) , g. andersoni ( n = 5 ) , r. norvegicus ( n = \n 7 ) , r. r. frugivorous ( n = 3 ) and r. r. alexandrinus \n ( n = 1 ) ( table iii ) . \n", "none of the m. musculus , m. sacramenti and \n m. crassus specimens were positive for leishmania \n infection .", "the infected rodents included rodents collected from el - hassana ( 1 r. \n r. alexandrinus ) , rafah ( 7 r. norvegicus , 14 g. p. \n floweri and 5 g. andersoni ) and beer lehfen ( 3 r. \n r. frugivorous and 2 g. p. floweri ) .", "no positive infections \n were found in the rodents collected from the nekhel , beer el - abd and sheikh zuweid .", "all \n rodent samples were inoculated into nnn medium and the parasites survived in 29 out of \n 32 culture passages . \n", "table iiinumber of rodents trapped in different districts of north sinai , egypt , \n from 2005 - 2011 and infection percentages with leishmania \n speciesel \n hassana n ( % )", "nekhel n ( % ) rafah \n n ( % ) beer \n el abd n ( % ) beer \n lehfen n ( % ) sheikh zuweid n ( % ) total \n n ( % ) \n rattus norvegicus \n 1 ( 0)0 ( 0)34 ( 20.58)1 ( 0)0 ( 0)3 ( 0)39 ( 18 ) \n rattus rattus frugivorous \n 2 ( 0)1 ( 0)0 ( 0)1 ( 0)9 ( 33.33)0 ( 0)13 ( 23.07 ) \n rattus rattus alexandrinus \n 3 ( 33.33)1 ( 0)0 ( 0)0 ( 0)0 ( 0)0 ( 0)4 ( 25 ) \n gerbillus pyramidum floweri \n 0 ( 0)0 ( 0)31 ( 45.16)0 ( 0)7 ( 28.57)0 ( 0)38 ( 42.10 ) \n gerbillus andersoni \n 0 ( 0)0 ( 0)23 ( 21.74)0 ( 0)1 ( 0)4 ( 0)28 ( 17.85 ) \n mus musculus \n 2 ( 0)1 ( 0)1 ( 0)0 ( 0)0 ( 0)1 ( 0)5 ( 0 ) \n meriones sacramenti \n 0 ( 0)0 ( 0)19 ( 0)0 ( 0)3 ( 0)0 ( 0)22 ( 0 ) \n meriones crassus \n 0 ( 0)0 ( 0)8 ( 0)0 ( 0)1 ( 0)1 ( 0)10 ( 0 ) \n\n total8 ( 12.5)3 ( 0)116 ( 22.41)2 ( 0)21 ( 21.73)9 ( 0)159 ( 20.12 ) \n \n sandfly , rodent diversity and habitat clustering : sandfly species \n diversity - both simpson diversity and berger - parker dominance indices \n revealed different diversity between the different districts , with the highest overall \n diversity in nehkel and beer el abd ; the least diverse site was sheikh zuweid , where \n p. papatasi was the only species occurring at this site ( fig .", "3 : biodiversity index of both the sandfly and rodent populations collected \n from six districts of north sinai . a : the simpson ( 1-d ) and berger - parker \n dominance biodiversity index for the sandfly species ( 1/d ) ; b : the shannon ( h ) \n and berger - parker dominance biodiversity index for the rodent species . \n \n", "rodent species diversity - all districts sampled in the study had a \n different diversity index based on both shannon ( h ) and berger - parker dominance indices \n of rodent populations ( fig .", "the highest \n overall diversity index was that of rafah ( 1/d = 3.412 , h ", "both nekhel and \n beer lehfen had higher diversity indices compared to el - hassana , beer el abd and sheikh \n zuweid . \n", "habitat clustering - bray curtis cluster analysis of the different \n districts in north sinai revealed levels of similarity between the habitats clusters . \n", "based on the sandflies collected from the different districts , two clusters were \n identified : sheikh zuweid and beer el abd formed a distinct cluster separated from the \n rest of the districts , which comprised a different cluster ( fig .", "however , the cluster analysis based on rodent data \n revealed different cluster patterns than those produced by the sandfly data , with both \n beer lehfen and rafah forming a distinct cluster and the other districts comprising \n another cluster in which beer el abd was separated from the lower part of the core \n ( fig .", "4b ) . finally , the bray curtis analysis \n for the combination of the sandfly and rodent data formed two distinct clusters : one \n included both sheikh zuweid and beer el abd and the second cluster included the other \n districts , with rafah separated from the lower part of the core ( fig .", "4 : dendrogram from bray - curtis cluster analysis based on the sandfly \n populations data ( a ) , rodents populations data in six districts of sinai \n peninsula ( b ) and both the sandfly and rodents populations data ( c ) . \n \n", "leishmania identification and characterisation - thirty - five samples \n from both the infected sandfly p. papatasi ( n = 6 ) and rodent \n reservoirs ( n = 29 ) produced viable cultures in nnn medium .", "these samples were found to be positive for l. \n major dna only ( supplementary data ) .", "twenty - nine \n rodent samples found to be positive for l. major were r. \n norvegicus ( n = 7 ) , r. r. frugivorous ( n = 3 ) , r. \n r. alexandrinus ( n = 1 ) , g. p. floweri ( n = 13 ) and \n g. andersoni ( n = 5 ) .", "all l. major - infected rodents \n were collected from the rafah ( n = 23 ) , beer lehfen ( n = 5 ) and el - hassana ( n = 1 ) , with \n no evidence for the presence of infections in the beer el abd , nekhel and sheikh \n zuweid ." ], [ "this study represents a comprehensive report of seven years in north sinai and provides \n evidence for the circulation of only one species of the leishmania \n parasite .", "previous studies in egypt reported the presence of only l. \n major circulating in sinai ( wahba et al . \n", "2003 ) , though the most recent study in \n sinai reported the incursion of cl caused by l. tropica in a remote \n border area of north sinai on the egyptian - palestinian border .", "the possibility of the \n incursion of l. tropica from neighbouring countries could not be \n excluded according to a recent study ( shehata et al . \n", "therefore , we carried out our study to reveal insight into the \n ecological system for cl transmission with regard to sandflies and rodents by examining \n of several criteria used by the who to implicate either the vector(s ) or \n reservoir(s ) .", "there are several criteria adopted by the world health organization ( who ) to implicate \n p. papatasi as the potential vector for circulation of leishmaniasis \n in sinai , including anthropophilic behaviour , the ability to feed on the reservoir \n host(s ) , the presence of natural infections , the ability to support the growth of the \n parasite and the ability to transmit the parasite by bites ( who 2010 ) .", "however , the results revealed no evidence for the presence of infection in most of the \n sandflies collected ; for instance , the only species found infected with \n leishmania promastigotes was p. papatasi , with an \n infection rate close to 0.5% .", "the sandfly p. papatasi , the potential \n vector of l. major in the sinai peninsula ( wahba et al .", "2009 ) , was the most prevalent sandfly in our catches . in the current study , \n most p. papatasi females were caught indoors and in large numbers , \n whereas , more males were collected outdoors . the difference in the indoor and outdoor \n catches reported here might suggest that female p. papatasi is more \n endophagic compared to p. sergenti , p. kazeruni and p. \n alexandri .", "there was a significant difference in the infection rates of the \n sandflies between different study districts , which might be attributed to the host \n preference of p. papatasi for different vertebrates .", "the host \n preference is influenced by the availability of hosts , for example , p. \n papatasi in beer lehfen and rafah had infection rates approximately 0.73% \n and 0.72% , respectively , correlating with the high density of gerbils at both sites . to understand cl eco - epidemiology , the ecology of the animal reservoir populations and \n their roles in disease transmission were also considered in our study .", "the most \n predominant species sampled in all the districts was r. norvegicus , \n previously identified in similar habitats in sinai as a potential leishmaniasis \n reservoir host ( morsy et al .", "1992 ) . however , the \n current study revealed the presence of infections in g. p. floweri , r. rattus \n and g. andersoni ; infections were also recovered from \n r. norvegicus .", "similar observations were reported in different sites \n in egypt ( morsy et al . 1992 , fryauff et al . 1993 ) , but , interestingly , these \n observations also refer to the difference in the eco - epidemiology of cl in egypt and \n other countries ; for instance , jordan and morocco , where psammomys \n obesus was identified as the potential animal reservoir ( saliba et al .", "the burrows of p. obesus are identified by \n halophytic vegetation and by the remnants of plant material at the entrances ( who 2010 ) .", "the structure of habitats in the six \n districts of the current study was relatively similar to the p. obesus \n habitat , but with no record for the species during the seven years of collection . \n", "several criteria were also proposed by the who for the implication of animal reservoirs \n ( who 2010 ) with cl transmission ; one such \n criterion was fulfilled by isolating the parasite from wild rodents with positive \n infections collected from different sites in the study .", "secondly , the parasite was found \n to be identical to that isolated from patients attending clinics in north sinai \n communities ( am samy , unpublished observations ) .", "some criteria depend on the \n availability of the parasite in the skin in sufficient numbers for the sandfly to \n transmit .", "2006 ) to infer the potential \n role of these animals in the dynamics of this disease . throughout the late phases of our study , we used cluster analysis to infer similarity \n between the habitats using the data from the collection of sandflies , rodents or the \n combination of both .", "interestingly , the areas identified to have disease risk formed a \n distinct cluster , for instance , the distinct cluster that included rafah , nekhel , beer \n lehfen and el hassana ( fig .", "these \n observations revealed the importance of multivariate methods in the study of disease \n ecology and in inferring the area with a favourable habitat for cl circulation .", "one of \n the interesting findings of this study was the presence of infections in different \n animal reservoirs that were not necessarily previously known as potential reservoirs \n ( morsy et al .", "these changes in the animal hosts may be a \n response to climate change , especially in the presence of continuous heavy rains and \n floods in sinai .", "these environmental changes coincided with the increase in cl incidence \n in sinai due to a change in the vector and rodent populations and consequently a change \n in the disease dynamics in the area .", "our report identified the presence of only l. major , whereas no \n l. tropica was detected during seven years of observations in the \n study areas .", "2009 ) may be allochthonous , i.e. , the parasite may \n have originated from other sites where l. tropica is established ( jacobson et al .", "sergenti , the presumed \n vector of l. tropica , was found in this study , though we found no rock \n hyraxes , the main l. tropica reservoir in countries including israel \n and kenya ( mebrahtu et al .", "other factors that could \n mask the dynamics of l. tropica transmission might include differences \n in the seasonality of vectors or distinct reservoir populations for different \n transmission cycles ( faulde et al .", "l. major infections circulate in the country through different seasons \n of the year , with three incidence peaks in november , march and august and few sporadic \n cases were reported during the rest of the year .", "these peaks correspond to the time \n after the peaks of sandfly abundance ( samy 2009 , \n fahmy et al .", "the continuous circulation \n of l. major is maintained by the highest densities of both the \n p. papatasi and gerbil populations after the heavy rains that are \n considered as favourable habitats for the survival of the vector and reservoir \n populations .", "the number of zoonotic cutaneous leishmaniasis ( zcl ) cases is still \n underestimated due to the bedouin traditions of preventing females to visit clinics and \n their dependence on leishmaniasis treatment using routine heat therapy .", "the mean annual \n cases reported to the official public health centres in north sinai during 2006 - 2011 \n were 296.67 cases ( ministry of health of egypt , unpublished observations ) , with the \n highest infection rate reported during 2008 - 2010 due to a change in environmental \n conditions . toward the end of this period , the incidence of zcl caused by l. \n major decreased after control efforts for both vectors and rodent reservoirs \n by the egyptian ministry of health .", "due to such continuous disease dynamics in response \n to environmental changes , we plan in our future research to investigate the potential \n role of rodent populations in the circulation of the parasite in the sinai , to study in \n detail the coarse - resolution ecology and to study the biogeography of disease through \n mapping exercises and site suitability analysis using efficient quantitative \n techniques ." ] ]

[ [ "sternoclavicular joint septic arthritis ( ssa ) and its clinical presentation are infrequently seen and often difficult to manage .", "presenting symptoms of ssa can vary , with chest and shoulder pain being the most common clinical features .", "after thorough literature search , no cases have yet been reported on ssa leading to vocal cord palsy .", "vocal cord palsy is an important sign of thoracic and head and neck pathology that is caused by an extremely wide set of pathology ." ], [ "a 67-year - old gentleman presented to the emergency department with a 3-week history of worsening dysphagia and hoarse voice .", "routine examination of the patient in the emergency department revealed that he was haemodynamically stable and apyrexial and exhibited tenderness in the left anterior neck .", "examination by the otolaryngology team demonstrated no evidence of cervical lymphadenopathy but tenderness of the lower left anterior triangle , as well as evident swelling , erythema and mild bruising of the anterior chest wall . on questioning the patient regarding this , he revealed that he burnt his chest using a hot water bottle 3 weeks previously and he also admitted to having stiffness and pain in the left shoulder over this same period .", "indirect laryngoscopy with flexible nasendoscopy revealed non - discrete swelling / oedema of the left pharayngeal wall and reduced mobility of the left vocal cord .", "routine haematological investigation revealed a white cell count of 18.6 10/l , c - reactive protein of 288 mg / l and platelets of 499 10/l .", "no other haematological abnormality was noted on admission . with a working differential of parapharyngeal space infection and possible malignancy ,", "the patient was referred for a computed tomography ( ct ) scan of the neck and thorax with contrast .", "the patient was also started empirically on intravenous co - amoxiclav as treatment for neck space collection .", "ct imaging , performed 24 h after admission , revealed no evidence of malignancy or indeed any paraphayrngeal space collection .", "few small lymph nodes were noted on the left side of the neck , but were deemed to be reactive in nature , and left vocal cord palsy was evident ( fig . 1 ) .", "the key finding was that of a left sternoclavicular joint collection and closely associated superficial anterior chest wall , soft tissue swelling and oedema ( fig . 2 ) .", "this inflammatory process was also noted deep to the manubrium and sternum and extending somewhat into the mediastinum with evident enlarged mediastinal lymph nodes ( fig . ", "the ct findings were in keeping with ssa with associated superficial and deep tissue inflammation and oedema . with no other", "cause found , the vocal cord palsy was attributed to the inflammation within the mediastinum , which in turn was caused by superficial burn from hot water bottle use . \n", "findings : left vocal cord palsy indicated by the para - median position of the left vocal cord in comparison with the right .", "findings : left sternoclavicular joint collection and closely associated superficial anterior chest wall , soft tissue swelling and oedema .", "findings : soft tissue oedema of the chest seen retrosternally ( marker a ) and superficially on the left anterior chest ( marker b ) as well as evidence of mediastinal lymph node enlargement .", "computed tomography . a 67-year - old male with ssa . findings : left vocal cord palsy indicated by the para - median position of the left vocal cord in comparison with the right .", "findings : left sternoclavicular joint collection and closely associated superficial anterior chest wall , soft tissue swelling and oedema .", "computed tomography . a 67-year - old male with ssa . findings : soft tissue oedema of the chest seen retrosternally ( marker a ) and superficially on the left anterior chest ( marker b ) as well as evidence of mediastinal lymph node enlargement .", "the antibiotic regimen for the patient was converted to intravenous benzylpenicillin ( 1.2 g four times per day ) and flucloxacillin ( 1 g four times per day ) .", "response to antibiotic therapy was limited in the first few days of admission with little change in haematological inflammatory markers .", "after discussion with the microbiologist , the flucloxacillin was increased to 2 g four times a day on the fourth day of admission .", "the patient made slow but positive improvements over the course of the next 8 days while on intravenous antibiotics , after which he was successfully discharged .", "he continued on oral antibiotics and on outpatient review 3 weeks after his admission , his external swelling , erythema and voice had returned to normal .", "repeat ct performed 3 months following discharge demonstrated complete resolution of the deep and superficial inflammatory process as well as the mediastinal lymph nodes ." ], [ "vocal cord palsy can be due to weakness in one or both vocal cords , and diagnosis is made when reduced mobility is evident by laryngoscope examination . in a review of 117 cases ,", "benninger et al . attributed the following as the most common causes of vocal cord palsy : surgical trauma ( 44% ) , malignancies ( 17% ) , endotracheal intubation ( 15% ) , neurological disease ( 12% ) and idiopathic causes ( 12% ) .", "furthermore , a review of 389 vocal cord palsy cases by holinger et al . makes no reference to the cause being related to a septic sternoclavicular joint .", "explanations for this unusual presentation of ssa seen in this case include tracking infection from the septic sternoclavicular joint , resulting in a vocal cord palsy due to reactive mediastinal lymphadenopathy . spreading infectious sequeale of ssa", "significant contributing factors to these outcomes are the methicillin - resistant staphylococcus aureus ( mrsa ) strains , which are becoming increasingly prevalent .", "a literature review of 180 cases shows mediastinitis as a clinical feature in up to 13% of patients with ssa .", "reports of fibrosing mediastinitis and descending necrotizing mediastinitis leading to vocal cord palsy have been documented .", "the mild reactive mediastinal inflammation seen in the presented case has not been presented in the literature as a cause of vocal cord palsy .", "therefore , as mentioned previously , it is most likely explained by mediastinal lymphadenopathy , which is a known cause of left vocal cord palsy in malignancy and atypical infections such as tuberculosis .", "it has been shown that if radiological findings indicate a limited extent of disease , then medical therapy alone should be sufficient .", "this empirical antibiotic coverage should be active against s. aureus , the most common infective agent in ssa .", "joint resection would only be indicated if extensive bony destruction , chest wall phlegmon or abscess , retrosternal abscess , mediastinitis or pleural extension is evident on ct / mri imaging .", "it is clear from the haematological and radiological findings , as well as the response to treatment , that all the presenting features of this patient were as a result of the septic focus in the sternoclavicular joint ." ], [ "" ] ]

[ [ "vertically aligned zno nanorods ( nrs ) and nanowires ( nws ) are attracting much interest for several applications such as nanophotonics , dye - sensitized solar cells , electron field emitters , surround - gate field effect transistors , and nanopiezotronics .", "a number of preparation methods by high temperature vapor transport and low temperature chemical synthesis were developed . for comparison", ", the nr arrays can be classified from several aspects : physical and geometrical properties of the individual building blocks and their uniformity in length , in diameter , and in axis - to - substrate angle .", "the nrs / nws can be distributed either randomly or in a well - defined way .", "for instance , photonic crystals with well - defined defects are of importance in nanophotonics .", "another demanding application is the construction of zno nw - based dc current generator , where the nws convert the mechanical energy of a vibrating pt - coated , zig - zag - shaped electrode to electric energy by exploiting the piezoelectric nature of zno . even for nanosensors , however , the generated power density ( ~80 nw / cm ) should be significantly increased . as liu et al", ". have pointed out the output voltage of the system , being now typically in the order of ~10 mv , can be drastically improved by increasing the number of the active nw - s , i.e. , the ones which are in continuously contact with the zigzag top electrode .", "therefore , two approaches were proposed : improving the uniformity of the nws on one hand and patterning the array according to the dimension and shape of the top electrode .", "vertical zno nanoarrays arranged in a designed pattern were recently produced by a few groups using different techniques , however , either the geometrical non - uniformity of the nws or the low density of the vertical microcrystals ( ~1 nr/m ) makes their use in nanogenerator application difficult .", "solid ( vls ) method the metal catalyst droplet on the top of the nw can hinder the formation of the required schottky contact at the top electrode / nw interface . here , we demonstrate alternative fabrication routes which fulfill all the above crucial requirements by providing highly uniform , crystallographically oriented nrs in the 100-nm diameter range , in predefined , dense patterns .", "our method benefits of the catalyst free , low temperature epitaxial growth , and the direct writing nanolithography .", "we have tried two options for the formation of nr arrays . in the first ,", "the desired nucleation pattern was drawn in a polymethyl - methacrylate ( pmma ) layer , which was subsequently removed resulting in an all - zno structure . in the second route ,", "the nucleation pattern was realized in a hard metal coating ; therefore , the fabricated nrs were electrically contacted at the anchoring surface ." ], [ "the process flow for the fabrication of all - zno nr arrays is shown in fig .", ", the zn- and o - terminated single crystal zno wafers were washed ultrasonically in acetone , ethanol , and deionized water , which was followed by a thermal - annealing step in a quartz tube at 1,050 c for 8 h in oxygen atmosphere . in order to prevent the sublimation of zn", ", the substrates were placed between yttrium stabilized zirconia ( ysz ) wafers before annealing .", "the 250-nm - thick pmma resist layer was exposed by e - beam lithography in an elionix els-7500ex instrument ( fig .", "circular spots of different ( 50100 nm ) diameters arranged in a triangular ( tri ) or honeycomb ( hc ) lattice were generated .", "the aqueous bath contained the same ( 4 or 40 mm ) molar amount of zinc nitrate hexahydrate ( zn(no3)2 6h2o ) and hexamethylene tetramine ( ( ch2)6n4 ) . during the zno nanostructure growth", ", the specimen was mounted upside - down on a polytetrafluoroethylene ( ptfe ) sample holder .", "the nanocrystal growth was carried out without an electric field applied in a multipurpose oven for 13.5 h periods at a set temperature of 85 c . however , due to the high heat capacity of the glass container and the dry atmosphere , the warming up was relatively slow : the bath temperature reached 80 and 82 c after 2 and 3 h , respectively . following slow cooling , the sample was thoroughly washed in de - ionized water and purged in nitrogen . afterward , the pmma layer was removed in acetone .", "this step also helps to lift - off the parasitic zno debris formed in the solution volume ( fig .", "schematic process flow of all - zno ( a d ) and anchored ( e h ) nanorod arrays .", "the processing steps for all - zno structure are : surface treatment of zno substrates ( a ) , pattern generation in pmma by e - beam lithography ( b ) , chemical nanowire growth ( c ) , and pmma removal ( d ) .", "processing steps for the anchored zno array are : ru thin film deposition ( e ) , e - beam lithography ( f ) , arion milling ( g ) , and chemical nanorod growth after pmma removal ( h ) nanorods grown through a hard metal mask obtained by ar - ion milling are anchored in the single crystal substrate in the recessed dips etched during metal milling . thereby the fabrication of arrays of electrically contacted nrs", "however , here the surface treatment process of zno substrate was followed by the deposition of a 30-nm - thick , high - quality ru layer by using ion - beam sputtering ( fig .", "1f ) and was transferred into the hard metal film by ar ion milling ( fig .", "the same chemical growth method was used as for the all - zno arrays ( fig .", "the preparation condition details for both all - zno and anchored arrays are summarized in table 1 .", "summary of the growth parameters and the obtained nanorod dimensions the obtained nanostructures were visualized by a hitachi s4800 field emission scanning electron microscope ( fesem ) .", "transmission electron microscope ( tem ) images were obtained by a 200 kv jeol jem-2010 instrument .", "the electrical characterization of the individual nws was carried out in air by conductive afm technique by means of a sii nanotechnology inc . ,", "the spring constant and resonant frequency of the used au - coated cantilever is 1.4 n / m and 26 khz , respectively ." ], [ "the process flow for the fabrication of all - zno nr arrays is shown in fig .", ", the zn- and o - terminated single crystal zno wafers were washed ultrasonically in acetone , ethanol , and deionized water , which was followed by a thermal - annealing step in a quartz tube at 1,050 c for 8 h in oxygen atmosphere . in order to prevent the sublimation of zn", ", the substrates were placed between yttrium stabilized zirconia ( ysz ) wafers before annealing .", "the 250-nm - thick pmma resist layer was exposed by e - beam lithography in an elionix els-7500ex instrument ( fig .", "circular spots of different ( 50100 nm ) diameters arranged in a triangular ( tri ) or honeycomb ( hc ) lattice were generated .", "the aqueous bath contained the same ( 4 or 40 mm ) molar amount of zinc nitrate hexahydrate ( zn(no3)2 6h2o ) and hexamethylene tetramine ( ( ch2)6n4 ) . during the zno nanostructure growth", ", the specimen was mounted upside - down on a polytetrafluoroethylene ( ptfe ) sample holder .", "the nanocrystal growth was carried out without an electric field applied in a multipurpose oven for 13.5 h periods at a set temperature of 85 c . however , due to the high heat capacity of the glass container and the dry atmosphere , the warming up was relatively slow : the bath temperature reached 80 and 82 c after 2 and 3 h , respectively . following slow cooling , the sample was thoroughly washed in de - ionized water and purged in nitrogen . afterward , the pmma layer was removed in acetone .", "this step also helps to lift - off the parasitic zno debris formed in the solution volume ( fig .", "schematic process flow of all - zno ( a d ) and anchored ( e h ) nanorod arrays .", "the processing steps for all - zno structure are : surface treatment of zno substrates ( a ) , pattern generation in pmma by e - beam lithography ( b ) , chemical nanowire growth ( c ) , and pmma removal ( d ) .", "processing steps for the anchored zno array are : ru thin film deposition ( e ) , e - beam lithography ( f ) , arion milling ( g ) , and chemical nanorod growth after pmma removal ( h )" ], [ "nanorods grown through a hard metal mask obtained by ar - ion milling are anchored in the single crystal substrate in the recessed dips etched during metal milling .", "thereby the fabrication of arrays of electrically contacted nrs is achieved . the process shown in fig .", "however , here the surface treatment process of zno substrate was followed by the deposition of a 30-nm - thick , high - quality ru layer by using ion - beam sputtering ( fig .", "1f ) and was transferred into the hard metal film by ar ion milling ( fig .", "the same chemical growth method was used as for the all - zno arrays ( fig .", "the preparation condition details for both all - zno and anchored arrays are summarized in table 1 ." ], [ "the obtained nanostructures were visualized by a hitachi s4800 field emission scanning electron microscope ( fesem ) .", "transmission electron microscope ( tem ) images were obtained by a 200 kv jeol jem-2010 instrument .", "the electrical characterization of the individual nws was carried out in air by conductive afm technique by means of a sii nanotechnology inc . ,", "the spring constant and resonant frequency of the used au - coated cantilever is 1.4 n / m and 26 khz , respectively ." ], [ "the sem images of the all - zno arrays fabricated at optimized conditions are shown in fig .", "c . the c - axis - oriented nrs show hexagonal cross section , which are according to the crystal orientation of the substrate collectively aligned to each other .", "the sidewalls of the prism - shaped rods correspond to the most stable non - polar faces .", "note the ~250 nm high bottleneck - shaped part at the bottom of the nanocrystals in fig .", "we have found that by changing the template geometry , the diameter and the length of the nrs can be tuned in the range of 90170 nm and 0.52.3 m , respectively .", "the perpendicularly standing nrs reflect excellent geometrical uniformity . according to the image analysis done on the fesem image ( pixel size of 1.4 nm ) shown in fig .", "this is the diameter of a circle having the same area as the hexagonal cross section of the object .", "we have tried the same growth conditions on zn- and o - polar zno surfaces , but no significant difference was found in the obtained arrays .", "a typical example observed during the optimization of the growth parameters is inserted in fig .", "2d . when the concentration in the growth solution is increased to 40 mm , the growing nrs coalesce at their non - polar sides to form a contiguous network .", "fesem images on all - zno nanorod arrays prepared by soft - masking method in honeycomb ( a , d ) and on triangular ( b , c ) arrangements .", "the single crystal nanorods have hexagonal cross - sections ; the uniformity of diameter can be < 2% ( b inset ) . when the concentration of the growth solution is increased to 40 mm ,", "a coalescence of nanorods is observed ( d ) anchored , i.e. , metal back contacted arrays show similar geometrical features as the all - zno structures ( fig .", ", we have also downscaled the pattern : the densest array had an rod - to - rod distance of 175 nm , which in hc lattice corresponds to a nr density of 25 nr/m", ". however , in the case of high aspect ratio ( ~26:1 ) and short rod - to - rod distance , a self - attraction of nr tips occurs ( fig .", "3c ) . perspective view ( a ) and top view ( b ) fesem images on bottom contacted , anchored zno nanorods prepared by hard - mask method .", "when the aspect ratio is high , during the drying process ( c ) the nanorods attach to each other at their tips similar phenomenon was described by other groups , as well , albeit they used high temperature vapor transport methods .", "wang et al . explained the self - attraction by the accumulated coulomb charges at the nr / au catalyst droplet interface when charged by the primary electrons during sem observation .", "have also observed self - attracted nws prepared by catalyst - free vapor solid ( vs ) preparation method .", "therefore , the charging can not be ascribed to the presence of catalysts . in our case", ", the nr tip attachment can be attributed to surface tension of water during the drying process , as it was described by segawa et al . for hybrid organic inorganic nr .", "we believe that further down - scaling is limited mainly by the resolution of our e - beam lithography facility rather than by growth kinetics . in fig .", "4a , the cross - sectional fesem image of the so - called anchored - type nrs is provided .", "the arrows on top and bottom mark the characteristic diameter of the rods being ca .", "the development of this taper is the effect of the finite growth rate on the nonpolar faces of the sidewalls .", "figure 4b reflects the anomaly encountered during ion - milling of the base - metal film ( ru ) through the pmma holes formed by e - beam lithography . after the removal of the pmma mask", ", a cylindrical object is left surrounding the ion - milled hole in the metal .", "this cylinder is composed of sputtered residues originating from the ru - film , mixed with zno from the underlying substrate and polymers formed from pmma components . a schematic cross section of the structure after ion - milling , but before pmma removal", "the hexagonal faceting forms outside of this cylinder . that gives rise to the neck observed on the bottom of the nrs in fig .", "fesem image of the cross section of anchored - type zno nanorods with indication of the size - distribution ( a ) , the parasitic ring remaining after removal of the pmma mask ( b ) , and from the ar - ion milled structure shown in the sketch in cross section ( c ) the tem observations revealed that both all - zno and anchored , contacted nrs are wurtzite type single crystals of high quality ( fig .", "5 ) , where the rotational axis is parallel to the direction . the tem observation reveals the single crystalline nature of the nanorods .", "the fast growing crystallographic direction is parallel to the longitudinal axis the electrical properties of the individual nrs in fig .", "this can be ascribed to the effect of the condensates on the mantle surface of the nrs .", "6 ) , which can be originated either from the contact between probe - tip and nr - tip or from the collar - shaped zno / ru interface at the bottom of the nr .", "however , as it was shown earlier and found here as well , the ru / single crystal zno interface - contact has ohmic character .", "therefore , the au / zno nr contact is responsible for the observed rectifying behavior .", "voltage characteristic recorded on an individual nanorod by conductive afm . in order to obtain reproducible results in air", "increased contact force is required , which can be ascribed to the condensate formation on the nanorods ( inset ) in order to correctly describe the electrical behavior by an equivalent circuit and to separate the contributions of contact resistance , internal resistance of the nr , surface conductance , and piezoelectricity induced schottky barrier height change , a refinement of the measurement technique and further systematic investigation is required . still , in our work", "the successful formation of a rectifying schottky contact between zno nr and the measuring tip could reproducibly be obtained .", "this was pointed out by liu et al . to be a necessary requirement for the operation of the dc nanogenerator with vibrating top contact ." ], [ "we have demonstrated that by using homoepitaxial chemical growth method highly uniform , single crystalline nr arrays arranged in a predefined pattern can be prepared . by changing the growth parameters , diameter and length of the nrs", "can be tuned in the range of 90170 nm and 500 nm2.3 m , respectively .", "the monodispersity of the diameter of single crystalline nrs can be < 2% by maintaining an excellent uniformity in the longitudinal dimension .", "we exploited two alternative synthesis routes using soft and hard under - layer to obtain all - zno and metal contacted , anchored nr arrays , respectively .", "the former one can be a promising candidate for nanopillar - based photonic crystals , especially if a refractive index contrast between the nr and the zno substrate is realized .", "on the other hand , anchored nr arrays contacted on the bottom are promising structures for nanopiezotronics .", "the arrays show excellent uniformity in length and the dense pattern ( ~30 nr/m ) can be adjusted to the top vibrating electrode of the nanogenerator .", "thereby a significant improvement in the output voltage , hence a more efficient energy harvesting can be predicted ." ], [ "this work was supported by the nanotechnology network project of the ministry of education , culture , sports , science and technology ( mext ) in japan , and by the hungarian fundamental research found ( otka ) under contract pd 77578 ." ] ]

