Datasets:

xNoper

/

pubmed-sections-test

like 0

[ "differences in life span between males and females are commonly observed across many species . for example , where the heterogametic sex ( xy sex chromosomes ) is male , as in humans and drosophila , females tend to live longer than males . similarly , in caenorhabditis elegans , where the hermaphrodite has two x chromosomes ( xx ) and the male has one ( xo ) , the hermaphrodite tends to live longer . in contrast , in most bird species , where the heterogametic sex is female ( zw sex chromosomes ) , males tend to live longer than females . genetic and environmental interventions that affect life span tend to have a greater effect in one sex than the other . for example , reduced insulin / insulin - like growth factor 1 ( igf-1 ) signaling and dietary restriction tend to increase life span more in females than males in drosophila and mammals , whereas mild stress tends to increase life span more in males than in females , at least in drosophila . quantitative genetic analyses have revealed a different genetic architecture of life span in males versus females . for example , quantitative trait loci ( qtls ) that affect life span are often sex - specific or sex - biased in drosophila , mice and humans , and studies over the past few years show strikingly different effects of inbreeding in male versus female insects . two recent studies in bmc evolutionary biology on the effects of inbreeding in a seed beetle ( bilde et al . ) and in drosophila ( vermeulen et al . ) , respectively , provide additional insight into the genetic factors involved . taken together , all these data suggest that the genetic differences between males and females have a significant effect upon aging and life span .", "several possible and potentially overlapping genetic mechanisms have been suggested to explain differences in life span between genders , including asymmetric inheritance of sex chromosomes , differences in physiology , maternal effects , and sex - specific selective pressures . for example , the asymmetric inheritance of the sex chromosomes , such that males inherit a single x chromosome in flies , c. elegans and humans , means that in males any x chromosome recessive mutant phenotype will be expressed ( the ' unprotected x ' model ) , whereas in females the presence of the second x chromosome means that there is likely to be a wild - type copy of the gene present , and the recessive phenotype will not be expressed . these deleterious recessive mutations could lead to decreased life span , affecting males more than females . consistent with this idea , inbreeding ( which will tend to make recessive mutations homozygous ) has been found to cause decreased life span in drosophila , mice and several other species ( called inbreeding depression of life span ) . however , several other studies , including that of vermeulen et al . ( and see references therein ) have failed to detect inbreeding depression of adult life span , or found effects that varied depending upon the particular strain , sex , or environmental conditions . for example , vermeulen et al . mapped a recessive qtl on the second chromosome of drosophila that causes a temperature sensitive reduction in life span in inbred males but not females . asymmetric inheritance of mitochondrial genomes and other cytoplasmic genomes is another possible contributor to sex - specific differences in life span . given that the mitochondrial genome is inherited maternally in drosophila and humans , natural selection can not act to optimize mitochondrial function or nuclear - mitochondrial genetic interactions in the male genetic background . this might result in suboptimal mitochondrial function in males and reduced life span in males relative to females . the maternal effect may also contribute to differences in life span between males and female . in many species , the mother makes a large contribution of gene products to the egg or embryo , and this has been shown to affect life span in a gender - specific way in certain species . because the mother contributes these materials equally to eggs that will develop as either male or female , the genetic differences between male and female zygotes must underlie aspects of the sex - specific effects of maternal products on life span . one possibility is that because maternal - effect gene products are being produced by a female genome , they may be more optimized for female offspring , thereby contributing to the reduced life span often observed in males . consistent with this idea , maternal effects on life span are greater in males than females for certain species such as the seed beetle .", "finding mechanisms that explain the difference in life span between males and females is hindered by our lack of understanding of the basic mechanisms of aging and underlying causes of mortality . life span appears to be limited by the accumulation of irreversible damage , probably including oxidative damage to macromolecules , mutations , and loss of epigenetic regulation , as well as more acute and dynamic modifiers of mortality rates , perhaps including the efficiency of detoxification and excretion . mechanistic explanations often involve the concept of tradeoffs , that is , the allocation of energy or other ' resources ' to functions such as reproduction and behavior , at the expense of somatic maintenance pathways required for optimal longevity . in several recent studies , however , it was shown that life span can be increased by dietary restriction or altered insulin / igf-1 signaling without a detectable decrease in reproduction or overall metabolism , and conversely , reproduction can be increased in old female flies with no detectable cost for life span . seed beetles ( figure 1 ) could be a particularly powerful model in which to look for trade - offs between somatic maintenance required for optimal life span and other traits such as fecundity . the adult is ' facultatively aphagous ' and does not require food or drink , but can rely on nutrient stores accumulated during development . have examined the effects of inbreeding on male and female life span in the species callosobruchus maculatus . they found that inbreeding reduced fitness of both males and females , as indicated by reduced total reproductive output . as expected , female life span was decreased by extreme inbreeding , but surprisingly , male life span was increased . previous studies of seed beetles by fox et al . had found a large maternal effect on life span of males but not females . however , the bilde et al . study included an elegant control for maternal effects , in that animals with varying amounts of inbreeding had mothers of the same genotype , thus separating the effects of cytoplasmic factors such as mitochondria and maternally contributed gene products from the effects of inbreeding . of course , this result does not rule out an important role for maternal products in modulating life span , but it does show that they are not the direct targets of the observed inbreeding effects . one possible explanation for the decrease in female life span is that inbreeding led to homozygosity of recessive alleles that are deleterious for female lifespan , providing support for the unprotected x hypothesis . however , this hypothesis can not account for the increase in life span observed in males . suggest that the increase in male life span might be due to changes in energy - intensive behaviors , such as a reduction in courtship or aggression , thereby leading to longer life span . ( a ) male and ( b ) female . the sex specific coloration of the posterior abdominal plate ( pygidium ) is shown . the squares are 1 mm . from beanbeetles.org . photographs by lawrence blumer , reproduced with permission .", "sex - specific differences in genetic architecture could contribute to the observed differences in life span and the effects of inbreeding . for example , a recent study examined how evolution shapes variation in transcript abundance in male and female drosophila , and sex - specific differences in the mode of transcriptome inheritance were identified . in males , variation in gene expression was found to be due mostly to additive interactions of alleles , whereas in females , gene expression variation was found to be due mostly to non - additive ( epistatic ) interactions between alleles ; a substantial x - chromosome effect was shown to underlie these differences . similarly , in the seed beetle , loci affecting life span exhibited more non - additive interactions ( dominance ) in females than in males . given that additive variation responds to selection more quickly , because additive variation does not involve interactions of multiple loci , sex - specific differences in selection could underlie aspects of sexual dimorphism in life span observed in many species . sex - specific selective pressures that result in higher male reproductive fitness may contribute to sexual dimorphism of life span . for example , costly male - biased metabolism or behaviors , such as aggression or specific courtship behaviors , might be positively selected for , but could result in decreased life - span in males relative to females . future studies may be directed toward further study of the underlying differences in genetic architecture between males and females , in particular , testing the idea that deleterious alleles affecting life span may be more exposed to selection in males than in females due to reduced non - additive effects in males , thereby reducing inbreeding load for male - specific deleterious alleles in the population . it will be particularly interesting to ask if the increased life span observed in highly inbred male seed beetles by bilde et al . can be found to correlate with a reduction in specific costly aspects of metabolism , or behaviors such as locomotion and aggression .", "we thank sergey nuzhdin for helpful discussions . this work was supported by grants from the department of health and human services to jt ( 1r01ag011833 ) and to ma ( 1r01gm073039 ) ." ]

[ "sepsis can be difficult to distinguish from non - infectious conditions in critically ill or comatose patients in the early stages ; and diagnosis , treatment and outcomes greatly differ between patients with and without sepsis . positive bacteriological cultures , including blood cultures , may not be available before 24 to 48 hours ; interpretation of local colonization may be ambiguous ; and traditional markers of infection , such as body temperature and white blood cell ( wbc ) count , may not be specific . furthermore , there are concerns about possible blood culture negative clinical sepsis , particularly in the setting of increased prophylactic and empirical antibiotic use . conversely , differentiating true infection from contamination after growth of common skin commensals in blood cultures , poses a diagnostic problem . since early identification of infections and sepsis is crucial for patient management , an effective marker specific for bacterial infection is very useful in the critical care settings . there are several markers of sepsis , like c - reactive protein , serum procalcitonin ( pct ) , il-6 , il-8 , lactate , etc . , of pct has been proposed as an indicator of the presence of infection and as a useful marker of the severity of sepsis . the present study was an attempt to assess the usefulness of serum pct as a marker of sepsis in critically ill patients , using the semi - quantitative , rapid immunochromatographic kit , in apollo hospitals , bangalore .", "this study was carried out from july 2007 to june 2008 in the department of microbiology , apollo hospitals , bangalore . the study included patients from the intensive care unit ( icu ) with suspected sepsis . sepsis was confirmed clinically and by positive blood culture ( bact / alert system ) . ( sepsis , severe sepsis , septic shock ) or no sepsis based on the accp ( american college of chest physicians ) recommendations . serum pct was assayed semi - quantitatively by rapid immunochromatographic technique using a commercially available test kit ( pct - q , b.r.a.h.m.s . the result was independently read by two microbiologists to minimize reading bias and interpreted as per the manufacturer 's recommendations : \n i)pct > 10 ng / ml : severe bacterial sepsis or septic shockii)pct 2 to 10 ng / ml : severe systemic inflammatory response , most likely due to sepsis unless other causes are knowniii)pct 0.5 to 2 ng / ml : a systemic infection can not be excludediv)pct < 0.5 ng / ml : local bacterial infection possible ; sepsis unlikely \n pct > 10 ng / ml : severe bacterial sepsis or septic shock pct 2 to 10 ng / ml : severe systemic inflammatory response , most likely due to sepsis unless other causes are known pct 0.5 to 2 ng / ml : a systemic infection can not be excluded pct < 0.5 ng / ml : local bacterial infection possible ; sepsis unlikely the clinical condition , signs and symptoms of sepsis , antibiotics used , blood culture and final outcome of patients were recorded for all patients . sensitivity and specificity of the pct assay were analyzed using two different cut - off values for pct ( 0.5 ng / ml and 2 ng / ml ) ; sensitivity being pct positives / total no . of sepsis cases 100 and specificity being pct positives / total no . of cases without sepsis statistical analysis was carried out using chi - square test to evaluate the correlation between pct levels and sepsis .", "sensitivity and specificity of the pct assay were analyzed using two different cut - off values for pct ( 0.5 ng / ml and 2 ng / ml ) ; sensitivity being pct positives / total no . of sepsis cases statistical analysis was carried out using chi - square test to evaluate the correlation between pct levels and sepsis .", "patient ages ranged from 18 to 84 years [ male - female ratio , 28:12 ] . among these patients , pct above 10 ng / ml was seen in 12 patients ; 2 - 10 ng / ml , in 7 patients ; 0.5 - 2 ng / ml , in 3 patients ; and < 0.5 ng / ml , in 18 patients [ table 1 ] . serum procalcitonin values in the 40 patients with suspected sepsis among the 12 patients with pct > 10 ng / ml , 1 patient in shock did not have any signs of sepsis or infection and recovered with inotropic support only ( no antibiotics were required ; cardiogenic shock ) . of the 11 patients with clinically diagnosed sepsis , 8 yielded positive blood cultures subsequently ( 2 patients with septic shock had staphylococcus aureus bacteremia ) ; 1 patient had rickettsial disease with a typical clinical presentation ( fever , skin rashes , altered sensorium ) , which was confirmed by a positive weil felix reaction which showed elevated titres and a rise in titre within a week , and responded well to doxycycline and supportive therapy ; and 2 patients with negative blood cultures were on empiric antimicrobial therapy . four patients in this group expired due to complications of sepsis ( mortality , 33.3% ) . one of the patients with renal transplant and with features of sepsis had a serum pct > 10 ng / ml ( day 1 ) . he responded to parenteral meropenem and teicoplanin , and his subsequent serum pct levels reduced to < 0.5 ng / ml on day 3 and day 5 . all 7 patients with pct of 2 - 10 ng / ml had some form of sepsis ( sepsis , 4 patients ; severe sepsis , 2 ; and septic shock , 1 patient ) . four of them yielded positive blood cultures ; 1 patient had parasitemia ; and 2 malignancy patients with febrile neutropenia who were on empiric antimicrobial therapy had negative blood cultures . of the 3 patients with pct of 0.5 - 2 ng / ml , 1 patient had clinical evidence of sepsis secondary to culture - proven pseudomonas bronchopneumonia , though his blood culture did not yield any organism . he responded well to a combination therapy of cefoperazone - sulbactam and amikacin and was stable at discharge . the other 2 patients had no evidence of infection ( congestive cardiac failure and unstable angina ) , and 1 of them expired due to cardiac complications . of the 18 patients with pct < 0.5 ng / ml , only 2 patients with bronchopneumonia had evidence of sepsis . among 3 other patients with infections , 1 patient had lobar pneumonia but without sepsis ; 1 , pyrexia of unknown origin ( possibly a viral infection ) ; and 1 , probable viral encephalitis but no signs of sepsis . two patients ( post - myomectomy hypertrophic obstructive cardiomyopathy and acute myocardial infarction ) with positive blood cultures ( s. epidermidis and s. haemolyticus ) were concluded to have cardiogenic shock and not septic shock , as they responded well to inotropic support . in 1 of them , antibiotics were given additionally , considering his postoperative status ( single - vessel stenting done 3 days prior to pct testing ) . in this cohort , in a patient with a differential diagnosis of food botulism , a low pct assisted in excluding an infective aetiology , and the patient was subsequently diagnosed as having acute oculobulbar syndrome . in 8 out of the 9 fatal cases , serum pct cut - offs of 0.5 ng / ml and 2 ng / ml were analyzed separately for their sensitivity and specificity as biomarkers for sepsis among the 21 patients with sepsis and 19 patients without sepsis . there was a statistically significant correlation with the presence of sepsis determined using either pct 0.5 ng / ml or 2 ng / ml ( p<0.0001 in both cases ) . using 0.5 ng / ml or more as cut - off , 19 of the 21 patients with sepsis could be detected , but 3 out of the 19 patients without sepsis showed pct above 0.5 ng / ml ( sensitivity , 90% , i.e. , 19/19 + 2 ; and specificity , 84% , i.e. , 16/16 + 3 ) . using pct cut - off of 2 ng / ml or more as a marker of sepsis , 18 of the 21 patients with sepsis could be detected by pct , and only 1 out of the 19 patients without sepsis showed pct above 2 ng / ml ( sensitivity , 85.7% , i.e. , 18/18 + 3 ; and specificity , 94.7% , i.e. , 18/18 + 1 ) [ table 2 ] . relation of serum pct levels with sepsis , number of patients ( blood cultures ; mortality )", "the aim of this study was to assess the usefulness of serum pct as a marker of sepsis in critically ill patients in our hospital . early identification of infection and sepsis in critically ill patients is a challenge for clinicians . serum pct has been found to be a very good indicator of sepsis syndrome . to the best of our knowledge these include studies on its use in determining bacterial sepsis in children with febrile neutropenia , its use as a marker of renal parenchymal infection and its use as a marker of the severity of acute pancreatitis.[68 ] most studies using pct for interpretation of bacterial infection and sepsis have used the quantitative pct assay ( immunoluminometric method ) . several studies have achieved high sensitivity and modest specificity with a cut - off of 1 to 1.2 ng / ml . others have used 2 ng / ml as the diagnostic threshold for infection and sepsis . various studies have found the pct values in sepsis ranging from 0.5 to 3.5 ng / ml ; in severe sepsis , 6.2 - 9.1 ng / ml ; and in septic shock , 12.8 to 38.5 ng / ml . on the other hand , semi - quantitative pct assay is a rapid immunochromatographic assay and is easy to perform . the method shows good sensitivity and specificity in diagnosing bacterial sepsis at pct levels of 2 ng / ml.[1315 ] using pct levels above 2 ng / ml as the cut - off to indicate sepsis syndrome , the present study showed sensitivity of 86% and specificity of 95% . using a cut - off of above 0.5 ng / ml revealed higher sensitivity but with a reduction in the specificity to 84% . hence serum pct of 2 ng / ml or more using the rapid immunochromatographic method is an effective marker of sepsis and may help in aggressive management of such patients along the lines of sepsis . despite improved methods , blood cultures are not always positive in clinically confirmed sepsis . presumed bacterial cause of fever can not be detected in 60% to 80% of patients with suspected primary and secondary bloodstream infections . in this study , excluding the 2 cases of malaria and rickettsial fever , the sensitivity of blood culture was 63% ( 12 of 19 ) ; and in all these patients , serum pct was above 2 ng / ml . differentiating true infection from contamination or probable skin commensals in blood cultures poses a diagnostic problem . the 2 blood cultures yielding coagulase - negative staphylococci were probable skin commensals , as both patients did not have any infective foci and both responded well with inotropes alone . in both these patients , the serum pct was less than 2 ng / ml . falsely high pct is known to occur in cardiogenic shock , major surgery , accidental trauma , pancreatitis and burn patients . of patients with cardiogenic shock , 1 patient had pct above 10 ng / ml , 2 had pct less than 0.5 ng / ml and 1 patient with coexisting sepsis had pct of 2 - 10 ng / ml . pct levels are significantly higher in patients with septic shock than in those with cardiogenic shock , and hence a cut - off of above 10 ng / ml is recommended to discriminate between septic and cardiogenic shocks . serum pct increases early after trauma and peaks within 48 to 72 hours post - trauma and declines thereafter in the absence of infection or sepsis . in the present study , out of 13 patients with major surgery or trauma , 4 patients had surgery or trauma with in 72 hours of suspected sepsis and pct testing ; 3 of them with pct levels below 0.5 ng / ml did not have sepsis , and 1 patient had septic shock ( pct > 10 ng / ml ) . in contrast , initial falsely low pct levels , typically seen during the early course or localized state of infection , often show a gradual increase during follow - up measurements after 6 - 24 hours . reduction in concentration of pct has been described in response to antibiotic administration and may be used to detect antibiotic responsiveness . in the present study , serial serum pct levels were not estimated for most patients . however , one of the patients ( post - renal transplant status ) from this cohort for whom 3 serum pct levels were performed showed a marked decrease in the pct levels in response to the antibiotics administered . this is in concordance with the several clinical - management protocols , like the pct - guided antimicrobial stewardship , that have been used to either withhold or continue antibiotics based on the pct levels . a limitation of the present study is that serial measurements of pct were not done for most patients . more indian studies evaluating pct on a larger number of patients with suspected sepsis are needed to conclusively corroborate the findings of this study , and such studies will be useful in an age of overuse of antibiotics and emerging antibiotic resistance . another limitation of the study was that c - reactive protein ( crp ) levels were not estimated for most patients . however , most studies have found superiority of pct in comparison to crp as a marker of infection and sepsis .", "the pct assay was found to be a promising biomarker of sepsis in this small exploratory study and provided valuable and early information before the culture results were available . the semi - quantitative , rapid assay revealed moderate sensitivity ( 86% ) and high specificity ( 95% ) at a cut - off above 2 ng / ml . pct assay might assist in avoiding unwarranted antibiotic usage in critically ill patients who present with symptoms similar to those in infective conditions . however , the assay result must be interpreted in association with the clinical findings and other laboratory parameters ." ]

[ "we used monthly reports of slide - confirmed malaria and annual census based population data from 434 counties ( municpios ) in the brazilian amazon region for 19961999 , during which no coordinated national malaria interventions occurred ( 12 ) . to study the relationship of reported malaria cases to climate , we used monthly precipitation and temperature from the cru ts 2.1 gridded climate data set for selected states ( 13 ) ( figure 1 ) . to consider how the precipitation malaria relationship depends on surface water conditions , including the extent of open water and wetlands , we used 100 m 100 m maps from the jers-1 synthetic aperture radar satellite and calculated the percentage of maximum inundatable open water and wetland coverage for each county ( figure 2 , panel a ) ( 14 ) . in this region , monthly temperatures were between 24.6c and 29.4c ( well within the range for optimal malaria transmission ) for 95% of the observations ( 18,416 of 19,364 ) included in the analysis ( temperature relationships not shown ) . malaria incidence per 1,000 population ( black lines ) and mean monthly precipitation ( blue lines ) during la nia ( orange bars ) and el nio ( red bars ) events for the states of a ) amazonas , b ) mato grosso , and c ) roraima . a ) percentage of wetlands in amazon basin counties ( shades of blue ) , counties without wetlands data ( yellow ) , and counties with < 80 total malaria cases ( gray ) . wetland colors correspond to percentage wetland values in panel d. b ) risk ratios for malaria incidence for 1 sd ( 14 cm ) change in monthly precipitation ( january 1996december 1999 ) , plotted at each county seat of government ; c ) spatially smoothed risk ratios for 14-cm changes in monthly precipitation . in both panels , red shaded squares show reduced risk for 14-cm increase in monthly precipitation ; blue shaded squares show increased risk for malaria with increased precipitation . d ) boxplot of risk ratios for malaria incidence for 14-cm changes in monthly precipitation , by percentage wetland cover . if the lag and the rainfall coefficient vary across regions , meaningful geographic comparisons would be difficult to achieve because neither the lag nor coefficient have consistent meanings across models . to interpret results , either the coefficient must be fixed and the lags varied ( difficult to do ) or the lags must be fixed and the coefficients varied ( relatively easy to do ) . the aim is to describe the variable patterns of malaria incidence and precipitation , not create a highly predictive model . we chose to fix the lag and vary the coefficients . to assess the association between malaria incidence and precipitation data , we estimated the rate ratio of malaria incidence associated with 1 sd - increase in monthly precipitation ( 14 cm ) for each county by using the following poisson regression model , which includes a flexible temporal trend represented as a natural cubic spline with 6 degrees of freedom ( figure 2 , panel b ) : malariait poisson(it ) log it = log popit + i + iprecipit + fi(t ) i normal(g(lati , loni ) , ) the ( estimated ) regression coefficients from the county - specific models were then modeled as a spatially smooth surface , a thin - plate spline . degrees of freedom for the thin - plate spline were selected using generalized cross - validation ( figure 2 , panel c ) . the relationships between precipitation and malaria incidence in the amazon basin are spatially varied and change signs , depending on the region . positive correlations between monthly precipitation and malaria incidence ( rate ratios > 1 ) occur in the upland regions of the southwest and central amazon basin , whereas negative correlations between precipitation and incidence ( rate ratios < 1 ) occur in the north , largely along the main waterways of the amazon river and the major wetland regions of the basin ( figure 2 ) . for a 14-cm increase in monthly rainfall , the malaria rate can double in the upland area , yet decrease by up to 80% along the main amazon channel . the p values of the precipitation coefficient are 0.00020.0009 along the main waterways and 0.0040.10 in uplands areas . we hypothesize that this reversal of the malaria precipitation relationship from positive to negative is related to the extent of open water and wetlands in the basin . mosquito habitats in wetlands or along large rivers may wash out or become too deep during months with high precipitation , but in areas with fewer wetlands , mosquito habitats are limited by precipitation . to test this hypothesis , we compared the malaria precipitation association for 338 counties that reported > 80 cases of malaria over the 48 months against the estimated percentage of open water and wetland cover for each county ( figure 2 , panel d ) . as expected , the precipitation - linked risk for malaria fell as the percentage of wetland in each county increased , but the risk for malaria varied in counties with low percentages of wetlands . the central - east region had the lowest level of malaria incidence , which may explain why this region also lacked a malaria - precipitation relationship .", "studies have proposed that flooding created new pools of water suitable for mosquito larvae as the water levels slowly receded from alluvial forests along the rio branco river in roraima and the maroni river on the frontiers of suriname and french guiana ( 6,15 ) . our results suggest that monthly precipitation along the amazon basin can have both strong positive and negative associations with malaria incidence . further research is needed to address the limitations of our study , including its short time frame and the crude countywide approximation of percentage wetlands as an exposure . the quality and reliability of the health data were concerns , but we verified that the distribution of null reporting was unbiased temporally and spatially . also , our study did not quantify increasing malaria incidence in response to increasing or decreasing precipitation or the impact of lag factors . instead , we focused on the seasonality of these patterns until longer data series of malaria incidence and climate data are available . our evidence suggests that precipitation drives malaria risk in the amazon basin , but the relationship varies in the uplands ( more precipitation , more / less malaria ) and is negative in areas dominated by wetlands and large rivers ( more precipitation , less malaria ) . our findings show the need to account for local landscape characteristics , especially the extent of wetlands and open water , in regional to global projections of the effects of climate change on malaria . better understanding the impact of climate and landscape on malaria will improve our ability to assess health risks ." ]

[ "the clavicle is a rare site for bone tumours . according to the world health organisation , the giant cell tumor is an aggressive potentially malignant lesion which means that its evolution based on histological features is unpredictable . sites commonly affected by giant cell tumour are proximal tibia , distal femur and distal radius . the oncologic patterns of clavicle resemble that of flat bones and not other long bones . among tumors of clavicle ,", "a 60 year old man presented to our department with pain and swelling over lateral end of left clavicle ( fig . 1 , fig . the pain was insidious in onset , non radiating and had no diurnal variations and was aggravated on shoulder movements and relieved on taking medications . we got a plain radiograph which revealed which an expansile radiolucent lesion arising from lateral end of left clavicle ( fig . 3 ) . the swelling demonstrated geographic type destruction without any soft tissue component or periosteal reaction . 4 ) . to aid in the diagnosis fine needle aspiration cytology was done which revealed a predominantly cellular lesion having sheets of plump , oval mononuclear cells with mild pleomorphism . the cells had moderate cytoplasm , oval to elongated nucleus with moderate anisokaryocytosis with irregular nuclear membrane . amongst these cells , many multinucleated giant cells were also which were distributed evenly . the differential diagnosis which were kept in mind are aneurysmal bone cyst , non ossifying fibroma , eosinophilic granuloma and tuberculous osteomyelitis . since the clavicle does not necessary require reconstruction and the patient was a retired school teacher , not engaged in any physical work so surgical resection of the tumor was planned . after proper investigations and pre anaesthetic clearance , a wide excision of the mass along with 3 cm of the healthy tissue was done ( fig . the excised mass was sent for histopathological examination which also confirmed it to be a giant cell tumor . the range of motion of the left shoulder was normal and post operatively there was no neurovascular deficict . the patient was happy with the surgical outcome and at 1 year follow up there was no evidence of recurrence or metastasis .", ". primary bone tumors of the clavicle are more likely to be malignant than benign , and amongst these tumors which occur in clavicle , giant cell tumor is a rare entity . the differential diagnosis of giant cell tumor of clavicle which pose a diagnostic challenge both for the surgeon and the histopathologist are primary aneurysmal bone cyst , non ossifying fibroma.eosiniphilic granuloma and tuberculous osteomyelitis . giant cell tumor is basically a cellular lesion made up of sheets of plump mononuclear cells with mild pleomorphism . the cells have moderate amount of cytoplasm , oval to elongated nuceuswith moderate anisokaryosis with irregular nuclear membrane and 01 nucleolus . amongst these cells are multinucleated giant cells distributed in a regular fashion.no collagen formation , no new bone formation or no necrosis is usually seen . giant cells in abc are smaller as compared to giant cell tumor and their arrangement is loose with collagen formation . histologically it has histiocytes loaded with lipid and hemosiderin and spindle cells arranged in storiform or whorled pattern and there is presence of collagen fibres . eosinophilic granuloma has diagnostic langerhans cells and also it has large number of leucocytes , fibroblasts , plasma cells and lymphocytes . curettage remains the main stay of treatment for giant cell tumors but for giant cell tumors occurring in expendable bones like distal ulna , iliac wing or proximal fibula , en bloc resection is performed without any reconstruction . after extensive search of literature it was found that there are very few case reports describing giant cell tumors of clavicle , , . due to the paucity of the available literature no definite treatment guidelines are available on the management of giant cell tumor of clavicle . some authors reported not so favourable outcomes after total claviculectomy due to pain , loss of muscle strength and dropping of shoulder . while some authors established that total or subtotal excision of clavicle was rarely associated with loss of function . based on their reports we also performed partial claviculectomy and at one year follow up , patient was well satisfied with", "the clavicle is a rare site for bone tumors and shares its oncological behavior with that of flat bones rather than long bones . we have reported this case to emphasize the fact any expansile lytic lesion occurring in the lateral end of clavicle should be taken seriously and the diagnosis can be easily missed both clinically and radiographically if the clinician is not aware of the wide array of differential diagnosis which range from an infectious etiology like tuberulous osteomyelitis to a neoplastic etiology like giant cell tumour . there seems to be a difference in opinion regarding functional outcome after claviculectomy for tumour like lesions of clavicle and our case report further highlights the fact the claviculectomy without any reconstruction seems to be a good option with no disability noted in long term .", "", "", "since it is a single case report involving a single subject and we are not reporting the first case of this type in the literature , hence no approval was taken from the relevant ethics committee but written informed consent was taken from the patient to publish his details and clinical photographs .", "written informed consent was obtained from the patient for publication of this case report and accompanying images . a copy of the written consent is available for review by the editor - in - chief of this journal on request .", "ak , kk and js contributed to the development of protocol and edited the manuscript .", "" ]

[ "pathological gambling is defined in the current classification system of the world health organization ( 1992 ) ( icd10 ) as an impulse control disorder ( icd ) which causes excessive , uncontrollable gambling despite financial losses and social problems , while the latest version of the diagnostic and statistical manual ( dsm5 ) of the american psychiatric association ( 2013 ) grouped pathological gambling together with substancerelated and addictive disorders and renamed it to gambling disorder . despite this aetiological debate , in parkinson 's patients it has been observed that pathological gambling occurs more frequently ( 3.46.1% ) than in the general population ( 0.252% ) , alongside with icds , such as binge eating , so called hypersexuality and compulsive shopping ( cox et al . , 2005 ; avanzi et al . , 2006 ; grosset et al . , 2006 ; voon et al . , 2006 ; bondolfi et al . , 2008 ; weintraub et al . , 2010 ; santangelo et al . , the aetiology of the development of pathological gambling in parkinson 's disease is still unclear , however , research suggests an association with dopamine replacement therapy , specifically with dopamine agonists ( voon et al . , 2006 ; weintraub et al . , 2006 ; gallagher et al . , 2007 ) . this review summarizes evidence in this field of research attempting to reveal the relationship between parkinson therapy and pathological gambling , discusses the reasons why some patients react on them differently than others , what the relevant risk factors are and considers how impulsivity may contribute to the development of gambling symptoms .", "( 2007 ) found that these patients are younger , earned a higher score in tests investigating noveltyseeking and impulsive behaviour , and were more likely to have a personal or family history of alcohol abuse . being male and smoking in the past also seem to be risk factors ( gallagher et al . , 2007 ; valena et al . , 2013 ) . in this respect , pathological gambling with and without parkinson 's disease is rather similar : young age , male sex , impulsivity , noveltyseeking , smoking and alcoholism are also considered risk factors for pathological gambling in the general population ( johansson et al . , 2009 ) . observing the progress of their disease , in comparison to other parkinson 's patients , those who later develop pathological gambling tend to have an earlier onset of the illness and also suffer more frequently from manic or hypomanic episodes during the onperiod of dopaminergic medication ( voon et al . , 2007 ) .", "even in the first case reports about parkinson 's patients developing pathological gambling , a clear correlation has been observed with the initiation or dose escalation of dopaminergic medication ( molina et al . , 2000 ; seedat et al . , 2000 ) . in further studies comparing the effect of different parkinson 's therapies , dopamine agonists emerged as the medication with the strongest association with the development of pathological gambling ( voon et al . , 2006 ; weintraub et al . , 2006 , 2010 ; some studies claim that pramipexole could have the largest effect ( dodd et al . , 2005 ) . other studies systematically comparing different dopamine agonists have found no significant difference between each of them ( weintraub et al . , 2006 ; recent research also shows a strong effect of aripiprazole , prescribed for the treatment of mood disorders and schizophrenia , with stronger gamblingrelated cognition in comparison to other dopamine agonists ( grallbronnec et al . , 2016 ) . levodopa seems to play a less important role as only a few patients developed pathological gambling under levodopa monotherapy ( dodd et al . , 2005 ; voon et al . , 2006 ; gallagher et al . , 2007 ) , however , studies suggest that additionally prescribed levodopa raises the risk of the development of pathological gambling and icds ( dodd et al . , particularly high doses and longterm use of levodopa and shortacting dopamine agonists are also associated with dopamine dysregulation syndrome and punding , that is , stereotypic behaviour ( gallagher et al . , 2007 ) . further , subthalamic nucleus deep brain stimulation ( stn dbs ) has a controversial role in the development of pathological gambling in parkinson 's disease . it has been observed that after the initiation of stn dbs therapy , gambling symptoms resolved ( ardouin et al . , 2006 ; bandini et al . these results could be explained by the significant reduction in the dosage of dopamine agonist medications . however , in some individual cases , pathological gambling and/or impulsive behaviour only developed after stn dbs surgery ( funkiewiez et al . , 2003 ; contarino et al . , 2007 ; smeding et al . , 2007 ; 2011 ) ; although in these cases the symptoms resolved spontaneously or after the change in stimulation parameters and further reduction in dopaminergic therapy . this could be associated with the stimulation of the limbic subregion of the stn which has been shown to affect neurotransmission in the limbic basal gangliathalamocortical circuitry ( winter et al . , 2008 ) . evidence also shows that patients are more impulsive after activating stn dbs ( frank et al . 2009 ) . as impulsivity is considered as a risk factor for developing pathological gambling in parkinson patients ( voon et al . , 2007 ) , the contentious effects of stn dbs raise questions about the role of impulsivity in the development of gambling behaviour in general ( table 1 ) . main results of studies on the association of pathological gambling with parkinson 's disease therapy bis , barratt impulsivity scale ; da , dopamine agonists ; icd , impulse control disorder ; igt , iowa gambling task ; ledd , ldopa equivalent daily dose ; pd , parkinson 's disease ; pg , pathological gambling ; stn dbs , subthalamic nucleus deep brain stimulation .", "the fact that not all parkinson 's patients develop medicationassociated impulse control disorders or pathological gambling and that most of the patients solely developed pathological gambling under dopaminergic medication suggests an underlying genetic vulnerability mechanism ( voon et al . , 2006 ) . to analyse the genetic susceptibility of parkinson 's patients with pathological gambling , several genes have been examined that are relevant for the function of the mesolimbic reward system . the most obvious genes to investigate are the dopamine receptor genes , which could be affected by dopaminergic medications . some studies suggest that a certain mutation of the drd2 gene ( taq1a ) is more frequent in pathological gamblers than in the general population ( lobo et al . , 2010 ) . this variation in the gene may be connected to a lower density of d2receptors in the striatum ( thompson et al . , 1997 ) and to impulsivity ( eisenberg et al . , 2007 ) , while the literature is inconclusive regarding its potential role in alcohol addiction ( heinz et al . , 1996 ; heinz & goldman , 2000 ; munaf et al . , 2007 however , no significant difference was found between the frequency of this mutation between parkinson 's patients with and without pathological gambling ( lee et al . , 2009 ) . interestingly , recent case reports suggest that not only dopamine agonists but also dopamine antagonists acting on the d2 receptors can trigger pathological gambling ( grtsch et al . , 2015 ) , which underlines the role of this receptor . on the other hand , the homozygote genotype of a single nucleotide mutation ( p.s9 g ) of the drd3 gene has been shown to have a higher frequency in pathological gamblers with parkinson 's disease ( lee et al . , 2009 ) . this mutation is not associated with increased risk for pathological gambling in the general population ( lobo et al . , 2010 ) . however , the heterozygote genotype of this mutation has been reported to be linked to impulsivity ( retz et al . , 2003 ; limosin et al . , this mutation was also associated with decreased response rate to pramipexole in parkinson 's patients ( liu et al . , 2009 ) , which could result in higher prescribed dosage . according to our current knowledge , there has not been any study performed yet to assess the relationship between drd4 mutations and pathological gambling in parkinson 's patients . however , the number of tandem repeats of a 48bp region in the drd4 gene is associated with pathological gambling , substance abuse and impulsivity , with discordant results of what number of repeats is relevant ( de castro et al . , 1997 ; comings et al . , 1999 healthy subjects with this genotype also presented an increased gambling behaviour after receiving ldopa ( eisenegger et al . , 2010 ) . another neurotransmitter system that has been shown to be affected in patients with pathological gambling is the serotoninergic system . ( 1999 ) have observed a significantly higher frequency of the short ( s ) allele of the promoter region of the serotonin transporter gene , 5httlpr , in male pathological gamblers compared to the general population . the s allele of 5httlpr has also been associated with increased risk of developing depression under stress ( karg et al . , 2011 ) , some aspects of impulsivity ( sakado et al . , 2003 ) , impulsive aggression and increased activity in the amygdala after negative affective visual stimuli ( heinz et al . , 2011 ) . an association between this mutation and pathological gambling has indeed been observed in patients with parkinson 's disease ( lee et al . , 2009 ) . another mutation that may be associated with pathological gambling in parkinson 's patients is the mutation of grin2b ( lee et al . , 2009 ) . grin2b is a gene from the 2b subunit of the nmda receptor , which is mainly expressed in the hippocampus , the striatum and also the cortex ( loftis & janowsky , 2003 ) . the variation found to be more frequent in parkinson 's patients with pathological gambling is a single nucleotide polymorphism . its specific role in the development of pathological gambling in parkinson 's disease is unclear , as this variation does not cause an amino acid change ( c.366c > g ) . furthermore , it was also found to be associated with schizophrenia ( li & he , 2007 ) , as a different polymorphism of grin2b has been associated with obsessive compulsive disorder ( arnold et al . , 2004 ) . ( 2011 ) found a different single nucleotide polymorphism of the grin2b gene to be related with risky decisionmaking , which might be considered as impulsive behaviour and therefore explain a link to pg in parkinson 's disease . these research findings suggest that an underlying genetic susceptibility might facilitate the development of pathological gambling in parkinson 's patients . however , some studies are inconsistent and there are some differences between pathological gamblers with and without parkinson 's disease . altogether , these results and the observed connection to dopaminergic medication described above suggest that the vulnerability of parkinson patients towards pathological gambling may be triggered by dopamine agonists .", "several studies have compared neuronal activation patterns of parkinson 's patients with and without pathological gambling . summarizing the results , differences have been found in the activity of regions associated with the mesolimbic reward system , mainly in the orbitofrontal cortex ( ofc ) and the ventral striatum ( cilia et al . , 2008 ; ( 2008 ) compared the blood perfusion of different brain regions in parkinson 's patients with pathological gambling with patients who only have parkinson 's disease and a control group in a spect imaging study in a resting condition . they have observed a generally increased blood flow in the ofc , hippocampus , parahippocampal gyrus , amygdala , ventral striatum and cuneus on the right hemisphere and in the insulae on both sides in parkinson 's patients with pathological gambling compared to both other groups . ( 2013 ) studied the function of the subthalamic nucleus by capturing local field potentials ( lfp ) in parkinson 's patients with and without pathological gambling on medication during an economic task . the lfps were recorded with the aid of stn dbs electrodes that were implanted 4 days prior to the experiment . the economic task included nonconflict and conflict decisions with stimuli pairs with the same probability vs. stimuli pairs with different probabilities of winning money . in conflict situations , risky choices could result in a higher reward , however , the task was overall designed to reward more nonrisky choices . the results showed that during the economic decisionmaking task , lowfrequency oscillations synchronize in the subthalamic nucleus . this synchronization was stronger during highconflict situations in comparison to lowconflict situations in patients with pathological gambling . patients without pathological gambling showed no differences in the synchronization of lowfrequency oscillations during conflict or nonconflict situations . the results of this experiment underline the role of the subthalamic nucleus in decisionmaking and might also explain why symptoms of pathological gambling resolve in some parkinson patients after stn dbs surgery . however , the results do not explain why patients usually only improve after months of stn dbs therapy . some studies focused more on the dopaminergic system and several differences were found between pathological gamblers with parkinson 's disease and parkinson 's patients without gambling . the turnover of monoamines , including dopamine , in the ofc was found to be higher ( joutsa et al . , 2012 ) , further the dopamine release during gambling tasks was found to be significantly increased in pathological gamblers ( steeves et al . , 2009 ) . these results suggest that the vulnerability to gambling problems is partly mediated by increased dopaminergic neurotransmisson the ofc and the ventral striatum . pathological gambling in these patients may be caused by dopamine agonists in the mesolimbic dopaminergic system , particularly in the ventral striatum , which is less affected by the disease than the dorsal striatum . as dopamine agonist therapy seems to have a very strong association with the development of pathological gambling ( voon et al . 2010 ) , imaging studies have been conducted to further understand the effect of this medication . dopamine agonists have been shown to effect reward processing ; patients on this medication have a diminished reaction in the ofc after negative prediction errors compared to patients on levodopa therapy or off medication ( van eimeren et al . , 2009 ) , suggesting a decreased learning effect after punishment . parkinson 's patients with and without pathological gambling or compulsive shopping were compared in a prediction learning task on or off dopamine agonists . patients with pathological gambling were faster and better at learning and had a higher activity in the ventral striatum and the ofc during rewardrelated learning while on medication . on the contrary , while learning through loss , the activity of these areas was lower in this group of patients than in the group with parkinson 's disease only under the same circumstances . ( 2012 ) suggest that these patients have an impaired activation of d2 and d3autoreceptors caused by tonic stimulation through dopamine agonists . through the absence of negative feedback , these findings could be used to propose that dopamine agonists cause a higher vulnerability to pathological gambling due to impaired learning processes . as a consequence of the impaired negative feedback , the dopamine concentration would not decrease to the previous level after a rewardrelated dopamine release . the high level of dopamine could also blunt the drop of dopamine concentration after punishment . imaging studies with nonparkinson patients with pathological gambling also showed differences in the activation of the mesolimbic rewards system , however , the results are not consistent . some studies showed a reduced activation of the prefrontal cortex and ventral striatum during loss and gain anticipation as well ( balodis et al . 2012 ) , others showed higher activity in the striatum during gain anticipation ( romanczukseiferth et al . , 2015 ) . the activity of the prefrontal cortex and the ventral striatum also seems to be diminished after successful loss avoidance compared to healthy control subjects ( romanczukseiferth et al . neuronal activity during loss and gain anticipation and loss avoidance have not been researched yet in parkinson 's patients with pathological gambling .", "as described above , impulsive behaviour is considered to be a general risk factor for developing pathological gambling in patients with parkinson 's disease ( voon et al . , 2007 ; johansson et al . , 2009 ) . however , there are studies that indicate a more specific connection : frank et al . ( 2007 ) compared two groups of patients with parkinson 's disease with a control group , assessing their learning ability in a probabilistic prediction task and their performance in a conflictbased decision task . one of the groups of parkinson 's patients was treated with dopaminergic medication , the other group with stn dbs and lowdose dopaminergic therapy . the first group 's performance was compared on and off medication , the second group 's performance on and off stn dbs without changing the dosage of their medication . the results in the prediction task in the group taking dopaminergic medication only were similar to the findings of voon et al . ( 2010 ) described above , that is , the learning ability of patients from negative outcome was impaired on medication . the activation of deep brain stimulation showed no effect on the learning ability of the patients , neither after reward nor after punishment . on the other hand , in the conflictbased decision task , patients with activated stn dbs responded faster in high rather than in lowconflict conditions , while off deep brain stimulation , their response was slower during highconflict situations . dopaminergic medication did not affect the difference in decisionmaking speed in high vs. lowconflict conditions . this result is supported by other experiments assessing patients with stn dbs clinically with the barratt impulsiveness scale ( hlbig et al . , 2009 ) and the simon task ( wylie et al . , 2010 ) . if high impulsivity can promote pathological gambling , as suggested by the results of frank et al . ( 2007 ) , there should be a higher risk for parkinson 's patients treated with stn dbs . however , there are only individual cases of patients developing pathological gambling after initiation of deep brain stimulation ( smeding et al . , 2007 ) , with no clear way of interpretation , because dopaminergic medication had also been changed postoperatively . ( 2009 ) found a higher frequency of impulse control disorders ( icds ) in parkinson 's patients treated with stn dbs . however , the difference in prevalence of icds to the patient group only receiving drug therapy was not significant and it was not described when these patients developed icds and how long they had already received dbs therapy . this information is relevant , as the recovery from icds after the initiation of dbs therapy can take up to 4 years and in some cases the symptoms initially worsen after the therapy ( ardouin et al . , 2006 ) . the effects on impulsive and compulsive behaviour of stn dbs can also depend on the localization of the electrodes . the stimulation of the limbic subregion of the stn or the stimulation of adjacent structures can change the neurotransmission in limbic brain regions ( winter et al . , 2008 ) . these findings question the causal relationship between high impulsivity and pathological gambling in parkinson 's patients . altogether , more research is needed for clarification of the effects of stn dbs . on the other hand , the results of those studies comparing the effect of stn dbs and dopamine agonist medication support the theory that parkinson 's patients with pathological gambling show impaired learning mechanisms modulated by dopamine agonists . therefore , alterations of reward and punishment processing seem to play a prominent role in the development of pathological gambling in parkinson 's patients .", "several genetic and neurofunctional findings suggest that individual differences in dopaminergic neurotransmission in the ventral striatum and associated brain areas contribute to pathological gambling in parkinson 's disease , and indicate complex interactions between such risk factors . taken together , altered learning processes in parkinson 's patients with pathological gambling appear to include increased baseline blood perfusion of mesolimbic brain areas , increased activation by reward and reduced activation by punishment in those brain areas , which are implicated in reinforcement learning ( schultz , 2002 ) , impulsivity ( horn et al . , 2003 ) , addiction ( kalivas & volkow , 2005 ) and pathological gambling ( romanczukseiferth et al . , 2015 ) . however , most of the studies performed in parkinson 's patients with pathological gambling are retrospective or crosssectional research , which makes the analysis of potentially causal factors more difficult . for example , in crosssectional studies , impulsivity seems to be an important risk factor ( voon et al . , 2007 ) ; however , these findings are not fully consistent with the results of experimental studies on the effects of dbs of the stn . prospective or longitudinal studies could broaden the perspective on the role of potential risk factors , that is , impulsivity or impaired learning . despite the obstacles in conducting such studies , the results of this research can play a crucial role in understanding the development of pathological gambling and icds not only in parkinson 's patients but also in the general population .", "" ]

[ "suicide is one of the leading causes of death throughout the world ; it ranks among the top 10 causes of death for individuals of all ages and is the leading cause of death in males under 35 years old.1,2 a decrease in the concentrations of serotonin metabolites ( in particular the serotonin 5-hydroxyindoleacetic ) in patients with suicide behavior ( suicide attempt and suicide ) suggests that the serotonergic system is associated with suicide behavior.3,4 studies have consistently proposed that genes of the serotonergic system could play an important role in suicide.5,6 for example , in sh - sy5y cells , the administration of human interferon - alpha modifies the htr2c mrna editing , and this could be a mechanism of drug - induced depression or suicidal side effects in humans.7,8 it has also been proposed that the serotonin receptor 2c ( htr2c ) gene9,10 contributes to suicide behavior.11 the htr2c belongs to the family of 5-ht2 receptors , which has three members : 5-ht2a , 5-ht2b , and 5-ht2c.1 the gene that encodes the htr2c is located on the long arm of the x chromosome at position 24 ; and it contains six exons and five introns , spanning at least 230 kb.12 one of the most common variants of the htr2c is the cys23ser ( rs6318 ) , which is a functional polymorphism ( c / g at position 68 ) that results in the substitution of cysteine for serine at position 23 of the n - terminal extracellular domain.2,13,14 in the last few years , several authors have reported an association between the htr2c polymorphism and suicidal behavior.15 furthermore , in analyses performed by gender , a negative association has been observed between the htr2c polymorphism and suicidal behavior.14,16 other polymorphisms of htr2c that also have been studied in suicide behavior are rs547536 , rs2192372 , rs2428707 , and rs4272555;14 however , no association has been established in several populations . therefore , the association between the htr2c gene remains controversial , given that the available case control studies have obtained both positive and negative findings.1315,1620 in addition , to date , the relationship between the htr2c gene and suicide behavior in the mexican population has not yet been studied . as the htr2c gene is located on chromosome x , the objective of this work was to analyze the association by gender between five genetic variants of htr2c gene , rs547536 , rs2192372 , rs6318 , rs2428707 , and rs4272555 , and suicide attempt in a mexican population .", "a total of 187 unrelated patients , of whom 110 ( 58.8% ) were females and 77 ( 41.2% ) were males who had attempted suicide , were included in this study . we defined suicide attempt as a self - harm behavior with at least some intent to end one s life . the subjects were recruited from the outpatient service of the general hospital of comalcalco in the state of tabasco , mexico . we also included 223 healthy subjects as controls ( 146 females [ 65.5% ] , 77 males [ 34.5% ] ) who were recruited from the blood donor center at the same hospital . we want to emphasize that all the individuals in this study were exclusively from comalcalco and had parents and grandparents of mexican origin so as to reduce ethnic variation and stratification effects . we considered as exclusion criteria patients who had an organic disorder or self - injury behavior , patients who had concomitant diagnoses of mental retardation or drug dependence , and patients with somatic or neurological illnesses that impaired psychiatric evaluation . all the individuals ( suicide patients and healthy subjects ) were evaluated by trained psychiatrists or clinical psychologists with a master s degree as the minimum education level . for all of them , the lifetime diagnoses were determined using the diagnostic and statistical manual of mental disorders fourth edition ( dsm - iv ) criteria following appropriate interviews ( structured clinical interview for dsm - iv [ scid ] i and ii).21 the suicide patients were classified in one of the following psychiatric diagnoses : schizophrenia spectrum disorders n=32 ( 17.1% ) , mood disorders n=59 ( 31.5% ) , stress - related disorders n=73 ( 39.0% ) , and substance - related disorders 23 ( 12.4% ) . written informed consent was obtained from all subjects after the procedures had been fully explained to them . the study was approved by the local ethics and research committee of divisin acadmica multidisciplinaria de comalcalco ( damc)-universidad jurez autnoma de tabasco ( ujat ) ( ujat - damc-2012 - 02 ) . the study was performed in compliance with the ethical standards of the 1964 declaration of helsinki . genomic dna was isolated from whole blood samples using standard procedures that have been previously reported.9,22 genotyping of the htr2c variants rs547536 , rs2192372 , rs4272555 , rs6318 , and rs2428707 was performed using the taqman ( applied biosystems inc , foster city , ca , usa ) snp genotyping assay obtained from applied biosystems . we selected five single - nucleotide polymorphisms ( snps ) of the htr2c gene found in the promotor and introns of the gene ( table 1 ) . first , the hardy weinberg equilibrium for the htr2c variants was determined using pearson s goodness of fit test . for female controls , the genotype frequencies of rs6318 , rs2428707 , and rs4272555 did not deviate from hardy weinberg equilibrium ( p>0.05 ) ; however , the genotype frequencies of rs547536 and rs2192372 did deviate from hardy weinberg equilibrium ( p<0.05 ) . random blind duplicates of up 30% of the samples were used as a quality control measure , and we obtained consistent results . then , and fisher s exact tests were used to compare the genotype and allele frequencies between cases and controls . finally , the haploview 4.2 ( broad institute , cambridge , ma , usa)23 was employed to calculate the linkage disequilibrium ( ld ) of the markers .", "all the individuals ( suicide patients and healthy subjects ) were evaluated by trained psychiatrists or clinical psychologists with a master s degree as the minimum education level . for all of them , the lifetime diagnoses were determined using the diagnostic and statistical manual of mental disorders fourth edition ( dsm - iv ) criteria following appropriate interviews ( structured clinical interview for dsm - iv [ scid ] i and ii).21 the suicide patients were classified in one of the following psychiatric diagnoses : schizophrenia spectrum disorders n=32 ( 17.1% ) , mood disorders n=59 ( 31.5% ) , stress - related disorders n=73 ( 39.0% ) , and substance - related disorders 23 ( 12.4% ) .", "written informed consent was obtained from all subjects after the procedures had been fully explained to them . the study was approved by the local ethics and research committee of divisin acadmica multidisciplinaria de comalcalco ( damc)-universidad jurez autnoma de tabasco ( ujat ) ( ujat - damc-2012 - 02 ) . the study was performed in compliance with the ethical standards of the 1964 declaration of helsinki .", "genomic dna was isolated from whole blood samples using standard procedures that have been previously reported.9,22 genotyping of the htr2c variants rs547536 , rs2192372 , rs4272555 , rs6318 , and rs2428707 was performed using the taqman ( applied biosystems inc , foster city , ca , usa ) snp genotyping assay obtained from applied biosystems . we selected five single - nucleotide polymorphisms ( snps ) of the htr2c gene found in the promotor and introns of the gene ( table 1 ) .", "first , the hardy weinberg equilibrium for the htr2c variants was determined using pearson s goodness of fit test . for female controls , the genotype frequencies of rs6318 , rs2428707 , and rs4272555 did not deviate from hardy weinberg equilibrium ( p>0.05 ) ; however , the genotype frequencies of rs547536 and rs2192372 did deviate from hardy weinberg equilibrium ( p<0.05 ) . random blind duplicates of up 30% of the samples were used as a quality control measure , and we obtained consistent results . then , and fisher s exact tests were used to compare the genotype and allele frequencies between cases and controls . finally , the haploview 4.2 ( broad institute , cambridge , ma , usa)23 was employed to calculate the linkage disequilibrium ( ld ) of the markers .", "the demographic characteristics of the cases ( mean age : 25.96 years , standard deviation [ sd ] : 9.26 range : 1456 years ) and comparison group ( mean age : 31.95 years , sd : 13.03 range : 1461 years ) in this mexican population are presented in table 2 . table 3 shows the genotype and allele frequencies of the htr2c variants rs547536 , rs21923372 , rs6318 , rs2428707 , and rs4272555 in the suicide attempters and control groups . the htr2c variants rs4272555 and rs2428707 were significantly associated with suicide attempt in this mexican population . in the female group , the g allele of the snp rs2428707 was associated with an increased risk of suicide attempt ( p=0.01 , odd ratio [ or ] = 3.68 , 95% confidence inrterval [ ci ] : 1.2410.90 ) , while the c allele of the snp rs4272555 was associated with a decreased risk of suicide attempt ( p=0.01 , or = 0.26 , 95% ci : 0.090.79 ) . the distributions of the htr2c variants rs547536 , rs21923372 , and rs6318 were not significantly different between the subjects with suicidal behavior and the control group ( table 3 ) . subsequently , for the snps that showed a significant association , we summarized the evidence and performed a meta - analysis . the results of the meta - analysis ( supplementary materials ) showed a nonsignificant association for the rs2428707 ( fixed effects : or : 1.21 , 95% ci : 0.801.82 , p(q)=0.03 ) and for the rs4272555 ( fixed effects : or : 0.56 , 95% ci : 0.161.94 , p(q)=0.03 ) ( figures s1s4 and tables s1 and s2 ) . the ld ( linkage disequilibrium ) in this mexican population was measured for all markers examined in this case control study ( rs547536 , rs2192372 , rs6318 , rs4272555 , and rs2428707 ) . we conducted a haplotype analysis of the same five markers and did not find a significant association between suicide attempt and any of the examined haplotypes ( p>0.01 , table 4 ) .", "the demographic characteristics of the cases ( mean age : 25.96 years , standard deviation [ sd ] : 9.26 range : 1456 years ) and comparison group ( mean age : 31.95 years , sd : 13.03 range : 1461 years ) in this mexican population are presented in table 2 . table 3 shows the genotype and allele frequencies of the htr2c variants rs547536 , rs21923372 , rs6318 , rs2428707 , and rs4272555 in the suicide attempters and control groups . the htr2c variants rs4272555 and rs2428707 were significantly associated with suicide attempt in this mexican population . in the female group , the g allele of the snp rs2428707 was associated with an increased risk of suicide attempt ( p=0.01 , odd ratio [ or ] = 3.68 , 95% confidence inrterval [ ci ] : 1.2410.90 ) , while the c allele of the snp rs4272555 was associated with a decreased risk of suicide attempt ( p=0.01 , or = 0.26 , 95% ci : 0.090.79 ) . the distributions of the htr2c variants rs547536 , rs21923372 , and rs6318 were not significantly different between the subjects with suicidal behavior and the control group ( table 3 ) . subsequently , for the snps that showed a significant association , we summarized the evidence and performed a meta - analysis . the results of the meta - analysis ( supplementary materials ) showed a nonsignificant association for the rs2428707 ( fixed effects : or : 1.21 , 95% ci : 0.801.82 , p(q)=0.03 ) and for the rs4272555 ( fixed effects : or : 0.56 , 95% ci : 0.161.94 , p(q)=0.03 ) ( figures s1s4 and tables s1 and s2 ) .", "the ld ( linkage disequilibrium ) in this mexican population was measured for all markers examined in this case control study ( rs547536 , rs2192372 , rs6318 , rs4272555 , and rs2428707 ) . we conducted a haplotype analysis of the same five markers and did not find a significant association between suicide attempt and any of the examined haplotypes ( p>0.01 , table 4 ) .", "the aim of the present study was to assess the association between the htr2c variants rs547536 , rs2192372 , rs6318 , rs2428707 , and rs4272555 and suicide attempt in a mexican population . to our knowledge , this is the first association analysis between htr2c polymorphisms and suicidal behavior performed in a latin american population . we found that the g allele of rs2428707 was associated with an increased risk of suicidal behavior in females ; however , this is not similar to the results of previous studies.14,20 this discrepancy could be due to differences of the sample sizes used . the number of control subjects used in those previous studies and our study were similar ; however , the number of cases in our study were fewer than what the german and italian populations used in previous studies.14,20 another possible explanation for this discrepancy is the heterogeneity between the studies . in our study , the absence of the a allele of rs2428707 and the t allele of rs4272555 in the female group , could be ethnic - dependent because the allelic and genotypic distributions we observed were different from those reported in the literature.14,20 third , the positive results of this study are modest because we did not exclude the presence of false positives , even when the results were corrected by bonferroni s . for major evidence , we performed a meta - analysis that included studies that have been reported up to date and observed a no - association . however , we considered that the low number of studies , the low number of samples , and the presence of heterogeneity in the analysis reduced the statistical power to detect a possible association between the htr2c polymorphisms and suicidal behavior . in consequence , more studies that analyze this association are needed . our analysis also showed an opposite effect for the rs4272555 and suicide ; we observed that in females , the c allele of the rs4272555 is a protective allele against suicidal behavior . it is fundamental to consider these findings with caution for the following reasons : first , the ld analysis indicated stronger linkage disequilibrium for rs2428707 and rs4272555 than for the other htr2c variants . second , the small sample size of our study may have resulted in a weaker statistical association than other studies with a larger study population . therefore , it is necessary to analyze other populations and increase the sample size , without the presence of the heterogeneity , in order to have conclusive results . the htr2c cys23ser ( rs6318 ) polymorphism is perhaps the most extensively studied for a possible association with suicidal behavior11,13,14,1720 and self - injury.24 the present study did not find an association between the htr2c cys23ser ( rs6318 ) and suicidal behavior . however , this finding is in accordance with previous studies14,20 performed in caucasian and chinese populations.18,19 in contrast , in a recent study by karanovic et al,11 an association between the c allele of htr2c rs6318 and suicide attempt was observed . karanovi et al11 included 165 suicide attempters and 188 controls , which is similar to what we used in the present study ; however , their controls were subjects with psychiatric diseases other than suicidal behavior and our controls were subjects without any psychiatric disorders . hence , these findings need to be replicated before any strong conclusions can be drawn . second , although we perform a bonferroni correction and performed a meta - analysis , the small sample size and the small number of the studies ( respectively ) do not ensure the absence of false positives . finally , we did not analyze the clinical features of suicide attempters that may predispose them to this behavior .", "our results suggest an association between the rs2428707 and rs4272555 polymorphisms of htr2c in mexican females with suicidal ideation . future research must examine the potential mediating effects of the htr2c gene variants to highlight the importance of the serotonin system in suicidal behavior , with special focus on the receptor gene htr2c .", "or and forest plot for the meta - analysis of rs2428707 . note : g allele vs a allele with heterogeneity . note : g allele vs a allele with heterogeneity . or and forest plot for the meta - analysis of rs4272555 . funnel plot indicating publication bias for studies included in the meta - analysis of rs4272555 . descriptive characteristics of two studies analyzing the role of the htr2c gene variant rs2428707 in suicide attempt descriptive characteristics of two studies in the meta - analysis of the htr2c gene variant rs4272555 in suicide attempt" ]

[ "in the right amounts , boron is an essential nutrient for animals , plants , and fungi [ 13 ] . however , at high concentrations boric acid ( ba ) becomes an effective poison that is widely used for the killing of diverse organisms ranging from bacteria to rodents . in medicine while the molecular details of ba action on yeast remain unclear , it was recently shown that ba interferes with morphogenesis , to the effect that it inhibits the transition from the yeast to the hyphal form of the pathogenic yeast c. albicans . because the ability to switch to hyphal growth is an important virulence factor in c. albicans , suppression of such elongated growth by ba may in part explain its therapeutic effect . the present study was undertaken to assess the effect of ba on morphogenesis and cell wall synthesis in yeast , using the well - established model organism saccharomyces cerevisiae as a study subject . in s. cerevisiae , morphogenesis and cell wall synthesis depend on the correct assembly of cytoskeletal proteins . to guide cell wall synthesis during cytokinesis , a ring of septin filaments forms during the g1 phase of the cell cycle and is subsequently completed into a contractile actomyosin ring ( car ) by the addition of myosin and actin , among other proteins [ 8 , 9 ] . to complete abscission , the last phase of cytokinesis , the cells first separate mother and daughter cells with a chitin primary septum . the deposition of glucan and mannoprotein - rich cell wall material on the mother and daughter side of the primary septum later completes the trilaminar septum that can be observed under normal culture conditions . a disturbance in the assembly of the septation apparatus the cohesive functional unit that constructs the primary septum leads to the formation of highly aberrant septa [ 10 , 11 ] . the septa formed under these conditions do not allow for the separation of cells after cytokinesis , leading to the formation of chains and clumps of misshaped cells . based on the observation that ba causes such clumping and chain formation in s. cerevisiae , the present study was initiated to assess the influence of ba on the function of the septation apparatus .", "strain yms415 ( chs3::ha - his3 ) was constructed by the short flanking homology method . the chs3::3ha - his3 fragment was amplified by pcr from plasmid pfa6a-3ha - his3mx6 with primers 5-tattctcaatcggaaggaggaaagtgactccttcgttgcaggtggaggtggaggtggaggtggacggatccccgggttaattaa-3 and 5-tcaacttgtaagtatcacagtaaaaatattttcatactgtgaattcgagctcgtttaaac-3. integration of the fragment was verified by pcr and western blotting . transformants showed a wild - type like distribution of chitin in calcofluor white stained preparations , demonstrating full functionality of the chs3p - ha fusion protein . a visual representation of ba sensitivity was obtained by serially diluting an overnight culture of yeast grown in ypd and spotting 5 l of cell dilutions on ypd plates with the indicated concentrations of ba . viability staining of yeast cultures was performed by incubating cells in 0.2 mg / ml methylene blue in 50 mm kh2po4 for 5 minutes at rt . in order to visualize the distribution of chitin and glucan in the cell wall , cells were washed and incubated for 5 minutes in 0.01% calcofluor white or 0.5% aniline blue , respectively . fluorescence was observed with a standard diamidino-2-phenylindol ( dapi ) filter set ( zeiss ) . fifty ml yeast cultures at a titer of 1510 cells / ml in ypd were fixed by the addition of formaldehyde to a final concentration of 4% and incubated for 10 minutes at room temperature . cells were pelleted and incubated for 1 hour in phosphate buffered saline ( pbs ; 137 mm nacl , 2.7 mm kcl , 10 mm na2hpo4 , 1.76 mm kh2po4 , ph 7.4 ) with 4% formaldehyde . after 2 washes in pbs , cells were suspended in 100 l pbs with 10 l of an alexa 568-phalloidin solution ( 6.6 m in methanol ; invitrogen ) and 1 l of 1 mg / ml calcofluor white . cells were incubated for 1 hour in the dark and washed twice with pbs . cells were then pelleted and taken up in 50 l prolong antifade reagent ( invitrogen ) before mounting on slides . gfp - tagged cdc3p and myo1p were observed with the gfp - filter set ( zeiss ) in cells transformed with prs316cdc3gfp and pms55 . analysis of slt2p phosphorylation and total slt2p by western blotting followed established protocols [ 19 , 20 ] . as a loading control , an antibody directed against tub4p ( goat -tubulin yk18 , santa cruz biotechnology ) was used at 1/1,000 dilution . for the determination of chs3p - ha , cell membranes were isolated according to orlean . one volume of mercaptoethanol - free 2x sample buffer with 2% sds ( bio - rad ) was added to the protein extracts and samples were loaded on 6% sds polyacrylamide gels without boiling . antibodies used were a 1/5,000 dilution of anti - ha/1/5,000 dilution of goat antimouse hrp ( santa cruz biotechnology ) . membranes were stained in 0.02% coomassie blue r250 in 40% methanol , 5% acetic acid to serve as loading controls . for the determination of enzyme activities , a 40 l glucan synthase assay contained 20 l of membrane suspension at a protein concentration of 1 mg ml , 5 mm c - udp - glucose ( activity 1 10 cpm mmol ) , 75 mm tris - cl ph 7.5 , 25 mm kf , and when indicated with 20 m gtp--s for the determination of maximal gs activity . the reaction was incubated for 1 hour at 30c and then stopped by adding 1 ml 10% trichloroacetic acid ( tca ) . reaction mixtures were filtered through a type a / e glass fiber filter ( pall ) . filters were washed twice with 1 ml 10% tca and four times with 70% ethanol . filters were dried and taken up in 10 ml cytoscint es scintillation fluid ( icn ) , and activity was recorded in a scintillation counter . chitin synthesis was determined as described by choi and cabib . to measure chitin synthase 2 and 3 activities , experiments were performed in the chs1 deletion strain ecy46 - 1 - 8d . the chs1 deletion was found to have no influence on ba sensitivity ( figure 1(a ) ) . the chitin synthase assay mixture contained 20 l of membrane suspension at 1 mg protein ml , 5 l of 0.5 m tris / cl ph 7.8 , 5 l of 20 mm cobalt acetate , 5 l of 10 mm c - udp - glcnac ( 5000 c.p.m . l ) , and 2 l of trypsin solutions ( sigma ) at concentrations from 0.25 to 2.0 mg ml in a total volume of 46 l . for determination of chitin synthase 3 activity , 5 l of water were substituted with 5 l of 50 mm nickel acetate . proteolysis was stopped after incubating for 15 minutes at 30c by adding 2 l of a soybean trypsin inhibitor solution at 1.5x the concentration of the trypsin solution . chitin synthesis was initiated by adding 2 l of 0.8 m glcnac . after incubating for 60 minutes at 30c , chitin synthesis reaction mixtures were filtered , washed , and assayed in cytoscint fluid as described above . assays containing cobalt only show activities of chitin synthases 2 and 3 while cobalt / nickel assays show the activity of chitin synthase 3 .", "vital staining of strains yph499 and ecy46 - 1 - 8d with 0.05% methylene blue showed that ba concentrations between 0.1 and 0.4% do not severely reduce cell viability ( figure 1(a ) ) . in the examined range around the minimal inhibitory concentration of 0.31% , ba thus functions as a fungistatic agent that slows down proliferation but does not kill cells . note that the decline in viability in chs1 deletion strain ecy46 - 1 - 8d parallels the decline in wildtype viability . due to the previously reported lysis of daughter cells in chs1 mutants , strain ecy46 - 1 - 8d shows a higher fraction of dead cells in all of the examined samples . clumping and chain formation of cells occurs at ba concentrations above 0.2% , with the most striking effect observed at 0.4% ( figure 1(b ) ) . this clumping is the hallmark of a cytokinesis defect that causes daughter cells to remain attached to mother cells . a spot test of by4742 cells on ypd plates showed that no growth occurs at ba concentrations above 0.5%although viable cells can be retrieved even after 10 days of incubation under these conditions ( data not shown ) . staining of chitin and glucan in walls of cells grown with 0.4% ba revealed a buildup of cell wall material at bud necks , particularly in cell chains ( figure 2 ) . in order to characterize the cytokinesis defect in ba - treated cells , the localization of key morphogenetic proteins at the bud neck was examined by fluorescence microscopy . it was found that ba influences the localization of the septin cdc3 , the cytokinetic myosin myo1p , and the ring of filamentous actin that form sequentially in preparation for cytokinesis . increasing concentrations of ba leads to the formation of cdc3gfp rings that are disorganized , uneven , and not centered at the bud neck . moreover , ba causes the formation of cdc3gfp patches at sites other than the buck neck ( figure 3 ) . imaging of myo1gfp and actin shows that the formation of the car is impaired in a manner similar to the disturbance in septin ring organization . increasing ba concentrations lowers the fraction of cells with myo1gfp rings at the bud neck from 49 5% at 0% to 25 11% at 0.2% to 11 11% at 0.4% . in addition , myo1gfp rings formed under the influence of ba are often irregular in shape and at high concentrations ( 0.4% ) ectopic localization of myo1gfp patches at sites other than the bud neck is common ( figure 4(a ) ) . ba also impairs the assembly of the actin ring at the bud neck , which is the last component to be incorporated into the car before contraction starts ( figure 4(b ) ) . actin rings formed under the influence of ba become blurry , faint , and irregular in thickness . under these conditions , it can be observed that some actin rings fail to localize to the narrowest point of the bud neck . in some cases , ba - treated cells due to the low abundance of cells with actin rings in culture ( < 2% in controls ) , quantification of rings yielded no statistically significant data . cultures of cells grown with 0.3% and 0.4% ba were examined by electron microscopy using a protocol that allowed for the visualization of chitin ( figure 5 ) . the analysis of ba - treated cells showed massive abnormalities in the cell wall , particularly in the area of the septum , worse at 0.4% than at 0.3% . at these concentrations , ba prevented the construction of a single , straight chitin septum to separate mother and daughter cells . instead , the cells synthesized protuberances extending far into the cytosol and large irregular septa , often at ectopic locations at the cell periphery . in order to assess ba - induced cell wall integrity signaling , the amounts and the phosphorylation status of the signaling kinase slt2p were determined by western blotting ( figure 6(a ) ) . phosphorylation of slt2p increases with escalating concentrations of ba , suggesting that ba induces a cell wall integrity stress response . the dramatic increase in phosphorylation of slt2p is accompanied by a weak increase in protein expression . furthermore , it was determined that a slt2 deletion mutant is sensitive to ba ( figure 6(b ) ) , suggesting that slt2p - signaling improves ba resistance by causing a transcriptional response to ba stress . western blotting showed a nonlinear correlation between ba concentration and abundance of chs3p - ha ( figure 7(a ) ) . while at ba concentrations of 0.1 and 0.2% the amount of chs3p - ha decreases , there is an increase of chs3p - ha at 0.4% ba . the increase of chs3p - ha parallels the increase of chitin - rich septa visible in calcofluor white - stained cultures . the multiple posttranslational and protein targeting processes involved in chs3p and chs2p activation necessitate enzymatic determination of chitin synthase activities in addition to detection of protein amounts . figure 7(b ) shows that ba - induced changes in chitin synthase activities mirror the changes in chs3p - ha amount ( figure 7(a ) ) and bud neck thickness ( figure 2 ) . while at 0.1% and 0.2% ba decreases chitin synthase activities , presence of 0.3% and 0.4% ba increases chitin synthesis . at 0.4% ba , a measurement of glucan synthase activity in the membranes of strain yph499 showed a constant decline with increasing ba concentrations ( figure 7(b ) ) . neither maximal nor physiological ( without addition of gtp-s ) glucan synthase activity showed an increase at high concentrations of ba .", "living organisms are constantly exposed to boron , a mineral that is abundant in soil and water . boron is a weak acid and , at physiological ph , is present mostly as boric acid ( h3bo3 ; ba ) . for each organism , there is an optimal ba concentration . too little ba causes symptoms of deficiency while too much ba has a poorly defined cytotoxic effect . particularly the toxic effects of boron overload have led to a variety of applications for ba and related compounds , ranging from pest control to the treatment of vaginal yeast infections . . the biological function of ba might be due to its reactivity with cis - hydroxyl groups on carbohydrate molecules . examples for boron - dependent reactions include plant hormone - sensitive nadh oxidase activity , the crosslinking of plant cell wall carbohydrates , and the mineralization of bone . the molecular effects of boron lead to developmental defects in animals , particularly in the formation of the skeleton [ 30 , 31 ] . these teratogenic effects of boron might be caused by direct or indirect inhibition of histone deacetylase activity and a shift in hox gene expression . however , none of the above observations about ba toxicity serve to explain its effect on yeast an organism that does not undergo genomic imprinting or hox - dependent development . the only published data about the ba effect on yeast come from a recent study of the yeast c. albicans that suggested that ba impairs oxidative metabolism . while this observation in itself is interesting and deserves further study , the authors also show that ba directly or indirectly influences the morphology of c. albicans . the present study expands on this observation by showing that ba disturbs morphogenesis in the model yeast saccharomyces cerevisiae , particularly during cytokinesis . the data presented here show that ba impairs the formation of the primary septum in s. cerevisiae a defect that can be explained by incorrect assembly of the cytoskeleton at the bud neck . the molecular machinery that constructs the chitin cell wall between mother and daughter cells , the septation apparatus , consists of chitin synthase 2 , and a contractile actomyosin ring ( car ) . the septation apparatus is assembled sequentially from myosin , chitin synthase 2 and actin on a scaffold of septins at the bud neck [ 8 , 9 ] . should the assembly of a functional septation apparatus fail , the cell is unable to construct an orderly primary septum by chitin synthase 2 and is forced to divide by depositing large amounts of chitin - rich cell wall material at the bud neck . the chitin in these so - called default septa is provided by chitin synthase 3 [ 10 , 33 , 34 ] . since these irregular septum structures are resistant to degradation by chitinase , cells remain connected after cytokinesis and form cell chains and clumps . in s. cerevisiae . a septin assembly that erroneously localizes to a site other than the bud neck will direct the formation of a septum - like structure at the respective location . our data show that in s. cerevisiae increasing concentrations of ba leads to an irregular assembly of the septin scaffold , an inability to position the myo1 ring , and a failure to correctly assemble an actin ring at the bud neck . the aberrant localization and irregular appearance of the septin cdc3gfp in ba - treated cells is an important key to understanding the septation defect . we propose that ba causes problems with the assembly of the septin scaffold which later impair the localization and function of the car , resulting in the formation of highly irregular cell wall structures . like other threats to the integrity of the cell wall , septation defects trigger cell wall integrity signaling through the protein kinase c ( pkc ) pathway . under these conditions , cell wall integrity signaling leads to hyperphosphorylation of the pkc downstream effector slt2p [ 3638 ] , accompanied with a much weaker increase in slt2p amount . this will ultimately lead to the activation of cell wall repair enzymes , most notably chitin synthase 3 [ 36 , 40 ] . the present study shows that ba activates yeast cell wall integrity signaling pathways as evidenced by ba concentration - dependent phosphorylation of slt2p . presumably in response to cell wall integrity signaling , cells increase the activity of the cell wall repair enzyme chitin synthase 3 in a ba concentration - dependent manner . a decline at low concentrations followed by an increase at higher doses should be interpreted based on the impact boric acid on growth . we propose that at concentrations below the mic where the impact on growth is measurable but weak , boric acid stress reduces cell wall synthesis activity along with other metabolic activities . once boric acid stress exceeds a tolerable limit at concentrations above the mic the cell responds forcefully by induction of stress survival mechanisms such as chitin synthase 3-mediated cell wall reinforcement . it is worth noting that the activity of the chitin septum - forming chitin synthase 2 also increases during ba exposure . it is evident that the increase in chitin synthase 2 activity correlates well with the increased number and size of chitin septa in ba - treated cells . however , since the regulation of chitin synthase 2 activity is not well understood , we dare not hazard an explanation for this phenomenon . the data presented in this study show that in s. cerevisiae ba disturbs the localization of the contractile actomyosin ring secondary to causing irregularities in the septin scaffold at the bud neck . in agreement with the reviewed literature we propose that the aberrant localization of the septins ultimately impedes the formation of the primary septum , which leads to the synthesis of thick , chitin - rich default septa . in addition , the localization of septins at sites other than the bud neck explains the synthesis of cell wall protuberances that should be interpreted as incomplete ectopic septa . furthermore , our data show that a ba - induced septation defect , just like other septation defects , triggers cell wall integrity signaling through the pkc1-slt2 pathway and results in increased chitin synthase 3 activity ." ]

[ "the pylorus , duodenal c - loop , and ileocecal valve are the three physiological narrowings in the gastrointestinal tract , and most of the swallowed indigestible foreign bodies pass through it without complications . however , foreign bodies such as a toothbrush can not pass out of the stomach , and the gastrointestinal tract should get rid of these objects as soon as possible to avoid pressure necrosis and gastrointestinal perforation . although these objects are extracted either by endoscopy or laparoscopic gastrostomy , we devised an innovative technique by using pneumatic gastric insufflation and extracted the toothbrush by a tiny gastrotomy under local anesthesia .", "a 35-year - old male presented in our hospital at m.m . institute of medical sciences and research ( mmimsr ) , mullana , ambala , haryana , india in may 2013 ; he had accidentally swallowed a toothbrush two months back and there was a history of epigastric discomfort especially after meals . however , the vital signs were within normal limits and the abdomen was soft and nontender . x - ray of the abdomen suggested the presence of a foreign body and a computed tomography ( ct ) scan was done which confirmed a toothbrush lying in the stomach [ figures 1 , 2 ] . an upper gastrointestinal endoscopy was done which revealed the toothbrush in the stomach with its head toward the gastroduodenal junction . biopsy forceps were used to deliver the toothbrush by holding its bristles [ figure 3 ] . the endoscope was kept inside to insufflate and distend the stomach and a minilaparotomy with gastrotomy of 1.5 - 2 cm was performed through the midline under local anesthesia and the toothbrush was successfully removed . x - ray of the abdomen suggesting the presence of the toothbrush in the abdomen computed tomography ( ct ) scan of the abdomen showing the presence of the toothbrush in the tomach endoscopic picture of toothbrush with biopsy forceps in situ to retrieve it from the stomach", "in the stomach , 80 - 90% of foreign bodies pass uneventfully through the gastrointestinal tract without complications . however , objects longer than 10 cm like a toothbrush can not negotiate the duodenal c - loop due to its fixed position in the retroperitoneum , and these must be removed as soon as possible to avoid pressure necrosis and gastric perforation . more than 40 cases of toothbrush ingestion have been reported in the literature till date . however , extreme caution and experience of the endoscopist is required for such procedures . in failed cases of endoscopic removal , however , we devised a simple technique of minilaparotomy and gastrotomy under local anesthesia for removing such foreign bodies . in this technique , the stomach is distended with the help of air insufflation through the endoscope and a small incision is made in the midepigasrium under local anesthesia and the foreign object can be removed directly under the vision of the endoscope .", "a swallowed toothbrush is a rare occurrence and it never passes through the gastrointestinal tract spontaneously . early removal of the toothbrush is critical for reducing morbidity and mortality . in cases where endoscopic removal fails , endoscopy still remains an aid in performing surgical gastrotomy for delivering such complex foreign bodies under local anesthesia ." ]

[ "in a contemporary health - care environment characterized by rapidly changing developments and relentlessly increasing knowledge , professional nurses need to develop critical thinking ( ct ) skills that will provide them with expertise in flexible , individualized , situation - specific problem - solving . ct has been defined as a nonlinear and cycled process that allows people to make decisions on what to believe and what to do within a given context . according to kostovich et al . , the ability to think critically is an essential attribute for today 's nurses , and the development of this skill in nursing students requires multiple approaches and techniques . use of the nursing process is an essential element to cultivate ct and judgment skills in nursing students . the nursing process is a nonlinear , dynamic activity , which focuses on the multifaceted aspects of a patient , their family , and the environment . nurses and nursing students must develop and write nursing care plans to provide and organize nursing interventions based upon identified patients needs . however , some researchers have reported that the current linear nursing care plan format does not meet the educational needs of students to develop ct skills and visualize the interconnectedness of patient clinical data . in addition , nurse educators feel that the nursing care plans developed by students are not case sensitive and need in - depth comprehension of each client 's physical , psychological , social , and spiritual health . in the authors program , the traditional linear format nursing care plan used in the first five semesters was found not to meet the needs of sixth - semester nursing students . these students need to be able to quickly conceptualize the plan of care in a functional format as they graduate and enter the practice arena , where they will be expected to care for multiple patients simultaneously and to rapidly use the nursing process to develop a nursing plan of care based upon priority needs of these patients . concept map development is an alternative to using care plans as a method to document a plan of care based on evidenced - based practices . , learners assimilate new concepts into their existing cognitive structure . when new concepts are integrated by identifying relationships with concepts already possessed , learning becomes meaningful . hence , concept maps provide a format to visualize physiological , pathological , and psychological relationships and interactions in a concrete fashion . visualization of patient care priorities through a holistic view of the patient can be achieved through concept mapping . in addition , the minimal use of text or words makes it easy to scan for a word , phrase , or the general idea that is being explored . some studies have explored the short - term effects of concept map teaching on students ct and found positive effects in clinical or classroom teaching . concept mapping has also been described in an online course on distance education to adults in nursing to assess thinking processes of the students where it was found that they helped the students to self - assess their own thinking processes , thus facilitating reflective practice . it has also identified by gerdeman et al . to improve clinical judgment skills in nursing students . however , contrary to previous positive results , some other studies reported contradictory results , for example in a quasi - experimental study , wheeler and collins found that the experimental group scored significantly higher on the overall analysis and evaluation scores in the pre and posttest comparisons , but no significant differences between the groups were found . yeh and chen also found no significant differences of ct scores between their experimental and control groups , and one longitudinal study on concept mapping , conducted in a united states medical school with 1 year medical students , found no significant differences between ct scores in the pre- and post - tests . possible explanations for the findings of these studies may stem from several factors , such as measurement error , instrumentation , the curriculum and various definition of ct adopted by the studies . on the other hand , some studies indicate that ct skill of nursing students in different countries had been different . in iran , it can be stated that although ct is important in clinical judgments and decisions but during the training period , have had no significant development therefore the traditional education system needs evolution and revision in order to realize training purposes in line with fostering creative and efficient students . with regard to the need for finding best way to promote nursing students ct and the limited evidence of comparing concept mapping with traditional nursing care plan in clinical setting , this study was performed to compare the effect of concept mapping with traditional nursing care plan on nursing students ct in clinical pediatric course .", "a before - after experimental design with the control group was used to compare the effect of concept mapping and traditional linear nursing care planning on baccalaureate nursing student 's ct skills at shahrekord university of medical sciences in shahrekord , iran . all 60 students from the nursing faculty of the shahrekord university of medical sciences , shahrekord , iran , who had enrolled in pediatric nursing clinical course , and in sixth - semester of their study in the year 2011 , were invited to participate in this study . students were randomly divided into six equal groups of 10 students ; three groups as the control group and the other three groups as an experimental group . to prevent contact between the control and experimental groups , they take the pediatric clinical course in sequential time order . during the course , students cared for patients from an assigned pediatric setting . because students were not able to have prior contact with their patients , they began developing their nursing care plans on the 1 day of their clinical experience . they were asked to create a nursing care plan for a child they were caring for , which required gathering information on complete patient histories , relevant medications , treatments and medical diagnoses . on the 2 day of clinical experience , clinical instructor who has the experience of concept mapping development taught the students in the experimental group how to create concept maps . the students were informed in advance that a concept map should display each nursing diagnosis and more importantly , its relationship to the patient 's data , pathophysiology of the disease and interventions in a holistic view . students were required to analyze assessment data and identify nursing diagnoses , relevant pathophysiology and interventions related to those diagnoses . they used diagrams , color , and shapes to code the parts of the nursing process . they also had 5 days after the clinical experience to reflect on and evaluate the effectiveness of their nursing care before the concept maps were due . each student in the experimental group created nine concept maps during the course . during clinical group discussions this activity provided all students with the opportunity to think out aloud about the accuracy and completeness of the nursing diagnoses , goals , nursing interventions and relationship depicted on their concept maps . a sample concept map demonstrated by student students in the control group received traditional clinical teaching to create linear nursing care plans on a blank sheet . the students were asked to read and analyze the patient profile data , formulate initial problems , prioritize nursing diagnoses and identify the relationship between nursing diagnoses , then develop and implement interventions to solve the problems , and to evaluate the effectiveness of their nursing care . linear care plans were in text format without using any shapes , propositions or arrow to illustrate the interconnectedness between the data , nursing diagnosis and interventions . they also had the opportunity to discuss their care plans in group discussion with guidance provided by the teacher . nobody in the control group asked about concept mapping showing that control groups did not contaminate with the intervention by experimental groups . a well - known , validated and reliable tool was selected for this study . ct skills were measured using the california critical thinking skill test ( cctst ) with subscales of analysis ( 9 items ) , evaluation ( 14 items ) , inference ( 11 items ) , and two types of reasoning ( deductive reasoning and inductive reasoning included 16 and 14 items respectively ) . we selected this scale because it was tested for reliability and validity in iranian nursing students . khalili and hossein zadeh reported that this scale in comparison with the other measuring tools of ct is more comprehensive . the reliability coefficient of subscales after factor analysis in their study was in the range of 62 - 67% . ( l4 items ) note that a kr-20 range of 0.650.75 for this type of instrument is acceptable . this instrument contains 34 items in multiple - choice format , 19 four - option multiple - choice items and 15 five - option multiple - choice items . the range of possible total scores was 034 , with each subscale having a possible score range of 012 . an overall score of < 11 indicated a lack of ct skills , a score of 1125 indicated average ct skills , and a score above 25 indicated strong ct skills . for a given ct skill , a subscale score of 4 or less indicated weakness , whereas a subscale score of 7 or above indicated strength . data were collected before and after the program in a clinical setting at the beginning and end of clinical education . agreement to use and evaluate concept mapping as a teaching strategy in clinical courses was obtained from the nursing department of shahrekord university of medical sciences , shahrekord , iran . information about the study was given to every participant to assure the protection of human rights by the clinical teacher . participants in the experimental group were informed that they would be free to change to the traditional teaching strategy at any time without effects on their course evaluation . to ensure students in the control group were not disadvantaged , after completing the study , they were taught concept mapping during a 1-day workshop . chicago , il , usa ) software . in all analyses , p - 0.05 was considered as statistically significant . we used independent and paired t - tests to compare mean scores between the experimental and control groups at pre- and post - tests .", "a before - after experimental design with the control group was used to compare the effect of concept mapping and traditional linear nursing care planning on baccalaureate nursing student 's ct skills at shahrekord university of medical sciences in shahrekord , iran .", "all 60 students from the nursing faculty of the shahrekord university of medical sciences , shahrekord , iran , who had enrolled in pediatric nursing clinical course , and in sixth - semester of their study in the year 2011 , were invited to participate in this study . students were randomly divided into six equal groups of 10 students ; three groups as the control group and the other three groups as an experimental group . to prevent contact between the control and experimental groups , they take the pediatric clinical course in sequential time order . during the course , students cared for patients from an assigned pediatric setting . because students were not able to have prior contact with their patients , they began developing their nursing care plans on the 1 day of their clinical experience . they were asked to create a nursing care plan for a child they were caring for , which required gathering information on complete patient histories , relevant medications , treatments and medical diagnoses .", "on the 2 day of clinical experience , clinical instructor who has the experience of concept mapping development taught the students in the experimental group how to create concept maps . the students were informed in advance that a concept map should display each nursing diagnosis and more importantly , its relationship to the patient 's data , pathophysiology of the disease and interventions in a holistic view . students were required to analyze assessment data and identify nursing diagnoses , relevant pathophysiology and interventions related to those diagnoses . they used diagrams , color , and shapes to code the parts of the nursing process . they also had 5 days after the clinical experience to reflect on and evaluate the effectiveness of their nursing care before the concept maps were due . each student in the experimental group created nine concept maps during the course . during clinical group discussions this activity provided all students with the opportunity to think out aloud about the accuracy and completeness of the nursing diagnoses , goals , nursing interventions and relationship depicted on their concept maps . a sample concept map demonstrated by student students in the control group received traditional clinical teaching to create linear nursing care plans on a blank sheet . the students were asked to read and analyze the patient profile data , formulate initial problems , prioritize nursing diagnoses and identify the relationship between nursing diagnoses , then develop and implement interventions to solve the problems , and to evaluate the effectiveness of their nursing care . linear care plans were in text format without using any shapes , propositions or arrow to illustrate the interconnectedness between the data , nursing diagnosis and interventions . they also had the opportunity to discuss their care plans in group discussion with guidance provided by the teacher . nobody in the control group asked about concept mapping showing that control groups did not contaminate with the intervention by experimental groups .", "ct skills were measured using the california critical thinking skill test ( cctst ) with subscales of analysis ( 9 items ) , evaluation ( 14 items ) , inference ( 11 items ) , and two types of reasoning ( deductive reasoning and inductive reasoning included 16 and 14 items respectively ) . we selected this scale because it was tested for reliability and validity in iranian nursing students . khalili and hossein zadeh reported that this scale in comparison with the other measuring tools of ct is more comprehensive . the reliability coefficient of subscales after factor analysis in their study was in the range of 62 - 67% . ( l4 items ) note that a kr-20 range of 0.650.75 for this type of instrument is acceptable . this instrument contains 34 items in multiple - choice format , 19 four - option multiple - choice items and 15 five - option multiple - choice items . the range of possible total scores was 034 , with each subscale having a possible score range of 012 . an overall score of < 11 indicated a lack of ct skills , a score of 1125 indicated average ct skills , and a score above 25 indicated strong ct skills . for a given ct skill , a subscale score of 4 or less indicated weakness , whereas a subscale score of 7 or above indicated strength . data were collected before and after the program in a clinical setting at the beginning and end of clinical education .", "agreement to use and evaluate concept mapping as a teaching strategy in clinical courses was obtained from the nursing department of shahrekord university of medical sciences , shahrekord , iran . information about the study was given to every participant to assure the protection of human rights by the clinical teacher . participants in the experimental group were informed that they would be free to change to the traditional teaching strategy at any time without effects on their course evaluation . to ensure students in the control group were not disadvantaged , after completing the study , they were taught concept mapping during a 1-day workshop .", "data analysis was performed using statistical package for the social sciences ( spssinc . , chicago , il , usa ) software . in all analyses , p - 0.05 we used independent and paired t - tests to compare mean scores between the experimental and control groups at pre- and post - tests .", "almost all students were 21 years old except one who was 22 years old ( range : 2122 ) . the statistical analysis showed that two groups did not appreciably differ in age or sex . there was no significant difference between the groups overall , and in all subscales before the program [ table 1 ] . paired t - test showed significant improvement in overall and all subscales of cctst from pretest to posttest in both groups ( p < 0.001 ) [ tables 2 and 3 ] but t - test demonstrates that improvement in students ct skills in the experimental group was significantly greater than that in the control group after the program ( p < 0.001 ) [ table 4 ] . student 's ct skills on the pretest comparison of overall and subscales of cctst - a in the experimental group comparison of overall and subscales of cctst - a in the control group student s ct skills on the posttest", "this study was developed to examine whether concept mapping helped students develop better ct skills than the traditional method in an undergraduate pediatric clinical course . in the current study , it was found that either concept map or traditional linear nursing care plan could promote ct skills in nursing students from lacking to an average ct standard . however , similar to findings of other prior studies which observed improvements to nurses ct abilities following a concept mapping teaching strategy , the present study provided evidence to indicate that the effects of concept mapping were greater than those of traditional linear nursing care plans , with greater improvements to students overall and all subscales of ct skills as indicated by cctst scores . considering that the test of ct is based on the problem - solving process and the nursing process in the defined problem - solving stages , the use of which could improve ct skills . the ct skills overall describe overall strength in using reasoning to form reflective judgments about what to believe or what to do and includes core reasoning skills such as analysis , inference , evaluation , induction , and deduction . analytical reasoning skills enable people to identify the elements of a situation and determine how these parts interact . in the nursing process , students identify bio - psycho - social aspects of patients health and determine how these parts interact . in our study , students tried to understand the relationship between patient data , nursing process , interactions and connections between sign and symptoms , diagnostic data and medications as they developed traditional care plans or concept maps . although both care plans and concept maps could reinforce the students analytical reasoning skills , concept mapping had a greater effect . according to cook et al . , the linear format of the nursing care plan is based upon the nursing process that does not always allow for a holistic picture of patient needs and does not allow for visualization of the interrelatedness of patient data . in contrast , concept maps provide a format to visualize physiological , pathophysiological and psychological relationships and interactions in a concrete fashion , which is more effective to support quality analysis . schuster also suggested that visualization of patient care priorities through a holistic view of the patient can be achieved through concept mapping . nirmala and shakuntala also supported that the cross - links in concept maps are useful for correlating patients diagnoses , symptoms , treatment and interventions and then to thinking critically in clinical decision - making . according to facione et al . inductive reasoning helps in isolating the cause of an ailment or arriving at a theory to explain the relationship between symptoms . evaluative reasoning skills enable students to assess the credibility of resources of information and the claims they make . in our study , after the 5 weeks program , the concept mapping participants demonstrated greater ct abilities to assess the credibility of , and relationships between statements and to provide reasoning according to evidence and using deduction , comprehend , express and clarify meaning and to perform inductive reasoning tasks . similar to some previous studies ( yeh and chen ) , our study found that the experimental group had significantly higher scores of inference and deduction than those of the control group in the posttest . when constructing concept maps , students need to draw logical conclusions from factual knowledge or promises known through a process of inference such as identifying the major concepts , determining the relationship between concepts and making propositions using cross - links before coming to conclusions . in summary , converting to a concept map format allow for visualization of all aspects of patient clinical data , physical assessment , disease process and the relationship between this information , facilitating ct in nursing students in a clinical area . previous researches on the ct of nursing students in iranian faculties showed that learning in the educational system takes place at the initial cognitive levels , and higher levels such as analysis or synthesis and evaluation are less addressed . in fact , less attention is paid to the growth of the ct power according to kermansaravi et al . there are main and serious obstacles in the development of ct , one of which is the predominant use of traditional teaching methods in the current education system which is preventing from the development of decision making and troubleshooting ( or problem - solving ) skills in the learners and as a result limits the opportunities for students ct . considering that the test of ct is based on the problem - solving process and the nursing process is the defined problem - solving stages , the use of which is one - way emphasized in nursing education programs to the growth of ct . our study suggested that preparing nursing care using the concept map is more effective in promoting ct in nursing students than traditional linear nursing care plans . as with all studies with small samples , generalization of findings must be made cautiously . however , this study adds to the growing body of knowledge that suggests concept mapping improves students abilities to see patterns and relationships . although this study identified some short - term effects of the concept mapping program , its long - term effects remain unknown . the sample set came from only one university in iran limiting the feasibility of generalization of results to other universities and countries . future investigations should include multisite evaluations in a range of geographic locales with larger sample sizes .", "as with all studies with small samples , generalization of findings must be made cautiously . however , this study adds to the growing body of knowledge that suggests concept mapping improves students abilities to see patterns and relationships . although this study identified some short - term effects of the concept mapping program , its long - term effects remain unknown . the sample set came from only one university in iran limiting the feasibility of generalization of results to other universities and countries . future investigations should include multisite evaluations in a range of geographic locales with larger sample sizes .", "when presented with complex health - care situations and the need to process vast amounts of information , clinical nurses must be in ownership of ct skills in order to make appropriate professional judgments and clinical decision making . results from the present study support the application of concept mapping as a clinical teaching strategy to promote the development of ct skills . concept mapping , in comparison with the traditional linear nursing care plan , resulted in greater improvements in all ct skills . however , the 5 weeks program demonstrated only short - term effects , therefore , further longitudinal studies are suggested .", "", "" ]

[ "these include the \n intrinsic flexor pollicis brevis , flexor pollicis longus , lumbricalis , flexor brevis , and \n flexor longus muscles1 . toe - gripping \n strength is measured in the sitting position with the trunk vertical , the hip and knee \n joints at 90 , and the ankle joint in the neutral position1,2,3 . low toe - gripping strength is a risk factor of falls for the \n elderly , and several studies have reported that toe - gripping strength is lower in subjects \n with a history of falls than in those with no history of falls1,2,3,4 . furthermore , toe - gripping \n strength can be increased by training5 , \n which can decrease the risk of falls1 . \n souma et al.6 studied the % iemg of \n several crural muscles ( the soleus muscle , medial head of the gastrocnemius muscle , and \n tibialis anterior ) during toe - gripping in 3 different ankle joint positions10 of plantar \n flexion and 0 and 10 of dorsiflexion and reported that the crural muscles help the ankle \n joint by co - contracting during toe - gripping . in another study , nakae et al.7 calculated the % iemg of the same muscles \n during toe - gripping with subjects seated on the edge of a seat or standing , and reported \n that the % iemg of the medial gastrocnemius muscle was significantly lower when subjects were \n seated than when they were standing . however , as both studies focused on the activity of the \n crural muscles , the activity of the femoral muscles during toe - gripping remains unclear . we \n believe it is important to elucidate the contribution of femoral muscles to toe - gripping \n strength . in the present study , we investigated femoral muscle activity during toe - gripping to \n examine the role of the femoral muscles in toe - gripping strength .", "their \n average ( mean sd ) age , height , and body weight were 20.6 1.0 years , 159.4 6.3 cm , and \n 51.8 5.8 kg , respectively . this study was approved by the ethics committee for human \n research of tohoku fukushi university , and written informed consent was received from all of \n the subjects after the purpose of the study had been explained to them . toe - gripping strength of the dominant toe and emg activity of the ipsilateral thigh were \n synchronously recorded to assess the activity of the rectus femoris and biceps femoris \n muscles . toe - gripping strength was measured using a toe - gripping dynamometer ( t.k.k.3360 ; \n takei co , ltd , niigata , japan ) . as described by uritani8 , the subjects were instructed to sit with their trunk in the \n vertical position , hip and knee joints at 90 , and ankle joints in the neutral position . after a sufficient \n number of training trials and adequate rest , toe - gripping strength was measured twice and \n the maximal force was used in the analysis . for all subjects , the right toe was dominant \n ( defined as the toe used to kick a ball ) . to measure the maximum voluntary contraction ( mvc ) activity of the rectus femoris muscles , \n as described by kai9 , each subject was \n instructed to sit on a chair with the hip and knee joints at 90 , and to exert maximal \n isometric force of knee extension while resisting an opposing force applied by the examiner . \n the emg was recorded for 3 seconds while each subject exerted maximal force of knee \n extension . to measure the mvc of the biceps femoris muscle , each subject was instructed to \n generate maximal isometric force of knee flexion while resisting an opposing force applied \n by the examiner . the emg was recorded for 3 seconds while each subject exerted maximal force \n of knee flexion . after confirmation of adequate skin preparation ( skin resistance of less \n than 5 k ) , three bipolar lead electrodes ( de-2.1 , delsys , inc . , boston , usa ) were attached \n to the skin over the rectus femoris and the long head of the biceps femoris , as described by \n peroto10 . for measurement of the rectus \n femoris muscle , the electrode was attached at the midpoint between the superior edge of the \n patella and the anterior superior iliac spine . for measurement of the long head of the \n biceps femoris , the electrode was attached at the midpoint between the head of the fibula \n and ischial tuberosity . the emg signal was collected using ml846 power lab 4/26 ( sample : 1,000 hz ; ad instruments \n co. , ltd . ) and transferred to a personal computer . the bandwidth was 20500 hz . the emg \n signal segment selected and integrated ( integrated electromyogram : iemg ) for analysis was \n the middle 1 s of the entire 3-s duration of continuous maximal toe - gripping strength . the iemg was analyzed using lab chart pro v7.3.5 ( ad instruments co. , ltd . ) and normalized \n to the iemg of each muscle s mvc . repeated mann - whitney u tests were used to compare the % iemg of the \n rectus and biceps femoris muscles . relationships between the % iemg of the rectus and biceps \n femoris muscles were statistically analyzed using spearman s correlation coefficient .", "the average ( mean sd ) toe - gripping strength was 20.9 3.6 kg . the average ( mean sd ) \n % iemg values of the rectus and biceps femoris muscles were 7.0% 6.2% and 25.6% 15.9% , \n respectively . the % iemg of the biceps femoris was significantly higher than that of the \n rectus femoris ( p < 0.01 , table 1table 1.comparison of the % iemg values of the rectus femoris and biceps femoris muscles \n during toe - gripping actionrectus femorisbiceps femorismedian ( range : min max)median ( range : min max)%iemg4.8 * ( 1.521.1)27.2 ( 3.068.1)mann - whitney u test * : p < 0.05 ) . mann - whitney u test * : p < 0.05 using spearman s correlation coefficient analysis , a significant positive correlation was \n found between the % iemg of the rectus femoris and that of the biceps femoris ( r = 0.548 , p \n", "in the present study , we found that the % iemg of the biceps femoris was significantly \n higher than that of the rectus femoris . moreover , a significant positive correlation was \n found between the % iemg of these two muscles . these results suggest that femoral muscles \n co - contract during toe - gripping action , and thus possibly contribute to knee joint \n stability . we found that toe - gripping action stimulates femoral muscle activity and that the % iemg of \n the biceps femoris was significantly higher than that of the rectus femoris . sato et \n al.11 reported that during \n toe - gripping , the tibialis anterior and soleus muscles are activated first , followed by the \n gradual activation of the medial head of the gastrocnemius muscle . the biceps femoris \n initiates knee flexion , and the medial head of the gastrocnemius is a synergist for knee \n flexion . additionally , active tension of the biceps femoris decreases during toe - gripping in \n knee flexion . this may be because the length of the biceps femoris is shorter during active \n tension than during resting tension . we think that the activation of the biceps femoris \n during toe - gripping was caused by increasing motor unit recruitment and synchronization of \n the impulse to compensate for decreasing activity of the biceps femoris . in the present study , we found a significant positive correlation between the % iemg of the \n rectus femoris and that of the biceps femoris . this suggests that the % iemg of the rectus \n femoris increases with increases in the % iemg of the biceps femoris . toe - gripping strength was measured using a closed kinetic chain movement , and therefore , \n the likelihood of movement in the directions of flexion or extension of the knee joint is \n less . however , because the gastrocnemius also acts on knee joint flexion during exertion of \n toe - gripping strength , the knee joint is readily displaced in the direction of flexion . to \n prevent this , it is thought that the knee joint is immobilized by contraction of the rectus \n femoris , that is , we think the rectus femoris during exertion of toe - gripping strength acts \n in order to control the action of knee joint flexion by the gastrocnemius . first , we were unable to avoid the common problems that \n negatively affect surface emg recording , such as skin resistance , artifacts , and the effects \n of proximal muscles . second , as only healthy young women participated in this study , it is \n difficult to extend our findings to the general population . in future studies , we need to \n consider this aspect , and involve healthy young men and individuals of different age \n groups ." ]

[ "the majority of our likes and dislikes we acquire throughout the lifespan are the product of learning . one of the most important ways through which stimuli acquire affective meaning is the change of valence that results from pairing one stimulus ( cs ) with a positive or negative affective stimulus ( ucs ) . as a result this effect is called ( associative ) evaluative conditioning and has been demonstrated in humans with a large variety of procedures and stimuli ( e.g. , [ 24 ] ; for a meta - analysis see ) . in dementia severely impaired explicit memory nonetheless , patients with dementia might still be able to implicitly learn affective reactions through the process of evaluative conditioning . however , to the best of our knowledge , no study applied this approach in dementia patients . another classical paradigm that has already been used to investigate conditioning of affective reactions in this population is fear conditioning . indeed , two studies indicate that fear conditioning is impaired in dementia patients [ 6 , 7 ] . even though fear conditioning is impaired , evaluative conditioning might still be possible in dementia patients . some researchers have argued that while on a procedural level evaluative conditioning is similar to fear conditioning , the underlying processes might be different . it was hypothesized that fear conditioning is an instance of signal learning ; it is learned that the ucs is going to appear after the presentation of the cs . evaluative conditioning , on the other hand , only involves a reference to the ucs without expectation of its occurrence . thus , explicit knowledge about the cs - ucs relation seems crucial in fear conditioning while evaluative conditioning can be demonstrated in the absence of contingency awareness [ 1012 ] . since there could be variables that play a different role in these forms of learning ; dementia patients might show intact evaluative conditioning despite impaired fear conditioning . indeed , some studies indicate that dementia patients might retain the capacity to acquire affective reactions [ 13 , 14 ] . blessing et al . demonstrated that dementia patients ' affective reactions can be influenced by pairing faces with fictional biographical content that characterized the depicted persons in terms of either positive or negative traits . pictures were rated before and at two different time points after the presentation of fictional biographical content with respect to valence and arousal . patients changed their ratings of pictures according to the biographical information presented , but did not recognize pictures above chance level or recall biographical information . these findings were replicated and extended in a subsequent study . the paradigm used by blessing et al . [ however , there are two main differences : ( 1 ) in standard evaluative conditioning paradigms the subjects are not explicitly informed about the interrelation between stimuli in the learning phase . in the paradigm used by blessing et al . [ 13 , 14 ] the paring of the cs and ucs is made explicit and thus , the procedure can not be described as a simple cooccurrence of stimuli ; ( 2 ) in contrast to the approach of blessing et al . [ 13 , 14 ] the ucs and cs in evaluative conditioning paradigms belong to the same type of stimuli ( e.g. , faces ) . hence , in the present study we addressed the question if affective evaluations of dementia patients can be manipulated using a standard evaluative conditioning paradigm .", "\n participants . demographical data and clinical characteristics of both groups are listed in table 1 . the study included 15 dementia patients ( diagnosed as alzheimer 's disease ( n = 10 ) or mixed dementia ( n = 5 ) ) . patients were outpatients in the memory clinic of the psychiatric clinic of muensterlingen at the time of testing . all patients were diagnosed by a multidisciplinary team of the hospital ward using icd 10 criteria . all patients had received medical attendance including magnetic resonance imaging and specific screening blood tests , in order to exclude syphilis , diabetes , thyroid disorders , and vitamin b12 and folic acid deficiency . they reported that they had no known cns diseases , contact with toxic substances , or substance abuse . test stimuli were 10 pictures of neutral ( i.e. , displaying no facial expression of emotion ) unfamiliar faces ( 6 female : 3 young , 3 old ; 4 male : 2 young , 2 old ) and one picture of a happy young , female adult as well as one picture of a happy old , male adult selected from the productive aging laboratory face database . however , based on affective valence ratings of these pictures in other studies ( dann hier referenz ) , some of the included faces were also rated as positive or negative . the happy faces were added to increase the variance in subjective liking between pictures . \n emotional ratings . the sam was designed to assess subjective ratings of participants ' emotional responses and minimize the influence of language and culture on ratings . the sam valence rating scale has been successfully used in previous studies with dementia patients [ 13 , 14 ] . using the paper - pencil version of this instrument , participants rated the stimuli as to their emotional valence ( range : 19 ) . similar to other studies investigating evaluative conditioning we used a cover story in order to minimize demand effects . participants were told that the aim of the experiment was to examine the relationship between mood and subjective affective evaluation . in line with this cover story participants rated their mood on a five - point likert scale ( very good / good / normal / bad / very bad ) . subsequently , the pictures were presented to participants one after the other and rated with respect to valence using the sam rating scale . pictures were presented in four different pseudorandom sequences . after the valence rating an individual , unequivocal preference order of all stimuli was established . the pictures that received identical valence ratings were again presented to participants who then had to decide which of the pictures they preferred and the respective picture was put aside . again , the participants had to choose which of the remaining pictures with identical valence ratings they preferred and so on . the most preferred stimulus out of the 12 faces was used as the liked ( l ) stimulus and the stimulus with the lowest ranking was used as the disliked ( d ) stimulus . the four stimuli ranked 5th , 6th , 7th , and 8th were used as neutral ( n ) stimuli . the experimenter entered these six individual l , d , and n stimuli in a computer program ( presentations 11.3 ) that automatically formed three stimuli pairs ( i.e. , neutral - liked , neutral - disliked , and neutral - neutral ) by randomly assigning the neutral stimuli . participants were then seated about 50 cm from the computer screen and instructed to look at the pictures that would appear on the screen . each picture from the different pairs ( i.e. , ( n - l ) , ( n - d ) or ( n - n ) ) was presented 10 times in the center of the computer screen . the duration of each stimulus presentation was 1 second and the interstimulus interval ( isi ; i.e. , onset of the first stimulus of a pair to onset of the second stimulus of a pair ) was 4 seconds . the inter - trial interval ( iti ; i.e. , onset of the first stimulus of the previous trial to onset of the first stimulus of the next trial ) was 13 seconds . after the presentation of stimuli on the computer screen , participants were again asked to rate the n , d , and l stimuli on the sam valence rating scale . the three relevant n stimuli ( i.e. , the first stimulus of each pair ) were placed one after the other in front of participants together with the three stimuli second in the pairs ( l , d , n ) . participants were asked to indicate which of these three stimuli followed the currently presented n stimulus . the experimenter registered the answer on a response sheet . a repeated measures analyses of variance ( anovas ) was conducted for the valence ratings of the relevant n stimuli ( i.e. , the first stimulus of each pair ) . a separate analysis was performed for ratings of stimuli paired with l and d pictures . type of stimulus pair and measurement point ( i.e. , valence rating pre and post presentation ) were used as within - participant factors and group was included as between subject factor . in the case of significant group differences a separate analysis was performed for both groups .", "the repeated measures anova revealed no main effect of type of stimulus pair ( f(2,26 ) = 2.42 ; p > .109 ) but an interaction between type of stimulus pair and time ( f(2,26 ) = 7.354 ; p > .003 ; see table 2 ) . this interaction was due to the fact that there was no influence of the type of stimulus pair at baseline ( f(2,27 ) = 0.296 ; p > .746 ) , but a significant effect after conditioning in the direction of the experimental manipulation ( f(2,27 ) = 5.460 ; p < .010 ) . no interaction between type of stimulus pair and group ( f(2,26 ) = 3.023 ; p > .066 ) or stimulus pair , time , and group ( f(2,26 ) = 2.798 ; p > .079 ) appeared . anova indicated no main effect of time ( f(1,27 ) = 0.78 ; p > .385 ) . as expected , we found a grater rating change over time for stimuli paired with l and d pictures than stimuli paired with n pictures ( see table 2 ) . we conducted a separate analysis using only pictures paired with l and d pictures to further investigate the influence of the experimental manipulation . the repeated measures anova revealed a main effect of type of stimulus pair ( f(1,27 ) = 4962 ; p > .034 ) along with an interaction between type of stimulus pair and time ( f(1,26 ) = 15.237 ; p > .001 ; see table 2 ) . we found no significant interaction between type of stimulus pair and group ( f(2,26 ) = 2.894 ; p > .10 ) but a significant interactions between stimulus pair , time , and group ( f(1,26 ) = 5.784 ; p < .023 ) . anova indicated no main effect of time ( f(1,27 ) = 0.296 ; p > .591 ) . because of the significant interaction between stimulus pair , time , and group , indicating group differences , we performed a separate analysis for each group . the repeated measures anova for valence ratings of pictures paired with l and d stimuli of dementia patients revealed a significant main effect of type of stimulus pair ( f(1,14 ) = 16.000 ; p > .001 ) along with an interaction between type of stimulus pair and time ( f(1,14 ) = 29.007 ; p > .001 ) . we found no main effect of time ( f(1,14 ) = 0.121 ; p > .733 ) . the repeated measures anova for ratings of controls indicated no main effect of type of stimulus pair ( f(1,13 ) = .087 ; p > .773 ) and no interaction between type of stimulus pair and time ( f(1,13 ) = .832 ; p > .378 ) . again , anova indicated no main effect of time ( f(1,13 ) = 0.188 ; p > .671 ) . in the group of dementia patients , 24.4% of the relevant n stimuli were assigned to the correct stimulus second in the pairs in the forced choice test , which did not differ from chance level ( i.e. , 33.3% ; p > .14 ) . in the control group , 31% relevant n stimuli were assigned to the correct stimulus second in the pairs in the forced choice test , which did not differ from chance level ( i.e. , 33.3% ; p > .37 ) .", "the main aim of the present study was to investigate if affective evaluations of dementia patients can specifically be influenced through a standard evaluative conditioning paradigm . as hypothesized , dementia patients changed their valence ratings of unfamiliar and previously neutral faces according to its pairing with either a liked or disliked face stimulus . generally , the neutral pictures that were paired with a liked stimulus were rated higher and the neutral picture that was paired with the disliked stimulus was rated lower on the valence dimension after our evaluative conditioning intervention by dementia patients . thus , results indicate that ratings of initially neutral stimuli can be influenced in the according direction through simple time - near presentation ( i.e. , pairing ) with both a liked as well as a disliked stimuli . it does not seem surprising that our forced choice recognition test indicated no contingency awareness as this is based on the functionality of explicit memory that is severely impaired in dementia patients . however , dementia patients significantly differed from controls in the effect of the experimental manipulation . the negative finding in the control group could indicate that our paradigm did not produce evaluative conditioning effects . consequently , the detected influence in the ad group could be accounted for by demand effects or other nonevaluative conditioning effects . another explanation could be that there was only a small effect in the control group that could not be detected due to small sample size . however , the sample size was only slightly smaller than that of the ad group . we looked at the data on the level of individual subjects and found that 11 of 14 subjects in the control group changed their ratings in the expected direction or showed no rating change . the negative result in the control group was due to two participants who showed a strong rating change in the opposite direction . post hoc analysis indicated a significant influence of the experimental manipulation in the control group after exclusion of these two outliers ( p < .028 ) . thus , it seems possible that evaluative conditioning effects in the control group were masked by the influence of outliers in our small sample . the rating changes of outliers could have been motivated by reactance , as observed in other studies investigating evaluative conditioning . our result could also indicate that evaluative conditioning effects are stronger in dementia patients than in healthy elderly controls . a possible reason for stronger effects could be lower attentional resources in dementia patients due to disease - related cognitive impairments . some studies indicate that attentional resources have a negative impact on affective learning through evaluative conditioning ( e.g. [ 19 , 20 ] ) and accordingly it seems possible that dementia patients show stronger effects . however , there are conflicting findings concerning the influence of attentional resources on evaluative conditioning ( e.g. , ) . the observed positive change of the valence rating in the neutral stimulus that was paired with another neutral stimulus could be a result of the mere exposure effect . this effect describes the preference for stimuli that have been previously presented over novel stimuli . preference changes due to the mere exposure effect have also been demonstrated in dementia patients [ 2325 ] . in line with this explanation are findings from other studies investigating evaluative conditioning that report a similar trend of positive changes in evaluations of neutral pictures paired with other neutral pictures over time . the results suggest that dementia patients changed their ratings according to the experimental manipulation without contingency awareness , since pairings were not identified above chance level in the forced choice recognition test . in fact , participants of the control group performed better than dementia patients in the recognition test , yet their results did not differ from chance level as well . the results of dementia patients are in line with findings demonstrating evaluative conditioning in healthy participants using subliminally presented stimuli [ 2729 ] . could show that the individual amount of the evaluative conditioning effect is not related to the number of pairings ( i.e. , neutral stimulus - affective stimulus ) participants were aware of . on the other hand , findings of a recent meta analysis suggest that contingency awareness is an important moderator in evaluative conditioning . however , a critical limitation of the present study is our assessment of contingency awareness using a forced choice recognition test . following the recent discussion of gawronski and walther , it seems possible that we measured contingency memory rather than contingency awareness . subjects may have realised the respective pairings during conditioning but may not have been able to remember these pairings explicitly when the recognition test was applied . this may have been the case especially in dementia patients because of severe memory deficits . subjects may have remembered statistical probabilities that could not be assessed using a forced choice test . thus , it is also possible that contingency awareness differed between dementia patients and controls in our study and that contingency awareness influenced the results . to prohibit contingency awareness , very long time intervals on short isi could facilitate the detection of contingencies in the combinations of pictures and would enhance contingency awareness . however , this result has to be considered preliminary , since it is unclear what prevented rating changes in the expected direction in the control group in our paradigm . nevertheless , the results seem to be in contrast to previously reported impaired fear conditioning . as discussed above it is still unresolved whether evaluative conditioning is a form of pavlovian conditioning or if there are variables that are unique to evaluative conditioning . thus , the results of our study support the notion that different processes are involved in evaluative conditioning and fear conditioning . a relevant difference could be the dependence of pavlovian conditioning on contingency awareness in contrast to evaluative conditioning as discussed above . another reason for conflicting findings in fear conditioning versus evaluative conditioning studies could be the use of different dependent measures . fear conditioning studies primarily use skin conductance as a dependent measure , whereas evaluative conditioning studies rely on behavioural measures . this explanation is supported by recent findings from our lab revealing that changes of affective evaluations were not related to skin conductance responses but to heart rate response in dementia patients in a face - emotion association paradigm . accordingly , there might be a specific impairment in dementia patients with respect to skin conductance response . on a neurophysiological level , the underpinnings of evaluative conditioning are not well understood . some studies indicate that temporal regions and specifically the amygdala are involved in both fear conditioning [ 3235 ] and evaluative conditioning . however , there is also evidence suggesting that the functionality of the amygdaloid nuclear complex may not be crucial for the occurrence of evaluative conditioning . hence , preserved evaluative conditioning in dementia patients would be in line with findings demonstrating that despite of impaired fear conditioning evaluative conditioning is preserved in persons with unilateral damage to the amygdaloid nuclear complex . similarly , tranel and damasio report the case of a patient with bilateral damage to the entire medial lobe who could learn connections between unfamiliar persons and affective valence they displayed , despite severely impaired explicit memory . in summary , results of our study suggest that dementia patient ' affective evaluations of neutral stimuli can be changed through pairing with liked or disliked stimuli . however , caution is warranted since it is not unambiguous what caused these rating changes in our study . future research should focus on preserved learning processes in dementia patients since they are of great importance for nonpharmacological therapeutic interventions ." ]

