Datasets:

xNoper

/

pubmed-test-memsum-20sent-concat

like 0

[ "high resolution transmission electron microscopy and high angle annular dark - field scanning transmission electron microscopy were employed to investigate the microstructure and the epitaxial growth of the structures . room temperature ferroelectric and ferrimagnetic domains of the heterostructures were imaged by piezoresponse force microscopy ( pfm ) and magnetic force microscopy ( mfm ) , respectively .", "pfm and mfm investigations proved that the hybrid epitaxial nanostructures show ferroelectric and magnetic order at room temperature . dielectric effects occurring after repeated switching of the polarization in large planar capacitors , comprising ferrimagnetic nife2o4 dots embedded in ferroelectric pbzr0.52ti0.48o3 matrix , were studied .", "these hybrid multiferroic structures with clean and well defined epitaxial interfaces hold promise for reliable investigations of magnetoelectric coupling between the ferrimagnetic / magnetostrictive and ferroelectric / piezoelectric phases .", "there is no conflict of interest in the present study for any of the authors ." ]

[ "malnutrition can lead to increased risk of surgery , decreased quality of life , increased incidence of postoperative complications , increased fatality rate , and decreased survival rate among elderly lung cancer inpatients.1,2 nutrition support has also been reported to improve the perioperative nutritional status and reduce the severity of postoperative complications in lung cancer.3 in the people s republic of china , the number of elderly lung cancer inpatients is increasing at a rapid rate ; thus , there is a great need to develop a tool that can accurately and effectively assess the nutritional status of these patients . the mini - nutritional assessment ( mna ) is a tool that is widely used in the usa and europe to evaluate patients nutritional status . malnutrition is a common and serious problem among geriatric patients , particularly for those who are diagnosed with lung cancer caused by declined functional reserve of visceral organs , decreased stability of the internal environment , and effects of acute or chronic diseases . this study examines the use of the mna and short - form mna ( mna - sf ) ( with a revised scoring system to better suit the elderly chinese population5 ) in assessing the nutritional status of elderly chinese lung cancer inpatients prior to scheduled surgery .", "the original mna and mna - sf scoring systems developed by guigoz4 were revised to account for differences in height , weight , and dietary behaviors between asian and western populations . for the present study , guigoz s cutoff point of < 17 for malnutrition finally , in assessing dietary behaviors , cheese , which is infrequently consumed by the chinese population , was replaced with soy and peanut milk . a total of 180 elderly chinese lung cancer inpatients ( 120 men and 60 women ) aged 60 and older were randomly selected from the tianjin medical university cancer institute and hospital between june 2010 and july 2011 . was changed to < 19 , thereby modifying the overall scoring system for assessing patients nutritional status ( maximum score = 30 ) , thus : a score 24 would indicate that a patient was well nourished , a score in the range 1923 would indicate that a patient was at risk of malnutrition , and a score < 19 would indicate that a patient was malnourished.5 in addition , the body mass index ( bmi ) ( kg / m2 ) ranges were adjusted to align with the following scores : < 18.50 kg / m = 0 ( vs < 19.00 kg / m = 0 ) , 18.5021.25 kg / m = 1 ( vs 19.0021.00 kg / m = 1 ) , 21.2524.00 kg / m = 2 ( vs 21.0023.00 kg / m = 2 ) , > 24.00 kg / m = 3 ( vs > 23.00 kg / m = 3 ) . the maximum score for the mna - sf is 14 , where a score of 12 or more reflects a well - nourished nutritional status . anthropometric parameters and biochemical markers were determined based on previous research.5 biochemical markers were provided by clinical laboratories at the tianjin medical university cancer institute and hospital , and reference values of biochemical markers were modified to assess the nutritional status of hospitalized patients .", "a total of 180 elderly chinese lung cancer inpatients ( 120 men and 60 women ) aged 60 and older were randomly selected from the tianjin medical university cancer institute and hospital between june 2010 and july 2011 .", "the original mna and mna - sf scoring systems developed by guigoz4 were revised to account for differences in height , weight , and dietary behaviors between asian and western populations . for the present study , guigoz s cutoff point of < 17 for malnutrition was changed to < 19 , thereby modifying the overall scoring system for assessing patients nutritional status ( maximum score = 30 ) , thus : a score 24 would indicate that a patient was well nourished , a score in the range 1923 would indicate that a patient was at risk of malnutrition , and a score < 19 would indicate that a patient was malnourished.5 in addition , the body mass index ( bmi ) ( kg / m2 ) ranges were adjusted to align with the following scores : < 18.50 kg / m = 0 ( vs < 19.00 kg / m = 0 ) , 18.5021.25 kg / m = 1 ( vs 19.0021.00 kg / m = 1 ) , 21.2524.00 kg / m = 2 ( vs 21.0023.00 kg / m = 2 ) , > 24.00 kg / m = 3 ( vs > 23.00 kg / m = 3 ) . finally , in assessing dietary behaviors , cheese , which is infrequently consumed by the chinese population , was replaced with soy and peanut milk . the maximum score for the mna - sf is 14 , where a score of 12 or more reflects a well - nourished nutritional status .", "patients demographic data , including age , sex , and smoking history ( eg , date started smoking , number of cigarettes smoked per day , date ceased smoking ) , were collected by clinically trained nurses . anthropometric parameters and biochemical markers were determined based on previous research.5 biochemical markers were provided by clinical laboratories at the tianjin medical university cancer institute and hospital , and reference values of biochemical markers were modified to assess the nutritional status of hospitalized patients .", "all nurses and patients participating in this study were informed about the objectives of the study and signed an informed consent document prior to participating . all protocols used in this study were approved by the tianjin cancer institute and hospital .", "analysis of variance for normally distributed dates and nonparametric methods , such as the wilcoxon two - sample test and the kruskal - wallis test were used to make statistical comparisons . spss ( v 17.0 ; ibm , armonk , new york , ny , usa ) software was used to conduct all statistical analyses . means , standard deviations , cross tabulation , and frequency tables were used as descriptive statistics .", "significant correlations were found between bmi and mna scores ( p = 0.000 ) ; mna scores of well - nourished at risk of malnutrition , and malnourished patients ( p < 0.001 ) ; the bmi of well - nourished and malnourished patients ( p < 0.05 ) ; and the calf circumference ( cc ) of well - nourished and at risk of malnutrition patients with malnourished patients ( p < 0.05 ) . patients who were well nourished , at risk of malnutrition , and malnourished differed significantly in their responses to anthropometrics , and global , diet , and subjective assessments ( table 3 ) . this suggests that all four aspects of the mna contribute to the total mna score and the nutritional status of the patients . there was also a strong correlation between self - perceived nutritional status and self - perceived health status .", "assessed 9% ( n = 17 ) were malnourished ( mna score < 19 ) , 33% ( n = 59 ) were at risk of malnutrition ( mna score 1923 ) , and 58% ( n = 104 ) were well nourished ( mna score 24 ) . significant correlations were found between bmi and mna scores ( p = 0.000 ) ; mna scores of well - nourished at risk of malnutrition , and malnourished patients ( p < 0.001 ) ; the bmi of well - nourished and malnourished patients ( p < 0.05 ) ; and the calf circumference ( cc ) of well - nourished and at risk of malnutrition patients with malnourished patients ( p < 0.05 ) . average age of the 180 sample patients was 67.3 5.0 years , with a range of 60~85 years . across all patients average mna - sf score was 11.5 2.3 with a range of 4 to 15 . among all patients assessed 4% ( n = 7 ) had a bmi of greater than 30 kg / m and 7% ( n = 13 ) had a bmi of less than 20 kg / m . to measure the criterion - related validity of the mna ,", "significant correlations between total mna score and mna questions were found for all questions with the exception of four related to neuropsychological problems , independence , skin problems , and number of meals eaten per day . reliability was measured as homogeneity using cronbach s coefficient and item - to - total score correlations .", "for example , declined food intake was strongly correlated with weight loss during the last 3 months ( r = 0.538 ) , self - perceived nutritional status ( r = 0.485 ) , and self - perceived health status ( r = 0.482 ) . there was also a strong correlation between self - perceived nutritional status and self - perceived health status . in contrast , no significant correlations were linked to skin problems , number of meals eaten per day , and neuropsychological problems .", "mna questions that had a high number of an assigned score of 0 provided key insights : 99% ( n = 178 ) of patients could consume their food independently , 44% ( 80 ) suffered psychological stress , 26% ( 46 ) consumed low amounts of protein each day , 25% ( 45 ) had a cc < 31 cm , 15% ( 27 ) drank fewer than three cups of water per day , and 13% ( 24 ) consumed fewer than three different types of fruits and vegetables per day .", "patients who were well nourished , at risk of malnutrition , and malnourished differed significantly in their responses to anthropometrics , and global , diet , and subjective assessments ( table 3 ) . this suggests that all four aspects of the mna contribute to the total mna score and the nutritional status of the patients .", "the malnutrition or cachexia in these patients may have been caused by a slowdown in metabolism due to decreased organic functions , or absorption of the body s nutrients by malignant tumors before metastasis.9 this study also showed that there were significant correlations between mna score and bmi ( p = 0.000 ) ; the mna scores of well - nourished , at risk of malnutrition , and malnourished patients ( p < 0.001 ) ; the bmi of well - nourished and malnourished patients ( p < 0.05 ) ; and the cc of well - nourished and at - risk of malnutrition patients with malnourished patients ( p < 0.05 ) . in contrast , other studies have shown that malnutrition rates are overestimated in lung cancer patients . some studies conclude that there is a high incidence of malnutrition among lung cancer inpatients . published findings on the nutritional status of lung cancer inpatients vary greatly in the medical literature . jagoe et al reported that severe malnutrition was uncommon among lung cancer patients who were referred for surgery.8 however , in the present study , the incidence rate of malnutrition was found to be 42% among 180 lung cancer inpatients who were referred for surgery .", "the high incidence rates of preoperative malnutrition and risk of malnutrition among elderly chinese lung cancer inpatients highlights the need for further investigations to determine the relationship between nutritional status and prognosis of these patients . the mna is a valid and reliable diagnostic tool that can be used to identify elderly lung cancer inpatients who are malnourished , as well as those who are at risk for malnutrition ." ]

[ "thus , the objective of this work is to verify the correlation between physical exercise , dizziness , probability of falls , and symptoms of depression in a group of middle - aged and elderly group . population aging can be considered as the most evident and dynamic aspect of modern demography , influencing the economy and public health in a significant way . as for the health of the elderly , changes in body balance ( postural instability ) have received much attention , as it is one of the symptoms that most affect their lives . its manifestation occurs in a heterogeneous form regarding both the presentation aspects of its etiology and its treatment.15 \n studies relate the involvement in physical activities with a better general health condition and lesser occurrence of depression and falls in the elderly.16 \n 17 physical activity is capable of improving mental and clinical conditions of depressed elderly .", "assessment procedures included a medical history prepared for this study ; the abridged version of the geriatric depression scale ( gds ) ; and anterior functional reach test . scores below five points indicated lack of depressive symptoms ; 6 to 10 points indicated mild / moderate depressive symptoms ; and 11 to 15 points meant severe depressive symptoms.24 \n for the functional range test was initially placed a tape measure on the wall , parallel to the floor , at the height of the acromion of each individual . the medical history assessment included questions on individuals socio - demographic and health ( age , gender , presence of diseases , treatment used ) , as well as questions about their practice of physical exercises ( frequency , time of practice , type of physical exercise ) . as for assessing the results of the geriatric depression scale , each answer indicating depression scored one point . values greater than 25.4 cm indicate low probability of falls.25 \n the authors analyzed the data using descriptive statistics through measures of central tendency ( mean and median ) and variability ( standard deviation and inner quartile ranges ) , as well as absolute and relative distribution ( n - % ) . the inclusion factors for subjects were non - institutionalized elderly with no history of neurological or cognitive alterations , who voluntarily accepted to take part in the research and signed the informed consent form ( icf ) . the sample comprised adult and elderly individuals of both sexes who took part in university extension projects .", ", results indicated that the non - practice of physical exercise , the presence of depressive symptoms , and the result of the anterior functional reach test ( indicating medium probability of falls ) are factors associated to the occurrence of dizziness in the investigated sample . the following were significant predictive factors for the occurrence of dizziness : non - practice of physical exercise , classifications of light / moderate depressive symptoms , and dislocation in the anterior functional reach test . , there was an association between the occurrence of dizziness and light / moderate depressive symptoms ( p < 0.001 ) .", "muscular weakness , reduction in articular mobility , degraded synergy , programming mechanisms , and motor control difficulties are the variables present in low levels of physical activity , predisposing to falls in the elderly.55 \n results indicated an association between the level of physical activity and the incidence of falls and health conditions . the research verified a significant association between light to moderate depressive symptoms and 4.5-fold increase in the risk of feeling dizziness . regarding the anterior functional reach test , this research verified a significant association between the probability of falls and reports of dizziness . in other words , the more frequent the practice of physical activity the less the occurrence of falls . age also reduces capacity of modifications of the adaptive reflexes , may be responsible for the occurrence of vertigo and/or dizziness in the geriatric population.35 \n the data from the studied sample evidenced that 33.7% of the elderly presented depressive symptoms .", "the results of this study indicated the existence of an association between the practice of physical exercise , dizziness , probability of falls , and depressive symptoms in a group of non - institutionalized middle aged adults and elderly people , evidencing that physical activity is a beneficial factor for the aging population ." ]

[ "we did a penetrometer test to measure the initial modulus of rigidity of the spot being tested , using a texture analyzer ( ta.xt2i , stable micro systems , surrey , uk ) fitted with a 10 stainless steel cone moving at 0.5 mm / s . in each stipule we measured the differences in stiffness between extrafloral nectaries of v. faba and the tissue that surrounds them . stipule stiffness was calculated from these 3 measurements and this value was compared with the measured stiffness of the extrafloral nectary on that stipule . , one measurement was done in the center of the extrafloral nectary and 3 measurements were done in random locations on the stipule . for each stipule , an average we mounted 20 stipules from 20 , 18-day - old plants on adhesive tape that was attached ( sticky side up ) to the surface of a piece of flat styrofoam .", "", "" ]

[ "the concept of the postgraduate - trained family physician qualified to deliver equitable , high - quality phc closer to the community is now accepted in many countries around the world . however , in sub - saharan africa , family medicine is still a relatively new concept . in this article , we analyse the development of family medicine in anglophone sub - saharan africa in the recent years based on the experiences of the primafamed ( primary health care and family medicine education ) project ( 6 ) . health systems based on primary health care ( phc ) distribute health care more equitably , are more cost effective and have better overall health outcomes and impact than health systems based on specialist care ( 1 ) . worldwide , authorities have recognized that the health and well - being of a population is highly dependent on a quality phc system that is equitable , easily accessible and affordable for all members of the community ( 4 ) and that emphasizes universal coverage ( 5 ) . this is the foundation of the health for all concept of alma - ata , adopted by the world health organization ( who ) in 1978 ( 2 ) and reiterated in the world health report 2008 ( 3 ) . this consensus statement defined the contribution of family medicine to equity , quality and phc within an african context , as well as the role and training requirements of the african family physician ( 15 ) . due to the low number of trained doctors per capita and the high burden of disease , african family physicians work in their specific context , mainly in district hospitals with outreach to health centres , in phc teams that address the problems of the community in a comprehensive , holistic and patient - centred way whereby specific skills like surgery and district management often are essential due to the lack of other specialists . the consensus illustrates the ownership of the development of family medicine by african universities , one of the key points from the paris declaration ( 2005 ) and the accra agenda for action ( 2008 ) ( 16 ) .", "this consensus statement defined the contribution of family medicine to equity , quality and phc within an african context , as well as the role and training requirements of the african family physician ( 15 ) . due to the low number of trained doctors per capita and the high burden of disease , african family physicians work in their specific context , mainly in district hospitals with outreach to health centres , in phc teams that address the problems of the community in a comprehensive , holistic and patient - centred way whereby specific skills like surgery and district management often are essential due to the lack of other specialists . the consensus illustrates the ownership of the development of family medicine by african universities , one of the key points from the paris declaration ( 2005 ) and the accra agenda for action ( 2008 ) ( 16 ) . , many countries , such as the democratic republic of congo ( dr congo ) , are emerging from conflict and need to rebuild both state and infrastructure . at the wonca ( world organisation of family doctors ) africa conference in 2009 , lower - resource countries in sub - saharan africa face enormous health challenges and pervasive poverty . despite the work of governments and nongovernmental organizations ( ngos ) , the majority of people still do not have easy access to affordable quality health care . the concept of the african family physician in other anglophone african countries is even more recent . only in the 21st century family physicians together with phc nurses ( and in some countries , mid - level care workers ) act as the clinical practitioners of the phc team . in 2009 , the university of pretoria was the first university in south africa to start training specialized phc physicians , now referred to as african family physicians ( 11 ) .", "the specific objectives are the following : the implementation of the primafamed project ; the outcomes of the primafamed project ; the development of family medicine training in sub - saharan africa from the viewpoint of the primafamed partners . south cooperative project contributed to the development of family medicine in sub - saharan africa . the aim of this article is to explore the extent to which the primafamed south ", "a process analysis of the primafamed project between 2008 and 2011 is presented to discuss the implementation of the programme and the development of the network of 10 universities and associated partners in anglophone sub - saharan africa . a call for proposals under the name edulink was launched by the secretariat of the african , caribbean and pacific ( acp ) group of states ( 17 ) . the aim of the primafamed project was to establish an institutional network between new and established departments of family medicine in universities in sub - saharan africa , within a framework of south south cooperation ( 18 ) . the objectives of the primafamed project were formulated as follows : 1 . to contribute to the health of communities through accessible , responsive and quality health systems in sub - saharan countries by educating and training family physicians who provide interdisciplinary phc services , oriented towards the needs of individuals , their families and the communities in which they live secondly , global recognition of the importance of training health - care workers in phc ( world health report 2006 and 2008 ) is vital to the development of african family medicine . the specific objectives were as follows : 1 . to develop a comprehensive vision and strategy , within the specific context of sub - saharan countries , that delineates the integral contribution of family medicine and the phc team to an equitable and quality phc system ; 2 . to establish a specific institutional network between departments and units of family medicine . the expected results of the primafamed project were the following : 1 . an improved institutional and administrative functioning in terms of policy , management , planning and administrative capacity building of the participating departments and units of family medicine . 2 . improved relevance of family medicine in undergraduate and postgraduate training in the regional context .", "the specific objectives were as follows : 1 . to develop a comprehensive vision and strategy , within the specific context of sub - saharan countries , that delineates the integral contribution of family medicine and the phc team to an equitable and quality phc system ; 2 . to establish a specific institutional network between departments and units of family medicine . the aim of the primafamed project was to establish an institutional network between new and established departments of family medicine in universities in sub - saharan africa , within a framework of south south cooperation ( 18 ) . the who world health report 2006 , working together for health , emphasized the need for phc training in the local community in order to deal with the brain drain from acp states ( 19 ) . in 2007 , a call for proposals under the name edulink was launched by the secretariat of the african , caribbean and pacific ( acp ) group of states ( 17 ) . the objectives of the primafamed project were formulated as follows : 1 . to contribute to the health of communities through accessible , responsive and quality health systems in sub - saharan countries by educating and training family physicians who provide interdisciplinary phc services , oriented towards the needs of individuals , their families and the communities in which they live . together with 10 universities in eight countries in sub - saharan africa ( sudan , ghana , nigeria , dr congo , rwanda , uganda , kenya and tanzania ) , figure 1 , the department of family medicine and phc at ghent university in belgium developed the primafamed project proposal with a focus on developing family medicine training in sub - saharan africa . an improved institutional and administrative functioning in terms of policy , management , planning and administrative capacity building of the participating departments and units of family medicine . develop and strengthen academic departments or units of family medicine that offer family medicine training at the undergraduate and postgraduate levels . 2 . improved relevance of family medicine in undergraduate and postgraduate training in the regional context .", "the south south network connecting these 10 universities worked together with the eight departments of family medicine in south africa and accordingly formed a forum to share knowledge , experiences and resources . the partnering universities in the primafamed project were university of goma ( dr congo ) , moi university ( kenya ) , national university of rwanda , aga khan university ( tanzania ) , university of lagos ( nigeria ) , makerere university ( uganda ) , mbarara university ( uganda ) , ahfad university for women ( sudan ) , gezira university ( sudan ) and university of ghana .", "to further strengthen family medicine residents education , training sessions by professors from south african universities and other associated primafamed partners were held . a yearly conference for partners , associates and stakeholders each of the 10 partner universities hired a local coordinator to oversee the implementation of the project , coordinate the activities and actively communicate with all partners . the first level corresponds to the institution being at a preparatory stage in the development of a postgraduate family medicine training programme . all 10 primafamed partners made progress during the 2.5 years that the project provided funding and support ( table 1 ) . at the start of the project , all of them had a unit or department of family medicine under development or in place , yet only three had officially started postgraduate family medicine training . at the end of the project , a critical mass of well - trained family physicians is needed to demonstrate the effectiveness of family medicine training programmes . because all but one partner universities train only a limited number of family medicine residents simultaneously due to limited capacity , reaching that critical mass takes time . however , as the example of gezira university ( sudan ) has shown , it is possible to create a large pool of well - trained family physicians who can make a difference , in a short time . in this particular situation , because there was a vital need , policymakers and local authorities worked closely together with gezira university in development of the training ( example 1 ) . in 2012 , postgraduate training has started the ministry of health has accepted family medicine as a specialization and graduated family physicians are part of the health - care system adopted from the primafamed edulink acp eu project .", "in 2010 , all primafamed local coordinators contributed to a swot ( strengths , weaknesses , opportunities and threats ) analysis on the development of family medicine training programmes and of family medicine as a new discipline within the health systems of their countries ( box 3 ) . the main findings are presented and categorized into the following levels : local / university level , national level , regional / african level and international level . the position of family physicians in the different health systems is unclear ( what is the career perspective of graduated family physicians ? ) there is international support for the concept of family medicine : in the world health report 2008 primary health care : now more than ever , the who advocated for the importance of moving health care out of tertiary hospitals into the community and from vertical to horizontal care , in order to respond to the needs of the community family medicine training is growing in the whole african continent , and there is support in the surrounding countries . secondly , global recognition of the importance of training health - care workers in phc ( world health report 2006 and 2008 ) is vital to the development of african family medicine .", ", during the wonca africa conference , representatives from many african family medicine departments came together and discussed steps forward in creating a strong family medicine and phc - oriented health - care system in various african countries . this led to the statement of the primafamed network : scaling up family medicine and primary health care in africa. concrete action for scaling up is needed , including convincing ministries and leadership of medical schools to integrate family medicine and phc into the undergraduate curriculum and to train a significant proportion of medical school graduates ( between 40% and 60% ) in family medicine and phc . essential conditions include having accredited under- and postgraduate curricula ; well - equipped training centres for transformative learning with well - trained trainers ; national and international support networks ; a sufficient number of funded posts for family medicine residents / registrars with appropriate remuneration ; and continuous advocacy at the population and government levels ( 25 ) . continuous interaction with key players at the policymaking level and support from the government are necessary to scale up family medicine and to develop it into an essential part of the health - care systems , in order to provide equitable , high - quality health care for communities and , ultimately , to improve overall health in sub - saharan africa . the primafamed project showed that developing sustainable family medicine training programmes is a feasible but slow process with many obstacles . the south south cooperation between the primafamed partners and the south african family medicine departments strengthened confidence in the project and reinforced the principal need for well - trained african family physicians . recruitment , training and retention of doctors in family medicine need to be adopted in the health system of each of the african countries . inverse care law through achieving universal coverage and by providing equitable and high - quality health care through well - trained health - care workers to every individual . exposure to family medicine and community health in the undergraduate medical curriculum is required to create awareness among new medical doctors .", "a coordinator for this development was financed , a curriculum was developed and training sites were identified and equipped with the needed material . in 200910 , the first 10 medical doctors were trained in the 1-year course . in 2010 , 120 candidates were selected for the 2-year in - service msc in family medicine . in the fall of 2012 , together with policymakers , district health officers and representatives from the ministry of health identified the need for further training for medical doctors in primary health care . the university of gezira can be seen as a perfect example of how working together with policymakers is essential for the development of family medicine . gezira university decided to develop a 1-year diploma and a 2-year in - service master of science ( msc ) in family medicine . these 120 sudanese family physicians graduated with comprehensive knowledge in district primary health care . in 2013 , 200 new candidates were selected . in many health centres , community physicians and medical officers were in charge of patient care . both are accepted by the sudan national medical specialisation board . with the help of the primafamed project ,", "most of these registrars are now working in connection with the department to further develop the curriculum and the training sites . a study in 2011 on the challenges of family physicians after placement showed that the ministry s posting policy needs to be improved to ensure that family physicians have a chance to perform their intended roles ( 28 ) . in 2011 , one of the first - graduated kenyan family physicians , dr patrick chege , became the head of department . in 2005 , moi university started the first family medicine training programme in anglophone eastern africa , outside south africa , nigeria and ghana , leading to the degree of master of medicine in family health . infa - med contributed financial support , expatriate family medicine faculty and well - established training hospitals ; and the moh provided political support to the new specialty as well as scholarships to medical doctors entering the residency programme ( 26 ) . a national policy ( the kenyan family medicine policy ) was developed ( 27 ) and in august 2009 , this was adopted by the kenyan government . in 2008 , the first registrars finalized the family medicine programme at moi university . a review of the present family medicine curriculum was started to improve the curriculum with a focus on the needs of the hospitals where the family physicians will be based . the development of this residency programme was a triangular effort from moi university , infa - med ( institute of family medicine , a faith - based ngo , aiming to introduce family medicine in kenya ) and the kenyan ministry of health ( moh ) . the department of family medicine has strongly been focussing on the development of research . in 2009 ,", "the west african college of physicians ( wacp ) accepted family medicine in 1985 ( 29 ) and it extended to the subregion outside nigeria in 1991 ( 29 ) . in ghana , postgraduate training began in march 1999 with three family medicine residents under the auspices of the faculty of family medicine ( then general medical practice ) of the wacp . these local efforts at promoting the specialty in ghana received a major boost with two significant collaborations : first with the primafamed edulink acp - eu project in 2007 , a north south south cooperation , and second , with the department of family medicine , university of michigan health systems in 2008 , a north south cooperation . . currently , there are two well - established postgraduate training complexes in accra ( korle - bu teaching hospital ) and kumasi ( komfo - anokye teaching hospital ) with 35 family medicine residents at various levels of membership and fellowship training ( 30 ) . these collaborations focussed on curriculum development , faculty development , teaching of students and family medicine residents , development of training complexes and research this was a hospital - based training programme with the initial group of trainers being private general practitioners who were elected into fellowship by the college in the early 1990s . the ministry of health provides sponsorship for the programmes and accords graduates of family medicine equal status and remuneration as graduates from other specialties . in january 2008 , the undergraduate programme began in the university of ghana medical school with the first two fellowship graduates appointed as lecturers . that same year , the ghana college of physicians and surgeons also started another programme in family medicine to run alongside the one conducted by wacp . it started as a 4-year programme leading to membership after the initial 2 years and fellowship after a further training for 2 years .", "funding : the primafamed project was funded by the edulink acp eu ( european commission funded programmes in the africa , caribbean and pacific group of states ) . the vlir uos ( flemish interuniversity council ) supported the funding for the yearly primafamed conferences2008 in kampala , uganda ; 2009 in rustenburg , south africa ; 2010 in swaziland and 2011 in cape town , south africa ." ]

[ "the objective of this commentary is to review current sodium consumption worldwide , discuss cost - effective strategies to reduce dietary sodium , as well as briefly review the role of behavioural and policy - based environmental interventions in reducing dietary sodium on a population - based scale . diets high in salt are now recognized as one of the leading risks to cardiovascular health in the world as they increase blood pressure in both children and adults . many national and international agencies have acknowledged the role of lifestyle and diet , in particular sodium intake , on blood pressure levels . not surprisingly , elevated blood pressure levels are a major cause of these diseases and are found at higher rates among low- and middle - income countries . the relationship between blood pressure levels and risk of developing cardiovascular disease is strong and well supported . in 2008 , approximately one billion adults worldwide had uncontrolled hypertension ( defined as systolic blood pressure 140 mm hg systolic and/or diastolic blood pressure 90 mm hg ) . given the increasing prevalence of hypertension worldwide and the associated risk for developing cardiovascular disease , public health interventions aimed at reducing blood pressure are crucial . this relationship has been empirically supported and is sufficiently strong to warrant recommendations for public health interventions aimed at substantially reducing dietary sodium intake .", "the world health organization currently recommends a daily consumption of less than 5 grams of salt , although some agencies recommend that no more than 1500 mg of sodium should be consumed per day [ 2729 ] , calculated as 2/3 tsp of table salt . in most populations , for example , in canada , a country with average salt consumption of 8.5 gm / day , 85% of men and 60% of women aged 9 to 70 consume over the upper recommended limit for salt and the vast majority ( > 90% ) are above the level recommended for individuals to consume [ 33 , 34 ] . , it is clear that the economic costs associated with such illnesses can be substantial . furthermore , within high sodium consumption countries , only a small proportion of individuals consume the recommended levels of salt . for example , one study found that in a population of overweight adults , a daily intake of sodium greater than 2300 mg / day was associated with a 61% increase in coronary heart disease mortality , an 89% increase in stroke mortality , and a 39% increase in all - cause mortality over a 19-year period . humans evolved on diets consisting of natural plant and animal foods containing small amounts of sodium , typically less than 2 g / day [ 25 , 26 ] . today , nearly all populations consume far greater quantities of salt than those provided in natural , unprocessed food diets . along with the other sodium - related illnesses discussed above ( i.e. , gastric cancers , kidney stones , etc . )", "in countries with developed economies , salt added during the processing of foods accounts for the vast majority of dietary salt ( 7580% ) . an additional 10% of dietary salt are estimated to cost little ( less than $ 0.40 usd per person per year ) , reduce premature deaths by close to 14 million in 10 years , and to be slightly more cost effective than strategies to reduce tobacco use ( both highly advocated interventions ) [ 8 , 40 ] . is accounted for by salt that is naturally occurring in foods , while the rest is accounted for by salt added at the table or during cooking . in low- to - middle income countries where populations may have limited access to processed foods , salt added at home , in cooking , or at the table , accounts for the majority of dietary salt . reducing dietary salt is estimated to save substantial health care costs [ 7 , 10 , 16 , 30 , 3741 ] . for example , reducing dietary salt by 3 g / day in the united states is estimated to save 194,000 to 392,000 quality adjusted life years and reduce health care costs $ 10 to $ 24 billion us dollars a year . in canada , reducing salt consumption to recommended levels is estimated to reduce the prevalence of hypertension by 30% and to save up to $ 430 million dollars per year just in direct hypertension management costs alone . in lower - income countries , programs aimed at reducing consumption of dietary salt through an intervention largely based on education", "although there is a general lack of awareness of salt as a health issue in many countries , some countries with established salt reduction programs show increasing awareness . in addition , many food companies have developed low - salt options to their product lines for people to choose , with some companies reducing salt additives in their full product line . in developed economies , there are substantial barriers to free choice in those who chose to eat less salt [ 16 , 44 ] . in most countries , some of the challenges of individual choice in selecting low salt diets is perhaps best illustrated by clinical trials where highly motivated patients are carefully and repeatedly trained how to select low - salt foods but generally can only sustain small reductions in salt intake long term [ 44 , 48 ] . , we found that in a sample of over 100 people with diabetes who had received training on how to read a food label , not one could accurately answer how much of a processed food they could eat in a day when presented with the food label . however , it is often the case that the same people who recognize that canadians in general consume too much salt , believe that their personal consumption of dietary sodium is within the recommended amount . for example , in canada , 80% of people diagnosed with hypertension are attempting to reduce dietary sodium . this suggests that even a relatively affluent , well - educated population may have difficulty identifying and avoiding high - salt foods even if they perceive it is a health issue and have chosen to follow a low - salt diet .", "population - based approaches to reducing dietary salt may be effective in developed economies and have shown promising results for reducing blood pressure . in the late 1950s , the japanese government implemented a campaign to reduce salt intake given the high stroke mortality rates . has shown promising outcomes for blood pressure reduction with little to no burden on the consumer . more recently in the united kingdom , reductions in the amount of salt added to foods , in conjunction with a social marketing campaign , have been associated with reduction in population salt intake . in developing economies the reduction resulted in a decrease in average blood pressure and an 80% reduction in stroke mortality . in the 1970s , finland 's government began a public education campaign and enforced regulations on food processing companies through a warning label on high - salt foods in order to reduce salt consumption across the country [ 50 , 51 ] .", "clearly both a mix of population approaches and behavioural approaches targeting individuals are required to reduce sodium intake to within recommended levels [ 10 , 11 , 15 , 16 , 33 , 56 ] . a universal reduction in salt additives during the manufacturing process has a strong potential to reduce health disparities in vulnerable populations while improving overall population health . for example , motivational interviewing , a directive patient - centred counselling approach focused on exploring and resolving ambivalence , which emerged as an effective therapeutic approach within the addictions field , has recently shown promise for other complex behaviour change problems such as weight loss in overweight and obese patients and adherence to antihypertensive medication . behavioural interventions may be most important to ensure the population and especially policy makers understand and are supportive of the need to reduce dietary salt . similar methods have been successfully employed in reducing tobacco use . with respect to individually targeted efforts , for example , however , for specific individuals with strong motivation or at a greater personal risk from consuming a diet high in sodium , intensive behavioural interventions may be efficacious .", "given the promising outcomes observed in recent randomized controlled trials and population - based interventions , reducing dietary sodium intake to modest levels ( approximately 5 g / day ) worldwide would result in a major improvement in overall health and reduce the costs associated with diseases connected to excess sodium intake . however , it is apparent that relying solely on interventions that target individual behaviour is not the ideal approach for reducing sodium consumption . while it may contribute to behaviour change among highly motivated individuals and increase the acceptability of population - based interventions , the latter approach seems better suited for this particular health behaviour ." ]

[ "the disease may show variation in terms of its presentation and clinical course , which needs to be addressed carefully before making any airway management plan . the associated edema which may develop within an hour is the leading cause of potential life - threatening airway compromise . the purpose of reporting this case is to highlight these issues in the management of adult patient with acute supraglottitis . literature is convincing both for the active as well as conservative approach of airway management depending upon the patient 's clinical condition .", "the unanticipated rapidly progressive course of the disease was confirmed by the computerized tomography scan of the neck done after 24 h , which showed the marked swelling of oropharynx reducing the size of airway to not more than a pin hole [ figure 1 ] . a 52-year - old man presented in the emergency department with the complaints of sore throat for 1 day . the past medical history was unremarkable except the history of ischemic heart disease for which he was taking regular clopidogrel , losartan , and sublingual trinitrates as required . rest of the course in the hospital was uneventful and then he was discharged home . patient was shifted to specialized center on the first postoperative day where he was treated medically . the patient remained stable throughout the procedure and shifted to the intensive care unit on completion of the procedure . however , consideration was given to nasolaryngoscopy findings and the fact that we did not have overnight otorhinolaryngology cover in our district hospital .", "a multidisciplinary approach involving the otorhinolaryngologist and anesthesiologist is of prime importance for the management of airway . either the prophylactic or conservative approach may be used depending upon the patient condition and the health care facilities available . the current literature supports the conservative approach for the patients in which no airway compromise is suspected . the reported incidence in this population group is 12.9/100,000 annually and is higher than that in the pediatric population . sore throat , dysphagia , and change in voice are the common findings in the adults while the children usually present with the cardinal signs of airway obstruction as stridor , drooling , and dyspnea . severe swelling of the epiglottis and its extension to the arytenoids are the two factors strongly associated with the airway intervention ." ]

[ "a 15-year - old boy had complained of motility limitation in the right eye since a young age . because open reduction surgery for an old orbital wall fracture would be very difficult , and fruitless for this patient , we decided only to perform surgery on the eye muscle . the patient 's ocular motor impairment was concluded to have arose from a long - term medial orbital wall fracture and was diagnosed as ' pseudo - duane 's retraction syndrome ' . postoperatively , the patient had orthotropia in the primary position , and the anomalous head posture disappeared , though there were still some limitations in both abduction and adduction in the right eye one year after the surgery .", "we report a case of pseudo - duane 's retraction syndrome caused by entrapment of the medial rectus muscle in an old medial orbital wall fracture presenting very similar clinical features as those of classic duane 's retraction syndrome . recently , a case of innervational etiology , such as bilateral inverse duane 's retraction syndrome , due to simultaneous co - contraction of both horizontal rectus muscles has been reported by khan.9 to the best of our knowledge , there is no report presenting very similar clinical features as those of classic duane 's retraction syndrome arising from the entrapment of the medial rectus muscle in a medial orbital wall fracture . the primary lesion in pseudo - duane 's retraction syndrome is suspected to be the medial rectus muscle ." ]

[ "therefore , this study aims to help adult women with lumbar disc herniation recover muscle \n strength and stability through 8-week lumber extension strength exercise programs , and to \n provide data for constructing an integrated exercise program . lumbar spine instability has been reported to be the leading cause of chronic back \n pain1 . an a abnormal vertebral joint \n creates mechanical lesions and pains in the lumbar spine , decreasing stability and \n increasing the range of motion , resulting in functional degeneration2 .", "in this study , an 8-week exercise program for lumbar muscle extension strength and \n stabilization was performed by 26 females older than 20 with lumbar disc herniation . the main exercises were designed to be individually \n conducted in the form of a circuit training in which the number of repetitions increased \n gradually , utilizing sling and weight exercise equipment . a lumbar extension strength machine ( medx , medx inc . , ocala , fl , usa ) was utilized for the \n evaluation of lumbar extensor strength . the programs was conducted for a total of 8 weeks , 60 minutes a session , twice a week , to \n improve strength and stabilize lumbar extension . the warm - up exercises and \n cool - down exercises were conducted focusing on the range of joint motion ( rom ) without pain , \n utilizing cycles and steppers for 10 minutes , alternately . for the purpose of improving the \n lumbar stability and resistance muscles , the maximum static muscular strength of lumbar \n extension was measured at 7 different angles of lumbar flexion : 0 , 12 , 24 , 36 , 48 , 60 , and \n 72 degrees . the exercise program was divided into \n warm - up exercises , main exercises and cool - down exercises .", "significant differences were observed in lumbar extension strength ( les ) between \n pre - exercise and post - exercise at every angle of lumbar flexion , but no significant \n difference was found in wdi ( % ) ( table \n 1table 1.changes of the les and wdivariableanglepre - exercisepost - exerciseles ( ft - lbs)061.8 33.880.1 31.6**1278.7 33.898.8 33.6**2487.6 36.5116.5 32.7***3698.6 35.9129.7 32.3***48104.7 35.0137.6 30.2***60113.1 36.9146.5 30.5***72122.3 40.1158.7 34.7***wdi ( % ) 5.9 3.35.0 the post - exercise les were found to be very significantly ( p<0.01 ) higher \n than pre - exercise at 0 degree and 12 degree , and extremity significantly ( p<0.001 ) higher \n than pre - exercise at 24 , 36 , 48 , and 72 degrees of lumbar flexion . 2.8values are mean sd , les : lumbar extension strength , wdi : weight distribution \n index . values are mean sd , les : lumbar extension strength , wdi : weight distribution \n index .", "this study attempted to identify the positive impacts that were exerted on extension muscle \n strength and stability by an 8-week extension strength exercise program which was performed \n by 26 females with lumbar disc herniation . the above results indicate that improving muscle extension strength to enhance and improve \n the functions the patients with chronic back pain or lumbar herniated nucleus pulposus can \n help improve muscle functions and increase the range of joint motion thereby exerting a \n positive impact on physical stability . similar to the present study , a study analyzing the impacts of an 8-week functional \n exercise program for lumbar muscle strength , that was performed by 26 females with \n degenerative disc findings , found that there were significant differences between \n pre - exercise and post - exercise15 in \n lumbar muscle extension strength at all 7 angles of lumbar flexion , proving that exercise \n participation develops stability of the muscles around the lumbar spine ." ]

[ "they provide the first glimpse at changes occurring within the general economy and the health care sector . the accompanying tables report selected quarterly statistics for 1990 through the first quarter of 1993 , and the calendar year aggregation of quarterly information in the past 3 years . this article presents statistics on health care utilization , prices , expenses , employment , and work hours , as well as on national economic activity . , this calculation permits analysis of quarterly data to focus on the direction and magnitude of changes , without interference introduced by seasonal fluctuations . in the national health accounts , indicators such as these play an important role in the estimation of the latest historical year of health care expenditures . some of these statistics are based on sample surveys conducted monthly or quarterly by government agencies or private organizations , and are available 1 to 3 months after the completion of the period . , we will identify important indicators of health care and national economic activity and their sources . therefore , we rely extensively on indicators such as these to anticipate and predict changes in health care sector expenditures for the most recent year . we then describe what these indicators tell us about general economic and health sector activity during the most recent quarter .", "since 1963 , the american hospital association ( aha ) , in cooperation with member hospitals , has been collecting data on the operation of community hospitals through its national hospital panel survey . community hospitals , which comprised more than 80 percent of all hospital facilities in the united states in 1991 , include all non - federal , short - term general , and other special hospitals open to the public . statistics covering expenses , utilization , beds , and personnel depict trends in the operation of community hospitals annually from 1990 to 1992 and quarterly for selected quarters from 1990 through 1993 . the survey also identifies important factors influencing expenditure growth patterns , such as changes in the number of beds in operation , number of admissions , length of stay , use of outpatient facilities , and number of surgeries . figure 1 shows changes from the same quarter 1 year earlier in various measures of hospital utilization for 1984 through the first quarter of 1993 . for purposes of national health expenditures ( nhe ) , the sample is designed to produce estimates of community hospital indicators by bed size and region ( american hospital association , 1963 - 93 ) . in tables 1 and 2 , this one segment of nhe accounted for 33 percent of all health spending in 1991 ( letsch et al . , 1992 ) . survey statistics on revenues ( not shown on table 1 ) are analyzed in estimating the growth in the largest component of health care costs community hospital expenditures .", "the survey is designed to collect industry - specific information on wage and salary jobs in non - agricultural industries . similar statistics for the private non - agricultural sector , included on these tables , provide a basis for comparing the economy as a whole with the health sector in employment , earnings , and work hours . we use these composite indicators in the estimation of growth in physician and dental expenditures for the most recent period . we study the historical relationship of changes in this indicator to changes in expenditures , and estimate this relationship for the most recent period . table 5 summarizes business activity in the health sector and the overall economy by measuring change in the implied non - supervisory work hours and payroll . implied work hours", "bls publishes monthly information on changes in prices paid by consumers for a fixed market basket of goods and services . , dri updates its macroeconomic forecasts of wages and prices based on updated historical information and revised forecast assumptions . tables 6 and 7 and figure 4 present information on the consumer price index ( cpi ) for all urban consumers that measures changes in prices faced by 80 percent of the non - institutionalized population in the united states . ( the more restrictive wage earner cpi gauges prices faced by wage earners and clerical workers in addition , some medical care sector indexes measure changes in list or charged prices , rather than in the prices actually received by providers after discounts are deducted . in several health care areas , received or transaction prices are difficult to capture , although bls is making advances in this area . in the nhe , a combination of cpis for selected medical care items , input price indexes for nursing homes , and the cpi for hospital and related services , adjusted by the health care financing administration ( hcfa ) to provide transaction price changes , are used as measures of inflation for the health industry . , hcfa developed the medicare hospital input price index ( hospital market basket ) , which was designed to measure the pure price changes associated with expenditure changes for hospital services . in the early 1980s ,", "bls publishes monthly information on changes in prices paid by consumers for a fixed market basket of goods and services . the index reflects changes in prices charged for the same quality and quantity of goods or services purchased in the base period . for most items , the base period of 1982 - 84 is used to define the share of consumer expenditures purchasing specific services and products . cpis for health care goods and services depict price changes for out - of - pocket expenditures made directly by consumers . ( the more restrictive wage earner cpi gauges prices faced by wage earners and clerical workers tables 6 and 7 and figure 4 present information on the consumer price index ( cpi ) for all urban consumers that measures changes in prices faced by 80 percent of the non - institutionalized population in the united states . the composite cpi for medical care weights together product - specific or service - specific cpis in proportion to household out - of - pocket expenditures for these items .", "in 1979 , hcfa developed the medicare hospital input price index ( hospital market basket ) , which was designed to measure the pure price changes associated with expenditure changes for hospital services . in the early 1980s , the skilled nursing facility ( snf ) and home health agency ( hha ) input price indexes , often referred to as market baskets , were developed to price a consistent set of goods and services over time . all of these indexes have played an important role in helping to set medicare payment percent increases , and in understanding the contribution of input price increases to growing health expenditures . also , in the early 1980s , the original medicare hospital input price index was revised for use in updating payment rates for the prospective payment system ( pps ) . cost categories , such as food , fuel , and labor , are identified and their 1987 expenditure amounts determined .", "national economic indicators provide a context for understanding health - specific indicators and how change in the health sector relates to change in the economy as a whole . in the past three quarters , growth in health services employment also appears to be unaffected by the recent upsurge in employment growth for all private , non - agricultural establishments , as health sector employment growth remains steady ( figure 2 ) . the health service sector , maintaining steady employment growth during 1991 , appeared immune to the recent recession marked by sagging total private sector employment growth .", "growth in operating expenses for community hospitals slowed considerably in the first quarter of 1993 , increasing 7.5 percent . total employment in the health service sector continued to grow at nearly the same rate as in 1992 . in the first quarter of 1993 , there were 360,900 more health services jobs than in the first quarter of 1992 , an increase of 4.3 percent . for non - supervisory workers , the deceleration continued steadily throughout 1992 , but appears to have leveled off in the first quarter of 1993 . all measures of utilization admissions , inpatient days , surgical operations , and outpatient visits" ]

[ "the purpose of this study was to determine whether the completion of a vd questionnaire could have a good predictive value for uroflowmetry findings , in a population of sui women showing no obvious etiologies of obstruction . urinary retention and voiding dysfunction ( vd ) symptoms ( hesitancy , straining to void , difficulty in starting micturition , diminished stream , and sensations of incomplete emptying of the bladder ) are common and problematic features occurring after surgery for stress urinary incontinence ( sui ) , especially following a mid - urethral sling placement ( retropubic or trans - obturator procedure ) . the prevalence of urinary retention varies from 2.216% after surgery for sui.[13 ] preexisting voiding dysfunction is known to be a predictive factor for post - surgery urinary retention . in 2003 hong et al . it is thus important to screen women suffering from sui for emptying symptoms before such surgery . they can lead to urinary infections , and can also require self - catheterization or sling section . , showed that the best predictive factor for obstructive complications was the maximum flow rate , with which it was shown to be directly correlated .", "these 93 women were divided into two groups : those who complained of vd symptoms ( vds group ) according to the bristol female lower urinary tract symptoms ( bfluts ) questionnaire , and those without vd symptoms ( non - vds group ) . we investigated the parity , age , menopausal status , and concomitant anorectal disorders of each woman . we analyzed 415 sui women from the urodynamic database , who had undergone a filling cystometry in the department , and whose uroflowmetry indicated a total urine volume greater than 200 ml . both a quantitative and a qualitative analysis of bladder outlet obstruction ( boo ) was made by uroflowmetry . quantitatively , a patient was considered to have boo when a maximum flow rate of less than 15 ml / sec was observed for a urine volume greater than 200 ml , and/or the post - void residual was greater than 50 ml , as measured with a bladder scan or by catheterization . the urine flow was also analyzed in terms of average flow rate , urine volume , voiding time and acceleration ( defined as the maximum flow rate divided by the time taken to reach maximum flow rate ) . we screened for five items related to voiding difficulties : hesitancy , slow or intermittent stream , straining , or sensations of incomplete emptying .", "these 93 women were divided into two groups : those who complained of vd symptoms ( vds group ) according to the bristol female lower urinary tract symptoms ( bfluts ) questionnaire , and those without vd symptoms ( non - vds group ) . we analyzed 415 sui women from the urodynamic database , who had undergone a filling cystometry in the department , and whose uroflowmetry indicated a total urine volume greater than 200 ml . women with neurological disorders , pelvic organ prolapse , urge or mixed urinary incontinence , detrusor overactivity or previous sui surgery were excluded . with these exclusion criteria , we investigated the parity , age , menopausal status , and concomitant anorectal disorders of each woman .", "the women were interviewed on the presence of emptying symptoms , and completed the bfluts questionnaire [ table 1 ] , which is systematic in our department . we screened for five items related to voiding difficulties : hesitancy , slow or intermittent stream , straining , or sensations of incomplete emptying . for the purposes of data analysis , those women who answered never to all five items were classed in the non - vds group . those women for whom one or more of the answers was positive ( i.e. : occasionally , sometimes , most of the time or all the time ) , were classified in the vds group .", "the urine flow was also analyzed in terms of average flow rate , urine volume , voiding time and acceleration ( defined as the maximum flow rate divided by the time taken to reach maximum flow rate ) . quantitatively , a patient was considered to have boo when a maximum flow rate of less than 15 ml / sec was observed for a urine volume greater than 200 ml , and/or the post - void residual was greater than 50 ml , as measured with a bladder scan or by catheterization . both a quantitative and a qualitative analysis of bladder outlet obstruction ( boo ) was made by uroflowmetry . we determined the sensitivity and specificity as well as the positive and negative predictive value of the vds questionnaire using the uroflowmetry data . the qualitative analysis dealt with the flow patterns : a standard bell - shaped three pathologic patterns were considered : intermittent or continuous polyphasic curves , and flat curves [ figures 1a c ] . none of the patients presented with abnormal compliance , do , or abnormal detrusor sensation .", "a comparison of the clinical characteristics and uroflowmetry of the two groups was made using a wilcoxon test for continuous data and a fischer test for categorical data .", "as the bfluts questionnaire and urodynamics were identical to those systematically used for the routine evaluation of sui women in our department , the study did not require specific ethics committee approbation .", "among the 93 women eligible for the study , 61% ( 57/93 ) complained of vd symptoms on the bfluts questionnaire ( vds group ) and 39% ( 36/93 ) had no vd symptoms ( non - vds group ) . sui population without severe pelvic organ prolapse ( baden and walker staging system 1 ) , previous sui surgery , or neurological disorders ( the most frequent etiologies of voiding dysfunction in women ) we found a 29% ( 29/93 ) rate of abnormal uroflowmetry . characteristics of women with and without voiding difficulties symptoms in terms of age , menopausal status , parity , anorectal disorders and uroflowmetry parameters sensitivity , specificity , positive and negative predictive value of voiding dysfunction symptoms on bfluts multivariate analysis ( using multiple logistic regression method ) demonstrated no correlation between symptoms and quantitative uroflowmetry parameters ( maximum and average flow rate , acceleration , urine volume , time to maximum flow and voiding time ) , and no correlation was found between vds and age , menopausal status , parity or concomitant anorectal disorders [ table 4 ] . logistic regression method for multivariate analysis of urodynamic parameters ( maximal and average flow rate , time to void and acceleration ) , age , menopausal status , parity , concomitant anorectal disorders with respect to voiding difficulties symptoms univariate analysis of multiple factors with respect to voiding difficulties symptoms there was no statistical correlation between symptoms and the defined criteria of boo on uroflowmetry ( fischer test : p=0.64 ) . among the 42 women who complained of a sensation of incomplete the positive predictive value of the vds questionnaire was 32% and the negative predictive value was 75% [ table 3 ] . patients characteristics are detailed in table 2 . no difference was observed between the two groups concerning age , parity , menopausal status , concomitant anorectal disorders and uroflowmetry parameters . in the vds group , 75% ( 27/36 ) of the women in the non - vds group had normal uroflowmetry , and 25% ( 9/36 ) an abnormal one without symptoms . emptying , only one had a real post - void residual greater than 50 ml . in this", "our results show that 25% of sui women without obstructive symptoms , i.e. without an obvious cause for bladder outlet obstruction ( no severe genital prolapse ( > grade 1 ) ) , having had no previous surgery for sui , and with no neurological disorders , have an abnormal uroflowmetry , and thus a higher risk of post - surgery obstructive disorders . in which voiding dysfunctions should be less frequent than in the general population , we found that almost 30% of the patients had an abnormal uroflowmetry . we found the same results , but in a particular population of sui women , with no obvious reasons for obstruction . even in this selected population , our study clearly demonstrates the poor predictive value of the vds questionnaire , when compared with urodynamic data .", "no correlation was found between obstructive symptoms and boo as defined on uroflowmetry , in a specific population of sui women ." ]

[ "scurvy is a disease that played an important role in history and used to be the number one killer of sailors . it is still diagnosed in third - world countries because of malnutrition and in epidemic form in refugee camps .", "a 35-year - old patient was seen at the emergency department of a level 1 trauma centre with spontaneous bruisings on the lower extremity . no surgical cause for the haematomas was found . instead , the diagnosis of a severe vitamin c deficiency ( scurvy ) by malnutrition due to his eating disorder was considered . the patient was an electrician , currently unemployed because of knee problems . since 10 weeks initially , the patient was seen by an orthopaedic surgeon at an outpatient clinic with a painful knee without any preceding trauma . his dentist proposed to remove the decaying teeth . according to the patient , the bad teeth", "this present case report emphasizes that scurvy may still occur in developed countries and that patients with scurvy could be encountered by physicians of multiple medical disciplines . treatment is relatively simple with a versatile diet with citrus fruits , sweet peppers and tomatoes . vitamin c is needed for the synthesis of collagen , which is essential for firmness of the blood vessels . in patients with scurvy , , the biopsy could have been avoided , and supplements could have been initiated more quickly in case of higher awareness of the signs and symptoms of vitamin c deficiency . nowadays , scurvy occurs predominantly in developed countries because of malnutrition , and frequently epidemics are reported from the lesser civilized areas . however , even in these modern timeframe , groups with a high risk of vitamin deficiencies can be discerned . in our patient", "" ]