[ [ "many recent articles highlight the data revolution in healthcare , an offshoot of the vast amount of digital medical information that has now accumulated in electronic medical records ( emrs ) , and present it as an opportunity to create a learning healthcare system. the generally proposed vision is for a population data - driven knowledge system that generalizes from every patient s life , disease and treatment experiences to impute the best course of action for diagnosis , prognosis and treatment of future patients .", "there have also been many articles focusing on the risk that nave use of big data ( or data in general ) poses .", "as stated by zak kohane of harvard medical school , big data in healthcare can not be a simple , blind application of black - box techniques : you really need to know something about medicine .", "if statistics lie , then big data can lie in a very , very big way .", "this paper will discuss the general issue of data in critical care with a focus on the big data phenomenon that is sweeping healthcare . with the vast amount of digital medical information that has accumulated in emrs , the challenge is the transformation of the copious data into usable and useful medical knowledge .", "we are experiencing a rapidly expanding collection of vast amounts of clinical data from routine practice and ambulatory monitoring .", "clinicians must already make sense of a diverse variety of data input streams in order to make clinical decisions .", "data from our everyday activities ( financial transactions , cellphone and internet use , social media posts ) , the environment , and even the local government promise to provide even more clinically relevant information ( figure 1 ) , but to what end ? and how can increasing amounts of data be incorporated into a system of already overburdened clinicians?figure 1 \n where big data in healthcare come from ( figure courtesy of yuan lai ) . \n \n where big data in healthcare come from ( figure courtesy of yuan lai ) . \n ", "the bottom line is that pertinent quality data add tremendous value , which accounts for their ", "unreasonable effectiveness. there is no way to minimize undesirable variability in practice without the data to substantiate the standardization .", "the volume and variety of increasingly available big data can allow us to interrogate clinical practice variation , personalize the risk - benefit score for every test and intervention , discover new knowledge to understand disease mechanisms , and optimize processes such as medical decision making , triage and resource allocation .", "clinical data have been notorious for their variable interoperability and quality , but a holistic use of the massive data sources available ( vital signs , clinical notes , laboratory results , treatments including medications and procedures ) can lead to new perspectives on challenging problems .", "while the wetware of the human mind is a wonderful instrument for this purpose , we must design better data systems to support and improve those components of this data integration process that exceed human abilities ." ], [ "decisions in the intensive care unit ( icu ) are frequently made in the setting of a high degree of uncertainty , and clinical staff may have only minutes or even seconds to make those decisions .", "the increasing need for intensive care has spiked the ratio of icu beds to hospital beds as the icu plays an expanding role in acute hospital care .", "but the value of many treatments and interventions in the icu is unproven , with many standard treatments being ineffective , minimally effective , questionably effective , or even harmful to the patient . in a setting where the effects of every intervention are subject to patient and clinical context - specific factors , the ability to use data for decision support becomes very attractive and closer to essential as increasing complexity transcends typical cognitive capabilities .", "an example of collected data being used to infer high - level information is the icu scoring systems in use today .", "icu scoring systems , such as apache ( acute physiology and chronic health evaluation ) , mpm ( mortality probability model ) , and saps ( simplified acute physiology score ) , are all based on the use of physiologic and other clinical data for severity adjustment ( table 1 ) .", "while these scores are primarily used to assess and compare icu performance ( e. g. , by examining the ratio of actual - to - predicted outcomes ) they also have use as short - hand indicators of patient acuity . but scoring system value depends not only on the accuracy of the underlying data , but also on clinical trust in the reliability of the data and the predictions based on that data . in 2012 , scoring systems were used in only 10% to 15% of us icus , despite demonstrated good discrimination and calibration .table 1 \n a comparison of intensive care unit ( icu ) scoring systems ( from with permission ) \n\n icu scoring system \n\n timing of data collected \n\n physiological values \n\n other required data \n\n total data elements required \n\n original reported mortality prediction performance \n saps iiiprior to and within 1 hour of icu admission10age , six chronic health variables , icu admission diagnosis , icu admission source , los prior to icu admission , emergency surgery , infection on admission , four variables for surgery type26auc = 84.8% ( n = 16,784)apache ivfirst icu day ( 1632 h depending on time of admission)17age , six chronic health variables , icu admission diagnosis , icu admission source , los prior to icu admission , emergency surgery , thrombolytic therapy , fio2 , mechanical ventilation32auc = 88.0% ( n = 52,647)mpm0-iiiprior to and within 1 hour of icu admission3age , three chronic health variables , five acute diagnosis variables , admission type ( e. g. , medical - surgical ) and emergency surgery , cpr within 1 h of icu admission , mechanical ventilation , code status16auc = 82.3% (", "n = 50,307)saps : simplified acute physiology score ; mpm : mortality prediction model ; apache : acute physiology and chronic health evaluation ; auc : area under the curve ; cpr : cardiopulmonary resuscitation ; los : length of stay . \n", "a comparison of intensive care unit ( icu ) scoring systems ( from with permission ) \n saps : simplified acute physiology score ; mpm : mortality prediction model ; apache : acute physiology and chronic health evaluation ; auc : area under the curve ; cpr : cardiopulmonary resuscitation ; los : length of stay . in practice , clinical prediction must be motivated by the needs of clinical staff , and this must be driven in large part by perceived utility and an increase in technical comfort amongst clinicians . some of the biggest opportunities for big data to make practical gains quickly are focused on the most expensive parts of current clinical practice : reliable , predictive alerting and retrospective reporting analytics for high - cost patients , readmissions , triage , clinical decompensation , adverse events , and treatment optimization for diseases affecting multiple organ systems .", "icu physicians have embraced the value of collecting and storing electronic clinical records , and this has led to partnerships between industrial and academic entities .", "for example , the commercial apache outcomes database has gathered partial physiologic and laboratory measurements from over 1 million patient records across 105 icus since 2010 . the philips eicu archives data from participating icus , and", "has collected an estimated database of over 1.5 million icu stays . as an ongoing provider , the eicu adds more than 400,000 patient records per year to its stores , and these data are also commercially available to selected researchers via the eicu research institute .", "in contrast to these commercial databases , the multiparameter intelligent monitoring in intensive care ( mimic ) database is open and publicly accessible ( figure 2 ) . over the past decade , the mimic database", "has collected clinical data from over 60,000 stays in beth israel deaconess medical center icus , including clinical notes , physiological waveforms , laboratory measurements , and nurse - verified numerical data .figure 2 \n the mimic database .", "ssa : social security administration ( figure courtesy of the laboratory of computational physiology , massachusetts institute of technology ) . \n", "ssa : social security administration ( figure courtesy of the laboratory of computational physiology , massachusetts institute of technology ) ." ], [ "medicine is ultimately based on knowledge , and each of the many ways to establish knowledge has certain advantages and pitfalls . here , we focus on the randomized controlled trial ( rct ) , observational studies and what we have termed dynamic clinical data mining ( dcdm ) ( figure 3).figure 3 \n dynamic clinical data mining .", "emr : electronic medical record ( figure courtesy of kai - ou tang and edward moseley , from with permission ) . \n", "emr : electronic medical record ( figure courtesy of kai - ou tang and edward moseley , from with permission ) .", "rcts are the gold - standard for clinical knowledge discovery . but 65 years after the first rct was published , only 1020% of medical decisions are based on rct - supported evidence . when examining the validity of a variety of medical interventions , about half of systematic reviews report insufficient evidence to support the intervention in question .", "the reality is that the exponential combinations of patients , conditions and treatments can not be exhaustively explored by rcts due to the large cost of adding even small numbers of patients .", "furthermore , the process of performing rcts often intentionally or inadvertently excludes groups of patients , such as those with particular co - morbidities or medications , or of certain ages or ethnic groups .", "thus , when trying to make a real decision under practice conditions , the rct conclusions may simply not be applicable to the patient and situation in hand .", "this was the driver for the concept of dcdm in which the user of an emr would be automatically presented with prior interventions and outcomes of similar patients to support what would otherwise be a completely subjective decision ( see below ) .", "these include the heterogeneity of treatment effect of red blood cell ( rbc ) transfusion , the impact of pre - admission selective serotonin reuptake inhibitors on mortality in the icu , the interplay between clinical notes and structured data on mortality prediction , optimization of heparin dosing to minimize the probability of over- and under - anticoagulation , long - term outcomes of minor troponin elevations in the icu and the association between serum magnesium and blood pressure in the critically ill , to name a few .", "but these observations may be specific to the beth israel deaconess medical center and need to be validated using databases from other institutions .", "others have examined institution - specific databases , and these studies have yielded findings that have been translated into practice : a recent study at seattle children s compared a wide range of performance metrics and translated results into prioritized departmental and enterprise - wide improvements .", "celi , zimolzak and stone described an operational vision for a digitally based , generalized decision support system that they termed dynamic clinical data mining .", "the proposed system aggregates individual patient electronic health data in the course of care ; queries a universal , de - identified clinical database using modified search engine technology in real time ; identifies prior cases of sufficient similarity as to be instructive to the case at hand ; and populates the individual patient s emr with pertinent decision support material such as suggested interventions and prognosis , based on prior treatments and outcomes ( figure 3 ) .", "some of the most clear - cut arguments for big data in healthcare are in conjunction with the formulation of fully digitized prevention and pharmacovigilance processes ( figure 4 ) .", "clinicians of the future will have to work with user friendly versions of these tools to make timely and informed decisions about the drugs their patients are receiving . in a more general sense , clinicians will have to begin to consider an individual emr as only part of a patient s record with the remainder of the record consisting of the two - way relationship of the patient s emr with the entire population database", ". the essential starting point of the individual patient can be enhanced by the knowledge present in population - level databases , and the resulting information combinations and comparisons used to make informed clinical decisions . in turn , the information accumulated from individuals benefits the healthcare of the entire population.figure 4 \n clinical care optimization : a big data model for efficient targeting of tests and treatments and vigilance for adverse events ( figure courtesy of kai - ou tang and edward moseley , from with permission ) . \n \n", "clinical care optimization : a big data model for efficient targeting of tests and treatments and vigilance for adverse events ( figure courtesy of kai - ou tang and edward moseley , from with permission ) . \n ", "national pharmaceutical benefits manager , express scripts , can predict which patients may fail to take their medication 12 months in advance , with an accuracy rate of 98% ; ibm is modifying their famed watson system ( in tight collaboration with clinicians ) for predicting different types of cancer .", "23andme s database has already been used to find unknown genetic markers for parkinson s disease and myopia , and their acquisition of $ 1.3 million in national institute of health funding has shown additional confidence in their goals ." ], [ "more recently , the open data movement has been quietly sweeping almost every industry , including the specialized domain of healthcare .", "it calls for data sharing , and by its very nature , requires a degree of accountability as well as collaboration across disciplines never seen before . at the forefront of the open data movement in healthcare", "glaxosmithkline ( gsk ) announced that it would make detailed data from its clinical trials widely available to researchers outside its own walls , stunning the scientific community .", "for a company that spends $ 6.5 billion a year on research and development , it was a sharp turn away from a historic system of data secrecy . in may 2013 ,", "it then invited others to join clinicalstudydatarequest.com , where gsk and six other drug makers have already uploaded data from nearly 900 clinical trials .", "the following month , the medical device company , medtronic , teamed up with yale university and shared its clinical trials data through the yale university open access data ( yoda ) project .", "other important trends in open data are crowdsourcing , data marathons and hackathons , which leverage several newly available phenomena .", "these include combining publically available , detailed , and de - identified emrs with crowdsourcing techniques and coordinated hackathons to capture , organize and integrate stakeholder user input from a necessary variety of input sources ( figure 5 ) .", "the traditional approach to knowledge discovery involves publication in peer - reviewed journals by a very circumscribed group of contributors .", "this process excluded a number of potentially valuable contributors , such as full time clinical physicians , nurses , medical trainees , and patients , among others.figure 5 \n beyond open big data : addressing unreliable research ( figure courtesy of kai - ou tang ) . \n \n beyond open big data : addressing unreliable research ( figure courtesy of kai - ou tang ) . \n ", "hackathons are large - scale events that contemporaneously bring together ( physically and/or by teleconferencing ) large groups of qualified individuals to collectively contribute their expertise towards a common problem set .", "crowdsourcing also focuses large groups of qualified individuals towards a common problem , but allows those individuals to do so asynchronously and in a mobile manner using phones , tablets , laptops and other devices to contribute from any location . with such tools , individual clinical encounters", "this amalgamation of individual knowledge should allow each clinician to address gaps in their knowledge , with the confidence that their decisions are supported by evidence in clinical practice . in january 2014 , the inaugural critical data marathon and conference was held at the massachusetts institute of technology . in the data marathon ,", "physicians , nurses and pharmacists were paired with data scientists and engineers , and encouraged to investigate a variety of clinical questions that arise in the icu . over a 2-day period ,", "more than 150 attendees began to answer questions , such as whether acetaminophen should be used to control fever in critically ill patients , and what the optimal blood pressure goal should be among patients with severe infection .", "this event fostered collaboration between clinicians and data scientists that will support ongoing research in the icu setting .", "the associated critical data conference addressed growing concerns that big data will only augment the problem of unreliable research . thought leaders from academia , government and industry across disciplines including clinical medicine ,", "computer science , public health , informatics , biomedical research , health technology , statistics and epidemiology gathered and discussed the pitfalls and challenges of big data in healthcare .", "the consensus seemed to be that success will require systematized and fully transparent data interrogation , where data and methods are freely shared among different groups of investigators addressing the same or similar questions .", "the added accuracy of the scientific findings is only one of the benefits of the systematization of the open data movement .", "another will be the opportunity afforded to individuals of every educational level and area of expertise to contribute to science . from a broader analysis of big data , we can try to understand larger patterns by comparing the strength of many signals in large populations .", "there is a critical need for collaborative research amongst many groups that explore similar questions .", "the association between data sharing and increased citation rate , and an increasing commitment by companies , funding agencies and investigators to more widely share clinical research data point to the feasibility of this move .", "the prospect of using big data in an open environment may sound overwhelming , but there have been key steps to encourage this cultural transformation . for example , the centers for medicare and medicaid services ( cms ) have begun to share data with providers and states . as the largest single payer for health care in the united states , cms has used its vast store of data to track hospital readmission rates in the medicare program ( importantly finding a rapid decline in readmission rates in 2012 and 2013 ) , and combat medicare fraud ( in its first year the system stopped , prevented , or identified an estimated $ 115 million in improper payments ) . as large amounts of shared data become available from different geographic and academic sources , there will be the additional benefit from the collection of data from sources with different viewpoints and biases . while individual researchers may not be aware of their own biases or assumptions that may impact reported results , shared exploration of big data provides us with an inherent sanity check that has been sorely lacking in many fields ." ], [ "in a recent analysis of data - driven healthcare by the mit technology review , the authors noted that medicine has entered its data age . driven by the promise of an estimated $ 300 to $ 450 billion a year , companies of all sizes are beginning to fight in earnest to capture and tame the data explosion .", "key innovations fall into three major areas : more and more data , especially resulting from mobile monitoring ; better analytics using new machine learning and other techniques ; and meaningful recommendations that focus on prediction , description , and prevention of poor health outcomes ( that are finally captured in an easily accessible format ) .", "the mass of new data rests primarily in the proprietary hands of large entities like insurance companies and care providers .", "for example , the genomics company 23andme is famously creating a huge database of genomic data , moving from over 700,000 records towards their goal of tens of millions . some countries with centralized healthcare systems like", "in addition , smaller companies like welldoc and ginger.io are beginning to focus on rampant cell - phone penetration to get into the health - data market .", "mobile phones can now seamlessly acquire daily patient metrics on meals , exercise , call patterns and other behaviors ; welldoc uses these data to recommend personalized insulin doses based on patients daily habits , and ginger.io monitors patients with mental illnesses for the kinds of actions that might indicate a need for help .", "other companies provide physical attachments to mobile devices that enrich the possible data types available : cellscope sells an attachment to support remote otoscopy ; alivecor provides electrocardiogram ( ekg ) signals ; propeller health attaches to an inhaler to record pertinent data ; and there are a slew of others for nearly every imaginable data need .", "but bigger data require better methods , and better machine learning techniques for clinical data have been a long time in coming .", "the most intuitive argument ( that more data from which to learn can not be worse , so must be better ) is true : there have been empirical demonstrations that predictive models built from sparse , fine - grained data see marginal gains in predictive performance even to massive scale .", "but there is another less intuitive argument for bigger data : certain rare trends or behaviors simply may not be observed in sufficient numbers without employing big data . dubbed the", " heavy tail of data , these rare behaviors are even more difficult to observe as we add more features to our datasets .", "intuitively , we can think of datasets as a set of samples out of a larger space ; for example , a circle inscribed within a square gets most of the area , leaving only the corners out .", "but as we move from inscribing a circle within a square , to inscribing a sphere within a cube , the ratio of space in the corners increases ( figure 6 ) .", "repeat this to a higher dimension and most of the volume of the cube will be concentrated in its ( many ) corners .", "but it is these rare instances ( sometimes appropriately referred to as corner cases ) of behaviors or patient characteristics that machine learning can not reliably analyze with historically available data sample sizes .", "the big data explosion is finally offering data at a scale large enough to overcome the risks of higher - dimensional spaces when working with healthcare data issues.figure 6 \n the data space and corner cases ( figure courtesy of yuan lai ) . \n \n the data space and corner cases ( figure courtesy of yuan lai ) . \n ", "along with big data s promise , there have been warnings of over confidence and disaster , labelled by lazer et al . as big data hubris", "the warning parable told to illustrate this is google s flu trends . in 2008 , google launched its flu trends , which used the search terms typed into google to track the progression of influenza epidemics over time .", "however , this approach was subsequently revealed to have suffered from several known data analysis pitfalls ( e. g. , overfitting and concept drift ) so that by 20122013 , the prevalence of flu was being greatly overestimated .", "other oft - cited risks include misleading conclusions derived from spurious associations in increasingly detailed data , and biased collection of data that may make derived hypotheses difficult to validate or generalize . but avoiding spurious conclusions from data analysis is not a challenge unique to big data .", "a 2012 nature review of cancer research found reproducibility of findings in only 11% of 53 published papers .", "there is concern that big data will only augment this noise , but using larger datasets actually tends to help with inflated significance , as the estimated effect sizes tend to be much smaller .", "if researchers have large amounts of data that severely oversample certain populations or conditions , their derived hypotheses can be incorrect or at least understandably difficult to validate .", "the way that current literature is designed , generated , and published creates sequential statistically significant discoveries from restricted datasets .", "it is not uncommon in the scientific literature to get a different story for a variable s ( vitamin e , omega-3 , coffee ) relationship to outcome ( mortality , alzheimer s , infant birth - weight ) depending on what is adjusted for , or how a population was selected .", "there is little meaning to exploring the impact of one variable for one outcome : it is the big picture that is meaningful ." ], [ "the benefits of the data explosion far outweigh the risks for the careful researcher . as target populations subdivide along combinations of comorbid conditions and countless genetic polymorphisms , as diagnostic and monitoring device including wearable sensors become more ubiquitous , and as therapeutic options expand beyond the evaluation of individual interventions including drugs and procedures , it is clear that the traditional approach to knowledge discovery can not scale to match the exponential growth of medical complexity . rather than taking turns hyping and disparaging big data , we need organizations and researchers to create methods and processes that address some of our most pressing concerns , e. g. , who is in charge of shared data , who ", "owns clinical data , and how do we best combine heterogeneous and superficially non - interoperable data sources ? we need to use big data in a different way than we have traditionally used data collaboratively . by creating a culture of transparency and reproducibility" ] ]

[ [ "odorant binding proteins ( obps ) were identified almost three decades ago ( vogt and riddiford 1981 ) , but their roles in insect olfaction are still a matter of considerable debate . that obps are involved in odorant reception was disputed after odorant receptors ( ors ) were demonstrated to respond to semiochemicals when expressed in heterologous systems these expression systems , however , have limitations in addressing the role(s ) of obps in olfaction . the heterologous expression system that uses drosophila empty neurons ( dobritsa et al .", "2003 ) includes surrogate obps , i.e. , obps expressed in the ab3 sensilla , whereas in non - insect cell systems1 ( forstner et al . 2009 ) odorants are solubilized with organic solvent or with the addition of recombinant obps .", "thus , ultimately the role(s ) of obps in insect olfaction must be addressed by examining insects with reduced levels ( knockdowns ) or devoid of a test obp ( knockouts ) . in drosophila ,", "analysis of a mutant defective for expression of an obp revealed that dmelobp76a ( aka lush ) is required for the activation of pheromone sensitive neurons by ( e)-11-vaccenyl acetate and associated behavior ( xu et al .", "2005 ) , but other insect species are not amenable to this type of genetic manipulation . previously , we employed the empty neuron system of drosophila to express the pheromone receptor from the silkworm moth , bombyx mori , bmoror1 alone or co - expressed with a pheromone - binding protein , bmorpbp1 ( syed et al .", ", we demonstrated clearly that pbps enhance the sensitivity of the insect olfactory system ( syed et al .", "recently , it was shown that addition of a recombinant pbp to a heterologous system that expresses a pheromone receptor from antheraea polyphemus increases both sensitivity and selectivity ( forstner et al . 2009 ) .", "given that our previous attempts to knockdown pbp expression in the silkworm moth were unsuccessful ( leal and ishida , unpublished data ) , we explored knocking down obp expression in mosquitoes .", "we then focused on cquiobp1 , which is highly expressed in the antennae of the southern house mosquito culex pipiens quinquefasciatus ( = cx .", "recently , cquiobp1 was shown to bind a mosquito oviposition pheromone ( mop ) ( laurence and pickett 1982 ) in a ph dependent manner and to be expressed in antennal sensilla sensitive to this pheromone ( leal et al .", "2008 ) . in the present study , we used cquiobp1 as a target in rna interference ( rnai ) experiments to examine its function in the reception of oviposition attractants . mosquitoes injected with double strand rna ( dsrna ) showed reduced levels of cquiobp1 transcripts as well as reduced antennal responses to mop , skatole , and indole when compared to water - injected controls", "interestingly , antennal response to nonanal , a major host cue detected with extremely high sensitivity by cx .", "these findings suggest that cquiobp1 is involved in the detection of multiple oviposition attractants and plays a key role in the sensitivity of the mosquito olfactory system ." ], [ "cquiobp1 rna interference full - length cquiobp1 dsrna was synthesized by in vitro transcription from purified pcr product that contained t7 promoter sequences in inverted orientations and purified by using rneasy minelute cleanup kit ( qiagen ) .", "approximately 100 nl ( 350 ng ) of dsrna were injected through the intersegmental thorax membranes into 1-to-48 h - old cx .", "quinquefasciatus female mosquitoes with a microinjector system minj-1 ( tritech research , los angeles , ca , usa ) .", "dsrna - injected , water - injected , and non - injected mosquitoes were generated .", "individual female heads were dissected in liquid nitrogen 4 d post - injection , rna from each head was extracted with rneasy mini kit ( qiagen ) , and individual cdnas were synthesized from 0.1 g of rna using 100u superscript ii reverse transcriptase ( invitrogen ) .", "real - time quantitative pcr ( qpcr ) was carried out by using express sybr greener qpcr supermix universal ( invitrogen ) in a final volume of 20 l . reactions were run with a standard cycling program , 50c for 2 min , 95c for 2 min , 40 cycles of 95c for 15 s , and 60c for 1 min , on an ab7300 real - time pcr system ( applied biosystems ) .", "cquiobp1 expression was normalized to the expression levels of an endogenous control , the ribosomal protein that encodes gene s7 ( cquirps7 ) .", "relative quantification analysis based on the comparative ct method ( ct ) was performed using ab7300 system sds software ( applied biosystems ) .", "non quantitative pcr was carried out from the same cdnas by using 2u gotaq dna polymerase ( promega ) in a final volume of 25 l .", "quinquefasciatus female was mounted on a syntech eag platform equipped with micromanipulator-12 and a high - impedance ac / dc preamplifier ( syntech , germany ) .", "chloridized silver wires in drawn - out glass capillaries filled with 0.1% kcl and 0.5% polyvinylpyrrolidone ( pvp ) were used for reference and recording electrodes .", "the recording electrode accommodated the two antennae of the excised head after the tips of the antennae were clipped to provide a better contact .", "preparation was bathed in a high humidity air stream flowing at 20 ml / s to which a stimulus pulse of 2 ml / s was added for 500 ms .", "any change in antennal deflection induced by the stimuli or control puffs was recoded for 10 s. indole and 3-methyl indole ( skatole ) were purchased from acros ( usa ) and were 95% pure ; nonanal ( 99% ) was from sigma - aldrich ; racemic 6-acetoxy-5-hexadecanolide ( mop ) was a gift from bedoukian research incorporated , usa . chemicals were dissolved in dichloromethane ( dcm ) , wt / vol , to make a stock solution of 10 g/l and decadic dilutions were made .", "an aliquot ( 10 l ) of a stimulus was loaded onto a filter paper strip , the solvent was evaporated for 30 s , and the strip was placed in a 5 ml polypropylene syringe from which various volumes were dispensed .", "data presented are from a pool of mosquitoes injected and tested in three different batches on different days . in each session ,", "eag responses of at least three of rnai - treated and water - injected mosquitoes were recorded ." ], [ "we employed a combination of rt - pcr and real - time quantitative pcr ( qpcr ) to examine mrna levels of cquiobp1 in heads of rnai ( dsrna - injected ) and control ( water - injected , non - injected ) mosquitoes using cquirps7 as a control gene .", "rt - pcr analysis showed a clear reduction of cquiobp1 transcript levels in dsrna - injected mosquitoes , as compared to water - injected and non - injected mosquitoes ( fig . ", "we then examined by electroantennogram ( eag ) the responses of sham - and rnai - treated female mosquitoes to oviposition attractants . silencing the cquiobp1 gene clearly affected antennal responses to mop and indole , a putative oviposition attractant ( millar et al .", "1c ) , which confirmed the trend observed by a semi - quantitative method ( fig . ", "dsrna - injected mosquitoes displayed reduction of cquiobp1 transcript levels ( average 59.9% ) when compared to both water - injected ( sham - treated ) mosquitoes ( average 97.3% ) and non - injected controls ( normalized to 100% ) .", "dsrna - injected individuals displayed significant reduction of cquiobp1 transcripts ( 47% to 65% ) ( fig . ", "furthermore , water - injected and non - injected mosquitoes displayed almost equivalent levels of cquiobp1 transcripts , thus demonstrating that rnai treatment is responsible for the observed reduction of cquiobp1 mrna levels ( fig . ", "this partial silencing of cquiobp1 shown by qpcr analysis demonstrates the feasibility of significantly reducing even highly expressed olfactory genes like obps by using the rnai approach .", "1b ) also suggests that 50% transcripts reduction is enough to generate reduced responses to several semiochemicals . \n", "1pcr and eag data . a rt - pcr analysis indicating that cquiobp1 transcripts were reduced in rnai - treated females ( rna1 & rna2 ) when compared to the transcript levels in water - injected ( water ) and non - injected ( non ) females .", "b eag traces recorded from antennae of water- and rnai - treated female mosquitoes challenged with mop ( 100 g ) , indole ( 10 g ) , and nonanal ( 10 g ) .", "bars on the top of traces indicate the duration of the 500 ms stimulus .", "c relative expression of cquiobp1 by qpcr using express sybr green er. rnai - treated , water - injected , and non - injected mosquitoes ( each n = 5 ) .", "d , e , f dose - response eag curves for skatole , indole , and nonanal , respectively ( n 10 ) .", "the scale for skatole ( d ) and indole ( e ) graphics is the same , but the high sensitivity of nonanal ( f ) required a different scale pcr and eag data . a rt - pcr analysis indicating that cquiobp1 transcripts were reduced in rnai - treated females ( rna1 & rna2 ) when compared to the transcript levels in water - injected ( water ) and non - injected ( non ) females .", "b eag traces recorded from antennae of water- and rnai - treated female mosquitoes challenged with mop ( 100 g ) , indole ( 10 g ) , and nonanal ( 10 g ) .", "bars on the top of traces indicate the duration of the 500 ms stimulus .", "c relative expression of cquiobp1 by qpcr using express sybr green er. rnai - treated , water - injected , and non - injected mosquitoes ( each n = 5 ) .", "d , e , f dose - response eag curves for skatole , indole , and nonanal , respectively ( n 10 ) .", "the scale for skatole ( d ) and indole ( e ) graphics is the same , but the high sensitivity of nonanal ( f ) required a different scale finally , we compared the responses of sham- and rnai - treated female mosquitoes to various doses of these oviposition - related compounds .", "eag responses of rnai - treated females to mop were below the detection limit , but the dose required to generate consistent eag signals with water - treated or untreated mosquitoes was high ( 100 g ) .", "in contrast , reduction of cquiobp1 transcripts led to a significantly reduced response to skatole ( n = 10 , p < 0.05 ) at all doses tested ( fig . ", "likewise , eag responses to indole by rnai - treated females were significantly lower than the responses recorded from water - treated female mosquitoes at all doses tested ( fig . ", "lastly , we observed an apparent trend towards smaller eag responses to nonanal by rnai - treated compared water - treated female mosquitoes , but the differences were not significant ( fig . ", "the simplest explanation for these findings is that obps play an important role for the sensitivity of the insect s olfactory system . although we were not able to completely silence cquiobp1 , probably because of the high level of transcription , the partial knockdown clearly affected antennal response to physiologically relevant compounds .", "previously , we demonstrated by in vitro assays that cquiopb1 binds mop in a ph - dependent manner , and we showed its expression in antennal sensilla sensitive to this oviposition attractant ( leal et al .", "these rnai experiments are the first evidence in vivo that cquiobp1 is involved in the reception of culex mosquito oviposition attractants . although it is tempting to speculate that cquiobp1 is selective because responses to nonanal were not significantly different in sham- and rnai - treated mosquitoes ( fig . ", "1f ) , the level of transcript reduction achieved by our rnai treatments may not be high enough to affect eag responses of semiochemicals such as nonanal for which the olfactory system responds with remarkable sensitivity ( syed and leal 2009 ) .", "by contrast , the reduced levels of cquiobp1 transcripts affected the responses of compounds with higher thresholds , thus allowing us to conclude that cquiobp1 is indeed involved in the detection of oviposition attractants , and that high levels of obps expression are essential for the sensitivity of the insect s olfactory system ." ] ]