[ "para - aortic and pelvic lymphadenectomy is often performed in the treatment of ovarian or testicular cancer . internal herniation of a small bowel behind the external iliac artery after lymphadenectomy is a very rare complication to this procedure and to our knowledge only reported twice in the literature . in the first paper published in 1978 the author described how they managed their patient with laparotomy and resection of a perforated small bowel . the hernia orifice was closed by using a free peritoneal graft harvested from the under surface of the anterior abdominal wall . this patient had to undergo several surgical procedures to re - establish blood flow to the extremity because of trombosis of the iliac artery . as there are few similar cases reported worldwide , there is no consensus or guidelines available . we did not close the orifice . because of the skeletonized vessel we were afraid of compromising the vessel if we tried to close the defect . at follow - up after 10 months", "a 56-year - old woman underwent in 2008 prophylactic bilateral laparoscopic salpingoophrectomy because of a mutation in brca1 gene . the histological result revealed a serous papillary adenocarcinoma in the right ovary and on its surface . therefore a restaging operation was performed . she underwent laparotomy with total abdominal hysterectomy , omentectomy , appendectomy , with a radical retroperitoneal lymphadenectomy which involved en bloc dissection and removal of the para - aortic and iliac lymphe nodes . there was no metastasis in the biopsies taken from the rectum wall and the laparoscopy trocar ports as well as the 46 harvested lymphe nodes . the patient did not receive any radiation therapy . in 2012 , 4 years later , she was admitted to hospital with a 2 days history of severe abdominal pain , vomiting and the inability to pass gas or stools for the last few days . the abdomen was distended , diffused tender and tympanitic , without guarding or rebound tenderness . her groin examination was normal without any sign of herniation through the femoral or inguinal canals . blood pressure 140/90 mmhg , pulse 71 beats / minute and a temperature of 37.9 c . our patient received 90 ml of iomeprol 350 mgl / ml i.v . and this was sufficient to see the vessels . the ct scan demonstrated transition zone both where the loop entered behind the external iliac vessel and where the intestine passed out behind the vessel as a closed loop . the small bowel was dilated both proximal to , as well as inside the closed loop ( figs . 2 and 3 ) . the patient received a prophylactic antibiotics composed of metronidazole 1.5 g and doxycycline 400 mg i.v . we established pneumoperitoneum with a pressure of 12 mmhg and inserted two other working ports of 12 mm and one of 5 mm . we examined the non dilated bowel from the ileocoecal junction , approximately 200 cm from the ilecoecal junction the small bowel made a closed loop underneath the left external iliac artery ( picture 1 ) . the small bowel was strangulated by the external iliac vessel . by gentle manipulation we reduced the herniated small bowel ( picture 2 ) that soon recovered . the blue color and venous congestion were fading out and we noticed peristaltic movement of the previously herniated bowel we therefore did not perform any bowel resection . the defect underneath the artery was about 23 cm ( picture 3 ) in diameter . we found it risky to try to close the orifice and decided to leave it unrepaired . we noticed pulsation on the iliac vessel after the small bowel reduction and we evaluated the pulsation of the dorsalis pedis artery and the posterior tibial artery during the operation . the abdomen was exsufflated and the fascia defects in the 12 mm ports were sutured and the skin closed with stapler . the patient was observed in the intensive care unit until the next morning , with focus on her leg pulse and color . dalteparin 5000 ie was given subcutaneously 6 h after surgery and continued for the first 24 h after surgery . the postoperative course was uneventful and she was discharged from hospital the day following operation .", "due to limited peritoneum in the area of the hernia defect and the skeletonized external iliac artery , we did not do any direct suture of the orifice as this might have compromised the artery and/or the vein . due to previous omentectomy , an alternative might have been to harvest a free peritoneum graft to cover the defect as described in the two other cases . another option was to use a mesh covered with an oxidized regenerated cellulose or expanded polytetrafluoroethylene ( eptfe ) that minimize bowel adhesions . a longer follow - up of the patient is needed to clearly conclude if this simple procedure has been sufficient . if the patient later experience any sign of recurrence and need another operation we will have to close the defect . a challenge would have been if the bowel could not be reduced due to long standing obstruction . in such a case a bowel resection and/or a vascular surgical procedure might have been necessary . the small bowel in ileus might be fragile , gangrenous or necrotic and there is probably a higher risk of bowel perforation performing a laparoscopic approach . we do not routinely use verres needle in laparoscopy , we prefer to use visiport as an optical trocar or an open hasson approach that is another safe alternative to minimize the chance of bowel perforation on entrance into the abdominal cavity .", "strangulated internal hernia behind the iliac vessel is a rare entity only reported twice in the literature . this is the first case in the literature where laparoscopically reduction of the internal herniated bowel underneath the iliac vessel is performed . a quick recovery with no complications , short hospital stay and minimal discomfort postoperatively made our approach an acceptable surgical option for this patient .", "", "", "written informed consent was obtained from the patient for publication of this case report and accompanying images . a copy of the written consent is available for review by the editor - in - chief of this journal on request ." ]

[ "tumor - associated cell cycle defects , manifesting in unscheduled proliferation , and the associated genomic and chromosomal instabilities are mediated by misregulation of cyclin - dependent kinases ( cdks ) . because of the main role in the division cycle , cdks have been recognized as targets for anticancer therapy . many small - molecule organic compounds , which have been identified as cdk modulators , are currently in preclinical or clinical development . however , no cdk inhibitors have gained marketing approval , despite 20 years of scientific investigation . several studies have shown synergism when cdk inhibitors were combined with organic ( e.g. , doxorubicin , paclitaxel ) and inorganic ( e.g. , cisplatin , carboplatin ) cytotoxic drugs . the first publications have appeared recently and include fe , cu , and pt complexes with cdk inhibitors derived from 6-benzylaminopurine , metal - based indolo-[3,2-d]benzazepines ( paullones ; ga , cu , ru , and os ) , and indolo-[3,2-c]quinolines ( ru , os ) . another class of compounds potentially suitable for targeted metal - based chemotherapy is that of 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines . these have been documented recently as potent cdk1 inhibitors with antiproliferative activity in hela ( cervical carcinoma ) , hct116 ( colon carcinoma ) , and a375 ( melanoma ) human cancer cell lines . comparison of cdk1 inhibitory activity with the inhibiting activity in four other protein kinases ( vegf - r2 , her2 , aurora - a , and ret ) revealed selectivity for cdk1 . structural modifications consisting of a replacement of both bicyclic rings in 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines by monocycles while retaining the imidazolyl pyrazole core have been proposed in order to obtain inhibitors with improved pharmacokinetic and solubility properties . the most promising were suggested to be 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines ( see chart 1 ) . the inspection of substitution patterns on the benzimidazole moiety and structure activity relationships revealed that a methoxymethyl group in position 7b ( 4b ) is favorable for cdk1 inhibiting potency . the role of the pyrazole nh group is also of note , since its methylation led to a significant reduction of cdk1 activity . the effect of various heteroaryl groups in position 5a was also remarkable for the development of more - effective cdk inhibitors and antiproliferative agents . our previous experience with metal - based indolo-[3,2-d]benzazepines prompted the use of the half - sandwich metal - arene moiety as a suitable scaffold to which 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines may be attached . organometallic compounds [ m(-arene)(yz)x ] ( where m = ru , os ) exhibit promising anticancer activity and are the focus of attention for several groups . these compounds have shown activity toward classic ( dna ) and nonclassic ( e.g. , cdks ) targets in anticancer chemotherapy . herein , we report ( i ) the modified synthetic approach to 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines ( recall chart 1 : l1 , x = h , y = h ; l2 , x = br ; y = h ; l3 , x = br ; y = ch2och3 ) ; ( ii ) the synthesis and characterization of a new family of organoruthenium(ii ) ( 11a , 12a , 13a ) and osmium(ii ) ( 11b , 12b , 13b ) complexes of the general formula [ mcl(-p - cymene)l]cl , where l = 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines ( l1l3 ) ( chart 1 ) ; ( iii ) stabilization of the 7b tautomer of methoxymethyl - substituted l3 by metal coordination as well as ( iv ) nmr spectroscopic characterization of two tautomers 7b - l3 and 4b-l3 in a metal - free state ; and ( v ) cell cycle effects , as well as the antiproliferative and cdk inhibitory activities of both metal - free ligands and organometallic complexes .", "1h - pyrazolo[3,4-b]pyridine-3-carboxylic acid ( 1 ) was obtained via the oxidation of 3-methyl-1h - pyrazolo[3,4-b]pyridine by kmno4 in the presence of a base , followed by acidification with 37% hcl . solvents [ toluene , ethanol ( etoh ) , tetrahydrofuran ( thf ) , diethyl ether ( et2o ) ] were dried using standard procedures . 3-methyl-1h - pyrazolo[3,4-b]pyridine ( 10.9 g , 0.08 mol ) and anhydrous sodium acetate ( 10.21 g , 0.13 mol ) were suspended in glacial acetic acid ( 42 ml ) . bromine ( 20.42 g , 0.13 mol ) was added , and the resulting mixture was stirred at room temperature for 22.5 h and then at 110115 c for 2.53 h. afterward , water ( 300350 ml ) was added and the mixture was stirred at room temperature . the formed light yellow precipitate was filtered off and dried in vacuo at 4050 c . yield : 17 g. the raw product was used without further purification in the next step . purification by column chromatography afforded a white powder ( sio2 , etoac , rf = 0.79 ; 12.5 g , 72.6% yield ) . esi - ms in meoh ( positive ) : m / z 213 [ m+h ] , 235 [ m+na ] , 253 [ m+k ] ; ( negative ) : m / z 211 [ m h ] . h nmr ( 500.32 mhz , meoh - d4 ) : 8.55 ( d , 1h , j = 2.16 hz , ch ) , 8.43 ( d , 1h , j = 2.15 hz , ch ) , 2.56 ( s , 3h , ch3 ) ppm . h nmr ( 500.32 mhz , dmso - d6 ) : 13.42 ( brs , 1h , nh ) , 8.54 ( d , 1h , j = 2.19 hz , ch ) , 8.53 ( d , 1h , j = 2.18 hz , ch ) , 2.49 ( s , 3h , ch3 ) ppm . colorless crystals of 20.5h2o suitable for x - ray diffraction ( xrd ) study were grown in etoac ( see figure s1 in the supporting information ) . to sodium hydroxide ( 9.54 g , 0.24 mol ) in water ( 150 ml ) was added the raw product 2 ( 7.1 g , 0.03 mol ) . after a dropwise addition of kmno4 ( 16.98 g , 0.11 mol ) in water ( 300 ml ) at 100 c over 2 h , the reaction mixture was further heated for 1 h. mno2 was filtered off from the hot reaction mixture and washed with hot water . 400 ml , and the yellow solution was acidified to ph 2 , using concentrated hcl . yield : 2.28 g. the crude hydrochloride of 3 was used without further purification in the next step . esi - ms in meoh ( positive ) : m / z 243 [ m+h ] , 265 [ m+na ] , 287 [ m+2na h ] ; ( negative ) : m / z 241 [ m h ] . h nmr ( 500.32 mhz , meoh - d4 ) : 8.69 ( d , 1h , j = 2.22 hz , ch ) , 8.68 ( d , 1h , j = 2.22 hz , ch ) ppm . h nmr ( 500.32 mhz , dmso - d6 ) : 14.65 ( s , 1h , nh ) , 13.45 ( brs , 1h , nh ) , 8.72 ( d , 1h , j = 2.23 hz , ch ) , 8.58 ( d , 1h , j = 2.25 hz , ch ) ppm . nah ( 1.75 g , 0.07 mol ) was suspended in dry thf ( 200 ml ) . a solution of 2-amino-3-nitrobenzyl alcohol ( 5.23 g , 0.03 mol ) in dry thf ( 100 ml ) was added dropwise at 0 c and the mixture was stirred at the same temperature for 15 min . after a dropwise addition of mei ( 11.5 g , 0.08 mol ) , stirring was continued at room temperature for 3 h. a saturated aqueous solution of nahco3 ( 300 ml ) and meoh ( 300 ml ) then were added . the organic phase was dried over na2so4 , filtered , and evaporated to yield a red oil ( 4.85 g ) . the raw product was purified by column chromatography ( sio2 , etoac , or etoac / hexane 1/1 , first fraction , a red - orange oil crystallized to form a red solid at 4 c ; yield : 3.68 g , 65% ) . h nmr ( 500.32 mhz , dmso - d6 ) : 8.00 ( d , 1h , j = 8.71 hz , c6h3 ) , 7.09 ( br , 2h , nh2 ) , 6.67 ( t , 1h , j = 8.45 hz , c6h3 ) , 4.48 ( s , 2h , ch2 ) , 3.31 ( s , 3h , ch3 ) ppm . a mixture of 4 ( 1.4 g , 0.008 mol ) and 10% pd / c ( 0.18 g ) in dry etoh ( 55 ml ) was stirred under hydrogen atmosphere at room temperature for 1824 h. the catalyst was removed by filtration through gf-3-filter under argon and washed with dry etoh ( 5070 ml ) . the filtrate was evaporated in vacuo to give a light - orange solid ( 1.17 g , 100% yield ) , which was used immediately in the next step . h nmr ( 500.32 mhz , dmso - d6 ) : 6.52 ( dd , 1h , j = 1.87 hz , j = 7.25 , c6h3 ) , 6.426.36 ( m , 2h , c6h3 ) , 4.48 ( br , 2h , nh2 ) , 4.31 ( br , 4h , nh2+ch2 ) , 3.24 ( s , 3h , ch3 ) ppm . n , n-carbonyldiimidazole ( cdi , 4.16 g , 0.026 mol ) was added in small portions to 1 ( 2.34 g ) in dry dmf ( 12 ml ) . the mixture was stirred at room temperature for 2024 h. water ( 5 ml ) then was added and the suspension was stirred until all co2 was ceased . the white precipitate was filtered off , washed with water ( 35 ml ) , and dried in a sublimator in vacuo at 60 c , to remove the imidazole as a contaminant . esi - ms in methanol ( positive ) : m / z 214 [ m+h ] , 237 [ m+na ] ; ( negative ) : m / z 212 [ m h ] . h nmr ( 500.32 mhz , dmso - d6 ) : 14.95 ( brs , 1h , nh ) , 8.91 ( s , 1h , chim ) , 8.74 ( dd , 1h , j = 1.61 hz , j = 4.51 hz , chpy ) , 8.63 ( dd , 1h , j = 1.59 hz , j = 8.12 hz , chpy ) , 8.14 ( t , 1h , j = 1.23 hz , chim ) , 7.51 ( dd , 1h , j = 4.46 hz , j = 8.06 hz , chpy ) , 7.20 ( s , 1h , chim ) ppm . n , n-carbonyldiimidazole ( cdi , 16.2 g , 0.1 mol ) was added in small portions to crude 3 ( 11.58 g ) in dry dmf ( 70 ml ) . the mixture was stirred at room temperature for 2024 h. water ( 10 ml ) then was added and the suspension was stirred until all co2 was ceased . the white precipitate was filtered off , washed with water ( 1015 ml ) , and dried in a sublimator in vacuo at 60 c , to remove the imidazole as a contaminant . esi - ms in methanol ( positive ) : m / z 315 [ m+na ] ; ( negative ) : m / z 291 [ m h ] . h nmr ( 500.32 mhz , dmso - d6 ) : 14.95 ( brs , 1h , nh ) , 8.89 ( s , 1h , chim ) , 8.83 ( d , 1h , j = 2.12 hz , chpy ) , 8.75 ( d , 1h , j = 2.07 hz , chpy ) , 8.13 ( s , 1h , chim ) , 7.20 ( s , 1h , chim ) ppm . the solution of 1,2-diaminobenzene ( 0.5 g , 4.67 mmol ) in dry dmf ( 2 ml ) was added to the suspension of 6 ( 0.94 g , 4.41 mmol ) in dry dmf ( 13 ml ) , and this reaction mixture was heated under argon at 85 c for 5 h. dmf then was evaporated in vacuo at 50 c and water ( 1012 ml ) was added . the light - yellow precipitate was filtered off and dried in vacuo at 50 c . yield : 0.86 g. the raw product was used without purification in the next step . esi - ms in methanol ( positive ) : m / z 255 [ m+h ] , 277 [ m+na ] ; ( negative ) : m / z 253 [ m h ] . h nmr ( 500.32 mhz , dmso - d6 ) : 14.30 ( brs , 1h , nhpz ) , 9.73 ( brs , 1h , conh ) , 8.64 ( dd , 1h , j = 1.59 hz , j = 4.44 hz , chpy ) , 8.56 ( dd , 1h , j = 1.53 hz , j = 8.02 hz , chpy ) , 7.397.36 ( m , 2h , chpy+chbz ) , 6.97 ( td , 1h , j = 1.31 hz , j = 7.73 hz , chbz ) , 6.82 ( dd , 1h , j = 1.2 hz , j = 7.89 hz , chbz ) , 6.64 ( td , 1h , j = 1.2 hz , j = 7.67 hz , chbz ) , 4.93 ( s , 2h , nh2 ) ppm . ( 10 ml ) was added to the suspension of 7 ( 2.28 g , 7.8 mmol ) in dry dmf ( 10 ml ) , and this mixture was heated under argon at 85 c for 7 h. dmf then was evaporated in vacuo at 50 c and water ( 20 ml ) was added . yield : 2.2 g. the raw product was used without purification in the next step . esi - ms in methanol ( positive ) : m / z 333 [ m+h ] , 355 [ m+na ] ; ( negative ) : m / z 331 [ m h ] . h nmr ( 500.32 mhz , dmso - d6 ) : 14.54 ( brs , 1h , nhpz ) , 9.80 ( brs , 1h , conh ) , 8.73 ( d , 1h , j = 2.26 hz , chpy ) , 8.69 ( d , 1h , j = 2.22 hz , chpy ) , 7.34 ( dd , 1h , j = 0.98 hz , j = 7.88 hz , chbz ) , 6.99 ( td , 1h , j = 1.43 hz , j = 8.03 hz , chbz ) , 6.82 ( dd , 1h , j = 1.22 hz , j = 7.96 hz , chbz ) , 6.64 ( td , 1h , j = 1.19 hz , j = 7.73 hz , chbz ) , 4.94 ( s , 2h , nh2 ) ppm . a mixture of 5 ( 1.17 g , 7.69 mmol ) and 7 ( 2.1 g , 7.2 mmol ) in dry dmf ( 45 ml ) was heated under argon at 85 c for 20 h. dmf then was evaporated in vacuo at 50 c and water ( 20 ml ) was added . yield : 2.3 g. the product was used without further purification in the next step . esi - ms in methanol ( positive ) : m / z 399 [ m+na ] ; ( negative ) : m / z 375 [ m h ] . h nmr ( 500.32 mhz , dmso - d6 ) : 14.54 ( brs , 1h , nhpz ) , 9.85 ( brs , 1h , conh ) , 8.73 ( d , 1h , j = 2.13 hz , chpy ) , 8.68 ( d , 1h , j = 2.05 hz , chpy ) , 7.29 ( d , 1h , j = 7.56 hz , chbz ) , 7.03 ( d , 1h , j = 7.29 hz , chbz ) , 6.65 ( t , 1h , j = 7.79 hz , chbz ) , 4.78 ( brs , 2h , nh2 ) , 4.42 ( s , 2h , ch2 ) , 3.29 ( s , 3h , ch3 ) ppm . the raw product 8 ( 0.86 g ) was heated in a glacial acetic acid ( 10 ml ) at 125 c for 2.5 h. the solvent was evaporated under reduced pressure and the residue was dried in vacuo at 50 c , then resuspended in ch2cl2/meoh ( 4/1 , 25 ml ) , filtered off , and dried in vacuo to give l1 as a white powder ( 0.4 g ) . the filtrate was evaporated and the residue was purified by column chromatography ( sio2 , etoac , rf = 0.58 ) to give an additional amount of l1 ( 0.22 g ) . calcd for 110.15h2o0.1etoac ( mr = 246.76 g / mol ) : c , 65.22 ; h , 4.13 ; n , 28.38 . found : c , 65.56 ; h , 3.90 ; n , 28.39 . esi - ms in methanol ( positive ) : m / z 237 [ m+h ] , 259 [ m+na ] ; ( negative ) : m / z 235 [ m h ] . vis ( methanol ) , max , nm ( , m cm ) : 232 ( 25618 ) , 275 ( 15198 ) , 324 ( 22333 ) . h nmr ( 500.32 mhz , dmso - d6 ) : 14.19 ( brs , 1h , h1a ) , 13.11 ( brs , 1h , h1b ) , 8.85 ( dd , 1h , j = 1.5 hz , j = 8.1 hz , h4a ) , 8.66 ( dd , 1h , j = 1.5 hz , j = 4.5 hz , h6a ) , 7.75 ( d , 1h , j = 7.3 hz , h4b or h7b ) , 7.54 ( d , 1h , j = 7.7 hz , h4b or h7b ) , 7.39 ( dd , 1h , j = 4.5 hz , j = 8.0 hz , h5a ) , 7.24 ( m , 2h , h5b+h6b ) ppm . c nmr ( 125.81 mhz , dmso - d6 ) : 153.13 ( c8a ) , 150.22 ( c6a ) , 146.99 ( c2b ) , 144.34 ( c8b or c9b ) , 136.06 ( c3a ) , 134.68 ( c8b or c9b ) , 131.82 ( c4a ) , 123.35 ( c5b or c6b ) , 122.11 ( c5b or c6b ) , 119.44 ( c4b or c7b ) , 118.65 ( c5a ) , 113.33 ( c9a ) , 112.01 ( c4b or c7b ) ppm . n nmr ( 50.70 mhz , dmso - d6 ) : 166.2 ( n1a ) , 121.3 ( n1b ) ppm . the raw product 9 ( 2.2 g ) was heated in a glacial acetic acid ( 30 ml ) at 125 c for 2 h. the solvent was evaporated under reduced pressure , and the residue was dried in vacuo at 50 c , then resuspended in ch2cl2/meoh ( 7/1 , 50 ml ) , filtered off and dried in vacuo to give l2 as a white powder ( 1.15 g ) . the filtrate was evaporated and the residue was purified by column chromatography ( sio2 , etoac / hexane 2/1 , rf = 0.6 ) to give an additional amount of the product ( 0.27 g ) . yield : 1.42 g , 58% based on 7 . calcd for 120.25h2o0.04etoac ( mr = 322.17 g / mol ) : c , 49.06 ; h , 2.76 ; n , 21.74 . esi - ms in methanol ( positive ) : m / z 315 [ m+h ] , 337 [ m+na ] ; ( negative ) : m / z 313 [ m h ] . vis ( methanol ) , max , nm ( , m cm ) : 234 ( 28154 ) , 282 ( 17628 ) , 335 ( 17198 ) . h nmr ( 500.32 mhz , dmso - d6 ) : 14.43 ( brs , 1h , h1a ) , 13.19 ( brs , 1h , h1b ) , 8.99 ( d , 1h , j = 2.2 hz , h4a ) , 8.75 ( d , 1h , j = 2.3 hz , h6a ) , 7.77 ( d , 1h , j = 7.9 hz , h4b or h7b ) , 7.54 ( d , 1h , j = 7.9 hz , h4b or h7b ) , 7.26 ( m , 2h , h5b+h6b ) ppm . c nmr ( 125.81 mhz , dmso - d6 ) : 151.49 ( c8a ) , 150.66 ( c6a ) , 146.42 ( c2b ) , 144.24 ( c8b or c9b ) , 135.61 ( c3a ) , 134.67 ( c8b or c9b ) , 133.35 ( c4a ) , 123.54 ( c5b or c6b ) , 122.27 ( c5b or c6b ) , 119.55 ( c4b or c7b ) , 114.87 ( c5a or c9a ) , 113.49 ( c5a or c9a ) , 112.09 ( c4b or c7b ) ppm . n nmr ( 50.70 mhz , dmso - d6 ) : 167.5 ( n1a ) , 121.3 ( n1b ) ppm . the raw product 10 ( 2.3 g ) was heated in a glacial acetic acid ( 40 ml ) at 125 c for 2 h. the solvent was evaporated under reduced pressure , and the residue dried in vacuo at 50 c . after washing with ch2cl2 ( 30 ml ) , ch2cl2/meoh ( 2/1 , 57 ml ) the gray product was purified by column chromatography ( sio2 , etoac , rf = 0.68 ) to give a white powder ( 0.9 g ) . the filtrates were evaporated and the remaining solid was purified by column chromatography to give an additional amount of the product ( 0.3 g ) . calcd for 13 : c , 50.29 ; h , 3.38 ; n , 19.55 . found : c , 50.03 ; h , 3.19 ; n , 19.19 . esi - ms in methanol ( positive ) : m / z 381 [ m+na ] ; ( negative ) : m / z 357 [ m h ] . vis ( methanol ) , max , nm ( , m cm ) : 235 ( 29776 ) , 282 ( 17544 ) , 337 ( 16958 ) . nmr characterization of 7b - l3 and 4b-l3 tautomers ( 1/1.3 ) in dmso - d6 : h nmr ( 500.32 mhz , dmso - d6 ) , 7b - l3 : 14.47 ( brs , 1h , h1a ) , 13.25 ( brs , 1h , h1b ) , 8.99 or 8.98 ( d+d , ( 1 + 1.3)h , j = 2.3 hz , h4a+h4a ) , 8.75 ( d , ( 1 + 1.3)h , j = 2.3 hz , h6a+h6a ) , 7.72 ( dd , 1h , j = 1.8 hz , j = 6.8 hz , h4b ) , 7.287.21 ( m , ( 2 + 2.6)h , h5a , h6a+h5a , h6a ) , 4.80 ( s , 2h , h10b ) , 3.37 ( s , 3h , h11b ) ppm . h nmr ( 500.32 mhz , dmso - d6 ) , 4b-l3 : 14.43 ( brs , 1.3h , h1a ) , 13.22 ( brs , 1.3h , h1b ) , 8.99 or 8.98 ( d+d , ( 1 + 1.3)h , j = 2.3 hz , h4a+h4a ) , 8.75 ( d , ( 1 + 1.3)h , j = 2.3 hz , h6a+h6a ) , 7.47 ( dd , 1.3h , j = 1.2 hz , j = 7.7 hz , h7b ) , 7.287.21 ( m , ( 2 + 2.6)h , h5a , h6a+h5a , h6a ) , 4.96 ( s , 2.6h , h10b ) , 3.44 ( s , 3.9h , h11b ) ppm . c nmr ( 125.81 mhz , dmso - d6 ) , 7b - l3 : 151.51 ( c8a+c8a ) , 150.69 ( c6a or c6a ) , 150.65 ( c6a or c6a ) , 146.70 ( c2b ) , 144.46 ( c9b ) , 135.62 ( c3a+c3a ) , 133.45 ( c4a or c4a ) , 133.42 ( c4a or c4a ) , 133.29 ( c8b ) , 123.38 ( c6b ; c5b or c6b ) , 123.36 ( c6b ; c5b or c6b ) , 122.95 ( c7b ) , 122.16 ( c5b or c6b ) , 118.97 ( c4b ) , 115.04 ( c5a or c9a or c5a or c9a ) , 114.92 ( c5a or c9a or c5a or c9a ) , 113.49 ( c5a or c9a or c5a or c9a ) , 70.49 ( c10b ) , 57.95 ( c11b ) ppm . c nmr ( 125.81 mhz , dmso - d6 ) , 4b-l3 : 151.51 ( c8a+c8a ) , 150.69 ( c6a or c6a ) , 150.65 ( c6a or c6a ) , 146.13 ( c2b ) , 142.50 ( c9b ) , 135.62 ( c3a+c3a ) , 134.42 ( c8b ) , 133.45 ( c4a or c4a ) , 133.42 ( c4a or c4a ) , 129.38 ( c4b ) , 123.38 ( c6b ; c5b or c6b ) , 123.36 ( c6b ; c5b or c6b ) , 122.16 ( c5b or c6b ) , 120.81 ( c5b ) , 115.04 ( c5a or c9a or c5a or c9a ) , 114.92 ( c5a or c9a or c5a or c9a ) , 113.49 ( c5a or c9a or c5a or c9a ) , 111.17 ( c7b ) , 69.90 ( c10b ) , 58.35 ( c11b ) ppm . n nmr ( 50.70 mhz , dmso - d6 ) : 167.6 ( n1a+n1a ) , 121.4 ( n1b+n1b ) ppm . a mixture of l1 ( 54.7 mg , 0.23 mmol ) and [ rucl2(-p - cymene)]2 ( 70 mg , 0.11 mmol ) in dry ethanol ( 25 ml ) was stirred at room temperature for 1 h. ethanol then was evaporated up to ca . calcd for 11ah2o ( mr = 559.45 g / mol ) : c , 49.38 ; h , 4.50 ; n , 12.52 ; cl , 12.67 . found : c , 49.68 ; h , 4.25 ; n , 12.11 ; cl , 12.26 . esi - ms in methanol ( positive ) : m / z 470 [ m hcl cl ] , 507 [ m cl ] , 528 [ m hcl+na ] ; ( negative ) : m / z 468 [ m2hcl h ] , 505 [ m hcl h ] . vis ( methanol ) , max , nm ( , m cm ) : 251 ( 16335 ) , 299 ( 26663 ) , sh 347 ( 16012 ) . vis ( h2o ) , max , nm ( , m cm ) : sh 245 ( 10728 ) , 294 ( 18597 ) , 360 ( 9666 ) . h nmr ( 500.32 mhz , dmso - d6 ) : 14.91 ( brs , 1h , h1b ) , 9.17 ( d , 1h , j = 7.7 hz , h4a ) , 8.82 ( d , 1h , j = 3.8 hz , h6a ) , 8.11 ( d , 1h , j = 7.1 hz , h4b ) , 7.84 ( d , 1h , j = 8.5 hz , h7b ) , 7.58 ( m , 3h , h5a+h5b+h6b ) , 6.43 ( m , 2h , h2c+h6c ) , 6.31 ( d , 1h , j = 5.3 hz , h3c or h5c ) , 6.12 ( d , 1h , j = 5.5 hz , h3c or h5c ) , 2.54 ( sep , 1h , h7c , under dmso - d6 peak ) , 2.21 ( s , 3h , h10c ) , 0.94 ( d , 3h , j = 6.6 hz , h8c or h9c ) , 0.91 ( d , 3h , j = 6.6 hz , h8c or h9c ) ppm . c nmr ( 125.81 mhz , dmso - d6 ) : 153.97 ( c8a ) , 150.45 ( c6a ) , 146.52 ( c2b ) , 141.37 ( c9b ) , 134.70 ( c8b ) , 134.64 ( c3a ) , 131.48 ( c4a ) , 125.39 ( c5b or c6b ) , 124.92 ( c5b or c6b ) , 119.56 ( c5a ) , 117.85 ( c4b ) , 113.96 ( c7b ) , 111.54 ( c9a ) , 103.96 ( c4c ) , 103.74 ( c1c ) , 84.44 ( c2c or c6c ) , 83.73 ( c2c or c6c ) , 82.15 ( c3c or c5c ) , 80.84 ( c3c or c5c ) , 31.12 ( c7c ) , 22.19 ( c8c+c9c ) , 19.17 ( c10c ) ppm . n nmr ( 50.70 mhz , dmso - d6 ) : 128.7 ( n1b ) ppm . a mixture of l1 ( 42.5 mg , 0.18 mmol ) and [ oscl2(-p - cymene)]2 ( 70 mg , 0.09 mmol ) in dry ethanol ( 25 ml ) was stirred at room temperature for 2 h. ethanol then was removed under reduced pressure up to ca . calcd for 11bh2o ( mr = 648.61 g / mol ) : c , 42.59 ; h , 3.88 ; n , 10.79 . found : c , 42.56 ; h , 3.57 ; n , 10.97 . esi - ms in methanol ( positive ) : m / z [ m hcl cl ] , 596 [ m cl ] , 618 [ m hcl+na ] ; ( negative ) : m / z 595 [ m hcl h ] . vis ( methanol ) , max , nm ( , m cm ) : sh 252 ( 17048 ) , 299 ( 20228 ) , 343 ( 19879 ) . h nmr ( 500.32 mhz , meoh - d4 ) : 8.99 ( dd , 1h , j = 1.3 hz , j = 8.1 hz , h4a ) , 8.77 ( dd , 1h , j = 1.4 hz , j = 4.8 hz , h6a ) , 7.96 ( dd , 1h , j = 2.0 hz , j = 6.4 hz , h4b ) , 7.80 ( dd , 1h , j = 1.9 hz , j = 6.1 hz , h7b ) , 7.647.59 ( m , 3h , h5a+h5b+h6b ) , 6.66 ( d , 1h , j = 5.6 hz , h2c or h6c ) , 6.59 ( d , 1h , j = 5.7 hz , h2c or h6c ) , 6.43 ( d , 1h , j = 5.6 hz , h3c or h5c ) , 6.21 ( d , 1h , j = 5.7 hz , h3c or h5c ) , 2.43 ( sep , 1h , j = 6.9 hz , h7c ) , 2.38 ( s , 3h , h10c ) , 0.96 ( d , 3h , j = 6.9 hz , h8c or h9c ) , 0.92 ( d , 3h , j = 6.9 hz , h8c or h9c ) ppm . c nmr ( 125.81 mhz , meoh - d4 ) : 153.25 ( c8a ) , 148.91 ( c2b ) , 147.42 ( c6a ) , 140.49 ( c9b ) , 135.15 ( c3a ) , 134.25 ( c8b ) , 132.07 ( c4a ) , 125.47 ( c5b or c6b ) , 124.81 ( c5b or c6b ) , 118.48 ( c5a ) , 116.89 ( c4b ) , 112.98 ( c7b ) , 112.92 ( c9a ) , 97.71 ( c4c ) , 94.88 ( c1c ) , 76.44 ( c2c or c6c ) , 74.99 ( c2c or c6c ) , 71.93 ( c3c or c5c ) , 70.44 ( c2c or c6c ) , 31.37 ( c7c ) , 21.35 ( c8c or c9c ) , 21.09 ( c8c or c9c ) , 17.84 ( c10c ) ppm . crystals of 11b4h2o suitable for xrd study have been obtained from a solution of 11b in ethanol . a mixture of l2 ( 73.2 mg , 0.23 mmol ) and [ rucl2(-p - cymene)]2 ( 70 mg , 0.11 mmol ) in dry ethanol ( 25 ml ) was stirred at room temperature for 1 h. ethanol then was removed under reduced pressure up to ca . calcd for 12ah2o ( mr = 638.35 g / mol ) : c , 43.28 ; h , 3.79 ; n , 10.97 . esi - ms in methanol ( positive ) : m / z 548 [ m hcl cl ] , 608 [ m hcl+na ] ; ( negative ) : m / z 549 [ m2hcl h ] , 582 [ m hcl h ] . vis ( methanol ) , max , nm ( , m cm ) : sh 254 ( 17778 ) , 303 ( 29953 ) , 351 ( 17387 ) . h nmr ( 500.32 mhz , dmso - d6 ) : 14.34 ( brs , 1h , h1b ) , 9.21 ( s , 1h , h4a ) , 8.73 ( s , 1h , h6a ) , 8.06 ( d , 1h , j = 7.6 hz , h4b ) , 7.79 ( d , 1h , j = 8.5 hz , h7b ) , 7.52 ( m , 2h , h5b+h6b ) , 6.32 ( d , 2h , j = 5.8 hz , h2c+h6c ) , 6.22 ( d , 1h , j = 6.2 hz , h3c or h5c ) , 6.03 ( d , 1h , j = 6.1 hz , h3c or h5c ) , 2.52 ( sep , 1h , h7c , under dmso - d6 peak ) , 2.18 ( s , 3h , h10c ) , 0.94 ( d , 3h , j = 6.8 hz , h8c or h9c ) , 0.89 ( d , 3h , j = 6.9 hz , h8c or h9c ) ppm . c nmr ( 125.81 mhz , dmso - d6 ) : 154.04 ( c8a ) , 151.24 ( c6a ) , 146.57 ( c2b ) , 141.37 ( c9b ) , 134.63 ( c8b ) , 133.43 ( c3a ) , 131.82 ( c4a ) , 125.33 ( c5b or c6b ) , 124.88 ( c5b or c6b ) , 117.78 ( c4b ) , 114.72 ( c5a or c9a ) , 113.85 ( c7b ) , 112.48 ( c5a or c9a ) , 103.96 ( c4c ) , 103.74 ( c1c ) , 84.44 ( c2c or c6c ) , 83.69 ( c2c or c6c ) , 82.16 ( c3c or c5c ) , 80.76 ( c3c or c5c ) , 31.09 ( c7c ) , 22.20 ( c8c or c9c ) , 22.17 ( c8c or c9c ) , 19.16 ( c10c ) ppm . n nmr ( 50.70 mhz , dmso - d6 ) : 127.3 ( n1b ) ppm . a mixture of l2 ( 56.4 mg , 0.18 mmol ) and [ oscl2(-p - cymene)]2 ( 70 mg , 0.09 mmol ) in dry ethanol ( 25 ml ) was stirred at room temperature for 2 h. ethanol then was removed under reduced pressure up to ca . calcd for 12bh2o ( mr = 727.51 g / mol ) : c , 37.97 ; h , 3.33 ; n , 9.63 . found : c , 37.82 ; h , 3.02 ; n , 9.33 . esi - ms in methanol ( positive ) : m / z 638 [ m hcl cl ] , 696 [ m hcl+na ] ; ( negative ) : m / z 672 [ m hcl h ] . vis ( methanol ) , max , nm ( , m cm ) : sh 253 ( 21638 ) , 302 ( 30505 ) , 357 ( 21813 ) . h nmr ( 500.32 mhz , meoh - d4 ) : 9.08 ( d , 1h , j = 2.1 hz , h4a ) , 8.84 ( d , 1h , j = 2.1 hz , h6a ) , 7.96 ( dd , 1h , j = 2.1 hz , j = 6 hz , h4b ) , 7.80 ( dd , 1h , j = 2.1 hz , j = 6.1 hz , h7b ) , 7.63 ( m , 2h , h5b+h6b ) , 6.69 ( d , 1h , j = 5.7 hz , h2c or h6c ) , 6.63 ( d , 1h , j = 5.6 hz , h2c or h6c ) , 6.48 ( d , 1h , j = 5.6 hz , h3c or h5c ) , 6.22 ( d , 1h , j = 5.7 hz , h3c or h5c ) , 2.42 ( sep , 1h , j = 6.9 hz , h7c ) , 2.39 ( s , 3h , h10c ) , 0.95 ( d , 3h , j = 6.9 hz , h8c or h9c ) , 0.91 ( d , 3h , j = 6.9 hz , h8c or h9c ) ppm . c nmr ( 125.81 mhz , meoh - d4 ) : 153.04 ( c8a ) , 152.49 ( c6a ) , 148.15 ( c2b ) , 140.47 ( c9b ) , 134.58 ( c3a ) , 134.19 ( c8b ) , 131.13 ( c4a ) , 125.79 ( c5b or c6b ) , 125.05 ( c5b or c6b ) , 116.99 ( c4b ) , 115.39 ( c5a or c9a ) , 113.09 ( c7b ) , 112.11 ( c5a or c9a ) , 98.54 ( c4c ) , 95.52 ( c1c ) , 75.73 ( c2c or c6c ) , 75.25 ( c2c or c6c ) , 71.87 ( c3c or c5c ) , 69.99 ( c3c or c5c ) , 31.41 ( c7c ) , 21.34 ( c8c or c9c ) , 21.16 ( c8c or c9c ) , 17.84 ( c10c ) ppm . crystals of 12b and 12b2ch3oh2h2o suitable for xrd study have been obtained from a solution of 12b in methanol . a mixture of l3 ( 64 mg , 0.18 mmol ) and [ rucl2(-p - cymene)]2 ( 50 mg , 0.08 mmol ) in dry ethanol ( 25 ml ) was stirred at room temperature for 1 h. ethanol then was removed under reduced pressure up to ca . calcd for 13a1.5h2o ( mr = 691.41 g / mol ) : c , 43.43 ; h , 4.23 ; n , 10.13 ; cl , 10.26 . found : c , 43.81 ; h , 4.24 ; n , 10.11 ; cl , 10.57 . esi - ms in methanol ( positive ) : m / z 592 [ m hcl cl ] , 650 [ m hcl+na ] ; ( negative ) : m / z 591 [ m2hcl h ] , 628 [ m hcl h ] . vis ( methanol ) , max , nm ( , mcm ) : sh 252 ( 18744 ) , 306 ( 28529 ) , 354 ( 16889 ) . h nmr ( 500.32 mhz , dmso - d6 ) : 13.88 ( brs , 1h , h1b ) , 9.41 ( s , 1h , h4a ) , 8.68 ( s , 1h , h6a ) , 7.99 ( d , 1h , j = 7.7 hz , h4b ) , 7.49 ( m , 2h , h5b+h6b ) , 6.29 ( m , 2h , h2c+h6c ) , 6.20 ( d , 1h , j = 5.5 hz , h3c or h5c ) , 6.00 ( d , 1h , j = 5.9 hz , h3c or h5c ) , 4.88 ( s , 2h , h10b ) , 3.39 ( s , 3h , h11b ) , 2.48 ( sep , 1h , h7c , under dmso - d6 peak ) , 2.17 ( s , 3h , h10c ) , 0.93 ( d , 3h , j = 6.9 hz , h8c or h9c ) , 0.87 ( d , 3h , j = 6.8 hz , h8c or h9c ) ppm . c nmr ( 125.81 mhz , dmso - d6 ) : 155.35 ( c8a ) , 150.27 ( c6a ) , 147.43 ( c2b ) , 141.64 ( c9b ) , 133.07 ( c8b ) , 132.68 ( c3a ) , 131.68 ( c4a ) , 124.87 ( c5b or c6b ) , 124.59 ( c5b or c6b ) , 124.53 ( c7b ) , 117.18 ( c4b ) , 114.23 ( c5a or c9a ) , 112.78 ( c5a or c9a ) , 103.74 ( c4c ) , 103.09 ( c1c ) , 85.38 ( c2c or c6c ) , 83.68 ( c2c or c6c ) , 82.13 ( c3c or c5c ) , 81.05 ( c3c or c5c ) , 70.19 ( c10b ) , 58.03 ( c11b ) , 31.04 ( c7c ) , 22.22 ( c8c or c9c ) , 22.09 ( c8c or c9c ) , 19.13 ( c10c ) ppm . n nmr ( 50.70 mhz , dmso - d6 ) : 122.9 ( n1b ) ppm . the red xrd - quality crystals of [ rucl(-p - cymene)(l3h ) ] ( 13c ) were obtained from etoh / et2o and an etoh solution of 13a ( long crystallization ) . the yellow crystals of [ rucl(-p - cymene)(l3)]cl[rucl(-p - cymene)(l3h)]ch3oh ( 13dch3oh ) suitable for xrd study have been obtained from methanolic solution of 13a ( short crystallization ) . h nmr ( 13c , 500.32 mhz , dmso - d6 ) : 13.43 ( s , 1h ) , 9.18 ( d , 1h , j = 2.1 hz ) , 8.48 ( d , 1h , j = 2.2 hz ) , 7.94 ( d , 1h , j = 8.2 hz ) , 7.45 ( t , 1h , j = 7.8 hz ) , 7.39 ( d , 1h , j = 7.2 hz ) , 6.16 ( d , 1h , j = 6.0 hz ) , 6.13 ( d , 1h , j = 6.1 hz ) , 6.07 ( d , 1h , j = 5.9 hz ) , 5.89 ( d , 1h , j = 6.4 hz ) , 4.85 ( s , 2h ) , 4.04 ( s , 3h ) , 2.14 ( s , 3h ) , 0.93 ( d , 3h , j = 6.8 hz ) , 0.86 ( d , 3h , j = 6.9 a mixture of l3 ( 59 mg , 0.17 mmol ) and [ oscl2(-p - cymene)]2 ( 60 mg , 0.08 mmol ) in dry ethanol ( 25 ml ) was stirred at room temperature for 3 h. ethanol was evaporated up to ca . calcd for 13b : c , 39.85 ; h , 3.48 ; n , 9.29 . found : c , 39.60 ; h , 3.32 ; n , 9.20 . esi - ms in methanol ( positive ) : m / z 682 [ m hcl cl ] , 704 [ m2hcl+na ] ; ( negative ) : m / z 680 [ m2hcl h ] , 716 [ m hcl h ] . vis ( methanol ) , max , nm ( , m cm ) : sh 256 ( 19825 ) , 303 ( 24634 ) , 357 ( 18850 ) . h nmr ( 500.32 mhz , meoh - d4 ) : 9.33 ( d , 1h , j = 2.1 hz , h4a ) , 8.84 ( d , 1h , j = 2.2 hz , h6a ) , 7.91 ( dd , 1h , j = 1.2 hz , j = 7.8 hz , h4b ) , 7.647.58 ( m , 2h , h5b+h6b ) , 6.69 ( d , 1h , j = 5.6 hz , h2c or h6c ) , 6.62 ( d , 1h , j = 5.7 hz , h2c or h6c ) , 6.47 ( d , 1h , j = 5.5 hz , h3c or h5c ) , 6.21 ( d , 1h , j = 5.6 hz , h3c or h5c ) , 4.94 ( q , 2h , j = 12.4 hz , h10b ) , 3.49 ( s , 3h , h11b ) , 2.41 ( sep , 1h , j = 6.9 hz , h7c ) , 2.39 ( s , 3h , h10c ) , 0.94 ( d , 3h , j = 6.9 hz , h8c or h9c ) , 0.89 ( d , 3h , j = 6.9 hz , h8c or h9c ) ppm . c nmr ( 125.81 mhz , meoh - d4 ) : 153.18 ( c8a ) , 152.16 ( c6a ) , 148.36 ( c2b ) , 140.82 ( c9b ) , 134.35 ( c3a ) , 132.68 ( c8b ) , 131.68 ( c4a ) , 125.63 ( c5b or c6b ) , 124.85 ( c5b or c6b ) , 124.51 ( c7b ) , 116.72 ( c4b ) , 115.24 ( c5a or c9a ) , 112.26 ( c5a or c9a ) , 98.75 ( c4c ) , 95.50 ( c1c ) , 75.98 ( c2c or c6c ) , 75.34 ( c2c or c6c ) , 71.82 ( c3c or c5c ) , 70.29 ( c10b ) , 70.04 ( c3c or c5c ) , 57.17 ( c11b ) , 31.39 ( c7c ) , 21.34 ( c8c or c9c ) , 21.16 ( c8c or c9c ) , 17.85 ( c10c ) ppm . the yellow crystals of [ oscl(-p - cymene)(l3)]cl[oscl(-p - cymene)(l3h)]0.75 ch3oh0.25h2o ( 13e0.75ch3oh0.25h2o ) suitable for xrd study have been obtained from a methanolic solution of 13b . elemental analyses ( c , h , n , cl ) were performed by the microanalytical service of the institute of physical chemistry , university of vienna . electrospray ionization mass spectrometry ( esi - ms ) was carried out with an esquire 3000 instrument ( bruker daltonics , bremen , germany ) , using solutions of compounds in methanol . vis spectra were recorded on a lambda 20 uv vis spectrophotometer ( perkin elmer ) , using samples dissolved in methanol ( l1l3 , 11a , 12a , 13a , 11b , 12b , 13b ) and water ( 11a ) over 24 or 48 h , correspondingly . the one - dimensional ( h , c , n ) and two - dimensional spectra ( n , h hsqc , c , h hsqc , c , h hmbc , h , h cosy , h , h tocsy , h , h noesy ( l3 , 12a ) , h , h roesy ( l3 , 11a , 12a , 13a , 13b ) ) were recorded with a bruker model dpx500 ( ultrashield magnet ) system in dmso - d6 ( l1l3 , 11a , 12a , 13a ) , meoh - d4 ( 11b , 12b , 13b ) , d2o ( h nmr , 11a ) , and d2o / dmso - d6 ( h nmr , 12a ) , using standard pulse programs at 500.32 ( h ) , 125.81 ( c ) and 50.70 ( n ) mhz . h signals are referenced relative to the solvent signals ( dmso - d6 at 2.51 , meoh - d4 at 3.33 ppm ) . single crystals were positioned at distances of 35 , 40 , 40 , 40 , 40 , 40 , and 35 mm from the detector , and 1556 , 1131 , 518 , 1911 , 1176 , 1978 , and 1039 frames were measured , each for 30 , 60 , 30 , 20 , 70 , 60 , and 30 s over 1 scan width for 20.5h2o , 11b4h2o , 12b , 12b2ch3oh2h2o , 13c , 13dch3oh , and 13e0.75ch3oh0.25h2o , correspondingly . crystal data , data collection parameters , and structure refinement details are given in table 1 . the structures were solved by direct methods and refined by full - matrix least - squares techniques . refinement of the structure of 12b revealed that the chloride counteranion occupies two statistically disordered positions with site occupation factor ( sof ) values of 0.57:0.43 , whereas , in 13c , the methoxymethylene group was found to be disordered over two positions with sof values of 0.80:0.20 . similarly , the methoxymethylene group of one crystallographically independent complex in 13dch3oh or in both crystallographically independent complexes in 13e0.75ch3oh0.25h2o is disordered with sof values of 0.35:0.65 and 0.60:0.40 , 0.80:0.20 , correspondingly . the disorder was resolved with constrained anisotropic displacement parameters and restrained bond distances using eadp and sadi instructions of shelx97 , respectively . structure solution was achieved with shelxs-97 and refinement with shelxl-97 , and graphics were produced with ortep-3 . wr2 = { [w(fo fc)]/[w(fo)]}. gof = { [w(fo fc)]/(n p ) } , where n is the number of reflections and p is the total number of parameters refined . a549 ( non - small cell lung carcinoma , human ) and sw480 ( colon carcinoma , human ) cells were kindly provided by brigitte marian ( institute of cancer research , department of medicine i , medical university of vienna , austria ) . ch1 cells ( ovarian cancer , human ) were a gift from lloyd r. kelland ( crc centre for cancer therapeutics , institute of cancer research , sutton , u.k . ) . cells were grown in 75-cm culture flasks ( iwaki ) in a complete medium ( i.e. , minimum essential medium supplemented with 10% heat - inactivated fetal bovine serum , 1 mm sodium pyruvate , 4 mm l - glutamine , and 1% nonessential amino acids from 100 stock ) as adherent monolayer cultures . cultures were grown at 37 c under a humidified atmosphere containing 5% co2 and 95% air . antiproliferative activity in vitro was determined by the colorimetric mtt assay ( mtt = 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2h - tetrazolium bromide , fluka ) . for this purpose , cells were harvested from culture flasks by the use of trypsin and seeded in complete medium ( 100 l / well ) into 96-well plates ( iwaki ) in densities of 4 10 ( a549 ) , 1.5 10 ( ch1 ) , and 2.5 10 ( sw480 ) viable cells per well . test compounds were dissolved in dmso first , appropriately diluted in complete medium , and instantly added to the plates ( 100 l / well ) , where the dmso content did not exceed 0.4% and 1% for the ligands and complexes , respectively . after exposure for 96 h , the medium was replaced with 100 l / well rpmi 1640 medium ( supplemented with 10% heat - inactivated fetal bovine serum and 4 mm l - glutamine ) plus 20 l / well mtt solution in phosphate - buffered saline ( 5 mg / ml ) , followed by incubation for 4 h. subsequently , the medium / mtt mixture was removed , and the formazan product formed by viable cells was dissolved in dmso ( 150 l / well ) . optical densities were measured with a microplate reader ( tecan spectra classic ) at 550 nm ( and a reference wavelength of 690 nm ) to yield relative quantities of viable cells as percentages of untreated controls , and 50% inhibitory concentrations ( ic50 ) were interpolated from concentration effect curves . calculations are based on at least three independent experiments with triplicates for each concentration level . to study the effects on the cell cycle of exponentially growing ch1 cells by flow cytometric analysis of their relative dna content , cells were harvested from culture flasks , seeded in complete medium into 90-mm petri dishes ( 1 10 cells / dish ) and , after recovery for 24 h , exposed to various concentrations of the test compounds for 24 h. for this purpose , test compounds were diluted from dmso stocks with complete medium ( see above ) such that the effective dmso content did not exceed 0.5% . after exposure , treated and control cells were collected by scratching , washed with pbs , and stained with 5 g / ml propidium iodide overnight . their fluorescence was measured with a facs calibur instrument ( becton dickinson ) , and the obtained histograms were analyzed with cell quest pro software ( becton dickinson ) . at least two independent experiments were performed for each setting , and 2.5 or 3.0 10 cells were measured per sample . the cdk - inhibitory capacities of test compounds were studied by a radiochemical assay using recombinant cdk1/cyclin b and cdk2/cyclin e isolated from sf21 insect cells and histone h1 as the substrate for phosphorylation , as described by marko et al . briefly , mops - buffered assay mixtures containing the test compound ( with a maximum of 1% dmso ) , the respective kinase / cyclin complex , histone h1 , and 0.4 ci ( -p)atp per sample were incubated for 10 min at 30 c . aliquots of the solution were spotted onto phosphocellulose squares , which had been washed three times with 0.75% phosphoric acid , followed by acetone . the dried squares were measured in scintillation vials by -counting ( perkin elmer tri - carb 2800tr ; quanta smart software ) . results were obtained in duplicate in at least two independent experiments , and ic50 values were calculated by interpolation .", "several routes to 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines have been proposed by johnson & johnson pharmaceutical research & development l.l.c . the first one was developed for 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines with an unsubstituted benzimidazole moiety and involved sulfur - induced benzimidazole ring formation via the treatment of 5-bromo-1h - pyrazolo[3,4-b]pyridine-3-carboxaldehyde with 1,2-diaminobenzene . the poor reproducibility of this synthesis prompted the exploration of an alternative way , via 5-bromo-1h - pyrazolo[3,4-b]pyridine-3-carboxylic acid , which was used for the preparation of 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines with a substituted benzimidazole moiety . the patented route to 5-bromo-1h - pyrazolo[3,4-b]pyridine-3-carboxylic acid ( 3 ) consists of four steps ( see scheme 1 , steps i iv ) : oxidation of 3-methyl-1h - pyrazolo[3,4-b]pyridine by kmno4 in the presence of a base with subsequent acidification with h2so4 , esterification of 1h - pyrazolo[3,4-b]pyridine-3-carboxylic acid ( 1 ) in the presence of h2so4 in methanol , bromination of 1h - pyrazolo[3,4-b]pyridine-3-carboxylic acid methyl ester in an acoh / acona mixture , and hydrolysis of 5-bromo-1h - pyrazolo[3,4-b]pyridine-3-carboxylic acid methyl ester in the presence of naoh , followed by acidification with hcl . reagents and conditions : ( i ) kmno4 , naoh , 3 h , 100 c , h2so4 ; ( ii ) methanol , h2so4 , reflux , 68 h , nahco3 , 42% ( i + ii ) ; ( iii ) br2 , acoh , acona , 115 c , overnight , chromatographic purification , 43% ; ( iv ) naoh , meoh , reflux , 4 h , hcl , 100% ; ( v ) br2 , acoh , acona , 115 c , 2.53 h ; and ( vi ) kmno4 , naoh , 3 h , 100 c , hcl , 2435% ( v + vi ) . we performed the synthesis of 3 in two steps ( see scheme 1 , steps v and vi ) : bromination of 3-methyl-1h - pyrazolo[3,4-b]pyridine in acoh / acona mixture and oxidation of crude 5-bromo-3-methyl-1h - pyrazolo[3,4-b]pyridine ( 2 ) by kmno4 in a basic medium , followed by acidification with 37% hcl , with an overall yield of 2435% . 5-bromo-3-methyl-1h - pyrazolo[3,4-b]pyridine ( 2 ) is a known compound , the synthesis of which is well - documented . for the benzimidazole ring formation , 1,2-diaminobenzene and 1-methoxymethyl-2,3-diaminobenzene the reported synthesis of 1-methoxymethyl-2,3-diaminobenzene ( 5 ) from 2,3-diaminobenzyl alcohol afforded the desired product in 34% yield ( see scheme 2 , step i ) . however , the instability and low yield of diamines , as well as the necessity to purify the desired ether using column chromatography , stimulated the search for a more - convenient procedure that was subsequently proposed : etherification of 2-amino-3-nitrobenzyl alcohol , followed by the reduction of 1-methoxymethyl-2-amino-3-nitrobenzene ( 4 ) with 10% pd / c in ethanol under a hydrogen atmosphere afforded 5 in 6575% yield ( see scheme 2 , steps ii and iii ) . reagents and conditions : ( i ) nah , mei , dry thf , 0 c , 30 min , room temperature , overnight , chromatographic purification , 34% yield ; ( ii ) nah , mei , dry thf , 0 c , 15 min , room temperature , 3 h , chromatographic purification , 6575% yield ; ( iii ) 10% pd / c , ethanol , h2 , room temperature , 1824 h , 100% yield . patented benzimidazole ring formation by cyclization of the 3-carboxyl group of 5-bromo-1h - pyrazolo[3,4-b]pyridine-3-carboxylic acid ( 3 ) with substituted 1,2-diaminobenzenes was realized via amide formation using coupling reagents , followed by treatment with glacial acetic acid . hatu ( n , n , n,n-tetramethyl - o-(7-azabenzotriazol-1-yl)uronium hexafluorophosphate ) was used as a coupling reagent . three 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines ( l1l3 ) ( where x = h , br ; and y = h , ch2och3 ) have been synthesized in this work ( see chart 1 ) : 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridine ( l1 ) is a new compound that we have prepared as a model ligand for coordination to metals ; 3-(1h - benzimidazol-2-yl)-5-bromo-1h - pyrazolo[3,4-b]pyridine ( l2 ) was previously known as boc - protected compound prepared via 5-bromo-1h - pyrazolo[3,4-b]pyridine-3-carboxaldehyde;5-bromo-3-(4-methoxymethyl-1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridine ( l3 ) was synthesized via 5-bromo-1h - pyrazolo[3,4-b]pyridine-3-carboxylic acid ( 3 ) and patented as a potential cdk inhibitor and antiproliferative agent . for the synthesis of l1l3 , we used n , n-carbonyldiimidazole ( cdi ) as an amide - coupling reagent , because it is relatively inexpensive and the side products , carbon dioxide and imidazole , could be easily removed from the reaction mixture . cdi - mediated amidation of acids 1 and 3 was performed as shown in scheme 3 ( steps i and ii ) . in the first step , the acyl - imidazolides 6 and 7 were obtained in dry dmf at room temperature and isolated as white solids . the yields based on 3-methyl-1h - pyrazolo[3,4-b]pyridine are : 2529% ( 6 ) and 1316% ( 7 ) . in the second step , monoacylation of phenylenediamines ( 1,2-diaminobenzene and 1-methoxymethyl-2,3-diaminobenzene ( 5 ) ) using acyl - imidazolides was performed in dmf at 8085 c . reagents and conditions : ( i ) cdi , dry dmf , room temperature , 2024 h ; ( ii ) 1,2-diaminobenzene or 5 , dry dmf , 8085 c ; 520 h ; and ( iii ) glacial acoh , 120125 c , 2.54.5 h , chromatographic purification . amides 810 were used without further purification in ring closure reactions in a glacial acetic acid at 120125 c and afforded the desired 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines : l1 ( 5560% ) , l2 ( 5861% ) , and l3 ( 4451% ) , based on 6 and 7 ( see scheme 3 , step iii ) . the reported synthesis of l3 is a one - pot approach for amide formation using hatu with 57% yield , followed by cyclization under acidic conditions ( acetic acid ) with 87% yield . thus , the ligands l1 , l2 , and l3 have been prepared in 7 , 8 , and 11 steps , correspondingly . finally , the ligands l1l3 were reacted with [ mcl2(-p - cymene)]2 ( where m = ru , os ) in a 2:1 molar ratio in dry ethanol at room temperature to give [ mcl(-arene)(l)]cl complexes ( 11a , 11b , 12a , 12b , 13a , 13b ) in quantitative yields . crystallization of [ rucl(-p - cymene)(l3)]cl ( 13a ) in etoh or etoh / et2o resulted in xrd - quality crystals of [ rucl(-p - cymene)(l3h ) ] ( 13c ) , while the crystallization of 13a in methanol afforded crystals of composition [ rucl(-p - cymene)(l3)]cl[rucl(-p - cymene)(l3h)]ch3oh ( 13dch3oh ) . the osmium(ii ) analogue 13e0.75ch3oh0.25h2o was obtained via the crystallization of 13b in methanol . the full assignment of proton , carbon , and nitrogen resonances for l1l3 , 11a , 11b , 12a , 12b , 13a , and 13b is quoted in tables s1s3 in the supporting information . 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines with an unsubstituted benzimidazole moiety ( l1 , l2 ) display one set of signals . l1 is characterized by three doublets of doublets for h4a , h5a , h6a ( 8.85 , 7.39 , 8.66 ppm , correspondingly ) of pyrazolopyridine moiety , two doublets for h4b , h7b ( 7.54 and 7.75 ppm ) , the overlapped h5b , h6b proton signals in one multiplet ( 7.24 ppm ) for a benzimidazole moiety and two singlet resonances for h1a and h1b ( for atom numbering , see chart 1 ) . the substitution of h5a by bromine ( l2 ) results in reduced multiplicity for the h4a and h6a signals ( two doublets at 8.99 and 8.75 ppm ) , whereas the benzimidazole moiety spectrum remains almost unchanged . two singlets were attributed to nh protons and related to pyrazolopyridine ( h1a , at 14.19 ( l1 ) , 14.43 ( l2 ) ppm ) and benzimidazole ( h1b , at 13.11 ( l1 ) , 13.19 ( l2 ) ppm ) moieties . nmr spectra for 11a , 11b , 12a , and 12b , where l1 and l2 coordinate as bidentate ligands via n2a and n3b with the formation of a stable five - membered chelate cycle , show one set of signals . there was no evidence for monodentate or tridentate coordination of ligands with the formation of dinuclear or polynuclear complexes . coordination of l1 and l2 to ruthenium(ii ) made it possible to assign the two doublets to proton resonances of h4b and h7b of the benzimidazole moiety . in the h , h roesy plots , one of them has cross - peaks with a ch cymene ring and the nearest to them is h4b ( e.g. , at 8.11 ( 11a ) , 8.06 ( 12a ) ppm ) . a singlet at 14.91 ( 11a ) , 14.34 ( 12a ) ppm was assigned to nh proton and showed no couplings with other atoms . the nitrogen resonance shift at 128.7 ( 11a ) , 127.3 ( 12a ) ppm is closer to the benzimidazole nh chemical shift in metal - free ligands ( 121.3 ( l1 , l2 ) ppm ) and , therefore , was assigned as n1b ( see table s3 in the supporting information ) . the h1b resonance shows a significant shift by 1.8 and 1.15 ppm for 11a and 12a , respectively , upon ligand coordination ( l1 and l2 ) to the metal(ii)-arene moiety . the nearest to the metal binding site pyrazolopyridine proton h1a was not detected for 11a , 11b , 12a , and 12b , and the proton resonance of h1b was also not seen for 11b or 12b . l3 displays two sets of signals originated from 7b - l3 and 4b-l3 tautomers ( see chart 1 ) . the signals of pyrazolopyridine moieties are partially overlapped ( e.g. , h1a ( h1a ) at 14.47 and 14.43 ppm , h4a ( h4a ) at 8.99 and 8.98 ppm , h6a ( h6a ) at 8.75 ppm ) , whereas the signals of the benzimidazole moieties are better resolved ( see table s1 in the supporting information ) . according to the h , h roesy plot , one of the ch2 groups at 4.80 ppm couples with the nh proton at 13.25 ppm , indicating their attribution to the 7b - l3 tautomer , whereas another nh proton at 13.22 ppm gives a cross - peak with h7b at 7.47 ppm and belongs to 4b-l3 tautomer ( figure 1 ) . tautomers 7b - l3 and 4b-l3 are present in solution in 1:1.3 molar ratio and give , for the substituted benzimidazole moiety , two singlets ( h1b at 13.22 ppm , h1b at 13.25 ppm ) , two doublets of doublets ( h7b at 7.47 ppm , h4b at 7.72 ppm ) , one multiplet ( h5b , h6b , h5b , h6b at 7.287.21 ppm ) , two ch2 ( 4.80 ( h10b ) , 4.96 ( h10b ) ppm ) and two ch3 singlets at 3.37 ( h11b ) and 3.44 ( h11b ) ppm . the absence of cross - peaks between h7b and h4b in the h , h cosy plot supports their relation to the two different molecules . the binding site in 4b-l3 tautomer is sterically shielded by a methoxymethyl group . consistent with this nmr spectra display , only one set of signals is shown for 13a and 13b with the coordination of the 7b - l3 tautomer to ruthenium(ii ) and osmium(ii ) via n2a and n3b ( see scheme 4 ) . the preference for coordination of the 7b - l3 tautomer is also confirmed by h , h roesy plots : h4b ( 7.99 ( 13a ) , 7.91 ( 13b ) ppm ) has couplings with ch protons of cymene ring . the cross - peak between h10b at 4.88 ppm ( 13a ) and nh at 13.88 ppm ( 13a ) enabled the assignment of this singlet to a benzimidazole moiety ( h1b ) . in addition , the chemical shifts for the c atoms of the benzimidazole moiety ( c4b , c7b , c5b , c6b ) of the coordinated ligand and metal - free 7b - l3 tautomer are very similar ( see table s2 in the supporting information ) . the nitrogen resonance at 122.9 ppm ( 13a ) compares well to the benzimidazole nh chemical shift in metal - free l3 at 121.4 ppm . as for 11a , 11b , 12a , and 12b , the nearest to the coordination place pyrazolopyridine proton h1a resonance was not detected . according to the h , h roesy plots of 11a , 12a , 13a , and 13b only ch cymene ring protons have couplings with the nearest h4b benzene ring proton , suggesting that the isopropyl or methyl groups are further away from the h4b proton . the results of the xrd studies of [ oscl(-p - cymene)(l1)]cl4h2o ( 11b4h2o ) , [ oscl(-p - cymene)(l2)]cl ( 12b ) , [ oscl(-p - cymene)(l2)]cl2ch3oh2h2o ( 12b2ch3oh2h2o ) , [ rucl(-p - cymene)(l3h ) ] ( 13c ) , [ rucl(-p - cymene)(l3)]cl[rucl(-p - cymene)(l3h)]ch3oh ( 13dch3oh ) and [ oscl(-p - cymene)(l3)]cl[oscl(-p - cymene)(l3h)]0.75ch3oh0.25h2o ( 13e0.75ch3oh0.25h2o ) are shown in figures 2 , figure s2 in the supporting information , and figures 36 , respectively . all complexes have a typical three - legged piano - stool geometry of ruthenium(ii ) and osmium(ii ) arene complexes , with an -bound p - cymene ring forming the seat and three other donor atoms ( two nitrogens n1 and n5 of the corresponding 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridine and one chlorido ligand ) as the legs of the stool . selected bond distances and angles are quoted in the figure captions . all complexes crystallize as racemates , because of the presence of the stereogenic metal center . fragment of the crystal structure of 11b4h2o showing nitrogen atoms n3 and n4 , which act as proton donors in intermolecular hydrogen bonding interactions n3hcl2 [ n3cl2 3.067(7 ) , n3hcl2 177.3 ] and n4ho3 [ n4o3 2.671(9 ) , n4ho3 170.9 ] ; thermal ellipsoids have been drawn at 50% probability level . selected bond lengths and angles : os cl1 , 2.421(2 ) ; os c(arene)av , 2.198(32 ) ; c1n2 , 1.349(11 ) ; n2n1 , 1.366(10 ) ; n1c6 , 1.357(11 ) ; c6c7 , 1.428(12 ) ; c7n5 , 1.345(11 ) ; n5c13 , 1.391(11 ) ; n1os n5 , 75.6(3) ; n1os cl1 , 85.5(2) ; n5os cl1 , 83.4(2). the bidentate 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines , which can have different substituents in positions 5a and 7b , reveal different acid base properties . it can act as a neutral organic ligand , with nitrogen atoms n2 and n4 as proton donors involved in intermolecular hydrogen bonding interactions n4ho1(x + 1 , y + 1 , z + 2 ) [ n4o1 , 2.730(4 ) ; n4ho1 , 176.1 ] and n2ho3(x + 2 , y + 1 , z + 1 [ n2o3 , 2.697(4 ) ; n4ho1 , 172.3 ] with one methanol and one water molecule , respectively , as is the case for 12b2ch3oh2h2o ( figure 3 ) or n2hcl2(cl2x ) and n4hcl1(x , y , z + 2 ) [ n4cl1 , 3.213(9 ) ; n4ho1 , 162.91 ] in 12b ( see figure s2 in the supporting information ) , correspondingly . the ligand can be protonated at n3 ( n3hcl2 ) and deprotonated at n2 [ n2h o4 ( x + 1 , y + 1 , z + 1 ) with n2o4 2.923(9 ) , n2h o4 138.7 ] ( overall charge zero ) with atom n4 as a proton donor to one of the four co - crystallized water molecules n4ho3 , as occurs in 11b4h2o ( see figure 2 ) . ortep plot of the structure of the cation [ oscl(-p - cymene)(l2 ) ] in 12b2ch3oh2h2o . thermal ellipsoids have been drawn at the 50% probability level . selected bond lengths and angles : os cl1 , 2.4043(1 ) ; os c(arene)av , 2.197(26 ) ; c1n2 , 1.361(5 ) ; n2n1 , 1.344(4 ) ; n1c6 , 1.336(5 ) ; c6c7 , 1.447(6 ) ; c7n5 , 1.335(5 ) ; n5c13 , 1.380(5 ) ; n1os n5 , 74.73(13) , n1os cl1 , 84.29(10) ; and n5os cl1 , 83.25(10). in 13c , the ligand was found to be deprotonated at n2 , acting as a proton acceptor in the intermolecular hydrogen bonding interaction n2h n4 ( i denotes symmetry transformations x , y + 1.5 , z + 0.5 ) used to generate equivalent atoms ) [ n2n4 , 2.896(7 ) ; n2h n4 , 155.6 ] ( see figure 4 ) . ortep plot of the complex [ rucl(-p - cymene)(l3h ) ] ( 13c ) . thermal ellipsoids have been drawn at 30% probability level . selected bond lengths and angles : ru cl , 2.399(2 ) ; ru n1 , c(arene)av , 2.186(31 ) ; c1n2 , 1.366(8 ) ; n2n1 , 1.353(7 ) ; n1c6 , 1.362(7 ) ; c6c7 , 1.426(9 ) ; c7n5 , 1.335(8 ) ; n5c13 , 1.398(8 ) ; n1ru n5 , 75.9(2) ; n1ru cl , 87.35(17) ; and n5ru cl , 85.73(17). complexes 13dch3oh and 13e0.75ch3oh0.25h2o crystallized both in the centrosymmetric triclinic space group p1. the asymmetric unit in both consists of a neutral complex [ mcl(-p - cymene)(l3h ) ] and a complex cation [ mcl(-p - cymene)(l3 ) ] ( m = ru or os ) , a chloride counteranion and co - crystallized solvent ( methanol or methanol / water ) . deprotonation of the organic ligand in [ mcl(-p - cymene)(l3h ) ] is corroborated by the presence of hydrogen bonding of the type n2ah n2b ( x + 1 , y + 1 , z + 1 ) in the crystal structure of the ruthenium complex 13dch3oh ( figure 5 ) and a similar interaction n2bh n2a ( x , y + 1 , z ) [ n2bn2a , 2.810(9 ) ; n2bh n2a , 170.1 ] in the crystal of the osmium analogue 13e0.75ch3oh0.25h2o . in figure 6 the structure of [ oscl(-p - cymene)(l3h ) ] is shown . in both structures , the atoms n4a and n4b act as proton donors in strong hydrogen bonding interactions to the chloride counteranion , namely , n4ah cl2 ( x + 1 , y + 2 , z + 1 ) [ n4cl2 , 3.275(6 ) ; n4ah cl2 , 176.9 ] , n4bh cl2 [ n4bcl2 , 3.211(5 ) ; n4bh cl2 , 176.0 ] ( 13dch3oh ) and n4ah cl2 ( x + 1 , y + 1 , z + 1 ) [ n4acl2 , 3.273(8 ) ; n4ah cl2 , 177.0 ] , n4bh cl2 [ n4bcl2 , 3.204(7 ) ; n4bh cl2 , 177.0 ] ( 13e0.75ch3oh0.25h2o ) . fragment of the crystal structure of [ rucl(-p - cymene)(l3)]cl[rucl(-p - cymene)(l3h)]ch3oh ( 13dch3oh ) showing the intermolecular hydrogen bonding n2a hn2b [ n2an2b ( x + 1 , y + 1 , z + 1 ) , 2.814(7 ) ; n2a hn2b , 163.3 ] . selected bond lengths and angles : ru1a cl1a , 2.3952(17 ) ; ru1a c(arene)av , 2.194(33 ) ; c1a n2a , 1.358(8 ) ; n2a n1a , 1.354(7 ) ; n1a c6a , 1.350(8 ) ; c6a c7a , 1.441(9 ) ; c7a n5a , 1.335(8 ) ; n5a c13a , 1.381(8 ) ; n1a ru1a n5a , 75.6(2) ; n1a ru1a cl1a , 84.45(15) ; and n5a ru1a cl1a , 85.05(15). ortep plot of [ oscl(-p - cymene)(l3h ) ] in [ oscl(-p - cymene)(l3)]cl[oscl(-p - cymene)(l3h)]0.75ch3oh0.25h2o ( 13e0.75ch3oh0.25h2o ) . selected bond lengths and angles : os1a cl1a , 2.402(2 ) ; os1a n1a , 2.068(7 ) ; os1a n5a , 2.086(7 ) ; os1a c(arene)av , 2.192(25 ) ; c1a n2a , 1.349(10 ) ; n2a n1a 1.369(9 ) ; n1a c6a , 1.361(10 ) ; c6a c7a , 1.431(11 ) ; c7a n5a , 1.339(10 ) ; n5a c13a , 1.398(11 ) ; n1a os1a n5a , 75.1(3) ; n1a os1a cl1a , 83.56(18) ; and n5a os1a cl1a , 84.2(2). ligands l1l3 , as well as the corresponding ruthenium(ii ) ( 11a13a ) and osmium(ii ) ( 11b13b ) arene complexes , were studied with regard to their capacity of inhibiting cell growth in vitro in the human cancer cell lines ch1 ( ovarian carcinoma ) , sw480 ( colon carcinoma ) , and a549 ( non - small cell lung cancer ) , yielding the ic50 values listed in table 2 . all compounds show the strongest effect in the generally chemosensitive ch1 cells , whereas the more chemoresistant a549 cells are also less affected by the compounds investigated here . > l2 > l1 , indicating that bromination ( l2 , l3 ) and , even more so , the double substitution ( bromination and an additional replacement of h by a methoxymethyl group ( l3 ) ) are advantageous , with regard to activity . these structure activity relationships are also reflected in the rank orders of the corresponding ruthenium and osmium complexes for the ruthenium complexes , 13a > 12a > 11a , and for the osmium complexes , 13b > 12b > 11b . however , the ic50 values are shifted to higher concentrations ( see figure 7 ) . the differences between the ruthenium and osmium analogues are mostly small ( ic50 values differ only up to a factor of 2.4 ) , with the osmium complexes being at least as active as their ruthenium counterparts . ch1 denotes ovarian cancer , human ; sw480 denotes colon carcinoma , human ; and a549 denotes non - small - cell lung carcinoma , human . 50% inhibitory concentrations ( mean value standard deviation from at least three independent experiments ) obtained by the mtt assay ( 96-h exposure ) . concentration effect curves of each ligand , compared to the corresponding ruthenium and osmium complexes , in ch1 ovarian cancer cells ( mtt assay , 96 h exposure ) : ( a ) l1 , 11a , 11b ; ( b ) l2 , 12a , 12b ; and ( c ) l3 , 13a , 13b . both the presence of substituents in the ligands and complexation result in a marked shift of antiproliferative activity . since 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines have been reported to be potent cdk inhibitors , we expected the investigated ligands and complexes to induce cell cycle perturbations . to confirm this assumption in a sensitive cell line , exponentially growing ch1 cells were treated with the compounds for 24 h , stained with propidium iodide , and analyzed for their dna content by fluorescence - activated cell sorting ( facs ) . surprisingly , the metal - free ligands l1l3 turned out to exert only modest effects on cell cycle distribution , with a slight increase of the g2/m fraction from 32% in the untreated control to 53% by 20 m l2 as the strongest effect observed in this setting ( higher concentrations of this compound led to disintegration of cells already after 24 h ) . however , the less cytotoxic ruthenium complexes 12a and 13a , both bearing substituted ligands ( l2 and l3 correspondingly ) , cause a more pronounced g2/m phase arrest , as reflected by an increase of this cell fraction to 65% at 80 m and 59% at 40 m , respectively , and a concomitant decrease of the g0/g1 fraction to 21% and 24% ( compared to 42% in controls ) , whereas ruthenium complex 11a bearing an unsubstituted ligand l1 is devoid of activity on the cell cycle . on the other hand , the osmium complexes do not generally show stronger effects on the cell cycle than the metal - free ligands , perhaps with the exception of 13b , which induces an increase of the g2/m fraction up to 53% at 80 m , accompanied by a decline of the g0/g1 fraction to 31% ( see figure 8) . concentration - dependent effects of metal - free ligands ( top ) , and the corresponding ruthenium ( middle ) and osmium complexes ( bottom ) , on the cell cycle distribution of ch1 cells ( ( ) g0/g1 , ( ) s , and ( ) g2/m phase ) . although the lack of generally pronounced cell cycle effects does not argue for a strong role of cdk inhibition in the mechanism of action of the investigated compounds , inhibitory potencies were studied in cell - free experiments with two recombinant cdk / cyclin complexes , by means of the histone h1 kinase assay . results reveal that all compounds are capable of inhibiting kinase activities in a concentration - dependent manner , being more effective on cdk2/cyclin e than on cdk1/cyclin b ( see figure 9 ) . in contrast to the observed cell cycle effects , but in accordance with antiproliferative activities , cdk - inhibitory potency of the metal - free ligands is consistently higher than that of the metal complexes . in particular , only l1l3 effectively inhibit cdk2/cyclin e in low concentrations ( 1 m or 10 m ) , whereas all complexes require higher concentrations to exert > 50% inhibitory effects . as in the mtt assay , differences between the effects of corresponding ruthenium and osmium complexes are minor , compared to the differences from those of the metal - free ligands . concentration - dependent effects of metal - free ligands ( l1l3 ) as well as corresponding ruthenium ( 11a13a ) and osmium complexes ( 11b13b ) , on kinase activities of recombinant cdk1/cyclin b ( top ) and cdk2/cyclin e ( bottom ) .", "the known multistep synthesis of 3-(1h - benzimidazol-2-yl)-1h - pyrazolo[3,4-b]pyridines , which we have modified , essentially afforded three organic compounds ( l1l3 ) that possess cdk - inhibiting properties . these were used as bidentate ligands , and six novel organometallic complexes of the general formula [ mcl(-p - cymene)(l)]cl , where m = ru ( 11a , 12a , 13a ) or os ( 11b , 12b , 13b ) and l = l1l3 , have been synthesized and comprehensively characterized using spectroscopic and x - ray diffraction methods . complexation of l1l3 with ruthenium or osmium yielded compounds with increased solubility in the biological medium , yet lowered antiproliferative activity in human cancer cell lines . modulation of biological activities by substitution at the ligands can be accomplished in the metal - free molecules and their metal complexes in a similar way . the known cdk - inhibitory activity of the ligands could be confirmed in cell - free experiments , in particular in cdk2/cyclin e , and their stronger effects on cdk activity parallel their higher capacity of inhibiting cancer cell growth in vitro , compared to their metal complexes . nevertheless , the lack of pronounced effects on the cell cycle of chemosensitive ovarian cancer cells argues against a major role for inhibition of cell growth , at least in this setting ." ]

[ "fibro - osseous lesions of the jaws represent a diverse group of entities which include developmental ( hamartomatous ) lesions , reactive or dysplastic processes and neoplasms . benign fibro - osseous lesions of the head and neck region are uncommon and represent a wide range of tumors sharing some histopathological features ; which comprise fibrous dysplasia , ossifying fibroma ( of ) , and cement - osseous dysplasia . of can be further divided into conventional and juvenile forms ( juvenile ossifying fibroma ( jof ) ) . jof has to be distinguished from a larger group of ofs on the basis of the age of the patient , site of involvement and clinical behaviour . according to the world health organization ( who ) classification of odontogenic tumors 2005 , jof is further subdivided into psammomatoid jof ( psjof ) and trabecular jof ( trjof ) . benjamins in 1938 first reported psjof as an osteoid fibroma with atypical ossification of the frontal sinus , golgi in 1949 called it as psammomatoid ossifying fibroma , and johnson in 1952 coined the term juvenile active ossifying fibroma . according to who classification of odontogenic tumors 2005 , it was named as the term juvenile psammomatoid ossifying fibroma is now used to designate the neoplasm of the craniofacial skeleton of young age with well - defined clinicopathological features . the pathogenesis of these jaw lesions are related to the abnormal development of basal generative mechanism that is essential for root formation . this paper highlights a rare entity of psjof involving the maxillary sinus and nasal cavity on the left side .", "a 20-year - old female patient reported with a painless progressive swelling in the left cheek region and difficulty in breathing since 1 year . past medical history revealed that the patient underwent surgery in a private dental clinic 5 years back for the impacted tooth 23 which was associated with pathology . the swelling was 6 4 cm in size approximately extending anteroposteriorly from ala of the nose to 5 cm from tragus of the ear on the left side . nasal polyp was seen in the left nostril with obliteration of left ala of the nose [ figure 1 ] . nasal polyp seen in left nostril with obliteration of left ala of nose intraoral examination presented a swelling extending anteroposteriorly from the distal aspect of 21 to mesial aspect of 26 ; medially till the mid palatine raphe and laterally the buccal vestibule was obliterated and the swelling extended from 21 to 26 . paranasal sinus ( pns ) x - ray revealed haziness in the left maxillary sinus . computed tomography ( ct ) scan confirmed well - defined mixed radiolucent and radiopaque areas with calcifications extending superoinferiorly from infraorbital rim to alveolus and anteroposteriorly from the nasal septum to post zygomatic buttress on left side [ figure 2 ] . axial computed tomography revealing well - defined radiolucent and radiopaque areas with calcifications histopathological examination of incisional biopsy revealed connective tissue stroma with numerous spherical / irregular ossifications interspersed with cellular fibrous tissue [ figure 3 ] . the ossifications showed peripheral brush border surrounded by an eosinophilic rimming [ figure 4 ] . haemorrhagic areas were also seen . the constellation of clinical , radiological , and histopathological features of this lesion supported an interpretation of psammomatoid variant of jof . photomicrograph of hematoxylin and eosin ( h&e ) stained section ( 100 ) showing numerous spherical and irregular calcifications interspersed with fibrous tissue photomicrograph of h&e stained section ( 400 ) showing peripheral brush border surrounded by eosinophilic rimming under general anesthesia , a weber - ferguson incision was given to expose the complete lesion . subtotal maxillectomy was performed and the tumor mass along with nasal and ethmoidal polyps were removed with the help of a chisel and mallet . after complete removal of the mass , borders were carefully osteotomized to avoid the chances of recurrence [ figure 5 ] . the excised specimen was sent for histopathological examination [ figure 6 ] and the diagnosis of psjof was confirmed .", "jof are benign , potentially aggressive fibro - osseous lesions of the craniofacial bones . the word psjof is a unique variant of jof that has a predilection for orbit and pnss accounting for about 72% followed by calvarium 11% , maxilla 10% , and mandible 7% . the ethmoidal sinuses are most commonly involved , followed by the frontal sinuses , the maxillary sinuses , and the sphenoid sinus . both the variants of jof show a predilection for males . the swelling in this case is associated with maxilla involving maxillary sinus and nasal cavity in a 20-year - old female patient . table 1 summarizes the clinical presentation of case series of psjof reviewed in the literature . the patients may develop exopthalmoses , bulbar displacement , and nasal obstruction . in the present case because of the extension of the tumor into the nasal cavity , nasal obstruction was present on the left side . radiographically , psjof can be radiolucent , radiopaque , or mixed depending upon cystic changes and the degree of calcification . sclerotic changes are evident in the lesion which may show a ground - glass appearance . histologically , psjof shows highly cellular fibrous stroma often with whorled pattern containing closely packed spherical ossicles resembling psammoma bodies . these ossicles are round to oval in shape which have a basophilic center and peripheral pink rim showing some radiating fibers which corroborates with the microscopic features provided in the present case . psjof should be differentiated from extracranial meningioma with psammoma bodies , which demonstrates epithelial membrane antigen ( ema ) positivity and even the psammomatoid ossicles in psjof are clearly different from spherical true psammoma bodies . other differential diagnosis include fibrous dysplasia , osteoma , cementoblastoma , well - differentiated osteosarcoma , psammomatous extracranial meningioma [ table 2 ] . differential diagnosis the clinical management of smaller lesions is simple excision with surrounding marginal bone , whereas larger lesions warrant more aggressive surgical management . prognosis is good with a recurrence rate of about 30 - 58% . no malignant transformation has been documented . even though these lesions tend to locally invade , there were no cases of metastasis being reported .", "therefore , it is very important to correlate the clinical , radiographical , and histopathological findings for proper treatment . early detection and complete surgical excision of the lesion followed by long - term follow - up is necessary for proper clinical management ." ]

[ "endoscopic methods are among the most important and frequently employed means of treating pancreatic pseudocysts . when possible an endoscopic approach should generally be attempted in all patients with pseudocysts , and for pancreatic fluid collections endoscopic transmural drainage is the treatment of choice . if the cyst contains more than 2/3 solid material a self - expandable stent should be selected to ensure effective drainage . an additional advantage of the self - expandable metal stent is that the necrotic tissue contained within the cyst can be actively removed using an endoscope . this article discusses the unusual case of a stent that became dislodged and migrated into the omental bursa . following this migration some time was allowed to elapse , and the gastrotomy closed completely . since a simple endoscopic retrieval was no longer possible , a combined laparoscopic - endoscopic technique ( rendezvous technique ) was used instead , and the stent was successfully retrieved .", "in 2013 , a 49-year - old male smoker with a history of diabetes mellitus and arterial hypertension developed severe necrotizing pancreatitis . imaging revealed paralytic ileus along with an expanding cystic formation near the liver hilus and pancreatic head with compression of the duodenum . a pseudocyst near the left abdominal wall with enormous but stable proportions was also found to be compressing the left colon transversum ( 14 cm ) . due to the extreme thinness of the wall areas of necrosis in the corpus area developed , necessitating transgastral cystotomy and placement of a wall stent ( niti - s nagi stent - taewoong - medical co , seoul , south korea , 14 mm wide , 22 mm long ) . twenty - four hours later , however , the stent became dislodged and migrated into the omental bursa . an attempt at endoscopic removal the following day was unsuccessful , making the insertion of a second stent ( nagi fully covered taewoong,16 mm wide , 22 mm long ) necessary . endoscopic retrograde cholangiopancreatography ( ercp ) was then performed , along with papilotomy and insertion of an 8.5 fr . two weeks later , after significant clinical improvement and drainage of necrotic tissue , the second transgastric stent was removed with no complications . for technical reasons , retrieval of the migrated stent was not possible . at follow - up gastroscopy 4 weeks later the gastric wall had completely closed and hence that endoscopic localization of the stent was no longer possible . in november 2013 the pseudocysts had regressed significantly , and a computed tomography of the abdomen showed the migrated stent in the omental bursa with no direct contact to the gastric wall . in february 2014 , we decided to attempt a laparoscopic - endoscopic retrieval of the displaced wall stent . in the first step , intraoperative endoscopy demonstrated normal gastric mucosa so that a purely macroscopic localization of the stent was not possible [ figure 1 ] . after localization of the stent via image converter we made a targeted 3 cm incision into the posterior gastric antrum using an endo knife ( erbe , germany ) . due to the location of the stent deep within the omental bursa neither optical nor palpatory contact could be made , and consequently , endoscopic retrieval was not an option . in the next step , first , electrocoagulation was used to make three incisions in the anterior wall of the greater gastric curvature ( two in antrum , one in fundus ) . then , 3 ( applied medical kii , usa ) 5 mm trocars were inserted [ figure 1 ] . dissection within the omental bursa was performed using two dissectors , inserted through an incision that had been made endoscopically . after localization of the stent and some blunt dissection it was possible to carefully dislodge the stent into the gastric lumen [ figure 2 ] . after further inspection , the transgastral trocars were removed , and the gastric wall incisions were closed with lahodny stitches ( ethicon , usa ) . the postoperative clinical course was without complications , and the patient was discharged on the 6 postoperative day . at follow - up 4 weeks later , no complications were found . the gastric wall has closed , and the stent can not be localized ( a ) . three applied kii 5 mm trocars in the stomach ( b ) blunt dissection near the omental bursa after incision and retrieval of the stent ( a ) .", "currently , endoscopic ultrasound - guided drainage is a safe and effective means of treating pancreatic fluid collections . compared with surgical or percutaneous drainage it is less invasive and results in lower mortality , costs , and hospitalization times . drainage - related complications either may be related directly to the procedure or can occur in relation to the stents themselves . the stent should not , however , be removed before complete involution of the pseudocyst or before the passage of at least 2 months . on average , 15% of stents will become accidentally dislocated , but efforts to develop technically superior stents continue . tllez - vila et al . , for example , report on fully covered self - expandable metal stents with an innovative anti - migration system . describe a stent - in - stent combination which employs the mechanical advantages of both plastic stents and fully covered self - expandable metal stents . although these new solutions will help reduce the rate of migration , they will not eliminate it completely . in most cases of stent migration endoscopic retrieval can be performed without difficulty . in cases of extraluminal loss , however , a surgical approach is often necessary , and a minimally invasive exploration of the abdominal cavity is the approach of choice . retrieval from the retroperitoneal space may pose a more significant challenge due to the proximity of the large vessels . when endoscopic retrieval fails a combined laparoscopic - endoscopic approach offers an alternative to open surgery . the choice of technique is likely best predicated by individual patient presentation and local expertise . with this endoscopy - laparoscopy combination ( rendezvous technique )" ]

[ "adenomyoepithelioma has been described as a rare benign neoplasm that occurs almost exclusively in the breast . in the breast it is defined as a neoplasm composed of two structures , namely , tubules limited by an inner epithelial layer of duct - like cells and an outer layer with mostly clear myoepithelial cells . apart from the breast , adenomyoepitheliomas have been described in the salivary glands and in the lung . in the skin , these neoplasms seem to be exceedingly rare , with only few reports of adenomyoepitheliomas published to date [ 47 ] . we present the case of a 53-year - old woman with a clinically benign nodular cutaneous lesion that revealed histopathologic and immunohistochemical features of adenomyoepithelioma .", "a 53-year - old woman presented to her dermatologist with a 3 cm asymptomatic nodule on the left forearm . the biopsy specimen consisted of a 2.5 1.9 1.5 cm tan ellipse of skin and contained a hard yellow nodule measuring 1.5 cm in greatest dimension . examination of the sections at scanning magnification revealed beneath an intact epidermis a zone of fibrosis within the upper part of the dermis ( figure 1 a , b ) . beneath the scar , there was a large , lobulated neoplasm , which for the most part was surrounded by a compressed fibrous pseudocapsule . each of the aggregates of neoplastic cells varied in sizes and shapes and some were large and nodular ( figure 1a c ) . at higher magnification , most of the cells that constituted the lesion displayed myoepithelial differentiation with polygonal and plasmacytoid features ( figure 2 ) . the cells presented sometimes as solid sheets , but also as cords and solitary units . in places glandular and ductal structures were evident ; in some areas apocrine - type secretion within glandular structures was found ( figure 2 a c ) . f ) . in some areas cells were present within a myxoid stroma ( figure 2 g foci of cells with pleomorphic nuclei and mitotic figures were identified ( figure 2 k the myoepithelial cellular component of the neoplasm stained for s100 protein and was negative for cytokeratin and carcinoembryonic antigen ( cea ) expression .", "we describe a cutaneous neoplasm composed of myoepithelial cells and a focal epithelial and glandular component . the s100 positivity indicates myoepithelial cells , while epithelial - glandular cells are negative for s100 protein expression . based on findings by conventional microscopy and immunohistochemistry , this neoplasm shows myoepithelial differentiation and focal epithelial lined tubules with features of apocrine secretion , findings that are consistent with the diagnosis of primary adenomyoepithelioma of the skin . while various adnexal neoplasms with a myoepithelial cellular component have been described in the skin , adenomyoepithelioma of the skin seems to be extremely rare . what are the criteria that distinguish adenomyoepithelioma from other benign cutaneous neoplasms with myoepithelial differentiation ? while myoepithelioma is defined as a benign neoplasm consisting exclusively of myoepithelial cells embedded in a myxoid stroma , adenomyoepithelioma shows in addition to myoepithelial cells a second component displaying various degrees of epithelial - ductal differentiation . chondroid syringoma , at the other end of the spectrum is a benign adnexal neoplasm that , in addition to apocrine epithelium , manifests various degrees of follicular and/or sebaceous differentiation . clinically , myoepitheliomas occur usually in children and young adults and are located on the extremities , while mixed apocrine tumors affect older individuals and are usually found on the face . the few cases of cutaneous adenomyoepitheliomas that have been described to date , including the present case , were described in older patients and were located on the extremities and on the trunk . pleomorphic adenoma in the breast is regarded as the analogue to mixed apocrine tumor in the skin , while adenomyoepithelioma of the breast is defined as a neoplasm with nodular aggregations of clear myoepithelial cells that surround epithelial lined tubules . occasionally , the myoepithelial component predominates and loses the close association with epithelial structures . in the skin , the predominance of myoepithelial cells in relation to ductal epithelial structures lacking features of follicular and/or sebaceous differentiation separates this neoplasm from mixed apocrine tumor . therefore , myoepithelioma , adenomyoepithelioma and mixed apocrine tumor lie in the spectrum of neoplasms with pure myoepithelial differentiation at one end and apocrine - sebaceous - follicular differentiation at the other . the most important question for the patient is the biologic potential of such a lesion . while the chronic course in our patient and the majority of the histopathologic features suggest a benign neoplasm , foci of cells having pleomorphic nuclei and mitotic figures were present . both findings could indicate the potential for locally aggressive behavior and/or metastasis , as has been rarely described in adenomyoepitheliomas of the breast . therefore , adenomyoepitheliomas of the skin should be completely excised , as has been recommended in the reported case ." ]

[ "although the human genome sequence was released a decade ago , the role of functional noncoding rnas ( ncrnas ) is much less understood compared with their coding counterparts . several previous studies have demonstrated that the human genome is pervasively transcribed ( 14 ) , but thoroughly cataloging all the rna species ( especially ncrna ) is challenging . undiscovered ncrnas might be rare , transient or beyond the detection limits of conventional approaches . furthermore , ncrnas also tend to be idiosyncratic to species and tissues ( 5,6 ) . nevertheless , advances in rna - seq have provided a new method of surveying the whole transcriptome to an unprecedented degree . recent genome - wide studies revealed tens of thousands of novel transcripts , the majority of which were long noncoding rnas ( lncrnas , > 200 nt ) ( 49 ) . although a few dozen lncrnas have been characterized to some extent and are reported to have critical roles in diverse cellular and disease development processes ( 6,1014 ) , the biogenesis and function of most lncrnas remain unclear . accurate and quantitative assessment of coding potential is the first step toward comprehensive annotation of newly discovered transcripts . until now , prediction of coding potential heavily relied on sequence alignment , either pairwise homology search for protein evidence such as that used in the coding - potential calculator ( cpc ) and portrait methods ( 15,16 ) or multiple alignments to calculate the phylogenetic conservation score such as that used in the phylogenetic codon substitution frequencies ( phylocsf ) and rnacode methods ( 17,18 ) . alignment - based approaches are particularly useful for highly conserved protein - coding genes and , to a lesser extent , short genes encoding housekeeping or regulatory rnas ( e.g. snrnas , snorna , transfer rna ) . however , these approaches can not immediately apply to all the novel transcripts because of several intrinsic limitations . first , most newly discovered transcripts are lncrnas , which tend to be lineage specific and less conserved ( 5,6 ) . for example , only 29 of 550 lncrnas identified from zebrafish had detectable sequence similarity with putative mammalian orthologs ( 6 ) , and only 993 of 8195 human lncrnas have orthologous transcripts in other species ( 5 ) . second , considerable fractions of lncrnas are overlapped with either the sense or antisense strand of protein - coding genes . these lncrnas can not be correctly classified by homology searching because they would have significant matches to protein - coding genes ( 3,8,19 ) . third , the reliability of alignment - based approaches largely depends on the quality of alignments ( 20 ) . this is problematic because most widely used multiple - sequence alignment tools use heuristics and do not guarantee optimal alignments . for instance , cpc and phylocsf took 2 days to evaluate the coding potential of 14 353 lncrnas identified by cabili et al . this problem is getting more attention as massive - scale rna sequencing is increasingly being performed . consequently , a more accurate , robust and faster method that does not rely on sequence alignment is needed to distinguish ncrnas , especially lncrnas , from protein - coding genes . here , we present coding - potential assessment tool ( cpat ) , an alignment - free program , which uses logistic regression to distinguish between coding and noncoding transcripts on the basis of four sequence features . cpat is highly accurate ( 0.967 ) and extremely efficient ( 10 000 times faster than cpc and phylocsf , and 50 times faster than portrait ) . cpat needs only the sequence or coordinate file as input , and it is straightforward to use . we expanded the availability of cpat to a larger scientific audience via a web interface , which allows users to submit sequences and receive the prediction results back almost instantaneously ( http://lilab.research.bcm.edu/cpat/index.php ) .", "coding - potential prediction is essentially a binary decision problem , which makes logistic regression a suitable approach . as an alignment - free method , all selected features ( predictor variables ) the first feature was the maximum length of the open reading frame ( orf ) . orf length is one of the most fundamental features used to distinguish ncrna from messenger rna because a long putative orf is unlikely to be observed by random chance in noncoding sequences . despite the simplicity , orf length has high concordance with more sophisticated discrimination methods and remains the primary criterion in almost all coding - potential prediction methods ( 21 ) . the second feature was orf coverage defined as the ratio of orf to transcript lengths . this feature also has good classification power , and it is highly complementary to , and independent of , the orf length ( supplementary figures s1 and s3 ) . some large bona fide ncrnas may contain putative long orfs by random chance ( 5 ) , and thus can not be classified correctly by orf length alone . fortunately , those large ncrnas usually have much lower orf coverage than protein - coding rnas ( figure 1b ) . \n figure 1.score distribution between coding ( red ) and noncoding ( blue ) transcripts for the four linguistic features selected to build the logistic regression model ; training data set containing 10 000 coding and 10 000 noncoding transcripts were used . score distribution between coding ( red ) and noncoding ( blue ) transcripts for the four linguistic features selected to build the logistic regression model ; training data set containing 10 000 coding and 10 000 noncoding transcripts were used . the third feature we used was the fickett testcode score ( termed fickett score hereafter ) , which is a simple linguistic feature that distinguishes protein - coding rna and ncrna according to the combinational effect of nucleotide composition and codon usage bias ( 22 ) . briefly , the fickett score is obtained by computing four position values and four composition values ( nucleotide content ) from the dna sequence . the position value reflects the degree to which each base is favored in one codon position versus another . for example , position value of a ( apos ) is calculated as follows : \n\n cpos , gpos and tpos are determined in the same way . these eight values are then converted into probabilities ( p ) of coding using a lookup table provided in the original article . each probability is multiplied by a weight ( w ) for the respective base , where the value of w reflects the percentage of time each parameter alone successfully predicts coding or noncoding function for the sequences of known function . finally , the fickett score is calculated as follows : \n\n the fickett score is independent of the orf , and when the test region is 200 nt in length ( which includes most lncrna ) , this feature alone can achieve 94% sensitivity and 97% specificity , with the fourth feature we used was hexamer usage bias ( termed hexamer score hereafter ) . this may be the most discriminating feature because of the dependence between adjacent amino acids in proteins ( 23 ) . the hexamer score can be computed in numerous ways ; here , we used a log - likelihood ratio to measure differential hexamer usage between coding and noncoding sequences . for a given dna sequence , we calculated the probability of the sequence under the model of coding dna and under the model of noncoding dna , and then we took the logarithm of the ratio of these probabilities as the score of coding potential . we used f ( hi ) ( i = 0 , 1 , , 4095 ) and f ( hi ) ( i = 0 , 1 , , 4095 ) to represent in - frame hexamer frequency , calculated from coding and noncoding training data sets ( described below ) , respectively . for a given hexamer sequence s = h1 , h2 , , hm , \n\n hexamer score determines the relative degree of hexamer usage bias in a particular sequence . positive values indicate a coding sequence , whereas negative values indicate a noncoding sequence . we build a logistic regression model using these four linguistic features as predictor variables . a test was used to evaluate whether our logit model with predictors fits the training data significantly better than the null model , which had only an intercept . we built a high - confidence training data set to measure the prediction performance of our logit model . this data set contained 10 000 protein - coding transcripts selected from the refseq database ; all transcripts had high - quality protein sequences annotated by the consensus coding sequence project . we evaluate the model with a 10-fold cross - validation and measured its sensitivity , specificity , accuracy , precision and area under the curve ( auc ) characteristics . the receiver operating characteristic ( roc ) curve and precision recall ( pr ) curve were generated using rocr package ( 24 ) . we also built a nonparametric two - graph roc curve for selecting the optimal cpat score threshold that maximizes the sensitivity and specificity of cpat while minimizing misclassifications . we built an independent test data set to compare the performance of cpat with that of cpc , phylocsf and portrait . this test set composed of 4000 high - quality protein - coding genes ( refseq annotated ) and 4000 lncrnas from a human lncrna catalog ( 5 ) . assuming that all 4000 lncrnas are truly noncoding sequences , we could compute the sensitivity , specificity , accuracy and precision of the algorithms to measure their performance . those 528 genes were equally assigned to the true - negative and false - positive categories . the abbreviations in the equations below are as follows : fn , false negative ; fp , false positive ; tn , true negative ; tp , true positive \n\n\n", "all four selected features were concordantly higher in coding transcripts and lower in noncoding transcripts ( figure 1 ) . we plotted three major features ( orf size , fickett score and hexamer score ) in a three - dimensional space to evaluate their combinatorial effect ( figure 2 ) . coding and noncoding transcripts in our training data set were grouped into two distinct clusters , indicating good concordance between features . the test p value was < .001 ( = 23 548.44 ; degrees of freedom = 4 ) , indicating that the logit model as a whole fits significantly better than the null model . ten - fold cross - validation showed that cpat could achieve very high accuracy , with an auc of 0.9927 ( figure 3a ) . we also provide the pr curve because the roc curve can be misleading when the test data are largely skewed ( figure 3b ) . we use nonparametric two - graph roc curves to determine an optimal cpat score threshold that maximizes the discriminatory power ( figure 3c and d ) . according to figure 3d , a score threshold of 0.364 gave the highest sensitivity and specificity ( 0.966 for both ) for human data . \n figure 2.three-dimensional plot shows combinatorial effects of fickett score , hexamer score and orf size on 10 000 coding genes ( red dots ) and 10 000 noncoding genes ( blue dots ) . \n dashed curves represent the 10-fold cross - validation ; solid curves represent the averaged curve from 10 validation runs . ( d ) two - graph roc curve is used to determine the optimum cutoff value . three - dimensional plot shows combinatorial effects of fickett score , hexamer score and orf size on 10 000 coding genes ( red dots ) and 10 000 noncoding genes ( blue dots ) . dashed curves represent the 10-fold cross - validation ; solid curves represent the averaged curve from 10 validation runs . ( d ) two - graph roc curve is used to determine the optimum cutoff value . we compared the performance of cpat with that of cpc , phylocsf and portrait ( protein - independent support vector machine model ) using an independent test data set composed of 4000 coding genes and 4000 noncoding genes . a multiple alignment of 45 vertebrate genomes , including that of human , was downloaded from the ucsc ( university of california , santa cruz ) genome browser and was used as the input alignment for phylocsf . in general , cpat ( sensitivity : 0.96 , specificity : 0.97 ) had greater classification power compared with all other programs ( figure 4 ; supplementary tables s1 and s2 ) . although cpc had the highest sensitivity ( 0.99 ) , it suffered from poor specificity ( 0.74 ) . one possible explanation is that a significant proportion of ncrnas has a certain degree of sequence similarity to protein - coding genes . phylocsf had the least sensitivity ( 0.90 ) and the lowest specificity ( 0.63 ) . part of the reason for these outcomes is that nonconserved transcripts can not be processed by phylocsf . if we consider those 528 nonconserved transcripts as noncoding , the specificity increased from 0.63 to 0.69 , and the sensitivity remained unchanged . cpat achieved highest overall accuracy ( 0.97 ) when compared with cpc ( 0.87 ) , phylocsf ( 0.76 ) and portrait ( 0.92 ) . cpat s excellent discriminatory power was further demonstrated by the greatest separation between the score distributions of coding and noncoding sequences ( figure 5 ) . unlike cpc , phylocsf and portrait , choosing a smaller cpat score threshold to increase the sensitivity will not sacrifice too much specificity . \n figure 4.performance comparison between cpat , cpc , phylocsf and portrait using roc curves . \n figure 5.cumulative curves of coding - potential assessment score for ( a ) cpat , ( b ) portrait , ( c ) cpc and ( d ) phylocsf . cumulative curves of coding - potential assessment score for ( a ) cpat , ( b ) portrait , ( c ) cpc and ( d ) phylocsf . one could argue that phylocsf underperformed in this study because we used whole transcripts for testing rather than consecutive protein - coding exons and intergenic regions as used in its original article ( 17 ) . to address this issue , we compiled another single - exon test data set consisting of 184 protein - coding and 278 noncoding transcripts . the test results with this data set indicated that cpat ( sensitivity : 0.962 , specificity : 0.842 ) still outperformed phylocsf ( sensitivity : 0.832 , specificity : 0.588 , supplementary figure s2 ) . ( 25 ) , phylocsf ( sensitivity 0.91 , specificity 0.99 ) has better performance than cpat ( sensitivity 0.50 , specificity 0.98 ) . this is reasonable because lncrnas in our test data set are poorly conserved , whereas lncrnas in lin et al . test data set are highly conserved because they are taken from multiple - sequence alignments of three closely related drosophila species . hence , we argue that phylocsf works better if the transcripts are highly conserved , which are rare to find in lncrnas ( 5,6 ) . this also highlights the achilles heel of the alignment - based methods for detecting lncrnas . in contrast , the dramatic decrease in cpat s sensitivity is due to the lack of orf information in lin et al . test data set , which is largely composed of individual exons , and not exon - length complete transcripts . this , however , will not limit the application scope of cpat because most full - length transcripts can be constructed at the current sequencing depth ( 8) . we measured the computational speed of cpat , cpc and phylocsf on a sample of 200 sequences randomly selected from the test data set . cpat took 0.67 s to process the data , and it was four orders of magnitudes faster than both cpc [ 11 945 s ( 3.3 h ) ] and phylocsf [ 11 737 s ( 3.3 h ) ] . furthermore , computational time for the phylocsf did not include the time spent preparing multiple - alignment files for analysis . portrait was significantly faster than cpc and phylocsf , and therefore all 8000 test genes were used to evaluate its speed : cpat took 23.83 s to process the test set , and it was 48 times faster than portrait [ 1146.30 s ( 19 min ) ] .", "a number of linguistic features characterizing coding rna sequences have been developed over the past 30 years . these include maximum orf size , dinucleotide usage , codon usage bias , hexamer usage bias , nucleotide composition bias between codon positions and imperfect periodicity in base occurrences ( 23,26 ) . among these features , we selected orf features ( size and coverage ) because of their discriminatory power and ease of calculation ( 21 ) . in - frame hexamer score was selected because it has the highest prediction accuracy ( average of sensitivity and specificity ) as evaluated by fickett and tung in 1992 ( 23 ) . fickett score was selected because it simultaneously captures the compositional bias and position asymmetry , which are orthogonal to the orf features . supplementary figure s3 shows the performance of these individual features as well as the combined feature set . the combined feature set has very high sensitivity and specificity ( > 0.966 ) , leaving very little room for further improvement . annotation of genomes has always been a challenging task for biologists , and these efforts have been accelerated by deep transcriptome sequencing . distinguishing between protein - coding and noncoding sequences is the first and arguably the most crucial step in genome annotation . detecting the coding - potential of these transcripts via alignment - based software is intractable . we developed cpat , a highly accurate alignment - free method , which uses a logistic regression model to discriminate between coding and noncoding transcripts using pure linguistic features . compared with other tools , cpat is more robust , markedly faster and more convenient to use . taken together , cpat is able to accurately assess the coding potential of tens of thousands of transcripts in real - time , and will be a valuable tool for the rapidly growing rna - seq community .", "source code was implemented in c and python and is freely available at : http://code.google.com / p / cpat/. the web server was implemented in php , mysql and apache , with support for all major browsers : http://lilab.research.bcm.edu/cpat/index.php .", "supplementary data are available at nar online : supplementary tables 1 and 2 and supplementary figures 13 .", "department of defense prostate cancer program [ pc094421 to w.l . ] ; the cancer prevention and research institute of texas [ rp110471-c3 to w.l . ] ; the center for individualized medicine ( cim ) at mayo clinic ( to j.p.k . ) . funding for open access charge : cancer prevention and research institute of texas [ rp110471-c3 to w.l . ] .", "" ]