[ "therefore , we analyzed muscle \n activity under free walking , jogging ( 8.7 km / h ) , and running ( 8.8 km / h ) conditions on a \n treadmill . we \n postulated that the load imposed on the lower limbs would change at different running \n velocities . furthermore , because portion failure differs among individuals , the load applied \n to each muscle is probably not uniform . such repeated impacts are considered to cause lower limb muscle \n fatigue via chronic irritation . the incidence of running injury is affected by the running \n velocity and distance ran .", "analog signals of myogenic potential were processed using a band - pass filter ( 10500 hz ) at \n a sampling frequency of 1,000 hz . the greater trochanter , lower limb joint space , and lateral malleolus of the left hip , \n knee , and ankle were marked with tape to measure the range of motion . one 30-second cycle of \n walking , jogging , and running recorded with the video camera was selected , and then initial \n contact , mid stance , toe off , and the range of motion of hip flexion , knee flexion , and \n ankle dorsiflexion were measured on printouts . activity was assessed at the left \n vastus medialis , vastus lateralis , hip adductors , tibialis anterior , lateral head of \n gastrocnemius , medial head gastrocnemius , and soleus . maximum voluntary isometric contraction ( mvc ) was determined as manual resistance against a \n maximally contracted muscle . the average activity was calculated from 30-second cycles of walking , \n jogging , and running , including both the swing and stance phases . ten male students without leg injuries ( age , 23.2 6.5 y ; height , 170.4 5.7 cm ; weight , \n 67.6 11.1 kg ; bmi , 23.3 3.2 ) provided written informed consent to participate after \n receiving an oral and written explanation of the study and its purpose . the participants walked , jogged , and ran for 10 minutes in \n random order , and the myogenic potentials were measured for 30 seconds 10 minutes later . \n", "the average electromyographic activities of the vastus medial , tibialis anterior , medial \n head of the gastrocnemius , and lateral head of the gastrocnemius were significantly higher \n during jogging and running compared with walking . the average walking , jogging , and running speeds were 3.6 0.4 , 6.7 0.6 , and 10.4 \n 1.3 km / h , respectively . ic : initial \n contact , ms : mid stance , to : toe off the average lengths of the running stride were significantly longer than those of jogging \n and walking . also , that of jogging was significantly longer than that of walking ( table 5table 5.average length of stride ( n=10)walkingjoggingrunningstride ( m)1.240.041.460.06 * 2.140.08*,**values are meansse .", "the \n present study found that the amount of activity in the soleus muscle was significantly \n higher during running and jogging compared with the amounts of activity in the vastus \n medialis , tibialis anterior , and gastrocnemius muscle , which are involved in walking . \n the \n present study investigated differences in the amount of muscle activity during walking , \n jogging , and running . the averages values for the tibialis anterior muscle were significantly higher during \n running and jogging compared with walking . the average value of the soleus muscle was significantly higher during running than during \n walking . the central frequency of each muscle seemed to remain essentially unchanged between running \n and jogging compared with walking , and fatigue did not arise ." ]

[ "", "the online version of this article ( doi:10.1007/s13300 - 015 - 0133-z ) contains supplementary material , which is available to authorized users .", "chronic kidney disease ( ckd ) is a common condition in patients with type 2 diabetes ( t2 dm ) . prior studies have demonstrated the preferential use of sitagliptin in several populations [ 47 ] . in general , patients initiating treatment with sitagliptin were older and had more complications of diabetes and comorbidities than patients initiating other antihyperglycemic therapies [ 47 ] . if not recognized and appropriately considered in the analysis , this preferential selection of patients with specific demographic and disease characteristics for treatment with sitagliptin ( channeling bias ) could lead to inaccurate treatment effect estimates in comparative analyses that include sitagliptin . the objective of this study was to describe the baseline characteristics of patients with t2 dm and ckd initiating treatment with sitagliptin or non - dpp-4i oahas to ascertain whether channeling exists in this patient population . . however , many antihyperglycemic medications are contraindicated or need to be used with caution in patients with ckd , complicating t2 dm treatment choices and management . patients with t2 dm and ckd are particularly susceptible to safety and tolerability issues related to many classes of oral antihyperglycemic agents ( oaha ) . dipeptidyl peptidase-4 inhibitors ( dpp-4i ) such as sitagliptin are well tolerated in a broad range of t2 dm patient types , including those with renal disease , and may therefore be preferentially used in patients with ckd . an estimated 2035% of patients with t2 dm have moderate to severe renal impairment [ 1 , 2 ]", "patients 25 years of age with t2 dm and ckd , with claims in the united states ( us ) between january 2006 and june 2012 , were identified in marketscan . of these patients , the truven health marketscan databases ( marketscan , truven health analytics , ann arbor , mi , usa ) contain medical claims records for more than 150 million unique patients dating from 1996 . the records of retirees with supplemental insurance are included in the database thus providing data on the elderly with continuity of care across those < 65 and 65 years of age . demographics , and clinical conditions and health care resource utilization recorded up to 5 years before therapy initiation were assessed as baseline characteristics . over 70 clinical conditions and comorbidities may have been recorded in the database , including diabetes complications , cancers , and cardiovascular ( cv ) , metabolic , gastrointestinal , hepatic , infectious , psychiatric , pulmonary , and neurological events . types of health care resource utilization recorded in the database included physician and emergency department visits , hospitalizations , days hospitalized , and number of medications received . the records are derived from outpatient and inpatient insurance claims for employees of over 100 employers participating in more than 12 health plans , and their beneficiaries in the united states .", "a total of 35,922 patients with t2 dm and ckd were identified as meeting the inclusion criteria . over 45% of patients ( 46.7% ; n = 16,742 ) initiated sitagliptin ( n = 1234 ) or a non - dpp-4i oaha monotherapy ( n = 15,508 ) , 40.5% ( n = 14,540 ) initiated an escalation to dual combination therapy ( sitagliptin , n = 2683 ; oaha , n = 11,857 ) , and 12.9% ( n = 4640 ) initiated an escalation to triple combination therapy ( sitagliptin , n = 1385 ; oaha , n = 3255 ) . roughly , 15% of patients with t2 dm and ckd ( 14.8% ; n = 5302 ) initiated treatment with sitagliptin . in comparison , in the patients excluded from this analysis due to a lack of recorded ckd , the percentage of patients initiating sitagliptin was 7.4% . the greatest differences between treatment groups were observed in patients initiating monotherapy or an escalation to dual combination therapy . compared to patients initiating monotherapy with non - dpp-4i oahas , asd absolute standardized difference , chf congestive heart failure , dpp-4i dipeptidyl peptidase-4 inhibitor , hosp hospital , htn hypertension , meds medications , mi myocardial infarction , phys physician , tia transient ischemic attack in patients initiating an escalation to triple combination therapy , the differences between treatment groups ( non - dpp-4i oaha users versus sitagliptin users ) were not as pronounced as those seen in patients initiating monotherapy or escalation to dual therapy , including the between - group age difference ( mean [ sd ] : sitagliptin 68.9 [ 10.9 ] years , non - dpp-4i 68.4 [ 10.5 ] years ; asd 5% ; fig . 1baseline characteristics of patients with type 2 diabetes and chronic renal disease up to 5 years before initiating treatment with sitagliptin or non - dpp-4i oral antihyperglycemic agent as monotherapy or as part of dual or triple therapy . a , c , e clinical conditions and comorbidities .", "in this study of patients with t2 dm from an employee - based insurance database , sitagliptin was initiated in a higher percentage of patients with t2 dm and ckd ( 14.8% ) compared to patients with t2 dm but no record of ckd ( 7.4% ) . unlike many other oahas , sitagliptin is approved for patients with any stage of renal disease . in light of this and its favorable renal safety profile [ 1215 ] , the higher use of sitagliptin in patients with ckd observed in the current analysis is not surprising . in general , these observations of channeling in patients receiving treatment with sitagliptin are similar to those previously reported in a general t2 dm population [ 47 ] . importantly for this study , patients with end - stage renal disease are likely underrepresented since these patients are medicare eligible .", "this study further documents the presence of channeling in patients initiating treatment with sitagliptin . in this study , patients with ckd initiating treatment with sitagliptin were generally older and were more likely to have a pre - treatment history of heart failure , arrhythmia , or use of loop diuretics or beta - blockers than patients initiating other classes of oral therapies . if not recognized and analyzed appropriately , this channeling could lead to biased treatment effect estimates in comparative analyses , including those involving users of sitagliptin .", "", "kenilworth , nj , at the time this analysis was carried out and may own stock and/or hold stock options in the company . kenilworth , nj , at the time this analysis was carried out and may own stock and/or hold stock options in the company . , a subsidiary of merck & co. , inc . , kenilworth , nj and may own stock and/or hold stock options in the company . k. g. brodovicz was an employee of merck sharp & dohme corp . , a subsidiary of merck & co. , inc . ,", "this article does not contain any new studies with human or animal subjects performed by any of the authors .", "this article is distributed under the terms of the creative commons attribution - noncommercial 4.0 international license ( http://creativecommons.org/licenses/by-nc/4.0/ ) , which permits any noncommercial use , distribution , and reproduction in any medium , provided you give appropriate credit to the original author(s ) and the source , provide a link to the creative commons license , and indicate if changes were made ." ]

[ "the use of the kuntscher nail has been the most important advancement in trauma surgery .", "firstly , we performed a simple unicortical osteotomy on the lateral side from the proximal part to below the callus in order to decompress the femoral canal without success . he had an acetabulum fracture and a femoral shaft fracture treated 30 years ago with a reamed kuntscher femoral nail . lateral hip approach was performed and after attempting to remove the nail with the specific tools being unsuccessful we decided to be more aggressive . secondly , a trench in the greater trochanter around the proximal hole was performed to hit the nail from below which was still insufficient and furthermore , the hole broke when hitting the nail so we needed to drill a new hole distally . several cerclages closed the osteotomy and a bone graft was used to close the trench .", "with this case report , we present a new salvage technique to remove an incarcerated kuntscher nail when all the described methods have failed .", "the use of the kuntscher nailing system for the treatment of long bone fractures has been the most important advancement in trauma surgery in recent history . since its first implementation in a german hospital in the late 30 s , this article presents a case of an incarcerated femoral nail and describes a salvage procedure for nail extraction after all previously described methods have failed . removal of a kuntscher nail is considered a routine procedure but could be really challenging . the biggest challenge appears when all the described methods result in failure of removal of the nail . bone ingrowth or overgrowth , damage to the proximal threads of the nail , and broken nails or locking screws may complicate the removal of intramedullary nails .", ", we decided to use the saw to perform a simple unicortical osteotomy in the proximal third of the femur to decompress the endomedullar canal ( fig . the patient was involved in a plane accident 30 years before sustaining a femoral shaft fracture treated with a reamed kuntscher nail and a posterior wall acetabulum fracture treated with open reduction and internal fixation with lag screws ( fig.1 ) . clinicalintra operative image : simple unicortical osteotomy in the proximal third of the femur to decompress the endomedullar canal . after trying all these different ways to remove the nail being unsuccessful pre - operative x - ray of the pelvic ring : intramedullary kuntscher nail in the left femur and osteosynthesis with three screws in the posterior wall of the acetabulum . , we decided to continue the longitudinal osteotomy from proximal to distal in the lateral side of the femur . 3 ) . after this decompression osteotomy we tried to hit the nail from below with an impactor engaged in the proximal hole of the nail . however , the implant remained in the same position . the first step was to find the proximal tip of the nail which was found seated deep in the great trochanter .", "various reasons have been described in the literature for nail incarceration , including excessive callus formation closing the intramedullary canal , ingrowth of bone into the nail , bone ingrowth through the locking holes and bent or broken nails . there are different techniques to remove retained intramedullary nails , most of these techniques are designed for broken nails , but others are for incarcerated nails . there is only one case similar to our case report by lindeque et al which describes removal of tibial nail using a large longitudinal osteotomy . we decided to perform a two - stage procedure especially due to the incipient arthritis of the hip . if our patient would have had advanced stage of arthritis , we could have considered a single - staged procedure with nail removal and hip replacement or a hip replacement without removing the nail .", "however , despite the aggressiveness of the procedure , the patient had a good result , and the osteotomy healed normally with no complications . this is the first case published in the literature using this longitudinal osteotomy to remove a femoral nail . it is recommended to remove it as soon as it possible to minimize later complications ." ]

[ "finally , the stability and transport characteristics of the dipeptide monoester prodrugs of floxuridine were compared with those of the corresponding amino acid monoester prodrugs . the feasibility of selective antiproliferative action of amino acid / dipeptide floxuridine prodrugs was also explored using cancer cells that overexpress pept1 . the chemical stability at physiological ph and the enzymatic activation of the prodrugs in caco-2 , aspc-1 , and capan-2 cell homogenates were also evaluated to determine the effects of the amino acid / dipeptide promoiety structure on enzyme - mediated activation . , we describe the synthesis , characterization , and stability of dipeptide monoester prodrugs of floxuridine . various dipeptides and peptidomimetics", "the tfa salts of amino acid prodrugs of floxuridine were obtained as white fluffy solids . the combined yield , consisting of 3-monoester , 5-monoester , and 3,5-diesters , of each floxuridine prodrug was 60% . caco-2 cell monolayers were grown on collagen - coated polytetrafluoroethylene membranes for 21 to 24 days , and capan-2 cell monolayers were grown on the same type of membrane for 14 days . the concentrations of prodrugs and their metabolites were determined on a waters hplc system ( waters , inc . , the concentrations of floxuridine and its prodrugs in the receiver and donor compartments were analyzed using hplc . the synthesis and characterization of 5-mono amino acid ester prodrugs of floxuridine have been reported previously . the slopes of these plots are related to the rate constant k and given by \n\n the degradation half - lives were then calculated by the equation \n\n statistical significance was evaluated with graphpad prism v. 3.0 by performing one - way analysis of variance with posthoc tukey s test to compare means . the apparent permeability ( papp ) for the prodrugs was calculated using the following equations : \n\n where jss is the steady state flux , m is the cumulative amount of prodrug , and regenerated mono amino acid prodrug , drug and 5-fu in the receiver compartment .", "additionally , 5-d - valyl - floxuridine exhibited antiproliferative activity similar to that of floxuridine and gly - sar , despite an affinity for pept1 that was similar to that of other mono amino acid / dipeptide monoester prodrugs of floxuridine . the amino acid ester prodrugs of floxuridine were found to be quite resistant to degradation by thymidine phosphorylase . the composition of the amino acids in the dipeptide moiety exerted a profound effect on the stability of the ester bond regardless of the mode of attachment . dpd is the rate - limiting enzyme involved in the catabolism of pyrimidines and is also the main enzyme involved in the degradation of structurally related compounds like 5-fu ( figure 1 ) .", ", enhanced metabolic resistance and superior affinity to oligopeptide transporters of dipeptide prodrugs may facilitate their prolonged systemic circulation and enhanced therapeutic action . with its display of respectable stability in biological surrogate media and its approximately 2- to 3-fold shorter half - life in cancer cell homogenates than ones in human plasma and caco-2 cell homogenates , we describe the synthesis of dipeptide monoester prodrugs of floxuridine and their chemical stability , bioactivation and transport in caco-2 cells , a surrogate for intestinal transport , and in two pancreatic duct cell lines , aspc-1 and capan-2 , that overexpress the pept1 transporter . amino acid ester prodrugs have been widely employed to improve intestinal absorption of poorly permeant drugs . , 5-l - phenylalanyl - l - tyrosyl - floxuridine could be an optimal candidate for cancer cell targeting with enzyme - specific activation . these studies revealed that mono amino acid ester prodrugs in general provide enhanced pept1-mediated transport , a range of bioactivation rates , and enhanced glycosidic bond resistance to metabolic enzymes such as thymidine phosphorylase and cytidine deaminase . in this report" ]

[ "we present here a study of the primate macaca mulatta genome to identify and characterize insertion sites of the two representative retroelements present , and further , comparison with similar features of the human genome ( excluding the y chromosome ) . the structural and thermodynamic features as well as protein interaction measures are computed in preinsertion loci using the tool dna scanner . repetitive elements account for about 50% of the genome among all of the presently sequenced primate species ( table 1 ) . in m. mulatta , approximately 50% of the rhesus macaque genome consists of various repetitive sequences , similar to the human genome . the m. mulatta genome has a total of 22 chromosomes including x and y ( although the sequencing project did not sequence y ) . the only y chromosome that has been completely sequenced is of humans , and sequencing of the chimpanzee and mouse y chromosomes is in progress .", "two different nucleosomal related features , the bending energy / persistence length and the position profiles of the nucleosomes , were studied . we first compute the nucleotide sequence divergence of l1 ( human ) with respect to the corresponding l1 ( macaca genome ) ( table 2(a ) ) . regions with comparatively low energies were obtained , within the upstream areas of the insertion sites . we found regions of low gc and high at content , indicating that a relatively less energy is required to melt dna near insertion sites , which in turn favors retrotransposition ( figs . in the human genome , a full - length l1 element is around 6 kb long , and is reported to be the most successful tes in human genome by mass while alu elements , typically ~300 bp long are most successful in terms of copy number . currently , there are three macaque consensus sequences for alu : alumacya3 , alumacyb2 , and alumacyb4 and five of that for l1 : l1p4a , l1p4b , l1p4c , l1p4d , l1p4e in repbase ( version 13.5 ) . ( 4 ) stacking energy profiles showed a maximum near -10 , indicating that this region is unstable , leading to easy de - stacking of dna sequence , which would thereby enable an easy insertion of alu .", "the present study confirmed that the region 100 bp upstream from alu and l1 insertion sites show statistically significant distinctive properties both in the physical and structural characteristics , as well as in the energetics . previously , we analyzed several genomes for distribution of mges as well as their insertion sites along with the signals facilitating their insertion . in the present study of alus ( sine ) and l1s ( line ) in the macaca genome we found that the insertion sites had physicochemical characteristics that were similar to those observed in other organisms , suggesting that these are generally important . the present work adds insight into primate genome architecture , showing the common structural features that promote mge insertion and genome expansion . in future work , we aim to compare the insertion sites across species- a task that will be facilitated as the diversity of sequenced genomes increases further .", "this tool finds the nature , distribution , genomic location , and the site of truncation for each of the insertion sites and performs comparative genome analysis and also generates several set of sequences . the tool dna scanner analyses the dna for many physico - chemical properties by using various thermodynamic , protein interactions and sequence - based features , which are beyond the t density and at density . in accordance to the choice of input parameters , the program evaluates a number of properties , using windows that move along the length of the query dna sequence . since we have previously shown that intact copies show the presence of signal as compared with the truncated groups , the analysis of the full - length elements , i.e. , of those capable of transposition was also performed . elefinder was used to find the insertion site of alu and l1 in the macaca genome . the controls were selected by scrambling sequences , randomly picking sequences from genome as well as gene sequences . since downstream sequences tend to show signals that are not sufficiently statistically significant only upstream sequences were investigated for both alu and l1 elements ." ]

[ "we report herein the case of a patient with severe uc that had developed during the first trimester of pregnancy and was refractory to combination therapy with high - dose corticosteroids and intensive gma , but was successfully treated with tacrolimus following cesarean section early in the third trimester . intensive gma involving two gma sessions per week has recently been shown to be more efficacious than conventional weekly gma . furthermore , intensive gma also safely induced rapid remission in patients with moderately active uc inflammation . very recently , the drug tacrolimus was approved in japan for the treatment of patients with moderate or severe uc , regardless of whether the uc is dependent on or refractory to corticosteroids . the prevalence of ulcerative colitis ( uc ) has increased each year for the past several decades .", "tacrolimus is not currently approved in japan for maintenance therapy , and therefore tacrolimus administration was stopped . in july 2009 , a 36-year - old pregnant woman was referred to our hospital for treatment of refractory uc . she had been diagnosed with uc ( total colitis ) at the age of 17 . then , oral 5-asa ( 2,250 mg / day ) plus 3 mg betamethasone enema had induced and maintained remission up to 2008 . in april 2009 , at the age of 36 years , she became intentionally pregnant for the first time , while her uc was in remission with oral 5-asa at a dose of 2,250 mg daily . however , during pregnancy , the flare - up of her total colitis required daily intravenous administration of up to 80 mg / day prednisolone , oral 5-asa 2,250 mg / day and weekly gma for 10 weeks , followed by weekly lymphocytapheresis for 3 weeks under the management of a total parenteral nutrition program at the previous hospital . azathioprine ( aza ) administration was also tried , but had to be stopped due to aza - induced pancytopenia .", "we report herein the case of a patient with flared refractory uc during pregnancy who underwent a bridging therapy consisting of high - dose corticosteroids combined with intensive gma until it was impossible to prolong gestation any further . at that point , in clinical settings , therapeutic treatment for uc flare - up during pregnancy is limited because of concerns for the safety of the unborn child . this therapy ultimately resulted in clinical remission . in conclusion , for pregnant uc patients , combined therapy consisting of high - dose corticosteroids and intensive gma is recommended until it is impossible to prolong gestation any further . when clinical remission can not be obtained , rescue therapy using tacrolimus after cesarean section may be useful . thus , the safety of aza and 6-mp in the treatment of pregnant patients with ibd remains controversial .", "the authors declare that no financial or other conflict of interests exists in relation to the content of this paper ." ]

[ "only a few cases of pulmonary vascular tumors diagnosed using endobronchial ultrasound - guided transbronchial needle aspiration ( ebus - tbna ) have been reported in the literature . they frequently present as filling defects in the pulmonary vasculature on computed tomography ( ct ) making it challenging to distinguish between vascular tumor and thrombotic emboli . ebus - tbna of mediastinal and hilar lymph nodes has proven value in diagnosis and staging for lung cancer . in addition , ebus - tbna may provide an opportunity to identify and sample endovascular abnormalities in the mediastinal and hilar area . although fluorodeoxyglucose - positive emission tomography ( pet ) scan may reportedly help differentiate malignant growth from benign emboli , pet scans are not routinely performed for this purpose . increased uptake on the pet scan increases the malignant suspicion of vascular tumors but in most cases", "a 43-year - old white male was diagnosed with leiomyosarcoma of proximal left thigh involving femoral vessels 2 years back . only one endovascular lesion was identified , which extended to the right lower lobe branch of the pulmonary artery . he was found to have pulmonary embolism involving right pulmonary artery for which he was started on anticoagulation and an inferior vena cava filter was placed prior to surgery . despite being on anticoagulation postoperatively , serial surveillance imaging continued to show persistent thrombus . eventually , an interval increase in size of the filling defect in right main pulmonary artery extending to the right lower lobe pulmonary artery was noted on contrast - enhanced chest ct [ figure 1 ] . at this point , an endovascular hyper - echoic lesion was identified in right pulmonary artery [ figure 2 ] . ( d ) ebus - guided transbronchial needle aspiration ( arrow ) of the right pulmonary artery tumor .", "in addition , there have been reports of using ebus - guided trans - pulmonary vascular lymph - node sampling without any complications . here , we present the first case of metastatic leiomyosarcoma of pulmonary artery diagnosed with ebus - tbna . successful diagnosis of primary pulmonary artery leiomyosarcoma with catheterization and biopsy has also been reported . in the last few years , several cases of primary and metastatic pulmonary artery tumors diagnosed by ebus - tbna have been reported without any procedure - related complications . historically , most cases of pulmonary artery tumors were diagnosed with surgery or during postmortem examination . the diagnosis of pulmonary embolism in patients with malignant diseases can be challenging especially in ill patients where the wells score is already high .", "ebus - tbna seems to be a safe , feasible , and minimally invasive tool for the diagnosis of vascular tumors such as metastatic pulmonary artery leiomyosarcoma ." ]

[ "the purpose of this study was to develop and validate prognostic nomograms for disease recurrence in patients with ta , t1 transitional cell carcinomas of the bladder . these nonograms will facilitate patient counseling , choosing the most appropriate adjuvant treatment after tur , and determining the frequency of follow - up in individual patients . transitional cell carcinoma ( tcc ) of the urinary bladder can present as a non - muscle invasive or as a muscle - invasive lesion . several studies have suggested risk tables for the recurrence and progression of non - muscle invasive bladder cancer ( 5 , 7 , 9 , 10 ) , but they can not calculate the probability of a certain event , such as the probability of recurrence within five years . however , not all non - muscle invasive bladder cancer patients have the same risk for disease recurrence and progression , and the absence of risk stratification between aggressive and indolent tumors contributes to potentially excessive frequent surveillance or unnecessary intravesical therapy . prognostic factors in patients with non - muscle invasive bladder cancer have been the subject of numerous publications for many years ( 2 - 18 ) .", "they were treated with transurethral resection ( tur ) and diagnosed with ta or t1 tcc of the bladder based on the 2002 american joint committee on cancer ( ajcc ) tnm staging system ( 19 ) . thirty - eight training hospitals participated in this retrospective multicenter study . between january 1998 and december 2002 , 3,060 patients with newly diagnosed we assessed the impact of various clinical and pathological features on time to first recurrence . the median age was 63 yr ( 21 - 98 ) , and the median follow - up duration was 44 months ( 12 - 97 ) . the clinical and pathological data ( local ) , including sex , age , tumor size ( <3 cm or 3 cm ) , multiplicity ( single or multiple ) , t category ( ta or t1 ) , tumor grade , presence of concomitant cis or squamous differentiation , and intravesical therapy were obtained from each hospital and merged . one - thousand and eighty - two patients were treated with intravesical therapy after tur , and drugs used for intravesical therapy were as follows : bcg in 827 patients , mitomycin - c in 108 patients , epirubicin in 135 patients , and other drugs in 12 patients . follow - up data were also obtained , including pathologically proven recurrence and time to first recurrence , which was defined as the time period between the date of initial diagnosis and the date of recurrence . the predictive accuracy of each univariate and multivariate logistic regression model was tested using the area under the receiver operating characteristics ( roc ) curve .", "the bootstrapping estimate of the predictive accuracy of the nomograms suggested that the area under the roc curve was approximately 0.599 at three years and 0.604 at five years . three - year and five - year recurrence - free rates were 64.3% and 55.3% , respectively ( fig . 1 ) . on univariate cox proportional hazard analysis , age , tumor size , multiplicity , tumor grade , concomitant cis , and intravesical therapy had a significant influence on recurrence - free survival ( p<0.05 ) ( table 2 ) . the results of bootstrap re - samples were 0.723 for the three - year estimation of the nomogram and 0.738 for the five - year estimation . the scales of the nomograms reflected the coefficients from the cox model rescaled to a user - friendly ( 100 point ) range . multivariate analysis revealed that age ( hazard ratio [ hr]=1.437 , p<0.001 ) , tumor size ( hr=1.328 , p=0.001 ) , multiplicity ( hr=1.505 , p<0.001 ) , tumor grade ( hr=1.347 , p=0.007 ) , concomitant cis ( hr=1.611 , p=0.007 ) , and intravesical therapy ( hr=0.681 , p<0.001 ) were independent predictors for disease - recurrence ( table 3 ) . based on this analysis , nomograms for the prediction of recurrence probabilities at three and five years were constructed ( fig .", "this study showed that patient age , tumor size , multiplicity , tumor grade , cis , and intravesical therapy are significant predictors for recurrence in patients with ta , t1 tcc of the bladder . , current nomograms can be used to predict the probability of disease recurrence in patients with newly diagnosed ta , t1 transitional cell carcinoma of the bladder . the prognostic importance of various factors is not always consistent among various studies , and analyses of prognostic factors of the bladder tcc related to recurrence are sometimes difficult to compare ( 8) . of these , multiplicity and intravesical therapy following tur were the most influential determinants for prediction of recurrence in nomograms ( fig . there was no difference in the time to the first recurrence between grade ii and grade iii tumors in the univariate analysis , so a dichotomized tumor grade ( grade i vs. grade ii / iii ) was used for the multivariate analysis ( table 2 ) . in addition , differences among intravesical instillation agents had no influence on time to first recurrence , and intravesical therapy was also simply dichotomized ( not performed vs. performed ) ( table 2 ) ." ]

[ "we are presenting a case of ebtb that manifested with two endobronchial masses , which almost totally occluded the bronchial lumen and resulted in repeated episodes of post - obstructive pneumonia for more than a year prior to diagnosis . endobronchial stenosis is a common complication of ebtb despite the use of anti - tuberculous chemotherapy . endobronchial tuberculosis ( ebtb ) is a form of tuberculous infection that involves mainly the trachea and/or bronchi . the disease is often mistaken for more common lung diseases like pneumonia , asthma , lung cancer and other lung diseases . our patient was successfully treated with anti - tuberculous chemotherapy without the use of corticosteroids .", "a 62 year old pakistani woman was admitted to hamad general hospital with history of fever for 10 days prior to admission . three years earlier she was admitted for abdominal surgery due to a perforated duodenal ulcer and incidentally discovered to have type 2 diabetes for which she was commenced on glibenclamide . prior to admission she was prescribed a seven - day course of amoxicillin that was changed to cephalexin by her family physician without improvement . for more than a year prior to this admission she had frequent visits to emergency room and a hospital admission for recurrent episodes of fever and cough that were diagnosed as community acquired pneumonia based on the radiographic finding of right lung opacity and the response to antibiotic therapy . she denied any history of cough , hemoptysis , breathlessness , chest pain , nocturnal sweating or weight loss . a repeated bronchoscopy 6 months later revealed complete resolution of the endobronchial masses without evidence of bronchial stenosis ( figure 5 ) .", "secondly , bronchial stenosis is a serious complication of the disease that may develop despite efficacious antituberculous chemotherapy and thirdly , it is often misdiagnosed as bronchial asthma or lung cancer . some previous studies have suggested that delay in diagnosis of ebtb is an independent predictor of the development of persistent airway stenosis . considering the prognosis of tumorous type ebtb and the delay in diagnosis as a predictor for the development of bronchial stenosis , healing without stenosis in our case seems interesting . ebtb is defined as tuberculous infection of the tracheobronchial tree with microbial and histopathological evidence [ 3 , 4 ] ." ]

[ "the present study was conducted in the psychiatry outpatient department of a tertiary care hospital during one year after obtaining clearance from institutional ethical committee . their sociodemographic profile , characteristics of migraine , psychiatric history , detailed physical examination as well as mental status examination was recorded . the patients were subjected to specialists opinion ( e.g. , ophthalmologist , ent or medical specialist ) and relevant investigations ( e.g. , fundus , x - ray skull , c.t . the cases suffering from organic mental disorders , chronic psychiatric disorders , epilepsy or drug dependence were excluded from the study .", "characteristic of migraine generalized anxiety disorder ( f41.1 ) was the commonest psychiatric diagnosis ( 34% ) followed by mixed anxiety and depressive disorder ( f41.2 ) ( 18% ) , 22 patients ( 22% ) did not have any psychiatric disorder [ table 3 ] . out of 3245 patients seen during the study period , 100 ( 3.2% ) were suffering from migraine . socio - demographic characteristics of patients with migraine family history of migraine was present in 12% cases whereas family history of depression was present in 6% . maximum patients belonged to age - group of 31 - 40 years ( 40% ) followed by 21 - 30 years ( 22% ) . the physical comorbidity included hypertension ( 12% ) , cervical spondylosis ( 8% ) , refractive errors ( 7% ) , chronic sinusitis ( 3% ) and diabetes mellitus ( 2% ) . the personality profile of the patients showed anankastic traits ( 25% ) , dysthymic traits ( 20% ) , histrionic traits ( 17% ) , anxious traits ( 14% ) , schizotypal traits ( 10% ) , cyclothymic traits ( 6% ) and others ( 8% ) . the provoking factors were reported in 18 patients ( 18% ) [ table 2 ] .", "the other provoking factors for migraine as reported in the literature e.g. , aged cheeses , caffeine , chocolate , concentrated sugar , dairy products , fermented , pickled food , fruits ( bananas , figs , raisins , pineapple etc . migraine is reported to be more common in persons between the age of 20 and 45 years . in the present study also migraine without aura ( previously called common migraine ) was the commonest subtype seen ( in 81% ) . unilateral type of headache was much more common than the bilateral type and the headache was throbbing in nature in a majority of migraneurs . but the present study , a cross sectional one , did not determine whether the onset of anxiety disorder and depression preceded or followed the migraine . retrospective studies on the onset and course of these syndromes showed that the onset of anxiety generally preceded that of migraine whereas the onset of depression tended to occur after that of migraine .", "the present study confirms that majority ( 78% ) of patients with migraine had psychiatric disorders ." ]

[ "medullary thyroid carcinoma ( mtc ) is a rare neuroendocrine cancer that originates from thyroid parafollicular calcitonin-(ct- ) producing cells . the possibility of testing these novel drugs in vitro ( in primary thyroid cancer cells ) and in vivo may help to improve the personalization of treatments . other studies have demonstrated the potential for immunotherapy in combination with agents that target signal transduction pathways that are important for mtc growth . this has led to the development of novel compounds that have been used in several clinical trials , including tkis that can target multiple tkrs simultaneously in addition to ret and agents that can target other altered signaling pathways . in recent years , the discovery of mechanisms of resistance to tkis and of several other molecular events that contribute to mtc transformation and metastasis suggested that combinatory therapy may result in a more significant tumor growth inhibition . thus , multiple promising therapeutic agents that target these genetic alterations have been developed to treat progressive and advanced mtc . activating mutations of the tyrosine kinase receptor ( tkr ) rearranged during transfection ( ret ) locally advanced and distant metastatic diseases are incurable , as surgical resection and conventional radio- and cytotoxic chemotherapies are not effective against metastatic mtc [ 7 , 8 ] . clinical trials of various combinations of chemotherapeutic drugs have yielded unsatisfactory results [ 9 , 10 ] . however , research over the last years has led to a good understanding of the genetic defects and altered molecular pathways that are associated with the development of mtc .", "however , this paper will mainly focus on additional cellular signaling pathways other than ret responsible of mtc tumorigenesis and progression and potential targeted approaches for the treatment of advanced or metastatic mtc . the role of the ret oncogene in the tumorigenesis of mtc has been characterized extensively . although activating mutations of the tkr ret are believed to be the primary oncogenic event in the development of a majority of mtc cases , it is clear that ret cooperates with other signal transduction pathways to promote mtc tumorigenesis . germline mutations in the ret proto - oncogene are responsible for hereditary mtc , while somatic ret mutations are responsible for sporadic mtc . have been reported in nearly all hereditary cases of mtc ; some of these mutations are included in the men2a , familial mtc , or men2b syndromes in which there is a genotypic / phenotypic correlation between the type of ret mutation and clinical features . ras is a frequently mutated oncogene in a broad spectrum of human tumors , including thyroid carcinoma , mainly in the follicular forms . in this context , investigators aimed to determine whether mutations in the ras oncogene could play a possible role in the carcinogenesis of sporadic mtc .", "due to increased knowledge of the molecular pathogenesis of mtc , therapeutic agents that target specific altered pathways have been developed ( figure 1 ) . because the alterations of protein kinases and their pathways are involved in mtc development , several tyrosine kinase receptors inhibitors ( tkis ) have been tested in vitro , preclinical , and clinical studies . epigenetic drugs are expected to target the two main mechanisms of epigenetic alterations , dna methylation and acetylation , and are regarded with increasing interest by both endocrinologists and oncologists . concluded trials of such drugs have shown that few patients with advanced thyroid cancer responded completely , which suggests that these treatments were effective at stabilizing progressive disease . , epigenetic therapy may be a promising novel approach for the treatment of some cases of mtc . epigenetic drugs , when used in combination with other target molecules , might significantly increase response rates to treatment in advanced thyroid cancer patients , either by relaxing the chromatin structure to make dna more accessible to the effects of a dna targeting drug or by acting synergistically with antimitotic drugs . thus thus , immunotherapy may be a promising alternative therapy in combination with agents that target specific signal transduction pathways for aggressive forms of mtc that are resistant to classical therapies . finally an important study reported the existence of cancer stem - like cells in mtc , which exhibit the features of self - renewal and of multiple lineage differentiation that is dependent on ret proto - oncogene receptor activity suggesting a potential mechanism of resistance to cytotoxic or tkis agents . one of the mechanisms for the resistance of mtc to chemotherapeutic drugs is multidrug resistance ( mdr ) . several other therapeutic agents are being investigated for their uses in the treatment of thyroid carcinomas , including mtc .", "most cases of metastatic mtc are incurable due to resistance to conventional chemo- and radiotherapies . in recent decades , the identification of genetic defects and altered cellular signaling pathways involved in human mtc tumorigenesis have led to the development of targeted therapies , of which the most important are tyrosine kinase inhibitors . however , the low rates of partial responses or complete responses and the short duration of responses in mtc patients who were observed while taking these drugs prompted researchers to develop new drugs and alternative therapies to be combined with multi - tkis and to reduce potential cross - toxicity effects . to this end , a recent study has shown synergistic effects with a combination of sorafenib and the mek inhibitor azd6244 against a human mtc cell line . novel combined or sequential therapies request a further step in the knowledge of the cellular signaling of this tumor . finally , larger multi - institutional clinical trials to fully understand the clinical benefits of these therapies are warranted . however , a complete overview of all signaling pathways , including their interactions , role of the activating gene mutations that contribute to mtc tumorigenesis , and mechanisms of intrinsic and acquired resistance to treatments , is required and will permit us to identify the best therapy for each patient . the mtor cascade is emerging probably as one of the most important deregulated pathways in advanced and metastatic mtc and certainly deserves further study . targeting mtor in combination might be efficacious in patients with this tumor types . concomitant use of a raf inhibitor , raf265 , and a dual pi3k / mtor inhibitor , bez-235 , was another effective combinatorial therapy against thyroid cancer in xenograft mouse models ." ]

[ "bactericidal activity thus may be useful in the therapy of respiratory tract infections as a means to curtail , but not avoid , the emergence of resistance . the ability of bactericidal activity to influence therapeutic efficacy and clinical outcome has been evaluated in infections that typically are refractory to antimicrobial therapy . all of the effects of antimicrobial agents against microbes , including the delineation of microbial resistance , are based upon the results of in vitro susceptibility testing . both experimental models of infection ( 1922 ) and clinical studies ( 2327 ) have shown that bactericidal activity predicts therapeutic efficacy and results in improved clinical outcome . the emergence of macrolide resistance in s. pneumoniae has been rapid in comparison and has even been described during treatment of pneumococcal pneumonia ( 34 ) .", "the key to resolving the problem of antibacterial resistance lies in identifying the mechanisms that engender it ( 3133 ) . among the most important mechanisms are decreased ability of antibacterials to penetrate the bacterial cell wall , active efflux of antibacterial agents , inactivation of antibacterial agents , destruction of antibacterial agents , alteration of antibacterial target sites , development of bypass pathways around antibacterial targets , and constitutive phenotypic variation in bacterial physiology . these two examples illustrate the desirability of achieving bactericidal activity to curtail the emergence of resistance . if a bactericidal agent kills a pathogen such as klebsiella before mutation of the porin gene , resistance is less likely to develop . an example of this principle can be seen with the upper respiratory tract pathogen , streptococcus pyogenes , which to date has not developed resistance to penicillin , a bactericidal agent , but has developed resistance to erythromycin , a bacteriostatic agent ( 3638 ) .", "smx - tmp has long been used for the therapy of respiratory tract infection ( 41 ) and has proven particularly useful in the treatment of acute exacerbations of chronic bronchitis . sulfamethoxazole / trimethoprim ( smx - tmp ) is an example of a combination of two agents , each of which alone is bacteriostatic , that achieves bactericidal activity . bactericidal activity can be achieved through the mechanism of action for a single antimicrobial agent or by the use of combination therapy , or both . combinations of antimicrobial agents are also used in the therapy of bacterial endocarditis to achieve synergism leading to increased bactericidal activity and improved sterilization of infected valves .", "other examples of the importance of bactericidal activity are the fluoroquinolones . studies of the bactericidal action of the quinolones against escherichia coli demonstrate at least two independent and important mechanisms of action . the emergence of fluoroquinolone resistance with respect to staphylococcus aureus and p. aeruginosa has been well - documented ( 53 ) . this major problem is due to a wide variety of fluoroquinolone - resistance mechanisms ( 54,55 ) , particularly the mutation of dna gyrase ( 56 ) . an important issue associated with the use of fluoroquinolones in the therapy of respiratory tract infections is the fact that fluoroquinolones also are used to treat other infections . failure of treatment of pneumococcal pneumonia due to resistance to levofloxacin recently has been described ( 63 ) .", "other examples of the importance of bactericidal activity are the fluoroquinolones . studies of the bactericidal action of the quinolones against escherichia coli demonstrate at least two independent and important mechanisms of action . the emergence of fluoroquinolone resistance with respect to staphylococcus aureus and p. aeruginosa has been well - documented ( 53 ) . this major problem is due to a wide variety of fluoroquinolone - resistance mechanisms ( 54,55 ) , particularly the mutation of dna gyrase ( 56 ) . an important issue associated with the use of fluoroquinolones in the therapy of respiratory tract infections is the fact that fluoroquinolones also are used to treat other infections . failure of treatment of pneumococcal pneumonia due to resistance to levofloxacin recently has been described ( 63 ) .", "moreover , clinical data on quinupristin / dalfopristin therapy of pneumococcal pneumonia caused by macrolide resistant strains of s. pneumoniae is lacking . although antibacterial agents in the mls class have been largely bacteriostatic , newer members demonstrate bactericidal activity . these bacteriostatic compounds bind to bacterial 50s ribosomes , inhibiting protein synthesis without a concomitant inhibition of nucleic acid synthesis . the term mls ( macrolide , lincosamide , and streptogramin ) has become the accepted nomenclature for this important group of antibacterial agents except when the emphasis is on structural similarity , in which case the erythromycin congeners ( erythromycin - a , clarithromycin , and azithromycin ) are often referred to as the true macrolides ( 64 ) .", "telithromycin , the first of a new class of antibacterials , the ketolides , is approved for use in europe and is currently being reviewed by the u. s. food and drug administration ( 71 ) . the clinical use of telithromycin in germany , as well as safety data presented to the food and drug administration , suggests that the toxicity and adverse reactions are similar to those of clarithromycin . this similarity is not surprising , as the ketolides are novel semisynthetic erythromycin - a derivatives structurally similar to clarithromycin . clearly , careful monitoring for ketolide resistance by surveillance studies such as the protekt study will need to be continued . the c6-hydroxyl of erythromycin - a has been replaced by a methoxy group , as in clarithromycin , improving acid stability .", "therefore , the use of bactericidal agents such as telithromycin for therapy of respiratory tract infections may well ensure that the antibacterial era endures long into the 21st century . meeting the challenge presented by the increasing numbers of bacterial pathogens resistant to common antibiotic treatments will require new types of antibacterial agents . however , careful monitoring of resistance will be needed to ensure that this agent remains active against common pathogens . therapies that maximize bactericidal effects are important because they reduce the development of bacterial resistance mechanisms . his research interests include the mechanisms of antimicrobial activity , antimicrobial resistance , and the pathogenesis of chlamydia pneumoniae . stratton is associate professor of pathology and medicine and director of the clinical microbiology laboratory at the vanderbilt university medical center in nashville , tennessee ." ]

[ "the fa pattern of six sponge species and three types of reef food resources were analyzed , and the relative input of different sources to the diet of the sponges was determined . , bacterioplankton , coral mucus , and coralline algae as proxies for dom were analyzed . through stable isotopes and fatty acid biomarkers , we characterized energy sources of cavity sponges collected from coral reefs and open water on the southwest coast of curaao , caribbean ( 1212n , 6856w ) . stable isotopes are a classical way to trace food sources of aquatic animals ( peterson and fry 1987 ) . the carbon and nitrogen stable isotope signatures of 12 sponge species were compared with those of putative food compounds . this study aims ( 1 ) to determine whether cavity sponges mainly rely on reef - produced or open water - derived dissolved organic matter and ( 2 ) to identify key sources of dom for cavity sponges . as putative food compounds different fractions of suspended matter fatty acid biomarkers have been repeatedly used as source - specific indicators of dissolved and particulate organic matter both in environmental and in food web studies ( e.g. hall et al .", "multi - dimensional scaling ( mds plots ) of fa composition and dual isotope label patterns were compared for six sponge species and the three different reef - derived resources ( cca , mucus of m. annularis , and mucus of m. mirabilis ) . the siar stable isotope mixing model analysis ( parnell et al . 2010 ) was applied to investigate probable solutions for the diet of sponges based on dual stable isotope data of four sources ( gfc and gff fractions of suspended matter , crustose coralline algae , and coral mucus ) . the tukey s hsd method was used for pair wise comparisons of different sponge species ( multiple comparisons of means ) . similarities between fa profiles were investigated using the simper ( similarity of percentages ) function , and statistical differences were determined using the anosim ( analysis of similarities ) function . fatty acid composition patterns were explored with multivariate analyses of fas composition profiles ( non - transformed percentage abundance ) using the program primer version 5 ( clarke and gorley 2006 ) . model fitting is via markov chain monte carlo ( mcmc ) which produces simulations of plausible values for each dietary source consistent with the data .", "( n = 8) , we collected 20 l. on the fore - reef slope stations ( n = 4 ) , we collected a few small pieces of the stony corals montastraea annularis and madracis mirabilis ( also siderastrea siderea and porites astreoides but only at b1 ) between 15 and 17 m depth , which were kept in seawater under natural light conditions until mucus collection on the next day . from the entrance of coral cavities at 1517 m depth on the fore - reef slope , we chiseled crusts of calcareous algae . from the same cavities , position of sampling transects ( ljt , ct , b1 , and sb ) along the southwest coast of curaao , with an inset of the geographic position of the island in the caribbean an off - shore open water station about 12 km distance from the reef where water was collected at 1517 m depth in the blue water and a coral reef station where we collected bottom water at 1517 m depth on the fore - reef slope , approximately 0.5 m above the coral bottom . ( ljt , ct , b1 , and sb ) along the southwest coast of curaao , with an inset of the geographic position of the island in the caribbeanan off - shore open water station about 12 km distance from the reef where water was collected at 1517 m depth in the blue water anda coral reef station where we collected bottom water at 1517 m depth on the fore - reef slope , approximately 0.5 m above the coral bottom . various species of encrusting sponges were collected , up to eight different species per station . samples were collected from march 14 to 22 , 2006 , along four transects perpendicular to the sw coast of curaao ( fig . 1 ) . transects from the shore to open water cross the narrow fringing reefs and water masses representative for the variation in coral community composition and water quality along the sw coast of curaao ( van duyl 1985 ; gast et al .", "the carbon and nitrogen isotope ratios are expressed as corg and n relative to the vienna pee dee belemnite standard and air , respectively , and the standard error of the measurements is ~0.15. all carbon isotope samples ( except bacteria that were caught on aluminum filters ) were acidified ( tissue directly with acid and glass filters in acid vapor ) prior to measurements and corrected for individual sets of blanks ( isotope mass balance corrections ) . the identification of fames was based on the comparison of retention times with authentic commercially available reference material and standards . seawater as source of carbonates leading to possible enrichment of corg in case of un - acidified aluminum bacteria filters was eliminated by the rinse with mq water at the end of filtration . fatty acid source designation was achieved using data on distinctive fa for bacteria , algal carbon , and higher organisms ( e.g. , parrish et al . were also analyzed for their total fatty acid composition using a method of one - step procedure of fatty acid extraction and methylation ( masood et al .", "multi - dimensional scaling ( mds plots ) of fa composition and dual isotope label patterns were compared for six sponge species and the three different reef - derived resources ( cca , mucus of m. annularis , and mucus of m. mirabilis ) . we used the following trophic enrichment factors with standard deviations for the sponges : 3.5 0.5 for n and 1 1 for c ( vander zanden and rasmussen 2001 ; behringer and butler iv 2006 ) . similarities between fa profiles were investigated using the simper ( similarity of percentages ) function , and statistical differences were determined using the anosim ( analysis of similarities ) function . the siar stable isotope mixing model analysis ( parnell et al . 2010 ) was applied to investigate probable solutions for the diet of sponges based on dual stable isotope data of four sources ( gfc and gff fractions of suspended matter , crustose coralline algae , and coral mucus ) . we ran one- and two - way anovas with non - transformed stable isotope data to determine whether variations in stable isotopes of sponges were due to sponge species and/or sponge location assuming no interaction effects ( not enough replication for testing interaction ) . fatty acid composition patterns were explored with multivariate analyses of fas composition profiles ( non - transformed percentage abundance ) using the program primer version 5 ( clarke and gorley 2006 ) . the siar model takes data on organism isotopes and fits a bayesian model to their dietary habits based upon a gaussian likelihood with a mixture dirichlet - distributed prior on the mean .", "mean% show the contribution of plankton - derived ( gfc and gff ) and reef - derived organic matter ( cca and mucmix ) in the diet as % for six sponge species , cca and mucus of two coral species at b1 dual isotopes as well as fatty acid patterns were measured ( fig . 3 ; table 4 ) . mean% show the contribution of plankton - derived ( gfc and gff ) and reef - derived organic matter ( cca and mucmix ) in the diet as % dual isotope mixing model analyses of the diet of sponges the sources comprise two suspended matter size fractions , gfc ro > 1.2 m and gff ro > 0.7 and < 1.2 m from reef overlying and open water ( ro ) , cca representing crustose coralline algae and mucmix representing coral mucus of two different coral species , m. annularis and m. mirabilis . 3carbon and nitrogen isotopes of six sponge species ( sp1sp6 ) and putative organic matter sources for sponges at reef site b1 .", "cryptic encrusting sponges living in coral cavities on the fore - reef slope of fringing reefs sequester most of their organic matter from the passing water . they efficiently filter the pico- and nanoplankton , but dissolved organic matter ( dom ) appears to be the major resource of various sponge species living on the open reef and in coral cavities ( yahel et al . 2003 ; de goeij et al . diatom - derived om as well as mucus may have contributed to the abundance of 20:53 in sponges . considering the congruencies between the fa compositions and the dual stable isotope signals in the trophic transfer and relations between sources and consumers , it was not surprising that the matrices ( based on euclidean distances ) of the reef sources and consumers of both approaches were significantly correlated . results of both methods strongly support a trophic transfer from zooxanthellate corals and cca to cavity sponges . the isotope mixing model analysis showed that cavity sponges incorporate from half to three quarters of their organic matter from mucus and cca ( benthic macroalgae ) with mucus as the dominant source of reef - derived organic matter ( up to 66% of the diet ) . both methods apparently lead to comparable results with fa composition and biomarkers identifying the food items of consumers , and evidencing trophic transfer and with dual stable isotope analyses estimating the contribution of the different sources to the diet of consumers . 2008a ) . by analyses of dual stable isotope signatures ( corg and n ) and fa patterns of sponges and their potential food sources , we obtained circumstantial evidence that the reef itself mainly feeds her cavity sponges .", "sponge link in the coral reef food web is favorable for the coral reef health status remains to be investigated . 2008a ) , and ( 3 ) most of the om assimilated by sponges is reef - derived ( this study ) , we argue that cryptic sponges play a key role in conserving reef - produced dom for the reef system by converting it into pom . whether the cryptic results unambiguously point to the reef benthos as the main source of organic matter for encrusting cavity sponges on coral reefs . food sources for sponges on the reef comprise dom derived from coral mucus and benthic macroalgae ( cca ) . the prominent presence of a characteristic fatty acid of coral mucus and cca , 20:46 in sponges further confirms this trophic transfer ." ]