[ [ "minimally invasive surgery was first described by wickham in 1987 and refers to surgical techniques that are less invasive than open surgery for the same purpose .", "conventional open , laparoscopic , robot - assisted laparoscopic , and video - assisted minilaparotomy surgery ( vams ) have been performed as minimally invasive renal surgery .", "this surgical technique was performed through minilaparotomy and patients who underwent it recovered quickly . more than 600 cases of living donor nephrectomy have been conducted successfully , and this technique is also widely used to manage renal malignancy .", "many studies have compared the cost - effectiveness of laparoscopic and robot - assisted renal surgeries with that of open surgery .", "compared the costs of open surgery and robot - assisted laparoscopic radical prostatectomy for prostate cancer .", "they noted that robot - assisted laparoscopic prostatectomy was more expensive than open surgery in terms of medical supply and operation costs .", "reported that laparoscopic living donor nephrectomy with low complication rates was a cost - effective renal surgery .", "however , there has been no research on the cost - effectiveness of minilaparotomy kidney surgeries such as vams .", "therefore , this study aimed to compare the cost - analysis of vams versus open , laparoscopic , and robot - assisted laparoscopic radical nephrectomy ( rn ) surgery under korean medical insurance ." ], [ "twenty patients with suspected renal cell carcinoma who underwent vams , open , laparoscopic , or robot - assisted laparoscopic rn between january 2008 and december 2010 were selected .", "the patients sampled for this study were treated between 2008 and 2010 while the insurance system applied , and the most recent 20 cases not subject to the exclusion criteria were selected .", "patients who met the following criteria were excluded : 1 ) those who underwent another surgery apart from rn , 2 ) those who incurred additional medical fees owing to postoperative complications , 3 ) those who underwent rn during hospitalization in another department , and 4 ) those whose final pathological finding was not renal cell carcinoma .", "patient information ( age , gender , body mass index [ bmi ] , and length of hospital stay ) was retrospectively collected from medical records .", "tumor stage was based on the american joint committee on cancer tumor , nodes , metastasis staging , 7th edition .", "four items considered to be related to the surgery were compared from the itemized statements : procedure and operation , anesthesia , laboratory testing , and medical supply fees .", "items such as room and meal charges and medications , which were regarded as being minimally related to surgery , were excluded .", "surgery was defined as a medical service directly performed by doctors with their hands or tools .", "laboratory test fees refer to costs associated with extracting and testing specimens to diagnose a disease or ascertain its progression .", "anesthesia fees refer to the costs of anesthesia for a surgery or treatment associated with alleviating pain .", "medical supplies refer to the costs of materials used in a test or a surgery .", "criteria for insured and uninsured costs were based on benefit coverage criteria prescribed by the health insurance review and assessment service . for laparoscopic rn ,", "routine disposable laparoscopic equipment was used . for robot - assisted laparoscopic rn , the da vinci robot ( intuitive surgical inc . ,", "18.0 ( ibm co. , armonk , ny , usa ) . to determine the significance of the differences observed between the means of continuous variables , student 's t - test was used . to determine the significance of the differences observed between the rates of categorical variables , fisher 's exact test was used ." ], [ "there was a significant difference in patient age and bmi ( p<0.05 ) between the laparoscopic and the vams group .", "there was no significant difference in tumor sizes or stage distributions between the vams group and the other three groups ( table 1 ) .", "patient costs ( meanstandard deviation ) were 2,023,791240,757 , 2,024,246674,859 , 3,603,557870,333 , and 8,021,902330,157 korean won ( krw , the currency of south koea ) for the vams , open , laparoscopic , and robot - assisted rn groups , respectively . among them , the sum of the insured costs was 1,904,627231,957 , 1,798,127645,602 ( p=0.634 ) , 3,039,769711,792 ( p<0.01 ) , and 899,668323,508 ( p<0.01 ) krw in the vams , open , laparoscopic , and robot - assisted rn groups , respectively , whereas the sum of the uninsured costs was 119,16324,581 , 226,119215,009 , 563,788487,798 ( p<0.01 ) , and 7,122,23456,117 ( p<0.01 ) krw , respectively ( table 2 ) . in the vams group ,", "medical supply fees accounted for the highest portion of total costs at 38.63% ( insured costs were 33.43% and uninsured costs were 5.20% ) , followed by procedure and operation fees at 29.99% ( insured costs were 29.99% ) .", "procedure and operation fees in the open rn group , medical supply fees in the laparoscopic rn group , and procedure and operation fees in the robot - assisted laparoscopic rn group accounted for the largest percent at 33.19% ( insured cost at 33.19% ) , 60.51% ( insured cost at 45.3% and uninsured cost at 15.08% ) , and 88.24% ( insured cost at 0.98% and uninsured cost at 87.26% ) , respectively ( fig .", "1 ) . there was a significant difference between the vams and open rn groups in the laboratory test ( insured ) and surgical material fees ( insured and uninsured ; p<0.05 ) .", "medical supply fees were the item with the greatest difference between the laparoscopic and the vams groups ( p<0.05 ) .", "there was likewise a significant difference between the groups in terms of laboratory test fees ( insured ; p<0.05 ) . in the robot - assisted laparoscopic rn group ,", "procedure and operation fees had the greatest difference compared with those of the vams group .", "laboratory test costs ( insured ) and medical supply costs ( insured ) were also significantly different from those of the vams group ( p<0.05 ) .", "there was no significant difference in total cost between the vams and the open rn groups ( p=0.998 ) .", "there was a significant difference in the sum of insured costs , uninsured costs , and total costs between the vams and the laparoscopic rn group ( p<0.01 ) ." ], [ "with patients placing importance on quality of life and decreased postoperative pain , demand for minimally invasive surgery is increasing . furthermore , along with the development of imaging and operative equipment , surgical techniques have undergone much improvement .", "four minimally invasive surgical techniques are being used for kidney surgery in the urological field : laparoscopic surgery , minilaparotomy surgery , robot - assisted laparoscopic surgery , and percutaneous cryotherapy or ablation therapy . in 1990 , clayman et al", "this surgical technique , compared with conventional open surgery , caused less postoperative pain and required a shorter hospital stay and time to return to normal life . in 2001 , guillonneau et al . ", "subsequently , other studies reported good functional and oncologic outcomes in patients undergoing this surgical technique . for the minilaparotomy technique , yang et al . reported the first living donor nephrectomy using vams , and since then , data on safety and clinical usefulness from more than 600 cases of nephrectomy have been reported .", "currently , vams is used for diverse renal surgeries including radical , partial , and living donor nephrectomies .", "the clinical usefulness of percutaneous techniques has been verified by many reports , but they have limits in that they are applied to selected patient cases only .", "conventional open , laparoscopic , robot - assisted laparoscopic , and vams have been performed for renal masses .", "vams is a minilaparotomy technique in which an endoscope is used and a technique of internal traction is applied with a piercing retractor .", "it leaves minimal operation - related scars owing to the surgical window available through minilaparotomy . for a certain surgical technique", "to become widely used , it should be associated with advantages in terms of cost - effectiveness , patient benefits , and postoperative outcomes .", "however , there has been no study on the cost - effectiveness of vams compared with other surgical techniques for rn . for comparison and analysis , we divided patients who were diagnosed with renal cell carcinoma and underwent rn into the open , laparoscopic , robot - assisted laparoscopic , and vams rn groups .", "to research the cost - effectiveness of surgical techniques , it is necessary to evaluate complications from such procedures , because complications affect total cost .", "therefore , only four direct cost items related to surgery were compared and analyzed : procedure and operation , anesthesia , laboratory testing , and medical supply costs . in this study , items such as room and meal charges related to the length of stay were excluded from the evaluation of the cost - effectiveness of surgical techniques . in korea , the cost of ward stay is approximately 10,000 krw per day , which is inexpensive and therefore may lead to longer hospital stays . according to our study results , vams was more cost - effective than laparoscopic and robot - assisted laparoscopic rn ( p<0.01 ) ( table 2 ) .", "the greatest difference in medical supply fees was between the vams and laparoscopic rn groups ( p<0.01 ) .", "in korea , changes in the benefit coverage criteria of health insurance in 2006 enabled medical supply fees in laparoscopic surgery to be covered by health insurance .", "however , such a difference between the two groups in medical supply fees was probably due to fees for the disposable device ( e.g. , autosuture multifire endo gia 12 mm [ covidien plc , dublin , ireland ] ) that is currently used and which is expensive ( more than 100,000 krw ) . disposable devices ( e.g. , floseal hemostatic matrix [ baxter healthcare co. , hayward , ca , usa ] , harmonic scalpel [ ethicon endo - surgery , cincinnati , oh , usa ] ) are expensive and are rarely used in open or vams rn .", "this increases the cost of laparoscopic and robot - assisted laparoscopic rn , making them more expensive compared with the open or vams group .", "laboratory testing ( insured ) fees were less in the vams group than in the laparoscopic rn group ( p=0.037 ) , which is related to the shorter length of stay in the former group . among the itemized costs ,", "the greatest difference in produced and operation fees ( uninsured ) was between the vams and robot - assisted laparoscopic rn groups . in robot - assisted surgery , many reusable devices ( e.g. , endowrist [ intuitive surgical inc . , sunnyvale , ca , usa ] ) were used .", "those devices are reusable several times with cleansing and sterilization ; thus , it was not feasible to charge this cost for each surgery . at most hospitals ,", "the maintenance cost for reusable devices is included in the uniform procedure and operation fee .", "disposable devices were not charged separately , and the cost was also included in the uniform fee .", "therefore , the cost of medical supplies for the robot - assisted laparoscopic rn group can seem to be lower than the costs for other groups . currently , the price of the da vinci robot ranges from 1.5 to 1.75 million dollars and maintenance costs from 112,000 to 150,000 dollars .", "this is why procedure and operation fees are more expensive in the robot - assisted laparoscopic rn group than in the vams group .", "laboratory test fees were greater in the open than in the vams group because of the former group 's longer length of hospital stay .", "the mean total costs of laboratory tests in the immediate postoperative 5 days were almost the same in all groups ; after that period , the cost increase was proportional to the length of hospital stay .", "medical supply fees were greater in the vams group than in the open rn group .", "this is due to the use of an endoscope and a disposable device 12 mm visiport plus ( tyco healthcare , norwalk , usa ) accompanying it .", "nevertheless , there was no significant difference in the total cost between the open rn and vams groups .", "judging from the study results thus far , vams seems to be more cost - effective than laparoscopic and robot - assisted laparoscopic surgeries .", "comparison of vams with open surgery showed no significant differences in costs between them , proving that vams is a competitive modality in renal minimally invasive surgery .", "in addition to direct costs , hamidi et al . compared and analyzed social costs after discharge , including costs resulting from complications in laparoscopic donor nephrectomy .", "when a patient undergoes a surgery , other costs such as medication and room and meal charges are incurred in addition to the direct costs related to the surgery .", "after discharge , patients may incur indirect costs such as sick leave , copayments for health care , and hiring fees for home work .", "our study compared only costs directly related with surgery and therefore was unable to predict outcomes resulting from the incurrence of other costs .", "surgeons who have not yet overcome the associated learning curve tend to have higher complication rates than do experienced surgeons . in this study ,", "the surgeries of the vams group were conducted by experienced surgeons , which suggests that their complication rates would not be significantly different from those of the patients who underwent an open surgery .", "although the learning curve of vams is not very steep , it is not a common technique ; therefore , a large - scale multi - center study is necessary . finally , this study only examined rn , which does not represent all vams procedures .", "recent medical advancements , including abdominal ultrasonography , have resulted in increased discovery rates of small renal masses .", "the standard method for treating small renal masses is shifting from radical to partial nephrectomy .", "to fully research the cost - effectiveness of vams from different aspects , studies on other surgical techniques such as partial nephrectomy and pyeloplasty in addition to rn are necessary ." ], [ "furthermore , the procedure has cost - effectiveness advantages compared with laparoscopic and robot - assisted laparoscopic rn ." ] ]

[ [ "the clinical utility of most conventional chemotherapeutics is limited either by the inability to deliver therapeutic drug concentrations to the target tissues or by severe and harmful toxic effects on normal organs and tissues .", "liposomes are small , spherical , and enclosed compartments separating an aqueous medium from another by phospholipid bilayer . many hundreds of drugs , including anticancer and antimicrobial agents , chelating agents , peptide hormones , enzymes , proteins , vaccines , and genetic materials , have been incorporated into the aqueous or lipid phases of liposomes , with various sizes , compositions , and other characteristics , to provide selective delivery to the target site for in vivo application .", "several techniques , such as the bangham , detergent - depletion , ether / ethanol injection , reverse phase evaporation , and emulsion methods , have been reported for preparing liposomes with high - entrapment efficiency , narrow particle size distribution , and long - term stability.17 recently , some alternative methods including dense gas and supercritical fluid techniques have been introduced for liposome preparation without using any organic solvent.1,79 due to the differences in preparation methods and lipid compositions , liposomes can be classified according to their lamellarity ( uni- and multilamellar vesicles ) , size ( small [ 100 nm ] , intermediate [ 100250 nm ] , or large [ 250 nm ] ) , and surface charge ( anionic , cationic , or neutral).1012 in clinical studies , liposomes show improved pharmacokinetics and biodistribution of therapeutic agents and thus minimize toxicity by their accumulation at the target tissue.13,14 liposomes were first discovered by bangham in 1965 and the first liposomal pharmaceutical product , doxil , ( ben venue laboratories , inc bedford , oh ) received us food and drug administration ( fda ) approval in 1995 for the treatment of chemotherapy refractory acquired immune deficiency syndrome ( aids)-related kaposi s sarcoma.1315 currently , there are about twelve liposome - based drugs approved for clinical use and more are in various stages of clinical trials ( tables 1 and 2).1362 most liposomal drug formulations , such as doxil and myocet ( gp - pharm , barcelona , spain ) , are approved for intravenous application.63 other administration routes such as intramuscular delivery have been approved for delivery of surface antigens derived from the hepatitis a or influenza virus ( epaxal [ berna biotech ltd , berne switzerland ] and inflexal v [ berna biotech espaa sa , madrid , spain]).37,38 oral delivery has also been examined ; however , this is more troublesome due to the potential for liposome breakdown following exposure to bile salts.64" ], [ "liposomes dispersed in aqueous solution generally face physical and chemical instabilities after long - term storage.65 hydrolysis and oxidation of phospholipids and liposome aggregation are the common cause of liposome instabilities . according to the literature ,", "many methods have been investigated for the stabilization of liposomes , such as lyophilization , freezing , and spraying drying . in commercial liposome - based drugs ( table 1 ) , ambisome ( gilead sciences , inc , san dimas , ca ) , amphotec ( ben venue laboratories , inc , bedford , oh ) , myocet , visudyne ( novartis pharma ag , basel , switzerland ) , and lep - etu ( liposome - entrapped paclitaxel easy - to - use", "in general , freeze - drying increases the shelf - life of liposomal formulations and preserves them in dried form as lyophilized cakes to be reconstituted with water for injection prior to administration.66 furthermore , cryoprotectants need to be added to maintain particle size distribution of liposomes after the freeze - drying - rehydration cycle . various types and concentrations of sugars have been investigated for their ability to protect liposomes against fusion and leakage during lyophilization processes.66 in commercial liposome lyophilized products , lactose has been used as a cryoprotectant in the formulations of amphotec , myocet , and visudyne , and sucrose was added in the formulations of ambisome and lep - etu to increase liposome stability during lyophilization .", "interestingly , these commercial lyophilized products showed similar shelf - life in comparison with other liposome products ( eg , suspension and emulsions ) and hence lyophilization may not have the expected effect on liposome stability . in 1998 ,", "clemons and stevens compared the potency and therapeutic efficacy among the different lipid - based formulations of amphotericin b ( amphotec , ambisome , and abelcet ( sigma - tau pharmasource , inc , indianapolis , in ) ) for the treatment of systemic and meningeal cryptococcal disease.67 their work indicated that the therapeutic efficacy of amphotec and ambisome was superior to that of abelcet , by up to ten - fold , in survival and in clearing infection from all organs . in these", "three commercially available lipid - based formulations of amphotericin b , amphotec and ambisome are both lyophilized products and abelcet is formulated as a suspension . therefore , lyophilization may not extend the shelf - life of products but may increase therapeutic efficacy in vivo .", "similar results were also reported in our previous studies.70 we investigated the stability of the sirna - loaded liposomes in suspension and lyophilized powder form up to 1 month postmanufacture.68 following formulation , the sirna - loaded liposomes were stored at either 4c or room temperature .", "the particle size and zeta potential of sirna - loaded liposomes remained unchanged in both storage conditions .", "however , sirna entrapment efficiencies were observed to have decreased slightly after 1 month in storage for both suspension ( 90% 83% ) and lyophilized powder ( 94% 84% ) forms .", "surprisingly , the gene - silencing efficiency of sirna - loaded liposomes in aqueous solution showed 80% reduction following 1 month of storage at either 4c or room temperature .", "this was in contrast to liposomes prepared in the lyophilized powder form where 100% of the gene - silencing efficiency was retained following storage at either 4c or room temperature for 1 month .", "although therapeutic efficiency of liposome - based drugs may vary depending on the choice of lipids , the preparation technique , physico - chemical characteristics of the bioactive materials , and overall charge of the liposome , lyophilization is useful for the long - term storage of liposome - based drugs ." ], [ "liposome delivery systems offer the potential to enhance the therapeutic index of anticancer drugs , either by increasing the drug concentration in tumor cells or by decreasing the exposure in normal host tissues .", "doxorubicin is an anthracycline widely used to treat solid and hematological tumors , but its major drawback is its related cardiotoxicity . in cardiotoxicity ,", "positively charged doxorubicin s affinity for negatively charged cardiolipin , a lipid abundant in heart tissue , is thought to be involved in drug localization in the heart tissue.69 therefore , doxorubicin - loaded liposomes were developed to combat aggressive tumors , like breast and ovary metastatic cancers and kaposi s sarcoma .", "myocet and doxil were the first - approved liposome - based drugs for cancer treatment .", "both products contain doxorubicin but are different , particularly in the presence of polyethylene glycol ( peg ) coating ( figure 1 ) . in pharmacokinetic studies of doxorubicin - loaded liposomes ,", "free doxorubicin had an elimination half - life of 0.2 hours and an area under the plasma concentration time curve ( au ) of 4 g h ml in patients as compared with 2.5 hours and 45 g h ml for myocet and with 55 hours and 900 g h ml for doxil , respectively.25 the particle size of myocet is about 190 nm and doxil is about 100 nm .", "both liposome products have longer circulating half - life in blood as compared with the free drug , but doxil has a much longer circulation time in blood than myocet .", "generally , the blood circulation time of liposomes ( t1/2 ) increases with decreasing size , negative charge density , and fluidity in the bilayer or peg surface coating . in a phase", "iii head - to - head comparison of free doxorubicin vs myocet in patients with metastatic breast cancer , similar results were presented in first - year survival rate ( 64% vs 69% ) and progression - free survival ( 3.8 vs 4.3 months ) , but myocet had low incidence of cardiac events ( 13% vs 29% ) , mucositis / stomatitis ( 8.6% vs 11.9% ) , and nausea / vomiting ( 12.3% vs 20.3%).70,71 therefore , myocet tends to reduce drug - related toxicity ( eg , cardiotoxicity ) rather than to enhance antitumor efficacy .", "similar to myocet , doxil had a better safety profile , including reduction of cardiotoxicity ( 3.9% vs 18.8% ) , neutropenia ( 4% vs 10% ) , vomiting ( 19% vs 31% ) , and alopecia ( 20% vs 66% ) in a phase iii trial of metastatic breast cancer , whereas its progression - free survival times ( 6.9 vs 7.8 months ) and overall survival times ( 21 vs 22 months ) demonstrated equivalent efficacy to conventional doxorubicin.72 however , palmar - plantar erythrodysesthesia ( 48% vs 2% ) , stomatitis ( 22% vs 15% ) , and mucositis ( 23% vs 13% ) were found to be more often associated with doxil than free doxorubicin .", "lipo - dox ( tty biopharm company ltd , taipei taiwan ) is the second generation of pegylated liposomal doxorubicin , composed of distearoylphosphatidylcholine ( dspc ) and cholesterol with a surface coating of peg.27 dspc , which has two completely saturated fatty acids ( both stearic acids ) , has high phase - transition temperature ( tm ) , 55c , and good compatibility with cholesterol . normally , lipid bilayer has two thermodynamic phases : gel or liquid - crystal phase . at temperature < tm , the lipid membrane is in the gel phase , which is relatively rigid and tight because the lipid molecules have lower energy of random motion and the hydrocarbon chains are fully extended and closely packed .", "liposomes composed of phospholipids like dspc have higher stability compared with others containing unsaturated fatty acid ( egg phosphatidycholine [ pc ] ) or fatty acids of shorter or not uniform carbon chains like hydrogenated soy pc ( hspc ) . in a phase", "i clinical study , lipo - dox achieved the most prolonged circulation half - life ( 65 hours).73 however , tseng et al demonstrated that there were no differences in survival between free doxorubicin only ( median survival time of 23 days ) and lipo - dox ( medium survival time of 23.5 days ) in a murine b - cell lymphoma model.74 in patients with metastatic breast cancer , the median time to disease progression of 163 days represented the result of lipo - dox treatment and the median duration of response in responding patients ( 286 days ) are comparable with those of doxil treatment.75 neutropenia , stomatitis , and skin toxicity were reported in many cases of lipo - dox administration .", "for lipo - dox , stomatitis appeared at doses of 30 mg / m and reached dose limit at 50 mg / m.27 in contrast , doxil reached dose limit at 80 mg / m and hence lipo - dox had higher incidence of severe stomatitis than doxil . in comparison with myocet ( the non - pegylated form of liposomal doxorubicin ) , doxil and lipo - dox ( both pegylated forms of liposomal doxorubicin ) both showed significant incidence of stomatitis and this is mainly due to the long circulation properties of pegylated liposomes.27,71,72 the new generation of doxorubicin - loaded liposomes are thermosensitive liposomes ( tsls ) , which release their encapsulated drugs in regions where local tissue temperatures are elevated.76 compared with non - tsls that remain stable and do not release drug in the physiologic temperature range , tsls undergo a gel - to - liquid crystalline phase change when heated that renders the liposomes more permeable , releasing their encapsulated drugs .", "thermodox ( celsion corporation , lawrenceville , nj ) , a proprietary tsl encapsulation of doxorubicin , has recently begun phase iii clinical trials for the treatment of hepatocellular carcinoma.77 thermodox is composed of dipalmitoylphosphatidylcholine ( dppc ) , monostearoylphosphatidylcholine ( mspc ) , and polyethylene glycol 2000-distearoylphosphatidylethanolamine ( peg 2000-dspe ) in 90:10:4 molar ratio.49,50 in the design of tsls , it is necessary to choose a phospholipid that has a gel - to - liquid crystalline phase transition temperature ( tc ) in the temperature range of clinically attainable local hyperthermia ( 41c 42c ) .", "the mechanism behind tsls is the temperature - induced membrane instability at the tc of the used lipids .", "dppc with a tc = 41.5c is an ideal lipid according to temperature - triggered technology.78,79 for liposomes composed of dppc alone , the rate of release and the amount released are relatively small . by incorporating a small amount of lysolipids , such as mspc or monopalmitoylphosphatidylcholine , into dppc liposomes ,", "tc is shifted down slightly and membrane instability and drug release rate is significantly enhanced at tc . in vitro release studies , monopalmitoylphosphatidylcholine - containing tsls released about 45% of encapsulated doxorubicin in bovine serum at 42c in a few seconds ( 20 seconds ) , while pure dppc liposomes released only 20% over 1 hour.79 banno et al demonstrated that the presence of mspc , rather than peg 2000-dspe , in dppc liposomes would give rise to the rapid drug - release profile in vitro , suggesting that lysolipid is the more important component in determining the rate of tsl content release.80 indeed , banno s in vivo data showed that the presence of 9.6 mol% mspc in tsl could result in more rapid elimination of the encapsulated doxorubicin ( t1/2 = 1.29 h ) , compared with the formulation without lysolipid ( t1/2 = 2.91 h ) . in 2007 ,", "dromi et al compared the accumulation of doxorubicin in mice tumors among free doxorubicin , doxil , and thermodox.50 results showed that over time , doxorubicin gradually increased in tumors when both doxil and thermodox were used but not with free doxorubicin . at 24 hours after administration , doxorubicin concentrations in tumors were found to be significantly higher with doxil than thermodox .", "thermodox is currently under evaluation in clinical trials and hence the therapeutic efficacy of thermodox is still unknown ." ], [ "daunorubicin is classified as an anthracycline anticancer drug in the treatment of leukemia and a wide variety of solid tumors , but its major drawbacks are myelosuppression and cardiotoxicity.81 daunorubicin has also been incorporated into liposomes for the formulation of liposomal anticancer chemotherapy drugs .", "daunoxome ( gilead sciences , inc ) is a commercial liposomal formulation of daunorubicin in which the drug is entrapped into small unilamellar vesicles ( 45 nm ) composed of dspc and cholesterol in 2:1 molar ratio . in animal studies with tumor models in mice", ", daunoxome increased tumor uptake of daunorubicin ten - fold when measured against free drug ( 2470.5 vs 245.1 g ", "hr / ml for 048 hours).82 furthermore , clinical pharmacokinetic studies have demonstrated that daunoxome was 36-fold higher in auc ( 375.3 vs 10.33 g hr / ml ) in comparison with conventional daunorubicin.83 in a phase iii trial of daunox - ome versus a conventional combination of doxorubicin , bleomycin , and vincristine ( abv ) in aids - related kaposi s sarcoma , the efficacy of daunoxome was comparable to that of vincristine . response rates ( 25% vs 28% ) , time to treatment failure ( 115 vs 99 days ) , and overall survival ( 369 vs 342 days ) were similar on both treatment arms.84 moreover , patients treated with daunoxome experienced less alopecia ( 8% vs 36% ) and neuropathy ( 13% vs 41% ) and their cardiac function remained stable" ], [ "taxol ( paclitaxel ) is a marketed product for the treatment of ovarian , breast , non - small cell lung cancer , and aids - related kaposi s sarcoma.40 however , paclitaxel is only sparingly soluble in water and , therefore , intravenous administration depends on the use of the non - ionic surfactant cremophor el ( polyethoxylated castor oil ) to achieve a clinically relevant concentrated solution .", "unfortunately , cremophor el increases toxicity and leads to hypersensitivity reactions in certain patients.85 the lep - etu formulation of paclitaxel is being developed to potentially reduce toxicities associated with taxol by eliminating the drug formulation component polyoxyethylated castor oil .", "lep - etu formulations composed of 1,2-dioleoyl - sn - glycero-3-phosphocholine ( dopc ) , cholesterol , and cardiolipin in 90:5:5 molar ratio were prepared by the modified thin - film hydration method .", "dopc , a zwitterionic natural phospholipid , is chosen as one of the lipid components in the lep - etu formulation because of a low tc ( 22c ) and hence dopc can form more flexible liposomes to entrap highly hydrophobic molecules . moreover ,", "liposomes containing cardiolipin reportedly reduced cardiotoxicity associated with doxorubicin by altering the pharmacokinetics and tissue distribution of the drug and hence cardiolipin may also exert similar results in lep - etu.86 fetterly et al evaluated the maximum tolerated dose , dose - limiting toxicities , and pharmacokinetics of liposome - encapsulated paclitaxel ( lep - etu ) in comparison with taxol.87,88 the maximum tolerated dose of lep - etu was 325 mg / m in a phase i study of patients with locally advanced or metastatic carcinoma.88,89 this dose is higher than that achieved with taxol , which is typically delivered at a dose range of 135 to 200 mg / m .", "the major toxicity to administration of paclitaxel is neuropathy . in the phase i study ,", "neurotoxicity occurred in 5 of 12 patients ( 42% ) treated with lep - etu at 325 mg / m .", "although a direct comparison with taxol is not possible , neutropenia was seen in 53% of metastatic breast cancer patients treated with 250 mg / m taxol as demonstrated by winer et al.89 therefore , the neuropathy caused by lep - etu appears to be no worse than that reported for taxol within 3 weeks of treatment .", "following lep - etu administration , the auc of paclitaxel in patients with advanced or metastatic carcinoma was improved ( 8.2 to 6.16 g hr / ml ) with increasing dose ( 135 to 375 mg / m ) , which is similar to taxol .", "although similarities exist between the plasma pharmacokinetics of the two formulations , the clinical evidence obtained from the phase i study shows lep - etu can be administered safely at higher doses than taxol.88,89 another liposome formation of paclitaxel is endotag-1.4244 the formulation of endotag-1 is prepared by 1,2-dioleoyl-3-trimethylammonium propane ( dotap ) , dopc , and paclitaxel in 50:47:3 molar ratio .", "dotap is a cationic synthetic lipid , which comprises one positive charge at the head group .", "the use of cationic lipids to enhance gene delivery has been studied extensively , but their application in clinic is relatively unexplored .", "recently , there has been great interest in cationic liposomes , mainly due to their inherent ability to selectively target tumor vasculature .", "this selective affinity of cationic liposomes to tumor vasculature provides an opportunity for the development of many anti - angiogenic and anticancer formulations based on cationic liposomes.42 endotag-1 is the first formulation of cationic liposomes carrying paclitaxel in clinical trial . for commercial storage", ", endotag-1 formulations are lyophilized , and they are reconstituted with water for injection directly prior use . in preclinical programs ,", "endotag1 - 1 inhibited tumor growth also in taxol - resistant animal tumor models such as b16 melanoma and sk - mel 28 melanoma .", "endotag-1 demonstrated a strong antivascular effect on the preexisting tumor vasculature and affected several tumor microcirculatory parameters . in a phase ii trial of patients with pancreatic adenocarcinoma who were not candidates for surgery , endotag-1 in combination with gemcitabine", "substantially extended overall survival compared with gem - citabine alone.90 median survival in patients who received gemcitabine alone was 7.2 months , whereas it was up to 9.4 months in those who received combination treatment of endotag-1 plus gemcitabine .", "after 6 and 12 months of treatment , survival rate was superior for all endotag-1 doses plus gemcitabine compared with gemcitabine alone .", "the 12-month survival rates in patients given the two higher doses of endotag-1 ( 22 and 44 mg / m plus gemcitabine ) were 36% and 33% , respectively , compared with 17.5% in those given gemcitabine alone .", "combination treatment with endotag-1 plus gemcitabine was well tolerated and led to substantially more prolonged survival rates compared with standard therapy in this phase ii trial .", "further clinical studies are warranted to demonstrate a statistically significant survival benefit associated with endotag-1 plus gemcitabine in advanced pancreatic cancer ." ], [ "the incorporation of viral membrane proteins or peptide antigens into liposomes has been shown to potentiate cell - mediated and humoral immune response , and generate solid and durable immunity against the pathogen .", "virosomes are reconstituted virus liposomes , constructed without the genetic information of the virus making them unable to replicate or cause infection.91,92 the lipid layers of virosomes , composed of dioleoyl phosphatidylethanolamine ( dope ) and dopc , are employed to mimic viral membrane for vaccine delivery .", "epaxal and inflexal v are both vaccine products using the virosome - based antigen delivery system for commercial use ( table 1 ) . for the production of inflexal", "v , the influenza viruses , grown in hens eggs , are first inactivated with beta - propiolactone .", "the influenza surface antigens , hemagglutinin and neuraminidase , are then purified and mixed with the phospholipid lecithin to form virosomes . due to the virosomal technology ,", "hepatitis a virus ( hav ) vaccine epaxal , and influenza vaccine inflexal v are highly efficacious by mimicking natural viral infection . the use of virosomes to deliver hepatitis a or influenza antigens stimulates a strong immune response of immunocompetent cells .", "in contrast to other commercially available hav vaccines , epaxal is an aluminium - free vaccine based on formalin - inactivated hepatitis a ( strain rg - sb ) antigen - incorporated virosomes . in a clinical study by usonis et al ,", "seroprotection rates were 100% in all infants and children at 1 and 12 months after primary vaccination with epaxal.35 in contrast , the seroprotection rate after vaccination with the aluminium - containing vaccine havrix ( glaxosmithkline biologicals rixensart , belgium ) was 67.7% in infants with pre - existing maternal anti - hav antibodies , and a booster vaccination was required for complete seroprotection .", "moreover , epaxal was generally well tolerated by infants and children , with no serious systemic or local events reported after either primary or booster vaccination . for inflexal", "v , most studies have shown inferior efficacy or ineffectiveness on clinical parameters for these vaccines compared with the nonadjuvanted , split - virus , or subunit seasonal vaccines.93 kanra et al , compared the immunogenicity and safety of inflexal v in children with a split influenza vaccine , fluarix ( glaxosmithkline biologicals , dresden , germany).94 both vaccines were well tolerated and could induce effective immune responses in children .", "interestingly , the virosome - adjuvanted influenza vaccine showed greater immunogenicity ( 88.8% seroconversion rates for h3 n2 ) over the split influenza vaccine ( 77.5% seroconversion rates for h3 n2 ) in unprimed children .", "in essence , virosomal techniques may not be able to give superior protective immunity in clinic but play an important role in preventing morbidity and lethality associated with vaccine ." ], [ "verteporfin is a hydrophobic chlorin - like photosensitizer , which has been shown to be highly effective for photodynamic therapy in vivo .", "however , verteporfin also has a tendency to undergo self - aggregation in aqueous media , which can severely limit drug bioavailability to biological systems .", "it is important to introduce verteporfin into the bloodstream in its monomeric form and hence verteporfin was encapsulated in liposomes ( visudyne ) for intravenous drug delivery.2931 the lipid layers of visudyne are composed of unsaturated egg phosphatidylglycerol and dimyristoyl phosphatidyl choline in 3:5 molar ratio .", "visudyne was the only drug approved by the fda for the photodynamic treatment of age - related macular degeneration .", "visudyne treatment prevents the growth of the destructive blood vessels without hurting the surrounding tissues .", "phase i and ii clinical trials were conducted for 609 patients with age - related macular degeneration.95,96 after 12 months of treatment , the group treated with visudyne ( 6 mg / m body surface area ) had statistically better visual acuity , contrast sensitivity , and fluorescein angiographic outcomes than those who had placebo treatment ( 5% dextrose in water ) . at the examination 12-months posttreatment , 246 ( 61% ) of 402 eyes assigned to verteporfin compared with 96 ( 46% ) of 207 eyes assigned to placebo had lost fewer than 15 letters of visual acuity from baseline . in subgroup analyses , the visual acuity benefit of verteporfin therapy", "was clearly demonstrated ( 67% vs 39% ) when the area of choroidal neovascularization , caused by age - related macular degeneration , occupied 50% or more of the area of the entire lesion .", "however , chowdhary et al reported that visudyne was readily destabilized in the presence of relatively low concentrations of plasma.29 therefore , the aim of future investigation of liposomal formulations in ophthalmology is to develop stable liposome structures for extending the plasma circulation time following intravenous injection ." ], [ "since the first liposomal pharmaceutical product , doxil , received fda approval in 1995 , liposomes have been widely applied as drug carriers in clinic . until now", ", several important types of liposomes , such as pegylated liposomes ( doxil and lipo - dox ) , temperature sensitive liposomes ( thermodox ) , cationic liposomes ( endotag1 - 1 ) , and virosomes ( expal and inflexal v ) have been investigated for clinic use .", "in contrast with liposomal - based drugs on the market ( table 1 ) , liposome - based drugs in clinical trials ( table 2 ) focused more on the types of delivered drugs ( eg , cisplatin , blp25 lipopeptide , grb2 antisense oligodeoxynucleotide , bacteriophage t4 endonuclease 5 , etc ) and therapeutic applications ( from topical delivery systems to portable aerosol delivery systems ) . new liposomal formulations , such as pegylated liposomes , may extend blood circulation time , vary drug distribution in the body , and hence reduce the possible side effects related to the drugs ( eg , cardiotoxicity ) . however , pegylated liposomes ( doxil and lipo - dox ) displayed significant incidence of stomatitis in clinical trials , which may be related to pegylation .", "moreover , some of the new generation liposomes showed only comparable or even poor therapeutic efficiency compared with free drug or conventional vesicles in clinical trials . in comparison with doxil ,", "thermodox displayed significantly weaker doxorubicin accumulation in mice tumors at 24 hours after administration.50 endotag-1 plus gemcitabine and endotag-1 plus paclitaxel achieved excellent therapeutic effect in two phase ii clinical trials in pancreatic cancer and triple receptor - negative breast cancer , but endotag-1 therapy alone in triple receptor - negative breast cancer resulted in poor survival rate ( 34% ) and median progression - free survival time ( 3.4 months ) in comparison with paclitaxel ( 48% and 3.7 months).97 spi-077 , the first liposomal formulation of cisplatin , had limited clinical efficacy in a phase ii clinical trial of advanced non - small cell lung cancer , even though spi-077 demonstrated enhanced cisplatin tumor accumulation in preclinical models.98 similar to spi-077 , a phase ii study of liposomal annamycin in the treatment of doxorubicin - resistant breast cancer had no detectable antitumor activity.99 although new liposomal - based drugs have been well studied in preclinical animal models , these liposomal pharmaceutical products may be unable to provide promising therapeutic effects in clinical trials . for future development of liposomal - based drugs", ", the comparison of drug circulation time in blood , drug accumulation in tissues , and possible toxicity between conventional vesicles and new generations of liposomes should be investigated in preclinical animal models .", "furthermore , there should also be focus on the clinical therapeutic effects and toxic side effects of liposomal lipid composition ." ] ]