[ "beyond its role of cellular energy currency and phosphate donor , atp plays a potent signaling role through its extracellular release and activation of cell surface purinergic receptors . fast responses to atp are mediated through activation of p2x receptors , a family ( p2x1p2x7 ) of atp - activated ligand - gated ion channels and metabotropic effects through the activation of p2y receptors ( p2y12 , p2y4 , p2y6 , p2y1114 ) which couple to heterotrimeric g proteins . human leukocytes including monocytes , mast cells , neutrophils and central microglia express a diverse repertoire of p2y receptors though p2x1 , p2x4 and p2x7 are the dominant p2x subtypes present . activation of purinergic receptors in leukocytes is coupled to the production and secretion of cytokines and other pro - inflammatory molecules including prostaglandin e2 . purinergic receptors are associated with inflammation , with some receptors inhibited either directly ( p2y12 ) or indirectly through the activity of anti - thrombotic , in the case of platelet p2y12 , or anti - inflammatory agents , in the case of the action of statins on monocyte p2x4 . atp can act as a non - peptide damage - associated molecular pattern ( damp ) release from injured cells and tissues . in this fashion the release of cellular atp is unregulated and released due to cell lysis or puncture . cell surface purinergic receptors are activated by this atp damp signal which serves to initiate an inflammatory response and promote wound healing . however , atp can be released from cells physiologically and act as a critical signal for painful , inflammatory processes . do release other nucleotides including utp and udp - sugars but our focus here is atp release . mechanisms of atp release during physiological processes remain diverse and controversial .", "investigation into how cellular stress stimulates atp release in non - leukocytes suggests roles for connexin and pannexin hemichannels , maxi- and volume - regulated anion channels and efflux through the p2x7 receptor , though release routes and signal transduction mechanism underlying atp release in leukocytes remain poorly defined .", "in neutrophils atp is released in response to activation of fmlp receptor by bacterially derived n - formylmethionine . the precise release mechanism is unclear but occurs at the leading edge of migrating neutrophils . released atp and its subsequent metabolism to adenosine at the cell surface activate p2y2 and a3 receptors serving to direct cell orientation and promote migration in response to chemotactic signals . bacterially derived lipopolysaccharide can stimulate central microglia to secrete atp which in - turn activates neighboring astrocytes and modulates excitatory neurotransmission . this raises the possibility that atp can act in a feed forward loop possibly amplifying responses to itself or other external cues which couple to atp secretion .", "furthermore , such constitutive secretion leads to activation of cell surface gq - coupled p2y receptors which elevate intracellular calcium levels through release of calcium . this mode of constitutive secretion generates a constant pericellular atp cloud or halo which appears to be important in regulating intracellular calcium homeostasis following p2y receptor activation . in cells of hematopoietic lineage such as monocyte / macrophage , nk killer and mast cells , secretory lysosomes have evolved as bifunctional organelles which combine classical degradative properties with secretion . the mechanism of lysosomal atp transport remains undefined though a nucleotide transporter ( v - nut ) has been characterized for other atp containing vesicles .", "the signal transduction coupling external cues such as cytokines , chemokines and bacterially derived molecules to atp release is poorly defined . what are the release machines in leukocytes and do they differ from other cell types ? it is expected that therapeutic intervention in agonist stimulated atp release is a potentially novel route to pharmacological modulation of innate immune responses but also in chronic inflammatory disease where normal inflammatory responses are heighten and act deleteriously ." ]

[ "paraoxonases were originally discovered as enzymes hydrolyzing exogenous toxic organophosphate compounds such as insecticide paraoxon . there are three members of paraoxonases family currently known : paraoxonase 1 ( pon1 ) , paraoxonase 2 ( pon2 ) , and paraoxonase 3 ( pon3 ) , which are encoded by three separate genes on the same chromosome 7 ( human ) or chromosome 6 ( mouse ) . all three human members of the family are 70% identical at nucleotide level and 60% identical at the amino acid level . studies on enzymatic activity of paraoxonases revealed esterase and lactonase / lactonizing activities in addition to organophosphatase activity . despite of the large number of compounds that can be hydrolyzed by paraoxonase , in many cases arylesterase activity is measured to access pon1 level in biological samples . based on kinetic parameters of paraoxonases toward different substrates hydrolysis of homocysteine thiolactone by pon1 is considered to be protective against coronary artery disease ( cad ) . after the introduction of the oxidative stress hypothesis of atherosclerosis and the discovery of antioxidant effect of high - density lipoprotein ( hdl ) , pon1 attracted significant interest as a protein that is responsible for the most of antioxidant properties of hdl . purified pon1 protects hdl and low - density lipoprotein ( ldl ) from oxidation catalyzed by copper ions . pon1 inhibits copper - induced hdl oxidation by prolonging oxidation lag phase , and reduces peroxide and aldehyde content in oxidized hdl . remarkably , pon1 inhibitors pd-11612 , pd-65950 , pd-92770 , and pd-113487 lessen this antioxidative effect of pon1 . pon1 is especially effective in decomposition of linoleate hydroperoxides . also , mass - spectrometry analysis of biologically active fraction of oxidized2-arachidonoyl - sn - glycero-3-phosphorylcholine ( ox - papc ) underwent pon1 treatment showed degradation of these oxidized phospholipids by pon1 . the exact antioxidant mechanism of pon1 is not known yet , although it is known that protection is not caused by chelating of copper ions or because of potential lipid transfer from ldl to hdl . existence of an enzymatic mechanism is supported by the observation that heat inactivation of purified pon1 abolishes its antioxidant effect . some in vitro data suggest that antioxidant activity might be related to other components of purified pon1 preparations . however , experiments with pon1 deficient mouse provide strong evidences that pon1 is required to enable hdl antioxidant properties . hdl from pon1 knockout animals were more prone to oxidation and were less efficient in the protection of ldl from oxidation in co - cultured cell model of the artery wall compared with hdl from control mice . also , transfection of pon1-deficient peritoneal macrophages ( isolated from pon1 knockout mice ) with human pon1 decreased level of peroxides , lowered release of superoxide , and increased intracellular level of reduced glutathione , key observations are summarized in table 1 . summary of key facts on pon1 expression , activity , and effects in in vitro and in vivo studies", "the first pon1 messenger ribonucleic acid ( mrna)ionanalysis in different rabbit tissues was performed by northern blot , and revealed pon1 mrna expression predominately in liver . polymerase chain reaction ( pcr ) amplification using a panel of first - strand complementary deoxyribonucleic acid ( cdnas ) from 24 tissues detected pon1 expression in kidney and colon beside liver and fetal liver expression . biopsies showed pon1 mrna and protein expression in human but not in mouse gastrointestinal tract . deletion analysis in cultured cells revealed that cell type specific expression in liver and kidney is determined within first 200 bp of promoter area . there are several transcription factors and pathways that regulate pon1 expression [ figure 1 ] . all processes occur in liver , and bile acid -stimulated synthesis of fibroblast growth factor 19 ( fgf-19 ; or fgf-15 in mouse ) might be additionally occur in ileum . signals from pma ( phorbol 12-myristate 13-acetate ) and high glucose activate transcription factor sp1 through protein kinases c ( pkc ) and p44/ p42 mitogen - activated protein kinases ( mapk ) a ubiquitous mammalian transcription factor specificity protein 1(sp1 ) plays an essential role in regulation of pon1 expression . high glucose level activates protein kinase c ( pkc ) , which activates sp1 , and stimulate pon1 transcription in human hepatoma cell lines hepg2 and huh7 . a potent pkc activator phorbol 12-myristate 13-acetate ( pma ) also stimulates pon1 transcription in hepg2 through activation of sp1 . two members of pkc family are involved , pkc ( zeta ) and pkc- ( alpha ) activation . statins ( pitavastatin , simvastatin , or atorvastatin ) stimulate pon1 transcription through sp1 activation as well , however , they activate another kinase , p44/p42 mitogen - activated protein ( map ) kinase , as was observed for pitavastatin in huh7 cells . also , pivostatin - stimulated p44/p42 mitogen - activated protein kinase ( mapk ) activates sterol regulatory element binding protein 2 ( srebp-2 ) , which contributes to transcriptional activation of pon1 . dietary polyphenols , such as resveratrol , aspirin and its hydrolysis product salicylate , and artificial ligands of aryl hydrocarbon receptor ( ahr ) , such as 3-methylcholanthrene , activate ahr and stimulate pon1 transcription activation in mouse liver and hepg2 cell line.[2426 ] c - jun is another transcription factors that is involved in pon1 expression . the activity of c - jun is regulated by c - jun n - terminal kinase ( jnk ) . phosphorylated c - jun in a complex with c - fos or some other transcription factors forms an active ap-1 complex that usually promotes transcription of target genes . thus , berberine ( benzyl tetrahydroxyquinoline ) , a cholesterol lowering alkaloid , activates jnk , c - jun and stimulates pon1 transcription in human hepatoma cell lines . however , stimulation of jnk / c - jun pathway by bile acids leads to opposite effect . bile acids such as taurocholate , cholic acid , or chenodeoxycholic acid inhibit pon1 expression in liver of c57bl/6j mice , and in hepg2 and huh7 . the inhibition of pon1 expression starts with activation of farnesoid x receptor ( fxr ) by bile acids that promote expression of fibroblast growth factor 19 in human ( fgf-19 ) or fgf-15 in mouse . the growth factor activates fibroblast growth factor receptor 4 ( fgfr4 ) followed by activation of jnk , and phosphorylation of c - jun . opposite to activation of c - jun by berberine , fxr / fgf-19/fgfr4/jnk / c - jun pathway results in suppression of pon1 transcription . it is likely that pon1 stays associated with endoplasmic reticulum through its hydrophobic n - terminus until it is released from the hepatocytes . the mechanism of pon1 secretion is not well investigated . a study on cultured hepatocytes and transfected chinese hamster ovary ( cho ) cells , which do not naturally express pon1 and apoa proteins , when pon1 protein is synthesized , it accumulates on plasma membrane and slowly dissociate into extracellular medium . dissociation is promoted by hdl , very - low - density lipoprotein ( vldl ) , and in much lesser extent by protein - free phospholipids particles or apoa - i protein . pon1 binds to hdl through interaction of hydrophobic n - terminus to phospholipids , and through pon1-apoa interaction . two major principal hdl proteins , that is , apoa - i and/or apoa - ii which differ in their properties are linked to atherosclerosis modulation . thus , transgenic mice with hdl consisting of both human apoa - i and apoa - ii developed 15-fold greater lesions compared with mice with hdl containing solely human apoa - i . in vitro study of reconstituted hdl demonstrated that apoa - i containing hdl stabilizes pon1 binding as compared with protein - free hdl particles , and apoa - ii in opposite destabilizes the hdl the paraoxonase and arylesterase activities of pon1 do not depend on the apolipoprotein content of hdl . however , apoa - i containing hdl significantly increases lactonase activity of pon1 , promotes inhibition of ldl oxidation , and stimulates macrophage cholesterol efflux compared with apoa - ii containing hdl . a study of human hdl isolated from apoa - i deficient patients revealed that pon1 is still associated with hdl in the absence of apoa-1 , however , the pon1hdl complex is less stable , and pon1 loses activity faster than in normal controls . a higher content of human apoa - ii protein in mouse hdl suppresses pon1 binding to hdl compared with hdl with lower human apoa - ii content . hdl high in human apoa - ii binds less pon1 protein , possesses less pon1 activity , and is impaired in protection of ldl from oxidation . transgenic mouse with higher human apoa - ii content in hdl are more susceptible to atherosclerosis compared with transgenic animals with lower apoa - ii level in hdl and control animal . hdl - associated pon1 can be successfully transferred to cultured cells in vitro and deliver protection from oxidative stress and bacterial substrate of pon1 n-3-oxo - dodecanoyl - l - homoserine lactone . beside hdl while liver is the major tissue of pon1 gene expression , lipoprotein - assisted circulation of pon1 in plasma delivers the enzyme to multiple tissues that do not express pon1 themselves . immunohistochemical staining of rat tissues revealed pon1 presence in liver , kidney , in endothelial lining of lung and brain . more recent study with mouse tissue detected pon1 protein in hepatocytes , adipocytes , chondrocytes , skeletal and cardiac muscle , kidney , spermatozoa , and epithelial cells of skin , stomach , intestine , trachea , bronchiole , and eye lens . studies did not find co - localization of pon1 with apoa - i protein that might mean local pon1 expression or different sources of apoa - i , an integral component of hdl . immunostaining of healthy human aorta shows a low level and granular distribution of pon1 in smooth muscle cells . western blot confirmed presence of intact and degraded pon1 in media of healthy aorta . with the development of atherosclerosis , pon1 increasing accumulation of pon1 with the progression of the atherosclerosis can be seen in the intimal part of aorta as well . aorta with advanced atherosclerosis lesions shows massive pon1 accumulation . a more recent study attributed an increased pon1 immunostaining in human atherosclerotic arteries to macrophages accumulated in lesions .", "high fat , high - cholesterol ( atherogenic ) diet leads to fast development of atherosclerosis in c57bl/6j mouse strain with concomitant decrease in liver pon1 expression . at the same time pon1 expression and its protective effects macrophages from this mouse did not protect ldl from oxidation by other cells in vitro , and pon1 knockout mice developed atherosclerosis faster than control mice on high fat , high cholesterol diet . to study the effect of pon1 knockout further , . plasma lipid profile of these double knockout mice was similar to apoe-/- control animals with slightly decreased level of intermediate density lipoprotein ( idl ) and ldl , and increased level of lysophosphatidylcholine and oxidized phospholipids in idl and ldl . the rates of ldl oxidation and clearance were higher in pon1-/- , apoe-/- mice than in control mice as was determined by injection of human ldl . expression of genes responding to increase of oxldl , such as heme oxygenase-1 , peroxisome proliferator - activated receptor gamma , scavenger receptor type a , cd36 , and macrosialin , was upregulated in liver of pon1-/- , apoe-/- mice compared with apoe-/- mice . involvement of pon in inflammation and oxidative stress were detected in vascular wall of pon-/- animals . expression of mrna of essential cell adhesion molecules p - selectin and icam1 was upregulated in aortic wall . if a deficiency of pon1 leads to inflammation and oxidative stress , then increases in pon1 function could be beneficial . a transgenic mouse mpon1 was developed in 2001 , with 5-fold higher level of mouse pon1 protein and corresponding increase in arylesterase activity . pon1 was associated with hdl , and protected hdl from oxidation by copper ions as it was assessed by lipid hydroperoxide formation assay , and by retaining oxidation - sensitive activity of lecithin : cholesterol acyltransferase ( lcat ) . a decrease in atherosclerotic lesion size and improved oxidation status of aorta and peritoneal macrophages in pon1 overexpressing transgenic mouse on apoe-/- background have been compared with apoe-/- control have been reported . in another transgenic mouse model , pon1-tg , which overexpresses human pon1 gene of 55l/192q genotype , plasma level of arylesterase activity was twice higher in pon1-tg mouse compared with control mouse when animals were fed normal chow . the excess of pon1 level resulted in better retaining of its activity after feeding animals with atherogenic diet . pon1 activity decreased to about three - fourth ( 3/4 ) of original level after 15 weeks of atherogenic diet feeding to pon1-tg mice , and to less than one - half ( 1/2 ) of original level in control animals . thus , arylesterase activity mediated by pon1 was almost 4-fold higher in pon1-tg mice compared with control mice after feeding atherogenic diet . aortic lesion areas in pon1-tg animals were about half of the size of areas of the control mice after feeding atherogenic diet . apoe-/- , pon1-tg genotype mice fed normal chow similarly developed lesions slower , compared with apoe-/- controls ; however , the difference in lesion area was just 22% . plasma arylesterase activity of apoe-/- , pon1-tg mice was 2.5-fold higher than that of apoe-/- animals , however , there is no difference between their lipid profile . a decreased inflammatory status of aortas in apoe-/- , pon1-tg mice compared with apoe-/- mice was detected by examination of the expression level of mcp-1 cytokine gene . hdl isolated from pon1-tg mouse plasma or apoe-/- , pon1-tg mouse plasma provided better protection against ldl oxidation , than hdl isolated from control animals . beside pon1 studies on transgenic mouse , a transient overexpression of pon1 gene in mouse adenovirus - mediated delivery of human pon1 gene ( 55 m , 192q genotype ) in double knockout leptin-/- ( ob / ob ) , ldlr-/- mouse resulted in more than 4-fold increase of pon1 activity on day 7 with gradual decrease to the control level by day 21 . mice were injected with adenovirus at the age of 18 weeks when the progression of atherosclerosis occurs in a fast rate . six weeks later , cross - sections of the aortic root were analyzed by immunohistochemistry . plaque size , volume of macrophages , concentration of oxldl was significantly lower in pon1 expressing animals . the titer of anti - oxldl antibodies was lower in plasma of pon1 overexpressing mice as well . while an early pon1 intervention proved to have significant athero - protective effect , another study was performed to assess whether transient pon1 overexpression can improve vascular function in advanced atherosclerosis . similar to the previous study , 55m/192q variant of human pon1 gene was delivered in 18 month old apoe-/- mouse fed normal chow using adenovirus vector . serum pon1 activity was increased 10-fold by day 7 and 2.5-fold on the day 21 in pon1 overexpressing animals compared with controls . after 3 weeks , lesions were measured and no changes in their size were found . however , vasomotor function was improved by transient overexpression of pon1 . thus , phenylephrine - constricted segments of the aortas relaxed significantly better in response to endothelium dependent agonists ach , adenosine-5-triphosphate ( atp ) , and uridine-5-triphosphate ( utp ) observations on pon1 role in animal models is summarized in table 2 .", "meta - analysis of 47 studies with 9853 cad and 11,408 control subjects published in 2012 confirmed association of lower plasma pon1 activity with increased cad risk ( 19% lower pon1 activity , p < 0.00001 ) . another meta - analysis published in 2012 included 43 studies with total 20,629 subjects showed similar association of pon1 activity and cad with standardized mean difference ( smd ) of -0.78 ( p < 0.001 ) for cad subjects compared with controls . slightly weaker association was between arylesterase activity of pon1 and cad with smd of -0.50 ( p < 0.001 ) . both meta - analyses observed increased risk of cad in subjects with lower pon1 regardless of age and ethnicity ; tables 3 and 4 summarizes the role of pon1 in human studies . summary of allele differences of pon1 in vitro , and conclusions from pon1 human studies recent human studies on the role of pon1 in cvd some alleles of polymorphous genes can be causative factors in development of diseases and reliable predictors . there are at least five known polymorphisms in promoter region of pon1 : -909/-907 ( c or g ) , -832/-824 ( a or g ) , -162/-160 ( a or g ) , -126 ( c or g ) , and -108/-107 ( c or t ) . also , there are two polymorphisms in the pon1 coding region , q192r ( aka rs662 or 575a > g ) and l55 m ( aka rs854560 or 163 t > a ) , and several polymorphisms in 3 untranslated region of the gene . pon1 protein level in human serum varies more than 13-fold , and variations in the sequence of promoter region of pon1 gene might cause difference in its expression . two - fold differences in expression level between alleles were observed in cell culture reporter gene assay for three polymorphisms : -909/-907 ( c or g ) , -162/-160 ( a or g ) , and -108/-107 ( c or t ) . polymorphisms -162/-160 ( a or g ) is a putative binding site for transcription factor nf - i , and -108/-107 ( c or t ) is a putative binding site for sp1 . no effect on expression level in the reporter gene assay was observed for -832/-824 ( a or g ) , -162/-160 ( a or g ) polymorphisms . gene expression and enzyme activity studies on pon1 polymorphisms in protein coding region q192r and l55 m resulted in several observations . first , messenger rna of allele 55 m appeared to be more stable than 55l as determined by pcr amplification and restriction analysis of cdna synthesized from heterozygous liver samples . l55 m heterozygous liver had roughly twice more mrna of 55 m allele compared with 55l . that might results in difference in protein expression levels between alleles and ultimately in pon1 activity and protection , although it was not assessed in the study . q192r and l55 m alleles differ in their enzymatic activities . in a study of serum of 279 healthy human subjects activity of 55 m homozygotes were always lower than 55l / m heterozygotes or 55l homozygotes . qq , qr , and rr phenotypes can be reliably determined by assaying pon1 catalytic activities toward two substrates : diazoxon and paraoxon . pon1 of qq genotype exhibits relatively high activity toward diazoxon and relatively low activity toward paraoxon . rr genotype , opposite to qq , exhibits low activity toward diazoxon and high activity toward paraoxon . 192r pon1 hydrolyzes homocysteine thiolactone faster than 192q pon1 . q192r and l55 m pon1 enzymes differ in their protection to ldl from oxidation in vitro using ldl oxidation assay with copper in the presence of hdl . protection by pon1 decreases in the order of genotypes qq > qr > rr with almost no antioxidant activity in rr genotype , and about a half of qq activity in qr phenotype . the antioxidant activity of pon1 decreased in the series mm > lm > ll , with the activity of ll genotype about a half of activity of mm genotype . multiple clinical studies were performed to expose whether pon1 polymorphism may contribute to cad and other diseases . currently , analyses of association of pon1 polymorphism with atherosclerosis - related diseases determined just one reliable association , an association of q192r polymorphism with ischemic stroke . meta - analysis of 22 studies have been published earlier up to mid of 2009 , totaling 7384 ischemic stroke subjects and 11,074 controls revealed odds ratio of 1.10 for g ( 192r ) allele ( 95% ci : 1.041.17 ) . another meta - analysis study that was published in 2010 and summarized results of 11 studies confirmed that 192r allele confers significant risk of ischemic stroke ( odds ratio = 1.25 , 95% ci : 1.07,1.46 , p = 0.006 ) . surprisingly , this risk is confined to caucasian subjects , but there is no significant association of 192r allele of pon1 and ischemic stroke in east asian population . association of pon1 polymorphism q192r with cad was examined in extensive meta - analysis of studies published before 2011 . per - allele odds ratio for cad for 192r was 1.11 ( 95% ci : 1.05 , 1.17 ) based on all studies regardless of their size . however , analysis suggested that small studies were less reliable , perhaps because of small studies bias . no significant association of 192r allele with cad was observed when 10 larger studies with more than 500 cases each were analyzed . similar conclusions regarding small study bias and the absence of reliable association of q192r polymorphism with cad were concluded in two other independent massive meta - analysis studies published in 2004 ; also , no association was found between cad and l55 m or -108/-107 ( c or t ) polymorphisms of pon1 gene . meta - analysis for l55 m and -108/-107 ( c or t ) pon1 polymorphisms determined per - allele odds ratios for cad as 0.94 ( 95% ci : 0.88,1.00 ) for 55 m and 1.02 ( 95% ci : 0.911.15 ) for -108/-107 c , respectively . no significant association of l55 m or -108/-107 ( c or t ) pon1 polymorphisms with cad were observed in an earlier meta - analysis study . no association between l55 m ( rs854560 ) polymorphism and ischemic stroke was found in meta - analysis of 16 studies published before mid-2009 totaling 5518 ischemic stroke subjects and 8951 controls . similarly , a meta - analysis published in 2010 for 10 studies did not find significant association 55l allele with stroke regardless on the stroke type , age of patients , and ethnicity . resent human studies generally support the conclusions of meta - analyses [ table 4 ] . a novel pon1 polymorphism associated with atherosclerosis was recently revealed , snp rs854563(a / g ) . in conclusion , pon1 antioxidant and anti - inflammatory effect is extensively examined in vitro , in cell culture and animal models . human studies confirm protective role of pon1 in cad and another atherosclerosis - related disease , ischemic stroke . although the current knowledge of pon1 provides valuable insights on the function and role of pon1 , yet mechanism of pon1 action is still not well investigated . transient overexpression of pon1 in mouse demonstrated beneficial effects of pon1 beyond its antiatherogenic properties . further research of pon1 could potentially lead to new clinical strategies in prevention and treatment of cardiovascular diseases ." ]

[ "uterine adenomyosis is a common gynecologic disorder characterized by the presence and growth of heterotopic endometrial or endometrium - like structures in the myometrium , with adjacent smooth muscle hyperplasia and can lead to dysmenorrhea and infertility . the ectopic endometrial tissue induces hypertrophy and hyperplasia of the surrounding myometrium , resulting in diffuse globular enlargement of the uterus analogous to the concentric enlargement of the pregnant uterus . the presenting symptoms include a soft and diffusely enlarged uterus with menorrhagia ( 40%50% ) , dysmenorrhea ( 10%30% ) , metrorrhagia ( 10%12% ) , dyspareunia and dyschezia . the advised treatment for severe adenomyosis is total hysterectomy , but for patients wishing to preserve their uterus , a minimally invasive alternative procedure , uterine artery embolization ( uae ) , can be performed . uae is a nonsurgical alternative for patients with menorrhagia , symptomatic adenomyosis , or symptomatic uterine fibroids . although uterine infarction is a relatively common occurrence after uae for the treatment of fibroids or adenomyosis , uterine infarction after ivf - et in a patient with adenomyosis is very rare . to our knowledge , this is the first report of uterine infarction after ivf - et in a patient with uterine adenomyosis in korea .", "she had suffered severe dysmenorrhea , menorrhagia , and pelvic pain due to severe adenomyosis which was diagnosed following a pelvic magnetic resonance imaging ( mri ) and clinical examination three years earlier . the patient had undergone three unsuccessful cycles of frozen - thawed embryo transfer at an external infertility clinic , due to primary infertility , during the period from 4 - 7 months before hospital admission . the patient was admitted to hospital for treatment of ovarian hyperstimulation syndrome ( ohss ) arising after controlled ovarian hyperstimulation about four months before the initiation of embryo transfer . a thyroid function test on january 2013 indicated a euthyroid state : triiodothyronine 166 ng / dl ( range , 80 - 200 ng / dl ) , thyroid stimulating hormone 0.17 iu / ml ( range , 0.4 - 4.1 iu / ml ) , free thyroxine 1.21 ng / dl ( range , 0.80 - 1.90 mg / dl ) . the patient underwent another cycle of ivf at a local clinic in february 2013 , during which she received follitropin- 150 iu from menstrual cycle day 3 to day 12 and chorionic gonadotropin 250 g at menstrual cycle day 13 . ovum pick - up was performed about four weeks before she present to the emergency department and embryo transfer three days later . the patient received intramural progesterone 50 mg and was prescribed a vaginal progesterone gel ( crinone ) for daily use for 11 days after the embryo transfer . the patient presented to hospital with vaginal bleeding , fever and abdominal pain on eleven days after embryo transfer , and received antibiotic treatment followed by supportive care at a local clinic for three days . she visited our outpatient clinic due to vaginal bleeding and lower abdominal pain on sixteen days after embryo transfer and was admitted to hospital . c - reactive protein ( crp ) was elevated to 7.52 mg / dl and intravenous antibiotic treatment was given . biochemical abortion was diagnosed on nineteen days following embryo transfer after serum -hcg decreased from 161 to 63 mlu / ml in two days . the patient was discharged after symptom improvement , but presented with vaginal bleeding and lower abdominal pain , at a local clinic two days later , where she received hydration . the last day of that month , she presented to the emergency department with high fever ( 39 ) and , lower abdominal pain . peripheral blood cell analysis indicated a : white blood cell count of 17.510/l , an elevated crp of 24.3 mg / dl , a hemoglobin level of 7.6 g / dl and a hematocrit level of 24.5% . computed tomography at the emergency department revealed a wedge - shaped low attenuation area in the anterior uterine corpus . focal uterine infarction was suspected , and the pelvic mri revealed a wedge - shaped , irregularly marginated , non - enhancing area in the anterior uterine wall and the presence of preserved myometrium between the endometrial cavity and the inner margin of the necrotic myometrium ( figure 1 ) . blood markers investigated to establish the cause of infarction , including antiphospholipid immunoglobulin g ( igg ) and igm , protein c activation , protein s , and plasminogen , were all within normal ranges . five days after hospital admission , pelvic pain improved and crp decreased to 6.08 mg / dl , and the patient was discharged . two months later , pelvic mri showed interval regression of the previously noted possible focal uterine infarction site with a remarkably improved blood flow ( figure 2 ) .", "adenomyosis uteri is a pathological entity characterized by the presence of endometrial glands and stroma embedded within the myometrium , but without apparent contact with the endo - myometrial junction . uterine adenomyosis is relatively frequent , affecting 1% of females ; its diagnosis is more often made in multiparous patients , in their fourth and fifth decade of life , and for this reason , infertility is not frequently concurrent with adenomyosis . however , given the trend for first pregnancies to be delayed until women are in their thirties or forties , adenomyosis uteri becoming a more frequently considered diagnosis . pregnancy resulting from assisted reproductive technology ( art ) is possible in patients with ademoyosis ; however , spontaneous abortion , including biochemical abortion , still occurs in these patients . uterine infarction after ivf - et in a patient with adenomyosis has not previously been reported . the objective of uae is to initiate tumor infarction resulting in substantial reduction of the uterine and tumor volumes . first , when undergoing ivf - et , the risk of thrombosis is increased , as in the cases of pregnancy and hyperthyroidism , with which the patient also presented . the precise mechanisms by which the ohss and exogenous hormonal stimulation used in art induce thromboembolic events are still uncertain . however , vascular endothelial growth factor secreted during ohss , high estradiol concentrations , and blood hyperviscosity play a prominent part in inducing a prothrombotic state . reported that the overall venous thrombosis incidence rate during ivf pregnancies was three times higher than in reference pregnancies . an elevated crp can activate the coagulation system , following which microthrombosis formation , in the uterine myometrium , could cause necrosis of the myometrium and lead to focal uterine infarction . second , the disruption of the endometrial - myometrial interface also disrupts the organization of myometrial muscle fibers and may also disrupt normal contractility of the subendometrium . uterine adenomyosis with abnormal contractility and the subsequent abortion caused massive vaginal bleeding which may have led to uterine ischemia , and the resulting uterine infarction . clinical hyperthyroidism is generally accompanied by a hypercoagulable state , which may lead to microthrombosis of the uterine myometrium . last , fever and the elevated crp suggested that infection could have complicated the ischemic necrosis after uterine infarction . however , there were no clinical features such as rapid tumor growth , extrauterine extension or metastases , leading to the conclusion that the possibility of uterine sarcoma was very small . a follow - up mri three months later showed only traces of uterine infarction lesion and adenomyosis . in conclusion , we experienced a rare case of uterine adenomyosis that developed into uterine infarction after ivf - et and biochemical pregnancy . this case demonstrates that uterine infarction should be considered in the differential diagnosis of acute abdominal pain , vaginal bleeding and infectious signs in women with biochemical abortion after ivf - et , with a history of adenomyosis and hyperthyroidism . the insertion of a hormonal intrauterine device could be considered another option for treating the symptoms of adenomyosis in cases presenting with focal uterine infarction dysmenorrhea and menorrhagia . in addition , the surgical management of focal uterine infarction , may be considered in the management of uterine infarction after ivf - et in patients with uterine adenomyosis if future fertility is not desired . finally , it is important to note that the previous infarction site might be a potential risk site for uterine rupture in a future pregnancy ." ]

[ "to optimize the benefits of minimally invasive procedures , surgeons have attempted to reduce the overall abdominal wall trauma by decreasing either the size of the ports or the number of trocars . in these efforts , transumbilical single - port surgery uses an umbilical single incision technique to access the peritoneal cavity and target organs . owing to the nature of umbilicus , single - port laparoscopy through the umbilicus offers an exciting opportunity to perform laparoscopic surgery with no visible scar . however , transumbilical single - port laparoscopy is not a new concept in gynecologic surgery [ 15 ] . in 1969 , wheeless and thompson first published the technique and the results of a large series of laparoscopic tubal ligations using single - trocar laparoscopy . later , wheeless reported a large series of one - incision tubal ligation . additionally , in 1991 , the first laparoscopic total abdominal hysterectomy with bilateral salpingooophorectomy ( bso ) using only a single incision was reported by pelosi and pelosi iii . one year later , four supracervical hysterectomies with bso for benign uterine disease were reported by the same authors [ 15 ] . although single - port surgery enhances cosmetic benefits and reduces postoperative pain and morbidity , use of this technique was not widespread due to technical difficulties . however , with advances in instrumental and surgical skills , the technical difficulties associated with this surgical procedure have been overcome considerably [ 615 ] . particularly , single - port surgery is ideal for laparoscopic - assisted vaginal hysterectomy ( lavh ) because the vagina of woman can be considered as an additional route for surgery ; thus , uterine manipulators can be applied through the vagina [ 1117 ] . unlike uterine repair following myomectomy or bowel reanastomosis after bowel resection this is because the vaginal stump can be repaired not by laparoscopy , but through the vagina . in this study , we report our initial 100 cases observations of spa - lavh ( with or without bilateral salpingooophrectomy ( bso ) ) using a homemade , single - port , three - channel system .", "a retrospective medical records review was performed for the initial 100 patients who underwent spa - lavh at eun hospital . between march 2010 and september 2011 , 100 patients had undergone spa - lavh for nonmalignant gynecological diseases , including uterine leiomyoma ( 25 cases ) , adenomyosis ( 19 cases ) , adenomyosis coexisting leiomyoma ( 41 cases ) , preinvasive lesion of cervix coexisting adenomyosis or leiomyoma ( 7 cases ) , ovarian huge cyst ( 5 cases ) , endometrial hyperplasia ( 2 cases ) , and tuboovarian abscess ( 1 case ) . past abdominopelvic surgery , body mass index ( bmi ) , and the size of the uterus were not considered as exclusion criteria . the following parameters were determined in the present observational study : age , parity , bmi , surgical history , indication for surgery , operative time ( from incision to final umbilical closure ) , largest dimension of the uterus , weight of the extirpated uterus ( as pathology report ) , hemoglobin change ( from before surgery to postoperative day 1 ) , and perioperative and postoperative complications . we used homemade , single - port , three - channel system using the alexis wound retractor ( applied medical , rancho santa margarita , ca , usa ) , surgical glove , two 10 mm trocars , and one 5 mm trocar [ 7 , 16 , 17 ] . after partial eversion of the umbilicus , a curved semilunar skin incision was performed at the hidden lateral aspect of the umbilical crater . the incision was c - shaped and followed the natural curve of the inferior lateral aspect of the umbilical crater near the base . after skin incision , a rectus fasciotomy and peritoneal incision were performed by direct cut - down technique . an approximately 1.5 2 cm - sized skin incision was sufficient to install the three - channel , single - port system , because of the elasticity of the skin and the tissue beneath it , which can be dissected as long as required [ 16 , 17 ] . as shown in figure 1(a ) , the fascial edges were tagged with suture for traction prior to port system installation ; this was useful for fascial closure at the end of the procedure . the alexis wound retractor consists of a proximal ring , distal ring , and connecting retractable sleeve . as shown in figure 1(a ) , the distal ring was loaded within the intraperitoneal space and tightly turned inside out of the proximal ring ( rolled up manner ) , creating an effective seal and a wider opening of the single - port incision by connecting retractable sleeve between the distal and proximal rings . once fixed in the opening site , it laterally retracted the sides of the wound opening . subsequently , as shown in figure 1 , a sterile surgical glove was placed over the proximal ring and fixed tightly to prevent leakage of carbon dioxide gas . three trocars were inserted through the surgical glove with cut edges of the distal fingertips and tied with an elastic string . the elastic nature of the glove enabled to achieve an airtight seal , which maintained the pneumoperitoneum . the multiple truncated fingers of the glove functioned as a multiport for surgical instruments [ 16 , 17 ] . a limited range of motion was closely related to the bulkiest portion of the trocar head and instrumental grip ( external handle ) extracorporeally overlapping . as shown in figure 1(b ) , the length of the instruments was the same , but the lengths of the truncated glove digits varied . however , varying the height of the trocar head may minimize clashing of the bulkiest portion of the trocar head and instrumental grip ( the external handle ) extracorporeally overlapping . all the surgical procedures were performed as a standard lavh ( with or without bso ) technique using conventional nonarticulated rigid laparoscopic instruments and the ligasure system ( valleylab , boulder , co , usa ) . as has been established earlier , exploration of pelvis , coagulation and cut of ligaments and vessel above the uterine vessel , and bladder mobilization were undertaken in laparoscopic phase . ligation of uterine vessel , cardinal and uterosacral ligament , extirpation of uterus , and vaginal stump closure were undertaken in the vaginal phase .", "all procedures were successfully completed through the single - port system and vagina without the need for extraumbilical puncture or conversion to laparotomy . as shown in table 1 , the mean standard deviation ( sd ) of patient age , parity , and bmi was 48.2 6.5 years , 2.3 1.0 , 25.4 3.3 kg / m , respectively . thirty - three patients had a past history of abdominopelvic surgery , such as a caesarean section , laparoscopic tubal ligation , appendectomy , ovarian cystectomy , or salpingooophrectomy . among these patients , six had a history of caesarean sections , five had a history of repeat caesarean sections , and five had a history of three caesarean sections . seven patients needed 2 - 3 units of packed red blood cell transfusion due to chronic anemia or intraoperative hemorrhage . the mean sd of time to installation of the transumbilical single - port system was 7.3 1.5 min . the mean sd of total operative time , largest dimension of the uterus , and weight of the uterus were 73.1 24.6 min , 10.5 2.1 cm , and 300.8 192.5 gram , respectively . the operative time between laparoscopic phase and vaginal phase was similar but depended on pelvic pathology . the median decline in the hemoglobin level from before surgery to postoperative day 1 was 1.8 0.9 g / dl . bladder injury occurred in one patient who had a history of three caesarean sections but was repaired through intraoperative laparoscopic suture . the postoperative course was uneventful in most patients , but three had a transient paralytic ileus , and five had pelvic hematoma , all of whom recovered following conservative managements . no port - related complications were noted , and the cosmetic results and patient satisfaction were excellent .", "spa - lavh is a technically safe and feasible procedure , and the homemade single - port system offers reliable and cost - effective access for single - port surgery .", "as mentioned earlier , lavh is most ideal for single - port surgery because the vagina of woman can be considered as an additional route for surgery ; thus , uterine manipulators can be applied through the vagina . unlike uterine repair after myomectomy this is because the vaginal stump can be repaired not by laparoscopy , but through the vagina . thus , spa - lavh is safe , and the procedure can be learned by skillful surgeons over a short period of time , because a considerable portion of the procedure can be performed through the vagina . the homemade three - channel , single - port system using a surgical glove and an alexis wound retractor offers reliable , flexible , and cost - effective access for single - port procedures , and the system can be applicable in nonarticulated , rigid , conventional laparoscopic instruments [ 16 , 17 ] . limitations of single - port surgery include the loss of instrumental triangulation , reduced operative working space , reduced laparoscopic visualization , and instrumental crowding and clashing . these limitations act as hurdles for some reconstructive procedures , such as repair after myomectomy . however , the reconstructive procedure can be performed with instrumental advancement , such as the use of articulated instruments [ 615 ] . our observations show that a history of abdominopelvic surgery is not a contraindication for single - port surgery ; however , central obesity is problematic to secure a route for the single - port system through a small intraumbilical incision . procedural difficulties resulting from previous abdominopelvic surgery are not because of the single - port surgery itself , but owing to abdominopelvic conditions [ 10 , 1517 ] . a linear correlation existed between the operation time and an extirpated uterine weight of > 400 g , because more time was needed for uterine fragmentation for extirpation through the vagina ; however , no linear correlation existed between the operation time and a uterus weight of < 400 g. for pelvic adhesion , such as in previous pelvic surgery or endometriosis , additional operation time is required for adhesiolysis . it is not a case - control study , and pain score , hospital stay , cost effectiveness , and return to work were not considered because of the retrospective nature of the study . additional clinical data and long - term followup may be needed to address port - related complications ." ]

[ "drug eruptions are common , affecting 23% of all hospitalized patients , and complications associated with medications make up the largest proportion of adverse events seen in hospitals . drug eruptions can be difficult to diagnose , particularly causality , as even biopsies are nonspecific and patients are often on more than one potentially offending medication . we present 3 cases that highlight these difficulties and the broad spectrum of drug eruptions in the setting of lymphoma patients receiving multidrug regimens including bendamustine .", "a 60-year - old caucasian female presented with a 6-month history of constitutional symptoms , dyspnea on exertion , lymphadenopathy and pleural effusions and was diagnosed with stage iv marginal zone lymphoma with bone marrow involvement . four to six weeks prior to admission , she had developed a progressive generalized erythematous rash and edema involving her trunk and extremities . these findings were characterized as consistent with drug eruption , although no new drugs were identified in her history . the decision was made to treat with bendamustine and rituxan as an inpatient due to nonresolving malignant pleural effusion . her initial rash on presentation was thought to be due to possible lymphomatous involvement and lymphedema as it improved over the 23 days following chemotherapy . on day 7 she developed a bullous rash involving 6070% of her skin as well as mucosa ( fig . a new biopsy revealed vacuolar interface dermatitis with necrosis of keratinocytes in the epidermis , with the underlying dermis displaying a superficial perivascular lymphocytic inflammatory infiltrate with eosinophils ( fig . 2 ; fig . 3 ) . she began to deteriorate rapidly with a clinical course further complicated by the development of severe hepatic and renal failure . a diagnosis of dress syndrome was made . despite a high dose of steroids , the rash spread , eventually involving 100% of her body surface area , including her eyelids , conjunctiva , oral and vaginal mucus membranes . despite the use of filgrastim and broad spectrum antibiotics the second case was a 66-year - old male diagnosed in 2009 with chronic lymphocytic leukemia associated with the deletion of chromosome 13 . in 2012 , his lymphocyte count reached 253,000 , and he developed autoimmune hemolytic anemia . he initially received one cycle of intravenous immunoglobulin , cyclophosphamide , vincristine and prednisone ( without rituxan ) . the initial cycle was again given without rituxan due to the high burden of the disease . he received antibiotic therapy with cefepime , fluconazole , azithromycin and levofloxacin during two separate hospitalizations . two days following the second admission ( day 7 following bendamustine ) , he developed a generalized erythematous rash with desquamation that did not resolve with the discontinuation of cefepime or the administration of rituxan . his rash slowly resolved . a second episode of nonneutropenic fever , hypotension and acute renal failure occurred with the second cycle of bendamustine and rituxan 2 months later . this resolved as well . given the timing of the reaction , it was questioned that the offending drug was bendamustine in both events . the third patient was a 59-year - old female diagnosed with stage ivb splenic marginal zone lymphoma after presenting with constitutional symptoms and urticaria . she was treated with splenectomy and systemic chemotherapy consisting of bendamustine and rituxan . prior to the third cycle , the eruption worsened 2 weeks later as the lesions became intensely pruritic , erythematous and ulcerative . despite the treatment with antibiotics and corticosteroids , she progressed over the course of 1 week to a tense bullous rash covering the extremities .", "a 60-year - old caucasian female presented with a 6-month history of constitutional symptoms , dyspnea on exertion , lymphadenopathy and pleural effusions and was diagnosed with stage iv marginal zone lymphoma with bone marrow involvement . four to six weeks prior to admission , she had developed a progressive generalized erythematous rash and edema involving her trunk and extremities . these findings were characterized as consistent with drug eruption , although no new drugs were identified in her history . the decision was made to treat with bendamustine and rituxan as an inpatient due to nonresolving malignant pleural effusion . her initial rash on presentation was thought to be due to possible lymphomatous involvement and lymphedema as it improved over the 23 days following chemotherapy . on day 7 she developed a bullous rash involving 6070% of her skin as well as mucosa ( fig . a new biopsy revealed vacuolar interface dermatitis with necrosis of keratinocytes in the epidermis , with the underlying dermis displaying a superficial perivascular lymphocytic inflammatory infiltrate with eosinophils ( fig . 2 ; fig . 3 ) . she began to deteriorate rapidly with a clinical course further complicated by the development of severe hepatic and renal failure . a diagnosis of dress syndrome was made . despite a high dose of steroids , the rash spread , eventually involving 100% of her body surface area , including her eyelids , conjunctiva , oral and vaginal mucus membranes . despite the use of filgrastim and broad spectrum antibiotics", "the second case was a 66-year - old male diagnosed in 2009 with chronic lymphocytic leukemia associated with the deletion of chromosome 13 . in 2012 , his lymphocyte count reached 253,000 , and he developed autoimmune hemolytic anemia . he initially received one cycle of intravenous immunoglobulin , cyclophosphamide , vincristine and prednisone ( without rituxan ) . the initial cycle was again given without rituxan due to the high burden of the disease . he received antibiotic therapy with cefepime , fluconazole , azithromycin and levofloxacin during two separate hospitalizations . two days following the second admission ( day 7 following bendamustine ) , he developed a generalized erythematous rash with desquamation that did not resolve with the discontinuation of cefepime or the administration of rituxan . his rash slowly resolved . a second episode of nonneutropenic fever , hypotension and acute renal failure occurred with the second cycle of bendamustine and rituxan 2 months later . this resolved as well . given the timing of the reaction , it was questioned that the offending drug was bendamustine in both events .", "the third patient was a 59-year - old female diagnosed with stage ivb splenic marginal zone lymphoma after presenting with constitutional symptoms and urticaria . prior to the third cycle , the patient developed a mild pruritic eruption with raised plaques . the eruption worsened 2 weeks later as the lesions became intensely pruritic , erythematous and ulcerative . despite the treatment with antibiotics and corticosteroids , she progressed over the course of 1 week to a tense bullous rash covering the extremities .", "severe drug eruptions associated with high morbidity and mortality include stevens - johnson syndrome and toxic epidermal necrolysis . these syndromes are often confused and may represent a continuum of each other , with toxic epidermal necrolysis having > 30% of epidermal detachment and stevens - johnson syndrome having only 10% or less morbidity and mortality from these conditions stem from their complications including massive fluid losses , electrolyte imbalances , infections and diffuse interstitial pneumonitis , leading to acute respiratory distress syndrome . dress syndrome represents another severe drug eruption with a 10% mortality rate , typically in the setting of hepatic failure . the term dress syndrome was later coined in 1996 as a syndrome specifically describing a drug eruption with internal organ involvement and hematologic abnormalities , particularly eosinophilia or atypical lymphocytosis . dress syndrome can be difficult to diagnose , as onset is typically 26 weeks after the drug was administered but is more probable when associated with hypereosinophilia , liver involvement , fever and lymphadenopathy . etiology , as with other severe drug eruptions , is unclear but postulated to be associated with human herpes virus reactivation . many drugs have been implicated in dress syndrome ; however , the ones most often reported are allopurinol , penicillins , sulfonamides and antipsychotics . severity and likelihood of the diagnosis of dress as well as other severe cutaneous drug reactions are scored using the regiscar in europe . the mainstay of treatment remains the removal of the offending drug and supportive care with the use of steroids remaining controversial in their effectiveness [ 2 , 5 ] . bendamustine was first synthesized in 1963 as a chemotherapeutic agent with both antimetabolite and alkylating properties . since that time , bendamustine has demonstrated significant efficacy in many lymphoma subtypes , particularly indolent lymphomas resistant to other alkylators . in 2008 , it was approved by the fda for the treatment of rituximab - refractory chronic lymphocytic leukemia and indolent b - cell non - hodgkin lymphomas . its side effect profile has been shown to be well tolerated , with the most common side effects being cytopenias and fatigue . the fda prescribing guidelines state that skin reactions have been reported with bendamustine , most often in combination with another agent ( rituximab or allopurinol ) , so that true causality can not be determined . however , these reactions have been reported to be severe and progressive with several deaths mentioned . most described rashes develop following the first administration of bendamustine and generally worsen in severity over the following days . one patient with b - cell prolymphocytic leukemia developed rash with palpable purpura and hemorrhagic plaques while thrombocytopenic . this rash was preceded by a severe generalized maculopapular rash with most bendamustine skin reactions . a biopsy revealed a diffuse eosinophilic infiltrate . in a case series of 16 patients with chronic lymphocytic leukemia or follicular lymphoma , over 50% of the patients developed an erythematous maculopapular rash . another case report described a severe desquamating rash involving > 75% of the skin as well as oral mucosa . a biopsy revealed interface dermatitis with a lymphohistiocytic infiltrate . in our case of dress syndrome , this led to the question of the offending agent ; however , the patient did not have a reasonable alternate medication exposure . we also postulate that both the patient 's lymphoma and bendamustine itself may have induced a quicker response based on already reduced immunoglobulin levels and a rapid reduction in b - cell lymphocytes . this initiating factor in the mechanism of dress was proposed by criado et al . and has been cited as the reason for the long latency in cases . case 2 represents the typical scenario of a drug exanthem where the causative agent is in question . rash developed following bendamustine , but the patient was also exposed to antibiotics that are known to cause dermatologic complications . however , unlike most reported cases , rituximab was not a questionable cause , as it was not administered with the bendamustine initially . case 3 also represents a more atypical presentation than initially reported , with a reaction after the second cycle rather than after initial exposure to the drug . however , no other causative agent was found ." ]

[ "although indomethacin is usually well tolerated , some patients developed gastrointestinal side effects , specially those patients who require long term therapy . therefore , the use of cyclo - oxygenase-2 specific inhibitors could reduce secondary effects and they are essentially equipotent to indomethacin in vitro and in vivo . indeed , some reports in the literature indicate the usefulness of the cox-2 inhibitors in the treatment of indomethacin - responsive headaches [ 38 ] . we report four cases of hemicrania continua and a patient suffering chronic paroxysmal hemicrania completely responsive to cox-2 inhibitors .", "a 42 years - old woman had sudden onset of short - lived pains on the left side of her head . she suffers for a month an intense headache with short attacks ( about 510 min ) but high frequency ( 1018 attacks per day ) . we put her on indomethacin 25 mg 3 times a day , and in 24 h her hemicranial pain completely disappears . because of legs oedema we discontinued indomethacin and 1 week later the pain returned . a 56 years - old man present with an 8 month history of a continuous left - sided headache strictly unilateral . the pain was moderate in intensity but fluctuating ( between 2 and 7/10 vas ) . the pain exacerbations were associated with lacrimation but not phono , photofobia , nausea or vomiting . an mri was normal and indomethacin 25 mg 3 times a day was started with completely recovery . two - month later he started to have gastric symptoms , indomethacin was discontinued and the hemicrania return . a 78 years - old woman with 1 year history of continuous and strictly left - sided headache , fluctuating in intensity ( 39 in vas ) and accompanied by conjuntival injection and nasal congestion during exacerbation time . with indomethacin 50 mg 3 times a day the hemicrania disappear , however , she developed disabling subjective tinnitus 1 month later . we discontinued indomethacin and introduced celecoxib 200 mg twice a day with completely recovery that persists 18 month later . a 64 years - old woman with 3 years history of right - sided headache , fluctuating in intensity ( 28 in vas ) . with indomethacin 25 mg 3 times a day the hemicrania disappear , however , the patient suffer gastrointestinal disturbances . we discontinued indomethacin and introduced celecoxib 200 mg twice a day with completely recovery that persists 10 month later . a 76 years - old man with 6 month history of continuous left - sided headache and facial pain . after 2 weeks on indometacina he complaint about pyrosis , that persists after omeprazol 40 mg per day . we decided to discontinue indomethacin and introduced celecoxib 200 mg twice a day with completely recovery that persists 6 month later .", "a 42 years - old woman had sudden onset of short - lived pains on the left side of her head . she suffers for a month an intense headache with short attacks ( about 510 min ) but high frequency ( 1018 attacks per day ) . we put her on indomethacin 25 mg 3 times a day , and in 24 h her hemicranial pain completely disappears . because of legs oedema we discontinued indomethacin and 1 week later the pain returned .", "a 56 years - old man present with an 8 month history of a continuous left - sided headache strictly unilateral . the pain was moderate in intensity but fluctuating ( between 2 and 7/10 vas ) . the pain exacerbations were associated with lacrimation but not phono , photofobia , nausea or vomiting . an mri was normal and indomethacin 25 mg 3 times a day was started with completely recovery . two - month later he started to have gastric symptoms , indomethacin was discontinued and the hemicrania return . with celecoxib 200 mg twice a day the hemicrania disappears . after 10 month", "a 78 years - old woman with 1 year history of continuous and strictly left - sided headache , fluctuating in intensity ( 39 in vas ) and accompanied by conjuntival injection and nasal congestion during exacerbation time . with indomethacin 50 mg 3 times a day the hemicrania disappear , however , she developed disabling subjective tinnitus 1 month later . we discontinued indomethacin and introduced celecoxib 200 mg twice a day with completely recovery that persists 18 month later .", "a 64 years - old woman with 3 years history of right - sided headache , fluctuating in intensity ( 28 in vas ) . with indomethacin 25 mg 3 times a day the hemicrania disappear , however , the patient suffer gastrointestinal disturbances . we discontinued indomethacin and introduced celecoxib 200 mg twice a day with completely recovery that persists 10 month later .", "a 76 years - old man with 6 month history of continuous left - sided headache and facial pain . after 2 weeks on indometacina he complaint about pyrosis , that persists after omeprazol 40 mg per day . we decided to discontinue indomethacin and introduced celecoxib 200 mg twice a day with completely recovery that persists 6 month later .", "we present five patients suffering indomethacin - responsive headache case 1 suffering from paroxysmal hemicranias and cases from 2 to 5 from hemicranias continua ( table 1 ) . all of them have absolutely response to indomethacin , but the presence of adverse reactions or intolerability let us discontinued and introduce celecoxib with completely recovery of the symptoms.table 1clinical characteristics of the patientscaseagegenderheadache typesidedoses ( mg)time in month142fhpleft20012256mhcleft40010378fhcleft40018464fhcright40010576mhcleft4006all doses correspond to celecoxibf female , m male , hc hemicrania continua , hp hemicrania paroxistica clinical characteristics of the patients all doses correspond to celecoxib f female , m male , hc hemicrania continua , hp hemicrania paroxistica indomethacin is consider the first - choice drug for the treatment of indomethacin - responsive headaches , and the headache resolution is consider as a diagnosis criteria in some of theses headaches . although other drugs have been reported as useful treatment , most of them are anecdotic or single cases [ 915 ] . other anti - inflammatory drugs that have been demonstrated as alternative drugs , in particular piroxicam , however , their efficacy is lower when compared with indomethacin . the pathophysiology of theses indomethacin - response headache are still unknown , but the cyclo - oxygenase ( cox)-2 should be implicated in the pathogenesis . celecoxib have been previously reported to be effective in the treatment of other indomethacin - responsive headache [ 311 ] , however , there was no absolutely response in all patients . anyhow , in our experience celecoxib is a good option treatment for patients suffering from hemicrania continua or chronic paroxysmal hemicranea that presents indomethacin adverse effects ." ]

[ "according to early treatment of diabetic retinopathy study ( etdrs ) , protocol panretinal photocoagulation ( prp ) can prevent severe visual loss in proliferative diabetic retinopathy ( pdr ) . several studies have shown histopathologic changes in choroid of diabetic patients [ 24 ] . meanwhile , using panretinal photocoagulation ( prp ) , as was suggested beneficially by diabetic retinopathy study for proliferative diabetic retinopathy , has gotten general acceptance . with the advent of enhanced depth imaging optical coherence tomography ( edi - oct ) , it is now possible to visualize and measure choroidal changes easily . to the best of our knowledge , no other study has compared these two laser modalities in changing choroidal or central retinal thickness . in this study , we have evaluated the subfoveal choroidal , central retinal , and peripapillary retinal nerve fiber layer ( rnfl ) thickness changes before and after prp using edi - oct and we compare the green and red laser in this regard .", "this clinical trial was approved by the institutional review board / ethics committee . written informed consents were obtained from all participants . exclusion criteria were advanced proliferative diabetic retinopathy , a history of any laser treatment ( panretinal or focal laser photocoagulation ) , any history of intravitreal drug injection , ocular surgery , significant media opacity , myopia , or hyperopia with refractive error of more than 3 diopters . primary objective was to determine subfoveal choroidal and retinal thickness and peripapillary nerve fiber layer thickness changes 6 weeks after red versus prp laser . a complete ophthalmic examination including best corrected visual acuity ( bcva ) using snellen chart , goldmann applanation tonometry , and dilated indirect ophthalmoscopy was conducted . enhanced depth imaging optical coherence tomography ( edi - oct ) mapping was performed using sd - oct ( spectralis , heidelberg engineering , heidelberg , germany ) . a total number of 1600 to 2000 spots per eye were applied to ablate retina using ellex integre pro scan laser photocoagulator ( 82 gilbert street , adelaide , sa 5000 , australia ) . the order of treated areas was as follows : nasal , inferior , superior , and then temporal retina . power setting was chosen to have a mild gray - white burn ( grade 2 ) according to etdrs guidelines . laser setting parameters did not differ significantly between two groups ( mean power 303 mwatts in red and 290 mwatts in green laser group , p value : 0.14 ; mean laser spots 1789 spots in red and 1869 spots in green laser group , p value : 0.13 ) . one eye of all patients was randomly assigned to red laser and the other eye to green laser . spectral domain optical coherence tomography images were obtained using spectralis oct ( heidelberg engineering , heidelberg , germany ) to measure central retinal thickness and enhanced depth imaging ( edi ) mode to measure subfoveal choroidal thickness . bcva measurement and an oct scan were performed at baseline and 6 weeks after completion of prp . subfoveal choroidal thickness was measured using apparatus measurement tool at baseline and 6 weeks after prp . choroidal segmentation was done manually , moving the reference lines from the retinal borders to the choroidal borders . the internal limiting membrane line was moved to the base of the retinal pigment epithelium . also retinal nerve fiber layer ( rnfl ) thickness analysis was done at baseline and 6 weeks after treatment . data were analyzed using spss software ( version 16 , spss , inc . ) . a paired sample t - test was used to compare macula and choroid thickness before and after treatment . independent sample t - test was performed to compare macula and choroid thickness changes from baseline between two groups .", "the mean visual acuity of patients was 0.32 0.28 logmar and 0.27 0.23 logmar in red laser group and green laser group , respectively . the mean subfoveal ct increased significantly in each group at 6 weeks follow - up ( in red laser group , 202.14 24.5 micron at baseline and 211.7 26.6 micron at 6 weeks , p value < 0.00 , showing 4.86% ct increase compared to baseline ) ( in green group , 201.9 21.13 micron at baseline and 208.9 25.0 at 6 weeks , p value < there was not a significant difference between red and green laser in terms of choroidal thickness changes from baseline ( p value 0.184 ) . in red laser group , the mean central retinal thickness was 271.6 30.33 micron at baseline and 298.5 62.14 micron at week 6 of follow - up ( p value 0.03 ) . in green laser group , the mean central retinal thickness was 267.0 36.9 micron at baseline and 306.4 73.3 micron at week 6 of follow - up , ( p value 0.000 for both groups ) . there was no significant difference between macular thickness increase between two groups ( p value : 0.404 ) ( table 2 ) . there was no significant association between choroidal thickness change and retinal thickness change in each group ( p values : 0.051 and 0.52 , resp . ) . the mean peripapillary rnfl thickness was 100.5 20.1 micron in red laser group at baseline which increased to 108.2 23.1 micron at 6 weeks ( p value 0.000 ) ( 7.8% as compared to baseline ) . in green laser group , it was 103.5 19.8 micron at baseline which increased to 112.7 22.9 in week 6 of follow - up ( p value 0.000 ) ( 9.2% as compared to baseline ) . rnfl change between two groups was not significant ( p value : 0.762 ) ( table 2 ) .", "in this study , in eyes with proliferative diabetic retinopathy and without significant macular edema , the mean subfoveal choroidal , central retinal , and peripapillary rnfl thickness increased significantly after both red and green argon laser treatments . this is in accordance with some of previously published studies that confirm this finding [ 69 ] . takahashi et al . measured changes in choroidal blood flow in the foveal area one month after prp in patients with severe diabetic retinopathy and no macular edema using a laser - doppler flowmetry . they reported that prp increases both the choroidal blood flow and the choroidal blood volume . changes in subfoveal choroidal thickness did not correlate with changes in macular thickness in their study . first , it has been attributed to redistribution of choroidal blood flow [ 1014 ] . this leads to redistribution of blood in other untreated areas , especially the macula . following blood flow increase , this transient inflammation probably causes release of cytokines and leads to increase of blood flow and choroidal thickness [ 18 , 19 ] . mean ct increase in both groups in this study is similar to what have been reported before in other trials [ 710 ] . it is noteworthy that , in some other trials , the measured subfoveal ct showed decreased thickness after prp in short term follow - up . they have hypothesized that the reason may be due to the destruction of choroidal vasculature after thermal damage of prp [ 20 , 21 ] . also , we found that central macular thickness and rnfl thickness increased significantly in both groups ; this is also similar to what has been found in other studies [ 2024 ] . this finding is similar to what has been reported before about the increase of retinal thickness after prp and it was attributed to the release of proinflammatory cytokines or hypoxia - induced macular edema [ 2024 ] . also , we did not find any correlation between changes of choroidal thickness and central retinal thickness . one of the novel analyses done in this study is the comparison between red and green laser in changing retinal , choroidal , and rnfl thickness . although all three measured variables showed significant increase after treatment in each eye , intereye comparisons were not statistically significant considering central retinal , subfoveal choroidal , and rnfl thickness changes ( p values : 0.404 , 0.184 , and 0.762 , resp . ) that may indicate no considerable difference between red and green laser in this regard . to the best of our knowledge , there is only one report by ghassemi et al . that compared the difference between red and green laser in pdr patients . they reported significant increase of rnfl thickness after prp without any difference between red and green laser . one of the advantages of this study is selection of both eyes of one patient which can exclude the effect of systemic factors on retinal , choroidal , and rnfl thickness . this study has some limitations including low sample size and short follow - up time . nonetheless , this study showed significant increase of subfoveal choroidal , foveal retinal , and peripapillary rnfl thickness after red and green laser prp and no significant difference between these two lasers in aforementioned measurements ." ]

[ "the prognosis for patients with non - small cell lung cancer ( nsclc ) deteriorates with advancing disease stage , and only about 1% of patients with metastatic nsclc are alive after 5 years.1 the most appropriate treatment for these patients is palliative , systemic , platinum - based chemotherapy in first line.25 however , platinum - based , first - line treatment is limited to 46 cycles due to cumulative toxicity and a plateau in effectiveness . following discontinuation of chemotherapy , most patients will experience disease progression within 23 months.6,7 previous guidelines have recommended withholding second - line treatment until disease progression.2,3 however , cappuzzo et al suggested that 30%50% of patients were not receiving second - line treatment due to rapid disease progression and decreasing performance status.8 hence , there is a need for therapies that prolong the clinical benefits of first - line treatment . bevacizumab has been approved for use in patients with metastatic non - squamous nsclc in combination with platinum - based chemotherapy until disease progression.9 however , there remains an unmet need for further treatment options that extend survival in patients with advanced or metastatic nsclc . an alternative treatment strategy that can be used to prolong duration of first - line treatment and extend survival in metastatic nsclc is first - line maintenance therapy . maintenance therapy is defined as the prolongation of treatment duration or administration of additional treatment at the end of a defined number of initial chemotherapy cycles , after maximum tumor response has been achieved ( this may be complete response , partial response , or stable disease ) . erlotinib ( tarceva , f hoffmann - la roche ltd , basel , switzerland ) is one of only two treatments approved for use as first - line maintenance therapy by the european medicines agency,10 the other being pemetrexed.11 the randomized , multicenter , phase iii saturn ( sequential tarceva in unresectable nsclc ) study compared first - line maintenance therapy with either erlotinib or placebo ( n = 487 ) following four cycles of platinum - based chemotherapy in patients with metastatic nsclc.8 patients who had not experienced disease progression after initial chemotherapy were randomized 1:1 to receive erlotinib 150 mg / day orally + best supportive care or placebo + best supportive care until disease progression , unacceptable toxicity , or death.8 erlotinib therapy significantly improved progression - free survival ( hazard ratio [ hr ] : 0.71 ; 95% confidence interval [ ci ] : 0.620.82 ; p < 0.0001 ) and overall survival ( hr : 0.81 , 95% ci : 0.700.95 ; p = 0.0088 ) in the intent - to - treat population ( n = 438)8 and in a subpopulation of patients ( n = 252 ) with stable disease following initial first - line chemotherapy ( progression - free survival hr : 0.68 , 95% ci : 0.560.83 ; p < 0.0001 ; overall survival hr : 0.72 , 95% ci : 0.590.89 ; p = 0.00198 ) . the survival benefits observed following erlotinib maintenance therapy in patients with mutated epidermal growth factor receptor and patients with wild - type epidermal growth factor receptor were also achieved without significantly compromising tolerability or health - related quality of life . the objective of this analysis was to estimate the cost - effectiveness of erlotinib versus best supportive care when used as first - line maintenance therapy for patients with locally advanced or metastatic nsclc and stable disease following first - line therapy in three european countries , ie , france , germany , and italy .", "to estimate the incremental cost - effectiveness of erlotinib , an economic decision model was developed using patient data on progression - free survival and overall survival for erlotinib and best supportive care as first - line maintenance therapy from the saturn trial.8 an area under the curve ( or partitioned survival ) model was developed consisting of three health states , ie , progression - free survival , progression , and death ( figure 1 ) . survival data from the trial were used to follow patients from the progression - free survival to the progression and death states , and allowed for extrapolation of the data beyond the trial period . the model uses the stable disease population , as indicated in the european union label,12 to calculate efficacy and the same dose as was used in the trial , ie , erlotinib 150 mg / day orally + best supportive care or placebo + best supportive care . the area under the curve model works by assuming that , at any discrete time point , the difference between the proportion of patients in overall survival and the proportion of patients in progression - free survival determines the proportion of patients who have experienced disease progression . at the start of the analysis , it was assumed that all patients were in the progression - free survival health state . a half - cycle correction is used to account for events that occur during each monthly cycle . the time horizon of 5 years can be considered to be a lifetime perspective in this patient population ( after 5 years , virtually all patients will have died ) . the model was developed from the perspective of the national health care payer in three european countries , ie , france , germany , and italy ; therefore , indirect costs , including travel costs , and costs to other public agencies were not included . probabilistic sensitivity analyses were performed to investigate the impact of changes in the key input parameters and assumptions on the results of the base - case analysis . distributions around the following parameters were used to reflect uncertainty in the model ( ie , the probability of erlotinib being cost - effective ) : estimates for the parametric progression - free survival and overall survival functions , and cost and frequency of adverse events . adverse events were selected for inclusion in the model by grade of severity and frequency of occurrence by event and treatment arm , according to the following rules : all treatment - related adverse events grade 34 , and adverse events that occurred from the start of the study and 28 days after the last cycle of first - line treatment inclusively . the frequency of each event was further categorized into the number of patients experiencing at least one adverse event . these values were used for calculating the average number of each adverse event per patient ( eg , probability of a specified adverse event per patient average number of episodes of adverse event per patient ) . the model does not include post - progression - free survival treatments ( following disease progression ) once maintenance therapy is stopped , because it was not designed to incorporate this information . therefore , second - line and further - line treatment costs , capturing the various treatment strategies used following progression , were not accounted for within the model . this was due to the variation in second - line treatment observed in the saturn study ; uncontrolled patients received multiple therapies after disease progression , which included taxanes ( eg , docetaxel ) , antimetabolites ( eg , pemetrexed ) , anti - neoplastic agents , epidermal growth factor receptor tyrosine kinase inhibitors ( eg , erlotinib ) , and platinum compounds . in addition , insufficient data were reported in the saturn study on second - line treatment dosing and duration . survival curves were fitted parametrically to the kaplan meier progression - free survival and overall survival curves to facilitate extrapolation beyond the clinical trial period . the gamma function13,14 provided the best fit for overall survival , whereas for progression - free survival the gompertz distribution14 was shown to be the best fit for the stable disease population . therefore , these functions were used in all analyses to estimate and extrapolate progression - free survival and overall survival beyond the clinical trial period . the cost of erlotinib was incorporated into the model using the country - specific list price of a pack of 30 150 mg tablets ( 2130.00 , 2928.24 , and 1864.57 for france , germany , and italy , respectively ) and was applied in the base - case analysis for the average treatment duration during the clinical trial ( table 1 ) . as per the study protocol , patients received a single daily dose of erlotinib 150 mg orally . in order to calculate the monthly cost of erlotinib , the cost per 150 mg tablet ( 71.00 , 83.63 , and 49.10 , respectively ) was multiplied by the average number of days per month ( 30.4 days , table 1 ) . to estimate the resource use associated with administration of erlotinib , the appropriate reference costs associated with administration of oral medication in the pharmacy were used ( table 1 ) . administration costs were obtained from france,15 germany,16 and italy.17 country - specific estimates of the most likely minimum and maximum costs of treatment - related adverse events were employed to propagate the gamma distribution to express uncertainty in the cost of treating the event.18 the cost values were then applied to the frequency of adverse events.1921", "an area under the curve ( or partitioned survival ) model was developed consisting of three health states , ie , progression - free survival , progression , and death ( figure 1 ) . survival data from the trial were used to follow patients from the progression - free survival to the progression and death states , and allowed for extrapolation of the data beyond the trial period . the model uses the stable disease population , as indicated in the european union label,12 to calculate efficacy and the same dose as was used in the trial , ie , erlotinib 150 mg / day orally + best supportive care or placebo + best supportive care . the area under the curve model works by assuming that , at any discrete time point , the difference between the proportion of patients in overall survival and the proportion of patients in progression - free survival determines the proportion of patients who have experienced disease progression . at the start of the analysis , it was assumed that all patients were in the progression - free survival health state . a half - cycle correction is used to account for events that occur during each monthly cycle . the time horizon of 5 years can be considered to be a lifetime perspective in this patient population ( after 5 years , virtually all patients will have died ) . the model was developed from the perspective of the national health care payer in three european countries , ie , france , germany , and italy ; therefore , indirect costs , including travel costs , and costs to other public agencies were not included . probabilistic sensitivity analyses were performed to investigate the impact of changes in the key input parameters and assumptions on the results of the base - case analysis . distributions around the following parameters were used to reflect uncertainty in the model ( ie , the probability of erlotinib being cost - effective ) : estimates for the parametric progression - free survival and overall survival functions , and cost and frequency of adverse events . adverse events were selected for inclusion in the model by grade of severity and frequency of occurrence by event and treatment arm , according to the following rules : all treatment - related adverse events grade 34 , and adverse events that occurred from the start of the study and 28 days after the last cycle of first - line treatment inclusively . the frequency of each event was further categorized into the number of patients experiencing at least one adverse event . these values were used for calculating the average number of each adverse event per patient ( eg , probability of a specified adverse event per patient average number of episodes of adverse event per patient ) . the model does not include post - progression - free survival treatments ( following disease progression ) once maintenance therapy is stopped , because it was not designed to incorporate this information . therefore , second - line and further - line treatment costs , capturing the various treatment strategies used following progression , were not accounted for within the model . this was due to the variation in second - line treatment observed in the saturn study ; uncontrolled patients received multiple therapies after disease progression , which included taxanes ( eg , docetaxel ) , antimetabolites ( eg , pemetrexed ) , anti - neoplastic agents , epidermal growth factor receptor tyrosine kinase inhibitors ( eg , erlotinib ) , and platinum compounds . in addition , insufficient data were reported in the saturn study on second - line treatment dosing and duration .", "survival curves were fitted parametrically to the kaplan meier progression - free survival and overall survival curves to facilitate extrapolation beyond the clinical trial period . the gamma function13,14 provided the best fit for overall survival , whereas for progression - free survival the gompertz distribution14 was shown to be the best fit for the stable disease population . therefore , these functions were used in all analyses to estimate and extrapolate progression - free survival and overall survival beyond the clinical trial period . the cost of erlotinib was incorporated into the model using the country - specific list price of a pack of 30 150 mg tablets ( 2130.00 , 2928.24 , and 1864.57 for france , germany , and italy , respectively ) and was applied in the base - case analysis for the average treatment duration during the clinical trial ( table 1 ) . as per the study protocol , patients received a single daily dose of erlotinib 150 mg orally . in order to calculate the monthly cost of erlotinib , the cost per 150 mg tablet ( 71.00 , 83.63 , and 49.10 , respectively ) was multiplied by the average number of days per month ( 30.4 days , table 1 ) . to estimate the resource use associated with administration of erlotinib , the appropriate reference costs associated with administration of oral medication in the pharmacy were used ( table 1 ) . administration costs were obtained from france,15 germany,16 and italy.17 country - specific estimates of the most likely minimum and maximum costs of treatment - related adverse events were employed to propagate the gamma distribution to express uncertainty in the cost of treating the event.18 the cost values were then applied to the frequency of adverse events.1921", "comparison of the total average costs of alternative therapies for first - line maintenance shows that erlotinib was more costly than best supportive care in all three countries . treatment with erlotinib in first - line maintenance resulted in a mean life expectancy of 1.39 years ( 16.7 months ) in all countries , compared with a mean 1.11 years ( 13.3 months ) with best supportive care , which represents 0.28 life - years ( 3.4 life - months ) gained with erlotinib versus best supportive care . results of the base - case and probabilistic analyses , presented as mean values and corresponding 95% ci for the latter are shown in table 2 . in the base - case analysis , the cost per life - year gained was 39,783 , 46,931 , and 27,885 in france , germany , and italy , respectively . in the probabilistic analysis , the cost per life - year gained was 39,214 , 46,816 , and 27,864 , respectively . the variation in cost per life - year gained between countries was due to the difference in the total monthly cost of erlotinib , which comprises administration costs , acquisition costs , and costs of adverse events ( table 3).2225 a cost - effectiveness acceptability curve for each country , generated from the probabilistic analysis , is presented in figure 2 . these curves show that there is a 50% chance that erlotinib would be cost - effective in first - line maintenance with a willingness to pay approximately 50,000 in france and germany and 40,000 in italy .", "treatment of advanced or metastatic nsclc is often considered costly ; however , the value of a new treatment should incorporate the clinical benefit it provides compared with current treatment options , and the incremental cost of funding the new therapy versus the unmet need . in view of the current poor survival outcomes in metastatic nsclc , it is of interest to consider the cost per life - year gained with a new therapy . an increase in health care expenditure in cancer care makes cost - effectiveness analysis an important tool for national health care payers.26 this is the first analysis of its kind to present a cross - market analysis of cost per life - year gained for first - line maintenance therapy in patients with locally advanced or metastatic nsclc . in each country , erlotinib resulted in a survival gain when compared with best supportive care . the difference between highest and lowest cost per life - year gained across the three countries was 19,000 for both base - case and probabilistic results . figure 2 demonstrates that the chance of erlotinib being cost - effective versus best supportive care in first - line maintenance is relatively stable across the three countries , although slightly higher in italy given the same willingness to pay . a strength of the model is its transparency , given that the discrete health states closely match the end points measured in the clinical trial . the methods of extrapolation are also similar to those commonly suggested by the health economic community,18 as well as the modeling methods widely reported in peer - reviewed publications . despite the strengths of the model , it is important to recognize any associated limitations . the model was developed to estimate the cost - effectiveness of treatment in the first - line maintenance setting only . this was due to a variety of second - line and further - line treatments reported in the saturn trial and insufficient data reported on treatment dosing and duration . pemetrexed , a multitargeted antifolate chemotherapeutic agent , is the only other therapy approved by the european medicines agency for use in first - line maintenance for metastatic nsclc ( in patients with non - squamous disease).11 in the jmen trial,27 pemetrexed was associated with similar efficacy benefits versus best supportive care ( progression - free survival hr : 0.50 , 95% ci : 0.420.61 ; p < 0.0001)27 as erlotinib versus best supportive care in the saturn trial . in a population - matched , indirect comparison analysis comparing erlotinib and pemetrexed as first - line maintenance therapy in metastatic nsclc , both treatments were found to be similarly efficacious ( table 3).23 an economic analysis of pemetrexed versus best supportive care in the us market showed that the cost per life - year gained using pemetrexed first - line maintenance therapy versus best supportive care in patients with advanced , non - squamous nsclc was us$122,371 ( 86,869).22 the analysis suggests that pemetrexed is not cost - effective compared with best supportive care , given the cost - effectiveness ratios for medication typically reimbursed in the us , while our analysis shows that erlotinib is cost - effective when compared with best supportive care ( table 3 ) . however , it is difficult to compare the cost - effectiveness of erlotinib and pemetrexed using the results of these three analyses . pemetrexed was only efficacious in a non - squamous population and erlotinib was efficacious in both the intent - to - treat and stable disease populations . patient distributions of key characteristics between the saturn and jmen studies were not balanced . the adenocarcinoma population varied by 3% , the number of patients with stage iiib and iv disease varied by 8% between the two trials for both disease stages , and eastern cooperative oncology group performance status varied by 9% for both 0 and 1 . patients in the jmen trial had a better prognosis at baseline.8,27 furthermore , drug costs in the us and europe are different . if a cost - effectiveness analysis of erlotinib versus pemetrexed were to be performed , the comparable efficacy of erlotinib and pemetrexed derived from the indirect comparison analysis23 would make drug costs the key driver . monthly costs of erlotinib and pemetrexed comprising administration , acquisition , and adverse event costs ( table 3 ) derived from a manuscript in press28 ( published in part at a recent scientific conference24,25 ) show erlotinib has lower monthly per - patient treatment costs . based on these costs , a cost - effectiveness analysis of erlotinib versus pemetrexed might be expected to show that erlotinib is as efficacious as pemetrexed but less costly . however , the results would need to be interpreted with caution , given the imbalance in the key characteristics of patient populations between the saturn and jmen trials.8,27 given that erlotinib is cost - effective versus best supportive care based on this economic analysis , and has efficacy similar to that of pemetrexed at a lower cost , it could become the new standard of care in first - line maintenance therapy in locally advanced and metastatic nsclc . in addition to the clinical similarity and economic advantages of erlotinib over pemetrexed , erlotinib may also have other advantages due to a lower incidence of adverse events and an oral , as opposed to intravenous , formulation.8 oral treatment is often considered more convenient and is not usually associated with any administration costs .", "erlotinib is a cost - effective treatment option versus best supportive care when used as first - line maintenance therapy for locally advanced or metastatic nsclc in patients with stable disease . this study suggests that , in conjunction with toxicity and efficacy data , economic analyses are useful in defining the best maintenance strategy for patients with locally advanced or metastatic nsclc ." ]

[ "spinal anaesthesia has been widely used for caesarean section ( cs ) deliveries because of greater maternal safety , foetal benefits , higher parental satisfaction , and consumer demand . however , to address the problem of limited duration of action and to improve the quality of analgesia , various adjuvants are added intrathecally with local anaesthetics ( la ) . the adjuvants gained widespread popularity as they reduce the amount of la and thus the incidence of side - effects . clonidine , a selective partial agonist for alpha-2 adrenoreceptors , is an attractive alternative to commonly used opioids , and is known to increase both sensory and motor block of la . several studies have shown that clonidine also has antihyperalgesic effect and thus reduces the post - operative analgesic requirement . commonly , adjuvants are mixed with la in a single syringe before injecting the drugs intrathecally . mixing of these drugs changes the density of both drugs , thus affecting their spread in the cerebrospinal fluid ( csf ) . density is known to influence the spread of la , but the effect of adjuvant solution density on its movement in the csf has not been studied extensively . therefore , we hypothesised that if we administer la and the adjuvants separately , it may minimise the effect of the changes in densities and also hence their actions . thus , in this study we aimed to compare block characteristics , intra - operative haemodynamics and post - operative pain relief in parturients undergoing cs under subarachnoid block ( sab ) , after administering hyperbaric bupivacaine ( hb ) and clonidine as a mixture in single syringe and sequentially in two syringes .", "after approval by the institutional ethical committee and written informed consent , sixty parturients with singleton pregnancy , american society of anaesthesiologist ( asa ) i and ii physical status , scheduled for elective cs under sab , were enrolled in this single - blind prospective randomised controlled trial . patients having multiple pregnancy , intrauterine deaths or known foetal anomaly , severe pregnancy induced hypertension , contraindication to sab , patients on cardiovascular medications and those having history of hypersensitivity to clonidine and la were excluded from the study . using a sealed envelope technique , ( n = 30 ) received hyperbaric bupivacaine ( 0.5% ) 10 mg ( 2 ml ) and clonidine 75 mcg ( 0.5 ml ) as a mixture . group b ( n = 30 ) received clonidine 75 mcg ( 0.5 ml ) followed by hyperbaric bupivacaine ( 0.5% ) 10 mg ( 2 ml ) in different syringes . for our study , the two drugs used were sourced from same company to avoid manufacturer 's difference . hyperbaric bupivacaine used was heavy anawint and clonidine used was cloneont manufactured by neon laboratories limited , mumbai . patients were kept fasting overnight and antacid prophylaxis with oral ranitidine 150 mg at night and on the morning prior to surgery were given . the patients were familiarised with the concept of visual analogue scale ( vas ) for pain assessment with 0 = no pain and 10 = worst possible pain . in the operating room , monitor for heart rate ( hr ) , non - invasive blood pressure , electrocardiography and oxygen saturation ( spo2 ) was connected and baseline parameters were recorded . after establishing 18 gauge venous cannula , patients were pre - loaded with 15 ml / kg of lactated ringer 's solution 15 - 20 min before spinal block . under all aseptic precautions sab was administered with 23 g quincke spinal needle through mid - line approach in sitting position . intrathecal ( it ) drug was injected in l3-l4 interspace over 30 s ( including the time for change of syringe in sequential administration ) . after the block was performed , the patients were made supine with 15-20 left displacement of uterus until birth of baby by keeping a wedge under the right buttock . fluid therapy was maintained with lactated ringer 's solution 10 ml / kg / h . an experienced anaesthesiologist who was unaware of the drug given evaluated the spinal block and other physiological parameters . haemodynamic parameters such as hr , systolic arterial pressure ( sap ) , diastolic arterial pressure ( dap ) were monitored at every 2 min ( min ) for the first 20 min and then every 5 min subsequently until 75 min or until completion of surgery . any episode of hypotension and bradycardia in 24 h was noted . hypotension ( decrease in sap below 90 mmhg or a fall in blood pressure by > 20% of baseline values ) was treated with a rapid infusion of crystalloids ( 200 ml ) and a bolus of ephedrine 5 mg intravenous ( i.v ) was administered if hypotension persisted . bradycardia ( hr < 50 beats / min ) was treated with injection atropine 10 mcg / kg i.v . the onset of sensory block was assessed by loss of pin prick sensation along the mid clavicular line bilaterally . dermatomal level was tested every 2 min after sab until level was stabilised for four consecutive readings . the time from it injection to highest sensory level ( maximum block height ) was noted . furthermore , level was tested every 30 min until regression from highest level to t10 dermatome was noted . degree of motor block was assessed by modified bromage scale as follows ; i free movement of legs and feet ; ii just able to flex knees with free movement of feet ; iii unable to flex knees but with free movement of feet ; iv unable to move legs and feet . time to achieve complete motor block ( modified bromage iv ) and its regression to modified bromage i was noted . respiration was monitored and respiratory depression was defined as respiratory rate < 10 breaths / min or spo2 < 92% ; oxygen was then supplemented through nasal prongs at 4 l / min . sedation score was assessed at the same interval as sensory block until 2 h post - operatively by ramsay sedation score ( rss ) as : level 1 awake , anxious , agitated , restlessness ; level 2 awake , tranquil , co - operative ; level 3 responds to commands ; level 4 asleep , brisk response to stimuli ; level 5 n asleep , sluggish response to stimuli ; level 6 asleep , no response to stimuli . intra - operative pain was checked and expressed as vas , whenever the parturients complained of any discomfort or pain . duration of effective analgesia was defined as time from it injection till vas was 3 , when rescue analgesia in the form of injection i.v diclofinac sodium 75 mg was administered . patients complaining of nausea or having any episode of vomiting were given injection ondansetron 0.15 mg / kg i.v . , new - born 's apgar scores were determined by a paediatrician not otherwise involved in the study at 1 , 5 , and 10 min . post - operatively any incidence of bradycardia , hypotension , nausea / vomiting , prolonged sedation reported by the recruited post - operative care unit staff was taken into account and managed accordingly . the parturients were also interviewed for post - dural puncture headache ( pdph ) , backache , and examined for any neurological deficit . power analysis suggested that a sample size of 30 patients / group was required to achieve a power of 80% and a level significance of 0.05 to be able to detect a difference between the groups , based on the assumption that an increase in the mean duration of analgesia by 60 min in sequential group . interpretation of the data was carried out and analysed using software microsoft excel and spss version 19 . data is represented as mean standard deviation for continuous data and frequency ( percentage % ) or median ( range ) for non - parametric ( categorical ) data . the proportion of adverse effects was compared using chi - square test and level of sedation was compared with the help of wilcoxon test . the p < 0.05 was considered significant and p < 0.01 was considered highly significant .", "demographic data in terms of age , height , weight , asa physical status and duration of surgery were comparable in both groups [ table 1 ] . the onset time of sensory and motor block and also the highest level of block achieved ( t4 ) were comparable in both groups [ table 2 ] . mean time to reach maximal cephalad sensory block height was significantly less in group b ( 3.21 0.13 min ) than in group m ( 4.43 0.26 min ) and the total duration of analgesia lasted significantly longer in group b ( 474.3 20.79 min ) as compared to group m ( 337 18.22 min ) ( p = 0.000 ) . complete motor blockade was achieved earlier in group b ( 4.75 0.40 ) than in group m ( 5.84 0.36 ) ( p = 0.000 ) . the resolution time of motor block back to modified bromage i was significantly prolonged in group b ( 292.23 15.24 min ) than in group m ( 189.50 16.31 min ) [ table 2 ] . characteristics of sensory and motor block haemodynamic parameters showed that the lowest values of the hr were after 45 min of the administration of sab , but none of the patients had bradycardia [ figure 1 ] . there was a significant fall in sap at 2 min and 4 min after administration of sab in both groups [ figure 2 ] . a significant fall in dap was seen at 2 , 4 , 6 , and 8 min of administration of sab . there was an overall trend of fall in sap and dap in both groups , except during the time intervals of 20 and 25 min ( during delivery of baby ) where there was rise in both sap and dap [ figures 2 and 3 ] . the falling trend of arterial blood pressures was more in the group b than in group m. heart rates at different time intervals systolic blood pressure at different time intervals diastolic blood pressure at different time intervals there was no noticeable fall in spo2 in both groups . it was observed that only one patient in group m and 3 in group b had sedation score of 4 according to rss . intra - operative incidence of hypotension , bradycardia , respiratory depression , nausea / vomiting , dry mouth and additional analgesic requirement are comparable in both groups [ figure 4 ] . newborn 's well - being , assessed by the apgar scoring system was observed in both groups . the median value was 8 at 1 min , 9 at 5 min and 10 at 10 min in both groups .", "activation of post - synaptic alpha-2 receptors in the substantia gelatinosa of the spinal cord is the presumed mechanism by which clonidine produces analgesia . these receptors are located on primary afferent terminals ( both at peripheral and spinal endings ) , on neurons in the superficial lamina of the spinal cord , and within several brainstem nuclei implicated in analgesia , supporting the possibility of analgesic action at peripheral , spinal , and brainstem sites . various authors have used different doses of it clonidine ranging from 15 mcg to 300 mcg along with local anaesthetics . kaabachi et al . , in their study used 2 mcg / kg of it clonidine and reported extended duration of post - operative analgesia , but with moderate side - effects . sethi et al . , used 70 mcg of clonidine and found a significant decrease in mean arterial pressure and hr in clonidine group , but no therapeutic intervention was required for either . since marked decrease in blood pressure is observed only with intermediate doses of spinal clonidine ( 150 mcg ) and relative haemodynamic stability is maintained after larger doses ( 300 - 400 mcg ) , we were interested to test a dose of lower range of efficacy . hence , we selected a 75 mcg of preservative free clonidine as an adjuvant for spinal anaesthesia in cs . patients scheduled for cs were chosen for the study because it is a well - known fact that visceral discomfort and pain is common occurence in cs under sab . the observations and results obtained in the study are based on the assumption that the original densities of hyperbaric bupivacaine and clonidine are lost when they are premixed in a syringe thus , they exert suboptimal actions when compared to their it administration in a sequential manner . the above assumption is supported by the work of desai et al . who studied the same effect by adding opioids to la solution intrathecally . the densities of the drugs that we used ( hb and clonidine ) were 1.0260 and 0.9930 , respectively . the density of the mixture of 2 ml ( 10 mg ) of hyperbaric bupivacaine and 0.5 ml ( 75 mcg ) clonidine was also estimated and it was found to be 1.0189 . in our study , we observed that the mean onset time of sensory and motor block was similar in both groups . however , onset of sensory block does not get any better after a particular dose as supported by a study done by heo et al . who did not report any difference in onset time even after using 150 mcg clonidine . the time to reach maximum sensory block height and maximum motor block was significantly less in group b ( sequential drugs ) than in group m ( mixed drugs ) in this study . this difference might have existed because of the preferential cephalad spread of clonidine when we administered it through a separate syringe , owing to its hypobaric nature which is lost when the drugs are premixed . desai et al . also observed that the time to reach highest level of block was less when morphine and fentanyl were administered sequentially with hb than when given as a mixture . in our study , we found that the mean time taken for sensory block to regress to t10 level was significantly longer in group b ( 240.67 18.47 min ) than in group m ( 153.83 13.11 min ) . similarly , the mean duration of analgesia lasted significantly longer in group b ( 474.33 20.79 min ) than in group m ( 337 18.22 min ) , depicting significant prolongation of analgesic effect in the group receiving drugs in a sequential fashion . this difference might be due to the fact that injecting clonidine and bupivacaine as a mixture dilutes clonidine and receptor occupancy might decrease leading to less pronounced effect . however , if clonidine is administered separately , we expect a greater spread and therefore formation of stronger bonds with the receptor leading to a denser and prolonged block . according to desai et al . , dextrose in a hb solution slow the movement of morphine molecules in the csf , reducing the exposure of supraspinal centres to morphine . clonidine also being hypobaric drug , acting on both spinal and supraspinal receptors , might exhibit similar properties . gray et al . observed that duration of analgesia is increased when it morphine is administered with normal saline ( hypobaric ) than with dextrose saline ( hyperbaric ) . clonidine decreases hr by a presynaptic mediated inhibition of nor epinephrine release and by a direct depression of atrioventricular nodal conduction after systemic absorption . the maximum fall in the hr when compared to the baseline was 28% in group b , whereas it was only 13% in group m which was statistically significant ( p < 0.001 ) . this fall in hr was more pronounced after about 40 - 60 min of administration of sab and toward end of the surgery . however , in our study none of the patients had bradycardia . a significant fall in arterial blood pressure after sab the fall from baseline sap and dap in group m was 15% and 18% and in group b was 19% and 20% , respectively . haemodynamic effects of clonidine after neuraxial or systemic administration begin within 30 min , reach maximum within 1 - 2 h , and last approximately 6 - 8 h after a single injection . we observed hypotension in 13% patients in group m and 16% patient in group b. hypotention was managed by i.v fluids and vasopressors were needed for only 1% and 3% parturients in groups m and b , respectively which was comparable in both groups , suggesting that the clonidine groups did not have a higher predisposition for the development of hypotension if administered sequentially . in our study , the level of sedation provided by it clonidine ( rss 2 and 3 ) was not only acceptable , but also beneficial owing to its anxiolytic role . none of the patients needed any additional analgesics during the intra - operative period . in line with our observations , benhamou et al . found that when it clonidine was administered with hb , none of patients required additional analgesics to obtain an adequate sensory block . none of the patients complained of dry mouth . in the post - operative period one patient each in group m and b developed pdph , which was managed conservatively . there was no incidence of hypotension , bradycardia and nausea / vomiting , neurological deficit , prolonged sedation in the post - operative period . neves et al . also concluded that addition of it clonidine did not adversely affect the neonatal outcome in terms of apgar scores . the limitation of our study was that we measured the densities of solutions in vitro ; but , we could not measure the densities when injected into the csf .", "sequential administration of clonidine reduces the time to achieve complete sensory and motor block and significantly prolongs the total duration of analgesia . addition of clonidine to hyperbaric bupivacaine provided a dense surgical anaesthesia irrespective of the technique of administration . however , we noticed that sequential technique did not increase the level of sedation and incidence of hypotension or bradycardia as compared to the administration of drugs as mixture ." ]

[ "in 2014 , there will be 63,920 new cases of kidney and renal pelvis cancer diagnoses resulting in approximately 13,860 deaths . renal cell carcinoma ( rcc ) is one of the most lethal genitourinary cancers and comprises 85% of these new diagnoses . the incidence of rcc has steadily increased over the past few decades due to incidentally discovered small renal masses ( srm ) on radiographic imaging resulting in stage migration to clinical t1a disease from more advanced disease . numerous treatment options exist for clinical t1a disease , including total nephrectomy , partial nephrectomy , radiofrequency ablation , cryoablation , and high - intensity focused ultrasound ( hifu ) . in 2009 , the american urologic association ( aua ) published the guideline for the clinical stage 1 renal mass which concluded that partial nephrectomy is the standard of care for clinical t1a disease suggesting that the open approach is preferred over minimally invasive techniques . in experienced hands , laparoscopic partial nephrectomy ( lpn ) is associated with similar oncologic outcomes to open partial nephrectomy ( opn ) with the added benefit of decreased narcotic use , decreased hospital stay , and earlier convalescence [ 57 ] . robotic partial nephrectomy ( rpn ) and lpn have also been compared with similar outcomes , if not superior rpn outcomes , in the hands of an experienced minimally invasive surgeon . most studies report the outcomes of either ( a ) single surgeon and single and/or dual approach or ( b ) multicenter , multisurgeon , and dual approach . to our knowledge , there have been no reports of a single surgeon 's experience with each of the three modalities . our hypothesis is that when performed by a single surgeon , open , laparoscopic , and robotic partial nephrectomy could differ in postoperative complication rates and overall kidney function . thus , we report the perioperative outcomes of 106 consecutive patients treated with partial nephrectomy by a single surgeon using all three surgical approaches opn , lpn , and rpn .", "after obtaining institutional review board approval , a retrospective chart review of a prospectively collected kidney cancer database was performed . from august 2006 to february 2012 , a single surgeon ( rm ) with minimally invasive and urologic oncology fellowship training performed 106 consecutive partial nephrectomies using any of the three available surgical modalities opn , lpn , or rpn . the decision for the approach was multifactorial and was based on patient and tumor characteristics . initially in the practice , lpn was offered to patients with tumors of favorable size and location . opn was reserved for patients who were uninephric , had compromised kidney function , or had large tumors in an unfavorable location . in early 2008 , rpn gradually replaced lpn as the preferred minimally invasive approach . preoperative variables and demographics analyzed included age , gender , body mass index ( bmi ) , american society of anesthesiologist ( asa ) score , glomerular filtration rate ( gfr ) , hematocrit ( within 30 days of surgery ) , tumor laterality , and tumor size . operative variables analyzed included operative time , estimated blood loss ( ebl ) , complications , pathology ( benign , malignant ) , and margin status . postoperative variables included length of stay , discharge hematocrit , transfusion , gfr , 3-month gfr , and 30-day complications . the indication for partial nephrectomy was an enhancing renal mass found on cross - sectional abdominal imaging . pathology was reviewed by a dedicated genitourinary pathologist for margin status and tumor type . \n briefly , patients were positioned in a modified 45-degree flank and an incision was made for access to the retroperitoneum . the kidney was dissected free of attachments in the retroperitoneal space and the hilum was identified . intravenous mannitol ( 12.5 g ) administration and renal hypothermia ( cold ischemia ) were utilized prior to hilar clamping in all cases . the hilum was clamped using the satinsky vascular clamp and the resection of the renal lesion was performed with sharp dissection . the collecting system was closed primarily , and individual vessels were identified and controlled using nonabsorbable monofilament suture . argon beam coagulation achieved hemostasis prior to reapproximation of the renal parenchyma with surgicel ( ethicon inc , somerville , nj ) bolsters . in all cases , the patient was positioned in a modified flank configuration with a total of four ports . once the hilum and mass were identified , mannitol ( 12.5 g ) was administered and the hilum was controlled using a laparoscopic vascular clamp ( warm ischemia ) . surgicel ( ethicon inc , somerville , nj ) and floseal ( biosurgery , deerfield , il ) were used for hemostasis and the tumor bed was repaired in a running fashion based on the depth of the lesion . the parenchyma was reapproximated with 2.0 v lock suture , surgicel ( ethicon inc , somerville , nj ) bolsters , and secured with hem - o - lok clips . in superficial tumors penetrating less than 1 cm into kidney parenchyma , clamping and/or repair of the base of resection was not performed . \n all patients underwent warm ischemia , which was achieved using either laparoscopic bulldog clamps or a vascular clamp . similar to the lpn technique , the resection bed was closed in a running fashion using an absorbable suture and the defect was approximated using a surgicel ( ethicon inc , somerville , nj ) bolster in most cases . the statistical package for the social sciences v.19 ( spss inc . all p values were one - sided , and p < 0.05 was considered statistically significant . categorical variables were compared using a chi - square test and continuous variables were compared using one - way anova .", "among the 106 patients in the study , 23 patients ( 22% ) underwent opn , 48 patients ( 45% ) underwent lpn , and 35 patients ( 33% ) underwent rpn . there was no difference in age , gender , bmi , asa score tumor laterality , or tumor size between the three groups ( table 1 ) . there was a statistical trend towards lower preoperative hematocrit for opn patients compared to the minimally invasive patients ( opn40 4% , lpn43 4% , rpn42 4% , p = 0.09 ) . preoperative gfr was 71 28 ml / min for opn patients , 76 25 ml / min for lpn patients , and 96 37 ml / min for rpn patients ( p = 0.004 ) . there was no difference in intraoperative complication rate , tumor pathology , or margin status between the opn , ldn , and rpn patients ( table 2 ) . operative time was the shortest in the opn group ( opn163 35 min , lpn227 53 min , rpn244 53 min , p < 0.0001 ) . ebl ( opn367 286 ml , lpn163 179 ml , rpn191 173 ml , p < all patients who had opn had the kidney cooled for an average time of 8 minutes before excision of the tumor . there were no differences in length of stay , blood transfusion , discharge gfr , or 3-month gfr for the three cohorts of patients ( table 3 ) . discharge hematocrit was significantly lower for opn patients ( 30 3% ) compared to lpn ( 36 4% ) and rpn ( 35 4% ) patients ( p < 0.0001 ) . upon follow - up , the opn group had the highest incidence of 30-day complications ( 30% ) , while the rpn group had the lowest ( 14% , p = 0.008 ) . the opn complications included clavien i ( n = 2 ) , clavien ii ( n = 1 ) , clavien iii ( n = 3 ) , and clavien iv ( n = 1 ) . the lpn complications included clavien i ( n = 4 ) , clavien ii ( n the rpn complications included clavien i ( n = 1 ) , clavien ii ( n = 1 ) , and clavien iii ( n = 3 ) .", "radical nephrectomy ( rn ) has been the mainstay of treatment for clinical stage i tumors resulting in excellent cancer specific survival , local tumor control , and progression free survival ; however , reports have highlighted a negative impact on renal function and chronic kidney disease ( ckd ) associated with rn . this effect was acknowledged in the 2009 aua guideline for the management of small renal masses which concluded that opn should be considered standard of care and that minimally invasive options , such as lpn and rpn , be considered as second line treatment modalities . furthermore , recent studies have established that partial nephrectomy ( pn ) provides similar oncological outcomes when compared to rn [ 1214 ] . the current study is the first , to our knowledge , which compares all three modalities of pn ( opn , lpn , and rpn ) by a single surgeon . multi - institutional studies may represent dissimilar patient cohorts that introduce selection bias and may invoke concerns regarding surgeon variability . , there was no randomization or objective criteria for the pn approach ; rather , the trend was for more minimally invasive surgery as the surgeon developed a comfort level with the lpn and rpn approach . this is evident by the fact that tumor characteristics for each group are comparable ( laterality , size , pathology , and margin status ) . previous single surgeon studies have analyzed rpn versus lpn [ 11 , 1519 ] with the consensus being that rpn offers a shorter learning curve to minimally invasive pn and comparable warm ischemia time , ebl , and length of stay . two common criticisms associated with rpn include ( i ) the cost of the robot and ( ii ) increased surgical time . although it is difficult to mitigate the cost associated with rpn compared to lpn and opn , the oft - held conception that procedures take significantly longer may be a misconception after achieving the learning curve associated with rpn . concluded that rpn achieved similar operative times to lpn after only 5 procedures and the current study corroborates similar operative times between the two approaches ( 244 53 versus 227 53 min ) . in the opn cohort , there was a 30-day complication rate of 30% , which was statistically significant compared to the lpn ( 17% ) and rpn ( 14% ) groups , and higher than that reported by other authors . gill et al . reported a 16% and 13% postoperative complication rate in their initial comparison of lpn and opn , respectively . bhayani and waxman and winfield reported postoperative complication rates of 16% and 18.2% , respectively , in each of their single - surgeon experiences with lpn [ 21 , 22 ] . a recent report , which pooled data from 4 institutions considered centers - of - excellence , reported a postoperative complication rate of 14.4% in patients who underwent rpn . most complications were clavien grade i / ii and were managed conservatively and affirm the safety of rpn in experienced hands . the complication rate was lowest in the rpn group at 14% and is similar to other reports , with ranges of 1020% [ 8 , 15 , 24 ] . the primary limitation of the study is the inherent selection bias and patient confounders associated with a retrospective study . surgical confounders were minimized as only operations performed by a single surgeon were analyzed . secondly , renorrhaphy differed between the opn and minimally invasive cohorts along with the use of renal cooling in the opn group compared to warm ischemia time for the minimally invasive approaches .", "nephron sparing surgery has emerged as the optimal surgical approach for t1a and in experienced hands t1b kidney masses . by removing surgeon as a confounding variable , although not currently the gold standard for partial nephrectomy , robotic surgery continues to emerge as the future for renal surgery secondary . rpn offers less blood loss and fewer postoperative complications than opn and overcomes the technical difficulties of lpn ." ]

[ "job syndrome is one of the hyper immunoglobulin e ( ige ) syndrome ( hies ) conditions characterized by signal transducer and activator of transcription 3 ( stat3 ) signaling mutations . patients with job syndrome have characteristic clinical features in association with mutations in stat3 signaling . these include marked elevation in serum ige and susceptibility to staphylococcal infections of the pulmonary tract and skin.1 one of the hallmark features of the disease includes the formation of abscesses . on the basis of the elevation of serum ige levels , it was hypothesized that there would be a lower incidence of clinical anaphylaxis among pediatric job syndrome patients .", "an electronic medical record database , including both inpatient and outpatient records , was utilized . the database from a large urban children s medical center was searched from january 1 , 2009 to december 31 , 2014 , using the international classification of diseases , ninth revision ( icd-9 ) codes assigned to each diagnosis , job syndrome , hies , and anaphylaxis . the icd-9 codes used corresponding to each diagnosis were as follows : asthma , 493.00493.99 ; job syndrome , 288.1 ; and anaphylactic shock , 995.61 ( peanut ) and 995.67 ( milk ) . the anonymous data generated for anaphylactic shock , asthma with anaphylactic shock , and job syndrome / hies were used to identify patients . the total number of patients was identified with 1 ) job syndrome / hies ; 2 ) asthma with anaphylactic shock ; 3 ) anaphylactic shock with and without peanut allergy , and with and without milk allergy ; and 4 ) job syndrome / hies with anaphylactic shock . the database search was conducted with the medical center health information support and did not involve personal health information analysis . the study was exempt from irb review because there was no use of personal health information , as discussed with the university of california irb office .", "the total number of patients with job syndrome / hies identified in the database was 18 . among the 22,890 patients evaluated with asthma of the 614 total anaphylactic patient cases identified , 286 ( 46.5% ) had anaphylaxis with no determined specific cause . there were 250 cases ( 40.7% ) of peanut allergen - induced anaphylaxis and 78 cases ( 12.7% ) were because of milk products . some patients may have been coded for one or more causes of shock . despite the elevation of ige associated with hies / job syndrome a one- and two - tailed t - test showed that there was no statistically significant difference when comparing asthma and anaphylaxis and hies with anaphylaxis .", "a one- and two - tailed t - test showed that there was no statistically significant difference when comparing asthma and anaphylaxis and hies with anaphylaxis .", "this study shows that there were no identified cases of anaphy - laxis among the job syndrome / hies population studied . this low incidence is in contrast to established higher rates of ana - phylaxis among atopic conditions associated with high levels of serum ige . the incidence of anaphylaxis among children and adolescents has been reported as between 0.05% and 2%.2 this study identified > 600 cases of anaphylaxis , during the same time period at the same medical center , among the non - hies pediatric population . the association between allergic disease and autosomal - dominant ( ad ) hies was studied in a murine model . these mutations result in a very elevated serum ige level , usually without any evidence of atopic disease . the authors found that in a murine model of mast cell degranulation , mast cell - induced anaphylaxis was blunted in the mutant mice . the animals treated with a c188 - 9 stat3 inhibitor demonstrated altered physiologic responses . the responses measured included body temperature and survival . those treated with the inhibitor had longer survival and less change in body temperature.3 in a cellular model described in the same citation , human umbilical vein cells from ad hies patients or control cells treated with a stat3 inhibitor demonstrated aberrant responses to mast cell mediators , such as histamine or platelet - activating factor . the cells from two newborns with hies were less permeable than wild - type cells when exposed to mast cell mediators.3 these findings suggest that stat3 mutations confer resistance to mast cell degranulation . a clinical study of food allergies and adult hies conducted a clinical evaluation of food allergies in a cohort of 71 patients with ad hies compared with healthy control subjects ( n=41 ) and atopic subjects ( n=65 ) . the results indicated that fewer patients with ad hies developed food allergies and anaphy - laxis than atopic patients with marked serum ige elevation , eczema , and no stat3 mutations . the study reported that fewer patients with ad hies had anaphylaxis to a food allergen than atopic controls ( 8.5% vs. 33.3% ) . the ad hies patients did demonstrate that they had specific ige to food allergens . when comparing peanut anaphylaxis between the groups , there were no cases of peanut - induced anaphylaxis found in the patients with hies.4 the authors concluded that stat3 mutations may play a role in protecting the individual from food allergies as a trigger for anaphylaxis . in studying the activation of a key regulatory cell , basophils from hies patients were less sensitive to ige cross - linking than basophils from non - allergic subjects.4 this study demonstrates that among the pediatric cases identified , there have been no cases of anaphylaxis among the hies patients . this is in contrast to a large number of children without hies who did have anaphylaxis due to peanut or milk allergens . this study finds support for a potential protective effect of stat3 mutations in preventing anaphylaxis and demonstrates this finding in a pediatric population . further studies are warranted to identify the molecular and cellular pathways involved in reducing vascular permeability during mast cell degranulation among children with hies ." ]