[ "the data showed that both asgr1 and asgr2 are expressed in human monocytes in the circulation , that expression can not be detected in lymphocytes and granulocytes , that the transcripts of both genes differ between individuals and that , in a given individual , the transcription profile for asgr2 is restricted to one of two patterns . the present study investigated the expression of asgr1 and asgr2 in human peripheral blood monocytes . the asialoglycoprotein receptor ( asgpr ) ( also known as the ashwell receptor ) mediates the capture and endocytosis of galactose- ( gal ) and n - acetylgalactosamine- ( galnac ) terminating glycoproteins . human asgpr is composed of two types of subunit : a major subunit ( asialoglycoprotein receptor 1 , asgr1 ) and minor subunit ( asialoglycoprotein receptor 2 , asgr2 ) . studies using knock - out mice have provided evidence for direct involvement of the asgpr in removal of abnormally sialylated plasma glycoproteins .", "the primer sequences ( 5 to 3 ) were as follows : asg1rtf gaaagatgaagtcgctagagt asg1rtr aggctccgcaggtcagacac a1cdsf1 gtagcgcgacggccagtactgaagaacctgggaatcagac a1cdsr1 cagggcgcagcgatgacagctcctcaccttcggaacatca a1test2 gaccaaggagtatcaagacctt asg2rtf cacacctggtggtcatcaac asg2rtr aattatctggctgagtgacag asgr2rtf3 agctgagctcggaggaaaatg asgr2rtr2 gcagctcggcttgcagctgtg a2cdsf1 gtagcgcgacggccagtcccagccctcagagcaacctca a2cdsr1 cagggcgcagcgatgactcaacagagaagccagagctggg b2mrtf tccgtggccttagctgtgct b2mrtr ccagtccttgctgaaagaca n13f gtagcgcgacggccagt n13r cagggcgcagcgatgac asg1rtf gaaagatgaagtcgctagagt asg1rtr aggctccgcaggtcagacac a1cdsf1 gtagcgcgacggccagtactgaagaacctgggaatcagac a1cdsr1 cagggcgcagcgatgacagctcctcaccttcggaacatca a1test2 gaccaaggagtatcaagacctt asg2rtf cacacctggtggtcatcaac asg2rtr aattatctggctgagtgacag asgr2rtf3 agctgagctcggaggaaaatg asgr2rtr2 gcagctcggcttgcagctgtg a2cdsf1 gtagcgcgacggccagtcccagccctcagagcaacctca a2cdsr1 cagggcgcagcgatgactcaacagagaagccagagctggg b2mrtf tccgtggccttagctgtgct b2mrtr ccagtccttgctgaaagaca n13f gtagcgcgacggccagt n13r cagggcgcagcgatgac primers were designed for rt - pcr according to the following criteria : ( 1 ) they flanked at least one intron ; ( 2 ) they were specific for asgr1 or asgr2 transcripts , cross hybridization was not possible despite the sequence homology between the coding sequences of the two genes . n13f and n13r are , respectively , modified m13 universal and reverse sequencing primers as previously described . underlined nucleotides are not part of asgr1 or asgr2 sequence but are tails corresponding to n13f or n13r to facilitate sequence analysis . for nested pcr , genes , transcripts , and proteins are referred to by their formal scientific names as listed in the national centre for biotechnology information ( ncbi ) , which complies with standardized international nomenclature . the wbc interface was harvested , washed , and an aliquot used for determination of cell counts as described above ( separation of white blood cells ) . following centrifugation at 800 g for 1 h at ambient temperature , the cells at the interface between the plasma and histopaque 1077 ( monocytes and lymphocytes ) were harvested ; the cells at the interface between histopaque 1077 and 1119 ( principally granulocytes with a small proportion of lymphocytes ) were also harvested . gating was restrictive rather than permissive : each gate was set only for the core population of cells that had the required scatter characteristics . in particular , the lymphocyte gate was set to minimise the possibility of small monocytes being harvested . the dna size standard pbr322/mspi ( new england biolabs , hertfordshire , uk ) was used for all electrophoretic analyses .", "the findings demonstrate that thp1 cells have the capacity to transcribe and process correctly , transcripts encoding functional isoforms of the asgpr . taken together with the results in figures 3 and 4 , the data provide evidence that monocytes express correctly processed transcripts from both asgr1 and asgr2 and thereby have the potential to produce functional asgpr . different individuals showed the presence of either t1 or of both t1 and t2 ( figure 3 ) . among the five individuals screened , none showed the presence of transcript t2 on its own . in combination with the data in figure 2 ( which showed that asgr1 transcripts are detected in monocytes and not lymphocytes ) , these data suggest that the monocyte transcription profile for asgr1 differs between individuals . these data provide strong evidence for expression of asgr1 and asgr2 in monocytes but not in lymphocytes or granulocytes . the ratio of expression of asgr1 : asgr2 in monocytes and the monocyte cell line thp1 was approximately 1 : 100 . to ascertain whether thp1 would be a suitable cell line for future asgpr studies in monocytes , the coding sequences of the asgr1 and asgr2 transcripts produced by these cells were determined . the data therefore indicate that in some individuals , monocytes may produce both soluble and membrane - bound asgr2 , whilst in others , the soluble form is not produced by these cells .", "in this study , expression of asgr1 and asgr2 was demonstrated in peripheral blood monocytes . for both genes , the data presented here indicate that monocytes are able to express transcripts encoding soluble and membrane - bound isoforms of the asgpr proteins . the findings of the present study do not suggest expression of alternative asgpr - related genes in monocytes , rather they are entirely consistent with transcription of asgr1 and asgr2 , as occurs in the liver . pharmacological targeting of the asgpr could not be considered to be predominantly liver - specific if monocytes express the receptor . the restricted tissue specificity for asgpr expression in the body , and the lower expression level observed at the nonhepatic locations , could signal a specific role or function at those sites . in the case of monocytes , the receptor could , at the very least , serve a scavenger function where there is infection or tissue injury . the results in these studies were ascribed to the activity of the liver receptor ; however , our data raise the possibility that monocytes may contribute to the relevant physiological processes via the asgpr .", "the liver may represent a static site to which blood carries glycoconjugates for asgpr - mediated removal , whilst monocytes may represent a mobile pool that can reach sites where the activity of the receptor is needed . monocytes play a pivotal role in inflammation and immunity , the finding of asgpr transcripts within these cells offers new insight into their biochemistry and functional potential . \n asgr1 and asgr2 are expressed in peripheral blood monocytes in humans . for both genes , monocytes have the ability to produce correctly spliced transcripts encoding each of the known protein isoforms . the data presented here open various important avenues for future research , a notable one of which is the measurement and characterization of monocyte asgpr protein . the results for the cell line thp1 indicated it could be used as a model system for the investigation of monocyte aspgr function and activity . quantitative studies indicate that expression of both asgr1 and asgr2 is lower in monocytes than in the liver , but none - the - less is readily detected in monocytes ( in comparison to other blood cells in which expression could not be demonstrated ) ." ]

[ "using these recommended estimates along with results from the fitnessgram body composition classifications , the purpose of this analysis is to estimate the lifetime economic impact of childhood obesity for this single age cohort in the two most populous states , california and texas . the prevalence of obesity in the united states has increased over the past several decades . according to the national health and nutrition examination survey ( nhanes ) results , between the years of 1988 and 1994 perhaps more concerning is the prevalence of obesity among american youth , defined by the centers for disease control and prevention ( cdc ) as a bmi greater than or equal to the 95 percentile on the cdc growth charts ( 2 ) . among children and adolescents aged 2 analyses of several large - scale data pools confirm that obesity contributes to the risk for development of many negative health outcomes including coronary heart disease , hypertriglyceridemia , hypercholesterolemia , hypertension , and type ii diabetes ( 20 , 23 ) . thus , using the cdc childhood obesity estimates could result in a substantial underestimation of the number of children at risk for negative health outcomes based upon bmi .", "then , using the low , high , and recommended cost estimates suggested by finkelstein and colleagues ( 7 ) , the lifetime direct medical costs attributable to obesity were calculated for students in the ni hr category for each of the three school years in california and in texas by multiplying the number of students in this category by the corresponding cost estimate per obese student the analysis used the costs estimated for a ten - year - old obese child ; however , it should be noted that students in the fifth grade range from ages 911 . the first set of estimates compared the direct medical costs for obese children against the direct medical costs for normal - weight children who gain weight as adults . the second set of estimates compared the direct medical costs for obese children against the direct medical costs for normal - weight children who remain at normal body weight as adults the results reflect the lifetime direct medical costs attributable to obesity for each fifth grade cohort over the three - year period in california and texas . the california report included the total number of fifth graders tested for body composition as well as the number and percentage of students in each fitness zone . fitnessgram data from the school years 20102011 , 20112012 , and 20122013 were obtained for california ( 1 ) and texas ( 21 ) . the total number of fifth grade students tested for bmi in california and in texas and the number of fifth grade students in each bmi category were calculated for each of the three school years .", "the percentage of fifth grade students with bmi values in each category remained stable from the 2010 2011 school year through the 2012 2013 school year within each state ( see table 1 ) . just over half of fifth graders in each state hr for bmi during this timeframe . despite their geographical distance from one another , california and texas had comparable percentages of students in each category for each of the three school years . were identified as having bmi values in the hfz , whereas at least one - third of fifth graders in each state were identified as having bmi values in the ni hr zone for each year in each state was multiplied by the estimated per capita lifetime direct medical costs of obesity previously established by finkelstein and colleagues ( 7 ) . hr for bmi , and in texas , between 36.5 and 36.8 percent of students were categorized as ni the resulting values represent the low , high , and recommended statewide lifetime costs of obesity for the ten - year - old cohorts accounting for adulthood weight gain ( see table 2 ) and compared to children who maintain normal weight as adults ( see table 3 ) .", "using the presidential youth fitness program s fitnessgram body composition data , results indicate that in each of the two most populous states , childhood obesity for each cohort of fifth graders over the 3-year timeframe will cost between $ 1.4 and $ 3.0 billion ( compared to normal - weight children who become overweight as adults ) and $ 1.8 and $ 3.0 billion ( compared to normal - weight children who remain at normal weight as adults ) beyond the direct medical expenses for children of normal weight who remain at normal weight throughout adulthood . results indicate that the estimated lifetime medical costs of childhood obesity in the two most populous states , california and texas , are between $ 1.4 and $ 3.0 billion for each single - year age cohort analyzed . . however , the current analysis uses data from the two most populous states in the union and underscores the large economic impact of childhood obesity . using bmi data from the presidential youth fitness program s fitnessgram over a three - year timespan and the estimated lifetime direct medical costs associated with obesity as recommended by finkelstein and colleagues ( 7 ) , in contrast to these findings , nhanes data from 2011 2012 indicate that 17.7% of children aged 6 11 were classified as obese by bmi according to the cdc standards ( 19 ) . using this obesity estimate along with recommended cost estimates , the increased lifetime economic burden of obesity would be approximately $ 9 billion ( accounting for adulthood weight gain ) or $ 13.5 billion ( not accounting for adulthood weight gain ) in direct medical costs for each single - year age cohort this information can be used to encourage spending , resource development , and prevention program implementation to reduce obesity in these two states ." ]

[ "we report an interesting and rather unique case of a brown tumor of maxilla and mandible developing after acute exogenous thyroxine poisoning in a young female patient under treatment for hypothyroidism and ectopic intrathoracic parathyroid adenoma . brown tumor is a non - neoplastic giant cell lesion characterized by increased circulating levels of parathyroid hormone ( pth ) . tertiary hpt is associated with renal failure and autonomous functioning glands in long - standing secondary hpt cases .", "the mandibular lesion presented a giant cell proliferation in the background of a variably fibrotic stroma . these features were suggestive of brown tumor of hpt [ figure 4b ] . ( a ) histopathological section of mandibular lesion showing giant cell proliferation with variable areas of haemorrhage and hemosiderin deposition ( h and e , 20 ) . ( b ) histopathological section of parathyroid neoplasm composed of nuclear pleomorphism with cystic changes , suggestive of parathyroid adenoma ( h and e , 20 ) . an incisional biopsy of the mandibular lesion was performed under local anesthesia that revealed fibro collagenous tissue containing plenty of osteoclastic giant cells dispersed throughout the lesion with small fragments of reactive bone , the features consistent with reparative giant cell granuloma .", "our patient represents a rare case of brown tumor with a wide spectrum of associated clinical findings . in conclusion to best of our knowledge , no case of brown tumor of hpt with such aggressive behavior and wide spectrum of clinical findings associated with acute thyroxine ingestion has been reported in the past . the most interesting aspect of this case report is association of brown tumor with ectopic intrathoracic parathyroid gland with normal functioning anatomic parathyroid glands . this case emphasizes the need for periodic biochemical investigations in the hypothyroid patients on exogenous thyroxine therapy . , the management of the brown tumor should involve early diagnosis , complete biochemical assay and full body skeletal survey followed by normalization of pth , serum calcium and phosphorus levels and parathyroidectomy , if indicated . in the absence of any pathology of anatomic parathyroid" ]

[ "( figure ) . the phylogenetic position of candidatus rickettsia vini based on the ompa nucleotide sequences in a study of the role of birds in dispersal of etiologic agents of tick - borne zoonoses , spain , 2009 . during april october 2009 , bird bandings were conducted in the protected area of finca ribavellosa in la rioja , spain ( 4214n , 254w ) . we named it candidatus rickettsia vini ( 17 in technical appendix ) ( table 2 ) . furthermore , according to glta , ompa , and ompb sequence analysis , a possible new rickettsia sp . was found in 25 i. arboricola ticks and 2 i. ricinus ticks .", "our data confirm the involvement of birds in the cycle of human tick - borne diseases . the presence of anaplasma , borrelia , and rickettsia species in ticks removed from passerine birds corroborates the role of these vertebrates in the epidemiology and dispersion of tick - borne pathogens in spain and in other zones of the planet . r. sibirica sibirica , responsible for siberian tick typhus in western people s republic of china and in siberia , was also amplified in an i. ricinus larva in this study .", "" ]

[ "central nervous system drugs ( 58.7 % ) were the most prescribed class of inappropriate medications in korean long - term care facilities.inappropriate medication use was associated with the number of co - medications and long - term care insurance grade 3 , which means less dependence and a requirement of low - level care.effective management of nursing home residents belonging to long - term care grade 3 via reducing potentially inappropriate medications is considered .", "hence , we evaluate the frequency of inappropriate medication use in elderly patients admitted to nursing homes in korea by applying the newly revised 2012 ags beers criteria . , there have been no reports on the prevalence of pim prescriptions in south korea ltc facilities using the 2012 version of the beers criteria . there have been few reports dealing with the prevalence of pim prescriptions or their adverse effects on elderly patients in south korea [ 14 , 15 ] . to our knowledge korea became an aging society in 2000 , and in 2008 , the prevalence of individuals aged 65 years or older was 10.3 % . in 2018 , korea will become an aged society when 14.4 % of its population comprise the elderly , and a super - aged society by 2026 [ 1 , 2 ] . the purpose of this insurance system was to meet the markedly increased demand for elderly healthcare as a result of a rapidly aging population , elevated expectations for healthcare , and a change in the pattern of medical conditions in the elderly from acute illness to chronic disability . elderly nursing home residents regularly receive complex multi - drug therapy because of the presence of both acute and chronic diseases . for this reason ,", "a retrospective cross - sectional survey study was performed in patients aged 65 years or older , which produced a sample of 824 people admitted to 20 nursing facilities in northwest korea from january 2012 to february 2012 . use of pims has been consistently associated with female sex , higher number of medications , higher number of chronic diseases , and older age [ 1621 ] . we assessed the patients age , sex , co - medication , comorbidity , activities of daily living ( adl ) , length of stay , grade of ltc insurance for seniors , and the bed size and business type of the ltc care facilities . we focused on evaluating 34 pims to avoid in older adults and one of the categories in the 2012 update to the ags s beers criteria . drug disease interactions and drugs to be used with caution in geriatric patients were also assessed using the beers criteria .", "this study recruited 529 patients ; 221 of these did not use a pim , while the remaining 308 patients were currently taking pims . the number of patients whose ltc insurance for seniors was grade 3 was relatively higher in the pim group than it was in the non - pim group . significant differences between those prescribed and those not prescribed a pim were found for sex , age , deductible class , number of different medications used , number of chronic conditions , total healthcare costs in the previous year , and number of concurrent pims . categories of ltc grade are defined as follows : grade 1 ( most severe ) ; grade 2 ( severe ) ; grade 3 ( moderate )", "the present study focuses on a growing public health problem : inappropriate medication prescriptions in ltc facilities . central nervous system drugs ( 58.7 % ) were the most prescribed class of inappropriate medications in korean ltc facilities . inappropriate medication use was associated with the number of co - medications and ltc insurance grade 3 , which means less dependence and a requirement of low - level care . a disturbingly high level of pims were prescribed ( 58.2 % ) , which is of concern , indicating room for improvement . the results described in the multivariate analysis regarding the factors associated with a potentially inappropriate prescription showed that the likelihood was determined by the number of drugs prescribed during the patient s hospitalization . , the results of a logistic regression model showed that multiple diseases and a higher use of drugs during hospital stay predicted pim prescription .", "central nervous system drugs ( 58.7 % ) were the most prescribed class of inappropriate medications . there was a relationship between inappropriate medication use and the number of co - medications . the frequency of inappropriate medication prescriptions was higher among patients whose ltc insurance for seniors was grade 3 , which means less dependence and a requirement of low - level care .", "this retrospective study was carried out after obtaining the permission of the institutional review board of myoung - ji hospital in korea and has been performed in accordance with the ethical standards of the declaration of helsinki .", "kang soo lee , sang - hwan kim , and hee - jin hwang have no conflicts of interest to declare .", "kang soo lee , sang - hwan kim , and hee - jin hwang certify that no funding has been received for the conduct of this study and/or preparation of this manuscript ." ]

[ "once hcc is detected , patients experience repeated recurrence , despite the fact that a variety of hcc treatment methods have been developed , such as anti - viral agents , surgical treatment , percutaneous ethanol injection ( peit ) , radiofrequency ablation ( rfa ) , trans - catheter arterial chemoembolization ( tace ) , and molecular - target drugs . in the last 10 years , tumor vaccines generated from patients ' own formalin - fixed hcc tissues , we report a case in which aftv injection resulted in suppression of multiple - recurrent hcv - background hcc recurrence . in this case in patients with chronic hepatitis and in those with liver cirrhosis , detection of increasing incidences of hepatocellular carcinoma ( hcc ) requires careful monitoring every 36 months using ultrasound sonography ( us ) , computed tomography ( ct ) , magnetic resonance imaging ( mri ) , and frequent blood tests . the autologous formalin - fixed tumor vaccine ( aftv ) has been reported to reduce the recurrence risk of primary resected hepatitis b virus - background hcc by 81% 1 . in one case , recurrence of multiple - recurrent hepatitis c virus ( hcv)-back ground hcc was clearly suppressed long - term without any additional treatment 2 . here , we detected a significant density of glypican-3 ( gpc3)-specific cytotoxic t lymphocytes ( ctl ) in the blood at 12 months after the last intradermal injection of aftv .", "results showed complete remission of the hepatitis as liver transaminases normalized , as well as conversion of seropositive hcv to negative up to the present . liver biopsy showed active chronic hepatitis accompanied by bridging fibrosis and necrotic inflammatory reactions . to reduce the activity of chronic hepatitis , the patient was treated with consensus interferon for 24 weeks . pathology and glypican-3 ( gpc3 ) expression in hepatocellular carcinomas . ( a ) h&e staining and ( b ) gpc3 immunohistochemistry of representative tissue from a 2004-resected hepatocellular carcinoma ( hcc ) specimen of the present case . a 55-year - old female patient was diagnosed with hcv - related hepatitis in 2002 .", "gpc3 , a heparan - sulfate proteoglycans linked to the outer surface of cell membrane via a glycosylphosphatidylinositol anchor 6 , is frequently overexpressed in hcc 7,8 and in precancerous lesions in the liver 9 . for this reason , a recombinant humanized monoclonal antibody against gpc3 10 and a gpc3-peptide vaccine 11 have been developed for treatment of hcc . autologous formalin - fixed tumor vaccine differs from these specified molecule - targeted agents in that the autologous tumor , containing a wide array of unidentified antigens , is the source of antigens . thus , ctl induced with aftv made from tumor tissue must be polyclonal by nature ; for example , polyclonal ctl induced in vitro with a formalin - fixed carcinoembryonic antigen protein 12 . at present , no one provided any evidence that the impure tumor antigenic formalin - fixed autologous hcc tissue is truly active to induce a specific cellular immune response against a specified tumor antigenic molecule . ( 2 ) the gpc3-specific ctl apoptosed after killing all target hcc cells in vivo , thereby eliminating all tumor antigens and preventing replicative stimulation to active ctl . the present case is the first one we could identify gpc3-specific cellular immune response based on the autologous formalin - fixed hcc .", "present results suggest that aftv should be taken in consideration as one of treatment modalities in cases involving potential hcc derived from chronic hepatitis and liver cirrhosis . this is the first case we could identify gpc3-specific cellular immune response based on impure tumor antigenic formalin - fixed autologous hcc tissue .", "" ]

[ "we need to identify and understand the mechanisms that predispose patients to the excessive inflammation resulting from an overactive innate immune response that characterizes sepsis and lung injury . these include stimuli , signal transduction ( receptors , enzyme cascades , transcription factors ) , gene(s ) response and the measured clinical phenotype . john haddad , in his two - part review , identifies many ' clinical stimuli ' in cell culture , animal model and patient studies representing an oxidative stress that can generate a response via nf-b or hif-1 dependent signalling . recent studies have demonstrated that low tidal volume ( 6 ml / kg ) ventilation strategies dramatically reduce this mortality . the topic is large and ever changing , and the complete coverage of nuclear factor-b ( nf-b ) and hypoxia - inducible factor ( hif)-1 is spread over two issues . in critical care we continue to explore the association of gene and environment . with respect to lung injury , however , many other clinical trials of various treatments have failed at either reducing the lung injury or accelerating the healing to the end - point of reduced mortality . in this age of genomics and proteomics in this and the next issue of critical care , john haddad presents a comprehensive review on the contributions of transcription factors to lung injury .", "nf-b was originally described in b lymphocytes , but it is now recognized as a member of the rel family of transcription factors and is a critical response element in many cytokine - dependent events or inflammatory conditions . as a result of this link , nf-b has become a major target for new therapeutic approaches in such clinical disease states as asthma , cancer , arthritis , and cardiovascular and neurodegenerative conditions . these dynamic variations in cellular redox or oxidative stress , if in disequilibrium , may regulate gene expression and lead to apoptosis ( cell death without inflammation ) , inflammation and lung injury . haddad discusses the roles of critical care conditions such as hyperoxia , haemorrhage and resuscitation ; the ' stress response ' to illness ( interleukin-6 , interleukin-8 , tumour necrosis factor , rantes [ regulated upon activation , normal t cell expressed and secreted ] ) ; and mechanical ventilation and ischaemia / reperfusion . in all of these conditions", "haddad discusses in detail how hypoxia and inflammatory stimuli initiate many signalling cascades via hif-1 to generate a response phenotype to these oxidative stresses . the master regulatory element of hypoxic conditions and adapting oxidative stresses to gene expression is hif-1 . this process leads to selective upregulation of genes whose products are involved in hypoxia and inflammatory lung injury . these include erythropoietin , vascular endothelial growth factor ( vegf ) and glucose transporter . work by haddad has demonstrated that proinflammatory cytokines also activate hif-1 stability and dna binding . it is felt that hif-1 , via its action on vegf expression , is directly related to lung injury by endothelial barrier dysfunction mediated by vegf and recognized clinically as increased pulmonary vascular permeability . this effect was most profound in hypoxic conditions and was , in fact , greater than that in hypoxaemia alone .", "understanding the molecular signalling that couples oxidative stresses via nf-b or hif-1 to acute lung injury should generate new therapeutic options . haddad discusses the rationale for the use of tyloxapol to reduce proinflammatory cytokines , n - acetyl cysteine ( a glutathione precursor ) to reduce neutrophil - associated alveolitis in chronic conditions such as cystic fibrosis , and the use of pyrrolidine dithiocarbamate in transplantation to reduce neutrophil - associated oxidant lung injury . two new compounds , isohelenin and lisofylline , a phosphodiesterase inhibitor , are described as being able to reduce proinflammatory cytokines and ameliorate oxidant lung injury in animal models . as exciting as this emerging field is , with its predictable contribution to future ' bench to bedside ' discussions , a more complete mechanistic understanding and future clinical trials will assist in the realization of improved treatment and reduced mortality from oxidant - mediated lung injury .", "", "hif = hypoxia - inducible factor ; nf-b = nuclear factor-b ; vegf = vascular endothelial growth factor ." ]

[ "a distally - based island sural flap was used in 10 cases for hindfoot reconstruction , and the lateral supramalleolar fasciocutaneous flap was used in 3 cases for lateral arch reconstruction of the mid- and forefoot after wide excision of malignant melanomas ( table 1 ) . one patient had ipsilateral inguinal and popliteal lymph node metastasis , and one patient had ipsilateral inguinal lymph node metastasis at the time of diagnosis . we enrolled 13 consecutive patients between march 2005 and march 2009 and who met the following inclusion criteria : 1 ) they were diagnosed with acral lentiginous melanoma by punch biopsy ; 2 ) their skin lesion confined to the foot ; 3 ) there was no skin or soft tissue disease on the ipsilateral lower leg . we performed wide excision of the malignant melanoma with a 2 cm margin in all the patients . we routinely checked the preoperative ultrasonography for popliteal and inguinal lymph node metastasis , and we performed computed tomography of the chest and positron emission tomography to assess for distant metastasis .", "we performed wide excision of the malignant melanoma with a 2 cm margin in all the patients . after wide excision , we confirmed that the margin of resection was free of tumor by frozen section , and then we measured the exact size of the defect . the distally based island sural flap was outlined at the junction of the two heads of g the astrocnemius muscle . a line of incision was traced over the presumed course of the sural nerve and the lesser saphenous vein .", "partial and full weight bearing ambulation could be started after 6 weeks and 12 weeks after the first operation without concern for wound healing .", "one patient , who had a split thickness skin graft without lymph node dissection , was revealed to have pulmonary and inguinal lymph node metastasis at 4 months postoperatively , and the patient died of disease at 13 months . among those who underwent elective inguinal lymph node dissection , the length of the flap varied from 7.5 to 12 cm ( mean length , 9.6 cm ) and the width varied from 6.5 to 12 cm ( mean width , 8.8 cm ) . in 4 cases , superficial necrosis developed , but this was successfully treated by debridement and suture or skin graft ( table 1 ) . 2 patients were revealed to be alive with disease and 3 patients died of disease at 7 , 10 , 13 , 15 months later after operation respectively . all 13 flaps survived completely and they provided stable defect coverage , good contour and normal weight bearing ambulation . as for the patients who had neurorrhaphy , the recovery of sensation was not observed .", "the distally based sural flap and lateral supramalleolar flap provide effective coverage of variable sized soft tissue defects on the foot after wide excision of malignant melanoma , this is quick and safe surgery without the necessity of microsurgical expertise , it preserves the major arteries of the leg and the donor - site morbidity is acceptable . the distally based sural flap is useful for the hindfoot , and the lateral supramalleolar flap is good for lateral archs of the mid- and forefoot . the lateral supramalleolar flap is a distally based fasciocutaneous flap that is vascularized by branches of a perforating branch of the dorsal peroneal artery . the distally based sural flap had a tendency of having a short flap pedicle for coverage of a forefoot defect , as compared to that of the lateral supramalleolar flap ." ]

[ "more recently , the technique of automatic tube compensation ( atc ) has become available to specifically address this issue . in this issue of critical care , maeda and commonly , pressure support ventilation ( psv ) has been suggested as the technique of choice for eliminating imposed work due to the et tube . techniques and equipment to accomplish endotracheal ( et ) intubation were the precursor to modern day invasive mechanical ventilation . in recent years , however , the popularity of the et tube has waned . clinically , the et tube is seen as an impediment to spontaneous breathing , a transit route for bacteria to the lower airway , and with the advent of noninvasive ventilation a device to be avoided when possible . the future of atc , like many new techniques , may not be in overcoming et tube resistance , but as a method of support during spontaneous breathing that improves patient - ventilator synchrony as compared with psv .", "", "atc = automatic tube compensation ; copd = chronic obstructive pulmonary disease ; et = endotracheal ; peep = positive end - expiratory pressure ; psv = pressure support ventilation ." ]

[ "our previous study indicated that fowler s position with an upright upper trunk is effective for maintaining circulatory volume with lower tachycardia via vagal withdrawal compared with having the whole trunk upright in younger subjects.25 however , whether an upright upper trunk in fowler s position allows easy maintenance of circulatory volume in cases with autonomic hypofunction associated with aging remains unclear . the present study was performed as a cross - sectional study to assess our hypothesis with a fundamental study of the effects of the two fowler s positions on hemodynamics and hr variability parameters in healthy older and younger subjects . we postulated that stroke volume ( sv ) would be higher and heart rate ( hr ) would be lower with the upper trunk upright than with the whole trunk upright in fowler s position in both older and younger subjects . in addition , we presumed that the lower hr would be caused by reduced sympathetic activation in older individuals but by reduced vagal withdrawal in younger individuals .", "we assessed hemodynamics and hr variability in 11 male younger subjects ( mean age standard error of the mean [ sem ] : 20.50.2 years ; range : 2022 years ; weight : 60.61.8 kg ; height : 170.21.8 cm ) and 11 male community - dwelling older subjects ( mean age sem : 69.51.2 years ; range : 6479 years ; weight : 62.02.1 kg ; height : 165.41.8 cm ) . we calculated logarithm - transformed respiratory sinus arrhythmia ( ln rsa ) from the power spectrum of the rr intervals ( 0.150.4 hz ) . all parameters of hr variability reflect vagal modulation.27,28 changes in hemodynamic variables from supine and hr variability parameters in the three positions in subjects from the two age groups were compared by two - way mixed - design analysis of variance ( anova ) . we performed frequency domain and time domain analysis of ecg for the assessment of vagal function . we collected physiological data with the patient in the supine position and two fowler s positions . prior to experiments icg ( nico 100c ; biopac systems ) was performed using eight spot electrodes ( vitrode m ; nihon kohden , tokyo , japan ) attached to the neck and lower thorax of each subject for icg based on a previous study.26 sv was estimated from transthoracic bioimpedance using bernstein s method that has been validated as offering high reliability comparable to the technique of thermodilution.26 icg allows continuous noninvasive evaluation of sv .", "we assessed hemodynamics and hr variability in 11 male younger subjects ( mean age standard error of the mean [ sem ] : 20.50.2 years ; range : 2022 years ; weight : 60.61.8 kg ; height : 170.21.8 cm ) and 11 male community - dwelling older subjects ( mean age sem : 69.51.2 years ; range : 6479 years ; weight : 62.02.1 kg ; height : 165.41.8 cm ) . subjects were instructed to refrain from beverages containing caffeine or alcohol for 24 h before starting experiments and to refrain from eating and drinking after 2,200 h on the day prior to the experiments that started in the morning or to consume a light breakfast before experiments that started in the afternoon . all subjects were interviewed regarding medical history , and blood pressure was checked after a period of rest . all subjects in the final analysis were healthy and had no history of chronic or acute cardiovascular or respiratory disease or other chronic diseases . final decisions on subject selections were made by consultations between a medical doctor and researchers . the ethics commission of the international university of health and welfare approved the study , and all participants provided voluntary written consent to participate after being fully informed about the procedure , risks , and protocol .", "we defined the upper and lower segments at ut60 around the spinous process of the 10th thoracic vertebra . the height of the bottom of the upper and lower trunk was adjusted according to individual trunk size . subjects were placed in the fowler s positions on a bed at 30 of lower trunk inclination and 60 of upper trunk inclination ( ut60 ) and 60 of whole trunk inclination ( wt60 ) ( figure 1 ) . we collected physiological data with the patient in the supine position and two fowler s positions . prior to experiments measurements in the supine position were made with sufficient time between measurements in the two fowler s positions . between measurements in each fowler s position , subjects rested for more than 3 min . data were recorded for 5 min in each of the supine position and the two fowler s positions . , subjects rested in a thermoneutral room at 28c for 15 min and were set up for electrocardiography ( ecg ) , noninvasive arterial pressure monitoring , and impedance cardiography ( icg ) .", "we calculated logarithm - transformed respiratory sinus arrhythmia ( ln rsa ) from the power spectrum of the rr intervals ( 0.150.4 hz ) . we performed frequency domain and time domain analysis of ecg for the assessment of vagal function . icg ( nico 100c ; biopac systems ) was performed using eight spot electrodes ( vitrode m ; nihon kohden , tokyo , japan ) attached to the neck and lower thorax of each subject for icg based on a previous study.26 sv was estimated from transthoracic bioimpedance using bernstein s method that has been validated as offering high reliability comparable to the technique of thermodilution.26 icg allows continuous noninvasive evaluation of sv . we thus calculated the square root of the mean of the sum of the squares of differences between adjacent rr intervals ( rmssd ) , number of pairs of adjacent rr intervals differing by more than 50 ms ( nn50 ) and the proportion derived by dividing nn50 by the total number of rr intervals ( pnn50 ) for 5 min . ecg , thoracic bioimpedance , and continuous arterial pressure signals were recorded on a personal computer using the mp150 data acquisition system ( biopac systems ) at a sampling rate of 1 khz . hr was estimated from type ii ecg ( ecg 100c ; biopac systems , goleta , ca , usa ) in all experiments .", "when three positions two age group interactions were significant , one - way repeated - measures anova of the three positions in each subject and one - way anova of subjects from the two age groups in each position were used to evaluate simple main effects . changes in hemodynamic variables from supine and hr variability parameters in the three positions in subjects from the two age groups were compared by two - way mixed - design analysis of variance ( anova ) . subsequent post hoc analysis to determine differences between the three positions in each age group were evaluated using a paired t - test with shaffer s multiple comparison procedure in each age group.29 the level of statistical significance was set at p<0.05 . data were statistically analyzed using r for windows version 3.3.0 statistical software ( www.r-project.org ) and the car 2.14 package .", "figure 2 shows the results of changes in hemodynamic variables from supine at all positions . change in hr ( hr ) increased and change in sv ( sv ) decreased with the change from supine to an upright trunk in younger and older subjects . multiple comparisons among the three positions showed that all hr variability parameters were significantly higher at ut60 and supine position than at wt60 in younger subjects ( p<0.05 ) . although all parameters decreased with the change from supine to upright trunk in younger subjects , significant differences were not seen between all positions in older subjects .", "figure 2 shows the results of changes in hemodynamic variables from supine at all positions . change in hr ( hr ) increased and change in sv ( sv ) decreased with the change from supine to an upright trunk in younger and older subjects . two - way mixed - design anova of hr and sv revealed significant main effects of the three positions ( hr , f = 31.73 ; sv , f = 15.73 ; p<0.05 ) , but no significant main effects of the two age groups ( p>0.05 ) and no significant three positions two age groups interactions ( p>0.05 ) . anova of changes in map ( map : ut60 and wt60 in younger , 1.21.9 mmhg and 4.24.0 mmhg , respectively ; ut60 and wt60 in older , 0.52.8 mmhg and 2.72.6 mmhg , respectively ) revealed no significant main effects for the three positions ( p>0.05 ) or two age groups ( p>0.05 ) and no significant interaction of the three positions two age groups ( p>0.05 ) .", "although all parameters decreased with the change from supine to upright trunk in younger subjects , significant differences were not seen between all positions in older subjects . post hoc analysis revealed significant simple main effects of the three positions in younger subjects ( ln rsa in younger , f = 8.67 ; rmssd in younger , f = 6.71 ; nn50 in younger , f = 5.95 ; pnn50 in younger , f = 7.12 ; p<0.05 ) but no significant simple main effect of the three positions in older subjects ( p>0.05 ) and significant simple main effects of the two age groups among each position ( ln rsa of supine , f = 34.6 ; rmssd of supine , f = 25.18 ; nn50 of supine , f = 27.45 ; pnn50 of supine , f = 29.77 ; ln rsa of ut60 , f = 24.72 ; rmssd of ut60 , f = 19.87 ; nn50 of ut60 , f = 20.43 ; pnn50 of ut60 , f = 19.46 ; ln rsa of wt60 , f = 14.36 ; rmssd of wt60 , f = 4.95 ; nn50 of wt60 , f = 6.59 ; pnn50 of wt60 , f = 6.12 ; p<0.05 ) . multiple comparisons among the three positions showed that all hr variability parameters were significantly higher at ut60 and supine position than at wt60 in younger subjects ( p<0.05 ) . two - way mixed - design anova of ln rsa , rmssd , nn50 , and pnn50 revealed significant main effects of the three positions ( p<0.05 ) and two age groups ( p<0.05 ) but significant three positions two age groups interactions ( p<0.05 ) . these parameters in older subjects were lower compared with younger subjects for each position ( table 2 ) .", "the major findings of the present study were as follows : 1 ) the reductions in sv and tachycardic response were smaller with the upper trunk upright compared with the whole trunk upright , in healthy young and older individuals , and 2 ) the reduced tachycardic response with the upright upper trunk would be caused by decreased vagal withdrawal in younger subjects and reduced sympathetic activation in older subjects . our findings indicate that an upright upper trunk during fowler s position allowed maintenance of sv and inhibited tachycardic response compared to an upright whole trunk regardless of age , although the autonomic mechanisms underlying tachycardic responses differed between younger and older adults . an upright upper trunk in fowler s position might help to reduce orthostatic stress and facilitate routine activities and conversation in frail patients . these results suggest that the tachycardic response and vasomotor contraction response maintained q and map to compensate for reduced sv under orthostatic stress regardless of age . orthostatic stress might therefore be smaller at ut60 than at wt60 , suggesting differences in the distribution of the blood volume shift to lower parts of the body at ut60 compared to wt60 in both subject groups .", "the present results suggest that reduced tachycardic response with an upright upper trunk may be regulated by reduced sympathetic activation compared with having the whole trunk upright during fowler s position in older subjects . confirmation by direct measurement of sympathetic nerve activity or venous plasma norepinephrine concentration in fowler s positions in younger and older subjects may be necessary . in consideration of using a fowler s position such as ut60 at clinical sites , validation in patients with orthostatic intolerance however , the present study did not directly assess sympathetic nerve activity in the two fowler s positions or while supine . to corroborate our findings , is needed because the influences of an upright upper trunk on hemodynamics and cardiovascular regulation in such patients have yet to be completely clarified .", "we demonstrated that an upright upper trunk during fowler s position allowed maintenance of sv and inhibited tachycardic responses compared to having the whole trunk upright in both younger and older subjects . such inhibition of tachycardic responses might be caused by reduced vagal withdrawal in younger subjects and by reduced sympathetic activation in older subjects . an upright upper trunk during fowler s position might be useful to maintain circulatory volume for reduced orthostatic stress and to facilitate daily activities in frail patients at clinical sites ." ]

[ ", we will outline the pivotal role that lipid rafts play in linking together the generation , self - assembly and toxicity of a oligomers , which underlie the development of the neuropathology in ad . a major focus will be upon the interaction between a oligomers and their putative cellular receptors . crucially , all three of these processes occur in lipid raft domains of the plasma membrane which are considered to play a key role in the development of ad . in this paper alzheimer 's disease ( ad ) is a progressive , neurodegenerative brain disorder which affects over 37 million people worldwide with an estimated global cost of over $ 600 billion in 2010 [ 1 , 2 ] . ad is characterized by the presence of extracellular senile plaques and intracellular neurofibrillary tangles in the brain . recently , several neuronal receptors which bind a oligomers have been identified , including the cellular prion protein ( prp ) and glutamate receptors [ 10 , 11 ] among others .", "lipid rafts are involved in the regulation of app processing and the generation of the a peptide which is the driving force in ad pathology [ 23 , 24 ] . for comprehensive reviews detailing the involvement of membrane rafts in ad and a production , lipid rafts are implicated in various essential cellular functions , including signal transduction , cell adhesion and protein / lipid sorting . the dynamic clustering and pinching off of lipid rafts regulates the spatial and temporal assembly of signalling and trafficking molecules , forming short - lived but vital signalling platforms . the multitude of different lipids and proteins within the plasma membrane were once thought to be distributed homogeneously across the entire lipid bilayer , as proposed by the fluid mosaic model in 1972 . however , the plasma membrane is now known to be more akin to a sea of disordered phospholipids , in which float microdomains with distinct lipid compositions , known as lipid rafts .", "a is a physiological peptide which is present in the brain tissue and csf of healthy subjects throughout life , without necessarily causing neurodegeneration [ 7476 ] . the aggregation of a is therefore a critical step in the development of ad pathogenesis , and one in which lipid rafts appear to play a fundamental role . in fact , monomeric a has recently been reported to have neuroprotective roles in the brain [ 77 , 78 ] . a plethora of studies have now demonstrated that levels of soluble a oligomers in the brain correlate much better than plaques or fibrils with ad onset , progression and severity [ 5 , 6 , 8 , 63 , 64 ] . within the last fifteen years , a large number of studies from research groups worldwide have reported the existence of many different oligomeric assemblies from various sources , including ad brain and cerebrospinal fluid ( csf ) samples , secreted into the conditioned medium of cultured cells or prepared artificially from recombinant or synthetic a peptides .", "although the correctly - folded prp is critical for prion disease pathogenesis , its physiological function remains enigmatic , with potential neuroprotective roles in oxidative stress defence , metal ion homeostasis and antiapoptosis . in a search to identify neuronal receptors for a oligomers , laurn et al . taken together , these data indicate a strong association between a oligomers binding to prp within lipid rafts of hippocampal neurons and the induction of memory deficits that are characteristic of ad . nevertheless , there has been some dispute over the role of prp in transducing the deleterious effects of a oligomers in vivo , as other studies have reported data which oppose this theory . interestingly , the prp - mediated response to oxidative stress is thought to induce signalling cascades which can modulate ca flux and synaptic plasticity . further investigation is needed to clarify the role of prp in modulating the a oligomer - mediated impairments in memory and ltp . metabotropic glutamate receptors have been implicated previously in the pathogenesis of ad and other neurodegenerative disorders .", "understanding the cell biology of the downstream effects of amyloid oligomers binding to neuronal lipid raft proteins may uncover potential therapeutic targets for the prevention of ad and other neurodegenerative diseases . lipid rafts are not only implicated in ad but may also be the key to a range of neurodegenerative proteinopathies , including parkinson 's disease , huntington 's disease , amyotrophic lateral sclerosis and prion diseases ( reviewed in ) . indeed , lipid raft disruption protects neurons against the toxicity of other oligomers besides a and lipid rafts may therefore represent generic platforms for oligomer - mediated neurotoxicity . neuronal lipid rafts are crucial modulators of a production and aggregation , leading to the accumulation of neurotoxic a oligomers in the brain which drive ad pathology . recent evidence now incriminates lipid rafts as pathological signalling platforms in which a oligomer receptors , such as prp and glutamate receptors , cluster . , lipid rafts appear to be directly responsible for the transduction of a oligomer - mediated memory impairments and neurotoxicity which characterise ad . a oligomer binding appears to induce the aberrant localisation of these proteins with deleterious effects upon their physiological functions including hippocampal ltp , which underlies memory , and defence against oxidative stress . in this way" ]

[ "the reproduction of the optical characteristics of the teeth , such as translucency , opalescence and fluorescence , requires a considerable knowledge of restorative techniques and the materials currently available . this article presents a case report of a restorative treatment of enamel hypoplasia using hybrid composite resin to mask color alteration and enamel defects of the anterior upper teeth . in dentistry , the concept of aesthetics is extremely subjective and is related to beauty , harmony and the needs of the patient . nevertheless , during the evaluation of aesthetically compromised teeth , we encounter unfavorable clinical situations of great complexity , characterized by deep invasions of the mineralized structures . the interactions between new restorative materials and techniques allow the reproduction of dental structures , restoring form and function in such a way that restorative procedures become imperceptible .", "initial clinical aspect of the maxillary incisors a buccal view of the central and lateral incisors with hypoplastic alterations the clinical situation revealed that it was not possible to re - establish aesthetics and function without the use of a restorative procedure . the position and pattern of the enamel irregularities , the occlusion and a tooth remnant with a large substrate suggested that a composite resin restoration would be a reliable option for this case . clinical examination also evidenced an enamel defect in the maxillary lateral and central incisors , with rough surfaces with irregular limits that principally involve the middle third of the crown [ figure 2 ] .", "the procedures employed are simple , but they require knowledge of the real causes of the staining and comprehension of restorative techniques . various treatment protocols may be performed , depending on the level of involvement and the severity of the lesions . nevertheless , during the evaluation of aesthetically compromised teeth , we encounter adverse clinical conditions of great complexity , marked by the invasion of the mineralized structures at depth . composite resin restorations are fully capable of reproducing the appearance of a natural tooth with highly aesthetic outcomes . in this context with the valuation of aesthetics , minimally invasive restorative techniques have provided an expansion of the current conservative philosophy . , the main goal of the treatment of enamel hypoplasia is to re - establish the anatomical harmony between occlusion , function and aesthetics and to restore patient self - esteem , promoting social and psychological benefits .", "in conclusion , this case report demonstrates that restorative rehabilitation , in addition to promoting health , may provide a more favorable aesthetic appearance for the smile , matching the tooth polychromatic and raising the self - esteem of the patient ." ]

[ "gastrointestinal lipomas are rare , mostly small and detected incidentally during endoscopic examination ( 1 ) . these changes if extensive can mimic a liposarcoma ; however , frank liposarcoma of the colon is extremely rare and requires the presence of lipoblasts ( 2 ) . these tumours are benign proliferations of mature fatty tissue arising in the submucosa and predominately arise in the large intestine ( 51 - 70% ) preferentially on the right side . lipohypertrophy of the ileo - caecal valve is classified as a variant of normal ( 1 ) . the vast majority are asymptomatic but they can manifest due to intussusceptions , ulceration leading to haemorrhage or iron deficiency anaemia , intestinal obstruction or present as an abdominal mass . most are compressible and submucosal although they can rarely develop in the serosa and appear as a fold or polyp . where this is not technically feasible a minimally invasive approach using either mini - laparotomy or laparoscopic resection has successfully been reported ( 4,5 ) .", "a 74 year old man with a background of chronic obstructive airways disease ( coad ) was referred for urgent assessment by his general practioner with a 1 month history of lower abdominal pain and altered bowel habit . there are areas of fat necrosis and mucosal ulceration microscopy shows lobules of mature adipocytes . gross and microscopic histological examination showed a submucosal lipoma with areas of fat necrosis and surface ulceration with extensive granulation tissue . proximal to the lesion was circumferential colonic wall thickening and surrounding fat stranding suspicious of colonic malignancy .", "endoscopists , radiologists and pathologists need to be aware of this entity . careful discussion and review of the investigations at an mdt meeting may permit a pre - operative diagnosis . imaging may reveal tissue with the signal and uptake of adipose tissue but a confident diagnosis may not be possible . endoscopic resection can be used where technically feasible but where doubt remains or this is not feasible then laparoscopic or open resection may be required ." ]

[ "a total of 10,420 est - ssrs were identified , among which 2744 est - ssrs are detected for the first time , according to the ssr marker database for brassica ( http://oilcrops.info/ssrdb ) . could also be identified for further studies such as high - density genetic linkage map construction , gene / qtl mapping , and cultivar identification . in our previous study , the whole transcriptomes were analyzed for the rosette leaves and folding leaves of a typical heading chinese cabbage , namely , fushanbaotou , using a solexa / illumina rna - seq platform , and a large - scale est database was generated . in this study , we further assembled those ests from the rl and fl libraries into nonredundant unigenes . we characterized these identified est - ssrs and designed 7877 pcr primer pairs for 1561 est - ssrs . pekinensis ) is a diploid ( 2n = 2x = 20 ) dicot with a genomic size of 550 mb ( http://www.brassica.info/resource/ ) . furthermore , serving as a validation purpose , we tested polymorphisms of 24 est - ssrs . we expect this study can pave the road for further investigation of new est - ssr markers and for construction of high - density genetic maps .", "a panel of twenty - four cultivars of chinese cabbage was used , including nineteen morphologically diverse cultivars of brassica rapa l. ssp . for est - ssr identification and primer design , a typical heading chinese cabbage , namely , fushanbaotou , was used in this study . for primer assessment and ssr polymorphism analysis , leaves were collected after they were grown for two weeks from ten seedlings of each cultivar and were pooled together for dna extraction . the dna samples of those aforementioned twenty - four cultivars of chinese cabbage were used as templates for ssr polymorphism analysis . the physical positions of the est - ssrs identified in the study were determined by aligning the ssrs and flanking sequences ( 50 bp at each side ) to the brassica rapa ( chiifu-401 ) reference genome ( http://brassicadb.org/brad/ ) using blastn . new est - ssrs were identified by comparing with previously reported ssrs in the ssr marker database for brassica ( http://oilcrops.info/ssrdb ) . the dna sample of the chinese cabbage fushanbaotou was used as template to detect the availability of ssr primers designed above .", "we sequenced the polymorphic alleles of the 17 polymorphic loci and found that polymorphisms of 9 loci ( br - es1 , br - es4 , br - es7 , br - es8 , br - es10 , br - es14 , br - es17 , br - es18 , and br - es19 ) were because of different iterate numbers of ssr repeat motifs . in another 6 polymorphic loci ( br - es2 , br - es3 , br - es12 , br - es13 , br - es15 , and br - es16 ) , of the 17 polymorphic loci , twelve loci were polymorphic in all cultivars of b. pekinensis l. and b. chinensis l. three loci ( br - es2 , br - es9 , and br - es19 ) had no polymorphism in the cultivars of b. pekinensis l. but had polymorphism in the cultivars of b. chinensis l. , while two loci ( br - es4 and br - es7 ) were polymorphic in the cultivars of b. pekinensis l. but were not polymorphic in the cultivars of b. chinensis l. ( figure 5 , table s8 ) .", "the est - ssrs developed in this study , in combination with previously reported est - ssrs , will provide valuable resources for constructing high - density genetic linkage maps , mapping quantitative trait loci , assessing germplasm polymorphism and evolution , marker - assisted selection , and cloning functional gene in chinese cabbage . to our knowledge , this is the first successful attempt to develop large quantity of est - ssrs with high quality based on the transcriptome of chinese cabbage using high - throughput rna sequencing technology . the results indicate that the est - ssrs identified and the pcr primers designed in this study could further be used for constructing high - density genetic linkage maps , mapping quantitative trait loci , assessing germplasm polymorphism and evolution , marker - assisted selection , and cloning functional gene in chinese cabbage . in summary , we assembled a large set of clean reads with high quality derived from the chinese cabbage transcriptome using high - throughput rna sequencing technology with a solexa / illumina platform . primer pairs for 24 est - ssrs were selected for primer evaluation , and 79.2% of the 24 est - ssr loci successfully generated high quality amplicons . among the effective primers , 89.5% of them showed polymorphism in 24 cultivars of chinese cabbage . 10,420 est - ssrs were identified and characterized , and pcr primer pairs for 1561 est - ssrs were designed . by comparing with previously reported ssrs in the ssr marker database for brassica ( http://oilcrops.info/ssrdb ) , we identified a total of 2744 new est - ssrs . a total of 51,694 nonredundant unigenes were obtained from 40.7 mb sequence data , providing substantial knowledge for est - ssr identification and characterization . the transcriptome of rosette and folding leaves in chinese cabbage was analyzed using the illumina paired - end rna sequencing technology , and abundant clean reads and ests with high quality were obtained . most of the est - ssr loci ( accounting for 89.5% of the tested loci ) were found to be polymorphic among the 24 tested cabbage cultivars ." ]

[ "much of the current success in clinical positron emission tomography ( pet ) can be attributed to the development of 2-(f ) fluoro-2-deoxy - d - glucose ( f18-fdg ) . it is the most commonly used radiopharmaceutical in the pet , with a half - life of 110 min . before the release of f18-fdg for human use , the quality control tests need to be performed to check the safety of the product . the bet using gel clot method is a 60-min test and typically performed after the decay of the f18-fdg sample to determine the endotoxin content . the objective of this study protocol was to set up a standard pyrogen testing facility and to establish documented evidence if the process employed for bet testing of f18-fdg by gel clot method produces the desired results consistently , when performed as per the standard operating procedures . the gel clot is technically the most simple and was the first bet approved by the food and drug administration ( fda ) .", "random samples of the f18-fdg from september 2010 to march 2011 were subjected to the gel clot bet . the pwc and ppc used for these tests were at the endotoxin concentration of 0.5 eu / ml . the four dilutions of the f18-fdg , i.e. 1:10 , 1:100 , 1:350 and 1:700 , were freshly prepared from the batches and subjected to the gel clot assay . the standard gel clot test for assessing the bacterial endotoxin content consisted of four controls : negative water control ( nwc ) , positive water control ( pwc ) , negative product control ( npc ) and positive product control ( ppc ) . a positive test indicated that the concentration of endotoxin in the tube is greater than or equal to the sensitivity of the lal reagent . any other state of the reaction mixture constituted a negative test , which indicated an endotoxin concentration less than the lal reagent sensitivity . the sensitivity of the lal reagent contained in each vial was 0.125 eu / ml . the test for confirmation of lysate sensitivity was carried out with every new batch of the lysate as per the usp < 85 > recommendations .", "random samples of the f18-fdg from september 2010 to march 2011 were subjected to the gel clot bet . the assay was performed at four different maximum valid dilutions ( mvds , i.e. 1:10 , 1:100 , 1:350 and 1:700 ) . the ph of the samples was measured to ensure a ph within the range 6.08.0 for the validity of the gel clot procedure . f18-fdg was synthesized in the in - house medical cyclotron and radiochemistry lab at the department of nuclear medicine and pet centre , using the tracerlab mxfdg ( ge healthcare , mnster , germany ) .", "the cse having predetermined amount of endotoxin was prepared according to the directions for use given in the specific certificate of analysis ( coa ) . the sensitivity of the lal reagent contained in each vial was 0.125 eu / ml . the test for confirmation of lysate sensitivity was carried out with every new batch of the lysate as per the usp < 85 > recommendations . the standard gel clot test for assessing the bacterial endotoxin content consisted of four controls : negative water control ( nwc ) , positive water control ( pwc ) , negative product control ( npc ) and positive product control ( ppc ) . the matched control standard endotoxin ( cse ) , lal reagent and lal reagent water obtained from charles river laboratories india private limited , bangalore , india , were used in this study . the nwc is the endotoxin - free limulus amaebocyte lysate ( lal ) reagent water .", "all the dilutions were made in the depyrogenated 16 125 mm glass tubes using endotoxin - free water and pyrogen - free sterile pipettes tips . depyrogenations were performed in the dry heat oven at 250c for 1 hour , when the endotoxin - free glass tubes were not obtained commercially .", "a positive test indicated that the concentration of endotoxin in the tube is greater than or equal to the sensitivity of the lal reagent . any other state of the reaction mixture constituted a negative test , which indicated an endotoxin concentration less than the lal reagent sensitivity . the pwc and ppc used for these tests were at the endotoxin concentration of 0.5 eu / ml . the four dilutions of the f18-fdg , i.e. 1:10 , 1:100 , 1:350 and 1:700 , were freshly prepared from the batches and subjected to the gel clot assay . the lal reagent was constituted after the addition of lal reagent water ( endotoxin free ) in the freeze - dried power of lysate . the ppc was separately prepared for all the dilutions at the endotoxin concentration of 0.25 eu / ml . the reaction solution was mixed thoroughly and placed immediately in the incubator at 37c1c for 602 min . at the end of the incubation period , if the gel had formed and remained intact in the bottom of the reaction tube after an inversion of 180 , the test was considered positive .", "this indicated that all the vials did not contain endotoxin greater than 0.125 eu / ml . results for the diluted f18-fdg samples all the 20 positive endotoxin control pwc vials gelled . none of the 20 1:10 f18-fdg sample vials gelled after 60-min incubation at 37c . however , 1 out of 20 ppc vials for the 1:10 dilution did not gel probably due to some interference with the gel formation at the lysate sensitivity of 0.125 eu / ml . results for undiluted f18-fdg sample table 2 summarizes the results for the 60-min gel clot assay on the four different dilutions of the f18-fdg samples . this indicated that all the batches did not contain endotoxin greater than 0.5 eu / ml . table 1 summarizes the results of the undiluted f18-fdg on the positive control solutions at an endotoxin concentration of 0.5 eu / ml ( 4 ) . of the 10 undiluted f18-fdg batches , the mean ph was 7.05 ( 6.57.5 ) . the total numbers of tests performed on the f18-fdg were 100 excluding nwc , pwc and ppc .", "the gel clot method is often considered as the most accurate and sensitive procedure for testing endotoxin content in injectable radiopharmaceutical products because fewer false - positive and false - negative results are observed when this method is used . the total time taken to complete the lal reaction requires optimal ph range . in the undiluted samples , the measured ph ( 7.05 ) was well within the acceptable range ( i.e. 6.08.0 ) for the gel clot assay . similar results were found in the present study with the undiluted samples as two vials of the ppc ( endotoxin concentration equal to 0.5 eu / ml ) did not gel , indicating the interference with the gel formation . the interference may be due to the presence of the citrate ions . at the expiration time , the maximum administered total dose in milliliters of fdg should contain less than 175 eu . the gel clot assay has a major drawback which limits its use for the short - lived radiopharmaceuticals . nakao et al . reported the effect of the citrate salt concentration on the endotoxin test for the f18-fdg preparations .", "this study suggests that the bet needs to be performed , standardized and documented in each cyclotron and pet facility . the dilution of the test sample is the easiest means to resolve the potential product inhibition / enhancement problem during the gel clot testing procedure . the final f18-fdg preparation at any time point did not contain more than 8 eu , thus making it safe for human administration ." ]