[ [ "a 60-year - old male patient was referred to an otorhinolaryngology clinic due to a lump on the left side of his jaw , which had grown in 2 months .", "ultrasound sonography test examination revealed a cystic mass that was 2417 mm in size with smooth contours .", "multiple echogenic and reactive lymph nodes with partially visible hila were visualized in the neighboring upper jugular chain , with the largest being 1610 mm in size . following a neck magnetic resonance imaging and a preliminary diagnosis of wt ,", "left superficial parotidectomy materials were sent for pathologic examination in two pieces , which were 53.22 cm and 4.531.2 cm in size .", "cross section analysis showed an off white - yellowish , well - contoured nodular tumor with a bleeding center of 42.52.2 cm .", "microscopic examination indicated that the tumor had epithelial components with basaloid and oncocytic columns of cells neighboring lymphoid components ( fig .", "in addition to the lymphoid follicles with distinct germinal centers , infiltration of large neoplastic cells with bizarre and extremely atypical morphology was seen in the lymphoid component ( figs . 2 , 3 ) .", "4b ) , leukocyte common antigen , igg , cd138 , mum1 , and focal positivity for kappa .", "staining for lambda , igm , iga , cd3 , cd5 , cd10 , cd15 , cd56 , epithelial membrane antigen , bcl2 , bcl6 , cyclind1 , s100 , pancytokeratin , cytokeratin 20 , human melanoma black 45 , actin , and desmin were negative .", "latent epstein - barr virus ( ebv ) was shown to be negative in tumor cells by using ebv - encoded rna chromogenic in situ hybridization . due to these findings", ", the patient was diagnosed with \" wt and cd30 positive diffuse large b - cell lymphoma in the parotid gland . \" following the lymphoma diagnosis , a full body screen was performed .", "in addition to these findings , the left suprarenal gland showed two nodular mass lesions , which were assessed as likely adenomas ; however , this preliminary diagnosis was not confirmed by histopathology .", "the patient was stage 3a and received six courses of rituximab , cyclophosphamide , doxorubicin , vincristine , and prednisone ( r - chop ) therapy . during 6-month follow - up , the patient was free of disease ." ], [ "wt is the second most common type of salivary gland tumor . in 10 - 15% of cases , it is bilateral , and it accounts for 70% of all bilateral salivary gland tumors.2 the male / female ratio is 1.6/1 , and it typically develops in the 6th and 7th decades . smoking increases the risk of developing wt.5 microscopically the tumors are typically composed of proliferative epithelial components accompanied by lymphoid stroma with lymphoid follicles that have distinct germinal centers .", "histogenesis of the lymphoid stroma in wt has been a topic of discussion for many years .", "lymphoid stroma can arise as a cell response to epithelial neoplasms or as a normal lymph node due to residue held by the epithelial neoplasm.5,6 the most widely accepted hypothesis suggests that wt is a neoplasm that develops in the heterotopic salivary gland ductus within or around the parotid lymph nodes.7 transformation to carcinoma in wt is a well - known phenomenon ; however , the development of lymphomas from wts is very rare.4,8 although some cases contain a normal residual lymphoid component , in others cases the lymphoid component contains entirely neoplastic lymphoid cells.4 in the present case , non - neoplastic lymphoid tissue was also present in the neighboring areas .", "the pathogenesis of malignant transformation of wt remains unclear ; however , exposure to radiation is of particular interest , as the relationship between previous radiotherapy and lymphomas arising from wts has been determined by some authors.4,5,9 chronic immune sialadenitis is thought to play an important role , independent of the presence of sjgren syndrome symptoms.4,7,10 in this case , there was no history of radiotherapy or sialadenitis , but a history of smoking may have provoked the development of wt .", "saxena et al.1 state that because the lymphoid stroma of wt is part of the systemic lymphoid tissue , in patients with lymphomatous spread of wt , disseminated disease is present during the staging either at the time of the diagnosis or after . in the present case ,", "with screening techniques , lymphadenopathies of a pathologic size were found in the inguinal and iliac regions .", "some researchers suggested that although the relationship between wt and lymphoma could be coincidental , it might also be of a pathogenic nature . according to the latter statement , a single agent can affect different tissues or one tumor could trigger the formation of another . from this point of view , the epithelial component is a continuous antigenic stimulator for the lymphoid component , which provides the stimulus for the development of lymphoma.1,6,8 according to this theory , the frequently observed reactive follicular hyperplasia in wt may be histological evidence of chronic antigen stimulation.1 it has been suggested that the lymphomas seen with wt are typically non - hodgkin lymphomas ; however , there are a few cases reporting hodgkin 's lymphomas.11,12 the majority of non - hodgkin 's lymphomas in wt are follicular lymphomas .", "dlbcl , small lymphocytic lymphoma , extranodal marginal zone lymphoma of mucosa associated lymphoid tissue , and mantle cell lymphoma have also been reported.4,6,8,9 a small number of t - cell lymphomas such as peripheric t - cell lymphoma and t - cell lymphoblastic lymphoma have also been described in wt.4,8,13 in summary , malignant lymphomas in wt are very rare .", "the presented case is a diffuse large b - cell lymphoma expressing cd30 positivity . to the best of our knowledge", "this is the first case in literature describing dlbcl with expression of cd30 in wt ." ] ]

[ [ "they almost always require open reduction and internal fixation . due to the increase in the emergence of native bone setters", ", these fractures are increasingly been managed by these spurious bone setters using native splints . as a result", "the choice of implants used can be either a dynamic condylar screw plate ( dcs ) orproximal femoral nail ( pfn ) ." ], [ "here we have used a surgical grade 316 l stainless steel proximal femoral anatomical locked compression plate ( pf - lcp ) .", "we analyzed 13 patients with established non unions of subtrochanteric fractures treated in our centre by the use of the pf - lcp .", "all our patients were followed up by serial radiographs at 6 , 12 , 18 , 24 weeks and thereafter at 6 months interval .", "union was achieved in 11 out of 13 patients at 12 weeks whereas two patients had delayed union which eventually healed at 18 weeks and 24 weeks .", "the average harris hip score at 1 year follow - up was excellent in eight , good in four and fair in one patient respectively ." ], [ "we conclude that in complicated non - unions , the use of pf - lcp has a definite positive role in the management of such cases ." ], [ "while inter - trochanteric malunite frequently , subtrochanteric fractures most often end in non - unions .", "the interposing soft tissues along with the displacement means that these fractures necessitate open reduction . also to complicate matters ,", "there has been a surge in the number of traditional bone setters who use native splints with massages .", "hence , the frequency of non - union subtrochanteric fractures has increased in the recent past . the implant of choice has traditionally been either dcs plates or pfn . in our study", "clinical picture of the anatomical pf - lcp with proximal screws showing divergent screws and various angles ( 95 , 120 and 135 degrees )" ], [ "we analyzed 19 consecutive patients with non - unions of subtrochanteric fractures who presented to our clinic .", "all patients underwent open reduction with removal of interposing fibrous tissue , freshening of the edges and anatomical reduction .", "the pf - lcp was used with proximal 6.5 mm locking cancellous screws and distally using both cortical and locked screws .", "primary bone grafting was done in two patients ( seinsheimer type iv ) i.e patients s. no . 2 and 12 [ table no .", "2 ] to maintain poesteromedial cortical contact . wound closure and suture removal done as per standard guidelines .", "all patients were started on non - weight bearing walking for 6 weeks . then weight bearing was started as tolerated .", "eleven out of 13 patients started full weight bearing by 12 weeks with 2 patients walking full weight bearing at 18 and 24 weeks respectively .", "the functional assessment was done using the modified harris hip score and results were tabulated ( table 2 ) .", "serial radiographs were taken at 6 , 12 , 18 , 24 weeks follow - up and thereafter at 6 months interval ." ], [ "two patients ( case no . 2 and 12 ) had delayed unions which healed eventually at 18 and 24 weeks respectively . they were both type iv seinsheimer fracture pattern with loss of posteromedial cortical contact .", "they were primarily grafted and this could be a possible reason for the delayed union .", "there was one patient who had one case of wound dehiscence which required secondary suturing under local anaesthesia ( case no.9 ) .", "at one year follow - up , all our patients were ambulatory full weight bearing , walking without any aid and were doing well .", "the functional assessment showed excellent results in eight [ fig . 2 , 3 & 4 ] , good in four and fair in one patient respectively .", "we do not routinely advise or perform implant removals for any of our patients due to social and financial constraints . pre ", "op x ray showing type v seinsheimer fracture non - union with smooth edges post op x ray at 1 year follow - up showing complete fracture union with implant insitu in good position a : clinical photo at 1 year follow - up showing excellent function of hip movements figure 4b : clinical photo at 1 year showing no limb length inequality ." ], [ ". the earlier used proximal femoral side plates namely dcs and the newly introduced pf - lcp have their own advantages in select cases .", "shukla et al reviewed 60 patients treated with i m nailing and reported a union rate of 95 % .", "they also reported a higher malunion and non - union rate in those patients treated by closed reduction than those treated by open reduction ( 3 and 1 in open versus 6 and 2 in closed reduction group ) .", "they also concluded that the complication rate was higher in those fractures fixed in varus ( > 10 degrees ) at the fracture emphasizing that correct anatomical alignment is of paramount importance in achieving union . in our study , all our patients underwent open reduction and anatomical reduction was achieved in all our patients .", "hence , we had a comparable union rate with no varus collapse or implant failure .", "bartonincek et al used the double angled blade plate with valgus osteotomy in his series of 15 patients and achieved a union rate of 93.33% which is comparable to our study .", "one patient had an implant failure due to a repeat fall and required revision surgery .", "the average harris hip score improved from 73 pre - operatively to 92 following surgery . in our study , the average harris hip score following union was 89 which is comparable .", "pelet et al compared gamma nail versus side plate and reported 100 % healing with gamma nail with 2 failures in the side plate group .", "however though we have used only anatomical pf - lcp and achieved comparable union rates . however weight bearing was delayed till about 12 weeks in 11 out of 13 patients ( radiological union ) .", "liporace et al reported a case report of using a femoral fixator distractor over a i m nail to achieve length in a patient with limb length discrepancy . in our study", ", we were able to restore limb length to within 0.5 cm of the opposite normal side in all our patients .", "giannoudis et al reported a new diamond concept of treating non union subtrochanteric fractures using local injection of growth factor ( rhbmp-7 ) , ria ( reamer irrigator aspirator ) and mesenchymal growth factors ( msc ) .", "he concluded that in addition to the above , preventing varus malalignment at the fracture is the keystone to allow fracture healing and prevent implant failure .", "muller et al reported a careful usage of additional circlage wiring to provide stability to the fracture site treated by i m nail .", "in our study , we ensured anatomical reduction along the posteromedial cortex was achieved to prevent varus collapse at the fracture leading to implant pull out .", "pugh et al compared first generation nails to second generation nails and preliminary reports by them suggested a slight biomechanical advantage for the second generation nail over the first generation nails . in our study", ", we have obtained results which are comparable to the i m nail with fewer complications .", "omalley et al showed in 46 patients of unstable trochanteric fractures treated by intra medullary devices that there was on an average a 7 mm lateral shift of the distal femoral shaft ( i.e wedge effect ) . as a result", "all of those patients had a varus malignment ( neck shaft angle of 129 degrees versus 133 degree in the opposite normal hips ) but the fracture eventually united .", "in our study , we ensured a near anatomical neck shaft angle and supported the postero - medial cortex with graft when required ( case no.2 & 12 ) to ensure that no varus collapse occurs .", "seyham et al compared the outcomes of proximal fractures using pfna and intertan nails and concluded that the rate of proximal screw back - out and varus collapse was significantly higher in the pfna than in the intertan group . in our study", ", we did not report any varus collapse or implant pull out in any of our cases .", "niu et al conducted a survey among aaos members about the preferred choice of implant for proximal femur fractures .", "he concluded that although both intramedullary devices and plate fixation devices produced equal results with regard to fracture healing , the implant of choice in the current scenario is the i m device due to ease of surgery and biomechanical stability over the plate devices . in our study however , we have shown that in select complicated cases , these newer pf - lcp have proved to be as efficient and stable as i m devices .", "muller et al showed by a comparative study between pfn and dhs , a significantly higher rate of screw cut - out was seen in dhs group compared in the pfn group .", "the pf - lcp that we have used in our study has the advantage of having three locked screws in place of one dhs screw at 95,120 and 135 degrees to offer increased stability with a negligible cut out risk . in our study , we did not include a control group treated by either a pfn or dhs implant .", "however , we compared our results with the results of other authors [ 3 , 7 , 9 , 10 ] who used either pfn or dhs as the standard implant of choice for such fractures .", "the results in our study show promising outcomes in favour of the pf - lcp , but our study group is small ( 13 patients ) and we need to have a bigger study group and include more patients ." ], [ "although the gold standard remains intramedullary devices for such fractures , we have concluded from our study that the anatomical proximal femur locked plates ( pf - lcp ) is able to provide comparable results with those of i m devices .", "the potential advantages of this implant over the other side plates are as follows : three locked screws in the proximal fragment at various angles namely 95 , 120 and 135 degrees providing multi planar stability [ fig . 1 & fig .", "2 ] no loss of bone as no reaming is done as with dcs screws anatomical so no pre - contouring is required provision of combi hole to use either locking or cortical screw to achieve plate to bone contact distally .", "can be safely used with fracture extension into greater trochanter ( entry point for nail ) .", "we therefore conclude that pf - lcp is a valuable tool in the arsenal of every orthopaedic surgeon .", "we believe that with the right patient selection , this implant provides a similar result and outcome to that offered by intramedullary devices .", "although the conventional and current implant of choice is intramedullary nailing ( im / il nail ) following open reduction , the use of the pf - lcp has produced results similar to those of i m nails .", "hence , for the appropriate patient choice , the pf - lcp is a newer and proven implant to use for excellent outcomes ." ] ]

[ [ "ensuring the highest quality of health care for all stroke patients is important in the current climate of scarce resources and the increasing burden of stroke to the health sector .", "there is a strong international momentum to improve the quality of acute stroke management.1 this is supported by high level evidence that now underpins many acute stroke interventions , including several provided by allied health professionals.2 although much of the current research on quality in stroke care has focused on factors that may influence medical interventions,37 allied health professionals are similarly interested in ways to implement best practice care.8 allied health professionals are members of multidisciplinary stroke teams and contribute to patient care from early in acute admission , through the stroke rehabilitation phase , and beyond .", "the professional composition of acute stroke teams may vary internationally . in the australian context of this study ,", "allied health members include physiotherapists , occupational therapists , speech pathologists , social workers , dietitians , and psychologists.2 several researchers suggest that patient age is a determinant of the quality of medical and allied health care patients receive following acute stroke.35,913 we have previously reported that age and gender , on their own , are not related to an overall index of allied health care quality.14 further investigation is now required to determine whether patient age and gender are associated with individual measures of allied health care , and further , whether other variables , such as comorbidity , prestroke independence , and stroke severity , are putatively associated with allied health care . if there are differences in allied health care provided to patients with acute stroke , it is important to understand why care might differ , so that quality improvement strategies can be effectively targeted at problem areas .", "this paper explores demographic and stroke - related factors ( predictor variables ) , including patient age , which may be associated with individual measures of quality of care provided to acute stroke patients by allied health professionals .", "our aim was to provide systematically determined information to guide clinical quality audits and targeted quality improvement strategies in stroke care ." ], [ "ethical considerations and our sampling framework have been reported in detail previously.14 in summary , we conducted a retrospective clinical audit of medical records for 300 acute stroke patients from three metropolitan tertiary hospitals in adelaide , south australia , australia .", "sampled patients had been consecutively admitted to hospital prior to august 2009 , and the audit was conducted between november 2009 and april 2010 .", "we previously reported on an overall index of 20 performance indicators of allied health service quality , identified from a literature review ( listed in table 2).14,15 although several of these indicators relate to interdisciplinary elements of stroke care which may be shared within a stroke team , the focus of this study is the ability of allied health professionals to contribute to this work , because this is largely unexplored . in our earlier study ,", "quality of care was determined by per patient compliance with all 20 process indicators.14 in the current study phase , compliance with each process indicator was considered individually and associations were explored with predictor variables .", "allied health professionals of interest in our research were from physiotherapy , occupational therapy , speech pathology , dietetics , social work , and psychology .", "previous clinical audits and literature reviews of stroke provided awareness of the demographic and clinical variables that could be extracted retrospectively from medical records.1315 these variables are captured by stroke clinicians to assist diagnosis and clinical management , or for service monitoring .", "data were extracted from medical records on patient age , gender , premorbid levels of independence and accommodation type , english proficiency , comorbidity levels , weekend or weekday admission , stroke unit admission , initial stroke severity , length of stay in the acute hospital , and process indicator compliance .", "many of these demographic and clinical variables have been associated with care quality in the stroke literature , especially for medical care,14 or as predictors of stroke outcomes .", "however , none of these predictor variables have previously been well explored for their influence on stroke care by allied health professionals .", "in addition to the evidence discussed above regarding age - related differences in care , researchers have reported associations between gender and stroke care quality.1618 stroke severity is strongly linked to survival and discharge destination outcomes,19,20 and a priori reasoning suggests that it may prompt allied health care processes , such as swallow assessment , in patients with obvious risks of poor outcome .", "stroke severity may also influence the ease with which specific care , such as early rehabilitation , can be achieved .", "admission over a weekend has previously been reported to influence care standards and patient outcomes following acute stroke.12,21 the scarcity of allied health staff at the research sites over weekends suggested that day of admission may alter care .", "patient outcomes following stroke have been associated with previous levels of independence and accommodation,22,23 comorbidity levels,24,25 and length of stay in the acute hospital.26,27 these factors may influence allied health staff decisions regarding care , for example , the priority given to early rehabilitation interventions .", "factors such as length of stay may also influence the achievability of some care processes for patients .", "we considered english proficiency in our study because it has previously been linked to stroke outcomes and the quality of health care patients receive.28,29 a simple causal pathway was constructed to assist in our understanding of how to undertake the analysis of the putative predictors of the allied health indicators of care .", "this approach was based on the causal modeling theory of rothman and greenland.30 we called this a simple causal pathway because we had no understanding at this point of the ongoing influence of early predictor variables on other variables which become important along the pathway .", "we undertook a series of analyses to understand the relationships between the putative predictor variables and each care process indicator , using our causal pathway as an analysis model .", "univariate logistic regression models were constructed between : adherence with individual process indicators and age ; adherence with individual process indicators and non - age predictor variables ; the association of age with other predictor variables ; and the association between non - age variables .", "data were analyzed using sas proprietary software ( v 9.2 ; sas institute , cary , nc ) .", "correlations between variables were expressed as relative risks , odds ratios ( or , as appropriate ) , and 95% confidence intervals ( ci ) .", "we report relative risks for the first two of the analyses because we were examining associations between independent care predictors with dependent variables ( indicators of care quality derived from cross - sectional observational data ) .", "we reported or for the third and fourth analyses because we were examining the association between independent variables .", "as reported in our earlier paper , age was most appropriately dichotomized as younger ( < 75 years ) and older ( 75 + years ) patients.14 stroke severity on admission was determined by retrospectively extracting data from medical records to complete a national institute of health stroke scale ( nihss ) for each patient .", "the nihss is a widely used , valid , and reliable measure of stroke severity.31,32 it is also reliable and valid when data are extracted retrospectively from patient medical records.33,34 based on previous stroke studies , nihss scores were divided into three groups for analysis , ie , mild strokes ( nihss < 8) , moderate severity strokes ( nihss 816 ) , and severe strokes ( nihss > 16).35 comorbidity levels were measured using the charlson comorbidity index ( cci ) , which is a summary score of the existence or absence of 17 medical conditions , weighted to account for disease severity.36 this index has been validated as a predictive comorbidity index for patients with stroke .", "it has been used in previous stroke outcome studies and has also been validity and reliability tested for retrospective data extraction.37,38 comorbidity information was extracted from the medical records to complete a cci for each patient . based on analysis reported in previous studies , patient cci scores were dichotomized as low comorbidity levels ( cci 1 ) vs high comorbidity levels ( cci > 1).38 patients admitted between 1600 hours on a friday and 2400 hours on a sunday , when access to allied health professionals was scarce , were recorded as weekend admissions .", "admission directly from the emergency department to a stroke unit was recorded in binary terms ( yes = 1 , no = 0 ) .", "nonaphasic patients were recorded as not proficient in english if there was evidence that assistance had been required with language translation , or if limited english or similar was found in the medical records .", "premorbid dependence level was recorded as independent or dependent , according to whether assistance was required with activities of daily living or instrumental activities of daily living.39 premorbid accommodation was recorded as a private home or a residential care facility ( nursing home or hostel ) .", "length of stay data ( in days ) was broadly classified for analysis . for univariate analysis ,", "length of stay was dichotomized into shorter stay ( < 12 days ) and longer stay ( 12 days ) .", "the cut point of 12 days was the mean length of stay for the data set and was also the average length of stay for acute stroke patients at the three data collection hospitals in 2007/08 and 2008/09.40 to provide more detailed consideration of the possible influence of length of stay on care , analysis considered length of stay in three groups divided at the data tertiles ( < 4 days , 49 days , and 10 days ) ." ], [ "we previously reported on an overall index of 20 performance indicators of allied health service quality , identified from a literature review ( listed in table 2).14,15 although several of these indicators relate to interdisciplinary elements of stroke care which may be shared within a stroke team , the focus of this study is the ability of allied health professionals to contribute to this work , because this is largely unexplored . in our earlier study ,", "quality of care was determined by per patient compliance with all 20 process indicators.14 in the current study phase , compliance with each process indicator was considered individually and associations were explored with predictor variables .", "allied health professionals of interest in our research were from physiotherapy , occupational therapy , speech pathology , dietetics , social work , and psychology ." ], [ "previous clinical audits and literature reviews of stroke provided awareness of the demographic and clinical variables that could be extracted retrospectively from medical records.1315 these variables are captured by stroke clinicians to assist diagnosis and clinical management , or for service monitoring .", "data were extracted from medical records on patient age , gender , premorbid levels of independence and accommodation type , english proficiency , comorbidity levels , weekend or weekday admission , stroke unit admission , initial stroke severity , length of stay in the acute hospital , and process indicator compliance .", "many of these demographic and clinical variables have been associated with care quality in the stroke literature , especially for medical care,14 or as predictors of stroke outcomes . however , none of these predictor variables have previously been well explored for their influence on stroke care by allied health professionals .", "in addition to the evidence discussed above regarding age - related differences in care , researchers have reported associations between gender and stroke care quality.1618 stroke severity is strongly linked to survival and discharge destination outcomes,19,20 and a priori reasoning suggests that it may prompt allied health care processes , such as swallow assessment , in patients with obvious risks of poor outcome .", "stroke severity may also influence the ease with which specific care , such as early rehabilitation , can be achieved .", "admission over a weekend has previously been reported to influence care standards and patient outcomes following acute stroke.12,21 the scarcity of allied health staff at the research sites over weekends suggested that day of admission may alter care .", "patient outcomes following stroke have been associated with previous levels of independence and accommodation,22,23 comorbidity levels,24,25 and length of stay in the acute hospital.26,27 these factors may influence allied health staff decisions regarding care , for example , the priority given to early rehabilitation interventions .", "factors such as length of stay may also influence the achievability of some care processes for patients .", "we considered english proficiency in our study because it has previously been linked to stroke outcomes and the quality of health care patients receive.28,29" ], [ "a simple causal pathway was constructed to assist in our understanding of how to undertake the analysis of the putative predictors of the allied health indicators of care .", "this approach was based on the causal modeling theory of rothman and greenland.30 we called this a simple causal pathway because we had no understanding at this point of the ongoing influence of early predictor variables on other variables which become important along the pathway ." ], [ "we undertook a series of analyses to understand the relationships between the putative predictor variables and each care process indicator , using our causal pathway as an analysis model .", "univariate logistic regression models were constructed between : adherence with individual process indicators and age ; adherence with individual process indicators and non - age predictor variables ; the association of age with other predictor variables ; and the association between non - age variables .", "data were analyzed using sas proprietary software ( v 9.2 ; sas institute , cary , nc ) .", "correlations between variables were expressed as relative risks , odds ratios ( or , as appropriate ) , and 95% confidence intervals ( ci ) .", "we report relative risks for the first two of the analyses because we were examining associations between independent care predictors with dependent variables ( indicators of care quality derived from cross - sectional observational data ) .", "we reported or for the third and fourth analyses because we were examining the association between independent variables ." ], [ "as reported in our earlier paper , age was most appropriately dichotomized as younger ( < 75 years ) and older ( 75 + years ) patients.14 stroke severity on admission was determined by retrospectively extracting data from medical records to complete a national institute of health stroke scale ( nihss ) for each patient .", "the nihss is a widely used , valid , and reliable measure of stroke severity.31,32 it is also reliable and valid when data are extracted retrospectively from patient medical records.33,34 based on previous stroke studies , nihss scores were divided into three groups for analysis , ie , mild strokes ( nihss < 8) , moderate severity strokes ( nihss 816 ) , and severe strokes ( nihss > 16).35 comorbidity levels were measured using the charlson comorbidity index ( cci ) , which is a summary score of the existence or absence of 17 medical conditions , weighted to account for disease severity.36 this index has been validated as a predictive comorbidity index for patients with stroke .", "it has been used in previous stroke outcome studies and has also been validity and reliability tested for retrospective data extraction.37,38 comorbidity information was extracted from the medical records to complete a cci for each patient . based on analysis reported in previous studies , patient cci scores were dichotomized as low comorbidity levels ( cci 1 ) vs high comorbidity levels ( cci > 1).38 patients admitted between 1600 hours on a friday and 2400 hours on a sunday , when access to allied health professionals was scarce , were recorded as weekend admissions .", "admission directly from the emergency department to a stroke unit was recorded in binary terms ( yes = 1 , no = 0 ) .", "nonaphasic patients were recorded as not proficient in english if there was evidence that assistance had been required with language translation , or if limited english or similar was found in the medical records .", "premorbid dependence level was recorded as independent or dependent , according to whether assistance was required with activities of daily living or instrumental activities of daily living.39 premorbid accommodation was recorded as a private home or a residential care facility ( nursing home or hostel ) .", "length of stay data ( in days ) was broadly classified for analysis . for univariate analysis , length of stay", "was dichotomized into shorter stay ( < 12 days ) and longer stay ( 12 days ) .", "the cut point of 12 days was the mean length of stay for the data set and was also the average length of stay for acute stroke patients at the three data collection hospitals in 2007/08 and 2008/09.40 to provide more detailed consideration of the possible influence of length of stay on care , analysis considered length of stay in three groups divided at the data tertiles ( < 4 days , 49 days , and 10 days ) ." ], [ "mean age at stroke onset was 74.7 years ( standard deviation [ sd ] : 13.5 , range 18100 years ) .", "the mean length of stay in acute care was 12.5 days ( sd : 15.6 , range 198 days ) .", "the sample was proportionally balanced for gender . despite similar mean ages for males and females , a larger proportion of females were in the older age groups , with 72% females aged 75 years or older , compared with", "53% of males . a greater proportion of females suffered a moderate or severe stroke ( 28% ) than males ( 18% ) .", "for the whole sample , there were weak relationships between increasing age and increasing stroke severity ( r = 0.21 ) and comorbidity levels ( r = 0.20 ) .", "compliance with each process indicator was generally poor ( table 2 , columns 2 and 3 ) . for 16 of the process indicators ( 80% ) ,", "the outcome of univariate logistic regression models , associating process indicator adherence with age , is reported as relative risks in table 2 , column 4 .", "only one process indicator had a significant association with age , where patients younger than 75 years were significantly more likely to receive first mobilization within 24 hours of stroke onset than older patients .", "compliance with 12 of the 20 process indicators ( 60% ) was significantly correlated with non - age variables .", "the only variables which were not associated with any process indicator compliance were previous accommodation type and english proficiency . for 30% of the process indicators", "significant correlations were found between patient age , and the predictor variables of stroke severity , comorbidity levels , premorbid accommodation , premorbid independence level , gender , english proficiency , and length of stay . in summary , compared with younger patients , patients 75 years or older were significantly more likely to have a moderate - to - severe or severe stroke ( or : 1.8 , 95% ci : 1.13.2 and or : 2.9 , 95% ci : 1.46.1 , respectively ) , to have higher comorbidity levels ( or : 2.5 , 95% ci : 1.54.2 ) , to have lived in residential care ( or : 2.6 , 95% ci : 1.16.2 ) , or been previously dependent ( or : 6.2 , 95% ci : 3.212 ) .", "older patients were also more likely to be female ( or : 2.2 , 95% ci : 1.43.6 ) , to have a length of stay of 59 days ( or : 0.6 , 95% ci : 0.30.9 ) , and to have poor english proficiency ( or : 3.2 , 95% ci : 1.19.7 ) .", "females were less likely than males to have been previously independent ( or : 2.2 , 95% ci : 1.43.7 ) , more likely to have a moderate or severe ( nihss 8) stroke ( or : 0.4 , 95% ci : 0.20.6 ) , and a length of stay 10 days ( or : 0.4 , 95% ci : 0.20.7 ) .", "patients who suffered a moderate - to - severe stroke ( nihss 8) were more likely to have lived previously in residential care ( or : 0.3 , 95% ci : 0.10.7 ) , to have high comorbidity levels ( or : 0.6 , 95% ci : 0.40.98 ) , and to have a length of stay 10 days ( or : 2.6 , 95% ci : 1.54.7 ) . compared with patients having low comorbidity , high comorbidity levels were associated with previous residential care ( or : 8.3 , 95% ci : 2.035.6 ) , and previous dependence ( or : 4.1 , 95% ci : 2.18.0 ) .", "patients were less likely to be admitted to a stroke unit if they were previously dependent ( or : 5.5 , 95% ci : 2.711.3 ) or living in residential care ( or : 8.5 , 95% ci : 3.024.3 ) . patients with poor english proficiency were more likely to be dependent prior to their stroke ( or : 2.9 , 95% ci : 1.36.9 ) .", "patients admitted on a weekend were less likely to have a short length of stay ( < 4 days ) or long length of stay ( 10 days ) compared with weekday admissions ( or : 0.4 , 95% ci : 0.20.8 and or : 0.6 , 95% ci : 0.31.0 , respectively ) .", "there was also a trend for less likelihood of stroke unit care if admitted on a weekend .", "this analysis also demonstrated the potential redundancy in considering some non - age variables for their relevance to quality of allied health care .", "for example , an association between previous accommodation and previous independence was impossible to assess because all patients in residential care were , by default , also dependent .", "when this is considered in the light of earlier findings , previous independence may be the more important predictor variable because it is associated with process indicator compliance and has a stronger correlation than accommodation , with age .", "the complex confounding associations between the various non - age predictor variables are illustrated in figure 2 . in figure 3", "we revisit our initial causal pathway , adding in the associations found between adherence to allied health process indicators , and the early predictor variables captured in patient demographic and stroke event data .", "this new pathway summarizes the journey for patients admitted with acute stroke and the multiple factors that can impact on the care they receive from allied health professionals ." ], [ "mean age at stroke onset was 74.7 years ( standard deviation [ sd ] : 13.5 , range 18100 years ) .", "the mean length of stay in acute care was 12.5 days ( sd : 15.6 , range 198 days ) .", "the sample was proportionally balanced for gender . despite similar mean ages for males and females , a larger proportion of females were in the older age groups , with 72% females aged 75 years or older , compared with", "53% of males . a greater proportion of females suffered a moderate or severe stroke ( 28% ) than males ( 18% ) .", "for the whole sample , there were weak relationships between increasing age and increasing stroke severity ( r = 0.21 ) and comorbidity levels ( r = 0.20 ) ." ], [ "compliance with each process indicator was generally poor ( table 2 , columns 2 and 3 ) . for 16 of the process indicators ( 80% ) ," ], [ "the outcome of univariate logistic regression models , associating process indicator adherence with age , is reported as relative risks in table 2 , column 4 .", "only one process indicator had a significant association with age , where patients younger than 75 years were significantly more likely to receive first mobilization within 24 hours of stroke onset than older patients ." ], [ "compliance with 12 of the 20 process indicators ( 60% ) was significantly correlated with non - age variables .", "the only variables which were not associated with any process indicator compliance were previous accommodation type and english proficiency . for 30% of the process indicators" ], [ "significant correlations were found between patient age , and the predictor variables of stroke severity , comorbidity levels , premorbid accommodation , premorbid independence level , gender , english proficiency , and length of stay . in summary , compared with younger patients , patients 75 years or older were significantly more likely to have a moderate - to - severe or severe stroke ( or : 1.8 , 95% ci : 1.13.2 and or : 2.9 , 95% ci : 1.46.1 , respectively ) , to have higher comorbidity levels ( or : 2.5 , 95% ci : 1.54.2 ) , to have lived in residential care ( or : 2.6 , 95% ci : 1.16.2 ) , or been previously dependent ( or : 6.2 , 95% ci : 3.212 ) .", "older patients were also more likely to be female ( or : 2.2 , 95% ci : 1.43.6 ) , to have a length of stay of 59 days ( or : 0.6 , 95% ci : 0.30.9 ) , and to have poor english proficiency ( or : 3.2 , 95% ci : 1.19.7 ) ." ], [ "females were less likely than males to have been previously independent ( or : 2.2 , 95% ci : 1.43.7 ) , more likely to have a moderate or severe ( nihss 8) stroke ( or : 0.4 , 95% ci : 0.20.6 ) , and a length of stay 10 days ( or : 0.4 , 95% ci : 0.20.7 ) .", "patients who suffered a moderate - to - severe stroke ( nihss 8) were more likely to have lived previously in residential care ( or : 0.3 , 95% ci : 0.10.7 ) , to have high comorbidity levels ( or : 0.6 , 95% ci : 0.40.98 ) , and to have a length of stay 10 days ( or : 2.6 , 95% ci : 1.54.7 ) . compared with patients having low comorbidity ,", "high comorbidity levels were associated with previous residential care ( or : 8.3 , 95% ci : 2.035.6 ) , and previous dependence ( or : 4.1 , 95% ci : 2.18.0 ) .", "patients were less likely to be admitted to a stroke unit if they were previously dependent ( or : 5.5 , 95% ci : 2.711.3 ) or living in residential care ( or : 8.5 , 95% ci : 3.024.3 ) . patients with poor english proficiency were more likely to be dependent prior to their stroke ( or : 2.9 , 95% ci : 1.36.9 ) .", "patients admitted on a weekend were less likely to have a short length of stay ( < 4 days ) or long length of stay ( 10 days ) compared with weekday admissions ( or : 0.4 , 95% ci : 0.20.8 and or : 0.6 , 95% ci : 0.31.0 , respectively ) .", "there was also a trend for less likelihood of stroke unit care if admitted on a weekend .", "this analysis also demonstrated the potential redundancy in considering some non - age variables for their relevance to quality of allied health care .", "for example , an association between previous accommodation and previous independence was impossible to assess because all patients in residential care were , by default , also dependent .", "when this is considered in the light of earlier findings , previous independence may be the more important predictor variable because it is associated with process indicator compliance and has a stronger correlation than accommodation , with age .", "the complex confounding associations between the various non - age predictor variables are illustrated in figure 2 . in figure 3", "we revisit our initial causal pathway , adding in the associations found between adherence to allied health process indicators , and the early predictor variables captured in patient demographic and stroke event data .", "this new pathway summarizes the journey for patients admitted with acute stroke and the multiple factors that can impact on the care they receive from allied health professionals ." ], [ "this paper provides new data regarding the possible predictors of allied health care quality for patients with acute stroke .", "the sample is robust because it is appropriately powered and derived from a consecutive sample of stroke patient records .", "based on our findings , we suggest that the quality of acute stroke care contributed by allied health in multidisciplinary settings could be improved .", "this is the first known study to examine a range of individual processes of care by allied health professionals and the factors which may relate to compliance with these processes .", "the findings suggest a complex relationship between variables which may be related to the provision of best practice by allied health professionals caring for acute stroke patients .", "we acknowledge that the generalizability of the findings for some variables chosen in our study may be limited by international variations in health care systems and policy .", "length of stay data and admissions directly to a stroke unit , for example , are both particularly influenced by local contexts .", "variability in the roles of stroke team members must also be taken into account when interpreting our results .", "for example , in the study settings , speech pathologists and dietitians made a strong contribution to team decisions regarding enteral feeding ( process indicator 12 ) , but this may not be an allied health role in some settings .", "furthermore , we recognize that , as part of a multidisciplinary team with shared roles and responsibilities , the work of the allied health professions can be difficult to consider separately .", "correlates were found for older age , including increased stroke severity , higher comorbidity levels , previous residential care accommodation , previous dependence , female gender , poor english proficiency , and longer length of stay .", "these predictor variables were age proxies in our sample and may be stronger predictors of care decisions than patient age per se .", "some medical literature suggest that the age of an acute stroke patient is a determinant of the quality of medical care for stroke.35,912 in allied health care , we suggest that other factors may be at work .", "patient age had a strong correlation with only one quality process indicator ( early first mobilization ) , and this process indicator was even more strongly correlated with stroke severity .", "non - age variables were more frequently correlated with process indicator compliance ( twelve indicators ) than was patient age .", "stroke severity was the most frequent predictor variable ( seven process indicators ) , with length of stay the second most common predictor ( five process indicators ) .", "this analysis also demonstrated the lack of importance of some non - age variables , such as previous residential care accommodation data made redundant by data on previous independence .", "it is possible that systematic variations between professions may contribute to age - related differences in the medical care provided following stroke , which do not apply to allied health care .", "it is recognized , for example , that older patients are under - represented in some of the primary stroke research which guides evidence - based medical diagnostics and interventions.3 patients over 80 years have been excluded from many thrombolysis trials,41 and similar age exclusions are reported for secondary prevention stroke medications.42 the evidence base for allied health stroke care is still in early development and may therefore have less influence on which patients receive particular elements of care .", "as well as practicing within the biomedical framework adopted by medical practice , many areas of care provided by allied health professionals also fit within a biopsychosocial model.43 these differences may result in different clinical reasoning processes and decision - making by the separate professions .", "allied health professional decision - making regarding the care delivered to patients with stroke has not been well explored . there may be complex influences on the decisions they make about the care they provide to patients with acute stroke , underpinned by their perspectives of the role of non - age predictor variables on patient outcome . our causal pathway ( figures 1 and 2 ) suggests that many factors can not be adjusted because they are a priori to the stroke ." ], [ "ensuring the highest quality of allied health care for all stroke patients is important in the current climate of scarce resources and the increasing burden of stroke to the health sector .", "the associations identified between independent variables , including patient age , indicate that there are unlikely to be simple explanations for why some patients receive recommended care and others do not .", "to understand fully the important factors influencing the quality of care provided to acute stroke patients by allied health professionals will require further investigations into their perspectives on the capacity of stroke patients to improve , and how they make care decisions ." ] ]