[ "\n leishmania parasites are heteroxenous kinetoplastid protozoan organisms , which undergo complete differentiation upon a cycle of proliferation / differentiation in the midgut of phlebotomine sand flies followed by the transmission of infective metacyclic promastigotes [ 1 , 2 ] to mammalian hosts during the insect blood meal . once infecting mammalian hosts , these organisms , from free - living protozoa , become obligate intracellular parasites , residing and proliferating inside phagolysosomes of mononuclear phagocytic cells as amastigote forms . in humans , leishmania parasites can cause a broad spectrum of clinical manifestations from mild , self - resolving skin diseases to potentially fatal , disseminated visceral diseases . the outcome of the infection is dependent on multiple , interdependent factors , such as vector species , parasite species and strain , genetic background , and immunological status of the host . there are two main groups of parasites , stratified upon the clinical outcome of the infection : the ones capable of causing tegumentar and the ones capable of causing visceral diseases . in both cases , disease is initiated by the bite of an infected sand fly , followed by the generation of a skin lesion , mainly caused by the inflammatory response induced on that site . in some cases the disease is confined to the skin or mucosal tissues , and is termed cutaneous ( cl ) or muco - cutaneous ( mcl ) leishmaniasis , respectively . in addition , diffuse cutaneous leishmaniasis ( dcl ) occurs when the parasite disseminates causing the appearance of multiple skin lesions , in distal sites relative to the transmission site . in a similar way , in visceral leishmaniasis , there is parasite dissemination through blood and lymphatic vessels from the initial lesion site . however , these parasites establish in organs that comprise important populations of mononuclear phagocytes , such as bone marrow , spleen , and liver . among the clinical manifestations observed in humans with the tegumentary disease , diffuse and mucocutaneous leishmaniasis most patients were found in the south and central america , associated with l. amazonensis infection for dcl and l. braziliensis infection for mcl . diffuse cutaneous leishmaniasis ( dcl ) is a rare clinical manifestation and is characterized by the appearance of several nonulcerated nodular skin lesions , uncontrolled parasite proliferation , an inefficient cellular immune response against parasite antigens , and resistance to most therapeutic strategies [ 5 , 6 ] . the intense parasitism in the dcl lesions reflects the functional state of macrophages , which are considered permissive . the deficient macrophage activation in dcl hinders the elimination of leishmania resulting in a disorganized inflammatory process , unable to control the infection . the determinants of dcl are multifactorial and may be associated with both immunologic and genetic events of the patient and the pathogenic factors related to the parasite and vector . the participation of factors associated with the parasite has been shown by some authors although it is a point that still remains to be further explored . in this context , the exhibition of markers of apoptosis by the parasite could be a contributing factor during host - parasite interactions as a possible immunosuppressive mechanism of dcl .", "experimental infection models with leishmania parasites have been extensively used as a tool to study immune responses , especially regarding t - cell differentiation [ 8 , 9 ] . this is due to the fact that inbred mice strains demonstrate specific patterns of susceptibility and resistance to the disease [ 9 , 10 ] which correlate with the immune response built by these animals . the classical experimental model that generated this knowledge was infection with l. major parasites . c57bl/6 mice infected with this parasite develop a th1 cd4 t - cell response , which is highly effective to activate leishmanicidal and inflammatory mechanisms in macrophages , leading to intracellular parasite destruction . in this case , nevertheless , latent parasites remain in the infected tissue , providing antigens to maintain a protective immune response that prevent reinfections . on the other hand , balb / c mice infected with the same parasite species and strain developed a th2 cd4 t - cell response , which is not efficient to promote macrophage classical activation , leading to progressive disease . at the cellular level , this difference is mainly due to the activation of a population of cells that express a highly restricted t - cell receptor , v4 v8 , which recognizes the lack ( leishmania homologue of receptors for activated kinase ) antigen and rapidly produces il-4 , necessary to deviate the immune response towards th2 . currently , it is clear that the proposed model of susceptibility and resistance to leishmania infection is quite reproducible when working with some specific strains of l. major though , for other strains and/or species , the picture is relatively more complex . indeed , effective macrophage activation is the key to control the infection ; however , the phenotype displayed by t cells in different situations is not as polarized as observed in the classical model . actually , there are several papers that suggest that most correlations between cd4 t - cell response and disease development are not straightforward . balb / c il-4 receptor knock - out ( ko ) mice remained susceptible to l. major infection when infected with lv39 strain , which seems to be due to an increased production of il-10 by t cells . c57bl/6 mice infected with a l. major strain , isolated from a patient with nonhealing lesions , still developed a th1 response but displayed a progressive disease . in addition , when infected with the ir173 strain of l. major , cd4 t cells from both balb / c and the resistant mice strain b10.d2 produce il-4 very rapidly . other factors such as infection route , number of parasites inoculated , and type of infection ( needle versus sand fly inoculation ) are crucial to determine the type of response elicited ( reviewed in ) . the complexity of the interactions that determines the clinical and immunological outcome of the disease is much less known , and apparently much more multifactorial in other infection systems , such as the ones that involve l. amazonensis infection . experimental infection with l. amazonensis parasites leads to progressive disease and uncontrolled lesion development in all inbred mouse strains , including those ones that are highly resistant to l. major infection . however , there is a gradient of disease severity , ranging from balb / c mice , which develop a very fast lesion , that ulcerate , generating extensive areas of necrotic tissue , to c3h.hen mice that still develop nonhealing lesions , however , displaying slow progression rates [ 16 , 17 ] . nonetheless , the phenotype displayed by different mouse strains does not correlate with dichotomic th1/th2 responses . actually , in the analyzed mouse strains such as balb / c , c57bl/6 , and c3h.hen , it was possible to observe cd4 t cells capable of producing different types of cytokines such as th2 cytokines ( il-4 , il-5 , and il-13 ) , th1 cytokines ( ifn , and tnf ) , and regulatory cytokines ( tgf and il-10 ) , which characterizes an unpolarized cellular response [ 1820 ] . targeted deletion of the il4 or il10 gene [ 21 , 22 ] causes minimal effects on lesion development and parasite tissue loads as well as treatment of infected mice with ifn or il-12 . interestingly , l. amazonensis promastigotes and , especially amastigotes , are able to get through the innate immune response almost unnoticeable . as mentioned before , the main host cell for leishmania proliferation in the mammalian host is the macrophage , which is , together with dendritic cells ( dcs ) , the main antigen presenting cells of the innate immune response . when compared to l. braziliensis parasites , for example , l. amazonensis parasites are much less capable of triggering the expression of cd40 and cd80 , both costimulatory molecules for t - cell activation , and the production of il-12p40 . actually , amastigote infection is able to downregulate the expression of mhc class ii molecules , which , during macrophage infection , is depending on sequestering these molecules inside the parasitophorous vacuole for degradation [ 26 , 27 ] . during the first week of infection in c57bl/6 mice , chemokines such as ccl5 , ccl3 , ccl2 , ccl4 , and ccl11 as well as their receptors , are not upregulated when compared to l. major infection , both at the lesion site and draining lymph node . additionally , amastigote infection downregulates several intracellular pathways that lead to dc activation such as stat 1 , stat 3 and erk 1/2 phosphorylation and the expression of the interferon - responsive elements irf8 and 1 , suggesting a global inhibition of inflammatory responses of these cells . the most well - characterized ligand for amastigote recognition and internalization in macrophages is the opsonizing antibodies produced throughout infection . triggering of fc receptors on the host cells lead to il-10 production and has a pathogenic role . these events are necessary to evade the early immune response culminating with the ineffective t - cell response observed in most cases . in parallel to l. major infection in balb / c mice , where the oligoclonal v4 v8 cd4 t - cell population is necessary to the development of susceptibility in the host and is considered as pathogenic t cells , in l. amazonensis infection , t cells , in a general way , seem to be highly pathogenic . first of all , there is no clonal or oligoclonal t - cell population involved , since there is no predominance of a single or a group of v chains expressed on t cells that respond to l. amazonensis infection . however , the disruption of cd4 t cell effector functions , as observed in recombinase - activating gene ko mice ( rag ko ) , mhc class ii transactivator ko mice ( ciita ko ) and nude mice leads to transient resistance to l. amazonensis infection , measured by lesion development . in addition , the adoptive transfer of regulatory t cells also restrains pathogenic effector t cells , diminishing lesion size and parasite tissue loads . the mechanisms underlying pathogenic role of t cells for the disease need to be determined .", "phosphatidylserine ( ps ) is a structural phospholipid present in virtually all membranes and cell types . in normal cells these molecules face the cytoplasmic leaflet of the plasma membrane , whereas during apoptotic cell death these molecules translocate to the outer surface . once outside the cell , ps becomes one of the ligands recognized by surrounding phagocytes to clear dying cells . ps is the most characterized tickling ligand of apoptotic cells , which means that ps provides the signals for the phagocyte to activate immunosuppressive and anti - inflammatory mechanisms . ps recognition is mandatory to prevent the establishment of a response to the self - antigens engulfed by these cells during apoptotic cell clearance and to avoid triggering inflammatory responses , especially during the embryogenesis , when massive amounts of apoptotic cells are generated and therefore , cleared [ 3537 ] , but also in adults to prevent inflammatory immunopathologies . the intracellular events , receptors , and soluble factors involved in this mechanism are still being deciphered and are not the focus of this discussion . however , the effects of ps recognition in macrophages and dcs have a direct impact in immune responses . apoptotic cells actively induce the production of the anti - inflammatory cytokines tgf , pge2 , and paf and actively inhibit the production of tnf and il-1 , even upon lps challenge [ 35 , 38 ] . recognition of apoptotic cells also decreases the expression of several activation markers and costimulatory molecules by both human and murine dcs [ 39 , 40 ] and regulates the expression of cytokines involved with t - cell differentiation at the transcriptional level [ 41 , 42 ] . at the single cell level , dcs that ingested an apoptotic cell and bacteria at the same time are able to discern between them and only present bacterial antigens this is possible because the generation of peptide - mhc class ii complexes is controlled by toll - like receptors ( tlrs ) in a strictly phagosome autonomous manner . since apoptotic cells do not trigger tlr activation , the generation of stable complexes is inhibited or abrogated . all these effects are fundamental to maintain homeostasis and comprehend the last step of the efferocytosis or apoptotic cell clearance . however , it seems that intracellular parasites elegantly make use of these mechanisms to establish in the host [ 4547 ] . furthermore , some parasites mimic the features of apoptotic cells to avoid host immune response , as discussed in the next section . one of the most common pcd phenotypes is phosphatidylserine ( ps ) exposure , which can be observed upon chemotherapy , starvation , and heat shock conditions in several unicellular organisms [ 4851 ] or is actively displayed in normal conditions . our group observed that lesion - derived amastigotes of l. amazonensis actively expose high levels of ps , and by blocking this molecule there is a drastic decrease in the ability of these parasites to infect and establish in the macrophages . these parasites are viable and capable of differentiating into promastigote forms in vitro ( unpublished data ) and inside the sand fly vector and to infect macrophages and mice [ 52 , 54 ] and did not display other markers of pcd . ps exposure on amastigotes of l. amazonensis occurs in virtually 100% of the parasites ; however , the amount of ps molecules depends on the infected host . parasites obtained from balb / c mice expose higher amounts of ps than the ones obtained from c57bl/6 mice . this observation demonstrates that the amount of ps at the surface of the amastigotes has a positive correlation with the severity of the disease and suggests that the host is able to modulate this phenotype of the parasite . following our description several other groups demonstrated the role of ps exposure and recognition in different infection models . blood and cell - derived trypomastigotes of trypanosoma cruzi are able to expose ps , in contrast with epimastigotes , which are not . in addition , infection with ps - exposing trypomastigote forms induces smad nuclear translocation and inducible nitric oxide synthase inhibition ( inos ) , suggesting an autocrine modulation of the host cell dependent on tgf . it is interesting to note that , among all t. cruzi parasite stages , only the ones that are infective for mammalian cells evolve the ability to expose ps , suggesting the presence of an evolutionary link between ps exposure and the ability to infect host cells . similarly , toxoplasma gondii peritoneal tachyzoites expose ps at their surface , and the recognition of this molecule seems to be necessary to downmodulate inos expression and activity upon macrophage infection . more recently , several papers have demonstrated the role of exposed ps molecules for the infection by enveloped viral particles . for human immunodeficiency virus-1 ( hiv-1 ) , ps at the viral envelope is a cofactor for monocyte infection ; in vaccinia virus infection , ps recognition modulates the activity of proteins involved in cytoskeleton reorganization such as p21-activated kinase ( pak ) and the small rho gtpase rac , leading to increased macropinocytic activity and uptake of viral particles . in addition , ps exposure by tumor cell , microvesicles shed by transformed cells , or endothelial cells in the intratumor environment seems to be involved in different events in tumor development , maintenance , and metastasis [ 59 , 60 ] . this knowledge stimulated some researchers to evaluate the efficacy of anti - ps antibodies to treat viral and tumoral diseases . actually the results so far are promising . in murine models of lassa fever ( pichinde virus ) or murine cytomegaloviruses the treatment efficacy was very high , reaching complete cure ( total absence of detectable viral loads ) in combination with available antiaviral drugs . for experimental tumoral disease , lung cancer , pancreatic tumors , and glioblastomas were efficiently treated , decreasing tumor growth and metastasis in some cases or potentiating the effect of chemo- and radio - therapies [ 6264 ] . our group has been committed to study the role of ps exposure on the surface of different isolates of l. amazonensis . we worked with the hypothesis that l. amazonensis isolates from dcl patients would have higher ps exposure compared with localized cutaneous leishmaniasis ( lcl ) , and this would contribute to macrophage deactivation , favoring parasite replication . for this , we compared ps exposure in l. amazonensis isolates from dcl clinical cases in the active phase of the disease , reported in maranho state in brazil , to those isolated from lcl patients of clinical cases from bahia . the results indicate that the isolates obtained from dcl patients indeed displayed more ps than isolates from lcl patients at early times postinfection . in addition , isolates from dcl patients were more infective than the ones obtained from lcl patients ( frana - costa et al . the other hand , independent of parasite strain analyzed , the parameters of infectivity correlated positively with the exposure of ps in the parasites . these data suggest that in human infections the pattern observed in mice when comparing balb / c versus c57bl/6 mice is maintained . however , it is necessary to investigate the mechanisms by which the recognition of ps on the surface of the isolates of l. amazonensis deactivate the macrophage response . particularly , it would be necessary to evaluate whether freshly isolated parasites display this phenotype to validate our analysis made on amastigotes derived from macrophages infected in vitro with cultured promastigote parasites isolated from human lesions . we believe that understanding the dynamics of ps expression , along with identification of the mechanisms involved in the immunosuppression of dcl patients , can result in therapeutic targets for intervention in the immunopathogenesis of this chronic and severe form of leishmaniasis . in a similar way we are interested in the immunomodulatory mechanisms underlying ps exposure in different inbred mice strains . for that we are currently evaluating these mechanisms during balb / c infection , which induces high levels of ps exposure on intracellular amastigotes . we observed that ps exposure is intrinsic to the intracellular parasite and however , these levels are dramatically increased when infected macrophages are in the presence of previously primed t cells or their soluble products . we confirmed these results by infecting balb / c nude mice where we observed that the amastigotes obtained from these mice display minimal levels of ps , which are completely restored if we adoptively transfer primed cd4 t cells to nude mice ( wanderley et al . interestingly , these data indicate that one possible role for the previously reported pathogenic t cells would be to induce ps exposure on intracellular amastigotes and , therefore , contributing to the generation of highly infective parasites . the t - cell - dependent ps exposure on amastigotes seems to be dependent on the induction of inos expression on host macrophages , and parasite survival is dependent on the concomitant induction of arginase 1 expression ( wanderley et al . we propose that high levels of ps exposure are induced by parasite stress delivered by inos activity . in this case , it is still unknown whether ps exposure on amastigotes is indeed a phenotype triggered by pcd or a specific process involving modulation of ps translocation . under ps - inducting conditions , unpublished results ) , that is the enzyme necessary to produce ornithine , the precursor of polyamines . in this situation , polyamines could protect the parasite from the inos - dependent stress , stimulating parasite growth [ 66 , 67 ] and increasing dna stabilization [ 68 , 69 ] . we understand that the unique characteristics of the t - cell response to l. amazonensis infection contribute to the generation of a perfect environment to stimulate and maintain increased levels of ps on the surface of intracellular parasites . probably the balance observed in infected balb / c mice , when disrupted , leads to the differences observed among different mouse strains . in figure 1 we summarized our hypothesis regarding the t - cell - dependent modulation of ps exposure on intracellular amastigotes of l. amazonensis .", "the observation of ps exposure as a strategy to evade the immune system and persist in the mammalian host , made initially in the experimental model of l. amazonensis infection , was a breakthrough since it stimulated different groups around the world to look for the possibilities for basic and applied research on the field . our group is still studying the immunological , cellular , and molecular mechanisms underlying control of ps exposure in parasites and the effects of its recognition by parasitized cells and organisms . we believe that this could be a major strategy in different systems where avoidance from immune surveillance is necessary to establish a disease ." ]

[ "despite of presentation of medical ethics as a new science in academic teaching , the ethical concepts have been alongside the medicine , and its antiquity back to the medicine history . for instance , literatures such as hippocratic oath letter , liturgy of ibn maymun , and shirazi ethics ordinance are the old literatures in which the principles such as the necessity of patient preference defender on the physician and observing the principle of confidentiality have been emphasized . however , in the past literature using physician s commitment and pledge human being is a creature with physical , mental and spiritual dimensions which has rights during the health and illness . patient rights are the very expectations he has from the health care services and must encompass his physical , mental , spiritual and social needs which are manifested as criteria , standards , rules and laws ( 4 , 5 ) . emphasis on patient rights in the health care services particularly maintains patient dignity as a rank of a human , and is considered important especially when patient s vulnerability easily expose him to the violations and weaknesses of the health care system ( 6 ) . considering that health is the most important existence aspect of every person and according to the article 29 of the constitution , providing health is the most important commitment of the government of islamic republic of iran ; because of this , in 2002 , for the first time the patients right charter was developed in iran and was notified by department of health , treatment and medical education ( 7 ) . the patients right charter of iran was approved by health policy council with a new and comprehensive viewpoint aimed to clarify the rights of the health services recipients and observance of moral standards in the treatment and medical fields in november 26th , and in december 1st it was communicated to the relevant centers ( 1 , 8 , 9 ) . in this charter patient satisfaction is considered as one of the characteristics of hospital effectiveness ( 9 ) . today , the issues related to the quality of health care services , attention to the patients as customers and accomplishing their satisfaction are the main priorities and are of high importance . one of the important factors in patient satisfaction is regarding their demands and observing their rights and providing care along with respect ( 6 ) . awareness of the patients rights and observing them accomplishes more satisfaction of the patient , physician and other medical team and hospital staff and will lead to the spread of good morals among patients and medical team ; so eventually the moral status of all the individuals such as patients and medical team will be upgraded , but otherwise provided not observing these rights , it would lead to distrust to health care team . if there is no trust between medical staff and patients , it would lead to damages and losses for the patient and the medical team . furthermore , it would lead to terrible and unpleasant occurrences which are difficult to compensate and would be followed by the legal prosecution ( 5 , 10 ) . protecting the patient rights by the nurses only will be possible when they have gained necessary knowledge about it and suitable conditions be provided for respecting these rights ( 11 ) . appropriate care and observing patient rights require nurses knowledge which would be possible through different ways such as side studies , retraining courses , and academic courses during education ( 5 ) . in the studied researches about the nurses level of knowledge from patient rights , several aspects were mentioned . nasiriani et al ( 5 ) and houshmand et al ( 11 ) reported good nurses level of knowledge in yazd hospitals and teaching public wards of tehran hospitals respectively . observed moderate and parsinia et al obtained weak nurses knowledge in tehran and karaj hospitals respectively ( 10 ) . the clinical researchers in different wards of teaching hospitals have reported that the patients rights have been ignored or have not been considered seriously due to shortage of nursing staff , high number of patients in the hospitals , psychological pressures and etc . taken together , we decided to evaluate the nurses knowledge about patients rights in one of the teaching hospitals of tehran city .", "this was a descriptive cross - sectional study in which the nurses knowledge about patient rights was determined . the study samples consisted of 156 nurses who have been selected randomly from one of the teaching hospitals of tehran . the data collection instrument was a two - part questionnaire ; the first part included the demographic information ( age , gender , marital status , work experience , educational level , etc . ) ; the second part consisted of 10 questions according to the 10 section of patients rights charter of iran ( 11 ) . this part determined the following areas about patient rights : right to receive essential information about health care providers , rate of tariff , target insurance coverage if sent to the other medical centers . right to receive respectful and quick treatment and care regardless of cultural and racial factors . right to know about the probable complications , treatment options and participate in the ultimate treatment choosing . right to make a decision about the presence of those who are not directly involved in the treatment process . right to announce personal satisfaction from ending the treatment and referring to other centers , and right to preserve privacy and being ensured about confidentiality of all of the medical information . the answers of the study subjects to the questions were quantified by measuring a three - score scale ; good ( 3 scores ) , moderate ( 2 scores ) and weak ( 1 scores ) . the maximum score in the questionnaire was 30 scores which were considered 2130 as high knowledge , 1020 as moderate knowledge and less than 10 as weak knowledge . the validity was done using content validity i.e. the questionnaire was given to 10 faculty members of universities of tehran and after collecting the comments , the relevant comments were applied . the validated questionnaire was given to 10 eligible study subjects for reliability and in both stages the questionnaire was completed with a 10-day interval and the required correlation of the first and second answers and confidence was obtained r = 0.90 and finally these people were excluded from the study population . the questionnaires were completed during two weeks by direct referring of the researcher to the wards . in order to observe ethics , confidentiality and integrity , the mentioned questionnaires were anonymous and in all stages of the study the information were collected confidential and were kept by the researcher .", "the review of the demographic variables indicated that the majority of the nurses were females ( 76.28% ) with mean age of 34.31 7.3 . most of them ( 91.2% ) had bachelor degree and were married ( 62.82% ) . in terms of employment and work experience , almost half of nurses ( 47.43% ) were contractual , 46.79% had 610 years of work experiences , 30.99% never passed any course about patient rights and 30.99% of them had the simultaneous experience in public and private sectors . no association between the variables of gender , age , degree and marital status and nurses knowledge about patient rights was found . there was no significant difference between them in terms of work section , work experience and simultaneous work in the public and private sectors , however there was a significant difference between their level of knowledge about patient rights and simultaneous work in the public and private hospitals and work experience ( table 1 ) . the findings of the study about the nurses level of knowledge in different areas indicated that the highest level of knowledge ( 95.51% ) was in the area of right to preserve privacy and being ensured about confidentiality of all medical information and the lowest level was right to receive essential information about health care providers , rate of tariff , target insurance coverage if sent to the other medical centers .", "observing patients rights is the most important ethical issue in a hospital which should absolutely be considered . regarding patients rights and respecting them are two main factors for patients care . observing patients rights means the accountability of all health care staff to the patients at the time of treatment and care giving ( 12,13 ) . promoting patients rights is a multidimensional issue and in order to achieve it , comprehensive efforts should be done . world health organization has offered some strategies such as active participation of health care recipients and providers policy making and extending educational programs for health care providers and entire community ( 11 ) . the findings of the study showed that nurses level of knowledge about patients rights in terms of the variables such as type of the hospital , work experience , degree , age and gender was good , moderate and weak in 58.33% , 39.10% , and 2.56% of them respectively . in the studies conducted in karaj hospitals ( 10 ) and the public wards of teaching hospitals of tehran ( 11 ) also the nurses level of knowledge reported as weak . today patients are more aware of their rights and physicians responsibilities and commitments and also hospitals managements regarding their rights ( 14 ) and they are more insisting on their principle rights ( 2 ) . therefore it is highly needed that nurses with low level of knowledge , and the other health care providers be aware of patients right charter and increase their knowledge . determined the reasons of the nurses low level of knowledge as lack of institutionalization and regulation of the rights ( 12 ) ; lack of adequate time for studying and researching due to various obstacles such as poor economic conditions ; lack of positive vision in selecting nursing profession ; tough job conditions in the hospitals such as large number of the patients versus staff shortages , and lack of necessary facilities such as adequate and suitable libraries ( 5 ) . the results indicated that there was a significant and direct association between level of knowledge and simultaneous jobs in the public and private hospitals ( p=0.01 ) i.e. the nurses who provided services simultaneously in the public and private hospitals had higher level of knowledge . the reason might be due to regulations and rules which are performed more in the private hospitals compared to the public hospitals i.e. no implementation of patients right charter which may be followed by punishment . the findings of the present study indicated that in the area of right to preserve privacy and being ensured about confidentiality of all the medical information , the nurses had the highest level of knowledge . in the patients right charter codified in 2009 it says observance of the principle of confidentiality is necessary about all the information related to the patient except for the cases the law excluded ( 1 ) . in a comparative study about the patients right charter in the selected countries with iran in 2007 , it was indicated that regulations of iran for the right of the confidentiality of the patient information and medical records is similar to the other countries such as hungary , hong kong , new zealand , united states , south africa , european union and lithuania ( 14 ) . unlike the above results , in canada it was indicated that 84% of the medical staff did not have enough knowledge about commitments and obligations of the law about confidentiality of the information and privacy of the patients information ( 15 ) . our findings indicated that there was a direct and significant association between level of knowledge and work experience ( p= 0.008 ) and the level of knowledge of the study subjects from patients rights charter was increased by increasing work experience which was in accordance with the studies of nasiriani et al . and in addition , the study indicated that there was no association between level of knowledge and degree and increasing degree had no effect on the level of knowledge . in a study in karaj it was mentioned that the level of knowledge of the technicians was higher in comparison with supervisors and matrons and the most important reasons were sense of job security , professional status and disregardness of matrons and supervisors to the important tasks ( 10 ) . the findings indicated that nurses in the area of right to receive essential information about health care providers , rate of tariff , target insurance coverage if sent to the other medical centers had the lowest level of knowledge . the patients right charter codified in 2009 states that information must be given to the patient at the right time and appropriate condition by considering individual characteristics such as language , degree and perception ; however the patient has the right to access all the information recorded in his / her clinical records ( 16 , 17 ) . in the patients right charter of some countries such as canada and united states unlike the other countries such as iran , hong kong , new zealand , africa , european union , lithuania , right to ask for explanation about the costs has been discussed ( 14 ) . the results indicated that 66% of the nurses was aware of the right to access to the health care providers during hospitalization , instead of 90% of turkish nurses ( 17 ) . nowadays ethical and legal concepts such as patient rights are included in the educational curriculum of greek and turkey ( 18 , 19 ) . according to the considerable gap between development and realization of the patient rights ( 20 ) and the increased knowledge , claims and demands of the patients and also the results of this study , in order to observe patients right the following solutions are suggested : - encouraging the nurses to consider patients right charter seriously . - establishing and empowering the sanction of patients right charter - more emphasizing on concepts of professional ethics and patient rights in teaching nursing students - attending expertise meetings with presence of beneficiaries for evaluating barriers and presenting strategies in order to implement the patients right charter as soon as possible - providing periodic educational programs for health care providers and patients about patient rights", "generally , since 41.6% of the nurses of the study had not a proper level of knowledge about patient rights and considering the fact that awareness and knowledge can be the base of nurses performance and also patients increasingly are getting informed about their rights , the implementation of patients right charter is highly recommended . holding educational programs , seminars , workshops and academic panels for nurses , and nursing students help overcome difficulties ." ]

[ "all subjects were consecutively recruited from the greater philadelphia area from 20062009 at the children 's hospital of philadelphia . our study cohort consisted of 5,465 singleton children of european ancestry with recorded birth weight information . all of these participants had their blood drawn in an 8-ml ethylenediamine tetraacetic acid blood collection tube and subsequently dna extracted for genotyping . this study was approved by the institutional review board of the children 's hospital of philadelphia . parental informed consent was given for each study participant for both the blood collection and subsequent genotyping . we performed high - throughput genome - wide single nucleotide polymorphism ( snp ) genotyping using the illumina infinium ii humanhap550 or human 610 beadchip technology ( illumina , san diego , ca ) at the children 's hospital of philadelphia 's center for applied genomics , as described previously ( 23 ) . the snps analyzed survived the filtering of the genome - wide dataset for snps with call rates < 95% , minor allele frequency < 1% , missing rate per person > 2% , and hardy - weinberg equilibrium p < 10 . most loci described from gwa studies published to date have been found using either the affymetrix or illumina platform . in the event a locus was reported using both the illumina and affymetrix arrays , we used the snps present on the illumina array . in the event of a signal only being described on the affymetrix array , we either already had that snp on our illumina array or identified and used the best surrogate snp available based on the ceu hapmap ( supplementary table 1 , available in the online appendix at http://diabetes.diabetesjournals.org/cgi/content/full/db09-0506/dc1 ) . we used two snps at the cdkal1 ( rs4712523 and rs7756992 ; r = 0.677 ) , hhex - ide ( rs1111875 and rs7923837 ; r = 0.698 ) , and pparg ( rs17793693 and rs6802898 ; r = 0.011 ) loci as the association with type 2 diabetes , taken from various gwa studies that reported various snps that were in imperfect linkage disequilibrium with each other . in addition , rs4712523 is a proxy ( r = 1 ) for rs10946398 , which was previously associated with birth weight . from our database , we eliminated outliers with birth weight < 1 or > 8 kg , i.e. , those individuals not within the credible range for birth weight at term , to avoid the potential consequences of error or mendelian causes of extreme birth weight . each birth weight value was adjusted for each sex separately then expressed as a z score . all statistical analyses were carried out using the software package plink v. 1.05 ( 24 ) . ethnicity for our cohort was derived using the multidimensional scaling feature within plink . by treating birth weight as a quantitative trait ( treated as a z score after correcting for sex ) , association analysis for each snp was carried out using linear regression analysis with the snp included as an independent variable ( coded as 0 , 1 , and 2 ) . with 5,465 subjects , the powers to detect 0.2 , 0.3 , 0.4 , 0.5 , 0.6 , 0.8 , and 1% variation at the p = 0.002 level ( i.e. , the corrected p value for the number of tests ) were 47.4 , 74.6 , 90.0 , 96.6 , 98.9 , 100 , and 100% , respectively .", "all subjects were consecutively recruited from the greater philadelphia area from 20062009 at the children 's hospital of philadelphia . our study cohort consisted of 5,465 singleton children of european ancestry with recorded birth weight information . all of these participants had their blood drawn in an 8-ml ethylenediamine tetraacetic acid blood collection tube and subsequently dna extracted for genotyping . this study was approved by the institutional review board of the children 's hospital of philadelphia . parental informed consent was given for each study participant for both the blood collection and subsequent genotyping .", "all subjects were consecutively recruited from the greater philadelphia area from 20062009 at the children 's hospital of philadelphia . our study cohort consisted of 5,465 singleton children of european ancestry with recorded birth weight information . all of these participants had their blood drawn in an 8-ml ethylenediamine tetraacetic acid blood collection tube and subsequently dna extracted for genotyping . this study was approved by the institutional review board of the children 's hospital of philadelphia . parental informed consent was given for each study participant for both the blood collection and subsequent genotyping .", "we performed high - throughput genome - wide single nucleotide polymorphism ( snp ) genotyping using the illumina infinium ii humanhap550 or human 610 beadchip technology ( illumina , san diego , ca ) at the children 's hospital of philadelphia 's center for applied genomics , as described previously ( 23 ) . the snps analyzed survived the filtering of the genome - wide dataset for snps with call rates < 95% , minor allele frequency < 1% , missing rate per person > 2% , and hardy - weinberg equilibrium p < 10 . most loci described from gwa studies published to date have been found using either the affymetrix or illumina platform . in the event a locus was reported using both the illumina and affymetrix arrays , we used the snps present on the illumina array . in the event of a signal only being described on the affymetrix array , we either already had that snp on our illumina array or identified and used the best surrogate snp available based on the ceu hapmap ( supplementary table 1 , available in the online appendix at http://diabetes.diabetesjournals.org/cgi/content/full/db09-0506/dc1 ) . we used two snps at the cdkal1 ( rs4712523 and rs7756992 ; r = 0.677 ) , hhex - ide ( rs1111875 and rs7923837 ; r = 0.698 ) , and pparg ( rs17793693 and rs6802898 ; r = 0.011 ) loci as the association with type 2 diabetes , taken from various gwa studies that reported various snps that were in imperfect linkage disequilibrium with each other . in addition , rs4712523 is a proxy ( r = 1 ) for rs10946398 , which was previously associated with birth weight .", "we performed high - throughput genome - wide single nucleotide polymorphism ( snp ) genotyping using the illumina infinium ii humanhap550 or human 610 beadchip technology ( illumina , san diego , ca ) at the children 's hospital of philadelphia 's center for applied genomics , as described previously ( 23 ) . the snps analyzed survived the filtering of the genome - wide dataset for snps with call rates < 95% , minor allele frequency < 1% , missing rate per person > 2% , and hardy - weinberg equilibrium p < 10 . most loci described from gwa studies published to date have been found using either the affymetrix or illumina platform . in the event a locus was reported using both the illumina and affymetrix arrays , we used the snps present on the illumina array . in the event of a signal only being described on the affymetrix array , we either already had that snp on our illumina array or identified and used the best surrogate snp available based on the ceu hapmap ( supplementary table 1 , available in the online appendix at http://diabetes.diabetesjournals.org/cgi/content/full/db09-0506/dc1 ) . we used two snps at the cdkal1 ( rs4712523 and rs7756992 ; r = 0.677 ) , hhex - ide ( rs1111875 and rs7923837 ; r = 0.698 ) , and pparg ( rs17793693 and rs6802898 ; r = 0.011 ) loci as the association with type 2 diabetes , taken from various gwa studies that reported various snps that were in imperfect linkage disequilibrium with each other . in addition , rs4712523 is a proxy ( r = 1 ) for rs10946398 , which was previously associated with birth weight .", "from our database , we eliminated outliers with birth weight < 1 or > 8 kg , i.e. , those individuals not within the credible range for birth weight at term , to avoid the potential consequences of error or mendelian causes of extreme birth weight . each birth weight value was adjusted for each sex separately then expressed as a z score .", "from our database , we eliminated outliers with birth weight < 1 or > 8 kg , i.e. , those individuals not within the credible range for birth weight at term , to avoid the potential consequences of error or mendelian causes of extreme birth weight . each birth weight value was adjusted for each sex separately then expressed as a z score .", "all statistical analyses were carried out using the software package plink v. 1.05 ( 24 ) . ethnicity for our cohort was derived using the multidimensional scaling feature within plink . by treating birth weight as a quantitative trait ( treated as a z score after correcting for sex ) , association analysis for each snp was carried out using linear regression analysis with the snp included as an independent variable ( coded as 0 , 1 , and 2 ) . with 5,465 subjects , the powers to detect 0.2 , 0.3 , 0.4 , 0.5 , 0.6 , 0.8 , and 1% variation at the p = 0.002 level ( i.e. , the corrected p value for the number of tests ) were 47.4 , 74.6 , 90.0 , 96.6 , 98.9 , 100 , and 100% , respectively .", "in our initial analysis , 12 snps corresponding to the 9 type 2 diabetes loci previously studied in the context of birth weight were investigated in our cohort , namely , tcf7l2 , hhex - ide , pparg , kcnj11 , slc30a8 , igf2bp2 , cdkal1 , cdkn2a/2b , and jazf1 ( 4,6 ) ( table 1 ) . quantitative association results for previously studied type 2 diabetes risk alleles with birth weight in the european american cohort ( n = 5,465 ) , sorted by chromosomal location the direction of effect is shown for the minor allele in each case . * major allele previously reported to be associated with type 2 diabetes ; * * p 0.002 . , regression coefficient for the test snp ; bp , base pair position ; maf , minor allele frequency ; n , number of subjects tested ; p , two - sided trend test p value ; r , value in linear regression ; t , test statistic . as a result , we observed strong association with rs7756992 ( p = 8 10 ) at the cdkal1 locus with low birth weight ; this snp yielded strongest association to type 2 diabetes in an icelandic gwa study carried out on the illumina humanhap500 platform ( 21 ) . snps rs10946398 or rs7754840 at the same locus have been reported to be most strongly associated with type 2 diabetes from gwa studies on the affymetrix platform or the illumina humanhap300 beadchip ( 16,18,19 ) ; however , using a perfect surrogate , rs4712523 ( r = 1 ) , we only observed nominally significant association ( p = 0.01 ) . it should be noted that rs10946398 and rs7756992 are far from being in perfect linkage disequilibrium ( r = 0.677 ) , thus the inclusion of both in this current study . unlike previous reports , we did not observe association between rs1111875 at the hhex - ide locus and this trait ( 6 ) . in line with previous reports , we also did not observe association between birth weight and tcf7l2 , pparg , kcnj11 , slc30a8 , igf2bp2 , cdkn2a/2b , or jazf1 ( 4,6,10 ) . furthermore , we did not observe any significant association with risk alleles at other type 2 diabetes loci after correction for multiple testing for all 23 snps ( threshold p 0.002 ) ( supplementary table 2 ) . we detected nominal association with rs1387153 ( p = 0.02 ) at the mtnr1b locus ; however , the corresponding type 2 diabetes risk allele was tracking with higher birth weight . we also analyzed male and female subjects separately , but the effect of each locus on birth weight did not vary by sex ( supplementary tables 3 and 4 ) .", "from this interim analysis of our ongoing gwa study of birth weight in a european american cohort , it is clear that the cdkal1 locus , which was uncovered in gwa analyses of type 2 diabetes , is strongly associated with birth weight in our study population . this result clearly supports a previous report that came to a similar conclusion ( 6 ) . however , the study by freathy et al . used a different snp , namely , rs10946398 , which was not present on our illumina beadchip ; we used a perfect surrogate , i.e. , rs4712523 ( r = 1 ) , that only yielded nominal significance ( p = 0.01 ) . although they did not report for rs7756992 , we found that it gave us the strongest association ( p = 8 10 ) and was selected for this study because it yielded the strongest association to type 2 diabetes in an icelandic gwa study ( 21 ) . secondly , we did not observe association between hhex - ide and birth weight , which is in contrast with what had been described previously ( 6 ) . we acknowledge that our cohort is smaller than the original report ( 5,465 vs. 19,200 individuals ) ; indeed , this association was not observed ( p < 0.05 ) in the similarly sized 1958 birth cohort ( 6 ) . the lack of available covariate data , such as gestational age , was also a limitation of this study . therefore , it is possible that with a larger cohort with additional covariate data we may observe the association of this locus with birth weight ; however , it could also indicate that hhex - ide has a less pronounced impact on birth weight than cdkal1 . consistent with the existing literature , we did not find any evidence of association between birth weight and tcf7l2 , pparg , kcnj11 , slc30a8 , igf2bp2 , cdkn2a/2b , or jazf1 ( 4,6,10 ) . given the monogenic precedent for opposing effects of maternal and fetal genotype ( 25 ) , it is possible that effects of common type 2 diabetes alleles could be masked by this phenomenon . it has been shown that cdkal1 is expressed in the rat pancreatic -cell line ins-1 ( 21 ) . homozygous carriers of the risk allele have been shown to have a 22% lower corrected insulin response than individuals who are wild - type carriers . it has been suggested that cdkal1 might influence the secretion of insulin by interacting with cdk5 ( 21 ) . our data contributes another piece of evidence supporting the hypothesis , namely , that the same genotype conferring lower birth weight can also confer higher type 2 diabetes risk later in life . cdkal1 was first described in the context of type 2 diabetes in both european caucasians and in han chinese ( 21 ) ; as such , it would be interesting to examine whether the association of cdkal1 with lower birth weight also stands in this and other ethnicities , such as african americans and hispanics . in conclusion , we strongly confirm that the established type 2 diabetes locus cdkal1 also influences birth weight . however , we do not observe such association with tcf7l2 , hhex - ide , cdkn2a/2b , or jazf1 . in addition , of all the other established type 2 diabetes loci to date , we do not observe a convincing role for them in the determination of birth weight ." ]

[ "the most often reported reasons have been dehydration of dentin , removal of tooth structure during root canal treatment , prolonged use of high concentrations of irrigation solutions , and excessive pressure during obturation . in the literature there are several studies in which the fracture resistance of endodontically treated teeth were evaluated or the techniques for reinforcing of these teeth were described . it is important to examine systems in an in vitro model prior to in vivo use in order to identify treatment or materials that might improve clinical performances . extracted human teeth are also widely used for in vitro studies in fracture resistance tests . however standardization among the extracted teeth should be performed in order not to affect the study 's results . standardization of the roots is one of the important steps in the study in which fracture resistance is evaluated . if roots were not distributed among the groups equally , these variables could have affected the results of the studies . in many studies , the mesiodistal ( md ) and buccolingual ( bl ) dimensions and the lengths of the roots researchers also attempt to choose the same type of teeth in order to standardize the specimens . in spite of these standardization attempts , it has been discussed that the standard deviations within the groups were rather high , rendering the results meaningless , and prompting studies using a larger number of specimens . the aim of this study was to determine how physical ( weight , volume , and density ) and morphological ( md and bl dimensions ) properties affect the fracture resistance of roots , and which criteria are important for standardization in fracture resistance evaluated studies . the null hypothesis was that different physical properties of roots would not affect the fracture resistance of endodontically treated roots .", "seventy - five human canine teeth extracted for periodontal reasons with completed apices and similar lengths were used in this study . mesiodistal ( md ) and buccolingual ( bl ) radiographs were taken of the specimens to evaluate the anatomical structures of the teeth . the teeth with internal or external resorption , those which had two or more root canals , and those with calcification were discarded . the teeth were examined under a stereomicroscope to discard specimens with cracks and craze lines . soft tissues and calculus were removed mechanically from the root surfaces using a periodontal scaler . specimens were decoronated with a diamond disc under a water coolant to obtain a standardized root length of 16 mm . was carried out , weight , volume [ figure 1 ] , and density [ figure 1 ] were calculated with precisa xb 220a precision balance ( precisa , gravimetrics ag , dietikon , switzerland ) which had a capacity of 220 g , and a readability of 0.0001 g. weight change in distilled water is equal to root volume , because density of distilled water is 1 g / cm . md and bl dimensions at 16 mm ( the coronal end of the root ) from the apex of the each root were recorded with root number . a size 10 k - file ( dentsply , maillefer , ballaigues , switzerland ) was inserted into the canal until it was visible at the apical foramen , and the working length was determined to be 1 mm short of this position . root canal shaping procedures were performed with protaper universal rotary files ( dentsply maillefer , ballaigues , switzerland ) , and apical region was prepared to size # 30 ( f3 ) in all specimens . the canal was irrigated with 2 ml freshly prepared 5% naocl solution with a 27-gauge needle after each file . a final rinse with 5 ml 17% edta for 1 min , followed by rinsing with 5 ml 5% naocl for 1 min was applied for smear layer removal . the specimens were dried with paper points and filled with gutta - percha and ah plus sealer ( dentsply detrey , kontanz , germany ) using cold lateral compaction . calculation of root volume and density using a precise balance proper wax stencils were molded and the roots were mounted into acyclic resin at an angle of 45 degrees to its long axis , leaving 6 mm of each root exposed [ figure 2 ] . a universal testing machine ( instron corp . vertical force was loaded with a speed of 1 mm / min until fracture occurred .", "the results indicated that volume ( r = 0.427 , p < 0.001 ) and weight ( r = 0.394 , p < 0.001 ) of the roots had a more significant effect than bl ( r = 0.197 , p = 0.085 ) , md ( r = 0.239 , p = 0.037 ) dimension which implying that volume or weight had greater importance regarding the prediction of fracture strength [ table 1 ] . physical and morphological properties of the samples along with pearson correlation coefficients and p values .", "when extracted human teeth are used for evaluating the fracture resistance of roots , there is a potential for large uncontrollable variations to affect strength . for that reason , all controllable factors should be standardized as much as possible . many researchers who have carried out this type of study - performed standardization , according to root length , md and bl dimensions . however , many of these studies admitted very high standard deviations as normal . thus , this study aimed to control factors such as weight , volume , and density , which can affect the fracture resistance of teeth in order to contribute to the standardization process . in the current study , the volumes or weights of root specimens have more statistically significant value than density , md , and bl dimension . in previous studies , however , these variations did not take into account when the standardization of groups was performed . future studies should be standardized to inhibit high standard deviations . during the study design , standardization is generally achieved based on the lengths , and md and bl dimensions of roots with referrals to other studies in the literature . however , this study has shown that the physical properties of teeth can affect the resistance of roots . thus , it is important to determine the alternative properties of roots which could be useful for the standardization process in future investigations .", "this is the first study in the literature to conclude that the volume or weight of root as the most important determining factors in root fracture. within the limitations of this study , it can be concluded that when forming groups to evaluate fracture resistance , after the root length is standardized , the roots should be equally distributed according to their volumes or weights , rather than their md and bl dimensions , as these dimensions can not closely simulate the entire strength of the root as much as the volume or weight ." ]

[ "intensive insulin therapy using basal - bolus insulin regimen is the standard therapy for patients with type 1 diabetes mellitus . by mimicking the endogenous insulin secretion profile in healthy subjects , it has been shown to improve glycemic control and reduce the risk of long - term complications compared with conventional insulin therapy [ 1 , 2 ] . unfortunately , many patients with type 1 diabetes can not achieve the target glycemic control , and insulin therapy leaves room for improvement . thus , the efficacy of basal insulin is especially important in this group of patients . importantly , in some type 1 diabetes patients with severe loss of endogenous insulin secretion capacity , once - daily injection of basal insulin does not always cover the basal effect of insulin over the 24-hour period [ 35 ] . in addition , the intraday and day - to - day variability in insulin agents could sometimes be an obstacle for optimized titration of insulin and a cause of increased frequency of hypoglycemia . given that increased frequency of injection and large fluctuations in blood glucose could be a burden in such patients , any improvement in the efficacy of basal insulin agents should be appreciated . insulin degludec is a new ultra - long - acting basal insulin that forms soluble multihexamers at the subcutaneous injection site from which insulin monomers are slowly and continuously absorbed into the circulation , leading to a peakless action profile over 42 hours . consistent with this pharmacological action , begin basal - bolus type 1 trial showed that the rate of nocturnal - confirmed hypoglycemia was 25% lower with insulin degludec than with insulin glargine . in addition , it was reported that the day - to - day variability in plasma glucose in type 1 diabetes patients treated with insulin degludec was lower compared to insulin glargine . taking these unique actions of insulin degludec into consideration , switching from twice - daily injections of basal insulin to once - daily injection of insulin degludec could provide great benefit to patients with type 1 diabetes . in this study , to evaluate the efficacy of insulin degludec as a basal insulin for basal - bolus regimen for japanese patients with type 1 diabetes mellitus who are treated with twice - daily basal insulin injection therapy , we investigated glycemic control , daily , and day - to - day variability in plasma glucose using continuous glucose monitoring before and after switching to once - daily insulin degludec injection in 22 patients with type 1 diabetes .", "we recruited 24 eligible japanese patients ( 8 males and 16 females ) with type 1 diabetes who visited the outpatient clinic of juntendo university hospital between july 2013 and january 2014 . patients who satisfied the following conditions were included : ( 1 ) treated with basal - bolus insulin regimen with twice - daily injections by insulin glargine or detemir and ( 2 ) aged more than 20 and less than 80 years . also , patients were excluded if they ( 1 ) had serious liver disease ( ast and/or alt > 100 iu / l ) , ( 2 ) had serious kidney disease ( serum creatinine > 2.0 mg / dl ) , ( 3 ) had untreated severe diabetic retinopathy , ( 4 ) had adrenal or pituitary insufficiency , ( 5 ) had other conditions considered by the attending physician to be contraindicated to inclusion in the study , or ( 6 ) were pregnant or breastfeeding women . this trial was conducted in accordance with the declaration of helsinki , and the protocol was approved by the human ethics committee of juntendo university . all patients provided a written informed consent prior to trial initiation . in this prospective , single - center , single - arm , open - label , 12-week study , we compared the effects of switching from twice - daily basal insulin to once - daily insulin degludec on glycemic control , daily , and day - to - day variability in plasma glucose . figure 1 shows the patient enrolment process . at baseline before switching , the following laboratory tests were performed in each patient : fasting plasma glucose ( fpg ) , plasma c - peptide , hba1c , and glycosylated albumin . plasma c - peptide assay was performed using ultrasensitive c - peptide elisa kit ( mercodia , uppsala , sweden ) for precise determination of intrinsic basal insulin level . then , cgm and 7-point self - measured blood glucose ( smbg ) profiles ( before and 2 hours after meals and bedtime ) were obtained . after that , the patient was switched from twice - daily basal insulin to once - daily insulin degludec , which involved 10% reduction in insulin dosage without any change in the rapid acting insulin therapy . insulin degludec was administered once - daily at bedtime . at 4 weeks after switching , the same fasting laboratory tests , cgm and 7-point smbg , were repeated . after 4 weeks , the basal insulin dose was adjusted for each individual patient based on self - measured fbg levels taken before breakfast . the dose of insulin degludec was decreased by 1 unit if fbg was 80 mg / dl over three consecutive days just before the hospital visit . then , the increase of the dose of basal insulin or titration of rapid acting insulin was performed by the judgement of each physician in charge . at the end of the study ( 12 weeks ) , the same laboratory tests ( fpg , hba1c , and glycosylated albumin ) were repeated again . cgm data were obtained by using the ipro2 ( medtronic ; northridge , ca ) . patients were required to use cgm for six consecutive days . over each cgm occasion , at least 288/day cgm glucose values were to be recorded . as an index of day - to - day variability , the mean of daily difference ( modd ) was calculated from the absolute difference between paired cgm values during two successive days ( days 2 to 3 and days 4 to 5 ) , and the data were presented as the average of the two values . the patient was asked to record 7-point smbg profiles for one day during cgm for before and 2 hr after meals and at bedtime . the primary outcome of the study was change in hba1c before and 12 weeks after switching . the secondary outcomes based on cgm values were ( 1 ) changes in standard deviation ( sd ) and modd . safety variables included the frequencies of severe hypoglycemia , which was defined as low blood glucose level requiring assistance from another person to treat , nocturnal hypoglycemia , and adverse events . confirmed hypoglycemia was defined as a glucose value of less than 70 mg / dl by cgm and was reported in percentage (= times < 70 mg / dl / total time of measurement ) . hypoglycemic episodes occurring between 0:00 and 5:59 hours were classified as nighttime while daytime episodes occurred between 6:00 and 23:59 . data were expressed as mean sd . the mann - whitney u test was used for analysis of cgm data before and 4 weeks after switching and , for analysis of fpg , hba1c and glycosylated albumin before and 12 weeks after switching were used . all statistical analyses were conducted using statview statistical software package , version 5.0 ( sas institute inc . , cary , nc ) .", "two patients withdrew from the study after the first treatment period ; one decided to withdraw during the conduct of the study and the other did not visit the outpatient clinic . the mean age and duration of type 1 diabetes mellitus were 54.8 14.5 and 14.6 9.0 years , respectively . fasting plasma c - peptide was below the detection limit of the ultrasensitive c - peptide elisa kit in 18 patients ( 81% ) , indicating severely low insulin secretion in most subjects . as shown in table 2 , hba1c levels at baseline and 4 and 8 weeks after switching to insulin degludec were 8.5 1.4% , 8.6 1.6% , and 8.7 1.6% , respectively . glycosylated albumin levels before and 4 and 8 weeks after switching were 24.9 5.0% , 25.3 5.2% , and 24.7 3.6% , respectively . furthermore , fasting blood glucose levels were 203.2 81.2 mg / dl , 165.5 82.1 mg / dl , and 206.5 122.4 mg / dl , respectively . based on these data , it is clear that switching to insulin degludec did not improve glycemic control throughout the study . the mean basal insulin and total daily doses at 12 weeks after switching to insulin degludec were significantly reduced compared to the baseline ( 15.2 7.6 versus 11.6 6.9 u , p < 0.01 , and 40.0 17.3 versus 37.9 16.7 u , p < 0.01 , resp . ) whereas the bolus insulin dose did not significantly change after switching . \n table 3 summarizes fluctuations in glucose level and the frequency of hypoglycemia recorded by cgm over 4 days before and after switching . the averages of blood glucose and standard deviation ( sd ) through the daytime ( 0:0023:59 ) were 184.1 45.8 versus 189.6 52.7 mg / dl and 68.4 14.5 versus 66.5 17.1 mg / dl , respectively . furthermore , the modd was 72.1 16.0 versus 74.0 23.0 mg / dl and the frequency of hypoglycemia below 70 mg / dl was 6.1 8.0 versus 6.5 9.7% , respectively . table 3 also shows fluctuations in glucose level and the frequency of hypoglycemic episodes recorded by cgm during the nighttime ( 0:005:59 ) . the averages of blood glucose before and after switching were 156.5 63.7 versus 174.6 58.5 mg / dl during the nighttime . the sd during nighttime did not change significantly ( before : 22.6 10.9 , after : 24.8 10.7 mg / dl ) . modd tended to increase during the nighttime both at baseline and after switching , however ; these changes were not significantly different . the frequency of hypoglycemic glucose ( below 70 mg / dl ) was 14.4 17.0 versus 11.1 15.0% during the nighttime , before and after switching . thus , the frequency of nocturnal hypoglycemia did not change significantly after switching , similar to other parameters , and no severe hypoglycemia was recorded during the study period . \n blood glucose level at 2 hours after lunch was significantly low before and after switching ( 207.6 87.7 versus 158.2 90.3 mg / dl , p < 0.01 ) .", "the present study investigated the efficacy and safety of switching from twice - daily basal insulin injections to once - daily insulin degludec injection in japanese patients with type 1 diabetes . however , some patients with extremely low insulin secretion capacity often need to use twice - daily basal insulin because the duration of action of insulin detemir is about 16 hours and that of insulin glargine does not last up to 24 hours [ 4 , 12 ] . a few studies from japan have already investigated the outcome of switching from once - daily or twice - daily basal insulin to once - daily insulin degludec in patients with type 1 diabetes [ 1315 ] . specifically , these studies investigated the effects of switching to insulin degludec in type 1 diabetes patients who were being treated with a combination of once- or twice - daily injections of insulin glargine or detemir , though there are no studies that focused on type 1 diabetes patients treated only with twice - daily basal insulin . the basal insulin levels were very low in our patients and the level could not be detected in most patients even by using high - sensitivity c - peptide kits with detection limit of < 0.015 ng / ml . therefore , the selection of twice - daily basal insulin injections in our study seems reasonable to achieve better glycemic control . insulin degludec , an ultra - long - acting basal insulin , became available in japan in 2013 , ahead of other countries , and is known to have longer duration of action ( over 42 hours ) compared with insulin glargine and detemir . therefore , it is clinically worthy to investigate the efficacy and safety of switching from twice - daily insulin glargine or detemir to once - daily insulin degludec in type 1 diabetes patients with severely reduced insulin secretion . the results showed no significant changes in various parameters of glycemic control , such as fasting plasma glucose , hba1c , and glycosylated albumin , after switching to insulin degludec despite about 20% reduction in basal insulin dose at 12 weeks , indicating that insulin degludec has longer duration of action and a more potent glucose - lowering effect than insulin glargine or insulin detemir . the frequency of hypoglycemic episodes recorded by cgm did not increase at 4 weeks after switching to insulin degludec . in our study protocol , the bolus insulin dose was not changed before and after cgm recording because the effect of bolus insulin on glycemic control needed to be minimized . according to a previous report by the begin basal - bolus type 1 trial investigators , the mean doses of basal and premeal bolus insulin were significantly decreased by 14% and 10% in the insulin degludec group compared with the insulin glargine group at the end of the trial , leading to similar rate of overall hypoglycemia between insulin glargine and degludec groups . therefore , in daily clinical practice , adjustment of the premeal bolus insulin dose also needs be considered when switching to insulin degludec . the smbg data in our study showed that postlunch blood glucose level was significantly lower after switching to insulin degludec injected at bedtime , suggesting that the peak action of insulin degludec occurs 14 - 15 hours after injection . consistent with this finding , another study showed that the trough blood glucose was recorded at daytime when insulin degludec was injected at bedtime . in addition , one review showed that the peak of the glucose - lowering effect of insulin degludec appeared about 12 hours after injection . in addition to the longer duration of action of basal insulin , its effects on daily and day - to - day variability of plasma glucose should be noted . reported that the use of insulin degludec resulted in lower day - to - day variability in blood glucose compared to insulin glargine in type 1 diabetes patients . however , different from this study , our results showed that switching to insulin degludec did not reduce modd , an index of plasma glucose day - to - day variation , which was consistent with a previous study in japan [ 13 , 14 ] . heise et al . examined the glucose fluctuation by the glucose clamp method after very long fasting , which was not different from our method by cgm . therefore , the inconsistency might be due to differences between experimental and real - world study . our study extended over a short period of time and included a limited sample size . in addition , the carry - over effect of hba1c could not be completely excluded because our study was not a randomized controlled trial . therefore , a crossover trial or randomized controlled trial of a larger sample size is needed in the future . in conclusion , our study demonstrated that glycemic control 12 weeks after switching to once - daily insulin degludec injection with 20% dose reduction was comparable to that in patients treated with twice - daily injection of basal insulin injections and that such switching did not change the frequency of nocturnal hypoglycemia recorded by cgm ." ]

[ "a 33 year old healthy male of afro - caribbean origin presented to the emergency department with acute generalised abdominal pain of three hours duration . he had not noticed any recent change in bowel habit , bleeding per rectum or any systemic symptoms . it was of note that there was no family history of inflammatory bowel disease or gastrointestinal malignancy . he was a non - smoker and did not consume alcohol . on examination he had a heart rate of 110 beats per minute , temperature of 37.2c , stable blood pressure but he was cold and clammy . bowel sounds were absent and rectal exam revealed an empty rectum and no palpable masses . blood tests revealed a neutrophilia of 25,000 but urea and electrolytes were within normal range . he was resuscitated with intravenous fluids and an emergency laparotomy was performed . during the laparotomy , a 0.5 cm perforation was noted in the ileum 25 cm proximal to the ileocaecal valve on the mesenteric border . an inflammatory mass measuring 5 3 cm was noted directly adjacent to the perforation in the mesentry . 30 cm of small bowel was resected with a right hemicolectomy , hence removing the mass and the perforation . no obvious cause of sepsis was identified and it was thought that he may have a subphrenic collection . therefore a computed tomography ( ct ) scan was arranged . however , he had a severe reaction to the intravenous contrast medium which resulted in hypotension . the patient underwent a second laparotomy to drain the subphrenic abscess and no masses were seen during this procedure . histological examination of the resected specimen from the first laporotomy revealed mesenteric fibromatosis ( desmoid tumour ) incompletely excised . the resected right hemi - colon did not show evidence of dysplasia , malignancy or polyposis . the estrogen receptor status was not reported . due to continuing abdominal discomfort on the ward after the second laparotomy , an ultrasound scan was arranged that revealed the following : a rather ill - defined , fairly ovoid , inhomogeneously - hypoechoic mass lesion is identified in the lower abdomen ( infra- umbilical ) para - sagittal plane . it measures about 5 3 4.5 cm in maximum dimensions surrounded by excess peritoneal fat and some bowel loops representing a residual of a previously resected abdominal desmoid . the pain eventually resolved and after making a good recovery , he was commenced on oral tamoxifen , 20 mg once a day . although estrogen receptor status was not reported , the patient was commenced on this therapy as it was assumed that most desmoid tumours have estrogen receptors . he was subsequently referred to a specialist in a distant tertiary unit for further evaluation of the residual tumour and for the prospect of further elective surgery .", "a 33 year old healthy male of afro - caribbean origin presented to the emergency department with acute generalised abdominal pain of three hours duration . he had not noticed any recent change in bowel habit , bleeding per rectum or any systemic symptoms . it was of note that there was no family history of inflammatory bowel disease or gastrointestinal malignancy . he was a non - smoker and did not consume alcohol . on examination he had a heart rate of 110 beats per minute , temperature of 37.2c , stable blood pressure but he was cold and clammy . bowel sounds were absent and rectal exam revealed an empty rectum and no palpable masses .", "blood tests revealed a neutrophilia of 25,000 but urea and electrolytes were within normal range .", "he was resuscitated with intravenous fluids and an emergency laparotomy was performed . during the laparotomy , a 0.5 cm perforation was noted in the ileum 25 cm proximal to the ileocaecal valve on the mesenteric border . an inflammatory mass measuring 5 3 cm was noted directly adjacent to the perforation in the mesentry . 30 cm of small bowel was resected with a right hemicolectomy , hence removing the mass and the perforation .", "no obvious cause of sepsis was identified and it was thought that he may have a subphrenic collection . therefore a computed tomography ( ct ) scan was arranged . however , he had a severe reaction to the intravenous contrast medium which resulted in hypotension . the patient underwent a second laparotomy to drain the subphrenic abscess and no masses were seen during this procedure . histological examination of the resected specimen from the first laporotomy revealed mesenteric fibromatosis ( desmoid tumour ) incompletely excised . the resected right hemi - colon did not show evidence of dysplasia , malignancy or polyposis . due to continuing abdominal discomfort on the ward after the second laparotomy , an ultrasound scan was arranged that revealed the following : a rather ill - defined , fairly ovoid , inhomogeneously - hypoechoic mass lesion is identified in the lower abdomen ( infra- umbilical ) para - sagittal plane . it measures about 5 3 4.5 cm in maximum dimensions surrounded by excess peritoneal fat and some bowel loops representing a residual of a previously resected abdominal desmoid . the pain eventually resolved and after making a good recovery , he was commenced on oral tamoxifen , 20 mg once a day . although estrogen receptor status was not reported , the patient was commenced on this therapy as it was assumed that most desmoid tumours have estrogen receptors . he was subsequently referred to a specialist in a distant tertiary unit for further evaluation of the residual tumour and for the prospect of further elective surgery .", "desmoid tumours ( fibromatosis ) are benign fibrous neoplasms originating from the musculo - aponeurotic structures throughout the body . desmoid tumours can arise from any skeletal muscle but commonly affect the rectus abdominus in post - partum females and in old surgical scars of the abdomen . peripheral tumours are smooth , firm and mobile . they are adherent to the surrounding structures gardner s syndrome and familial adenomatous polyposis coli ( fap ) should be suspected in patients with such soft tissue growths ( 3 ) . an intra - abdominal desmoid , also known as mesenteric fibromatosis , is the most common solid primary neoplasm of the mesentry . approximately 80% of intra - abdominal desmoids involve small bowel mesentry , as was the case with our patient . involvement of the transverse mesocolon , retroperitoneum , omentum and the ligamentum teres have also been reported ( 1 , 4 ) . intra - abdominal desmoids are usually asymptomatic until their growth and infiltration causes compression of the viscera . this can lead to intestinal obstruction , ischemic bowel secondary to vascular compression and hydronephrosis due to ureteric compression . bowel perforation is extremely rare and my research has yielded one previous case report ( 1 ) . other rare manifestations reported in the literature include deep vein thrombosis , pyrexia of unknown origin , gastrointestinal bleeding and intra - abdominal abscess formation ( 5 , 6 ) . the subphrenic abscess that our patient developed is very likely to have been a complication of the initial laparotomy . histologically , these tumours are composed of collagen that surrounds spindle cells which are poorly circumscribed ( figure 12 ) . exact etiology is uncertain but hormonal factors are implicated as there are estrogen eceptors present in some desmoid tumours . the adenomatous polyposis coli ( apc ) gene located on chromosome 5 is responsible for familial adenomatous polypsois coli ( fap ) . biallelic mutations of the apc gene induces desmoid tumour formation , hence the association between these two disorders ( 8) . in our patient , there was no polyposis in the resected right hemi - colon . trauma has also been suggested as another causative factor but there was no such history in our patient ( 1 ) . both ct and magnetic resonance imaging ( mri ) are useful in diagnosing and monitoring recurrence . they allow accurate staging and also enable one to delineate accurate anatomy prior to embarking upon major resection . mri has the advantage of defining the extent of involvement and monitoring post operative recurrence , which can be as high as 70% ( 6 ) . these patients should also undergo colonoscopy and examination of the eye to exclude gardner s syndrome . colonoscopy may reveal multiple colonic polyps and fundoscopy may demonstrate multiple pigmented lesions affecting the fundus of the eye ( 2 , 3 ) . complete surgical excision may be the only effective way of providing a cure but complete excision is often impossible and therefore adjuvant treatments have been employed with various degrees of success ( 1 , 2 ) . other treatment modalities include radiotherapy , if there is recurrence or as primary treatment to avoid radical surgery ( 9 ) . anti - estrogens ( e.g. tamoxifen ) , prostaglandin inhibitors and non - steroidal anti - inflammatory drugs ( nsaids ) have also been used . cytotoxic chemotherapy may be useful in those with disease recurrence or where surgery is contraindicated ( 10 ) .", "desmoid tumours originate from the musculo - aponeurotic structures of the body and can be peripheral or intra - abdominal . patients should be screened for gardner s syndrome and familial adenomatous polyposis coli since these can often present with dermatoid , epidermoid or other benign tumours . emergency presentations are not common , but are usually secondary to mass effect on the viscera . ct and mri are the imaging modalities of choice , particularly if surgery is contemplated and also in postoperative follow up to detect recurrence . surgery is usually the mainstay of treatment but recurrence is common and adjuvant therapy is used . some tumours possess estrogen receptors , hence they regress in response to anti - estrogens , such as tamoxifen ." ]

[ "between april 1999 and march 2001 , 32 ( 26 men and 6 women ; age range , 7 - 62 years ; mean age , 43 years ) of 195 patients who had undergone ldlt underwent 42 sessions of conventional arteriography in search of bleeding foci of arterial origin within 6 months of the operation . arterial bleeding was suspected clinically if the symptoms or signs were as follows : abnormally increased drainage of fresh blood through the jackson - pratt ( jp ) tube in 26 sessions , hematochezia or melena in 8 sessions , hemothorax or hemoptysis in 5 sessions , hemobilia in 2 sessions , or an acute decrease in the hemoglobin level in one session . six patients underwent two or three sessions of arteriography or tae , because of recurrent arterial bleeding . however , the bleeding foci were different in each of the sessions conducted for the same patient . in all patients , the arterial bleeding occurred within two months ( mean , 14 days ; range , 1 - 56 days ) after ldlt . arteriography was performed within three days ( mean , 1 day ) after the detection of arterial bleeding , depending on the patient 's condition . the underlying causes of hepatic failure and ldlt in these 32 patients were hepatitis b - related liver cirrhosis with or without hepatocellular carcinoma ( n=29 ) , secondary biliary cirrhosis due to intrahepatic stones ( n=1 ) , fatal fulminant hepatitis due to wilson 's disease ( n=1 ) , and biliary atresia ( n=1 ) . the grafts involved in the ldlt included the right lobe ( n=21 ) , left lobe ( n=8 ) , dual left lobe ( n=2 ) , and left lateral segment ( n=1 ) . in all patients , informed consent was obtained from the patient or the patient 's family prior to arteriography . once the right or left femoral artery was punctured , a 5-f end - hole catheter was introduced over a 0.035-inch guide wire ( terumo ; radiofocus , tokyo , japan ) . following the superior mesenteric and common hepatic arteriographies , which were performed to evaluate the patency of the portal and hepatic arterial anastomoses and potential bleeding foci , the suspected arteries destined for selective arteriography were selected . a provisional identification of the bleeding arteries was made based on the patient 's symptoms or signs , radiological findings , including dynamic ct and rbc scans , and the surgical information obtained during ldlt . in the patients with abnormally increased drainage of fresh blood through the jp tube , selective arteriographies were performed of several specific arteries , for which the arterial bleeding might be stagnant in the jp tube placed area . in those patients with hematochezia or melena , inferior mesenteric or left gastric arteriography was performed following superior mesenteric and common hepatic arteriographies , according to the available clinical information . in those patients with hemothorax or hemoptysis , selective arteriographies of the inferior phrenic artery , intercostal arteries adjacent to the pleural drain tubes , subclavian artery and/or bronchial artery were performed according to the available clinical information . aortography for the purpose of gaining an understanding of the arterial anatomy prior to selective arteriography was not routinely performed . however , aortography was performed to rule out the possible of there being any missed bleeding foci , if the selective arteriographies of the presumptive arteries did not demonstrate any active bleeding foci . if the bleeding foci were present on the arteriograms , then either tae or surgery was undertaken to control the bleeding , subject to the mutual agreement of the surgeons and interventional radiologists . tae was intended to be the primary treatment , however , surgical management was considered as the primary treatment if the bleeding foci were technically too difficult or dangerous to be embolized , such as in the case of a hepatic arterial anastomotic site or hepatic resection margin . for tae , the bleeding arteries were superselected using a 3f - microcatheter ( microferret ; cook , bjaerverskov , denmark ) and embolized with 0.018-inch - hilal microcoils ( cook , bloomington , u.s.a . ) or 0.018-inch - tornado microcoils ( cook , bloomington , u.s.a . ) . gelatin sponge particles ( gelfoam ; upjohn , kalamazoo , mi ) were also used in the case of several specific arteries ( intercostal , inferior phrenic and epigastric arteries ) prior to embolization using microcoils , to minimize any rebleeding from collateral vessels . if the bleeding foci were absent on the selective arteriograms and aortogram , explorative laparotomy or clinical observation was chosen by the surgeons , depending on the patient 's condition . in all patients , a complete retrospective review of the medical and surgical records and radiological imaging were performed . the following items were documented retrospectively : the presumptive causes and locations of arterial bleeding , the technical and clinical success rates of tae , and the complications . a bleeding focus was defined as an extravasation of the contrast media or a pseudoaneurysm that was a likely cause of bleeding . the arterial bleeding was divided into four categories according to the possible related causes : surgical bleeding was defined as an arterial bleeding related to the ldlt itself and included bleeding from the hepatic resection margin , hepatic arterial anastomotic site , incision wounds , and the hepaticojejunostomy site . iatrogenic bleeding was defined as bleeding associated with percutaneous invasive procedures , such as transhepatic biliary drainage , central venous access and chest tube insertion . spontaneous bleeding was defined as bleeding that developed spontaneously , such as gastrointestinal bleeding remote from the hepaticojejunostomy site . non - classifiable bleeding was defined as bleeding that was not able to be classified properly . the technical success of tae was defined as the complete disappearance of arterial bleeding following tae . technically impossible or incomplete clinical success was defined as an amelioration of the presenting signs or symptoms of arterial bleeding following tae . major complications were defined as those necessitating an increased level of care , surgery , prolonged hospital stay , permanent adverse sequelae or death .", "between april 1999 and march 2001 , 32 ( 26 men and 6 women ; age range , 7 - 62 years ; mean age , 43 years ) of 195 patients who had undergone ldlt underwent 42 sessions of conventional arteriography in search of bleeding foci of arterial origin within 6 months of the operation . arterial bleeding was suspected clinically if the symptoms or signs were as follows : abnormally increased drainage of fresh blood through the jackson - pratt ( jp ) tube in 26 sessions , hematochezia or melena in 8 sessions , hemothorax or hemoptysis in 5 sessions , hemobilia in 2 sessions , or an acute decrease in the hemoglobin level in one session . six patients underwent two or three sessions of arteriography or tae , because of recurrent arterial bleeding . however , the bleeding foci were different in each of the sessions conducted for the same patient . in all patients , the arterial bleeding occurred within two months ( mean , 14 days ; range , 1 - 56 days ) after ldlt . arteriography was performed within three days ( mean , 1 day ) after the detection of arterial bleeding , depending on the patient 's condition . the underlying causes of hepatic failure and ldlt in these 32 patients were hepatitis b - related liver cirrhosis with or without hepatocellular carcinoma ( n=29 ) , secondary biliary cirrhosis due to intrahepatic stones ( n=1 ) , fatal fulminant hepatitis due to wilson 's disease ( n=1 ) , and biliary atresia ( n=1 ) . the grafts involved in the ldlt included the right lobe ( n=21 ) , left lobe ( n=8 ) , dual left lobe ( n=2 ) , and left lateral segment ( n=1 ) .", "in all patients , informed consent was obtained from the patient or the patient 's family prior to arteriography . once the right or left femoral artery was punctured , a 5-f end - hole catheter was introduced over a 0.035-inch guide wire ( terumo ; radiofocus , tokyo , japan ) . following the superior mesenteric and common hepatic arteriographies , which were performed to evaluate the patency of the portal and hepatic arterial anastomoses and potential bleeding foci , the suspected arteries destined for selective arteriography were selected . a provisional identification of the bleeding arteries was made based on the patient 's symptoms or signs , radiological findings , including dynamic ct and rbc scans , and the surgical information obtained during ldlt . in the patients with abnormally increased drainage of fresh blood through the jp tube , selective arteriographies were performed of several specific arteries , for which the arterial bleeding might be stagnant in the jp tube placed area . in those patients with hematochezia or melena , inferior mesenteric or left gastric arteriography was performed following superior mesenteric and common hepatic arteriographies , according to the available clinical information . in those patients with hemothorax or hemoptysis , selective arteriographies of the inferior phrenic artery , intercostal arteries adjacent to the pleural drain tubes , subclavian artery and/or bronchial artery were performed according to the available clinical information . aortography for the purpose of gaining an understanding of the arterial anatomy prior to selective arteriography was not routinely performed . however , aortography was performed to rule out the possible of there being any missed bleeding foci , if the selective arteriographies of the presumptive arteries did not demonstrate any active bleeding foci . if the bleeding foci were present on the arteriograms , then either tae or surgery was undertaken to control the bleeding , subject to the mutual agreement of the surgeons and interventional radiologists . tae was intended to be the primary treatment , however , surgical management was considered as the primary treatment if the bleeding foci were technically too difficult or dangerous to be embolized , such as in the case of a hepatic arterial anastomotic site or hepatic resection margin . for tae , the bleeding arteries were superselected using a 3f - microcatheter ( microferret ; cook , bjaerverskov , denmark ) and embolized with 0.018-inch - hilal microcoils ( cook , bloomington , u.s.a . ) or 0.018-inch - tornado microcoils ( cook , bloomington , u.s.a . ) . gelatin sponge particles ( gelfoam ; upjohn , kalamazoo , mi ) were also used in the case of several specific arteries ( intercostal , inferior phrenic and epigastric arteries ) prior to embolization using microcoils , to minimize any rebleeding from collateral vessels . if the bleeding foci were absent on the selective arteriograms and aortogram , explorative laparotomy or clinical observation was chosen by the surgeons , depending on the patient 's condition .", "in all patients , a complete retrospective review of the medical and surgical records and radiological imaging were performed . the following items were documented retrospectively : the presumptive causes and locations of arterial bleeding , the technical and clinical success rates of tae , and the complications . a bleeding focus was defined as an extravasation of the contrast media or a pseudoaneurysm that was a likely cause of bleeding . the arterial bleeding was divided into four categories according to the possible related causes : surgical bleeding was defined as an arterial bleeding related to the ldlt itself and included bleeding from the hepatic resection margin , hepatic arterial anastomotic site , incision wounds , and the hepaticojejunostomy site . iatrogenic bleeding was defined as bleeding associated with percutaneous invasive procedures , such as transhepatic biliary drainage , central venous access and chest tube insertion . spontaneous bleeding was defined as bleeding that developed spontaneously , such as gastrointestinal bleeding remote from the hepaticojejunostomy site . non - classifiable bleeding was defined as bleeding that was not able to be classified properly . the technical success of tae was defined as the complete disappearance of arterial bleeding following tae . technically impossible or incomplete clinical success was defined as an amelioration of the presenting signs or symptoms of arterial bleeding following tae . major complications were defined as those necessitating an increased level of care , surgery , prolonged hospital stay , permanent adverse sequelae or death .", "conventional arteriography demonstrated 42 bleeding foci of arterial origin in 30 sessions ( 23 patients ) . the number of bleeding foci detected were one in 22 sessions ( 15 patients ) , two in six sessions ( 6 patients ) , and more than three in two sessions ( 2 patients ) . the bleeding foci originated most frequently from the hepatic artery ( 14/42 , 33% ) and intercostal artery ( 11/42 , 26% ) . based on a complete review of the clinical , interventional and surgical data , the bleeding foci were classified into 4 categories corresponding to the most likely causes of arterial bleeding ( table 2 ) . in this way , it was demonstrated that , in addition to surgical bleeding ( 36% ) , iatrogenic bleeding ( 40% ) was also a major cause of arterial bleeding after ldlt . tae was technically successful in 33 of the 42 foci of active arterial bleeding ( table 1 ) ( figs . 1 , 2 ) however , tae failed in the remaining 9 foci of active arterial bleeding , due to technically difficult superselection of the corresponding bleeding artery or the potential high risk associated with tae ( fig . 3 ) . these bleeding foci consisted of hepatic artery anastomotic sites ( n=2 ) , hepatic resection margins ( n=4 ) and hepaticojejunostomies ( n=3 ) , and they were treated by surgery . however , in three sessions , additional immediate surgery had to be conducted following successful tae for the evacuation of hematoma . however , there was no evidence of active arterial bleeding in the operation field in any of these cases . in 20 of the 21 sessions , the patients showed a clinical improvement in the active arterial bleeding after successful tae . one patient did not show any clinical improvement , because of recurrent arterial bleeding of the same focus . this patient had been treated by anti - coagulation therapy due to cerebral infarction , resulting in a severe iatrogenic bleeding tendency , and died of multifocal hemorrhage including cerebral hemorrhage several days after tae . the overall technical and clinical success rates for the 30 sessions of tae were 21 ( 70% ) and 20 ( 67% ) , respectively . these relatively low success rates can be ascribed to the three bleeding foci ( hepatic resection margins , hepatic artery anastomotic sites and hepaticojejunostomy sites ) , in which embolization was either incomplete or impossible . in the case of the three bleeding foci , if these bleeding foci were excluded , the overall technical and clinical success rates were 19 ( 100% ) and 18 ( 95% ) out of 19 sessions . six ( 19% ) patients underwent two or three sessions of arteriography , because of recurrent arterial bleeding . however , different bleeding foci were treated in each session of arteriography conducted for the same patient . recurrent bleeding at the same foci was present in only one patient , as described above . on the other hand these cases were managed either by surgery ( 6 patients ) or close clinical observation ( 5 patients ) with transfusion , depending on the patient 's condition . in three of the former six patients , surgery allowed the discovery of active arterial bleeding at the hepatic artery anastomotic site ( n=1 ) , hepatic resection margin ( n=1 ) , and venous oozing ( n=1 ) at the anastomosis of the hepatic vein and vena cava . however , a retrospective review of the selective angiographic images of these patients did not demonstrate the presence of any bleeding focus . in the remaining three patients , surgery did not lead to the discovery of any bleeding focus , and they only underwent hematoma evacuation . after either conservative or surgical management , the signs of active bleeding ameliorated in all 11 patients . during the 6 month follow - up period after ldlt , there were no major tae - related complications .", "conventional arteriography demonstrated 42 bleeding foci of arterial origin in 30 sessions ( 23 patients ) . the number of bleeding foci detected were one in 22 sessions ( 15 patients ) , two in six sessions ( 6 patients ) , and more than three in two sessions ( 2 patients ) . the bleeding foci originated most frequently from the hepatic artery ( 14/42 , 33% ) and intercostal artery ( 11/42 , 26% ) . based on a complete review of the clinical , interventional and surgical data , the bleeding foci were classified into 4 categories corresponding to the most likely causes of arterial bleeding ( table 2 ) . in this way , it was demonstrated that , in addition to surgical bleeding ( 36% ) , iatrogenic bleeding ( 40% ) was also a major cause of arterial bleeding after ldlt .", "tae was technically successful in 33 of the 42 foci of active arterial bleeding ( table 1 ) ( figs . 1 , 2 ) . however , tae failed in the remaining 9 foci of active arterial bleeding , due to technically difficult superselection of the corresponding bleeding artery or the potential high risk associated with tae ( fig . 3 ) . these bleeding foci consisted of hepatic artery anastomotic sites ( n=2 ) , hepatic resection margins ( n=4 ) and hepaticojejunostomies ( n=3 ) , and they were treated by surgery . however , in three sessions , additional immediate surgery had to be conducted following successful tae for the evacuation of hematoma . however , there was no evidence of active arterial bleeding in the operation field in any of these cases . in 20 of the 21 sessions , the patients showed a clinical improvement in the active arterial bleeding after successful tae . one patient did not show any clinical improvement , because of recurrent arterial bleeding of the same focus . this patient had been treated by anti - coagulation therapy due to cerebral infarction , resulting in a severe iatrogenic bleeding tendency , and died of multifocal hemorrhage including cerebral hemorrhage several days after tae . the overall technical and clinical success rates for the 30 sessions of tae were 21 ( 70% ) and 20 ( 67% ) , respectively . these relatively low success rates can be ascribed to the three bleeding foci ( hepatic resection margins , hepatic artery anastomotic sites and hepaticojejunostomy sites ) , in which embolization was either incomplete or impossible . in the case of the three bleeding foci , the technical success rate was only 2 ( 18% ) out of 11 sessions . if these bleeding foci were excluded , the overall technical and clinical success rates were 19 ( 100% ) and 18 ( 95% ) out of 19 sessions . six ( 19% ) patients underwent two or three sessions of arteriography , because of recurrent arterial bleeding . however , different bleeding foci were treated in each session of arteriography conducted for the same patient . recurrent bleeding at the same foci was present in only one patient , as described above . on the other hand , arteriography showed no active bleeding focus in 12 sessions ( 11 patients ) . these cases were managed either by surgery ( 6 patients ) or close clinical observation ( 5 patients ) with transfusion , depending on the patient 's condition . in three of the former six patients , surgery allowed the discovery of active arterial bleeding at the hepatic artery anastomotic site ( n=1 ) , hepatic resection margin ( n=1 ) , and venous oozing ( n=1 ) at the anastomosis of the hepatic vein and vena cava . however , a retrospective review of the selective angiographic images of these patients did not demonstrate the presence of any bleeding focus . in the remaining three patients , surgery did not lead to the discovery of any bleeding focus , and they only underwent hematoma evacuation . after either conservative or surgical management , the signs of active bleeding ameliorated in all 11 patients . during the 6 month follow - up period after ldlt , there were no major tae - related complications .", "according to our results , arterial bleeding after ldlt was not confined to surgical causes . surgical bleeding was one of the most common causes of bleeding after ldlt , however , iatrogenic bleeding was even more common than surgical bleeding in our retrospective study . coagulopathy after ldlt is inevitable for a certain period of time in most liver transplant recipients , until the graft 's function is normalized . the risk of iatrogenic bleeding is also high in the early post - ldlt period . thus , clinicians should make a particular effort to prevent iatrogenic bleeding during percutaneous procedures after ldlt . some amount of surgical bleeding from the hepatic artery at the hepatic arterial anastomotic site , hepatic resection margin or hepaticojejunostomy site is inevitable , because ldlt generates a liver graft with variable - sized cut surfaces and multiple anastomotic sites . in fact , bleeding from the hepatic artery was the most common cause of bleeding in our study . however , performing tae in the case of bleeding from the hepatic artery following ldlt was virtually impossible , because of the difficulty involved in the superselection of the bleeding arteries , due to the existence of fine arterial feeders , hepatic arterial anastomotic stenosis , a tortuous arterial course or multifocal occurrences . furthermore , performing tae of the hepatic artery runs the risk of hepatic infarction or failure following inadvertent diffuse proximal embolization ( 16 ) . ( 17 ) reported that three of nine patients with extrahepatic pseudoaneurysm following liver transplantation underwent effective coil embolization , however all patients subsequently underwent retransplantation due to graft ischemia . accordingly , we achieved technical success in only four of the 14 foci involving bleeding from the hepatic arterial branches . although tae can be performed in some patients with massive bleeding from the hepatic artery , we consider that surgical management is the treatment of choice for the management of surgically induced bleeding from the hepatic artery anastomotic site , hepatic resection margin or hepaticojejunostomy site . the cause of bleeding from the intercostal artery was iatrogenic bleeding in most cases , resulting from either placement of a drain tube or central venous catheterization . the cause of bleeding from the inferior phrenic artery was uncertain , however it might have been related to various causes , such as intraoperative retractor injury , chest tube insertion or spontaneous bleeding , and it must be routinely evaluated to rule out active bleeding . knowledge of the clinical symptoms or signs of arterial bleeding provided by the clinicians is very helpful prior to the performance of arteriography . a jp drain was the most common clinical clue to the presence of arterial bleeding after ldlt . bleeding can occur from the hepatic , intercostal , inferior phrenic or pancreaticoduodenal arteries or from the jejunal branches of the superior mesenteric artery . unusually , bleeding from the deep circumflex iliac and inferior epigastric arteries was manifested as jp bleeding in one case . therefore , in our opinion , arteriograms of the inferior phrenic and intercostals arteries , as well as of the superior mesenteric and common hepatic arteries , should be surveyed in cases of jp drain bleeding . in addition , those arteries supplying the lower thoracic and abdominal walls should also be considered as possible sources of arterial bleeding . as in the case of general surgical patients , ldlt recipients are also subject to bleeding from stress ulceration , peptic ulcer and angiodysplasia of the colon ( 4 , 6 , 18 ) . not uncommonly , this bleeding tends to be resolved only by proper medical treatment ( 4 ) . clinical observation may be sufficient whenever the patient 's condition tolerates it . in our study , four patients with hematochezia or melena showed negative outcomes on arteriography , but improved clinically without surgery or tae . in fact , tae was very effective in cases of positive arteriography , and all four patients with arteriographically proven gastrointestinal bleeding improved after only one session of tae . in the conventional arteriogram , a negative outcome does not always guarantee the absence of actual bleeding . in our study , surgery demonstrated active bleeding foci in three of six patients without active bleeding on selective arteriography . this discrepancy seems to have been caused by minor or intermittent arterial bleeding or venous oozing . in contrast , surgery did not lead to the detection of any bleeding focus in the three remaining patients . in conclusion , technical limitations were encountered when using tae for the management of hepatic arterial bleeding . however , in the other locations , tae seems to be effective and safe for the control of arterial bleeding after ldlt ." ]

[ "fibrodysplasia ossificans progressiva ( fop ) is a rare genetic disoder characterized by bone formation within muscles tendons and ligaments . we hereby report a case of fop in a four year male child from a tribal family in orissa .", "4 yr old male child presented with gradual development of stiffness of neck and hard nodules on his body for which his parents had sought all sort of indegenous treatment and manipulations by traditional bone setters . patient returned to our hospital at the age of four years with widespread ossification and stiffness of neck , shoulders and back . he also had upper tibial osteochondromas and scalp nodules and valgus deformity of bilateral great toes .", "though rare , diagnosis of myositis ossificans progressiva should be considered in a child with heterotopic bone formation and valgus deformities of great toes . being a rare condition , treatment guidelines are not clear and this condition need further research .", "fibrodysplasia ossificans progressiva ( fop ) is also known as myositis ossificans progressiva , stone man disease , munchmeyer s disease . fop is an extremely rare and most crippling form of heterotopic ossification in humans with an incidence of 1 in 2 millions . kitterman et al reported that it takes atleast six physician evaluations to reach the diagnosis and 90% of these individuals will have received some wrong or hazardous treatment before appropriate diagnosis . we hereby report a case of fop in a 4 year old boy coming from tribal family in orissa . the diagnosis of this patient was delayed due as the parents tried all sorts of indigenous medications and even manipulations by traditional bonesetters whose influence has been deep rooted in minds of the tribal population in this part of the country .", "our patients was a four year old boy who presented with chief complains of stiffness of neck , decreased movements in bilateral shoulders and had bony hard swellings in his back . , his parents noticed that he had stiffness of neck and had developed nodules at his scalp , which gradually subsided without any treatment . coming from a tribal background , parents consulted many indigenous medicine practitioners and child was subjected to repeated manipulations of the neck by traditional bone setters . these swellings hardened over a period of few days and the child developed stiffness of spine . he was subjected to further manipulations and gradually developed stiffness of bilateral shoulders and left elbow . on examination , the patient had bony hard swellings in cervico - thoraco - lumbar spine , bilateral axillae and left elbow and left 3rd costochondral junction along with hypoplasia and valgus deformity of great toes ( fig . a frontal view of the patient showing ankylosis of bilateral shoulders and left elbow with bony swelling at left 3rd costo chondral junction . radiographs revealed hallux valgus and hypoplasia of proximal phalanges of great toes with short widened first metacarpals bilaterally ( fig . 2b , c ) extensive ossification overlying both side of the neck and in the para vertebral tissues in dorsolumbar area ( fig . diagnosis of fop was made in basis of all these radiological and clinical findings radiological findings . a- bilateral hallux valgus and hypoplastic proximal phalynx of great toe with short and widened first metatarsal .", "our case once again highlights the deleterious effects of trauma in the form of manipulations and massage that can aggravate the ossification process in case of fop . trauma as trivial as intramuscular injections , mandibular block during dental procedures , muscle fatigue , muscle trauma due to bumps , falls and influenza like illness can aggravate the process of heterotopic ossification in these patients . a sporadic mutation in the gene encoding bone morphogenetic protein ( bmp ) activin receptor type ia / activin - like kinase 2 ( acvr1/alk2 ) located on chromosome 2q23 - 24 region has been identified as the main genetic abnormality in fop . recently , additional mutations have been identified in the gs - domain and kinase domain of acvr1 in individuals with a typical forms of fop . inheritance is in autosomal dominant manner but less than 10 cases of familial transmission have been reported . in vitro experiments with use of cells derived from patients with fibrodysplasia ossificans progressiva show a markedly attenuated response of noggin ( bmp-4 antagonist ) expression to bmp4 stimulation . an inadequate bmp - antagonist response following soft - tissue trauma would permit the rapid expansion of a bmp4 morphogenetic gradient in a patient with fibrodysplasia ossificans progressiva and could explain the explosive bone induction seen during flare - ups . a new research by quen et al interpreted that in addition to the above , the mutation also induces chondrogenesis by signaling in a bmp independent and bmp responsive manner . this mutation may also sensitize mesenchymal cells to bmp - induced osteoblast differentiation , and stimulates new bone formation . individuals with fop are normal at birth except for having valgus deformity of great toes . heterotopic ossification is heralded by the rapid appearance of large painful swellings of highly vascular fibro - proliferative tissue involving tendons , ligaments , fascia , and skeletal muscle . these preosseous swellings progress along a pathway of endochondral ossification to form mature heterotopic bone . typically , the dorsal , axial , cranial , and proximal regions of the body are involved early , and the ventral , appendicular , caudal , and distal regions are involved later . several skeletal muscles including the diaphragm , tongue , and extra - ocular muscles are spared from fop . cardiac muscle and smooth muscle histological examination of early fop lesions reveals an intense perivascular lymphocytic infiltrate followed by lymphocyte - associated death of skeletal muscle and robust development of fibro proliferative tissue with extensive neovascularity and mast cell infiltration . tissues from fop lesions at later stages of maturation exhibit characteristic features of endochondral ossification that support ectopic hematopoiesis . definitive genetic testing for fop is now available however is not essential for diagnosis which is purely clinical . this condition needs to be differentiated from progressive osseous hyperplasia ( poh ) , which presents with heterotopic ossification . poh is distinguished from fop by the absence of congenital skeletal malformations , the absence of predictable regional patterns of heterotopic ossification , the pre- dominance of intramembranous rather than endochondral ossification , and the presence of heterotopic ossification in skin and subcutaneous fat piram et al noted 40% incidence of scalp nodules in patients of fop in their retrospective study on 43 patients . deirmengian et al reported 90% incidence of upper tibial osteochondromas in a study on 96 patients . our case had this particular finding and cases with combined heterotrophic ossifications with osteochondromas should be considered for this diagnosis . based on these typical and commonly found characteristics , mutlu et the great toe malformations along with rapidly developing and waxing / waning soft tissue lesions over head , neck and upper back are characteristics for fop . kaplan et al commented that failure to make such association is the commonest cause of misdiagnosis of fop . misdiagnosis may lead to inadvertent managements like manipulations , biopsies and surgery . as in our case , these strategies just help the disease to flare and make the life of patient much difficult . kitterman et al reported incidence of misdiagnosis to be > 90% , with 68% receiving inappropriate treatment which lead to permanent disability in about 50% of cases . early diagnosis and high index of suspicion will not only prevent the itrogenic harm but may also slow the disease progress and avoid rapid and early deterioration in patients quality of life . in our case , this lead to rapid progression of disease in our case with early development of deformities . short course of steroids are used in during acute flare - ups in large joints and submandibular area . other drugs tried are nsaids and cox-2 inhibitors , bisphonates like etidronate and pamindronate , rosiglitazones , mast cell inhibitors , retinoic receptor agonists etc [ 15 , 16 ] . however a statement made by julius rosenstirn in 1918 still holds true : the disease was attacked with all sorts of remedies and alternatives for faulty metabolism ; every one of them with more or less marked success observed solely by its original author but pronounced a complete failure by every other follower . in many cases , the symptoms of the disease disappear often spontaneously , so the therapeutic effect ( of any treatment ) should not be unreservedly endorsed . the rare incidence of this disease and unpredictable nature of flare - ups makes it difficult to formulate an ideal treatment for it . kaplan et al reported that bone marrow transplant for replacement of hematopoietic cells was not sufficient to prevent ectopic skeletogenesis in the patient with fibrodysplasia ossificans progressiva but pharmacologic suppression of the apparently normal donor immune system following transplantation in the new host modulated the activity of the fibrodysplasia ossificans progressiva and diminished the expression of skeletal ectopia . glaser et al reported bmp4-induced heterotopic ossification can be prevented in vivo either by local delivery of wild - type noggin or after somatic cell gene transfer of a noggin mutein in murine model of fop . recently , dorsomorphin has been identified as a powerful orally - available signal transduction inhibitor of bmp signaling and preliminary data suggest that this category of stis may play a powerful role in inhibiting heterotopic ossification in animal models but its safety and efficacy in animal models of fop is still to be determined . although the rate of disease progression is variable , most patients are confined to a wheel- chair by their early twenties and require lifelong assistance with activities of daily living . patients with fop usually succumb later in adulthood at mean age of 40 years to cardiopulmonary complications secondary to thoracic insufficiency syndrome and severe restrictive pulmonary disease due to ossification and ankylosis of the joints of thoracic cage .", "thus in conclusion clinical suspicion , early diagnosis and expectant treatment are the main management strategy in cases with fop . fop demands further research to treat individuals suffering from this dreaded form of heterotopic ossification . valgus deformity of great toes and neck stiffness are important pointers towards diagnosis of fop and this condition needs further research to find an effective treatment modality for it" ]

[ "delivery of exogenous nucleic acids such as dna into cells ( transfection ) holds great promise for disease prevention and therapy ( aka : gene therapy).(1 ) genetic material delivered into the cell modifies the function of such cells generally by altering the production of proteins . the selection of appropriate dna carriers is a common problem for gene therapy , and better gene delivery agents are still being sought . viral vectors ( such as retroviral , lentiviral , adenoviral ) and nonviral vectors ( such as liposomal and polymeric ) have both been used as gene delivery agents in the past . although viral vectors are efficient carriers due to their natural ability to penetrate cells , they have also often been shown to provoke undesirable immune responses , thus limiting their usefulness.(2 ) nonviral vectors often prove less immunogenic , but improvement is needed to increase their overall transfection efficiency . to increase such efficiency , effort should be directed at increasing the vector s ability to promote efficient dna condensation , intracellular transport , and sustained gene expression . additionally , the cytocompatibility of nonviral vectors must be well understood before they can be further optimized and become a viable option for gene therapy . fullerene ( c60 ) derivatives have been extensively studied for a variety of medical applications(8 ) including their use as neuroprotective agents,(9 ) hiv-1 protease inhibitors,(10 ) bone - disorder therapy agents,(11 ) x - ray contrast agents,(12 ) and slow - release agents for drug delivery.(13 ) recently , c60-based reagents have also been examined as dna transfection vectors and tested for the ability to mediate gene transfer . these first generation c60-based transfection vectors have shown promise , but a few have also exhibited high cytotoxicity.(16 ) as many of the c60 derivatives previously described in the literature have only been slightly soluble in aqueous solutions , it has also been suggested that one possible reason for such observed cytotoxicity was due to the use of organic solvents that were necessary to dissolve those first generation c60-based transfection agents . thus , the search for new materials and enhanced protocols are key objectives in the continuing development of c60-based transfection vectors , including the design , construction , and testing of new reagents that are water soluble and able to effect enhanced gene delivery without promoting significant cytotoxicity . herein we report transfection efficiencies , cytotoxicity profiles , and biophysical structure / activity studies for a new class of water - soluble c60 vectors prepared using the hirschbingel reaction which is one of the simplest , highest - yielding , and most versatile c60 functionalization methods known . as shown in figure 1 , the structurally derivatized c60 vectors reported herein were synthesized to yield either positively charged , negatively charged , or neutral chemical structures when solvated under physiological conditions . these vectors , which have been analyzed for their ability to promote dna transfection , offer the opportunity to elucidate the roles that hydrophobicity ( due to the fullerene core ) , hydrophilicity ( due to the water soluble substituents ) , and overall charge state displayed by the c60 derivatives have on dna transfection , gene expression , and cytotoxicity . depiction of the structures of the derivatized c60 vectors ; the positively charged amino - c60 compounds ( iiv ) , the neutral serinolamide - c60 compound ( v ) , and the negatively charged c3-c60 compound ( vi ) ( chemical structures depicted at neutral ph in aqueous solution ; counterions in solution not shown ) .", "materials for culturing cells , including dulbecco s modified eagle s medium ( dmem ) , trypsin , and phosphate buffer saline ( pbs ) , were obtained from gibco ( gibco life , grand island , ny ) . complete osteogenic medium containing minimum essential medium ( mem ) , 10 mm -glycerophosphate , 50 g / ml ascorbic acid , and 10 vol % fetal bovine serum was obtained from gemini bio - products ( calabasas , ca ) . a plasmid dna ( 7.2 kbp ) containing the gene for a red - shifted wavelength variant of the enhanced green fluorescent protein ( egfp ) under the transcriptional control of the cytomegalovirus ( cmv ) immediate - early gene promoter was used as the dna construct from which reporter gene expression was measured in the transfection assays . plasmid dna was prepared in bulk from transformed bacterial sources and purified to homogeneity using commercial kits ( qiagen ; germantown , md ) employing anion - exchange chromatography . the amino - c60 adducts ( iiv ) , the seri - c60 adduct ( v ) , and the c3-c60 adduct ( vi ) were synthesized and characterized according to previously published procedures . stock solutions of individual compounds ivi were prepared by weight and filtered for sterilization using a cellulose acetate membrane filter ( 0.2 m pore diameter ) prior to use in forming transfection mixtures . standard solutions were prepared at a concentration 10 g/l for each of these compounds in both tris edta ( te ) solution ( 10 mm tris , 1 mm edta , ph = 7.4 ) , and in serum - free dmem in separate reaction vials . nih 3t3 mouse fibroblast cells ( atcc # crl-1658 ) and hek 293 cells ( human embryonic kidney ; atcc # crl-1573 ) were cultured in dmem containing 10% fbs in a 5% co2 atmosphere at 37 c prior to collection and plating in individual assay wells used for transfection studies . for subculture of cells , routinely on reaching 80% confluence , the cells were washed with pbs , detached using trypsin - edta , harvested by centrifugation , resuspended in culture medium and counted in a coulter counter prior to plating in multiwell dishes for subsequent transfection assays . marrow stromal cells ( mscs ) were harvested from wistar rats as previously described.(24 ) mscs were cultured for 6 days in the presence of 10 m dexamethasone in complete osteogenic media before use in transfection studies and cultured under identical environmental conditions to 3t3 and hek 293 cells . mixtures of individual derivatized c60 vector material and plasmid dna were allowed to form a complex in serum - free dmem , as described below , prior to adding to cells in the transfection assays . each c60-vector solution was added dropwise to a solution of plasmid dna to obtain a final volume of 200 l . each resulting solution was then vortexed briefly and allowed to stand for 30 min at room temperature to allow complete assembly of the vector / dna complex , which was then used immediately in the transfection experiment . the final dna mass of each solution remained constant at 10 g while the concentration of the c60 derivative was varied to obtain a range of c60-reagent - to - dna - base - pair ( bp ) ratios ( defined here as the value of dna mass was fixed at 10 g per well since it showed the most optimum transfection among different dna masses used ( 112 g ) for transfection at r = 16.8 . transfections of nih 3t3 cells were carried out with c60/dna complexes in a range of r values ( 0.4242 ) . for hek 293 cells and mscs , transfections were performed only at r = 4.2 and r = 16.8 . cells were plated at 40,000 cells / cm in 96 well tissue culture plates and incubated overnight to permit cell attachment to the well surface . the culture medium was then replaced by the serum - free transfection mixture for various time periods ( 2 h , 8 h , 24 or 48 h ) ( transfection time ) . after exposing the cells for the respective periods of time to the serum - free transfection mixture , the cells were washed with pbs and the medium was replaced with complete medium ( containing fbs ) . the cells were then further incubated for 8 h , 24 or 48 h ( incubation time ) before gfp fluorescence was measured using a flow cytometer . for comparative purposes , control cell populations were also transfected with plasmid dna alone ( no c60 vector ) , or with plasmid dna complexed with an optimal level of one of two commercially available transfection reagents ; such that the dna was complexed with either 25 kda polyethylenimine ( pei ) , or with cytopure transfection reagent , which is reported by the manufacturer to exhibit very low levels of cytotoxicity . the dna / pei complexes were assembled using a well - established protocol(25 ) and the cytopure / dna complexes were assembled as per the manufacturer s instructions and optimized to obtain an optimal level of dna transfection / gfp expression within the nih 3t3 cell type . below is a brief description of the conditions which gave the optimal level of transfected nih 3t3 cells using 25 kda pei and cytopure . for pei , dna / polymer complexes were prepared in serum - free dmem to achieve a ratio of polymer to dna of 4 . the complexes ( 100 l ) were then incubated at 25 c for 1015 min and then added to cell wells that contained 100 l of serum - free dmem . for cytopure , 1.1 l of cytopure stock was diluted to 50 l with serum - free dmem . the cytopure mixture was then added slowly to 1 g of dna diluted to 50 l with serum - free dmem . the transfection mixture was vortexed , left standing for 15 min at room temperature and added to cell wells that contained 100 l of serum - free dmem . after 24 h of transfection , the cells were washed and the medium was replaced with the serum - containing medium . for purposes of this study , transfection as described herein also relates to cell viability for sufficient time to ensure gfp gene expression , which was determined by cell fluorescence levels above a defined background threshold level ( determined using nontransfected cells to set lower detection limit parameter ) with flow cytometry . cells were prepared for flow cytometry by trypsinization after being washed with sterile pbs to remove cell debris and any residual gene - delivery agents . cells that were transfected successfully expressed gfp protein and were detected at 470/515 nm ( excitation / emission ) by the flow cytometer . transfection efficiency has been determined as the percent of cells that express gfp per study sample relative to the total number of cells passing through the flow cytometer per study sample ( 10,000 events counted for each transfection sample).(25 ) the c60/dna complex solutions were prepared as described above . c60 vector solutions without dna ( 010 g/l ) were prepared by diluting the c60 stock solution with serum - free dmem . the concentration of cultured cells was determined prior to cell plating using a coulter counter and the cells were plated on 96 well clear - bottom plates at a density of 40,000 cells / cm . after incubating overnight to allow cell attachment , the medium in each well was replaced either with 200 l of the c60 vector alone or with c60 vector / dna solutions prepared as described above . the cells were exposed to the solutions for either 2 , 8 or 24 h before the cytotoxicity was determined . control cell samples were plated and grown under identical conditions as those described for treated cell samples , with the exception that neither c60 compounds nor transfection mixtures were added to the control cells . the live / dead viability / cytotoxicity assay ( molecular probes , eugene , or ) was used to determine cytotoxicity levels in cells treated with either c60-vector or c60-vector / dna solutions . this assay makes use of 2 different fluorescent dyes , calcein am and ethidium homodimer ( ethd-1 ) , to measure the number of live and dead cells respectively . the lipid permeable dye , calcein am , when taken up by living cells with intact plasma membranes , emits green fluorescence ( excitation / emission : 495/515 nm ) upon being cleaved by esterase enzymes in the cells . conversely , the ethd-1 dye emits red fluorescence ( excitation / emission : 528/617 nm ) on binding to nucleic acids released from dead cells , and is excluded by the intact cell membranes of viable cells . this assay was preferred over the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide ( mtt ) assay for evaluation of cell viability because c60-vectors compounds i and ii interacted and attached to the mtt - formazan making the formazan crystals insoluble for the next colorimetric assay . similar effects have been reported for single - walled carbon nanotubes.(26 ) the reagents were prepared and added to the wells according to the manufacturer s guidelines . at the time points indicated , the media from the wells was aspirated and replaced with the live / dead reagent , after washing the cells with pbs . the plates were then incubated in the dark at room temperature for additional 30 min before being measured for fluorescence . fluorescence of each sample well was measured by using a fluorescent microplate reader ( tecan safire ) . fluorescence of each sample well was normalized to percent of both live ( no c60 compounds or transfection mixtures treatment condition ) and dead ( 70% methanol treated ) control cell groups . these normalized fractions are defined as the fraction of live and dead cells , respectively , in each of the c60-treated samples . since gfp fluorescence has excitation / emission wavelengths of 470/515 nm , close to that of calcein am , there was a possibility that gfp fluorescence could interfere with the calcein am ( live ) measurement leading to potential errors for those wells containing c60 vector / dna mixtures . thus , a baseline fluorescence intensity of each sample well at 495/515 nm was obtained before the addition of the live cell / dead cell dyes . this intensity was then subtracted from the final calcein am detection intensity . for the dynamic light scattering ( dls ) experiments , a standard solution with concentration 10 g/l of each of the c60 vectors was prepared in each of these solvents : hplc grade water , 10 mm tris / edta solution , and serum - free dmem . these solvents were filtered through a 0.22 m syringe filter ( millpore , millex- gp ) prior to use . the size of standard 100 nm polystyrene beads in tris / edta solution and in serum - free dmem was measured to confirm that no discrepancies were detected with the data acquisition system . dls measurements were conducted using a wyatt technologies dawn eos instrument equipped with a quasi - elastic light scattering interface module ( wyatt qels unit ) . the scattering angle used for detection was 90 at a constant temperature of 25 c . data analysis and size distribution computations were performed using the vendor supplied software ( astra v ) and a multi- digital recorder ( wyatt qels ) . statistical analysis was performed between groups for the live / dead assay and for flow cytometry studies . groups were analyzed by anova with significance defined by a p - value < 0.05 , and pairwise comparison was performed using the tukey test . the cytotoxicity studies had four samples per group , and the transfection studies had three samples per group .", "initial screening was performed on each of the six different derivatized c60 samples , compounds ivi ( figure 1 ) . the different c60-vector / dna complexes were assembled at various r values ( 0.4242 ) and each analyzed for its ability to affect transfection in nih 3t3 cells under serum - free conditions . serum - free conditions were used in these studies to ensure that derivatized nanomaterial / dna complexes were not compromised by serum lipids and/or proteins , and that the dna complexes were imported into the cells based on the individual physical properties of the complexes themselves , without the potential aid of serum proteins acting as carrier . the best transfection efficiencies were routinely observed after allowing transfection mixtures to remain on cells for 24 h ( transfection time ) , then removing the transfection mixtures and incubating cells for an additional 24 h ( incubation time ) in the presence of serum for maximal gene expression to be detected . unless otherwise noted , all transfection efficiency data presented below were for cells transfected for 24 h under serum - free conditions and incubated for an additional 24 h in the presence of serum . all c60-conjugated transfection mixtures showed the ability to transfect cells with exogenous dna with statistically significant differences relative to unconjugated dna alone ( naked dna ) ( table 1 ) . transfection efficiency as reported in table 1 is defined as the ratio of gfp - positive cells as determined by fluorescence under flow cytometry per total number of cells counted in the flow cytometer . no statistical difference was observed between the transfection efficiencies of the different groups at r = 0.42 and r = 4.2 . for r values above 4.2 , compounds iii and iv exhibited a statistical difference in transfection efficiencies compared to the other compounds . both of these compounds exhibited an increased transfection efficiency relative to the other c60 compounds studied , with a maximum transfection efficiency of 31% at r = 16.8 . at larger values of r the efficiency dropped off . at r = 16.8 , their transfection efficiencies were comparable to that of 25 kda pei containing and cytopure transfection reagent containing complexes . 25 kda pei is a widely used and well - studied nonviral vector , while cytopure is a biodegradable polymeric transfection reagent that exhibits very low cytotoxicity and is reported to work on a broad spectrum of cell types , including hard - to - transfect primary cell isolates . c60 vectors are listed in order of their measured efficiency at promoting transfection in nih 3t3 cells under serum - free conditions . to assess the transfection ability of c60 vectors in different cell types , studies were also performed on two other cell types : hek 293 cells and mscs . hek 293 cells were chosen since they are another standard cell line used routinely for transfection assays , while mscs were chosen due to their eminence as primary cells for tissue engineering . based on the initial screening results of each of the various derivatized c60 compounds for transfection - promoting ability in nih 3t3 cells as reported in tables 1 and 2 , transfection studies were also performed on hek 293 cells and mscs using compounds iii and iv at ratios of r = 4.2 and r = 16.8 . however , hek 293 cells ' transfection efficiencies were lower than those observed for nih 3t3 cell at similar r values . mscs exhibited low transfection efficiencies overall , and no increase in transfection efficiency was observed with increase in r values . transfected cells were visualized by fluorescence microscopy for morphological analysis after transfection ( micrographs not shown ) . positive transfection of cells with the plasmid coding for green fluorescent protein could be easily discerned by this technique . however , variations in transfection efficiency among the different cell types tested here is not surprising , as cell type is a major factor in determining the level of transfection and gene expression from nonviral vectors as noted previously.(27 ) differences in cell characteristics , such as cell mitosis rates , can play an important role in transgene expression , and may explain the differences in the level of gene expression among the various cell lines studied here . transfection efficiency values are presented as a quotient of gfp ( + ) cells relative to the total viable cells present in the transfected sample well as measured by flow cytometry . figures 2 a , b and c display the fraction of viable nih 3t3 cells as a function of the c60 vector ( no dna present ) concentration after 2 , 8 , or 24 h post - treatment incubation times , respectively . incubation with c60 compounds for 2 h resulted in a viable cell fraction greater than 50% for all c60 vector solutions . lowest overall cell viability was observed with compound i ( 0.55 0.08 ) at 10 g/l , and no statistically significant increase in cell viability was observed with decreasing compound i concentration . for all other c60 compounds tested , there was a general trend of increased cell viability with decreased c60 compound concentration . fraction of live nih 3t3 cells after incubation with the different c60 vectors as a function of derivatized fullerene concentration after ( a ) 2 h , ( b ) 8 h , or ( c ) 24 h c60-incubation times respectively , under serum - free conditions . error bars represent mean standard deviation for n = 4 . at the 8 h c60 incubation time , the fraction of live cells was higher than 50% for all c60 solutions tested except those exposed to compound i. for compound i , the cell viability was the lowest ( 0.51 0.04 ) at 10 g/l , but no statistically significant increase in cell viability was observed with decreasing compound i concentration . for all other c60 vectors , there was a general trend of increased cell viability with decreased compound concentration , but at each compound concentration tested , the cell viability was lower in the 8 h time point than in the corresponding sample concentration at the 2 h time point . at the 24 h c60 incubation time point , only cells treated with compounds iii and iv exhibited greater than 50% cell viability at all concentrations tested , with an increase in cell viability with decreased c60 compound ( iii and iv ) concentration . all other compounds showed a general trend of increased viability with a decrease in compound concentration , with cell viability values lower than 50% at 10 g/l . figures 3 a , b and c display the cell viability of nih 3t3 cells cultured in the presence of the various c60-vector / dna mixtures as a function of both c60 compound concentration and r values after 2 , 8 or 24 h post - transfection time , respectively . cell viability at the two hour post - transfection time point for compound i / dna and compound ii / dna mixtures increased from 0.19 0.0 at 10 g/l ( r = 42 ) to 0.70 0.15 at 0.1 g/l ( r = 0.42 ) . the fraction of live cells was greater than 50% for all other c60 derivative / dna solutions at the 2 h post - transfection time point . fraction of live nih 3t3 cells after incubation with the different c60/dna transfection mixtures as a function of c60 compound concentration and varying r value after ( a ) 2 h , ( b ) 8 h , or ( c ) 24 h post - transfection incubation time , under serum - free conditions respectively . error bars represent the mean standard deviation for n = 4 . at the 8 h post - transfection time point , the fraction of live cells for compound i / dna and compound ii / dna was less than 50% at all concentrations and r values tested . for all other samples , the trend was similar to that of the 2 h post - transfection time point , with cell viability greater than 50% and an increase in viability observed with a decrease in transfection mixture concentration . at the 24 h time point , cells treated with the compound v / dna mixture exhibited greater than 50% cell viability at all concentrations tested , while compound i / dna , compound ii / dna exhibited less than 50% cell viability . cells treated with compounds iii / dna , iv / dna and vi / dna mixtures resulted in cell viabilities less than 50% at 4 g/l ( r = 16.8 ) and 10 g/l ( r = 42 ) , but greater than 50% viability when added at lower concentrations . dls and optical microscopy studies were performed to help elucidate the biophysical structure / activity relationships that might exist between the various c60 complexes . these studies were carried out to help generate correlations between the different c60 vectors , and the various c60 vector / dna structural attributes resulting in the different transfection efficiencies and cytotoxicity results observed under serum - free conditions . table 3 presents the dls measurements on the various c60 vector compounds ivi when dissolved alone in either water ( 4 g/l ) , in a 10 mm tris / edta solution ( 4 g/l ) , in serum - free dmem ( 4 g/l ) , or when dissolved in complex with dna in 10 mm tris / edta ( 4 g/l , r = 16.8 ) or as a complex with dna in serum - free dmem ( 4 g/l , r = 16.8 ) . the concentration of 4 g/l was chosen for dls experiments since compounds iii and iv exhibited maximum transfection efficiency at this concentration of c60 . the rh values in table 3 provide qualitative information about the transfection mixture aggregate behavior which can readily be seen in figures 4 and 5 . the rh parameter obtained from the dls measurements , and shown in table 3 , corresponds to the radius of a monodisperse hypothetical sphere having the same diffusion constant as that of the c60 compound aggregates or the c60/dna mixture aggregates under study . pdi values between 0 and 0.05 indicate more monodisperse particles , and values above 0.05 indicate broadened size distributions.(30 ) clearly , the rh values shown in table 3 for the various c60 compounds and c60/dna complexes are average values for quite polydisperse populations of aggregates . previous work by our group and others using atomic force microscopy ( afm ) and cryo transmission electron microscopy ( cryo - tem ) have shown that derivatized c60 compounds form aggregates that are irregularly shaped in solution . the rh values observed for these c60 compounds and the c60/dna mixtures suggests that these reagents also form such irregularly shaped aggregates when in aqueous solutions , including when dissolved in solutions of physiological ionic strength such as dmem . such qualitative information about the aggregate behavior provides valuable information for understanding the transfection and toxicity results , as discussed below . representative morphologies of nih 3t3 cells and the c60/dna complexes at r = 0.42 ten minutes after transfection . the optical images represent complexes formed with compound ( a ) i , ( b ) ii , ( c ) iii , ( d ) iv , ( e ) v , and ( f ) vi . all images are shown at the same magnification . representative optical microscopy images of nih 3t3 cells incubated with c60/dna complexes formed using compounds ( a ) iii and ( b ) vi at r = 0.42 twenty four hours post - transfection . all c60 compounds display a broadly distributed aggregate size in each solvent tested ( water , 10 mm tris / edta solution , and serum - free dmem ) . the compounds had aggregate sizes between 47 and 650 nm ( pdi = 0.330.51 ) and between 33 and 446 nm ( pdi = 0.290.46 ) in plain water and 10 mm tris / edta solution , respectively . in the presence of dna , there is an increase in rh for all formulations . in general , the rh values decrease in the order v , vi > i > ii > iii , iv in the presence of dna . presumably , this trend is the result of the influence of the various structures of the c60 derivatives on the condensation behavior of the dna in the transfection mixture . in the case of cationic polymers , the condensation process with dna has been thought to rely predominantly on electrostatic interactions with minor contributions from other interactions such as hydrophobic interactions , hydrogen bonding , and van der waals forces.(5 ) in case of the positively charged c60 derivatives , the hydrophobicity of the c60 core , and electrostatic interactions between the water - soluble functional groups and the dna are the main contributors to the condensation process . compound i , with two adducts on the fullerene core , has less positive charge than the hexa - amino c60 adduct of compound ii and the octa - amino adduct of compound iii . fewer electrostatic interactions between functionalized c60 vectors and the dna sugarphosphate backbone can lead to a decrease in condensation capacity , resulting in larger c60-vector / dna complexes . compound v , although polar , has no net charge at neutral ph ; while compound vi will possess a negative charge , the same as that of dna . thus , for compounds v and vi , hydrophobicity is presumably the only interaction contributing to the formation of the dna condensates , and this interaction appears insufficient to fully condense the dna , leading to large c60 vector / dna complex aggregates . the relatively large sizes for the c60 vector / dna complexes , and in particularly for those formed from compounds i , ii , v and vi , may be a reason for the poor transfection efficiencies observed with these compounds . this may also be a reason for the low transfection efficiency reported for a similar positively charged amino - c60 compound with a monoadduct on the fullerene core.(17 ) however , increased positive charge - state alone is insufficient to solely predict increased transfection capability of amino - derivatized fullerenes . variation in transfection protocol and/or cell types can also dramatically affect transfection efficiencies , as positively charged amino - derivatized c60 similar to compound iv have previously been shown to be inefficient at effecting transfection.(17 ) in general , the condensation behavior of nonviral vector / dna complexes is governed by several factors including the molecular weight of the dna condensing agent , the density of the charges on the condensing agent , and the ratio of composition ( r values ) between the condensing vector and the dna.(5 ) in addition , it is now well - documented that the size of the transfection vector / dna complex is one of the most important parameters for efficient dna delivery into cells , with the most efficient uptake observed for complex with sizes < 150200 nm in diameter.(5 ) the rh values shown in table 3 suggest that only dna complexes formed with compounds iii and iv satisfy these criteria . on addition of the c60-vector / dna complexes to cells , the complexes formed with compounds i and ii immediately aggregated further to form large clusters , even at the lowest r value tested of 0.42 . figure 4af shows the optical microscopy images of all c60-vector / dna complexes at r = 0.42 ten min after their addition to nih 3t3 cells . large , irregularly shaped aggregates ( shown as brown ) can clearly be seen for complexes formed with compound i ( figure 4a ) and for complexes formed with compound ii ( figure 4b ) . the aggregate concentration is greater and more densely distributed for compound i than for compound ii . no such increased aggregation propensity was seen for the other c60 vector / dna complexes ( figure 4cf ) . however , time - dependence of aggregation could be observed for compound iii and compound vi . figure 5a , b shows the optical microscopy images of compound iii / dna , and compound vi / dna complexes at r = 0.42 at 24 h post - transfection time . the images show the presence of large sized aggregates , more densly distributed for compound vi than for compound iii . interestingly , addition of compound iii / dna mixtures caused cell morphological changes when added to cultured cells , causing the attached cells to round up from the substratum surface in contrast to the usual planar , extended / elongated shapes the cells assumed in the normal growth state . this shape change may be attributed to the depolymerization / disruption of either the actin or tubulin networks of the cytoskeleton by the complexes , and/or to the disruption / inhibition of focal adhesion plaques formed on the cell surface . however , this observation at r = 0.42 does not have any noticeable effects on cell proliferation , as flow cytometry measurements indicate no statistically significant difference in the number of cells for those treated with compound iii / dna complexes relative to the controls cells ( no c60/dna complexes added ) . our results indicate that compounds iii and iv , when complexed with dna , bring about the highest levels of transfection when compared to the other derivatized c60 compounds under evaluation in this study . at the optimal ratio of compound iii or iv to dna ( r = 16.8 ) , however , at 24 h post - transfection , there is only approximately 30% viability in cells treated with these two tranfection mixtures . this result is in contrast to cell viability of greater than 50% in cells treated with the compounds iii or iv alone at equivalent c60 concentrations ( 4g/l ) as that when in complex with dna at r = 16.8 . the temporal increase in aggregate sizes for these c60/dna complexes ( not seen in the free c60 compounds alone ) leads to precipitation onto the cell surface when these mixtures are left in the culture medium for 24 h ( e.g. , see figure 5 ) . this effect may explain the higher levels of cell death in the transfection mixture - treated cells . the overall trend observed in these studies was that increased cell death was observed with an increase in either c60 concentration alone or for increased r values in c60/dna mixtures , irrespective of the chemical nature of the c60 compound , with compounds iii and iv exhibiting the least toxicity when free in solution , but not necessarily when complexed with dna ( under these conditions , compound v seems to exhibit the least cell toxicity ) . also , higher levels of cytotoxicity seem to correlate more with complex aggregate formation induced by the presence of dna in the mixtures , leading to the formation of visible precipitates . such deposition of aggregates onto the cell surface will impair normal functioning of the plasma membrane and thereby contribute to cell death.(31 ) there may also be other slow processes contributing to cell death for the positively charged c60 vectors in the c60/dna solutions at the longer ( 8 and 24 h ) transfection times . following cellular entry , the presence of positively charged amino - c60 compounds ( iiv ) ( individuals or as aggregates ) inside the cell or nucleus may lead to disruptions to other cellular functions , such as interfering with histonedna interactions and/or other cellular processes.(7 ) the favorable transfection efficiencies of compounds iii and iv suggest that these compounds have some characteristics in common with other positively charged amino - c60 derivatives previously cited in the literature which are reported to effect transfection in cells . these similarities include having a flexible linker situated between the fullerene core and the positively charged amino groups . although the results presented here suggest that the structures of compounds iii and iv will result in higher levels of transfection than those previously reported by others , direct comparison of our results with the results from others using different structurally derivatized positively charged amino c60 vectors is not possible , since the structure of the c60 vectors , the cell lines tested , and the methodologies used are not consistent . another distinct feature of all the c60 vectors reported here is their water solubility which obviates the need to use organic solvents such as dimethylformamide ( dmf ) in the preparation of the transfection mixture ; the high cytotoxicity observed for some other c60-based transfection agents has been attributed to the toxicity of dmf . the comparable transfection efficiencies of compounds iii and iv on nih 3t3 cells to those of commercially available nonviral vectors 25 kda pei and cytopure is encouraging . 25 kda pei is a widely used nonviral vector and is quite often used as a standard for comparing new nonviral vectors . this high cytotoxicity has been attributed more to free pei than to the pei / dna complex . however , in case of compound iii or iv , at the optimal r = 16.8 , their complexes with dna show higher toxicity ( 30% viability ) compared to the free compounds iii or iv alone ( greater than 50% cell viability ) . since the cytotoxicity seems to correlate more with complex aggregate formation induced by the presence of dna in the mixtures , future refinement of the c60/dna complex preparation protocol , such as disaggregating these complexes with phosphate buffer and/or nacl , should potentially lead to lower cytotoxicity while maintaining the same level of transfection efficiency , or potentially even increase these transfection efficiency levels . furthermore , although not addressed in this study ( for reasons of maintaining uniformity in c60/dna complex formation and cellular entry ) , the presence of serum proteins on enhanced c60/dna complex uptake , and on subsequent cell viability during extended transfection times , would also be worth examining , and could be expected to lower the observed cellular cytotoxicity levels seen in this study . the small , but statistically significant , expression of the reporter protein from c60/dna conjugates formed from compounds v and vi was surprising and interesting since these samples do not possess a net positive charge under the physiological conditions used to form the complexes , although there have been limited reports of other nonpositive charged nanoparticles translocating into cells(35 ) and , indeed , also demonstrating gene transfection.(36 ) thus , at least for some derivatized c60 molecules , the hydrophobic nature of the c60 carbon nanostructures may be the common important property in their binding to dna and their subsequent translocation into the interior of the cell . there is now a growing body of work that suggests that carbon nanomaterials such as fullerenes , metallofullerenes and carbon nanotubes , due the hydrophobicity of their carbon sheaths , have the ability to efficiently translocate into the interior of cells irrespective of the charge of their water - solubilizing moieties . in addition , carbon nanomaterials such as gd@c60 , gd@c82 , gd@c80 and gd@ultrashort single - walled carbon nanotubes ( gd@us - tubes ) have shown potential as high - performance magnetic resonance imaging ( mri ) contrast agents suitable for advanced applications such as tracking and/or delivery of magnetically labeled cells by mri in vivo . these reports , along with the favorable c60-based gene transfection results reported here and by others , offer opportunities for development of analogous gd@c60-based vectors to monitor noninvasively the biodistribution and pharmacokinetics of gene therapy vectors in vivo.(49 )", "a new class of water - soluble c60 transfecting agents with positively charged , negatively charged , or neutral chemical functionalities under physiological conditions was prepared using hirschbingel chemistry . transfection , cytotoxicity and biophysical structure / activity studies were performed in an effort to elucidate the relationship between the hydrophobicity of the fullerene core , the hydrophilicity of the water - solubilizing groups , and the overall charge state of the c60 vectors in gene delivery / expression . however , only two positively charged c60 derivatives , namely , an octa - amino derivatized c60 and a dodeca - amino derivatized c60 vector , showed efficient in vitro transfection . increased levels of cellular toxicity were observed for positively charged c60 vectors relative to the negatively charged and neutral vectors . structural analyses using dynamic light scattering and optical microscopy confirmed that higher positive charge on c60 compounds is a dominant physical attribute necessary for optimal c60/dna structural features leading to increased transfection efficiency , and that aggregation is the major factor that negatively affected the cytotoxicity profiles of the c60 vector / dna complexes . aggregation is presumably also the dominant reason for increased cytotoxicity of certain specific derivatized c60 compounds ( most notable for compound i ) even in the absence of dna , at least when analyzed under the serum - free conditions utilized in this study . future studies should be able to capitalize on this information and enable the design of additional c60 derivatives that address these issues specifically and help lower the propensity of these reagents to aggregate in the presence of dna . such reagents would be expected to enhance transfection of cells and tissues while simultaneously lowering toxicity levels . future studies using these reagents will also more precisely indicate the cellular uptake and endosomal release mechanisms that these compounds inherently possess , thereby lending further insight into potential enhanced chemical design of future generations of these carbon - based nanomaterials specifically for dna delivery into the cell nucleus . the successful demonstration of intracellular dna uptake , intracellular transport , and gene expression from dna using c60 vectors suggests the possibility of developing analogous gd@c60-based vectors to serve simultaneously as both therapeutic and diagnostic agents ." ]