[ "bt seems to be superior option for dose escalation and psa control in prostate cancer patients . results of this study suggest that bt alone , particularly seed implant , provides superior psa free survival in low risk patients . comparative analysis of psa free survival outcomes by prostate cancer results study group has been published , recently . both low - dose ( ldr ) and high - dose rate ( hdr ) brachytherapy ( bt ) are used in prostate cancer patients . risk categories and treatment options according to nccn prostate specific antigen density if predicted probability of nodal involvement is 2% neoadjuvant , concomitant or adjuvant in selected patients without fixation radical prostatectomy ( rp ) remains one of basic curative therapy for prostate cancer , especially for low and inermediate risk patients . this is also reason to recall guidelines of european and north american societies on prostate cancer brachytherapy , both hdr and ldr .", "ebrt and permanent seed combination is considered as standard of care for high risk patients . prior rectal surgery or pelvic irradiation , i.e. rectal cancer treatment , in prostate cancer patients should be carefully evaluated and complications and outcome risk factors should be discussed with special hdr - bt center expertise . hdr - bt is recommended as a dose escalation technique combined with ebrt for patients with intermediate or high risk of failure with life expectancy longer than 5 years . european association of urology states that transperineal bt alone qualification criteria are : clinical stage between t1c and t2a , without nodal involvment or metastases , six or less gleason score diagnosed with sufficient number of random biopsies , initial psa level of 10 ng / ml or less , no more than 50% of biopsy cores with cancer , prostate volume of less than 50 cm and a good ipss ( < 20 fair tolerance ; < 9 good tolerance ) . ldr - bt is recommended both by eau and gec / estro as safe and effective in low risk group of prostate cancer patients with life expectancy longer than 5 years . also freehand implantation is acceptable , but experienced practitioners should perform ldr - bt in such cases . moreover these guidelines state that hdr - bt alone should be considered as an investigational treatment with proper fractionation . post - turp patients should avoid this procedure , however if turp was performed several years earlier some patients can undergo ldr - bt after careful evaluation .", "hdr - bt , according to gec / estro - eau recommendations , should be done under trus guidance with template , its proper fixation and treatment planning software . additional imaging with ct or mri after implantation may be used . clinical target volume ( ctv ) for hdr - bt can be whole gland ( prostate surface ) with homogenous needles distribution or with addition of visible tumor boost inside ctv . ldr - bt should be performed under trus guidance according to gec / estro guidelines . if possible gross tumor volume ( gtv ) should be delineated on pre - treatment scans . prostate surface dose prescription differs among cancer centers and is between 6 to 10 gy per fraction with total dose of 12 - 20 gy in 2 to 4 fractions combined with ebrt of 45 to 54 gy in 6 - 7 weeks . organs - at - risk doses should not exceed 120% of mtd for urethra and less then 6 gy per fraction for rectum . those doses should be precisely stated and valuated in clinical trials with long follow - up including penile bulb maximum dose . dose constrains for organs at risk should not exceed 150% of prescribed dose in 5% and 125% of prescribed dose in 30% of urethral volume in the preplan . although ct performed immediately or one day after the implantation has several positives , e.g. early detection of dosimetric problems , but after implant oedema can derive dosimetric underestimations . main procedure should be performed with trus and template ; patient position and probe angle should be similar to preplanned . if combination of ebrt and seed implantation is planned , i ptv dose should be between 108 - 110 gy and pd ptv dose should be between 90 - 100 gy . abs does not suggest any seed deposition technique , however it should have excellent outcome , be reproducible and with optimal dosimetry . both stranded and loose seeds can be chosen for implantation .", "both ldr and hdr - bt patients should be seen 6 weeks after implantation ( last one for temporary implants ) according to gec / estro recommendations . should be examined every 3 months , every 6 months until 5 years after treatment and then annually . phoenix definition of biochemical relapse is recommended , although case individual assessment is required and patient should be informed about psa bounce . abs suggests to follow - up hdr - bt patients every six months for first 2 - 3 years , and then at least annually . it should consist of dre , psa test and toxicity evaluation ( urinary , rectal and sexual function ) . dre , psa test , side effects evaluation ( urinary , rectal , potency toxicity and ipss ) and trus should be done [ 18 , 20 ] . ldr - bt patients should be seen every six to twelve months with regular intervals .", "gec / estro and eau recommendations on prostate cancer treatment with temporary implants with stepping sources are from 2005 and on permanent seeds from 2000 with 2007 update . although general approach for bt , both hdr and ldr , has not particular differences across the world , european recommendations need an update . \n feasibility of seeding or catheterization is basic for choosing appropriate candidates for bt , however there are articles describing series of patient with non - fitting anatomy , i.e. prostate smaller than 20 cm or bigger then 50 cm or post turp patients [ 24 , 25 ] . new abilities of mri , i.e. spectroscopy and diffusion , and 11c pet - ct should be discussed more in next recommendations [ 2628 ] . recommendations comparison for gec/ estro and abs [ 18 , 2022 ] under investigation for high risk patients to institutional review board trus stays basic imaging , but ct and mri are also very useful , either before procedure and as a planning guidance . excellent outcomes and relatively small irradiated volume seems more beneficial than any risk of intraoperative implantation , particularly in wisely selected patients . brachytherapy is supreme tool in prostate cancer management with a wide range of options in every risk group ( table 2 ) ." ]

[ "the goal of this study was to determine whether noncompliance with antibiotic treatment affects short - term or long - term complications . in addition to the uncertainly in the scientific literature , parents seem to be uncertain regarding the benefits of antibiotic treatment for acute gabhs pharyngitis and tend to stop treatment earlier than prescribed . in a pilot study this finding led us to conduct a multisite , prospective cohort observational study , the results of which are reported here . only 2030% of patients with group a beta hemolytic streptococcus ( gabhs ) pharyngitis presents with classical symptoms of the disease .", ", we located from our computerized data base 107,840 patients , aged 6 months to 18 years , who were examined by their primary care physician for upper respiratory tract infection , tonsillitis , pharyngitis , sore throat , tonsillopharyngitis , neck pain , cervical lymphadenopathy , pta , rpa , from january 1 , 1999 until december 31 , 2000 . two central , primarily rural , and agricultural regions of the largest health maintenance organization ( hmo ) in israel , comprising approximately one million patients . using a standard protocol the annual incidence of peritonsillar abscess ( pta ) in our region is 24 cases per 100,000 and the incidence of retropharyngeal abscess ( rpa ) is 57 cases per 100,000 . we then accessed the charts of 78,473 of these children who were diagnosed with infected throat or one of the differential variants , excluding all children diagnosed as having viral upper respiratory infections . the purpose of this culture was verification of antibiotics treatment failure or persistence of gabhs in the oropharynx of the untreated patients . 47,000 of these patients were formally diagnosed with acute pharyngitis or acute tonsillitis and received a prescription for antibiotics , indicating that their physician suspected bacterial disease . in the index visit , 35,000 of these children had at least four out of five symptoms in the modified centor criteria used for this study and nadir modified breese epidemiological and clinical score card ( ecsc ) that has 91% sensitivity and 98% specificity when the score was above 15 ( score between 4 and 36 ) for the diagnosis of gabhs [ 1719 ] .", "new onset cases of acute otitis media ( aom ) were diagnosed within 30 days of the initial diagnosis . cervical lymphadenitis , acute otitis media , and impetigo were the only suppurative complications noted . the duration of fever was the most significant predictor for such recurrence , age under 6 years being less significant , while treatment for 7 to 10 days had no significant influence on the recurrence of gabhs . however , only 31 ( 10% ) of those were in the untreated subgroup , as compared to 141 ( 46% ) in the 7 to 10 days treatment subgroup , 98 ( 38% ) in the 4 to 6 days treatment subgroup and 98 ( 33% ) in the 1 to 3 days subgroup , a statistically significant difference among the all treatment subgroups ( p < .0001 ) . attempting to elucidate the possible causes for the differences between the recurrence of gabhs and the length of antibiotic treatment or clinical score on enrolment or illness severity , a multivariate stepwise logistic analysis was performed . additionally , no children developed nonsuppurative complications during 10 years of followup nor did any of the children develop iga nephropathy during the follow - up period .", "this study found a very poor parent / child compliance to antibiotic treatment prescribed for symptomatic , culture - positive gabhs tonsillopharyngitis . we were unable to assess the true variation of the incidence of acute rheumatic fever , due to the fact that this disease has been practically eradicated from our population . furthermore , despite the poor compliance , we found no increase in the incidence of acute rheumatic fever , the most dreaded complication of gabhs , in our patients . 11% of children did not start taking any treatment at all , and only 10% completed a full course of treatment .", "our data suggest that the large majority of parents / patients stop administering antibiotics to their children who suffer from gabhs prior to the completion of the recommended course . a more judicious use of antibiotics would promote and improve compliance , cut costs , and prove more convenient to parents and children alike ." ]

[ "it has several advantages , as it is \n noninvasive and convenient , and can perform measurement even during dynamic motion10 , 11 . surface emg is widely used in kinetic analysis to diagnose normal \n or abnormal function in muscles and nerves according to amplitude and frequency9 . this study aimed to compare the \n electrophysiological characteristics of normal muscles versus muscles with latent or active \n myofascial trigger points , and to identify their neuromuscular physiological \n characteristics , in order to provide a quantitative evaluation of mps and clinical \n foundational data for its diagnosis . although a number of clinical reports on the pathologic mechanisms or clinical diagnosis \n and treatment of mps can be found , few studies have been conducted on the changes in \n contraction function in myofascial trigger point areas or on the electrophysiological \n characteristics and neuromuscular physiological information . surface electromyography ( emg ) analyzes functional changes in muscle by measuring \n quantitative changes in motor unit action potential that is activated by muscle \n contraction7 , 8 . mps activates trigger points in 54% of women and 45% of men , and is regarded as \n the most common cause of pain in the musculoskeletal system3 . in particular , the upper trapezius requires head movement according \n to the direction of view , but it can be vulnerable to damage when the hands and arms are \n used repetitively in work that requires precise control4,5,6 . once myofascial trigger points are activated , changes in the \n structural characteristics and contraction function of the muscle will occur .", "subjects in the active myofascial trigger point group were those diagnosed with mps \n by a physician and whose clinical characteristics were pain in the upper trapezius during \n rest , taut bands , tender nodules , referred pain , local twitch response , and muscle weakness . \n subjects in the latent myofascial trigger point group were those not diagnosed with mps but \n who felt tenderness when the upper trapezius was stimulated . mean age , height , and weight , respectively , were 23.27 \n 4.21 years , 172.32 8.44 cm , and 64.14 6.54 kg in the active trigger point group ; 23.74 \n 6.47 years , 174.76 6.22 cm , and 66.74 5.74 kg in the latent trigger point group ; and \n 24.17 3.14 years , 171.21 9.64 cm , and 63.44 7.51 kg in the control group . to measure maximum voluntary isometric contraction ( mvic ) , the shoulders and heads of the \n subjects were firmly fixed and pulled as the dynamometer as maximum power , thereby measuring \n mvic against the upper trapezius . endurance time was measured from the start of mvic to a \n 50% reduction in contraction force . median frequency ( mdf ) was measured by using emg at the \n muscle belly of the upper trapezius during mvic . muscle fatigue index was calculated by \n obtaining the mdf at a section where the mvic force was reduced from 100% to 50% , and remove \n the 50% mdf from 100% mdf was divided into 100% mdf . subjects were \n selected among those with no known neurologic disease , no regular exercise habit , and no \n drug use that could affect the experimental result .", "et : endurance time ; mdf : median frequency ; mfi : \n muscle fatigue index ; mvic : maximal voluntary isometric contraction et : endurance time ; mdf : median frequency ; mfi : \n muscle fatigue index ; mvic : maximal voluntary isometric contraction ) . tukey post hoc results showed that the active myofascial \n trigger point group was significantly different from the control group . tukey post hoc results showed \n that the active myofascial trigger point group was significantly different from the control \n group . there were no significant differences in mvic or endurance time among the three groups . \n however , mdf was significantly different among all three groups ( p < 0.05 ) ( table 1table 1.comparison of mvic , et , mdf , and fi among the three groupsgroup a ( n = 30)group b ( n = 30)group c ( n = 30)post hocmvic , kg19.811.5 * 22.19.423.510.2/et , s48.59.749.510.251.28.8/mdf , hz102.521.488.523.184.517.4a < group a : active myofascial trigger points ; group b : latent myofascial \n trigger points ; group c : control . group a : active myofascial trigger points ; group b : latent myofascial \n trigger points ; group c : control .", "this study aimed to measure mvic , endurance , mdf , and muscle fatigue index of normal \n muscles versus muscles with latent or active myofascial trigger points , thereby identifying \n the neuromuscular physiological characteristics of muscles with active myofascial trigger \n points and providing clinical foundational data that are applicable for the quantitative \n evaluation and diagnosis of mps . the results of \n mdf according to surface emg show changes in recruitment of fast - twitch muscle fibers and \n conduction velocity of motor unit action potential12 . in addition , increases in mdf reflect recruitment of type ii \n fibers , and muscle fatigue index can be analyzed according to the relationship between type \n ii fibers and mdf13 , 14 . in the present experiment , mdf was significantly higher in the \n active trigger point muscles than in normal muscles . the above results indicate that as \n trigger points were activated , recruitment of motor unit action potential of type ii fibers \n also increased . in addition , muscle fatigue index also increased due to the increased \n distribution of type ii fibers . surface emg , which was used to evaluate the functionality of trigger points in this study , \n is nonintrusive and convenient ; thus , it is widely used in studies on the functional \n characteristics of muscle , by analyzing the electrical activity of muscle ." ]

[ " cervical small cell carcinoma and ovarian carcinoids are the most common gynaecological ne tumours . primary or secondary neurondocrine ( ne ) tumours of the female genital tract are rare .", "neuroendocrine tumours comprise a set of neoplasms that arises from the diffuse neuroendocrine cell system . the purpose of this article is to review the epidemiological , clinical and imaging features with pathological correlation of primary gynaecological ne tumours , emphasising the importance of differentiating them from metastatic disease and other carcinomas with an ne component . these tumours are more commonly identified in the gastrointestinal tract , pancreas , lung and thymus . recently , a simplified terminology has been proposed , dividing ne tumours in two groups : poorly differentiated neuroendocrine carcinomas ( necs ) and well - differentiated neuroendocrine tumours ( nets ) . the clinical features of gynaecological ne tumours generally depend on the organ of origin and are non - specific the absence of endocrine clinical syndromes in most patients with ne tumours is possibly related to the release of insufficient amounts or inactive hormones .", "the differentiation of small cell ne carcinomas from poorly differentiated squamous cell carcinoma ( scc ) with ne features may be especially difficult . sometimes , and particularly for cervical cancers , the recognition of the ne component is only possible after the hysterectomy , since the tissue obtained on cervical biopsy may be insufficient , leading to the diagnosis of poorly differentiated cervical cancer . for the classification of ne differentiation , tumour cells have to express at least two ne markers such as chromogranin a , synaptophysin or neuron - specific enolase . some cancers display a combination of ne and non - ne features , usually either glandular or squamous components .", "mri is primarily used for local staging of vaginal tumours and should be performed after vaginal filling with gel . particularly for typical and atypical carcinoids ( well - differentiated neuroendocrine tumours ) , the imaging approach to gynaecological ne tumours is similar to that for other histological types . for the cervix , uterus and adnexa , ultrasound ( us ) using both transabdominal and transvaginal probes plays a critical role in the initial diagnosis . patients with negative octreotide scans should not be considered for somatostatin analogue therapy and typically show better responses to chemotherapy schemes . , ct is also indicated to evaluate the extent of disease and detect nonresectable metastases . magnetic resonance imaging ( mri ) due to the rarity of these tumours , data in the literature concerning their imaging features are scarce . we know that small cell carcinoma and large cell ne carcinoma tend to behave aggressively , in contrast to carcinoids , which are typically confined to the organ .", "", "compared the features of primary insular carcinoids and metastatic midgut carcinoids and concluded that the presence of extra - ovarian tumour , bilaterality , multinodularity , vascular invasion and the absence of teratomatous elements are suggestive of an extra - ovarian origin . primary carcinoid tumours of the ovary are rare and account for less than 5 % of all carcinoid tumours and for less than 0.1 % of all ovarian neoplasms . insular carcinoid is the most common type of ovarian carcinoid , typically presenting with a pelvic mass . these are germ cell tumours in origin and classified as teratomas with a predominance of ne features . the insular and trabecular subtypes most commonly have metastases in the ovary simulating a primary tumour . carcinoid syndrome is less common in the other subtypes ( 13 % in trabecular and 3.2 % in strumal carcinoids ) .", "we review three cases of neuroendocrine ovarian tumours , one primary carcinoid and two secondary carcinoid tumours ( figs . 1 , 2 and 3 ) . once again , we emphasise that few data are provided in the literature regarding the imaging features of these tumours both small cell carcinoma and large cell ne carcinoma of the ovary are highly malignant and aggressive , regardless of the stage . ovarian small cell carcinoma resembles the pulmonary type and is often associated with common epithelial tumours , typically an endometrioid carcinoma , suggesting an origin from ovarian surface epithelium .", "large cell ne carcinoma and carcinoid types are rarer than the former and few data can be found in the literature .", "cervical necs resemble cervical squamous cell carcinoma , displaying the same mri features : low signal intensity on t1-weighted images ( t1wi ) and high signal intensity on t2-weighted images ( t2wi ) . we review three cases of cervical small cell carcinoma ( figs . 4 , 5 and 6 ) . no histological distinction can be provided regarding only imaging features . however , according to the literature , cervical necs are generally highly aggressive and expected to be diagnosed in advanced figo stages . staging and treatment strategies for both small and large cell cervical carcinoma globally follow the same criteria used for common histological types of cervical carcinomas . some patients present with a cervical mass and an abnormal pap smear may be found . it appears to have a similar outcome to small cell carcinoma and its treatment remains challenging because of the high rate of recurrence and distant metastases even with early stage disease [ 2 , 32 ] .", "carcinoid syndrome is very rare and even in the lack of clinically evident carcinoid syndrome , many patients present with elevated urinary 5-hydroxyindoleacetic acid ( 5-hiaa ) . atypical carcinoids of the cervix are also very rare and , according to a review of yoshida et al . , only 13 cases have been reported in the literature . well - differentiated neuroendocrine tumours ( nets ) include typical and atypical carcinoid tumours . among the uncommon sites of primary carcinoid tumours ,", "we review two cases of poorly differentiated endometrial carcinoma with ne differentiation ( figs . 7 and 8) . like in cervical carcinoma , imaging does not allow histological distinction , since all endometrial cancers tend to present similarly : low to moderate signal on t2wi and hypointensity relative to the hyperintense enhancing myometrium on dynamic contrast - enhanced mri sequences . small cell carcinoma of the endometrium resembles that of the lung and is uncommon , accounting for less than 1 % of all endometrial carcinomas . the reported endometrial neoplasms with ne differentiation essentially include small cell carcinoma and endometrial adenocarcinoma with ne cells . however , when a highly aggressive endometrial tumour is found , a neuroendocrine nature may be suspected .", "neuroendocrine tumours of the fallopian tube , vagina and vulva are very rare and only a few cases have been reported . in the fallopian tube , almost ten cases of small cell carcinoma have been reported , occurring in females between 41 and 78 years of age . these tumours encompass carcinoids and small cell carcinoma , and they are not well known . in the vagina ,", "two groups are currently considered : necs , including small cell carcinoma and large cell ne carcinoma , and nets , which encompass typical and atypical carcinoids . the clinical features of theses tumours are non - specific and depend on the organ of origin and on the extension and aggressiveness of the disease . the diagnosis is obviously histological , and the role of imaging tools essentially includes initial detection , staging and biopsy guidance . the imaging evaluation should follow the same criteria used for other tumours , and figo remains the preferred staging system . ovarian carcinoids tend to behave in a benign fashion . while managing an ovarian carcinoid , extra - ovarian extension , bilaterality and multinodularity should raise the suspicion of metastatic disease . endometrial ne tumours are very rare and are usually small cell carcinoma or adenocarcinoma with ne differentiation . as for other tumours , us , ct , pet - ct and mri remain the most commonly used imaging tools , but octreotide scans may be useful for typical and atypical carcinoids .", "" ]

[ "adcc is a relatively rare malignant salivary gland tumor comprising less than 1% of all malignancies of head and neck . it is the 5 most common malignancy of salivary gland origin , representing 5 - 10% of all salivary gland neoplasms . the parotid and submandibular glands are the two most common sites for adcc accounting for 55% of the cases . among the major glands , tubular pattern ( well differentiated ) is believed to have the best prognosis compared to the cribriform pattern ( moderately differentiated ) and solid pattern ( poorly differentiated ) .", "a 60-year - old male patient reported to the department of oral and maxillofacial surgery with a chief complaint of pain and discharge in the upper left back region of the jaw since one and half years . according to the patient one year prior to our consultation , he got the maxillary molars extracted from a local dentist due to pain and mobility of the teeth in that area . upon consultation patient revealed that the pain continued to exist even after the extraction . the clinical differential diagnosis included a benign or malignant neoplasm of minor salivary glands , a neoplasm of maxillary sinus . the patient was treated by wide surgical excision with clear margins and hemi - maxillectomy of left maxillary region with post - radiotherapy . the present case was staged as t4n0m0 based on american joint committee on cancer as a guide to prognosis .", "adenoid cystic carcinoma most often presents a diagnostic and treatment challenge owing to the rarity of the lesion . the differential diagnosis of adcc includes plga , basal cell adenoma ( bca ) , mixed tumor and basaloid squamous cell carcinoma ( bsc ) . pain is a common and important finding , occurring early in the course of the disease before there is a noticeable swelling . most findings regarding adcc are actually based upon studies with a small number of patients and there is a need for further information regarding its clinical behaviour as well as treatment modalities and their results .", "lesions involving the sinus tend to have a poor prognosis due to its infiltrative growth and distant metastasis ." ]

[ "the quantity of trauma victims and the management involved in attending them leads to a great workload in most hospitals and places an enormous amount of pressure on the health care system . the aim of this retrospective study was to compare the peculiarities of maxillofacial injuries caused by interpersonal violence with other etiologic factors . furthermore , traumatic injuries have been reported as the leading cause of death in the first 40 years of life and appear to be on the increase . during the last decade , interpersonal violence ( ipv ) was one of the main etiological factors of fractures of the maxillofacial complex . road traffic accidents remain the most important cause of maxillofacial trauma worldwide , although falls and assaults have become more significant in north america , brazil and europe . blunt and cutting wounds on the head and neck are also common . legal underreporting is common due to associations with alcohol abuse , illicit drug use , firearms and acts of violence against women , children , and the elderly , which generate fear , shame , low self - esteem and a sense of powerlessness . facial fractures associated to ipv have functional , aesthetic and psychological effects on the victims , as well as a socioeconomic impact on the health systems of many countries .these victims are more likely to suffer from depression , anxiety and post - traumatic stress disorder . epidemiological studies help to identify demands , develop prevention programs and structure an integrated care system .", "mandibular fractures were described according to the anatomic site : condylar fractures ; angle fractures ; body fractures and fractures of symphysis . the sample was selected based on analysis of medical records of facial trauma patients attended by the department of oral and maxillofacial surgery in the piracicaba dental school at the university of campinas from january 1999 to december 2012 . the origin of the facial trauma was classified as follows : traffic accidents ( automobile and motorcycle ) ; work accidents ; sport accidents ; falls ; interpersonal violence ; cycling accidents ; pedestrian accidents and others . a standardized form was designed to investigate the epidemiologic features of maxillofacial traumas , considering aspects such as age , gender , diagnosis , soft tissue lesions , facial injuries and general injuries . this retrospective study involved data collected from clinical notes and surgical records of patients treated at seven different hospitals located in three different cities in so paulo state , brazil . facial injury sites were classified as follows : upper ( frontal bone ) ; middle ( maxilla , nasal bones , zygomatic - orbital complex , naso - orbital ethmoidal ) and lower ( mandible ) . the exclusion criterion was incomplete information about the type of trauma on the medical chart .", "distribution of facial injury diagnoses among a general sample and patients whose facial injury was associated with interpersonal violence ( ipv ) \n \n n = number of patients . \n in the cases of mandibular fractures , distribution of body injuries among patients with facial trauma and patients whose facial injury was associated with interpersonal violence ( ipv ) \n \n the calculation is based on whole sample ( n = 3724 ) . \n \n comparison of features of facial injury of victims of interpersonal violence ( ipv ) and other etiologic factors \n \n n = number of patients ; = chi - square a total of 612 patients ( 16.4% ) exhibited facial injuries related to ipv . in this group , distribution of patients with facial injuries according to etiological factors \n \n n = number of patients . \n \n", "although motor vehicle accidents are still the main cause of maxillofacial fractures in some developing countries , recent data from developed countries have shown that ipv is the dominant cause . ipv is one of the leading causes of maxillofacial fractures and its prevalence in a population varies according to geographic region and appears to be associated with factors such as socioeconomic status , population density and age characteristics . the role of health professionals is to identify the etiology of the injury and , in cases of physical aggression , provide the victim with information on where to seek help . however , children are also affected and several studies have reported the patterns and severity of these injuries . this age group is susceptible to craniofacial trauma due to their greater cranial mass - to - body weight ratio . compared to adults , less although the world health organization considers the response of health - care services to victims of violence to be an international priority , health professionals are generally not qualified to identify the injuries or council victims . moreover , health professionals are not well prepared to ask sensitive questions and are unaware of victim - support institutions .", "the findings of the present study demonstrated that facial trauma caused by interpersonal violence seem to be associated with a higher rate of facial fractures and lacerations when compared to all other patients with facial injuries . male patients are more likely to exhibit severe injuries and exhibited a greater amount of bone fractures . prominent areas of the face and neurocranium should be carefully examined as they tend to be more prone to injuries .", "glaucia maria bovi ambrosano , associate professor , department of community dentistry , campinas state university piracicaba dental school , for statistical analysis assistance ." ]

[ "the influence of the sialyl protecting groups , solvent \n polarity , and hydroxylamine steric bulk on the thermal equilibration \n reactions of the sialyl hydroxylamines are presented and afford insight \n into the influence of the trans - fused oxazolidinone \n group in sialic acid chemistry . the lack of kinetic selectivity of \n sialyl anomeric radicals is discussed from the viewpoint of their \n conformation , which is based on literature electron spin resonance \n data of cognate radicals . we report in \n full on the synthesis of the o - sialyl glycosides \n of two further hydroxylamines of differing steric bulk and conduct \n equilibration studies in three solvents spanning a broad range of \n polarities .", "dipole moments \n ( debye units ) of open chain and cyclic carbonyl \n functionalities in nonpolar solvents . if the anomeric effect is understood in terms of donation \n of electron \n density from a lone pair ( n ) on the ring oxygen into \n the synperiplanar c o * orbital of the axial glycosidic \n bond , the influence of the oxazolidinone can be \n attributed to the lowering of the energy of the lone pair due to the \n presence of the strongly electron - withdrawing group , which in turn \n reduces the n * interaction and so \n diminishes the anomeric effect . in valence bond terms the mechanism \n of the equilibration process involves reversible homolytic scission \n of the glycosyl - hydroxylamine c o bond to an anomeric radical \n and a persistent aminoxyl radical ( scheme 4 ) . thus , in the axial glycosides the vectors of the oxazolidinone dipole \n and the anomeric carbon oxygen bond dipole subtend an angle of approximately \n 90 , whereas in the equatorial glycoside the angle subtended \n is approximately 60 , suggesting that the equatorial glycosides \n will be more highly stabilized in less polar media , as is the case \n ( table 1 ) . the electron - withdrawing effect \n of the n - acetyloxazolidinone system , while still \n powerful because of the alignment of the oxazolidinone carbonyl with \n the c4o4 and c5n5 bonds in the mean plane of the pyranose \n ring , is moderated by the orientation of the acetyl group , which , \n as is clear from the available x - ray crystal structures and literature data with simple models , is oriented so as to minimize the overall dipole ( figure 8) at least in weakly polar environments . rather we suggest that the influence \n of the oxazolidinone on the \n anomeric effect is rooted in the highly polar nature of the oxazolidinone \n system with its strong dipole moment aligned with the axis of the \n carbonyl bond ( figure 8) .", "a new method of equilibration of sialyl anomeric \n c o bonds \n has been developed on the basis of the fischer ingold persistent \n radical effect . this method enables the investigation of protecting \n groups on the anomeric equilibrium and is compatible with acid and \n base sensitive functionality . the unusually poor kinetic diastereoselectivity \n of anomeric radicals in the sialic acid series is a function of the \n -type planar nature of these radicals coupled with the existence \n of competing 1,3-diaxial interactions in the diastereomeric transition \n states for the formation of both anomers ." ]

[ "we present a norwegian family with a v628 m mutation in the atp1a2 gene ( fig . 1 ) . familial hemiplegic migraine ( fhm ) is an autosomal dominant rare type of migraine with aura characterized by some degree of hemiparesis . the majority of fhm families have pure fhm , but cerebellar ataxia is frequent in fhm families with mutation in the cacna1a gene [ 5 , 6 ] . fhm1 , fhm2 and fhm3 are caused by mutations in the ion - channel genes cacna1a , atp1a2 and scn1a , respectively [ 24 ] .", "a 16-year - old male was referred to the neurological ward on a hot summer day due to a prolonged attack of fhm . the attacks usually start with dizziness followed by homonymous visual disturbances , unilateral sensory symptoms , aphasia and unilateral weakness and then a contralateral headache . due to fear of vasoconstriction and migraine infarction , several measures were evaluated including continuous conservative management and verapamil treatment . the proband s deceased grandmother on the mother s side was reported to have had attacks of hemiplegia , but never had epileptic seizures .", "a 16-year - old male was referred to the neurological ward on a hot summer day due to a prolonged attack of fhm . due to fear of vasoconstriction and migraine infarction , several measures were evaluated including continuous conservative management and verapamil treatment . several ct - scans of the brain were normal . at the age of 10 years he had the diagnosis fhm after a prolonged attack with visual disturbances , scotoma , sensory symptoms , motor weakness , aphasia , somnolence and contralateral headache . the patient had played soccer and shortly after heading a ball he experienced a left - sided homonymous hemianopsia , followed by left - sided sensory symptoms and motor weakness , and then a contralateral migrainous headache . from the age of 2 years he experienced several attacks of sudden drowsiness , nausea and headache . he continued to have some degree of hemiparesis along with apraxia , homonymous hemianopsia and mild cognitive failure , i.e. , 25 of 30 points on the mini mental state examination ( mmse ) , and mildly impaired memory score and moderately impaired construction score on the cognistat . at that time", "the proband s deceased grandmother on the mother s side was reported to have had attacks of hemiplegia , but never had epileptic seizures . mother . the attacks usually start with dizziness followed by homonymous visual disturbances , unilateral sensory symptoms , aphasia and unilateral weakness and then a contralateral headache .", "the nucleotide 1987 g > a substitution causes a change of the amino acid valine to methionine ( v628 m ) . both 16-year - old patients and mother had the mutation , while the elder brother was not tested .", "we conclude that nimodipine is contraindicated in the management of prolonged fhm attack , and recommend conservative management except from supplement of sufficient intravenous fluid in nauseated patients in order to avoid hypovolemia . however , the continuous intravenous infusion of nimodipine probably aggravated the arterial hypotension , a known side effect . the seizure is most likely caused by nimodipine , as the proband and his mother both noticed worsening of the aura symptoms after initiation of the intravenous nimodipine infusion . the phenotype genotype correlation of the identified mutation ( v628 m ) is strengthened by the fact that it has also been reported in a turkish family ." ]

[ "this article describes the experience of the informatics fellow and the new jersey geographic information system(gis ) coordinator during the first two weeks of the investigation in assessing information system needs and organizing on - site computer support for the new jersey arm of the investigation . a few days later , four more cases occurred among postal workers at the brentwood mail processing facility in the washington area . four letters containing anthrax spores were known to have been postmarked and processed in the hamilton mail processing center ( hmpc ) located in hamilton township , a suburb of trenton , new jersey . on october 19 , , , , , field investigation in trenton was initiated by a cdc team composed of an epidemiologist , environmental experts , occupational physicians , epidemic intelligence service ( eis ) officers , a public health informatics fellow , and support personnel . the team was headquartered in the new jersey department of health and senior services ( njdhss ) and had access to the local area network and computing environment of the department . public health , criminal investigation , and postal authorities at local , state and federal levels investigated the suspected bioterrorism event . within hours of the discovery of clusters of cases , the appearance of new cases in different locations around the country suggested contamination with b. anthracis of several postal facilities . in each location , the population potentially exposed was large .", "the information system developed consisted of three main components : a database of possibly exposed persons , a gis of the physical plant and equipment , and a document repository . early in the investigation , the number of people exposed to anthrax was estimated to be large . the response team planned to sample for anthrax contamination in the facility ; identify the exposed population ; locate , culture , and give prophylactic antibiotics to those most likely to be exposed ; and monitor the exposed and treated persons over time for potential long - term effects . the lists were used by eis officers for individual follow - up and were linked to the map of floor plans of the postal facility and environmental sampling results to help identify persons with the greatest likelihood of exposure . documents were made available to the team by using web pages ( html ) on the new jersey department of health intranet to link to the latest copies of the files . gis work was done using floor plans produced in arcview gis 3.2a ( environmental systems research institute , inc . , redlands , ca ) by screen - digitizing scanned not - to - scale xerographic copies of autocad drawings of the postal building .", "the response team planned to sample for anthrax contamination in the facility ; identify the exposed population ; locate , culture , and give prophylactic antibiotics to those most likely to be exposed ; and monitor the exposed and treated persons over time for potential long - term effects . early in the investigation , the number of people exposed to anthrax was estimated to be large . the lists were used by eis officers for individual follow - up and were linked to the map of floor plans of the postal facility and environmental sampling results to help identify persons with the greatest likelihood of exposure . laboratory results included cultures of both human and environmental samples performed by the new jersey state laboratory and cdc laboratories . managing reports from samples processed in different laboratories required linking of multiple unique identifiers . for epidemiologic investigation and management purposes , summary reports had to be generated frequently . because of the large number of agencies involved and the rapid progress of events , a system of document management for the many drafts of guidelines and other communications was also needed . frequent revisions made it necessary to identify and provide access to the latest documents and to track document revisions .", "the information system developed consisted of three main components : a database of possibly exposed persons , a gis of the physical plant and equipment , and a document repository . gis work was done using floor plans produced in arcview gis 3.2a ( environmental systems research institute , inc . , redlands , ca ) by screen - digitizing scanned not - to - scale xerographic copies of autocad drawings of the postal building . the exposed - person database required merging of files in multiple formats , manual data entry , rapid analysis , and frequent production of reports . documents were made available to the team by using web pages ( html ) on the new jersey department of health intranet to link to the latest copies of the files . building outlines , walls , work areas , equipment , furniture , the ventilation system and diffusers , and environmental sampling locations were digitized and stored as shapefiles , a format used by both the arcview gis and epi map software . the geographical features were then linked to environmental sampling data to specific locations in the building using epi map . the document repository was created using html on an intranet site inside the firewall of the njdhss . as the map creation process progressed over the 2-week period , additional , larger size paper drawings were provided to which a complete floor plan and heating , ventilation , and air conditioning systems components could be added .", ", we were able to access the most recent documents with minimal effort , using links in a web page . a more sophisticated version could be developed to allow tracking changes in a document over time . the system developed took advantage of several features available in epi info through its use of commercial component software and computer industry standards : rapid development of a relational database , in which identifying information was localized to a single table for security purposes importation of data from several of the 20 different file formats that can be read in epi info 2000 the ability to perform data management interactively but to preserve and replay the steps through automatically generated programs or scripts the ability to link and display microsoft access data with arcview shapefiles to create maps rapid development , with minimal coding , simplifying the testing and debugging process the ability to add or delete variables from a database merely by revising a form on the screen . we extended the mapping capabilities to illustrate the area of coverage of the active and passive surveillance systems implemented in surrounding communities for the detection of new cases ( figure 2 ) . the gis professional was able to create the shapefiles while the rest of the emergency response team ( ert ) focused on data collection and data management . the availability of analytic output and epidemiologic statistics in the same program used for data management interaction with high end gis programs and transition of database management to a commercial program through epi", "the traditional steps in systems development of requirements gathering , analysis , design , implementation , and testing must be traversed in rapid sequence during the first few hours or days of an investigation and repeated again as the system evolves and capabilities are added . the design of systems for emergencies should include methods for storing and maintaining version control of documents and images in addition to more structured data . the use of commercial software standards such as windows file formats , web pages , and mainstream gis programs facilitates the rapid implementation of systems in the field . the likelihood of success is greater if the same people and software provide support for more routine epidemic investigations in this field investigation , the informatics environment included excel spreadsheets , files in several other formats , paper questionnaires and computer printouts , an existing gis capability using arcview , and the need for frequent revisions in database structure , frequent summary reports , and protection of personal identifiers . emergency situations require rapid design and implementation of databases to provide reliable information in the field . having the ability to respond rapidly to emergency situations requires planning and preparedness . more formalized approach to systems development needs to be either extensively modified or compressed to account for the time - critical nature of the situation . key elements in preparation are in paying sufficient attention to informatics support and having both staff and software that can adapt quickly to new situations and computing environments .", "the database system consisted of a central database designed and maintained in epi info 2000 . epi info 2000 was developed at cdc from commercial component software and visual basic and offers compatibility with microsoft access files and 20 other standard database formats . the intelligent key contained facility code , deployment place ( nj ) exposed unique identifier , and postal facility involved . the informatics department of the hospital extracted relevant clinical data from the database system and made them available to the investigation team as excel tables on some days and comma delimited text files on other days . elements of information stored in databases created in epi info 2000 were sent directly to epi map for displaying ( figure 1 ) . database management was done in epi info 2000 , the windows version of epi info .", "a floor plan of the contaminated hamilton facility was available only as an incomplete and poor quality 8 1/2 11 inch photocopy of the original ' e ' sized autocad drawing . it was scanned as a tiff image , imported into arcview gis 3.2 software and used as a backdrop to create shapefiles of the building outline , walls , operational areas and equipment placements , and niosh and fbi sampling locations . elements of information stored in databases created in epi info 2000 were sent directly to epi map for displaying ( figure 1 ) . after completion , the shapefiles were linked to the data using epi map 2000 , a component of epi info that is arcviewcompatible . the elements of information to be displayed were divided into several layers showing samples taken by different agencies and their location . shapefiles were developed using a scanned copy of the floor plan of each facility and digitized using arcview .", "to obtain data on persons possibly exposed , a liaison between the u.s . postal service and the epidemiologic team the informatics department of the hospital extracted relevant clinical data from the database system and made them available to the investigation team as excel tables on some days and comma delimited text files on other days . potentially exposed populations such as regular visitors and relatives of postal workers were identified and manually entered into the main database as the investigation proceeded . he was able to obtain ms - excelfiles or computer printouts listing personnel for each of the facilities under investigation . additional information was added to those lists to record presence in the facility during the exposure period , sex of the employee , and post exposure prophylaxis ( pep ) . demographic characteristics of potentially exposed persons were assembled from various sources , including the local hospital where pep was administered . when pep was offered to a large group of people ,", "the intelligent key contained facility code , deployment place ( nj ) exposed unique identifier , and postal facility involved . the unique key at first contained information ( was \" intelligent \" ) , but we designed a mechanism to replace intelligent keys by non - intelligent keys . the database system consisted of a central database designed and maintained in epi info 2000 . we included the deployment site in the key assuming that the information would be linked with other sites at a latter time . epi info 2000 was developed at cdc from commercial component software and visual basic and offers compatibility with microsoft access files and 20 other standard database formats .", "from the beginning of the operation , security was a concern . because of the complexity of the investigation we decided that all sensitive information defined as information that would allow identification of specific individuals would be handled separately from the rest of the database . we created a single flat table with all identifiers and related the table to the rest of the database system . with that structure identifiers were not sent to cdc headquarters in atlanta , for example , and sensitive data were protected by the security features of the njdhss computing environment .", "members of the team were instructed to check in documents on a regular basis . the document check - in process included a simple computer - based form with the name of the document , the author , and a time stamp . the document repository allowed coding and storing versions of documents during the progress of the investigation . the first two elements were used to create a catalog , and the timestamp was used for versioning control . a commercial html editor ( microsoft front page 2000 ) was used for the maintenance of the document repository web page . web pages included in the system did not contain any special scripting that required an advanced web programming techniques . the level of html coding was basic , and mostly inserted automatically by front page .", "ad provided advice on the analysis of informatics needs and the development of the epi info applications through daily telephone conversations and wrote portions of the manuscript . rs developed the arcview gis system and shapefiles used in the investigation , and contributed to the manuscript . jz performed the analysis of informatics needs , set up the epi info portions of the field system and the document management system , and drafted the manuscript .", "esri ( environmental systems research institute ) provided a special license for the free distribution of mapobjects software within epiinfo / epimap 2000 ." ]

[ "most of the literature pertaining to the situation in the developed world , showed that the disease is largely confined to the elderly patients taking ulcerogenic medications.[15 ] the situation in the developed nations is summed up by johnson : the surgeon s major role in the management of peptic ulcer disease will be the performance of life - saving emergency operations in the elderly unfit patient . in contrast to the developing world , the patients are younger and have a long life - time of potentially useful activity ahead of them[18 ] as anti - secretory and anti - h . hence , we set out in this review to look at the prevalence , pattern of presentation , risk factors and management outcome in the study environment and we also set out to look at the management pattern if sufficient for a semi - urban area in a developing world . duodenal ulcer perforation is still a common complication of chronic peptic ulcer disease . despite the wide spread use of anti - secretory and h. pylori eradication therapy pylori eradication drugs are been freely used , we had expected an improvement in this disease condition .", "the diagnostic protocol for every patient at presentation included : the clinical findings , abdominal ultrasound , and chest x - rays which in some cases gave further credence to the diagnosis . the case records of all patients with clinically established diagnosis of pdus , managed in this center from january 2004 to december 2011 were reviewed . the patients were optimized for surgery with intravenous fluids , antibiotics , and urethral catheterization . full blood count , urea and electrolytes , creatinine , and urinalysis results were documented . this review was conducted at the federal medical centre ido - ekiti , southwest nigeria . clinical and intra - operative findings , treatment outcome and follow - ups were all evaluated .", "none of the patients had a prior diagnosis of their ulcer by an upper gastro - intestinal endoscopy ( ugie ) before presentation . the notable risk factor was the free abuse of herbal concoction ( admixture of local gin , spices , roots and bitters ) for body pains . most of the 26 managed patients had a favorable outcome ; were discharged home and followed - up at the clinic for 4 - 6 weeks but later lost to follow - up . after adequate resuscitation , all the 30 patients had emergency surgery of simple closure of their perforations , re - enforced with an omental patch and thorough peritoneal larvage . a good proportion of the patients 76.6% were referred to us from private health institutions , while the rest came to our center from their homes . although , 20 ( 66.6% ) of them had peptic ulcer symptoms with , inadequate or no medical treatment . the remainder , 10 ( 33.3% ) presented for the first time with perforation , with no prior treatment for peptic ulcer disease .", "omental patch closure + highly selective vagotomy omental patch closure + bilateral truncal vagotomy ( btv ) resectional surgery + truncal vagotomy pyloroplasty + btv . pdu is still a major complication of chronic peptic ulcer disease seen quite often in the study center , as well as other centers of the world as a frequent cause of acute abdomen . although experience from some parts of nigeria showed that gastric outlet obstruction has overtaken pdu in incidence , it is still frequently seen in many centers in nigeria , as well as many centers in the developed world.[17 ] this study has also highlighted that the perforation affected mostly the younger age group ( in their 3 -6 decade ) [ table 2 ] , which is in keeping with studies in many centers in the developing world.[111 ] much has been written about non - operative management of pdu in the western world . since the early works of croft et al . , there has been considerable interests in the non - operative management of pdus . in a randomized trial comparing surgical and non - surgical therapy , for pdu all patients had simple closure of their perforation with omental patch reinforcement , thorough peritoneal larvage and h. pylori eradication therapy was instituted . all patients were operated as soon as they were resuscitated and optimized for surgery . in the pre h. pylori era , in the developed world , it has been shown that only 30% of patients with pdu treated with simple closure and thorough peritoneal larvage had good long - term result . in the present era , ( h. pylori era ) , studies have shown , that operation may achieve long - term satisfactory results , only when h. pylori infections , present in 50 - 70% of patients with pdu is totally eliminated .", "the relative high costs of triple regime therapy for h. pylori eradication , fear of re - perforation and easy loss to follow - up , call for an urgent re - appraisal of the present method of surgical treatment . pdu disease is still a frequent cause of acute abdomen in many centers of the developing world where it affects mostly the youths . therefore , a more liberal role for wide spread definitive ulcer surgery is suggested for most of our young patients ." ]

[ "hemophilia b is a chronic hereditary disease characterized by a deficiency in factor ix ( fix ) activity . the benefit of such regimen in untreated patient or in primary prophylaxis or secondary prophylaxis remains to be demonstrated . effect of switching from twice - weekly to once - weekly prophylaxis is not yet known . gastrointestinal and intracranial bleeding can be life threatening.3 repeated bleeding into joints without adequate treatment can result in crippling chronic joint disease , pain , and reduced quality of life.3,58 the introduction and availability of factor concentrate has dramatically improved the treatment of hemophilia with a significant decrease in morbidity and mortality , and an increase in quality of life.9 early on - demand treatment of acute bleeding episodes decreases the number of joint deformities compared to untreated or minimally treated patient.10,11 nevertheless , long - term musculoskeletal follow - up of on - demand treatment in hemophilia showed a progressive deterioration of the joint functions in these patients . as on - demand treatment appears to be clearly suboptimal , prophylaxis meaning preventive use of clotting factor given at regular intervals was proposed and adopted since several decades in sweden.12 in 1994 , the medical and scientific advisory council ( masac ) of the us national hemophilia foundation issued guidelines stating that prophylaxis with twice- or thrice - weekly fix infusion , at a dose of 2540 iu / kg , should be considered the optimal treatment for hemophilia b.13 the european pediatric network for haemophilia management define primary prophylaxis as regular treatment started after first episode of bleeding and secondary prophylaxis as regular or intermittent regular treatment started after several episodes of bleeding.14,15 the world federation of hemophila ( wfh ) guidelines recommend prophylaxis to prevent bleed and joint destruction and preserve normal musculoskeletal function . prophylaxis should be the state - of - art treatment.3 despite the guidelines , prophylaxis has not been universally adopted . those who switched from intermittent prophylaxis to on - demand prophylaxis experienced improvements in physical and mental hrqol.26 there is no general agreement on the optimal prophylaxis regimen , and some schemes differ from those proposed by the consensus perspectives on prophylactic therapy for hemophilia , held in london , september 2021 , 2002.14 given the paucity of controlled clinical trials regarding prophylaxis in subjects with hemophilia b , choice of treatment approach is limited to clinical judgment , clinical experience , and interpretation of currently available data based on pharmacokinetics ( pk ) , bleeding phenotype , and type of fix used . in recent years , greater", "medical , psychosocial , and cost controversies limit the implementation of prophylaxis.16 in the canadian 2006 survey , only 32% of patients with severe hemophilia b received prophylaxis , while 69% of patients with hemophilia a received the treatment . prophylaxis should be the state - of - art treatment.3 despite the guidelines , prophylaxis has not been universally adopted . in 1994 , the medical and scientific advisory council ( masac ) of the us national hemophilia foundation issued guidelines stating that prophylaxis with twice- or thrice - weekly fix infusion , at a dose of 2540 iu / kg , should be considered the optimal treatment for hemophilia b.13 the european pediatric network for haemophilia management define primary prophylaxis as regular treatment started after first episode of bleeding and secondary prophylaxis as regular or intermittent regular treatment started after several episodes of bleeding.14,15 the world federation of hemophila ( wfh ) guidelines recommend prophylaxis to prevent bleed and joint destruction and preserve normal musculoskeletal function . moreover , it is advisable to give it to all patients before performing any activities associated with an increased risk of trauma . this difference could be explained by a less severe phenotype , less frequent joint bleeds , later presentation in life , paucity of clinical trials studying the use of prophylaxis , or simply a current treatment tradition.17 moderate hemophilia b is diagnosed much more frequently than the severe ( 37% versus 27% ) form .", "there is no general agreement on the optimal prophylaxis regimen , and some schemes differ from those proposed by the consensus perspectives on prophylactic therapy for hemophilia , held in london , september 2021 , 2002.14 given the paucity of controlled clinical trials regarding prophylaxis in subjects with hemophilia b , choice of treatment approach is limited to clinical judgment , clinical experience , and interpretation of currently available data based on pharmacokinetics ( pk ) , bleeding phenotype , and type of fix used .", "in recent years , greater attention has been paid to the pk of coagulation factor , dosing intervals , and trough levels . authors suggest that dosing in prophylactic treatment should be individualized.41 due to interindividual variations in pk parameters , targeting a particular trough level may not be appropriate for every individual.41 relationship between fix trough levels and therapeutic outcomes has not been confirmed in clinical trials.40 they are routinely measured in clinical practice to guide treatment dosing , particularly for primary prophylaxis , and in connection with surgery.27 in 2011 , the european medicines agency considered appropriate incremental recovery , half - life , area under the curve ( auc ) , and clearance to be the most important surrogate end points for efficacy of fix products.28 pk parameters of fix are not well characterized or widely investigated . fix is a small protein ( 55 kda ) with access to both intravascular and extravascular compartments.34 a number of clinical observations in hemophilia b patients suggest the presence of extravascular pool of fix .", "baseline factor levels are not the only determinants of bleeding phenotype in hemophilia . with the same factor level , the severity and frequency of bleeding may be different for people with hemophilia.42 in hemophilia b , where limited data exist , there is a need to strike a balance between clinical and pk end points in the evaluation of clinical efficacy.43 in hemophilia , bleeding frequency is considered a key indicator of the efficacy of the treatment regimen . the hemophilia severity score ( hss ) has been developed as a method to predict bleeding score in hemophilia.44 it includes in its assessment the annual joint bleeding rate , annual factor consumption , and wfh orthopedic score . this score was used by vyas et al to evaluate 178 hemophilia patients without inhibitors in a single us center ( hemophilia a [ n=139 ] , hemophilia b [ n=39 ] ) . they found heterogeneity of hemophilia phenotype and widespread variability in the hss values of patients with the same baseline factor activity.45 data from a single - center cohort study of 171 patients with severe hemophilia a and b in the netherlands demonstrated the importance of clinical issues in determining the phenotype .", "historically , effective treatment of hemophilia b started with fresh frozen plasma and prothrombin complex concentrate . in the early 1990s , highly purified plasma - derived factor concentrate was introduced.49,50 since then , large numbers have become commercially available.51 improvement in sourcing and purification procedure of blood components and the introduction of different steps of viral inactivation increased the safety of plasma - derived concentrates.52 despite these improvements , concerns remain and transfusion - transmitted emerging pathogens like prion and unencapsulated virus should not be overlooked.5356 in 1997 , the first purified rfix product , nonacog alfa , received us food and drug administration ( fda ) approval followed in 2014 by another rfix product , bax326 .", "the benefit of such regimen in untreated patient or in primary prophylaxis or secondary prophylaxis remains to be demonstrated . effect of switching from twice - weekly to once - weekly prophylaxis is not yet known . wfh who and nnh propose the twice- or thrice - weekly prophylaxis dose of 50 iu / kg . this regimen was extrapolated from the fviii prophylaxis experience , early pk data , and the few studies done on fix . in the original phase 3 nonacog alfa study in previously treated subjects aged 12 years , the mean dose was 40.3 iu / kg administered 23 times weekly.22 in the phase 3 trial of reformulated nonacog alfa in previously treated subjects , the median dose was 51.7 iu / kg administered 23 times weekly.30 frequency and dose of prophylaxis were determined by the investigator in these two studies . both the studies demonstrated safety and efficacy in persons with hemophilia b. however , rigorous regimens of prophylaxis are difficult and adherence remains a problem.66 only 45% of individuals with severe hemophilia b are currently receiving prophylaxis in the us.67 cost of clotting factor is certainly a main obstacle for the implementation of such management . this study evaluated the efficacy and safety of once - weekly prophylaxis with 100 iu / kg nonacog alfa compared with on - demand treatment in 25 adolescent and adult patients for a period of 52 weeks.76 at visits 2 and 4 of the study , assessment of thrombosis was done with monitoring of d - dimers and tat iii complex . no severe adverse event was observed and once - weekly prophylaxis was well tolerated.77 the studies of valentino75 and kavakli76 showed efficacy of once - weekly prophylaxis with no unexpected safety issues , no thrombotic event , no occurrence of inhibitors , and significant reduction in bleeding episodes .", "further research is needed to identify ideal prophylaxis regimens for patients with varying severity of hemophilia b. once - weekly prophylaxis with rix may be a viable treatment option for patients with hemophilia b. prophylaxis regimen at 100 iu / kg may be a safe and effective alternative to twice - weekly prophylaxis at 50 iu / kg . prophylactic regimen must be more convenient to patients and their caregivers , while being effective and safe to improve adherence to treatment . however , it remains unknown how patients with a less severe bleeding phenotype or with better baseline joint status might respond to once - weekly dosing with rix . in many regions of the world , the current unmet challenges with regard to management of hemophilia b are financial sustainability , inhibitor occurrence , and poor uptake of prophylaxis . to minimize the cost of treatment and to tailor individual treatment to clinical response , it would be of interest to investigate the effect of once - weekly administration of lower doses of fix ." ]