[ [ "different modalities of neuromodulation such as repetitive transcranial magnetic stimulation ( schlaepfer et al . , 2003 ;", "george , 2010 ) , vagus nerve stimulation ( kosel and schlaepfer , 2003 ; schlaepfer et al . , 2008b ) , and magnetic seizure therapy ( lisanby et al . , 2001", "; kayser et al . , 2010 ) have been proposed and systematically studied in psychiatric different disorders ( schlaepfer et al . , 2010 ) .", "both clinically and scientifically the most promising method of neuromodulation might be deep brain stimulation ( dbs ) .", "dbs refers to the stereotaxic placement of unilateral or bilateral electrodes connected to a permanently implanted neurostimulator ( schlaepfer and lieb , 2005b ) .", "the exact neurobiological mechanisms by which dbs exerts effects on brain tissue are not yet fully understood ( hardesty and sackeim , 2007 ) .", "various mechanisms have been discussed , on the neuronal level , excitatory and inhibitory processes might play a role ( mcintyre et al . , 2004 ) .", "today , it is unknown which part of the neuron ( e.g. , cell body , axon ) is primarily modulated by dbs .", "certainly , the stimulation volume is not a fixed area around the electrode and the effect on neuronal tissue is variable .", "stimulation parameters ( frequency , amplitude , pulse width , duration ) also clearly have an impact on the effect ( ranck , 1975 ) . with commonly used parameters , a relatively large volume of neural tissue", "side effects in dbs are either related to the operation itself ( e.g. , bleeding , local infections at the chest ) or to the stimulation ( e.g. , elevation of mood , anxiety , motor slowing ) .", "fortunately , the safety of the stereotactic operation technique has been extremely improved in the last years with the help of neuroimaging .", "on the other hand , dbs has many advantages over traditional therapy methods : clinical effects can be achieved without irreversible lesioning , stereotactic operation is the most minimal neurosurgical method and electrodes can be completely removed if necessary .", "furthermore , dbs offers the opportunity to continuously adjust stimulation variables for each patient in order to optimize therapy . the patient can turn off stimulation immediately if side effects occur .", "dbs is the only neurosurgical method that allows blinded studies for therapy control . in comparison to antidepressant medication , nor side effects such as extrapyramidal effects , weight gain , that substantially effect compliance and patient s quality of life , are reported .", "also no long - time side effects as in antidepressant treatments ( geddes et al . , 2003 ; furukawa et al .", "nonetheless , dbs can be associated with side effects due to stimulation that are transient and can be counteracted by a change in stimulation parameters ( see table 1 ) .", "but until it has been proven that dbs has the same clinical effect as pharmacotherapy , the latter together with psychotherapy must be the first treatment choice .", "thus , dbs could become an exciting method in the treatment of depression and obsessive compulsive disorder ( ocd ) and offers unique possibilities to gain more insight into the underlying neurobiology of psychiatric disorders ." ], [ "different modalities of neuromodulation such as repetitive transcranial magnetic stimulation ( schlaepfer et al . , 2003 ;", "george , 2010 ) , vagus nerve stimulation ( kosel and schlaepfer , 2003 ; schlaepfer et al . , 2008b ) , and magnetic seizure therapy ( lisanby et al . , 2001", "; kayser et al . , 2010 ) have been proposed and systematically studied in psychiatric different disorders ( schlaepfer et al . , 2010 ) .", "both clinically and scientifically the most promising method of neuromodulation might be deep brain stimulation ( dbs ) .", "dbs refers to the stereotaxic placement of unilateral or bilateral electrodes connected to a permanently implanted neurostimulator ( schlaepfer and lieb , 2005b ) .", "the exact neurobiological mechanisms by which dbs exerts effects on brain tissue are not yet fully understood ( hardesty and sackeim , 2007 ) .", "various mechanisms have been discussed , on the neuronal level , excitatory and inhibitory processes might play a role ( mcintyre et al . , 2004 ) .", "today , it is unknown which part of the neuron ( e.g. , cell body , axon ) is primarily modulated by dbs .", "certainly , the stimulation volume is not a fixed area around the electrode and the effect on neuronal tissue is variable .", "stimulation parameters ( frequency , amplitude , pulse width , duration ) also clearly have an impact on the effect ( ranck , 1975 ) . with commonly used parameters , a relatively large volume of neural tissue", "side effects in dbs are either related to the operation itself ( e.g. , bleeding , local infections at the chest ) or to the stimulation ( e.g. , elevation of mood , anxiety , motor slowing ) .", "fortunately , the safety of the stereotactic operation technique has been extremely improved in the last years with the help of neuroimaging .", "on the other hand , dbs has many advantages over traditional therapy methods : clinical effects can be achieved without irreversible lesioning , stereotactic operation is the most minimal neurosurgical method and electrodes can be completely removed if necessary .", "furthermore , dbs offers the opportunity to continuously adjust stimulation variables for each patient in order to optimize therapy . the patient can turn off stimulation immediately if side effects occur .", "dbs is the only neurosurgical method that allows blinded studies for therapy control . in comparison to antidepressant medication , nor side effects such as extrapyramidal effects , weight gain , that substantially effect compliance and patient s quality of life , are reported .", "also no long - time side effects as in antidepressant treatments ( geddes et al . , 2003 ; furukawa et al .", "nonetheless , dbs can be associated with side effects due to stimulation that are transient and can be counteracted by a change in stimulation parameters ( see table 1 ) .", "but until it has been proven that dbs has the same clinical effect as pharmacotherapy , the latter together with psychotherapy must be the first treatment choice .", "thus , dbs could become an exciting method in the treatment of depression and obsessive compulsive disorder ( ocd ) and offers unique possibilities to gain more insight into the underlying neurobiology of psychiatric disorders ." ], [ "the main focus of studies on the underlying neurobiology of major depression ( md ) has focused on the description of biological differences between patients and healthy subjects such as alterations of monoaminergic or endocrine systems .", "the relative importance of the various biological changes has not been elucidated ; correlation with specific symptoms of the disease has rarely been attempted .", "psychotropic drugs work by altering neurochemistry to a large extent in widespread regions of the brain , many of which may be unrelated to depression .", "in contrast to some neurological disorders , the pathological interplay of several brain regions contributes to the behavioral , emotional , and cognitive symptoms of psychiatric disorders .", "metabolic studies suggest that different symptoms are mediated by different brain regions ( berton and nestler , 2006 ; yurgelun - todd et al . ,", "2007 ; krishnan and nestler , 2008 ) a convincing network - model of depression integrating biochemical , electrophysiological , imaging , and animal studies , has been described by mayberg ( 1997 ) . according to this model , depression results from a dysregulation of limbic cortical connections :", "pathological changes in dorsal brain regions ( including the dorsolateral prefrontal cortex , inferior parietal cortex , and striatum ) were associated with cognitive symptoms ( e.g. , apathy , anhedonia , hopelessness , deficits in attention , and executive function ) , changes in ventral areas ( hypothalamic pituitary adrenal axis , insula , subgenual cingulate , and brainstem ) contribute to the vegetative and somatic aspects of depression ( e.g. , sleep disturbance , appetite , endocrine dysregulation ) .", "this model underlines the role of the rostral cingulate cortex in regulating the network ( mayberg , 1997 ) .", "the involvement of further regions in depression is discussed : the hippocampus contributes to memory deficits , the nucleus accumbens was associated with anhedonia and lack of motivation , the amygdala plays a role in the processing of aversive stimuli and avoidance ( berton and nestler , 2006 ) .", "obsessive compulsive disorder is characterized by obsessions ( anxiety - provoking thoughts ) and compulsions ( repeated , time - consuming behaviors ; stein , 2002 ) . as in most psychiatric disorders , a complex interplay of genetic factors , neurotransmitter changes and psychosocial characteristics contribute to the development of this disease .", "dysfunctions in a network connecting the cortex and basal ganglia are supposed to underlie ocd .", "imaging data demonstrated changes in orbitofrontal cortex , anterior cingulate cortex and caudate nucleus in ocd ( baxter , 1990 ) .", "emerging evidence suggests that different alternations of the ocd circuitry subserve different symptom subtypes ( kopell and greenberg , 2008 ) .", "it has been hypothesized that an over activation of the direct pathway of the cortico - striatal pallidal thalamic cortical loop leads to intrusive thoughts ( baxter et al . , 2001 ) .", "these novel conceptualizations of both ocd and md , brought about mainly by advances in functional neuroimaging but also electrophysiological and molecular studies and their synthesis have paved the road to hypothesis - guided studies on targeted reversible neuromodulation with dbs in these disorders .", "the subgenual cingulate cortex ( brodmann area cg25 ) has probably dysfunctional connections to the dorsal and ventral compartments of the emotion regulation circuit in depression ( mayberg , 1997 ) .", "the subgenual cingulate cortex modulates negative mood states ( mayberg et al . , 2005b ) .", "it has been involved in acute sadness and in antidepressive treatment effects ( mayberg et al .", "the rostral part of the cingulate cortex seems to play a key role in modulating the network of depression ( mayberg , 1997 ) .", "( 2005b ) could demonstrate , that 2 months after surgery , 5/6 patients met the response criterion [ baseline score in the hamilton depression rating scale ( hdrs ) minus 50% ] , after 6 months , four patients showed sustained response .", "different neuropsychological parameters that were impaired at baseline were significantly improved . a reduction in the pathological hyperactivity in this region", "has also been demonstrated using positron emission tomography ( pet ) in this study . during the blinded sham stimulation phase ( n = 1 ) , the patient s condition worsened considerably .", "no adverse events due to stimulation were observed ( mayberg et al . , 2005b ) .", "( 2009 ) investigated the use of dbs at the ventral capsule / ventral striatum ( vc / vs ) .", "the vc / vs was targeted , because former studies targeting the vc / vs in ocd patients ( nuttin et al . , 1999 ; greenberg et al", ". , 2006 ) showed improvement not only for ocd symptoms but also for depressive symptoms .", "this finding was supported by the fact that the vs has complex architecture and includes structures such as the bed nucleus of the stria terminalis and the nucleus accumbens , which are regions believed to be involved with stress - related and reward motivation components of depression ( forray and gysling , 2004 ; epstein et al . , 2006 ) .", "once stimulation was titrated to therapeutic benefit and the absence of adverse effects , patients received significant improvements in depressive symptoms measured by the hdrs .", "responder rates of 40% at 6 months ( n = 15 ) and 53.3% at last follow - up ( mean last follow - up of 23.5 14.9 months ) receiving continuous dbs stimulation are referred .", "remission rates were reported 20% at 6 months and 40% at last follow - up with the hdrs .", "so the results of this study suggest that dbs of the vc / vs could also provide benefit in highly treatment - refractory patients with depression .", "however , since the larger contacts of the vc / vs leads have twice the surface area of standard leads used in other dbs applications , more frequent battery replacements or rather implanting recharging batteries should be considered ( malone et al . , 2009 ) .", "we selected the nucleus accumbens as target for dbs because of its prominent role in the reward system .", "the nucleus accumbens is known to act as motivational gateway between systems involved in motor control and limbic systems in charge of emotion processing ; especially the ventral striatum is uniquely located to modulate other regions of the brain ( schlaepfer et al . , 2008a ) .", "by targeting one site in a network of brain regions implicated in processing of affective stimuli , it was possible to manipulate anhedonia in particular .", "it could be demonstrated that modulation of this structure was associated with changes in the symptoms of anhedonia and mood in three depressed patients .", "normalization of brain metabolism in fronto - striatal networks as result of stimulation was also observed ( schlaepfer et al .", "results from a total of nine patients in this study show acute as well as long - term antidepressant effects of dbs at this target have been published recently , demonstrating a responder rate of 50% ( bewernick et al . ,", "the habenula has been proposed recently as target for dbs in depression ( sartorius and henn , 2007 ) .", "animal data and imaging studies have shown , that this regions controls serotonergic fibers from the dorsal raphe nuclei and noradrenergic fibers from the locus coeruleus ( winter et al .", "the authors hypothesize that over activation of the habenula is related to depression and recently reported on the course of depression after dbs to the habenula in a case report ( sartorius et al . , 2010 ) .", "another putative target site for md has been proposed very recently , the medial forebrain bundle ( coenen et al . , 2011 ) . magnetic resonance diffusion tensor imaging ( dti ) can visualize distinct functional circuits in the living human brain on the basis of the anisotropy of the brain tissue .", "this technique has been applied to an analysis of the different dbs sites for md and lead to the hypothesis - guided development of yet another site with hypothetically greater efficacy and even less unwanted effects .", "single - case studies in ocd patients with comorbid depression have shown antidepressant effects : bilateral stimulation of the ventral nucleus caudatus in combination with nucleus accumbens for ocd led to remission of depression ( hdrs_17 ", "it was supposed that dysregulation of the connection between unspecific thalamic system and orbitofrontal cortex plays an important role in the development of depression ( jimnez et al . , 2005 ) .", "therefore , bilateral stimulation of the lower thalamus stem was performed one depressed patient and led to remission ( hdrs 42 10 ) .", "unfortunately , these regions are very large and not well circumscribed in relation to this disease .", "thus the size of cortex region that needs to be modulated would be too large ( lipsman et al . , 2007 ) . in most studies ,", "the anterior limb of the internal capsule was the target for either unilateral or bilateral stimulation ( anderson and ahmed , 2003 ; gabriels et al .", ", 2003 ; nuttin et al . , 1999 ; nuttin et al . , 2003 ;", "all studies reported on promising results ranging from response to complete remission . in terms of side effects , some studies reported on induced , directly stimulation related symptoms of hypomania which all ceased completely after reduction of stimulation intensity .", "zona incerta has been studied at three patients with parkinson s disease and comorbid ocd ( mallet et al . , 2002 ;", "the subthalamic nucleus was stimulated in a study ( malone et al . , 2009 ) , this group included 16 patients and received significant lower symptoms of ocd . in a recent ocd study targeting the subthalamic nucleus ,", "ocd symptoms were significantly reduced after the 3-months double - blind stimulation phase compared to the double - blind sham stimulation phase ( mallet et al . , 2008 ) .", "both studies refer to possible associated risk of serious adverse events ( mallet et al . , 2008 ; malone et al . ,", "the nucleus accumbens and nucleus caudatus were target in one case study with comorbid depression ( s above ) .", "unilateral stimulation of the nacc in a well - designed , controlled study lead to somewhat less impressive but significant improvements results in 10 patients ( huff et al . , 2010 ) .", "the stimulation of the vc / vs led to a significant improvement in 50% of the patients", "side effects related to the stimulation were transient hypomania and increased anxiety , which could be counteracted by parameter change ( greenberg et al . , 2006 ) .", "recently results of bilateral dbs to the nucleus accumbens in ocd with an open 8-month treatment phase , followed by a double - blind crossover phase with randomly assigned 2-week periods of active or sham stimulation , ending with an open 12-month maintenance phase have been published ( denys et al . , 2010 ) .", "nine of the 16 patients were classified as responders , indicating that bilateral stimulation of the nucleus accumbens may be an effective and safe treatment in patients with highly refractory ocd . in summary", ", promising effects for different targets have been demonstrated , but as worldwide sample sizes are small , it is too early to select one favorable target if there is any .", "as ocd is a heterogeneous disease , there might be different optimal targets for different symptom clusters ." ], [ "the high mortality , low quality of life , and the social burden of inadequately treated serious psychiatric illness favor the use of dbs for treatment - resistant patients .", "the potential benefit to the understanding of pathological principles in mental disorders is evident ( schlaepfer and lieb , 2005a ; fuchs , 2006 ; ford , 2007 ; synofzik and schlaepfer , 2008 , 2010 ) .", "fundamental ethical concerns are generally applicable to all clinical interventions ( e.g. , pharmacotherapy , psychotherapy ) including dbs in neurological disorders .", "foremost , are patients able to give conformed consent ? it has been demonstrated that depressed patients show few impairments in decision - making capacity related to clinical treatment research ( appelbaum et al . , 1999 ) .", "another concern is , how far human nature may ethically be manipulated ( fuchs , 2006 ) .", "long - term effects of dbs can not be evaluated yet , but in comparison to pharmacotherapy , brain stimulation is a more specific and reversible intervention .", "more problematic is the danger of misuse , such as for mind control or for over - enhancement of normal ( healthy ) cognitive function ( brain doping ; fuchs , 2006 ; ford , 2007 ) . as clinical researchers in psychiatry ,", "our aim is to help patients to lead a normal life , including normal cognitive function and personal autonomy .", "more practical ethical concerns are the availability of alternative treatment methods ( e.g. , pharmacotherapy , ect , psychotherapy ) . taking to account that dbs is used only with treatment - resistant patients , who have already shown no benefit with other treatment approaches currently available , the apparent reversibility of dbs and its robust potential benefits , as described by prior pilot studies , are strong ethical arguments for considering dbs treatment for resistant psychiatric disorders ( synofzik and schlaepfer , 2008 , 2010 ) . however , there are also some notable risks with dbs , particularly intracerebral bleeding and wound infection and its efficacy is not yet formally and extensively established in controlled trials .", "therefore , until the dbs treatment method is scientifically validated ; obligatory standards for patient inclusion and exclusion criteria as well as the selection of targets are needed .", "( 2009 ) , recommending 16 key points for guiding research and protecting the safety and rights of research subjects , as well as nuttin et al .", "( 2002 ) to form a separate committee with only distant access to the individual patient or no direct involvement to the study for reviewing patient selection .", "it is our belief , that despite any committee review might it be as thorough and exhaustive as possible the clinical responsibility remains with the patient s clinicians and can not be shared by review committees .", "so from our point of view further research regarding obligatory standards in dbs is needed .", "this is by no means unique to dbs , but this area is particularly vulnerable to bias because of an excessive reliance on single - patient case reports ( schlaepfer and fins , 2010 ) . until cohort studies are routinely performed , the possibility will remain that only positive results will be published at the expense of negative data that might also have important implications . balanced publishing of results is even more important taking to account , that patients and public understanding of the risks and benefits of dbs is strongly shaped by media ( racine et al . , 2007 ) ." ], [ "there are no fundamental ethic objections to its use in psychiatric disorders , but until substantial clinical data is available , mandatory standards are needed for patient and target selection , quality of research center , and study protocol .", "it is very important to point out that in the actual stage of research ; dbs for psychiatric diseases is clinical research on therapeutics .", "the benefit of this method has to be proven first , until dbs will be available for many patients .", "before , much more information about the therapeutic effect , individual predictors of response , possible short and long - time side effects , and neuroethical issues have to be gained .", "deep brain stimulation is a unique and very promising method for the treatment of therapy resistant psychiatric patients .", "nonetheless , the duration of the battery limits the choice of stimulation parameters , increases the risk of infection , and raises treatment costs .", "a particular advantage of dbs is , that it allows recording signals from the stimulating electrodes ( cohen et al .", ", 2009a,2009b,2009c ) and combining these data with functional neuroimaging in order to map the spatiotemporal unfolding of dbs - elicited whole brain activity will lead to a much broader knowledge on functional and dysfunctional circuits processing affective stimuli revealing fundamental mechanisms of brain function ." ], [ "the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest ." ] ]

[ [ "if left untreated , ureteropelvic junction obstruction ( upjo ) can lead to hydronephrosis and progressive impairment of renal function . with success rates exceeding 98% ,", "currently , several studies have reported on the high success rate of redo pyeloplasty . however , to our knowledge , the factors affecting functional outcomes after redo pyeloplasty have not yet been reported . accordingly , the aim of this retrospective study was to evaluate changes in differential renal function ( drf ) , as a functional outcome , in children who underwent redo pyeloplasty for the management of failed pyeloplasty and to outline the factors associated therewith ." ], [ "with approval from the institutional review broad of severance hospital ( 4 - 2014 - 0081 ) , medical records were obtained from a database of patients who had undergone redo pyeloplasty between january 2002 and november 2010 at severance hospital in seoul , korea . during this period ,", "a total of 21 children underwent redo pyeloplasty by a single surgeon ( s.w.h . ) at sevrance hospital .", "the initial pyeloplasties were performed at our institution in 11 children , and the remaining procedures were performed at other institutions .", "information on preoperative drf and renal cortical thickness ( rct ) was not available for 3 patients who had undergone renal scintigraphy or ultrasound at other institutions , and these patients were excluded from the analysis .", "failure of initial pyeloplasty was judged by either obstructive symptoms or signs . the decision to perform", "redo pyeloplasty depended on the presence of symptoms ( e.g. , urinary tract infection , flank pain ) , functional loss ( deterioration of drf of more than 5% ) , and an aggravated obstruction pattern on a renogram or a huge urinoma .", "the patients were followed up postoperatively by use of serial ultrasound and renal scintigraphy for evaluating long - term functional outcomes .", "follow - up ultrasound was performed at 4 to 6 weeks after the operation and was then repeated every 1 to 6 months thereafter , according to the results of a previous study .", "the degree of hydronephrosis was graded from 0 to 4 according to the society for fetal urology ( sfu ) classification scheme .", "rct was measured in the sagittal plane at the level of the midkidney , as described by moghazi et al . .", "the measurement was obtained over the medullary pyramid , perpendicular to the capsule , and as the shortest distance from the base of the medullary pyramid to the renal capsule .", "statistical comparisons of continuous variables in patient demographics were carried out by using the mann - whitney u - test .", "the wilcoxon signed rank test was used for paired comparisons of before and after the operation ." ], [ "the characteristics of the patients enrolled in this study af ter initial pyeloplasty are summarized in table 1 .", "all patients showed at least persistent or mild increases of hydronephrosis on ultrasound , with results on postoperative renal scintigraphy consistent with an obstruction .", "the mean interval between operations ( between initial pyeloplasty and redo pyeloplasty ) was 13.6710.33 months .", "the causes of redo pyeloplasty included persistent obstruction on renography related to worsening hydronephrosis or a huge urinoma on ultrasound or the development of symptomatic obstruction , such as urinary tract infection and recurrent pain . with a mean follow - up period of 44.8328.86 months", "both showed increased drain output and a huge urinoma on an ultrasound after the first pyeloplasty .", "thus , we first attempted ureteral stent insertion , which failed . within about 1 week , redo pyeloplasty was performed .", "was determined on the basis of viability and fibrotic changes in the upj , as well as the presence of perinephric tissue .", "drf on renal scintigraphy worsened after the initial pyeloplasty in 6 patients , who showed deterioration of renal function ( decrease of more than 5% ) ; was stable in 11 patients ; and slightly increased in 1 patient .", "the mean drf of diseased kidneys before and after initial pyeloplasty was 45.77%6.05% and 38.72%15.44% , respectively . at approximately 6 months", "after redo pyeloplasty , the mean drf increased to only 40.50%15.12% , a difference that was not significant .", "after redo pyeloplasty , prevention of further functional deterioration was recorded in two - thirds of the patients but not in the remaining one - third ( fig .", "when we evaluated hydronephrosis grade with serial ultrasound after redo pyeloplasty , all patients showed an improvement in hydronephrosis grade compared with that before redo pyeloplasty .", "the mean ages were 55.5072.1 months in the decrease in drf group and 55.5047.15 months in the no decrease in drf group ( p=0.616 ) .", "the mean follow - up duration between operations was 13.6612.40 months in the decrease in drf group and 13.666.77 months in the no decrease in drf group ( p=0.682 ) .", "the mean drf before initial pyeloplasty was 45.16%5.60% in the decrease in drf group and was not significantly different from that ( 46.08%6.41% ) in the no decrease in drf group ( p=0.604 ) .", "gender , hydronephrosis grade , and operation type ( dismembered vs. nondismembered ; stented vs. unstented ) were not statistically different between the two groups .", "ddrf was calculated as the difference in drf between before and after initial pyeloplasty . in the decrease in drf group ,", "the mean ddrf was -23.00%12.31% . in the no decrease in drf group , the mean ddrf was 0.91%4.62% .", "in the decrease in drf group , drf was significantly decreased between before and after initial pyeloplasty ( p=0.028 ) ; in the no decrease in drf group , the difference was not significant ( p=0.397 ) .", "drct was calculated as the difference in rct between before and after initial pyeloplasty . in the decrease in drf group ,", "the mean drct ( -3.562.9 mm ) was higher than that in the no decrease in drf group ( -0.410.27 mm ) , a significant difference between the two groups ( p<0.001 ) .", "additionally , we calculated rdrf as the difference in drf between before and after redo pyeloplasty , as a reflection of the level of recovery of drf after redo pyeloplasty . in the decrease in drf group , the mean rdrf was 1.16%2.99% . in the no decrease in drf group , it was 2.08%3.23% .", "the difference in rdrf between the two groups was not significant ( p=0.541 ) ( table 2 ) .", "finally , we noted a significant positive correlation between drct and ddrf ( differences between before and after the initial operation ; p<0.001 ; r2 linear=0.716 ) .", "meanwhile , patients with a decline in drf of more than 5% showed greater decreases in rct ( fig .", "the patient showed no change in hydronephrosis grade ( sfu grade 3 ) and reported experiencing flank pain after redo pyeloplasty .", "therefore , we performed double j stent insertion at 1 month after the redo operation ." ], [ "drf on renal scintigraphy worsened after the initial pyeloplasty in 6 patients , who showed deterioration of renal function ( decrease of more than 5% ) ; was stable in 11 patients ; and slightly increased in 1 patient .", "the mean drf of diseased kidneys before and after initial pyeloplasty was 45.77%6.05% and 38.72%15.44% , respectively . at approximately 6 months after redo pyeloplasty , the mean drf increased to only 40.50%15.12% , a difference that was not significant .", "after redo pyeloplasty , prevention of further functional deterioration was recorded in two - thirds of the patients but not in the remaining one - third ( fig ." ], [ "before redo pyeloplasty , 14 patients were hydronephrosis grade 4 and the others were hydronephrosis grade 3 . when we evaluated hydronephrosis grade with serial ultrasound after redo pyeloplasty , all patients showed an improvement in hydronephrosis grade compared with that before redo pyeloplasty ." ], [ "the mean ages were 55.5072.1 months in the decrease in drf group and 55.5047.15 months in the no decrease in drf group ( p=0.616 ) .", "the mean follow - up duration between operations was 13.6612.40 months in the decrease in drf group and 13.666.77 months in the no decrease in drf group ( p=0.682 ) .", "the mean drf before initial pyeloplasty was 45.16%5.60% in the decrease in drf group and was not significantly different from that ( 46.08%6.41% ) in the no decrease in drf group ( p=0.604 ) .", "gender , hydronephrosis grade , and operation type ( dismembered vs. nondismembered ; stented vs. unstented ) were not statistically different between the two groups .", "ddrf was calculated as the difference in drf between before and after initial pyeloplasty . in the decrease in drf group ,", "the mean ddrf was -23.00%12.31% . in the no decrease in drf group , the mean ddrf was 0.91%4.62% .", "in the decrease in drf group , drf was significantly decreased between before and after initial pyeloplasty ( p=0.028 ) ; in the no decrease in drf group , the difference was not significant ( p=0.397 ) .", "drct was calculated as the difference in rct between before and after initial pyeloplasty . in the decrease in drf group ,", "the mean drct ( -3.562.9 mm ) was higher than that in the no decrease in drf group ( -0.410.27 mm ) , a significant difference between the two groups ( p<0.001 ) .", "additionally , we calculated rdrf as the difference in drf between before and after redo pyeloplasty , as a reflection of the level of recovery of drf after redo pyeloplasty .", "in the decrease in drf group , the mean rdrf was 1.16%2.99% . in the no decrease in drf group , it was 2.08%3.23% .", "the difference in rdrf between the two groups was not significant ( p=0.541 ) ( table 2 ) .", "finally , we noted a significant positive correlation between drct and ddrf ( differences between before and after the initial operation ; p<0.001 ; r2 linear=0.716 ) . patients without deterioration of renal function showed almost no change in rct .", "meanwhile , patients with a decline in drf of more than 5% showed greater decreases in rct ( fig ." ], [ "during the follow - up period , we observed one complication associated with redo pyeloplasty .", "the patient showed no change in hydronephrosis grade ( sfu grade 3 ) and reported experiencing flank pain after redo pyeloplasty .", "therefore , we performed double j stent insertion at 1 month after the redo operation ." ], [ "since anderson and hynes reported on the first successful dismembered pyeloplasty in 1891 , many advances have been made in the surgical management of upjo .", "however , the basic surgical principles have remained largely the same , including the meticulous preservation of the ureteral blood supply , construction of a widely patent and watertight anastomosis , and careful tissue handling .", "these principles have allowed dismembered pyeloplasty to be successful in relieving upjo in up to 98% of cases .", "even when patients are optimally managed , however , pyeloplasty fails in a small but steady proportion of patients .", "several treatment approaches exist for secondary upjo af ter failed pyeloplasty . among them , redo pyeloplasty , by use of both open and minimally invasive techniques , appears to be the most effective , with success rates higher than 90% among pediatric patients .", "therefore , in the present study , we set out to evaluate changes in drf and rct by use of serial renal scintigraphy and ultrasound .", "in doing so , we found that , after redo pyeloplasty , drf on renal scintigraphy was similar to that after failed pyeloplasty , reflecting the difficulties of recovering initial renal function .", "in previous studies , researchers noted that drf significantly improved in children with immediate or delayed pyeloplasty . on the other hand", ", another study reported that anderson - hynes pyeloplasty had no effect on renal function after surgery and that the increase in renal function at follow - up in infants might be attributable to their normal growth potential . in light of our results", "nonetheless , prior to conducting this study , we assumed that recovery of renal function after redo pyeloplasty would reflect preservation or improvement in initial drf .", "however , when we compared two groups of patients divided according to a decrease in drf of more than 5% of initial drf , ddrf was shown to be a factor that significantly contributed to functional recovery after redo pyeloplasty in pediatric patients .", "we discerned this to mean that severe reductions in renal function after an initial surgery may greatly affect the likelihood of recovering initial renal function after redo pyeloplasty . for detecting", "severely reduced drf after a failed pyeloplasty , we attempted to assess rct as another factor of recoverability of renal function .", "herein , drct was shown to be a significant factor that affected the functional outcome of redo pyeloplasty .", "previously , harraz et al . reported that , after the relief of obstruction , there is a tendency for renal function to recover , irrespective of nephron mass , as determined by cortical thickness .", "other investigators have also reported rct as a powerful predictor of renal function . in connection with these reports", ", we found a positive correlation between ddrf and drct in patients who experienced a failed pyeloplasty .", "accordingly , we think that drct could be a predictor of ddrf in patients scheduled to undergo redo pyeloplasty , which may help physicians in predicting the likelihood of recovering initial renal function thereafter . although rct on ultrasound could present bias in the outcome measure , standardized measurement of rct with serial ultrasound would be helpful to determine the benefits of a secondary operation . additionally , we evaluated changes in hydronephrosis after redo pyeloplasty .", "most patients showed an improvement in hydronephrosis after redo pyeloplasty , although normalization was rare . in primary", "pyeloplasty , park et al . reported that both symptomatic cases and delayed improvements in hydronephrosis ( i.e. , up to 6 months ) were identified as risk factors for lack of normalization .", "therefore , the possibility of normalization after redo pyeloplasty seems to be lower than that after initial pyeloplasty .", "nevertheless , we must acknowledge the limitations of our report , including the inherent drawbacks of the retrospective design and the lack of bias control .", "also , the accuracy of using renal scintigraphy as a measure of renal function is in question . although large - scale studies are needed to draw more definitive conclusions , these are difficult owing to the very low failure rate of pyeloplasty . as strengths of our study ,", "however , the data in our series were collected from patients who underwent redo surgeries performed by a single surgeon and included many variables that might predict drf recoverability after redo pyeloplasty .", "accordingly , we believe that our study is important to establishing the concept of a renal functional outcome for predicting improvement after redo pyeloplasty . such a concept would better equip physicians for proper counseling of patients before surgery and for making successful surgical decisions ." ], [ "redo pyeloplasty should be considered in cases of failed pyeloplasty in order to preserve renal function and to offer relief from symptoms . in patients who underwent redo pyeloplasty , ddrf and drct", "were shown to be factors affecting the functional outcomes of this procedure . meanwhile , in patients who show severe deteriorations in drf or decreases in rct after initial pyeloplasty , recovery of initial drf after redo pyeloplasty may be difficult .", "therefore , redo pyeloplasty should be performed before severe deterioration of drf or decreases in rct ." ], [ "reoperation is a psychologically large burden on the operator , and the reoperation itself is more difficult than the initial operation because of the adhesive surgical field and poor tissue condition of the renal pelvis and ureter .", "complicated surgical techniques such as flap surgery or ureterocalicostomy should be applied in some cases .", "owing to the rarity of reoperation cases , knowledge about redo pyeloplasty has usually been gained through the experience of an individual surgeon .", "first , after initial pyeloplasty , the postoperative result is not as simple and conclusive as \" surgical failure . \" sometimes , it is not easy for the surgeon to decide on reoperation .", "discrepancies may exist in the imaging studies between the sonographic findings and excretion and renal function in the diuretic renogram .", "some patients show delayed excretion despite moderate improvement of hydronephrosis . in particular , postoperative transient hydronephrosis could be present and a \" wait - and - see \" approach is considered because most cases improve spontaneously . in case", "1 , differential renal function ( drf ) was 46% and hydronephrosis was grade 3 ; thus , the \" wait - and - see \" approach could be considered if the patient did not show flank pain or urinary tract infection .", "second , in a very poorly functioning kidney , maybe as the result of obstruction or infection , is it meaningful to perform redo pyeloplasty ?", "10 and 15 , the drf was only 1% and 6% , respectively ; thus , functional recovery was not expected in these cases . in my experience", ", functional improvement can be achieved only in the case of an acute high - grade obstruction .", "double j stenting and follow - up evaluation of functional change could be an option to predict functional restoration after the operation .", "finally , the author concluded that recovery of drf after redo pyeloplasty is difficult in patients who show severe deteriorations in drf or a decrease in renal cortical thickness after the initial pyeloplasty .", "the title of this article implicates the author 's conclusive mind that delayed redo pyeloplasty fails to recover lost renal function .", "the authors suggest that one should not hesitate to perform reoperation in cases of postoperative findings such as sonographic changes and loss of renal function . although it is not easy for surgeons to recommend reoperation during follow - up , it is worse to delay the decision for reoperation in cases showing definite deterioration . eventually , the deterioration causes superimposed urinary tract infection and flank pain and finally leads to decreased renal function .", "we acknowledge the limitations of this study , especially the unaccounted for compounding surgical factors such complicated surgical field conditions and the location and degree of stricture , which were unavoidable owing to the study design . despite this limitation" ] ]