[ "previously we reported that deletion of neutral endopeptidase ( nep ) provides protection from obesity- and diabetes - induced neural complications . we have also shown that treating obese and streptozotocin - diabetic mice with the vasopeptidase inhibitor ilepatril prevented neural complications including slowing of nerve conduction velocity , thermal hypoalgesia , and decreased intraepidermal nerve fiber density . vasopeptidase inhibitors are drugs that simultaneously inhibit nep and angiotensin - converting enzyme ( ace ) activity . recent studies have shown increased expression of angiotensin - ii - forming enzymes in adipose tissue and increased activity of the renin - angiotensin system being implicated in the development of insulin resistance and type 2 diabetes . nep is found in many tissues including vascular and renal tissue and its activity is increased by fatty acids and glucose in human microvascular cells [ 59 ] . in the peripheral nervous system nep is located in schwann cell membranes surrounding dorsal root ganglion cells and nerve fibers [ 10 , 11 ] . nep degrades many vaso- and neuroactive peptides including natriuretic peptides , adrenomedullin , bradykinin , and calcitonin - gene - related peptide [ 12 , 13 ] . therefore , inhibition of ace and nep activity would be expected to improve vascular and neural function . in this regard we have demonstrated that treating type 1 and type 2 diabetic rats as well as a genetic rat model of obesity with ilepatril improves vascular and neural dysfunction [ 1416 ] . however , little information is available about the effect of vasopeptidase inhibitors in animal models of diet - induced obesity . in order to further elucidate the effects of vasopeptidase inhibitors in peripheral nerve dysfunction associated with obesity we examined the effect of diet - induced obesity on nerve conduction velocity and thermal response latency in the hindpaw of c57bl/6j mice and mice deficient in nep treated with ilepatril , enalapril , ace inhibitor , or candoxatril , nep inhibitor [ 1 , 2 ] .", "unless stated otherwise all chemicals used in these studies were obtained from sigma chemical co. ( st . louis , mo ) . c57bl/6jj breeding pairs of neutral endopeptidase - deficient ( nep ) mice were provided by drs . these mice have been bred and a colony created at the veterans affairs medical center , iowa city , ia . deficiency of nep activity was confirmed in nep mice by measuring the specific activity of nep in kidney homogenates using the method described by ayoub and melzig with modification . activity of nep in kidney from c57bl/6j and nep mice was 0.35 0.02 and 0.02 0.02 mm 7-amido-3-methylcoumarin ( amc)/min / mg protein , respectively ( p < 0.001 versus c57bl/6j by unpaired t - test ) . this test was performed on all mice used in these studies in order to confirm that nep was functionally knocked out in the nep mice . mice were housed in a certified animal care facility and food ( harlan teklad , no . adequate measures were taken to minimize pain or discomfort and all of the experiments were conducted in accordance with international standards on animal welfare and were compliant with all institutional and national institutes of health guidelines for use of animals ( acurf protocol 1101009 ) . for the prevention protocol c57bl/6j and nep mice at 12 weeks of age were divided into five groups . a second group was fed a high - fat diet containing 24 gm% fat , 24 gm% protein , and 41 gm% carbohydrate ( d12451 ; research diets , new brunswick , nj ) . the primary source of the increased fat content in the diet was soybean oil and lard . the control and high - fat diet contained 0.4 and 0.3% sodium chloride , respectively . the average fat content of the control diet was 4.25 gm% ( harlan teklad , no . the third through fifth groups were fed the high - fat diet containing ilepatril ( 500 mg / kg in the diet ) , candoxatril ( 30 mg / kg in the diet ) , or enalapril ( 500 mg / kg in the diet ) . we have found that these doses provide maximal inhibition of nep and/or ace activity in vivo [ 2 , 19 ] . for the intervention study the same five groups of c57bl/6j and nep mice at 12 weeks of age were fed the control diet ( group 1 ) or high - fat diet ( groups 25 ) for 12 weeks . afterwards , the four groups of high - fat - fed mice were fed a high - fat diet with no additions ( group 2 ) or high - fat diet containing ilepatril , candoxatril , or enalapril ( groups 35 ) for 12 weeks . after an overnight fast mice were injected with a saline solution containing 2 g / kg glucose , i.p . immediately prior to the glucose injection and for 120 minutes afterwards blood samples were taken to measure circulating glucose levels with the use of glucose - dehydrogenase - based reagent strips ( aviva accu - chek , roche , mannheim , germany ) . blood samples ( 0.6 l ) were taken from a tail vein that was lanced once . thermal nociceptive response in the hindpaw was measured using the hargreaves method with instrumentation provided by iitc life science , woodland hills , ca ( model 390 g ) as previously described . the test was performed in a blind manner . thermal nociceptive responses were measured by placing the mouse in the observation chamber on top of the thermal testing apparatus and allowing it to acclimate to the warmed glass surface ( 33c ) and surroundings for a period of 15 min . the mobile heat source was maneuvered so that it was under the heal of the hindpaw and then activated , a process that starts a timer and locally warms the glass surface , when the mouse withdrew its paw , the timer , and the heat source was turned off . following an initial recording , which was discarded , two measurements were made for each hindpaw , with a rest period of 5 min between each set of measurements . the mean of the measurements , reported in seconds , was used as a measure of the thermal nociceptive response latency . , abbott laboratories , north chicago , il ) and sensory nerve conduction velocities were determined as previously described [ 1 , 2 ] . briefly , sensory nerve conduction velocity was recorded in the digital nerve to the second toe by stimulating with a square - wave pulse of 0.05 ms duration using the smallest intensity current that resulted in a maximal amplitude response ( grass s44 stimulator ; grass medical instruments , quincy , ma ) . the maximal sensory nerve conduction velocity was calculated by measuring the latency to the onset / peak of the initial negative deflection and the distance between stimulating and recording electrodes ( measured in millimeters using a vernier caliper ) . biopsies of skin of the right hindpaw were fixed , dehydrated , and embedded in paraffin . sections ( 7 m ) were collected and immunostained with anti - pgp9.5 antibody ( rabbit anti - human no . 7863 - 0504 ( this antibody cross - reacts with rat , mouse guinea pig , and other species ) , abd serotic , morpho sys us inc . , raleigh , nc ) overnight followed by treatment with secondary antibody alexa fluor 546 goat anti - rabbit ( invitrogen , eugene , or ) . profiles were imaged using a zeiss 710 confocal microscope with a 40x objective and were counted by two individual investigators that were blinded to the sample identity . length of the epidermis was determined by drawing a polyline along the contour of the epidermis and recording its length in mm . comparisons between the groups for body weight , blood glucose , sensory nerve conduction velocity , thermal nociception , and intraepidermal nerve fiber profiles were conducted using a one - way anova and bonferroni 's test for multiple comparisons ( prism software ; graphpad , san diego , ca ) .", "presented in table 1 are weight and blood glucose changes for c57/bl6j and nep mice used in the prevention study . at 12 weeks of age when fed a high - fat diet c57bl/6j and nep mice both gained a similar amount of weight . treating the high - fat diet with ilepatril or enalapril but not candoxatril completely prevented the gain in weight . the mass of the epididymal fat pad was significantly increased in high - fat - fed mice and mice fed the high - fat diet treated with candoxatril compared to control mice or mice fed the high - fat diet containing ilepatril or enalapril . when calculating the epididymal fat pad mass as a percent of total body weight epididymal fat pad mass was significantly increased in high - fat - fed c57bl/6j mice and mice fed a high - fat diet containing candoxatril compared to control . treating the high - fat diet with ilepatril and to a greater extent enalapril prevented the increase in epididymal fat pad mass when presented as percent of final body weight . nonfasting blood glucose levels were not significantly different between c57bl/6j and nep mice fed the control or high - fat diets and not affected by ilepatril , candoxatril , or enalapril treatment . in the intervention study all mice fed the high - fat diet for the initial 12 weeks of the experimental design gained a significant amount of weight ( table 2 ) . when transferred to a high - fat diet containing ilepatril or enalapril for an additional 12 weeks c57bl/6j and nep mice lost weight . mice remaining on the high diet or high - fat diet containing candoxatril continued to gain weight . the epididymal fat mass decreased after c57bl/6j or nep mice , fed a diet containing high fat for 12 weeks , were given a high - fat diet containing enalapril . the epididymal fat mass also was decreased after nep mice but not c57bl/6j mice were fed a high - fat diet treated with ilepatril . treating high - fat - fed c57bl/6j or nep mice with candoxatril did not reduce epididymal fat mass . a similar trend was observed when the epididymal fat mass data was presented as percentage of final body weight . nonfasting blood glucose levels were not changed in c57bl/6j or nep mice fed control or high - fat diets with or without ilepatril , candoxatril , or enalapril . in the prevention study c57bl/6j ( figure 1 ) and nep ( figure 2 ) mice fed the high - fat diet or high - fat diet containing candoxatril had an impaired glucose clearance curve compared to control mice . in contrast , the glucose clearance curve was near normal in c57bl/6j and nep mice fed a high - fat diet containing ilepatril or enalapril . in the intervention study feeding c57bl/6j ( figure 3 ) or nep ( figure 4 ) mice for 24 weeks a high - fat diet caused an impaired glucose clearance curve . treating high - fat - fed c57bl/6j or nep mice with enalapril for the last 12 weeks of the 24-week period partially corrected glucose utilization . treating nep mice with ilepatril treating c57bl/6j mice with ilepatril did not improve glucose utilization nor did treating c57bl/6j or nep with candoxatril . data in figure 5 ( left ) demonstrate that sensory nerve conduction velocity was significantly decreased in high - fat - fed c57bl/6j mice compared to control mice and that this was prevented by treating high - fat - fed mice with ilepatril or candoxatril using a prevention protocol . data in figure 5 ( center ) demonstrate that thermal nociception was significantly decreased in c57bl/6j mice after 12 weeks of a high - fat diet compared to control mice as indicated by an increase in paw withdrawal latency . treatment with ilepatril or candoxatril and to a lesser extent enalapril for the 12-week period prevented thermal hypoalgesia in high - fat - fed c57bl/6j mice . data in figure 5 ( right ) demonstrate that the number of intraepidermal nerve fiber profiles was significantly decreased in high - fat - fed c57bl/6j mice and that treatment of these mice with ilepatril or candoxatril but not enalapril for 12 weeks prevented the significant decrease . sensory nerve conduction velocity , thermal nociception , and intraepidermal nerve fiber density were not impaired in nep mice fed a high - fat diet ( figure 6 , left , center , and right , resp . ) . we also determined the effect of treating high - fat - fed c57bl/6j and nep mice using an intervention protocol ( figures 7 and 8 , resp . ) . in this study design high - fat - fed mice were untreated for 12 weeks followed by 12 weeks of a high - fat diet with or without treatment . feeding c57bl/6j mice a high - fat diet for 24 weeks caused a significant decrease in sensory nerve conduction velocity ( figure 7 , left ) . treating these mice for the last 12 weeks of the 24-week period with ilepatril , candoxatril , or enalapril the decrease in thermal nociception in high - fat - fed c57bl/6j mice was reversed by treating mice with ilepatril or candoxatril but not enalapril ( figure 7 , center ) . treating high - fat - fed c57bl/6j mice with ilepatril , candoxatril , or enalapril reversed the decrease in intraepidermal nerve fiber profiles ( figure 7 , right ) . feeding nep mice a high - fat diet for 24 weeks with or without treatment had no effect on sensory nerve conduction velocity , thermal nociception , or intraepidermal nerve fiber density ( figure 8 , left , center , and right , resp . ) .", "the main findings from these studies were that diet - induced obesity caused significant weight gain and impaired glucose utilization in c57bl/6j and nep mice that was improved when the mice were treated with ilepatril or enalapril using a prevention protocol . using the intervention protocol enalapril but not ilepatril treatment was effective improving glucose utilization by c57bl/6j mice . treating c57bl/6j or nep mice with candoxatril did not improve weight gain or glucose utilization . these data suggest that inhibition of ace and not nep activity was responsible for improving weight gain and glucose utilization in high - fat - fed mice . diet - induced obesity also caused slowing of sensory nerve conduction velocity , thermal hypoalgesia , and decrease in epidermal nerve fiber density in the paw of the hindlimb in c57bl/6j mice but not nep mice . the impairment in sensory nerve function endpoints in c57bl/6j mice fed a high - fat diet was prevented / improved when the mice were treated with ilepatril or candoxatril and to a much lesser extent enalapril using either the prevention or intervention protocol . these data suggest that increased nep activity / expression but not ace activity contributes to diet - induced obesity - related deficits in sensory nerve function . previous studies have shown that diet - induced obesity in rodent models can be prevented by ace inhibitors and angiotensin ii receptor blockers [ 2124 ] . in addition , diet - induced weight gain and fat mass are reduced , energy expenditure increased , and glucose tolerance improved in mice lacking ace or the angiotensin ii type 1a receptor [ 25 , 26 ] . the mechanisms proposed for the improvement in obesity and glucose tolerance with treatment of rodent models with ace inhibitors are increased energy expenditure , liver and adipose tissue metabolic modulation , lower concentration of leptin , improved insulin signaling , and increased glucose and fatty acid utilization by muscle [ 2130 ] . in a study comparing the effects of ramipril , an ace inhibitor , to ilepatril in jcr : la - cp rats , an obese , insulin - resistant , hyperinsulinemic , normoglycemic model , it was found that both compounds reduced the surge of plasma insulin in a meal tolerance test by about 50% but ilepatril was more beneficial in improving vascular reactivity . in our study we found that enalapril trended to be more effective than ilepatril preventing / reducing fat pad mass . this could be because enalapril at the dosage used was a more effective ace inhibitor than ilepatril in target tissues . in another study using obese zucker rats it was found that dual inhibition of ace and nep improved insulin - mediated glucose disposal more effectively than monotherapy and this effect was linked to increased activation of the kinin - nitric oxide pathway . in a similar independent study it was found that omapatrilat , a vasopeptidase inhibitor , induced insulin sensitization and increased myocardial glucose uptake in obese zucker rats and that the effect of omapatrilat was greater than ramipril in part due to stimulation of the b2 receptor . later this group reported that treatment of obese zucker rats with a vasopeptidase inhibitor increased muscle glucose uptake independent of insulin signaling . in two of these studies protection of bradykinin from degradation by nep interestingly , it has been shown that natriuretic peptides promote muscle mitochondrial biogenesis and fat oxidation as to prevent obesity and glucose intolerance . the natriuretic peptides are also degraded by nep . because nep is expressed in skeletal muscle in relatively large amounts and being located on the cell surface , nep is able to hydrolyze peptides in the vicinity of their receptors thereby neutralizing their bioactivity [ 34 , 36 ] . however , inhibition of ace may also lead to protection of bradykinin levels by inhibiting kininase - ii - mediated degradation of this nonapeptide . reported that ace inhibition by captopril improved glucose transport in insulin - resistant muscle of the obese zucker rat . they attributed the improvement to modulation of insulin action by bradykinin mediated through b2 receptors and by an increase in nitric oxide production . since bradykinin and natriuretic peptides may have a role in enhancing insulin action and regulating glucose and fatty acid metabolism by muscle protecting their bioactive function by preventing degradation through inhibition of ace and/or nep may be a therapeutic approach for treatment of obesity and insulin resistance [ 34 , 36 , 38 ] . we have previously shown that treating diabetic rats with enalapril improved vascular and nerve endpoints but enalapril was less effective in rats fed a high - fat diet [ 19 , 36 , 39 , 40 ] . in contrast , we found that treating obese or diabetic rats with ilepatril was more effective than enalapril in improving peripheral nerve dysfunction [ 19 , 36 , 40 ] . we have shown that treating diabetic or diet - induced obese rodents with ilepatril improves vasodilation of blood vessels that provide circulation to the sciatic nerve by reducing oxidative stress and preventing degradation of vasoactive peptides by nep including calcitonin gene - related peptide and c - type natriuretic peptide thereby maintaining endoneurial blood flow and preventing ischemia . since nep degrades both calcitonin gene - related peptide and substance p , peptides important in pain signaling pathways , it is likely that blocking nep activity or mice deficient in nep would maintain higher levels of both of these neuroactive peptides and perhaps be more sensitive to painful stimuli .", "data from clinical trials clearly suggest that activation of the renin - angiotensin - aldosterone system plays an important role in the pathophysiology of the metabolic syndrome through interaction of a wide range of physiological and molecular mechanisms . more recently in humans activity of nep has been shown to correlate with body mass index and measures of insulin resistance with increasing activity found in subjects with multiple cardiovascular risk factors . in these studies we found that feeding mice a high - fat diet causes weight gain , impaired glucose tolerance , and sensory nerve dysfunction . inhibition of ace was effective in reducing weight gain and improving glucose utilization but generally noneffective in improving sensory nerve dysfunction . in contrast , inhibition of nep improved sensory nerve dysfunction and had no effect in improving weight gain or glucose utilization . treating high - fat - fed mice with a vasopeptidase inhibitor improved weight gain , glucose utilization , and sensory nerve function . thus , we conclude that increased activity of nep is associated with sensory nerve dysfunction in an animal model of diet - induced obesity and that dual inhibition of ace and nep may be more effective than monotherapy in reducing insulin resistance and the sensory nerve complications associated with metabolic syndrome ." ]

[ "tetracyclines bind to the a - site on the bacterial ribosome , resulting in steric blocking of the aminoacyl - trna binding site , which prevents protein synthesis . they are effective against both gram - positive and gram - negative bacteria and , due to the relative lack of major side effects and cheap cost , have been used extensively in the treatment of infections as well as growth promoters in animal husbandry . bacterial resistance to tetracycline is often mediated through the acquisition of dna encoding proteins that confer resistance by one of three main mechanisms : atp - dependent efflux , enzymatic inactivation of tetracycline , or ribosomal protection . to date , a total of 60 different classes of tetracycline resistance gene , including oxytetracycline resistance genes , have been reported . these include 33 predicted or proven to encode active efflux pumps , 12 encoding ribosomal protection proteins ( rpps ) , 13 encoding inactivating enzymes and 1 reported to confer resistance via an as yet undetermined mechanism , designated tet(u ) ( a full list is periodically updated by roberts ) . although it has yet to be assigned a mechanistic class , tet(u ) has been identified in enterococcus and staphylococcus isolates . however , a study by caryl et al . reported that when tet(u ) was cloned and expressed in escherichia coli , the transformants were not resistant to tetracycline . to be considered a new class of tetracycline resistance gene determinants representing new classes were originally assigned a letter from the english alphabet . however , as all letters are used , they are now assigned an arabic numeral , with new determinants referred to the levy group ( bonnie.marshall@tufts.edu ) in order to obtain a designation prior to publication to avoid duplication and ensure taxonomic consistency .", "rpps are a related group of proteins that , when bound to the ribosome , result in the release of tetracycline from the ribosome , enabling protein synthesis to proceed ( reviewed by thaker et al . ) . of the 12 classes of rpp gene currently reported [ tet(m ) , ( o ) , ( q ) , ( s ) , ( t ) , ( w ) , ( 32 ) , ( 36 ) , ( 44 ) , b(p ) , otr(a ) and tet ] , tet(m ) is considered the most prevalent due to its association with the broad host range tn916/tn1545 family of conjugative transposons . however , a subgroup of rpp genes has been identified that consist of regions of different , already characterized rpp genes that appear to have undergone recombination forming a mosaic gene . it must be stressed here that the progenitors of mosaic genes are assumed based purely on the order in which they were discovered and we can not be sure of the directionality of mosaic gene formation .", "in 2003 , stanton and humphery reported two rpp genes in megasphaera elsdenii that encoded predicted proteins showing 89.1% and 91.9% identity to tet(w ) ( accession number aj222769 ) from butyrivibrio fibrisolvens . as this was above the < 80% cut - off , they did not qualify as a new resistance class under the nomenclature system . however , further analysis of the amino acid sequence revealed variability in the percentage identity to tet(w ) across its length . the large central section in both sequences showed 98.1% identity to tet(w ) , while small sections at the n- and c - terminal ends were found to have a lower amino acid sequence identity to tet(w ) [ between 66.6% and 75.3% ] . however , these same n- and c - terminal sections were shown to have between 99.3% and 100% amino acid identity to tet(o ) ( accession number m18896 ) , despite the central section showing identity to tet(w ) . given the evidence , this suggested recombination had occurred , creating a mosaic determinant with a central tet(w ) region flanked by two tet(o ) regions . although never before observed between two different rpp classes , recombination resulting in functional genes has previously been reported between different phylotypes of tet(m ) as well as in other antibiotic resistance genes , such as pena and pbp2x , which confer resistance to penicillin . furthermore , in vitro experiments have successfully recombined tet(a ) and tet(c ) to create mosaics that confer resistance to tetracycline at levels comparable to the non - mosaic tet(c ) . the guideline for determining a new resistance gene class was established prior to the discovery of these mosaic rpp genes and none of the mosaic genes qualified as a new class when analysed as one single continuous sequence . it was clear , however , that these mosaic genes were different from their non - mosaic counterparts and that the current classification did not adequately reflect the true evolutionary background of these genes . therefore , an expansion of the nomenclature system was suggested whereby the mosaic gene would receive a designation that reflected the structural order and class of the genes they comprised , better reflecting their variable nature . for example , the two resistance genes reported in m. elsdenii , which comprised a central tet(w ) region flanked by two tet(o ) regions , were designated tet(o / w / o ) . although stanton and humphrey were the first to report mosaic rpp genes , melville et al . had unknowingly reported a mosaic gene 2 years previously . this resistance gene , found in clostridium saccharolyticum k10 , encoded a predicted protein that showed 76% amino acid identity to tet(o ) ( accession number y07780 ) . as per the original nomenclature guidelines , it was given the new designation tet(32 ) . however , subsequent re - examination of the sequence found that only the central section showed < 80% identity to known proteins , while the n- and c - terminal regions flanking the central section shared 100% and 97.7% identity , respectively , to tet(o ) ( accession number m18896 ) . the central region was still thought to represent a section of a new tet(32 ) class and therefore the determinant was reclassified tet(o/32/o ) . subsequently , the proposed full , non - mosaic sequences of tet(32 ) have been reported in several isolates identified from the human oral cavity , with the tet(o/32/o ) mosaic determinant now showing 89% amino acid identity to these . similarly , the previously reported tet(s ) allele ( accession number ay534326 ) on the conjugative transposon tn916s has subsequently been reclassified as a result of in silico analysis . the amino acid sequence shows identity to tet(s ) across 595 amino acids ( 1595 inclusive ) , with the final 61 amino acids at the c - terminus end identical to tet(m ) ( accession number u09422 ) , resulting in it being reclassified as tet(s / m ) .", "to date , a total of 30 mosaic genes have been reported in the literature , of which 26 currently have sequences deposited in genbank ( table 1 ) . some studies have reported multiple occurrences of known genes ; however , many of these have been characterized by pcr amplification only . structurally , these chimeric genes currently comprise either two [ e.g. tet(o / w ) ] , three [ e.g. tet(o / w / o ) ] , four [ e.g. tet(o / w/32/o ) ] or six [ e.g. tet(o / w/32/o / w / o ) ] different regions ( figure 1 ) , with tet(o ) , tet(w ) and tet(32 ) being the predominant rpp genes reported to form mosaic genes , comprising all but two of the reported variants , and tet(m ) and tet(s ) forming the remaining two . given the prevalence of tet(m ) in certain samples , and the previous reports of self - recombination , it is surprising that there are so few reports of mosaic genes containing tet(m ) . furthermore , alignment of 12 representative rpp gene sequences shows tet(m ) sharing 75% and 70% identity , respectively , to tet(o ) and tet(44 ) , which is higher than the percentage identity observed between the more commonly reported rpp mosaic genes comprising tet(o ) , ( w ) and ( 32 ) ( table 2 ) . however , mosaic genes comprising tet(m ) and any other gene , with the exception of tet(s ) , have yet to be reported . it is entirely possible that this may be due to a lack of investigation rather than an absence of recombination followed by fixation of the recombinant allele in the bacterial population . alternatively , it is possible that there is little selective pressure for tet(m)-based mosaic genes if the resultant protein is no more efficient than tet(m ) itself and/or there is no indirect selective pressure for mosaicism . reported that the protein encoded by the tet(o / w / o ) mosaic genes in m. elsdenii conferred a higher level of resistance to tetracycline than their non - mosaic counterparts , but similar investigations are still to be reported for other rpp genes . therefore , the prevalence of certain mosaic gene variants could suggest that they are in some way more beneficial to the host than the non - mosaic genes they comprise . \n table 1.a summary of the mosaic tetracycline genes reported to dategeneorganismsource(s)accession numberreference(s)tet(o / w)bifidobacterium thermophilum b0219environmental ( pig slaughterhouse ) sampleam88911832tet(o / w)b . faecesam88912232tet(o / w)-2megasphaera elsdenii 25 - 51swine faecesay48512218,27tet(o / w)-1 [ n = 15]m . elsdenii 27 - 51swine faecesay48512627,33tet(o / w / o)-4uncultured bacterial clonepig faecesno accession number21tet(o / w / o)-3 [ n = 9]uncultured bacterial clonepig elsdenii 14 - 14swine caecumay19692013,18,27,33tet(o / w / o)-1 [ n = 2]m . elsdenii 7 - 11swine caecumay19692113,18,27tet(o / w/32/o ) [ n = 32]uncultured bacterial clonepig faecesef06552321tet(o / w/32/o ) [ n = 7]streptococcus suis ss1303pig ( brain , lung and spleen ) and human ( csf ) suisdiseased pig ( blood , brain , heart , joint and lung ) samplesjq74005328tet(o / w/32/o / w / o)lactobacillus johnsonii g41human faecesdq52502332tet(o / w/32/o / w / o)uncultured bacterial clonepig faecesdq67992621tet(o/32/o)s . suisdiseased pig ( blood , brain , heart , joint and lung ) samplesjq74005228tet(o/32/o)clostridium saccharolyticum k10human colonaj29523818tet(o/32/o)-2 [ n = 3]uncultured bacterial clonehuman and animal faecal samplesno accession number21tet(o/32/o)-3uncultured bacterial clonehuman and animal faecal samplesno accession number21tet(o/32/o)-4uncultured bacterial clonehuman and animal faecal samplesno accession number21tet(o/32/o)-5uncultured bacterial clonehuman and animal faecal samplesno accession number21tet(o/32/o)dorea longicatena agr2136rumen microbiomenz_aujs01000017 ( 41 62643 545 bp)direct submission , analysed in this studytet(o/32/o)campylobacter coli 202/04human faecesainh01000038 ( 23614280 bp)direct submission , analysed in this studytet(o/32/o)c . coli 317/04human faecesnz_ainj01000054 ( 20944013 bp)direct submission , analysed in this studytet(o/32/o)campylobacter jejuni subspecies jejuni 2008 - 894humanaioq01000025 ( 14 51516 434 bp)direct submission , analysed in this studytet(o/32/o)roseburia intestinalis xb6b4human intestinal tractfp929050 ( 2 873 8142 875 733 bp)direct submission , analysed in this studytet(s / m)streptococcus equinus 1357foodhm36771125tet(s / m)streptococcus intermediushuman isolateay53432623,24tet(w/32/o)b . thermophilum b0256pig faecesam71060532the number given in square brackets indicates the instances of that mosaic gene variant reported , if more than one.fourteen of the 15 tet(o / w)-1 variants were only determined by pcr analysis and so could be either tet(o / w)-2.eleven of the 28 tet(o / w / o)-2 variants were only determined by pcr analysis and so could be either tet(o / w / o)-2 or tet(o / w / o)-1.all s. suis isolates , but not the same strain . \n table 2.sequence identity matrix showing the percentage nucleotide identity between representatives of all 12 rpp gene classes , in descending order , compared with tet(m)rpp genetet(m)tet(s)tet(o)tet(44)tet(32)tet(w)tet(t)tet(36)tet(q)tetb(p)otr(a)tettet(m)1007875706964574946231111tet(s)10070696762565648111110tet(o)100696965564948151211tet(44)1007164505846151110tet(32)10067554947111210tet(w)10012451551412tet(t)10057561882tet(36)1006491111tet(q)100131212tetb(p)10011otr(a)10063tet100accession numbers of representative genes included in the matrix : tet(m ) , u09422 ; tet(o ) , y07780 ; tetb(p ) , ae001437 ; tet(q ) , x58717 ; tet(s ) , x92946 ; tet(t ) , l42544 ; tet(w ) , aj222769 ; tet(32 ) , dq647324 ; tet(36 ) , aj514254 ; tet(44 ) , fn594949 ; otr(a ) , x53401 ; tet , al939106.shaded boxes represent those genes currently reported to comprise mosaic genes . \n the coded bars indicate sequences of high identity to specific rpp genes : vertical line bars for tet(m ) , white bars for tet(o ) , grey bars for tet(s ) , black bars for tet(w ) and checked bars for tet(32 ) . indicates those sequences that are incomplete or absent in genbank , with the crossover points taken from the publication . indicates sequences that have been analysed in this study due to no specific crossover point(s ) reported . a summary of the mosaic tetracycline genes reported to date the number given in square brackets indicates the instances of that mosaic gene variant reported , if more than one . fourteen of the 15 tet(o / w)-1 variants were only determined by pcr analysis and so could be either tet(o eleven of the 28 tet(o / w / o)-2 variants were only determined by pcr analysis and so could be either tet(o / w / o)-2 or tet(o / w / o)-1 . sequence identity matrix showing the percentage nucleotide identity between representatives of all 12 rpp gene classes , in descending order , compared with tet(m ) accession numbers of representative genes included in the matrix : tet(m ) , u09422 ; tet(o ) , y07780 ; tetb(p ) , ae001437 ; tet(q ) , x58717 ; tet(s ) , x92946 ; tet(t ) , l42544 ; tet(w ) , aj222769 ; tet(32 ) , dq647324 ; tet(36 ) , aj514254 ; tet(44 ) , fn594949 ; otr(a ) , x53401 ; tet , al939106 . the coded bars indicate sequences of high identity to specific rpp genes : vertical line bars for tet(m ) , white bars for tet(o ) , grey bars for tet(s ) , black bars for tet(w ) and checked bars for tet(32 ) . indicates those sequences that are incomplete or absent in genbank , with the crossover points taken from the publication . indicates sequences that have been analysed in this study due to no specific crossover point(s ) reported .", "stanton and humphrey describe an assay that distinguished between the non - mosaic genes tet(o ) and tet(w ) and the mosaic tet(o / w / o ) from megasphaera strains , enabling them to detect tet(o / w / o ) variants in six additional m. elsdenii strains . patterson et al . investigated the presence of mosaic genes using various specific oligonucleotide sets that either bound within the resistance genes or flanked them . amplicons specific to tet(o / w ) , tet(o/32 ) and tet(w/32 ) were detected in faecal samples , with tet(o/32 ) being the most common of these mosaic amplicons ; it was amplified in all 12 pig faecal samples and 6 of 7 human faecal samples tested . in contrast , the faecal samples from cows and sheep , as well as human saliva samples , failed to produce any amplicons for these mosaic genes , suggesting they were not present at detectable levels . chen et al . also used an oligonucleotide primer set that annealed outside tet(o ) to determine the presence of tetracycline resistance genes in two streptococcus suis isolates . although no amplicon was produced using internal , tet(o)-specific primers , the primers binding to flanking dna yielded an amplicon , indicating the presence of mosaic genes [ identified as tet(o/32/o ) and tet(o / w/32/o ) ] . this full - length oligonucleotide primer set does aid the identification of mosaic genes ; however , it is only specific for those with regions homologous to tet(o ) flanking sequences . since pcr strategies aimed at identifying resistance genes require knowledge of the sequence of the target , mosaic rpp genes are likely to be largely undetected and under - reported by pcr - based studies . , almost all the mosaic genes reported to date have originated from faecal samples , with the majority identified from a porcine origin and less commonly from humans ( table 1 ) . the gut houses a complex and diverse bacterial community with potential for widespread horizontal gene transfer , and the mosaic genes found in faecal samples are likely to reflect the pool of non - mosaic genes present within the gut microbiota . genes such as tet(w ) and tet(o ) are commonly reported from these types of samples , but the prevalence of tet(32)-containing mosaic genes suggests that tet(32 ) may be more common than initially thought . in fact , tet(o/32/o ) was found to be the most common mosaic gene in both the human and pig faecal samples tested and was present in almost as many samples tested as the non - mosaic tet(o ) and tet(w ) genes . in contrast , mosaic genes have not yet been reported in faecal samples from bovine and ovine origin or in human saliva . why they are predominantly found in pigs while as yet unreported in other animals is not immediately clear , though the extensive use of tetracyclines in the swine industry may have contributed to their selection .", "the advent of high - throughput genomic sequencing has led to an increase in the number of genomes being deposited in sequence databases . many contain tetracycline resistance genes that are generically labelled simply as tetracycline resistance protein or as tet(m)-like , the designation of which may be a result of automated annotation pipelines . a preliminary search of the ncbi nucleotide database , using tet(o ) ( accession number y07780 ) as the query , found that some of these generically labelled tetracycline resistance genes gave a partial match to tet(o ) . further examination indicates that some are as yet uncharacterized and unreported mosaic genes , which have been further defined for this review using the nucleotide sequence to determine the crossover points . for example , the tet(m)-like gene ( accession number nz_aujs01000017 , location 41 62643 545 bp ) in the draft genome of dorea longicatena agr2136 from a human faecal sample appears to be a previously unreported variant of tet(o/32/o ) ( figure 1 ) . furthermore , the tetracycline resistance genes present in campylobacter jejuni subspecies jejuni 2008 - 894 , campylobacter coli 202/04 , c. coli 317/04 ( accession numbers aioq01000025 , ainh01000038 and nz_ainj01000054 , respectively ) and roseburia intestinalis xb6b4 ( accession number fp929050 ) are also structurally novel variants of tet(o/32/o ) ( figure 1 ) . the three mosaic genes present in the campylobacter spp . taking into account these newly defined genes , the total number of mosaic genes reported increases from 30 to 35 ( not including those identified via pcr amplification only ; table 1 ) and suggests that other generically labelled tetracycline resistance genes present in the database [ e.g. those labelled as tet(m)-like ] could be further classified , helping to understand mosaic gene proliferation and diversity .", "our knowledge of the mosaic rpp gene group is steadily increasing since their discovery in 2003 , with the majority derived from tet(o ) , tet(w ) and tet(32 ) and others deriving from tet(m ) and tet(s ) . it is clear that these genes are being under - reported both in terms of experimental detection and also within genomic data . further work and increased attention on mosaic rpp genes is important if we are to understand the evolutionary selective pressures driving their fixation in bacterial populations and the subsequent effects on resistance and mobile genetic element evolution within their host .", "" ]

[ "follicular thyroid cancer ( ftc ) metastasizes most commonly to the lungs and non - cranial bones . skull and skin are uncommon sites and usually manifest well after the diagnosis of primary malignancy . metastasis to skull and skin as the presenting feature of ftc is infrequently reported in the literature .", "a 65-year - old caucasian woman with a history of thyroid nodule presented with the complaint of rapidly growing skull nodules which had been present for 3 years but were stable previously . she denied any history of smoking or head and neck irradiation . on physical examination , she had two non - tender gray cystic lesions one on her left temporal region and the other on the right parietal region . magnetic resonance imaging of the brain demonstrated 7.13.8 cm and 3.74.5 cm fairly homogeneous , enhancing , relatively well - defined masses centered in the posterior and left anterior lateral calvarium with intracranial and extracranial extensions but without any vasogenic edema or mass effect on the brain . histopathological studies of the thyroid gland revealed a well - differentiated ftc in the left lobe . she did not have any recurrence of the ftc or metastases during the follow - up period and will be receiving radioactive iodine treatment .", "bone and lung are the common sites of metastasis from ftc , but involvement of skull or skin is unusual , particularly as the presenting feature . metastases from ftc should be in the differential of patients with new osteolytic hypervascular skull lesions or cutaneous lesions in head and neck area .", "a 65-year - old caucasian woman with a history of thyroid nodule presented to dermatology clinic with the complaint of rapidly growing skull nodules . she reported that the nodules had been present for 3 years but had been stable , so she had not sought medical attention . she denied any fevers , chills , pain , or redness over the nodules , fatigue , weight loss , recent infections , or history of trauma . she admitted to drinking alcohol on social occasions but denied any history of smoking or head and neck irradiation . her family history was positive for leukemia in her father and melanoma in her mother . she indicated a remote history of thyroid nodule which she reported was benign on biopsy . on physical examination , she had two non - tender gray cystic lesions one on her left temporal region measuring about 5 cm in diameter and the other on the right parietal region measuring about 7 cm in diameter . laboratory tests revealed a normal tsh of 0.52 iu / ml ( reference range 0.35.0 iu / ml ) and t4 of 0.68 ng / dl ( reference range 0.581.64 ng / dl ) . a complete metabolic panel including serum creatinine , bun , and hepatic panel was normal . biopsy was attempted under local anesthesia which revealed possible extension to the bone with vascular origin and hence the patient was referred to surgery for debulking . during surgery , total excision of the nodules could not be performed as there appeared to be skull erosion underneath . an immunohistochemical panel showed positive staining for ck7 , thyroglobulin , and hbme-1 while it was weakly positive for pankeratin , suggesting a thyroid origin of these lesions , that is , metastatic ftc ( fig . two large extra - axial enhancing masses with both intra- and extracranial components were seen ( figs . 2 , 3 ) . magnetic resonance imaging ( mri ) of the brain demonstrated 7.13.8 cm and 3.74.5 cm fairly homogeneous , enhancing , relatively well - defined masses centered in the posterior and left anterior lateral calvarium with intracranial and extracranial extensions but without any vasogenic edema or mass effect on the brain ( fig . 4 ) . positron emission tomography ( pet ) or ct of the skull demonstrated the two skull lesions to be lytic . two foci of hypermetabolic activity were also seen in the thyroid gland in the left lobe and thyroid isthmus . thyroid ultrasound showed numerous nodules in both lobes , the largest measuring up to 2.5 cm in greatest dimension . ct head with and without contrast showing a large , round , relatively smoothly marginated enhancing extra - axial left frontal mass ( 4.4 cm in anteroposterior diameter and 4.1 cm in transverse diameter ) that has eroded and partially destroyed the calvarium and extends into the subcutaneous scalp . ct head with and without contrast demonstrating a large , round , relatively smoothly marginated enhancing extra - axial mass ( measuring 6.8 cm in transverse diameter , 5.9 cm in ap diameter ) involving the right and left parietal region , straddling the posterior falx cerebri and superior sagittal sinus . mri brain revealing a large 7.13.8 cm fairly homogeneous enhancing relatively well - defined mass centered in the posterior calvarium with intracranial extension into the extra - axial space as well as extracranial extension . there is a similar appearing 3.74.5 cm fairly homogeneous relatively well - defined enhancing mass centered in the left anterior lateral calvarium also extending into the extra - axial space as well as extracranially . histopathological studies of the thyroid gland revealed a well - differentiated ftc in the left lobe , pathological stage pt2nxm1 , a 1-cm focus of classic papillary thyroid cancer in the right lobe of thyroid , with a background of multinodular goiter ( fig . she underwent intravascular embolization of the feeding blood vessels of her metastatic skull lesions from the external carotid system . then she underwent resection of the tumor in multiple stages with resection of the posterior and left frontal tumor , and calvaria , followed by cranioplasty . although she had other unrelated postoperative complications , she did not have any recurrence of the ftc or metastases during the follow - up period , had a normal thyroglobulin of 4.9 ng / ml ( reference range 2.840.9 ng / ml ) , and will be receiving radioactive iodine treatment .", "it typically presents as a thyroid nodule , either noted by the patient or the physician on routine physical examination or incidentally on routine imaging ( 1 ) . vascular invasion is characteristic for follicular carcinoma accounting for more common distant metastasis ( 5 ) . these metastases occur in 1015% of patients with ftc , with lung and bone being the commonest sites of involvement . bone metastases from ftc tend to be multiple and often involve sternum , ribs , and vertebrae ( 3 ) . skull metastases are uncommon with recent decline in incidence because of early detection and treatment of thyroid cancer ; among thyroid carcinomas , these metastases tend to occur more commonly in ftc and have a female preponderance ( 68 ) . there were only 12 reported cases of skull metastases out of 473 patients of thyroid cancer in one study , accounting for 2.5% of cases ( 8) . likewise cutaneous metastases from dtc are uncommon with less than 30 reported cases of cutaneous metastases in the english literature until 2010 ( 9 ) . these cutaneous metastases are more common in head and neck region and can manifest in a variety of histological appearances ( 1012 ) . however , in most of these cases metastases occurred long after the diagnosis and institution of treatment for ftc and it is extremely unusual to encounter skull and cutaneous metastases as the presenting feature of ftc ( 3 ) . skull metastases from ftc most commonly present as a slow - growing soft , painless usually hemispheric and singular lump in the occipital region ( 6 , 7 , 12 ) . unusual presentations include headaches , hemiparesis , exophthalmos , cranial nerve dysfunction , and altered consciousness ( 13 ) . these skull lesions are osteolytic on skull x - ray , and ct scans generally show homogeneous lesions with density slightly greater than the brain and a highly vascular appearance on angiographic assessment with blood supply most commonly from external carotid system ( 7 , 14 ) . in patients with scalp lesions , pet / ct can be used to determine the biopsy site ( 5 ) . in patients with established diagnosis of ftc with no documented metastases , evaluation of possible metastatic lesions can be done with ( 131)i single photon emission ct / ct [ ( 131)i - spect / ct ] ( 15 ) . ( 99m)tc - mibi scan has been reported to be a highly sensitive technique for the detection of dtc metastases that have lost the capability to uptake ( 131)i ; the combined ( 99m)tc - mibi scintigraphy and serum thyroglobulin ( tg ) estimation appear to be an alternative method of radioiodine imaging in cases with dtc and elevated tg ( 16 ) . bone metastases uncommonly respond to radioactive iodine therapy and are associated with poor prognosis ( 7 ) . surgical approach should be considered as one of the treatments of choice for bone metastasis , if possible , and curative resection of solitary bone metastasis is associated with improved survival ( 7 ) . bone defects often require extensive bone resection , bleeding is often profuse during surgical resection , and deaths have been reported from extreme hemorrhage ( 1 , 4 , 13 , 14 ) . because of the life - threatening nature of such hemorrhages , preoperative angiographic assessment of these lesions with prophylactic ligation or embolization of feeding vessels is recommended ( 14 ) . when surgical excision is not possible , internal radiation with i-131 is recommended ; external radiation is generally reserved for cases where uptake of i-131 by metastatic foci is poor ( 8) . thyroid hormone should be administered after complete excision of thyroid gland to suppress endogenous tsh from promoting tumor growth ( 17 ) . frequent follow - up examination is recommended and monitoring thyroglobulin measurement can be useful during follow - up ( 13 ) . ftc is thought to have the most optimistic prognosis even with metastases to the lymph nodes and lung . however , when combined with distant , especially widespread , metastases , the quality of life is compromised and the overall survival rate significantly decreases ( 2 ) . in one case series , the mean time from the diagnosis of thyroid tumor until discovery of skull metastasis was 23.3 years ( 8) . prognosis in case of metastasis is generally poor and the 10-year survival with bone metastases from dtc is reported to be 27% ( 7 ) . however , mean survival time of 4.5 years was reported with skull metastases in one case series , suggesting even worse prognosis and warranting an aggressive and multidisciplinary approach in this subset of patients ( 5 ) . a regular follow - up is crucial in these patients for early detection and management of any residual or recurrent metastatic ftc ( 6 ) .", "bone and lung are the common sites of metastasis from ftc but involvement of skull is unusual , especially as the presenting feature . metastases from ftc should be included in the differential of patients with new oteolytic hypervascular skull lesions or cutaneous lesions in head and neck area ( 7 , 14 ) .", "the authors have not received any funding or benefits from industry or elsewhere to conduct this study ." ]

[ "although water - bath polymerization is extensively used to process polymethylmethacrylate ( pmma ) , new resins and processing methods are often proposed to obtain better physical and esthetic properties and simplify the technique1,6,8,11,14 . one of the advantages of microwave and visible light polymerization methods is the shorter processing time they offer in comparison to water bath . in addition , light - polymerized resins can be processed directly in the mouth using a portable light - curing device , which simplifies the clinical procedures9 . while denture base acrylic resins polymerized by microwave irradiation and conventional water bath curing systems are composed of pmma6,8 , visible light - polymerized resins are similar to composites , having an organic instead of an inorganic filler content . the material is composed of a urethane dimethacrylate matrix plus small amounts of microfine silica . the filler consists of acrylic resin beads ( pmma ) of varying sizes that become part of an interpenetrating polymer network . light polymerization occurs by exposure to quartz halogen lamps in the shorter blue 400 to 500 nm wavelength spectrum of visible light . visible light - polymerized resins were initially proposed for clinical repairs and/or additions in sub - extended removable dentures7 , but due to their easy manipulation and fast polymerization , their are now indicated for many clinical situations , such as transitional and interim dentures , complete and removable partial dentures , provisional splints , denture repairs and additions , orthodontic appliances and record bases5,7,9 . although light - polymerized resins have been used in removable partial dentures , it is not clear whether the presence of a metal framework could interfere with their polymerization , by possibly reflecting the light and affecting important physical properties , such as surface roughness and hardness . these properties are largely investigated because they indicate polymerization characteristics4,7,11,14 and might influence plaque accumulation later on 2,3,10 . thus , the aims of this study were to investigate whether metal interferes with the surface hardness and roughness of a visible light - polymerized acrylic resin and to compare these values to those of water - bath- and microwave - polymerized resins .", "the resins used in this study are listed in table 1 . twelve disc - shaped specimens , 30 mm in diameter and 4 mm thick , were fabricated for each resin according to the manufacturers ' directions . all specimens were made using a silicone ( optosil , heraeus kulzer , hanau , germany ) matrix ( 30 0.05 mm in diameter and 4 0.05 mm thick ) . the matrix was flasked in type iii dental stone ( herodent soli - rock ; vigodent , rio de janeiro , rj , brazil ) using standard metal dental flasks ( uraby ; dlc , so paulo , sr brazil ) or plastic flasks ( onda cryl ; artigo odontolgicos clssico ltd , so paulo , sp , brazil ) for water bath and microwave polymerization , respectively . after the gypsum had completely set , the flasks were opened and the matrixes were removed . a separating medium ( al - cote , dentsply ltd , rio de janeiro brazil ) was applied to the exposed areas of the mold . before packing the resin , a rectangular ( 28 mm 8 mm 0.5 mm ) insert of co - cr alloy bar ( degussa , hanau , germany ) was centered at the bottom of each mold . as the size of the metal bars was almost the same as that of the mold cavities , once positioned at the bottom of each mold microwave acrylic resin specimens were polymerized in a microwave oven ( continental aw-42 , with 2,450 hz frequency and 900w maximum potency ; bosch , manaus , am , brazil ) , according to the manufacturer 's directions ( 3 min at 360 w ; 4 min resting and 3 min at 810 w ) . specimens polymerized by hot water bath were processed in an automatic polymerization unit ( termotron p-100 ; termotron piracicaba , sp , brazil ) at 74c for 9 h. once processed , all flasks were allowed to bench cooling for 2h . the resin samples were ground with water - cooled 320- , 400- , 600- and 1200-grit silicon carbide papers ( carbimet ; buehler , lake bluff , il , usa ) in a polishing machine ( arotec apl-4 ; so paulo , sp , brazil ) followed by polishing with cloths and 1-m diamond suspension ( metadi diamond suspension ; buehler ) . next , they were ultra - sound cleaned ( thornton - inpec eletrnica ltda , vinhedo , sp , brazil ) for 2 min and then immersed in distilled water at 37c for 12 h to release residual monomers6,12,14 . light - polymerized resin specimens were prepared using a transparent matrix , consisting of an acrylic resin plate containing a circular hole measuring 30 0.05 mm in diameter and 4 0.05 mm thick . first , a co - cr framework was placed at the bottom of the matrix and then the light - polymerized resin was inserted in the matrix . this assembly was put into a light box ( edg lux ; edg equipamentos e controles , so paulo , sp , brazil ) containing four 75 w halogen lamps . the resin was polymerized for 6 min , according to manufacturer 's instructions . after processing , the same finishing , polishing and cleaning procedures used for heat and microwave polymerized acrylic resins surface roughness was determined using a mechanical profilometer with a 2-m radius tip under a measuring force of 0.7 mn and accurate to 0.01 m ( surfcorder se 1700 , kosaka , tokyo , japan ) calibrated at sample length of 0.25 mm , spread of 2.0 mm and speed of 0.5 mms . six readings were performed on each specimen and an average ( ra ) was determined . these profilometric traces were taken from the edge of specimen , in the middle and at its bottom.12 \n knoop hardness was assessed using a microhardness tester ( shimadzu hmv-2000 , shimadzu corporation , kyoto , japan ) . knoop penetrations were made on the acrylic surface of each sample at distances of 50 , 100 , 200 , 400 and 800 m from the co - cr metal bar ( figure 2 ) . knoop hardness means were analyzed by two - way anova with 2 factors : acrylic resins and distances . the acrylic resin groups were compared using tukey test and distances were compared by kruskal - wallis test .", "means and standard deviations for acrylic resin surface roughness m ) are presented in table 2 . the visible light - polymerized resin ( triad ) showed the highest means ( p<0.05 ) , but the metal alloy did not interfere with surface roughness . . means and standard deviations for knoop hardness ( kg / mm ) of acrylic resins at several distances from the metal are described in table 3 . comparisons between acrylic resins showed that the visible light - polymerized resin ( triad ) exhibited significantly higher means ( p<0.05 ) . however , no differences in hardness values at several distances from the metal alloy were found . mean followed by different letters are statistically different ( p<0.05 ) lowercase letters indicate differences between acrylic resins and uppercase letters indicate differences between distances from metal .", "this technique is considered to be time - saving as it does not require cast inclusion , is non - toxic and biocompatible . it is therefore indicated for using in many clinical situations , such as complete and removable partial dentures9 . however , little is known about the influence of metal alloys on the polymerization process and on important physical properties , such as hardness and roughness . in this study , a visible light - polymerized resin was compared to microwave- and heat - polymerized acrylic resins , which have similar composition and surface characteristics6,8 . smooth surfaces do not readily retain food debris , epithelial cells and bacteria , thus facilitating oral hygiene , reducing the risk of plaque formation and preventing negative effects on periodontal tissues3 . therefore , the roughness of intraoral surfaces helps determining their colonization by different microorganisms because retention preferably occurs on rough surfaces , as they provide protection against shear forces2 . acrylic resin roughness is dependent on the polishing method used2 . in this study , polishing was done with 360- , 400- , 600- and 1000-grit abrasive papers , resulting in roughness values below 0.2 m , which is considered clinically acceptable for preventing plaque accumulation2 . although the same polishing procedure was carried out for all resins , higher roughness means were found in the light - polymerized resin group ( 0.11 0.02 m ) . this result may be explained by the large amounts of inorganic compounds in this resin , which were probably exposed during polishing procedures , causing irregularities on the resin surface . the surface roughness means of microwave- ( onda - cryl ) and water - bath - polymerized ( clssico ) resins did not differ statistically ( p>0.05 ) , probably because of the similarity of their composition . 12 ( 2004 ) , who investigated the influence of denture cleansers on the surface roughness of heat- and microwave - polymerized resins . however , the findings of the present are in contrast with those of ulusoy et al.15 , who reported higher roughness means ( 0.31 m ) . it is likely that these differences can be due to the polishing method used in each study because ulusoy et al.15 polished the specimens on a bench lathe using a roller brush with pumice / water paste , followed by a wet polishing wheel and a chalk . in contrast , in the present study , the specimens were polished with materials of decreasing granulation,(up to 1-m diamond particles ) . the other two resins ( onda cryl and clssico ) , which do not have inorganic compounds , had lower roughness . hardness is a property used to predict the wear resistance of a material and its ability to abrade opposing dental structures1 . therefore , surface scratching can be determined by its knoop hardness because its weakness explains why the surface is at risk of roughening during professional cleaning or even during habitual oral hygiene procedures10 . this test can also be used to verify the efficacy of polymerization . in this study , it was used to assess resin polymerization around a metal alloy . the visible light - polymerized resin presented the highest knoop hardness , which is in accordance with khan et al . 7 ( 1987 ) , who compared triad ( dentsply inc . ) hardness with that of a water - bath - polymerized resin . this could be explained by the inorganic content of the light - polymerized resin ( silica)9 , which increased the resistance of this resin to the microhardness indenter1 . water - bath - and microwave - polymerized resins had similar knoop hardness means , which are in agreement with many authors4,11,12,14 . no differences between 50 , 100 , 200 , 400 and 800 m distances from the metal were found in any of the acrylic resins evaluated ( p>0.05 ) . the absence of significant differences suggests that light emission and polymerization processes were not affected by the presence of metal . these results are in consistent with those of braun et al . 4 ( 1998 ) , who compared water bath- and microwave - polymerized resins with respect to the hardness means at pre - determined distances from a metal alloy . in this study , roughness and knoop hardness results indicated that triad has clinically acceptable properties and its polymerization was not affected by the presence of metal . however , further studies about the clinical behavior of visible light - polymerized acrylic resins should be conducted .", "within the limitations of this in vitro study , it may be concluded that the presence of a metal framework did not interfere with the roughness and knoop hardness of the tested visible light - polymerized ( triad ) , microwave - polymerized ( onda cryl ) and water - bath - polymerized ( clssico ) acrylic resins , indicating that all materials can be used in removable partial dentures ." ]

[ "there is limited data upon skin cancer screening program in western asia region and especially iran . the two most common variants are basal cell carcinoma ( bcc ) and squamous cell carcinoma ( scc ) ; regardless of their low mortality rates , these tumors can provoke severe consequence as a result of their treatment . the third most frequent skin cancer type , malignant melanoma ( mm ) , has a more destructive behavior and accordingly a poor prognosis ; malignant melanoma accounts for approximately 75% of all deaths from skin cancer . skin cancer screening includes the complete cutaneous examination and 2 - 3 minute visual inspection of the skin . there is strong data that whole - body clinical skin examination reduces the incidence of thick melanoma and , as a result , screening would reduce melanoma mortality . in us and however , some studies debate on the effective and beneficial method of skin cancer screening as mass screening or high risk group screening and the real impact of skin cancer screening result on the society health . in iran , there are limited studies about prevalence and incidence of skin cancers . therefore , this study was planned as a pilot one - week skin cancer screening campaign in tehran , iran to evaluate its profit and failure and design further large - scale screening program more definitely .", "this study was planned as a skin cancer screening campaign in the public health centers of shahid beheshti medical university in a one - week period in tehran , iran . we applied for the collaboration of the public health centers in tehran as the location of this screening program . the usual services provided in these centers include prenatal and pediatric care , women health , vaccination , health education , environmental or occupational health , etc . , due to distribution of these centers in different areas of tehran , we discussed with the health deputy of the university for the collaboration of these health centers in this screening campaign and finally , thirty one public health centers were selected in different areas of tehran . physicians and health staffs of these health centers were volunteered to cooperate in this study . due to cultural and religious belief in our country , some female participants might be reluctant to be examined by male physicians . in this regard , we select a male physician and female health staff or vice versa in each center to avoid any limitation in examination of the female participants . practical information upon skin cancer risk factors and its early symptoms or signs along with any needed guideline of this screening project provided to them in a two - day course by an expert board certified dermatologist . an illustrated educational pamphlet in the case of the risk factors especially sun exposure , ways of prevention and early detection of skin cancer published and distributed in the health centers for general patient education . we invited all people over 40 years old to the mentioned health centers for complete skin examination in a one - week period on october 2008 . we emphasized in these pamphlets and brochures that any bizarre or asymmetric skin lesion especially with change in shape , color and size might be important for screening . moreover , it has been advocated that any skin erosion or ulcer remained unimproved after one month should be examined by physicians . the participants would have undergone the whole - body skin examination by the trained physicians or health staffs . any lesion with bizarre or asymmetric shape , uneven color , increasing size , resistant ulcers or erosions considered as suspicious . patients with any suspected lesions were referred to the specialized dermatology clinics of shahid beheshti university of medical sciences for further evaluation of their lesions . all the participants were instructed about the study , and they signed the informed consent forms . a board certified dermatologist performed the whole - body skin examination for the referred patients and further evaluation particularly skin biopsy was done whenever needed . the skin examination was done by visual inspection and use of hand lens in the setting of proper lighting . the alarming signs including bizarre or asymmetric shape , uneven color , increasing size , resistant ulcers or erosions were considered for decision to perform skin biopsy . we could not use dermatoscope because of some limitation in the facilities . in the case of confirmed malignancies , the suitable treatment would be provided for the patients in the dermatology ward or referred to the proper department . all the data registered and the related questionnaires were completed . after gathering the data , statistical analysis was performed using the statistical software spss 16.0.0 .", "in a one - week period of screening , 1314 patients , 194 males ( 14.8% ) and 1120 females ( 85.2% ) , with mean age of 51.81 10.28 years were attended the allied health centers and underwent the whole - body skin examination . regarding the considerable attendance of female volunteers , most of them had indoor occupation especially being housewives . we had the data of the number of melanocytic nevi in 92.9% of the participants . 25% of them had less than 3 melanocytic lesions and 25% had more than 10 lesions . less than one percent of the participant had the positive personal history of skin cancer . we have found the personal history of non - skin cancers in 14 ( 1.1% ) of participants . these were ovarian , prostate , breast and gastrointestinal carcinoma . physicians found suspected lesions in 182 ( 13.85% ) of participants [ 142 ( 78% ) females and 40 ( 22% ) males ] with possible diagnosis of bcc , scc or malignant melanoma which were located mostly on the head , neck and trunk [ table 1 ] . these participants with suspected lesions were referred to the allied dermatology clinics of the university . all these patients underwent the whole - body skin examination by a board certified dermatologist and skin biopsy performed in 115 patients for the histopathological examination . table 2 shows the final diagnosis of suspected malignant skin lesions referred from the health centers . clinical diagnosis of suspected lesions by primary physician final diagnosis of the suspected lesions the diagnosis of skin cancer was finally confirmed by histopathology evaluation in 15 ( 1.14% ) patients out of 1314 volunteers who participated in this skin cancer screening program [ figures 1 and 2 ] . these malignancies include 10 ( 0.76% ) cases of bcc , 2 ( 0.15% ) cases of scc and 3 ( 0.23% ) cases of malignant melanoma . two patients with bcc had positive personal history of breast and gastrointestinal cancers but no family history of skin and non - skin cancer found in these patients . thirty six ( 2.74% ) cases of dysplastic nevus were also diagnosed in this study . in the case of confirmed malignancies , the proper treatment provided for the patients in the dermatology ward or surgery department . a morphoeic basal cell carcinoma found on the eyebrow of a middle - age man squamous cell carcinoma on the ear in an elderly man we found no significant difference in the number of common moles , multiple freckling , family history of skin and non - skin cancers between skin - cancer diagnosed patients and other participants . outdoor occupations and personal history of non - skin cancers was significantly higher in skin cancer diagnosed patients ( p < 0.05 , chi - square test ) .", "early diagnosis of skin cancer is very crucial to improve the prognosis , for best treatment results , and increase the quality of life of the patient . in this regard , there are many studies upon skin cancer screening with valuable results upon the importance of early detection of skin malignancies . however , there is no strong evidence to establish whether there is a decrease in mortality due to regular physical examination of the skin . in this study , we find 15 cases ( 10 bbc , 2 scc and 2 malignant melanoma ) of skin cancer . most of the participants in this campaign were housewives women and this could be due to the working hours of the public health centers that caused less attendance of male participants or those with outdoor jobs . if we could extend the active daily hours of screening to the evening , we could probably detect more skin cancers . regarding the high population of tehran , it would better screen more people or extend the campaign period to avoid this selection or estimating bias . however , this campaign was planned as pilot skin cancer screening program in tehran and its results and limitation could help us to design the large - scale screening program more definitely . there are different methods of skin cancer screening including population - based or targeted screening . planning of a population - based or mass skin cancer screening program needed considerable cooperation of different sectors including dermatology or health departments and it need substantial facilities for the project setting , announcement , training of the volunteered health staff , their remunerations and further diagnostic or treatment measure for the participants . well - trained physicians should be employed in order to reduce the false positive diagnosis and it may have great financial impact on the health care system . moreover , the current evidence seems to be insufficient to assess the balance of benefits and harms of mass screening for skin cancer . therefore , it might be more practical to perform the targeted screening programs for the high - risk groups such as patients with organ transplantation or those with the history of skin cancer or outdoor occupations . the media campaign increased the population awareness of skin cancers , promoted effective sun protection and make known the dangers of excessive uv - exposures . more educational activities for both patients and physicians regarding the skin cancer risk factors and their early signs and symptoms might be more beneficial and cost - effective to decrease the skin cancer mortality and morbidity . to the best of our knowledge , there was no similar study in iran to perform skin cancer screening and this study provides us useful information upon the profit and failure of a screening program . another limitation of this study was lack of comparison between different methods of skin cancer screening such as targeted or mass screening to provide more exact data upon the efficacy and cost - benefit of different methods of skin cancer screening . therefore , further controlled study could be beneficial to elucidate the more practical and cost - effective method of skin cancer screening in our country . this study gives us many practical clues to plan and perform large - scale skin cancer screening better ." ]

[ "early failure of fistulas due to thrombosis or inadequate maturation is a barrier to increasing the prevalence of fistulas . despite the benefits of avfs as a form of vascular access in end stage renal disease ( esrd ) patients , considerable time is required for the fistula to mature and suitably develop into a functional format maturation rate after autogenous avf depends on various factors such as age , body mass index ( bmi ) , venous and arterial diameter , venous distensibility , and arterial elasticity . the main cause of avf failure is outflow stenosis as a result of vascular intimal hyperplasia and thrombosis . this formation of neointimal hyperplasia and thrombosis may be initiated by activated platelet function , endothelial cell injury and vascular smooth muscle cell proliferation , which may occur due to unphysiologic vascular anastomosis . in view of these postulated mechanisms of avf failure , furthermore , only a few studies have addressed the safety of aspirin use after avf creation . van der linden et al . demonstrated that venous potential distensibility was significantly correlated with functional maturation , especially in the group of patients with vein diameter 2 mm . as a result of this study , they concluded that venous line distensibility was a better predictive factor than vein size . there is no report about the effects of combination therapy after avf creation using clopidogrel in combination with prostacycline analog as a potent vasodilator agent after autogenous avf creation . on the basis of these considerations , we performed a study to test the hypothesis that clopidogrel as an irreversible antiplatelet and oral prostacycline analog as an arterial vasodilator and additional antiaggregant drug may increase venous distensibility and arterial elasticity and would prevent primary avf failure in hemodialysis patients with diabetes mellitus .", "we excluded 289 patients [ table 1 ] , and 96 patients met the study criteria for enrollment . major exclusion criteria of the patients to detect the quality of the brachial artery ( ba ) and a venous line , doppler usg was used . preoperative venous and arterial spectral usg showed that there were no differences when we compared arterial and venous quality and diameter . the randomization was stratified according to the medical center with a permuted block scheme , with a block size of four and an equal allocation . eligible participants were called to the coordinating center to obtain a randomization protocol , which corresponded to a specific medication . neither the details of the randomization sequence nor the identity of the medication assigned was known to the participant or any personnel at the participating sites . the treatment was initiated 710 days prior to the scheduled access surgery and continued postoperatively . after randomization , the two groups of subjects are followed in exactly the same way , and the only difference between the care with which they receive drugs , outpatient visits and follow - up calls should be those intrinsic to the treatments being compared . in the first group of patients , 710 days prior to the surgery , we started clopidogrel ( 75 mg daily ) and an oral prostacycline analog ( 200 mg orally daily ) . patients in the control and study group were operated by two surgeons using the same technique and same suture materials ( 6/0 polypropylene suture ) . to provide the purse or narrowing effect of suture , we noticed that the two surgeons operated on the same number of patients in both the groups . clopidogrel and prostacycline were administered orally prior to surgery , and continued during the year . data collection was performed at baseline , 4 weeks after fistula creation , and monthly thereafter until ascertainment of fistula suitability . study medication was discontinued when there was a sign of fistula thrombosis confirmed by vascular surgeons . in a normally developed fistula , there is a continuous thrill from the anastomosis all the way centrally along the outflow vein . the thrill gradually decreases in intensity from the anastomosis centrally . in the absence of a stenosis we defined the maturation of avf when the mean blood flow from avf was more than 300 ml / min . and a minimum arterial end diastolic velocity was 70 cm / s by sonographic examination for both groups . venous and arterial line diameters were calculated using sonography . if there was no sign of restriction of blood flow when the patients underwent hemodialysis , we described the hemodialysis access to be good . primary patency was defined as the interval from avf creation to abandonment due to thrombosis or low flow , inadequate for sufficient hemodialysis . early patency or failure was defined according to a thrill and/or bruit 4 weeks after the surgery . the antero - posterior diameter of ba was measured in the transverse dimension on gray scale sonography . peak systolic velocity and end - diastolic velocity of the ba were measured in a representative waveform in each patient [ figure 1 ] . the resistive index was a measure of the downstream flow resistance and was calculated as the difference between the respective measurements obtained after fist release ( post ) and during fist clenching ( pre ) . the primary outcome measure was final avf failure , which required the creation of a new avf . first , we investigated the need of re - intervention after avf due to thrombosis or occlusion during the follow - up period . suitability was defined as use of the fistula at a dialysis machine blood pump rate of 300 ml / min . or more during 8 of 12 dialysis sessions . doppler ultrasonography ( in a gray scale ) shows the brachial artery and its diameter in a patient with insulin - dependent diabetes mellitus and peak velocity the statistical program , spss version 13 ( spss , chicago , il ) was used to analyze the data . data are presented as mean standard error for continuous variables and as percentages for categorical variables . the t - test was used when the means of two groups were compared . on the basis of intention - to - treat principles , all other participants were monitored according to the research protocol for whom study medications were continued . all hypothesis tests were conducted by using a significance level of 0.05 ( two - sided ) . for evaluation of the relationships between the avf maturation and independent variables , differences between matured and failed groups were tested with the wilcoxon rank - sum test for continuous variables . multivariate cox proportional hazards models were used to determine factors associated with reduced avf patency . test results were presented as hazard ratios with 95% confidence intervals ( cis ) , and two - sided p < 0.05 was considered statistically significant .", "the statistical program , spss version 13 ( spss , chicago , il ) was used to analyze the data . data are presented as mean standard error for continuous variables and as percentages for categorical variables . the t - test was used when the means of two groups were compared . on the basis of intention - to - treat principles , all other participants were monitored according to the research protocol for whom study medications were continued . all hypothesis tests were conducted by using a significance level of 0.05 ( two - sided ) . for evaluation of the relationships between the avf maturation and independent variables , differences between matured and failed groups were tested with the wilcoxon rank - sum test for continuous variables . multivariate cox proportional hazards models were used to determine factors associated with reduced avf patency . test results were presented as hazard ratios with 95% confidence intervals ( cis ) , and two - sided p < 0.05 was considered statistically significant .", "the mean ages were 54.23 2.6 and 55.8 2.8 years in group 1 and 2 respectively ( p > 0.05 ) . there were no significant differences in covariables between groups when we compared patient characteristics , blood pressure , blood ldl , calcium , and phosphate levels [ table 2 ] . we did not detect any complication during the treatment period such as bleeding in group 1 patients . three patients complained from a temporary headache on the 1 day of oral prostacycline analog administration . all patients were taking study medication prior to surgery and did not have to be discontinued prematurely . four weeks after the surgery , avf maturation failure developed in 14 patients ( 30.4% ) in placebo group and in 4 patients ( 8% ) in clopidogrel and oral prostacycline analog group ( p = 0.001 ) . fistula maturation and survival has been confirmed using physical examinations and by a doppler usg every month for each patient . the kaplanmeier survival curve showed avf maturation and survival results in figure 2 [ table 3 ] . the mean maturation time of avf was 38 6.5 day and 53 12.8 day in clopidogrel plus oral prostacycline analog and placebo groups , respectively ( p = 0.023 ) . patients treated with clopidogrel and oral prostacycline analog had a increased avf survival ( p = 0.001 ) . in the placebo group , early avf failure was detected in two patients due to venous line thrombosis . characteristics of patients in the two groups demonstrates the survival rate of arteriovenous fistulas ( avfs ) during the study period in group 1 and group 2 . meier estimates of the cumulative incidence of loss of primary avfs patency in both groups . the median duration of patency was 5.8 months ( 95% confidence interval ( ci ) : 4.37.1 ) in the group 1 ( study group ) and 4.3 months ( 95% ci : 3.65.4 ) in the group 2 ( placebo group ) clinical outcomes at the end of the study the preoperative mean diameter of ba was 4.3 1.5 mm in clopidogrel plus oral prostacycline analog group and 4.04 1.3 mm in placebo group ( p = 0.94 ) . after surgery , usg showed that the mean diameter of ba was 6.3 1.4 mm and 4.74 0.9 mm in the study and placebo group respectively ( p = 0.002 ) . the preoperative mean diameter of the vein in the study and placebo groups were 3.1 0.8 and 3.04 0.7 mm ( p = 0.96 ) . in the postoperative period , the corresponding values were 5.4 0.9 and 4.01 0.3 mm respectively ( p = 0.024 ) . blood flow from avf was 352 94 ml / min . in placebo group and 604 125 ml / min . doppler usg examination of avf showed that a minimum arterial end - diastolic velocity has been detected at 116 14 cm / s in group 1 , 3 months after the surgery . however , this value was 72 21 cm / s in the placebo group ( p = 0.036 ) . overall , the hazard ratio for primary avf failure was 0.82 ( 95% ci : 0.310.94 ) . during the follow - up period , from 4 weeks to 6 months , tenderness of the extremity , edema , and hematoma occurred in nine patients in study group , and in six in placebo group . hemodialysis was successfully performed in 36 patients ( 72% ) in the study group and 22 patients ( 47.8% ) in the placebo group at the end of study ( p = 0.001 ) . the hemodialysis period in group 1 was significantly longer and more successful than in the placebo group ( p = 0.001 ) . multivariate logistic regression analysis revealed that avf maturation and survival rate was more than in study group ( odds ratio 2.27 ; 95% ci : 1.078.50 ; p = 0.001 ) . the survival and maturation time of avf in study group and placebo group has been summarized in figure 3(p = 0.001 ) . the flow diagram demonstrates the number of patients who were screened and selected for research [ figure 4 ] . during follow - up this graphic demonstrates the cumulative incidence for the percent of primary end points attributable to flow monitoring compared to total end points in each treatment group . end points due to flow monitoring in the group 1 ( study group ) and group 2 ( placebo - treated control group ) are compared to total end points demonstrates the comparison of the mean avfs ' flow diagram ( left columns ) and the differences of arterial end - diastolic velocity ( right columns ) between the groups . in the early period , we detected high blood flows and lower arterial velocity in study group when we compared groups no bleeding episode such as intracranial hemorrhage in gastrointestinal tract was recorded during the active treatment period . there were no differences between baseline and follow - up hematocrit values or changes in recombinant human erythropoietin doses during the study period for either group .", "in this prospective double - blind research , we presented our experiences of a new combination therapy and its efficacies on avf access after surgery in our esrd population . according to the study , clopidogrel in combination with oral prostacycline analog as an arterial vasodilator can be used to provide early avf maturation in esrdp with diabetes . according to previous reports , the size and quality of the arterial and venous access and distensibility after avf creation play important roles . therefore , we decided to use our combination therapy to provide more dilated and elastic arterial and venous access after avf creation . thus , blood flow from the fistula increased significantly in patients who were given a combination therapy than in patients who were given placebo . our study findings support the importance of distensibility and quality of vessel access . as we know that after avf creation , anastomotic or juxta - anastomotic stenosis is the most common cause of a fistula failing to mature . the stenosis most likely occurs because of operative trauma . in case of transposed vein fistulas , the loss of vasa vasorum in the mobilized portion of the vein may also contribute to causation of stenosis . second , there is the element of neo - intimal hyperplasia . because of a large pressure gradient between arterial and venous circulation , blood accelerates while passing from the artery to the vein causing turbulent flow that is considered responsible for endothelial damage as a result of micro - trauma . in addition , unfortunately , some patients have a small arterial and/or venous access diameter . therefore , effective hemodialysis can be impossible due to occlusion and/or stenosis of the venous or arterial line . it is shown that venous distensibility is a major problem after avf creation . in van der 's study , it was demonstrated that venous distensibility was significantly correlated with avf maturation , especially in patients with vein diameter 2 mm . thus , if there is no suitable venous distensibility , avf maturation and survival will be a problem . according to this hypothesis , we believe that the effective vasodilatation can be required in these particular groups for early avf maturation and longer survival . there have been a few small trials evaluating pharmacological agents aimed at reducing the early thrombosis rate .. these trials utilized the antiplatelet agents , aspirin , sulphinpyrazone , and clopidogrel and varied in size from as few as 5 patients up to 250 patients . andrassy et al . compared patients given aspirin for 4 weeks with placebo ; the thrombosis rate in the aspirin group was 4% compared with the control group of 24% . in another study , kooistra et al . demonstrated that a low - dose aspirin could not prevent thrombovascular accidents in hemodialysis patients during treatment with recombinant human erythropoietin . 's study , it was demonstrated that there was a statistical significance when compared to fistula thrombosis rates in clopidogrel groups versus placebo groups ( 12% vs. 19% ) . studies using sulphinpyrazone showed variable results , but were underpowered with the largest study enrolling only a small number of patients . thus , although there is some data to suggest that antiplatelet agents may increase the primary patency of avf , the limited evidence base and the uncertainty regarding the choice of agent have not supported the widespread use of antiplatelet agents in the prevention of avf thrombosis . however , for the first time , our study showed the effects of clopidogrel in combination with oral prostacycline agent on autogenous avf creation . we know that autogenous avf is the preferred hemodialysis access and is associated with lower morbidity and mortality than avgs . however , 2060% of fistulas fail to mature sufficiently to support dialysis . thus , the high rate of maturation failure is a major unsolved problem , yet . the costs and morbidity problems due to avf maturation failure among hemodialysis patients are still reported worldwide . vascular access surgeons are faced with the same challenge all over the world choosing the best vascular access type for chronic hemodialysis . size and quality of the vessels seem to be the important factors known . despite the experiences of avf in esrdp , considerable amount of time is required for the fistula to mature and suitably develop into a functional format . a number of authors and dember et al . have maintained that outflow venous stenosis and vascular intimal hyperplasia were the main causes of avf failure . avf thrombosis resulting from neointimal hyperplasia can be initiated by activated platelet function , endothelial cell injury , vascular smooth muscle cell proliferation , and unphysiologic vascular anastomosis . in view of these postulated mechanisms of avf failure , possible clinical benefit of antiplatelet therapy has been proposed for prevention of avf failure . in particular , aspirin , the most widespread antiplatelet drug , has been evaluated as prophylaxis for avf failure in several studies , mainly among the use of avg . in a study , the authors examined the efficacy of combination therapy of aspirin and clopidogrel for prevention of arteriovenous graft failure , but this study was stopped before completion because the prevalence of hemorrhagic complication was significantly higher in the intervention group . in the study group , only 28% of patients required re - intervention during the 1-year follow - up period . however , 52% of placebo group needed re - intervention due to avf failure . during the aspirin therapy , the most important problem is hemorrhage in hemodialysis patients than in the general population because hemodialysis patients are more likely to have platelet dysfunction and they receive intermittent anticoagulant therapy during hemodialysis sessions . however , clopidogrel is tolerated by the patient and is not a cause of gastrointestinal bleeding . thrombosis or severe occlusion of autogenous avf can be seen within the first several weeks following surgical creation , or inadequate maturation of the vein . some of the previous studies have indicated that the frequency of avf failure can be reduced with antiplatelet agents ; but in other studies the authors maintained antiplatelet therapy did not affect avf maturation and survival . they also concluded that vessel dilation was not needed for adequate blood flow except at the smaller diameters . the successful results of our analysis suggest that to inhibit avf failure , daily administration of 75 mg oral clopidogrel and arterial prostacycline analog administration may be initiated 710 days prior to avf creation . in 's trial suggested that the use of antiplatelet was not associated with significant risk reduction in access failure . kaufman demonstrated no change in the risk of graft thrombosis with aspirin plus clopidogrel therapy . the author reported that in chronic hemodialysis patients there was a trend toward increased or did not change thrombosis rate of avf using aspirin therapy . in fiskerstrand et al . 's study , 2 out of 6 patients in the ticlopidine group compared with 5 out of 9 in the placebo group , developed fistulae thromboses in 1 month . in the previously published study by grntoft et al . , there were only 2 out of 19 patients who received treatment developed for fistulae thromboses compared to 8 out of 17 on placebo . the results of adequacy for avfs developed sufficiently to be used for dialysis in 46.5% of patients . allon and robbin have suggested that the higher adequacy rate could be provided in upper arm location and multidisciplinary team approach to vascular access by the surgeons , nurses , and radiologists . the arterial diameter , elasticity , and the venous line distensibility are the main factors of fistula maturation . in publications from dac consortium , followed the patients for a long time ( approximately 4 years ) but we could follow the cases for a year only . our therapy model may be provided more distensible and large size venous line , and more elastic arterial access . our study differences may be related to surgical experiences , patients ' age , smoking history , bmi , patients ' arterial and venous diameters , and distensibility .", "multiple individuals are involved in the management of vascular access , including nephrologists , access surgeons , radiologists , dialysis nurses , and the patient . achieving optimal vascular access outcomes requires agreement on a common set of goals by all these individuals , close collaboration , and good communication . however , primary avf failure remains a major problem for hemodialysis patients worldwide . according to our study , it is observed that prophylaxis of vascular access thrombosis needs to start earlier in the hemodialysis patients . clopidogrel and oral prostacycline analog , which begins 710 days prior to avf creation and continuing during follow - up period seems to be effective and safe , and inhibit primary avf failure with acceptable side effects in hemodialysis patients ." ]

[ "tension - free vaginal tape ( tvt ) is now the treatment of choice for female stress urinary incontinence because of its ease of use , minimal invasiveness , and high success rate . mesh in the bladder or urethra following midurethral sling has been reported to occur in somewhere between less than 1% to 6% of patients and can result from intraoperative needle penetration or tape erosion [ 2 - 4 ] . even though the trans - obturator tape ( tot ) procedure has less risk of lower urinary tract injury , surgeons should handle with care to prevent this complication . bladder injury that is recognized during the operation is not usually related to long - term sequelae . however , when bladder injury is missed or the mesh erodes into the bladder or urethra , patients might suffer from painful urination , recurrent urinary tract infection , irritative or obstructive symptoms , and hematuria . since the first case of urethral mesh erosion was reported in 2001 , several case series have provided various techniques to manage this difficult complication [ 7,8 - 10 ] . intravesical or intraurethral mesh can be removed by open surgery ( cystorrhapy or urethrolysis and urethroplasty ) or endoscopic surgery . the objective of this study was to determine the efficacy and complication associated with transurethral removal ( tur ) of the intravesical or intraurethral mesh following midurethral sling procedures .", "a retrospective chart review was performed for women who had undergone transurethral surgery for bladder or urethral mesh between january 2002 and december 2010 . a total of 23 consecutive women were identified , and their demographics , midurethral sling procedures , and removal procedures were reviewed . the surgical outcomes and complications were evaluated . to remove the mesh , transurethral resection with an electrode loop ( tur - e ) was used until march 2010 , when a holmium laser became available in the study center . thereafter , transurethral resection with a holmium laser ( tur - h ) was performed . the usual surgical techniques of tur - e and tur - h are described below . tur - e was performed for 15 women with intravesical mesh and 1 woman with intraurethral mesh . with the patient under spinal anesthesia in the lithotomy position , a urethro - cystoscopic exam was performed with a 25 fr resectoscope and a 0 , 30 , and 70 degree telescope . when the stone was attached to the mesh , lithotripsy was performed with a lithoclast . the mesh was then resected with an electrode loop until it was not visible or the perivesical fat was reached . the resected mesh was removed by foreign body forceps . after confirming that no mesh remained in the bladder or urethra a 16 fr foley catheter was inserted and left in place for a median of 6 days ( range , 3 to 29 days ) . the median operation time was 57 minutes ( 40 to 135 minutes ) , and the median hospital stay was 8 days ( 4 to 36 days ) . seven patients were treated with the tur - h procedure with a rigid scope : 5 cases of intravesical mesh and 2 cases of intraurethral mesh . the surgery was similar to that for tur - e except a holmium laser was used . when the laser could not cut deeply enough and strings or a portion of the mesh remained , the remnant was evaporated by the laser . the median energy used was 4.3 kj ( range , 0.7 to 14.9 kj ) . after confirming that no mesh remained in the bladder or urethra , a 16 fr foley catheter was inserted and left in place for a median of 1 day ( range , 1 to 2 days ) . the median operation time was 125 minutes ( range , 30 to 180 minutes ) and the median hospital stay was 4.5 days ( range , 3 to 10 days ) . three women required concomitant transvaginal surgery for remnant mesh after tur - h : 2 with intravesical mesh and 1 with intraurethral mesh . a midline vaginal incision was made and submucosal dissection was performed with mezenbaum scissors . after identifying the mesh , it was grasped with kelly forceps and further dissection proceeded toward the exposed side while carefully maintaining traction on the mesh . after exposing the cut edge of the mesh through the vaginal incision , the whole exposed portion of the mesh was resected and removed . the wound was closed layer - by - layer with 3 - 0 vicryl sutures . a foley catheter was left in place for a median of 14 days ( range , 6 to 21 days ) . the median operation time was 215 minutes ( range , 180 to 220 minutes ) and the median hospital stay was 8 days ( range , 6 to 22 days ) .", "tur - e was performed for 15 women with intravesical mesh and 1 woman with intraurethral mesh . with the patient under spinal anesthesia in the lithotomy position , a urethro - cystoscopic exam was performed with a 25 fr resectoscope and a 0 , 30 , and 70 degree telescope . when the stone was attached to the mesh , lithotripsy was performed with a lithoclast . the mesh was then resected with an electrode loop until it was not visible or the perivesical fat was reached . the resected mesh was removed by foreign body forceps . after confirming that no mesh remained in the bladder or urethra a 16 fr foley catheter was inserted and left in place for a median of 6 days ( range , 3 to 29 days ) . the median operation time was 57 minutes ( 40 to 135 minutes ) , and the median hospital stay was 8 days ( 4 to 36 days ) . 1 . seven patients were treated with the tur - h procedure with a rigid scope : 5 cases of intravesical mesh and 2 cases of intraurethral mesh . the surgery was similar to that for tur - e except a holmium laser was used . when the laser could not cut deeply enough and strings or a portion of the mesh remained , the remnant was evaporated by the laser . the median energy used was 4.3 kj ( range , 0.7 to 14.9 kj ) . after confirming that no mesh remained in the bladder or urethra , a 16 fr foley catheter was inserted and left in place for a median of 1 day ( range , 1 to 2 days ) . the median operation time was 125 minutes ( range , 30 to 180 minutes ) and the median hospital stay was 4.5 days ( range , 3 to 10 days ) . three women required concomitant transvaginal surgery for remnant mesh after tur - h : 2 with intravesical mesh and 1 with intraurethral mesh . a midline vaginal incision was made and submucosal dissection was performed with mezenbaum scissors . after identifying the mesh , it was grasped with kelly forceps and further dissection proceeded toward the exposed side while carefully maintaining traction on the mesh . after exposing the cut edge of the mesh through the vaginal incision , the whole exposed portion of the mesh was resected and removed . the wound was closed layer - by - layer with 3 - 0 vicryl sutures . a foley catheter was left in place for a median of 14 days ( range , 6 to 21 days ) . the median operation time was 215 minutes ( range , 180 to 220 minutes ) and the median hospital stay was 8 days ( range , 6 to 22 days ) .", "patient demographics and the clinical characteristics of a total of 23 women are described in table 1 according to the removal technique . sixteen women had the tur - e procedure and 7 women had the tur - h procedure . at the time of surgery , the median age was 51 years ( range , 40 to 67 years ) . the median period between the midurethral sling and mesh removal was 31.3 months ( range , 2.2 to 247.6 months ) , and the median follow - up period was 2.1 months ( range , 0.3 to 35.9 months ) after mesh removal . the previous midurethral sling procedures were 11 transobturator slings , 8 retropubic slings , 1 single incision sling , and 3 which were not identified . most women presented with multiple symptoms , including dysuria , hematuria , and irritative or obstructive urinary symptoms . table 2 summarizes the preoperative findings , surgical outcomes , and complications for all 23 cases . overall , 6 women ( 26% ) had a mesh remnant after transurethral surgery : 1 woman ( 6.2% ) after tur - e and 5 women ( 71.4% ) after tur - h . the woman who had a mesh remnant after tur - e underwent repeat tur - e for the remnant , and no mesh remained on the follow - up cystoscopic exam . of the 5 women who had remnant mesh after tur - h , 3 underwent concomitant transvaginal removal . on the postoperative cystoscopic exam , 2 women had remnant mesh after tur - h . one woman had transvaginal removal with no mesh visible on the follow - up cystoscopic exam . in the other woman she wanted to delay additional treatment for the remaining mesh because she had none of the preoperative symptoms . two cases of vesico - vaginal fistulas occurred in women treated with tur - e . one case was found during the tur - e , and the fistula tract was immediately repaired transvaginally . a foley catheter was placed for 29 days and no sequelae were observed during 9.5 months of follow - up . the woman experienced continuous urine leakage 7 days after the foley catheter was removed . on the vaginal exam , one case of stress incontinence ( stamey grade i ) recurred in a woman who had remaining intraurethral mesh after tur - h .", "in this retrospective study , 26% of women ( 6/23 ) had a mesh remnant after transurethral removal of intravesical or intraurethral mesh . mesh exposure in the bladder or urethra is an uncommon but troublesome complication of midurethral slings . several authors have described their approaches to this difficult problem , with no consensus on the best approach [ 11 - 16 ] . frenkl et al proposed a treatment algorithm after reviewing 22 cases of iatrogenic foreign bodies in the bladder and urethra following pelvic floor surgery . they commented on the technical difficulties of endoscopic resection of the mesh due to the encrusted stone material and the difficulty in applying tension to the mesh during resection . standard transurethral resection had success rates of 90% to 100% in several case series with a small number of patients [ 7,17 - 19 ] . with the electrode loop our series also showed a high success rate ( 93.7% [ 15/16 ] ) after the tur - e procedure . on the contrary , the holmium laser completely removed the mesh in only 28% of women ( 2/7 ) . doumouchtsis et al reported that 4 of 6 women had recurrent erosion after transurethral resection using a holmium laser . the holmium laser allows sharp incision of the mesh at the entrance and exit points . however , complete excision is difficult with a rigid cystoscope when the mesh is located in the bladder neck or urethra . of the 3 successful cases of holmium laser excision reported by giri et al , none were in the bladder neck or urethra , and a flexible instrument was used . in the present study , the mesh was in the bladder neck or urethra in all 5 cases with mesh remaining after tur - h , and we used a rigid scope . therefore , we suggest that complete removal of the mesh using tur - h depends on the location of the mesh and the range of motion of the instrument . another reason for the low success rate after tur - h might be less experience with the technique using holmium laser . two cases of vesico - vaginal fistulas were found during or after the tur - e procedure . as mentioned above , one advantage of the electrode loop is that it can resect the mesh down to the submucosal portion . because damaged urethral or bladder mucosa is atrophic , the risk of perforation may be increased . a laparoscopic trocar was inserted suprapubically into the bladder under cystoscopic control . under traction and fixation by suprapubically a disadvantage of this technique is that it requires an additional bladder tract , which can increase the hospital stay and morbidity . to avoid bladder or urethral perforation , nevertheless , transurethral resection using an electrode loop for intraurethral mesh might have a higher possibility of urethral perforation or incomplete resection . also , with a holmium laser and rigid scope the median duration from the manifestation of symptoms to diagnosis was more than 7 months . the possibility of unrecognized tape perforation or erosion and cystosopic exam should be considered in patients with lower urinary tract symptoms after a midurethral sling procedure . stress urinary incontinence recurred in 1 woman who had a mesh remnant after tur - h . she wanted to delay further treatment because the grade was minimal and her preoperative symptom was resolved . given these results , transurethral resection wolud have a good functional outcome and low risk recurrence of stress incontinence . however , there are only limited data on the effectiveness of transurethral management for bladder or urethral mesh . our results can provide information on the outcomes and complications of different transurethral removal techniques and can help physicians to choose the best treatment modality .", "transurethral surgery is associated with low morbidity and is familiar to urologists . to remove intravesical or intraurethral mesh after midurethral sling procedures , tur - e has a high success rate , although it has a high risk of bladder perforation . in contrast , tur - h has less risk of tissue damage , but complete resection seems to depend on the location of the mesh and the range of motion of the instrument . the evidence for tur - h is not sufficient to conclude that this is an ineffective method for mesh removal ; however , it should be performed in selected patients . transurethral resection has good functional outcomes and a low risk of recurrence of stress incontinence ." ]

[ "generalized anxiety disorder ( gad ) is a chronic disorder mainly characterized by pathological worry . gad also presents with a variety of somatic and psychological symptoms such as restlessness , muscle tension , sleep disturbance , irritability , difficulty concentrating , and fatigue . gad is one of the most prevalent anxiety disorders , with its lifetime prevalence estimated to be of 5.7% in the united states and 2.8% in europe [ 2 , 3 ] . patients with gad have a higher likelihood of developing other mood disorders in their lifetime ; one of the most common is major depressive disorder , present in 62% of gad patients . since gad affects normal functioning , these patients are usually frequent users of healthcare resources ; in fact , studies aimed to explore gad clinical prevalence have estimated it to be 7.3% in primary care and up to 13% in the psychiatric outpatient setting [ 5 , 6 ] . gad is difficult to diagnose by primary care physicians and psychiatrists . in people who suffer gad , commonly occurring comorbid conditions ( e.g. , depression , alcoholism , other anxiety disorders ) often mask the underlying anxiety and result in a missed diagnosis of gad [ 7 , 8 ] . other factors complicating the diagnosis of gad are patients tendency to complain about the somatic symptoms , such as sleeplessness and fatigue , rather than the psychic symptoms ( e.g. , nervousness , apprehension , chronic worry ) , and physicians lack of education in the diagnosis of gad . diagnostic criteria have been modified in each edition of the diagnostic and statistical manual of mental disorders ( dsm ) [ 1 , 11 , 12 ] . duration of excessive worry criterion and the number of associated symptoms are still questioned today . the duration criterion was increased to 6 month in the dsm - iii - r to distinguish gad from adjustment disorders or situational stress reactions . however , recent studies have suggested that this duration excludes significantly impaired patients from diagnosis . dsm - v , which is expected to get released in may 2013 , will revise the wording and organization of gad diagnostic criteria in order to simplify them . meanwhile , several groups are conducting studies aiming to assess the need for 6 months duration of excessive anxiety and worry criterion [ 13 , 15 - 17 ] . using data from the us national comorbidity survey replication , ruscio et al . have demonstrated that broadening the gad diagnosis criteria , more than doubles its prevalence . this broadening of the criteria consists on a shortening of anxiety duration from at least 6 months to at least 1 month ( but less than 6 months ) , relaxing excessiveness to include excessive and non - excessive worry , and reducing the associated symptoms from a minimum of 3 to a minimum of 2 . most of the increase in prevalence comes from reducing the minimum duration to 1 month and , to a lesser extent , from eliminating the excessive worry requirement . prevalence is minimally affected by requiring 2 rather than 3 associated symptoms . in a recent study conducted both in developed and developing countries , the 6-month duration criterion was not found to influence symptom severity , age of onset , persistence , impairment or comorbidity when compared to shorter criterion durations ( 1 - 2 months and 3 - 5 months ) . to our knowledge , there is no study aimed to evaluate prospectively the evolution of anxiety symptoms in patients diagnosed with broad dsm - iv criteria under medical practice . before considering changing dsm - iv criteria , full consequences of these changes should be explored . broadening of gad criteria could lead to earlier diagnosis of gad patients and to diagnosis of otherwise under diagnosed patients . earlier diagnosis could translate into a sooner start of treatment and this could lead to an improvement in the course of the illness and the quality of life . in fact , gad patients have reported lower perceived quality of life than non - anxious controls and a lower degree of social functioning than patients with arthritis or diabetes . in a recent study by lee et al . , those patients with more than 12 months duration of symptoms were more severely impaired and had a lower rate of recovery than the groups with shorter duration of symptoms , suggesting that an earlier diagnosis could also benefit patient response and recovery . in an attempt to elucidate the consequences of broadening dsm - iv criteria for generalized anxiety disorder , the current study examined prospectively the evolution of gad symptoms in two groups of diagnosed patients in public and private mental healthcare settings ; one group according to the existing dsm - iv criteria and the other according to broader criteria ( at least 1 month but less than 6 months of excessive or non - excessive worry and 2 associated symptoms listed on dsm - iv for gad diagnosis ) . by using the total ham - a scores , changes in evolution of anxiety symptoms were studied in both criteria groups under the basis of routine medical care in a 6 month period . finally , self - reported quality of life , disability and other patient - reported - outcomes were studied as a measure of the overall well - being of gad patients .", "this was a multicentre , prospective and observational study carried out in outpatient psychiatric clinics between october 2007 and january 2009 . the study was approved by the local ethics committee of the hospital clnico de san carlos ( madrid ) and was conducted according to the helsinki declaration for research in the human being . functional and clinical outcome measures were completed in all three visits and included the following instruments : hamilton anxiety rating scale , montgomery - asberg depression rating scale ( baseline and 6 month visit only ) , clinical global impression - severity of illness scale , sleep scale from medical outcomes study ( mos - sleep ) , world health organization disability assessment schedule ii ( baseline and 6 month visit only ) , and the quality of life questionnaire , eq-5d ( all described in detail below ) . at baseline , socio - demographic data , current therapy and psychiatric and medical illnesses information were collected . for the 3 and 6 months visits , psychiatrists participating in the study made a confirmatory diagnosis of gad in 6 consecutive patients , 3 according to dsm - iv criteria and 3 according to broad criteria . although patients could have symptoms and receive treatment before entering the study , they had nt been diagnosed before by the psychiatrist . eligible patients were men and women over 18 years of age that were diagnosed with gad by a trained psychiatrist at the baseline visit . exclusion criteria included previous gad diagnosis , inability or difficulty to understand patient - reported - outcomes questionnaires written in spanish . diagnosis was carried out by a trained psychiatrist , familiar with the study procedures , and who worked in an outpatient setting . sampling frame included all public and private healthcare settings within the 17 regions of spain . first stage consisted on a selection of the outpatient psychiatry clinics ( mental health centres ) in each healthcare region . the number of clinics selected in each region was proportional to the region s population , being the probability of choosing each clinic relative to the population in the area covered by the clinic . in the second stage , one psychiatrist per clinic was chosen randomly within those with previous experience in clinical and epidemiological research in psychiatry , and with at least 5 year experience in mental health diseases diagnosis . if a selected psychiatrist refused to participate , he or she was replaced by another from the same clinic ( also selected randomly ) . participant psychiatrists were asked to invite in a consecutive manner those patients from the daily list of appointments that fulfilled the inclusion criteria . psychiatrists were encouraged to maintain the above mentioned proportion of 3 subjects diagnosed following dms - iv criteria and 3 subjects diagnosed following the broad criteria . sample size was calculated taking into account study s main variable : evolution of anxiety symptoms according to the total ham - a scores for each patient group . a sample of 3400 evaluable patients was estimated assuming a 2-tailed 95% confidence interval for the total ham - a scores lower than 0.25 points from the observed mean . based on the results of a previous study , a standard deviation lower than 8 was assumed . gad was diagnosed following the dsm - iv criteria ( dsm - iv criteria group ) in one group . the other group ( broad criteria group ) was diagnosed according to broader criteria consisting on shortening of anxiety duration from at least 6 months to at least 1 month ( but less than 6 months ) , including excessive or non - excessive worry and reducing the associated symptoms from a minimum of 3 to a minimum of 2 . hamilton anxiety rating scale ( ham - a ) : the validated spanish version of the ham - a scale was used to evaluate the evolution of anxiety symptoms during all 3 visits of the study . the ham - a scales includes 14 items , each of them rates from 0 ( absence ) to 4 ( severe ) . the total score comes from the addition of all 14 items with a maximum of 56 . scores higher than 24 were considered as severe anxiety ; between 16 and 24 , moderate ; between 10 and 15 , mild ; and below 9 , no anxiety . a psychic anxiety sub domain ( addition of items 1 - 6 and 14 ) and a somatic anxiety sub domain ( addition of items 7 - 13 ) montgomery - asberg depression rating scale ( madrs ) : the validated spanish version of the madrs scale was used to measure the intensity of depression symptoms . this observer - rated depression scale consists on 10 items regarding different depressive symptoms , each item being scored from 0 to 6 depending on the severity of symptoms ; the total score results from adding the score of each item , obtaining a minimum of 0 ( no symptoms ) and a maximum of 60 ( very severe ) . clinical global impression - severity of illness scale ( cgi - s ) : participant psychiatrists evaluated patient s global severity with the cgi - s scale , which rates illness severity from 0 to 7 , where 0 was considered as not evaluated , 1 as no disease , 2 borderline ill , 3 mildly ill , 4 moderately ill , 5 markedly ill , 6 severely ill , and 7 extremely ill . sleep scale from medical outcomes study ( mos - sleep ) : mos - sleep scale evaluates the impact or interference with sleep of any disease or treatment . the 7 subscales are sleep disturbance ( 4 items ) , snoring ( 1 item ) , awaken short of breath or with headache ( 1 item ) , quantity of sleep ( 1 item ) , optimal sleep ( 1 item ) , sleep adequacy ( 2 items ) , and somnolence ( 3 items ) . this scale also has a sleep problems index , rated from 0 ( no interference ) to 100 ( maximum interference ) , and a sleep problems subscale . each item is rated independently with more interference scoring higher , except for the sleep adequacy and quantity and optimal sleep subscales [ 21 , 22 ] . world health organization disability assessment schedule ii ( who - das ii ) : the who - das ii is a psychometric instrument that measures day to day functioning and disability in the following six activity domains : understanding and communicating , moving and getting around , self care , getting along with people , work activities , and participation in society . the 12-item who - das ii scale is rated from 1 ( none or nothing ) to 5 ( extreme or inability to perform a given task ) . the total calculated score ranges from 0 to 100 , with higher scores indicating higher degrees of disability , for the total scale as well as for each subscale . eq-5d : this is a standard self - reported quality of life questionnaire developed in several european countries and validated for spain . this questionnaire consists of two parts , the first one aims to evaluate patient s health profile in five dimensions ( mobility , self - care , daily living activities , pain , and anxiety / depression ) . the patient rates his / her current status as no problems , some / moderate problems , and severe / extreme problems for each dimension . results are then converted into 1 of the 243 different eq-5d health state descriptions which are used to calculate a unique index or tariff , between 1 ( as healthy as possible ) and 0 ( usually equivalent to death ) . this index is used to calculate the time - trade off tariff which allows calculating quality - adjusted - life - year ( qaly ) gain ( further explanation below ) . the second part consists on a visual analogue scale ( vas or thermometer ) in which the patient has to rate his health status between 0 ( equivalent to death ) and 100 ( the best possible healthy status ) . for statistical analysis , last observation carried forward approach was used for those patients for whom data from the 6 months visit were missing . if the only missing data was that from the 3 months visit , this was estimated proportionally to the change observed at the 6 months visit , given that the missing data at 3 month visit were completely at random . patients were considered to respond to treatment when a higher than 50% reduction was observed for the total ham - a scale score at the study final visit when compared to that of the baseline visit . descriptive statistics were prepared for the continuous variables in the study , including the assessment of central position and dispersion ( two - tailed 95% confidence interval ) . the kolmogorov - smirnov test was applied to check adjustment of data to a gaussian distribution . student t tests and chi - square test were used for continuous and categorical variables , respectively , to test homogeneity of baseline data between groups . analysis of covariance ( ancova ) or binary logistic regression models were fitted comparing dsm - iv criteria versus broad criteria groups in most variables adjusting by baseline scoring , sex , age , body mass index , educational level , marital status and percentage of patients with comorbid major depression or depressive disorder . analysis of variance ( anova ) was applied for quantitative measures and chi square ( mcnemar s test ) for qualitative measures in case of paired comparisons . the clinical relevance of observed differences in baseline characteristics was ascertained by means of the effect size that was calculated using the difference of means for each group , divided by the combined standard deviation of the variables . qalys gain after the 6-months follow - up was calculated from patients responses to the eq-5d as described previously using tariff calculated with this instrument . gained qalys were estimated by using the trapezoidal approach , with baseline and 6- month visit values used as reference values . all statistical tests were two - tailed , and error of < 0.05 was accepted as statistically significant .", "this was a multicentre , prospective and observational study carried out in outpatient psychiatric clinics between october 2007 and january 2009 . the study was approved by the local ethics committee of the hospital clnico de san carlos ( madrid ) and was conducted according to the helsinki declaration for research in the human being . functional and clinical outcome measures were completed in all three visits and included the following instruments : hamilton anxiety rating scale , montgomery - asberg depression rating scale ( baseline and 6 month visit only ) , clinical global impression - severity of illness scale , sleep scale from medical outcomes study ( mos - sleep ) , world health organization disability assessment schedule ii ( baseline and 6 month visit only ) , and the quality of life questionnaire , eq-5d ( all described in detail below ) . at baseline , socio - demographic data , current therapy and psychiatric and medical illnesses information were collected . for the 3 and 6 months visits , psychiatrists participating in the study made a confirmatory diagnosis of gad in 6 consecutive patients , 3 according to dsm - iv criteria and 3 according to broad criteria . although patients could have symptoms and receive treatment before entering the study , they had nt been diagnosed before by the psychiatrist .", "eligible patients were men and women over 18 years of age that were diagnosed with gad by a trained psychiatrist at the baseline visit . exclusion criteria included previous gad diagnosis , inability or difficulty to understand patient - reported - outcomes questionnaires written in spanish . diagnosis was carried out by a trained psychiatrist , familiar with the study procedures , and who worked in an outpatient setting . sampling frame included all public and private healthcare settings within the 17 regions of spain . first stage consisted on a selection of the outpatient psychiatry clinics ( mental health centres ) in each healthcare region . the number of clinics selected in each region was proportional to the region s population , being the probability of choosing each clinic relative to the population in the area covered by the clinic . in the second stage , one psychiatrist per clinic was chosen randomly within those with previous experience in clinical and epidemiological research in psychiatry , and with at least 5 year experience in mental health diseases diagnosis . if a selected psychiatrist refused to participate , he or she was replaced by another from the same clinic ( also selected randomly ) . participant psychiatrists were asked to invite in a consecutive manner those patients from the daily list of appointments that fulfilled the inclusion criteria . psychiatrists were encouraged to maintain the above mentioned proportion of 3 subjects diagnosed following dms - iv criteria and 3 subjects diagnosed following the broad criteria . sample size was calculated taking into account study s main variable : evolution of anxiety symptoms according to the total ham - a scores for each patient group . a sample of 3400 evaluable patients was estimated assuming a 2-tailed 95% confidence interval for the total ham - a scores lower than 0.25 points from the observed mean . based on the results of a previous study , a standard deviation lower than 8 was assumed .", "gad was diagnosed following the dsm - iv criteria ( dsm - iv criteria group ) in one group . the other group ( broad criteria group ) was diagnosed according to broader criteria consisting on shortening of anxiety duration from at least 6 months to at least 1 month ( but less than 6 months ) , including excessive or non - excessive worry and reducing the associated symptoms from a minimum of 3 to a minimum of 2 .", "hamilton anxiety rating scale ( ham - a ) : the validated spanish version of the ham - a scale was used to evaluate the evolution of anxiety symptoms during all 3 visits of the study . the ham - a scales includes 14 items , each of them rates from 0 ( absence ) to 4 ( severe ) . the total score comes from the addition of all 14 items with a maximum of 56 . scores higher than 24 were considered as severe anxiety ; between 16 and 24 , moderate ; between 10 and 15 , mild ; and below 9 , no anxiety . a psychic anxiety sub domain ( addition of items 1 - 6 and 14 ) and a somatic anxiety sub domain ( addition of items 7 - 13 ) montgomery - asberg depression rating scale ( madrs ) : the validated spanish version of the madrs scale was used to measure the intensity of depression symptoms . this observer - rated depression scale consists on 10 items regarding different depressive symptoms , each item being scored from 0 to 6 depending on the severity of symptoms ; the total score results from adding the score of each item , obtaining a minimum of 0 ( no symptoms ) and a maximum of 60 ( very severe ) . clinical global impression - severity of illness scale ( cgi - s ) : participant psychiatrists evaluated patient s global severity with the cgi - s scale , which rates illness severity from 0 to 7 , where 0 was considered as not evaluated , 1 as no disease , 2 borderline ill , 3 mildly ill , 4 moderately ill , 5 markedly ill , 6 severely ill , and 7 extremely ill . sleep scale from medical outcomes study ( mos - sleep ) : mos - sleep scale evaluates the impact or interference with sleep of any disease or treatment . the 7 subscales are sleep disturbance ( 4 items ) , snoring ( 1 item ) , awaken short of breath or with headache ( 1 item ) , quantity of sleep ( 1 item ) , optimal sleep ( 1 item ) , sleep adequacy ( 2 items ) , and somnolence ( 3 items ) . this scale also has a sleep problems index , rated from 0 ( no interference ) to 100 ( maximum interference ) , and a sleep problems subscale . each item is rated independently with more interference scoring higher , except for the sleep adequacy and quantity and optimal sleep subscales [ 21 , 22 ] . world health organization disability assessment schedule ii ( who - das ii ) : the who - das ii is a psychometric instrument that measures day to day functioning and disability in the following six activity domains : understanding and communicating , moving and getting around , self care , getting along with people , work activities , and participation in society . the 12-item who - das ii scale is rated from 1 ( none or nothing ) to 5 ( extreme or inability to perform a given task ) . the total calculated score ranges from 0 to 100 , with higher scores indicating higher degrees of disability , for the total scale as well as for each subscale . eq-5d : this is a standard self - reported quality of life questionnaire developed in several european countries and validated for spain . this questionnaire consists of two parts , the first one aims to evaluate patient s health profile in five dimensions ( mobility , self - care , daily living activities , pain , and anxiety / depression ) . the patient rates his / her current status as no problems , some / moderate problems , and severe / extreme problems for each dimension . results are then converted into 1 of the 243 different eq-5d health state descriptions which are used to calculate a unique index or tariff , between 1 ( as healthy as possible ) and 0 ( usually equivalent to death ) . this index is used to calculate the time - trade off tariff which allows calculating quality - adjusted - life - year ( qaly ) gain ( further explanation below ) . the second part consists on a visual analogue scale ( vas or thermometer ) in which the patient has to rate his health status between 0 ( equivalent to death ) and 100 ( the best possible healthy status ) .", "for statistical analysis , last observation carried forward approach was used for those patients for whom data from the 6 months visit were missing . if the only missing data was that from the 3 months visit , this was estimated proportionally to the change observed at the 6 months visit , given that the missing data at 3 month visit were completely at random . patients were considered to respond to treatment when a higher than 50% reduction was observed for the total ham - a scale score at the study final visit when compared to that of the baseline visit . descriptive statistics were prepared for the continuous variables in the study , including the assessment of central position and dispersion ( two - tailed 95% confidence interval ) . the kolmogorov - smirnov test was applied to check adjustment of data to a gaussian distribution . for categorical variables student t tests and chi - square test were used for continuous and categorical variables , respectively , to test homogeneity of baseline data between groups . analysis of covariance ( ancova ) or binary logistic regression models were fitted comparing dsm - iv criteria versus broad criteria groups in most variables adjusting by baseline scoring , sex , age , body mass index , educational level , marital status and percentage of patients with comorbid major depression or depressive disorder . analysis of variance ( anova ) was applied for quantitative measures and chi square ( mcnemar s test ) for qualitative measures in case of paired comparisons . the clinical relevance of observed differences in baseline characteristics was ascertained by means of the effect size that was calculated using the difference of means for each group , divided by the combined standard deviation of the variables . qalys gain after the 6-months follow - up was calculated from patients responses to the eq-5d as described previously using tariff calculated with this instrument . gained qalys were estimated by using the trapezoidal approach , with baseline and 6- month visit values used as reference values . all statistical tests were two - tailed , and error of < 0.05 was accepted as statistically significant .", "a total of 3,549 patients were finally recruited by 618 psychiatrists in spanish psychiatric clinics for this observational study . four hundred and fifty three patients ( 12.8% ) were excluded because they did not meet all inclusion criteria . remaining patients were diagnosed of gad according to dsm - iv criteria ( 1,815 patients ) or to broad criteria ( 1,281 patients ) as described on the methods section . a total of 529 ( 17.0% ) patients drop - out from study , with no significant differences between study groups ( dsm - iv criteria : 313 patients , broad criteria : 216 patients ; p=0.899 ) ( fig . however , main reasons for drop - outs were a somewhat different between groups with 52.7% lost to follow - up in dsm - iv group , compared with 67.1% in broad criteria group ( p=0.033 ) , and unknown reasons in 22.0% of withdrawals in dsm - iv group compared with 13.6% in broad criteria group ( p=0.023 ) . the mean age was 45.5 years for the dsm - iv group and slightly lower for the broad criteria group ( 42.9 years , p<0.001 vs. dsm - iv group ) . regarding gad , all features studied were slightly , but significantly higher in the standard dsm - iv criteria group . thus , the mean number of anxiety symptoms was 4.7 for the dsm - iv group compared with 4.3 for the broad criteria group ( p<0.001 ) . significant differences were also observed in the percentage of patients presenting with each individual gad symptom . all ham - a scores indicated severe anxiety on both patient groups , being the scores in the dsm - iv group significantly higher ( table 1 ) . likewise , statistical differences were observed at baseline in the cgi and madrs scales between the two groups . however , the magnitude of the effect was low for all quantitative variables at baseline ( effect size < 0,50 ) so the statistically significant differences observed were of small or negligible clinical relevance . most patients in both groups ( 87.9% for dsm - iv ; 82.0% for broad criteria ) were following a pharmacological treatment in the six months previous to the baseline visit . ( 2 ) , benzodiazepines were the most commonly used drugs followed by antidepressants and antiepileptics . at the end of the study , there was an increase in the number of patients under pharmacological treatment ( 97% in both groups , p<0.001 versus baseline in all cases ) . the use of antiepileptic drugs increased by 3.2 and 3.8 fold in the dsm - iv and broad criteria groups , respectively , by the end - of - trial ( p<0.001 in all cases ) . the percentage of antiepileptic drugs users in dsm - iv group at baseline and at 6 months was significantly higher , albeit only slightly ( p=0.002 in both cases , fig . both groups showed a significant reduction in the percentage of benzodiazepines users after 6 months of follow - up ( p<0.001 ) , being this reduction even higher in the broad criteria group ( p=0.011 ) . also a slight but statistically significant increase was observed in the percentage of anti - depressive users in both groups ( p<0.001 , see fig . the percentage of subjects in dsm - iv and broad criteria groups that had at least one psychiatric comorbidity was 51.4% and 43.7% , respectively , ( p<0.001 ) . table 2 describes the most frequent psychiatric comorbidities and medical disorders in both study groups . however , neither the mean number of comorbid psychiatric disorders nor the medical illnesses were different between both criteria groups , except for comorbid major depression and other depressive disorders which were slightly more frequent , but statistically significant in dsm - iv group ( p<0.01 and p=0.05 , respectively , table 2 ) . regarding psychiatric disorders , most of them were present around 5 months before the diagnosis of gad , without significant differences between groups in disease evolution . major depression and panic disorders were the most frequent comorbid psychiatric disorders in both study groups . for medical illnesses , chronic pain was present in more than half of patients in both groups , although a higher percentage was seen in dsm - iv group ; 64.3% versus 52.0% , p<0.001 ( table 2 ) . anxiety severity was assessed with ham - a and cgi - s scales at 3 and 6 month visits . ( 3 ) shows the evolution of ham - a total and sub - scores over study time in the dsm - iv and broad criteria groups . all ham - a scores improved after 3 and 6 months in both criteria groups . moreover , the percentage of patients without symptoms of anxiety , showing ham - a<9 , increased up to 22.3% and 31.4% at the 3 month visit for the dsm - iv and broad criteria groups ( p<0.001 vs. basal visit in both groups , and p=0.006 between groups ) , and up to 49% and 58% at the 6 month visit ( p<0.001 vs. basal visit in both groups , and p=0.261 between groups ) , indicating similar results for both groups at the end of the study . also , patients responding to anxiety treatment increased when considering the responder criteria ( > 50% reduction of baseline scores ) ; 30.7% and 38.2% for the dms - iv and broad criteria , respectively , at the 3 months visit ( p= 0.004 ) ; increasing up to 59.7% in the dms - iv and 67.7% at the 6 month visit ( p=0.103 ) . 4 ) , differences between criteria groups were statistically significant at the study time points . regarding each gad symptom , fig . ( 5 ) shows the reduction in the percentage of patients presenting with each anxiety symptom . however , higher significant reductions were observed in dsm - iv group for the following symptoms : fatigue , irritability and sleep disturbance ( p<0.05 in all cases , fig . 5 ) . in this study , depression symptoms were evaluated using the madrs . when compared to scores at baseline visit ( table 1 ) , patients in both criteria groups improved their madrs scores with a mean reduction of 12.1 and 12.5 points for the dms - iv and broad criteria groups , respectively ( p=0.264 dsm - iv vs. broad criteria ) . mos - sleep scale scores revealed an overall improvement in sleep patterns over study time in both criteria group . as described in table 3 , all sleep domains in the mos - sleep scale changed significantly after 6 months when compared to basal visit scores . differences between the dsm - iv and broad criteria groups were observed for the total score ( p= 0.018 ) , sleep disturbance domain ( p=0.012 ) , sleep quantity ( p=0.016 ) , sleep adequacy ( p=0.031 ) , and sleep problems ( p=0.019 ) scores , always favouring the broad criteria group . health - related quality of life was measured by the eq-5d questionnaire . as seen in table 3 , both the health status ( visual analogue scale ) and the frequency of severe problems in each domain had significantly improved at the 6 month visit in both study groups ( p<0.001 in all cases ) . also , comparisons between both criteria groups in quality - of - life gain by domain were significant in favour of the broad criteria group in health status , daily living activities and mood status . mean qalys gain at the 3 month and 6 month visits were 0.034 and 0.103 years , respectively , for the dsm - iv criteria group and 0.034 ( 3 month ) and 0.101 ( 6 month ) for the broad criteria patients , without statistical significance between groups ( table 3 ) . at the 6 month visit , the percentage of patients reporting an improvement in their health status as compared with that of one year earlier increased by 13.8% for the dsm - iv criteria group , and 16.6% for the broad criteria group ( differences not significant ) . for measuring the disability degree in both groups of patients , , there was a significant improvement in all 7 domains of the who - das ii scale after the 6 month follow - up in both criteria groups . the improvements were not significantly different in the dsm - iv group when compared to the new criteria group except for household activity domain , in which the improvement in the dsm - iv group was significantly better when compared to the broad criteria group . nevertheless , a trend toward statistical significance was observed in the total scoring of the disability scale favouring broad criteria group .", "a total of 3,549 patients were finally recruited by 618 psychiatrists in spanish psychiatric clinics for this observational study . four hundred and fifty three patients ( 12.8% ) were excluded because they did not meet all inclusion criteria . remaining patients were diagnosed of gad according to dsm - iv criteria ( 1,815 patients ) or to broad criteria ( 1,281 patients ) as described on the methods section . a total of 529 ( 17.0% ) patients drop - out from study , with no significant differences between study groups ( dsm - iv criteria : 313 patients , broad criteria : 216 patients ; p=0.899 ) ( fig . however , main reasons for drop - outs were a somewhat different between groups with 52.7% lost to follow - up in dsm - iv group , compared with 67.1% in broad criteria group ( p=0.033 ) , and unknown reasons in 22.0% of withdrawals in dsm - iv group compared with 13.6% in broad criteria group ( p=0.023 ) . the mean age was 45.5 years for the dsm - iv group and slightly lower for the broad criteria group ( 42.9 years , p<0.001 vs. dsm - iv group ) . regarding gad , all features studied were slightly , but significantly higher in the standard dsm - iv criteria group . thus , the mean number of anxiety symptoms was 4.7 for the dsm - iv group compared with 4.3 for the broad criteria group ( p<0.001 ) . significant differences were also observed in the percentage of patients presenting with each individual gad symptom . all ham - a scores indicated severe anxiety on both patient groups , being the scores in the dsm - iv group significantly higher ( table 1 ) . likewise , statistical differences were observed at baseline in the cgi and madrs scales between the two groups . however , the magnitude of the effect was low for all quantitative variables at baseline ( effect size < 0,50 ) so the statistically significant differences observed were of small or negligible clinical relevance .", "most patients in both groups ( 87.9% for dsm - iv ; 82.0% for broad criteria ) were following a pharmacological treatment in the six months previous to the baseline visit . ( 2 ) , benzodiazepines were the most commonly used drugs followed by antidepressants and antiepileptics . at the end of the study , there was an increase in the number of patients under pharmacological treatment ( 97% in both groups , p<0.001 versus baseline in all cases ) . the use of antiepileptic drugs increased by 3.2 and 3.8 fold in the dsm - iv and broad criteria groups , respectively , by the end - of - trial ( p<0.001 in all cases ) . the percentage of antiepileptic drugs users in dsm - iv group at baseline and at 6 months was significantly higher , albeit only slightly ( p=0.002 in both cases , fig . both groups showed a significant reduction in the percentage of benzodiazepines users after 6 months of follow - up ( p<0.001 ) , being this reduction even higher in the broad criteria group ( p=0.011 ) . also a slight but statistically significant increase was observed in the percentage of anti - depressive users in both groups ( p<0.001 , see fig .", "at the study entry , the percentage of subjects in dsm - iv and broad criteria groups that had at least one psychiatric comorbidity was 51.4% and 43.7% , respectively , ( p<0.001 ) . table 2 describes the most frequent psychiatric comorbidities and medical disorders in both study groups . however , neither the mean number of comorbid psychiatric disorders nor the medical illnesses were different between both criteria groups , except for comorbid major depression and other depressive disorders which were slightly more frequent , but statistically significant in dsm - iv group ( p<0.01 and p=0.05 , respectively , table 2 ) . regarding psychiatric disorders , most of them were present around 5 months before the diagnosis of gad , without significant differences between groups in disease evolution . major depression and panic disorders were the most frequent comorbid psychiatric disorders in both study groups . for medical illnesses , chronic pain was present in more than half of patients in both groups , although a higher percentage was seen in dsm - iv group ; 64.3% versus 52.0% , p<0.001 ( table 2 ) .", "anxiety severity was assessed with ham - a and cgi - s scales at 3 and 6 month visits . fig . ( 3 ) shows the evolution of ham - a total and sub - scores over study time in the dsm - iv and broad criteria groups . all ham - a scores improved after 3 and 6 months in both criteria groups . moreover , the percentage of patients without symptoms of anxiety , showing ham - a<9 , increased up to 22.3% and 31.4% at the 3 month visit for the dsm - iv and broad criteria groups ( p<0.001 vs. basal visit in both groups , and p=0.006 between groups ) , and up to 49% and 58% at the 6 month visit ( p<0.001 vs. basal visit in both groups , and p=0.261 between groups ) , indicating similar results for both groups at the end of the study . also , patients responding to anxiety treatment increased when considering the responder criteria ( > 50% reduction of baseline scores ) ; 30.7% and 38.2% for the dms - iv and broad criteria , respectively , at the 3 months visit ( p= 0.004 ) ; increasing up to 59.7% in the dms - iv and 67.7% at the 6 month visit ( p=0.103 ) . 4 ) , differences between criteria groups were statistically significant at the study time points . regarding each gad symptom , fig . ( 5 ) shows the reduction in the percentage of patients presenting with each anxiety symptom . however , higher significant reductions were observed in dsm - iv group for the following symptoms : fatigue , irritability and sleep disturbance ( p<0.05 in all cases , fig . 5 ) . in this study , depression symptoms were evaluated using the madrs . when compared to scores at baseline visit ( table 1 ) , patients in both criteria groups improved their madrs scores with a mean reduction of 12.1 and 12.5 points for the dms - iv and broad criteria groups , respectively ( p=0.264 dsm - iv vs. broad criteria ) .", "mos - sleep scale scores revealed an overall improvement in sleep patterns over study time in both criteria group . as described in table 3 , all sleep domains in the mos - sleep scale changed significantly after 6 months when compared to basal visit scores . differences between the dsm - iv and broad criteria groups were observed for the total score ( p= 0.018 ) , sleep disturbance domain ( p=0.012 ) , sleep quantity ( p=0.016 ) , sleep adequacy ( p=0.031 ) , and sleep problems ( p=0.019 ) scores , always favouring the broad criteria group . health - related quality of life was measured by the eq-5d questionnaire . as seen in table 3 , both the health status ( visual analogue scale ) and the frequency of severe problems in each domain had significantly improved at the 6 month visit in both study groups ( p<0.001 in all cases ) . also , comparisons between both criteria groups in quality - of - life gain by domain were significant in favour of the broad criteria group in health status , daily living activities and mood status . mean qalys gain at the 3 month and 6 month visits were 0.034 and 0.103 years , respectively , for the dsm - iv criteria group and 0.034 ( 3 month ) and 0.101 ( 6 month ) for the broad criteria patients , without statistical significance between groups ( table 3 ) . at the 6 month visit , the percentage of patients reporting an improvement in their health status as compared with that of one year earlier increased by 13.8% for the dsm - iv criteria group , and 16.6% for the broad criteria group ( differences not significant ) . for measuring the disability degree in both groups of patients , the who - das scale was used . as shown in table 4 , there was a significant improvement in all 7 domains of the who - das ii scale after the 6 month follow - up in both criteria groups . the improvements were not significantly different in the dsm - iv group when compared to the new criteria group except for household activity domain , in which the improvement in the dsm - iv group was significantly better when compared to the broad criteria group . nevertheless , a trend toward statistical significance was observed in the total scoring of the disability scale favouring broad criteria group .", "this real world prospective study in usual medical practice has shown that broadening of gad dsm - iv diagnostic criteria , by reducing the duration of excessive or non - excessive worry to one month and associated symptoms to two , does not significantly affect patient s responsiveness to psychiatrist - prescribed therapy . the patient sample of this study seems to be similar to other gad populations presented in previous studies , with a higher prevalence among women and among those aged above 25 years [ 4 , 18 ] . the most frequent comorbid psychiatric disorder was major depression ; however , its presence was somewhat smaller than the observed in other studies , if we take into account major depression only . the main goal when treating a gad patient is to improve the symptoms , hopefully leading in the long - term to their complete remission and to recovery of patient s functionality . several guidelines recommend antidepressants , such as the selective serotonin reuptake inhibitors and the serotonin noradrenalin reuptake inhibitors , and antiepileptics as first line treatments , and benzodiazepines as second - line treatment [ 28 , 29 ] . although patients in this study received a confirmatory diagnosis of gad , a high percentage of them were already following a therapy recommended for gad at baseline . these results suggest that , in our sanitary context , general practitioners and/or family physicians start treatment to control anxiety symptoms , mostly with benzodiazepines , at patients first complaint . the general practitioner / family physician usually refers those patients with lower treatment response than expected to the psychiatrist . it should be taken into account that refractory patients may be difficult to manage at the primary care level in the spanish health system . one of the reasons is the brief period of time devoted by physicians to each patient visit in the spanish primary health care level , as described by duran et al . . other studies have explored the consequences of broadening dsm - iv diagnostic criteria for gad [ 3 , 13 , 15 - 16 , 31 ] . most of them have considered a reduction in the duration criteria [ 3 , 16 ] , the excessiveness of worry , and the number of associated symptoms . a possible learning from all of them is that the socio - demographic characteristics between the populations diagnosed with broad or strict dsm - iv criteria are not substantially different . as expected , the broadening of dsm - iv gad criteria results in an increase in the point - prevalence to more than double [ 15 - 16 ] . concluded that the increase was mainly due to the reduction of minimum duration to one month . in regards to gad s severity , ruscio \n et al . observed a tendency to reduced severity for the broad criteria group , however we have observed a similar tendency suggesting that patients diagnosed with broader gad criteria present a slightly less severe form of the disease . every study that has investigated the possibility of broadening the dsm - iv criteria has done it retrospectively [ 13 , 15 , 16 , 27 , 31 , 32 ] . the present study is the first one to compare two groups of gad patients with dsm - iv and broader criteria following a prospective design . according to our results , broadening of gad diagnostic criteria does not affect the response to the prescribed therapy , since ham - a scores , total and domains , improved similarly in both groups , and so did the presence of gad symptoms ( fig . a significant improvement was perceived by physicians ( cgi - s scores ) at the end of the study . the influence of broader gad diagnostic criteria in patient s disability has been studied previously by lee \n et al . lee et al . observed an increase in the sheehan disability scale score when increasing time for the duration criteria although it was not statistically significant . the same observation was made by kessler et al . with data from the ncs . parallel to their clinical improvement , patients in our study experienced an improvement in the studied quality of life variables . health status improvements in our study were similar to those observed in primary care patients receiving treatment over six months for their gad . the biggest improvements were observed in the daily living activities and mood domains of the eq-5d . qalys gain observed corresponded to more than one month of perfect health for both groups ; which were similar in magnitude to that observed in other health conditions such as trigeminal neuralgia , successfully treated with pregabalin . all other dimensions of functionality included in the who das - ii scale , and sleep scale were substantially ameliorated in both study groups by the end - of - trial ; however , the differences in the magnitude of these improvements for both groups were hardly meaningful from a clinical point of view . results from this study should be interpreted bearing in mind its observational design with its inherent limitations . since this study is based on out - patient psychiatric clinics , patients included in this study might not be representative of the whole gad population , since psychiatrists could deal with more severe and refractory cases . also , due to the high degree of expertise required for participant psychiatrists , diagnosis in our study may have been more accurate than in other settings , such as primary care . a consequence of broadening gad criteria in other healthcare settings could be the difficulty in distinguishing gad from adjustment disorders or situational stress reactions by other less trained physicians . in this study there was a high proportion of patients treated with antiepileptics ; that could be explained by the fact that most subjects included in the study were non responders to recommended first line drug treatment according to the european guidelines on the treatment and management of gad patients . finally , as this was a real world prospective study we did not have a control group so further clinical research with randomized controlled studies and newly diagnosed patients needs to be carried out to confirm the consequences of broadening the criteria .", "broadening criteria for gad diagnosis , by reducing excessive and non - excessive anxiety and worry duration to one month and the number of associated symptoms to two , captures a similar population of patients compared to the one identified by applying standard dsm - iv criteria . broadening diagnostic criteria is able to identify the core symptoms of gad according to the dsm - iv criteria and could lead to an earlier diagnosis .", "funding for this study was provided by pfizer spain ; pfizer spain participated in the idea and design of the study . enrique lvarez , jose l. carrasco and jos m. olivares declare not to have any conflict of interests as a consequence of participating in this study . inma vilardaga was employed of the european biometric institute , a consulting agency which was responsible for logistic of study and analysis of data . mara perez and vanessa lpez - gmez are employed by pfizer spain , the body funding the study ." ]