[ "the objective of the present study was to isolate and characterize proteins with protease inhibitory activity from white cloud beans . protease inhibitors have been purified from an array of leguminous and nonleguminous species encompassing torresea cearensis , erythrina caffra , dolichos lablab , crotalaria paulina , medicago scutellata [ 5 , 6 ] , canavalia gladiata , pisum sativum , dimorphandra mollis , swartzia pickellii , psophocarpus tetragonolobus , delonix regina , poecilanthe parviflora , adenanthera pavonina , cajanus cajan , dolichos biflorus , phaseolus acutifolius , arachis hypogaea , leucaena leucocephala , bauhinia bauhinioides , bauhinia variegata , bauhinia ungulata , vigna unguiculata , lens culinaris , glycine max , peltophorum dubium , pithecellobium dulce , glycine soja , and barley . protease inhibitors impair the activity of insect midgut proteases and thus adversely affect protein digestion and health in insects . they represent one of the multitude of entomotoxic proteins [ 30 , 31 ] . in addition to insecticidal activity [ 3235 ] , protease inhibitors demonstrate antiproliferative and antitumor activities [ 3645 ] .", "the activity of sars coronavirus ( cov ) protease was reflected by a cleavage of designed substrate which is composed of two proteins linked by a cleavage site for sars cov protease . the inhibitory activity of the trypsin inhibitor was calculated as percent inhibition compared to a control without the trypsin inhibitor . the highest iodoacetamide concentration used in the test was devoid of any effect on trypsin activity and the trypsin inhibitory activity of isolated trypsin inhibitor and soybean trypsin inhibitor . residual trypsin inhibitor activity was measured at ph 7.4 as described above in assay for trypsin inhibitory activity . a nonradioactive elisa - based hiv-1 integrase assay was carried out according to the dna - coated plate method . in this study the assay for hiv reverse transcriptase inhibitory activity was carried out in view of the report that trypsin inhibitors manifest this activity [ 50 , 51 ] . the detection and quantification of synthesized dna as a parameter for rt activity are based on a sandwich elisa protocol . ", "anion exchange chromatography of the bean extract on deae - cellulose resolved it into three fractions , an unadsorbed fraction d1 together with two adsorbed fractions d2 and d3 . ion exchange chromatography of fraction b1 on sp - sepharose resolved it into a small unadsorbed fraction sp1 and three large adsorbed fractions ( sp2 , sp3 , and sp4 ) of about the same size ( figure 1 ) . dtt treatment curtailed the trypsin inhibiting activity in a dose- and time - dependent manner ( table 3 ) . the two trypsin inhibitors did not inhibit hiv-1 reverse transcriptase when tested at various concentrations up to 100 m ( table 4 ) . these two white cloud bean trypsin inhibitors inhibited trypsin with an ic50 of about 0.6 m ( figure 4 ) .", "the present study disclosed the production of two trypsin inhibitors with closely related n - terminal sequences chromatographic behavior and bioactivities by the white cloud bean variety of phaseolus vulgaris . white cloud bean trypsin inhibitors demonstrate antiproliferative activity against tumor cells but do no inhibit mycelial growth or hiv-1 reverse transcriptase . the isolation of two trypsin inhibitors with very similar biochemical and biological characteristics from white cloud beans was achieved in the present investigation . " ]

[ "although about two - thirds of patients with epilepsy ( pwe ) treated with antiepileptic drugs ( aeds ) reach seizure - freedom , about one - third remains drug - resistant to the current therapies.1 despite the introduction of new aeds with a better pharmacokinetic and safety profile compared to old generation aeds , today , one of the major causes of failure of antiepileptic treatment is poor adherence often due to occurrence of adverse drug reactions ( adrs ) , leading up to 25% of patients to discontinue treatment before the achievement of effective doses and with a consequent increase of health care costs.2,3 during the last 25 years , many efforts have been directed to the development of new aeds with different mechanisms of action able to reduce brain hyperexcitability ; recently considerable interest has been focused on synaptic vesicle protein 2a ( sv2a ) and its role as a target for aeds.4 the first drug of this new class approved for epilepsy is levetiracetam ( lev ) , and from this lead compound , several racetam analogs have been synthesized.5 based on target - drug program , brivaracetam ( brv ) ( 2s)-2-[(4r)-2-oxo-4-propylpyrro - lidinyl]butanamide , an n - propyl analog of lev has been identified and has entered clinical trials for pwe;6 it is an sv2a ligand with high selectivity and a 1030-fold higher potency , depending on the experimental conditions , when compared to lev.7,8 the purpose of this review is to present updated data available on the pharmacology , efficacy , and tolerability of brv . we have conducted a systematic search in the pubmed and cochrane library databases up to august 14 , 2015 summarizing all relevant data for efficacy , safety , and tolerability of brv in the treatment of partial - onset seizure .", "although the correlation between sv2a binding and anti - convulsant potency in animal models has been previously demonstrated , the role of sv2a in neurotransmission still remains unclear.9 in fact , even if it has been established that sv2a protein is involved in normal synaptic vesicle function , the exact mechanism of synaptic vesicle cycling regulation and neurotransmitter release remains unknown.5,9 several preclinical studies have demonstrated that brv is more potent and efficacious than lev in animal models of both focal and generalized epilepsy.10 in particular , in fully amygdala - kindled rats , brv induced a significant suppression in motor - seizure severity from a dose of 21.2 mg / kg , whereas lev caused a similar effect from a dose of 170 mg / kg .", "brv presents a favorable pharmacokinetic profile , linear and predictable , with low intersubject variability and almost 100% bioavailability.2123 the pharmacokinetic properties of brv have been studied in healthy adult volunteers , in the elderly , in patients with pwe , and in those with hepatic or renal impairment.2225 the pharmacokinetic differences in elderly subjects compared to healthy volunteers are not so important as to require any dose adjustment.25 absorption of brv is unaffected by the presence of food , including high fat meals ; after oral administration , brv is rapidly absorbed by the gastrointestinal tract , and displays linear and dose - proportional profile over the dose range tested.22,26 its distribution volume is close to total body water ( vz=0.5 l / kg ) , and it binds weakly to plasma proteins ( 17.5% ) . it is possible to speculate that saliva might be a suitable sample for monitoring brv levels when blood sampling could be a limiting factor.23 brv is extensively metabolized through several metabolic pathways and is fully excreted by urine ( only 8%11% remains unchanged ) . its terminal half - life is ~9 hours.21 saliva and plasma brv levels are highly correlated , brv crosses the mucosa by passive diffusion , therefore , the saliva concentration of brv is correlated with plasma concentration .", "the efficacy of brv as add - on therapy in patients with uncontrolled partial seizures has been assessed in six randomized placebo - controlled clinical trials ( table 1).29 in the first two studies , brv as adjunctive therapy in adult patients with partial epilepsy and poor control with 12 concomitant aeds , at different doses ( 5 , 20 , 50 , and 50150 mg / d ) has been evaluated.30,31 french et al30 reported a statistically significant reduction of seizure frequency achieved at the 50 mg / d dose , with high tolerability and infrequent adrs . in particular , the percentage reduction over placebo in focal seizure frequency / week was directly correlated to brv dose , respectively 9.8% at 5 mg / d , 14.9% at 20 mg / d , and 22.1% at 50 mg / d , with a median percent reduction from baseline in seizure frequency / week of 21.7% ( placebo ) , 29.9% ( brv5 ) , 42.6% ( brv20 ) , and 53.1% ( brv50 ) ; 50% responder rates were 16.7% ( placebo ) , 32.0% ( brv5 ) , 44.2% ( brv20 ) , and 55.8% ( brv50 ) ; seizure freedom rates during the 7-week treatment period were 1.9% ( placebo ) , 8.0% ( brv5 ) , 7.7% ( brv20 ) , and 7.7% ( brv50 ) . on the other hand , higher doses of brv would not seem to be more effective , in fact , van paesschen et al31 did not find significant differences in seizure frequency reduction between brv 50 and 150 mg / d during the 7-week maintenance period . similar to lev , brv might become a useful aed for the treatment of myoclonic seizures occurring in the setting of idiopathic generalized epilepsies ( eg , juvenile myoclonic epilepsy)36 or of progressive myoclonic epilepsies.37 two randomized , placebo - controlled trials evaluating efficacy and safety of adjunctive brv ( 5150 mg / d ) in unverricht recently a randomized , multicenter , double - blind phase iii trial was conducted by klein et al34 to evaluate the efficacy and the safety profile of brv at fixed doses of 100200 mg / d in adult patients with refractory partial onset seizures . finally , to date , in all studies performed , brv was evaluated as an oral tablet formulation , and no data are available about intravenous infusion since the study nct02088957 , aiming at a comparison of the efficacy and safety of intravenous brv vs phenytoin in adult subjects with nonconvulsive electrographic seizures , was terminated for low enrollment .", "the most commonly reported adverse effects with brv in adults were primarily related to the central nervous system and included somnolence , fatigue , and dizziness.22 these adverse effects were mild to moderate , and the tolerability profile is so excellent that it did not impair therapeutic compliance . in fact , the daily dose of brv ( 20150 mg ) was well tolerated and associated with 6.1% of discontinuation rates due to adrs compared to 5.0% of the placebo group.35 furthermore , adrs induced by brv seem to be time - related , disappearing during the course of treatment . the entity of sedative effects of brv measured by psychometric tests is dose - related in healthy men and appeared clearly from 600 mg upwards as a decrease in attention , motor control , and alertness.22 moreover , the type and the severity of adrs are not influenced by food.22 as demonstrated in healthy males , a twice - daily dosing regimen could be a good clinical practice to reduce blood fluctuations and peak , which might influence the appearance of adverse events.22 no effects on cardiac function were reported even at very high daily dosages ( up to 800 mg / d).40 no data about fertility and/or potential teratogenic effect of brv in humans are currently available ; however , no adverse effects were detected up to the highest tested oral dose of 400 mg / kg / d on fertility , and no effects on pregnancy or fetal development at 600 mg / d were observed in animals.26 seizure aggravation or the appearance of new generalized seizures was rare : three studies reported this adverse event , occurring in similar proportions between placebo and treated group ( 4.3% vs 5.2% , p=0.67).32,33,35 in the above - reported five randomized clinical trials , 1,639 subjects were included in an intention - to - treat analysis ( 1,214 treated with brv and 425 with placebo).3035 no differences were observed in the proportion of subjects experiencing at least one adverse event ( 65.5% with brv vs 60.5% with placebo , p=0.10 ) . the proportion of patients reporting fatigue and somnolence was significantly higher in brv group compared to placebo ( table 2 ) . irritability was reported in three studies only , and it was present in a small proportion of subjects ( 3% receiving brv , 1% receiving placebo , p=0.36 ) .", "no effect on contraceptive disposition is reported at therapeutic doses of brv 100 mg / d.39 interestingly , there is a possible negative interaction between brv and lev , in fact , the concomitant use of both drugs may reduce brv efficacy ; however , this evidence is not robust because the number of patients with concomitant lev was very small , other studies may be useful to assess this apparent pharmacodynamic interaction.33 because of its advantageous pharmacokinetic profile , brv treatment does not appear to influence plasma concentrations of other aeds such as carbamazepine , lamotrigine , lev , oxcarbazepine , topiramate , or valproic acid.41 however , carbamazepine plasma levels are slightly reduced by coadministration of brv ( 400 mg / d ) , while levels of carbamazepine - epoxide are increased in a dose - dependent manner.26,42 this increase of plasma concentration of carbamazepine - epoxide is the result of inhibition by brv of epoxide hydrolase that metabolizes carbamazepine - epoxide into carbamazepine - diol.42 high doses of brv ( 400 mg / d ) cause a moderate decrease of ethinylestradiol and levonorgestrel plasma levels ( components of oral contraceptives ) but this posological range has no impact on ovulation .", "brv is a novel aed whose efficacy in partial epilepsies has been studied and established in five randomized controlled trials;3035 furthermore , two recent meta - analyses have confirmed significant effects for brv in patients with refractory partial seizures.29,43 considering that brv shares part of its mechanism of action with lev and that its ability to inhibit vgsc ( still debated ) is in common with several other aeds , it will be very intriguing to see how this drug will behave in real - life clinical practice . based on this hypothesis , brv may be reasonably considered as a valuable add - on aed in patients with partial seizures , also considering its suggested good tolerability . accordingly , it could be hypothesized that brv might possess at least the same effectiveness as lev . however , specific studies are needed to confirm its efficacy in specific epileptic syndromes , for example , a decreased expression of sv2a in the hippocampus of patients with temporal lobe epilepsy with hippocampal sclerosis has been documented and might represent a pharmacoresistance mechanism in some cases ; however , lev has been reported to be effective.44,45 in addition , because of its good safety and pharmacokinetic profile , brv might be ideal for use in monotherapy , as previously demonstrated for lev.46 finally , few studies have been performed , and more randomized double - blind studies are needed to confirm these considerations and to demonstrate if brv might really confirm its promises and become a new tool for epileptologists ." ]

[ "\n acute intussusception is one of the most common causes of acute abdomen in infants . management includes both surgical and non - surgical methods , with gradually increasing importance recently being accorded to the latter . conservative measures , including hydrostatic reduction , are the methods of choice for initial management . though widely accepted , the expertise is still not widely available , especially in developing countries .", "\n a six - month - old child presented with complaints of repeated episodes of vomiting that contained only ingested milk . the procedure was done in the ultrasonography room in the presence of a treating physician and a pediatric surgeon . without using any sedation , this was associated with the patient s improved condition , which included less crying and irritability . the parents were told about the possibility of recurrence and asked to pay close attention for the onset of symptoms . \n", "\n acute intussusception is defined as the telescoping of the proximal bowel ( intussusceptum ) into the distal bowel ( intussuscipiens ) . there is still some controversy regarding the exact method of the procedure , which can be attributed to the poor training of physicians and to the general belief that intussusception is entirely a surgical problem , especially in developing countries . the management of intussusception has seen a paradigm shift in recent years . in the past , the preferred non - surgical method involved use of a barium enema for reduction , followed by the air insufflation method . \n \n hydrostatic reduction using ultrasound - guided saline reduction has recently gained acceptance as the procedure of choice for initial nonsurgical management of intussusceptions in children . diagnosis usually needs a high suspicion on the part of the treating physician , as presentation can be quite varied , including irritability , vomiting , and poor feeding .", "" ]

[ "1structure of chitosan structure of chitosan in the present study , an attempt has been made to assess the salubrious effect of dietary chitosan intake on myocardial lipid peroxidation and glutathione - dependent antioxidant status in young and aged rats by virtue of its antioxidant and hypolipidemic properties . though the beneficial effects of chitosan have been extensively studied , the antiaging effect of chitosan has not yet been explored.fig . the identification of natural molecule with antioxidant , antilipidemic , and membrane - stabilizing properties is , therefore , one strategy to facilitate healthy aging . aging , a multifactorial process of enormous complexity , is characterized by impairment of physiochemical and biological aspects of cellular functions ( harman 1992 ) . oxidative stress , an unavoidable consequence in the metabolism of oxygen in aerobic cells , is a major factor in the aging process and , in the course of many chronic diseases , associated with aging ( mattson 2002 ) .", "each group was further subdivided into three groups ( six rats each ) : one control group ( group ia and group iia ) and two experimental groups based on the duration of supplementation of chitosan at 2 % level along with feed 30 days ( group ib and group iib ) and 60 days ( group ic and group iic ) . at the end of the experimental period , no.ingredientscomposition ( g/100 g diet)1carbohydrate ( nitrogen free)56.22crude protein22.03ash7.54crude oil4.25crude fiber3.06glucose2.57vitamins1.88sand silica1.49calcium0.810phosphorus0.6 composition of standard diet seven days after acclimatization , the animals were divided into two major groups : group i consisted of 18 normal young rats and group ii consisted of 18 normal aged rats . male wistar strain albino rats , weighing 120150 g [ 18 young rats of 23 months old ( mean age , 79.2 6.53 days ) ] and 350400 g [ 18 aged rats of 2025 months old ( mean age , 712 51.6 days ) ] , were selected for the study . the homogenate was used for the estimation of lipid peroxides ( lpo ; ohkawa et al . the animals were sacrificed , and the blood was collected in a heparinized tube for the separation of plasma . high - density lipoprotein - cholesterol ( hdl - cholesterol ) in plasma was determined by the method of izzo et al . ( 1981 ) , and low - density lipoprotein - cholesterol ( ldl - cholesterol ) was estimated according to the calculation of friedwald et al . the experiment was carried out according to guidelines of the committee for the purpose of control and supervision of experiments on animals , new delhi , india , and approved by the institutional animal ethics committee of the central institute of fisheries technology , cochin , india.table 1composition of standard diets .", "chitosan ( mw , 750,000 da ; viscosity , 8 cp ; deacetylation rate , 8587 % ; purity , 98.6 % ) used in the experiment was a kind gift from dr . t. k. thankkappan , principal scientist , central institute of fisheries technology , cochin , india . reduced glutathione , tetraethoxypropane , and 2-thiobarbituric acid were procured from m / s sigma chemical company , st .", "male wistar strain albino rats , weighing 120150 g [ 18 young rats of 23 months old ( mean age , 79.2 6.53 days ) ] and 350400 g [ 18 aged rats of 2025 months old ( mean age , 712 51.6 days ) ] , were selected for the study . the experiment was carried out according to guidelines of the committee for the purpose of control and supervision of experiments on animals , new delhi , india , and approved by the institutional animal ethics committee of the central institute of fisheries technology , cochin , india.table 1composition of standard diets . no.ingredientscomposition ( g/100 g diet)1carbohydrate ( nitrogen free)56.22crude protein22.03ash7.54crude oil4.25crude fiber3.06glucose2.57vitamins1.88sand silica1.49calcium0.810phosphorus0.6 composition of standard diet the animals were housed individually in polypropylene cages under hygienic and standard environmental conditions ( 28 2 c ; humidity , 6070 % ; 12 h light / dark cycle ) . the animals were allowed a standard diet ( m / s sai foods , bangalore , india ; table 1 ) and water ad libitum .", "each group was further subdivided into three groups ( six rats each ) : one control group ( group ia and group iia ) and two experimental groups based on the duration of supplementation of chitosan at 2 % level along with feed 30 days ( group ib and group iib ) and 60 days ( group ic and group iic ) . at the end of the experimental period , seven days after acclimatization , the animals were divided into two major groups : group i consisted of 18 normal young rats and group ii consisted of 18 normal aged rats . the homogenate was used for the estimation of lipid peroxides ( lpo ; ohkawa et al . the animals were sacrificed , and the blood was collected in a heparinized tube for the separation of plasma . the heart tissue was excised immediately and homogenized in ice - cold 0.1-m tris hcl buffer in a potter high - density lipoprotein - cholesterol ( hdl - cholesterol ) in plasma was determined by the method of izzo et al .", "multiple comparisons of the significant anova were performed by duncan 's multiple range comparison test . a p value < 0.05 was considered as statistically significant . all data were analyzed with the aid of statistical package program spss 12.0 for windows .", "in conclusion , the overall antiaging effect of dietary chitosan intake is probably related to its ability to inhibit the increased accumulation of lipids both in the systemic circulation and in the myocardium by its antilipidemic property , or to normal maintenance of the activities of glutathione - dependent antioxidant enzymes and the level of gsh , which protect myocardial membrane against oxidative stress by decreasing lipid peroxidation reactions . , there was a significant ( p < 0.05 ) increase in the level of lipid peroxidation observed with a concomitant reduction in the level of nonenzymatic ( gsh ) and enzymatic ( gpx and gr ) antioxidants in the heart tissue of group iia aged rats as compared to group ia young control animals ( table 3 ) . in the present study , the dietary supplementation with chitosan significantly reduced the total cholesterol level in plasma and myocardial tissue of group iic aged rats as compared to group iia rats . 2007 ) . in our study , the dietary chitosan intake significantly attenuated the age - associated oxidative stress and maintained the level of the glutathione - dependent antioxidant status in the heart tissue at near normal ." ]

[ "the aim of this retrospective pilot study was to examine and compare the cleft lip \n and palate patients ' satisfaction after treatment with either maxillary distraction \n or traditional advancement of the maxilla after a le fort i osteotomy . cleft lip and palate ( clp ) patients are going through an extensive treatment with \n orthodontic and surgical correction of the position of teeth and hard and soft \n tissues . the aim of the primary surgery is to close the clefts of the lip and the \n soft palate . the aim of the secondary surgery is to close the cleft of the alveolus \n by bone grafting . since the \n 1970 's the standard treatment of clp - patients with a maxillary hypoplasia has \n been a le fort i osteotomy with a bone graft .", "conventional group ( conv ) included patients treated with \n traditional advancement of the maxilla after a le fort i osteotomy in the period \n 1996 - 2007 . in the period 1996 - 2007 forty - two clp - patients with need for advancement of the \n maxilla were surgically treated at the department of oral and maxillofacial surgery , \n aarhus university hospital by either traditional advancement of the maxilla or \n distraction osteogenesis . until 2000 consequently , the patients in \n this study consisted of two groups of clp - patients with the need for \n surgical - orthodontic correction of maxillary hypoplasia . the group do included patients treated with maxillary distraction table 1 . patients ' characteristics according to gender , type of cleft , type \n of surgery performed , type of distractors used and age at surgery unsegmented le fort i osteotomy and internal distraction . unsegmented le fort i osteotomy and external distraction . the treatment was a conventional combined orthodontic - surgical treatment with \n model surgery and splint fabrication for the maxillary position and completed with \n postsurgical orthodontics . the treatment was a conventional \n combined orthodontic - surgical treatment with model surgery and splint fabrication \n for the maxillary position and completed with postsurgical orthodontics .", "the duration of the orthodontic treatment was in average 10 months longer in the do \n group than the conv group and this difference was significant ( p < 0.05 ) . neither \n the age distribution nor the period of time between surgery and completion of the \n questionnaire differed significantly ( p < 0.05 ) table 2 . distribution of the patients ' groups according to gender , age at \n surgery and period between surgery and completion of the \n questionnaire after the primary surgery with insertion of the \n distractors . after the surgical procedure . results of the patients ' satisfaction on a continuous visual \n analog - scale ( vas ) on a vas - scale scaled 0 - 100 with the score 0 indicating the \n highest level of satisfaction with functional parameters or facial \n aesthetics and the score 100 indicating the lowest level of \n satisfaction . both groups felt a great deal of satisfaction with their appearance both according to \n themselves and the perceptions of relatives and other people 's reaction in \n general . the greatest difference occurred in the parameter satisfaction with the \n duration of the treatment course . the do group scored higher on the vas - scale \n according to less satisfaction with the duration than the conv group . statistical \n analyses revealed no significant differences ( p > 0.05 ) among the groups which \n may be explained by the numbers of patients included in the study .", "the present study \n is a pilot study and evaluates retrospectively patients ' satisfaction in two groups \n of clp - patients treated for maxillary hypoplasia with either maxillary distraction \n or conventional le fort i advancement . distraction osteogenesis has become a widely used treatment of maxillary hypoplasia \n in clp - patients because of the reports of better stability and the possibility for \n larger advancements . however , it is a more complicated treatment because of the \n period with active distraction , the obligate need for good cooperation and the long \n consolidation phase with the patient still wearing the appliance . the results indicated a high level of satisfaction with the facial aesthetic at the \n end of treatment in both the do and the conv group .", "1 . cleft lip and palate patients experience a high level of satisfaction with \n functional parameters and aesthetics after surgical - orthodontic treatment of \n maxillary hypoplasia . patients treated with distraction osteogenesis were less satisfied with the \n duration of their treatment than the conventional group .", "no external \n funding , apart from the support of the authors ' institution , was available for \n this study ." ]

[ "a rising trend in the incidence and prevalence of inflammatory bowel disease ( ibd ) in asia has been recognized for the past two decades . the thiopurine drugs azathioprine ( aza ) and mercaptopurine are widely used for the treatment of ibd and have proven to be effective in both inducing and maintaining remission of crohn 's disease and ulcerative colitis ; however adverse effects can occur in 928% of patients , and these adverse effects often necessitate a dose reduction or discontinuation . there have also been some cases of ulcerative colitis with prolonged remission following aza - induced pancytopenia [ 5 , 6 ] . nevertheless , some reports suggested that neutropenia during aza therapy reduced the relapse rates in ibd patients [ 1 , 2 ] , and that the eradication of sensitized leukocytes , which was done by leukapheresis or bone marrow transplantation , improved ibd in some cases [ 3 , 4 ] .", "a 22-year - old man with a known history of crohn 's colitis who had undergone fistulectomy for complex perianal fistula 2 years previously was admitted with a complaint of severe weight loss ( 25 kg during 2 years ) , diarrhea , abdominal pain and recurrent perianal tenderness . after recovering from cytopenia , the frequency of bowel movements decreased and the perianal pain and oozing improved gradually . follow - up colonoscopy was performed 3 months later and demonstrated diffuse fibrotic scar instead of multiple ulcerations ( fig . contrast - enhanced computed tomography scan of the abdomen showed multifocal inflammatory wall thickening and thick - walled abscess pockets with the beaded appearance of subcutaneous small abscesses in the precoccygeal and perianal area ( fig .", "the tpmt was the wild type and this result raised doubts whether tpmt can be a reasonable screening test to identify patients with a high risk of severe myelotoxicity due to an inherited deficiency of tpmt activity . in conclusion , we report here a patient who had crohn 's colitis and complicated perianal fistulas that required immunosuppression , and who achieved endoscopically determined remission that showed accelerated mucosal healing as well as clinical remission after aza - induced pancytopenia . dieckgraefe and korzenik investigated the safety and possible benefit of gm - csf for the treatment of 15 patients with moderate to severe crohn 's disease . in fact , clinical relapse of ibd is characterized by increased neutrophil migration into the intestine . . moreover , some reports have described cases of ulcerative colitis with prolonged remission following pancytopenia . first , given that altered host immunity plays an important role in ibd activity , it is possible that this patient 's host immunity was reset following the pancytopenia caused by aza . according to one report that analyzed the course of patients with crohn 's disease and ulcerative colitis and who underwent allogeneic stem cell transplantation for myeloid leukemia and myelodysplastic syndrome , 10 of 11 patients showed no ibd activity after stem cell transplantation , and the colonoscopy after complete discontinuation of prophylactic posttransplant immunosuppression revealed no pathologic findings ." ]

[ "the aim of our study was to analyse the vitreous and serum of diabetic patients with dme and severe npdr and compare them to nondiabetic controls . we compared blood and vitreous levels of vegf , ua , and protein between the two study groups and describe their correlation with the changes seen in oct . , we found that also the intravitreal uric acid ( ua ) concentrations correlated significantly with degree of dr . the analysis focused on vegf and ua as two possible pathogenetic factors in the development of dme . we suspect that ua may play a role in the pathogenesis of dr and dme : studies of ua strongly suggest that its redox potential affects endothelial function and might contribute to the brb breakdown .", "the indications for vitrectomy in this study were macular edema and preoperative best corrected visual acuity ( bcva ) more than 0.3 logmar ( logarithm of the minimum angle of resolution ) and in the diabetic group no or poor response to previous therapy with photocoagulation or intravitreal injection . first group involved 16 subjects with type 2 diabetes mellitus ( dm ) with npdr and cystoid dme . in this group , the mean duration of dm was 18.6 8.3 years and 15 patients ( 93.75% ) were treated with insulin and 1 patient ( 6.25% ) was treated with peroral antidiabetics . the center involving dme was defined clinically and confirmed by retinal thickening in cross - sectional spectral domain ( sd ) oct scans . a group of 13 nondiabetic subjects with idiopathic epiretinal membrane and diffuse retinal thickening served as control . the retinopathy was graded according to the early treatment diabetic retinopathy study research group and patients enrolled in the study had moderate to severe nonproliferative dr ( npdr ) . vitrectomy was performed to improve visual acuity and to decrease retinal thickness in the macula .", "furthermore , we found that the cv measured with cirrus hd - oct correlate significantly with the concentration of vegf in the vitreous of patients with npdr and dme . in our earlier study , we showed that the levels of intravitreal ua correlated significantly with the degree of dr and recently also serum ua concentration has been found to be associated with increase in severity of dr . the results demonstrate that biochemical analysis of the vitreous showed significant higher concentrations of vegf , ua , and total protein in dm and control group . moreover , in patients with dme intravitreal levels of ua correlate significantly with intravitreal levels of vegf . finding significant higher ua concentration in vitreous of dm compared to controls and a correlation between ua and vegf in the vitreous of npdr patients supports our assumption that ua too may be one contributing causal factor in the pathogenesis of dr . , there was no significant correlation between vitreous vegf levels and crt of diabetic patients . although total vitreous protein was significantly higher in the diabetic group compared to controls , its level did not correlate with both ua and vegf . correlated significantly with vitreous vegf concentration ( = 0.559 , p = 0.03 ) . however , in dme vitreous vegf and ua did not correlate with the total vitreous protein .", "vitreous concentrations of uric acid and vegf were significantly higher in dm subjects than in controls . moreover , vitreous ua concentration correlated significantly with the vitreous vegf concentrations in patients with npdr and cystoid dme . increased vegf concentrations are known to be involved in the pathogenesis of dme . , we found that increased concentration of intravitreal vegf in patients with npdr and cystoid dme correlated with increase of cube volume calculated by cirrus hd - oct . since dme usually affects the macular area and not only the foveal region , the assessment of the vegf concentration in clinical practice using the cube volume is comprehensible . our results suggest that , apart from vegf , the role of ua in the pathogenesis and progression of dr should also be considered . comparing oct parameters to the vitreous levels of ua and vegf this oct parameter could be used to assess the efficacy of anti - vegf therapy ." ]

[ "this study aimed to investigate the impact of ficolin b ( the orthologue to human m - ficolin ) on the development of diabetic nephropathy in a mouse model of type 1 diabetes . the present paper focuses on the lectin pathway , in which at least five soluble pattern - recognition molecules are characterized that may activate the complement system , that is , mannan - binding lectin ( mbl ) , h - ficolin , l - ficolin , m - ficolin , and collectin - k1 . we speculate that ficolins also exert detrimental effects in diabetes similar to mbl through activation of the lectin pathway as indicated in patients with type 1 diabetes . three activations pathways exist : the classical , the alternative , and the lectin pathway . clear evidence indicates that the pathogenesis of diabetic nephropathy is multifactorial and triggered by a complex series of pathophysiological events .", "the ficolin b knockout mice and the wild - type mice were randomized into a diabetic and nondiabetic group ; thus four groups were made : ( 1 ) diabetic knockout mice ( n = 6 ) , ( 2 ) nondiabetic knockout mice ( n = 7 ) , ( 3 ) diabetic wild - type mice ( n = 11 ) , and ( 4 ) nondiabetic wild - type mice ( n = 11 ) . the main focus of interest was the interaction between the diabetic factor and the knockout factor ; that is , does ficolin b modify the effects of diabetes on the effect parameters ? if no interaction was found , the independent effects of diabetes and ficolin b on the kidney were estimated . this study was designed with two independent factors ; diabetes / nondiabetes and knockout / wild - type and thus analysed by two - way anova for normal distributed variable with equal variance . we used 11-week - old , female ficolin b knockout mice and age - matched , female c57bl/6j bomtac wild - type mice ( taconic , ry , denmark ) . the knockout ficolin b model was backcrossed more than 10 generations to a c57bl/6j bomtac genetic background ( own breeding ) . in each cage the 18-week experiment was initiated when the mice were classified as diabetic ( blood glucose > 15 mm ) . animals with more than 15% sustained weight loss , signs of illness , or persistent ketonuria were excluded from the study . two mice from each diabetic group were excluded because of insufficient increase in blood glucose levels .", "the kidney weight was equally increased in diabetic wild - type mice , 24% ( ci : 13%36% ) , and in the diabetic knockout mice , 29% ( ci : 12%47% ) , compared to the respective control groups ( figure 2(a ) ) . no interaction between knockout and diabetes was found ( p = 0.60 ) , indicating that wild - type and knockout mice develop the same degree of diabetes - induced renal hypertrophy . the albumin - to - creatinine ration ( acr ) was higher among the diabetic wild - type mice , 76 mg / g ( ci : 50103 mg / g ) , compared to the nondiabetic wild - type mice , 44 mg / g ( ci : 2563 mg / g ) , p = 0.07 . furthermore the diabetic knockout mice were significantly smaller than the diabetic wild type ( p < 0.05 ) . similarly , the acr of diabetic knockout mice was 96 mg / g ( ci : 71122 mg / g ) compared to the nondiabetic knockout group , 34 mg / g ( ci : 2344 mg / g ) , p < 0.001 . as depicted in figure 3 no interaction was observed between diabetes and ficolin b knockout , p = 0.21 . furthermore , no significant statistical difference was found in kidney weight per body weight between the diabetic wild - type , 1.95 mg / g , and the diabetic knockout , 2.89 mg / g ( p = 0.09 ) . ficolin b did not modify the diabetes - induced increase in kidney weight when testing for interaction ( p = 0.11 ) .", "in the present study we found no association between diabetes - induced kidney changes and the presence of ficolin b. we conclude that ficolin b is not responsible for , or a crucial contributory factor in , the pathophysiology of diabetic nephropathy . in our study , the kidney weight and to some extent the acr were altered by diabetes as expected . the diabetes - induced increase in kidney weight , measured by comparing the diabetic mice with the nondiabetic mice , was not statistically different between the wild - type and ficolin b knockout mice . the diabetes - induced increase in kidney weight was 24% in the wild - type mice and 29% in the ficolin b knockout mice . we are the first to investigate the role of ficolin b ( which corresponds to ficolin m in human ) in the inflammatory response of diabetic nephropathy . in mice with deficiency of mbl , our study provides important new information on the association between the lectin pathway and diabetic kidney damage .", "in conclusion , this study demonstrates that ficolin b does not modify the kidney weight and acr in a type 1 diabetes mouse model . this indicates that the role of the lectin pathway in the development of diabetic nephropathy is specific and that hyperglycaemia - induced glycations on renal cells may be more prone to bind mbl than ficolin b." ]

[ "how to choose surgical approach in severe multilevel cervical cord compression case is a hot debate on spine surgery . some surgeons prefer posterior approach , owing to easy decompression , low surgical risks and complications14 ) . whereas other surgeons suggest that combined anterior and posterior approach at one stage achieve more sufficient decompression though with increasing of complications and costs10 ) . thus , the purpose of this study was to investigate the causes for failed anterior multilevel acdf or accf , and the outcomes of secondary laminoplasty . some surgeons think anterior surgery should be of the primary choice , because of direct decompression , restoring intervertebral height and reconstruction of stability7,12 ) . reports elucidated the causes of unsatisfactory results and the revision techniques have so far been limited . multiple factors should be considered when a surgery is to be performed , especially on patients with multilevel cord compression from both ventral and dorsal parts .", "therapeutic treatments included traction , collar support , physical therapy , functional exercise and analgesics . of 23 patients , between feb 2003 and may 2011 , 23 patients who complained of persistence of primary symptoms or occurrence of new symptoms for more than 3 months after multilevel anterior cervical surgery ( acdf or accf ) in our spine surgery center were reviewed in the study . patients demonstrated as neck pain , cervical movement restriction , spasticity , sensory loss , weakness , or sphincter dysfunction to different extent . main indications for the second surgery were when patients displayed signs of cord compression at least at 2 levels associated with / without canal stenosis corresponding to signs of myelopathy . the study population consisted of 12 men and 5 women , with a mean age of 59.95.6 ( range , 49 - 78 ) years old . patients ' ages , gender , disease , the first surgical technique and levels , intervals between the first surgery and the onset of new symptoms or the persistence of primary symptoms , re - surgical levels , and causes for revision were examined .", "main indications for the second surgery were when patients displayed signs of cord compression at least at 2 levels associated with / without canal stenosis corresponding to signs of myelopathy . between feb 2003 and may 2011 , 23 patients who complained of persistence of primary symptoms or occurrence of new symptoms for more than 3 months after multilevel anterior cervical surgery ( acdf or accf ) in our spine surgery center were reviewed in the study . the study population consisted of 12 men and 5 women , with a mean age of 59.95.6 ( range , 49 - 78 ) years old . therapeutic treatments included traction , collar support , physical therapy , functional exercise and analgesics . of 23 patients , major exclusion criteria were symptomatic treatment less than 3 months , axial neck pain as the solitary symptom , cervical instability , active systemic infection , and other contraindications in routine surgery . instability documented as angle difference ( cobb angle ) more than 15 degrees and/or listhesis more than 3 mm on extension and flexion lateral views . patients demonstrated as neck pain , cervical movement restriction , spasticity , sensory loss , weakness , or sphincter dysfunction to different extent .", "a cervical midline incision is performed down to the cervical fascia , and the cervical musculature is reflected off of the involved cervical lamina . then the involved ligaments and flavum is removed until the pulse of dura sac is seen . the laminae are lifted carefully to create a greenstick fracture on the hinge side , expanding the spinal canal diameter the decompression levels extended to one level cranial or / and caudal to compressive lesions are included . the patient is placed in a hard cervical collar for the first 6 weeks after surgery .", "scores are based on the rating of motor function ( fingers , 0 to 4 points ; shoulder and elbows , -2 to 0 points ; and lower extremity , 0 to 4 points ) , sensory function ( upper extremity , 0 to 2 points ; lower extremity , 0 to 2 points ; and trunk , 0 to 2 points ) and urinary bladder function ( 0 to 3 points ) . recovery rate more than 75% was classified as excellent , 50 - 75% good , 25 - 50% fair , and less than 25% poor ; the excellent to good rate was calculated . patients ' ages , gender , disease , the first surgical technique and levels , intervals between the first surgery and the onset of new symptoms or the persistence of primary symptoms , re - surgical levels , and causes for revision were examined . patients were required to rate their neck pain , using the visual analogue scale ( vas ; 0 mm = no pain , 100 mm = worst pain ) at different intervals , supplemented with at 1 day postoperatively . cervical alignment was created by a line parallel to the inferior aspect of the c2 body and a line parallel to that of the c7 body , according to cobb 's method on neutral lateral view ( fig . the outcomes were evaluated preoperatively , at 1 week , 2 months , 6 months , and the final visit .", "all data were analyzed by sas 8.0 ( statistical analysis system , sas institute inc . , cary , nc , usa ) .", "one case demonstrated as axial pain and relieved 2 weeks after pain management and physical therapy . one case had excellent result , 5 good , 7 fair , and 4 poor , with an excellent to good rate of 35.3% at 1 week ; two cases had excellent results , 8 good , 5 fair , and 2 poor , with an excellent to good rate of 58.8% at 2 months ; three cases had excellent results , 9 good , 4 fair , and 1 poor , with an excellent to good rate of 70.6% at 6 months ; three cases had excellent results , 8 good , 4 fair , and 2 poor , with an excellent to good rate of 64.7% at the final visit . mean duration between the first surgery and the onset of new symptoms or persistence of symptoms was 14.54.2 ( range , 1 to 44 ) months . there were 8 patients of disease progression , with 4 cases of opll and 4 cases of cervical spondylotic myelopathy ( csm ) .", "laminoplasty should be considered as a primary procedure or as a revision procedure versus anterior approach in multilevel lesions because of effective decompression , preservation cervical alignment and minimum morbidity . acdf or accf has excellent and good results in treatment of cervical spondylosis and opll . besides , corpectomy of multilevel vertebrae in series destroys the integrity of spine column and has a risk of nonunion . especially for patients with congenital or acquired narrowed canal , the outcome was also worse in patients with expansion of high - signal area , which the causes might be not only from necrosis secondary to ischemia of the anterior spinal artery , but also from the repeated minor traumas inflicted on the cord from an unstable spine . combining the research and related literatures , we thought that multiple factors affect outcomes of revision surgery , which included age , extent lesion of cord , surgical times , mental disease , and so on . however , if the disease involved multiple levels or posterior compression , the ideal effects of anterior approach are difficult to achieve3,5 ) .", "laminoplasty has satisfactory results in failed anterior surgery , with a low incidence of complications ." ]

[ "but , use of drugs by the elderly and their clinical outcomes especially adverse drug reactions ( adrs ) have not been prominent research topic and continues to be given low priority in national and international public health arena , at least in a developing country like india . however , we feel that this probably needs more attention in india because we have not completely dealt with the scourge of communicable diseases yet . government and the who have already recognized the huge burden of preventable disease , disability , death and distress caused by the ncds . the present international health agenda guided by who focuses on four conditions ( cardiovascular disease , diabetes , cancer and chronic respiratory disease ) responsible for most of the premature mortality and four lifestyle risk factors ( smoking , harmful alcohol use , lack of physical activity and high salt , high fat diets ) leading to above conditions . medications play crucial role in geriatric health care as they treat chronic diseases , alleviate pain and improve quality of life . population aging will be faced globally by all countries in this century , although at varying levels of intensity and time . according to the world health organization ( who ) in addition , 70% of all older people now live in low- or middle - income countries , including india where sustainable pharmacovigilance systems has not developed as yet . it was the most distinctive global demographic event that the world witnessed in the past century and is an important event for the twenty - first century too . population aging is the process by which older individuals become a proportionally larger share of the total population .", "thus , studies have correlated the integral association between old age and increased rate of adrs arising out of confounding association between age and polypharmacy contributed by age - related changes in pharmacodynamics and pharmacokinetics at least for some medical conditions . the relationship between increased use of drugs and elderly is well established . consequently , increased use of medications in elderly increases the risk of adrs . out of all the factors that are most consistently associated with adverse drug reactions , polypharmacy is considered to be the most important . ( 1991 ) observed an exponential rather than the linear relation between the risks of adr and the number of medicines taken in 9000 elderly italian patients receiving 10 medicines . there has been much debate on whether advancing age by itself is a cause of increased risk of adrs but merely a marker for comorbidity , altered pharmacokinetics , and polypharmacy . gurwitz and avorn concluded that patient - specific physiological and functional characteristics are probably more important than any chronological measure in predicting both adverse and beneficial outcomes associated with specific drug therapies , while studies around the world have clearly shown that the risks of adrs ( including interactions ) is related to the number of medicines taken and sometimes due to inappropriate use of medicines .", ". the other contributing factor may be because of not considering the increased pharmacodynamic sensitivity of the elderly to several commonly used drugs , e.g. , central nervous system and cardiovascular drugs . since only around 3000 subjects receive a medicine prior to marketing type b adrs are usually uncommon , but rarely may sometimes cause serious toxicities . therefore , adrs in elderly are largely contributed by prescribing error e.g. , large doses of drugs without taking into account , the effect of age and frailty on drug disposition , especially renal and hepatic clearance the capacity of premarketing studies to recognize adrs is further reduced by the limited numbers of patients in the age group of 65 or older in trials and that even smaller numbers of the oldest old . , it is not surprising that less frequent ( particularly type b ) adrs are often recognized only after marketing . the classical pharmacological classification of adrs by rawlins and thompson divides adr into two major subtypes : type a reactions , which are dose - dependent and predictable , and unpredictable type b ( bizarre or idiosyncratic ) reactions . drugs associated with type a reactions are generally with low therapeutic index and commonly used among elderly .", "a drug combination may sometimes cause synergistic toxicity , which is greater than the sum of the risks of toxicity of either agent used alone . the latter has been defined in the literature in relative terms ( for example , the administration of an excessive number of drugs ) and in absolute terms , ranging from two to more than six simultaneous medications . for example , the combination of corticosteroids and nsaids : the risks of development of nsaid - induced peptic ulcer in older patients may increases by 10% among elderly . however , concurrent use of corticosteroids and nsaids had shown a risk of peptic ulcer disease that was 15 times greater than that of non - users of either drug . similarly , the relative risk of hospitalization for hemorrhagic peptic ulcer disease in elderly patients ( above 65 years ) has been observed to be increased by manifolds on concurrent use of oral anticoagulants and nsaids , while the risks were lower when used alone . in contrast to general population , the incidence of combination therapy is found to be greatest in the elderly . this suggests that there is certainly a need to recognize and consider the aspects of synergism of toxicity while prescribing medications in elderly .", "simple regimens of medication : choose the preparation suitable for the patient and minimize the dose whenever needed , but avoid advising the patient to break a single tablet into two or three equal pieces . ensuring safe management of medications by patients : involving patients in decisions on their therapy by educating the patient about important side effects and what to do if they occur . considering an adr as a possible cause for any new problem . utilizing available strategies and inter - disciplinary collaboration to enhance the quality use of medicines . considering an adr as a possible cause for any new problem.utilizing available strategies and inter - disciplinary collaboration to enhance the quality use of medicines . \n maintaining accurate record of all medications in use number of medications ( prescribed and non - prescribed ) : monitoring to balance the need and avoid polypharmacy while minimizing under - use of vital drugs . individual doses : reducing the doses wherever appropriate and titrating them carefully from a low starting dose , if pharmacodynamic sensitivity is likely to be the problem . some of the steps that may be helpful in minimizing adrs in elderly may be : \n maintaining accurate record of all medications in use : may include asking patients to bring all medications to clinic including the use of over - the - counter and complementary medicines.number of medications ( prescribed and non - prescribed ) : monitoring to balance the need and avoid polypharmacy while minimizing under - use of vital drugs.individual doses : reducing the doses wherever appropriate and titrating them carefully from a low starting dose , if pharmacodynamic sensitivity is likely to be the problem.simple regimens of medication : choose the preparation suitable for the patient and minimize the dose whenever needed , but avoid advising the patient to break a single tablet into two or three equal pieces.ensuring safe management of medications by patients : involving patients in decisions on their therapy by educating the patient about important side effects and what to do if they occur . minimize hoarding of previously used and expired drugs.therapeutic drug monitoring is encouraged , but should not replace clinical observation .", "further , growing pharmacotherapy with increase in the number of diseases in the elderly will require more timely and accurate drug safety data . this will result in promoting and ensuring a good health of older people , which can be of great benefit to their families and communities . . however , strategies to increase opportunities for identifying adrs and related problems have not been emphasized in current policy responses in india to meet the increase in elderly population and chronic conditions . policy changes that can result from better data on drug toxicities include withdrawal of drug from the market , change in drug labeling , educational programs to physician and changes in academic curriculum of pharmacology . pharmacoepidemiological studies that encompass large numbers of elderly drug users are needed to obtain this information as increased knowledge of the frequency and cost of adverse drug reactions is important in enabling more rational therapeutic decisions by individual clinicians and more optimal social policy . given quantitative information on medication risks , clinicians will be able to change the use of the drug ( prescribe for fewer patients , use safer alternatives when available , and use in lower doses for shorter duration ) or can take measures to minimize side effects ( prescribe prophylactic medications , increase monitoring for side effects , and intensify patient education ) . drugs are double - edged weapons and increased use of drugs by elderly increases the risk of adverse drug reactions causing increased morbidity and mortality . in addition , economic consequences of adrs constitute a problem of considerable magnitude . in the long run , more precise estimates of the true costs associated with adrs could stimulate development of prophylaxis and of alternative therapies ." ]

[ "day care or ambulatory anaesthesia is as old as the history of anaesthesia itself . in the last few decades , it has gained significant popularity mainly because of the enormous cost savings and has therefore been accepted by the hospitals , patients and the insurance companies alike . this study aimed to examine the incidence and factors associated with unanticipated admission following day care surgery at a tertiary level hospital in south india . unanticipated admission , whatever the cause , is an indicator of the quality of care because it negates the basic goal of preventing hospitalisation and same day discharge . while day care surgery in india is limited to a few hospitals , there is a dearth of data on hospitalisation following such intervention . however , the quality and excellence of care needs to be defined and defining good care is a challenge .", "it was planned to use the median value of controls for continuous exposure variables ( such as time of anaesthesia and time of starting last case ) to define exposure status . we required 70 cases and 70 controls to detect an odds ratio ( or ) of 2.5 with a power of 80% and error of 0.05% . to permit adjustment for confounders , two controls per case patients belonging to american society of anesthesiologists ( asa ) physical status classes 1 and 2 , undergoing surgeries under general or regional anaesthetic techniques along with appropriate nerve blocks for post - operative pain relief were included . the number of hours fasted was divided into 68 h , 911 h and > 11 h. the outcomes measured were the admission of patients following day care surgery , and the causes of unanticipated admissions . for the statistically significant variables , the mantel haenszel or was calculated to identify confounding , if any . for analysing the different narcotics used , each narcotic was given a score using morphine as a reference ; 10 mg of morphine = 100 g of fentanyl = 75 mg of pethidine = 100 mg of tramadol . demographic characteristics , patients weight , pre - operative medical illness , personal habits , asa status , the diagnosis and surgical procedures , time since last meal , duration of anaesthesia and surgery , experience of the surgeon and anaesthesiologist , and intraoperative management ( techniques , drugs , monitoring , etc . ) were documented . the equivalent narcotic dose was totalled and the narcotic score for each patient was then calculated . for example , if a patient received 100 g of fentanyl and 6 mg of morphine during the surgery , the patient would have a narcotic score of 16 .", "( p = 0.06 with an or of 0.84 and a 95% ci of 0.411.71 ) the dose of narcotic used during anaesthesia was analysed using the narcotic score and patients with a score of > 10 were 2.86 times at a greater risk of admission with a 95% ci of 1.177.09 . during the 3-month study , from the cohort of 776 patients , 63 patients with unanticipated admission formed the case group and were compared to twice the number of unhospitalised patients , which formed the control group . at the end of the day , after all the patients had been discharged or admitted from the day care centre , lots were drawn from the discharged group , which randomly selected controls . univariate analysis showing factors associated with unanticipated admissions the factors significantly associated with unanticipated admissions were the duration of anaesthesia , duration of surgery , experience of the surgeon , time of starting last case , hours of fasting and a high narcotics score . type of surgery requiring readmission technique of anaesthesia in those requiring readmission individual risk factors for admissions and or 's were calculated using univariate logistic regression [ table 4 ] . patients whose surgery started after 3 pm were also at a significantly high risk of admission . anaesthesia lasting more than 50 min and surgery lasting more than 35 min were at a higher risk of admission . anaesthesia time 50 min and surgery time 35 min were highly correlated and hence only anaesthesia time 50 min was entered into the model .", "the study showed that the incidence of ponv was one of the major anaesthetic risk factors for admission , which accounted for 51.14% of anaesthetic admissions . the factors associated with unanticipated admissions identified by the study were long duration of anaesthesia and surgery , starting of last case after 3 pm , shorter hours of fasting and greater dose of narcotics used . unanticipated admissions following day care surgery are a quality marker of efficiency of ambulatory surgery services . the ability to provide adequate pain relief without exacerbating ponv remains one of the major challenges for providers of outpatient anaesthesia and surgery . patients with a narcotic score of > 10 were nine times more likely to have ponv requiring admission . post - operative pain is the most commonly reported complication of day care anaesthesia with up to 50% of patients experiencing wound pain . however", "the factors associated with unanticipated admissions included longer duration of anaesthesia and surgery , later time of starting last case , shorter hours of fasting and the greater dose of narcotics used . these factors can guide decision making to facilitate improved efficiency of the day care centre . the low rates of medical causes of admissions reflect a good pre - anaesthetic assessment in terms of the suitability of patients .", "", "" ]