[ [ "the hydatid cyst is a zoonosis caused by adult or larval stages of tapeworms belonging to the genus echinococcus granulosus .", "the tapeworm stage is harbored in the intestine of carnivores such as dogs , which constitute the definitive host , and the eggs are passed in the feces of the infected carnivores and ingested by herbivores such as sheep , which comprise the intermediate host .", "larvae emerge from the eggs in the intestine ; and after invasion to the blood vessels , they can migrate into almost every part of the body .", "the usual destination is the liver via the portal tract , but sometimes the larvae pass through the liver barrier and reach the lungs and all the other viscera , where they transform into small cysts . \n ", "echinococcosis / hydatidosis is one of the most important zoonotic diseases inasmuch as it occurs in different parts of iran .", "adult worms have been recovered from dogs , jackals , and wolves , but human cases have been reported from hospital archives by pathological reports of surgically proven cases in different geographical areas of the country . in nearly all the previous reports , the liver was the most common location of the hydatid cyst , followed by the lung , with the approximate occurrence rates of 70% and 12% , respectively .", "there is a small number of reports of higher incidence rates of lung involvement in iran , but such cases are very unusual .", "the reported incidence in children has been a point of controversy in a few previous investigations , reporting incidence rates of 41 - 70% for the lung and 43 - 48% for the liver hydatid cyst . although most reported iranians with echinococcosis had cysts in their lungs and livers , more unusual cyst locations were also recorded . in a few previous reviews on hydatidosis form", "iran , unusual body sites such as the heart , orbit , brain , muscle , salivary gland , bone , urinary tract , and pancreas were reported .", "the aim of this paper is to provide an overview of the published cases of the hydatid cyst in unusual body sites from iran to delineate the most important demographic findings and locations of the disease in this hyperendemic country ." ], [ "the published cases of the hydatid cyst in unusual body sites from iran were reviewed via a search in pubmed , scopus , google scholar , iranmedex , scientific information database ( sid ) , magiran , and irandoc ( 1990 - 2011 ) , using the keywords of hydatid cyst and iran and echinococcus granulosus and iran .", "the following inclusion criteria were employed : 1 ) articles must be written in english and farsi ; 2 ) articles must have been published between 1990 and 2011 ; 3 ) studies must be from iran and contain case report(s ) , diagnosing the hydatid cyst in unusual locations ( i.e. other than the liver and lung ) ; and 4 ) cases must have been pathologically confirmed postoperatively ." ], [ "in the last 20 years , about 463 cases of the hydatid cyst located in different parts of the body , excluding the liver and lung , have been published from iran .", "the published cases of the hydatid cyst with unusual locations from iran the most common locations were the central nervous system ( brain , spinal cord , and orbit ) , musculoskeletal system , heart , and kidney , whereas some less common locations were the spleen , pancreas , appendix , thyroid , salivary gland , adrenal gland , breast , and ovary .", "most of the published cases were reported from tehran ( as a referral center for the whole country ) ; nevertheless , other centers such as khorasan , azerbaijan , fars , isfahan , and yazd also reported unusual locations of the hydatid cyst . \n", "central nervous system \n in the last 20 years , about 256 cases of the hydatid cyst in the brain , spinal cord , and orbit have been reported form different geographical areas of iran .", "there are two reviews by abassioun et al . who reported 69 cases of the brain hydatid cyst .", "these patients were 3 to 50 years of age , with a slight male preponderance . among these 69 reported cases , 5 cysts were in the posterior fossa , 2 in the cerebellum , one in the cp angle , one in the fourth ventricle , one in the pons , and 59 cases in the brain parenchyma .", "the hydatid cyst of the orbit in the above - mentioned review was detected in 28 patients , with an age range of 5 to 54 years .", "abassioun et al . also reported 36 cases of the spinal hydatid cyst , both intra and extradural , 20 of which were male and 16 cases were female patients .", "apart from the above reviews , 105 other intracranial hydatid cysts were reported in 73 males and 32 females , with an age range of 5 to 60 years .", "most of the intracranial hydatid cysts were within the brain hemisphere , and the most common presenting symptoms were headache and vomiting .", "as a rule , the hydatid cyst of the brain tends to be solitary and spherical .", "serologic tests are not diagnostic , and imaging studies such as computed tomography ( ct ) scan and magnetic resonance imaging ( mri ) are necessary for preoperative diagnosis . \n ", "there were 11 cases of the spinal hydatid cyst ; they were all adults above 20 years of age and presented with signs and symptoms related to cord compression such as low back pain , radicular pain , and paraparesis .", "the majority of the spinal hydatid cysts were extradural , and primary intradural hydatid cysts were very rare . aside from the aforementioned review ,", "the orbital hydatid cyst was rarely reported form iran : there were only 8 cases , all presenting in childhood .", "the reported symptoms were visual impairment and proptosis , and anatomically most of the orbital cysts were in the intraconal space because most branches of the ophthalmic artery supply the intraconal space . \n musculoskeletal system \n in the last 20 years", ", the skeletal hydatid cyst has been reported in 44 patients , comprised of 28 males and 16 females with an age range of 5 - 71 years ( mean age=41.5 years ) .", "the locations of the skeletal hydatid cysts were varied such as the maxillary sinus , mandible , knee , long bones , and ilium .", "the clinical manifestations of the osseous hydatid cyst may take a long time to become obvious , and that is when the cyst is detected by swelling , pathologic fracture , and secondary infection .", "the bone hydatid cyst is polycystic in contrast to other non - osseous locations , which is because of the absence of adventitia around the cyst .", "the diagnosis of the osseous hydatid cyst is based on imaging modalities such as ct scan .", "the hydatid cyst involvement of the skeletal muscle is even less common than that of the bone . in our review of iranian cases", ", we found 11 reported patients , 8 males and 3 females with an age range of 22 - 80 years ( mean age=29 years ) , with the hydatid cyst of the skeletal muscle .", "the reported locations were in the latissmus dorsi , gluteal muscle , cervical muscles of the paraspinal area , and thigh .", "the most common presenting symptoms were painless swelling , causing symptoms secondary to the compression effect on the adjacent organs .", "radiological studies , including mri , are the mainstay of the preoperative diagnosis of the skeletal muscle hydatid cyst . \n", "cardiovascular system \n the third most common unusual location of the hydatid cyst reported from iran is the cardiovascular system , with 42 cases having been reported in the last 20 years .", "the cases comprised 25 males and 17 females with an age range of 8 to 73 years ( mean age=29.5 years ) .", "most of the cardiac hydatid cysts were located in the ventricular wall , and the most common presenting symptoms were angina , dyspnea , and palpitation , in consequence of the pressure effects of the cyst on the coronary and conducting system .", "likewise , only 2 cases of the intrapericardial , and endocardial , hydatid cysts were reported from iran .", "the vascular hydatid cyst in the aorta and superior vena cava with invasion to the myocardium was reported in a study from iran .", "there were reports of very infrequent asymptomatic cases of the hydatid cyst of the heart detected during ekg evaluations for another surgery .", "serologic tests are positive in about 50% of the patients , but transesophageal echocardiography ( tee ) is known as the imaging procedure of choice for the diagnosis of the cardiovascular hydatid cyst . \n", "kidney and urinary tract \n our investigation yielded 31 published cases , 23 males and 8 females with an age range of 9 to 73 years ( mean age=44 years ) , of the hydatid cyst of the kidney and urinary tract . among these cases , 29 patients had the renal hydatid cyst and 2 had the bladder wall hydatid cyst .", "there is no serologic and immunological test pathognomonic for the diagnosis of the renal hydatid cyst , but ultrasonography and , in particular , ct scan can be of great help .", "there were 20 cases of the splenic hydatid cyst from iran in 13 males and 7 females with the reported age ranging from childhood to 75 years .", "the splenic hydatid cyst exhibits a variety of clinical features , requiring a high index of suspicion for diagnosis .", "uterus , ovary , and fallopian tube \n there were 9 published cases , with a mean age of 50 years ( mean age=34 - 84 years ) , of the ovarian hydatid cyst from iran .", "the uterine hydatid cyst is extremely rare , and only one case was reported from iran with the accompanied involvement of the fallopian tube in a 25-year - old female , who presented with lower abdominal pain .", "the diagnosis was made after laparotomy for the evaluation of the cause of the symptoms .", "the most popular methods of diagnosis are ultrasonography , ct scan , and mri , all of which are much more sensitive than immunologic tests . in the last 20 years", ", 6 patients , 4 males and 2 females with a mean age of 34.5 years , have been reported with the pancreatic hydatid cyst .", "this cyst usually manifests as an epigastric mass , recurrent acute pancreatitis , chronic pancreatitis , and obstructive jaundice .", "complications of the pancreatic hydatid cyst depend on the relationship between the cyst and the pancreatic duct .", "the methods of choice for the diagnosis of the pancreatic hydatid cyst are ct scan and mri .", "there were 9 published cases , 4 males and 5 females with a mean age of 16.5 years , of the hydatid cyst of the salivary gland : 7 in the parotid gland and 2 in the submandibular gland .", "eight cases of the breast hydatid cyst were published from iran , all in the female breast with a median age of 40.7 years .", "the most common presenting symptom was a well - defined palpable breast mass , which can be confirmed by mammography and ultrasonography . in the last 20 years", ", only 4 cases of the thyroid hydatid cyst have been reported from iran , all in females between 17 and 35 years of age ( mean age=14.3 years ) .", "the patients with the thyroid hydatid cyst presented with pressure symptoms and signs of dyspnea , hoarseness , goiter , and dysphagia .", "clinically , the thyroid hydatid cyst presents with a solitary mass , mimicking a thyroid cystic nodule .", "the diagnosis can be made by fine needle aspiration ( fna ) and isotope scanning .", "the adrenal hydatid cyst in iran was reported in only 2 cases : a 49-year - old female and a 42-year - old male .", "the adrenal hydatid cyst is mostly asymptomatic and is incidentally found by imaging ; on rare occasions , however , it can cause hypertension .", "another case was reported , presenting with vague flank pain with a primary diagnosis of a renal tumor , for which surgery was undertaken .", "there was only one reported case of the appendiceal hydatid cyst from iran , diagnosed after laparotomy in a 47-year - old male worker presenting with vague abdominal pain .", "seven cases , 5 males and 2 females with a mean age of 28.7 years , of the mediastinal hydatid cyst were reported from iran .", "omentum and retroperitoneum \n seven cases of the mesenteric , diaphragmatic , omental , pelvic , and retroperitoneal hydatid cyst have been reported from iran in the last 20 years .", "these cases may remain asymptomatic until reaching a large size , and the clinical signs vary according to the site . the parapharyngeal hydatid cyst in a 41-year - old female , and the nasolabial hydatid cyst in an 11-year - old adolescent , were the last two extremely rare case reports in this review from iran ." ], [ "hydatid disease is a unique parasitic disease that is endemic in many parts of the world .", "this parasitic disease is a significant public health concern in iran , as an endemic country , rendering a review of the published cases of hydatid disease from this hyperendemic country vitally important . in hydatid disease ,", "the liver and lung are the most common involved organs , but the disease can be seen in any organ of the body .", "the rates of the localization of hydatid disease in different body organs vary in the literature .", "all the published cases in iran included in this review are based on hospital experiences proven postoperatively by pathological examination .", "our results demonstrated that the most common locations of the hydatid cyst , after the lung and liver , were the central nervous system , orbit , musculoskeletal system , cardiovascular system , kidney , and urinary tract .", "there were also reports of the spleen , uterus , ovary , pancreas , salivary gland , breast , adrenal , appendix , mediastinum , omentum , and retroperitoneum hydatid cysts .", "the clinical manifestations in the hydatid cyst of most parts of the body are too nonspecific to make a diagnosis based on the signs and symptoms before surgery . in all of the previous reports from iran and all around the world", ", it has been shown that serologic tests have many false - negative results , but imaging modalities such as ultrasonography , ct scan , and mri have been the methods of choice , especially the latter , which has been the diagnostic method of choice for the preoperative diagnosis of the hydatid cyst in most unusual locations . \n the best treatment for the hydatid cyst is surgical excision , accompanied by postoperative medical therapy .", "the next part of this review presents the salient points of each unusual site of the hydatid cyst extracted from the most recently published literature . \n", "central nervous system , spinal cord , and orbit \n the cerebral and spinal cord hydatid cysts are very rare .", "indeed , the existing literature contains about 300 articles , accounting for 2 - 3% of all the cases of hydatidosis . \n ", "the most common location is the intraparenchymal supratentorial , and the most common presenting symptoms are headache and weakness in the previous reports from other parts of the world , which is very similar to the cases published from iran . in the last 20 years , 256 cases of the central nervous system hydatid cyst have been published from iran .", "this cyst site accounted for the third common site of the hydatid cyst after the lung and liver .", "according to the recent literature , this cyst accounts for about 1% of all the cases of the hydatid cyst . in this location ,", "the intravertebral discs are usually preserved because the disease tends to progress beneath the periosteum and ligaments .", "the orbital hydatid cyst accounts for about 1 - 2% of the cases in the previous literature and is most commonly detected in childhood .", "musculoskeletal system \n osseous hydatid disease and muscular hydatidosis are uncommon and account for 0.5 - 4% and 0.5 - 2.5% of all hydatidosis cases , respectively ( in endemic areas ) .", "the most common locations of the osseous hydatid cyst are the vertebra , pelvis , and long bones in the previous records from other parts of the world . however ,", "in the published cases form iran , there were 55 cases with variable locations such as the long bone , mandible , maxilla , and pelvis .", "muscle involvement of the hydatid cyst is reported as an uncommon location , because of high lactic acid , which is not a suitable environment for the parasite . \n", "cardiovascular system \n the heart and large blood vessels also have been reported as the common unusual body sites of the hydatid cyst in endemic areas of the world , accounting for 0.5 - 2% of all the reported cases .", "the diagnostic method unique for this part of the body is echocardiography , which has been claimed as the method of choice for the diagnosis of the cardiac hydatid cyst . nonetheless , ct scan and mri are also helpful in other parts of the body . \n kidney and urinary tract \n the kidney is the most common location in the urinary tract and has been reported in about 2 - 3% of all cases of the hydatid cyst . in many of the previous reports from other parts of the globe ,", "the kidney is reported as the third common site of the hydatid cyst after the liver and lung . in our survey of the published cases from iran , however , the renal hydatid cyst was the fourth most common location of the hydatid cyst .", "the clinical symptoms are nonspecific , and the only interesting and diagnostic symptom reported is hydatiduria .", "the hydatid cyst of the urinary bladder is even less common , and only 2 cases were published from iran .", "this cyst can also present with hydatiduria and is , otherwise , extremely difficult to diagnose before surgery .", "less than 2 - 5% of the cases of the hydatid cyst have been reported from the spleen .", "many of the reported splenic hydatid cysts worldwide are asymptomatic , and a very small number of patients show nonspecific left upper quadrant pain . \n", "uterus , ovary , and fallopian tube \n the ovary is the most common site of hydatidosis in the female genital tract , but overall it is extremely uncommon ( less than 1% ) .", "the clinical presentations are very nonspecific , and making a correct preoperative diagnosis is very difficult . there were only 9 cases of the ovarian hydatid cyst published from iran .", "the uterine hydatid cyst is even less common than ovarian hydatidosis , and its occurrence is exceptional .", "the clinical presentation of this cyst is also very nonspecific , and it is difficult to diagnose the cyst before surgery . only one case of the uterine hydatid cyst was reported from iran .", "the hydatid cyst of the fallopian tube is most often accompanied by the ovary hydatid cyst and can cause infertility and spontaneous rupture of the tube .", "the pancreatic hydatid cyst is very uncommon and accounts for less than 1% of the cases .", "there are reports from iran and other parts of the world about the diagnosis of the salivary gland hydatid cyst via fna cytology .", "this cyst is reported to be capable of causing anaphylaxis and dissemination , but there are increasing numbers of reports on the diagnosis of the salivary gland hydatid cyst via fna , without any complications .", "the breast involvement of the hydatid cyst is rare , with a reported incidence of 0.27% .", "mammography , ct scan , and mri can help to diagnose the breast hydatid cyst before surgery .", "however , there are rare case reports of preoperative diagnosis by fna cytology without complications .", "the hydatid cyst of the thyroid is very rare and clinically presents like a simple colloidal cyst .", "for all the reports of the role of fna in the diagnosis of the thyroid hydatid cyst , as is the case in the salivary gland and breast , its application is controversial .", "the adrenal hydatid cyst is most often asymptomatic , but reports of hypertension are also available . in our survey ,", "only 2 cases of the adrenal hydatid cyst were reported from iran ; both patients underwent surgery with the impression of the adrenal cyst .", "the hydatid cyst of the appendix is exceptional , and fewer than 10 cases have been reported worldwide .", "the mediastinal hydatid cyst is uncommon but it should be included in the differential diagnosis of the mediastinal cyst in endemic parts of the world .", "our findings yielded 7 cases from iran , presenting with cardiac or respiratory problems . \n", "omentum and retroperitoneum \n the omental and retroperitoneal hydatid cysts are very uncommon , but these cysts can become huge in size ." ], [ "the hydatid cyst can present in any part of the body and no site is immune .", "these unusual locations often produce nonspecific symptoms ; consequently , it is advisable that the hydatid cyst be considered in the differential diagnosis of all cysts of the body , especially in endemic countries such as iran ." ] ]

[ [ "neurocysticercosis is the most common parasitic disease of the central nervous system leading to seizures worldwide .", "humans develop cysticercosis when they ingest eggs of the tapeworm taenia solium usually found in fecal - contaminated water or food .", "neurocysticercosis ( ncc ) is endemic to many parts of the world [ 37 ] and is becoming an increasingly important cause of seizures in the united states due to immigration from mexico and central and south america [ 8 , 9 ] . ", "seizures in ncc most commonly arise as a result of the granulomatous responses to dead cysts in the brain .", "the granulomatous response is associated with production of several cytokines including t helper 1 ( th1 ) cytokines such as interferon gamma ( ifn- ) , interleukin-2 ( il-2 ) , and interleukin-12 ( il-12 ) . \n", "t. crassiceps infection in mice is an experimental model for t. solium cysticercosis in man [ 1115 ] .", "intraperitoneal inoculation with 10 cysts of t. crassiceps results in the entire peritoneal cavity of the mouse demonstrating granulomatous inflammation within 36 months .", "similar to human infection , minimal granulomatous inflammation is found surrounding live parasites ; rather , granulomatous inflammation is initiated when the parasite dies .", "the mediators contributing to development of granulomas around the dead parasite and production of proinflammatory cytokines are not completely understood .", "we previously detected substance p ( sp ) protein within granulomas associated with t. crassiceps infection [ 16 , 17 ] .", "we also demonstrated that levels of il-2 , ifn- , il-4 , and il-10 protein were significantly higher in granulomas from infected wt mice than granulomas from infected spp - knockout or the sp - receptor ( neurokinin 1 , nk1 ) nk1-knockout mice [ 16 , 17 ] .", "in addition , we detected mrna for il-1 , il-1 , il-1 receptor antagonist , and tnf- in all granulomas derived from infected wt mice .", "however , corresponding proteins levels were not assessed nor was the contribution of sp signaling to their mrna and protein production and to granuloma formation . ", "the current studies were aimed at determining if sp and nk1 contributed to granuloma development and/or to production of il-1 , tnf- , and il-6 in cysticercosis .", "sp stimulates production of proinflammatory cytokines such as of il-1 , il-6 , and tnf- by human peripheral mononuclear cells , bronchial cells , and astrocytes [ 1929 ] sp also contributes to inflammatory processes associated with other infectious diseases .", "sp injection induced recruitment of leukocytes into the pleural cavity of mice and into the skin of humans [ 1929 ] and stimulated the migration of human fibroblasts and peripheral blood lymphocytes in studies using modified boyden chambers or micropore filter analysis , respectively [ 1929 ] . in the current studies , we determined granuloma size and measured levels of il-1 , tnf- , and il-6 protein within granuloma obtained from t. crassiceps - infected wt and mice deficient in spp or nk1 .", "these studies indicate that sp signaling contributes to granuloma development and proinflammatory cytokine production in t. crassiceps infection and suggests a potential role for this mediator in human cysticercosis ." ], [ "female mice were infected by intraperitoneal inoculation with 10 cysts of the orf strain of t. crassiceps , as described in [ 16 , 17 ] .", "three months following infection , the mice were euthanatized by cervical dislocation under anesthesia using a combination anesthetic sacrifice rodent cocktail ketamine , 25 mg / kg , acepromazine 0.8 mg / kg , xylazine 5 mg / kg intraperitoneally , at a dose of 0.50.7 ml / kg intramuscularly .", "granulomas associated with dying cysts were removed from the peritoneal cavity of each of the infected mice that were euthanized .", "three groups of mice were included in the experiments : ( 1 ) wild type c57bl/6 mice ; ( 2 ) preprotachykinin or spp - knockout mice ( jackson laborotories , maine , usa , bred > 10 generations onto the c57bl/6 background ) ; ( 3 ) nk1-knockout mice provided by dr .", "joel weinstock , tufts new england medical center , boston , usa , bred > 10 generations onto the c57bl/6 background .", "three to 8 infected mice from each of the 3 groups were used for this study ; 415 granulomas per mouse group were used for this study .", "granulomas associated with parasites were identified visually , removed from the peritoneal cavity , and either used for quantifying cytokine proteins by elisa or used for size determinations .", "intact granuloma was obtained from t. crassiceps - infected wt mice ( 2 granulomas ) , spp - knockout mice ( 4 granulomas ) , and nk1-knockout mice ( 3 granulomas ) , fixed with 4% paraformaldehyde , paraffin imbedded and completely sectioned by microtome into 7 micron sections .", "the area of granuloma within each section was measured using image j software ( nih ) .", "the volume of granuloma within each section was calculated by multiplying the area times 7 microns and the volume of granuloma within each section totaled to give the total granuloma volume .", "cytokine protein levels were determined in 1215 granulomas derived from t. crassiceps infected wt mice , 46 granulomas derived from t. crassiceps infected spp - knockout mice , and 9 - 10 granulomas derived from t. crassiceps - infected nk1-knockout mice .", "a portion of each granuloma was homogenized in pbs , followed by centrifugation at 16,000 g. total protein in the supernatant was quantitated using the bradford method ( cat no .", "il-1 , il-6 , and tnf- protein levels were determined by sandwich elisa ( r&d systems , san diego , california ) as per manufacturer 's instruction ." ], [ "to begin to examine the contribution of sp signaling to granuloma formation in ncc , we measured granuloma volume in mice with normal and deficient sp signaling .", "the volumes of granulomas from taenia crassiceps infected spp - knockout mice ( 1.8 0.45 mm ) and nk1-knockout mice ( 1.68 0.40 mm ) were reduced by 31% and 36% , respectively , compared to granulomas derived from infected wt mice ( 2.62 0.28 mm ; p < .05 for both ; student 's t - test ; see figure 1 ) .", "il-1 is the primary mediator of granuloma formation in the s. mansoni pulmonary granuloma model .", "also , intratracheal injection of agarose beads coupled to recombinant il-1 induced pulmonary granulomas in mice . to determine if decreased production of il-1 in spp- and nk1-knockout mice contributed to reduced granuloma size in these animals , we measured il-1 protein levels in the granulomas derived from each group of mice .", "il-1 protein levels in granulomas from t. crassiceps infected spp - knockout mice ( 216 129 ng / mg total protein ) and nk1-knockout mice ( 101 43 ng / mg total protein ) were reduced by 48% and 76% , respectively , compared to granulomas from infected wt mice ( 418 278 ng / mg total protein ; p < .05 for both ; student 's t - test ; see figure 2 ) .", "thus , sp signaling contributes to il-1 production within granulomas formed in response to dying t. crassiceps cysts .", "furthermore , reduced levels of this cytokine likely contributed to reduced granuloma size in spp- and nk1-knockout mice .", "tnf- mediates granuloma growth in the s. mansoni pulmonary granuloma model and is required for granuloma formation in a mouse model of tuberculosis .", "similar to our findings with il-1 , tnf- protein levels in granulomas from t. crassiceps infected spp - knockout mice ( 96 67 ng / mg total protein ) were reduced by 79% compared to levels in granulomas derived from infected wt mice ( 460 452 ng / mg total protein ; p < .05 ; student 's t - test ; see figure 3 ) .", "tnf- protein levels within granulomas from nk1-knockout mice ( 345 153 ng / mg total protein ) were decreased by 25% compared to levels with granulomas of wt mice ; however , this difference did not achieve statistical significance .", "thus , sp contributes to tnf - production within granulomas formed in response to dying t. crassiceps cysts .", "furthermore , reduced levels of this cytokine likely contributed to reduced granuloma size in spp- and , perhaps , nk1-knockout mice .", "the failure to detect a significant difference in tnf- protein levels between nk1-knockout and wt mice suggests the possibility that sp - mediated increases in tnf- may occur through binding of sp to other members of the nk family , for example , nk2 or nk3 .", "il-6 production in human peripheral blood mononuclear cells , bronchial cells , and astrocytes is increased directly by sp through the action of nuclear factor il-6 ( nf - il-6 ) and p38 mapk , as well as indirectly in response to il-1 and tnf- through the activation of nf-b [ 26 , 27 , 34 , 35 ] .", "il-6 mediates its acute proinflammatory effects within infected or injured tissues , in part , through upregulation of cxc chemokines , which leads to recruitment of the first wave of inflammatory cells . ", "as we expected from the il-1 and tnf- results summarized above , il-6 protein levels in the granulomas derived from infected spp - knockout mice ( 28 30 ng / mg total protein ) and from infected nk1-knockout mice ( 50 16 ng / mg total protein ) were reduced by 79 and 62% , respectively , compared to levels in granulomas from infected wt mice ( 130 153 ng / mg total protein ; p < .05 for both ; student 's t - test ; see figure 4 ) .", "thus , sp signaling either directly or indirectly through the actions of il-1 and tnf- contributes to il-6 production within granulomas formed in response to dying t. crassiceps cysts ." ], [ "the current studies were performed to determine the contribution of sp and its specific receptor , nk1 , to granuloma development and proinflammatory cytokine production within granulomas arising in mice infected with t. crassiceps .", "we demonstrated that the size of granulomas from the t. crassiceps - infected spp - knockout mice and infected nk1-knockout mice were significantly smaller than granulomas from the infected wt mice .", "furthermore , proteins levels of il-1 , a key mediator of granuloma formation , were significantly lower within granuloma from spp- and nk1- knockout mice compared to granuloma from mice . ", "in addition , compared to granulomas from wt mice , protein levels of tnf- , another key mediator of granuloma formation , were significantly lower in spp - knockout mice and trended in the same direction in nk1-knockout mice .", "thus , sp signaling contributes to granuloma formation , in part , through induction of il-1 and tnf- , key mediators of granuloma formation .", "substance p and its high affinity receptor , nk1 , are known to play an important role in inflammatory responses .", "granuloma formation in response to murine schistosomiasis requires binding of sp to its specific receptor .", "sp is known to stimulate inflammatory cell infiltration and to induce the production of proinflammatory cytokines such as il-1 , il-6 , and tnf- by human peripheral mononuclear cells , bronchial cells , or astrocytoma cells [ 1929 ] .", "our findings extend these observations and indicate that sp signaling contributes to granuloma formation and production of il-1 , tnf- , and il-6 protein within granuloma formed in response to t. crassiceps infection .", "the mechanism by which sp stimulates the production of these cytokines may be by mediating inflammatory cell influx [ 1924 ] .", "nerves , endothelial cells , and cells of the immune system produce sp [ 3638 ] .", "all of these cells have receptors for sp and are known to respond to sp [ 3840 ] .", "sp is known to stimulate influx of lymphocytes , monocytes , macrophages , and other immune cells that produce proinflammatory cytokines such as il-1 , il-6 , and tnf- [ 1929 ] .", "although there are various studies on the molecular mechanisms by which sp stimulates the production of il-6 and tnf- , there is limited information on the molecular mechanisms by which sp stimulates il-1 production . a study by martin et al .", "these studies demonstrated that treatment with an intracellular calcium chelator blocked sp - induced il-1 production .", "other studies have demonstrated that sp induces tnf - alpha and il-6 production through nf kappa b in peritoneal mast cells", ". substance p production of tnf- in peritoneal mast cells is also known to be mediated via p38 and jnk map kinases .", "also il-6 production in human peripheral blood mononuclear cells , bronchial cells , and astrocytes is increased directly by sp through the action of nuclear factor il-6 ( nf - il-6 ) and p38 mapk [ 26 , 27 , 34 , 35 ] .", "preprotachykinin protein is cleaved to form two active neuropeptides , sp and neurokinin a. therefore , sp precursor ( preprotachykinin ) knockout mice produce neither sp nor neurokinin a. consequently , our results in spp - knockout mice can be attributed to a deficiency in either sp or neurokinin a or both . however , since nk1 binds only sp and not neurokinin a and the results in nk1-knockout mice mirror the findings in sp - knockout mice , we are confident in attributing reduced granuloma formation and proinflammatory cytokine production to the absence of sp signaling and not to reduced or absent neurokinin a signaling . in the current studies", ", we demonstrated that the granuloma size and the levels of the proinflammatory cytokine , il-1 , are lower in the infected nk1-knockout mice compared to those of the infected spp - knockout mice . besides sp , peptide hormones such as hemokinin can also bind and activate nk1 at sites of chronic inflammation .", "therefore , although the current studies suggest that sp may be an important mediator associated with cytokine production , there may be other peptide hormones like hemokinin that also bind and activate the nk1 receptor that may be associated with granuloma and cytokine production .", "therefore , it may be possible that in the nk1-knockout mice , the synergistic lack of activity of both sp and hemokinin may have resulted in lower il-1 levels and granuloma size as compared to spp - knockout mice . granuloma formation by the host in response to agents causing chronic infections is thought to be essential for limiting and eventually clearing infection .", "however , recent work in zebra fish infected with mycobacterium marinum suggests that granuloma formation contributes to early bacterial growth .", "intraparenchymal cysts of ncc are thought to die spontaneously and to elicit a granulomatous response that does not in itself contribute to the demise of the cyst .", "rather , we have previously demonstrated that early granuloma formed in response to dying cysts contributes to ncc disease manifestations by producing mediators that induce seizures .", "the current studies demonstrating that sp signaling contributes to granuloma formation in taenia crassiceps infection , together with other published observations , suggest the possibility that diminishing granuloma formation in ncc by blocking sp , which contributes to granuloma formation and epileptogenic responses , may be beneficial in the treatment of this disease ." ] ]