[ "renal clear cell carcinomas represent about 3% of all visceral cancers and account for 85% of renal cancers in adults . the tumours occur most often in older individuals , usually in the sixth and seventh decades of life , and are often diagnosed at incurable stages . in western countries the frequency of renal cancer remains relatively high , there being approximately 30,000 new cases and 12,000 deaths per year from the disease . the causes of kidney cancer are believed to be environmental ( such as cigarette smoking , asbestos , petroleum products , heavy metals , unopposed oestrogen therapy , hypertension and obesity ) , genetic or a mixture of both . to date there are 19 hereditary syndromes described in which renal cell cancer may occur ( table 1 ) . genetic syndromes characterised by an increased risk of renal cancer ( familial cancer database - facd , http://facd.uicc.org ) the identification of genetic predispositions to renal cell cancer remains a priority since knowledge about the underlying molecular genetic basis of the disease will allow for a better understanding of the mechanisms giving rise to the disease and , perhaps more importantly , allow for the identification of individuals who are at risk of disease development . there are two aspects of these criteria that can be problematic in the clinical setting with respect to the identification of familial renal cell cancer patients . the first is the difficulty in fulfilling criteria in countries where large families and extensive pedigrees are impossible to identify , for whatever reason , even though the incidence of hereditary renal cell cancer may be quite high . second , the criteria do not take into consideration the existence of family cancer syndromes where renal cell cancer may occur in association with an extra - gastric malignancy . from a clinical perspective , there is a necessity to be able to identify hereditary renal cell cancer families with a minimum set of criteria that will provide a high likelihood of ascertainment . the aim of this study was to determine whether a minimum set of criteria could be established to identify suspected hereditary renal cell cancer patients when there is restricted information about the familial occurrence of disease .", "a total of 146 clear cell renal carcinoma ( ccrc ) patients comprising 3 groups were enrolled in the study . group a ( familial renal cancer ) : comprising 46 patients affected by ccrc from 22 randomly selected families with at least two renal cancers among first or second degree relatives , independent of age at diagnosis of tumours . group a1 ( nuclear pedigree ) : comprising 25 patients affected by ccrc from group a. none of the parents of these patients have been diagnosed as affected with renal cell cancer . group b : a total of 100 individuals diagnosed with ccrc between the years 1993 and 1997 irrespective of family history were collected from the city of szczecin ( total population 400,000 ) . the following inclusion features ( if ) for the identification of suspected hereditary forms of clear cell renal cancer were used and compared against one another for their sensitivity and specificity : if 1 : at least one of the parents of the patient with ccrc was affected by lung cancer if 2 : at least one of the parents of the patient with ccrc was affected by gastric cancer if 3 : ccrc diagnosed at the age of 45 years or younger if 4 : ccrc diagnosed at the age of 50 years or younger if 5 : ccrc diagnosed at the age of 55 years or younger univariate statistical analysis ( chi - squared , odds ratio ( or ) , and sensitivity and specificity of selection were performed using the sas and logit programs .", "univariate statistical analysis ( chi - squared , odds ratio ( or ) , and sensitivity and specificity of selection were performed using the sas and logit programs .", "the comparison of the five ifs was undertaken to identify the most consistent criteria that can be employed in a clinical setting for the identification of suspected hereditary renal cell cancer , based on nuclear pedigree data . the first comparison was between group a ( associated with a genetic predisposition to disease ) compared to unselected cases from group b ( table 2 ) . the results indicate that all inclusion features are more frequent in group a ( or 1.62 - 4.88 ) . the second comparison was performed between group a1 and group b ( table 3 ) . the results indicate that there is a very strong correlation between hereditary ( familial ) predisposition to ccrc and occurrence of at least one of the following ifs : if1 , if2 or if5 - or 13.4 ; p < 0.00001 .", "the recognition of features that can be used for the identification of familial predispositions to ccrc in situations where extensive pedigree analysis is unknown or impossible to ascertain but the prevalence of the disease is relatively high in the population will aid in the identification of individuals at increased risk of developing ccrc . by using the criteria described herein and the consequent recognition of significant odds ratios for some of the inclusion features to identify ccrc families , we believe that the identification of additional genes associated with this malignancy will be expedited . of particular interest are the odds ratio values for the inclusion features if5 between groups a1 and b and if 1 between groups a1 and b , which were relatively high ( 6.21 and 6.09 , respectively ) . since these inclusion features are significant we have a relatively high degree of confidence that the reported observations are not biased and are an accurate reflection of the validity of our approach for the identification of hereditary ccrc families . indeed , these criteria have been tested in our outpatient clinics to successfully identify hereditary ccrc . therefore if we have families matching if1 or if2 or if5 , we are confident that a diagnosis of familial ccrc can be made . at present it seems reasonable to offer the option of ultrasonography examination to all individuals identified by the use of our inclusion features beginning at the age of 5 to 10 years before the youngest ccrc identified within the patient 's family . such surveillance should only be an option and not a recommendation because the efficiency of such management procedures has not been rigorously determined to reduce morbidity and/or mortality . with respect to surveillance the real value of this will have to be established by studies on large cohorts of individuals from families matching pedigree and clinical criteria of suspected hereditary ccrc with identified constitutional dna variants associated with genetic predispositions . so far , the list of genetic changes associated with ccrc is somewhat limited but should be extended in the near future as more knowledge is gained about the genetic factors associated with altered ccrc predisposition . in summary , we advocate the use of our criteria for suspected hereditary clear cell renal cancer identified in this report in order to : a. offer an ultrasound examination option , b. create repositories of nuclear clear cell renal cancer families for future studies on the efficiency of surveillance for individuals with genetic predispositions to renal cancer , c. perform further studies to aid in the identification of genetic factors associated with ccrc ." ]

[ "intracranial hypotension syndrome ( ihs ) is characterized by a postural headache that is aggravated in the erect or sitting position and relieved in the supine position . it is often associated with one or more of the following symptoms : nausea , vomiting , dizziness , diplopia , photophobia , hearing impairment , neck stiffness , and blurred vision6 ) . acquired or secondary intracranial hypotension is less common but has been reported after spinal procedures such as lumbar discectomy and dural puncture for myelogram , spinal anesthesia . we report a case of a 54-year - old man who was successfully treated with epidural blood patches for intracranial hypotension due to csf leakage into the lumbosacral area after l4 - 5 discectomy .", "a 54-year - old male admitted to the er complaining of headache \n from 13 days ago . it did not occur when lying down but became intensely squeezing around the occipital area within 10 seconds after being seated or standing . past medical history was insignificant other than undergoing l4 - 5 laminectomy and discectomy at a local hospital 15 days ago . physical examination did not display any neurologic findings such as neck stiffness and laboratory results as well as brain mri findings were not remarkable . under the strong impression of intracranial hypotension , he admitted to neurology department and underwent conservative therapy including absolute bed rest ( abr ) and hydration . a mr myelogram was performed , showing a pseudomeningocele accompanied by large csf leakage in the lumbosacral area ( fig . because resolution of symptoms was unsatisfactory , an epidural blood patch was placed on the sixth admission day . after placing the patient in a prone position , a 22 gage touhy needle was inserted through the l5-s1 epidural space through a paraspinal method . after confirming the epidural space by the loss - of - resistance technique , a dye was injected to confirm the epidural space with the c - arm . after three days of abr following the procedure , the patient practiced changing positions by sitting . five days after the procedure , the patient did not complain of any symptoms ( vas 0 ) . 2 ) . we decided to perform one more procedure of epidural patch placement because of the residual csf leakage 6 days after the first intervention . a total of 10 ml autologous blood was injected , and the patient was discharged the next day . follow up for six months confirmed no recurrence of symptoms ( fig .", "intracranial hypotension syndrome can occur spontaneously . acquired or secondary intracranial hypotension is less common but has been reported after spinal procedures . reported that the incidence of incidental durotomy during spine surgery was 3.84% in patients who underwent spinal surgery at a single spine unit5 ) . in one study looking into medicolegal aspects of spine surgery , 146 malpractice cases were reviewed and incidental durotomy was second most frequent complication in such cases4 ) . the study has shown that potentially serious problems such as pseudomeningocele , csf fistula formation , meningitis and arachnoiditis with subsequent chronic pain are all related to dural tears and csf leakage after spinal surgery . good long - term clinical results were noted in all patients with durotomy repaired at identification and are comparable to long - term results of patients undergoing similar surgical procedures but without durotomy . however , cammisa et al.1 ) reported the incidence of clinically significant durotomy occurred during surgery but not indentified at the time was 0.28% , and patients had subsequent surgical repair of dural defects because of failure of conservative therapy . in one study which investigated incidental durotomy during spine surgery and its treatment , in addition to primary repair , drain , bed rest , hydration , antibiotics had been used for treatment by spine surgeon7 ) . however to our knowledge , there have been no previous studies which compared the effects of epidural blood patch for the treatment of incidental durotomy with other treatments . epidural blood patch has been employed over the last five decades in the treatment of postdural puncture headache ( pdph ) and has proven to be beneficial . the mechanism by which an epidural blood patch ( ebp ) relieves pdph is not known . the \" plug \" theory for symptom resolution proposes that the blood injected during ebp forms a gelatinous plug , sealing the dural hole and preventing further csf leak into the epidural space . in the absence of continued loss , regeneration of csf restores csf pressure and alleviates the headache3 ) . the \" pressure patch \" hypothesis emphasizes the impact of injected blood or other fluid ( crystalloid or colloid ) on the pressure dynamics of the cns . the injected fluid increases epidural pressure which , in turn , elevates subarachnoid csf pressure by compressing the dura8 ) . the optimal volume of blood that must be injected is controversial but recommended volumes have increased over time . crawford 's initial experience using 6 - 15 ml produced a 30% failure rate while later experience with 20 ml produced a 96% success rate , so 20 ml became the recommended volume and has since become commonly cited as a \" target volume \" to enhance patch efficacy2 ) . however , the effects of ebp in intracranial hypotension are mostly focused on post - dural puncture during csf tapping or spontaneous intracranial hypotension . even patients with rather large amount of csf leakage and patients with severe complications such as intracranial hematomas have been effectively treated with ebp , so we considered epb for postoperative incidental durotomy due to such evidence . the effects of ebp in postoperative intracranial hypotension can not be discussed after one successful clinical trial , but additional trials and studies can provide the basis of epb treatment in such cases . when incidental durotomy was recognized postoperatively , conservative therapy or surgical correction has been the therapeutic choice . however , because there has been no report on indication for ebp according to the degree of dural injury or the size of peudomeningocele , additional research is needed . in our case , the patient underwent l4 - 5 spine surgery at a local orthopedic , but dural injury was not recognized at that time . after admitting to our hospital , there was no significant resolution of symptoms after conservative therapy including the five days of bed rest and hydration .", "epidural blood patch can be used as an effective treatment modality for csf leakage after lumbar spine surgery ." ]

[ "pituitary insufficiency in childhood is often secondary to pituitary or hypothalamic \n space - occupying lesions . the differential diagnosis in etiologies of a mass in the sella is \n broad in spectrum , including rathke s cyst , tumor , autoimmune diseases , primary or \n metastatic neoplasms , and granulomatous inflammation . among them , xanthomatous pituitary \n diseases are rare in childhood . these conditions include xanthomatous hypophysitis , \n xanthogranulomatous hypophysitis and xanthogranuloma of the sellar region ( 1,2,3,4,5 ) . xanthogranuloma of the sellar region is characterized \n by a granulomatous lesion containing cholesterol clefts , macrophages , chronic inflammatory \n infiltrates , and hemosiderin deposit ( 6 ) . this \n condition has been traditionally regarded as a hallmark of the adamantinomatous \n craniopharyngioma even in the absence of epithelium ( 6 ) . however , paulus et al . ( 7 ) suggested that \n xanthogranuloma is likely to constitute a different entity from the classical \n adamantinomatous craniopharyngioma clinically and pathologically . after their original \n report , several patients with xanthogranuloma of the sellar region have been described \n ( 8 , 9 ) . \n however , to our knowledge , there is no detailed clinical report of xanthogranuloma of the \n sellar region in cases of pediatric age . here , we report the cases of two children with \n xanthogranuloma of the sellar region , presenting central diabetes insipidus ( di ) .", "a 9-yr - old japanese boy was referred to our clinic because of a 6-mo history of polyuria \n and polydipsia . his height was 135.3 \n cm ( + 0.7 sd ) and body weight 29.9 kg . the growth hormone ( gh ) releasing \n hormone ( ghrh ) and the thyroid stimulating hormone releasing hormone ( trh ) tolerance tests \n showed subnormal responses of gh and tsh , respectively ( table 1table 1 endocrinological findings of cases 1 and 2 ) . the corticotropin releasing hormone ( crh ) tolerance test showed normal \n responses of acth and serum cortisol ( table \n 1 ) . magnetic resonance imaging ( mri ) the mass was hyperintense on the \n t1-weighted ( a ) and in the t2-weighted images ( b ) . the pituitary stalk deviated \n to the frontal direction and the anterior pituitary gland was compressed by the tumor . \n there was no calcification of the mass detected by computed tomgraphic ( ct ) scan . cyst was suspected preoperatively by the mri findings , however a definite diagnosis could \n not be made . the capsule of the tumor \n had tightly adhered to the dura of the sellar floor . histological examination of the tumor showed fibrous tissue with cholesterol \n clefts , macrophages , multinucleated giant cells , and lymphocyte infiltration ( fig . ( b ) macrophages ( white arrowheads ) \n and multinucleated giant cells ( black arrowheads ) were observed . postoperatively , di remains and has been treated with desmopessin \n acetate ( ddavp ) . two months after surgery , gh and tsh responses after stimulation tests \n recovered ( table 1 ) . after one - year follow - up , the patient continues to have di , but his basal \n levels of igf-1 , ft3 , ft4 and tsh are within normal ranges . radiological appearance on magnetic resonance imaging ( mri ) . the mass was hyperintense on the \n t1-weighted ( a ) and in the t2-weighted images ( b ) . ( b ) macrophages ( white arrowheads ) \n and multinucleated giant cells ( black arrowheads ) were observed . a 6-yr - old japanese boy was admitted to our hospital for evaluation of polyuria and \n polydipsia of 6-mo duration . his \n height was 113.2 cm ( 0.8 sd ) and body weight was 18.8 kg . brain mri showed an intrasellar mass , which was high on the t1-weighted ( fig . gadolinium \n administration caused no enhancement of the mass . ) and hypointense on the t2-weighted images ( fig . \n ghrh , trh , and crh \n tolerance tests showed normal responses one month after surgery ( table 1 ) . the patient is currently well only on ddavp \n medication , 12 mo after surgery .", "a 9-yr - old japanese boy was referred to our clinic because of a 6-mo history of polyuria \n and polydipsia . his height was 135.3 \n cm ( + 0.7 sd ) and body weight 29.9 kg . the growth hormone ( gh ) releasing \n hormone ( ghrh ) and the thyroid stimulating hormone releasing hormone ( trh ) tolerance tests \n showed subnormal responses of gh and tsh , respectively ( table 1table 1 endocrinological findings of cases 1 and 2 ) . the corticotropin releasing hormone ( crh ) tolerance test showed normal \n responses of acth and serum cortisol ( table \n 1 ) . magnetic resonance imaging ( mri ) the mass was hyperintense on the \n t1-weighted ( a ) and in the t2-weighted images ( b ) . the pituitary stalk deviated \n to the frontal direction and the anterior pituitary gland was compressed by the tumor . \n there was no calcification of the mass detected by computed tomgraphic ( ct ) scan . cyst was suspected preoperatively by the mri findings , however a definite diagnosis could \n not be made . the capsule of the tumor \n had tightly adhered to the dura of the sellar floor . histological examination of the tumor showed fibrous tissue with cholesterol \n clefts , macrophages , multinucleated giant cells , and lymphocyte infiltration ( fig . ( b ) macrophages ( white arrowheads ) \n and multinucleated giant cells ( black arrowheads ) were observed . postoperatively , di remains and has been treated with desmopessin \n acetate ( ddavp ) . two months after surgery , gh and tsh responses after stimulation tests \n recovered ( table 1 ) . after one - year follow - up , the patient continues to have di , but his basal \n levels of igf-1 , ft3 , ft4 and tsh are within normal ranges . radiological appearance on magnetic resonance imaging ( mri ) . the mass was hyperintense on the \n t1-weighted ( a ) and in the t2-weighted images ( b ) . ( b ) macrophages ( white arrowheads ) \n and multinucleated giant cells ( black arrowheads ) were observed .", "a 6-yr - old japanese boy was admitted to our hospital for evaluation of polyuria and \n polydipsia of 6-mo duration . his \n height was 113.2 cm ( 0.8 sd ) and body weight was 18.8 kg . brain mri showed an intrasellar mass , which was high on the t1-weighted ( fig . . the mass had a high appearance on the t1-weighted \n images ( a ) . gadolinium \n administration caused no enhancement of the mass . ) and hypointense on the t2-weighted images ( fig . \n ghrh , trh , and crh \n tolerance tests showed normal responses one month after surgery ( table 1 ) . the patient is currently well only on ddavp \n medication , 12 mo after surgery .", "we report the cases of two children with xanthogranuloma in the pituitary region with di . \n xanthogranuloma in the sellar region has been traditionally considered to be a variant of \n adamantinomatous craniopharyngioma despite the lack of epithelium ( 6 ) . however , paulus et al . ( 7 ) \n reviewed histological sections of 110 patients diagnosed with craniopharyngioma and found \n sections from 37 patients were exclusively or predominantly composed of xanthogranulomatous \n tissue . according to their study , pathological findings were characterized by cholesterol \n clefts ( 100% ) , macrophages infiltrates , lympho - plasmacelluar infiltrates ( 100% ) , marked \n hemosiderin deposits ( 97% ) , fibrosis ( 87% ) , and foreign - body giant cells around cholesterol \n clefts ( 86% ) . only sections from 3 of these patients had small adamantinomatous components \n ( corresponding to calcifying odontogenic cyst ) , which are histological features of \n adamantinomatous craniopharyngioma . based on these findings , paulus et al . suggested that \n xanthogranuloma of the sellar region is pathologically distinct from adamantinomatous \n craniopharyngioma . in our two patients , histological findings of cholesterol clefts , \n macrophages including cholesterol droplets , multinucleated giant cells , lymphocytes , and the \n absence of adamantinomatous components are consistent with those previously reported by \n paulus et al . clinically , xanthogranuloma in the sellar region has been reported to cause severe \n endocrinological deficits ( 7 ) . ( 9 ) also described one adult japanese patient with \n xanthogranuloma in the pituitary showing panhypopituitarism . by contrast , our patients did \n not have severe defects of anterior pituitary hormones and showed only central di . in the \n first report , xanthogranuloma of the pituitary in children was reported , but the frequency \n in children , and the clinical and endocrinological findings were not mentioned ( 7 ) . to answer whether clinical manifestations of \n xanthogranuloma in children are different from those of adults , more patients with \n xanthogranuloma of pediatric age must be studied . if xanthogranuloma is different form adamantinomatous craniopharyingioma , what is the \n origin of xanthogranuloma in the sellar region ? xanthogranulomatous inflammation ( also known \n as cholesterol granuloma ) has been reported in various tissues such as the middle ear , \n mastoid , and choroid plexus . also the obstruction of the gall \n flow has been considered to cause inflammation , eventually developing to xanthogranulomatous \n cholecystitis ( 11 ) . in addition , it is suggested that \n rathke s cyst and neuroepithelial cyst may undergo xanthogranulomatous changes ( 12 , 13 ) . taken \n together , xanthogranuloma of the sellar region is likely to represent a non - specific tissue \n reaction to hemorrhage or degenerative changes originating from heterogeneous etiologies . it \n may be plausible that xanthogranulomas of our patients were responses to ruptured cysts , \n however , no confirmation of pre - existing cysts has been identified . xanthogranuloma is difficult to differentiate from craniopharyngioma and rathke s cyst by \n mri findings . cystic \n and solid lesions may have any pattern of signal intensity on the t1 and t2-weighted images , \n although most often they are hypointense to isointense on the t1-weighted images and \n hyperintense on the t2-weighted images . on ct , craniopharyngiomas typically appear as \n moderate - to - large , partially calcified mass . rathke s cysts are present as intrasellar \n masses . as with craniopharyngiomas , the signal characteristics are variable on the t1 and \n t2-weighted images due to the variable quality of the cyst fluid . in our two patients , \n previously , two \n reports have also described xanthogranuloma as hyperintense on t1-weighted images ( 8 , 9 ) . in addition , \n there was no calcification of masses in our patients , as well as in previous reports ( 8 , 9 ) . these points \n may be helpful in considering xanthogranuloma of the pituitary region . however , there is no \n reliable way to distinguish xanthogranuloma from craniopharyngioma and rathke s cyst without \n histological examination . in conclusion , currently , whether this condition is a truly distinct entity or merely a different \n manifestation of adamantinomatous craniopharyingioma is unclear . to clarify the natural \n history , pathogenesis and prognosis in childhood , further accumulation of well - characterized \n pediatric cases with xanthogranuloma" ]

[ "a 52-year - old female patient visited the hospital complaining of pain in both breasts . the pain started immediately after breast reduction surgery she underwent 3 years previously at a private plastic surgery hospital , and it had continued despite a subsequent surgery . the pattern of the pain included burning , shooting and itching sensations at the operation site as well as unbearable burning sensations when the patient was in the places where the temperature was higher than normal . the pain as measured by the visual analogue scale ( vas ) was approximately 70/100 mm . in particular , the degree of pain was dependent on the season , and it was unbearable under hot weather , with the patient complaining of pain at vas 80 - 90/100 mm . before coming to the hospital , the patient had taken aceclofenac ( airtal , daewoong pharmaceutical ) 200 mg , pregabalin ( lyrica , pfizer ) 300 mg , acetaminophen 1,300 mg and tramadol hcl 150 mg ( ultracet , janssen korea ) per day , but the pain was not relieved . thus , the patient tried pregabalin 600 mg , acetaminophen 1,300 mg and tramadol hcl 150 mg per day , but there was no effect . complaining of dizziness due to ultracet , the patient started to take 20 mg of oxycodone hcl ( oxycontin , mundipharma korea ) each day , but she eventually stopped taking it because of dizziness , nausea , and vomiting . subsequently , the patient underwent drug treatment with pregabalin 300 mg a day , but she visited the hospital because the pain did not subside . there was no specific finding in a simple plane chest x - ray spectrograph , while digital infrared thermographic imaging ( diti ) showed a slight temperature drop in both breasts . because the previous treatments were not effective in improving the symptoms and because the patient wanted another method of treatment due to the continued pain , it was decided that a thoracic epidural block would be performed , and informed consent was obtained from the patient . the patient was laid on her side and the epidural space was checked using the loss - of - resistance method with a 22-gauge epidural needle ( hakko , japan ) in between the t4 and t5 , applying an aseptic technique in the interlaminar approach . 0.5% mepivacaine hcl ( emcaine 2% inj. reyon pharm ) 6 ml was then injected . the pain was relieved into the vas range of 40 - 50/100 mm after the procedure , and the patient was discharged . the vas was decreased to 40 - 50/100 mm after an additional procedure a week later , but the patient complained of continued pain . a decision was made to carry out prf to the spinal nerve and its root and . to measure the level and determine the effect , informed consent was received from the patient after she was provided with an explanation of the procedure and the side effects that may occur after the procedure . for the diagnosis , selective nerve root block ( snb ) was performed at t3 , t4 and t5 , one level each time in order with an interval of 2 days , by injecting 1% lidocaine 0.5 ml with a 25-gauge quincke needle ( spinocan , bbraun ) . prf was carried out at the fourth thoracic spinal nerve and its root after giving an explanation to the patient about the procedure and the side effects that may occur after the procedure and receiving informed consent once again . after supporting the patient 's lower abdomen with a pillow and placing her in a prone position , the site of the procedure was disinfected by a common sterilizing method and a standard monitor was attached . the area between t4 and t5 was identified in the anteroposterior view using a c - arm device and the 4 cm point right lateral from the t4 spinous process was chosen as the needle implantation point . local anesthesia was carried out with 1% lidocaine , and a 20-gauge 10 cm long rf cannula ( owl sharp curved rf insulated cannula , diros technology inc . , usa ) with a 10 mm - active tip was then introduced into the anesthetized part . by continuously monitoring the position of the cannula with the c - arm , it continued to the inferior of end plate of fourth thoracic vertebral body ( fig . 1 ) , and the tip of the cannula was located at the posterior border of the vertebral space in the lateral view ( fig . 3 ) , and an rf generator ( rfg-3c plus , radionics , usa ) was then connected and an electric stimulus of 50 hz at 0.1 volt was applied . electric stimulus of 2 hz at 0.1 volt was applied , and it was verified that the muscle did not contract up to 0.8 volt . one minute after injecting 1% mepivacaine 1 ml , prf was performed two times for 120 seconds at 42. the same procedure was performed on the opposite side after one week . during the procedure , the vital signs of the patient were normal and no side effect took place . after the procedure , the pain was reduced to vas 20 - 30/100 mm . the patient currently undergoes oral administration of pregabalin 300 mg / day and nortriptyline ( sensival , ilsung pharm ) 10 mg / day and this was followed up at the hospital for 9 months without particular exacerbation of the pain or any other inconvenience in her daily tasks .", "pain after breast surgery , which is commonly complaint by patients , is known to be related with the injury , ischemia and inflammation of the soft tissue . if the pain in the affected part and arm continues for one year after the surgery , it is considered as chronic pain in general . the mechanism is not yet accurately known , but the chronic pain may be caused by injuries in various peripheral nerves that arise during the surgery and can develop into neuropathic pain such as stabbing , pricking , burning , shooting and sharp pains . wallace et al . investigated 282 women who underwent different types of breast surgery , and their result showed that 31% of women who underwent mastectomy , 49% of those who underwent mastectomy with reconstruction , 38% of those who underwent cosmetic augmentation and 22% of those who underwent breast reduction complained of pain up to one year after the surgery . particularly , as the survival rate of breast cancer patients has increased , the number of patients who complain of chronic pain after breast cancer survey has also increased . the patient in this case study was also a chronic neuropathic pain patient whose pain had continued for 3 years following breast reduction surgery . she complained of pricking , shooting and burning sensations at the site of the operation . although the patient complained of pain immediately after the surgery , she continued to suffer neuropathic pain for 3 years without being given appropriate pain treatment because she was not able to take medicine due to the side effects of the drugs . macrae stated that severe acute pain after the surgery may be a risk factor for chronic pain . this can be one possible cause of the chronic pain of the patient in this case report , because she complained severe pain at vas 70 - 80/100 mm immediately after the surgery but the pain was not properly controlled . in general , it is thought that the intercostal nerve ( icn ) from t1 to t6 and the nerves that originate from those braches can be damaged by breast surgery . for the patient in this case report , because she complained of the pain at the dermatome of the t4 spinal nerve , neuropathic pain caused by damage at the 4th icn and at the branch was suspected . the effect of a nerve block in controlling pain after breast surgery is well known . in particular , it was reported that a paravertebral block ( pvb ) reduced pain , nausea and vomiting after breast surgery . in addition , kairaluoma et al . reported that preoperative pvb reduced chronic pain after breast surgery . these results show that a nerve block can be used in controlling pain following breast surgery effectively , preventing it from becoming chronic . a nerve block using a local anesthetic is easy to perform in the treatment of pain and is effective in reducing pain . however , because the duration of desensibilization may not be sufficient depending on the disease causing the pain and because many repeated procedures may be required , radiofrequency thermocoagulation is sometimes employed to maintain the effect of the nerve block . radiofrequency thermocoagulation was first introduced in 1930 's by kirschner , who applied it treating trigeminal neuralgia at the gasserian ganglion . recently , the application of radiofrequency thermocoagulation in the case of various diseases has gradually increased as quality of the radiofrequency generator , the associated equipment , and the catheter needle has been improved . this treatment is highly advantageous , in that a more accurate lesion can be generated compared to other nerve - destructive procedures . moreover , the mechanism of radiofrequency thermocoagulation is known to change the nerve tissue due to the heat around the electrode , blocking and the inflow of the nerve stimulus . on the other hand , prf was introduced as a new method because another mechanism of radiofrequency - aided treatment arises in that a clinical effect is noted by the heat applied to the nerve and the electromagnetic field that forms around the electrode . prf is a radiofrequency - aided treatment in which pulsed radiofrequency stimulus of 20 msec is generated two times every 0.5 second at a temperature of 42 , which is low enough for the nerve tissue to remain undamaged . prf is a novel treatment method that has corrected the problems of previous radiofrequency - aided treatments based on heat . it does not cause nerve destruction , side effects such as neuritis , or the complications of other types of radiofrequency - aided treatments based on heat . it can be performed to treat neuropathic pain even for body parts where side effects take place frequently due to radiofrequency thermocoagulation . it can be also performed on parts near bone or scar tissue , where the risk of complications is high when radiofrequency thermocoagulation is performed . rohof applied prf to the suprascapular nerve in the treatment of chronic shoulder pain and reported it to be a novel treatment method that is free from side effects or complications , in contrast to the conventional thermocoagulation . moreover , positive effects were reported when prf was applied to peripheral nerves such as the facial nerve , superior laryngeal nerve , suprascapular nerve , intercostals nerve , obturator nerve and the joint - dominating peripheral nerve articular branch , whose main nerve is sensory . in this case report as well , although the pain was controlled by an epidural block with a local anesthetic , repeated procedures were required due to the short duration of the first treatment . long - lasting pain reduction was achieved without any specific side effect , as the prf was carried out on the spinal nerve and its root under monitoring by a c - arm device . in this article , we report a case in which prf was applied to control the pain of a patient who came to the hospital complaining of chronic severe neuropathic pain at the operation site that arose after breast reduction surgery . appropriate pain control after breast surgery can reduce the suffering of the patient due to early pain and greatly affect the quality of life of the patient by preventing the pain from being chronic . if an appropriate pain treatment had been given after breast surgery to the patient in this case report , she would have not suffered from chronic pain . in the case of breast surgery , considerable attention should be paid to postoperative pain as well as surgical pain , and pain treatment should be carried out positively . it is thought that a nerve block as well as general analgesics can be helpful as a pain control strategy . in addition , prf may be helpful in reducing the pain of the patients who are not responsive to a nerve block using analgesics or local anesthetics . furthermore , additional studies are needed regarding the reduction of chronic neuropathic pain by prf after breast surgery ." ]

[ "the generation of expressed sequence tags ( ests ) was originally proposed as a strategy for cdna characterization over a decade ago ( 1 ) . subsequent improvements in sequencing methods and dramatically reduced unit costs have increased the attractiveness of the est - based research , such that it is now one of the most widely employed methods used for gene discovery and genome characterization . consequently , the number of organisms with est sequences deposited in the genbank dbest database is increasing rapidly ( ) . to maximize the value of these ests , ncbi has built unigenes that incorporated est data for a number of species ( ) , and the institute for genomics research ( tigr ) has been working on the gene indices for more than 70 species ( ) . annotating est and cdna sequences two tools that have been designed for locating protein - coding regions in cdna and est sequences are orffinder ( ) and estscan ( ) , respectively . the estscan server is designed for processing a batch of est sequences for identifying the protein - coding regions with a function for correcting insertions or deletions , but it is only trained for mammals and yeast . we tested estscan with our aspergillus niger est sequences and found that the results were not satisfactory . for example , using a full - length cdna sequence encoding glucoamylase , a well - characterized enzyme in a.niger , we found that estscan could not identify its correct coding region and had the undesired side effect of inserting nucleotides even when the test sequence was correct . we have implemented a web server called orfpredictor for the prediction of protein - coding regions within est - derived sequences . the algorithm uses the translation reading frames predicted by using blastx ( 2 ) as a guide for the identification of the coding region in sequences that have a hit ( 3 ) and predicts a coding region ab initio for sequences without a hit .", "a mature eukaryotic mrna molecule , starting from the 5 end , typically consists of a 5 cap , a 5-untranslated region ( 5-utr ) , a protein - coding region [ open reading frame ( orf ) ] and a 3-utr followed by a poly(a ) tail . the protein - coding region extends from the start codon aug ( atg in a cdna ) and continues until the reading frame defined by the start codon is terminated by one of three translation stop codons , uga , uaa or uag . most cdna libraries are constructed using oligo(dt ) primers to direct first - strand synthesis by reverse transcriptase . essentially , all clones in oligo(dt ) primed cdna libraries will therefore include information for the 3 end of the processed transcript and a poly(a ) region . ests are single - pass sequencing reads obtained from either the 5 or 3 end of the cdna insert . the high - quality sequence obtained using systems , such as abi 3730xl , is typically 700800 nt per read . given that the 3- and 5-utrs are typically much shorter than 500 nt , most ests and the consensus sequences ( contigs ) generated by an est assembler are expected to include some coding sequence useful for predicting gene function . in the annotation and analysis of ests , overlapping est sequences are often assembled into contigs to remove redundancy , reduce the frequency of sequencing errors and extend the length of sequence derived from each mrna species . assuming the ests are sequenced from the 5 end , sequence information from contigs and individual ests fall into 10 categories ( figure 1 ) as follows : \n a full - length sequence that includes the 5-utr with one or more stop codons ( 5 stop codon ) , translation start codon , complete protein - coding region , translation stop codon and the 3-utr . the protein - coding orf may have internal atg codons and the 3-utr may possess multiple stop codons . the 5-utr may be truncated.a full - length sequence as defined for category ( a ) , except that it does not contain any 5 stop codons.a partial sequence that has a portion of the 5-utr , one or more 5 stop codons , the start codon and a portion of the coding region.a sequence that contains only 5-utr sequence and there is a 5 stop codon.a sequence that contains a 5-utr sequence , the start codon and a portion of the protein - coding orf.a sequence that contains only 5-utr sequence without a 5 stop codon.a sequence that contains a portion of the protein - coding region , but does not contain the start codon or the stop codon.a sequence with the potential protein - coding region truncated at its 5 end , one or more atg codons in the truncated orf , the stop codon and a 3-utr.a sequence that contains a portion of the potential protein - coding region and the 3-utr sequence.a sequence that contains a portion of the 3-utr and a poly(a ) sequence at its 3 end . a full - length sequence that includes the 5-utr with one or more stop codons ( 5 stop codon ) , translation start codon , complete protein - coding region , translation stop codon and the 3-utr . the protein - coding orf may have internal atg codons and the 3-utr may possess multiple stop codons . the 5-utr may be truncated . a full - length sequence as defined for category ( a ) , except that it does not contain any 5 stop codons . a partial sequence that has a portion of the 5-utr , one or more 5 stop codons , the start codon and a portion of the coding region . a sequence that contains only 5-utr sequence and there is a 5 stop codon . a sequence that contains a 5-utr sequence , the start codon and a portion of the protein - coding orf . a sequence that contains only 5-utr sequence without a 5 stop codon . a sequence that contains a portion of the protein - coding region , but does not contain the start codon or the stop codon . a sequence with the potential protein - coding region truncated at its 5 end , one or more atg codons in the truncated orf , the stop codon and a 3-utr . a sequence that contains a portion of the potential protein - coding region and the 3-utr sequence . a sequence that contains a portion of the 3-utr and a poly(a ) sequence at its 3 end . for sequences generated by sequencing cdna inserts from their 3 ends , the categories of their reverse complementary sequences only include ( a ) , ( b ) , ( h ) , ( i ) and ( j ) . therefore , it is more challenging to predict the coding region within an est than it is to predict the coding region of a fully sequenced cdna . distinguishing the translation start codon from other atg codons remains a difficult task . identifying start codons is further complicated because there is not a universal consensus sequence surrounding eukaryotic start codons , although the conserved consensus sequence , gccrccaugg ( r : purine ; aug : start codon ) is present in mammals ( 4 ) . however , blastx using a nucleotide query against a protein database is able to reliably identify protein - coding regions within a dna sequence if sufficient similarity exists between the translated query and an entry in the database ( 3 ) . sequencing errors may disrupt the conceptual translation of orfs , blastx could also detect frame shifts if there are insertions / deletions in the coding regions of the query sequences . when significant blastx alignments can be generated our algorithm uses them as a guide to identify the translation reading frames and coding regions . for est - derived sequences without a database match , their frames and coding sequences are predicted based on the presence and the location of intrinsic signals in a sequence that include start codons , 5 or / and 3 stop codons and stretches of poly(a ) ( figure 1 ) . our algorithm uses the following rules to locate protein - coding regions and predict the translation reading frame . for cases where blastx identified a significant database match ( e - value lower than a user chosen threshold ) , the frame assignment in the blastx output will be used and rules 19 are applied . if there is a conflict , rules 1 and 2 will override the other rules . for sequences that do not produce a significant blastx alignment rules 310 rule 1 : the predicted coding region must contain at least a portion of the translated query aligned by using blastx.rule 2 : if there is a frame shift , the first frame assignment in the blastx alignment is used.rule 3 : when there are no internal stop codons within a potential protein - coding region that is flanked by translation start and stop codons , the predicted coding region extends from the start codon to the stop codon ( figure 1a).rule 4 : a sequence that contains a poly(a ) signature but does not contain a stop codon does not include any portion of the coding region ( figure 1j).rule 5 : if there are one or more atg codons in a sequence and they are all downstream from one or more stop codons , the first atg following the last 5 stop codon is selected as the start codon ( figure 1a and c).rule 6 : to be considered a potential coding region , an orf that is flanked by a 5 stop codon and a 3 stop codon must be at least 90 nt ( code for a protein that has at least 30 amino acids).rule 7 : if a sequence includes a poly(a ) signature preceded by one or more 3 stop codons , but does not include a 5 stop codon , the sequence upstream of the stop codons is considered the coding region ( figure 1b , h and i).rule 8 : if a sequence lacks a poly(a ) signature and encodes an orf without any stop codons , it is assumed that the entire sequence is the coding region ( figure 1e , f and g ) . although in rare cases ( such as in figure 1f ) , the 5-utr will be considered as a coding sequence.rule 9 : for cases like that presented in figure 1d , it is impossible to know if the stop codon is a 5 stop codon or a 3 stop codon , if it lacks a poly(a ) signature . however , because cdna clones are more likely to be truncated at their 5 end , the program assumes in this case that the sequence upstream of the stop codon is the coding sequence.rule 10 : the longest stretch of orf present in the six possible reading frames is selected as the coding region . rule 1 : the predicted coding region must contain at least a portion of the translated query aligned by using blastx . rule 2 : if there is a frame shift , the first frame assignment in the blastx alignment is used . rule 3 : when there are no internal stop codons within a potential protein - coding region that is flanked by translation start and stop codons , the predicted coding region extends from the start codon to the stop codon ( figure 1a ) . rule 4 : a sequence that contains a poly(a ) signature but does not contain a stop codon does not include any portion of the coding region ( figure 1j ) . rule 5 : if there are one or more atg codons in a sequence and they are all downstream from one or more stop codons , the first atg following the last 5 stop codon is selected as the start codon ( figure 1a and c ) . rule 6 : to be considered a potential coding region , an orf that is flanked by a 5 stop codon and a 3 stop codon must be at least 90 nt ( code for a protein that has at least 30 amino acids ) . rule 7 : if a sequence includes a poly(a ) signature preceded by one or more 3 stop codons , but does not include a 5 stop codon , the sequence upstream of the stop codons is considered the coding region ( figure 1b , h and i ) . rule 8 : if a sequence lacks a poly(a ) signature and encodes an orf without any stop codons , it is assumed that the entire sequence is the coding region ( figure 1e , f and g ) . although in rare cases ( such as in figure 1f ) , the 5-utr will be considered as a coding sequence . rule 9 : for cases like that presented in figure 1d , it is impossible to know if the stop codon is a 5 stop codon or a 3 stop codon , if it lacks a poly(a ) signature . however , because cdna clones are more likely to be truncated at their 5 end , the program assumes in this case that the sequence upstream of the stop codon is the coding sequence . rule 10 : the longest stretch of orf present in the six possible reading frames is selected as the coding region . the server provides a user interface for copy and paste , or for loading the users ' sequences and blastx outputs . these various inputs are summarized as follows : \n a sequence file in the fasta format . the poly(a ) or poly(t ) signatures that identify mrna poly(a ) tails should be retained , as they are used to determine the strand to be used for coding region and reading frame prediction.blastx output for all the est - derived query sequences . although it is optional , the user is encouraged to provide a pre - run blastx output . the user can choose a cut - off e - value when setting up the blastx run . if a blast output file is provided by a user , the frame used in blastx for alignments will be used for the prediction of the protein - coding region . for query sequences without a blastx hit or for which the blastx output is not provided , predictions will be performed based on the intrinsic signals of the query sequences using the rules described above . users can also use our targetidentifier server ( ) to obtain blastx outputs for their query sequences . targetidentifier server uses the uniprot / swiss - prot protein database.e - value : the user can also set a threshold e - value for their blastx file . if the e - value in the blastx file is larger than the user selected threshold , the query sequence will be taken as no hit. the default threshold is 1 10.strand : the user can choose which strand will be used for prediction . if the sequences were obtained by sequencing cdnas from the 5 ends , the + strand should be chosen . if the file contains sequences obtained by sequencing from both ends , both strands should be used for prediction . in this case , the default setting , users can select download or use email for receiving their results . a sequence file in the fasta format . the poly(a ) or poly(t ) signatures that identify mrna poly(a ) tails should be retained , as they are used to determine the strand to be used for coding region and reading frame prediction . although it is optional , the user is encouraged to provide a pre - run blastx output . the user can choose a cut - off e - value when setting up the blastx run . if a blast output file is provided by a user , the frame used in blastx for alignments will be used for the prediction of the protein - coding region . for query sequences without a blastx hit or for which the blastx output is not provided , predictions will be performed based on the intrinsic signals of the query sequences using the rules described above . users can also use our targetidentifier server ( ) to obtain blastx outputs for their query sequences . e - value : the user can also set a threshold e - value for their blastx file . if the e - value in the blastx file is larger than the user selected threshold , the query sequence will be taken as strand : the user can choose which strand will be used for prediction . if the sequences were obtained by sequencing cdnas from the 5 ends , the + strand should be chosen . if the sequences were obtained by sequencing cdnas from their 3 ends , the strand should be chosen . if the file contains sequences obtained by sequencing from both ends , both strands should be used for prediction . in this case , the default setting , an identifier for the sequence , the reading frame for the predicted coding region , the location of the beginning and end of the predicted coding region , a flag shown as fs that locates any translation frame shifts detected in the blastx alignment and the predicted protein sequence . the other file contains the query identifiers for those sequences that do not have predicted protein - coding regions ( figure 1j ) .", "most ests encompass only a portion of the mrna sequence . therefore , it is more challenging to predict the coding region within an est than it is to predict the coding region of a fully sequenced cdna . distinguishing the translation start codon from other atg codons identifying start codons is further complicated because there is not a universal consensus sequence surrounding eukaryotic start codons , although the conserved consensus sequence , gccrccaugg ( r : purine ; aug : start codon ) is present in mammals ( 4 ) . however , blastx using a nucleotide query against a protein database is able to reliably identify protein - coding regions within a dna sequence if sufficient similarity exists between the translated query and an entry in the database ( 3 ) . sequencing errors may disrupt the conceptual translation of orfs , blastx could also detect frame shifts if there are insertions / deletions in the coding regions of the query sequences . when significant blastx alignments can be generated our algorithm uses them as a guide to identify the translation reading frames and coding regions . for est - derived sequences without a database match , their frames and coding sequences are predicted based on the presence and the location of intrinsic signals in a sequence that include start codons , 5 or / and 3 stop codons and stretches of poly(a ) ( figure 1 ) . our algorithm uses the following rules to locate protein - coding regions and predict the translation reading frame . for cases where blastx identified a significant database match ( e - value lower than a user chosen threshold ) , the frame assignment in the blastx output will be used and rules 19 are applied . if there is a conflict , rules 1 and 2 will override the other rules . for sequences that do not produce a significant blastx alignment rules 310 rule 1 : the predicted coding region must contain at least a portion of the translated query aligned by using blastx.rule 2 : if there is a frame shift , the first frame assignment in the blastx alignment is used.rule 3 : when there are no internal stop codons within a potential protein - coding region that is flanked by translation start and stop codons , the predicted coding region extends from the start codon to the stop codon ( figure 1a).rule 4 : a sequence that contains a poly(a ) signature but does not contain a stop codon does not include any portion of the coding region ( figure 1j).rule 5 : if there are one or more atg codons in a sequence and they are all downstream from one or more stop codons , the first atg following the last 5 stop codon is selected as the start codon ( figure 1a and c).rule 6 : to be considered a potential coding region , an orf that is flanked by a 5 stop codon and a 3 stop codon must be at least 90 nt ( code for a protein that has at least 30 amino acids).rule 7 : if a sequence includes a poly(a ) signature preceded by one or more 3 stop codons , but does not include a 5 stop codon , the sequence upstream of the stop codons is considered the coding region ( figure 1b , h and i).rule 8 : if a sequence lacks a poly(a ) signature and encodes an orf without any stop codons , it is assumed that the entire sequence is the coding region ( figure 1e , f and g ) . although in rare cases ( such as in figure 1f ) , the 5-utr will be considered as a coding sequence.rule 9 : for cases like that presented in figure 1d , it is impossible to know if the stop codon is a 5 stop codon or a 3 stop codon , if it lacks a poly(a ) signature . however , because cdna clones are more likely to be truncated at their 5 end , the program assumes in this case that the sequence upstream of the stop codon is the coding sequence.rule 10 : the longest stretch of orf present in the six possible reading frames is selected as the coding region . rule 1 : the predicted coding region must contain at least a portion of the translated query aligned by using blastx . rule 2 : if there is a frame shift , the first frame assignment in the blastx alignment is used . rule 3 : when there are no internal stop codons within a potential protein - coding region that is flanked by translation start and stop codons , the predicted coding region extends from the start codon to the stop codon ( figure 1a ) . rule 4 : a sequence that contains a poly(a ) signature but does not contain a stop codon does not include any portion of the coding region ( figure 1j ) . rule 5 : if there are one or more atg codons in a sequence and they are all downstream from one or more stop codons , the first atg following the last 5 stop codon is selected as the start codon ( figure 1a and c ) . rule 6 : to be considered a potential coding region , an orf that is flanked by a 5 stop codon and a 3 stop codon must be at least 90 nt ( code for a protein that has at least 30 amino acids ) . rule 7 : if a sequence includes a poly(a ) signature preceded by one or more 3 stop codons , but does not include a 5 stop codon , the sequence upstream of the stop codons is considered the coding region ( figure 1b , h and i ) . rule 8 : if a sequence lacks a poly(a ) signature and encodes an orf without any stop codons , it is assumed that the entire sequence is the coding region ( figure 1e , f and g ) . although in rare cases ( such as in figure 1f ) , the 5-utr will be considered as a coding sequence . rule 9 : for cases like that presented in figure 1d , it is impossible to know if the stop codon is a 5 stop codon or a 3 stop codon , if it lacks a poly(a ) signature . however , because cdna clones are more likely to be truncated at their 5 end , the program assumes in this case that the sequence upstream of the stop codon is the coding sequence . rule 10 : the longest stretch of orf present in the six possible reading frames is selected as the coding region .", "the server provides a user interface for copy and paste , or for loading the users ' sequences and blastx outputs these various inputs are summarized as follows : \n a sequence file in the fasta format . the poly(a ) or poly(t ) signatures that identify mrna poly(a ) tails should be retained , as they are used to determine the strand to be used for coding region and reading frame prediction.blastx output for all the est - derived query sequences . although it is optional , the user is encouraged to provide a pre - run blastx output . the user can choose a cut - off e - value when setting up the blastx run . if a blast output file is provided by a user , the frame used in blastx for alignments will be used for the prediction of the protein - coding region . for query sequences without a blastx hit or for which the blastx output is not provided , predictions will be performed based on the intrinsic signals of the query sequences using the rules described above . users can also use our targetidentifier server ( ) to obtain blastx outputs for their query sequences . targetidentifier server uses the uniprot / swiss - prot protein database.e - value : the user can also set a threshold e - value for their blastx file . if the e - value in the blastx file is larger than the user selected threshold , the query sequence will be taken as no hit. the default threshold is 1 10.strand : the user can choose which strand will be used for prediction . if the sequences were obtained by sequencing cdnas from the 5 ends , the + strand should be chosen . if the file contains sequences obtained by sequencing from both ends , both strands should be used for prediction . in this case , the default setting , users can select download or use email for receiving their results . a sequence file in the fasta format . the poly(a ) or poly(t ) signatures that identify mrna poly(a ) tails should be retained , as they are used to determine the strand to be used for coding region and reading frame prediction . although it is optional , the user is encouraged to provide a pre - run blastx output . the user can choose a cut - off e - value when setting up the blastx run . if a blast output file is provided by a user , the frame used in blastx for alignments will be used for the prediction of the protein - coding region . for query sequences without a blastx hit or for which the blastx output is not provided , predictions will be performed based on the intrinsic signals of the query sequences using the rules described above . users can also use our targetidentifier server ( ) to obtain blastx outputs for their query sequences . e - value : the user can also set a threshold e - value for their blastx file . if the e - value in the blastx file is larger than the user selected threshold , the query sequence will be taken as no hit. the default threshold is 1 10 . strand : the user can choose which strand will be used for prediction . if the sequences were obtained by sequencing cdnas from the 5 ends , the + strand should be chosen . if the sequences were obtained by sequencing cdnas from their 3 ends , the if the file contains sequences obtained by sequencing from both ends , both strands should be used for prediction . in this case , the default setting , ", "it contains the following information for each input sequence . an identifier for the sequence , the reading frame for the predicted coding region , the location of the beginning and end of the predicted coding region , a flag shown as fs that locates any translation frame shifts detected in the blastx alignment and the predicted protein sequence . the other file contains the query identifiers for those sequences that do not have predicted protein - coding regions ( figure 1j ) .", "we evaluated the accuracy of orfpredictor using 2127 arabidopsis cdna sequences that have annotated protein sequences in genbank , and 4289 a.niger and 3065 phanerochaete chrysosporium sequences assembled from ests with phrap ( ) . we first compared the predicted arabidopsis protein sequences obtained when blastx alignments were used as a guide with the annotated protein sequences in genbank , and confirmed that our program was able to predict the protein - coding regions with 100% accuracy . then , we compared the ab initio predicted protein sequences with the results obtained by using blastx . we then examined the prediction accuracy using the a.niger and p.chrysosporium sequences , which had a blastx hit in the ncbi nr database with an e - value 1 10 . the ab initio predicted frames were then compared with the frames identified by using blastx . we found that the reading frame predicted ab initio was identical with the frames predicted by using blastx for 3943 ( 91.9% ) of the a.niger sequences and 2867 ( 93.5% ) of the p.chrysosporium sequences .", "we implemented a web server , orfpredictor , for predicting protein - coding regions in est - derived sequences . orfpredictor uses the reading frame predicted by using blastx when a significant alignment is produced , whereas for sequences that do not return a significant blastx alignment protein - coding regions are predicted ab initio . the predicted protein sequences can then be used as the input for additional annotation tools , such as interproscan ( 5 ) , for identifying protein families , domains and functional sites , the conserved domain search service ( 6 ) for the detection of structural and functional domains , and signalp ( 7 ) for locating potential signal peptides .", "categories of information derived from the est sequences . ( a ) a typical full - length cdna sequence including one or more stop codons in the 5-utr , a start codon and a stop codon . the coding region may contain multiple atg codons encoding methionine and the 3-utr may harbor additional stop codons . ( b ) a full - length cdna without a stop codon in the 5-utr . ( c ) a sequence containing a 5-utr with a stop codon and a portion of the coding region . ( d ) a sequence containing a 5-utr with a stop codon . ( e ) a sequence containing a 5-utr without a 5 stop codon , and a portion of the coding region . ( f ) a sequence containing a portion of 5-utr without a 5 stop codon . ( g ) a sequence containing the internal portion of a coding region with or without internal atg codons . ( h ) a sequence containing a portion of the coding region with an internal atg codon , a 3 stop codon and 3-utr . ( i ) a sequence containing a portion of the coding region with no internal atg codons , a 3 stop codon and a 3-utr . red star : stop codon at 5 end ; green circle : start codon ; blue circle : internal atg codon ; red hexagon : stop codon ; solid line : sequenced portion of the full - length cdna ; and dashed line : unsequenced or truncated portion of the full - length cdna . the orfpredictor server interface for loading data and choosing other parameters ." ]

[ "nature evolved a very limited number of chromophores in the different evolutionary branches of the tree of life because of the similar needs of the most diverse organisms for both the detection of the external world and the interaction with it . the study of these chromophores and their distribution inside cellular structures is usually based on extractive procedures , followed by biochemical or spectroscopic assays . extractive techniques often include disadvantages : they can modify the nature of the components and they are not successful in isolating the chromophores . direct investigation by means of microspectrophotometry of on intact samples has the advantage of preserving the integrity of biological structures or substructures . a microspectrophotometer is a simple apparatus consisting of a modified microscope that can measure absorption or emission spectra of very small areas inside a cell 1 . a high quality microscope is equipped with a polychromator , i.e. a flat field concave grating , which is connected to the slit - shaped exit pupil of a 19 light - guides probe . the dispersion image of the exit pupil produced by the polychromator is focused onto a digital slow scan cooled ccd camera . the main feature of this instrumentation is the possibility to measure in vivo absorption or emission spectra at the same time on different sub - cellular compartments using extremely low light intensities . this set - up represents a better strategy with respect to traditional instruments , since it eliminates errors typical of microspectrophotometry , such as photobleaching , distributional errors , the schwarzschild - villiger effect , and allows in vivo reliable spectroscopic investigations 2 , 3 . the photosynthetic and the photoreceptive compartments are the main location of chromophores inside algal cells . absorption and emission spectra measured in vivo on these compartments can provide very precise and accurate information about the spectral range in which chromophore molecules capture photons in their natural environment and their de - excitation pathways 4 . we tested our apparatus by measuring absorption spectra on the eyespot and chloroplast of the unicellular alga dunaliella and emission spectra on the photoreceptor and chloroplast of the unicellular alga euglena gracilis .", "cultures . euglena gracilis strain z ( sammlung von algenkulturen gttingen , 1224 - 5/25 ) cells were grown axenically in cramer - myers medium 0.025 m in sodium acetate ( ph 6.8 ) 5 ; cultures of dunaliella spp . ( sammlung von algenkulturen gttingen , 19 - 5 ) were grown axenically in johnson 's medium 6 . both cultures were kept under constant temperature ( 24 c ) and continuous illumination ( 2x10 mol photons m sec ) . the hardware platform consists of a zeiss axioplan microscope ( zeiss , oberkoken , de ) , equipped with an epifluorescence system , 100x ( n.a . the emission spectra were acquired with a combination of a uv - blue filter set ( 8 nm band pass excitation filter , 365 nm ; chromatic beam splitter , 395 nm ; barrier filter , 397 nm ; irradiance 800 w / cm ) , and a blue - violet filter set ( 8 nm band pass excitation filter , 436 nm ; chromatic beam splitter , 460 nm ; barrier filter , 470 nm ; irradiance 1100 w / cm ) . 77423 oriel , stratford , connecticut , usa ) connected to a schott kl 1500 probe illuminator system ( schott corporation , mainz , de ) was mounted in the back focal plane of the ocular of the microscope ( figure 1 ) . this probe consists of an outer bundle of 24 light - guides and a central bundle of 19 light - guides ( figure 2a ) . the outer bundle is used for centering the objects , while the central bundle of the probe is used for acquiring transmitted or emitted light . the sub - cellular components on which the spectra have to be measured , are placed in the microscope field and finely adjusted . the exit pupil of the probe ( figure 2b ) is connected to a flat field imaging concave grating polychromator ( mod . 52300070 , jobin yvon , longjumenau , france ) that produces a dispersion image of the probe . this image is in turn focused onto a digital slow scan cooled ccd camera ( dta discovery ds260e , pisa , italy ) , and it consists of 19 multi - lines strips showing the distribution of light intensity according to the wavelength . the microspectophotometer instrumentation possesses a graphical interface that allows the set - up of both the optics and the frame grabber ( scion corporation , frederick , maryland , usa ) and controls the measurements . once the instrumental has been set - up , the operator , on the basis of the light guide positions upon the cell , selects the zones of the dispersion image displayed on the top of the graphical layout ( in the layout r stands for reference , and s for sample ) . the resulting spectrum is displayed at the bottom of the graphical layout , ( figure 3 ) . absorption measurements are based on the comparison of two radiant fluxes density is and ir . is results from the interaction of light with the sample ( it is related to absorption cross section of the molecules and the number of absorbing molecules ) 7 , while ir results from the interaction of light with the reference material . therefore , we can consider the absorbance of a sample ( as ) as derived from the measures as follows : this equation is known as the lambert - beer 's law . for the discussion on the theoretical aspects of image formation and the light transmission in microspectrophotometry see barsanti et al . absorption spectra were performed on both the eyespot ( screening device ) and the chloroplast ( photosynthetic apparatus ) of the unicellular alga dunaliella . the central bundle of the probe was centered on both the structures in the apical portion of the cell ( is ) , in such a way that some light - guides were located outside the cell ; these guides measure ir . measurements of emission microspectroscopy are based on the radiant flux density f. this density is given by : where ia is the amount of light absorbed by the chromophores ; f is their fluorescence quantum yield and z represents the fraction of fluorescence collected by the objective , 9 . emission spectra were performed on both the photoreceptor and chloroplast of the photosensitive alga euglena gracilis . the outer bundle of the probe was used for centering the photoreceptor and the chloroplast in the apical portion of the cell , while the central bundle of the probe was used for acquiring light emitted by the two structures . photographs were taken with an olympus camedia c-30303 digital camera ( olympus , tokyo , japan ) mounted onto the microscope .", "the eyespot is recognizable as a the bright orange spot located on the left side of the cell in the apical portion . the size of the eyespot is about 3 and the size of the chloroplast is about 10 ; the probe is superimposed on the structures in order to show their relative position ( figures 4b ) . this spectrum closely resembles the spectrum obtained by batra and tollin 10 on a suspension of eyespot granules , and the other in vivo spectra previously recorded by strother and wolken 11 , by benedetti et al . major peaks are due to lutein whose bands are centered at 410 , 479.5 , and 510 nm and -carotene whose bands are centered at 455.5 , 481.5 , and 510.5 nm ( not shown ) . it clearly shows that dunaliella belongs to the green lineage of eukaryotic algae since only chlorophylls a and b and carotenoids are present in this spectrum . gaussian bands decomposition of this spectrum is easily explained as a combination of chlorophyll a bands centered at ( 410 , 435 , 444 , 585 , 615 , 626 , 634.5 , 663 , 672 , 678 , 683 , 695 nm , chlorophyll b bands centered at 412 , 428.5 , 445 , 452 , 582 , 594 , 607 , 621.5 , 652 nm , and carotenoids lutein and bands centered at 410 , 479.5 , and 510 nm , ( not shown ) , 14 . the photoreceptor is recognizable as a the bright green spot located in the apical portion of the cell . the size of the photoreceptor is about 2 and the size of the chloroplast is about 10 ; the probe is superimposed on the structures in order to show their relative position ( figure 6b ) . figure 7a shows the emission spectrum of a single photoreceptor under 436 nm excitation light , after 10 seconds of excitation with the 365 nm light . gaussian bands decomposition of the emission spectrum reveals 3 bands with different intensity centered at about 500 nm , 525 nm , and 556 nm ( not shown ) . the bands obtained by the gaussian decomposition indicate the presence of a mixture of very similar conformers in the photoreceptor , each one capable of photocycling between a non - fluorescent parent species and a fluorescent excited species 15 . the presence in the photoreceptor of euglena of a photochromic chromophore , which undergoes light - driven reversible photochromism has been well established by means of digital and fluorescence microscopy 16 . the photoreceptor possesses optical bistability , i.e. upon photoexcitation the ground state generates a stable excited state , which can be photochemically driven back to the ground state . the 27 kda protein extracted from the photoreceptor shows a similar behavior , the photochromic reaction cycling between two different stable conformers , the parent and the excited conformers 17 . figure 7b shows the emission spectrum of the thylakoid compartment of euglena gracilis excited at 463 nm . it is the typical emission spectrum of a chloroplast that contains only chlorophyll a and b whose bands are centered at 685 for the photosystem ii and at 725 nm for the photosystem i , 18 .", "set - up of the polychromator - based microspectrophotometer entrance ( a ) and exit ( b ) pupils of the light guide probe layout of the software interface a ) bright field image of dunaliella . b ) position of the probe upon dunaliella absorption spectra of the eyespot ( a ) and a chloroplast ( b ) of dunaliella a ) fluorescent image of euglena gracilis ; b ) position of the probe upon euglena gracilis emission spectra of the photoreceptor ( a ) and a chloroplast ( b ) of euglena gracilis" ]

[ "the rostral ventromedial medulla ( rvm ) is an important relay region that contributes to the descending pain control pathway from the periaqueductal gray ( pag ) to the superficial laminae ( laminae i and ii ) of the spinal cord [ 1 , 2 ] . it is well known that the rvm is closely linked to long - lasting activation of descending control circuits that involve descending facilitation , which significantly contributes to the development of persistent pain induced by tissue and nerve injury . although many studies have focused on this region , the cellular and molecular mechanisms of descending pain facilitation control remain poorly understood . due to the role of the descending pain facilitation pathway , several types of injuries , such as tissue and nerve injury , often become chronic and persistent , eventually leading to neuropathic pain . , significant progress has been made in basic and clinical studies ; however , the currently available therapies for neuropathic pain remain inadequate , and the search continues not only for improved treatments but also for novel targets . the mammalian target of rapamycin ( mtor ) , a conserved serine - threonine protein kinase that is inhibited by the effective clinical immunosuppressant rapamycin , regulates several intracellular processes in response to various extracellular signals and thereby modulates mrna translation . thus , mtor plays a critical role in the modulation of long - term plasticity and memory processes [ 57 ] . activation of the mtor complex with the protein raptor ( mtorc1 ) promotes the phosphorylation of mtor downstream targets , including eukaryotic initiation factor 4e - binding protein ( 4e - bp1/2 ) and s6 kinase ( s6k ) , which can further lead to local protein synthesis . it has been reported that deletion of either the 4e - bp1/2 or the s6k gene in mice results in deficits in synaptic plasticity and long - term memory [ 8 , 9 ] . moreover , phosphorylated mtor ( p - mtor ) , which is the activated form , is upregulated in the peripheral nervous system as well as at the spinal cord level in several pain models [ 1015 ] . inhibition of spinal cord mtor by intrathecal administration has proven to be effective in alleviating the nociceptive behaviors of animals under pain conditions [ 10 , 11 , 16 , 17 ] . synaptic plasticity changes in chronic pain conditions can occur not only at the spinal cord level but also at the supraspinal level , including the rvm . therefore , considering the important role of the rvm in descending pain facilitation , targeting mtor in the rvm might be a promising way to combat pain . because serotoninergic ( 5-htergic ) neurons are the primary constitutive element in the rvm and can send projections to the superficial spinal dorsal horn ( sdh ) [ 1820 ] , we thus hypothesize that 5-htergic spinally projecting neurons in the rvm contain mtor , the activation of which could in turn increase the excitability of the 5-htergic neurons and thus may potently potentiate the descending facilitation pain control pathway and exaggerate neuropathic pain conditions . accordingly , we used a spared nerve injury ( sni ) model to evaluate the role of mtor in the rvm in neuropathic pain in rats .", "adult male sprague - dawley ( sd ) rats ( weighing 250290 g ) were used in the present study . the ethics committee for animal experiments of the fourth military medical university ( xi'an , china ) approved the animal experiments ( permit number : 10071 ) . briefly , rats were anesthetized with pentobarbital ( 45 mg / kg , i.p . ) , and three terminal branches of the sciatic nerve were exposed by direct incision of the skin and a section of the biceps femoris muscle in the left thigh . the tibial and common peroneal branches were carefully tight - ligated with 5 - 0 silk sutures and sectioned distal to the ligation , removing 24 mm of the distal nerve stump . the surgical procedures for the sham - operated group were identical to those for the sni group , except that the nerves were not lesioned . mechanical allodynia , as a behavioral sign of sni - induced neuropathic pain , was assessed by measuring the 50% paw withdrawal threshold ( pwt ) as described previously . the 50% pwt in response to a series of ascending von frey filaments ( stoelting , kiel , wi , usa ) was determined by the up - and - down method . von frey force was delivered perpendicularly to the plantar surface of the hind paw for 2 to 3 seconds . an abrupt withdrawal of the hind paw during stimulation was recorded as a positive response . the 50% pwt was calculated using the following formula : 50% pwt = 10 . mechanical allodynia was assessed by measuring the 50% pwt of the ipsilateral hind paw in sni- or sham - operated rats . measurements of the paw withdrawal latency ( pwl ) were obtained using a timer that was started by the activation of the heat source and stopped when withdrawal of the paw was detected with a photodetector . three measurements of the pwl were taken for each hind paw and were averaged as the result of each test session . the ipsilateral hind paw was tested with intervals of more than 5 min between consecutive tests . fluoro - gold ( fg ) was used as a retrograde tracer to label the rvm neurons that project to the sdh . the procedures for fg injection were essentially the same as in our previous studies [ 20 , 27 ] . briefly , after exposing the lumbar cord , 0.1 l of a 4% solution of fg ( fluorochrome , denver , co , usa ) dissolved in 0.9% saline was stereotaxically injected into the left side of the lumbar dorsal horn with a microsyringe attached to a glass micropipette by pressure injection . due to the transportation period of the tracer , after perfusion , the brains and spinal cords of the rats were cut into sections . the sections were used to evaluate the fg injection sites in the sdh as well as the distribution patterns of the retrogradely fg - labeled neurons in the rvm under an epifluorescence microscope ( bx-60 ; olympus , tokyo , japan ) using an appropriate filter for fg ( excitation 350395 nm ; emission 430 nm ) . after the rats were anesthetized with pentobarbital ( 45 mg / kg , i.p . ) , a 26-gauge stainless steel guide cannula was stereotaxically implanted into a site above the rvm ( 10.52 mm posterior to bregma , 0 mm lateral from the midline , and 10.20 mm beneath the surface of the skull ) . intra - rvm microinjections were delivered via a 33-gauge injector needle cannula that was lowered 0.5 mm deeper into the brainstem than the guide cannula . the microinjection apparatus consisted of a hamilton syringe ( 10 l ) connected to an injector ( 33-gauge ) by a thin polyethylene tube and a motorized syringe pump . rapamycin ( 250 m/1 l , dissolved in a saline / dmso mix comprising 25% dmso , tocris bioscience , minneapolis , mn , usa ) , the specific inhibitor for mtor , was infused into the rvm at a rate of 0.1 l / min ; an equivalent volume of 25% dmso was used as a vehicle . after injection , the microinjection needle was left in place for at least 2 min . the injection sites were verified at the end of all of the experiments by nissl staining , and injection sites outside the rvm region were excluded from the study . these rats were randomly divided into two groups designed for different purposes , as shown in figure 6(c ) : group 1 : to investigate whether rapamycin could influence the induction stage of sni - induced neuropathic pain , behavioral tests were performed before the first drug or vehicle injection , followed by sni ( pre - sni ) , and 30 min after the second injection on day 1 after sni ( sni - d1 ) ( figure 6(c ) , top ) and group 2 : behavioral tests were performed before sni ( pre - sni ) , 6 days after sni ( sni - d6 ) , and 30 min after drug or vehicle injection on day 7 after sni ( sni - d7 ) for the purpose of demonstrating the effect of rapamycin on the maintenance stage of sni - induced neuropathic pain ( figure 6(c ) , bottom ) . the rats were transcardially perfused with 150 ml of 0.01 m phosphate - buffered saline ( pbs , ph 7.4 ) , followed by 500 ml of 4% paraformaldehyde in 0.1 m phosphate buffer ( pb , ph 7.4 ) . the brainstems and/or spinal cords were transversely sliced into 25 mm thick coronal sections using a freezing microtome ( cm1950 , leica , heidelberg , germany ) . double - immunofluorescence staining for p - mtor / neun , p - mtor / fg , or p - mtor/5-ht was performed . the sections were sequentially incubated at room temperature with primary antisera in 0.01 m pbs containing 5% normal donkey serum ( nds ) , 0.3% triton x-100 , 0.05% nan3 , and 0.25% carrageenan ( pbs - nds , ph 7.4 ) for 24 h. then , the sections were incubated with fluorescein - labeled igg ( secondary antisera ) for 6 h. a negative control experiment , in which the primary antisera were omitted , and a peptide competition assay were both carried out . after the immunofluorescence histochemical staining , the sections were observed and images were captured using a confocal laser - scanning microscope ( clsm , fv1000 , olympus ) . micrographs of 1012 sections per rat , which were 150 m apart within bregma 9.30 to 11.60 mm , were analyzed for p - mtor expression . using imagej software , the rvm area , including the nucleus raphe magnus ( rmg ) and the nucleus reticularis gigantocellularis pars , the p - mtor - positive cells within the area were counted manually by an observer blinded to the treatment conditions . the same counting method was used to evaluate the coexpression of 5-ht / p - mtor as well as that of p - mtor / fg within the rvm . cells with visible green cytoplasmic staining represent 5-htergic or fg - labeled cells , while red staining represents p - mtor - positive cells ; thus , cells with 5-ht or fg double - labeling with p - mtor appear yellow . the rats were decapitated , and brain slices ( 400 mm ) containing the rvm were cut at 0c with a vibratome ( vt1200s , leica ) in a sucrose cutting solution containing the following ( in mm ) : kcl 2.5 , nah2po4 1.2 , nahco3 26 , sucrose 252 , mgso47h2o 6 , cacl2 0.5 , and glucose 10 , bubbled with 95% o2/5% co2 ( ph 7.4 ) . for the electrophysiology studies , the brain slices were transferred to a submerged recovery chamber with oxygenated artificial cerebrospinal fluid ( acsf ) containing the following ( in mm ) : nacl 124 , kcl 2.5 , mgso47h2o 2 , nah2po4 1 , nahco3 25 , cacl2 2 , and glucose 37 for 2 hours at room temperature before recording . for the biochemical experiments , the slices were slowly brought to a final temperature of 30c in acsf gassed with 95% o2/5% co2 and incubated for at least 1 hour before the experiments . the brain slices were treated with rapamycin ( 250 m ) and vehicle for 30 min . subsequently , the rvm regions were microdissected and snap - frozen over dry ice . following the standard western blot protocol , rats were anesthetized with an overdose of pentobarbital ( 60 mg / kg , i.p . ) , and the rvm regions were carefully dissected and harvested for western blotting . to obtain total protein extracts , the tissues were lysed in 300 l lysis buffer containing 10 mm tris , 150 mm nacl , 1% triton x-100 , 0.5% np-40 , and 1 mm edta at ph 7.4 . the samples were adequately mixed at a 100 : 1 ( v / v ) ratio of protease inhibitor cocktail and phosphatase inhibitor cocktail ( roche , tucson , az , usa ) . the procedures for the in vitro - infused brain slices were similar to those of the tissue protocols . then , 30 g of cell lysis material ( quantitatively measured using the bca protein assay ; thermo scientific , rockford , il , usa ) was resolved by sodium dodecyl sulfate - polyacrylamide gel electrophoresis ( sds - page ) and transferred to pvdf membranes ( immobilon - p , millipore ) . after blocking in nonfat milk for 1 h , the membranes were incubated overnight at 4c with the following primary antibodies : rabbit anti - mtor ( 1 : 1000 , cell signaling technology ) ; rabbit anti - p - mtor ( 1 : 1000 , cell signaling technology ) ; rabbit anti - s6k ( 1 : 1000 , cell signaling technology ) ; rabbit anti - p - s6k ( 1 : 1000 , cell signaling technology ) ; and mouse anti--actin ( 1 : 5000 , sigma , st . the immunoblots were then reacted with the corresponding horseradish peroxidase- ( hrp- ) conjugated secondary antibodies ( anti - rabbit 1 : 5000 , anti - mouse 1 : 5000 ; amersham pharmacia biotech , piscataway , nj , usa ) . all of the reactions were detected by the enhanced chemiluminescence ( ecl ) detection method ( amersham ) and exposure to film . target protein levels were normalized against -actin levels and expressed as fold changes relative to the nave control group . neurons in the rvm region were targeted for recording using an upright microscope equipped with zeiss ( oberkochen , germany ) infrared - differential interference contrast ( ir - dic ) optics , a 40 water - immersion objective , and a video - imaging camera . the patch pipette was filled with intracellular solution containing the following ( in mm ) : k - gluconate 130 , nacl 5 , kcl 15 , egta 0.4 , hepes 10 , mg - atp 4 , and tris - gtp 0.2 , ph 7.257.35 , with an osmotic pressure of 290300 mosm / l . the pipette resistance , as measured in the bath , was typically 4 0.5 m. the voltage was held at 60 mv , and neurons were given at least 3 min to stabilize before data were collected . spontaneous discharge and the number of action potentials were used to investigate sni - induced changes in neuronal excitability in the rvm . the excitatory postsynaptic currents ( epscs ) of the rvm 5-htergic neurons , which are mediated by ampa receptors , were voltage - clamped and recorded at 60 mv with an axon 700b amplifier ( molecular devices , sunnyvale , ca , usa ) after blocking gabaergic transmission by picrotoxin ( 100 mm , sigma ) , a gabaa receptor antagonist . the membrane excitability of the recorded neurons was measured in current - clamp mode by determining the number of action potentials elicited by intracellular injection of 0 , 10 , 20 , 30 , 40 , 50 , and 60 pa depolarizing currents for 400 ms . the spike number was determined to estimate the influence of rapamycin on the recorded neurons . in all cases , biocytin ( 0.5% ) was introduced into the intracellular solution to identify the morphological properties of the recorded neurons . after recording , the brain slices were immediately fixed in 4% paraformaldehyde in 0.1 m pb for 4 h at room temperature . then , sections were rinsed with 3% hydrogen peroxide in 0.01 m pbs for 30 min . after thorough washing with pbs , the tissue was incubated with a goat anti-5-ht ( 1 : 500 , immunostar ) antibody in pbs - nds ( ph 7.4 ) for 24 h , followed by incubation with alexa 594 avidin d ( 1 : 1000 , invitrogen ) and alexa 488 donkey anti - goat ( 1 : 500 , invitrogen ) antibodies in pbs for 6 h at room temperature . the sections were then observed , and images were captured with a confocal microscope ( olympus ) . two - way anova with bonferroni multiple comparisons tests or one - way anova with tukey 's multiple comparisons post hoc tests were used for between - groups comparisons ( e.g. , the western blot data with surgery and drug administration as main effects ) . student 's paired t - test was used to analyze the differences between two groups ( e.g. , the difference in the numbers of p - mtor - positive cells between the sni - induced neuropathic pain group and the sham group ) .", "spared nerve injury ( sni ) produced increased nociceptive responses to innocuous mechanical stimulation ( mechanical allodynia ) of the ipsilateral hind paw in rats from as early as post - sni operation day 1 , and this effect was maintained for at least 2 weeks ( figure 1(a ) ) . however , sni had no impact on the latency of withdrawal to the radiant heat stimulus ( no thermal hyperalgesia ) ( figure 1(b ) ) . in fact , our present data are consistent with a previous report demonstrating that the low mechanical threshold induced by sni could persist even for 9 weeks after surgery , but there was no reported decrease in the hind paw withdrawal latency to the radiant heat stimulus . by using double - immunofluorescence staining , we found that the activated form of mtor , p - mtor , was expressed in the rvm , and it was exclusively expressed by neurons based on the observation that p - mtor was almost completely colocalized with neun , a marker for neurons , in rats in both the sham ( figures 2(a)2(c ) ) and post - sni day 7 groups ( figures 2(d)2(f ) ) . we observed that the number of p - mtor - positive neurons was significantly increased in the rvm on day 7 after sni compared to the sham group ( figures 2(a ) , 2(d ) , and 2(f ) ) , indicating that activation of mtor in the rvm may contribute to sni - induced neuropathic pain . it has been reported that s6k , a main downstream substrate for mtor , is involved in several intracellular processes , including neuronal plasticity and long - term memory . therefore , we used western blot analysis to further evaluate the mtor signaling pathway , including mtor and s6k , in the rvm after sni . compared with nave control rats , the expression of both phosphorylated mtor and phosphorylated s6k ( p - mtor and p - s6k ) was not significantly altered in the sham rats ( figures 2(h ) , 2(i ) , and 2(k ) ) . as indicated in figure 2(h ) , p - mtor and p - s6k were significantly elevated in the rvm 3 days after sni , and phosphorylation was maintained for at least 14 days compared to the control group ( figures 2(h ) and 2(i ) ; p - mtor : sni d3 : 1.42 0.25 ; sni d7 : 1.86 0.39 ; sni d14 : 1.49 0.28-fold of naive control , p < 0.05 ; p - s6k : sni d3 : 1.75 0.23 ; sni d7 : 1.96 0.57 ; sni d14 : 1.61 0.28-fold of nave control , p < 0.05 , n = 4 ) . the change in p - s6k was similar to that in p - mtor , indicating that the mtor signaling pathway in the rvm was activated by sni 3 days after surgery . compared with the nave control group , p - mtor and p - s6k expression was slightly increased , but no significant difference was detected at 1 day after sni ( figures 2(h ) , 2(i ) , and 2(k ) , p - mtor : sni d1 : 1.17 0.36-fold of nave control , p > 0.05 ; p - s6k : sni d1 : 1.14 0.38-fold of nave control , p > 0.05 , n = 4 ) . total mtor and s6k were not changed in any of the groups in the present study ( figures 2(h ) , 2(j ) , and 2(l ) ) . in summary , these data suggest that the mtor signaling pathway , including mtor and s6k , was activated in the rvm , which might indicate new protein synthesis and could result in changes in neuroplasticity . injections of fg into the lumbar sdh ( figure 3(a ) and 3(b ) ) resulted in many retrogradely labeled spinally projecting neurons in the rvm ( figure 3(d ) ) . although fg was injected unilaterally into the ( left ) lumbar sdh , 81.9% ( 203/248 ) of the retrogradely labeled spinally projecting neurons contained p - mtor - immunoreactive ( ir ) staining ( figures 3(c)3(e ) ) , which indicates that more than three - quarters of the spinally projecting neurons in the rvm express p - mtor . because 5-htergic neurons have previously been shown to be involved in the descending pain control pathway , particularly those localized within the rvm , we further investigated the relationship between 5-ht and p - mtor . our immunofluorescence staining results showed that a majority of the p - mtor - ir neurons contained 5-ht ( figures 4(a)4(f ) ) . the number of 5-htergic neurons was slightly increased within the rvm in the sni rats , but no statistical significance was detected compared to the sham control group ( 25.52 5.13 per section in the sni d7 group versus 20.8 4.02 in the sham control group , n = 3 rats / group , p > 0.05 ) . interestingly , 5-ht - positive p - mtor - ir neurons were remarkably increased in the rvm 7 days after sni compared to sham rats ( figure 4(g ) ) . in contrast , 5-ht - negative p - mtor - ir neurons were not significantly altered 7 days after sni ( figure 4(h ) ) . these results indicate that sni - induced neuropathic pain caused a substantial upregulation of p - mtor , which primarily occurred in 5-htergic neurons in the rvm . as reported previously , rapamycin is a specific and effective inhibitor of mtor . to investigate the inhibitory effect of rapamycin in vitro , we incubated brain slices containing the rvm with rapamycin ( 250 m ) for 30 min . we found that sni significantly increased the expression of both p - mtor and its downstream substrate p - s6k ( figure 5(a ) , p - mtor : sni d7 + vehicle : 1.80 0.48-fold of sham + vehicle , p < 0.05 ; p - s6k : sni d7 + vehicle : 1.77 0.45-fold of sham + vehicle , n = 4 , p < 0.05 ) , which is inconsistent with our tissue western blot data . moreover , rapamycin ( 250 m ) significantly reversed the upregulation of p - mtor as well as p - s6k after 30 min of drug infusion ( p - mtor : sni d7 + rapamycin : 1.11 0.27-fold of nave control versus sni d7 + vehicle : 1.80 0.48-fold of nave control , p < 0.05 ; p - s6k : sni 7d + rapamycin : 1.17 0.29-fold of nave control versus sni d7 + vehicle 1.77 0.45-fold of nave control , n = 4 , p < 0.05 ) , indicating that rapamycin could rapidly inhibit the activation of mtor after sni in vitro . to further investigate the neuronal excitability of 5-ht and the effect of rapamycin on 5-htergic neurons in the rvm a total of sixty 5-ht - positive neurons ( n = 60 ) from 12 rats were identified by biocytin introduction in combination with 5-ht immunofluorescence staining ( figure 5(b ) ) . moreover , they showed a relatively higher membrane capacitance ( cm ) and a smaller membrane resistance ( rm ) compared to other small neurons in the rvm , indicating that they have a larger membrane surface and smaller electrical resistance . we first investigated the frequency and amplitude of spontaneous excitatory postsynaptic currents ( sepscs ) in the rvm neurons . most of the 5-htergic neurons recorded in the rvm that were responsive to rapamycin showed increased activity . inconsistent with previous reports , the frequency and amplitude of sepscs were significantly increased after sni ( figures 5(c)5(f ) ) , which indicates that the probability of presynaptic transmitter release and the postsynaptic neuronal excitability , respectively , was elevated . subsequently , we used rapamycin ( 250 m ) to evaluate whether the enhanced presynaptic and postsynaptic excitability could be reversed . we found that the amplitude ( baseline , 45.26 1.89 pa ; rapamycin , 35.83 2.58 pa . p < 0.05 , n = 15 , paired t - test ) , but not the frequency ( baseline , 3.41 0.12 hz ; rapamycin , 3.29 0.33 , p > 0.05 , n = 15 , paired t - test ) , of the sepscs was inhibited by rapamycin application in rats with sni but not in the sham control rats ( frequency : baseline , 1.22 0.11 hz ; rapamycin , 1.20 0.19 hz . p > 0.05 , n = 15 , paired t - test ; amplitude : baseline , 29.79 1.80 pa ; rapamycin , 28.14 1.28 pa . p > 0.05 , n = 15 , paired t - test ) ( figures 5(c)5(f ) ) . these results suggest that rapamycin can decrease the postsynaptic excitability of 5-htergic neurons in the rvm after sni . we next compared the effects of rapamycin on the action potentials of the 5-htergic neurons and determined that the spike number of the recorded neurons was obviously increased after sni ( figures 5(g ) and 5(h ) ) . rapamycin ( 250 m ) did not change the spike number in recorded neurons from the sham group ( f(1,62 ) = 2.25 , p > 0.05 , n = 15 , two - way repeated measures anova ) ( figure 5(g ) ) . however , in the presence of rapamycin , the spike number of 5-htergic neurons in the sni group was significantly reduced ( f(1,48 ) = 8.56 , p < 0.05 , n = 15 , two - way repeated measures anova ) ( figure 5(h ) ) . these results indicate that rapamycin inhibited the excitability of 5-htergic neurons in the rvm under neuropathic pain conditions . we preliminarily investigated nociceptive behaviors in the sni rats mentioned above . in agreement with previous reports , significant mechanical allodynia rather than thermal hyperalgesia was observed in the present study ( figure 1 ) . based on this observation , we next used mechanical pwt instead of heat pwl to assess the nociceptive behaviors . to determine whether rapamycin could prevent the development of the induction stage of mechanical allodynia , we microinjected rapamycin via a cannula implanted into the rvm ( figures 6(a ) and 6(b ) ) immediately before sni surgery and at day 1 after sni , which was followed by behavioral testing 30 min later ( figure 6(c ) ) . after treatment with rapamycin , the pwt in the sni + rapamycin group showed no significant change compared to that in the sni + vehicle control group at day 1 after sni ( figure 6(d ) ) , indicating that rapamycin could not alleviate the neuropathic pain induced by sni in the induction stage . subsequently , we investigated whether rapamycin could reverse established neuropathic pain . on day 6 after sni , the rats demonstrated typical increased nociceptive responses to nonnoxious mechanical stimulation ( figure 6(e ) ) . compared with the vehicle control group , the mechanical allodynia was significantly reduced after microinjection of rapamycin into the rvm on day 7 after sni ( figure 6(e ) ) . because our biochemical results showed that the amount of both p - mtor and p - s6k was increased after sni ( figures 2(h ) , 2(i ) , and 2(k ) ) and because rapamycin infusion into the brain slices could effectively reverse the upregulated level of p - mtor and p - s6k ( figure 5(a ) ) , we concluded that the effect of rapamycin in partially reversing the mechanical allodynia was exerted via inactivation of the mtor signaling pathway , thus decreasing the excitability of 5-htergic spinally projecting neurons in the rvm .", "in the current study , we provide the first demonstration of the following : ( 1 ) mtor is expressed in the rvm region and can be activated in nerve injury - induced neuropathic pain ; ( 2 ) this mtor is largely expressed in 5-htergic neurons , which mainly comprise the descending pain control pathway ; ( 3 ) inhibition of the activated mtor restores the overexcitability of the 5-htergic neurons to normal ; and ( 4 ) inactivation of mtor by intra - rvm rapamycin microinjection alleviates established hyperalgesia ( abolished at the maintenance stage of neuropathic pain ) rather than influencing the beginning priming ( induction stage ) of neuropathic pain . these findings suggest that the mtor signaling pathway in the rvm is involved in the maintenance of nerve injury - induced neuropathic pain and that inhibition of mtor in the rvm could effectively alleviate neuropathic pain in sni rats . due to the importance of the descending pain control pathway in mammals , it has been demonstrated that blockade of rvm activity with lidocaine produced conditioned place preference ( cpp ) , which is linked to pain relief , in nerve injury models , indicating that descending pain facilitation pathways modulate injury - induced spontaneous tonic pain . wei et al . have reported that selectively depleting functional 5-ht phenotypes in rvm neurons with shrna interference ( rnai ) of tryptophan hydroxylase-2 ( tph-2 , the rate - limiting enzyme in the synthesis of neuronal 5-ht ) attenuated tissue or nerve injury - induced allodynia and hyperalgesia . this finding provides strong evidence that descending 5-ht from the rvm is an important contributor to pain facilitation during the development of persistent pain . recently , by taking advantage of optogenetic methods , optogenetic stimulation in tph2-channelrhodopsin 2 ( chr2 ) transgenic mice was shown to decrease both mechanical and thermal pain thresholds . however , in contrast , several studies showed the opposite results [ 3235 ] , that 5-ht from the rvm is important for the descending inhibitory pathway . these controversial arguments regarding whether rvm 5-ht plays a facilitatory or inhibitory role might be explained by the different subtypes of 5-ht receptors located in the sdh , according to the reports . for example , 5-ht3 receptors are reported to mediate descending facilitation and to contribute to pain hypersensitivity , whereas the activation of 5-ht2 receptors can potentiate glycine release in the sdh to inhibit pain transmission . in addition , a previous study also provided evidence that , under conditions of experimental pain , activation of 5-ht7 receptors leads to antinociceptive effects in the spinal cord . in the present study , we found that 5-htergic neurons were slightly , although not significantly , increased after nerve injury . however , the excitability of these 5-htergic neurons was elevated after sni ( figure 5 ) . rapamycin could effectively inhibit 5-ht overexcitability and thus attenuate hyperalgesia ( figure 6 ) , which indicates that 5-ht in the rvm is probably involved in the descending pain facilitation pathway under nerve injury - induced neuropathic pain conditions . mtor has been extensively studied in tumors , cardiovascular diseases , and neurodegenerative disorders [ 40 , 41 ] . recently , emerging evidence has indicated that mtor plays a role in pain processing , and it is becoming clear that mtor is important in the regulation of nociception , at both the peripheral and spinal cord levels [ 1017 ] . to date , however , no report has investigated mtor at the supraspinal level and its role in nociceptive modulation . here , we provide potent evidence that mtor contributes to neuropathic pain by increasing the neuronal excitability of 5-htergic neurons in the rvm , thus potentiating descending pain facilitation . 4e - bp1/2 and s6k are involved in the regulation of cell physiology through the modulation of protein synthesis . 4e - bp1/2 inhibits the interaction of the cap - binding translation initiation factor eif4e with other elongation factors , which is a key regulatory process in translation . mtor - mediated phosphorylation of 4e - bp1/2 releases this inhibition , allowing translation initiation to proceed . s6k - mediated phosphorylation of s6 promotes the unwinding and initiation of translation of a subgroup of mrnas called 5-terminal oligopyrimidine tract ( top ) mrnas . top mrnas encode ribosomal proteins and elongation factors 1a and 2 , which are important in translational control . in the present study , we detected that p - mtor and p - s6k levels were significantly elevated in the rvm after sni ( figure 2 ) , which suggests that mtor - mediated protein translation and synthesis are increased . in contrast , the number of 5-htergic neurons was slightly increased within the rvm in the sni rats , but no statistical significance was detected compared to the sham control group . however , by using whole - cell patch recording , we found that the 5-htergic neurons were overexcited , with significant increases in the amplitude and frequency of sepscs as well as the number of action potentials ( figure 5 ) . in addition , rapamycin inhibited only the amplitude and not the frequency of sepscs ( figure 5 ) ; we thus propose that the postsynaptic overexcitability of the 5-htergic neurons , which primarily depends on an increase in glutamate receptors , is mainly due to the activation of mtor . it has been reported that mtor signaling can potentiate the insertion of ampa ( -amino-3-hydroxy-5-methyl-4-isoxazole - propionic acid ) receptors into the postsynaptic membrane and lead to long - term potentiation ( ltp ) [ 44 , 45 ] . thus , the data collected from our immunofluorescence staining and electrophysiology are consistent with previous reports and suggest that the activation of mtor might lead to an increase in ampa receptors and their insertion into the postsynaptic membrane , resulting in the elevated neuronal excitability of the 5-htergic neurons in the rvm . as an effective immunosuppressant , rapamycin is widely used to prevent transplant rejection . chronic treatment of patients with mtor inhibitors is associated with an increased incidence of pain [ 46 , 47 ] , including the possible development of complex regional pain syndrome ( crps ) [ 48 , 49 ] . these conflicting results might be due to the following reasons : ( 1 ) the drug concentration of rapamycin or its analogues was not the same as in the other reports in which the inhibition of mtor produces antinociception ; ( 2 ) long - term treatment might lead to feedback activation of other pronociceptive signal proteins or molecules ; and ( 3 ) intrathecal administration of rapamycin ( at the spinal cord level ) might play a very complicated role in pain transmission with unknown mechanisms . the present study used intra - rvm , instead of intrathecal , administration of rapamycin ( 250 m , 30 min before the behavioral tests ) , and this treatment remarkably attenuated the nociceptive behaviors induced by sni ( figure 6 ) . moreover , intra - rvm rapamycin treatment was effective on day 7 after sni ( the maintenance stage of neuropathic pain ) but not on day 1 after sni ( the induction stage ) . the behavioral pharmacological data suggest that inhibition of mtor in the rvm at the late phase ( maintenance stage ) of neuropathic pain might be effective , even though pain has already been well established . by contrast , inhibition of mtor in the rvm had no effect on the development ( induction stage ) of neuropathic pain . all of these results are consistent with our biochemical data showing that rvm p - mtor was not greatly enhanced at day 1 but showed a significant increase at 7 days after sni ( figure 2 ) . combining our current results with previous findings , we conclude that the specific inhibition of mtor by rapamycin in the rvm is a promising avenue for the management of neuropathic pain . this effect probably occurs via deactivation of 5-htergic spinally projecting neurons in the rvm , which are required for descending pain facilitation . due to the lack of a specific mtor activator , reverse experiments involving the activation of mtor in the rvm , which should produce or enhance nociception , are difficult to achieve . moreover , optogenetic methods as well as transgenic animals should be further introduced to confirm the role of mtor in the rvm , not only in neuropathic pain but also in inflammatory pain .", "through the deactivation of 5-htergic spinally projecting neurons in the rvm and thus the weakening of descending pain facilitation , specific targeting of the activation of mtor in the rvm is a promising avenue for the management of neuropathic pain ." ]