[ "the complexity of the multiple actions of the proteins in both inflammation and coagulation should excite the clinician with regard to potential new therapies that may be beneficial via activation of one or both of the concurrent pathways . however , before clinicians can administer new therapies that utilize new knowledge on the actions of coagulation cascade components , and hence improve the outcomes of their patients , several gaps in our current understanding must be addressed . the accompanying review by riewald and ruf outlines the available information on the possible steps involving some of the various proteins that are common to both coagulation and inflammation . the potential key role of proteins that were originally believed to be exclusively involved in coagulation in the inflammatory response provides an exciting potential mechanism(s ) for modification through the application of new therapies . the relationship between the clotting cascade and the promotion or inhibition of the anti - inflammatory response continues to be defined through basic research . this information is imperative if the clinician is to take basic knowledge ' to the bedside ' , where individual patients can benefit .", "knowledge of the ' most beneficial ' balance between augmenting or inhibiting the contribution of the clotting cascade components to inflammation would be required for determining the selection and dosing of potential new therapies . administration of intrinsic or synthetic analogues of coagulation cascade components ( e.g. protein c , thrombin , and factor viia or xa ) , coagulation inhibitors ( e.g. heparin or analogues ) , or agonists or antagonists of the protease - activated receptors , in an attempt to alter the individual patient 's coagulation / inflammation balance , could theoretically produce responses ranging from beneficial to detrimental .", "this example illustrates that a broader knowledge of the impact of altering the coagulation/ inflammatory response will be required before clinicians can comfortably utilize new therapies in patient care . a safe assumption is that any new therapies that alter the intrinsic response to coagulation and inflammatory stimulants would also potentially produce detrimental effects on these , and potentially other , physiological responses . a simple example of such a potential for detrimental effects is the administration of protein c resulting in undesirable haemorrhage .", "it can be anticipated that certain patients would have contraindications to the new therapies or that dosages would need to be adjusted on the basis of pharmacokinetic or pharmacodynamic variables . it is unlikely that any new therapies resulting from the new knowledge of the contribution of the clotting cascade to inflammation can be applied to all patients . some , such as coagulation disorders , may be known and obvious , but any new strategies that could potentially alter the balance of a complex physiological response may be anticipated to be influenced by many , as yet unknown , factors in the individual patient . the clinician will need to know what these contraindications and variables are before the new therapies can be used confidently . a more complete understanding of the impact of concurrent conditions , therapies and the patient 's genetic make - up on outcome will be required if we are to obtain the maximum benefit from new therapies . an example is the concurrent administration of heparin , which appears to antagonize the anti - inflammatory effect of antithrombin iii in septic patients .", "for any new therapy resulting from our expanded knowledge of the clotting cascade in the inflammatory response to be tailored to the needs of the individual patient , a method(s ) for rapidly and easily assessing the patient 's dynamic inflammatory response will be required . unless any new therapies have very benign toxicities , the need to assess the need , dosage and response to treatment will mandate sensitive and specific monitoring techniques . bedside or clinical laboratory techniques that could be applicable to most clinical environments would allow the benefit of any new therapies to be applied to the greatest number of patients . conversely , any new treatments that require complex , laborious monitoring techniques will have limited applicability .", "clinical trials outlining the potential anticipated benefit(s ) and the appropriate target patient population for each new therapeutic strategy will need to be completed such developments will create the new dilemma for the clinician , namely that of trying to select between different treatment options for the individual patient . as our knowledge of the contribution of the intrinsic coagulation components increases , the development of many potential new therapies will hopefully emerge for clinical use . these may be totally new therapeutic entities or new strategies for using existing drugs or clotting factors . . this will allow the clinician to ensure that the most appropriate strategy can be selected for the individual patient .", "the above - mentioned concerns aside , the clinician should be excited about the expanding knowledge of the role of coagulation cascade components in modifying the inflammatory response . such knowledge will hopefully result in new strategies and therapies to manage the septic patient .", "" ]

[ "however , the discovery of jak2 mutations , which has established that dysregulation of the jak - stat signalling pathway is a major contributor to the pathogenesis of mpns , has also led to the development of small - molecule jak1/2 inhibitors , the first of which ( ruxolitinib ) has been approved for the treatment of mf in the united states and europe . in this article , we report on old and new therapeutic strategies that proved effective in early preclinical and clinical trials and subsequently in the daily clinical practice for patients with mf , particularly concerning the topics of anaemia , splenomegaly , iron overload ( io ) , and allo - hsct . conversely , mutations in asxl1 , srsf2 , and ezh2 predicted short survival in a large cohort of patients . more specifically , a report by tefferi et al19 points to the calr/asxl1 + profile as the most detrimental mutation profile in pmf .", "the management of anaemia can be one of the most challenging aspects of treating patients with mf ( table 2 ) . blood transfusion is the standard therapy for symptomatically anaemic patients , and the transfusion target should be assessed individually . the antiangiogenic and immunomodulatory properties of thalidomide , lenalidomide , and pomalidomide make them potentially effective medical therapies for mf , with some responses in patients with anaemia , thrombocytopenia , and splenomegaly ; potential modifications to the bone marrow microenvironment ; and a possible reduction in bone marrow fibrosis . a phase ii clinical trial ( nct00227591 ) assessed the therapeutic efficacy of lenalidomide combined with prednisone in 42 patients with mf .", "cytoreductive agents have been the treatment of choice for most mf patients with symptomatic splenomegaly ( table 3 ) . furthermore , they are mainly used in older patients as they are relatively manageable insofar as frequent laboratory monitoring is not required , unlike in the case of hu or other cytoreductive agents.41,46 in cases of massive refractory splenomegaly , it has been found that monthly courses of intravenous cladribine ( 2-chlorodeoxyadenosine ) lead to a response in up to 50% of patients , with severe but reversible cytopenia being the main toxicity.42 interferon - alfa ( standard and pegylated versions ) has proved to have only a minimal clinical effect in reducing splenomegaly , and therefore , its use is not generally recommended.43 hypomethylating agents , such as azacitidine and decitabine , have also been studied in mf , but currently play only a limited role in its treatment.47 more recently , thomas et al48 demonstrated that methotrexate ( mtx ) may act as an inhibitor of the jak - stat pathway and that this activity is likely to be specific and not related to a general effect on protein phosphorylation : the drug s in vitro activity was observed at a concentration equivalent to that used in patients taking low - dose mtx ( 525 mg / wk ) . what is important is that its efficacy in controlling haematologic parameters , systemic symptoms , and splenomegaly has been confirmed in vivo in 2 recent case reports.49 splenectomy is a palliative debulking measure used in patients with mpns . more recently , the efficacy and safety of 3 dose levels of a potent and selective oral jak1 inhibitor , incb039110 , have been evaluated in an open - label phase ii study , resulting in clinically meaningful symptom relief , modest spleen volume reduction , and limited myelosuppression.76 in particular , only 1 patient discontinued for grade 3 thrombocytopenia , whereas nonhaematologic aes were largely of grade 1 or 2 and most commonly represented by fatigue .", "consequently , treatment decisions concerning the use of ict in patients with mf continue to be extrapolated from the data of myelodysplastic syndromes . however , comparison of the baseline characteristics of the patients who achieved an erythroid response and those who did not achieve did not reveal any significant differences that could be considered predictive.85 deferoxamine ( desferal ) is a linear ligand that forms 1:1 complexes with iron that maintain a net charge , allow for membrane permeability , and provide access to intracellular iron stores86 that are then excreted primarily in urine.87,88 it is administered in the form of an intravenous or subcutaneous infusion , and because of its short plasma half - life , the efficacy of the treatment correlates with the duration of infusion , and it is only effective if administered at high doses between 5 and 7 times per week.89 when administered as a continuous 24-hour infusion for 6 to 7 days per week in patients with high - risk -thalassemia , it can reverse iron - induced cardiac dysfunction and increase long - term survival.90 however , treatment - related side effects include infusion site discomfort ( nearly 100% , with the development of local erythema or induration in some cases),91 visual changes ( 0%10% ) , generally transient auditory neurotoxicity ( 20%25%),92,93 increased serum creatinine levels ( 22% ) , vomiting ( 16% ) , abdominal discomfort ( 14% ) , constipation ( 14% ) , arthralgia ( 14% ) , nausea ( 11% ) , rash ( 5% ) , and diarrhoea ( 5%).94 deferasirox is an oral iron chelator frequently used in clinical practice in the united states and europe that has a long half - life of 8 to 16 hours and can be administered once daily.89 it forms a 2:1 complex with iron,95 which is then excreted largely in the bile and faeces ( much less in urine).96,97 unlike other iron chelators , it is thought that dfx also affects haematopoietic stem cell differentiation by means of a reactive oxygen species mediated mechanism , which may underlie the erythropoeitic response seen in some dfx - treated patients.95 the most frequently reported adverse effects are gastrointestinal toxicity ( 21%64% ) , diarrhoea ( 46% ) , abdominal pain ( 15%28% ) , nausea ( 24% ) , vomiting ( 21% ) , and constipation ( 10%).94,98101 patients have also been reported to experience renal dysfunction ( 10%64% , usually nonprogressive at the start of treatment and improving after a dose reduction ) , skin rash ( 4%39% ) , arthralgia ( 15%),94 and transaminitis ( 4%70%),81,98101 and there have been rarer reports of auditory neurotoxicity ( 1%6% ) as a potential side effect.100,101 it is not entirely clear whether ict can reverse the ill effects of io , and there are no completed studies that provide prospective evidence of a beneficial impact in terms of the restoration of normal haematopoiesis or outcomes in patients with mf . nearly 40% of patients with mf are anaemic at the time of diagnosis , including 25% who are already transfusion dependent,77,78 and more than 60% will develop clinically significant anaemia during the course of follow - up.49 the clinical impact of io and its potential relationship to the heightened inflammatory response of patients with mf warrant consideration not only because potential liver dysfunction , cardiac disease , and other complications of io probably contribute to patient morbidity and mortality but also because the growing evidence of impaired haematopoiesis attributable to bone marrow haemosiderosis suggests a viable therapeutic target.79,80 each unit of rbc contains 200 to 250 mg of iron , and as the reticuloendothelial system can clear approximately 10 to 15 g ( corresponding to 50 rbc units ) , any excess is deposited in tissues and leads to organ damage.81 iron overload is a concern when treating patients with mf , which is why iron chelation therapy ( ict ) has been used to counteract its potentially negative effects .", "allogeneic haematopoietic stem cell transplantation is still the only intervention that has been shown to be a potential cure for mf or a means of prolonging the survival of these patients . key questions include patient selection , donor selection , pre- and posttransplant management , conditioning regimen , and prevention and management of post - transplant relapses . ruxolitinib is being administered to eligible patients with mf for 60 days before definitive allo - hsct in a prospective multicentre phase ii study conducted by the myeloproliferative disorders research consortium ( nct01790295 ) . some reports have also shown faster engraftment in splenectomised patients ; however , the pretransplant use of splenectomy remains controversial as no study has yet prospectively evaluated the effect of protocol - based splenectomy before transplantation . in the case of older patients and/or those with comorbidities , a less intense conditioning regimen is more appropriate , whereas patients with advanced disease and a good performance status should undergo a more intensified regimen.104 finally , in patients relapsing with constitutional symptoms or splenomegaly , jak1/2 inhibitor treatment is recommended but remains experimental . to address this question ,", "traditional mf treatments are primarily palliative and have proved to be inadequate to address the considerable morbidity and mortality associated with this disabling disease . more specifically , concerning anaemia , there have been various therapeutic attempts , but rbc transfusions still remain the most frequently used approach , even though io represents an increasingly frequent clinical challenge . considering instead splenomegaly , besides hu , ruxolitinib , as well as other investigational jak1/2 inhibitors , offers new hope for these patients as they have been shown to lead not only to significant reduction in splenomegaly but also to the palliation of disease - related symptoms . however , allo - hsct is still the only intervention that has evidence indicating it is potentially curative . obviously , in such a context , participation into a clinical trial should be encouraged whenever possible , with the purpose of making new drugs available ." ]

[ "based on the patient clinical and radiographic findings , a diagnosis of multifocal periapical cemento - osseous dysplasia was made . periodontal ligament space widening was found , especially around the root of the left lateral incisor . the lesion associated with the left mandibular lateral incisor was radiolucent , whereas the lesion on the apex of the left central incisor was mixed radiolucent - radiopaque and the lesion associated with the right central incisor was radiopaque with a radiolucent rim around the lesion of this tooth ( fig .", "modern advances in imaging help the dentist to use the cbct with the appropriate field of view and spatial resolution ; therefore , the internal mineralized structure of the pathologic lesions can be investigated with a low radiation dose.14 axial cbct images clearly demonstrate the location and extension of the lesion . this report showed the discontinuity of the lingual cortex on some axial and cross - sectional cbct images . the expansion and perforation of the cortical plates can be evaluated on cbct even if they are slight . although 3d imaging could help the radiologist in diagnosing the lesion for the first look , it should be noted that it is not a reliable viewing modality for assigning the real status of the lesion in relation to its surrounding bone structures . in many cod cases that have been misdiagnosed and/or mismanaged , this feature also could be found in an exaggerated fashion on the 3d cbct images . treatment is usually not needed because development and maturation of the lesion is self - limiting ." ]

[ "the aim of this study was to evaluate the fracture resistance and failure pattern of \n endodontically treated mandibular premolars restored with different ferrule heights in \n combination with fiber posts and all - ceramic crowns . the null hypothesis was that \n different ferrule heights do not improve the fracture resistance or the failure pattern \n of the tested restorations . controversy exists as to whether endodontic procedures \n are the primary cause for loss of strength . it has been reported that \n endodontically treated teeth and their contralateral vital pairs exhibited similar \n biomechanical properties , such as punch shear strength , toughness , and load required for \n fracture .", "after preparation of the finish line , the coronal dentinal extension was modified \n accordingly ( figure 1 ) : group 1 ( control ) : 1 mm \n circumferential ferrule from the gingival margin without a fiber post ; group 2 : 1 mm \n circumferential ferrule with fiber post and resin core ; group 3 : non - uniform ferrule \n height ( 2 mm buccally and 1 mm lingually ) with fiber post and resin core ; group 4 : a \n non - uniform ferrule height ( 3 mm buccally and 2 mm lingually ) with fiber and resin \n core post ; group 5 : received no ferrule preparation with fiber post and resin \n core . after loading , the failure mode recorded for each specimen and classified as either \n favorable facture above the cement - enamel junction ( repairable ) or catastrophic \n fracture of the root below cement - enamel junction ( non repairable ) . after endodontic treatment , each root was thinly covered with a silicone impression \n material ( aquasil , dentsply ) to simulate thickness of periodontal ligament . all \n external debris were removed with an ultrasonic scaler , and examined stereoscopically \n at 10x magnification to verify the absence of cracks , defects and dental caries . \n all specimens received \n 15,000 cycles and surface damage was prevented by insertion of a 0.5 mm silicon sheet \n between the occlusal surface of the ceramic crown and the loading indenter ( 3 mm \n diameter ) of the pneumatically activated loading machine . 10 k - files ( flexo files , maillefer , ballaigues , switzerland ) ; the \n root canal length was established through direct observation of the file extruding \n from the apical foramen . buccolingual and mesiodistal coronal dimensions plus root length of all selected \n teeth were measured using a digital caliper ( digimatic calipers , mitsutoyo , tokyo , \n japan ) and only teeth with the following mean dimensions were selected : 14.1 mm root \n length , 7.3 mm buccolingual width , and 4.9 mm mesiodistal width .", "10 k - files ( flexo files , maillefer , ballaigues , switzerland ) ; the \n root canal length was established through direct observation of the file extruding \n from the apical foramen . buccolingual and mesiodistal coronal dimensions plus root length of all selected \n teeth were measured using a digital caliper ( digimatic calipers , mitsutoyo , tokyo , \n japan ) and only teeth with the following mean dimensions were selected : 14.1 mm root \n length , 7.3 mm buccolingual width , and 4.9 mm mesiodistal width . all \n external debris were removed with an ultrasonic scaler , and examined stereoscopically \n at 10x magnification to verify the absence of cracks , defects and dental caries . \n after endodontic treatment , each root was thinly covered with a silicone impression \n material ( aquasil , dentsply ) to simulate thickness of periodontal ligament . standardized root canal preparations were made using the following procedure : initial \n probing using no . after \n intermittent rinsing with 2.5% sodium hypochlorite solution , the endodontic treatment \n was completed using manual lateral condensation method ( ah plus , dentsply , de tray , \n konstanz , germany ) .", "a new diamond \n point ( lot - nr 1599 , dfs dental and technical products , gmbh , germany ) was attached to \n the milling machine ( k9 milling apparatus-990 , kavo , germany ) for every group . the \n mrd gauged diamond had a self - limiting tip , which produced a 1-mm - deep chamfer and \n the margins and the angle of convergence were standardized . after preparation of the finish line , the coronal dentinal extension was modified \n accordingly ( figure 1 ) : group 1 ( control ) : 1 mm \n circumferential ferrule from the gingival margin without a fiber post ; group 2 : 1 mm \n circumferential ferrule with fiber post and resin core ; group 3 : non - uniform ferrule \n height ( 2 mm buccally and 1 mm lingually ) with fiber post and resin core ; group 4 : a \n non - uniform ferrule height ( 3 mm buccally and 2 mm lingually ) with fiber and resin \n core post ; group 5 : received no ferrule preparation with fiber post and resin \n core .", "dentine primer liquids were mixed and applied on \n the whole prepared tooth surface for 15 s. resin cement was dispensed from the \n automix syringe directly into the inner surface of the crowns which were seated and \n held in position under fixed load of 20 n ; excess resin was removed immediately with \n a micro brush . exposed margins were covered with glycerin gel and rinsed off after \n complete polymerization of the resin cement . the fitting surface of the crowns was pretreated with hydrofluoric \n acid ( ips ceramic etching gel , ivoclar - vivadent ) for 20 s , rinsed off , air dried , \n silanized for 60 s and air dried . in the control group , excess gutta - percha was removed to a depth of 2 mm from the \n coronal surface of the preparation , using a carbide bur ( 171l-012 , brasseler , usa ) . \n a hybrid composite \n resin ( tetric ceram , ivoclar - vivadent ) was applied and light polymerized for 40 \n s. for the remaining groups , post space was created using no . then core build - up was performed using hybrid composite resin ( tetric ceram , \n ivoclar - vivadent ) in 1-mm - thick increments and light polymerized ( astralis 10 ; \n ivocar - vivadent ) for 40 s until the core was restored to predetermined dimensions . \n one coat of adhesive resin ( excite , ivoclar - vivadent ) was applied using a microbrush \n and light polymerized for 20 s ( astralis 10 , ivoclar - vivadent ) . one coat of adhesive resin ( excite , ivoclar - vivadent ) was applied \n using a microbrush and light polymerized for 20 s ( astralis 10 , ivoclar - vivadent ) . \n", "after loading , the failure mode recorded for each specimen and classified as either \n favorable facture above the cement - enamel junction ( repairable ) or catastrophic \n fracture of the root below cement - enamel junction ( non repairable ) . the \n failure load of the specimen was determined when the forceversus - time graph showed an \n abrupt change in load , indicating a sudden decrease in the specimen s resistance to \n compressive loading . all specimens received \n 15,000 cycles and surface damage was prevented by insertion of a 0.5 mm silicon sheet \n between the occlusal surface of the ceramic crown and the loading indenter ( 3 mm \n diameter ) of the pneumatically activated loading machine . all specimens were subjected to cyclic loading according to the following regime : \n sinusoidal load between 50 and 200 n at a rate of 2 hertz . these inspections \n were made using a stereomicroscope ( stereoscopic zoom microscope , smz-1000 , nikon , \n japan ) and during inspection , the teeth were trans - illuminated with a fiber optic \n cable . complete or partial debonding of the crown or of the post and core were also \n considered as favorable failure modes . canton , ma , usa ) was used to deliver a compressive load to the specimens at a \n crosshead speed of 1 mm / min at 45 degree angle to the long axis of the teeth ( root \n apex tilted lingually ) until failure . after completion of cyclic \n loading , a universal testing machine ( instron 8500 plus , instron , 100 royal st . \n", "although fracture resistance of the control group was \n comparable to that of the other groups that received fiber post , there was a higher \n catastrophic failure rate ( 70% ) in the control specimens in the form of vertical root \n fracture . statistical analysis revealed no significant differences between the failure load of the \n tested groups and the control group restored without fiber post \n ( p<0.780 ) . the groups restored with fiber post , on the other hand , had almost complete \n favorable fracture in the form of cervical fracture above the cervical line , previous \n data are summarized in table 1 . failure load ( standard deviation ) and failure type of tested groups similar superscript letter indicates no significant difference between \n different test groups in all specimens , the cemented ceramic crown was fractured without evidence of debonding \n of either the crown or the cemented post . the internal surface of the fractured ceramic \n fragments demonstrated evidence of resin cement and part of the core material indicating \n cohesive fracture of the resin core .", "considering the results obtained in this study , different ferrule heights did not \n improve the fracture resistance or the failure pattern of the tested specimens . on the \n other hand , the use of fiber posts with a modulus of elasticity close to that of dentin \n changed the catastrophic failure type of the control group to almost complete favorable \n fracture for the other four groups . the results of the fracture resistance test showed that the amount of residual coronal \n structure ( ferrule height ) did not increase significantly the fracture resistance of \n endodontically treated teeth . this could explain why all favorable fractures were \n limited to the cervical portion of the root including the core - dentin interface , since \n the stresses were concentrated in the cervical area and the outer root surface . \n supporting this opinion is the cohesive fracture of the resin core material , which \n remained attached to the fractured segments of ceramic crowns , thus indicating good bond \n strength between the core build up material and the cemented ceramic crown . the limited \n number of specimens and the difficulty related to reproducing the complexity of \n functional loads in the oral environment may be some of the shortcomings of the present \n study . further investigations including finite element analysis and long - term cyclic \n loading studies are recommended to complement the present study .", "within the limitations of this study , it may be concluded that increasing the ferrule \n length did not improve the fracture resistance of endodontically treated teeth restored \n with glass ceramic crowns . insertion of a fiber post could reduce the percentage of \n catastrophic failure of these restorations under functional loads ." ]

[ "dichlorvos ( dimethyl-2 , 2-dichloro vinyl phosphate ) is an organophosphorous ( op ) insecticide with moderate human toxicity , used for insect control in food storage areas , greenhouses , barns and control of insects on livestock . parenteral dichlorvos administration with suicidal intention is rarely reported in the literature . in one case report , i describe the case of a young female patient , who developed atypical signs of op poisoning following subcutaneous injection of dichlorvos .", "the present case report is about a 37-year - old , previously healthy female , who was admitted to our intensive care unit 18-h after alleged self - injection of 76% dichlorvos ( nuvos ) 3 ml in the upper left arm ( 3 times with a 1 ml insulin syringe ) . within an hour of the injections local skin necrosis with surrounding blisters her clinical course was complicated by respiratory arrest 9-h after hospital admission ( 27-h after the injection of dichlorovos ) leading to hypoxia and bradycardia . local examination revealed a blister and a black necrotizing lesion over the anterior aspect of the left arm [ figure 1 ] . debridement of the wound showed predominant involvement of the subcutaneous tissue plane with minimal necrosis of the superficial fibers of biceps brachii .", "in this case , other than the unusual route of administration , a number of atypical manifestations were found . two independent mechanisms are thought to be responsible for respiratory failure following op insecticide poisoning cholinergic cns depression in the early stage ( associated with other cholinergic features ) and late progressive neuromuscular transmission defect . this includes relatively delayed respiratory failure and central nervous system ( cns ) manifestations with few muscarinic signs ." ]

[ "we describe the clinical presentations and secondary complications associated with oropharyngeal injury with the case of a 74-year - old man who suffered a hypopharyngeal laceration after tee . transesophageal echocardiography ( tee ) is considered to be safe and relatively noninvasive diagnostic tool,1 ) however severe complications have been reported . the incidence of major tee - related complications range from 0.2% to 0.5% and mortality is reported to be < 0.01%.2345 ) among these complications , problems related to insertion of tee probe take a large proportion , including perforation of hypopharynx and esophagus . for our knowledge , there have been reported only few cases of hypopharyngeal perforation , especially not been reported in asian population to date .", "a 74-year - old man was referred to our cardiovascular center for the evaluation and treatment of mitral regurgitation ( mr ) . after 14 days of antibiotic therapy , when the infection was controlled completely , the patient had successful mitral valve repair with tricuspid annuloplasty with st . we concluded the lesion was limited to the hypopharynx because the presence of hematoma at the right side of hypopharynx , consistent with the direction and the depth of the probe passage . the insertion of tee probe was performed with the patient in left lateral decubitus position according to the following standardized technique : the probe was inserted through the midline and gently advanced to pass the first pharyngeal curvature corresponding to the base of the tongue . the probe was then extended , and the patient was asked to swallow , at which point the probe was further advanced to enter the esophageal inlet . when the probe has reached to the root of tongue , was maintained for 14 days with the drainage of abscess because no organisms were identified from the abscess fluid culture and repeated blood cultures .", "direct visualization of the passage of the probe with direct laryngoscope could be recommended to minimize blind injury of throat . we assumed that the patient 's poor cooperation and insufficient sedation might cause the wrong direction of the tee probe and advancing force of tee probe into the throat had led the probe to get lodged into the right pyriform sinus . it needs pre - procedural enough education , adequate sedation , careful insertion of tee probe , and an experienced assistant . in our case , procedure related risk factors include inexperience of the cardiologist , and resistance to prove insertion with poor cooperation . to avoid direct injury to the hypopharynx and upper esophagus during a blind insertion of probe , appropriate conscious sedation and local anesthetic spray was limited to pharyngeal space . in current case , our patient complained pain in his throat and we detected subcutaneous emphysema within 3 hours after injury that may prevent aggravation of infection and lead good prognosis . finally , it is very important to prevent sudden position change of the patient during the probe insertion ." ]

[ "our aims in the current study are to : ( 1 ) summarize epidemiological studies of dementia in japan including relevant details of study protocols and diagnostic criteria , ( 2 ) compare age - specific prevalence of all - cause dementia among studies , and ( 3 ) assess the trends in ad versus vad over time . there is an ongoing debate as to whether : ( 1 ) the higher proportion of vad found in the past studies in japan could be due to differences in diagnostic criteria used in japan and the us , ( 2 ) the similar ad / vad ratio with that of the us found in recent japanese studies could be due to decreased cerebrovascular disease incidence over the past decades in japan , or ( 3 ) there is no systematic time trend in ad / vad ratio in japan and the observed variation is due to regional differences within japan . despite a growing interest in the influence of vascular disease and its risk factors on alzheimer 's disease ( ad ) [ 812 ] , it has been reported that the prevalence and incidence of dementia in the united states have been either stable or even declining over the last 2 decades of the 1990s . studies conducted in the late 1980s and early 1990s reported that vascular dementia ( vad ) was more prevalent than alzheimer 's disease ( ad ) in japan , compared with the us and other western countries where ad is more prevalent than vad . in studies among japanese americans conducted in the early 1990s [ 4 , 5 ] , standardization of diagnosis is one of the challenges of cross - national comparisons of dementia prevalence . previous studies which concluded an increase in ad / vad over time in japan [ 1315 ] did not examine the diagnostic criteria used , nor did they examine age - specific ad / vad ratios .", " we selected dementia prevalence studies in japan that were designed to be representative of specific communities or prefectures with at least 500 study participants aged 65 and older , and whose age - specific prevalence ( for either 5- or 10-year age intervals ) for ad and vad was published between 1990 and 2009 in international journals , using medline with the search words japan , dementia , and prevalence . differences in overall dementia prevalence among 8 studies were examined using poisson regression models based on the number of dementia cases ( weighted numbers of cases for okinawa studies ) and the number of participants by 10 year age groups ( except the youngest age group where 5-year ages were used : 6569 , 7079 , 8089 , and 90 + ) to provide large enough sample sizes in each group for meaningful statistical comparisons , yet controlling for changing age composition over time . all residents as of the prevalence day of march 1 , 2008 were requested to participate in the dementia prevalence study . this study was conducted in the municipality of ama - cho , a rural island town in the northwestern part of japan . random sampling was conducted to recruit study participants in the selected sites between 1991 and 1992 . in 1958 , eight studies met these criteria : the hisayama study [ 16 , 17 ] conducted at four time points , the okinawa study , the radiation effect research foundation adult health survey ( rerf - ahs , a.k.a hiroshima study ) , the tajiri project , and the ama - cho study . we used the former criterion ( n 500 ) in order to have a large enough sample size to allow meaningful between - cohort comparisons of dementia prevalence .", "the youngest age group examined here ( age 7079 ) had a prevalence of vad that was consistently higher than that of ad in japan ( i.e. , ad / vad < 1 ) except in more recent studies conducted in 2005 ( hisayama ) and 2008 ( ama - cho ) . except for these two recent studies ( hisayama 2005 and ama - cho 2008 ) , the results showed that compared with the all - cause dementia prevalence in 1985 , that of 2005 was higher ( coefficient : 0.32 , 95% ci : 0.010.64 , p = 0.04 ) controlling for sex and age groups ( not shown in table 1 ) . poisson regression models for dementia prevalence showed that compared with the okinawa 1992 study , hiroshima 1996 ( p = 0.0002 ) , tajiri 1998 ( p < 0.0001 ) , hisayama 2005 ( p < 0.0001 ) , and ama - cho 2008 ( p = 0.007 ) had a higher prevalence of all - cause dementia , controlling for sex and age groups ( table 2 ) . therefore , we list age - specific prevalence of dementia and ad / vad ratios for the age groups 7079 , 8089 , and 90 and older in table 3 .", "although we can not confirm definitively from the current study , the possible explanation of the increase could be a shift in health conditions among the elderly in japan including the increase in diabetes mellitus in more recent years despite the plateau in decline in stroke incidence during the late 1990s ; ( 2 ) the similar ad / vad ratio found in recent studies in japan with that of the us could be due to a combination of at least 3 factors : ( a ) shifting diagnostic criteria ( more in line with us consensus diagnosis ) , ( b ) possible shifting in health conditions among the elderly in japan ( decline in stroke incidence , but increase in metabolic disease e.g. , type 2 diabetes , hyperlipidemia , and atherosclerosis ) , ( c ) an increase in the proportion of the oldest old who had an historically higher prevalence of ad ( as opposed to vad ) in japan , and ( d ) regional variations ( i.e. , a north - to - south gradient in vad ) possibly due to large difference in dietary patterns . eight major prevalence studies conducted in japan were reviewed in an attempt to identify trends in prevalence of all - cause dementia and subtypes of dementia , paying careful attention to diagnostic protocols . our systematic review shows that ( 1 ) there is an increasing trend in overall dementia in japan . thus , the dementia prevalence seems to be increasing in japan , in contrast to the us where decreasing or stable prevalence of all - cause dementia has been reported . cerebrovascular disease is more common among men than women , and we expect a higher proportion of vad among men than women . a steeper age - associated increase in ad prevalence found in japan , therefore ad incidence and prevalence tend to increase with age more than vad and older old women predominantly have ad rather than vad ." ]

[ "therefore , the \n purpose of this study was to identify the effects of joint mobilization using keomt and pnf \n on a patient with clbp and a lumbar transitional vertebra . this case study was a single patient with clbp and a lumbar transitional vertebra who has \n six lumbar vertebrae ( not five ) . in addition , pnf has been used to improve the muscular strength of \n athletes14 . joint mobilization using pnf has a positive effect on \n pain , muscle strength , and range of motion ( rom)8 , \n 9 .", "the program consisted of a 40-min session , 3 days a week for 4 weeks ( october 131 , 2014 ) , \n during which joint mobilization was performed using keomt and pnf techniques . the pnf exercise included shoulder flexion , abduction , and \n external rotation in a supine position , and dynamic reversal of the antagonist was \n performed17 , which indirectly exercised \n the abdominal muscle through irradiation of the shoulder muscle . the major complaint of \n the subject was a numb feeling , especially in the hind part of the left leg . the initial symptom developed about two years earlier , and at the time of the \n study the subject was not receiving any medical or physical therapy . it is composed of ten items , including pain severity , self - management , lifting , \n sitting , standing , sleeping , etc . the subject was assessed for spinal motion , low back pain , and thickness of the multifidus . \n it was performed by a therapist who had \n completed a keomt spine advance course .", "the rom of flexion increased from 14 to 20 , and the rom of \n extension increased from 1 to 4. in the lumbar vertebra , the angle of spinal curvature \n increased from 12 to 20. the rom in flexion increased from 33 to 47 , and the rom of \n extension increased from 2 to 7 ( table \n 1table 1.change of thoracic and lumbar movementvariablecurvature ( )flexion ( )extension ( )prepostprepostprepostthoracic2632142014lumbar1220334727 ) . the spinal curvature , flexion , and extension of thoracic and lumbar vertebrae were \n measured . in the thoracic vertebra , the thickness of the multifidus was measured at the fourth lumbar vertebra ( left and \n right ) . the left multifidus increased from 572.09 to 662.09 mm , and the right \n multifidus increased from 479.84 to 530.90 mm ( table 3table 3.change of multifidus thicknessvariableprepostmultifidus ( mm)l : 572.09l : 662.09r : 479.84r : 530.90l : left ; r : right ) . the odi percentage \n score decreased from 48.88 to 24.44 ( table \n 2table 2.change of vas and odivariablevas ( score)odi ( % ) prepostprepost7.5348.8824.44 ) . the subject mentioned she was less uncomfortable in \n daily life , e.g. during face washing , dishwashing , hair washing , etc .", "the purpose of this study was to identify the effects of joint mobilization using \n keomt and pnf techniques in a patient with clbp and a lumbar transitional vertebra . this study was a case study of a single patient with clbp and a lumbar transitional \n vertebra . joint mobilization using keomt and pnf had a positive \n effect on the spinal motion , pain , and thickness of the multifidus of a patient with clbp \n and a lumbar transitional vertebra ." ]

[ " to learn about the normal anatomy of the neural tube on mri to recognise the mr appearance of neural tube defects to understand the value of mri in assessing ntds", "the additional information provided by mri may lead to changes in the management of the pregnancy and/or of the delivery [ 25 ] . in this article we describe the radiological , pathological and clinical features of the most common ntds , and finally emphasise an integrated clinical and radiological approach for accurate diagnosis . ultrasonography allows accurate assessment of the neural tube . fetal magnetic resonance imaging ( mri ) complements ultrasonography , confirming the suspected anomaly and even detecting malformations that were not detected at ultrasonography . technological developments in diagnostic imaging have improved the diagnosis and treatment of congenital anomalies immensely , and this progress is especially evident in neural tube defects ( ntds ) .", "in our institution , all fetal mri studies are performed after ultrasonography and mri never constitutes the first imaging study of the fetus . none of the women or fetuses receives any special preparation . we use a 1.5-tesla scanner with a four - element phased - array body coil . t2-weighted single shot fast spin - echo ( ssfse ) or half - fourier single - shot turbo spin - echo ( haste ) images provide most of the information necessary for diagnosis . gradient echo sequences ( echo - planar imaging [ epi ] and true fast imaging with steady state precession [ fisp ] ) have greater ferromagnetic susceptibility , so they make it possible to identify bony and vascular structures [ 1 , 9 ] . both the head and spine must be studied in all three planes . even when the only indication for fetal mri is a suspected ntd , all the fetal structures should always be studied to rule out other possible anomalies . it seems that slow , rhythmic maternal respiration reduces fetal movements , so it is not necessary to acquire images with maternal breath - holding . the fetal mri images are obtained using ultrafast sequences to minimise artefacts due to fetal movements . although it is important to be extremely careful when undertaking any procedure on a fetus , there is no evidence of associated risk to fetal development with fetal mri [ 68 ] .", "the first phase , gastrulation , begins in the 2nd to 3rd weeks of gestation ; in this phase , the two layers of the embryonic plate divide into three definitive layers ( the ectoderm , mesoderm and endoderm ) . in the second phase , neurulation , which takes place in the 3rd to 4th weeks of gestation the fusion begins in the medial dorsal zone of the embryo and progresses in a zipper - like fashion cranially as the rostral neuropore and caudally as the caudal neuropore . , the cells that will become the notochord interact with the overlying ectodermic tissue , causing this tissue to thicken , fold over and fuse , thus forming the neural tube . the spinal column and spinal cord are the same length until 1215 weeks gestation , after which the spinal column grows more than the spinal cord until the medullary cone is situated approximately at the level of the second lumbar vertebra , where it will be at birth and will remain without significant changes throughout life [ 11 , 12 ] .", "mri is an excellent method for evaluating the structures of the fetal head and spine . it is important to evaluate the paravertebral soft tissues in mri studies , especially in fetuses with spina bifida or destructive processes or tumours that could affect these tissues . the skin and the paravertebral muscular structures are hypointense in t2-weighted sequences images can be obtained in any plane , regardless of the position of the fetus in the uterus . the cranial vault ( fig . . the spinal canal should be closed posteriorly by soft tissues ( fig . 1c , e , f ) . the position of the fetus within the uterus results in a certain degree of thoracolumbar kyphosis that displaces the spinal cord anteriorly in the thoracic spine , making it difficult to see because it is adjacent to the vertebral bodies ( fig . ", "ntds are a heterogeneous group of anomalies that result from the partial or total failure of the neural tube to close . the rate of ntds has varied widely over time and has a clear geographical distribution . nevertheless , this marker is only useful for detecting open ntds ; furthermore , alpha - fetoprotein levels are also elevated in a long list of fetal anomalies , including omphalocele , turner s syndrome , and sacrococcygeal teratoma , amongst others . a family history of ntds is absent in 9095% of cases , and ntds are reported in 3% of miscarriages . some genetic factors like single gene mutations ( meckel - gruber and", "it is the absence of a major portion of the brain , skull and scalp above the orbits . there are two subtypes : anencephaly , in which the cranial vault , cerebral hemispheres and diencephalic structures are replaced by amorphous neurovascular tissue , and exencephaly , in which the cranial vault is absent but relatively normal amounts of brain tissue , albeit abnormally developed , is present . some authors consider exencephaly an early stage of anencephaly , because the unprotected anomalous brain tissue located outside the cranial vault will eventually take on the appearance of anencephaly after being destroyed by the trauma induced by constant collision against the walls of the uterus . in both exencephaly and anencephaly , fetal mri studies show the absence of osseous structures above the orbits and the absence of brain tissue or alterations in brain tissue when it is present . it is considered a lethal anomaly , mri is usually not used to evaluate fetuses with these conditions because ultrasonography usually detects this anomaly very early and mri is not required to confirm this diagnosis . the base of the skull , the facial structures , and the orbits are present and are usually normal .", "the specific name of the anomaly depends on the structures contained in the herniated sac ; for example , a meningocele contains meninges and cerebrospinal fluid , an encephalomeningocele contains meninges and brain tissue and an encephalomeningocystocele or encephalomeningohydrocele contains meninges , brain tissue , and part of the ventricular system ( fig . 3 ) . the main differential diagnosis for encephaloceles located in the occipital region is with cystic hygroma , whereas for those located in the frontal region , the differential diagnosis is with teratoma and haemangioma of the scalp . 3d ) as well as the presence of brain tissue inside the herniated sac in cases of encephalomeningocele ( fig . 3a , b , e ) . it is essential to evaluate the rest of the structures in the head and the neural tube , fundamentally the posterior fossa because it can be difficult to evaluate with ultrasonography .", "iniencephaly is an ntd affecting the occipital bone combined with rachischisis of the cervicothoracic spine and retroflexion of the head ( fig . 4 ) . iniencephaly can be open ( associated with encephalocele ) or closed ( spinal anomaly without encephalocele ) .fig . fetuses with iniencephaly have a variable defect in the occipital bone with an enlarged foramen magnum , the partial or total absence of cervicothoracic vertebrae with irregular fusion of those that are present and incomplete closure of the vertebral bodies and arches .", "spinal dysraphism is the result of a congenital vertebral defect due to the failure of the caudal neuropore to close that leads to the exposure of the contents of the medullary canal to the exterior . rachischisis is the most severe form of spina bifida ; in this lethal condition , an extensive segment of the rachis is absent , resulting in extensive exposure of neural tissue . the defect usually involves the posterior vertebral elements , although it can also involve the vertebral body itself . spinal dysraphism comprises a wide spectrum of anomalies ; these can be divided into open and closed defects . , there must be a vertebral defect , the most common of which is the absence of the posterior vertebral arches ( figs . specific details with respect to the level and magnitude of the defect can help the intra - uterine management of the spinal anomaly . this association is thought to be due to the collapse of the primitive fetal ventricular system ( brought about by the loss of cerebrospinal fluid through the spinal defect ) , which prevents the rhombencephalic vesicle ( from which the brainstem , fourth ventricle , and cerebellum are derived ) from expanding and results in deficient development of the posterior fossa and herniation .", "their prenatal diagnosis can predict the viability of the fetus , has implications for family counselling about the pregnancy , and orients the prognosis and management of the newborn . ultrasonography remains the primary imaging test for the prenatal diagnosis of ntds , but sometimes it does not enable an accurate diagnosis so other diagnostic techniques are necessary . fetal mri has advanced rapidly in the last 25 years , developing from an experimental technique to become a fundamental tool in normal clinical practice in many centres around the world . fetal mri should be restricted to centres with experienced staff and should never be considered a replacement for ultrasonography , which continues to be the technique of choice to evaluate fetal morphology . mri s ability to detect complex anomalies that involve different organs has been widely reported ." ]

[ ". the standards of postoperative care issued by the american society of anesthesiology does not state how handover should be performed nor what information it should include , leaving the handover process decision up to the individual clinician . in these studies , critical details such as the preoperative state of the patient , type of operation performed , amount and kinds of analgesics given and problems encountered during the case were either barely mentioned or underplayed . in some instances significant intraoperative events were completely disregarded . there are no reported studies on handover practices performed by anesthesia providers when transition of care occurs intraoperatively . there is a lack of studies on how anaesthesiologists hand over their patients , which is surprising given that anesthesiology is a specialty that has always aimed at placing patient safety as its top priority this preliminary pilot study was a qualitative rather than quantitative survey to highlight the scope of the current us intraoperative handover of patient information . studies analyzing anesthetic team handover in the recovery room observed that the majority of handovers were remarkably brief and insufficient- . additionally , there were frequent distractions present at the time of the hand - over .", "an e - mail with a link to the questionnaire was sent to anesthesia providers at all anesthesia residency programs nationwide ( 120 out the 132 us programs encompassing around 4500 residents and their attending academic mdas ) and a smaller survey selection of crnas ( 10 institutions about 300 crnas in the metropolitan area of detroit , mi ) . this study used an online questionnaire format with 8 survey questions created using a computerized online survey program ( survey monkey , palo alto , ca , usa , ) . the only demographics of surveyed anesthesia health care providers obtained were for medical training level ( certified registered nurse anesthetist -crna , medical doctor of anesthesiology resident mdar , or medical doctor of anesthesiology mda ) . all questionnaires were anonymous and were only sent to us anesthesia providers working in an academic hospital setting with an associated residency program in anesthesiology . this study had institutional approval ( wayne state university irb ) . due to the anonymity of the suvey content ,", "ponv : post - operative nauseaand vommitting ; mh : malignant hyperthermia ; iv : intravenous . mdar - medical doctor of anesthesiology resident , crna- certified registered nurse anesthetist , mda - medical doctor of anesthesiology . the response rate to this survey was low with a response from approximately 5% of the resident population in us anesthesia programs and approximately 20% of the crnas surveyed in the metropolitan detroit area .", "major limitations of this study were the low response rate of 216 respondents and that due to annonymous nature of this survey the number of individual academic institutitions could not be determined . additionally , there is the possibility that there was a bias towards an increased proportion of responses from anesthesia providers who had prior poor handover experiences and were unsatisified with current practice . our study indicates that the current intraoperatvive handover processes among anesthesia providers do not have standard uniform practices , and there may be a high proportion of insufficient patient handover practices . this pilot study was a qualitative rather than quantitative survey to highlight the scope of the current problem of us intraoperative handover of patient information . these findings are surprising given that the anesthesiology specialty places patient safety as one of its top objectives and that all survey respondents practiced in an academic institution . poor transition of patient care from the operating room has a high potential for adverse patient outcomes . we believe that patient handover practices should be discussed and an optimal response would be the formation of an expert consortium with the aim to develop and implement standardized protocols . the lack of standardized handover process has resulted in substandard patient care in us healthcare setting , ." ]

[ "we show that the cytokines ifn , ip-10/cxcl10 and mig / cxcl9 serve as effector molecules in slc / ccl21-mediated anti - tumor responses . the capacity to facilitate the co - localization of both dc and t cells forms a strong rationale for the use of slc / ccl21 in cancer therapy . in previous studies based on these findings we hypothesized that augmentation in ifn , mig / cxcl9 , and ip-10/cxcl10 would play an important role in the slc / ccl21-mediated anti - tumor response . here we have shown that the slc / ccl21-mediated anti - tumor responses are accompanied by the enhanced elaboration of ifn , ip-10/cxcl10 , mig / cxcl9 , gm - csf and il-12 , but decreased pge2 , vegf , il-10 , and tgf- at the tumor site . slc / ccl21 , normally expressed in high endothelial venules and in t cell zones of spleen and lymph nodes , strongly attracts t cells and dendritic cells ( dc ) [ 1 - 8 ] . slc / ccl21 recruits both nave lymphocytes and antigen stimulated dc into t cell zones of secondary lymphoid organs , co - localizing these early immune response constituents that culminate in cognate t cell activation .", "our results imply that all 3 cytokines , ifn , mig and ip-10 play interrelated roles in the recruitment of cxcr3-activated t cells in slc / ccl21-mediated anti - tumor responses . while the number of cd4 and cd8 cells remained unaltered , , we have previously shown that the anti - tumor efficacy of slc / ccl21 is t cell - dependent . in both models recombinant thus molecules that attract host apc and t cells could serve as potent agents for cancer immunotherapy . neutralization of any one of these cytokines caused a concomitant decrease in all three cytokines , thus indicating that ifn , mig / cxcl9 and ip-10/cxcl10 are interdependent in the slc / ccl21-mediated anti - tumor responses . based on these findings , we speculated that the decrease of ip-10/cxcl10 and mig / cxcl9 led to a decrease in ifn by limiting the influx of t cells producing ifn at the tumor site . a potentially effective pathway to restore ag presentation is the establishment of a chemotactic gradient that favors localization of both activated dc and type 1 cytokine producing lymphocytes at the tumor site .", "our results suggest that the anti - tumor properties of slc / ccl21 may be due to its chemotactic capacity in co - localization of dc and t cells as well as in part to the induction of key cytokines such as ifn , ip-10/cxcl10 and mig / cxcl9 .", "a weakly immunogenic lung cancer , lewis lung carcinoma ( 3ll , h-2 ) obtained from atcc ( crl-1642 , llc ) was utilized for assessment of cytokines important for slc / ccl21 mediated anti - tumor responses in vivo . md ) neutralizing antibody was purified by affinity chromatography from scid mice ascites , which was generated 34 weeks after intraperitoneal injection of 10r4 - 462 hybridoma cells per mouse . for flow cytometry , labeled antibodies ( fitc , pe , percp ) against the t cell surface markers to cd3 , cd4 , cd8 and against the dc markers , cd11c and dec 205 and the appropriate controls were purchased from pharmingen . five day established tumors were treated with intratumoral injection of 0.5 g of recombinant murine slc / ccl21 ( pepro tech , rocky hill , nj ) or murine serum albumin ( utilized as an irrelevant protein for control injections ) were administered three times per week for two weeks as previously described . 24 h prior to slc / ccl21 treatment , and then three times a week , mice were injected i.p . with 1 ml / dose of anti - ip-10/cxcl10 , or anti - mig / cxcl9 , or 100 g / dose of purified monoclonal anti - ifn or appropriate control antibodies ( goat igg and rat igg ) at equivalent doses for the duration of the experiment . in response to these antibodies , there was a significant reduction of the respective cytokines in vivo ( figure 2 ) . mig / cxcl9 , ip-10/cxcl10 and ifn were quantified using a modification of a double ligand method as previously described . the cell lines were mycoplasma free and cells were utilized up to the tenth passage before thawing frozen stock cells from liquid n2 . for tumorigenesis experiments ,", "md ) neutralizing antibody was purified by affinity chromatography from scid mice ascites , which was generated 34 weeks after intraperitoneal injection of 10r4 - 462 hybridoma cells per mouse . for flow cytometry , labeled antibodies ( fitc , pe , percp ) against the t cell surface markers to cd3 , cd4 , cd8 and against the dc markers , cd11c and dec 205 and the appropriate controls were purchased from pharmingen . polyclonal goat anti - murine mig / cxcl9 and anti - murine ip-10/cxcl10 specific anti - serum were produced and characterized as previously described . anti - mouse ifn monoclonal ( r4 - 462 , american type culture collection , rockville , maryland , abs to murine ifn , recombinant ifn were obtained from pharmingen ( san diego , ca ) . abs to murine mig / cxcl9 , ip-10/cxcl10 and recombinant cytokine standards was purchased from r&d ( minneapolis , mn ) .", "a weakly immunogenic lung cancer , lewis lung carcinoma ( 3ll , h-2 ) obtained from atcc ( crl-1642 , llc ) was utilized for assessment of cytokines important for slc / ccl21 mediated anti - tumor responses in vivo . 24 h prior to slc / ccl21 treatment , and then three times a week , mice were injected i.p . with 1 ml / dose of anti - ip-10/cxcl10 , or anti - mig / cxcl9 , or 100 g / dose of purified monoclonal anti - ifn or appropriate control antibodies ( goat igg and rat igg ) at equivalent doses for the duration of the experiment . in response to these antibodies , there was a significant reduction of the respective cytokines in vivo ( figure 2 ) . five day established tumors were treated with intratumoral injection of 0.5 g of recombinant murine slc / ccl21 ( pepro tech , rocky hill , nj ) or murine serum albumin ( utilized as an irrelevant protein for control injections ) were administered three times per week for two weeks as previously described . injection in the right supra scapular area of c57bl/6 mice and tumor volumes were monitored three times each week . the cell lines were mycoplasma free and cells were utilized up to the tenth passage before thawing frozen stock cells from liquid n2 . for tumorigenesis experiments ,", "mig / cxcl9 , ip-10/cxcl10 and ifn were quantified using a modification of a double ligand method as previously described .", "flow cytometric analyses for t cell and dc markers were performed on a facscan flow cytometer ( becton dickinson , san jose , ca ) in the university of california , los angeles , jonsson cancer center flow cytometry core facility . 10,000-gated events were collected and analyzed using cell quest software ( becton dickinson ) . for staining , two or three fluorochromes ( pe , fitc , percp ) ( pharmingen ) were used to gate on the cd3 , cd4 and cd8 t lymphocyte population or cd11c dc in single cell suspensions from tumor nodule . for cxcr3 expression , cells were identified as lymphocytes or dc by gating based on forward and side scatter profiles .", "statistical analyses of the data in figures 1 , 2 and in table 1 were performed using the paired student t test .", "authors sh , lxz , mh , rkb and mdb contributed to the discussion of the article . authors rms and smd together with ss conceived of the study , participated in its design and drafted the manuscript .", "we thank kimberly atianzar for excellent technical assistance in conducting the elisa measurements . national institutes of health grant r01 ca78654 , ca85686 , p50 ca90388 , medical research funds from the department of veterans affairs , the research enhancement award program in cancer gene medicine and the tobacco - related disease research program of the university of california supported this work ." ]

[ "our \n previous studies showed that e. coli k1 invasion of human bmec was \n significantly greater with stationary - phase ( sp ) cultures than with \n exponential - phase cultures , suggesting that expression of e. coli k1 invasion - associated virulence \n genes is strongly regulated in a growth - phase - dependent manner . a nonsense mutation in the sp regulatory gene rpos was identified in e. coli k1 strains e44 and ihe3034 . \n we speculated that iber is an rpos - like regulator in sp gene expression in e44 . in order to dissect the \n regulation of sp gene expression in e44 that is associated with the \n pathogenesis of e. coli meningitis , a comparative proteomic analysis of \n an iber deletion mutant ( br2 ) and its parent strain e44 complementation with the wild type e. coli k12 rpos gene \n significantly enhanced ihe3034 invasion of bmec , but failed to improve the invasion activity of another e. \n coli k1 strain e44 . these studies suggest that the growth - phase - dependent \n invasion of bmec by ihe3034 is affected by rpos and that e44 carries a \n loss - of - function mutation in the rpos gene .", "the mutant strains used in this study \n were derived from e44 , which is a rifampin - resistant strain derived from a \n neonatal meningitis isolate , e. coli k1 rs218 ( o18 : k1 : h7 ) [ 4 , 21 ] . competent e. coli cells were made in 10% glycerol \n and were transformed by electroporation as described previously [ 6 , 7 ] . to determine the role of the iber gene in the \n growth - phase - dependent e. coli k1 invasion of bmec , an isogenic deletion \n mutant of iber we used pcr and dna sequencing to confirm the internal deletion in the iber deletion mutant br2 and the desired \n chromosomal gene iber of the mutant with primers iber - s1 and iber - x2 \n ( table 2 ) . the bacterial strain and plasmid vectors and their relevant \n characteristics are shown in table 1 . e. \n coli k12 strain mc4100 and its rpos \n\t\t\t\t\t insertion mutation tn10 mutant rh90 \n were used as positive and negative controls for rpos , respectively . , \n conjugation and screening were carried out as described above . the tnaa gene deletion in the mutant tna44 \n the mutants named br2 were \n obtained by mating e44 with sm10 pir that carries pcbr2 as described previously \n . the ftn53 \n fragment was subcloned into pcvd442 between sali and xbai sites to get the \n suicide plasmid pctna2 . to get the tnaa in - frame deletion mutant , tna44 the surviving rate with stress was \n calculated from the ratio of the bacterial number under stress condition to the \n bacteria number under nonstress condition .", "we conclude that iber is an rpos - like regulator to control \n gene expression of proteins that are critical for stress - resistance and cell \n survival in the sp in e44 , which carries a loss - of - function mutation in the rpos gene . the gene iber in e. coli k1 e44 is predicted as \n the only regulatory protein present in the iberat operon in gima by \n bioinformatics approaches . to determine the role of iber gene in \n the growth - phase - dependent invasion of bmec by meningitic e. coli k1 , we classified the proteins into two main categories on the \n basis of their roles in the sp growth of e. coli cells : ( a ) response to \n environmental modifications ( including tnaa , \n tufb , ompc , ompa , and ahpc ) \n and ( b ) central metabolism ( including lpda \n and gapa ) . since iber was hypothesized as an \n sp - regulator contributing to the growth regulation and virulence of e44 , its \n role in the invasion process and resistance to stress conditions should be \n further characterized . the iber deletion also significantly reduced the \n survival rates ( more than 60% cell death ) of br2 as compared to that of the \n wild type strain e44 , suggesting that iber had a global regulatory role in the \n resistance to acid , alkali , high osmolarity and oxidative stress . in the \n survival assays for the e. coli control strain mg1655 the \n increase in ahpc expression indicated that the iber deletion led to an increased oxidative stress in sp compared with the wild type \n strain , suggesting that iber is involved in the resistance to oxidative \n stress upon entry into sp . \n\t\t\t\t\t", "rpos plays a \n central role in regulating the sp regulatory genes for protecting cells against \n starvation and stress damage . , we have \n demonstrated for the first time that iber serves as an rpos - like regulator to \n control gene expression that is critical for stress - resistance and cell \n survival in the sp of e44 . the current proteomic studies may provide an answer to the \n long - standing question regarding the sp gene regulation in e44 . combining the \n proteomics analysis , virulence determination , and the stress survival studies \n of the iber mutant br2 iber , a regulator in the gima regulon , may contribute to \n bacterial virulence adaptation process in e44 to complement the functional \n deficiency of rpos ." ]