[ [ "in developing countries , congenital heart disease ( chd ) is the most common congenital malformation , and it presents high mortality and morbidity . the prevalence of chd has been reported to range from 4 to 50 cases per 1000 live births .", "most chd prevalence data are based on population - based birth defect registries or clinical symptoms .", "a few studies have assessed the prevalence of chd at birth by the echocardiographic screening of an in - hospital population .", "no large - sample , population - based study on chd using echocardiography has been conducted in langfang district .", "langfang district in hebei province is one of the prefecture - level cities with an area of 6429 square kilometers , and the population is approximately 4.4 million , mainly to the han nationality .", "the district governs 11 counties , namely sanhe , dachang , yongqing , yanjiao , bazhou , wenan , guan , guangyang , anci , dacheng , xianghe . in this cross - sectional study", ", we aimed to investigate the prevalence of chd in langfang district by analyzing data collected by hospitals located in the counties of the district , as supported a public health campaign focusing on chd treatment ." ], [ "this cross - sectional study took place in the langfang district 's 11 maternal and child health certificate registries responsible for the diagnosis of chd as commissioned by the health administrative department of district . according to the schedule of the public health campaign ,", "all 3-month - old infants in the district were encouraged to participate , but only those with willingness to undergo echocardiography in the outpatient department received an ultrasound examination . from july 19 , 2012 to july 18 , 2014 , it is reported that there were totally 77,836 3-month - old infants in the district . among those ,", "67,718 ( 87% ) joined the campaign and had received an ultrasound examination , whereas the remaining 10,118 did not .", "the reasons for nonparticipating were not surveyed , but as speculated by the local health staff involved in the public health campaign , feeling unnecessary may be a key reason .", "infants diagnosed with chd were followed up at 1 year of age , and their parents were invited to complete a questionnaire then .", "the study was approved by the general hospital of beijing military region ethics committee ( no .", "2011 - 98 ) , and written informed consent regarding the the protocol of chd screening in langfang district was signed by the parents of the infants . in this study ,", "diagnosis was made by echocardiography , and in all of the 11 hospitals , the sonosite m - turbo ultrasonic diagnostic instrument equipped with a pediatric probe ( frequency 48 mhz ) was used for the examination . cardiac structure and function", "were observed along the standard parasternal long - axis , short - axis , suprasternal , subcostal , and apical four - chamber views .", "all infants were scanned by a senior echocardiographic doctor with more than 5 years of echocardiographic experience to ensure quality .", "meanwhile , a self - administered standard questionnaire was designed to investigate socio - demographic characteristics , including maternal age , residence , infant gender , birth weight , gestational age , etc .", "the screening group comprised a pediatrician who was responsible for the clinical examination , an echocardiographic doctor who conducted the echo - diagnosis and a cardiologist who explained the abnormality or outcome .", "chd was classified on the basis of the international classification of diseases , ninth revision , and the clinical modification code .", "patent foramen oval and atrial septal defect ( asd ) ( defect < 4 mm in diameter ) were excluded from chd to avoid overestimation . to improve the participation rate ,", "half of the cost of echocardiography ( approximately rmb 245 yuan ) was supported by the local government , and the maternity and child care institutions prescribed an echocardiography application form for every infant while distributing birth certificates or at the time of vaccination or physical examination . along with the echocardiography application form , a data collection form was also provided to infants parents .", "the data collection form was used to collect the demographic information and to record the echocardiography result and referral information .", "once the echocardiography was completed , the data will be entered into an online data collection system designed specifically for this public health campaign by trained staff from the maternity and child healthcare institutions . to standardize the diagnosis , echocardiography expert from general hospital of beijing military region are in charge of confirmation of chd and providing technical support . to facilitate reassessment of echocardiography diagnosis", ", all image graphs were required to be stored in the computer . to avoid misdiagnosis and omissions", "the data used in this study were directly exported from the data collection system in the form of an excel spreadsheet .", "the chi - square test was used to compare rates . the value of p < 0.05 was considered statistically significant ." ], [ "this cross - sectional study took place in the langfang district 's 11 maternal and child health certificate registries responsible for the diagnosis of chd as commissioned by the health administrative department of district . according to the schedule of the public health campaign ,", "all 3-month - old infants in the district were encouraged to participate , but only those with willingness to undergo echocardiography in the outpatient department received an ultrasound examination . from july 19 , 2012 to july 18 , 2014 , it is reported that there were totally 77,836 3-month - old infants in the district . among those ,", "67,718 ( 87% ) joined the campaign and had received an ultrasound examination , whereas the remaining 10,118 did not .", "the reasons for nonparticipating were not surveyed , but as speculated by the local health staff involved in the public health campaign , feeling unnecessary may be a key reason .", "infants diagnosed with chd were followed up at 1 year of age , and their parents were invited to complete a questionnaire then ." ], [ "the study was approved by the general hospital of beijing military region ethics committee ( no .", "2011 - 98 ) , and written informed consent regarding the the protocol of chd screening in langfang district was signed by the parents of the infants ." ], [ "in this study , diagnosis was made by echocardiography , and in all of the 11 hospitals , the sonosite m - turbo ultrasonic diagnostic instrument equipped with a pediatric probe ( frequency 48 mhz ) was used for the examination . cardiac structure and function", "were observed along the standard parasternal long - axis , short - axis , suprasternal , subcostal , and apical four - chamber views .", "all infants were scanned by a senior echocardiographic doctor with more than 5 years of echocardiographic experience to ensure quality .", "meanwhile , a self - administered standard questionnaire was designed to investigate socio - demographic characteristics , including maternal age , residence , infant gender , birth weight , gestational age , etc .", "the screening group comprised a pediatrician who was responsible for the clinical examination , an echocardiographic doctor who conducted the echo - diagnosis and a cardiologist who explained the abnormality or outcome ." ], [ "chd was classified on the basis of the international classification of diseases , ninth revision , and the clinical modification code .", "patent foramen oval and atrial septal defect ( asd ) ( defect < 4 mm in diameter ) were excluded from chd to avoid overestimation ." ], [ "to improve the participation rate , half of the cost of echocardiography ( approximately rmb 245 yuan ) was supported by the local government , and the maternity and child care institutions prescribed an echocardiography application form for every infant while distributing birth certificates or at the time of vaccination or physical examination . along with the echocardiography application form , a data collection form was also provided to infants parents .", "the data collection form was used to collect the demographic information and to record the echocardiography result and referral information .", "once the echocardiography was completed , the data will be entered into an online data collection system designed specifically for this public health campaign by trained staff from the maternity and child healthcare institutions . to standardize the diagnosis , echocardiography expert from general hospital of beijing military region are in charge of confirmation of chd and providing technical support . to facilitate reassessment of echocardiography diagnosis", ", all image graphs were required to be stored in the computer . to avoid misdiagnosis and omissions" ], [ "the data used in this study were directly exported from the data collection system in the form of an excel spreadsheet .", "chicago illinois , usa ) . the chi - square test was used to compare rates . the value of p < 0.05 was considered statistically significant ." ], [ "of the 77,836 3-month - old infants who were born during the study , 67,718 were examined by echocardiography ( coverage rate : 67,718/77 , 836 = 87% ) , including 61,505 full - term infants and 6213 preterm infants ( < 37 weeks ) .", "a total of 1554 infants were diagnosed with chd during the 2-year ( 42.5% boys , 57.5% girls ) .", "the top five most common cardiac abnormalities were the following : asd ( 605 cases , 8.93 ) ; ventricular septal defect ( vsd , 550 cases , 8.12 ) ; patent ductus arteriosus ( pda , 228 cases , 3.37 ) ; pulmonary stenosis ( ps , 66 cases , 0.97 ) ; and tetralogy of fallot ( tof , 32 cases , 0.47 ) .", "the chd prevalence differed by gender in this study ( = 23.498 , p < 0.001 ) , and there were more females with asd ( = 56.62 ) ; however , this was not true of vsd ( = 0.01 ) or pda ( = 0.86 ) [ table 1 ] .", "regional differences in prevalence were also found ( = 24.602 , p < 0.001 ) ; a higher prevalence was found in urban areas ( 32.2 cases per 1000 live births ) than in rural areas ( 21.1 cases per 1000 live births ) . there was a significant difference in the prevalence of chd in preterm versus full - term infants ( = 133.443 , p < 0.001 ) .", "prevalence of chd in infants of maternal aged 35 years or over was significantly higher ( = 86.917 , p < 0.001 ) .", "chd distribution by gender asd : atrial septal defect ; vsd : ventricular septal defect ; pda : patent ductus arteriosus ; ps : pulmonary stenosis ; tof : tetralogy of fallot ; dorv : double - outlet right ventricle ; sv : single ventricle ; iaa : interrupted aortic arch ; chd : congenital heart disease ." ], [ "of the 77,836 3-month - old infants who were born during the study , 67,718 were examined by echocardiography ( coverage rate : 67,718/77 , 836 = 87% ) , including 61,505 full - term infants and 6213 preterm infants ( < 37 weeks ) ." ], [ "a total of 1554 infants were diagnosed with chd during the 2-year ( 42.5% boys , 57.5% girls ) .", "the top five most common cardiac abnormalities were the following : asd ( 605 cases , 8.93 ) ; ventricular septal defect ( vsd , 550 cases , 8.12 ) ; patent ductus arteriosus ( pda , 228 cases , 3.37 ) ; pulmonary stenosis ( ps , 66 cases , 0.97 ) ; and tetralogy of fallot ( tof , 32 cases , 0.47 ) .", "the chd prevalence differed by gender in this study ( = 23.498 , p < 0.001 ) , and there were more females with asd ( = 56.62 ) ; however , this was not true of vsd ( = 0.01 ) or pda ( = 0.86 ) [ table 1 ] .", "regional differences in prevalence were also found ( = 24.602 , p < 0.001 ) ; a higher prevalence was found in urban areas ( 32.2 cases per 1000 live births ) than in rural areas ( 21.1 cases per 1000 live births ) . there was a significant difference in the prevalence of chd in preterm versus full - term infants ( = 133.443 , p < 0.001 ) .", "prevalence of chd in infants of maternal aged 35 years or over was significantly higher ( = 86.917 , p < 0.001 ) .", "chd distribution by gender asd : atrial septal defect ; vsd : ventricular septal defect ; pda : patent ductus arteriosus ; ps : pulmonary stenosis ; tof : tetralogy of fallot ; dorv : double - outlet right ventricle ; sv : single ventricle ; iaa : interrupted aortic arch ; chd : congenital heart disease ." ], [ "a total of 67,718 3-month - old infants were diagnosed using echocardiography in langfang district during 20122014 , and 1554 infants were found to have chd .", "the total prevalence of chd was 22.9 , which higher than the previously reported 8 , but within the range reported using echocardiography .", "the order of chd in langfang district as follow : asd , vsd , pda , pa , and tof .", "the chd prevalence differed by gender , regional , gestational , and maternal age . in this study , we used echocardiography as a diagnosis tool to investigate the prevalence of chd in langfang district in china ; the overall prevalence of chd was found to be 22.9 cases per 1000 live births .", "this result is similar to those found in shanghai ( 26.6 cases per 1000 live births ) and japan ( 50.3 cases per 1000 live births ) but is significantly higher than that found in other reports .", "the similar findings in the former two studies might be a result of the use of echocardiography as a diagnosis tool .", "similarly , some of the differences in results might be caused by differences in methodology ( i.e. , in the us , assessment might be more accurate because of the assessment of intracardiac deformity rather than auscultation ) , data source ( birth defect registration or clinical assessment ) , and subject age at time of diagnosis ( small muscular vsd ; pda has a high spontaneous closure rate , which might decrease the detection rate ) .", "the chd prevalence found here ( 22.9 ) was determined by echocardiographic diagnosis and is higher than the internationally accepted level of 8 cases per 1000 live births and the published domestic rate ( 6.64 cases per 1000 live births ) . to some extent , this result occurred because of more complete supervision by local public health authorities , better monitoring and greater standardization , and the wide application of echocardiography diagnosis .", "however , this finding also reflects the heavy responsibility of diagnosis for chd and the need for long - term follow - up and observation .", "our data indicate that asd is the most frequent type of chd , followed by vsd , pda , ps , and tof , in that order .", "this result is consistent with a previous report from india , which indicated that asd was the most frequent lesion .", "however , some researchers have found vsd to be the most frequent type of chd .", "some small vsds might close spontaneously , and large vsds present symptoms early , prompting treatment .", "many asymptomatic infants with asd were diagnosed for the first time during the screening ; this might also be responsible for the higher asd prevalence found in our study . in general ,", "the difference in the prevalence between males and females was significant in this study ( = 23.498 , p < 0.001 ) ; there were more female cases of asd .", "at present , the cause of heart malformation in infants remains unclear and is perhaps related to gestational age , family history , radiation exposure , the use of medication , etc .", "previous studies have shown that the prevalence of chd in males and females is approximately the same ; however , the prevalence of artery stenosis , tof , and transposition of the great artery is higher in males than in females .", ", researchers have reported a higher prevalence in urban areas than in rural areas , but the potential risk factors for chd in urban areas are unknown .", "regional differences in prevalence were also found in our study ; the prevalence was higher in urban areas ( 32.2 cases per 1000 live births ) and lower in rural areas ( 21.9 cases per 1000 live births ) .", "although urban areas have the advantage over rural areas in terms of size , population , the economy and other aspects , there might be more environmental risk factors in urban environments , such as extensive applications of lead and other heavy metals in industrial and agricultural production or the emission of toxic pollutant gases , all of which increase the prevalence of chd .", "second , in rural areas , birth asphyxia , chds , premature birth / low birth weight , pneumonia , and drowning were the five leading causes of death in 1997 .", "the death rate was also lower in urban areas than in rural areas at that time .", "in addition , mahle et al . and hunte et al . suggest that a prenatal diagnosis has a favorable effect on the treatment of patients undergoing staged palliation , reduces early morbidity , and improves the child survival rate .", "the prevalence of chd in dachang hui autonomous county ( 19.5 cases per 1000 live births ) was below average ( 22.9 cases per 1000 live births ) ; further large - sample studies are necessary to clarify differences between races .", "unfortunately , the number of ethnicities in the current study was too small to yield significant results .", "langfang district is mainly rural , reflects the diagnosis of chd at the grass - roots level in china .", "the surgical survival of part of the chd has reached a higher level , but the understanding and diagnosis of chd remain to be improved at the grass - roots level in china , especially in rural areas and basic - level hospitals .", "the study is given priority to with the rural population , the data showed that train the doctor of community and township hospitals on chd diagnosis is very important .", "researchers have pointed out that in very preterm / low birth weight infants chd are more prevalent than in the general liveborn population , and confer an increased risk of death and serious morbidities independently of other risk factors .", "tanner et al . showed that preterm infants have more than twice as many cardiovascular malformations as do infants born at term and that 16% of all infants with cardiovascular malformations are preterm .", "pappas et al . reported that extremely preterm infants ( < 1000 g ) with congenital heart defect were 0.8% .", "the date came from the national institute of child health and human development neonatal research network . in this study", ", we found that prevalence of chd in infants of maternal aged 35 years or over were significantly higher .", "advanced maternal age is proposed to be a risk factor of the heart malformation in some studies ; miller et al .", "found that advanced maternal age 35 years was associated with increased prevalence of several chd .", "the reason might be caused by increased mutations in the germ cell line because of cumulated cell replications .", "similar to maternal age , advanced paternal age is proposed to be a risk factor of chd in the offspring , but the biological mechanism is not clear .", "the screening team comprised 3 doctors : a pediatrician who was responsible for clinical examination , an echocardiographer who was responsible for screening the chd , and a cardiologist who was responsible for explaining any abnormality or the outcome .", "our multidisciplinary clinical practice model consolidated different experts into one team , which directly communicated comprehensive treatment recommendations to parents with chd infants to improve the quality of the infants lives .", "early screening not only helps reduce undetected chd but also can provide accurate data for improving the management of chd .", "first , as a cross - sectional and single center study , the results only reflect the prevalence of chd in langfang district , providing the up - to - date in this geographical region .", "second , since not all infants underwent echocardiography , 13% of infants have been missed .", "third , we included only live births , and some infants with chd who died before screening were not included .", "long - term follow - up is necessary to determine the temporal trends of the prevalence of chd . in conclusions ,", "echocardiography is a reliable and simple imaging examination method that can be used in the diagnosis of chd , particularly for measuring intracardiac structure and blood flow .", "currently , echocardiography has become the most important , noninvasive and standard diagnostic method for chd and is helpful in early diagnosis and in reducing mortality ." ], [ "" ], [ "" ] ]

[ [ "renal transplantation rates are low among patients highly sensitized to human leukocyte antigen ( hla ) because of the high rate of antibody - mediated rejection and subsequent graft loss .", "it was recently reported , however , that preoperative desensitization using an anti - cd 20 antibody ( rituximab ) and intravenous immunoglobulin improved transplantation rates in patients highly sensitized to hla . in contrast , the significance of a positive lymphocytotoxic crossmatch in living donor liver transplantation ( ldlt ) is controversial .", "successful ldlt using a liver graft in which the lymphocytotoxic crossmatch was highly positive is reported ." ], [ "the recipient was a 41-year - old woman with end - stage liver disease due to alcoholic liver cirrhosis ( model for end - stage liver disease score 21 ) . at the age of 20 , she was gravida one , para one .", "she was considered a candidate for liver transplantation because of repeated episodes of encephalopathy . because of the severe shortage of cadaveric donor grafts in japan , we planned an ldlt , and her husband was willing to donate his partial liver .", "the abo blood type was identical , but the t lymphocytotoxic crossmatch titer was over 10,000 and the b lymphocytotoxic crossmatch titer was 128 ( complement method with the dilution technique according to the standard national institutes of health technique ) .", "in addition , an examination of anti - hla antibodies using fluorescent microspheres revealed that the recipient had donor specific antibodies ( b51 and b52 ) .", "after obtaining written informed consent from the patient and donor and the approval of the intra - institutional committee , we proceeded to the preoperative preparations .", "for preoperative desensitization , the patient was first infused with rituximab 2 weeks before the scheduled surgery ( due to a catheter - associated infection , however , the operation was postponed and ldlt was performed 21 days after initiation of the rituximab therapy ) . as the antibody to hepatitis b core antigen was positive , entecavir ( 0.5 mg / day ) was administered for 3 weeks preoperatively to prevent a possible hepatitis b virus breakthrough .", "on postoperative days 1 and 4 , 20 mg of anti - cd25 antibody ( basiliximab ) was administered in addition to the routine methylprednisolone and tacrolimus , as we were anxious about hyperacute rejection . besides , mycophenolate mofetil ( mmf ; 2,000 mg / day ) was started on postoperative day 7 .", "the postoperative course was uneventful except for an episode of mild acute cellular rejection ( banff score 3 ) on postoperative day 27 , which responded promptly to steroid recycle therapy .", "the liver biopsy specimen obtained at the time of the acute rejection showed mild infiltration of lymphocytes in the portal area and around the bile ducts .", "one year after the ldlt , the lymphocytotoxic crossmatch remained negative and the patient has been well with good graft function.fig . ", "acr acute cellular rejection , alt alanine aminotransferase , mmf mycophenolate mofetil , mp methylprednisolone , pe plasma exchange , tb total bilirubin , pod postoperative day the clinical profile of the present patient .", "acr acute cellular rejection , alt alanine aminotransferase , mmf mycophenolate mofetil , mp methylprednisolone , pe plasma exchange , tb total bilirubin , pod postoperative day" ], [ "the impact of a lymphocytotoxic crossmatch - positive liver graft on acute cellular rejection and graft survival remains controversial , both in deceased donor liver transplantation [ 3 , 4 ] and in ldlt [ 57 ] .", "some institutions have reported significantly unfavorable outcomes in ldlt recipients with a positive lymphocytotoxic crossmatch [ 6 , 7 ] .", "in contrast , our previous results showed that if the titer is low ( no more than 32 ) , a positive lymphocytotoxic crossmatch does not adversely affect the graft or survival in patients without desensitization .", "although the significance of a quantitative assessment of the lymphocytotoxic crossmatch has not been reported , the high titer in our present patient led to the need for perioperative desensitization to prevent early graft loss due to antibody - mediated rejection . after considering the results in the present patient ,", "we have settled the indication criteria for preoperative desensitization therapy at the titer of 1,000 ( t lymphocyte crossmatch ) . in this patient ,", "therefore , we applied preoperative desensitization using rituximab and plasmapheresis to reduce the high titer of preformed antibodies and b lymphocytes . as a result ,", "the lymphocytotoxic crossmatch was negative after the 3rd plasmapheresis , and negativity was sustained thereafter .", "preoperative desensitization using rituximab was introduced in abo - incompatible ldlt in 2003 and has dramatically improved the outcomes of abo - incompatible ldlt .", "the appropriate dosage of rituximab is still controversial , but many previous studies have reported the administration of 375 mg / m of rituximab 13 weeks before the transplant . following these successful cases , we planned the administration of 375 mg / m ( 500 mg / body ) of rituximab 2 weeks before the operation [ 8 , 9 ] .", "splenectomy is also considered to be effective to reduce antibody production , as the spleen is the site of antibody production .", "after the operation , the suppression of t - cell function to prevent the initiation of t - cell - mediated antibody production was regarded as indispensable .", "we have routinely used tacrolimus and steroid as an immunosuppressive regimen , and in this particular patient , we added basiliximab ( postoperative days [ pods ] 1 and 4 ) and mmf .", "mild acute cellular rejection occurred about 3 weeks after the ldlt , but response to the steroid recycle therapy was prompt , and the lymphocytotoxic crossmatch was negative during this episode . in summary , we report a successful ldlt using a lymphocytotoxic crossmatch highly positive graft .", "perioperative desensitization using plasmapheresis and rituximab may provide significant benefits for reducing anti - hla antibodies ." ] ]