[ "how should the stable patient with penetrating abdominal or lower chest wall trauma be evaluated ? traditional diagnostic methods and liberal indications for surgery have resulted in negative laparotomy rates ranging from 12 - 40% . while negative laparotomy was previously accepted as the inevitable and innocuous result of this policy , recent reports by renz and others have highlighted the 6 - 40% incidence of complications that accompany nontheraputic abdominal exploration . in view of these data , and dissatisfied with our own 33% negative laparotomy rate , prospective evaluation of the role of diagnostic laparoscopy in the evaluation of suspected penetrating abdominal injury was undertaken in september 1995 to identify those patients who could safely avoid surgical intervention , with the expectation that the rate of negative trauma celiotomy would markedly decrease . in this report we review our experience with 70 consecutive patients who underwent diagnostic laparoscopy , and discuss the benefits and pitfalls in diagnosis we encountered utilizing this technique .", "a prospective study of patients with penetrating injuries to the lower thorax and anterior abdomen admitted to the bellevue hospital trauma and shock unit , a level i trauma center in new york city , was performed between september 1995 through november 1997 . patients who were hemodynamically stable without obvious evidence of peritoneal penetration or free intra - abdominal air on upright chest radiograph were entered into the protocol . in light of evidence that co2 pneumoperitoneum may result in an increase in intracranial pressure , patients with known or suspected central nervous system injuries were initially excluded from the protocol . however , the use of diagnostic laparoscopy may be appropriate in head - injured patients when intracranial pressure monitors are in place . after initial evaluation in the emergency room , informed consent was obtained and the patient was transferred to the operating room . general endotracheal anesthesia was induced , orogastric tube and foley catheter inserted , and open laparoscopy performed with the hasson trocar positioned infraumbilically . after insufflation with carbon dioxide gas to 15 mm hg , a 10 mm laparoscope with attached video camera was inserted into the peritoneal cavity , and exploration performed . in patients with thoracoabdominal injuries and suspected diaphragmatic tears , a low pressure pneumoperitoneum of 8 - 10 mm hg was created , the diaphragms visualized , and if no diaphragmatic injuries were present , the pneumoperitoneum was raised to 15 mm hg . routine thoracostomy tubes were not placed prophylactically in light of zargut 's reported 1% pneumothorax rate following carbon dioxide insufflation ( 5 of 510 patients ) ; rather , the anesthesia and surgical teams were alerted to the possible development of a tension pneumothorax in patients at risk for diaphragmatic injury . if no peritoneal violation was noted , or an isolated non - bleeding injury to the liver was present beneath the site of peritoneal penetration , the procedure was terminated , and the patient subsequently discharged from the hospital . if peritoneal violation , major organ injury or hematoma were noted , the procedure was converted to open celiotomy . during this period we did not utilize the technique of gasless laparoscopy , or perform minilaparoscopy in the emergency department with local anesthesia utilizing 3 - 5 mm videoscopes . trauma service records were reviewed for the two years which preceded this study ( 1993 1994 ) ; the overall negative exploration rate for all patients with penetrating abdominal trauma during that time period was 33% .", "sixty - four ( 91% ) patients were male and six ( 9% ) female . forty - four patients ( 63% ) suffered stab wounds to the anterior abdomen , eleven ( 16% ) stab wounds to the left chest with suspicion of intra - abdominal injury , ( 19% ) with abdominal gunshot wounds . two additional patients ( 3% ) involved in motor - vehicle accidents were evaluated laparoscopically after indeterminate computed tomo - graphic ( ct ) scans . the mean operative time for laparoscopy was 16 minutes ( range : 3 60 ) . the mean time for negative laparoscopy was 23 minutes , and 10.8 minutes for laparoscopy with positive findings . forty - one ( 59% ) procedures met criteria for positive laparoscopy : thirty - nine were converted to celiotomy and two additional nonbleeding liver injuries were treated nonoperatively . twenty - five ( 65% ) of the 39 laparotomies were considered therapeutic by the operating surgeon . among the 14 nontheraputic laparotomies , ten were performed in patients with peritoneal penetration visualized on laparoscopy but found to have no intraperitoneal injury at laparotomy , three revealed only minor nonbleeding liver injuries early in our study that the individual attending surgeon was unwilling to treat nonoperatively , and one was performed for free blood secondary to a minor omental laceration . in patients without associated injuries , the mean length of stay following negative laparoscopy was 1.5 days in 21 patients ( range : 1 4 ; the single 4-day stay was due to social service issues ) , compared to 5.2 days ( range : 3 8) for 12 negative explorations following positive laparoscopy . there were no anesthetic complications in the study group , and no tension pneumothoraces or air emboli occurred . one small bowel injury resulted from insertion of the hasson trocar , and was repaired primarily in a patient during laparotomy for a thoracoabdominal gunshot wound with liver , adrenal and diaphragmatic injuries . no intra - abdominal injuries were missed in the negative laparoscopy group ( table 1 ) . however , two of ten patients ( 20% ) who underwent negative laparoscopy for lower left chest stab wounds required urgent return to surgery from the recovery room for missed ongoing hemothoraces . one was a 23-year - old female stabbed in the left anterior axillary line at the 7th intercostal space . a closed tube thoracostomy was per - formed for a nonbleeding pneumothorax upon initial presentation to the emergency room , and she was transferred to the operating room , where laparoscopy revealed no evidence of peritoneal penetration . soon after arrival in the recovery room she drained 750 milliliters of blood from her chest tube and became hypotensive . she was returned to the operating room , where thoracotomy revealed an actively bleeding injury to the lingula which was successfully controlled by stapled wedge resection . the second patient also required a left thoracotomy to oversew bleeding from the lung parenchyma .", "the mean operative time for laparoscopy was 16 minutes ( range : 3 60 ) . the mean time for negative laparoscopy was 23 minutes , and 10.8 minutes for laparoscopy with positive findings . forty - one ( 59% ) procedures met criteria for positive laparoscopy : thirty - nine were converted to celiotomy and two additional nonbleeding liver injuries were treated nonoperatively . twenty - five ( 65% ) of the 39 laparotomies were considered therapeutic by the operating surgeon . among the 14 nontheraputic laparotomies , ten were performed in patients with peritoneal penetration visualized on laparoscopy but found to have no intraperitoneal injury at laparotomy , three revealed only minor nonbleeding liver injuries early in our study that the individual attending surgeon was unwilling to treat nonoperatively , and one was performed for free blood secondary to a minor omental laceration . in patients without associated injuries , the mean length of stay following negative laparoscopy was 1.5 days in 21 patients ( range : 1 4 ; the single 4-day stay was due to social service issues ) , compared to 5.2 days ( range : 3 8) for 12 negative explorations following positive laparoscopy . there were no anesthetic complications in the study group , and no tension pneumothoraces or air emboli occurred . one small bowel injury resulted from insertion of the hasson trocar , and was repaired primarily in a patient during laparotomy for a thoracoabdominal gunshot wound with liver , adrenal and diaphragmatic injuries . no intra - abdominal injuries were missed in the negative laparoscopy group ( table 1 ) . however , two of ten patients ( 20% ) who underwent negative laparoscopy for lower left chest stab wounds required urgent return to surgery from the recovery room for missed ongoing hemothoraces . one was a 23-year - old female stabbed in the left anterior axillary line at the 7th intercostal space . a closed tube thoracostomy was per - formed for a nonbleeding pneumothorax upon initial presentation to the emergency room , and she was transferred to the operating room , where laparoscopy revealed no evidence of peritoneal penetration . soon after arrival in the recovery room she drained 750 milliliters of blood from her chest tube and became hypotensive . she was returned to the operating room , where thoracotomy revealed an actively bleeding injury to the lingula which was successfully controlled by stapled wedge resection . the second patient also required a left thoracotomy to oversew bleeding from the lung parenchyma .", "the mean operative time for laparoscopy was 16 minutes ( range : 3 60 ) . the mean time for negative laparoscopy was 23 minutes , and 10.8 minutes for laparoscopy with positive findings . forty - one ( 59% ) procedures met criteria for positive laparoscopy : thirty - nine were converted to celiotomy and two additional nonbleeding liver injuries were treated nonoperatively . twenty - five ( 65% ) of the 39 laparotomies were considered therapeutic by the operating surgeon . among the 14 nontheraputic laparotomies , ten were performed in patients with peritoneal penetration visualized on laparoscopy but found to have no intraperitoneal injury at laparotomy , three revealed only minor nonbleeding liver injuries early in our study that the individual attending surgeon was unwilling to treat nonoperatively , and one was performed for free blood secondary to a minor omental laceration .", "in patients without associated injuries , the mean length of stay following negative laparoscopy was 1.5 days in 21 patients ( range : 1 4 ; the single 4-day stay was due to social service issues ) , compared to 5.2 days ( range : 3 8) for 12 negative explorations following positive laparoscopy .", "there were no anesthetic complications in the study group , and no tension pneumothoraces or air emboli occurred . one small bowel injury resulted from insertion of the hasson trocar , and was repaired primarily in a patient during laparotomy for a thoracoabdominal gunshot wound with liver , adrenal and diaphragmatic injuries .", "no intra - abdominal injuries were missed in the negative laparoscopy group ( table 1 ) . however , two of ten patients ( 20% ) who underwent negative laparoscopy for lower left chest stab wounds required urgent return to surgery from the recovery room for missed ongoing hemothoraces . one was a 23-year - old female stabbed in the left anterior axillary line at the 7th intercostal space . a closed tube thoracostomy was per - formed for a nonbleeding pneumothorax upon initial presentation to the emergency room , and she was transferred to the operating room , where laparoscopy revealed no evidence of peritoneal penetration . soon after arrival in the recovery room she drained 750 milliliters of blood from her chest tube and became hypotensive . she was returned to the operating room , where thoracotomy revealed an actively bleeding injury to the lingula which was successfully controlled by stapled wedge resection . the second patient also required a left thoracotomy to oversew bleeding from the lung parenchyma .", "the optimal management of the asymptomatic patient with penetrating thoracoabdominal trauma has yet to be determined . prior to september 1995 , the criteria for mandatory laparotomy at our institution were broad and included all anterior abdominal gunshot injuries , and stab wounds to the anterior abdomen with posterior fascial penetration demonstrated by local wound exploration . recent reports have emphasized the complication rate following negative laparotomy for trauma , ranging from a six percent to 20% incidence in renz and feliciano 's series of 81 patients with penetrating abdominal trauma without associated injuries , and 22% in sosa 's recent comparison of mandatory laparotomy and diagnostic laparoscopy for asymptomatic abdominal gunshot wounds . leppaniemi et al . from finland reported their 24-year experience of a 40% negative laparotomy and 21% complication rate in 457 patients following mandatory laparotomy for penetrating truncal trauma . while many of the complications following negative laparotomy in these four reports were minor sosa et al . prospectively studied 85 patients with asymptomatic abdominal gunshot wounds by diagnostic laparoscopy , and compared them to the preceding four - year period when mandatory laparotomy was performed in a similar group of 817 patients . he was able to document a drop in the negative laparotomy rate from 12.4% to 4.7% when routine diagnostic laparoscopy was instituted . additionally , there was a significant decline in average length of stay from 5.1 to 1.4 days , with no missed intraperitoneal injuries and only one significant complication ( urinary retention ) following negative laparoscopy . the largest experience to date with the use of diagnostic laparoscopy is a retrospective multicenter study of 510 patients with penetrating abdominal trauma . in this series , 54.3% of exams revealed either nonpenetration or nonsignificant injuries , and the mean hospital stay was 1.7 days in the absence of associated injuries . laparotomy was considered therapeutic in 155 of the 213 patients ( 73% ) who underwent formal abdominal exploration . is an additional group of 26 patients who underwent therapeutic laparoscopy , including repair of diaphragmatic and anterior gastric lacerations , and control of hepatic bleeding . while it is not clear from this paper whether laparoscopy resulted in a reduction in the rate of negative laparotomy ( which was 25% overall in this combined series ) , it does indicate that laparoscopy can safely and reliably select those patients without intraperitoneal injury who can be spared a negative laparotomy . in view of these reports , and dissatisfied with our own negative laparotomy rate , prospective evaluation of diagnostic laparoscopy was undertaken with the expectation that insignificant injuries could be reliably identified , thus reducing both the incidence of negative celiotomy and hospital length of stay . in the 70 consecutive patients who underwent diagnostic laparoscopy , the negative laparotomy rate was 20% , and if the trivial liver injuries explored early in our experience are excluded , the rate drops to 16% . this is comparable to the negative laparotomy rates of 11 - 20% following laparoscopy recently reported by other authors . overall , the negative exploration rate for all patients with penetrating abdominal trauma treated during this time period at our institution fell from 33% to 20% . while a significant decrease in our negative laparotomy rate occurred , it is still not negligible , and this failure to eliminate nontheraputic laparotomy in one - fifth of the cases of penetrating trauma is the achilles ' heel of diagnostic laparoscopy as currently practiced . as our ability to laparoscopically explore the peritoneal cavity , reliably examine the large and small bowel , and perform laparoscopic repair of selected injuries improves , the negative laparotomy rate should continue to decline and can be expected to approach five percent . since bellevue hospital charges a fixed comprehensive daily rate , a true cost analysis could not be made , leaving the length of stay as the only valid index of comparison ; during the study period it was 5.2 days following negative laparotomy as compared to 1.5 days after negative laparoscopy . at current charges of $ 1,000 per day , a 3.7 day decrease in length of stay represents a $ 3,700 reduction in cost per patient , which translates into an overall savings of $ 77,700 for the 21 patients who underwent negative laparoscopy and did not require additional hospitalization for associated injuries . while primarily used to evaluate penetrating injuries , laparoscopy also proved to be a useful tool in selected blunt trauma patients with benign clinical exams and indeterminate radiologic studies . one patient had a minimal amount of free fluid in the pelvis on computed tomography ( ct ) ; laparoscopy revealed turbid fluid , and a perforation of the antimesenteric border of the proximal jejenum was found and repaired at laparotomy . the second patient was a pedestrian struck by a taxi on the right flank and hip ; she was hemodynamically stable and complained only of right hip pain upon evaluation in the emergency room . there was a question of bowel gas above the left hemidiaphragm on chest roentgenogram , and both ct scan and upper gastrointestinal series were equivocal regarding the presence of a diaphragmatic rupture . laparoscopy revealed free blood in the peritoneal cavity , and a splenic laceration and intact left hemidiaphragm were found at exploration . another subgroup in whom diagnostic laparoscopy proved efficacious was in the evaluation of the trauma patient infected by the human immunodeficiency virus . three hiv+ patients with abdominal stab wounds and equivocal physical exams underwent negative laparoscopy , sparing all three an unnecessary abdominal exploration . laparoscopy has been championed by some authors as a routine maneuver in the evaluation of penetrating lower chest injuries to detect clinically and radiologically occult diaphragmatic injuries . in this study , laparoscopy was selectively employed to evaluate those lower chest injuries felt to be at particular risk for intra - abdominal injuries , and one diaphragmatic injury was detected and repaired . however , two of the remaining ten patients with thoracoabdominal stab wounds who underwent negative diagnostic laparoscopy manifested ongoing thoracic blood loss that necessitated return to the operating room , reinduction of general anesthesia and thoracotomy for definitive control of pulmonary parenchymal bleeding . clearly , routine diagnostic laparoscopy in these patients resulted in initial evaluation of the wrong body cavity , and lulled us into a false sense of security regarding the extent and severity of injury . thus , in patients with penetrating thoracoabdominal trauma and negative diagnostic laparoscopy , we now believe that diagnostic thoracoscopy should be performed before the patient leaves the operating room . the applications of thoracoscopy in the trauma patient are expanding ; this technique can be used to detect and repair diaphragmatic injuries , evaluate the pericardium , and treat both ongoing and established hemothoraces .", "this experience confirms that laparoscopy is a safe and accurate tool for identifying peritoneal penetration following penetrating abdominal trauma , and adoption of this technique resulted in significant decreases in both the rate of negative laparotomy , and the hospital length of stay following a negative evaluation . one drawback is that the rate of negative laparotomy , while reduced , remains in the range of 1020% in our experience and recent comparable series . diagnostic laparoscopy reliably identifies those injuries to the liver that can be safely managed nonoperatively . it also proved useful in the evaluation of the hiv+ patient with equivocal findings on physical exam , and of stable patients with indeterminate or while other authors have demonstrated its sensitivity in the detection of diaphragmatic injuries , we urge caution in its use as the primary diagnostic study in penetrating thoracoabdominal trauma based on our experience with missed major intrathoracic injuries , and are currently investigating the complementary role of thoracoscopy in penetrating lower thoracic injuries ." ]

[ "selenium ( se ) has been recognized as an essential nutrient for plant , animal , and human body , but at high concentration it can become toxic . the range between the concentration in which selenium is essential and toxic is very narrow [ 1 , 2 ] . this element plays an important role in elderly people as well as in the prevention of many age - associated diseases and in maintenance of normal immune function . se is potent antioxidant involved in cellular defense against free radical reactions , and the risk of deficiency seems to increase in proportion to the age . evidence is accumulating that most of the degenerative diseases have their origin in deleterious free radical reactions . these diseases include atherosclerosis , cancer , inflammatory joint , asthma , diabetes , senile dementia , and degenerative eye disease . but high se concentrations in human can cause loosing hair and nails and irritation of skin and eye . the required daily amount of se is 20 mcg day and 4070 mcg day for 46 years old and adult males , respectively . the essential role of the se is due to its presence in the active site of some enzymes ( i.e. , glutathione peroxidase and iodotironine-5-deiodinase ) and the catalytic effect of selenium compounds on the reaction of intermediate metabolism and inhibition of the toxic effect of heavy metals . it has been established that diets with deficit in se are associated with some human diseases , but diets with se contents higher than 5 mg / kg are toxic and cause important symptoms in humans and animals . selenium is present as selenocysteine ( se - cys ) in at least 30 proteins . all these factors , together with the fact that the concentration levels are extremely low , call for sensitive and accurate method for the determination of this element . selenium can be present in 2 , 0 , + 4 , and + 6 oxidation states . these forms can not simultaneously be evaluated by direct application of certain analytical techniques such as instrumental neutron activation analysis ( inaa ) [ 6 , 7 ] , as well as hydride generation atomic absorption spectroscopy ( hg - aas ) , inductively coupled plasma atomic emission spectrometry ( icp - aes ) , electrothermal atomic absorption spectrometry ( et - aas ) , or inductively coupled plasma mass spectrometry ( icp - ms ) , after digestion of sample [ 810 ] . the most common methods used for determination of various species of selenium were atomic absorption spectrometry ( hydride generation and electrothermal atomization ) [ 1114 ] , molecular [ 15 , 16 ] and atomic fluorescence spectrometry [ 1719 ] , high - performance liquid chromatography ( hplc ) [ 2022 ] , voltammetry [ 23 , 24 ] , atomic emission spectrometry ( aes ) , such as inductively coupled plasma ( icp ) and inductively coupled plasma - mass spectrometry ( icp - ms ) , and spectrophotometry methods [ 2528 ] . in spite of some of the above methods , spectrophotometric methods are popular because of their simplicity and are based on piazselenol complex formation between the reagents and selenium . an interesting alternative to traditional liquid - liquid extraction is the micelle - mediated extraction , firstly developed by watanabe and tanaka . the cloud point is the temperature above which aqueous solutions of nonionic and zwitterionic surfactant become turbid . micelles of such well - known nonionic surfactant as triton x-100 or x-114 have a nonpolar core and extended polar layer , where both extractants and extracted complexes can be solubilized . above the cloud point , the solution is separated into two phases , a rich phase containing a high surfactant concentration in a small volume and a poor phase with a surfactant concentration close to the critical micelle concentration ( cmc ) . hydrophobic species ( hydrophobic organic compounds or metal ions after reaction with a suitable hydrophobic ligand ) present in sample are able to interact with the micelles , thus being concentrated in the small volume of the surfactant - rich phase . the aim of this work was to use a simple , rapid , and sensitive spectrophotometric method ( dithizone as chromogenic reagent ) for determination of trace amounts of selenium ( iv ) ( 5100 ng ml ) in micellar medium ( triton x-100 ) in cosmetic and pharmaceutical products . to improve the detection limit of this method , cloud point extraction ( cpe ) has been used .", "selenium metal ( purity : 99.9% ) was obtained from the riedel de haen ( germany ) . nitric acid ( > 99.5% ) , sodium hydroxide ( > 97% ) , ascorbic acid , hydrochloric acid ( 36.538% ) , phenol ( > 99.0% ) , methanol ( > 99.8% ) , and sulfuric acid ( 95.097.0% ) were purchased from merck ( germany ) . all chemicals were used without any further purification . deionized water from a milli - q system ( millipore , usa ) was used for preparation of all solutions . selenium sulphide shampoo ( iran ) , centrum tablet ( usa ) , and selen plus capsule ( germany ) were obtained from market . a shimadzu double - beam uv - vis spectrophotometer ( model 1650 pc , japan ) with 1.0 cm quartz cell was used for all spectral measurements . in order to investigate the accuracy of method a perkinelmer ( model optima 7000 dv ) inductively coupled plasma optical emission spectrometer ( icp - oes ) separation of surfactant phase and aqueous phase was carried out with a hettich centrifuge ( eba 20 , uk ) . a microwave system ( microdigest 301 , prolabo , france ) with a maximum irradiation power of 200 w was used . ph measurements were made with a metrohm ph meter ( model 744 , switzerland ) . the effect of temperature was investigated by a gfl thermostated bath ( model 1003 , germany ) . the stock standard solution of selenium ( iv ) ( 1000 g ml ) was prepared by dissolving 100 mg of selenium metal in hot concentrated nitric acid and diluted to 100 ml with water . from this solution serial dilutions were made to obtain different concentration levels of 5 , 15 , 30 , 40 , 55 , 70 , 80 , and 100 ng ml of selenium ( iv ) . the stock solution of dithizone ( 10 mol l ) was prepared daily by dissolving 12.8 mg of the reagent in 5 ml of naoh solution ( 0.1 m , containing the 50 mg of ascorbic acid for stabilizing the dithizone ) and diluting to 50 ml with water . the stock solution was diluted with water to obtain the final dithizone concentration of about 7.5 mol l. the stock solution of triton x-100 ( 10% ( w / v ) ) was prepared by weighing 10 g of this reagent into 100 ml volumetric flask , dissolving in water by gentle heating , and making up to the mark with water . the final concentration of triton x-100 ( 0.2% ) was prepared by suitable dilution of stock solution with the diluent ( solution of 0.5% ( w / v ) of phenol ) . an aliquot of 50 ml of a solution containing selenium ( iv ) ( final concentration 5100 ng ml ) , triton x-100 ( 0.2% ( w / v ) ) , dithizone ( 7.5 mol l ) , and hcl ( 0.35 m ) was kept for 15 min to complete the color development . then the mixture was placed in a water bath at 40c for 10 min , when 0.5% ( w / v ) of the phenol was used for inducing the cloud point . phase separation was accelerated by centrifuging the test tube at 3500 rpm for 15 min . the bulk aqueous phases were easily decanted by gently inverting the test tubes , and the surfactant - rich phase ( complex rich ) was made up to 5 ml by adding methanol . the same procedure was applied for preparation of blank solution without the selenium and dithizone . the absorbance of two methanolic solutions was measured at 424 and 592 nm , against a blank ( prepared in the same way without se and dithizone ) . the absorption maxima of the complex ( 424 nm ) and dithizone ( 434 nm ) were overlapping ( figure 1 ) . hence , the corrected absorbance , a \n corr , was used to overcome the problem : \n ( 1)acorr = a424(a424a592)la592 , \n where a \n 424 and a \n 592 are the absorbance of the complex measured at 424 and 592 nm , respectively , and ( a \n 424/a \n 592)l is the absorbance ratio of dithizone at 424 and 592 nm . the complex does not show any absorbance at 592 nm . under optimum conditions , a calibration graph was used for determination of selenium in cosmetic and pharmaceutical products . shampoo ( selenium sulphide , iran ) sample dissolution was prepared using the procedure described by afkhami et al . . approximately 1 g of shampoo sample was weighted into a 100 ml beaker . concentrated sulfuric acid ( 1 ml ) the solution was allowed to cool , and 5 ml of 30% ( w / v ) hydrogen peroxide was added . the mixture boiled vigorously to eliminate excess hydrogen peroxide and allowed to cool and then the digest transferred to a 100 ml volumetric flask . finally , 2 ml of this solution was taken for determination of selenium ( iv ) as in the recommended procedure . a centrum tablet ( usa ) containing 0.25 mg se ( as sodium selenate ) was placed in digestion vessel . 5 ml of concentrated nitric acid and 2 ml of hydrogen peroxide were added and the mixture subjected to microwave irradiation ( 25% of power , 5 min ) in order to digest the sample . then , 10 ml of hydrochloric acid ( 6 m ) was added , and the mixture was irradiated by microwave ( 75% of power , 5 min ) in order to reduce all se to se ( iv ) . . 1 ml of treated sample solution was dropwise passed through an eichrom cation exchange resin ( sulfonic acid groups , mesh ranges : 50100 m , 8 cm ) , for removal of interferences , and selenium was determined with the recommended procedure . a selen plus capsule ( germany ) was dissolved in 10 ml hcl ( 6 m ) , and the mixture was irradiated by microwave ( 75% of power , 5 min ) in order to reduce all se to se ( iv ) . the mixture was then diluted to 50 ml with water , and then 1 ml of this mixture was taken for determination of selenium ( iv ) as in the recommended procedure .", "from the plot obtained by job 's method of continuous variation , the se- ( iv ) to- dithizone ( h2dz ) ratio forming the complex was found to be 1 : 4 at ph < 1 . the complex can , therefore , be represented as se(hdz)4 which is in agreement with the reported composition in the organic phase . the conditional stability constant of the 1 : 4 ( se : h2dz ) complex was calculated , assuming the following equilibrium in the system : \n ( 2)h2seo3 + 4 h2dzse(hdz)4 + 3h2o . \n using the plot obtained by job 's method , xmax ( chdz / ctotal ) was found to be 0.8 , and therefore the ratio of se : hdz was calculated 1 : 4 ( figure 1 ) . selenium ( iv ) reacts with dithizone ( hdz ) in micellar medium and forms a hydrophobic complex , se(hdz)4 , which is subsequently trapped in the surfactant micelles and separated from the aqueous phase . figure 2 shows the absorption spectra for the dithizone and selenium - dithizonate complex in surfactant - rich phase against a reagent blank . the absorption maximum of the complex was 424 nm , and the absorption maxima of the dithizone were 434 and 592 nm . solution ph plays a unique role on metal - chelate function and subsequent extraction . figure 3 shows the influence of hcl concentration on the corrected absorbance of the selenium dithizonate complex at 424 nm . as can be seen , the complex extraction was increased with the increased hcl concentration and then showed a decrease . the reason for this behaviour might be because of decreasing the dithizone stability at higher phs . hence , an hcl concentration of 0.35 m was chosen for further studies . the influence of the dithizone ( hdz ) concentration on analytical response is shown in figure 4 . this figure shows that the absorbance increased up to a known concentration of dithizone ( 7.5 mol l ) and then reached a plateau that can be attributed to complete extraction . therefore , the concentration of 7.5 mol l of dithizone was selected as the optimum . the nonionic surfactant triton x-100 was chosen because of its commercial availability of high purified homogeneous form , low toxicological properties , and cost . the cloud point temperature of triton x-100 is 63.7c . to decrease the cloud point temperature of triton x-100 to room temperature ( desirable temperature in cloud point procedure ) , this solution was prepared by the diluent ( solution of 0.5% ( w / v ) of phenol ) . the variation of absorbance at \n max of complex as a function of the concentration of triton x-100 is shown in figure 5 . at lower concentrations of triton x-100 , the low extraction efficiency of the complex may be due to the inadequacy of the assemblies to entrap the hydrophobic complex quantitatively . the concentration of 0.2% ( w / v ) triton x-100 was selected for further studies . optimal incubation time and equilibration temperature are necessary to complete the reaction , easy phase separation , and preconcentration as efficient as possible . providing that the complexation reaction has been completed under certain conditions , corrected absorbance data show that , for equilibration times of 10 to 30 min , extraction efficiency is almost constant . on the other hand , it appears that the phase volume ratio of all nonionic surfactants decreases as the equilibration temperature increases . as can be seen in figure 7 , the corrected absorbance increases very gently up to 40c and starts to decrease afterwards due to decrease in the stability of the dithizone and consequently the extraction efficiency . the dependence of corrected absorbance upon centrifugation time was studied within the range of 530 min . it was found that a time of 15 min is adequate for separation of two phases . calibration graph was obtained by preconcentrating 50 ml of the sample containing 5 , 15 , 30 , 40 , 55 , 70 , 80 , and 100 ng ml of selenium ( iv ) under the optimal experimental conditions . analytical parameters for the determination of the selenium - dithizonate complex are presented in table 1 . the relative standard deviation was 2.18% for six replicate measurements of standard selenium solution ( 50 ng ml ) . the effect of various cations and anions on the determination of 0.05 g ml of se(iv ) was studied , and the results are summarized in table 2 . the tolerance limit was taken as the concentration of added ion causing less than 5% relative error . cations such as ag(i ) , cu(ii ) , hg(ii ) , and fe(iii ) were interfered with the determination of se(iv ) ion . these cations can be removed using a cation exchange resin ( sulfonic acid groups , mesh ranges : 50100 , 8 cm ) . for this purpose , 25 ml solution containing 2.5 g of se(iv ) and various amounts of desired cations was passed through 5 g cation exchange resin ( 8 cm wet resin ) dropwise and collected in a 50 ml volumetric flask containing optimum amount of dithizone ( 7.5 mol l ) , hcl ( 0.35 m ) , and triton x-100 ( 0.2% w / v ) . after washing the column with water ( three times , with 15 ml ) , 0.5% ( w / v ) phenol was added and the solution was diluted to the mark with water and the amount of se ( iv ) was determined using recommended procedure . to evaluate the analytical applicability , the method was applied to the determination of selenium in two multivitamin tablets ( centrum and selen plus ) and a selenium sulphide shampoo ( for treatment of dandruff ) . the results for selenium sulphide shampoo , centrum , and selen plus multivitamins are given in tables 3 , 4 , and 5 , respectively . in order to evaluate the accuracy of procedure , selenium was determined in centrum tablet ( containing 0.25 mg se as sodium selenate ) by icp - oes as reference method . in both methods the results agreed well ( table 6 ) . the limit of detection and relative standard deviation of the proposed method were compared with methods in the literature ( table 7 ) . as observed from the results limit of detection by the proposed method was lower than other methods .", "the simplicity , rapidity , and inexpensiveness of the proposed method in combination with the use of dithizone as a chromogenic reagent were utilized for selenium determination in cosmetic and pharmaceutical samples . precision and recovery data clearly indicated the reproducibility and accuracy of the method . in this investigation , spectrophotometric determination of selenium was carried out in micellar medium without the need for an extraction step . because of the overlapping of absorption maximum of complex at 424 nm with absorption maximum of dithizone at 434 nm , a \n corr was applied ." ]

[ "data on individuals aged 029 years diagnosed with any type of diabetes ( excluding gestational ) from 1 january 1991 to 31 december 2006 were extracted from clinical notes by a dedicated register manager and entered onto the population - based yorkshire register of diabetes in children and young people for residents of west yorkshire , which has a 97.6% level of completeness ( 1 ) . type of diabetes was defined in accordance with world health organization guidelines ( 10 ) as type 1 , type 2 , maturity - onset diabetes of the young ( mody ) , original diagnoses of uncertain / unclassified were reclassified as type 1 for 18% ( n = 32 ) and type 2 for 11% ( n = 20 ) . ethnicity was assigned as south asian ( pakistani , indian , bangladeshi ) or non - south asian ( all other ethnicities ) using the south asian names analysis program ( nam pehchan ) and the south asian name and group recognition algorithm ( sangra ) , two independent name recognition programs that are validated and sensitive tools for identifying south asians ( 11,12 ) . where the programs disagreed ( < 1% ) , a local expert examined the names and assigned ethnicity . incidence was defined as the number of newly diagnosed cases per calendar year and 100,000 population at risk . populations for west yorkshire were provided by the office for national statistics , supplemented by estimated midyear population denominators by age , sex , and ethnic group . effects on incidence of age at diagnosis ( 5-year groups ) , sex , ethnicity ( south asian or not ) , and year of diagnosis on all types , type 1 , type 2 and uncertain / unclassified diabetes were analyzed using poisson regression . average annual percentage change ( aapc ) and 95% cis were derived using the coefficient for year in the poisson model . all analyses were done in stata 11 software ( statacorp lp , college station , tx ) .", "diabetes was diagnosed in 2,889 children and young people , with 83% ( n = 2,410 ) type 1 , 12% ( n = 337 ) type 2 , 0.7% ( n = 19 ) mody , 0.1% ( n = 1 of each ) j-type or other , 0.1% ( n = 4 ) not recorded , and 4% the incidence ( 95% ci ) of all diabetes ( aged 029 years ) was 21.0 ( 20.221.7 ) per 100,000 , with no statistically significant differences between south asians and non - south asians . the incidence of type 1 diabetes was 17.6 ( 16.918.3 ) , with significantly higher rates in non - south asians ( 18.3 [ 18.319.0 ] ) than in south asians ( 13.1 [ 11.414.8 ] ) . type 2 incidence was 2.5 ( 2.22.7 ) , which was significantly lower for non - south asians ( 1.8 [ 1.62.1 ] ) than south asians ( 6.9 [ 5.68.1 ] ) . incidence of uncertain / unclassified diabetes was 0.8 ( 0.670.98 ) and was lower for non - south asians . aapc was 4.0% ( 95% ci 3.24.8 ) overall , and significantly greater in south asians ( 7.0% [ 4.89.2 ] ) compared with non - south asians ( 3.6% [ 2.74.4 ] ) ( fig . 1 ) and females ( 5.3% [ 4.16.4 ] ) compared with males ( 3.0% [ 1.94.0 ] ) . for type 1 diabetes , aapc was 1.3% ( 0.42.2 ) overall , with a significant increasing trend seen in non - south asians ( 1.4% [ 0.52.3 ] ) compared with no trend in south asians ( 0.0% [ 2.8 to 2.8 ] ) . annual incidence increased significantly for children ( aged 014 years ) at 2.9% ( 1.74.0 ) , but was stable for young people aged 1529 years ( 0.6% [ 1.9 to 0.7 ] ) . for type 2 , the incidence in those aged younger than 30 years rose from 0.1 to 4.9 per 100,000 between 1991 and 2006 and aapc was 19.4% ( 16.522.2 ) overall , with incidence increasing at a similar rate for both ethnic groups . incidence increased at a faster rate for children aged 014 ( 37.4% [ 21.553.2 ] ) compared with those aged 1529 ( a high - quality color representation of this figure is available in the online issue . ) the proportion of uncertain / unclassified cases per year rose from 0% in 1991 to 8% in 2006 . aapc was 26.4% ( 95% ci 20.732.1 ) overall , with similar increases for both ethnic groups .", "the incidence ( 95% ci ) of all diabetes ( aged 029 years ) was 21.0 ( 20.221.7 ) per 100,000 , with no statistically significant differences between south asians and non - south asians . the incidence of type 1 diabetes was 17.6 ( 16.918.3 ) , with significantly higher rates in non - south asians ( 18.3 [ 18.319.0 ] ) than in south asians ( 13.1 [ 11.414.8 ] ) . type 2 incidence was 2.5 ( 2.22.7 ) , which was significantly lower for non - south asians ( 1.8 [ 1.62.1 ] ) than south asians ( 6.9 [ 5.68.1 ] ) . incidence of uncertain / unclassified diabetes was 0.8 ( 0.670.98 ) and was lower for non - south asians .", "aapc was 4.0% ( 95% ci 3.24.8 ) overall , and significantly greater in south asians ( 7.0% [ 4.89.2 ] ) compared with non - south asians ( 3.6% [ 2.74.4 ] ) ( fig . 1 ) and females ( 5.3% [ 4.16.4 ] ) compared with males ( 3.0% [ 1.94.0 ] ) . for type 1 diabetes , aapc was 1.3% ( 0.42.2 ) overall , with a significant increasing trend seen in non - south asians ( 1.4% [ 0.52.3 ] ) compared with no trend in south asians ( 0.0% [ 2.8 to 2.8 ] ) . annual incidence increased significantly for children ( aged 014 years ) at 2.9% ( 1.74.0 ) , but was stable for young people aged 1529 years ( 0.6% [ 1.9 to 0.7 ] ) . for type 2 , the incidence in those aged younger than 30 years rose from 0.1 to 4.9 per 100,000 between 1991 and 2006 and aapc was 19.4% ( 16.522.2 ) overall , with incidence increasing at a similar rate for both ethnic groups . incidence increased at a faster rate for children aged 014 ( 37.4% [ 21.553.2 ] ) compared with those aged 1529 ( a high - quality color representation of this figure is available in the online issue . ) the proportion of uncertain / unclassified cases per year rose from 0% in 1991 to 8% in 2006 . aapc was 26.4% ( 95% ci 20.732.1 ) overall , with similar increases for both ethnic groups .", "an increasing burden of diabetes was observed in non - south asian and south asian children and young people , with a rising incidence of type 1 diabetes confirmed in children ( 3,4 ) and stable rates for young adults ( 1,2 ) . although the proportion of south asians in the diabetes population ( 13% ) was similar to the background population , south asians had a lower incidence of type 1 diabetes but an excess of type 2 , with an apparent shift from diagnosis of type 1 to type 2 from 2000 onwards . the previously reported steep rise in incidence of type 1 diabetes in south asian children up to 1999 ( 5 ) was not sustained , possibly as a result of a change in the recognition that type 2 and other forms of diabetes are emerging in younger age groups . all south asian children diagnosed with type 2 diabetes between 1991 and 2006 were 10 years or older , and a fall in type 1 in those 15 to 29 years old in the second period is unlikely to be attributable to changes in diagnostic classification . there are clinical challenges in the differential diagnosis of type 1 and type 2 diabetes ( 13,14 ) . treatment can be based on symptoms with no clear diagnosis , reflected in rising numbers of uncertain / unclassified diagnoses ( two diagnoses in the first 5 years , with 91 thereafter ) . we acknowledge that we may have underestimated the incidence of type 2 especially in earlier years , a problem identified in an earlier survey ( 15 ) , but these observations confirm the importance of including all forms of diabetes in our analyses ." ]

[ "familial adenomatous polyposis ( fap ) is a rare cause of colorectal cancer and is caused by a wide spectrum of mutations in the apc gene.1 \n 2 fap usually presents with a 100 to 1,000 of precancerous colonic polyps . without colectomy , while pathogenic apc mutations have a complete penetrance in the colon , this is not the case in extracolonic manifestations . gardner and richards first described the association of fap with a variety of extracolonic tumors , especially soft tissue lesions , but also osteomas , thyroid cancer , and hepatoblastoma . the triad of soft tissue lesions , osteomas , and dental abnormalities in fap patients has therefore been named gardner syndrome.3 \n 4 gardner fibromas ( gf ) have been defined only recently as superficial and poorly circumscribed tumor - like lesions , which consist mainly of thick haphazardly arranged collagen bundles with few interspersed spindle cells of fibroblast type.5 \n 6 \n 7 gf are regarded as a precursor lesion of desmoid tumors which have a more cellular appearance . both are associated with fap ( although it is unknown whether this is always the case).8 \n 9 the most common sites are the back , paraspinal region , and chest wall , but gf may occur in any part of the body . gf may precede the development of colonic adenomas and therefore lead to an early detection of fap in otherwise asymptomatic patients . although it is most frequently observed in the first decade of life , with 78% of the cases being diagnosed before 10 years of age,9 neonatal gf has only been reported in a single case report so far.10 in our report , we relate the cases of two patients with neonatal gf and very different findings .", "a 7-week - old otherwise healthy boy of nonconsangineous parents presented with a subcutaneous tumor on the left parasternal chest wall immediately after birth . ultrasound was performed and showed a dense structure lying above rib level measuring 1.4 0.5 cm ( fig . analysis of the family history revealed no family members with adenomas , fibromas , or colorectal cancer . 1b ) . magnetic resonance imaging ( mri ) scans at the age of 5.5 and 9 months revealed a tumor size of 4.5 4.0 1.2 and 6.2 5.6 1.8 cm , respectively . furthermore , the tumor had infiltrated the intercostal space and distal sternum at 9 months , eroding the bone , and was lying adjacent to the pericardium ( fig . a radical resection was performed with partial resection of the distal sternum , ribs 7 to 9 on the left side and the medial part of the major pectoralis muscle . closure of the chest wall was possible with insertion of a 5 4 cm goretexpatch ( w. l. gore & associates , inc . mobilization of major and minor pectoralis muscle as well as the abdominal wall muscles allowed full muscular covering and subsequent primary skin closure . resection margins were free of tumor except at the inferior end ( cartilaginous part of rib 10 ) . regular mri scans every 6 months during follow - up showed no recurrence ( fig . ( b ) growing tumor size 5 months after first resection : 4.8 3.5 1.4 cm . \n h&e stain ( 40 ) shows thick haphazardly arranged collagen bundles with few interspersed spindle cells of fibroblast type . ( image courtesy of a. kaiser , md , klinikum nrnberg , institute of pathology ) . \n mri scans of patient a. ( a ) tumor at the age of 9 months . ( b ) tumor site 24 months postoperatively without recurrence . mri , magnetic resonance imaging . molecular genetic analysis of the apc gene by polymerase chain reaction ( pcr ) and subsequent sanger sequence analysis of all coding exons did not show any causative mutation . in addition , multiplex ligation - dependent probe amplification ( mlpa , kit p043 , mrc - holland , the netherlands ) analysis , which allows for the detection of potential deletions and duplications , showed a large heterozygous deletion affecting most of the apc coding region ( exons 415 [ genbank nm_000038.3 ] , equals exons 718 [ genbank nm_000038.5 ] ) up to the most distal part of the gene ( fragment w ) ( fig . the deletion was confirmed on a second blood sample and classified as a bona fide pathogenic alteration because of its large size . \n deletion / duplication analysis using multiplex ligation - dependent probe amplification showing monoallelic deletion affecting most of the apc coding region , showing that the gene dose of exon 4 onwards is reduced by 50% and proving the heterozygous deletion of a large portion of apc . subsequent testing of the parents showed the same apc deletion in the father who had no complaints . after having established the diagnosis he underwent colonoscopy , which led to the diagnosis of cancer of the sigmoid colon . anal anastomosis , the histological workup verified a pt3 , pn2 ( 11/52 ) , l1 , g2 adenocarcinoma . the paternal grandmother did not show the familial apc deletion , the paternal grandfather was unavailable for investigation . the otherwise healthy boy of nonconsangineous parents was diagnosed with a left - sided paravertebral soft tissue tumor measuring 6 3 1 cm at birth . due to known fap in the father the soft tissue tumor was assumed to be an extracolonic manifestation of fap . because of tumor progression during the next 4 months ( fig . histology confirmed gf consisting of fatty tissue interspersed with thick collagen bundles , many small blood vessels and some dispersed mast cells . mri scan 16 weeks after birth tumor size : 8 5 cm . he developed osteomas of the skull and intestinal polyps were confirmed by colonoscopy but without the necessity for surgical intervention so far . the father of the boy had developed clinical symptoms of fap at the age of 27 and underwent prophylactic restorative proctocolectomy and ileal pouch anal anastomosis at the age of 28 . within 3 years after surgery he developed severe retroperitoneal desmoid disease leading to hydronephrosis necessitating nephroureterectomy . after 6 months he underwent a further desmoid tumor resection in the abdominal wall , the attempted resection of a large pelvic desmoid failed due to poor circumscription . molecular genetic analysis by pcr and sanger sequence analysis of all coding exons showed a heterozygous frameshift mutation c.4393_4394delag , p.ser1465trpfs*3 in exon 15 , segment h ( equals exon 18 , segment h [ genbank nm_000038.5 ] ) of the apc gene leading to introduction of a stop codon at amino acid position 1467 , thereby causing a truncated nonfunctional or functionally impaired apc protein .", "a 7-week - old otherwise healthy boy of nonconsangineous parents presented with a subcutaneous tumor on the left parasternal chest wall immediately after birth . ultrasound was performed and showed a dense structure lying above rib level measuring 1.4 0.5 cm ( fig . analysis of the family history revealed no family members with adenomas , fibromas , or colorectal cancer . 1b ) . magnetic resonance imaging ( mri ) scans at the age of 5.5 and 9 months revealed a tumor size of 4.5 4.0 1.2 and 6.2 5.6 1.8 cm , respectively . furthermore , the tumor had infiltrated the intercostal space and distal sternum at 9 months , eroding the bone , and was lying adjacent to the pericardium ( fig . a radical resection was performed with partial resection of the distal sternum , ribs 7 to 9 on the left side and the medial part of the major pectoralis muscle . closure of the chest wall was possible with insertion of a 5 4 cm goretexpatch ( w. l. gore & associates , inc . mobilization of major and minor pectoralis muscle as well as the abdominal wall muscles allowed full muscular covering and subsequent primary skin closure . resection margins were free of tumor except at the inferior end ( cartilaginous part of rib 10 ) . regular mri scans every 6 months during follow - up showed no recurrence ( fig . ( b ) growing tumor size 5 months after first resection : 4.8 3.5 1.4 cm . \n h&e stain ( 40 ) shows thick haphazardly arranged collagen bundles with few interspersed spindle cells of fibroblast type . ( image courtesy of a. kaiser , md , klinikum nrnberg , institute of pathology ) . \n mri scans of patient a. ( a ) tumor at the age of 9 months . ( b ) tumor site 24 months postoperatively without recurrence . mri , magnetic resonance imaging . molecular genetic analysis of the apc gene by polymerase chain reaction ( pcr ) and subsequent sanger sequence analysis of all coding exons did not show any causative mutation . in addition , multiplex ligation - dependent probe amplification ( mlpa , kit p043 , mrc - holland , the netherlands ) analysis , which allows for the detection of potential deletions and duplications , showed a large heterozygous deletion affecting most of the apc coding region ( exons 415 [ genbank nm_000038.3 ] , equals exons 718 [ genbank nm_000038.5 ] ) up to the most distal part of the gene ( fragment w ) ( fig . the deletion was confirmed on a second blood sample and classified as a bona fide pathogenic alteration because of its large size . \n deletion / duplication analysis using multiplex ligation - dependent probe amplification showing monoallelic deletion affecting most of the apc coding region , showing that the gene dose of exon 4 onwards is reduced by 50% and proving the heterozygous deletion of a large portion of apc . subsequent testing of the parents showed the same apc deletion in the father who had no complaints . after having established the diagnosis he underwent colonoscopy , which led to the diagnosis of cancer of the sigmoid colon . anal anastomosis , the histological workup verified a pt3 , pn2 ( 11/52 ) , l1 , g2 adenocarcinoma . the paternal grandmother did not show the familial apc deletion , the paternal grandfather was unavailable for investigation .", "the otherwise healthy boy of nonconsangineous parents was diagnosed with a left - sided paravertebral soft tissue tumor measuring 6 3 1 cm at birth . due to known fap in the father the soft tissue tumor was assumed to be an extracolonic manifestation of fap . because of tumor progression during the next 4 months ( fig . histology confirmed gf consisting of fatty tissue interspersed with thick collagen bundles , many small blood vessels and some dispersed mast cells . mri scan 16 weeks after birth tumor size : 8 5 cm . he developed osteomas of the skull and intestinal polyps were confirmed by colonoscopy but without the necessity for surgical intervention so far . the father of the boy had developed clinical symptoms of fap at the age of 27 and underwent prophylactic restorative proctocolectomy and ileal pouch anal anastomosis at the age of 28 . within 3 years after surgery he developed severe retroperitoneal desmoid disease leading to hydronephrosis necessitating nephroureterectomy . after 6 months he underwent a further desmoid tumor resection in the abdominal wall , the attempted resection of a large pelvic desmoid failed due to poor circumscription . molecular genetic analysis by pcr and sanger sequence analysis of all coding exons showed a heterozygous frameshift mutation c.4393_4394delag , p.ser1465trpfs*3 in exon 15 , segment h ( equals exon 18 , segment h [ genbank nm_000038.5 ] ) of the apc gene leading to introduction of a stop codon at amino acid position 1467 , thereby causing a truncated nonfunctional or functionally impaired apc protein .", "whereas early childhood gf have been reported and the assumption has been made that there is a strong connection to fap,9 to our knowledge there is only one report of a neonatal onset of gf leading to the diagnosis of fap in an otherwise asymptomatic child.10 in this report the patient 's parents were healthy and had negative genetic testing , so that a de novo mutation is most probable . in contrast , in our patient a , testing of the parents revealed the same mutation in the father and the diagnosis of abundant intestinal polyposis and sigmoid cancer in colonoscopy . this is to our knowledge the first report of a neonatal gf requiring immediate total proctocolectomy in a parent . coffin et al noted that 29% of all patients with gf developed this lesion under the age of 1 year , with an onset at 2 months of age.9 it is possible that in this series some gf may have existed unnoticed since birth . although the overall ( and possibly underestimated ) association rate with fap is as high as 69% in this study , no information is available about relevance of gf as a sentinel lesion for fap in neonatal patients . viera et al reported two infants with gf which led to previously unrecognized fap in the families.11 in their patients , immunofluorescent staining of -catenin in the tumor , which accumulates in cells with biallelic truncation of apc because of the impairment of apc - mediated degradation of -catenin,4 led to the strong suspicion of underlying fap . this may well be a future diagnostic tool in evaluating the role of gf in detection of fap.12 \n of note , in our patient a the tumor showed a rapid progression which necessitated extensive surgery , while the lesion remained stable in patient b. although the invasive rapid growth is already a sign of a desmoid tumor , it was histologically still regarded as a gf . it may be discussed if site and type of apc mutations may play a role in disease outcome , since patient a carries a large deletion encompassing most of the apc coding region , whereas patient b has an underlying mutation in the desmoid region of the apc gene.4 screening for somatic apc mutations in the tumor indicating loss of heterozygosity might have been instructive . the loss of the wildtype allele of apc in the tumor has been shown to be a relatively frequent event in desmoid tumors in adult fap individuals.13 unfortunately , these data are not available in our patients . however , it is known that trauma or surgery can be a predisposing factor to desmoid development in fap.9 therefore , the possibility that the first surgery triggered the intensive growth of the gf in patient a can not be excluded . if surgery is performed , a total excision of gf with a wide margin should be aimed for , but can be technically demanding or even impossible because of the poor circumscription or anatomic boundaries . in general , prediction of gf behavior it has been stated that approximately 5 to 10% appear to resolve spontaneously , 30% undergo cycles of progression and resolution , 50% remain stable after diagnosis , but 10% tend to progress rapidly , growing to massive sizes and infiltrating adjacent tissue.4 it is also known that there is a relationship between frequency of extracolonic manifestations and the position of apc germline mutations in patients with fap.4 \n 14 \n 15 for example , the risk of developing desmoid tumors is increased in patients with an apc mutation 3 to codon 1399,16 and reaches up to 100% in patients with a mutation in codons 1395 to 1493.17 studies correlating the risk of developing gf with a particular genotype are not available . nevertheless , surgery is the first - line therapy in fast - growing gf . in older patients with advanced cases with progression into desmoid tumor cytotoxic chemotherapy may be discussed , but was not considered promising in our case because of the young age and the gf still being considered a benign entity.18 \n 19 \n continuous follow - up is mandatory , since early onset of intestinal polyps in children from the age of 4 to 6 years has been reported.20 \n 21 \n 22 in general , routine colonoscopies have been suggested to start at the age of 10 . because of the unusual early clinical onset of intestinal symptoms ( bloody stools and > 75 polyps in colonoscopy ) at the age of 4 years in a previously reported patient with neonatal gf , we recommend early annual routine colonoscopy in patient a starting from the age of 2 years.10 \n since approximately 25% of fap cases are caused by de novo mutations , the development of a gf in a child must raise suspicion of an underlying fap even if the family history is negative . performing a sound genetic testing for fap including sequencing of the complete coding region of the apc gene and quantitative analysis by , for example , mlpa in every child with gf", "continuous follow - up is mandatory because of unpredictable growth behavior and early onset of intestinal polyps ." ]

[ "down 's syndrome ( ds ) is one of the common chromosomal disorders and the most common cause of mental retardation . it is well - known that patients with ds have an increased prevalence of autoimmune disorders affecting both endocrine and non - endocrine organs . although cases of ds associated with diabetes mellitus ( dm ) have been reported in the past , invariably all cases were associated with type 1 dm . we present two cases of type 2 dm with ds and believe that this is the first report of type dm with ds .", "a 28-year - old male patient with a body mass index ( bmi ) of 25.1 kg / m and positive family history of dm reported to the out - patient clinic of the department of endocrinology , medwin hospital with the clinical features of polyuria and polydipsia for last 1 year . physical examination revealed typical mongolian facies and other features of ds such as short stature ( 145 cm ) , brachycephaly , short neck and pot belly , small mouth with protruding tongue , wide occipital region and characteristic small eyes of ds . laboratory data revealed diabetes with fasting plasma glucose of 256 mg / dl , postprandial plasma glucose of 375 mg / dl and glycated hemoglobin ( hba1c ) level of 9.9% . c - peptide assay showed fairly well - preserved pancreatic cell function : fasting values of 1.3 pmol and stimulated values of 2.4 pmol / ml ( normal values in non - diabetic subjects , fasting > 1.5 pmol / ml and stimulated > 4.0 pmol / ml ) . glutamic acid decarboxylase ( gad ) antibody testing ( 3.2 iu / ml ) was negative . other investigations ( hemogram , renal and liver function parameters , serum electrolytes and lipid profile ) were within the normal limits . he was initiated on basal glargine insulin at a dose of 15 units subcutaneously at night along with oral hypoglycemic agent ( glimepiride 2 mg / metformin 1000 mg ) once daily and l - thyroxine 100 g daily . later , the doses of insulin were reduced and subsequently withdrawn completely and he is maintained well on oral hypoglycemic agents alone . a 26-year - old female patient with a bmi of 33.4 kg / m with strong family history of dm were admitted in the in - patient department of endocrinology , medwin hospital for proper control of hyperglycemia . physical examination revealed features of ds ( short stature , obesity , brachycephaly , gynecomastia , protruding tongue , simian crease , pot belly , short neck and acanthosis nigricans , wide occipital region with characteristic small eyes ) . the laboratory evaluation revealed fasting and postprandial sugar levels as 175 mg / dl and 240 mg / dl , respectively hba1c of 8.9% . his fasting and stimulated c - peptide levels were 1.4 pmol / ml and 2.5 pmol / ml with negative gad - antibody test ( 4.1 iu / ml ) .", "a 28-year - old male patient with a body mass index ( bmi ) of 25.1 kg / m and positive family history of dm reported to the out - patient clinic of the department of endocrinology , medwin hospital with the clinical features of polyuria and polydipsia for last 1 year . physical examination revealed typical mongolian facies and other features of ds such as short stature ( 145 cm ) , brachycephaly , short neck and pot belly , small mouth with protruding tongue , wide occipital region and characteristic small eyes of ds . laboratory data revealed diabetes with fasting plasma glucose of 256 mg / dl , postprandial plasma glucose of 375 mg / dl and glycated hemoglobin ( hba1c ) level of 9.9% . c - peptide assay showed fairly well - preserved pancreatic cell function : fasting values of 1.3 pmol and stimulated values of 2.4 pmol / ml ( normal values in non - diabetic subjects , fasting > 1.5 pmol / ml and stimulated > 4.0 pmol / ml ) . glutamic acid decarboxylase ( gad ) antibody testing ( 3.2 iu / ml ) was negative . other investigations ( hemogram , renal and liver function parameters , serum electrolytes and lipid profile ) were within the normal limits . he was initiated on basal glargine insulin at a dose of 15 units subcutaneously at night along with oral hypoglycemic agent ( glimepiride 2 mg / metformin 1000 mg ) once daily and l - thyroxine 100 g daily . later , the doses of insulin were reduced and subsequently withdrawn completely and he is maintained well on oral hypoglycemic agents alone . a 26-year - old female patient with a bmi of 33.4 kg / m with strong family history of dm were admitted in the in - patient department of endocrinology , medwin hospital for proper control of hyperglycemia . physical examination revealed features of ds ( short stature , obesity , brachycephaly , gynecomastia , protruding tongue , simian crease , pot belly , short neck and acanthosis nigricans , wide occipital region with characteristic small eyes ) . the laboratory evaluation revealed fasting and postprandial sugar levels as 175 mg / dl and 240 mg / dl , respectively hba1c of 8.9% . his fasting and stimulated c - peptide levels were 1.4 pmol / ml and 2.5 pmol / ml with negative gad - antibody test ( 4.1 iu / ml ) .", "a 28-year - old male patient with a body mass index ( bmi ) of 25.1 kg / m and positive family history of dm reported to the out - patient clinic of the department of endocrinology , medwin hospital with the clinical features of polyuria and polydipsia for last 1 year . physical examination revealed typical mongolian facies and other features of ds such as short stature ( 145 cm ) , brachycephaly , short neck and pot belly , small mouth with protruding tongue , wide occipital region and characteristic small eyes of ds . laboratory data revealed diabetes with fasting plasma glucose of 256 mg / dl , postprandial plasma glucose of 375 mg / dl and glycated hemoglobin ( hba1c ) level of 9.9% . c - peptide assay showed fairly well - preserved pancreatic cell function : fasting values of 1.3 pmol and stimulated values of 2.4 pmol / ml ( normal values in non - diabetic subjects , fasting > 1.5 pmol / ml and stimulated > 4.0 pmol / ml ) . glutamic acid decarboxylase ( gad ) antibody testing ( 3.2 iu / ml ) was negative . other investigations ( hemogram , renal and liver function parameters , serum electrolytes and lipid profile ) were within the normal limits . he was initiated on basal glargine insulin at a dose of 15 units subcutaneously at night along with oral hypoglycemic agent ( glimepiride 2 mg / metformin 1000 mg ) once daily and l - thyroxine 100 g daily . later , the doses of insulin were reduced and subsequently withdrawn completely and he is maintained well on oral hypoglycemic agents alone .", "a 26-year - old female patient with a bmi of 33.4 kg / m with strong family history of dm were admitted in the in - patient department of endocrinology , medwin hospital for proper control of hyperglycemia . physical examination revealed features of ds ( short stature , obesity , brachycephaly , gynecomastia , protruding tongue , simian crease , pot belly , short neck and acanthosis nigricans , wide occipital region with characteristic small eyes ) . the laboratory evaluation revealed fasting and postprandial sugar levels as 175 mg / dl and 240 mg / dl , respectively hba1c of 8.9% . his fasting and stimulated c - peptide levels were 1.4 pmol / ml and 2.5 pmol / ml with negative gad - antibody test ( 4.1 iu / ml ) .", "previous studies had suggested that type 1 dm is more prevalent in people with ds than in the general population and vice versa . to the best of our knowledge , impaired cell function and insulin sensitivity are the main factors in the pathogenesis of type 2 dm . cell function was fairly preserved in these two patients ( as indicated by c - peptide levels in the blood ) with negative antibody testing for gad - ab . this indicated toward the fact that impaired insulin sensitivity might have contributed to a greater extent in the development of type 2 dm in these two patients . a variety of genetic syndromes have been described in which dm occurs with increased frequency . the etiology of the disturbance in glucose homeostasis in these diverse and unrelated syndromes remain undefined . since rare forms a disease often provide insight into the possible mechanisms of the disease and since each candidate gene contributes a small amount of genetic risk to the disease , individuals with ds and type 2 dm may therefore provide the clinical insights into possible mechanisms underlying susceptibility to diabetes .", "further investigations are warranted to prove whether the presence of type diabetes in patients with ds was a chance association or whether there is a genetic basis for this association . however , these two cases point to the fact that one should screen patients with ds for type 2 diabetes ." ]

[ "recent progress in our understanding of brain development has significantly altered concepts for treating neurodegenerative diseases , including those that affect the retina to cause blindness . contrary to previous thought , it is now recognized that neurons are generated in the sub ventricular zone ( svz ) of the lateral ventricle , and the sub - granular zone ( sgz ) in the hippocampus from neural stem cells ( nsc ) of glial origin throughout life ( 1 ) . outside these discrete regions in the mammalian cns , including the retina , active neurogenesis has not been reproducibly demonstrated under normal conditions ( 2 ) . however , rare neurogenic changes are observed in the injured adult mammalian retina ; the source of injury - induced neurogenesis is traced to mller glia ( mg ) ( 35 ) . recent observations that mammalian mg possess nsc properties and are able to generate retinal neurons in vitro and upon transplantation in vivo posit these cells as the potential target for regenerating diseased or injured photoreceptors and retinal ganglion cells ( 6 ) . while growing evidence confirms that mg possess evolutionarily conserved neurogenic potential , studies from various labs have observed that , unlike their lower vertebrate counterparts , the injury or disease - activated mammalian mg proliferate , but that they convert to neurons rather infrequently ( 4 , 7 , 8) . whether or not the converted neurons are functional , make synaptic connections , and survive for the long term remains unknown . the challenge that remains is how to unlock the neurogenic potentials of the mammalian mg in vivo . this may essentially involve approaches to reprogram these cells to dedifferentiate and regain their lost ability to generate neurons or trans - differentiate them into neurons .", "to address this challenge , the neurogenic potentials of mg need to be evaluated against the backdrop of two models , with the understanding that examples from lower vertebrates would constitute a framework , but that solutions will be unique to the mammalian retina : ( 1 ) svz / sgz model , where mg have nsc properties and thus the capacity for neuronal differentiation like radial glia - derived nscs in svz and sgz . given the observations that the adult nscs are responsive to environmental cues for neuronal differentiation ( 1 ) , mg in this model should be amenable to directed differentiation along neuronal lineage through the manipulation of niche - based signals by recombinant growth factors and/or small molecules . ( 2 ) extra svz / sgz model , where mg may have neurogenic potential like parenchymal astrocytes but incapable of neuronal differentiation , presumably under the influence of the non - neurogenic niche . for example , both mg and astrocytes express nsc regulators such as sox2 ( mg ) and pax6 ( astrocytes ) and when cultured in the presence of mitogens tend to differentiate along neuronal lineage ( 2 , 6 , 9 , 10 ) . however , in vivo , although they proliferate and express neural progenitor markers such as nestin in response to injury , they maintain their glial phenotype , with rare expression of neuronal markers ( 2 , 5 , 10 ) . given their stable glial identity for supporting neurons despite expressing some of the nsc - specific genes , a trans - differentiation approach for the lineage conversion of mg has emerged as a practical option in this model . this notion is supported by recent observations that injury - activated resident astrocytes differentiate into functional neurons upon enforced expression of nsc regulator , sox2 and/or proneural gene , ascl1 ( 11 ) . regardless , information gained in deciphering the two models will be useful . in both cases , knowledge of the developmental mechanism for the lineage switch , the reaction of mg to different kinds of injuries , phenotypes of the activated mg in spatial and temporal contexts , transcriptional and epigenetic status , and niche - related signals will be critical . these approaches will reveal whether the roadblock to regeneration is cell - intrinsic or cell - extrinsic or both , information that will be essential in formulating strategies for making mg - dependent therapeutic regeneration practical and clinically applicable . toward this effort , the recent success of reprogramming to induce pluripotency in somatic cells and lineage - specific differentiation of pluripotent cells , whether through directed differentiation ( svz / sgz model ) or trans - differentiation ( extra svz / sgz model ) , is owed directly to the knowledge of developmental mechanisms ( 12 ) . there is a significant knowledge gap in our understanding of how neurogenesis shifts to the generation of mg in the mammalian retina , information essential to navigate the cellular or molecular roadblocks to neuronal differentiation . for example , although we know that notch signaling regulates the generation of mg , how it is incorporated into the gliogenic program and to what extent it is involved in suppressing neuronal differentiation remains rather unknown ( 4 ) . given the contextual role of notch signaling ( 4 ) , its complexity due to the oscillatory expression of its effector hes1 ( 13 ) , and its gliogenic interactions with the eye field gene lhx2 ( 14 ) , this information will be essential to formulate niche - based approaches for facilitating neuronal differentiation of mg . along this line , it will also be advantageous to know whether genes involved in neurogliogenesis elsewhere in the cns , such as lin28 , a heterochronic gene regulating the developmental timing ( 15 ) and ezh2 , an epigenetic regulator of gene expression ( 16 ) participate in mg differentiation and coordinate the influence of the niche . recent observations that the decision of retinal progenitors during late histogenesis to differentiate along glial or neuronal lineage is influenced by lin28 ( 17 ) and that ezh2 plays a role in constraining the generation of mg ( 18 ) posit these genes as potential targets for pivoting mg torwards neuronal differentiation . regardless of whether or not mg possesses dormant stem cell properties according to the aforementioned models they must initiate and complete an intertwined program of activation and neuronal conversion for successful regeneration ( 4 ) . given that injuries in general lead to proliferation of mg across species , but not to their neuronal differentiation in higher vertebrates , it is likely that the cross - talk between transcriptional networks sub - serving the activation and neuronal differentiation are either not connected to the process , or the network components are in place but are not epigenetically primed for optimal expression in the mammalian mg . these probabilities could be examined by a genome - wide screening of prospectively enriched mg in select animal models in quiescent and activated states ( facilitated by lineage reporters and other enrichment protocols such as the side population ( sp ) cell profiling by microarrays , rna seq , and chip seq analyses . a similar approach to characterizing mg in different states of activation and differentiation in controlled conditions in vitro will yield corroborative evidence and facilitate the means to test putative mechanism(s ) by manipulating gene expression . together , these approaches may provide insight into molecular axes that can be tested against the background of those operational in zebrafish ( 7 , 8 , 19 ) . for example , the molecular axis defined by lin28 and ascl1 , which facilitates mg - mediated regeneration in zebrafish , is a valid target for study in mammals . a variety of approaches in higher vertebrates have demonstrated important regulatory roles for lin28 in the maintenance of neural progenitors and neuroglial decision ( 20 ) . it is likely that lin28 influences different developmental function by contextual recruitment of hmga2 , a gene encoding a dna architecture protein ( 21 , 22 ) and ascl1 ( 23 ) by directly regulating the heterochronic mirna let-7 ( 17 , 21 , 23 ) . let-7 targets hmga2 ( 17 , 21 ) and ascl1 ( 23 ) ; therefore , the lin28-let-7-hmga2/ascl1 axis has emerged as an evolutionary conserved axis that could be a candidate for unlocking neurogenic potential of mg . for example , overexpression of lin28a ( 24 ) in the enriched mg ( fig . 2a ) prompted these cells to acquire neuronal morphology and to express immunoreactivities and transcripts corresponding to neuronal genes ( fig . more importantly , neuronal differentiation was accompanied by an increase in levels of mir-124 , a proneural mirna ( 25 ) , hmga2 , and ascl1 , and a decrease in those of rest , a global inhibitor of neuronal differentiation ( 26 ) , thus demonstrating the capacity of lin28a in activating the neurogenic program in mg . however , targeting the lin28-let-7-hmga2/ascl1 axis alone may not be sufficient for the functional reprogramming of mg along neuronal lineage , given that its influence may not be able to completely counter the inhibitory resistance of the rest axis . rest , by suppressing the expression of proneural mirnas , mir-124 and mir-9 - 9 * , whose targets are proglial genes encoding sox9 and he s family of regulators , may keep mg non - neuronal and therefore non - regenerative ( 25 ) . the existence of the rest - mir-124 - 9 - 9 * -sox9/hes1 axis in mg suggested that either inhibiting rest or ectopically expressing mir-124/mir-9 - 9 * or both may direct mg along the neuronal lineage . it is likely that the ectopic expression of mir-124/mir-9 - 9 * in itself might be effective , as they directly or indirectly influence the expression and function of rest ( 25 ) . for example , over expression of mir-124 - 9 - 9 * ( 27 ) in mg ( fig . 2a ) facilitated neuronal morphology with accompanied expression and suppression of neuronal- and glial - specific genes , respectively ( fig . expression of both ascl1 and lin28a was up regulated and that of rest was down regulated in the perturbed groups , compared to controls . however , no significant difference in hmga2 transcript levels was observed , suggesting a threshold requirement of lin28a levels for influencing hmga2 expression . that mir-124 and mir-9 - 9 * could facilitate proneural function of ascl1 was demonstrated by the improvement of ascl1-mediated reprogramming of mg by ectopically expressed mirnas ( 28 ) . together , these observations posit these molecular axes as valid intrinsic targets for studying and unlocking the dormant regenerative potential of mg . mg , the guardian of homeostasis in the retina , respond to injuries by proliferating and migrating out of the inner nuclear layer ( 5 ) . however , despite proliferation and migration as in zebrafish retina , as mentioned , mammalian mg do not initiate regeneration effectively . this raises the possibility that , in addition to internal constraints discussed above , the environment in the mammalian retina might not be conducive for neurogenic conversion of mg . a niche - based approach to unlock neurogenic potential of mg will involve examining the relationship of mg with neighboring retinal cells , microglia , immigrant astrocytes , and endothelial cells in the context of signaling pathways and their capacity to engage the molecular axes involved in reprograming along neuronal lineage . for example , the understanding of the role of microglia , one of the first responders to injury , and which may mediate regeneration through inflammatory signals , is still evolving in the retina ( 29 ) . studies have demonstrated that notch ( 8 , 30 ) , wnt ( 5 , 6 ) , fgf ( 6 , 8) , insulin and insulin - like growth factor-1 ( 8) , shh ( 31 ) , and cytokines such as tnf ( 8 , 19 ) , leptin , and il-11 ( 32 ) may play important roles in mediating the influence of the niche in reprogramming mg . however , the identity of cells delivering the signals and whether or not these signals and their associated pathways act in concert , which would determine niche - based strategies to promote regeneration , remain largely unknown . however , studies in zebrafish have begun to shed light on these issues . for example , it has been observed that tnf released by dying photoreceptors in mechanically damaged zebrafish retina may constitute one of the early signals for activating mg for regeneration ( 19 ) . also , it was reported that zebrafish mg respond to retinal injury by secreting leptin and il-11 , which help reprogram cells in an autocrine fashion ( 32 ) . in both cases , these cytokines facilitated injury - dependent induction of ascl1 , a key step in reprogramming of mg ( 8) . whether or not signaling - mediated by these factors are similarly involved in the mammalian retina remains to be demonstrated . although the identity of cells delivering notch signaling in mg remains speculative , emerging evidence from zebrafish and higher vertebrates posit it as an important niche - based target for mg - dependent regeneration . it remains active long after facilitating the differentiation of mg , enabling them to launch the proliferative response when injury takes place ( 4 , 5 ) . however , persistence of notch signaling in activated mg , which are poised for neuronal conversion , might be deleterious for regenerative process , given the inhibitory influence of notch signaling on the activation of proneural genes ( 33 ) . the inability to confine the activation of notch signaling in mg to a narrow temporal window following injury may be one of the reasons for their anemic neuronal conversion in mammals , compared to that in zebrafish ( 30 ) . emerging evidence , once again from the zebrafish model , suggests that these pathways , including notch signaling , may act in concert and mg integrate the diverse niche - based influence of a variety of signaling molecules for a calibrated regenerative response to injury ( 8) . therefore , niche - related information is crucial for understanding the temporal and spatial modulation of signaling required for activating mg and shifting them from the state of activation to neuronal differentiation . this is fundamental information missing from studies of mg - dependent regeneration , without which the underlying mechanisms remain difficult to grasp and the therapeutic target rather illusory . currently , the identity of the activated mg represents cells in the inner nuclear layer of the retina , which have incorporated brdu in response to injury and express mg - specific markers . given the transition of mg from a quiescent to a proliferative state and the generation of their progenies in different stages of development , the identity based on brdu incorporation , though important , is of limited value . attempts have been made to prospectively enrich activated mg by hoechst dye efflux assays and to characterize them as sp cells , a phenotype shared by the majority of stem cells ( 4 , 6 ) . however , since sp cells are also heterogeneous , this functional approach has limitations in the absence of specific cellular markers . although several signaling pathways ( e.g. notch signaling ) and intrinsic factors ( e.g. , ascl1 ) have been observed to regulate mg activation in fish , birds , and rodents ( 8) , their status as markers of activated mg in different stages of regeneration remain unspecified . progress in understanding the regenerative mechanisms in tissues like blood ( 34 ) , intestine ( 35 ) , and skin ( 36 ) has been facilitated by the identification and characterization of markers of the resident stem cells and their progenies . within the cns , insight into regeneration in the svz has come from the characterization of b1 quiescent and active progenitors and resulting neuroblasts ( 37 ) . therefore , to follow mg - mediated regeneration , spatially and temporally , and to identify the stage - specific intrinsic players , a concerted effort is needed to search for reliable and reproducible markers . currently , there is no consensus on reliable and reproducible mammalian models to study the activation and neurogenic potential of mg . rodent models representing retinal injuries , ranging from those caused by the exposure to light , neurotoxins , and genetic mutations have been used . given the observations that glia respond differently to different types and durations of injuries ( 2 ) , that their levels of activation differ from species to species ( ahmad et al . , unpublished observations ) , and that within the same species there are strain differences in responses ( 38 ) , a case may be made for developing injury- and species / strain - specific models for reproducible and unambiguous examination of mg neurogenic potentials . these models will be valuable in incorporating transgenic technology for reliable lineage tracing , and more importantly for molecular characterization of activated mg . characterization of these cells for gene regulatory network and epigenetic signature is essential to shed light on the status of their neurogenic potential and approaches to unlock it . furthermore , cell type specific injury models would test the ability of mg to replace specific neuronal types , which will be helpful in designing approaches for mg - dependent therapeutic regeneration . for example , the loss of vision in two of the intractable blinding diseases , age - related macular degeneration ( amd ) and glaucoma , is due to selective loss of photoreceptors and retinal ganglion cells ( rgcs ) , respectively . the neurotoxin injury models where exposure of the retina to n - methyl - n - nitrosourea ( mnu ) ablates photoreceptors ( 39 ) and nmda causes the degeneration of rgcs ( 40 ) would reveal whether or not mg could differentiate along specific neuronal types . also , it may shed light on if mg - dependent therapeutic regeneration would be a practical approach to address degenerative changes in amd and/or glaucoma .", "the recent success of reprogramming to induce pluripotency in somatic cells and lineage - specific differentiation of pluripotent cells , whether through directed differentiation ( svz / sgz model ) or trans - differentiation ( extra svz / sgz model ) , is owed directly to the knowledge of developmental mechanisms ( 12 ) . there is a significant knowledge gap in our understanding of how neurogenesis shifts to the generation of mg in the mammalian retina , information essential to navigate the cellular or molecular roadblocks to neuronal differentiation . for example , although we know that notch signaling regulates the generation of mg , how it is incorporated into the gliogenic program and to what extent it is involved in suppressing neuronal differentiation remains rather unknown ( 4 ) . given the contextual role of notch signaling ( 4 ) , its complexity due to the oscillatory expression of its effector hes1 ( 13 ) , and its gliogenic interactions with the eye field gene lhx2 ( 14 ) , this information will be essential to formulate niche - based approaches for facilitating neuronal differentiation of mg . along this line , it will also be advantageous to know whether genes involved in neurogliogenesis elsewhere in the cns , such as lin28 , a heterochronic gene regulating the developmental timing ( 15 ) and ezh2 , an epigenetic regulator of gene expression ( 16 ) participate in mg differentiation and coordinate the influence of the niche . recent observations that the decision of retinal progenitors during late histogenesis to differentiate along glial or neuronal lineage is influenced by lin28 ( 17 ) and that ezh2 plays a role in constraining the generation of mg ( 18 ) posit these genes as potential targets for pivoting mg torwards neuronal differentiation .", "regardless of whether or not mg possesses dormant stem cell properties according to the aforementioned models they must initiate and complete an intertwined program of activation and neuronal conversion for successful regeneration ( 4 ) . given that injuries in general lead to proliferation of mg across species , but not to their neuronal differentiation in higher vertebrates , it is likely that the cross - talk between transcriptional networks sub - serving the activation and neuronal differentiation are either not connected to the process , or the network components are in place but are not epigenetically primed for optimal expression in the mammalian mg . these probabilities could be examined by a genome - wide screening of prospectively enriched mg in select animal models in quiescent and activated states ( facilitated by lineage reporters and other enrichment protocols such as the side population ( sp ) cell profiling by microarrays , rna seq , and chip seq analyses . a similar approach to characterizing mg in different states of activation and differentiation in controlled conditions in vitro will yield corroborative evidence and facilitate the means to test putative mechanism(s ) by manipulating gene expression . together , these approaches may provide insight into molecular axes that can be tested against the background of those operational in zebrafish ( 7 , 8 , 19 ) . for example , the molecular axis defined by lin28 and ascl1 , which facilitates mg - mediated regeneration in zebrafish , is a valid target for study in mammals . a variety of approaches in higher vertebrates have demonstrated important regulatory roles for lin28 in the maintenance of neural progenitors and neuroglial decision ( 20 ) . it is likely that lin28 influences different developmental function by contextual recruitment of hmga2 , a gene encoding a dna architecture protein ( 21 , 22 ) and ascl1 ( 23 ) by directly regulating the heterochronic mirna let-7 ( 17 , 21 , 23 ) . let-7 targets hmga2 ( 17 , 21 ) and ascl1 ( 23 ) ; therefore , the lin28-let-7-hmga2/ascl1 axis has emerged as an evolutionary conserved axis that could be a candidate for unlocking neurogenic potential of mg . for example , overexpression of lin28a ( 24 ) in the enriched mg ( fig . 2a ) prompted these cells to acquire neuronal morphology and to express immunoreactivities and transcripts corresponding to neuronal genes ( fig . more importantly , neuronal differentiation was accompanied by an increase in levels of mir-124 , a proneural mirna ( 25 ) , hmga2 , and ascl1 , and a decrease in those of rest , a global inhibitor of neuronal differentiation ( 26 ) , thus demonstrating the capacity of lin28a in activating the neurogenic program in mg . however , targeting the lin28-let-7-hmga2/ascl1 axis alone may not be sufficient for the functional reprogramming of mg along neuronal lineage , given that its influence may not be able to completely counter the inhibitory resistance of the rest axis . rest , by suppressing the expression of proneural mirnas , mir-124 and mir-9 - 9 * , whose targets are proglial genes encoding sox9 and he s family of regulators , may keep mg non - neuronal and therefore non - regenerative ( 25 ) . the existence of the rest - mir-124 - 9 - 9 * -sox9/hes1 axis in mg suggested that either inhibiting rest or ectopically expressing mir-124/mir-9 - 9 * or both may direct mg along the neuronal lineage . it is likely that the ectopic expression of mir-124/mir-9 - 9 * in itself might be effective , as they directly or indirectly influence the expression and function of rest ( 25 ) . for example , over expression of mir-124 - 9 - 9 * ( 27 ) in mg ( fig . 2a ) facilitated neuronal morphology with accompanied expression and suppression of neuronal- and glial - specific genes , respectively ( fig . expression of both ascl1 and lin28a was up regulated and that of rest was down regulated in the perturbed groups , compared to controls . however , no significant difference in hmga2 transcript levels was observed , suggesting a threshold requirement of lin28a levels for influencing hmga2 expression . that mir-124 and mir-9 - 9 * could facilitate proneural function of ascl1 was demonstrated by the improvement of ascl1-mediated reprogramming of mg by ectopically expressed mirnas ( 28 ) . together , these observations posit these molecular axes as valid intrinsic targets for studying and unlocking the dormant regenerative potential of mg .", "mg , the guardian of homeostasis in the retina , respond to injuries by proliferating and migrating out of the inner nuclear layer ( 5 ) . however , despite proliferation and migration as in zebrafish retina , as mentioned , mammalian mg do not initiate regeneration effectively . this raises the possibility that , in addition to internal constraints discussed above , the environment in the mammalian retina might not be conducive for neurogenic conversion of mg . a niche - based approach to unlock neurogenic potential of mg will involve examining the relationship of mg with neighboring retinal cells , microglia , immigrant astrocytes , and endothelial cells in the context of signaling pathways and their capacity to engage the molecular axes involved in reprograming along neuronal lineage . for example , the understanding of the role of microglia , one of the first responders to injury , and which may mediate regeneration through inflammatory signals , is still evolving in the retina ( 29 ) . studies have demonstrated that notch ( 8 , 30 ) , wnt ( 5 , 6 ) , fgf ( 6 , 8) , insulin and insulin - like growth factor-1 ( 8) , shh ( 31 ) , and cytokines such as tnf ( 8 , 19 ) , leptin , and il-11 ( 32 ) may play important roles in mediating the influence of the niche in reprogramming mg . however , the identity of cells delivering the signals and whether or not these signals and their associated pathways act in concert , which would determine niche - based strategies to promote regeneration , remain largely unknown . for example , it has been observed that tnf released by dying photoreceptors in mechanically damaged zebrafish retina may constitute one of the early signals for activating mg for regeneration ( 19 ) . also , it was reported that zebrafish mg respond to retinal injury by secreting leptin and il-11 , which help reprogram cells in an autocrine fashion ( 32 ) . in both cases , these cytokines facilitated injury - dependent induction of ascl1 , a key step in reprogramming of mg ( 8) . whether or not signaling - mediated by these factors are similarly involved in the mammalian retina remains to be demonstrated . although the identity of cells delivering notch signaling in mg remains speculative , emerging evidence from zebrafish and higher vertebrates posit it as an important niche - based target for mg - dependent regeneration . it remains active long after facilitating the differentiation of mg , enabling them to launch the proliferative response when injury takes place ( 4 , 5 ) . however , persistence of notch signaling in activated mg , which are poised for neuronal conversion , might be deleterious for regenerative process , given the inhibitory influence of notch signaling on the activation of proneural genes ( 33 ) . the inability to confine the activation of notch signaling in mg to a narrow temporal window following injury may be one of the reasons for their anemic neuronal conversion in mammals , compared to that in zebrafish ( 30 ) . emerging evidence , once again from the zebrafish model , suggests that these pathways , including notch signaling , may act in concert and mg integrate the diverse niche - based influence of a variety of signaling molecules for a calibrated regenerative response to injury ( 8) . therefore , niche - related information is crucial for understanding the temporal and spatial modulation of signaling required for activating mg and shifting them from the state of activation to neuronal differentiation .", "this is fundamental information missing from studies of mg - dependent regeneration , without which the underlying mechanisms remain difficult to grasp and the therapeutic target rather illusory . currently , the identity of the activated mg represents cells in the inner nuclear layer of the retina , which have incorporated brdu in response to injury and express mg - specific markers . given the transition of mg from a quiescent to a proliferative state and the generation of their progenies in different stages of development , the identity based on brdu incorporation , though important , is of limited value . attempts have been made to prospectively enrich activated mg by hoechst dye efflux assays and to characterize them as sp cells , a phenotype shared by the majority of stem cells ( 4 , 6 ) . however , since sp cells are also heterogeneous , this functional approach has limitations in the absence of specific cellular markers . although several signaling pathways ( e.g. notch signaling ) and intrinsic factors ( e.g. , ascl1 ) have been observed to regulate mg activation in fish , birds , and rodents ( 8) , their status as markers of activated mg in different stages of regeneration remain unspecified . progress in understanding the regenerative mechanisms in tissues like blood ( 34 ) , intestine ( 35 ) , and skin ( 36 ) has been facilitated by the identification and characterization of markers of the resident stem cells and their progenies . within the cns , insight into regeneration in the svz has come from the characterization of b1 quiescent and active progenitors and resulting neuroblasts ( 37 ) . therefore , to follow mg - mediated regeneration , spatially and temporally , and to identify the stage - specific intrinsic players , a concerted effort is needed to search for reliable and reproducible markers .", "currently , there is no consensus on reliable and reproducible mammalian models to study the activation and neurogenic potential of mg . rodent models representing retinal injuries , ranging from those caused by the exposure to light , neurotoxins , and genetic mutations have been used . given the observations that glia respond differently to different types and durations of injuries ( 2 ) , that their levels of activation differ from species to species ( ahmad et al . , unpublished observations ) , and that within the same species there are strain differences in responses ( 38 ) , a case may be made for developing injury- and species / strain - specific models for reproducible and unambiguous examination of mg neurogenic potentials . these models will be valuable in incorporating transgenic technology for reliable lineage tracing , and more importantly for molecular characterization of activated mg . characterization of these cells for gene regulatory network and epigenetic signature is essential to shed light on the status of their neurogenic potential and approaches to unlock it . furthermore , cell type specific injury models would test the ability of mg to replace specific neuronal types , which will be helpful in designing approaches for mg - dependent therapeutic regeneration . for example , the loss of vision in two of the intractable blinding diseases , age - related macular degeneration ( amd ) and glaucoma , is due to selective loss of photoreceptors and retinal ganglion cells ( rgcs ) , respectively . the neurotoxin injury models where exposure of the retina to n - methyl - n - nitrosourea ( mnu ) ablates photoreceptors ( 39 ) and nmda causes the degeneration of rgcs ( 40 ) would reveal whether or not mg could differentiate along specific neuronal types . also , it may shed light on if mg - dependent therapeutic regeneration would be a practical approach to address degenerative changes in amd and/or glaucoma .", "the discipline of mg - based regeneration is a recent one , particularly in mammals . with information on the nature of the activated mg and the molecular axes mediating their response to the niche , aided by reproducible animal models and lineage reporters , a pharmacological recruitment of these endogenous progenitors for therapeutic regeneration is a near possibility . in addition , information emerging from these studies will help us understand how the neurogenic potential in the adult mammalian brain is constrained relative to that of lower vertebrates , currently a significant knowledge gap ." ]

[ "the field of utility organometallics is increasingly turning to more complex mixed - metal systems to deliver superior results , whether this be for metal halogen exchange , alkylation , insertion , or the trapping of reactive intermediates . in theory , mixed - metal reagents can offer more flexible , tunable solutions to any problem compared to more traditional monometallic alternatives due to the increased number of components which can be varied . furthermore , the different metal centers and ligand sets can exhibit cooperativity ( or synergism ) to produce new reactivities inaccessible to the monometallic components . hydrogen abstraction is an area in which the lure of such mixed - metal systems is proving to be irresistible . the combination of an alkali metal with a range of different subordinates ( i.e. , metals that would be expected to be less reactive than the alkali metals - zn , mg , mn , cr , fe , cu , cd , al ) have been integrated with a diverse array of ligands ( alkyl , amido , alkoxy , halide ) and have been efficiently deployed in both ethereal and hydrocarbon media to overcome some of the great challenges facing deprotonation chemistry such as the incapability to metalate low brnsted acidity substrates , lack of compatibility with sensitive functionalities , low selectivity and the need to perform reactions under cryogenic conditions . recently our own group has started to investigate the use of diamines in a bimetallic context , reporting in a communication the synthesis of the diazaethene zincate complex ( tmeda)li[(ipr)nch = chn(ipr)]zn(tbu ) 1 . 1,3-diazabutadiene ligands , from which diazaethene ligands are often prepared , are increasingly important within coordination chemistry due to their flexible coordination modes and redox properties . the synthesis of this complex from the fully saturated ( ipr)nhch2ch2nh(ipr ) ( diisopropylethylenediamine ) 2 ( scheme 1 ) displayed a new mode of hydrogen activation previously unseen within zincate chemistry . we now report a detailed mechanistic overview of this surprising transformation from both experimental and theoretical perspectives .", "as reported previously , the cocomplexation of the monolithiated diamine li[(ipr)nch2ch2nh(ipr ) ] with ( tbu)2zn(tmeda ) at 0 c gives the expected product ( tmeda)li[(ipr)nch2ch2nh(ipr)]zn(tbu)23 ( scheme 1 ) . in a fashion similar to that of the two - step mechanism for monoamido zincates originally proposed by uchiyama et al . , the amino n h group of 3 is rapidly deprotonated by a tbu ligand to form the dimetalated diamido ( tmeda)li[(ipr)nch2ch2n(ipr)]zn(tbu ) 4 with the evolution of ibuh . although diamido 4 has thus far not crystallized , it has been characterized by multinuclear nmr spectroscopy , and we have succeeded in the crystallographic identification of several analogous structures . using the homologous ( ipr)nhch2ch2ch2nh(ipr ) ( diisopropylpropylenediamine ) , the dimetalated diamido ( tmeda)li[(ipr)nch2ch2ch2n(ipr)]zn(tbu ) 5 ( scheme 2 and figure 1 ) could be crystallized from the corresponding reaction of li[(ipr)nch2ch2ch2nh(ipr ) ] with ( tbu)2zn(tmeda ) . unfortunately , the crystal data are of insufficient quality to allow discussion of the geometric parameters of the structure , but the connectivity is definite . zincate 5 contains an ncccnzn six - membered ring in a boat - type conformation . the diamido ligand thus chelates the zn center while its two ipr arms are oriented out of the plane of the ring . the ( tmeda)li cation is coordinated to the hull of the boat , anchored exclusively to the two secondary amido groups to produce a puckered linznn four - membered ring . h nmr spectroscopic studies confirm the fully saturated nature of the propylene bridge with methylene resonances at 3.33 , 2.95 , and 1.93 ppm , while no characteristic diazaethene resonances were present in the 56 ppm region . molecular structure of the diamido zincate ( tmeda)li[(ipr)nch2ch2ch2n(ipr)]zn(tbu ) 5 . hydrogen atoms and disordered tbu / tmeda components have been omitted for clarity . on utilizing thf as a donor ligand in the absence of tmeda , in a repeat of the synthesis of 4 , the dimeric thf - solvated product { ( thf)li[(ipr)nch2ch2n(ipr)]zn(tbu)}26 was isolated and subsequently crystallographically characterized ( scheme 2 and figure 2 ) . lithium zincate 6 has a centrosymmetric molecular structure consisting of two [ ( ipr)nch2ch2n(ipr)]zn(tbu ) complex anions , juxtaposed , and bridged by two ( thf)li cations to produce an eight - membered ( linznn)2 ring . the cyclic conformation of 6 allows for the symmetrical coordination of each amido group to one lithium and one zinc center . both sets of metal centers occupy distorted trigonal planar geometries . the ipr groups on the amido ligands lie syn with respect to the znnccn ring , while the nonplanar nature of the diamide ( n1c4c5n2 torsion angle of 50.0(2) ) as well as its n c [ 1.471(3 ) ] and c c [ 1.530(3 ) ] bond distances , which are comparable with those found in the ruthenium complex [ ( ipr)nch2ch2n(ipr)]ruh2(co)5 [ n c , 1.48(1 ) ; c c , 1.52(1 ) ] , establish that the ch2ch2 backbone remains saturated . thermal ellipsoids are shown at the 50% probability level . selected bond lengths [ ] and angles [ deg ] : zn1n1 , 2.019(2 ) ; zn1n2 , 1.986(2 ) ; zn1c9 , 2.019(9 ) ; li1n1 , 2.001(4 ) ; li1n2(a ) , 2.041(4 ) ; li1o1 , 2.004(4 ) ; n1c4 , 1.471(3 ) ; n2c5 , 1.470(3 ) ; c4c5 , 1.530(3 ) ; n1zn1n2 , 91.20(7 ) ; n1zn1c9 , 127.5(2 ) ; n2zn1c9 , 141.2(2 ) ; n1c4c5n2 , 50.0(2 ) ; n1li1n2(a ) , 127.0(2 ) ; n1li1o1 , 117.7(2 ) ; n3li1o1 , 114.9(2 ) . to gain mechanistic insight a detailed nmr spectroscopic study was carried out on the reaction between the monometallic compounds li[(ipr)nch2ch2nh(ipr ) ] and ( tbu)2zn(tmeda ) . a li nmr spectrum of isolated crystals of the cocomplexation product ( tmeda)li[(ipr)nch2ch2nh(ipr)]zn(tbu)23 in c6d6 solution reveals two major resonances at 0.37 ppm and 0.63 ppm , suggesting a mixture of products . when this solution is gently warmed and reanalyzed , the resonance at 0.37 ppm is absent , intimating that the product associated with this low - frequency resonance has been fully consumed , and only the resonance at 0.63 ppm remains ( see figure s24 in supporting information ) . this is consistent with the disappearing resonance at 0.37 ppm representing the bisalkyl zincate 3 which , via an intramolecular deprotonation and concomitant release of ibuh , forms the diamido complex 4 . further support for this interpretation can be found when considering how close the signal assigned to complex 4 ( 0.63 ppm ) comes to that of the structurally analogous propylene derivative 5 ( 0.75 ppm , i.e. a difference of only 0.12 ppm ) . when the reaction was repeated in situ at 0 c and an aliquot removed and analyzed by li nmr spectroscopy , two pertinent resonances at 2.39 ppm , and 1.71 ppm , as well as the resonance belonging to the previously identified intermediate 4 , are present ( see figure s24 in supporting information ) . li dosy nmr experiments reveal that the intermediate responsible for the resonance at 1.71 ppm has a molecular weight similar to that of 4 ( see figure s25 in supporting information ) , presumably ruling out an aggregation process for the formation of this , as yet , unidentified species . comparison with the li nmr spectra of the diazaethene 1 in c6d6 reveals that the signal at 2.39 ppm is the result of a trace amount of this final product . due to the highly reactive , transient nature of the bis - alkylzincate 3 , its presence is not detected in this in situ nmr study . another aliquot of the solution was removed after a 2-day stir at room temperature , but the recorded li nmr spectrum indicated no significant further compositional change had taken place . aliquots were then removed after 5 min , 1 h , and 2 h reflux time , and the recorded spectra revealed a gradual transformation from the saturated intermediate 4 to the unsaturated final product 1 . after 2 h reflux , decomposition of the reaction mixture is evidenced by the deposition of a black solid . any further intermediates along the reaction pathway must be too short lived to be visible on the nmr time scale . the next step in the reaction pathway 4 1 has been shown to likely proceed through a hydride intermediate as we successfully trapped a hydride by using the electrophilic ketone ( tbu)2co . the hydride produced can then deprotonate the now allylic proton on the ethylene bridge to give the final product . the system must then find a way of solubilizing and activating the produced lih , which is normally insoluble in hydrocarbon solvents . a more typical dehydrogenation pathway involving redox active transition metals , such as those reported by brookhart , can be ruled out as there are no redox - active metals present in our alkali metal instead , the reaction could be envisaged to proceed through a ligand - sited oxidation followed by a reduction ( scheme 3 ) . this reaction can thus be said to exploit a unique three - way cooperation , where the chemical properties of the two metals and the ethylenediamide ligand combine to allow a type of chemistry otherwise unavailable . in order to explore the possible pathways by which this reaction could proceed we carried out detailed mechanistic investigations using density functional theory ( dft , see the supporting information for full details on the level of theory employed ) in order to explore the potential energy surface ( pes ) associated with the proposed mechanisms . we initially inspected the structure and stability of the monomer species 4 at the dft level of theory . in agreement with the three - carbon bridge analogue ( 5 , figure 1 ) , 4 is found to be a stable minimum on the pes with the diamido ligand coordinated to the zn atom ( n zn : 2.04 and 1.99 ) to form a five - membered ring ( nccnzn ) in a slightly twisted ( nccn torsion of 31.4 ) envelope conformation with the zn atom below the nccn plane , ( figure 3 ) . the ( tmeda)li cation is coordinated directly above the two n atoms of the five - membered ring by two essentially equivalent li based on the optimized structure of 4 two different mechanisms by which the proposed zinc hydride species could be formed are possible . all h atoms , except those involved in the reaction , are omitted for clarity . the h atom could be initially abstracted by the li cation to form a zn h bond below the plane of the ring , or direct abstraction by the zn to form the zn h bond above the ring plane . optimisation of the two hydride intermediate structures revealed that both were stable minima on the pes but were formed in endothermic reactions relative to 4 ( figure 4 ) . the intermediate with the h atom above the nccn plane ( inta ) is destabilized by 14.7 kcal / mol ( g ) relative to 4 , while the intermediate with the h atom below the plane ( intb ) is destabilized by 8.6 kcal / mol ( g ) , relative to 4 . while both reactions are endothermic , the relative stabilities of the intermediates are not sufficiently different to determine which pathway is more favorable . therefore , we characterized the transition states leading to the intermediate structures in order to determine whether there was a kinetic preference toward either species . the activation barrier associated with the formation of inta is 23.2 kcal / mol ( g * ) , compared to a barrier of 31.8 kcal / mol ( g * ) for the formation of intb . an activation barrier of 31.8 kcal / mol is still accessible under the experimental conditions employed in the reactivity of 4 ; thus , while inta is expected to be preferentially formed as an initial hydride intermediate in the formation of the diazaethene product ( 1 ) , we also considered intb as a potential intermediate from which the second hydrogen abstraction could occur . abstraction of the second h atom from inta occurs with a barrier of 17.4 kcal / mol , relative to inta , ( g * ) in an exothermic reaction ( g = 13.2 kcal / mol ) to generate h2 and the final product 1 . however , despite exhaustive sampling , no transition state could be located that corresponded to the formation of h2 and 1 starting from intb . therefore , the overall reaction 4 1 + h2 , which is essentially thermoneutral ( g = 1.5 kcal / mol , figure 4 ) , appears to preferentially occur via the hydride inta . free energy ( g ) profile for the formation of 1 from 4 via a hydride intermediate . the path in red corresponds to the formation of the hydride intermediate above the ring plane ( inta ) , while the path in blue corresponds to the formation of the hydride intermediate below the ring plane ( intb ) . the relative stabilities of ts(4-inta ) and ts(4-intb ) ( figure 4 ) are dictated by the different roles that the li and zn centers play in the two different mechanisms . in both transition states , in order for the zn h bond to be formed , one zn n bond must be broken such that the zn atom is able to accommodate the incoming h and the unsaturated n = c bond can form . within the ts(4-inta ) n bond breaking is facilitated by the formation of a stabilizing interaction between the n atom and the li . this is evidenced by the rotation around the c c bond [ increase in the dihedral angle from 31.4 in 4 ( figure 3 ) to 56.3 ( figure 5a ) ] , which decreases the li n distance from 2.02 ( figure 3 ) to 1.98 ( figure 5a ) and increases the zn n distance from 2.04 ( figure 3 ) to 3.39 ( figure 5a ) . in contrast , the rotation around the c c bond in ts(4-intb ) is not as great ( 34.1 , figure 5b ) . in addition , in ts(4-intb ) the li atom is forced to migrate toward the second n atom in order to facilitate the transfer of the h atom beneath the plane of the ring . n distance to 3.60 for the primary n ( figure 5b ) , and consequently , the breaking of the zn n bond length is only slightly increased from 2.04 in 4 ( figure 3 ) to 2.12 in ts(4-intb ) ( figure 5b ) . thus , the formation of the hydride intermediate is truly the result of the synergic interplay between the zn ( stabilizing the formation of the zn h bond ) and li ( stabilizing the breaking of the zn returning to experimental studies , a molecular hydride species [ ( tmeda)li]2[(ipr)nch2ch2n(ipr)]zn(tbu)h 7 has been isolated by using a variation of this mixed - metal approach with the ethylenediamide ligand , demonstrating that this system has the ability to encapsulate lih ( scheme 4 and figure 6 ) . dilithium hydridozincate 7 was synthesized while attempting to generate [ ( tmeda)li]2[(ipr)nch2ch2n(ipr)]zn(tbu)2 by the n h deprotonation of ( tmeda)li[(ipr)nch2ch2nh(ipr)]zn(tbu)23 with a molar equivalent of nbuli(tmeda ) ( scheme 4 ) . [ ( tmeda)li]2[(ipr)nch2ch2n(ipr)]zn(tbu)2 facilitates the -hydride formation and elimination of ibuh to generate the zinc hydride species 7 . dft calculations have confirmed that such a process [ 4 + ( tmeda)lih 7 ] would be exothermic ( g = 28.4 kcal / mol ) . molecular hydride 7 can also be produced via the alternative reaction of the usually kinetically challenged base [ ( tmeda)li]2zn(tbu)4 with ( ipr)nhch2ch2nh(ipr ) with an improved yield of 65% relative to 35% . molecular structure of the zincate hydride complex [ ( tmeda)li]2[(ipr)nch2ch2n(ipr)]zn(tbu)h 7 with hydrogen atoms ( except for the hydride ion ) omitted for clarity . thermal ellipsoids are shown at the 50% probability level . selected bond lengths [ ] and angles [ deg ] : li1h100 , 1.96(2 ) ; li2h100 , 2.07(2 ) ; zn1h100 , 2.14(2 ) ; li1n2 , 1.979(4 ) ; li2n1 , 1.989(4 ) ; zn1n1 , 2.043(2 ) ; zn1n2 , 2.074(2 ) ; zn1c1 , 2.045(3 ) ; n1c9 , 1.481(3 ) ; n2c8 , 1.448(3 ) ; c8c9 , 1.523(4 ) ; n1zn1h100 , 92.8(6 ) ; n1zn1n2 , 89.66(8 ) ; n1zn1c1 , 133.1(1 ) ; n2zn1c1 , 125.19(9 ) ; n2zn1h100 , 92.8(5 ) ; h100zn1c1 , 113.0(6 ) ; n2li1n5 , 121.8(2 ) ; n2li1n6 , 129.6(2 ) ; n2li1h100 , 101.5(6 ) ; n5li1n6 , 85.7(2 ) ; n5li1h100 , 115.9(6 ) ; n6li1h100 , 101.6(6 ) . mixed - metal zincate hydrides have repeatedly demonstrated their utility in organic synthesis as reagents for chemoselective , diastereoselective , and catalytic reductions . highly soluble , stable , and well - defined zincate hydride species are thus highly desirable . despite this , however , structurally characterized alkali metal zincate hydrides are extremely rare . to date the only examples on the ccdb are the zinc zinc bonded arzn(-h)(-na)znar ( ar = c6h3 - 2,6-[c6h3-(ipr)2]2 ) , the heterocubanes [ ( tbuoznh)4n(liotbuthf)n ] ( n = 03 ) , and the higher - order zincates na2[(et)2znh]2 and na3[(ipr)3zn(-h)zn(ipr)3 ] . although metal hydride complexes are notoriously insoluble , a reputation perpetuated by common hydride reagents such as lih and cah2 , the hydride carrier 7 is soluble in the nonpolar solvent hexane . the structure of zinc hydride 7 bears a partial resemblance to that of the thf solvated dimer 6 , with a [ ( ipr)nch2ch2n(ipr)]zn(tbu ) complex anion having a lithium cation bound to each nitrogen atom . the li n amido bond distances in 7 ( average 1.984 ) are close to those in dimer 6 ( average 2.021 ) . likewise the zn n bond distances in hydride 7 [ 2.074(2 ) and 2.043(2 ) ] are only marginally longer than those in alkylamido 6 ( average 2.002 ) , owing to the increased number of anions bound to the zinc . the tbu group has been pushed out of the plane of the amido ligand to allow the zinc center to enter a distorted tetrahedral geometry by binding to the hydride ligand . as in the lithium zincate 6 , the n c [ 1.481(3 ) and 1.448(3 ) ] and c c [ 1.523(4 ) ] bond lengths in 7 are consistent with an unactivated ethylene bridge . the trapped 3-hydride was successfully located and freely refined in the x - ray diffraction study . it caps a li2zn triangle asymmetrically with unequal li h bond distances [ 1.96(2 ) and 2.07(2 ) ] and a longer zn h bond [ 2.14(2 ) ] . the ccdb at the time of writing contains only 45 compounds exhibiting a zn hydride bond . excluding an anomalously long contact within a zinc borohydride compound ( 2.409 ) , zn hydride bond lengths range from 1.4092.167 with an average distance of 1.771 . the zn hydride contact in 7 is thus long - range to the best of our knowledge , the longest zn hydride contact in a non - borohydride complex to date ( the value of 2.167 mentioned above also comes from a borohydride complex ) . there are currently 147 compounds in the ccdb containing li hydride contacts with their lengths spanning the wide range 1.6072.802 . the average distance ( 2.044 ) is comparable with those found in 7 . to the best of our knowledge however , there have been various dilithio 3-hydride compounds reported with other metals such as ga , al , zr , w , sm , ta , and fe . variable - concentration multinuclear ( h , c and li ) nmr spectroscopic studies of 7 , as well as exchange spectroscopic ( exsy ) experiments , confirm the presence of a dynamic equilibrium in c6d6 solution . as well as resonances consistent with the solid state structure of 7 , mixed - metal zincate complex 4 can thus be described as a molecular scaffold for the molecularization of the usually insoluble polymeric lih . an examination of the li nmr spectrum reveals a doublet with a jli h coupling constant of 13.3 hz , confirming the retention of the li only a few examples have been detected since the first measurement by bergman of ( cp*)irh2sime3li(pmdeta ) ( cp * = c5me5 , pmdeta = n , n , n,n,n-pentamethyldiethylenetriamine ) in 1985 . those detected have coupling constants ranging from 6.414.7 hz , placing our example at the upper end of the literature examples . surprisingly , two independent h resonances , at 3.27 and 3.19 ppm , were detected coupling with the doublet in the li nmr spectrum . this result can be tentatively assigned to the li resonance for the zincate hydride 7 sharing the same chemical shift as dissociated ( tmeda)lih , in agreement with the presence of a dynamic equilibrium in solution . given the equilibrium between 4 and 7 , the formation of a diazaethene compound , analogous to 1 , may also occur using 7 as the starting point . the optimized structure of 7 closely matches the experimental x - ray structure , with a mean unsigned error of 0.07 between the measured and calculated bond lengths . the largest deviation between the calculated and experimental values occurs for the interactions involving the hydride ion ( e.g. , zn h : 1.94 calculated vs. 2.14 experimental , see table s1 in supporting information for details ) . the deviations in the hydride ion distances may be due to the uncertainty inherent in the crystallographic determination of hydride positions ; however , even with the shorter calculated zn h interaction , at 1.94 the zn h contact is clearly long - range . the introduction of the ( tmeda)lih ligand to 4 to form 7 results in a different mechanism for the formation of the diazaethene compound . one of the ethylene c8 hydrogen atoms from 7 ( figure 7 ) is aligned for abstraction by the dilithio hydride to form the intermediate ( intc ) containing a ( lih)2 unit . the formation of intc occurs in an endothermic step ( g = 21.7 kcal / mol ) , relative to 7 , with an associated barrier of 30.1 kcal / mol ( g * , figure 7 ) . the subsequent abstraction of the h atom from c9 ( figure 7 ) to form h2 and the diazaethene compound 8 , occurs with a barrier ( g * ) of 11.8 kcal / mol , relative to intc , in an exothermic reaction ( g = 16.7 kcal / mol ) . overall , the reaction from 7 to form 8 is slightly endothermic ( g = 5.0 kcal / mol , figure 7 ) . from the intermediate structure ( intc ) the barriers to the forward and reverse reaction ( i.e. , the formation of 8 + h2 and 7 , respectively ) are comparable in energy ( g * = 3.4 kcal / mol ) . therefore , although the equilibrium from intc will be in the direction of 7 , the formation of 8 + h2 from this structure should also occur to some extent . free energy ( g ) profile for the formation of 8 from 7 via a dihydride intermediate . the possible formation of a zn hydride intermediate , in analogy to the mechanisms explored for the formation of 1 ( via inta ) was also investigated . the barrier associated with the formation of this hydride intermediate ( g * = 28.4 kcal / mol ) is accessible under the experimental reaction conditions and the intermediate produced in this reaction is destabilized by 21.1 kcal / mol , relative to 7 . however , the barrier to the subsequent second hydrogen abstraction ( i.e. , the formation of 8 + h2 ) is 34.4 kcal / mol , which results in a strong preference for the reverse reaction back to the reactant 7 ( g * = 6.0 kcal / mol ) . as such , the mechanism resulting in the formation of dihydride intermediate ( intc , figure 7 ) is expected to be the dominant mechanism for the formation of 8 + h2 , from 7 . despite the comparable energetics for the formation of 8 from 7 ( via intc ) and 1 from 4 ( via inta ) , the mechanisms and the synergic interaction of the two metals are distinctly different . the presence of the second li atom in 7 ( relative to 4 ) allows the zn to stabilize the formation of the c = n bond ( the zn n bond increases from 2.07 in 7 to 2.18 in ts(7-intc ) , figure 8) , while the li atom is able to facilitate the c h bond breaking step . finally , the free energy associated with the loss of a ( tmeda)lih ligand from 8 to form 1 is slightly less ( g = 24.9 kcal / mol ) than the equivalent association / dissociation reaction between 4 and 7 . therefore , given the similar overall kinetic barriers associated with the generation of the diazaethene species starting from 4 and 7 , both reaction mechanisms described in figures 5 and 8 , should be competitive and operate in a complementary fashion to generate the observed product 1 . the closest analogy to the synthesis of 1 was reported by veith who formed 1,3-diaza-2-silacyclopentene by the double lithiation of ( tbu)nhch2ch2nh(tbu ) ( di - tert - butylethylenediamine ) with nbuli followed by an electrophilic quench with cl2si(me)n(h)tbu . it was acknowledged at the time that the process leading to this dehydrogenation was unclear but it was noted that the reaction was highly concentration dependent . for dehydrogenation to occur the lithiation step needed to be carried out in a highly concentrated nbuli hexane solution ( 2 m ) . this concentration dependence infers a different mechanism of hydrogen activation from that which results in the synthesis of 1 , possibly involving either larger aggregates or an intermolecular process . large aggregates of liotbu have previously been found to activate and retain lih in solution . the diamido species was never characterized in veith s study . we have confirmed by nmr spectroscopy that ( ipr)nhch2ch2nh(ipr ) , like its homologue ( tbu)nhch2ch2nh(tbu ) , can be activated when refluxed in a concentrated nbuli solution . when the reaction was carried out at concentrations akin to that used in the synthesis of 1 , then the dilithiated species could be crystallized as a tmeda solvate ( figure 9 ) . this product , [ ( tmeda)li(ipr)nch2ch2n(ipr)li]29 , has a distorted ladder structure in the solid state with the diamido ligands adopting a trans bent conformation allowing them to bridge between opposite corners of alternate rungs . n bond distances of 2.227(2 ) and 1.971(2 ) between the outer rungs and 2.057(2 ) between the inner rungs . maintaining the c2 axis of symmetry , the long and short edges of the ladder alternate as the ladder is ascended . both outer lithium centers adopt distorted tetrahedral geometries , while the internal lithium atoms are three - coordinate . this trapping of a ladder segment instigated by the lewis base tmeda supports gardiner s assertions . selected bond lengths [ ] and angles [ deg ] : li1n1 , 2.227(2 ) ; li1n2 , 1.977(3 ) ; li1n3 , 2.209(3 ) ; li1n4 , 2.199(3 ) ; li2n1 , 2.025(2 ) ; li2n2 , 1.971(2 ) ; li2n1(a ) , 2.057(2 ) ; n1c2 , 1.460(2 ) ; n2c1 , 1.458(2 ) ; c1c2 , 1.521(2 ) ; n1li1n2 , 81.23(9 ) ; n1li1n3 , 125.9(1 ) ; n1li1n4 , 129.1(1 ) ; n2li1n3 , 117.3(1 ) ; n2li1n4 , 125.26(1 ) ; n3li1n4 , 83.34(1 ) ; n1(a)li2n1 , 109.6(1 ) ; n1(a)li2n2 , 151.4(1 ) ; n1li2n2 , 86.7(1 ) . the activation of ( ipr)nhch2ch2nh(ipr ) has also been achieved starting from the sodium congener na[(ipr)nch2ch2nh(ipr ) ] and ( tbu)2zn(tmeda ) to generate the sodium diazaethene zincate ( tmeda)na[(ipr)nch = chn(ipr)]zn(tbu ) 10 . although the initial cocomplexation adduct ( tmeda)na[(ipr)nch2ch2nh(ipr)]zn(tbu)2 with one n h bond still remaining is apparently too short - lived to isolate , when the reaction was carried out at 0 c and the resulting solution stored at 30 c , it was possible to isolate and fully characterize the dimeric species { ( tmeda)na[(ipr)nch2ch2n(ipr)]zn(tbu)}211 with no n h bond but containing the saturated ethylene diamido backbone ( figure 10 ) which must exist further along the reaction pathway that ultimately produces 10 . two independent centrosymmetric molecules of dimer 11 as well as a hexane molecule form the asymmetric unit . sodium zincate 11 is constructed from a 545 fused ring system in a distorted ladder conformation ; the two znnccn rings lie anti about the strictly planar central znnznn core . the n c [ 1.452(6 ) and 1.463(6 ) ] and c c [ 1.494(7 ) ] bond distances are indicative of a fully saturated bisamide . contrary to binding in the lithium monomer 5 , the heavier alkali metal binds to only one of the available amido groups , with the core nitrogen atoms ( n1 , n1a ) coordinating exclusively to zinc . despite the variety of amide environments around zinc , the zn n bond distances show little variation ( average 2.11 ) . due to the narrow bite angle of the diamido ligand ( 85.9 ) the zinc center adopts a distorted tetrahedral geometry . a highly distorted tetrahedral geometry around sodium is also completed by a weak agostic interaction [ 2.977(6 ) ] to a methyl arm of the tertiary butyl ligand on zinc . this is moderately longer than a similar interaction found in the bis - alkylamido zincate ( tmeda)na(tmp)zn(tbu)2 ( 2.75 ) . 545 fused ring systems have been found before in metallate complexes containing saturated nccn diamido ligands . examples include the lithium lanthanide complexes [ ( thf)3li[1,2-{n(sime3)}2c6h10]mcl2]2 ( m = nd , yb ) and the dimeric gallium species [ { ( bz)nch2ch2n(bz)}li{(bz)nch2ch2n(bz)}gao]2 ( bz = benzyl , ch2c6h5 ) . molecular structure of one of the independent molecules of the dimeric sodium zincate [ ( tmeda)na[(ipr)nch2ch2n(ipr)]zn(tbu)]211 . a weak agostic nac contact is denoted by a broken bond . hydrogen atoms , ipr groups , and disordered hexane of crystallization have been omitted for clarity . selected bond lengths [ ] and angles [ deg ] : na1n1 , 3.720(4 ) ; na2n2 , 2.326(5 ) ; na1n3 , 2.490(6 ) ; na1n4 , 2.490(5 ) ; na1c4 , 2.977(6 ) ; zn1n1 , 2.105(4 ) ; zn1n2 , 2.103(4 ) ; zn1c1 , 2.072(5 ) ; zn1n1(a ) , 2.122(4 ) ; n1c8 , 1.463(6 ) ; n2c9 , 1.452(6 ) ; c8c9 , 1.494(7 ) ; n4na1n3 , 75.4(2 ) ; n4na1n2 , 121.9(2 ) ; n4na1c4 , 147.7(2 ) ; n3na1n2 , 137.7(2 ) ; n3na1c4 , 91.8(2 ) ; n2na1c4 , 87.4(2 ) ; n2zn1c1 , 117.1(2 ) ; n2zn1n1 , 85.9(2 ) ; n2zn1n1(a ) , 110.5(2 ) ; n1zn1c1 , 127.6(2 ) ; n1zn1n5 , 88.8(2 ) ; n5zn1c1 , 120.0(2 ) . as might be expected from polarity considerations , the sodium reagent proves more reactive than the lithium analogue , providing after a 30 min reflux in hexane , the sodium diazaethene 10 in 61% isolated yield . although the tmeda solvate 10 could be isolated as a crystalline solid , to obtain crystallographic data of adequate precision , the donor ligand thf had to be used in place of tmeda to produce the analogous thf solvate ( thf)3na[(ipr)nch = chn(ipr)]zn(tbu ) 10a ( figure 11 ) . here , the zinc atom is chelated symmetrically [ zn n bond distances 1.957(2 ) and 1.971(2 ) ] by the diamide ligand , lying below the plane defined by the nccn core of the diazaethene ligand . the methine carbons of the isopropyl groups lie in the plane of the diazaethene ligand while their methyl groups protrude above and below this plane . the sodium atom lies above the nccn bridge , though slightly off center , coordinating to both pairs of nitrogen and carbon atoms . three thf molecules complete the coordination sphere of the sodium center . comparing the c n [ 1.398 ( average ) ] and c c [ 1.353(4 ) ] bond distances of the diazaethene core with those found in the lithium analogue ( tmeda)li[(ipr)nch = chn(ipr)]zn(me ) [ 1.400 ( average ) and 1.349(3 ) ] indicates that the change in alkali metal has little effect on the diazaethene ligand . dissolution of 10a in c6d6 to perform an nmr spectroscopic analysis was achieved by the addition of a drop of d8-thf . comparing the h nmr spectra of the thf solvate 10a with the tmeda solvate 10 reveals only marginal shift changes of the resonances associated with the diazaethene ligand . comparing the h nmr spectra of the homologues ( tmeda)li[(ipr)nch = chn(ipr)]zn(tbu ) 1 and ( tmeda)na[(ipr)nch = chn(ipr)]zn(tbu ) 10 reveals a 0.24 ppm downfield shift of the signal attributable to the ch = ch backbone of the diazaethene ligand on moving from lithium to sodium . interestingly , there are two sets of doublets associated with the methyl groups of the isopropyls of the lithium compound but only one set in the sodium congener . this would suggest sterically induced hindered rotation of the isopropyl groups in the lithium compound which is relieved on switching to the larger sodium cation . the synthesis of several alkali metal zincate diazaethene complexes has been achieved previously . however , to the best of our knowledge , all previous examples were synthesized by the reduction of unsaturated bis - imino ligands . therefore , the synthesis of the sodium zincate 10 , along with the lithium zincates detailed in our recent communication , appear to represent the first such complexes to be synthesized via a double ch activation of a saturated diamido ligand . molecular structure of the diazaethene sodium zincate ( thf)3na[(ipr)nch = chn(ipr)]zn(tbu ) 10a . hydrogen atoms and minor disordered thf components have been omitted for clarity . thermal ellipsoids shown at the 50% probability level . selected bond lengths [ ] and angles [ deg ] : na1o1 , 2.350(2 ) ; na1o2 , 2.312(2 ) ; na1o3 , 2.312(2 ) ; na1n1 , 2.587(2 ) ; na1n2 , 2.662(2 ) ; na1c8 , 2.612(2 ) ; na1c9 , 2.649(2 ) ; zn1n1 , 1.957(2 ) ; zn1n2 , 1.971(2 ) ; zn1c1 , 2.009(2 ) ; n1na1n2 , 60.81(6 ) ; n1zn1n2 , 85.14(8 ) ; n1zn1c1 , 139.88(10 ) ; n2zn1c1 , 134.97(10 ) .", "conversions of saturated diamines into unsaturated diazaethenes are usually associated with redox - amenable transition metal catalysts . however here we show through a combination of experimental ( nmr spectroscopic , x - ray crystallographic ) and theoretical ( dft ) studies that working co - operatively in a molecular mixed - metal system , an alkali metal ( lithium or sodium ) and zinc can bring about such transformations under challenging redox - inactive conditions ." ]