[ "therefore , it is mandatory to understand that how coping ways adopted by college students differ from other students who experience the significant stress ; their perception of handling the psycho - social problems effectively , might help in the planning of intervention services . thus , the present study was made to understand the ways in which college students differ in coping with significant stress experienced by the students and to examine the different ways of coping strategies adopted by them . a coping style can be effective at one age but may be totally unsuitable at another age . in the similar way , a particular coping style may be totally appropriate in one situation while inappropriate in another . majority of the college students strive and try to handle the stress in a positive way . whereas , some of the students do not know , the ways to cope up with their problems and ; therefore , adopt unhealthy ways . stress is a very familiar condition faced by the students when they are unable to bear the risks involved in higher education . this may be determined to a large part of cultural expectations on the other hand , individual vulnerabilities set limits to ones coping . the parents have unlimited expectation from their children and therefore they impose their own desires on them . the impact of these influences results in a number of students reporting emotional problems , anxiety , stress , and other neurotic problems .", "the present study examines the coping patterns adopted by the junior college students with respect to stress in the academic area , and to study the gender difference in coping patterns among junior college students . the universe considered for the study was , i puc and ii puc students , who were studying either in bachelor of arts , science , or commerce . in the investigation process , a coping checklist with 70 diverse coping pattern , prepared by rao et al . , was used . yesno format and they described a broad range of behavioural , emotional , and cognitive response that may be used to handle stress ; and a socio - demographic data sheet was also used . in order to compute the difference between the means of two groups ( male and female ) , frequency , percentage , and t - test were used ; and to compare the frequencies of certain variables in the two groups , chi - square was used .", "the study was conducted on i puc and ii puc college students . with regard to the socio - demographic characteristics of the college students , overall , the total coping repertoires of students belonging to arts , science , and commerce faculties were 37 , 38 , and 35 , respectively . with respect to gender , the total coping repertoire for male and female students , were 36 and 37 , respectively . it was observed that majority of the students were aged between 1718 years , and number of females was slightly more than males . with respect to the religion , a majority of the students were hindu , and the least were islamic , compared to the students belonging to other religion ; because most of the people from islam do not tend to pursue higher education . it was seen that most of the students were from nuclear families , which is a very common trend in urban areas . with respect to education background , the coping strategies adopted by college students with regard to stressful events , i.e. , academic area were assessed .", "the study was conducted on i puc and ii puc college students . with regard to the socio - demographic characteristics of the college students , a majority of the students were hindu , and the least were islamic , compared to the students belonging to other religion ; because most of the people from islam do not tend to pursue higher education . it was observed that majority of the students were aged between 1718 years , and number of females was slightly more than males . with respect to the religion , it was seen that most of the students were from nuclear families , which is a very common trend in urban areas . with respect to education background , a majority of the students were from well - educated families , with their fathers being postgraduate and mothers being educated up to higher secondary . with regard to birth order of the child , majority of the students were middle born . it was also noted that , a majority of the respondents spoke other languages at home than kannada .", "majority ( 90% ) of the students belonging to science and arts faculties and 75% from commerce , used appraisal - focused coping strategies such as , console yourself that the things are not at all that bad , it could be worse , make light of the situation , refused to get too serious about it , refusing to believe that it happened . also , 43% of the students from commerce and science faculties used emotion - focused coping strategies , whereas 35% from arts faculty used emotional - focused coping strategies , such as , preparing themselves for the worst to come , feeling that other people are responsible for what has happened , and trying to feel better by eating / nibbling . the coping strategies adopted by college students with regard to stressful events , i.e. , academic area were assessed . distribution of the coping strategies adopted by the college students was examined with respect to their gender background . the distribution of coping strategies adopted by college students was examined with respect to different faculties , such as arts , science , and commerce . the results also revealed that the students irrespective of their gender , used combination of problem - focused and emotion - focused coping strategies ." ]

[ "however , 1530% of cases of dm are manifestations of paraneoplastic syndromes of an underlying malignancy . here , we present a case of concurrent dm and breast cancer to highlight a rare presentation , progression and regression of symptoms , as well as key components of diagnosis and treatment . dermatomyositis ( dm ) is an uncommon idiopathic inflammatory myopathy that primarily affects skeletal muscle and skin with well - characterized cutaneous findings . it has been well documented that dm carries an increased risk of malignancy and can present as a paraneoplastic syndrome to multiple types of underlying malignancies [ 3 , 4 ] .", ", she was presumptively diagnosed with paraneoplastic dm secondary to invasive ductal carcinoma of the left breast and treated with 20 mg prednisone daily . image of patient with facial rash and periorbital edema that initially developed during her workup ( a ) . her persistent and slowly progressing symptoms despite aggressive treatments prompted our decision to proceed with surgical intervention in hopes of preventing progression of her musculoskeletal manifestations . the patient is a 47-year - old polish premenopausal female who presented with complaints of a non - tender palpable left breast mass for 4 months at an outside institution . two weeks after the biopsy , she complained of new onset pruritic , erythematous rash on her anterior chest , face and back of the hands ( fig . ", "early diagnosis of dm as a paraneoplastic syndrome allows for initiation of systemic therapy for symptom control and also treatment of the underlying malignancy itself , which may aid in control of the dm symptoms . dm typically presents with progressive , symmetrical , proximal muscle weakness and characteristic skin lesions such as helitrope rash , gottron 's papules , gottron 's sign , the v - sign and shawl sign . given the high frequency of malignancy in patients with a diagnosis of dm , any woman over the age of 45 with newly diagnosed dm should prompt a thorough physical examination , including a breast examination , as well as further workup for other malignancies ( e.g. ovarian or colorectal cancer ) . malignancy can precede , occur concurrently or develop after the diagnosis of dm . in our patient , the symptoms of dm occurred 2 weeks following her diagnosis of breast cancer . the complete surgical excision of the underlying breast cancer resulted in dramatic improvement in both her cutaneous manifestations and her musculosckeletal symptoms .", "" ]

[ "target \n repurposing , wherein inhibitors of human homologues of essential \n parasite proteins are assessed for efficacy against parasite cells . we have recently initiated the repurposing of \n a variety of kinase inhibitors for parasitic diseases and have also described the use of established human phosphodiesterase \n inhibitors as starting points for lead discovery . we posit that such a \n cross - screening approach can be a highly fruitful method for identification \n of new protozoan parasite growth inhibitors . show activity against plasmodium falciparum , we also screened this set of compounds against \n cultures of drug - sensitive and drug - resistant strains of malaria . \n in doing so , we noted differential structure activity relationships \n for these compounds growth inhibitory properties against each \n of the parasites , thus launching a multiparasite optimization campaign \n from the same lead series . in this paper taken together , malaria ( caused by plasmodium species ) , human african trypanosomiasis ( hat , caused by trypanosoma brucei ) , chagas disease ( caused by t. \n cruzi ) , and leishmaniasis ( caused by leishmania species ) represent diseases with an estimated combined burden of \n over 87 million disability - adjusted life years . we have described the discovery of neu-617 ( 1 ) , a \n derivative of the approved human cancer drug lapatinib ( 2 ) , which acts as a potent , orally bioavailable growth inhibitor of t. brucei that showed a modest effect in a mouse model of \n bloodstream infection .", "first , \n in order to ascertain antiparasitic activities of our 66 \n previously reported analogs , we measured \n their growth inhibitory activities against t. cruzi ( intracellular amastigotes ) , l. major ( promastigote \n and intracellular amastigote life stages ) , and p. falciparum ( d6 , drug sensitive strain ) . the structures of the most potent compounds \n for each parasite are shown in figure 1 and \n table 1 , and the complete set of screening \n data for these is tabulated in the supporting \n information ( tables s1s7 ) . program progression from 2 to four thus , we planned a broader evaluation of other bicyclic aromatic replacements \n for the quinazoline scaffold that would test the important features \n of the chemotype for activity . , we observed that 15 morpholinosulfonamide \n compounds were identified with activity against l. major promastigotes : seven of these were submicromolar inhibitors and \n two were also submicromolar against intracellular amastigotes ( the \n most relevant life stage for human infections of leishmaniasis ) . these scaffold replacements were selected \n for exploration of the requisite nitrogen atom positioning in the \n heteroaromatic ring ( see the heterocycle precursors highlighted in \n figure 2 , dihalides 69 ) . , we elected to maintain \n the four permutations of head / tail combinations that displayed the \n most potency in each parasite ( shown in figure 1 ) in the new analogs that we prepared .", "such \n properties are undoubtedly a result of the high molecular weights \n and clogp values ; these issues remain the focus of ongoing efforts , \n which are now focused on specific scaffolds for each pathogen . in summary , through a cross - parasite \n screening campaign of existing \n quinazoline t. brucei proliferation inhibitors , we \n uncovered new hits against three other protozoan parasites . encouraged \n by that initial success , we focused on exploring the central heterocycle \n scaffold , an exercise that has uncovered additional highly potent \n compounds . thus , we have established a new lead series \n for each of these protozoan parasites , which can be now advanced in \n parallel for drug discovery against four different parasitic diseases . \n with this in mind , our studies \n demonstrate which of these scaffolds are the most promising \n for further optimization on a parasite - by - parasite basis . scaffold variations have revealed heteroatom positioning \n essential for activity within this chemotype , while variations to \n regiochemical attachment points have introduced a new set of regioisomers \n with multiparasite potency . compound 1 remained the most potent t. brucei growth inhibitor among this set of analogs . we were gratified to observe that all \n of the compounds tested are similarly active against drug resistant \n strains of p. falciparum ( table s9 , supporting information ) , suggesting that despite the shared \n scaffold , these analogs likely display a mechanism of action or mechanism \n of resistance that differs from those of chloroquine .", "to a solution of the appropriate \n aryl chloride ( 1 equiv ) in 2-propanol ( 0.15 m ) was added 3-chloro-4-((3-fluorobenzyl)oxy)aniline \n or 4-(benzyloxy)-3-chloroaniline ( 1.1 equiv ) . the formed precipitate was collected by vacuum \n filtration to obtain the desired products . to a solution of the appropriate \n aryl chloride ( 1 equiv ) in 2-propanol ( 0.15 m ) the crude product was \n purified by flash column chromatography . to a solution \n of the appropriate aryl iodide ( 1 equiv ) in 3:2 dimethoxyethane / ethanol \n ( 0.05 m ) the product was separated by silica column chromatography \n ( dichloromethane / methanol ) and purified by hplc to obtain the formic \n acid salt ." ]

[ "we report an atypical case of appendiceal abscess , which was diagnosed during colonoscopy . \n additionally , up to 10% of patients especially older ones , immunocompromised patients , and pregnant women are diagnosed with atypical presentations such as appendiceal mass which requires long hospital admissions , intravenous antibiotics , and often needs percutaneous drainage . \n \n \n acute appendicitis is considered as the most frequent cause of acute abdomen in young patients with a slight predominance in males . using colonoscopy for the diagnosis and treatment of asymptomatic acute appendicitis and appendiceal abscess are rare . in unusual appendicitis cases , especially in the presence of abdominal comorbidities , colonoscopy is used ; although colonoscopy is not considered as the first line intervention because of complications risk such as bleeding or perforation . furthermore non - invasive tests such as ultrasonography and computed tomography with more sensitivity can be used . although its clinical diagnosis is simple , 20 - 30% of appendicitis cases are reported to be gangrenous or perforated because of delayed diagnosis , which can lead to increased morbidity and mortality . \n \n", "\n a 30-year - old man referred for evaluation to our center with epigastric pain from three days prior to his evaluation . the collection was extended to pelvic cavity associated with inflammation of the surrounding fat in favor of appendiceal abscess ( figure 3 ) . \n purulent discharge from the appendiceal orifice before ( up ) and after ( down ) pressing by forceps ( arrow ) \n result of the biopsies of the mucosa at the base of the appendix showed mild nonspecific inflammation with some necrotic materials and staphylococcus organism . the appendiceal orifice was discovered in the floor of cecum which was draining pus into the lumen ( figure 1 ) . \n after 3 months of follow - up the patient was well without any complaint or physical finding . \n on the 5th week after antibiotic therapy , exploratory laparotomy did not show any mass or collection in the appendiceal region and elective appendectomy was performed .", "this unusual case highlights a patient with an appendiceal abscess diagnosed by colonoscopy . because of spontaneous drainage of abscess into the lumen of colon and antibiotic therapy , \n acute appendicitis is one of the most frequent causes of acute abdomen . despite the use of scores in the radiological evaluation , and laparoscopic advances , colonoscopy is reported as a diagnostic and therapeutic approach for delayed or atypical presentations of acute appendicitis . although the diagnostic and therapeutic role of colonoscopy in these patients is uncertain , however , it s use can be selected in special situations in the future . \n", "" ]

[ ". preparations containing isoforms ( cramoll 1,4 ) and isolectins ( cramoll 1,2,3 ) , as well as cramoll 1 , have been studied in structural analyses and for the most several biotechnological applications ( de souza et al . , 2003 ) [ 612 ] . the use of nuclear technique for the evaluation of biomolecules and medicines although old is not widely used even nowadays . since the discovery of the element technetium , in 1947 scintigraphy imaging provides a dimensional method for exactly locating gamma emitters in a noninvasive procedure under in vivo conditions . for the characterization of drugs , and biomolecules , molecular imaging techniques are extremely helpful to follow biodistribution in experimental animal studies . in this study molecular forms of c. mollis seed lectin ( cramoll 1 , cramoll 2 , cramoll 3 , and cramoll 4 ) have been highly purified and characterized ( de souza et al . , , the isolectins cramol 1,4 were radiolabeled with tc-99 m for the evaluation of the biodistribution and in order to forecast a possible use as radiopharmaceutical in healing process . cramoll 1 , cramoll 2 , and cramoll 4 specifically bind glucose / mannose , while cramoll 3 is a galactose - specific glycoprotein", "results were expressed as the percentage of injected dose per organ and percent of injected dose per gram of tissue ( table 2 , figures 2 and 3 ) . the radioactivity of the strips was verified in a gamma counter ( packard , cobra ii ) as described in table 1 . then , animals were sacrificed , their were organs removed and weighted , and the radioactivity uptake was counted in a gamma counter ( packard - cobra ii ) . then , this solution was incubated with 100 ci ( approximately 300 l ) of technetium-99 m ( ipen / cnen ) for other 10 minutes in order to label the cramol 1,4 ( here just called cramol ) with tc-99 m . in order to characterize the labeled cramol , thin - layer chromatography ( tlc ) was made using paper whatman no . counts were acquired for 5 min in a 15% window centered at 140 kev ( figure 1 ) . the labeling processes were made using 150 l of cramol ( isoform 1,4 ) solution incubated with stannous chloride ( sncl2 ) solutions ( 80 l / ml ) ( sigma - aldrich ) for 20 minutes at room temperature . planar images were obtained 1 hour after injection at a millennium gamma camera ( ge healthcare , cleveland , usa ) .", ", the results showed that the acetone can be used for this purpose . in a triplicate test , in both cases , further studies should be made to clarify this mechanism and the relevance of that information in a developed drug based on lectin similar to the cramol 1,4 . it is interesting to notice , analyzing both figures 1 and 2 , that the lectin can not pass the hematoencephalic barrier . and in this case , the lectin does not represent a risk for the brain function . however , the rate between the bowel and the kidney is over the double . in this case , the clearance time would be reduced and the reabsorption of the drug could be facilitated by the microvilli of the bowel . in this case moreover , the results observed in the chromatogram elucidated the question about the efficacy of the labeling process , corroborating that the cramol was efficiently labeled with tc-99 m .", "the radiolabeling of the cramol showed that this lectin has an uncommon behavior specially related to the clearance mechanism that we believe must be more studied . it also showed that the nuclear technique can be very helpful for the development of drugs and medicines ." ]

[ ", we investigate fair specific risk factors contributing to the emergence of influenza a virus in exhibition swine that could be altered to mitigate the risk of iav transmission in these settings . the comingling of swine from numerous premises with varied management practices and their interaction with large numbers of exhibitors and visitors make agricultural fairs an ideal setting for the intra- and inter - species transmission of influenza a viruses ( iavs ) between swine and human populations . epidemiological data show that zoonotic transmission of iav from swine to humans has been documented at unprecedented levels in recent years .", "the commercial swine inventory was retrieved from united states department of agriculture 's 2007 census of agriculture . classification of swine included market swine ( pigs bred , raised and intended for food purposes ) and breeding swine ( gilts , sows and/or boars being raised for breeding purposes ) . as part of an ongoing active iav surveillance project , swine nasal swabs and associated metadata about management practices were collected at 40 ohio fairs in 2012 . all pigs sampled in this study were from junior fair market swine shows occurring at agricultural fairs . terminal swine shows are those in which all participating livestock are consigned to harvest immediately following the exhibition and partial terminal shows usually require the champion animals to be harvested following the exhibition and other pigs may or may not go to harvest . to account for the variability of arrival and departure procedures among fairs enrolled in this study , the length of the swine exhibition was defined as the number of days between the required arrival deadline for the pigs and the day the pigs were sampled .", "pre - fair tag - in and/or weigh - in events were rather common with 23 out of 40 ( 57.5% ) of the enrolled fairs holding one of these events . for every increase of 20 pigs at a fair , the odds ratio of iav infection in the pigs increased by 1.27 times ( table 2 ) . influenza a virus was recovered from pigs at 10 of the 40 fairs included in the investigation . the presence or absence of iav infection among the pigs at the fairs average daily mean temperature was almost 4 c higher for fairs with iav - positive pigs ( table 1 ) . could not be associated with county population , county swine inventory and number of people attending the fair ( table 1 ) . all iav - positive fairs and 27 of 30 ( 90% ) negative fairs were mixed sex ( barrows and gilts ) market swine exhibitions . the average space per pig at the studied fairs was 12.8 ft / pig . properly functioning hand - wash and/or hand - sanitizer stations were available at 25 of 40 ( 62.5% ) fairs .", "the results of the current study provide the first look at fair - level risk factors associated with iav infections in swine at agricultural fairs . these data provide a critical first step toward developing effective iav mitigation strategies in swine populations that benefit fairs , exhibitors , visitors and the swine industry . use of iav vaccine in exhibition swine to decrease the risk of iav infections in swine and humans has been one of the most debated topics following the h3n2v outbreak of 2012 . while it is likely impossible to completely prevent iav transmission at swine exhibitions , these data can be used to develop and evaluate mitigation strategies to reduce the impact of intra- and inter - species iav infections at swine exhibitions ." ]

[ "", ", we conducted reference based transcriptome assembly of suvarna , a well - known turmeric cultivar which could latter on used to get potential snps by comparing with other varieties towards proper identification . single nucleotide polymorphism ( snp ) study could be useful to solve these problems by comparing sequence of each variety with each other . in this current study it is a vegetatively propagated , polyploid crop commonly known as golden spice . because of its multipurpose use as food preservative , spice , therapeutic agent and natural dye , it is acquiring more importance in cosmetics , food and pharmaceutical industries , . in turmeric number of cultivars turmeric ( curcuma longa l. ) of family zingiberaceae is industrially as well as pharmaceutically important crop extensively cultivated in india . has been developed with different characteristics like high curcumin content , high essential oil content , rhizome yield and disease tolerance etc . but their asexual mode of reproduction and poor genetic makeup has creates confusion towards authentic identification .", "as per our understanding transcriptome analysis of cultivar suvarna has been done for the first time and this result could be efficiently used for development of markers such as ssrs and snps for identification of suvarna from its closely similar turmeric cultivars . we have precisely given detail information about the reference based transcriptome assembly of suvarna cultivar ( table 1 ) . fresh mature rhizomes of suvarna variety has been collected from centre for biotechnology , siksha o anusandhan university , bhubaneswar , india . the transcriptome assembly of suvarna developed 42994 numbers of transcripts , with median transcript length 773 and n50 value 1216 . rna extraction and library preparation has been done by using illumina truseq rna library tool kit . 75 bp paired - end sequencing has been done using illumina nextseq500 sequencing platform which developed5 gb of raw data .", "fresh mature rhizomes of suvarna variety has been collected from centre for biotechnology , siksha o anusandhan university , bhubaneswar , india . these rhizomes were washed properly with distilled water and suspended in rna later solution for further analysis .", "rna extraction and library preparation has been done by using illumina truseq rna library tool kit .", "we have precisely given detail information about the reference based transcriptome assembly of suvarna cultivar ( table 1 ) . as per our understanding transcriptome analysis of cultivar suvarna has been done for the first time and this result could be efficiently used for development of markers such as ssrs and snps for identification of suvarna from its closely similar turmeric cultivars . 75 bp paired - end sequencing has been done using illumina nextseq500 sequencing platform which developed5 gb of raw data . the transcriptome assembly of suvarna developed 42994 numbers of transcripts , with median transcript length 773 and n50 value 1216 . we annotated the transcripts using various databases like go , kegg , kog , plantcyc etc ." ]

[ ", only four studies have investigated the relationship between the soc and depressive symptoms , one used the brief job stress questionnaire and the other three used general health questionnaire . the aim of this study was to investigate the relationship between depressive state , job stress , and soc among nurses in japanese general hospital . people with a strong soc have a high ability to cope with stress and maintain good physical and mental health . to the best of our knowledge the sense of coherence ( soc ) , which was proposed by antonovsky is based on the salutogenic model of health . the soc is composed of three factors ; ( 1 ) the stimuli derived from internal and external environments in the course of living are structured , predictable , and explicable ( comprehensibility ) ; ( 2 ) resources are available to meet the demands posed by these stimuli ( manageability ) ; and ( 3 ) such demands are challenges , worthy of investment and engagement ( meaningfulness ) . antonovsky defined the soc as a personality dimension that is hypothesized to influence stress recognition style , facilitate stress management , and contribute to overall well - being . , six studies have investigated the association between soc , job stress , and mental health .", "we used pearson 's correlation to investigate the relationship among age , work related - factors , job stress , soc , and depressive state . to examine factors with a significant effect on depressive state , higher scores indicate a more depressive state . the k6 was translated into japanese and showed good validity with the diagnostic and statistical manual of mental disorders , fourth edition , mood , and anxiety disorders in a community sample . in february 2013 , supervisors distributed a questionnaire to all nurses ( n = 710 ) in a general hospital with 611 beds in an urban area in japan . we measured job stress using the japanese version of the effort - reward imbalance ( eri ) scale ( 23 items ) translated by tsutsumi et al . we measured depressive state using the k6 short screening questionnaire that was developed in accordance with the world health organization translation guidelines .", "pearson 's coreration between work environments , eri ratios , over - commitment , soc and depressive state table 3 shows the influence of work - related factors , eri ratios , and soc on depressive state . soc , over - commitment , effort - esteem ratio , and age were significantly correlated with depressive state ( = 0.46 , p < 0.001 ; = 0.27 , p < 0.001 ; = 0.16 , p < 0.001 , = 0.10 , p < 0.01 , respectively ) . depressive state moderately correlated with three eri ratios , over - commitment , and soc . characteristics of study subjects table 2 shows the pearson 's correlation coefficients between age , overtime hours , eri ratios , soc , and the depressive state . subjects with missing values for job stress , soc , or depressive state were also excluded ( n = 43 ) . the final sample for analysis consisted of 348 female nurses ( 52.1% ) , including nurses who were managers and middle managers . overtime was reported in hours per week , which was voluntary but limited to 45 h / month .", "intervention support enhancing the soc could be effective in preventing nurses from experiencing a depressive state . we found that soc , over - commitment , effort - esteem ratio , and age were predictors of depressive state among female nurses in the general hospital . previous studies suggested that an increasing soc of workers may reduce negative job stress responses and mental health problems . age correlated positively with soc [ table 2 ] , which was also similar to a previous study by harri who suggested that soc tends to increase with age . the present findings suggest that a depressive state of nurses was associated with not only job stress but also both over - commitment and soc . strength of our study is that we investigated the independent contribution of three ratios of eri ( effort - esteem , effort - job security , and effort - promotion ) , over - commitment , and soc to the depressive state . according to our previous study , the soc was inversely associated with depressive state , which was similar to previous studies .", "intervention support such as group cognitive psychotherapy to strengthen comprehensibility , manageability , and meaningfulness may help nurses cope better with job stress and reduce their risk of depression . our findings provide insight into some factors associated with a depressive state among nurses in a general hospital . from a practical perspective , the influence of soc on a depressive state should be considered for health care professionals ." ]

[ "huntington 's disease ( hd ) is an autosomal dominant , progressive neurodegenerative disorder characterized by chorea , subcortical dementia and psychiatric symptoms . we report three patients with huntington 's disease , who showed good response to treatment with low dose lithium . one of the treatment options is the use of drugs with neuroprotective potential , like lithium . the causal hd gene has been identified as it15 , which has cag repeats in the open reading frame ( orf , in exon 1 ) just following the 5end of the gene . it leads to the translation of a protein , huntingtin , whose function is unknown . the therapeutic strategies for hd are diverse , ranging from the classical drug therapies to the modern molecular strategies .", "b , a 58-year - old male , presented in 2001 with a history of abnormal movements . c , a 51-year - old lady presented in 2002 with history of psychiatric symptoms for the previous 8 years . however , she continued to be dependent on husband for activities of daily living and eventually died due to cardiac arrest . mrs . a , a 48-year - old homemaker , presented in 2008 with a three - year history of involuntary movements of the trunk and the hands , which had worsened over the previous 7 - 8 months . patient had a significant family history of hd ; involving both parents and 7 out of 9 siblings , totally 9 affected first - degree relatives . on examination , patient was noted to have severe generalized chorea involving the hands , legs , trunk and the neck .", "mrs . a , a 48-year - old homemaker , presented in 2008 with a three - year history of involuntary movements of the trunk and the hands , which had worsened over the previous 7 - 8 months . patient is on regular follow up for the last four years and is maintaining the same improvement . a genetic analysis for huntington 's disease was performed after obtaining written informed consent which showed cag repeat expansion .", "b , a 58-year - old male , presented in 2001 with a history of abnormal movements . patient was noted to have severe generalized chorea involving the hands , legs , trunk and the neck . the patient has been on follow up for the last three years and maintains status quo . patient had a significant family history of hd ; involving both parents and 7 out of 9 siblings , totally 9 affected first - degree relatives . on examination ,", "c , a 51-year - old lady presented in 2002 with history of psychiatric symptoms for the previous 8 years . however , she continued to be dependent on husband for activities of daily living and eventually died due to cardiac arrest . two years later , patient had sudden deterioration in symptoms with worsening of chorea and onset of cognitive decline memory disturbances and apraxia , which made her completely dependent for all activities of daily living . during this time , she also developed significant mood swings . , patient developed psychotic symptoms like delusions of reference and persecution toward her family members and was also started on quetiapine up to 300 mg .", "in this report , we have described the use of lithium to prevent the progression of the huntington 's disease . huntington 's disease ( hd ) is an autosomal dominant progressive neurodegenerative disorder caused by an expanded polyglutamine ( poly q ) tract within huntingtin protein and is characterized by neuronal loss mainly in the striatum and the cortex . in addition to the well - documented use of lithium as a mood stabilizing drug , primarily in the treatment of bipolar disorder , recent in vitro and in vivo studies in animal models have increasingly indicated that lithium can be used in the treatment of chronic neurodegenerative diseases like huntington 's disease . this report signifies the use of lithium as a neuroprotective agent . it may be beneficial to explore the possibility of use of other psychotropic drugs in the treatment of neurodegenerative disorders" ]

[ "the purpose of this study was to determine if there were differences in calf muscle sto2 parameters before and after 12 weeks of a traditional walking program versus a walking - with - poles exercise program . we hypothesized that the calf muscle tissue deoxygenation would be less in both groups after 12 weeks of exercise training than at baseline and that the decrease would be greater in those patients assigned to the walking - with - poles group . three of the above studies examined the changes in tissue oxygenation , using nirs , in patients with pad before and after an exercise training program [ 1214 ] . no studies however compared leg muscle responses after a traditional walking program compared to a walking - with - poles program of rehabilitation in patients with claudication . ", "patients with pad were screened and recruited to participate in a randomized clinical trial designed to compare the effects of a traditional walking training program versus walking - with - poles exercise training program . the major study was a randomized clinical trial to examine the effects of a traditional walking program compared to walking with poles on walking endurance and perceived physical function in patients with pad . our primary outcome focused on changes the patients realized walking on the constant work rate treadmill test whereas this analysis used data from the progressive treadmill test . at two minutes on the constant work rate test , the speed and incline increased to 85% of the patient 's workload on the progressive treadmill test resulting in a sudden decline in sto2 . due to the gentle nature of the progressive treadmill protocol used , we were able to detect more subtle changes in sto2 and onset of claudication pain . of those 85 patients , 45 were assigned to the walking - with - poles group and 40 patients were assigned to the traditional walking group . , we included only those participants with an abi of 0.90 ( n = 91 patients ) . of those 91 patients , 3 did not have sto2 analyses on their baseline progressive treadmill test due to equipment malfunction and 3 had questionable data resulting in a final sample of 85 patients . the abi was measured in the more severely affected leg at baseline and 12 weeks after training .", "therefore , we examined the onset of claudication pain and time to nadir sto2 for those whose exercise was limited by claudication pain only ( n = 72 ) . calf muscle oxygenation decreased from 56 17% prior to the treadmill test to 16 18% at peak exercise ( 71% relative decline from rest to peak exercise ) . after 12 weeks of exercise training , within - group changes in initial claudication time , absolute claudication time and time elapsed prior to reaching nadir sto2 values increased ( table 4 . ) the time elapsed prior to reaching nadir sto2 values increased more in the traditional walking group when compared to the walking - with - poles group ( walking group = 4.01 5.13 minutes , walking - with - poles group = .89 3.56 minutes , p = .009 ) . the change in the time elapsed prior to reaching nadir sto2 values ( p = .002 ) and absolute walking time ( p = .002 ) were greater in the traditional walking group when compared to the walking - with - poles group . prior to reaching nadir sto2 values between baseline and 12 weeks was related to the change in absolute walking time between baseline and 12 weeks ( r = .65 , p < .001 ) and initial claudication time at 12 weeks ( r = .33 , p = .002 ) . patients walked 4.45 3.67 minutes before experiencing claudication pain and 4.39 3.99 minutes when the sto2 reached its nadir value .", " there are three major findings of this study : ( 1 ) the time elapsed before reaching nadir sto2 values is associated with initial claudication time and absolute walking time , ( 2 ) there was no difference in the time associated with the nadir of sto2 and the onset of claudication pain , and ( 3 ) the time to nadir sto2 of the gastrocnemius muscle was greater after 12 weeks of exercise training in the traditional walking group when compared to the walking with poles group . as bauer notes , during higher work rates and apparent blood flow limitation , muscle oxygen desaturation becomes more rapid in pad subjects . our findings provide further evidence that walking exercise improves tissue muscle oxygenation in patients with pad . lastly , although all of our patients experienced claudication pain , not all patients stopped exercise due to claudication pain . including patients that did not stop exercise due to claudication pain thus , one would expect that oxygen desaturation would be associated with onset of claudication and walking duration . likewise , our findings support the possibility that the onset of claudication and walking duration are linked by the decline in tissue oxygenation . thus , the patient 's perception of pain is a good indicator of sto2 in the calf muscle .", "contrary to our hypothesis , after 12 weeks of exercise training , absolute walking time and time to reach nadir muscle tissue oxygenation were prolonged in the patients assigned to the traditional walking program more than those assigned to a walking - with - poles exercise training program reflecting greater tissue perfusion and enhancement of arteriovenous oxygen extraction . the precise mechanism for these differences remains unknown but these findings may provide some insight to tissue adaptations to exercise stimulus and may therefore be useful to pad rehabilitation programs . in summary , we conclude that there is a significant decline in sto2 in the gastrocnemius muscle during walking exercise in patients with peripheral arterial disease reflecting muscle tissue ischemia ." ]

[ "we examine sequences from pathogenic interactions between species from the genus phytophthora and the plant hosts g. max and medicago truncatula , then apply the word - counting approach to sequences from two microbial mutualists in association with m. truncatula , the arbuscular mycorrhizal zygomycete glomus versiforme , and the nitrogen - fixing bacterium sinorhizobium meliloti . various solutions are readily conceived , each with merits and faults . here , we show that a comparative lexical analysis of word counts ( specifically , hexamer frequencies ) , previously used to detect library contamination in sequencing projects , provides a powerful computational basis to infer a transcript 's species of origin . experimentally , one can attempt to solve the problem by hybridizing a clone ( as probe ) to genomic dna ( target ) from both species and determining to which target the probe hybridizes . access to automated dna sequencing technology has made possible the rapid generation and analysis of gene transcripts expressed in organisms via expressed sequence tags ( ests ) . novel gene products and target leads for therapeutic intervention can also be gleaned rapidly from ests . a more detailed understanding of the molecular interactions between symbionts , whether pathogenic or mutualistic , is also possible with this approach . for a sequence isolated from interacting symbionts , determining its cellular role ( or roles )", "the method of preparing a library can affect the proportion of plant and non - plant sequences , as discussed below . thus , the majority of the most plant - like transcripts in the infected soybean library strongly resemble characterized plant sequences . analysis results from all m. truncatula and mixed - culture transcripts are available as additional data files , grouped by the library from which transcripts were sequenced , and sorted from the least plant - like transcripts to the most plant - like . mycorrhizal test sequences are more difficult to differentiate than sequences from the rhizobacterial or pathogenic associations , as seen by the diminished variation about the identity function in mycorrhizal comparisons ( figure 5b ) , contrasted with comparisons from pathogen - infected and nodulating root libraries ( figures 5a and c , respectively ) . distributions of gc content are approximately normal in two of three cases studied , those of axenic p. sojae cultures ( figure 1 ) . for sequences from infected plant cultures ,", "symbiotic interactions , whether pathogenic or mutualistic , present novel challenges to both plant hosts and the biologists who study them . computational approaches , in concert with experimental verification , can help resolve these challenges . the abundance of putative microbial symbiont transcripts among sequences from a pure plant root library is difficult to interpret . clearly , the word - counting approach provides a reliable solution to the problem of source identification with known confidence , and has several significant advantages . the transcripts identified as most and least like plant or symbiont might also be studied in more detail as candidate participants in symbiosis . for clear separation between the two species to appear , the two must differ in composition and a detectable proportion of transcripts from each species must be present in the library . to be detectable , the proportion of transcripts present from a particular species must be greater than the error rate obtained from calibration curves . though these criteria are true for the infected g. max library ( t < 0 for < 25% of 927 transcripts ) , they do not appear to be true for the m. truncatula libraries we analyzed ( t < 0 for 8099% of 8903,017 transcripts ) . in the p. medicaginis interaction library these differences in how tissues were cultured prior to library preparation could have produced the disparate abundance of plant transcripts , though both libraries were prepared from plant tissues infected with phytophthora . for mycorrhizal root libraries", "the most challenging case was that of the arbuscular mycorrhizal fungi , for which very few protein - coding sequences are available . to increase the amount of data in this training set ( b2 ) without biasing sample sizes , we pooled sequences from all species in the zygomycetes with all available chytridiomycete coding sequences , and compared this training set with a set from a single plant genus , medicago ( a2 ) . to characterize hexamer frequencies in plant hosts and their microbial symbionts , we collected sets of training sequences from public databases and edited them for quality . the decision to exclude non - coding rna sequences from training sets was informed by the appearance of bimodal distributions of hexamer frequencies and a large degree of overlap between calibration curves ( data not shown ) , likely a result of divergent evolutionary rates between protein - coding and non - coding sequences . due to considerable overlap of calibration curves between taxonomically general , inclusive training sets ( that is , all eudicots , all fungi and miscellaneous eukaryotes , and all eubacteria , data not shown ) , we opted to work with specific training sets that included only the most species - specific sequences available , while maintaining approximately equal sample sizes across taxa . we withheld these sequences , and partial transcripts of the same genes , from training sets prior to comparative lexical analysis , and calculated hexamer dissimilarities for each of the three training sets as described below . to diagnose the species of origin for sequences expressed in symbiotic cultures , we collected sequences generated by distinct est sequencing projects from the genbank database . chloroplast and mitochondrial sequences were eliminated to avoid complications due to variation in codon usage between nuclear and organellar genomes .", "to test the validity of word counting as a solution to the problem , we identified a set of 50 gene sequences from plants ( m. truncatula and g. max ) , oomycetes ( phytophthora ) , zygomycetes ( glomus versiforme ) , and bacteria ( sinorhizobium meliloti and agrobacterium tumefaciens ) , for which the function and origin have been characterized experimentally . the most challenging case was that of the arbuscular mycorrhizal fungi , for which very few protein - coding sequences are available . to increase the amount of data in this training set ( b2 ) without biasing sample sizes , we pooled sequences from all species in the zygomycetes with all available chytridiomycete coding sequences , and compared this training set with a set from a single plant genus , medicago ( a2 ) . to characterize hexamer frequencies in plant hosts and their microbial symbionts , we collected sets of training sequences from public databases and edited them for quality . the decision to exclude non - coding rna sequences from training sets was informed by the appearance of bimodal distributions of hexamer frequencies and a large degree of overlap between calibration curves ( data not shown ) , likely a result of divergent evolutionary rates between protein - coding and non - coding sequences . chloroplast and mitochondrial sequences were eliminated to avoid complications due to variation in codon usage between nuclear and organellar genomes . training sets represent protein - coding sequences from three taxonomic groupings : plants ( a1 , medicago and glycine spp . ) , either fungi ( b2 , zygomycetes and chytridiomycetes ) or stramenopiles ( b1 ) , including ests from p. infestans , and bacteria ( b3 , rhizobium , sinorhizobium and bradyrhizobium ) .", "to characterize hexamer frequencies in plant hosts and their microbial symbionts , we collected sets of training sequences from public databases and edited them for quality . the most challenging case was that of the arbuscular mycorrhizal fungi , for which very few protein - coding sequences are available . to increase the amount of data in this training set ( b2 ) without biasing sample sizes , we pooled sequences from all species in the zygomycetes with all available chytridiomycete coding sequences , and compared this training set with a set from a single plant genus , medicago ( a2 ) . that is , the ascomycetes and basidiomycetes are more highly derived from the common fungal ancestor than zygomycetes and chytridiomycetes , which resemble more closely the ancestral state in modern lineages . we chose this option , rather than including an arbitrary subset of sequences from the ascomycetes and basidiomycetes , because zygomycetes and chytridiomycetes have diverged from their common ancestor less recently than the ascomycetes and basidiomycetes , based on 18s ribosomal rna sequence data . training sets represent protein - coding sequences from three taxonomic groupings : plants ( a1 , medicago and glycine spp . ) , either fungi ( b2 , zygomycetes and chytridiomycetes ) or stramenopiles ( b1 ) , including ests from p. infestans , and bacteria ( b3 , rhizobium , sinorhizobium and bradyrhizobium ) .", "the decision to exclude non - coding rna sequences from training sets was informed by the appearance of bimodal distributions of hexamer frequencies and a large degree of overlap between calibration curves ( data not shown ) , likely a result of divergent evolutionary rates between protein - coding and non - coding sequences . starting with a full set of sequences , we filtered for high - quality sequences by trimming regions having extensive ambiguous bases ( n - rich ) and poly(a ) or poly(t ) regions . chloroplast and mitochondrial sequences were eliminated to avoid complications due to variation in codon usage between nuclear and organellar genomes . thus , we trimmed poly(a ) and poly(t ) sites to minimize the cases in which a test sequence resembles one training set more closely than the other , simply by virtue of having an abundance of the hexamer aaaaaa or tttttt . table 2 summarizes counts of sequences and nucleotides in training sets before and after trimming and screening . those sequences found to contain an internal poly(a ) or poly(t ) segment longer than 13 nucleotides were partitioned into two fragments , and the longer of the two fragments was used in analysis , provided its length was at least 300 nucleotides . after trimming , we screened all remaining sequences of 300 nt or longer for similarity to escherichia coli using blastn .", "to test the validity of word counting as a solution to the problem , we identified a set of 50 gene sequences from plants ( m. truncatula and g. max ) , oomycetes ( phytophthora ) , zygomycetes ( glomus versiforme ) , and bacteria ( sinorhizobium meliloti and agrobacterium tumefaciens ) , for which the function and origin have been characterized experimentally . we chose genes known to play a role in plant - microbe interactions , as well as genes that are found across taxa . we withheld these sequences , and partial transcripts of the same genes , from training sets prior to comparative lexical analysis , and calculated hexamer dissimilarities for each of the three training sets as described below .", "sequences from pathogenic interactions originated from cultures of a species from the genus phytophthora with its plant host , such as p. sojae and soybean ( g. max ) isolated from inoculated hypocotyls two days after infection and p. medicaginis and m. truncatula isolated from infected roots 10 days after infection ( c. vance , unpublished data ) . to diagnose the species of origin for sequences expressed in symbiotic cultures , we collected sequences generated by distinct est sequencing projects from the genbank database . independent blastn comparisons identified sequences having very high similarity ( e < 10 ) to vector sequences or moderately high similarity ( e < 10 ) to non - nuclear or non - coding sequences obtained from genbank . . sequences expressed in pure , axenic cultures from p. sojae mycelia and zoospores and from sterile , uninoculated m. truncatula roots provided a basis for comparison in which no foreign transcripts were expected . to maximize the reliability of diagnostic comparisons , we screened test sequences for high quality as for training sequences , and for low similarity to e. coli , chloroplast and mitochondrial genes , and non - coding rna transcripts ( ribosomal and transfer rnas ) . sequences expressed during mutualistic interactions were obtained from cultures with m. truncatula and mycorrhizal ( glomus versiforme ; m.j . harrison , unpublished data ) or rhizobacterial ( s. meliloti ; k. vandenbosch , unpublished data ) endosymbionts several days after inoculation", "we wrote a perl program ( countgc.pl ) that calculates the gc base content of a sequence as the portion of guanine and cytosine residues among all unambiguous ( non - n ) nucleotides in a sequence . the hist method in r , version 1.1.1 aggregated continuous percentages into discrete histogram bins , using bin sizes of 2% difference in gc , with inclusive lower bin boundaries and exclusive upper bounds ; the lm method tested for linear correlation of the dissimilarity test statistic t with gc .", "white et al . used a likelihood - ratio test to determine whether word frequencies from a particular sequence more closely resemble the frequency distribution of control data sets from the taxon being sequenced or a distantly related outgroup . reported the best results were obtained using hexamers , and because a word size of six nucleotides corresponds to the size of a dicodon , we chose to analyze hexamer frequencies . to use longer words requires more training data , because the number of possible words increases exponentially with increasing word size . we simplified one program ( called hybridize ) to compute individual dissimilarity values , rather than paired differences ; a patch that details how to modify the c program is available ( see hyb2dis.txt in additional data files ) . is justified because we know the correct answer and determine the error rate via resampling , as with bootstrap methods to infer error rates or confidence intervals . more importantly , we amended the null hypothesis and interpreted calibration curves to test for statistically significant dissimilarity differences . though the likelihood - ratio test statistic indicates the magnitude of similarity to a or b , we do not know what values for t are significant with known confidence . the false - positive rate is denoted and false - negative rate . we determine and from overlap in the calibration curves . inferring error rates from calibration curves the null hypothesis here is that sequence x is from a. alternatively , it might be from b. evaluating the calibration curve overlap at t = 0 quantifies the associated error rates . originally , the investigators used the null hypothesis that no difference exists for dissimilarity measures between the two data sets , or that t(a , b , x ) = 0 .", "the following files are available for download : countgc.pl : perl script used to compute gc content of sequences analyzed . hyb2dis.txt : patch file that converts white 's hybridize program to compute individual dissimilarity values . training sets ( glycinemedicago.txt,rhizobia.txt , stramenopiles.txt , zygochytrid.txt ) : fasta - formatted text files that contain the sequences used for calibration and comparison . test results ( psojaeha.dat , psojaemy.dat , psojaezo.dat , mtrhe-a1b1.dat , mtrhe-a2b2.dat , dsir.dat , mham.dat , kv0.dat , kv2.dat , kv3.dat ) : text files that contain transcript analysis results , sorted from least to most plant - like .", "fasta - formatted text files containing transcripts analyzed , edited for quality . text files that contain transcript analysis results , sorted from least to most plant - like .", "we thank callum bell , mark gijzen , maria harrison , tom kepler , deb samac , and bruno sobral for valued discussions and feedback . comments from b. m. tyler and an anonymous reviewer on an earlier version of this work greatly enhanced its presentation .", "( a ) calculation of statistical parameters from cdfs a and b. overlap in the upper tail of cdfa with cdfb and the lower tail of cdfb with cdfa are likely regions for error . each point corresponds to an expressed tag from either ( a ) infected g. max or ( b ) axenic p. sojae mycelial or ( c ) zoospore sequences , compared with plant ( a1 ) and stramenopile plus p. infestans est training sequences ( b1 ) . we find the false - positive rate where 1 - cdfa intersects 0 [ cdfa(0)= 1 - ] , and the false - negative rate where cdfb crosses 0 . also shown distribution of gc content in pure and mixed - culture libraries . ( a ) probability densities for histogram bin sizes of 0.02 ( 2% ) in base content . cumulative distributions of test results from m. truncatula axenic and microbial symbiont mixed cultures appear in each panel ( colored lines ) ." ]

[ "the transition - metal - catalyzed \n amination of aryl halides has become \n one of the most powerful methods to construct arylamines . these \n studies rule out a catalytic cycle occurring through a ni(i ) halide \n intermediate and are consistent with a ni(0)/ni(ii ) catalytic cycle \n for the amination of aryl chlorides and aryl bromides , which react \n with different ni(0 ) species . the reaction occurs \n with aryl and heteroaryl chlorides and bromides catalyzed by a single - component \n binap - ligated nickel(0 ) precursor . however , the scope of the nickel - catalyzed amination of aryl halides \n has been limited to the coupling of secondary alkylamines and arylamines .", "we initiated our studies \n of nickel - catalyzed amination of aryl \n chlorides with primary aliphatic amines by studying the reaction between \n 3-chloroanisole and octylamine . nickel complexes of n - heterocyclic carbenes have \n been shown to couple aryl chlorides and sulfonates with secondary \n amines and with arylamines , but not primary alkylamines . mechanistic \n studies on the reactions of secondary amines catalyzed by the complexes \n of n - heterocyclic carbenes are too limited to determine \n the origin of their lack of reactivity with primary amines , but recent \n studies have shown that the arylnickel halide complexes containing \n hindered n - heterocyclic carbenes are not formed by \n the reaction of ( imes)2ni(0 ) with chlorobenzene , bromobenzene , \n and iodobenzene . instead , ni(i ) species \n are formed , and this formation of ni(i ) complexes could either constitute \n the pathway for catalyst decomposition or a mechanism for reaction \n with this catalyst involving odd - electron nickel intermediates . we investigated nickel complexes generated \n in situ from ni(cod)2 and various phosphine ligands as \n catalysts . the different reactivities \n of aryl halides with binap - ligated nickel complexes of different coordination \n numbers parallels a trend in oxidative addition to pd(0 ) complexes \n noted in the introduction to this section . based on the stoichiometric reactions of \n the isolated binap - ligated arylnickel halides with primary amines \n in the presence of base and the conducted kinetic studies , we propose \n a catalytic cycle depicted in scheme 6 for \n the nickel - catalyzed amination of aryl chlorides and aryl bromides \n reported in this paper . the mechanism of palladium - catalyzed cross - coupling reactions with \n aryl halides as electrophiles has been extensively studied . the formation of bis(amine)-ligated palladium complexes \n was reported \n as one possible pathway for deactivation of the catalyst in the palladium - catalyzed \n amination of aryl halides .", "we have shown that nickel complexes containing \n common aryl bisphosphine \n ligands can catalyze the coupling of aryl chlorides and bromides with \n primary amines . ( 6 ) mechanistic and kinetic \n studies imply that the turnover - limiting \n step of the reactions of aryl bromides is also oxidative addition , \n but that aryl bromides react with a different nickel species , of composition \n ( binap)ni(-nc - ph ) containing a bound nitrile . in particular , we have shown that the mixed ni(0 ) \n species ( binap)ni(-nc - ph ) containing one bisphosphine \n and one side - bound nitrile is a particularly active catalyst for the \n coupling of chloroarenes with primary amines and is more active than \n the related ( binap)2ni catalyst . a range of electronically \n varied aryl halides and nitrogen - containing heteroaryl chlorides , \n including pyridine , quinoline , and isoquinoline derivatives , couple \n with a variety of aliphatic primary amines in high isolated yields . \n several aspects of the current system lead to the ability of this \n first - row metal system to catalyze this class of amination reaction . \n in general , we attribute the high yields for these amination reactions \n to the facile oxidative addition of aryl chlorides and heteroaryl \n chlorides to the ( binap)ni(-nc - ph ) precatalyst \n at ambient temperatures . detailed studies on the mechanism of \n the amination reaction" ]

[ "children 10 years old or younger presenting to our clinic with intraocular inflammation were referred for pediatric consult to verify a possible jia association . included in this study the intraocular pressure ( iop ) using the goldman applanation tonometer was obtained in cooperative children . in a few of the very young children with early ocular complications the iop assessment , fundus examination and refraction data children diagnosed with jia were referred by pediatricians to our immuno - ophthalmology unit for ophthalmic examination . the pattern of fixation for near and distance and the elicitation of optokinetic nystagmus were used to assess their visual functions ( benezra and rose 1990 ) . slit lamp biomicroscopy , thorough fundus examination and assessment of refractive errors in both eyes were performed in all cases . all patients underwent an ocular examination which included assessment of the visual acuity using the snellen charts or the illiterate e charts and/or familiar pictures for the young verbal children . in a few of the very young and pre - verbal children ,", "the pattern of fixation for near and distance and the elicitation of optokinetic nystagmus were used to assess their visual functions ( benezra and rose 1990 ) . slit lamp biomicroscopy , thorough fundus examination and assessment of refractive errors in both eyes were performed in all cases . all patients underwent an ocular examination which included assessment of the visual acuity using the snellen charts or the illiterate e charts and/or familiar pictures for the young verbal children . in a few of the very young and pre - verbal children , the intraocular pressure ( iop ) using the goldman applanation tonometer was obtained in cooperative children . in a few of the very young children with early ocular complications the iop assessment , fundus examination and refraction data history of possible systemic disease and ocular manifestations were carefully reviewed with the patients and parents . ocular movement abnormalities , the presence or absence of strabismus and the binocular functions were also routinely assessed .", "the frequency of eye drops instillations in these cases was arbitrarily modulated for every affected eye according to the intensity of inflammatory reaction in the aqueous humor as assessed at the slit lamp . ocular medical treatment consisted on instillations of corticosteroids and cycloplegic eye drops when the intraocular inflammation was confined to the anterior segment . systemic corticosteroids ( up to 1.0 mg / kg / day ) and/or methotrexate ( up to 25 mg once a week ) were prescribed if the intermediate and posterior segments demonstrated active inflammatory process or at the advice of the treating rheumatologist for the control of severe arthritic manifestations .", "complete blood count ( cbc ) , sedimentation rate ( esr ) , c reactive protein ( crp ) , urine culture , kidney and liver function tests were performed in all cases . according to the clinical observations and the results of these routine preliminary examinations , a tailored individual more arduous battery of tests", "the type of intraocular inflammation ( uveitis ) was classified according to the anatomical site of the major inflammatory manifestations following the intraocular inflammation society guidelines ( forrester et al 1998 ; benezra et al 2000 ) . the intraocular inflammation was further subdivided to whether the disease was strictly ocular or it was associated with a systemic disease . systemic disease associations were determined according to established sets of criteria ( bloch - michel and nussenblatt 1987 ; weiner and benezra 1991 ; dollfus 1998 ; forrester et al 1998 ; benezra et al 2000 ; benezra et al 2005 ) .", "thus , out of a total of 172 children with jia , 51 children had an associated intraocular inflammation ( uveitis ) . ten additional children developed uveitis less than three years of the initial ocular examination and , in 7 children the uveitis was detected 3 to 7 years later ( table 1 ) . among the 20 children presenting initially with uveitis , 19 developed clinical manifestations compatible with the pauciarticular type of jia . of the 152 children presenting with all types of jia arthritic manifestations , in 14 children ( 9.2% ) , the intraocular inflammation ( uveitis ) was diagnosed during the first ophthalmic examination ( 12/14 had clinical evidence for the pauciarticular type of jia ) . a systemic type of jia was confirmed two months after the diagnosis of uveitis in one out of these 20 children ( table 2 ) .", "early surgery may even be considered in children with severe visual impairment in one eye due to band keratopathy , seclusion of the pupil by inflammatory membranes and/or dense cataract . in these cases , adequate surgical procedure of the cataract combined with intraocular lens implantation is to be considered and can result in good restoration of vision ( benezra and cohen 2000 ; khotaniemi and penttila 2006 ) . last but not least , in the management of jra associated ocular inflammation , surgery should be considered despite the potential for complications . in properly selected cases , are : \n thirty nine of the 51 children with uveitis in our study group ( 76.5% ) had the pauciarticular type of jia.the majority of children with pauciarticular jia developing intraocular inflammation harbor signs of ocular disease either before or shortly after the development of arthritic manifestations.most children with polyarticular or systemic jia types do not present signs of intraocular inflammation during the first three years following the initial arthritic manifestations.the potential for a child with jia to develop de novo ocular inflammation , at any time during the ophthalmic follow up , is low . noteworthy is the fact that 20 of the 51 children with jia and uveitis in our cohort presented with severe intraocular inflammation . the diagnosis of jia was made only after these children were referred specifically for pediatric examination to assess the possible presence of jia . in most of these 20 children" ]