[ [ "acute kidney injury ( aki ) , defined as an abrupt drop of renal function within a short period , is a frequent and serious complication in the intensive care unit ( icu ) or after surgery , with an incidence of 7.7%42% in patients with previous normal renal function.1,2 aki or even a minor increase in serum creatinine level from baseline was independently associated with increased length of hospitalization , health care costs , cardiovascular events , and mortality.3,4 although there have been many clinical studies on the protection of kidney function in patients with critical illness or perioperative care , such as the administration of n - acetylcysteine , atrial natriuretic peptide , and fenoldopam , the results of such interventions are somewhat contradictory or unproven.5 consequently , it is paramount that more attention should be paid to explore effective preventative and therapeutic strategies for the management of aki .", "erythropoietin ( epo ) , a 30-kda glycoprotein hormone , is produced by the kidney to regulate the hematopoiesis in bone marrow , and recombinant human epo has been widely used in the treatment of anemia , especially in end - stage renal disease and certain hematologic diseases.6 interestingly , there is considerable evidence indicating that epo acts as a novel renoprotective agent against ischemic , toxic , and septic aki in animal experiments by reducing apoptosis , stimulating cell proliferation and eliciting its antioxidative and anti - inflammatory functions.7,8 recently , a few randomized controlled trials ( rcts ) analyzed the role of epo to prevent aki in patients within the icu or after surgery who were at high risk of aki.918 however , the results from these trials were inconsistent , partly because they involved single - site studies with small - scale samples .", "therefore , we conducted a systematic review and meta - analysis of rcts to determine whether the use of epo in patients with critical illness or perioperative care could ameliorate the incidence of aki and assess its adverse event ." ], [ "this systematic review and meta - analysis was conducted according to the preferred reporting items for systematic reviews and meta - analyses ( prisma ) statement recommendations.19 a comprehensive search was conducted in medline ( through ovid ) , embase ( through ovid ) , the cochrane central registry of controlled trials , and the web of science from inception to october 2014 .", "medical subject headings , entry terms , and text word searches included the following terms : critical illness , critical care , intensive care , ", "icu , severely ill , perioperative care , perioperative period , erythropoietin , ", "epoetin , epo , erythropoiesis stimulating protein , darbepoetin , acute kidney injury , acute renal injury , acute renal insufficiency , acute kidney insufficiency , acute renal failure , acute kidney failure , acute tubular necrosis , aki , ", "arf , and atn . there was no restriction on language or publication date .", "in addition , other potentially relevant studies were searched from the clinical trials database ( http://clinicaltrials.gov/ ) for completed trials and the references cited in the retrieved articles and pertinent reviews .", "all titles , abstracts , and full articles were independently searched and evaluated using predesigned inclusion and exclusion criteria by 2 investigators ( c.z . and z.c.l . ) .", "any discrepancies were resolved by consensus with a third investigator ( q.m.l . ) if necessary , which was infrequent .", "studies were included when the following inclusion criteria were met : ( 1 ) rcts , ( 2 ) adult patients ( age 18 years ) with critical illness or perioperative care , ( 3 ) use of epo for prevention at least in 1 treatment group , ( 4 ) control group receiving placebo or usual treatment , ( 5 ) reported incidences of aki in both groups , and ( 6 ) for more than 1 publication on the same trial , data from the most recent or complete report were used .", "exclusion criteria were as follows : ( 1 ) nonrandomized or pseudo - randomized design , retrospective study , case report , and case series ; ( 2 ) enrolled participants undergoing chronic dialysis therapy , nephrectomy , or transplant surgery ( heart , liver , or kidney ) due to their complex situations ; ( 3 ) lack of a control group ; ( 4 ) studies not addressing the target outcome as mentioned above ; and ( 5 ) use of epo as a treatment agent after the occurrence of aki .", "two investigators ( q.m.l . and x.x . ) independently extracted data from all eligible trials and assessed the risk of bias .", "data included the first author , publication year , nation of origin , study participants , sample size , whether epo was used previously , mean age , proportions of male patients , hypertension , and diabetes mellitus , mean baseline hemoglobin and serum creatinine levels , mean blood transfusion volume , treatment regimens of the epo - based intervention and control groups , definition of aki , and outcomes measured .", "the primary outcome was the incidence of aki , the secondary outcomes included dialysis requirement , 30-day mortality , and the adverse events .", "when the study had several dosage intervention arms,14 all epo intervention arms were combined as one arm by weighted means . in the case of missing or incomplete data , the corresponding author of the original trial was contacted by e - mail for additional information .", "the risk of bias in the eligible trials was assessed according to the cochrane collaboration tool ( version 5.1.0),20 which included 7 items : random sequence generation , allocation concealment , blinding of participants and personnel , blinding of outcome assessment , incomplete outcome data , selective reporting , and other bias . in each item , an answer of low risk of bias suggested sufficient and correct information , high risk of bias indicated that the item was reported incorrectly , and unclear risk of bias meant insufficient or unmentioned details for judgment . for dichotomous outcomes ( the incidence of aki , dialysis requirement , and mortality ) ,", "data were pooled as risk ratio ( rr ) with 95% confidence interval ( ci ) .", "the between - study heterogeneity was quantified by cochran 's q - statistic and the inconsistency index ( i ) . if there was significant heterogeneity among studies ( pq - statistic < 0.10 and i >", "50% ) , the random effect model ( dersimonian and laird method ) was adopted to pool the results ; otherwise , the fixed effect model ( mantel - haenszel method ) was used .", "subgroup analysis was performed based on ( 1 ) entirely perioperative care , ( 2 ) no use of epo previously , ( 3 ) at least 2 doses of epo , and ( 4 ) patients at high risk for aki according to each study .", "sensitivity analysis was conducted to assess the influence of individual studies on the pooled estimate of effects by withdrawing 1 study at a time .", "an asymmetric funnel plot and pegger 's test less than 0.05 indicated a significant publication bias . the assessment for the risk of bias", "all statistical analyses were conducted using the stata / se 12.0 software ( stata corporation , college station , tx ) .", "a p value less than 0.05 by a 2-sided test was considered to be statistically significant ." ], [ "a comprehensive search was conducted in medline ( through ovid ) , embase ( through ovid ) , the cochrane central registry of controlled trials , and the web of science from inception to october 2014 .", "medical subject headings , entry terms , and text word searches included the following terms : critical illness , critical care , intensive care , ", "icu , severely ill , perioperative care , perioperative period , erythropoietin , epoetin , epo , erythropoiesis stimulating protein , darbepoetin , acute kidney injury , acute renal injury , acute renal insufficiency , acute kidney insufficiency , acute renal failure , acute kidney failure , acute tubular necrosis , aki , ", "arf , and atn . there was no restriction on language or publication date .", "in addition , other potentially relevant studies were searched from the clinical trials database ( http://clinicaltrials.gov/ ) for completed trials and the references cited in the retrieved articles and pertinent reviews ." ], [ "all titles , abstracts , and full articles were independently searched and evaluated using predesigned inclusion and exclusion criteria by 2 investigators ( c.z . and z.c.l . ) .", "any discrepancies were resolved by consensus with a third investigator ( q.m.l . ) if necessary , which was infrequent .", "studies were included when the following inclusion criteria were met : ( 1 ) rcts , ( 2 ) adult patients ( age 18 years ) with critical illness or perioperative care , ( 3 ) use of epo for prevention at least in 1 treatment group , ( 4 ) control group receiving placebo or usual treatment , ( 5 ) reported incidences of aki in both groups , and ( 6 ) for more than 1 publication on the same trial , data from the most recent or complete report were used .", "exclusion criteria were as follows : ( 1 ) nonrandomized or pseudo - randomized design , retrospective study , case report , and case series ; ( 2 ) enrolled participants undergoing chronic dialysis therapy , nephrectomy , or transplant surgery ( heart , liver , or kidney ) due to their complex situations ; ( 3 ) lack of a control group ; ( 4 ) studies not addressing the target outcome as mentioned above ; and ( 5 ) use of epo as a treatment agent after the occurrence of aki ." ], [ "two investigators ( q.m.l . and x.x . ) independently extracted data from all eligible trials and assessed the risk of bias .", "data included the first author , publication year , nation of origin , study participants , sample size , whether epo was used previously , mean age , proportions of male patients , hypertension , and diabetes mellitus , mean baseline hemoglobin and serum creatinine levels , mean blood transfusion volume , treatment regimens of the epo - based intervention and control groups , definition of aki , and outcomes measured .", "the primary outcome was the incidence of aki , the secondary outcomes included dialysis requirement , 30-day mortality , and the adverse events .", "when the study had several dosage intervention arms,14 all epo intervention arms were combined as one arm by weighted means . in the case of missing or incomplete data , the corresponding author of the original trial was contacted by e - mail for additional information .", "the risk of bias in the eligible trials was assessed according to the cochrane collaboration tool ( version 5.1.0),20 which included 7 items : random sequence generation , allocation concealment , blinding of participants and personnel , blinding of outcome assessment , incomplete outcome data , selective reporting , and other bias . in each item , an answer of low risk of bias suggested sufficient and correct information , high risk of bias indicated that the item was reported incorrectly , and unclear risk of bias meant insufficient or unmentioned details for judgment ." ], [ "for dichotomous outcomes ( the incidence of aki , dialysis requirement , and mortality ) , data were pooled as risk ratio ( rr ) with 95% confidence interval ( ci ) .", "the between - study heterogeneity was quantified by cochran 's q - statistic and the inconsistency index ( i ) .", "if there was significant heterogeneity among studies ( pq - statistic < 0.10 and i > 50% ) , the random effect model ( dersimonian and laird method ) was adopted to pool the results ; otherwise , the fixed effect model ( mantel - haenszel method ) was used .", "subgroup analysis was performed based on ( 1 ) entirely perioperative care , ( 2 ) no use of epo previously , ( 3 ) at least 2 doses of epo , and ( 4 ) patients at high risk for aki according to each study .", "sensitivity analysis was conducted to assess the influence of individual studies on the pooled estimate of effects by withdrawing 1 study at a time .", "an asymmetric funnel plot and pegger 's test less than 0.05 indicated a significant publication bias .", "the assessment for the risk of bias was performed with review manager software ( version 5.3 from http://tech.cochrane.org/revman ) .", "all statistical analyses were conducted using the stata / se 12.0 software ( stata corporation , college station , tx ) .", "a p value less than 0.05 by a 2-sided test was considered to be statistically significant ." ], [ "the initial search yielded 615 citations , of which 72 were duplicate studies that were excluded . after reviewing the titles and abstracts of 543 citations ,", "516 articles were removed because of irrelevant content . upon review of the full text of 27 articles , ten eligible rcts with 2759 participants were identified for this meta - analysis.918 flow diagram of article selection approach .", "the included studies spanned from 2002 to 2014 , and with the exception of 2 articles,9,10 the sample size of all other studies was relatively small ( 63108 participants ) .", "four trials were conducted in korea,12,13,16,17 2 in the united states,9,10 and the others in new zealand,11 switzerland,14 thailand,15 and sweden.18 napolitano et al10 reanalyzed the data from critically ill trauma patients in epo-2 trial,9 which had been included in this meta - analysis , so only the part of epo-3 trial was included in this analysis .", "the intention to treat of participants in 1 study included aki patients on randomization,11 and for the objective of this meta - analysis , the data of the subgroup not aki on randomization were used in this analysis .", "one study13 was the follow - up of a previous trial21 ; therefore , the incidence of aki was extracted from the former , and the baseline data were extracted from the latter . all studies enrolled participants from single - site center except 3.911 with respect to the participants setting , 8 studies were performed in perioperative period , 6 of which were conducted in patients with elective cardiac surgery,1216,18 one assessed patients undergoing thoracic aorta surgery with hypothermic cardiac arrest,17 and the rest one partly included patients with scheduled cardiothoracic surgery.11 baseline clinical characteristics of included studies six studies excluded patients who used epo previously,9,10,13,15,17,18 whereas other studies did not specify this issue . in 3 of the 10 studies , a high risk for developing aki , the definitions of which were not the same , was included in the enrollment criteria.11,14,16 in 8 studies , baseline end - stage renal disease or dialysis was set as a compulsory exclusion criterion.913,15,16,18 when reported , mean baseline hemoglobin levels ranged from 9.3 to 13.1 g / dl,9,10,1215,18 and mean baseline serum creatinine levels varied from 0.92 to 1.35 mg / dl.1316,18 the type of erythropoiesis - stimulating agent used in all of the intervention groups was epo - alpha or -beta , but not darbepoietin .", "the one - time epo dosage was either fixed as 20,000 units or 40,000 units in 3 studies9,10,14 or was based on participant weight ranging from 100 units / kg to 500 units / kg in the other 7 studies .", "the participants in 6 studies received only a single administration of epo1214,1618 ; however , participants received at least 2 doses in the other studies . two studies provided supplementary iron therapy to both the intervention and control groups,9,10 and 1 study provided an iron sucrose supplement only to the intervention group.12 there was considerable variation in the definition of aki across these studies , which was not clear in 2 studies.9,10", "all ten studies reported randomization , but 7 studies described the methods of randomization,912,14,16,18 and only 4 studies showed the details of concealed allocation.11,13,15,18 all studies reported double blinding and no or few missing outcome data with the reason .", "eight studies provided the clinical trial registration number online with a low risk of bias in selective outcome reporting.10,11,1318 because of the unbalanced use of iron supplementation in 2 groups , 1 study exhibited a high risk of bias in the item other biases.12 risk of bias in included studies .", "a , risk of bias graph demonstrates the percentages of included studies for each item in the tool ; ( b ) risk of bias summary illustrates the review author 's judgments with a cross - tabulation for each eligible study .", "all ten eligible rcts reported that the overall incidence of aki was 10.57% ( 147 of 1391 participants ) in the epo - based intervention group and 10.38% ( 142 of the 1368 participants ) in the control group .", "pooled analysis using a fixed effect model showed that there was no significant difference for preventing the development of aki between the epo and control groups ( rr , 0.97 ; 95% ci , 0.791.19 ; p = 0.782 ) , as shown in figure 3a . meanwhile , the test for between - study heterogeneity among the included trials was not significant ( i = 20.2% and p = 0.257 ) .", "forest plots of rr estimates with the corresponding 95% ci for ( a ) the incidence of aki , ( b ) dialysis requirement , and ( c ) mortality in patients receiving epo therapy versus control .", "the columns of intervention and control were presented as number of events / number of participants .", "stratified analyses of studies with entirely perioperative care demonstrated no significant difference between the epo and control groups using a fixed effect model ( rr , 0.86 ; 95% ci , 0.661.12 ; p = 0.260 ; i = 33.9% ; p = 0.169).1218 among studies that excluded patients with prior epo use , similar result of rr was obtained ( rr , 0.89 ; 95% ci , 0.661.21 ; p = 0.467 ; i = 23.3% , p = 0.259).9,10,13,15,17,18 among patients who received at least 2 doses of epo911,15 or were at high risk of aki according to each study,11,14,16 the prevention of aki remained nonsignificant ( rr , 0.99 ; 95% ci , 0.731.35 ; p = 0.962 ; i = 44.3% , p = 0.145 and rr , 1.22 ; 95% ci , 0.891.67 ; p = 0.215 ; i", "the sensitivity analysis after exclusion of 1 study at a time demonstrated that the above pooled result was robust and did not change much depending on any single study ( fig .", "it should be noted that after removing the study,12 which gave iron supplement only to epo intervention group , the overall rr was 1.02 ( 95% ci , 0.821.27 ; p = 0.824 ) without statistical significance .", "the sensitivity analysis by removing each individual study at a time is shown on the pooled effect size of the incidence of aki .", "the funnel plot and egger 's test analysis indicated that there was no evidence of publication bias for the aki outcome ( fig .", "the funnel plots for publication bias tests of studies assessing the effect of epo on ( a ) the incidence of aki and ( b ) mortality .", "the dialysis requirement was reported in 7 studies11,1318 totaling 590 analyzable patients , and in 3 of these studies , no patient was treated with dialysis in either group.13,14,18 the overall incidence of dialysis was 2.65% ( 8 of the 302 participants ) in the epo - based intervention group and 3.82% ( 11 of the 288 participants ) in the control group . by meta - analysis for 4 studies using a fixed effect model,11,1517", "there was no significant difference of mortality between the epo and control groups ( rr , 0.72 ; 95% ci , 0.311.70 ; p = 0.457 ) without significant between - study heterogeneity ( i = 0% , p = 0.662 ) , as shown in figure 3b .", "because there were only 4 articles in the literature with the effective data , the publication bias was not investigated .", "the ten included studies demonstrated that overall mortality was 11.07% ( 154 of the 1391 participants ) in the epo - based intervention group and 11.40% ( 156 of the 1368 participants ) in the control group .", "mortality was ascertained in - hospital in 3 studies,13,15,16 at 30 days in 5 studies,912,14 and unclear in the remaining study.17,18 pooled analysis using a fixed effect model showed that there was no significant difference of mortality between the epo and control groups ( rr , 0.96 ; 95% ci , 0.781.18 ; p = 0.705 ) without significant between - study heterogeneity ( i = 0% , p = 0.562 ) , as shown in figure 3c . meanwhile , there was no evidence of publication bias for the mortality outcome ( fig .", "six studies demonstrated that none of the patients who received the epo intervention suffered from adverse events , which were associated with the use of drug , throughout the study period , such as hypertension , symptomatic thrombosis , myocardial infarction , stroke , headache , and seizures.1216,18 one study did not report adverse events,17 and 1 study reported adverse events for the entire participants without specifically describing the specific group.11 corwin et al9 showed that the incidence of deep thrombophlebitis was 2.15% ( 14/650 ) among the epo intervention group and 2.30% ( 15/652 ) in the control group without significant difference .", "napolitano et al10 reported that the incidence of clinically relevant thrombovascular events was 16.42% ( 66/402 ) in the epo intervention group and 12.53% ( 49/391 ) in the control group with an rr of 1.31 ( 95% ci , 0.931.85 ) ." ], [ "the included studies spanned from 2002 to 2014 , and with the exception of 2 articles,9,10 the sample size of all other studies was relatively small ( 63108 participants ) .", "four trials were conducted in korea,12,13,16,17 2 in the united states,9,10 and the others in new zealand,11 switzerland,14 thailand,15 and sweden.18 napolitano et al10 reanalyzed the data from critically ill trauma patients in epo-2 trial,9 which had been included in this meta - analysis , so only the part of epo-3 trial was included in this analysis .", "the intention to treat of participants in 1 study included aki patients on randomization,11 and for the objective of this meta - analysis , the data of the subgroup not aki on randomization were used in this analysis .", "one study13 was the follow - up of a previous trial21 ; therefore , the incidence of aki was extracted from the former , and the baseline data were extracted from the latter . all studies enrolled participants from single - site center except 3.911 with respect to the participants setting , 8 studies were performed in perioperative period , 6 of which were conducted in patients with elective cardiac surgery,1216,18 one assessed patients undergoing thoracic aorta surgery with hypothermic cardiac arrest,17 and the rest one partly included patients with scheduled cardiothoracic surgery.11 baseline clinical characteristics of included studies six studies excluded patients who used epo previously,9,10,13,15,17,18 whereas other studies did not specify this issue . in 3 of the 10 studies , a high risk for developing aki , the definitions of which were not the same , was included in the enrollment criteria.11,14,16 in 8 studies , baseline end - stage renal disease or dialysis was set as a compulsory exclusion criterion.913,15,16,18 when reported , mean baseline hemoglobin levels ranged from 9.3 to 13.1 g / dl,9,10,1215,18 and mean baseline serum creatinine levels varied from 0.92 to 1.35 mg / dl.1316,18 the type of erythropoiesis - stimulating agent used in all of the intervention groups was epo - alpha or -beta , but not darbepoietin .", "the one - time epo dosage was either fixed as 20,000 units or 40,000 units in 3 studies9,10,14 or was based on participant weight ranging from 100 units / kg to 500 units / kg in the other 7 studies .", "the participants in 6 studies received only a single administration of epo1214,1618 ; however , participants received at least 2 doses in the other studies . two studies provided supplementary iron therapy to both the intervention and control groups,9,10 and 1 study provided an iron sucrose supplement only to the intervention group.12 there was considerable variation in the definition of aki across these studies , which was not clear in 2 studies.9,10" ], [ "all ten studies reported randomization , but 7 studies described the methods of randomization,912,14,16,18 and only 4 studies showed the details of concealed allocation.11,13,15,18 all studies reported double blinding and no or few missing outcome data with the reason .", "eight studies provided the clinical trial registration number online with a low risk of bias in selective outcome reporting.10,11,1318 because of the unbalanced use of iron supplementation in 2 groups , 1 study exhibited a high risk of bias in the item other biases.12 risk of bias in included studies .", "a , risk of bias graph demonstrates the percentages of included studies for each item in the tool ; ( b ) risk of bias summary illustrates the review author 's judgments with a cross - tabulation for each eligible study ." ], [ "all ten eligible rcts reported that the overall incidence of aki was 10.57% ( 147 of 1391 participants ) in the epo - based intervention group and 10.38% ( 142 of the 1368 participants ) in the control group .", "pooled analysis using a fixed effect model showed that there was no significant difference for preventing the development of aki between the epo and control groups ( rr , 0.97 ; 95% ci , 0.791.19 ; p = 0.782 ) , as shown in figure 3a .", "meanwhile , the test for between - study heterogeneity among the included trials was not significant ( i = 20.2% and p = 0.257 ) .", "forest plots of rr estimates with the corresponding 95% ci for ( a ) the incidence of aki , ( b ) dialysis requirement , and ( c ) mortality in patients receiving epo therapy versus control .", "the columns of intervention and control were presented as number of events / number of participants .", "stratified analyses of studies with entirely perioperative care demonstrated no significant difference between the epo and control groups using a fixed effect model ( rr , 0.86 ; 95% ci , 0.661.12 ; p = 0.260 ; i = 33.9% ; p = 0.169).1218 among studies that excluded patients with prior epo use , similar result of rr was obtained ( rr , 0.89 ; 95% ci , 0.661.21 ; p = 0.467 ; i = 23.3% , p = 0.259).9,10,13,15,17,18 among patients who received at least 2 doses of epo911,15 or were at high risk of aki according to each study,11,14,16 the prevention of aki remained nonsignificant ( rr , 0.99 ; 95% ci , 0.731.35 ; p = 0.962 ; i = 44.3% , p = 0.145 and rr , 1.22 ; 95% ci , 0.891.67 ; p = 0.215 ; i = 0% , p = 0.805 , respectively ) . the sensitivity analysis after exclusion of 1 study at a time demonstrated that the above pooled result was robust and did not change much depending on any single study ( fig .", "it should be noted that after removing the study,12 which gave iron supplement only to epo intervention group , the overall rr was 1.02 ( 95% ci , 0.821.27 ; p = 0.824 ) without statistical significance .", "the sensitivity analysis by removing each individual study at a time is shown on the pooled effect size of the incidence of aki .", "the funnel plot and egger 's test analysis indicated that there was no evidence of publication bias for the aki outcome ( fig .", "the funnel plots for publication bias tests of studies assessing the effect of epo on ( a ) the incidence of aki and ( b ) mortality ." ], [ "the dialysis requirement was reported in 7 studies11,1318 totaling 590 analyzable patients , and in 3 of these studies , no patient was treated with dialysis in either group.13,14,18 the overall incidence of dialysis was 2.65% ( 8 of the 302 participants ) in the epo - based intervention group and 3.82% ( 11 of the 288 participants ) in the control group . by meta - analysis for 4 studies using a fixed effect model,11,1517", "there was no significant difference of mortality between the epo and control groups ( rr , 0.72 ; 95% ci , 0.311.70 ; p = 0.457 ) without significant between - study heterogeneity ( i = 0% , p = 0.662 ) , as shown in figure 3b .", "because there were only 4 articles in the literature with the effective data , the publication bias was not investigated ." ], [ "the ten included studies demonstrated that overall mortality was 11.07% ( 154 of the 1391 participants ) in the epo - based intervention group and 11.40% ( 156 of the 1368 participants ) in the control group .", "mortality was ascertained in - hospital in 3 studies,13,15,16 at 30 days in 5 studies,912,14 and unclear in the remaining study.17,18 pooled analysis using a fixed effect model showed that there was no significant difference of mortality between the epo and control groups ( rr , 0.96 ; 95% ci , 0.781.18 ; p = 0.705 ) without significant between - study heterogeneity ( i = 0% , p = 0.562 ) , as shown in figure 3c .", "meanwhile , there was no evidence of publication bias for the mortality outcome ( fig ." ], [ "six studies demonstrated that none of the patients who received the epo intervention suffered from adverse events , which were associated with the use of drug , throughout the study period , such as hypertension , symptomatic thrombosis , myocardial infarction , stroke , headache , and seizures.1216,18 one study did not report adverse events,17 and 1 study reported adverse events for the entire participants without specifically describing the specific group.11 corwin et al9 showed that the incidence of deep thrombophlebitis was 2.15% ( 14/650 ) among the epo intervention group and 2.30% ( 15/652 ) in the control group without significant difference .", "napolitano et al10 reported that the incidence of clinically relevant thrombovascular events was 16.42% ( 66/402 ) in the epo intervention group and 12.53% ( 49/391 ) in the control group with an rr of 1.31 ( 95% ci , 0.931.85 ) ." ], [ "in this present meta - analysis of 10 rcts with 2759 participants , we found that compared with placebo , prophylactic epo therapy for patients who are critically ill or under perioperative care was not associated with a significant reduction in the incidence of aki , dialysis requirement , or mortality .", "meanwhile , the effect of epo on aki prevention was consistent with the above result for the stratified analyses on patients with entirely perioperative care , no previous epo use , or more than 1 dose of epo .", "in addition , epo therapy was not associated with adverse events in these studies , which appeared to be safe in this kind of patients .", "aki is a frequent and serious complication occurring in the critically ill or surgical patients and is associated with increased length of hospital stay , occurrence of end - stage renal disease , and mortality.22 ischemia and reperfusion injury , inflammation , oxidative stress , apoptosis , etc .", "have all been demonstrated as crucial factors in the development of aki.23 recently , results from several animal studies indicated that epo exerts a renoprotective effect against aki induced by cardiopulmonary bypass or sepsis through mechanisms of reducing ischemia / reperfusion injury , inhibiting apoptosis , and alleviating inflammatory responses.8,24,25 however , the benefits of epo in these animal studies were not reproducible in clinical trials or in this meta - analysis", "first , many patients included in these trials suffered from some comorbidities , such as hypertension , diabetes , dyslipidemia , or ischemic heart disease and had complicated pathophysiological conditions , which might reduce the effects of epo.26,27 second , compared with animal experiments , the dosage of epo in clinical studies is relatively lower , which might be unable to obtain therapeutic effects .", "third , the variable time of epo treatment in clinical studies is not the same as animal experiments , and the optimal time has not been established .", "only 1 epo intervention study was enrolled in a previous meta - analysis without estimating the risk of aki,28 and 9 additional rcts with over 2600 participants were included into our meta - analysis .", "the majority of trials in this analysis had good or moderate methodological quality , which indicated that the results were not susceptible to be influenced by the biases of original researches . meanwhile , most trials investigated the effect of epo on clinically hard end points such as dialysis requirement and short - term mortality .", "both the between - study heterogeneity and publication bias were relatively minimal without statistical significance , which made the pooled effect size less likely to be affected .", "in addition , the appropriate stratified analyses and sensitivity analyses , which removed one study at a time , were performed with consistent results .", "first , several inclusion trials might not have sufficient sample size with designed only at the single - center level.1217 in the future , more large multicenter rcts with adequately participants will be needed to elucidate the prevention role of epo .", "second , there were differences in patient selection , treatment regimen , and the definition of aki across these trials .", "an accepted uniform epo study protocol would reduce the degree of variation among the studies .", "finally , our meta - analysis was based on aggregated data , not on individual patient - level data . as a consequence", ", the results might be less accurate and could not be adjusted for certain confounding factors , such as age , comorbidities , and laboratory parameters , which might influence the true therapeutic effect of epo ." ], [ "in summary , this meta - analysis , based on currently available rct evidence , suggests that prophylactic epo treatment of patients with critical illness or under perioperative care does not reduce the incidence of aki , dialysis requirement , or death .", "considering the limitations of this study , larger scale , well - designed multicenter rct studies using optimal doses and administration times are needed to investigate the role of epo in aki prevention ." ] ]

[ [ "human brain plasticity or neuroplasticity refers to the capacity of the nervous system to modify the organization of the brain structure and function in response to experience .", "previous studies suggested that both short - term [ 2 , 3 ] and long - term training [ 46 ] can modulate brain structural changes involved with both the gray matter ( gm ) and white matter ( wm ) .", "the candidate mechanisms for these changes are multifaceted and likely include gliogenesis , synaptogenesis , and vascularization in gm , as well as myelination and axonal sprouting in wm .", "in addition to normal training or experience , a growing body of evidence has accumulated supporting injury - induced functional or structural plasticity at different levels in the adult central nervous system [ 810 ] .", "previous studies suggest that , at least in primates , plasticity in the cortical representation can occur rapidly as a consequence of peripheral lesions or sensory deprivation [ 11 , 12 ] . as a drastic limb injury ,", "amputation in humans has been reported to lead to extensive reorganization , most prominently in the primary somatosensory and motor areas , which was suggested to correlate with phantom limb pain ( plp ) [ 1316 ] . despite extensive neurobiological research ,", "while some authors have argued that cortical reorganization following amputation is triggered by the loss of sensory input [ 16 , 17 ] , others have proposed that the mechanisms should be attributed to the persistent experience of pain .", "these discrepancies in the literature raise the fundamental question of whether brain reorganization occurs in amputees without plp . on the other hand", ", it also should not be overlooked that the short- and long - term effects of amputation on the brain may be varied , as plp is usually more common in the initial stage after amputation .", "one study using automated voxel - based morphometric analysis found that subjects with limb amputation exhibited a gm decrease in the thalamus , which was unrelated to plp .", "in addition , reduced gm volume in the primary motor or sensory cortices was also observed in patients with amputation or spinal cord injury .", "in contrast to voxel - based morphometry , the measurement of cortical thickness provides a more direct and meaningful index .", "preiler and colleagues found that cortical thickness in upper limb amputees was reduced in the motor cortex but increased in the temporal and parietal lobes .", "although gm reorganization was initially the focus of many brain imaging studies , wm changes after limb amputation are increasingly being investigated using neuroimaging techniques , especially diffusion tensor imaging ( dti ) , which provides information about wm tracts and their organization based on water diffusion .", "fractional anisotropy ( fa ) is the most often used dti index of wm integrity , and reduced fa in amputees has been reported in the corpus callosum ( cc ) and corticospinal tract . although these studies have been carried out to determine the effects of missing limbs on brain reorganization , little is known about the associations between gm and wm changes after amputation .", "the purpose of this study was to examine the long - term patterns of brain reorganization following limb amputation . to systematically characterize brain reorganization", ", we first used a combined tract - based spatial statistics ( tbss ) and tractography analysis , which enables a precise characterization of both whole - brain wm and specific anatomical fiber tracts , to assess the microstructural changes in patients with unilateral amputation in the lower limb .", "we then performed surface - based morphometry across the whole brain gm and regions of interest ( roi ) focusing on the sensorimotor cortices ." ], [ "seventeen adult patients ( 13 males and 4 females ) with right lower limb amputation were recruited from the prosthetic and orthotic clinics at the department of rehabilitation , southwest hospital in chongqing .", "twelve were amputations following traumatic injury and five were due to tumors ( 2 being melanoma and 3 being osteosarcoma ) .", "exclusion criteria were the following : ( 1 ) age at amputation of less than 18 years or more than 60 years ; ( 2 ) amputation at another part of the body ; ( 3 ) presence of major systemic disease ( e.g. , diabetes mellitus , cardiovascular diseases , and inflammation ) , psychiatric or neurological illnesses ; ( 4 ) duration between amputation and magnetic resonance imaging ( mri ) scanning of less than 6 months ; ( 5 ) presence of plp or stump pain assessed by the five - category verbal rating scale .", "eighteen age- and sex - matched healthy controls without neurological or psychiatric diseases and with normal brain mri were recruited from the local community .", "all the participants were dominantly right - handed as determined by the edinburgh handedness inventory and had a score of 27 or higher on the chinese version of the mini - mental status examination ( mmse ) .", "the study was approved by the medical research ethics committee of southwest hospital , and written informed consent was obtained from all participants .", "all of the participants were scanned using a 3.0 tesla imager ( tim trio , siemens , erlangen , germany ) with a 12-channel head coil .", "dti data were acquired using a single - shot twice - refocused spin - echo diffusion echo planar imaging sequence ( repetition time = 10,000 ms , echo time = 92 ms , 64 nonlinear diffusion directions with b = 1000 s / mm , and an additional volume with b = 0 s / mm , matrix = 128 124 , field of view = 256 248 , and 2 mm slice thickness without gap ) . from each participant 75", "axial slices were acquired and the diffusion sequence was repeated twice to increase the signal - to - noise ratio . t1-weighted three - dimensional magnetization - prepared rapid gradient echo images were then collected using the following parameters : repetition time = 1,900 ms , echo time = 2.52 ms , inversion time = 900 ms , flip angle = 9 , matrix = 256 256 , thickness = 1.0 mm , and 176 slices with voxel size = 1 1 1 mm .", "the dti data were preprocessed using the fmrib software library ( university of oxford , uk ) .", "first , the diffusion data were corrected for eddy currents and head motion , and the two acquisitions were averaged .", "the averaged images were masked to remove skull and nonbrain tissue using the fsl brain extraction tool .", "first , fa images for all subjects were nonlinearly aligned to a study - specific minimal - deformation target ( mdt ) brain and resampled to an isotropic 1 mm resolution .", "the mdt brain was selected as the brain image that minimizes the deformation from other brain images in the group through warping all fa images in the group to each other [ 29 , 30 ] .", "next , the mean fa image was created and thinned to create a mean fa skeleton that represents the centers of all fiber tracts .", "clusters showing group differences in the tbss analysis were used as seed masks for multifiber probabilistic tractography in each subject 's native space .", "the steps have been described in detail in our previous articles [ 32 , 33 ] . for each participant", ", pdt was run from each voxel in the seed mask to the whole brain using default parameters .", "the warp fields of nonlinear registration and the inverse versions were used for the translation between the original space and the standard space . for the elimination of spurious connections ,", "the individual tracts in standard space obtained by pdt were arbitrarily thresholded to include only voxels through which at least 25% ( 1,250 ) of samples had passed .", "each subject 's tracts were then binarized and summed to produce group probability maps for each pathway .", "the group probability maps were also thresholded at 25% ( at least 9 of the 35 subjects ) to generate the masks for each fiber pathway .", "the wm labels atlas and tractography atlas implemented in fsl were used for the structural identification .", "individual mean fa values of each pathway were then extracted from the standardized whole - brain dti images .", "all the structural t1 images were analyzed using freesurfer ( version 5.3.0 , https://surfer.nmr.mgh.harvard.edu/ ) to create anatomical surface models .", "the automated processing stream mainly included removal of nonbrain tissue , talairach transformation , segmentation of gray / white matter tissue , intensity normalization , topological correction of the cortical surface , and surface deformation to optimally place the tissue borders .", "cortical thickness was calculated as the shortest distance between the gm and wm surfaces at each vertex across the cortical mantle . moreover ,", "the gm volume in each hemisphere and total intracranial volume ( tiv ) was also calculated from the freesurfer processing stream .", "finally , using the brodmann areas ( ba ) atlas in freesurfer ( https://surfer.nmr.mgh.harvard.edu/fswiki/brodmannareamaps ) , we measured the individual mean cortical thickness values in the sensorimotor regions , including the bilateral ba 1 , 2 , 3a , 3b , 4a , 4p , and 6 . in order to avoid the overlap among these labels ,", "group differences in age , years of education , and neuropsychological scores were examined using independent samples t - tests .", "randomize tool , which is specifically designed for permutation testing with nonparametric values . age and sex", "clusters were reported reaching a significance level of p < 0.05 , corrected for multiple comparisons across image using the null distribution of the maximum cluster mass ( t > 3 ) . cluster mass is the sum of all statistic values within the cluster and has been reported to be more sensitive than cluster size .", "whole - brain vertex - wise group comparisons for cortical thickness were performed on a standardized surface and the data were smoothed using a full - width / half - maximum gaussian kernel of 10 mm on the surface .", "regional differences between amputees and controls were assessed using a vertex - by - vertex general linear model controlling for the potential confounding effects of age , sex , and tiv .", "the statistical analyses were performed with the surfstat toolbox based on random field theory ( rft ) .", "clusters were first reported reaching a significant level of rft - corrected p < 0.05 , and then those reaching a looser significance level of uncorrected p < 0.005 were also indicated .", "analyses of covariance ( ancova ) adjusting for age and sex were used to explore the group differences in the mean fa value for each of the fiber tracts generated by pdt and in the mean cortical thickness for each of the selected sensorimotor regions in both hemispheres . finally , the relationships between the wm and gm changes were investigated using partial correlation analyses ( adjusted for age and sex ) .", "a false discovery rate ( fdr ) corrected threshold of 0.05 was considered as significant for these analyses ." ], [ "there were no significant differences in sex ratio , age , education , and mmse scores between the amputees and controls . compared with controls , the amputees showed a decreased fa in the right superior corona radiata and wm regions underlying the right temporal lobe and left premotor cortex ( pmc ) ( figures 1(a ) , 1(c ) , and 1(e ) ; table 2 ) .", "pdt from the above clusters revealed that the contributing wm tracts were the commissural fibers connecting the bilateral premotor cortices and the association fibers that exactly overlapped with the inferior frontooccipital fasciculus ( ifof ) ( figures 1(b ) and 1(d ) ) .", "the cluster underlying the left pmc also generated local premotor and transcallosal paths ( figure 1(f ) ) .", "the results of ancova demonstrated that the mean fa values extracted from the thresholded group probability maps in amputees were all significantly reduced ( p < 0.05 , fdr correction for multiple comparisons ) in all the fiber tracts ( table 3 ) . the gm volume ( controls versus amputees : left , 0.25 0.02 versus 0.24 0.03 l , p = 0.13 ; right , 0.25 0.02 versus 0.24 0.03 l , p = 0.17 ) and tiv ( 1.56 0.15 versus 1.51 0.14 , p = 0.17 ) of amputees did not differ significantly from those of controls .", "the amputees showed a thinning trend ( p < 0.005 , uncorrected ) in different cerebral lobules , with the largest one in the left pmc .", "smaller clusters of cortical thinning were also noted in the bilateral occipital lobes , the right temporooccipital junction , precentral gyrus , precuneus lobe , the left inferior parietal lobule , and frontal orbital cortex ( figure 2 ; table 4 ) .", "we did not find any clusters exhibiting thickness increase in the amputees compared with the control group ( p < 0.005 , uncorrected ) .", "the results of ancova for the roi confirmed that the cortical thickness was only significantly decreased in the left premotor area ( ba 6 ) in the amputees relative to the controls ( 2.73 0.14 versus 2.84 0.12 ; p = 0.02 ) .", "the difference remained significant ( p = 0.03 ) even when we added tiv as an extra covariate ( table 5 ) .", "no significant associations were found between the cortical thickness in the affected regions ( as shown in table 4 ) and the dti parameters of the fiber tracts generated from the pdt in the amputees . however , partial correlation analyses revealed that the fa value of the ifof ( as shown in figure 1(d ) ) was negatively correlated to the time since amputation ( r = 0.55 , p = 0.03 ) ." ], [ "in the present study , we explored brain structural reorganization in lower limb amputees without plp .", "cortical thickness and fa values were used as measures to evaluate the gm and wm microstructural changes across the whole brain compared with normal controls . as a consequence , we found that patients with amputation at the right lower limb exhibited cortical thinning in the left premotor area and the right visual - to - motor regions . additionally , the integrity of the fiber tracts connecting the bilateral pmc and those underlying the right visual - to - motor regions was also significantly reduced in the patients .", "our study demonstrates that cortical reorganization occurs in lower limb amputees , even in the absence of plp .", "we observed a thinning trend in different cerebral lobules , especially in the pmc contralateral to the affected side .", "the pmc encompasses the anterior lip of the precentral gyrus , the posterior portion of the middle frontal gyrus , and the superior frontal gyrus on the superolateral surface of the brain , corresponding to part of ba 6 .", "the time - specific studies of the pmc and primary motor cortex reflect the distinct roles of the two areas : the pmc is involved in movement selection , whereas the latter is involved in movement execution [ 44 , 45 ] .", "the activity of pmc neurons is also responsible for the specification of movement parameters such as amplitude , direction , and speed of movement .", "additionally , the pmc also seems to be involved in the control of eye movements and eye - related neural activity or in specific tasks that require eye - limb coordination [ 46 , 47 ] .", "as amputation in the lower limb will lead to a lack of movement selection and disorders of movement parameters and coordination , it can be inferred that the gm loss in the pmc following amputation is possibly attributed to long - term use - dependent blockage .", "reduced gm volume in the left primary motor cortex had also been reported in patients with right upper limb amputation but was not found in the current lower limb amputees .", "one possible reason for the discrepancy could be the sample heterogeneity between studies . as the upper limb representation is much bigger than the lower limb in the brain , the morphological changes due to functional nonuse could be less significant for the patients with lower limb amputation . in line with our reports , one previous study , in which 19 of the 28 patients were amputated at the lower limb , also did not find alterations in the primary motor cortex .", "in addition , reorganization in the primary somatosensory and motor areas after amputation has been suggested to correlate with plp [ 15 , 16 ] . in our study , the amputees with plp were not included .", "therefore , our findings would provide an update on the distinctive patterns of brain plasticity in lower limb amputees without plp . in this study ,", "the pdt approach was used to reconstruct the tracts from the wm skeleton regions characterized by fa decrease in lower limb amputees .", "our tbss analysis revealed that right lower limb amputees displayed significant fa reduction in the right superior corona radiata and wm underlying the left pmc .", "further fiber tracking generated the transcallosal paths linking the homologous pmc of the bilateral hemispheres .", "these findings are very consistent with one pioneering dti study , which reported the reduced integrity in the body of the cc in amputees .", "it is known that unilateral movement requires sequential processing in bihemispheric motor areas . using transcranial magnetic stimulation", ", previous studies found that the pmc modulates the activity of contralateral motor areas during the preparatory period of a voluntary movement with the ipsilateral limb [ 49 , 50 ] .", "such modulation is mediated by interhemispheric inhibition through fibers within the cc and enables healthy adults to perform complex motor tasks without the activation of contralateral muscles .", "therefore , the fa reduction within the cc connecting the bilateral pmc may reflect adaptive wm modification following the changes of movement patterns , as the transcallosal inhibition function is disused in unilateral lower limb amputees . beyond the left pmc , smaller clusters of cortical thinning in amputees", "were also noted , mainly in the brain regions constituting visual - to - motor networks , including the bilateral visual cortices , the right temporooccipital junction , left inferior parietal lobule , and orbital frontal cortex . functional mri has found that human parietal and temporooccipital cortices constitute the core nodes for cross - modal vision - action representations .", "meanwhile , the inferior parietal lobule , particularly in the left hemisphere , contributes to motor attention and is activated in neuroimaging experiments when subjects prepare movements or switch intended movements .", "visual - motor transformation also engages the orbital frontal cortex , which becomes active during response preparation and execution .", "further functional / structural connectivity studies confirm that the pmc integrates visual and somatosensory information from the intraparietal area to allow effective exchange and elaboration of information .", "the connections within the neural networks are plastic and are modified in response to injuries [ 57 , 58 ] , training , and treatments .", "previous imaging studies demonstrated that stimulation of afferent input could result in functional reorganization and a corresponding structural expansion of the cortical and subcortical areas [ 2 , 60 ] .", "accordingly , the loss of afferent input following limb amputation should cause negative structural alterations with a decrease in gm .", "lower limb amputees also display significant fa reduction in the right ifof , which is negatively correlated with the time span after amputation .", "the ifof connects the inferior frontal lobe to the posterior temporal - occipital regions and provides the main anatomical connections for the ventral ( bottom - up ) attention system , which is specialized for the detection of behaviorally relevant stimuli .", "reduction of wm integrity in the ifof has been reported to be associated with deficits in executive function in patients with chronic trauma .", "furthermore , our previous dti study showed that the right hemispheric ifof confers an advantage for the executive function of attention , which is in line with the well - described rightward dominance of visuospatial processing .", "interestingly , the amputees presented time - related microstructural abnormalities of the ifof in the right rather than the left hemisphere , indicating the degenerative function of visuospatial processing following amputation .", "future studies including neuropsychological assessments should be used to investigate the underlying explanations for the associations between brain wm plasticity and visuospatial function in amputees .", "the negative findings of gm increase are supported by one mri study but are incongruent with another .", "the differences might be due to the status of plp , prosthesis use , amputation sites , or time span after amputation . using a smaller sample size , preiler et al . ", "found that upper limb amputees with slight plp showed gm increase in regions of the visual stream .", "they initially hypothesized that it might be a compensatory effect for the lack of sensorimotor feedback and could serve as a protection mechanism against high plp development .", "however , in their following study using the same patients , a negative association between prosthesis use and cortical volume in the posterior parietal and occipital lobes , which greatly overlap with the regions with gm loss in our findings , was reported . as prosthesis use has been shown to have a beneficial influence on the prevention of cortical reorganization and plp [ 67 , 68 ] , and patients rely less often on bottom - up or stimulus - driven control with increasing prosthesis use", "; we could speculate that the cortical thinning and fa reductions in the ventral visual stream also reflect adaptive brain plastic changes along with the transformation of human abilities and might be beneficial for the prevention of plp .", "although these findings are robust , some limitations of the present study need to be addressed .", "first , the relatively small sample size in this study may mask subtle differences between groups , especially in the vertex - based cortical thickness analysis across the whole brain .", "left lower limb amputation might result in different morphological and functional changes , especially with respect to the contralateral pmc and the structures in the visual stream .", "it will be of interest to determine whether the individuals with amputation at the left side will demonstrate the analogous changes at the homologous regions of the other hemisphere .", "future studies should be performed to confirm the interhemispheric interactions using noninvasive transcranial current or magnetic stimulation ." ], [ "in this study , we combined high - resolution brain structural mri and dti to investigate the existence and extent of cortical and wm plasticity in subjects with right lower limb amputation . in summary , we found specific motor and somatosensory plastic changes in amputees without plp and provided an update on the plasticity of the human brain involving both gm and underlying wm after limb injury ." ] ]