[ "the herb cinnamomi ramulus ( cr ) has traditionally been used in asia and europe to treat maladies involving blood circulation and inflammation . in one study , the present study explored the suggestion that the vasodilatory effect of cre is related to ca - dependent mechanisms in rat aorta . increasing cytosolic calcium ion ( ca ) concentration is essential for the contraction of smooth muscle cells . recently , we reported that cr ethanol extract ( cre ) reduces vascular contraction through the inhibition of voltage - dependent ca channels .", ", aortic rings were pretreated with nifedipine or verapamil before pe contraction , and were preincubated with cre before contraction by fpl64176 . to investigate the inhibitory effect of cre on intracellular ca release by pe in ca - free conditions , and by caffeine in normal krebs solution , the cacl2 dose - dependent maximum constriction of the aortic ring with 60 mm kcl in ca - free krebs solution was expressed as 100% . to determine the influence of cre on ca influx through the l - type ca channel the transient contraction of cre preincubated aortic rings was measured . to further investigate the relationship with the plc pathway , the denudation of endothelium was assessed by treating the rings with 1 m acetylcholine . also , cinnamaldehyde was known as major active compound of cr for vasodilation , antitumor , and antifungal activity . the influence of cre on extracellular ca influx was studied in ca - free krebs solution . endothelium - free rings were used because preliminary experiments ( data not shown ) established that cre relaxes vascular constriction in an endothelium - independent manner .", "pretreatment of aortic rings with nifedipine or verapamil significantly inhibited the relaxant effect of cre ( figure 3(a ) ) . pe- or ang ii - induced contraction was significantly dilated by 53.6 7.8% and 66.0 5.4% , respectively , as compared to maximal tension ( figure 1 ) , indicating that that cre - mediated vasodilation may be related to decreased intracellular ca concentration . to determine the influence of cre on ca influx , the change of contraction was measured by adding cacl2 in an accumulative manner ( 0.3 , 0.6 , 1 , 1.5 , 2.5 , 5 , and 10 mm , in order ) before and after cre pretreatment in ca - free krebs solution containing 60 mm kcl . was also reduced by cre pretreatment ( figure 4(b ) ) . to evaluate whether the relaxant effect of cre was involved in the plc pathway , the plc pathway inhibitor u73122 and activator m-3m3fbs were used . ang ii increases the intracellular ca concentration in vascular smooth muscle cells through a sequence of events following activation of ang ii type 1 receptor and l - type calcium channels [ 6 , 7 ] . pi3k is directly activated by g - protein for generation of pip3 , which eventually stimulates l - type calcium channels in vascular myocytes [ 5 , 12 ] .", "the present study investigated the vasodilatory effect of cre resulting from the inhibition of both ca influx and release in rat aorta . furthermore , cre exerts an endothelium - independent vasodilatory response through inhibition of voltage - dependent ca channels . cc inhibits helicobacter pylori and ameliorates sucrose - induced blood pressure elevation in spontaneously hypertensive rats . pretreatment with the plc inhibitor u73122 significantly reduced the vasorelaxation of cre on pe - induced vasoconstriction , and cre relaxed m-3m3fbs - induced vasoconstriction . pe or ang ii stimulate plc isoforms to generate ip3 through the activation of g proteins , causing release of activator ca from sr [ 9 , 10 , 1416 ] . presently , cre markedly and similarly relaxed aortic rings that were precontracted with pe or angii ." ]

[ "the samples were grouped by whether they came from pastures grazed by healthy horses or horses with am ( nonam versus am pastures ) . mean concentrations of hypoglycin a were compared for the type of sample ( seed versus sprout versus leaf ) , season ( spring versus autumn ) and disease status for the pasture ( nonam versus am ) . this approach resulted in 143 usable samples , 30 from the spring and 113 from the autumn of 2014 . the geographic location of the pastures where the acer seeds , sprouts and leaves were sampled . \n owners were asked to complete a questionnaire with information about date of collection , address of the pasture , species of maple tree ( in their opinion ) , signalment ( name , breed and age ) of the horse(s ) , and presence of disease ( am ) in horses that were grazed in the pastures where the material was collected . recoveries obtained for hypoglycin a in spiked seed samples ( 10 mg / kg ) concurrently analyzed with the study samples were consistent with those of the validation and in the range of 7395% after an information campaign in horse journals and at meetings , 278 samples of maple tree leaves , sprouts , and seeds collected by horse owners in 2014 were sent to utrecht university ( uu ) and rikiltwageningen ur ( figs 1 , 2 , 3 ) . the samples were taken from the ground , packed in plastic , and immediately sent to the laboratory where they were stored at 20c within 24 hours of collection . the accuracy of the method was determined as the recovery obtained after spiking known amounts of hypoglycin a to blank leaf ( 1 mg / kg ) and seed ( 10 mg / kg ) samples in 5fold dilutions .", "owners were asked to complete a questionnaire with information about date of collection , address of the pasture , species of maple tree ( in their opinion ) , signalment ( name , breed and age ) of the horse(s ) , and presence of disease ( am ) in horses that were grazed in the pastures where the material was collected . after an information campaign in horse journals and at meetings , 278 samples of maple tree leaves , sprouts , and seeds collected by horse owners in 2014 were sent to utrecht university ( uu ) and rikiltwageningen ur ( figs 1 , 2 , 3 ) . the samples were taken from the ground , packed in plastic , and immediately sent to the laboratory where they were stored at 20c within 24 hours of collection . the geographic location of the pastures where the acer seeds , sprouts and leaves were sampled . \n sprouts were only used in this study upon positive classification by means of accompanying leaves , seeds or both . the minimum amount of material was 50 g for seeds and sprouts and 100 g for leaves . they were classified by an experienced botanist at the species level ( acer pseudoplatanus , acer platanoides , or acer campestre ) on the basis of the samples and accompanying photographs sent by owners . if the pasture had contained horses with am , details about the disease ( including date of onset and the final outcome ) , laboratory results and name of the veterinarian were provided . inclusion criteria to confirm am were recumbency , dark colored urine , high serum activity of creatine kinase ( ck , either too high to measure in practice , or > 100,000 iu / l in a laboratory ) and postmortem examination , which was performed in 4 cases . exclusion criterion for am was lack of ck analysis unless postmortem examination was performed .", "recoveries obtained for hypoglycin a in spiked seed samples ( 10 mg / kg ) concurrently analyzed with the study samples were consistent with those of the validation and in the range of 7395% . the accuracy of the method was determined as the recovery obtained after spiking known amounts of hypoglycin a to blank leaf ( 1 mg / kg ) and seed ( 10 mg / kg ) samples in 5fold dilutions . the rsd obtained for repetitive analysis ( n = 5 ) of a homogenized seed sample containing hypoglycin a at a concentration of 194 mg / kg was 8% . hypoglycin a was identified based on matching retention time and ion ratio of the 2 transitions , against an analytical reference standard ( shypoglycin a2 ) dissolved in milliq water . hypoglycin a was measured using a newly validated method based on liquid chromatography coupled to tandem mass spectrometry ( lc ms / ms).1 \n seed samples ( 50 g , as received ) were ground in a retsch mill , and leaf samples ( 50100 g ) were cryogenically milled into a powder , using liquid nitrogen .", "this approach resulted in 143 usable samples , 30 from the spring and 113 from the autumn of 2014 . mean concentrations of hypoglycin a were compared for the type of sample ( seed versus sprout versus leaf ) , season ( spring versus autumn ) and disease status for the pasture ( nonam versus am ) . samples with incomplete questionnaire data on relevant facts , such as address and obtainable data about the disease if present , were excluded from further statistical analysis ( 9 samples ) . if multiple samples from 1 pasture were submitted , which happened often , the mean result of the analyses per sample type ( sprout , seed or leaf ) were counted as 1 result in further statistical analysis . the samples were grouped by whether they came from pastures grazed by healthy horses or horses with am ( nonam versus am pastures ) . samples that could not be unambiguously assigned to an acer species ( 6 ) , samples that were not fresh ( 17 ) , and samples that contained material other than seeds , sprouts and leaves ( 10 ) also were excluded from the study .", "statistical analysis was performed using univariate generalized linear models with multiple comparisons , corrected with a posthoc bonferroni test.3 \n control for normal distribution was performed . a p value of .05 was set as statistically significant .", "in total , 143 of the collected samples ( 93 seed samples , 14 sprout samples , and 36 leave samples ) from a total of 81 locations were included ( fig 1 ) . none of the acer platanoides ( n = 11 ) and acer campestre ( n = 13 ) samples ( 29 samples of seeds , 11 of leaves and 1 of sprouts ) contained detectable concentrations of hypoglycin a. in contrast , most acer pseudoplatanus leaves , seeds , and sprouts contained the toxin . in 2 samples of seeds and 6 samples of leaves , the concentration ( mg / kg ) of hypoglycin a in samples of acer pseudoplatanus taken from pastures or paddocks grazed by healthy horses and horses with atypical myopathy ( am ) concentration significantly different between pastures used by healthy and am horses ( p = 0.039 ) . there was no relationship between the concentration of hypoglycin a in the samples and outcome of the disease ( p = .250 ) . there were 16 horses ( providing 29 samples ) with am of which 11 died and 5 survived . hypoglycin a concentrations differed significantly among the sample types ( seeds and sprouts , p < .001 ; seeds and leaves , p < .001 ; sprouts and leaves , p = .000 ) .", "thus , the most important recommendation is that owners should prevent horses from eating seeds , sprouts , leaves , or any combination of these from acer pseudoplatanus ( sycamore maple ) , whereas the seeds of acer campestre ( hedge maple ) and acer platanoides ( norway maple ) appear to be safe for horses . , acer negundo ( box elder tree ) and acer pseudoplatanus ( sycamore maple ) have been associated with am.15 , 17 \n the species acer campestre ( hedge maple ) and acer platanoides ( norway maple ) did not contain detectable hypoglycin a concentrations , and thus it is probably safe , in terms of am , to grow these species in or around pastures and paddocks . in 1973 , semiquantitative measurements ( notdetected , trace , weak , moderate , and strong ) also indicated that these tree species were free of hypoglycin a.18 \n the most common maple tree in the netherlands is acer pseudoplatanus . we found that the leaves , sprouts , and seeds contained measurable concentrations of hypoglycin a. although hypoglycin a concentrations were significantly lower in seeds collected from pastures grazed by healthy horses than in samples from pastures grazed by am horses , concentrations were too variable to allow predictions to be made as to whether or not the presence of an individual tree would be a threat to horses grazing in its vicinity . however , in all cases in which no hypoglycin a was found , no clinical signs of am were observed .", "" ]

[ "taken together , our results suggest that wasp and wip work as a functional unit in a cellular context as has been previously proposed [ 8 , 9 ] to regulate podosome formation and dynamics during the establishment of cell polarity as seen in the chemotactic response to extracellular stimuli . in summary , we have shown that in dcs wip is essential for podosome formation and cell polarity by preventing the extensive degradation of wasp by calpain and by facilitating the recruitment of wasp to discrete foci to form the core of podosomes . the presence of integrin ligands failed to induce major changes in the composition of adhesions of wip dcs ( figure 1b ) except for an increase in the size of the focal adhesions . taken together , our data indicate that wip plays a key role in regulating dc adhesion structure and dynamics on biologically relevant substrata , processes crucial for the migratory capacity of cells . this suggests that the wasp / wip complex may couple with cortactin to induce a type of meshwork of actin filaments and associated proteins that allow the clustering of 2-integrins during the assembly of podosomes and dc polarization . in the absence of wip to study the role of wip in podosome formation , the distribution of f - actin and vinculin was examined in wild - type and wip dcs by confocal microscopy . our data suggest that the key role of wip in podosome formation is in the organization of f - actin and the clustering of integrins and associated proteins ." ]

[ "multiple techniques for initial placement of the catheters have been described , including conventional minilaparotomy , peel - away introducer sheaths , as well as full laparoscopic approaches . ventriculoperitoneal ( vp ) shunting is commonly utilized as a diversion procedure for patients with hydrocephalus . initial shunt failure rates continue to be high , with a reported failure rate of 31% at 6 months and an infection rate of 7% . vp shunts fail for a variety of reasons , including failure secondary to disconnection of abdominal tubing with migration of the tubing , most commonly further into the peritoneal cavity ; this occurs in 2.5% to 4% of shunts placed according to current published series . laparoscopy avoids laparotomy and may provide improved confirmation of shunt functionality and placement at the time of revision . common presenting features of shunt failure include headache , mental status changes , and vomiting .", "a 31-year - old obese female was initially treated for pseudotumor cerebri with placement of a lumbar peritoneal shunt in 2003 . a laparoscopic approach was again utilitzed for retrieval and attempted improved fixation of the vp shunt . the patient subsequently presented 11 days postoperatively with headaches , dizziness , and formation of a seroma in her right upper quadrant . the patient was seen in follow - up 7 months postprocedure and reported no recurrence of her symptoms . one month later , the patient presented with recurrence of headaches , nausea , and right upper quadrant abdominal pain .", "retrieval and repositioning of a displaced vp shunt in the peritoneal cavity using laparoscopic techniques has been previously described . in the present case , our subsequent laparoscopic approach utilized ptfe mesh , well described in the use of laparoscopic ventral hernia repair , to fixate the tubing to the abdominal wall to prevent further tubing migration . the advent of laparoscopy has afforded a minimally invasive approach that has resulted in decreased patient morbidity related to shunt placement . traditionally , laparotomy was necessary for both peritoneal shunt placement as well as subsequent shunt revisions . the technique described was well tolerated without complication and resulted in improvement of clinical symptoms . this approach also allowed us to simultaneously repair the fascial defect associated with the shunt entry site into the peritoneal cavity , allowing us to reap the benefits of decreased recurrence and decreased patient morbidity associated with this technique ." ]

[ "hence , the present study is undertaken to isolate , identify and quantitate bacteria and to perform the antibiotic susceptibility testing from the endotracheal aspirates of the clinically suspected patients of vap . ventilator - associated pneumonia ( vap ) is defined as pneumonia occurring more than 48 hours after patients have been intubated and received mechanical ventilation . vap is the most common nosocomial infection in the intensive care unit ( icu ) with an incidence ranging from 8% to 28% in intubated mechanically ventilated patients . more importantly , recent small trials have repeatedly shown that there is no advantage of bronchoscopic cultures over quantitative eta cultures when mortality was considered as the end - point further strengthening the case for quantitative eta as a diagnostic tool.[811 ] detection of causative organisms and their antibiotic susceptibility is crucial for diagnosis of vap in order to initiate the appropriate antibiotic treatment thereby reducing the adverse effects of inadequate antibiotic treatment on the patient prognosis . bronchoscopy , being invasive , is not uncommonly associated with complications , especially in patients on high respiratory supports . ventilator - associated pneumonia complicates the course of patients receiving mechanical ventilation inspite of major advances in techniques for its diagnosis and treatment . in the absence of a gold standard , vap", "the prospective study was carried out during the period from january 2010 to december 2010 in department of microbiology and medical intensive care unit ( micu ) on 54 patients with clinical suspicion of ventilator - associated pneumonia . isolates showing reduced susceptibility to imipenem were selected for detection of metallo - beta lactamases ( mbl ) enzymes by imipenem - edta combined disc method . isolates showing reduced susceptibility to either ceftazidime ( 30 g ) or cefotaxime ( 30 g ) discs were considered asscreen positive for ampc beta lactamases and selected for detection of plasmid - mediated ampc by the ampc disc test . the aspirate specimens showing presence of < 10 squamous epithelial cells per low power field or organisms seen under oil immersion in the entire field on gram stain were included in the study . all the patients 18 years and above who were under mechanical ventilation for more than 48 hours and clinically suspected of having contracted vap were included in this study . as per clsi 2011 guidelines , when using the new interpretive criteria , routine esbl testing is no longer necessary before reporting results ( ie , it is no longer necessary to edit results for cephalosporins , aztreonam , or penicillins to resistant ) .", "all the patients 18 years and above who were under mechanical ventilation for more than 48 hours and clinically suspected of having contracted vap were included in this study . the diagnosis of vap was established using clinical pulmonary infection score ( cpis ) , which was evaluated on a daily basis until the patient was on ventilator support . clinically diagnosed ventilator - associated pneumonia were observed and clinical parameters were recorded from their medical records and bedside charts .", "isolates showing reduced susceptibility to either ceftazidime ( 30 g ) or cefotaxime ( 30 g ) discs were considered asscreen positive for ampc beta lactamases and selected for detection of plasmid - mediated ampc by the ampc disc test . as per clsi 2011 guidelines , when using the new interpretive criteria , routine esbl testing is no longer necessary before reporting results ( ie , it is no longer necessary to edit results for cephalosporins , aztreonam , or penicillins to resistant ) . isolates showing reduced susceptibility to imipenem were selected for detection of metallo - beta lactamases ( mbl ) enzymes by imipenem - edta combined disc method . the aspirate specimens showing presence of < 10 squamous epithelial cells per low power field or organisms seen under oil immersion in the entire field on gram stain were included in the study . escherichia coli atcc 25922 and pseudomonas aeruginosa atcc 27853 were used as quality control strains . growth of any organism below the threshold was assumed to be due to colonization or contamination .", "endotracheal aspirate ( 1 ml ) was collected under aseptic precaution after 48 hours of intubation whenever patient was suspected to have developed vap in micu . the eta was collected using a 22-inch ramson 's 12 f suction catheter with a mucus extractor , which was gently introduced through the endotracheal tube for a distance of approximately 25- 26 cm . chest vibration or percussion for 10 min was used to increase the retrieved volume ( 1 ml ) in case the patient produced very little secretions . only 1 eta sample was collected from each patient and was immediately taken to the laboratory for prossessing .", "the aspirate specimens showing presence of < 10 squamous epithelial cells per low power field or organisms seen under oil immersion in the entire field on gram stain were included in the study . isolates showing reduced susceptibility to either ceftazidime ( 30 g ) or cefotaxime ( 30 g ) discs were considered asscreen positive for ampc beta lactamases and selected for detection of plasmid - mediated ampc by the ampc disc test . as per clsi 2011 guidelines , when using the new interpretive criteria , routine esbl testing is no longer necessary before reporting results ( ie , it is no longer necessary to edit results for cephalosporins , aztreonam , or penicillins to resistant ) . isolates showing reduced susceptibility to imipenem were selected for detection of metallo - beta lactamases ( mbl ) enzymes by imipenem - edta combined disc method . growth of any organism below the threshold was assumed to be due to colonization or contamination . escherichia coli atcc 25922 and pseudomonas aeruginosa atcc 27853 were used as quality control strains .", "vap common organisms isolated were acinetobacter baumannii , pseudomonas aeruginosa , klebsiella pneumoniae , citrobacter freundii and staphylococcus aureus while in case of late onset vap common organisms were acinetobacter baumannii , pseudomonas aeruginosa and methicillin - resistant staphylococcus aureus . organisms causing vap ( early and late onset vap ) eight ( 47.06% ) of the 17 pseudomonas aeruginosa isolates were mbl producers . among 27 isolates of acinetobacter baumannii , different enzymes produced by the isolated strains in the present study it was found that the mortality rate was 45.28%.rate of mortality was less in early - onset vap ( 23.80% ) as compared to late onset vap group ( 59.37% ) and the difference was found to be statistically significant ( x1=6.473 ; df=1 ; p=0.011 ) .", "one of them was methicillin - resistant staphylococcus aureus ( mrsa ) , but mrsa is generally associated with late onset vap . found x - ray pattern in acinetobacter baumannii vap is non - specific . in half of the cases it causes lung infiltration and a diffuse bilateral pattern studies have shown that previous antibiotic use decreases early - onset vap but markedly increases multidrug - resistant ( mdr ) pathogens , which is also reflected in our study . in the present study , it was found that the mortality rate was 45.28% which was in accordance with previous studies such as those by gupta a et al . the low incidence of early onset vap in our study may be due to antibiotic use before admission to the icu . presently , there is concern about the acquisition of plasmid - mediated metallo - beta lactamases active against carbapenems , penicillins and cephalosporins . in this study", "the antibiotic susceptibility pattern of these isolates will also help the clinicians to choose the appropriate antimicrobial agents for prophylactic as well as treatment purposes . this study showed that quantitative culture of eta is a useful test for early diagnosis of vap . the bacteriological approach for the management of vap avoids the problem of overtreatment by separating colonizers from infecting pathogens ." ]

[ "furthermore , we investigated whether activation of peroxisome proliferator - activated receptor- ( ppar ) or ppar , known renoprotective intervention in animal models of type 2 diabetes , would affect renal expression of 1-ar subtypes . however , the expression and distribution patterns of 1d - ar in normal and diabetic rat kidneys remain unknown . in the present study , we examined mrna levels of three 1-ar subtypes in the kidney cortex of normal zucker lean ( zl ) and zucker diabetic ( zd ) rats by microarray and real - time pcr analyses . confocal immunofluorescence microscopy was performed to evaluate the distribution of 1d - ar in the kidney of zucker rats . however , recent experiments performed in 1d - ar knockout models suggest that this 1-ar subtype plays an important role in the overall regulation of blood pressure", "glomeruli were isolated from the kidney cortex of zl and zd rats at the age of 7 , 12 , and 2022 weeks , respectively , by a modified procedure as described previously . , we showed that blood glucose of the zd rats began to increase at week 8 , reached a peak at week 12 , and remained at this higher level thereafter . blood glucose was monitored using the accu - chek glucometer by tail - vein blood sampling . in a previous study in which we characterized the time course of blood glucose in this model 12-week - old zd animals were treated with rosiglitazone ( 10 mg / kg / day in drinking water ) or vehicles for 8 weeks . mg / kg / day ig ) treated zd ( f - zd ) rats for 10 weeks . for rosiglitazone treatment , each sample was run in triplicate , and the comparative threshold cycle ( ct ) method was used to quantify fold increase ( 2 ) compared with controls . for immunofluorescent staining , 5 m thick cryostat sections of oct - embedded kidney samples were used . to study the localization of 1d - ar in the rat kidney significantly differentially expressed -adrenergic receptor genes among zl , zd , and f - zd groups were identified by a threshold of 2 fold change and p 0.05 .", "we have previously shown that ppar activation protects against kidney injury in zucker diabetic fatty rats [ 15 , 17 ] . here , we further examined the effect of ppar activation on the expression level of 1-ar mrnas in the diabetic kidneys . we performed microarray analysis to assess gene expression levels of -adrenergic receptor subtypes in the kidney cortex of 22-week - old normal zl ( blood glucose : 108 8 mg / dl ) and diabetic zd ( blood glucose : 425 35 mg / dl ) rats . gene microarray analysis revealed that ppar activation inhibits the upregulation of 1d gene in the diabetic kidneys . additionally , the effect of ppar activation on gene expression of 1-ar subtypes was examined in the zd rats after rosiglitazone treatment . similar to ppar activation , 1a- and 1b - ar mrna expression in the diabetic rats was not affected by rosiglitazone treatment . in a previous study", "an increase in renal expression of 1d - ar mrna and protein was associated with glomerular and tubulointerstitial injury in diabetic nephropathy . chronic treatment with ppar agonists prevents the increase in 1d - ar mrna in the diabetic kidneys . the current study highlights mrna expression of the three 1-ar subtypes in rat kidney cortex . although mrna expression of all three 1-ar subtypes ( 1b > 1d > 1a ) was detected in rat kidney cortex , only 1d - ar gene was massively upregulated in the diabetic animals . 1d - ar protein was significantly increased in the glomeruli and proximal tubules of diabetic animals . in this study , the expression and distribution of 1d - ar mrna and protein were determined by the gene microarray , qpcr , and confocal immunofluorescence analyses . these findings may provide new insights into the prevention and early management of diabetic kidney disease ." ]

[ "this study hypothesized that the formulation of an experimental solution containing both naf and tif4 would increase the ph , allowing its use in the clinical situation without losing its protective effect against dentin erosion compared to tif4 alone and the commercial solution erosion protection . the null hypothesis is that there is no significant difference in the protective effect against dentin erosive loss among the tested fluoride mouthrinses . considering that the modification in population habits and the decrease of acid exposure are very tough , alternatives to reduce the progression of tooth erosive loss have been investigated . therefore , the protective effect of tif4 on dentin erosion is still in debate . considering that the application of professional fluoride , such as varnish , is not often done , patients at high risk of erosion would benefit from other alternatives to increase the frequency of fluoride exposure . accordingly , titanium tetrafluoride ( tif4 ) has been widely studied against tooth erosive demineralization since 1997 \n , demonstrating the enamel erosion - inhibiting effect \n\n\n\n\n\n\n\n\n . on the other hand ,", "dentin erosive loss ( m ) was quantitatively determined by a contact profilometer ( mahr perthometer , gttingen , lower saxony , germany ) before ( baseline ) and after 7 days of experiment . for the profilometric measurement the fluoride treatments were performed twice a day ( immediately after the first and the last erosive challenges of the day ; v=0.5 ml / sample ) for 1 min , during 7 days of erosive challenges . , so paulo , sp , brazil ) were applied on 2/3 of the control surface ( sound surfaces ) , leaving only 1/3 central of the exposed dentin ( 1.0 mm x 5 mm ) . dentin samples were randomly allocated to each of the six treatment groups ( n=15 ) : 1 ) commercial sncl2/naf / amf solution ( 800 ppm sn , 500 ppm f , ph 4.5 , erosion protection , gaba int . ag , erosive challenges took place by immersion in a freshly opened bottle of soft drink ( sprite zero , coca - cola company spal , porto real , rj , brazil , ph 2.6 , 30 ml / sample ) four times a day for 90 s each , at 25c . prior to the experiment , the baseline profile was measured and two layers of nail varnish ( colorama , com . all solutions had approximately 500 ppm f based on the calculation obtained from the salts concentrations diluted in deionised water , and their ph was measured using a ph electrode .", ", so paulo , sp , brazil ) were applied on 2/3 of the control surface ( sound surfaces ) , leaving only 1/3 central of the exposed dentin ( 1.0 mm x 5 mm ) . small drilling was also done on the outer area of the dentin surface to allow the correct position of the sample in the profilometric system . prior to the experiment , the baseline profile was measured and two layers of nail varnish ( colorama , com . the reference areas on the polished dentin surface were marked with two parallel lines made with a scalpel blade , 1.0 mm apart . the root was separated from the crown using a water - cooled diamond saw and a cutting machine ( isomet low speed saw , buehler , lake bluff , il , usa ) , and embedded in pre-30 self - polymerized acrylic resin in cylindrical shape to facilitate the handling .", "the fluoride treatments were performed twice a day ( immediately after the first and the last erosive challenges of the day ; v=0.5 ml / sample ) for 1 min , during 7 days of erosive challenges . all solutions had approximately 500 ppm f based on the calculation obtained from the salts concentrations diluted in deionised water , and their ph was measured using a ph electrode . the experimental fluoride solutions were prepared using the analytical grade reagents from sigma - aldrich ( st . dentin samples were randomly allocated to each of the six treatment groups ( n=15 ) : 1 ) commercial sncl2/naf / amf solution ( 800 ppm sn , 500 ppm f , ph 4.5 , erosion protection , gaba int . ag , basel , switzerland , positive control ) ; 2 ) experimental 0.0815% tif4 solution ( 315 ppm ti , 500 ppm f , ph 2.5 ) ; 3 ) experimental 0.105% naf solution ( 500 ppm f , ph 4.5 adjusted with phosphoric acid ) ; 4 ) experimental 0.042% naf+0.049% tif4 solution ( naf- 190 ppm f , tif4 190 ppm ti and 300 ppm f , ph 4.4 ) ; 5 ) experimental 0.063% naf+0.036% tif4 solution ( naf 285 ppm f , tif4 140 ppm ti and 220 ppm f ; ph 4.5 ) ; 6 ) no treatment ( untreated , negative control ) .", "erosive challenges took place by immersion in a freshly opened bottle of soft drink ( sprite zero , coca - cola company spal , porto real , rj , brazil , ph 2.6 , 30 ml / sample ) four times a day for 90 s each , at 25c . then , the samples were rinsed with deionized water ( 5 s ) and exposed to artificial saliva ( ph 6.8 , 30 ml / samples , 25c ) for 2h between the erosive challenges and overnight .", "dentin erosive loss ( m ) was quantitatively determined by a contact profilometer ( mahr perthometer , gttingen , lower saxony , germany ) before ( baseline ) and after 7 days of experiment . for the profilometric measurement the scans were superposed and the average depth of the under curve area was calculated ( m ) \n . for a better understanding of the treatments effect , the prevention fraction ( % ) of each treatment five profile measurements were performed at exactly the same sites as the baseline measurement , at intervals of 0.5 mm . to achieve this outcome , the dentin samples presented the identification marks ( small drillings made with drill 1/4 ) and were inserted into a metal device , allowing the stylus to be accurately repositioned at each measurement . , the nail varnish was carefully removed using a scalpel and acetone solution ( 1:1 water ) . baseline and final profiles were done and compared using the software mahrsurf cxr20 ( mahr , gttingen , lower saxony , germany ) .", "once the homogeneity was not achieved , the data from dentin loss ( m ) were analyzed using kruskal - wallis followed by dunn s test . the assumptions of equality of variances and normal distribution of data were checked using the bartlett and kolmogorov - smirnov tests , respectively . the software graphpad instat version 2.0 for windows ( graphpad software , la jolla , ca , usa ) was used for the statistical analysis .", "all experimental mouthrinses promoted significantly lower dentin erosive loss when compared to the negative control ( p<0.0001 ) , except naf solution ( prevention fraction of 13.3% ; p>0.05 ) . the best anti - erosive effect was found for experimental solutions containing 0.0815% tif4 ( prevention fraction of 100% ) and 0.042% naf+0.049% tif4 ( 58.3% ) . sncl2/naf / amf ( erosion protection , 52% ) and 0.063% naf+0.036% tif4 ( 40% ) did not significantly differ from 0.042% naf+0.049% tif4 and naf alone , but both were less effective than tif4 alone . the median values ( minimum - maximum ) of dentin erosive loss for each group", "the present study investigated the protective effect of the daily application of solution containing tif4/naf . the null hypothesis tested in this study was rejected because the tested fluoride mouthrinses had a significantly different effect among them against dentin erosive loss . the solution containing pure tif4 showed the best protective effect , differing from all other groups except from a specific combination of tif4 and naf . considering the increase of dental erosion s prevalence \n\n\n\n\n\n\n\n\n , the attention has been focused on the development of preventive approaches to reduce the progression of this dental condition .", "under the conditions of the present study , we can conclude that the daily application of an experimental mouthrinse containing a specific combination of tif4 and naf has the ability to reduce dentin erosion in vitro , and may be a good alternative for high - risk populations ." ]

[ "the present study was carried out in order to evaluate the diagnostic performance of phadiatop infant , an in vitro test designed to detect allergen - specific ige antibodies known to be relevant in the development of ige - sensitisation in early childhood . although there is a general consensus on the importance of a genetic predisposition for atopic diseases , only changes in environmental factors can explain this increase [ 46 ] . there is a strong association between sensitisation and symptoms of allergic diseases although this association is not absolute . allergic diseases are among the most common chronic diseases throughout the world and the prevalence of atopic diseases in childhood has significantly increased during the past several decades [ 2 , 3 ] . food allergy and atopic eczema during the first years of life have been considered risk factors for subsequent asthma and rhinitis caused by indoor and outdoor inhalant allergens [ 5 , 9 , 10 ] . thus , better predictors of disease development and diagnostic markers for allergic disease are needed to give proper treatment and valuable advice , especially concerning environmental control to parents of young children . the allergy march refers to the natural history of sensitisation to allergens and symptoms of eczema , asthma , and rhinitis , which is characterized by a typical sequence of sensitisation and manifestations of symptoms that appear during a certain age period [ 7 , 8 ] .", "the study was designed to make the diagnosis with best possible available tools ( case history , spt , and allergen - specific ige results ) to evaluate the clinical performance of phadiatop infant . a preliminary diagnosis whether a child was atopic or not was assessed by the investigating physician in retrospect , taking into account clinical history and diagnostic procedures , which includes available spt and allergen - specific ige results , noted in the patient records . in the final diagnosis of the atopic state , the laboratory results from phadiatop and fx5 were also taken into consideration in order to get comparable data of allergen - specific ige sensitisation on all children . the study was conducted retrospectively in consecutively included children , below the age of five years and admitted to bkl voksentoppen , rikshospitalet , oslo , during a period of twelve months . phadiatop infant is designed to detect allergen - specific ige antibodies to food and inhalant allergens , relevant in the development of ige - mediated disease in young children . frozen - serum samples from 122 children were analysed and clinical data documented in the patients ' records were compiled for the study . the subgroups divided by age , < 2 years and 2 years were compared with regard to the diagnostic performance of phadiatop infant using descriptive statistics . total and allergen - specific ige antibodies were determined in immunocap 100 ( phadia ab , sweden ) at the hospital laboratory when appropriate according to clinical findings .", "the demographic characteristics of the children classified according to the final diagnosis of atopy / nonatopy or inconclusive diagnosis are shown in table 1 . the diagnostic performance of the test was found to be similar when the children were separated in the two age groups , below or above two years , but due to small numbers of children in the separated age groups , the calculated values are not presented . thirty - eight ( 31% ) subjects in the study population were girls and 84 ( 69% ) were boys with a median age of 2.7 years . of the 122 children , 86 ( 70% ) were atopic , 26 girls and 60 boys , which is a commonly found gender distribution among atopic children at that age . the ppv and npv values were 95% ( 95% ci : 8999% ) and 94% ( 95% ci : 8099% ) , respectively . the sensitivity calculated for the whole group of children was 98% ( 95% ci : 92100% ) and the specificity 89% ( 95% ci : 7497% ) . ", "the present study shows that phadiatop infant has a diagnostic performance with a high sensitivity and specificity . thus , the test could be recommended as a complement to the clinical information in the differential diagnosis on ige - mediated disease in young children with allergy - like symptoms . the paediatric section of the european academy of allergy and clinical immunology has recently published a position paper with recommendations on allergy testing in children to improve the identification of allergy and quality of care . family history has been considered an important risk factor for atopy and has been widely used for prediction of allergy and allergic diseases . the results from our study confirm these findings and suggest that phadiatop infant could be a useful tool for discrimination between atopy / non - atopy . the clinical appearance of allergy in our study is in agreement with the concept of the allergy march and supports what has been reported earlier from other studies [ 7 , 8 ] ." ]

[ "the goal of this study was to test the efficacy of the varia ( video , accelerometry , and radar - induced activity recording ) system and algorithms for tonic clonic and clonic seizures compared with that of semicontinuous monitoring by professional caregivers ( keeping an eye on multiple patients ) , as well as the independence , robustness , comfort , and user - friendliness of the system . clonic and clonic seizures with patients remaining in one place , their bed , mainly because of the need for supervision at night and because seizures often occur during sleep . as sensors need to be as unobtrusive as possible but still effective , small wireless accelerometers ( measuring the acceleration of movement ) are used and attached to the wrists and ankles of the patient . we therefore measure long term in a home environment without uncomfortable and stigmatizing electroencephalography ( eeg ) electrodes rather than in a video / eeg monitoring unit , and the system therefore needs to be able to store the data and to allow visual verification of detected events . in addition to being used for alarming , a detection system could allow offline storage or online streaming of selected data , allowing follow - up on treatment efficacy or summoning emergency support , respectively . our team is interested in the long - term observation of patients with epilepsy and detection of their seizures , .", "two patients were measured for one month in their rooms in an epilepsy center in flanders , belgium . they recognize epileptic seizures ( one month training and yearly tuition ) , are awake during the whole night , know the patients , and are semicontinuously watching on average four patients with active epilepsy in front of a video screen , only leaving if one of them or one of the other ( maximum ) twelve patients need care . the events detected with the algorithms , it shows the intensity and duration of the movement . after the application of each of the three developed seizure detection algorithms and during postprocessing , the following logical reasoning was used : rule 1 : a margin of error of 5 min has been taken into account for the seizure reporting . as the caregiver might write down the seizure after having attended to the patient , we assume the seizure may have been noticed 5 min before or after the actual time in the notes.rule 2 : only seizures longer than 10 s are considered as possibly dangerous and therefore candidates for the alarm system , hence shorter seizures are not counted when calculating detection performance.rule 3 : an alarm is set after 7 s of continuous positive detection . as they returned home for the weekends and as the caregivers needed to get acquainted with the recording system , they were measured for a mean of 12 nights per patient . professional caregivers were asked to write down all seizures the patients had , with time and description in a form of a clinical report . the caregivers use a babyphone and semicontinuous video monitoring to keep an eye on him . false positives ( fp ) are detections that were not seizures , which in some occasions were multiple alarms in one movement event . false detection rate ( fdr ) is calculated as the number of fp per night .", "as they returned home for the weekends and as the caregivers needed to get acquainted with the recording system , they were measured for a mean of 12 nights per patient . two patients were measured for one month in their rooms in an epilepsy center in flanders , belgium . the caregivers use a babyphone and semicontinuous video monitoring to keep an eye on him . patient 1 is an 8-year - old girl with epilepsy e.c.i . and different types of seizures that typically last no more than 3 min : tonic clonic seizures with or without faltering respiration , tonic seizures , and clonic seizures . seizures are noticed based on semicontinuous video monitoring and when a scream or breathing problem is heard .", "radar technology is also used for detection of falling , wandering , sitting , or getting up , so we expect it to detect large and slow epileptic and nonepileptic movements , also those caused by other persons in the room . four shimmer sensors with integrated three - axis acm ( shimmer , ireland ) , streaming wireless ( bluetooth ) communication standards , are adjusted to allow recording of more than 10 h before batteries need recharging and are put in elastic bracelets worn around wrists and ankles . a laptop with a software application developed in labview ( national instruments corporation , us ) stores all movement data recorded by either camera , radar , or acm ( fig . the system uses video , accelerometry ( acm ) , and radar - induced activity recording and is therefore named varia . the radar is added for detection of movements in the direction of the sensor and for measurement through sheets . the camera and radar are attached to a tripod that is placed close to the patient 's bed . the technical aspects of the recording system will be published in more detail by bonroy et al . and are briefly described in the supplementary material . it consists of an axis m1011 camera ( axis communications ab , sweden ) and a hygrosens rad - mod motion sensor based on the radar principle ( b + b thermo - technik gmbh , germany ) .", "results of a patient - specific ( algorithm trained only on data of the patient itself ) , a nonpatient - specific ( algorithm trained on data not including those of the patient itself ) , and a semipatient - specific ( algorithm trained on data also including those of the patient itself ) approach were compared with the notes of professional caregivers . for a full description on how to implement these methodologies in practice the algorithms developed by milosevic et al . for tonic clonic and clonic seizures based on a large database of video / electroencephalography ( eeg ) data were used . . false detection rate ( fdr ) is calculated as the number of fp per night . the graph at the lower left corner sets out amplitude of all events based on acm signals and length of all events based on the three detection modalities . in other words , it shows the intensity and duration of the movement . after the application of each of the three developed seizure detection algorithms and during postprocessing , the following logical reasoning was used : rule 1 : a margin of error of 5 min has been taken into account for the seizure reporting . as the caregiver might write down the seizure after having attended to the patient false negatives ( fn ) are seizures reported by the caregiver but not detected by the algorithm . to calculate sensitivity , the formula tp / ( tp + fn ) was used . false positives ( fp ) are detections that were not seizures , which in some occasions were multiple alarms in one movement event true positives ( tp ) are detected seizures with the extra seizures detected by the algorithm but not the caregiver mentioned in between brackets .", "monitoring for 15 nights for patient 1 and nine nights for patient 2 resulted in 9586 movement events . in this first validation , 322 events ( 3.4% or 15 min ) were discarded before algorithm application because the data of one or more accelerometers lasted less than 1 s or was completely missing . the results of the nonpatient - specific and semipatient - specific approaches can be found in table 1 . the nonpatient - specific approach resulted in a sensitivity of 90% and fdr of one per night for patient 1 and a sensitivity of 33% and fdr of almost two per night for patient 2 . the semipatient - specific approach gave somewhat better results with a sensitivity of 93% and fdr of a little over one per night for patient 1 and a sensitivity of 40% and fdr of one per night for patient 2 . results of the patient - specific approach are not depicted as it was immediately clear that many seizures were missed , many false alarms occurred , and the approach was not stable in between trials ( the results depended on which data were used for algorithm training ) .", "in this work , we validated algorithms for the detection of tonic clonic and clonic epileptic seizures with a new ( wireless ) system using video , wireless accelerometry ( acm ) , and radar - induced activity recording , which is placed in a home environment for a prolonged period of time . although setup without eeg is less optimal for seizure detection performance , it is optimal for testing the independence and robustness of the system and the patient - friendliness of the system in a long - term home environment . also , the second part of the gold standard , namely video , is present in our system . three methodologies were tested : patient - specific , nonpatient - specific , and semipatient - specific algorithms . 2 . the screening tool can be used before a diagnosis is made to quickly and retrospectively look at a night and report abnormal nocturnal behavior , including seizures . once the patient is diagnosed ( with epilepsy ) therapeutic impact can be examined by using the logging function of a seizure detection device , but in order to look into social impact , the device obviously needs to allow online use ( with real - time alarming ) .", "compared with the professional caregivers ' observations , a mean sensitivity of 61.97% and false detection rate of 1.44 per night were obtained with the nonpatient - specific approach and a mean sensitivity of 66.87% and false detection rate of 1.16 per night with the semipatient - specific approach . this study demonstrates the first clinical results of an algorithm for the detection of tonic clonic and clonic seizures tested on two patients with epilepsy monitored in a long - term home environment with the varia system ( video , accelerometry , and radar - induced activity recording ) developed by our team . we believe that , while privacy protection needs to be taken into account , the addition of video to accelerometry allows a seizure detection system not only to alarm the family or ( informal ) caregiver but also allows retrospective ( offline ) or emergency ( online ) verification of detected events . much work remains to develop a multimodal , learning , comfortable , and user - friendly device .", "", "" ]

[ "it is relatively rare benign tumour appearing in about 0.3% of general population and accounts for 3% of solid renal masses . extra renal amls ( eramls ) are rare tumours that present as incidentalomas upon imaging for other conditions . case reports of extra renal aml are rare with < 60 reported cases since they were first described by friis and hjortrup in 1982 . angiomyolipoma ( aml ) is a benign mesenchymal tumour consisting of varying amounts of mature adipose tissue , smooth muscle , and thick walled blood vessels . our case described one of the largest ever reported myolipomas , which despite its size , can be rather asymptomatic .", "a well - encapsulated , firm globular mass separate from the right kidney and no definable adrenal was found [ figures 2 and 3 ] . histological examination revealed benign adrenal cortical elements , with a predominance of mature benign adipose tissue interspersed with pockets of haemopoietic ( erythro - myeloid ) intermediates , and megakaryocytes which was confirmatory for the diagnosis of adrenal aml . the tumour was predominantly hyperintense with signal intensity similar to fat on t1/t2-weighted images and lost signal on the fat - suppressed sequences .", "angiomyolipoma is a rare clinical entity mostly involving kidney and is part of the group of tumour known as tumours of perivascular epithelioid cell origin . one is isolated aml , and the other is that is associated with tuberous sclerosis . the demonstration of fat density ( hypodense ) within an adrenal mass by computed tomography is virtually diagnostic of aml . mri is sometimes required to demonstrate origin of the tumour , to define the tissue planes when the tumour is large and heterogeneous , and to distinguish benign from malignant lesions by comparing signal intensity ratios of adrenal to liver .", "the adrenal myolipoma is a rare urological entity , which seems to increase its frequency , probably due to causes affecting primarily the function and physiology of the adrenals . ever since its introduction by gagner in 1992 , laparoscopic adrenalectomy has become the standard of care for the treatment of functioning and non - functioning adrenal tumours . many authors have found a decrease in perioperative morbidity and convalescence after this procedure when compared with open surgery ." ]

[ "vitrectomy , removal of silicone oil , epiretinal membrane peel , subretinal pvr removal and retinectomy were performed with laser retinopexy and intraocular gas tamponade . further retinal biopsy taken during vitrectomy for retinal detachment revealed no fungal elements on microscopy and intravitreal amphotericin b was also injected perioperatively . a 67-year - old male presented to the emergency eye centre ( eec ) complaining of a painful right eye of 5-day duration . a diagnosis of presumed toxoplasma chorioretinitis was made and treatment with pyrimethamine and sulfadiazine followed by oral clindamycin was initiated . on further questioning , it was discovered that there was the possibility of a previous pulmonary tuberculosis ( tb ) infection . the patient developed a retinal fold secondary to proliferative vitreoretinopathy ( pvr ) , which extended from the biopsy site to the optic disc . a diagnostic pars plana vitrectomy was therefore performed with vitreous sampling , which revealed a chronic vitritis without infectious agent or neoplasia .", "phaeohyphomycosis is a collective term that describes infection caused by darkly pigmented mycelial fungi , a feature secondary to the presence of melanin within their cell walls . however , this is the first time a subretinal abscess caused by phaeohyphomycosis has been documented in the medical literature . however , it is not uncommon for vitreoretinal surgeons to aid in the diagnosis of a posterior uveitis of unknown aetiology by sampling vitreous , retina or choroidal tissue , leading to increased diagnostic accuracy and prompt treatment . infection is presumed to be as a result of implantation following superficial trauma and exposure to contaminated soils or organic matter . posterior segment pathology is usually diagnosed by characteristic clinical signs , extensive systemic investigations and non - invasive ocular investigations such as fluorescein angiography . the specific treatment of this patient 's phaeohyphomycosis with antifungal medication would not have been possible and years of treatment for idiopathic uveitis may have ensued ." ]

[ "in 1978 , primary health care was seen as the solution to the inadequate illness management systems that had developed throughout the world . , phc used family physician as the most important ways to increase equitable access and utilization of public health services . in any case , family physician , with the key elements of first contact , comprehensiveness , continuity , and coordination of patient care , is central to the health of any health care system . in addition , most graduate nurses in our community can play an important role in preventing medicine and family physician team . consequently , in spite of their ability and capacity , they have a brief role in our family physician team & their job description . according to the health - for - all goals , the central concern of nurses in primary care should be the prevention of the disease by educating individuals and families on healthy lifestyles , and teaching community health workers and traditional birth practitioners to carry out many of the functions that nurses themselves have normally performed . now , people in most of the countries use professional and educated nurses [ called nurse practitioner ( np ) ] besides family physician or are under their supervision for diagnosis , treatment , and specifically health education of the family . in accordance with the international council of nurses definition , recent government initiatives are supporting general practice to deliver health care through a variety of means and personnel .", "the main goal of this study was to review the role and situation of nps in the new reform for better use of their capabilities in health care services . the second stage was a comparative study on four countries that had great experiences in these two fields ( family physician reform and nps ) and included usa , uk , austria , and canada , based on purposive sampling . in the third stage , this is a qualitative , comparative ( role of nurses in family physicians team ) , and cross - sectional study that was carried out with triangulation method in three stages in 2011 . in the first stage , we conducted a literature review to design a conceptual framework . all experts were completely familiar with the health system and had academic and research experiences in nursing education system in iran .", "the role of the nps had evolved from that of undertaking traditional , medically prescribed nursing tasks in a treatment room to undertaking screening activities and health assessments of new patients , with over 50% of the nps managing chronic disease clinics . role of nurses in some organizations in canada , the nurses involved in clinics should participate in specific training course of diagnosis and management of health care after registration . having access to patient medical record , nps can reduce unnecessary visits . according to the standards of practice for nps , the college of nurses of ontario states that they offer the full scope of primary health care practice , including consultation with physicians or other health care professionals when the client requires care beyond the nps scope of practice . practice nurses and nps increasingly substitute for gps in the care of minor illness and routine management of chronic diseases such as asthma , diabetes , and coronary heart disease . in england and wales , no legislative or regulatory deterrent related to the scope of practice exists for the nps to refer to specialist physicians . in austria , nurses in nursing home and maternity do some of the medical procedures under the supervision of physicians . meanwhile , using nps as substitution of gps does not seem to be logically correct due to the gps workload and the social and cultural background in iran . nps provide high - quality , cost - effective individualized care that is comparable to the health care provided by the physicians , and np services are often covered by insurance providers .", "the survey on health systems in different countries indicates that many of the health sectors have begun their reforms with two main goals , including quality improvement and cost limiting . family physician and referral system are among the few options that can maintain and even upgrade the quality of services , reducing the costs simultaneously . as each health system in each country has its specific referral system , iran is now on the verge of implementing a best fit referral system reform . so , it is crucial to well define the roles of each component , such as nurses , in this system .", "further , they are accountable for establishing a consultative relationship with a physician and consultation occurs with a family physician ; however , nps may consult with a specialist physician , if appropriate to the situation and practice setting . having access to patient medical record , nps can reduce unnecessary visits . according to the standards of practice for nps , the college of nurses of ontario states that they offer the full scope of primary health care practice , including consultation with physicians or other health care professionals when the client requires care beyond the nps scope of practice . the role of the nps had evolved from that of undertaking traditional , medically prescribed nursing tasks in a treatment room to undertaking screening activities and health assessments of new patients , with over 50% of the nps managing chronic disease clinics . the gps monopoly on primary care has been broken by nurse - led services , including nhs direct , which provides 24-h health advice by telephone , and nhs walk - in centers , which treat minor illness and injury . no legislative or regulatory deterrent related to the scope of practice exists for the nps to refer to specialist physicians . in austria , nurses in nursing home and maternity do some of the medical procedures under the supervision of physicians . practice nurses and nps increasingly substitute for gps in the care of minor illness and routine management of chronic diseases such as asthma , diabetes , and coronary heart disease . in england and wales , role of nurses in some organizations in canada , the nurses involved in clinics should participate in specific training course of diagnosis and management of health care after registration . these nurses are educated , and can treat , inject drugs , and request for some diagnostic tests for their patients . in the united kingdom ,", "six experts in two panels were asked to confirm the role of nurses in family physician reform . they suggested that special courses are needed to empower our graduated nurses for their new rules . meanwhile , using nps as substitution of gps does not seem to be logically correct due to the gps workload and the social and cultural background in iran .", "according to the who , in most countries , nurses are the most important group of health workers in terms of numbers , closeness to people and their health problems , and understanding of community needs . there is still debate in nursing and medical circles about what the focus of their role should be . in contrast , campbell believes that public acceptance of nurses as gp substitutes would be poor , and therefore suggests that a better role for nurses in primary care would be health education and illness prevention . on the other hand , in our country ( iran ) until now , nurses have not got a competent role in health sector reform . thus , it can be concluded that in order to achieve the goals of family physicians reform and also utilize the maximum capacity of trained nurses , a fixed and definite place must be considered for them in the gp team to provide their services under the supervision of family physicians . it means that any effort to change nurses roles in health care services should accompany with some social and cultural changes toward their competencies . in iran , whereas a noticeable reform toward family physician is going on , redefining nurses role is essential . their active role not only enriches the family physician team , but also might be crucial in patients training , which is currently one of our weaknesses . for example , lauder , sharkey , and reel suggest that nps and gps in rural and remote areas should be interchangeable and that the focus should be on the competency of the person delivering care rather than the right of one discipline ( medicine ) to perform a particular role . given that consumers have limited understanding of phc , it is not surprising they do not articulate confidence in nps acting autonomously but rather as complementary to gps , perhaps undertaking initial assessment for triage purposes and providing ongoing management , education , and support under the gps delegation . their competencies for case management , education , treatment , and follow - up may repair many of the pitfalls we are confronting in health care services ." ]

[ "the purpose of this paper is to review emerging concepts of organ crosstalk and recent experimental data regarding the activation and systemic expression of proinflammatory pathways during ischemic aki . for a complete list of abbreviations used in this paper , please see table 1 recent data highlights the importance of both the innate and adaptive immune response , activation of proinflammatory cascades , and an alteration of transcriptional events in remote organs during ischemic aki . clinical and translational laboratory studies have demonstrated the relevance of interactions between the injured kidney and distant organs , and complex mechanisms of crosstalk between injured kidneys and remote organs such as the lungs , liver , heart , gut , brain , and hematologic system have been identified . kidney ischemia - reperfusion injury ( iri ) occurs in various clinical settings including shock , sepsis , organ transplantation , and vascular surgery . it has become apparent that clinically much of the high patient mortality can be attributed to the onset of systemic inflammatory response syndrome ( sirs ) and progression to multiple organ failure ( mof ) . since the 1950s", "we will now focus on cellular mediators , specifically those involved in the innate and adaptive immune system , which may connect local ischemic aki with distant organ injury . the innate immune system plays an important role in mediating the inflammatory response during ischemic aki . the specific role of subpopulations of t cells in the pathogenesis of ischemic aki remains a stimulating topic of current and future investigation , both in the innate and adaptive immune response to kidney iri . little is known about the role of b cells in renal iri ; however , b - cell - deficient mice demonstrated renal protection in the early phase of experimental iri . in summary , both the innate and adaptive immune responses play critical roles in the pathophysiology of ischemic aki . either following antigen stimulation or in the presence of proinflammatory chemokines and oxygen free radicals , significant evidence exists to support the role of t cells in gut , heart , and lung ischemia - reperfusion injury [ 2428 ] .", "the combination of aki with acute lung injury ( ali ) remains a formidable challenge to clinicians caring for critically ill patients . in the setting of mof , aki and ali the role of the gut in response to organ crosstalk during ischemic aki remains a fascinating topic of future investigation . pulmonary apoptosis plays a critical role in the genomic and phenotypic response to ischemic aki . this exceedingly high mortality can not be attributed solely to volume overload ; leukocyte trafficking , uremic toxins , and oxidative stress mechanisms all likely contribute to this devastating clinical syndrome . for the purposes of this paper , ali represents a pao2/fio2 ratio < 300 combined with chest radiograph findings of acute bilateral infiltrates in the absence of elevated cardiac filling pressures , as defined by the america - european consensus conference on acute respiratory distress syndrome ( ards ) .", "ischemic aki initiates a cascade of proinflammatory pathways , and through the release of soluble mediators and activation of the host innate and adaptive immune systems , it facilitates organ crosstalk and remote organ injury . as our understanding of the postischemic kidney 's role in mediating organ crosstalk continues to evolve , further laboratory investigation into the remote organ response to this devastating injury aki is a frequent complication amongst hospitalized patients , with grave implications in the setting of mof ." ]