[ "we reviewed the literature for reports of e. sakazakii disease in infants . using medical subject heading terms \" e. sakazakii \" or \" enterobacter \" in combination with \" newborn , \" \" infant , \" or \" meningitis , finally , we reviewed e. sakazakii case consultations conducted by the centers for disease control and prevention ( cdc ) from 1998 to 2005 and reviewed results of a french outbreak reported to cdc in 2005 ( 14 ) . we defined a case as an infant ( < 12 months of age ) with e. sakazakii cultured from an area of the body that is normally sterile : tissue , blood , cerebrospinal fluid , or urine aspirated through the bladder wall . infants with cultures of cerebrospinal fluid or brain abscesses yielding e. sakazakii were considered to have meningitis . because bacteremia is usually an intermediate step during the process of developing meningitis , patients with both bacteremia and meningitis bacteremia was defined as e. sakazakii grown from the blood of a case - patient without evidence of meningitis . infants with gestational ages < 37 weeks , or those reported to be premature , were considered premature . a gestational age of 40 weeks was assigned to 3 ( 27% ) of 11 infants with bacteremia and 4 ( 14% ) of 28 infants with meningitis who were reported as born following term gestation without a specific gestational age mentioned . we defined birthweight < 2,500 g as low birthweight ( lbw ) , < 1,500 g as very low birthweight ( vlbw ) , and < 1,000 g as extremely low birthweight ( elbw ) . descriptive analysis was performed by using sas software ( sas institute , cary , nc , usa ) .", "forty - six infants met the case definition ( table 1 ) . reported onset years ranged from 1958 to 2005 ; 32 ( 70% ) cases cases were reported in 7 countries in north america , europe , and the middle east . thirty - three ( 72% ) infants had meningitis , 12 ( 26% ) had bacteremia , and 1 ( 2% ) had a urinary tract infection . eight ( 40% ) of 20 infants for whom data were available were delivered by cesarean section . twenty - nine ( 69% ) of 42 infants experienced disease onset within a hospital . gestational duration was available for 38 infants ; 21 ( 55% ) were born prematurely , and the median gestational age overall was 36 weeks ( range 23.540 weeks ) . the median birthweight was 2,063 g ( range 5403,401 ) ; 18 ( 56% ) of 32 infants had lbw ; 9 ( 28% ) of these met the definition for vlbw , and 7 ( 22% ) met the definition for elbw . median age at the time of infection onset was 8.5 days ( range 2300 ) . * lbw , low birth weight ; vlbw , very low birth weight ; elbw , extremely low birth weight . although the proportion of infants who experienced nosocomial disease onset was not significantly different between the meningitis and bacteremia groups , other infant characteristics differed by site of infection ( figure ) . the median gestational ages of infants with meningitis and bacteremia were 37 and 27.8 weeks , respectively ( p = 0.02 ) . median birthweights were 2,454 g and 850 g , respectively ( p = 0.002 ) . however , median age at infection onset was 6 days in the group with meningitis and 35 days in the group with bacteremia ( p < 0.0001 ) . thirty ( 94% ) of 32 infants with meningitis , but only 2 ( 18% ) of 11 infants with bacteremia , were < 28 days old when infection was detected . one infant ( 8% ) with bacteremia died ; this infant also had necrotizing enterocolitis . the single infant with a urinary tract infection recovered without complication . of 19 surviving infants , only those with meningitis suffered adverse outcomes , including brain abscess ( 21% , p = 0.2 ) , developmental delays ( 53% , p = 0.004 ) , motor impairment ( 21% , p = 0.3 ) , and ventricular shunt placement ( 42% , p = 0.01 ) ; 74% experienced at least one of these outcomes . box plot with each box indicating range ( vertical lines ) , first and third quartiles ( lower and upper boundaries of box , respectively ) , and median value ( horizontal solid line ) for gestational age in weeks , birth weight in grams , and age of onset in days for infants with bacteremia only or meningitis . the dotted lines indicate median values for all cases . * significantly different values ( = 0.05 ) between groups . twenty - four ( 92% ) received a powdered formula product , including an infant who received powdered breast milk fortifier but no powdered infant formula ; 1 additional infant received formula of an unspecified type . e. sakazakii was cultured from formula associated with 15 ( 68% ) of 22 cases investigated . isolates were obtained from prepared formula , opened formula tins , and previously unopened formula tins associated with 2 , 6 , and 7 cases , respectively . thirteen ( 87% ) of the 15 formula isolates were indistinguishable from the corresponding clinical strain by biotype or genotype ; multiple formula manufacturers were implicated . in one of the remaining cases , multiple e. sakazakii strains were recovered from powdered formula , but none matched the clinical isolate by pulsed - field gel electrophoresis ( cdc , unpub . , 2 e. sakazakii strains were isolated from blood and from rectal swabs ; a third strain , as determined by arbitrarily primed pcr , was recovered from the powdered infant formula ( 9 ) .", "although numerous reports include infants with e. sakazakii isolated from nonsterile sites , such as respiratory secretions or stool , 46 infants identified from the literature and cdc sources met the case definition for this analysis ( 1,9,10,12 ) . of the infants with sterile - site infection contrary to previous characterizations of e. sakazakii disease , we found that infants with meningitis and bacteremia alone fell into 2 distinct groups . those in whom meningitis developed tended to be of greater gestational age and birthweight than those with bacteremia alone . in fact , infants in whom meningitis developed tended to attain near - term gestational age and birthweight . in contrast , infants in whom bacteremia alone developed tended to be born very prematurely and have elbw . a second major difference between the group with meningitis and the group with bacteremia was the infants ' chronological ages . infants with meningitis were generally < 1 week of age at the onset of infection with e. sakazakii , whereas infants with bacteremia had generally surpassed the neonatal period at the onset of their disease . rates of adverse outcome also differed between the 2 groups , although this was not unexpected . most infants with e. sakazakii bacteremia fared better than those with meningitis . among those in whom meningitis developed , rates of adverse outcome were similar to those reported in the literature : in this case series , 74% of meningitis survivors experienced an adverse neurologic outcome , while other studies cite adverse outcome in 20%78% of neonatal or infant meningitis survivors ( 2123 ) . the division of the infant population into 2 distinct groups occurred for unclear reasons . that infants < 1 week of age comprised the meningitis group was not surprising ; the disparities in other infant characteristics , however , are not intuitive . since infants in the 2 groups experienced similar rates of nosocomial disease onset , the infants with bacteremia were unlikely to have simply received treatment earlier in the disease course than the infants with meningitis . powdered infant formula is a demonstrated source of e. sakazakii infection . a microbiologic survey of powdered infant formulas published in 1988 found e. sakazakii in 20 ( 14% ) of 141 samples tested ( 24 ) . however , a survey of 82 powdered infant formula samples in 2003 yielded e. sakazakii in 2 ( 2.4% ) , which suggests that recent rates of powdered formula contamination may be lower ( 25 ) . powdered formula has also been implicated both epidemiologically and microbiologically as a vehicle in several cases of e. sakazakii disease in infants ( 1,3,9,10,13 ) . although we could not explore feeding exposures fully with the data available in this series , infant feeding practices may relate to the differences we describe in chronological age of infants at onset of meningitis and bacteremia . infants with nearly normal gestational ages and birthweights are likely to be tended in normal newborn nurseries during the first 2472 hours of life . in such nurseries , powdered formula is frequently given to babies who are not breast - fed , and it may also be used as a supplement by mothers who have chosen to breast - feed . since infants are at highest risk for meningitis during the first several weeks of life , possibly because of immaturity of the blood - brain barrier , exposures to e. sakazakii in powdered formula or other sources during this time may quickly lead to central nervous system disease ( 26,27 ) . conversely , in the intensive care settings where immature and low birthweight infants are tended , babies are not often fed powdered formula in the first few weeks of life . they may be given parenteral nutrition initially and may be fed breast milk from their own mothers or from a banked source when they do begin enteral feeds . if breast milk is not available , they are more likely to be given sterile , premixed infant formula than powdered formula , since standard preterm infant formula is only available in this form ( 28 ) . powdered breast milk fortifiers are not introduced until premature infants tolerate full - volume feeds , which may not occur for days or weeks after birth . thus , infants in intensive care settings may not be exposed to nonsterile formula until they are more mature , which would lead to a greater proportion of e. sakazakii bacteremia than meningitis in this group if powdered formula is a source of infection . in this series , we were unable to explore the roles of indwelling enteric tubes , prior gastrointestinal surgery , and antecedent antacid or antimicrobial drug use as risk factors for infection . while the reservoir for e. sakazakii is unknown , e. sakazakii has been isolated from factories used to produce milk powder , chocolate , cereal , potato flour , spices , and pasta ( 29 ) . it also has been isolated from household vacuum cleaner bags and from the guts of the stable fly , stomoxys calcitrans , and the mexican fruit fly , anastrpha ludens ( 2931 ) . although a human vaginal tract culture yielding e. sakazakii has been reported , vertical transmission is unlikely because nearly half of infants with e. sakazakii disease in this review were delivered by cesarean section , and symptoms developed in only 1 infant earlier than 3 days of age ( 32 ) . although cases with more severe outcomes might have been investigated and published more frequently than uncomplicated cases , this possible bias would not likely affect the representativeness of baseline infant characteristics . assigning a gestational age of 40 weeks to term infants without a reported gestational age may have falsely elevated the median gestational ages we report , since most term infants are born at < 40 weeks ' gestation ( 33 ) . however , a greater proportion of bacteremic infants than meningitic infants received this assignment , and therefore the significance of the differences in gestational age between the groups may be even greater than we report . we were unable to explore the effects of concomitant medical problems , treatments , and other environmental factors , and we relied on existing reports of feeding practices and formula testing . clearly , additional study is needed to elucidate the lingering questions about e. sakazakii reservoirs , disease risk factors , and disease course . other gram - negative organisms , including escherichia coli , enterobacter agglomerans , e. cloacae , klebsiella pneumoniae , k. oxytoca , and citrobacter freundii , can be found in powdered infant formula ( 24,25 ) . powdered infant formula also has been associated with outbreaks of illness due to citrobacter and multiple salmonella serotypes ( 13,3438 ) . the degree to which e. sakazakii is a marker for a range of neonatal infections possibly related to powdered infant formula remains to be defined . certain steps can be taken immediately , however , to prevent or mitigate e. sakazakii disease . in a joint conference on infant formula safety in february , 2004 , the world health organization and food and agriculture organization of the united nations made the following recommendations : 1 ) encourage industry partners to develop a range of affordable sterile formula options ; 2 ) consider setting an industry standard for enterobacteriaecae and e. sakazakii in infant formula ; 3 ) inform infant caregivers of the risks associated with nonsterile , powdered formula ; and 4 ) consider feeding high - risk infants sterile formula if they can not breast - feed ( 39 ) . the findings of our case review suggest that all neonates as well as premature infants should be included in this high - risk infant category . the american dietetic association has issued guidelines for infant formula preparation , storage , and administration ; these should be followed by infant caregivers in hospitals and private homes ( 40 ) . rapid reporting of cases by clinicians could streamline data collection by local health departments and more rapidly resolve remaining questions about this illness . manufacturer warning labels on powdered infant formula packages should stress that powdered infant formula is nonsterile and requires proper preparation , handling , and storage , and that sterile , liquid formula alternatives are available . these actions , adopted in whole or in part , may decrease the infectious risks associated with powdered formula and prevent this rare but potentially devastating disease ." ]

[ "sterilization in orthodontics has repeatedly been discussed and emphasized in the dental literature.[16 ] the orthodontic personnel are at a great risk of various contagious diseases and hepatitis b , acquired immuno deficiency syndrome ( aids ) and herpes infections are some of the serious conditions encountered in an orthodontic office . therefore , the center for disease control ( cdc ) specifies that all instruments which are not expected to penetrate into soft tissue or bone but will certainly contact oral tissues must be sterilized , too . in cases in which barrier techniques are not used , cross - infection between the orthodontic personnel and patients is possible . in addition , since orthodontic clinics have a large number of patients during the day compared to other dental clinics , each clinic requires its own custom - made sterilization processes . that 12% of unused orthodontic wires are not sterile and produce bacterial colonies in a culture . therefore , the instructions on the packages generally recommended sterilization before use . at present , orthodontic wires are selected in different stages of the treatment procedure not only based on wire diameter , but also biomechanical and deactivation properties of wires in order to achieve the best treatment results . -titanium ( tma ) wires are alloys of titanium and molybdenum , which were introduced in the early 1979 by goldberg and burstone for use in orthodontic treatment . these wires are becoming more popular because of their excellent balance of mechanical properties and absence of nickel , resulting in better tolerance by many patients ; some of these mechanical properties include : \n lower elastic modulus in comparison to stainless steelhigh formabilityability of direct weldinggood spring - backlow stiffnesslow force delivery[1116 ] \n lower elastic modulus in comparison to stainless steel ability of direct welding low force delivery[1116 ] the limitation of -ti wires is their high coefficient of friction . however , some manufacturers have used different methods to solve this problem , including incorporation of a titanium nitride and titanium oxide layer on the wire surface through ion implantation , changing their composition , highly polishing of the surface and increasing the surface smoothness.[71724 ] some previous studies have evaluated the effect of sterilization on wires with various alloy combinations ( -ti , niti , ss),[82528 ] with contradictory results in relation to -ti wires . in addition , after the expiration of patent on -ti wires by ormco ( glendora , california , usa ) various manufacturers produce these wires with different compositions and processing methods , resulting in different mechanical properties and different effects as a result of sterilization processes . the aim of the present study was to evaluate the effect of sterilization with dry heat and steam on load - deflection characteristics of -ti wires , with different brands .", "in the present study five different types of -titanium wires with a cross - section of 0.43 0.64 mm ( 0.017 0.025 inch ) were evaluated [ table 1 ] . the wires were of the straight type . in cases in which only the preformed arch forms were available their straight posterior segments a total of 30 wire segments from each type were provided ; each segment measured 30 mm in length . -titanium wires tested in the present study group i was assigned as the control group . the wire samples in group ii were sterilized by dry heat in an oven ( 12 bahman digital sterilizer , dsl 40 , isfahan , iran ) at 160c for 1 hour . the wire samples in group iii were sterilized by steam in an autoclave ( melag euroclav , 23 v - s , berlin , germany ) at 121c and 15 psi for 15 minutes . the wire samples were left to gradually cool to temperatures near the ambient temperature in the same sterilizers . both process indicators and test strips were used to ensure the sterilization cycles and processes . then the samples underwent a three - point load - deflection test in the dry state as described by miura et al . the test was carried out using a universal mechanical testing machine ( model 1122 , instron corporation , canton , ma , usa ) using a specially designed setup , consisting of two metallic half - cylindrical structures placed parallel to each other . a single maxillary first premolar bracket ( american orthodontics , master series , wis , usa ) , with a 0.022 0.028-inch slot size with zero angulation and zero torque was bonded on each of the half - cylinders [ figure 1 ] , with a distance of 14 mm between the brackets . the wire sample to be tested was fixed on the brackets using 0.012-inch elastomeric ligatures ( ortho organizers , carlsbad , california , usa ) . the center of each wire was deflected by moving a metallic pole adjusted on the upper head of the testing machine at a crosshead speed of 0.5 mm / min . the load was recorded at 0.1-mm intervals from the inactive position up to 1.5 mm of activation and then returning to the zero point to achieve load - deflection characteristics of each wire . load - deflection apparatus with the wire in place data was analyzed using repeated measures anova to compare load - deflection properties of the five types of -ti wires and determine the changes in characteristics during loading and unloading separately after sterilization of each wire type . scheffe is a post - hoc test , done after anova test , to evaluate the differences between each two groups .", "tables 2 and 3 present means and standard deviations of loading and unloading forces of different types of -ti wires after 1.5 mm of deflection in the three groups under study at 0.1-mm intervals . figures 26 show load - deflection curves . means and standard deviations ( sd ) for loading forces at 0.1 mm intervals of deflection for wire samples in groups i - iii means and standard deviations ( sd ) for unloading forces at 0.1 mm intervals of defl ection for wire specimens in groups i - iii load - deflection graph of beta wires in the control group and after sterilization with dry and moist heat load - deflection graph of cna wires in the control group and after sterilization with dry and moist heat load - deflection graph of res wires in the control group and after sterilization with dry and moist heat load - deflection graph of hone wires in the control group and after sterilization with dry and moist heat load - deflection graph of tmal wires in the control group and after sterilization with dry and moist heat repeated measures anova showed that during loading , hone wire had the least force level ( p < 0.05 ) and res wire had the highest force level . however , there were no statistically significant differences in force levels between res , cna and beta wires ( p > 0.05 ) . no significant differences were observed in force levels between tmal and beta wires ( p > 0.05 ) . the force levels of res and cna wires were significantly higher than that of tmal wire ( p < 0.05 ) . during unloading , tmal and hone wires exhibited the lowest force levels ( p < 0.05 ) ; although the force of tmal wire was a little less than that of hone wire res wire exhibited the highest force level , which was significantly higher than those of beta , tmal and hone wires ( p < 0.05 ) . although res wires exhibited force levels slightly higher than those of cna wires , there were no significant differences between the two wires ( p > 0.05 ) . there were no significant differences in force levels between beta and cna wires ( p > 0.05 ) . repeated measures anova revealed the following [ figures 26 ] : dry heat sterilization group ( ii ) exhibited the highest force levels during loading and unloading ( p < 0.05 ) . the force levels in the group sterilized by steam ( iii ) were significantly higher than those in the control group ( i ) during both loading and unloading ( p < 0.05 ) . the force levels of various groups of beta wires during loading and unloading were as follows : i < iii < ii . the dry heat sterilization group ( ii ) exhibited the highest force levels during loading and unloading ( p < 0.05 ) . there were more differences between groups i ( control ) and ii in the higher deflection ranges [ figures 3 and 4 ] . there were no significant differences in force levels between the control ( i ) and steam sterilization groups during loading and unloading ( p > 0.05 ) . the force levels of various res and cna groups during loading and unloading were as follows : iiii < ii . during loading , the dry heat sterilization group ( ii ) exhibited the highest force level ( p < 0.05 ) . there were no significant differences in force levels between the control ( i ) and steam sterilization ( iii ) groups ( p > 0.05 ) . during unloading , the steam sterilization group ( iii ) had the highest force levels ( p < 0.05 ) . there were no significant differences in force levels between the dry heat ( ii ) and control ( i ) groups ( p > 0.05 ) . the force levels of different hone wire groups during loading and unloading had the following relationships , respectively : iiii < ii and iii < iii . there were no significant differences in force levels during loading and unloading between groups i , ii and iii ( p > 0.05 ) ( iiiiii ) . according to hysteresis evaluation ( energy loss upon unloading ) of wires before and after sterilization showed that only sterilization with dry heat resulted in an increase in hysteresis of tmal and hone wires ; however , autoclave sterilization did not have any effect on hysteresis of the wires under study .", "repeated measures anova showed that during loading , hone wire had the least force level ( p < 0.05 ) and res wire had the highest force level . however , there were no statistically significant differences in force levels between res , cna and beta wires ( p > 0.05 ) . no significant differences were observed in force levels between tmal and beta wires ( p > 0.05 ) . the force levels of res and cna wires were significantly higher than that of tmal wire ( p < 0.05 ) . during unloading , tmal and hone wires exhibited the lowest force levels ( p < 0.05 ) ; although the force of tmal wire was a little less than that of hone wire res wire exhibited the highest force level , which was significantly higher than those of beta , tmal and hone wires ( p < 0.05 ) . although res wires exhibited force levels slightly higher than those of cna wires , there were no significant differences between the two wires ( p > 0.05 ) . there were no significant differences in force levels between beta and cna wires ( p > 0.05 ) .", "repeated measures anova revealed the following [ figures 26 ] : dry heat sterilization group ( ii ) exhibited the highest force levels during loading and unloading ( p < 0.05 ) . the force levels in the group sterilized by steam ( iii ) were significantly higher than those in the control group ( i ) during both loading and unloading ( p < 0.05 ) . the force levels of various groups of beta wires during loading and unloading were as follows : i < iii < ii . the dry heat sterilization group ( ii ) exhibited the highest force levels during loading and unloading ( p < 0.05 ) . there were more differences between groups i ( control ) and ii in the higher deflection ranges [ figures 3 and 4 ] . there were no significant differences in force levels between the control ( i ) and steam sterilization groups during loading and unloading ( p > 0.05 ) . the force levels of various res and cna groups during loading and unloading were as follows : the dry heat sterilization group ( ii ) exhibited the highest force level ( p < 0.05 ) . there were no significant differences in force levels between the control ( i ) and steam sterilization ( iii ) groups ( p > 0.05 ) . during unloading , the steam sterilization group ( iii ) had the highest force levels ( p < 0.05 ) . there were no significant differences in force levels between the dry heat ( ii ) and control ( i ) groups ( p > 0.05 ) . the force levels of different hone wire groups during loading and unloading had the following relationships , respectively : iiii < ii and iii < iii . there were no significant differences in force levels during loading and unloading between groups i , ii and iii ( p > 0.05 ) ( iiiiii ) . according to hysteresis evaluation ( energy loss upon unloading ) of wires before and after sterilization showed that only sterilization with dry heat resulted in an increase in hysteresis of tmal and hone wires ; however , autoclave sterilization did not have any effect on hysteresis of the wires under study .", "dry heat sterilization group ( ii ) exhibited the highest force levels during loading and unloading ( p < 0.05 ) . the force levels in the group sterilized by steam ( iii ) were significantly higher than those in the control group ( i ) during both loading and unloading ( p < 0.05 ) . the force levels of various groups of beta wires during loading and unloading were as follows : i < iii < ii .", "the dry heat sterilization group ( ii ) exhibited the highest force levels during loading and unloading ( p < 0.05 ) . there were more differences between groups i ( control ) and ii in the higher deflection ranges [ figures 3 and 4 ] . there were no significant differences in force levels between the control ( i ) and steam sterilization groups during loading and unloading ( p > 0.05 ) . the force levels of various res and cna groups during loading and unloading were as follows : iiii < ii .", "during loading , the dry heat sterilization group ( ii ) exhibited the highest force level ( p < 0.05 ) . there were no significant differences in force levels between the control ( i ) and steam sterilization ( iii ) groups ( p > 0.05 ) . during unloading , the steam sterilization group ( iii ) had the highest force levels ( p < 0.05 ) . there were no significant differences in force levels between the dry heat ( ii ) and control ( i ) groups ( p > 0.05 ) . the force levels of different hone wire groups during loading and unloading had the following relationships , respectively : iiii < ii and iii < iii .", "there were no significant differences in force levels during loading and unloading between groups i , ii and iii ( p > 0.05 ) ( iiiiii ) . according to hysteresis evaluation ( energy loss upon unloading ) of wires before and after sterilization showed that only sterilization with dry heat resulted in an increase in hysteresis of tmal and hone wires ; however , autoclave sterilization did not have any effect on hysteresis of the wires under study .", "-ti wires have gained great popularity in orthodontics due to their favorable nature to tooth and supporting tissues . multi - stage processing of orthodontic wires by manufacturers has a significant influence on their mechanical properties . high autoclave or dry heat sterilizer temperatures , too , might influence the mechanical properties of wires . therefore , it is important for the manufacturers to evaluate the effect of sterilization procedures on -ti wires . heat sterilization techniques were selected in the present study because they are the most popular type of sterilization technique used in dental offices ; in addition , it is the most typical method recommended until now . the load - deflection properties are significant parameters in determining the biologic nature of tooth movement . a modified version of the three - point bending test was used in the present study to evaluate load - deflection properties of orthodontic wires . this technique provides a simple model by determining the nature of forces applied during orthodontic treatment and closely simulates clinical situations . in the clinic , when a wire undergoes deflection to be placed within a bracket on a malaligned tooth , in fact , it undergoes loading . when a wire is inclined to return to its original shape , unloading takes place , which provides the necessary force to elicit a biologic tissue response , resulting in the alignment of teeth . however , laboratory tests do not necessarily reflect the clinical situations ; rather , they provide a basis for the comparison of various brands of wires . of the five brands of wires under study [ tables 2 and 3 ] , the wires manufactured by ormco ( tmal and hone ) exhibited the lowest force during unloading , with tmal forces being higher than those of hone during loading , statically equal to those of beta wires . therefore , hone wires , compared to the other types tested , are more easily engaged in the brackets of malaligned teeth due to lower force levels needed to deflect . res and cna wires required higher force levels for deflection ; therefore , these wires exhibited greater stiffness in comparison to tmal and hone wires , which might be attributed to differences in composition and processing of the alloys used in the manufacture of each of these orthodontic wires . given the curves and steepness of load - deflection graphs of the control wires in the present study [ figures 26 ] , it appears res , beta and cna wires have different behaviors compared to the two products from the ormco company ( tmal and hone ) . these results are supported by those of kusy et al . who reported that the same wire manufacturer due to similar composition and surface roughness could have manufactured the -ti new products of res , beta iii and cna . the original -ti alloy from the ormco company could have been manufactured with the same characteristics . the results of the present study showed that dry heat sterilization significantly increases force levels during loading and unloading of cna , beta and res and loading of hone wires , making them stiffer . as indicated by the increased slope of the graphs [ figures 25 ] dry heat sterilization influences the clinical performance of cna , res , beta and hone wires . it also results in increased force delivery by cna , res and beta to teeth . the differences in the effect of sterilization with dry heat and steam might be attributed to the use of longer times and higher temperatures in the sterilization process by dry heat . however , sterilization with dry heat did not result in significant changes in force levels during loading and unloading of tmal wires [ figure 6 ] . previous studies on the effect of dry heat sterilization on -ti wires have evaluated only tma wires ( ormco , glendora , california , usa ) with a size of 0.016 inch . reported that use of dry heat sterilization with a temperature of 375f ( 191c ) for 10 minutes on tma archform wires ( ormco , glendora , california , usa ) which had already been used clinically did not exert any influence on tensile and load - deflection test results of the wires . the results of the present study with tmal wires are consistent with the results of a study by smith et al . with tma wires evaluated the effect of dry heat sterilization at 375f for 20 minutes on tma wires ( ormco , glendora , california , usa ) and reported a significant increase in the tensile strength of wires . in addition to the type and size of the wires , other factors , which might have resulted in differences between the results of the present study and other studies , mentioned above might be the differences in the sterilization protocols and the type of the mechanical tests applied . the results of the present study did not show any effect of steam sterilization ( autoclave ) [ figures 26 ] on load - deflection characteristics of the majority of -ti wires tested ; however , it increased force levels during loading and unloading of beta and unloading of hone wires , which is reflected by an increased slope of loading and unloading of beta and unloading of hone wires [ figures 2 and 5 ] . therefore , these wires will deliver greater forces to teeth after sterilization in an autoclave . regarding the low force levels of tmal wire , especially during unloading both in the control group and after sterilization , it appears ion implantation process is only related to surface characteristics and a decrease in friction , with no detrimental effects on load - deflection characteristics of the wire even after sterilization . the different effects of sterilization on hone and tmal wires might be attributed to differences in the type and concentration of ions or other factors during the manufacturing processes of these wires . it is suggested that clinicians sterilize tmal , res and cna wires in an autoclave before using them without any worries because their favorable load characteristics will not undergo any changes after sterilization , which is consistent with the results of a study carried out by pernier et al . on the effect of autoclave sterilization at 134c or 274f for 18 minutes on tma , tmal and res wires . they reported no differences in load - displacement curves after sterilization of any wire tested . reported no effect of autoclave sterilization ( 250f for 20 minutes ) on tensile strength of tma wires . in addition , a study by smith et al . did not show any perceptible clinical differences between new wires and clinically used wires , which are later , sterilized in an autoclave ( 274f for 10 minutes ) .", "\n the results of the present study showed differences in force levels during loading and unloading between the five brands of -ti wires under study after 1.5 mm of deflection ; res , cna and beta wires exhibited different force deflection behaviors in comparison with the two products of ormco company ( tmal and hone).there are different changes in load - deflection characteristics of various -ti wires after sterilization with dry heat and heated steam.the clinicians who want to provide maximum safety for their patients can sterilize res , tmal and cna wires in an autoclave without any worries before placing them in the oral cavity . \n the results of the present study showed differences in force levels during loading and unloading between the five brands of -ti wires under study after 1.5 mm of deflection ; res , cna and beta wires exhibited different force deflection behaviors in comparison with the two products of ormco company ( tmal and hone ) . there are different changes in load - deflection characteristics of various -ti wires after sterilization with dry heat and heated steam . the clinicians who want to provide maximum safety for their patients can sterilize res , tmal and cna wires in an autoclave without any worries before placing them in the oral cavity . however , further in vivo studies are required to substantiate the results of the present study ." ]

[ "most pituitary adenomas are clinically inactive . in patients with long - standing compression of the optic chiasm , ganglion cells may undergo axonal degeneration . spectral domain optical coherence tomography ( sd - oct ) is able to identify retinal nerve fiber layer ( rnfl ) and ganglion cell loss in the retina . we present a case in which sd - oct was used to diagnose an asymptomatic pituitary macroadenoma .", "sd - oct identified atrophy of the ganglion cell and nerve layers , with preservation of outer layers bilaterally .", "as macroadenomas enlarge , they can induce uncrossed axon loss , resulting in nasal field defects and reduced visual acuity . in these cases , there is atrophy of the nasal and temporal portions of the optic disc , thus occupying a horizontal band across the disc . sd - oct is able to identify rnfl loss in eyes with band atrophy of the optic nerve , which correlates with visual field defects found in perimetry . sd - oct is a useful tool to assess the structural and functional damage of ganglion cells . in our case the sd - oct demonstrated a symmetrical loss of the rnfl and the ganglion cell layer in both eyes , indicating important optic nerve damage .", "pituitary adenoma is the most common cause of the chiasmal syndrome.1 the tumor is classified based on size as microadenoma , smaller than 10 mm , or as macroadenoma when it exceeds 10 mm in diameter.2 some tumors secrete one or more hormones in excess , so - called secretory pituitary adenomas , but most are clinically inactive.3 classically , the nonsecretory tumors present with vision loss,4 whereas patients with secretory tumors are usually referred to ophthalmologists for evaluation due to hormonal imbalances that affect bodily functions.5 in patients with long - standing compression of the optic chiasm , ganglion cells may undergo axonal degeneration4 . optical coherence tomography ( oct ) is able to identify retinal nerve fiber layer ( rnfl ) and ganglion cell loss in retina.6,7 we present a case in which the oct ( 3d oct-2000 spectral domain oct , topcon corporation , tokyo , japan ) was used to diagnose an asymptomatic pituitary macroadenoma . the authors adhere to the international standards developed in the 2 conference on research integrity in singapore ( 2010 ) , while performing this study . the patient agreed to have their case published , and all information presented is non - identifiable.8", "a 48-year - old , caucasian female presented with progressive vision loss in both eyes for several months . her past ocular , medical , and family history was non - contributory with no fatigue , loss of libido , no mood change , and no weight change . on examination , best - corrected visual acuity was hand motion in the right eye and 2/3 in the left eye . spectral domain optical coherence tomography ( sd - oct ) demonstrated diffuse atrophy of the ganglion cell and nerve layers , with preservation of outer layers bilaterally ( figure 1 and figure 2 ) . magnetic resonance imaging of the brain was performed and a pituitary macroadenoma with suprasellar extension was observed ( figure 3 ) .", "pituitary adenomas are common benign tumors of the pituitary gland that account for 12% of all intracranial tumors.9 people can develop pituitary adenomas at any age . some adenomas secrete hormones in excess . of the secretory tumors , the most common are prolactinomas.5 they may be relatively small when detected . the most common symptoms include headaches , menstrual changes in females , sexual dysfunction in males , vision problems , and behavioral changes.5 diagnostic imaging may include a high - resolution , t1 weighted , gadolinium enhanced magnetic resonance imaging.10 other secretory tumors may secrete corticotropin , growth hormone , gonadotropins , or thyroid - stimulating hormone.11 adenomas remain confined to the pituitary gland , but when a pituitary adenoma is 10 mm it is called a macroadenoma . macroadenomas can compress the rest of the pituitary gland and surrounding structures , such as the crossing retinal ganglion cell axons in the optic chiasm , resulting in bitemporal visual field loss.4 as the tumor enlarges , it has been shown to induce uncrossed axons loss , resulting in nasal field defects and reduced visual acuity . in these cases , there is atrophy of the nasal and temporal portions of the optic disc with relative sparing of the superior and inferior parts where the majority of temporal fibers enter . the optic atrophy occupies a horizontal band across the disc , called bowtie or band atrophy.12,13 oct is a noninvasive technique that allows cross - sectional imaging of the retina and quantifies the thickness of the rnfl around the optic nerve head . a number of studies have demonstrated that oct is able to identify rnfl loss in eyes with band atrophy of the optic nerve.6,7 the degree of rnfl thickness reduction has been shown to correlate with that of visual field defects using goldmann perimetry4 and automated static perimetry.14,15 this fact gives oct prognostic value regarding the visual outcome , as demonstrated in different studies.16,17 oct is a useful tool to assess the structural and functional damage of ganglion cells , objectively and quantitatively.4 in our case the sd - oct demonstrates a symmetrical loss of the rnfl and the ganglion cell layer in both eyes , indicating important optic nerve damage .", "sd - oct can help in the diagnosis of adenomas in equivocal situations in which there is only subtle optic nerve pallor in the setting of nonspecific visual complaints or visual field defects , or when patients are referred to screen for subclinical compressive optic neuropathies ." ]

[ "percutaneous nephrolithotomy ( pcnl ) is a widely accepted treatment for urinary calculi > 2 cm or resistant to other modalities . complications of this procedure are well reported ; however , to our knowledge no mention has occurred in the literature of a retained nephrostomy tube after pcnl . thus , we will present the management of a retained council tip catheter after pcnl .", "a 76-year - old gentleman underwent a pcnl for a 2.2x1.4-cm lower pole calculus via an uneventful upper pole puncture . incomplete stone fragmentation was obtained using the ultrasonic lithotripter ; therefore , a 24-french council tip nephrostomy tube was placed , the balloon was inflated with 3 ml of sterile water , and the patient was scheduled for a second look nephroscopy when a holmium laser was available . one week later at the second look nephroscopy , attempts to deflate the catheter balloon were unsuccessful . after transection of the balloon port valve , attempted passage of a 0.038 movable core bentson guidewire down the balloon port was unsuccessful . an antegrade nephrostogram outlined the catheter balloon within the renal pelvis ( figure 1 ) . with the c - arm in a vertical orientation , an 18-gauge chiba needle ( cook , bloomington in ) was advanced through a puncture site directly over the balloon under fluoroscopic guidance . the balloon was successfully punctured by the chiba needle with clear efflux through the needle . contrast was then instilled through the chiba needle to evaluate the integrity of the balloon and exclude the possibility of retained balloon fragments from a ruptured balloon ( figure 2b ) . flexible nephroscopy was performed to evaluate for balloon fragments , which were not identified , and to remove the lower pole stone . ( a ) chiba needle ( white arrow ) has punctured and drained the catheter balloon . ( b ) contrast injected via chiba needle has filled the catheter balloon ( dark arrow ) and confirmed its integrity .", "a retained urethral catheter due to balloon malfunction is a well - recognized urologic complication . many solutions to this problem have been attempted , including overinflation until rupture , puncture of the balloon via a wire through the balloon port , and puncture of the balloon under ultrasound guidance via a suprapubic or transvaginal route . given this infrequent but known complication of balloon - type cystostomy catheters , it is not surprising that a similar complication occurred in our patient . our familiarity with the use of the chiba needle and 3-dimensional fluoroscopy for percutaneous renal access facilitated percutaneous puncture of the catheter balloon . if equipment or experience limits the urologist 's ability to perform this technique , collaboration with an interventional radiologist using conventional c - arm or ultrasound for guidance should be considered . prevention of a retained catheter due to a balloon - port malfunction requires use of sterile water instead of saline and limiting the time of catheter placement . malecot tubes have been utilized for nephrostomy drainage , but these tubes are not without difficulties . tissue bridge formation over flanges of the tube has occurred , requiring endoscopic removal . tubeless pcnl would avoid these issues entirely ; however , the tubeless technique is contraindicated in the face of significant postoperative bleeding , urinary extravasation , ureteral obstruction , or anticipated need for a second - look nephroscopy . pigtail catheters following pcnl may represent a good alternative for drainage and access , while minimizing the risk of catheter malfunction or retention ." ]

[ "radical prostatectomy ( rp ) is a common curative surgical treatment option in localized prostate cancer ( pca ) . pelvic lymph node ( ln ) dissection is performed in order to determine the disease stage , prognosis , and the necessary future treatment options [ 1 , 2 ] . the fatty tissue overlying the prostate is removed in order to have a better exposure of the dorsal venous complex , the puboprostatic ligaments , and the prostate apex . however , if this fatty tissue is not examined separately by a pathologist , the presence of lns and possible metastasis might be missed and underreported . this might ultimately have an impact on the postoperative disease stage , treatment , and oncologic outcomes . in our study , we investigated the histopathologic evaluation outcomes of anterior periprostatic fat ( appf ) tissues that were separately sent for pathologic evaluation in order to examine presence of lns and metastasis .", "overall , 129 patients who underwent rarp between january 2012 and october 2014 were included in our study . surgical procedures were performed by three robotic surgeons ( afa , aec and mdb ) . all of the rarp procedures were performed via a transperitoneal approach and patients who had history of transurethral surgery or radiotherapy were excluded from the study . during the rarp procedures , appf covering prostate , endopelvic fascia , dorsal venous complex , prostatic apex , puboprostatic ligaments , prostate - vesical junction and the bladder neck was dissected en bloc laterally and cephalad . if metastatic ln(s ) was /were detected , immunohistochemistry for prostate specific antigen ( psa ) and prostate specific acid phosphatase were performed . parameters including serum psa , prostate weight , body mass index ( bmi ) , positive surgical margins ( psm ) and gleason score ( gs ) were included for further evaluation . patients were classified according to bmi ( kg / m ) as follows : < 18.5 underweight , 18.524.9 optimal weight , 2529.9 overweight and > 30 obese .", "mean patient age , serum psa , prostate weight and bmi were 62.2 5.5 ( range 4574 ) , 9.3 6.3ng / dl ( range 0.330.3 ) , 60.3 27.2 grams ( range 11.0180 ) and 26.6 1.9 kg / m ( range 20.0 - 30.3 ) , respectively . overall , lns in appf tissues were detected in 14 ( 10.6% ) patients with a mean ln yield of 1.1 0.7 lns ( range , 13 ) . among those found , no additional complication or morbidity due to excision of the appf was found in any of the patients . \n patient characteristics postoperative pathologic stages included pt0 ( n = 1 , 0.8% ) , pt2a ( n = 22 , 17.1% ) , pt2b ( n = 15 , 11.6% ) , pt2c ( n = 62 , 48.1% ) , pt3a ( n = 21 , 16.3% ) and pt3b ( n = 8 , 6.2% ) . overall , psm were detected in 32 ( 24.8% ) patients . of the patients with pt2 disease ( n = 99 ) , psm rate was 13.1% ( n = 13 ) . of the patients with pt3 disease ( n = 29 ) , psm rate was 65.5% ( n = 19 ) . of the patients with pt2a ( n = 22 ) , pt2b ( n = 15 ) , pt2c ( n = 62 ) and pt3a ( n = 21 ) disease , lns in appf tissues were detected in 1 ( 4.6% ) , 1 ( 6.7% ) , 11 ( 17.7% ) and 1 ( 4.8% ) patient in each group , respectively . no ln was detected in appf tissue in patients with pt0 ( n = 1 ) and pt3b ( n = 8) disease . of the patients with postoperative gs 3 + 3 = 6 ( n = 63 ) , gs 3 + 4 = 7 ( n = 34 ) , gs 4 + 3 = 7 ( n = 14 ) and gs 4 + 4 = 8 ( n = 7 ) diseases , lns in appf tissues were detected in 11 ( 17.5% ) , 1 ( 2.9% ) , 1 ( 7.1% ) and 1 ( 14.3% ) patient , respectively . no ln was detected in appf tissue in patients with postoperative gs of 5 + 3 = 8 ( n = 1 ) , 3 + 5 = 8 ( n = 2 ) and 4 + 5 = 9 ( n = 6 ) . we did not have any patient with postoperative gs of 5 + 4 = 9 or 5 + 5 = 10 . of the patients , lns in appf tissues were detected in 0 ( 0% ) , 5 ( 35.7% ) , 8 ( 57.1% ) and 1 ( 7.1% ) patients of underweight , optimal weight , overweight and obese patients due to bmi , respectively . no association was detected between bmi and presence of lns or mean ln count in the appf tissue ( p > 0.05 ) . we removed appf tissue as an en bloc excision and sent it as one piece for pathologic evaluation . we generally started removing the fat laterally from one side on the endopelvic fascia from , laterally to medially , and then shift to the other side . we accumulated both sides in the middle around the superficial dorsal vein on the prostate . thereafter , we elevated it above the prostate using maryland bipolar scissors and cauterized and cut its tip over the prostatic apex by applying bipolar energy . we then pushed it back up to the junction between the prostate and bladder neck and excised the tissue by applying monopolar and bipolar cautery . following excision of the appf tissue , the area of endopelvic fascia , puboprostatic ligaments , prostatic apex , surface of the prostate and junction between prostate and bladder neck are all cleared ( figures 1 and 2 ) . prostate , endopelvic fascia , puboprostatic ligaments , junction between prostate and bladder neck are covered with fat tissue . prostate , endopelvic fascia , puboprostatic ligaments , junction between prostate and bladder neck are seen clearly following excision of the fat tissue .", "in our study , we identified lns in appf tissue in 10.9% of the patients . aning et al . reported 14.7% ( n = 204 ) lns in appf tissue in their series , respectively . therefore , our findings are similar to previously published studies . in our study , no metastatic ln was detected in the lymphoid tissue that was obtained from the appf tissue region overlying the prostate . however , finley et al . found ln metastasis in 4 of 204 patients and jeong et al due to the published literature , ln metastasis rate in anterior periprostatic lymphoid tissue varied between 1.22.5% [ 58 ] . in our study , no metastatic ln was detected , which might be related to the limited number of patients in our series compared to the other published articles with a larger number of patients . in addition , studies that identified ln metastasis in anterior periprostatic lymphoid tissue had a higher volume of patients with high and intermediate risk patients , as compared to our study . in a multi - center study , kim et al . included 4261 rrp and rarp patients and there were 40 patients who had metastasis on periprostatic lns . of the 40 patients , 31 ( 77.5% ) were in a high - risk group , 6 ( 15% ) of them were in an intermediate group and 3 ( 7.5% ) of them were in a low - risk group according to d'amico risk classifications . jeong et al . detected metastatic lns in appf tissue in 3 patients that were all in the high - risk group . in our study , 55 ( 42.6% ) patients were in the high - risk group , 52 ( 40.3% ) patients were in the intermediate - risk group and 22 ( 17.1% ) patients were in the low - risk group . we summarized the outcomes of published literature on appf tissue and presence of lns in table 2 . \n outcomes of published literature on periprostatic fat tissue and presence of lymph nodes the european association of urology ( eau ) and national comprehensive cancer network ( nccn ) recommended extended pelvic lymph node dissection ( plnd ) in patients at 10% or greater and 7% or greater calculated risk , respectively , for ln metastases . likewise , the american urological association ( aua ) recommended plnd in patients at higher risk for nodal involvement . prognostic significance of ln metastases in prostate cancer and assessment of rates of lns and ln metastases in periprostatic fat pads in radical prostatectomy were reported before . in our experience , we performed extended plnd in intermediate or high - risk pca patients and in those with at least 5% risk of pelvic ln involvement by pca , according to partin 's tables . in addition , we always remove appf tissue and send it separately for histopathologic evaluation in patients with low , intermediate and high - risk in order to identify the presence of lns and possible metastasis that we think could have an impact on identifying the correct stage of the disease . we remove appf tissue in low - risk patients because removal of this tissue leads to better exposure of the prostatic apex , puboprostatic ligaments , endopelvic fascia and junction of bladder and prostate . kim et al . suggested that removal of appf tissue leads to more accurate staging of the patients . in their series , due to the identification of metastatic lns in the appf tissue , 0.63% of the patients were up - staged pathologically . this finding might certainly have an impact on postoperative adjuvant treatment requirement in this patient group . the condition of regional lns is one of the most important prognostic indicators of disease free survival and overall survival in pca . if a metastatic ln is detected in appf tissue ; patients might require adjuvant hormone therapy or radiotherapy . by dissecting appf tissue anatomically , finley et al . observed that the anterior fat pad was directly connected to the obturator ln chain at the lateral pelvic wall . jeong et al . identified 3 patients with metastatic lns in appf tissue in their series of 258 patients , and 2 of these 3 also had metastasis in pelvic lns . harnisch et al . identified 4 patients who had metastasis in appf tissue in their study including 302 patients and 2 of these 4 patients had also pelvic ln metastasis . identified 4 patients with metastatic periprostatic lns but only one of them had also pelvic ln metastasis . to assess the need of adjuvant therapy , postoperative serum psa follow - up is important as well as detecting metastatic lns . in their multicenter study including 4261 patients , kim et al . reported that 6 of 40 patients with metastasis on periprostatic anterior fatty lymphoid tissue did not require adjuvant therapy at a follow - up of 1.651 months , which might suggest a therapeutic advantage . however , kim et al . separately evaluated appf tissue in three pieces as a left packet , middle packet and a right packet . in their results , , increased cost was another issue for pathological evaluation of periprostatic fat tissue . in order to decrease cost , they suggested asking for pathological evaluation of the appf tissue only in intermediate and high - risk patients . in our country , if the surgery is performed in private institutions , pathologic evaluation of the appf tissue increases costs . however , in government institutions , it does not increase overall cost because all expenses are covered by the government . in addition , because we think that complete removal of appf tissue leads to better exposure of the surgical field to the operating console surgeon , we excise it even in patients with low - risk pca . in our study , no association was detected between bmi and presence of lns or ln count in the appf tissue . bmi might have an impact on the amount of periprostatic fat rather than presence of lns . not only robotic series but also open retropubic radical prostatectomy ( rrp ) series have evaluated ln existence in appf tissue . identified lns in periprostatic region in 19 ( 5.5% ) patients of 356 in their rrp series and 4 ( 1.2% ) of them had metastasis , one of 4 patients had also pelvic ln metastasis . in this study they reported that there is no connection between periprostatic ln meta - stasis and pelvic ln metastasis , but in order to provide exact staging , pathologic examination of periprostatic lymphatic area should be a routine procedure . our study has some limitations that include limited number of patients and differences in the experiences of the surgeons that performed the cases . with increasing number of patients and having more high - risk pca patients", "lymph nodes might be present in the appf tissue which should be removed and sent for histopathologic evaluation following rarp . identification of metastatic lns in the appf might have an impact on postoperative staging and management of the patients . in addition , removal of appf leads to a better exposure of the surgical field .", "" ]

[ "the american marten ( martes americana ) is an arboreal mesocarnivore that ranges from the boreal forests of northern north america into coniferous and mixed coniferous / deciduous forests of the northern and northeastern united states , including the great lakes region ( clark et al . , 1987 ) . the american marten was reintroduced to michigan 's upper peninsula ( up ) and northern lower peninsula ( nlp ) in the mid-20th century after regional extirpation due to habitat loss and over - harvest ( cooley et al . , 2004 ) . over 200 animals were reintroduced to the up over the course of several reintroductions . many fewer animals ( n = 36 ) were reintroduced in the huron - manistee national forest of the nlp and 49 martens were reintroduced to the pigeon river state forest of the nlp . in contrast , the species is considered a regional forester sensitive species and there is no harvest in the nlp ( usda forest service , 2012 ) . factors hypothesized to be contributing to the differences in population sustainability between the up and nlp include differences in habitat , genetic diversity , health and others . at the time of the original reintroduction , american marten were not examined for parasitic or infectious diseases ( spriggs , unpublished data ) . some parasites are of economic or zoonotic importance and may be introduced with animal translocations . therefore , reintroduction programs should take into account the presence of parasites which are pathogenic or to which the species of concern is not adapted ( kimber and kollias , 2000 ) . a collaborative research effort has begun in order to investigate factors that may be contributing to the difference in sustainability between the up and nlp populations . the aim of this parasite survey was to describe the presence and prevalence of parasites in the huron - manistee national forest of the nlp and to determine whether there are differences in presence or prevalence of parasites between the nlp and up . should future translocation of animals from the up into the nlp be considered for management of the species , a non - invasive and inexpensive method for screening animals would be desirable . also , american marten are not harvested in the nlp and thus adequate numbers of carcasses are not available for examination . while some information exists regarding the prevalence of endoparasitism in american marten in north american , relatively little information is available for the species in michigan ( poole et al . , 1983 , veine - smith et al . , 2011 ) . this study reviews previous parasite prevalence reports from american marten in north america , presents data from the parasitological examination of live - trapped american marten in michigan , and identifies a possible association between hookworm infection and anaemia in affected american marten .", "american marten ( n = 49 ) were sampled from the manistee national forest in the nlp ( n = 31 ) , hiawatha national forest in the up ( n = 13 ) and ottawa national forest in the up ( n = 5 ) . american marten were trapped and immobilized from 2011 to 2015 as described by desmarchelier et al . nine american marten were recaptured and re - sampled , resulting in a total of 60 faecal samples included in analyses . blood was collected from the jugular vein and placed into lithium heparin anticoagulant ( bd microtainer tubes , becton dickinson and company ) . we determined haematocrit using microhematocrit capillary tubes ( safecrit ) and the statspin vt centrifuge ( iris ) . individuals were identified as anaemic if the haematocrit was < 42% based on a report of normal haematocrit in captive , fed american martens of 47 5% ( nieminen et al . , 2007 ) . other health parameters were collected as part of a complete health assessment ( spriggs , unpublished data ) . faecal float and sedimentation examinations were performed at michigan state university 's diagnostic center for population and animal health using standard methods ( zajac and conboy , 2012 ) . faecal flotation was performed using sheather 's sugar solution ( specific gravity 1.251.27 ) alone ( n = 30 ) from may 2011may 2012 or with both sheather 's sugar solution and zinc sulfate solution ( specific gravity 1.18 , n = 30 ) from june 2012january 2015 and examined by light microscopy . fifty - nine of the samples , representing 48 individual animals , were sufficient in quantity for faecal sedimentation procedure . ova were identified based on morphologic characteristics including size and in accordance with parasitologic references and previous reports . upon consultation with a wildlife veterinary parasitologist ( gerhold ) , 2 nematode species ( syphacia muris and aspicularis sp . ) prevalence was calculated as the number of infected hosts divided by the number of hosts examined . because some american marten were sampled more than once , all parasite species found in an individual were considered together for prevalence calculations . differences between locations ( up and nlp ) and sexes were examined with a pearson 's test with p < 0.05 considered significant . significant differences between presence or absence of anaemia and hookworm infection were also examined with a pearson 's test . parasite species richness by host was calculated as the number of parasite species present per host ; species richness by sample was calculated as the number of parasite species present per sample . an unidentified capillarid species was not included in the prevalence or host species richness if one or more species of capillaria was identified in other samples from the same host . thus , an individual american marten found with unidentified capillarid at the initial exam and aonchotheca sp . at a subsequent exam if both samples had unidentified capillaria , then the host was included in the calculation of prevalence of unidentified capillaria . differences between sex and location in species richness were examined with a wilcoxon rank sum test , with p < 0.05 considered significant . the capture and handling protocol was approved by the university of tennessee animal care and use committee ( protocol # 2180 ) , and american marten live - trapping and sample collection was an authorized tribal activity under the 2007 inland consent decree between the state of michigan and the little river band of ottawa indians .", "sixty samples from 49 individual american marten ( 28 males , 21 females ) were examined , and results are shown in table 1 . of 49 individual american marten examined , 91.8% were positive for 1 or more parasites and 69.4% were infected with 2 or more parasites . there was no significant difference in mean species richness by host between sexes or locations ( nlp and up ) . trematode egg identification was suspected but not confirmed to be alaria sp . during the early part of the study ( may 2011may 2012 ) when sheather 's sugar solution alone was used for flotation , as alaria species may be distorted due to the osmotic pressure of sugar solution . later in the study ( june 2012january 2015 ) , trematode ova found on sedimentation were confirmed to be alaria species when the sample was floated with zinc sulfate solution , in which trematode ova will not be distorted . once the use of zinc sulfate solution was implemented , no trematode other than alaria species was identified , and the authors concluded that trematode eggs identified in the early samples were most likely alaria species , as suspected . in the up , 3 samples that were positive on sedimentation for trematode ova were suspected to be alaria species and 7 were confirmed via zinc sulfate flotation ; in the nlp , 14 samples positive on sedimentation were suspected to be alaria species and 5 were confirmed via zinc sulfate flotation . capillaria eggs were seen in 79% and 78.1% of samples from the up and nlp , respectively . capillaria eggs were further identified as eucoleus aerophila , eucoleus boehmi , or aonchotheca putorii based on size and morphologic characteristics . a hookworm egg is shown in fig . 1 . there was no significant difference in prevalence of any of the identified parasites between male and female american marten . of 9 american marten that were sampled more than once , only one had identical results for each time point . the mean haematocrit was 45.6 8.1 ( range 3068 ; n = 49 ) . haematocrit was reported to be 47 5% in the only other report of american marten haematocrit ( nieminen et al . , 2007 ) . using < 42% as a cut - off american marten infected with hookworms were significantly more likely to be anaemic than non - infected american marten ( p = 0.01 ) with an odds ratio of 8.75 ( 95% confidence interval : 1.456.4 ) .", "parasite species richness per host was similar to that reported by veine - smith et al . we identified more parasite species in the nlp than the up , but this result may be a function of the larger sample size from the nlp , and there was no significant difference in richness between the 2 locations . foreyt and langerquist ( 1993 ) found 2 or more parasites in 35% of american marten from eastern washington . in another survey from washington , 9 helminth species were found , and 48.4% of hosts had coinfection of 2 or more parasites , with a maximum of 4 ( hoberg et al . , 1990 ) . overall , parasite prevalences were similar between the up and nlp in our samples and we conclude that the up may be suitable source for a translocation of marten to the nlp from the point of view of parasite translocation . additional screening of both populations , the use of molecular techniques to definitively speciate parasites , and testing of individual martens marked for translocation are recommended . parasites in our study were identified to the genus and/or species level as possible by microscopic examination alone . future research could employ the use of molecular tools such as polymerase chain reaction to provide more specific results . such techniques were not used in this study because we desired an inexpensive method that could be repeated in any future reintroduction programs that require screening of large numbers of animals . parasites identified as a concern for reintroduction of north american river otter included alaria canis , strongyloides lutrae , crenosoma goblei , capillaria and coccidia due to potential for pathogenic effects or high prevalence ( kimber and kollias , 2000 ) . river otter reintroduction programs tested and treated parasitized otters , and similar methods could be considered for reintroduction of american marten ( hoover et al . , 1985 , griess , 1987 , serfass et al . , of 9 american marten that were sampled more than once , only one had identical results at subsequent sampling , indicating either a change in infection status or inconsistent shedding of ova in the remaining 8 marten . alaria species are flukes found in the small intestine of definitive hosts including felids , canids and mustelids . alaria mustelae is known to infect mink ( mustela vison ) and short - tailed weasels ( mustela erminea ) , as well as american marten ( veine - smith et al . , alaria taxidae was identified from 25% ( n = 6 ) of american marten from the district of mackenzie , northwest territories and was identified in manitoba , canada , at prevalences ranging from 36 to 73% depending on the area ( holmes , 1963 , poole et al . , 1983 ) . a definitive host infected with alaria species in its intestines sheds eggs in its faeces . after 2 weeks in wet soil or water , the eggs hatch , producing a miracidium . the miracidium invades a freshwater snail , at which point it develops into a cercaria . when the tadpole is ingested by an amphibian , reptile , or rodent , the mesocercariae remain in the tissues of the paratenic host . the mesocercariae migrate through the stomach , across the diaphragm and into the lungs where the mesocercariae develops into metacercariae . the metacercariae are able to travel up the trachea and are then swallowed , at which point they develop into adult trematodes in the small intestines . while infection with alaria species typically does not cause disease in the definitive host , there are reports of the mesocercariae causing neurologic disease due to aberrant migration through the central nervous system and of respiratory illness due to migration through the lungs in domestic dogs ( kimber and kollias , 2000 , kazacos , 2001 ) . other species of trematodes have caused disease in north american river otters , but the pathogenicity of alaria in american marten is not known ( kimber and kollias , 2000 ) . if a pregnant female rodent or carnivore becomes infected with alaria , the mesocercariae can migrate to the mammary glands and can be transmitted to nursing young ( bowman et al . , not yet weaned , in the nlp , histopathology revealed infection with alaria species in the duodenum , confirming the potential for lactogenic transmission of mesocercariae in this mustelid . in the report by veine - smith et al . ( 2011 ) , faeces from the large intestines of 140 american marten carcasses from the up were examined for flukes using a sedimentation technique and found a prevalence of 39% ( n = 54 ) . the difference in prevalence between that report and ours ( 55.6% , n = 10 ) may be due to differences in sample size , methodology or a true difference ( veine - smith et al . , 2011 ) . we recommend the use of both faecal sedimentation and zinc sulfate flotation for identification of trematode eggs in faecal samples obtained from live animals . euryhelmis squamula has been reported in raccoons ( procyon lotor ) , mink , and american marten in washington and uses amphibian intermediate hosts in this region ( hoberg et al . american marten from washington were documented with 6% prevalence from the southern cascades , confirming that marten are ingesting anuran prey in this area ( hoberg et al . , e. squamula has been reported in mink in north america and is a common parasite of the polecat in europe ( ameel , 1938 , miller and harkema , 1964 ) . a related parasite , the mink is the natural host for euparyphium beaveri in michigan , while euparyphium inerme has been reported to infect river otters in the pacific northwest ( miller and harkema , 1964 , hoberg et al . , 1997 ) . hymenolepis nana is a zoonotic cestode of rodents , carnivores and humans found worldwide , but other species of hymenolepis infect galliformes , including potential american marten prey species . the parasite may use intermediate hosts or paratenic hosts , including dung beetles , stable flies and fleas ( drew , 2003 , joslin , 2003 , loomis , 2003 , sainsbury , 2003 ) . without knowing the species of hymenolepis found from the american marten in the nlp , it is not known whether this may have been a pass - through finding or was truly an infection of the american marten ; the zoonotic potential is not known . taenia species are cestodes ( commonly known as tapeworms ) that maintain a completely sylvatic life cycle . the definitive hosts for taenia mustelae and taenia martis americana are primarily mustelids . adult parasites live in the small intestine and eggs are passed in the faeces of the host . the ingested larvae form cysticercus in skeletal muscle and viscera , and the life cycle is completed when a carnivore consumes the infected intermediate host . while the definitive host typically shows no signs of disease , the intermediate host may suffer morbidity or mortality , including liver damage , as a result of infection ( jones and pybus , 2001 ) . t. mustelae has a wide distribution across the northern hemisphere and has been reported in north american mustelids , including american marten , short - tailed weasel ( mustela erminea ) , mink ( neovison vison ) and least weasel ( m. nivalis ) . the cestode has been found in 2 sciurid definitive hosts , marmota broweri and m. caligata ( jones and pybus , 2001 ) . taenia martis americana infects mustelids , including american marten , fisher ( martes pennanti ) and the ringtail ( bassariscus astutus , family : procyonidae ) , as definitive hosts . rodents in north america reported with the larval stage of infection include lemmus sibiricus , microtus xanthognathus , mus musculus and ondatra zibethicus ( jones and pybus , 2001 ) . two american marten from the southern cascades were co - infected with both t. mustelae and t. martis americana ( hoberg et al . adult parasites are found in the small intestine of definitive hosts , which include canids , felids and mustelids ( bowman et al . , larval or adult parasites can also infect birds , reptiles and other mammals ( wardle and mcleod , 1952 ) . eggs , or gravid proglottids , are suspected to be ingested by a first intermediate host , a coprophagic insect or a mite ( chowdhury and aguirre , 2001 , bowman et al . , the insect is consumed by a second intermediate host , which may include birds , mammals , reptiles and amphibians . lastly , the definitive host becomes infected by ingesting the second intermediate host ( bowman et al . definitive hosts may have clinical signs of infection including anorexia , low serum albumin and vomiting ( chowdhury and aguirre , 2001 ) . humans can be incidental definitive hosts and become infected by consuming undercooked game ( chowdhury and aguirre , 2001 , fuentes et al . mesocestoides lineatus was identified in the small intestine of 33% ( n = 14 ) of american marten from eastern washington with significantly higher rates in juveniles than in adults . current taxonomy , however , suggests that this species may have actually been m. variabilis , which occurs in north america , while m. lineatus is an old world species ( fuentes et al . , 2003 ) . coinfections with m. lineatus and capillaria putorii occurred in 35% of parasitized american marten , and juveniles had statistically higher rates of coinfection than adults ( foreyt and langerquist , 1993 ) . hookworms are zoonotic nematode parasites infecting carnivores ( taylor et al . , 2007 ) . carnivores may become infected via ingestion of larvae or eggs , paratenic hosts , or via percutaneous or lactogenic transmission . larvae migrate to the lungs , moult , and are coughed up and swallowed to lay eggs in the small intestine . ingested larvae may bypass pulmonary migration or migrate out of the lungs into the muscle and remain in an infected female mammal until pregnancy occurs , at which point the larvae migrate to the mammary gland leading to lactogenic transmission ( taylor et al . , 2007 ) . hookworm infection in dogs and foxes can result in bloody diarrhoea , anaemia , poor hair coat , poor growth in puppies and respiratory signs ( taylor et al . , 2007 ) . we found that the odds of having anaemia ( haematocrit < 42% as described by nieminen et al . , 2007 ) were 8.75 higher for american marten infected with hookworms than in uninfected american marten in this study . while there was a significant association between presence of hookworm infection and presence of anaemia in this report , other clinical signs related to hookworm infection in addition , molecular techniques could be used to determine the species of parasite infecting american marten in michigan . because of the potential for anaemia to affect fitness of an individual american marten or the growth of kits infected via transmammary transmission , treatment of hookworm - infected american marten destined for relocation may be warranted . ( previously known as capillaria putorii ) infects the gastrointestinal tract of mustelids and other species , while other capillarids infect the respiratory tract , bladder or liver of their respective definitive hosts ( bowman et al . a. putorii can have a direct or indirect life cycle in which adult parasites shed eggs in the gastrointestinal tract of the mammalian host . the eggs are capable of infecting other susceptible hosts directly or using an earthworm as an intermediate host ( segovia et al . , 2007 , taylor et al . , 2007 ) a. putorii was found in 77.8% ( n = 14 ) of american marten from the up in the current report , which was significantly higher than the 29.0% ( n = 9 ) prevalence in the nlp ( p < 0.05 ) . however , during the initial stage of this parasite survey , some capillaria ova were not identified to species , and these are represented as if the 42.0% ( n = 13 ) prevalence of unidentified capillaria found in the nlp were in fact a. putorii , then there would not be a significant difference in prevalence of a. putorii between the up and nlp . the prevalence of a. putorii from the up in this report is higher than the 47% ( n = 66 ) previously reported from american marten carcasses from the up ( veine - smith et al . , 2011 ) . a. putorii has also been reported in the stomach of ferret , mink , short - tailed weasel , raccoon , fisher and striped skunk ( mephitis mephitis ) and in the small intestine of bobcats , bears , raccoons , swine , hedgehogs and the domestic cat ( foreyt and langerquist , 1993 , bowman et al . , 2009 ) . in northeastern washington , c. putorii was found in 86% ( n = 13 ) of american marten carcasses , mostly in the stomach and less frequently in the large or small intestine of american marten . using faecal flotation alone , capillaria species ova were found in 64% ( n = 21 ) of samples examined from the same population ( foreyt and langerquist , 1993 ) . additional future comparisons between carcass and faecal examinations to determine prevalence of capillaria and other parasites is warranted . eucoleus aerophilus , previously known as capillaria aerophila , infects the respiratory tract of hosts including american marten and other carnivores , such as fisher , red fox ( vulpes vulpes ) , raccoon , coyote ( canis latrans ) , striped skunk and badger ( taxidea taxus ) ( bowman et al . , 2009 ) . e. aerophilus rarely infects humans ( laloevi et al . , 2013 ) . the life cycle of e. aerophilus may be direct or indirect with earthworms serving as intermediate hosts ( bowman et al . aerophilus can lead to respiratory disease and clinical signs include coughing , wheezing , failure to thrive , pneumonia and even death . cats and dogs have also been infected but typically do not suffer the same degree of clinical signs as foxes since their infections are not as intense ( bowman et al . , 2009 ) . e. aerophilus was identified in 4% of the respiratory tracts of american marten from ontario , but it is unknown whether infection resulted in disease or increased risk of being trapped ( seville and addison , 1995 ) . eucoleus boehmi has been reported to infect the respiratory tract of foxes and dogs ( bowman et al . , 2009 ) . its ova can be differentiated from the similar e. aerophilus by its pitted surface ( bowman et al . , 2009 ) . the relative contribution of earthworms to the american marten diet in michigan is not known but may be significant given the high overall prevalence of capillarid parasites seen there . physaloptera species are found in the stomach of infected carnivores , including mink , striped skunk , raccoons , dogs , and cats , and eggs are shed intermittently ( chowdhury and aguirre , 2001 , veine - smith et al . , 2011 ) . crickets , beetles or other invertebrates act as intermediate hosts , while rodents and reptiles may be paratenic hosts ( chowdhury and aguirre , 2001 ) . while most infections do not cause disease in the host , severe ulcerative gastritis has been reported in the bandicoot , a marsupial ( perameles species ) ( holz , 2003 ) . crenosoma species is a lungworm found within the respiratory tract of carnivores and insectivores ( craig and anderson , 1972 ) . adult parasites lay eggs in the lungs ; larvae are coughed up , swallowed , and passed in host faeces . heavy infection with crenosoma species can cause clinical signs such as coughing , sneezing , nasal discharge and difficulty breathing ( chowdhury and aguirre , 2001 ) . the red fox is the typical host for crenosoma vulpis and is sympatric with american marten in both the up and nlp . given the global distribution of c. vulpis , it is likely that this parasite exists in the nlp red fox population although the parasite was not identified in american marten from the nlp in this study . crenosoma petrowi has been reported from free - ranging russian sable , a captive fisher in the united states and a badger from canada ( craig and anderson , 1972 ) . a single american marten from ontario was found to be infected with crenosoma petrowi ( < 1% prevalence ) , but the reported prevalence in fisher from the same region was 15% ( seville and addison , 1995 ) . olsen ( 1952 ) examined 62 carcasses of martes caurina from colorado and found 18 ( 29% ) to be infected with crenosoma , which he designated crenosoma coloradoensis . crenosoma species was found in the lungs of 2% ( n = 3 ) of american marten from the up of michigan ( veine - smith et al . , 2011 ) . strongyloides martis and s. lutrae have been reported in river otters ( hoberg et al . , 1997 ) . parasites of this genus are generally species or host - specific and undergo both a direct life cycle and a free - living stage . infective larvae or eggs in the soil are consumed by the host ; larvae of some species can also enter the host through the skin ( morris and shima , 2003 ) . pathogenicity of strongyloides species in mustelids is not known , but disease could result from migration of the parasite through the lung ( kimber and kollias , 2000 ) . dioctophyme renale , commonly known as the giant kidney worm , is one of the largest roundworms infecting wild and domestic species worldwide including wolves , bears , foxes and mink , as well as domestic dogs , cattle , horses and pigs . humans have also been reported with d. renale ( chowdhury and aguirre , 2001 ) . the adult worm is typically found in the right kidney because the infective larvae exits the intestinal tract on the right side near the stomach . when the parasite dies , the kidney is essentially destroyed , and the host becomes reliant on the remaining left kidney . occasionally , both kidneys are infected or the parasite is found elsewhere in the abdomen . an adult female worm lays eggs within the kidney , and the eggs are shed in the urine of the host mammal . it takes about 6 months for the egg to become infective , at which point it may be swallowed by the intermediate host , lumbriculus variegatus , an aquatic annelid commonly known as blackworm . if the annelid is eaten by an american marten , or other mammalian host , the life cycle is completed when the larvae finds its way to a kidney . fish , frogs and crayfish may act as paratenic hosts by consuming the infected annelid ( cheng , 1986 , chowdhury and aguirre , 2001 ) . a single american marten from the up was reported with nephritis due to suspected prior infection with d. renale ( spriggs , unpublished data ) . in an examination of 405 american marten from ontario , d. renale was found in only 2% of american marten and only from districts with previous reports of infected mink . in 4 of the 5 infected american marten , there was evidence only of past infection such as the entire right kidney missing or merely a fibrous capsule remaining , while in 1 american marten the actual parasite was identified ( seville and addison , 1995 ) . filaroides martis is a helminth parasite found in the trachea , bronchi and lungs and has been reported to infect mustelids , including mink and american marten , as well as canids ( chowdhury and aguirre , 2001 ) . the larvae moults in the stomach mucosa of the definitive host and migrates to the thoracic cavity over the next month . larvae increase in size over 100-fold during this timeframe ( ko and anderson , 1972 ) . infection with f. martis has been reported to cause pneumonia in other species , but its effect on american marten is not known ( chowdhury and aguirre , 2001 ) . of 405 american marten examined from ontario , 8% had lung or aortic nodules associated with the parasite . because yearlings had a significantly higher prevalence of infection than other ages , the authors suggest that infection could have an effect on survival of yearlings or that american marten are able to recover from infection at older age groups ( seville and addison , 1995 ) . f. martis was found in the lungs of 4% ( n = 5 ) of american marten carcasses from the up of michigan ( veine - smith et al . , histopathology revealed lesions consistent with verminous pneumonia in 60% ( n = 9 ) of american marten carcasses from michigan ( spriggs , unpublished data ) . while these were incidental findings and the causative parasite was not identified , it is possible that pneumonia may have resulted in mild respiratory compromise in affected american marten . pearsonema plica , previously known as capillaria plica , was identified in the urinary bladder of 6% of american marten from ontario ( seville and addison , 1995 ) . p. plica has been reported in the urinary tract of the domestic cat , dog , raccoon , red fox , coyote , wolf , striped skunk and fisher , as well as american marten ( butterworth and beverley - burton , 1980 ) . the definitive host begins to shed eggs of c. plica in the urine about 8 weeks after consuming an earthworm , the paratenic host ( bowman et al . , 2009 ) . infection usually does not cause disease for the host , but there is a suggestion that p. plica resulted in poor growth in fox kits ( bowman et al . , baylisascaris devosi is a nematode reported in both american marten and fisher ( kazacos , 2001 ) . eggs shed from the definitive host become infective after 1114 days , at which point small mammals such as rodents and squirrels become infected by ingesting the eggs while foraging . the larvae migrate throughout the tissues of these paratenic hosts and typically localize to the muscle of the forelimbs and thorax . neural larval migrans , a neurologic disease , is rare or non - existent with b. devosi ( kazacos , 2001 ) . in contrast , the larvae of the related baylisascaris procyonis , or raccoon roundworm , frequently migrate to the central nervous system of non - adapted hosts and cause neural larval migrans . humans are susceptible to neural larval migrans caused by baylisascaris species , but b. devosi is less likely to cause disease in humans than b. procyonis ( kazacos , 2001 ) . adult b. devosi inhabits the small intestine ; the definitive host does not typically show signs , but intestinal blockage is possible with a severe infection ( chowdhury and aguirre , 2001 ) . in 42 m. caurina carcasses examined from idaho , one was infected with b. devosi ( erickson , 1946 , poole et al . , 1983 ) . soboliphyme baturini , commonly known as stomach worm , is a nematode parasite distributed from central siberia across beringia to the pacific northwest of the united states ( koehler et al . , 2009 ) . other mustelids reported with the parasite include ermine ( m. erminea ) , mink and ferrets ( mustelo putorius furo ) ( levine , 1968 , swartz , 1968 , koehler et al . , 2009 ) . s. baturini has been reported in other carnivores , including the fox and domestic cat ( levine , 1968 ) . mature female worms are found in the stomach or small intestine of the mustelid host , and eggs are passed in the faeces of the host . earthworms are the intermediate host , while shrews become paratenic hosts when they ingest the earthworm . american marten may be infected by consuming either infected shrews or earthworms ( koehler et al . , 2009 ) . ( 2009 ) used genetic molecular data of s. baturini to shed light on the expansion of the ancestral american marten across beringia into north america , its speciation during isolation in glacial refugia , and re - colonization in alaska and reinfection with s. baturini . clinical manifestation of infection in sable includes anaemia and gastric ulceration ( thomas et al . , 2008 ) . there was a 55% ( n = 155 ) prevalence of infection with s. baturini in american marten from prince of wales island in alaska ( table 3 ) . there was no correlation between intensity of s. baturini infection and fat deposits which measured to assess nutritional condition ( thomas et al . american marten carcasses were collected over an 8-year time period from 3 locations in alaska and stomachs were examined for s. baturini ( table 3 ) . none of the american marten in that study had any sign of negative health impact from the parasite infection ( zarnke et al . , 2004 ) . a study conducted in idaho examined 42 m. caurina carcasses and found one with s. baturini ( erickson , 1946 ) . it is found worldwide except in antarctica and australasia ( chowdhury and aguirre , 2001 ) . adult t. spiralis are found in the small intestine , and the females give birth to larvae which migrate through the body to become encysted in skeletal muscle . an american marten may become infected by consuming a rodent or other mammal with the encysted parasite . once consumed , the larvae are freed and migrate to the small intestine of the host to complete their life cycle . humans can acquire trichinellosis by eating undercooked meat ( taylor et al . , 2007 ) . the first report of t. spiralis in american marten in north america was from manitoba , canada , where a single yearling was found infected of 139 american marten examined ( poole et al . , 1983 ) . prevalence of trichinella in american marten and other species may vary from year to year ( dick et al . , 1986 ) . american marten from the northern and southern cascades of washington were found to have trichinella encysted in the diaphragm , with a prevalence of 50% and 31% , respectively ( hoberg et al . , 1990 ) . another study examined tongue muscle from 42 american marten from northeastern washington and found only 5% prevalence , which the authors attribute to differences in technique and tissues examined ( foreyt and langerquist , 1993 ) . a study conducted in ontario found a 3.4% prevalence ( n = 68 ) of infection with t. spiralis in american marten ( dick et al . , 1986 ) . the prevalence in fishers in the study was slightly higher at 4.5% ( n = 83 ) , and a single mink ( of 12 tested ) was positive . the authors suggested that american marten and fishers are key in the sylvatic transmission of trichinella in this part of canada ( dick et al . , 1986 ) . other reports of t. spiralis in american marten are found in table 3 . ( 1986 ) in which only mustelids were found with t. spiralis , this study found a high prevalence in coyote ( 61% , n = 22 ) and confirmed infection in a variety of other mammals including carnivores and rodents ( schmitt et al . , 1976 ) . dracunculus insignis is a parasite known to infect raccoons , dogs , mink , fishers and skunks in the united states east of the rocky mountains and in ontario , canada ( crichton and beverly - burton , 1973 , cheng , 1986 ) . experimental infections in ferrets are used as a model for human dracunculiasis ( eberhard et al . , 1988 ) . dracunculus lutrae infects otters in north america ( crichton and beverly - burton , 1973 ) . both species have a similar life cycle to the related the old world parasite didelphis medinensis , commonly called the guinea worm , a zoonotic parasite . female d. lutrae migrate to the tissues under the skin of the animal to give birth to live larvae while secreting a substance that causes a blister to form . when the blister ruptures and is exposed to water , the infective larvae is released into the water . the free - living larvae can survive for several days until they are consumed by an aquatic copepod , the intermediate host . d. insignis develops through several more stages within the copepod over the next 3 weeks . when a definitive host ingests the copepod while drinking water , the larvae are freed in the stomach or small intestine and migrate to abdominal organs and tissues where they continue to develop into adult worms over the next 812 months ( cheng , 1986 ) . d. insignis was found in only a single american marten of 405 examined in ontario despite the parasite being commonly found in raccoons of the same region . the authors suggested a higher true prevalence , but detection was low due to the pelt being removed for commercial reasons in most of the examined specimens ( seville and addison , 1995 ) . this parasite is of economic concern as it can affect pelt quality in fur - bearer species . a single american marten from the nlp was found to be shedding sarcocystis species sporocysts . sarcocystis species is a protozoal parasite that has infrequently been reported in carnivores such as domestic cats , dogs , raccoons , cougars , bobcats , mink , striped skunks , sea otters , fishers and pacific harbor seals ( foreyt and langerquist , 1993 , gerhold et al . , 2005 , larkin et al . , 2011 ) . ( 2005 ) reported a case of meningoencephalitis in a fisher caused by sarcocystis neurona in maryland , usa . the virginia opossum ( didelphis virginiana ) is the definitive host for the parasite in north america , but the natural intermediate host for s. neurona has not been discovered ( gerhold et al . , 2005 ) . sarcocystis species was found in the tongues of 10% ( n = 4 ) of american marten examined from northeastern washington ( foreyt and langerquist , 1993 ) . antibodies to toxoplasma gondii were detected in 10.8% ( n = 15 ) of american marten in ontario . american marten in michigan were found to have a 58% seroprevalence ( n = 47 ) , and there was no significant difference between the up and nlp ( spriggs , unpublished data ) . t. gondii has been reported to cause mortality in the related black - footed ferret ( mustela nigripes ) , captive - raised american mink ( neovison vison ) and southern sea otters ( enhydra lutris ) ( dubey et al . , 2003 , burns et al . , 2003 , jones et al . , 2006 coccidian parasites have been only rarely reported in american marten , but this is likely because few studies have used faecal flotation and/or histopathology to detect parasites . all coccidian parasites are obligate , intracellular parasites and undergo stages of asexual and sexual reproduction in the life cycle , which may be direct or indirect . coccidian oocysts from 5 american marten in this report were sporulated to allow identification to the genus level . eimeria species were identified in 2 of the 5 sporulated samples from american marten in the current study , and cystoisospora species in the remaining 3 samples . it is unknown whether coccidian oocysts seen in faecal samples were pass - through from prey species . taxonomy of coccidian parasites has been controversial ; some have considered cystoisospora species to be synonymous with isospora species , while others believe it to be a distinct genus based on molecular and morphological characteristics ( yi - fan et al . , 2012 ) . cystoisospora species were identified in american marten from michigan in this report based on morphological features of the sporulated oocysts . ( 2012 ) reported cystoisospora species in steppe polecats in china and suggested that previously reported isospora species in various other mustelids , including that of sable , should be reassigned to cystoisospora species . faeces from 33 american marten from eastern washington were examined , and 6% were found with coccidian oocysts ( foreyt and langerquist , 1993 ) . cryptosporidium and giardia species cysts were detected in the faeces of american marten from the up of michigan , both having a prevalence of 4% ( n = 5 ) ( veine - smith et al . , 2011 ) .", "north american marten are infected with a wide variety of endoparasites , but information regarding the pathologic effects of parasitism remains limited . american marten infected with hookworms in the current study were found to be at risk for anaemia , and this association warrants further investigation . some parasites are infrequently reported in only a single location , while those reported in multiple locations typically have a varying prevalence . multiple ecological factors , including habitat , prey availability , sympatric carnivore community , and host adaptation , are likely involved in the variation of prevalence at different geographic locations . a number of parasites known to infect american marten have zoonotic potential . as american marten are frequently trapped as a furbearer species , this information could guide prevention of disease transmission to trappers and researchers working with the species . parasite infections could cause illness under conditions of stress and presumed immunosuppression associated with reintroduction programs ( kimber and kollias , 2000 ) . the majority of previous studies examined american marten carcasses for parasitism , which allows characterization and speciation of the adult parasite and information about intensity of infection . however , a non - invasive method of detecting endoparasitism is desired for reintroduction programs and our results provide baseline information about parasites detected by faecal examination from american marten in michigan . multiple faecal exams from individuals destined for relocation , including sedimentation and molecular techniques when available , are warranted to identify novel parasites and parasites with pathologic or zoonotic potential and to make appropriate treatment or management decisions ." ]

[ "in korea , close to 86.8% of the elderly population ( aged 65 or older ) has chronic \n degenerative disease1 . among these \n degenerative diseases , arthritis has the highest prevalence rate . osteoarthritis mainly \n occurs in the hip joints and knee joints , which are weight - bearing joints , and most elderly \n persons aged 65 years or older have this disease1 , \n 2 . osteoarthritis induces the growth of \n osteophytes , leading not only to pain but also to the loss of movement and often to a state \n of lethargy , in which the individual avoids walking1 . this lethargy hinders the individual from performing functional \n activities , often resulting in muscle weakening and atrophy , including decrease in muscle \n force and motor unit activation of the muscles around the joint affected by \n osteoarthritis3 . muscle weakening and \n atrophy further contribute to reduced walking and functional abilities required for daily \n living3 . flexion - relaxation phenomenon ( frp ) refers to the appearance of muscular - electrical silence \n on the surface of the erector spine during complete trunk flexion4 , which could be affected by several factors , including \n lumbopelvic postures5 , repetition of \n tasks6 , and muscle fatigue7 . chronic osteoarthritis , therefore , often leads to stooped postures \n as a result of the tension experienced when assuming postures in which the erector spine is \n elongated3 , 4 . the erector spinae muscle is a posture - maintaining muscle that is \n used in all daily living activities in which trunk forward - tilting and straightening motions \n are performed . normal frp of the erector spinae is an important precondition for smoothly \n performing the functional activities of daily living and is an important measurement \n variable in the evaluation of treatment effects at clinics8 . there are currently insufficient studies examining the effects of osteoarthritis on the frp \n of the erector spinae and on how the frp of the erector spinae observed in young adults is \n different from that of the elderly in whom osteoarthritis has occurred . therefore , the \n present study compared the frps of the erector spinae occurring during ( 1 ) trunk flexion , \n ( 2 ) complete trunk flexion , and ( 3 ) trunk extension motions in both healthy , young females \n and elderly females with chronic knee osteoarthritis . in addition , data regarding whether \n the frp of the erector spinae can be used as a method of evaluating the degree of pain in \n chronic osteoarthritis in the elderly will be presented . if the erector spinae \n flexion - relaxation rates can be used as a pain scale , it may assist healthcare professionals \n to improve elderly patients quality of life .", "this study was a randomized controlled trial , which included healthy adult females \n attending a university and elderly females aged at least 65 years diagnosed with chronic \n osteoarthritis in the leg , among the elderly community residing in a metropolitan area of \n chungcheongnam - do in south korea . the selection criteria for elderly subjects were as \n follows : those who had no orthopedic or neurologic disease affecting the leg other than \n chronic osteoarthritis , had not undergone surgical treatment of the leg within the last 6 \n months , had not experienced any fracture in the leg in the last 6 months , had corrected \n visual acuity not lower than 0.8 and had no blurred vision , could understand experimenters \n instructions and cooperate with the experimenters , and had understood the purpose of the \n present study and voluntarily agreed to participate . the study was approved by the \n institutional review board of hanyang university , and written informed consent was obtained \n from all patients prior to the experiments . the general characteristics of the subjects that \n participated in the present study are shown in table \n 1table 1.general characteristics of study subjects ( n=30)elderly females with chronicosteoarthritis \n ( n=17)healthy adult females ( n=13)age ( years ) , m sd 75.8 12.0 * 21.1 0.8height ( cm ) , m sd153.5 6.3159.6 3.7weight(kg ) , m sd56.5 8.752.9 5.4*p<0.05 . in the present study , surface electromyography ( emg ) ( trigno wireless system , delsys inc . , \n boston , ma , usa ) was used to measure the muscle activity of the healthy adult females and \n elderly females with chronic knee osteoarthritis while they were performing trunk flexion , \n complete trunk flexion , and trunk extension . the emg signals measured by the trigno sensor \n and wirelessly transmitted to the trigno base station were analyzed using emgworks 4.0 \n ( delsys inc . , boston , ma , usa ) software . all measured muscle activity values were calculated \n as percentages of maximal or submaximal voluntary isometric contraction values . the emg \n signal - sampling rate was 1,024 hz , and the signals were band - pass filtered within a range of \n 10500 hz . metronomes were used to enable the experimental subjects of the present study to perform \n trunk flexion , complete trunk flexion , and trunk extension for 5 s each over a total of 15 \n s. the beat was set to 60 bpm , and seconds were counted so that the subjects could hear and \n perform each motion for 5 s. before attaching the emg electrodes , sweat and foreign matter in the experimental muscle \n regions were removed in order to minimize skin resistance . the attachment points for \n measuring the thoracic erector spinae were 5 cm to the left and right of the spinous process \n of the t9 , while the attachment points for measuring the lumbar erector spinae were 2 cm to \n the left and right of the spinous process of the l2 . the manual muscle force postures for \n measuring of the maximal voluntary isometric contraction ( mvic ) in healthy adults and the \n submaximal voluntary isometric contraction in elderly persons with chronic knee \n osteoarthritis were determined following the method of osullivan et al6 . the values of each subject were measured 3 times for 5 s , \n in succession , over a total of 15 s. measurements during the first and last seconds of each \n measurement period were excluded , and the maximum values during the middle 3 s were used for \n the quantification of the root mean square ( rms ) . to minimize muscle fatigue , 1 the subjects were randomly measured in the \n order of voluntary participation . during the measurement of the flexion - relaxation rates , \n three motions were performed : ( a ) trunk flexion , ( b ) complete trunk flexion , and ( c ) trunk \n extension . posture 1 was a standing posture , posture 2 was a trunk - bending motion , and \n posture 3 was a maximum trunk - bending motion . in the complete trunk flexion section , the \n subjects were instructed to bend the trunk maximally within the range of bending with no \n pain before measurement . preliminary instruction was provided to the subjects by the \n experimenter , who performed the motions in front of the subjects and helped the subjects \n practice the motions at least one time . the flexion - relaxation rates were determined using both the values obtained by dividing the \n data for trunk extension by that of complete trunk flexion ( c / b ) and by dividing the data \n for trunk flexion by that of complete trunk flexion ( a / b ) . the mean values of the three \n trunk flexion extension motions were used to determine the flexion - relaxation rates . the means and standard deviations of \n the general characteristics of the study subjects ( age , gender , height , and weight ) were \n calculated using descriptive statistics . in the present study , the independent variable was \n the presence or absence of chronic knee osteoarthritis , and the dependent variable was the \n frp of the erector spinae . independent t - tests were used to examine the erector spine \n flexion - relaxation rates according to whether the presence or absence of chronic knee \n osteoarthritis . to test the statistical significance , was set to 0.05 , and the collected \n data were analyzed using pasw ver .", "the effect of chronic knee osteoarthritis on the frp of the erector spinae was first \n examined . the values obtained by dividing the data for trunk extension by that of complete \n trunk flexion were not different for the left and right lumbar erector spinae or right \n thoracic erector spinae ; however , they were significantly different for the left thoracic \n erector spinae ( p<0.05 ) ( table 2table 2.flexion-relaxation phenomenon ( frp ) values obtained by dividing the data for \n trunk extension by those for complete trunk flexion from healthy adults and elderly \n individuals ( units : % ) musclesmean sdelderly females withchronic osteoarthritishealthy adultfemalesleft thoracic erector spine1.67 0.61 * 1.22 0.45right thoracic erector spine1.87 0.822.31 1.35left lumbar erector spine2.35 1.312.08 1.36right lumbar erector spine2.46 1.031.85 1.81*p<0.05 ) . the values obtained by dividing the data for trunk flexion by that of \n complete trunk flexion , were not different for the left and right lumbar erector spinae and \n right thoracic erector spinae , but were significantly different for the left thoracic \n erector spinae ( p<0.05 ) ( table 3table 3.flexion-relaxation phenomenon ( frp ) values obtained by dividing the data for \n trunk flexion by those for complete trunk flexion from healthy adults and elderly \n individuals ( units : % ) musclesmean sdelderly females with chronic osteoarthritishealthy adult femalesleft thoracic erector spine1.47 0.55 * 1.12 0.31right thoracic erector spine1.41 0.491.99 1.43left lumbar erector spine2.00 1.082.58 2.75right lumbar erector spine1.76 0.901.62 1.31*p<0.05 ) .", "in the present study , the frp of the erector spinae in elderly females with chronic knee \n osteoarthritis and healthy young females were measured to determine whether the erector \n spinae flexion - relaxation rates could act as a useful pain evaluation tool for patients with \n knee osteoarthritis . although no significant differences were evident in the \n flexion - relaxation rates of the left and right thoracic erector spinae or right lumbar \n erector spinae , significant differences were shown in the flexion - relaxation rates of the \n left thoracic erector spinae . degenerative arthritis develops in most people aged 65 or older , with a higher prevalence \n in females than in males . lower - limb osteoarthritis is \n associated with foot postures and affects the dynamic alignment of the lower limbs9 . reilly et al.9 reported that patients with knee joint osteoarthritis showed changes \n in the ankle joint postures when compared with healthy individuals , and according to the \n study of hu et al.10 , foot posture and \n stance widths affected the load - sharing mechanism of the lumbar muscle tissues . therefore , \n knee osteoarthritis was believed to affect the frp of the lumbar erector spinae . the frp can act as a quantitative measure for the evaluation of changes in the \n neuromuscular system functions11 . varying \n flexion - relaxation rates among patients are a useful clinical tool that can help in \n diagnosing chronic lower back pain in patients3 . this argument is supported by strong evidence that those subjects \n with low back pain do not exhibit the frp during complete trunk flexion12 . watson et al.13 demonstrated the validity of measuring the frp of the lumbar \n vertebrae to diagnose lower back issues and reported high specificity and sensitivity . in \n addition , the flexion - relaxation rates are a valuable tool for distinguishing between \n patients with cervical pain and those with no cervical pain , and to indicate changes in the \n neuromuscular control in patients with cervical pain . the flexion - relaxation rates of the \n cervical spine were reported to be significantly lower in patients with cervical pain14 . shin et \n al.15 advised that the knee angles and \n individuals flexibility levels affected the frp of the lumbar muscles . they reported that \n in the case of subjects with high flexibility , knee angles affected the flexion - relaxation \n rates when the trunk angle became 90 , and in the case of those with moderate flexibility , \n the foregoing reactions appeared when trunk angles were 7090. they also reported that in \n the case of those with poor flexibility , knee angles did not affect the flexion - relaxation \n rates . according to the study by hashemirad et al.16 , muscle activity pattern of the erector spinae varied with \n flexibility during trunk flexion / extension . the flexion - relaxation reactions are affected by \n several factors , including trunk loads , lumbosacral postures , trunk angular speed , number of \n task repetitions , and muscle fatigue6,7,8 , 17 . although previous studies were actively \n conducted on the effects of loads , angular speed , muscle fatigue , and postures on the \n flexion - relaxation rates , studies on the effects of changed lumbosacral postures of patients \n with chronic knee osteoarthritis on the frp of the erector spinae have been insufficient . \n therefore , the present study intended to examine the differences in the frp of the erector \n spinae between elderly persons with degenerative knee osteoarthritis and healthy adults . \n although not clinically significance , the results showed significant differences only in the \n left thoracic erector spinae , but not in the left and right lumbar erector spinae or right \n thoracic erector spinae . first , the study sample was small and was limited to females \n with chronic knee osteoarthritis second , \n although the same voice signals were given using a metronome during trunk flexion and \n extension , trunk speeds were different among individual subjects . third , the levels of knee \n pain were different among individual patients with chronic knee osteoarthritis , and the \n effects of medication and previous treatment could not be eliminated . to further determine \n the frp of the erector spinae in elderly females with chronic knee osteoarthritis , further \n studies that account for the limitations of the present study may be required ." ]

[ "\n new - onset diabetes after transplantation ( nodat ) represents a common comorbidity after solid organ transplantation . nodat after kidney transplantation is associated with inferior outcomes , including higher risk of infections , decreased graft survival , higher rates of cardiovascular disease , and increased overall mortality [ 15 ] . risk factors for nodat include use of immunosuppressants , in particular corticosteroids and calcineurin - inhibitors , as well as traditional risk factors for type 2 diabetes including obesity , family history , age , and ethnicity [ 68 ] . metformin is the first - line agent of choice for the treatment of type 2 diabetes in the general population . though some data suggests metformin is safe in the setting of chronic kidney disease , the use of metformin in kidney transplant patients is still quite controversial due to the concern about lactic acidosis and lack of data regarding metformin use in this patient population [ 911 ] . therefore , it is important to identify an alternative first - line oral agent for the treatment of nodat in kidney transplant recipients . short - term studies have shown some oral antihyperglycemic agents to be effective in patients with nodat [ 1214 ] . however , use of these agents is limited by adverse effects including fluid retention and bone loss with pioglitazone and hypoglycemia and weight gain with insulin secretagogues [ 12 , 15 , 16 ] . sitagliptin , an oral dipeptidyl - peptidase-4 ( dpp-4 ) inhibitor , was approved in the united states in 2006 for the treatment of type 2 diabetes . sitagliptin has a low incidence of hypoglycemia and does not promote weight gain , and the dosage can be adjusted based on renal function . additionally , in a 3-month trial of kidney transplant recipients , sitagliptin use did not alter immunosuppressant levels . however , evidence supporting the efficacy and safety of long - term use of sitagliptin in kidney transplant recipients is lacking . we hypothesized that in kidney transplant recipients sitagliptin would improve nodat control , as assessed by hemoglobin a1c ( hba1c ) , with a favorable safety profile including no effect on immunosuppressant levels or graft function .", "in this single center study , we performed a retrospective analysis of kidney transplant recipients in the multidisciplinary transplant clinic at the university of nebraska medical center ( unmc ) between october 2006 ( release date of sitagliptin in the united states ) and december 2012 . all subjects in this study received their kidney transplant at unmc . between 2009 and 2013 , 125 to 149 kidney transplants were performed per year at unmc ( http://optn.transplant.hrsa.gov/ ) . we have previously reported an incidence of nodat of 18% in our kidney transplant population . the study was approved and monitored by the unmc institutional review board . a general query was performed to identify all kidney transplant recipients who had been prescribed sitagliptin during the study dates . data for the query and subsequent data collection for the study were obtained from review of the electronic medical records centricity ( ge healthcare ) , ottr ( ottr chronic care solutions ) , and epic ( epic systems corporation ) . inclusion criteria for the study included diagnosis of nodat by the 2003 international consensus guidelines criteria ( fasting plasma glucose 126 mg / dl or 7.0 mmol / l after no caloric intake for at least 8 hours or random plasma glucose 200 mg / dl or 11.1 mmol / l with symptoms of diabetes or 2 h plasma glucose in a 75 g oral glucose tolerance test ( ogtt ) 200 mg / dl or 11.1 mmol / l ) and diabetes care received at the unmc diabetes center to allow for accurate record of diabetes medication changes and reporting of side effects . additionally , to specifically understand the efficacy and safety of sitagliptin for the treatment of nodat , patients included in the study either used sitagliptin as the initial agent for nodat or had other diabetes medications stopped prior to or at the time of sitagliptin initiation . exclusion criteria included diagnosis of diabetes prior to transplant and death or loss of followup prior to 12 months after initiation of sitagliptin . sitagliptin dosing was performed based on the patients ' renal function , as directed by the prescribing information for sitagliptin ( https://www.merck.com/ ) . initiation of sitagliptin therapy marked the start of followup for each patient and patients were followed up until discontinuation of sitagliptin or december 2012 , whichever came first . the first was a 12-month followup to assess the subacute efficacy and safety of sitagliptin in terms of diabetes control , side effects , immunosuppressant levels , and graft function . the second endpoint was at discontinuation of sitagliptin or , for those patients who continued on sitagliptin through the entire study , in december 2012 . this longer followup allowed for assessment of long - term efficacy and safety in terms of diabetes control , acute rejection episodes , allograft function , and other side effects . the patient medical records were reviewed in detail for a number of different diabetes and transplant - specific outcomes including dates of sitagliptin initiation / discontinuation ; dates of initiation / discontinuation of any other diabetes medications ; patient or physician - reported side effects ; reason for discontinuation of sitagliptin ; acute rejection episodes ; graft loss ; immunosuppressant regimens and dosages ; opportunistic infections ; and death . body mass index ( bmi ) was obtained at the time of transplant , at the time of sitagliptin initiation , after 12 months of sitagliptin therapy , and at the end of followup . as part of routine posttransplant and diabetes care , patients underwent fasting labs weekly to monthly at the clinical laboratory of the nebraska medical center including serum creatinine , tacrolimus and/or sirolimus trough levels ( as appropriate ) , and fasting glucose levels . hba1c was performed every 3 months and fasting lipid panel every 3 to 6 months . serum creatinine , fasting serum glucose , hdl cholesterol , and ldl cholesterol measurements were performed using standard calibration protocols and dedicated analyzers and were assayed by colorimetric means . tacrolimus and hba1c was performed on a national glycohemoglobin standardization program ( ngsp ) certified high - pressure liquid chromatography ( hplc ) analyzer . estimated gfr ( egfr ) was calculated using the modification of diet in renal disease ( mdrd ) equation .", "a total of 65 patients were identified to have received sitagliptin after kidney transplant during the study dates . of these , 37 patients met criteria for nodat ( figure 1 ) . of these 37 patients , a total of 15 were excluded from the study : 9 patients who obtained their diabetes care at outside clinics and clear records of diabetes medication adjustments were not available ; 1 patient who was deceased 8 months after sitagliptin initiation ; and 5 patients because sitagliptin was added to other diabetes medications . the remaining twenty - two ( 22 ) patients met inclusion criteria and had at least one year of followup and were subsequently analyzed . this cohort of 22 patients does include long - term followup of eight of the fifteen patients analyzed previously at our center in a 3-month prospective study of sitagliptin for the treatment of nodat . baseline characteristics of the 22 patients included in the study are shown in table 1 . of the 22 patients , nodat was diagnosed in 21 by fasting blood glucose 7.0 mmol / l on two occasions ; one patient was diagnosed with random blood glucose > 11.1 mmol / l with symptoms of diabetes . a majority of patients utilized tacrolimus - based immunosuppression with the addition of either sirolimus or mycophenolate mofetil ( table 1 ) . hepatitis c has been reported to be a risk factor for nodat ; however , none of our subjects were hepatitis c positive . sitagliptin was the initial diabetes medication for a majority of the patients ( 16/22 ) . a total of twenty - two patients were analyzed at the end of 12 months of sitagliptin therapy . of these , 19 patients remained on sitagliptin alone as their only diabetes medication , one patient required initiation of an additional oral diabetes medication , and 2 patients had sitagliptin discontinued in favor of other diabetes medications due to hyperglycemia . diabetes control , as noted by hba1c , was significantly improved at the end of 6 months and this effect persisted at 12 months ( figure 2(a ) ) . significance remained when analyzing just those patients ( n = 19 ) who remained on sitagliptin alone for the entire 12 months ( data not shown ) . there was a modest but significant decrease in bmi from the start of sitagliptin to the 12-month followup ( figure 2(b ) ) , though certainly this weight loss may have been due to multiple factors including lifestyle modifications . ldl and hdl cholesterol values remained unchanged with sitagliptin therapy ( figures 2(c ) and 2(d ) ) . at the 12-month followup , graft function as noted by serum creatinine and estimated gfr ( egfr ) was no different than at start of sitagliptin ( figures 3(a ) and 3(b ) ) . we then reviewed immunosuppressant levels over the 12 months of followup and also meticulously reviewed medical records for immunosuppressant dose changes and , if changes to dose were made , the impetus for doing so . tacrolimus and sirolimus levels remained stable throughout the 12-month followup ( figures 3(d ) and 3(e ) ) . in tacrolimus - treated patients , for the remainder of tacrolimus - treated patients only 3 patients required a single protocol dose adjustment and the rest maintained consistent tacrolimus doses . similarly , the patient with noncompliance required frequent sirolimus dose adjustments during the follow - up period while 3 patients had single , protocol - related sirolimus dose adjustments . to assess the long - term efficacy and risk for adverse effects of sitagliptin in kidney transplant recipients , we followed our cohort from the initiation of sitagliptin until december 2012 or discontinuation of sitagliptin , whichever came first ( mean followup for all 22 patients = 32.5 17.8 months ) . in the cohort , 17/22 patients remained on sitagliptin throughout the study period , for a mean duration of sitagliptin use of 37.9 16.5 months . of these 17 patients , 9 remained on sitagliptin alone for the entirety of the study ( 31.8 18.7 months ) . diabetes was well controlled in this group , with hba1c maintained below 7% ( 6.5 0.5% ) at the end of followup ( figure 4(a ) ) . eight patients continued on sitagliptin for the duration of the study ( 44.9 10.9 months ) but required addition of other diabetes medications to maintain glycemic control ( oral agents , n = 4 ; insulin , n = 4 ) . hba1c remained well controlled in this group ( figure 4(b ) ) and two of the four patients on insulin required only basal insulin in addition to sitagliptin . therefore , five patients discontinued sitagliptin in favor of other diabetes medications after 14 4.2 months . of these , 4 patients discontinued sitagliptin due to worsening hyperglycemia ( figure 4(c ) ) and need for intensive insulin therapy while one patient was switched from sitagliptin to a sulfonylurea due to cost . hemoglobin a1c was significantly lower at baseline in patients who were able to continue on sitagliptin alone for the duration of the study ( n = 9 ) compared to patients who discontinued sitagliptin and were switched to more aggressive diabetes management ( n = 5 ) ( figure 4(d ) ) . change in bmi , from sitagliptin initiation to the end of followup , was no different between these groups ( sitagliptin alone : 0.8 2.2 kg / m versus sitagliptin discontinued : 1.1 1.7 kg / m , p = ns ) suggesting the need for intensification of diabetes therapy in the sitagliptin discontinuation group was not necessarily related to weight gain . glucagon - like peptide-1 ( glp-1 ) therapies have been implicated to potentially increase the risk of pancreatitis , a matter of significant controversy . in the current study , no episodes of pancreatitis were reported during the follow - up period . additionally , other transplant - specific adverse events were rare in our cohort , including one episode of acute rejection ( 47 months after sitagliptin initiation ) ; two episodes of opportunistic infections ( 13 and 14 months after sitagliptin initiation ) ; no graft loss ; and one death ( due to end - stage liver disease ) .", "our study represents the largest cohort investigating the safety and efficacy of sitagliptin for the treatment of nodat in kidney transplant recipients . though our study was retrospective , through meticulous review of the medical records of patients followed up primarily in our transplant endocrine clinic we were able to closely follow medication prescribing changes , laboratory values , and reports of potential side effects and transplant - related comorbid events . in our cohort , sitagliptin was efficacious with a majority of patients meeting a goal hba1c < 7% . specifically , sitagliptin alone was adequate to improve and maintain glycemic control in a majority of patients ( 19/22 ) for 12 months after sitagliptin initiation , consistent with its efficacy in the nontransplant population [ 21 , 22 ] . sitagliptin inhibits dpp-4 with several subsequent effects that improve blood glucose control including potentiation of insulin secretion and inhibition of glucagon secretion . in studies utilizing animal models of type 2 diabetes , sitagliptin has also been shown to reduce islet inflammation and protect beta cell mass [ 2325 ] . beta cells exposed to glp-1 in vitro are resistant to toxicities associated with immunosuppressants , suggesting another potential benefit to dpp-4 inhibitor therapy for the treatment of nodat . these beta cell - specific protective effects of sitagliptin may explain why , in our cohort , patients with lower baseline hba1c responded better to sitagliptin monotherapy as these patients may have been earlier into the disease and may have had more beta cell mass that was subsequently protected by sitagliptin . overall , these findings suggest that initiating sitagliptin therapy early in the treatment of nodat , when average glucose levels are only modestly elevated , may provide long - term benefits in terms of glycemic control . larger cohorts are needed to investigate this point further . in solid organ transplant recipients , drug - drug interactions and adverse effects of medications on graft function we set out to better define the safety profile of sitagliptin in kidney transplant recipients in terms of effects on immunosuppressant levels / dosing , graft function , and other side effects . renal function and tacrolimus and sirolimus dosing and trough levels remained stable during the initial 12-month follow - up period , indicating sitagliptin does not adversely affect renal function or interfere with immunosuppressant dosing . hypoglycemia was not encountered in our cohort , consistent with reports of sitagliptin use in the nontransplant population . the use of dpp-4 inhibitors for the treatment of hyperglycemia and nodat in kidney transplant recipients is gaining more interest . recently , a 3-month clinical trial of vildagliptin , another oral dpp-4 inhibitor , revealed that this agent improved oral glucose tolerance test outcomes and modestly improved hemoglobin a1c in kidney transplant recipients with impaired glucose tolerance ( igt ) . similarly , a small , randomized control trial recently revealed vildagliptin to be a safe and effective therapy for the treatment of nodat in kidney transplant recipients . finally , a 24-week retrospective study of linagliptin suggests this agent may be beneficial for treating nodat , as well . however , data regarding sitagliptin for the treatment of nodat in kidney transplant recipients is scarce . a single pilot study of 15 patients followed up for 3 months revealed no significant effect of sitagliptin on renal function ( as measured by estimated gfr ) or tacrolimus or sirolimus levels . additionally , iuppa et al . presented an abstract discussing the use of sitagliptin in solid organ transplant recipients and , although most of the subjects were liver transplant recipients , 18 kidney transplant recipients were reported on with a median followup of all patients ( kidney and liver transplant recipients ) of 178 days . these small trials and a case report of a single kidney transplant recipient treated with sitagliptin for 2.5 years encompass the entire literature available on this subject . our study provides the most person - years of followup of any trial of sitagliptin for the treatment of nodat in kidney transplant recipients . additionally , though retrospective , our study provides the longest followup of any dpp-4 inhibitor used for the treatment of nodat in kidney transplant recipients . limitations of our study include the retrospective nature of our study and the small cohort size . however , large , prospective studies regarding glucose - lowering therapy for nodat do not exist currently ( as reviewed ) and our study represents the largest study to date examining the use of sitagliptin in the setting of nodat after kidney transplantation . our cohort was comprised mostly of caucasian males and steroids were not part of the maintenance immunosuppressant regimen . these factors may limit the ability to generalize our findings . finally , our mean time to diagnosis of nodat ( 56.3 57.7 months after transplant ) was longer than many studies of nodat . this likely reflects that the patients in our cohort had slower , less aggressive development of nodat and did not require insulin therapy . kidney transplant recipients with viable grafts remain at higher risk of diabetes development , a significant portion of the risk being ascribed to immunosuppressant therapy . safe , effective therapies are needed for patients who develop nodat regardless of the timing of the diagnosis , and sitagliptin may be useful for this purpose given the favorable side effect profile and lack of interaction with immunosuppressant medications .", "in conclusion , we have shown that , in a small cohort of kidney transplant recipients who developed nodat , sitagliptin was efficacious as a single agent or in combination with other glucose - lowering medications . sitagliptin was also well tolerated and renal function and immunosuppressant levels and dosing were stable during 12 months of therapy . sitagliptin may be valuable as a first - line agent in kidney transplant recipients diagnosed with nodat who are candidates for oral therapy ." ]

[ "substantial improvement in survival of people living with hiv has been observed with the introduction of antiretroviral therapy ( art ) in sub - saharan africa . however , the introduction of art has led to new immune - mediated complications from dysfunction of the recovering immune system , termed immune reconstitution inflammatory syndrome ( iris ) . in patients with cryptococcal meningitis ( cm ) , a very common opportunistic infection in sub - saharan africa , iris is a frequent complication that is most often associated with exaggerated inflammatory responses in the central nervous system . although cm remains the most common cause of adult meningitis in the overall population in sub - saharan africa , there are only a few recognized , reported cases of gastrointestinal ( gi ) involvement with cryptococcus in the literature . an hiv - infected patient on art with a history of recent cm presented with chronic abdominal pain , thickened ileum , and abdominal lymphadenopathy . he was initially treated for abdominal tuberculosis ( tb ) but later , he was shown to have a histologically confirmed cryptococcoma in the ileum . the major objective of this case report is to highlight the challenges in diagnosis and management of intra - abdominal cryptococcosis , especially in the setting of recent initiation of art .", "a 37 year old hiv - positive male was initially diagnosed and treated for cm in may of 2009 with amphotericin induction therapy for 2 weeks followed by fluconazole 400 mg / day . he had a protracted hospital course lasting 4 weeks because of persistently high intracranial hypertension despite sterilization of his cerebrospinal fluid , and he , required repeated therapeutic lumber punctures . he started art ( zidovudine , lamivudine , and efavirenz ) on the 11th june 2009 with a baseline cd4 count of 5 cells/l . at day + 21 of art , he reported abdominal pain with hypogastric tenderness that was empirically treated as urinary tract infection with a 5 day course of ciprofloxacin , and he noted some improvement . his cd4 count at the time had risen to 29 cells/l . at day + 35 of art , his general exam was unremarkable , except for a tachypnea of 28 breaths per minute . the patient was managed as a possible atypical pneumonia with doxycycline , and his respiratory symptoms improved . however , the abdominal pain persisted intermittently with occasional vomiting . at day + 84 of art and in view of the persistent abdominal pain and an occasional dry cough , another chest radiograph was performed to exclude tb , which was also unremarkable . at this time , his cd4 was only 14 cells/l , and the hiv-1 viral load was 22,000 copies / ml . he reported 100% adherence to his art , and pill counts verified his adherence . at day + 112 of art , the patient still had similar complaints of abdominal pain and occasional vomiting . repeat cd4 was 8 cells/l , and the viral load was minimally decreased at 15,475 copies / ml . the patient initially declined an ultrasound - guided biopsy but consented to the procedure at day + 140 of art . this second ultrasound revealed a thickened ileum up to 6 mm , with adjacent 1 cm lymph nodes . two biopsy specimens from the lymph nodes demonstrated no abnormality at histology . at day + 168 , the patient still had the same complaints with almost unchanged cd4 of 24 cells/l and viral load of 23,755 copies / ml . he was presumed to be failing art , possibly due to poor absorptive surface because of the thickened gut wall . a decision was made to initiate empiric anti - tb treatment for possible gastrointestinal tb . after one week of tb empiric therapy , the patient presented with an acute abdomen , having signs of focal peritonitis in the right iliac fossa . an upright abdominal radiograph demonstrated evidence of perforation with free air visible under the right hemidiaphram . an emergency laparotomy was performed , revealing fecal matter with purulent fluid , adhesions , pneumoperitonium , and intestinal perforation at 10 cm proximal to the ileocecal junction . the confirmatory histopathology report received 2 weeks later revealed a cryptococcoma in the ileal wall as the cause of the perforation with exuberant inflammation demonstrated by the multinucleated giant cell ( figs . 2 and 3 on hematoxylin and eosin stain and figs . 4 and 5 on periodic acid - schiff stain ) . the patient 's marked clinical improvement after surgery , the lack of any evidence of cryptococcal infection elsewhere in the body especially in the central nervous system and a well formed granuloma formed the basis for the patient 's continuation with maintenance dose of fluconazole 200 mg / day under observation . at this point , his tb medications were stopped and he was switched to second line art with subsequent viral suppression . through december 2014 , he continues to remain in care on second line art without any complaints .", "we have presented a 37 year old hiv positive male , with a history of recent cm who subsequently developed chronic abdominal pain , eventually manifesting as a cryptococcoma of the ileum . after treatment for cm and initiating art , he had presented with chronic abdominal pain and low grade fever without diarrhea . he subsequently developed an intestinal perforation and presented with an acute surgical abdomen requiring bowel resection . we suspected an iris phenomena , in accordance with the patient presentation shortly after initiation of art , recent history of cm , and exuberant inflammation in the granuloma on histology . although , the initial immune recovery coupled with falling hiv-1 viral loads is consistent with iris , the subsequent virological failure makes the diagnosis of paradoxical iris less clear . in cryptococcosis , ideally , intra - operative cultures would have been performed which could have helped distinguish iris from cryptococcal relapse , based on culture sterility vs. growth , respectively . cryptococcus organisms can be acquired in the gut primarily through hematogenous dissemination or less commonly through direct inoculation during paracentesis or via a neurosurgical shunt . the presentation in these gi cases of cryptococcal infection is usually vague , as seen in our patient , with subacute fevers , constitutional symptoms , asthenia , and anorexia . virtually every intra - abdominal organ has been reported to be affected by cryptococcal infection . the diagnosis of gi cryptococcosis requires a high index of suspicion , yet as in this case , clinicians may often initially focus on other common etiologies in immunocompromised persons , such as tb . although abdominal tb was found to be the most common diagnosis in patients with hiv / aids presenting with chronic abdominal pain and abdominal lymphadenopathy , these studies were conducted predominantly in persons without cryptococcosis . among persons with a known pre - existing opportunistic infection , such as cm , the pre - test probability changes as paradoxical iris enters into the differential diagnosis . in our case , the characteristics of granulomas found in hiv - infected persons varies depending on whether or not they are receiving art . in pulmonary cryptococcomas , persons not receiving art demonstrate yeast proliferation with a histiocytic response but only minor lymphocytic and neutrophilic components . conversely , cryptococcal granulomas in persons on art are characterized by the presence of cd4 t cells , greater response of histiocytes , and multinucleated giant - cell formation , as demonstrated in our patient . there is a paucity of evidenced - based data for the management of cryptococcomas . in our case , the initial abdominal lymph node biopsy ( 5 weeks prior to the perforation ) did not reveal a diagnosis . the question raised is , if we had confirmed the diagnosis of gi cryptococcoma before the perforation , would we have been able to effectively intervene . to answer this question , it might be important to know if the cryptococcoma were due to iris or cryptococcal relapse . could the patient have benefited from immunosuppressive therapy to treat iris and perhaps , avoid the perforation , or would more enhanced fungal therapy be needed to eradicate the cryptococcus ? two case reports have described cryptococcomas due to paradoxical iris ; one in the brain and the other in the retroperitoneal abdomen . in both cases , they simply observed the patients but also emphasized the importance of confirming sterility of contents in the cryptococcoma by culture . in a case report by katchanov et al . , a similar presentation of a central nervous system cryptococcoma was initially treated with antifungals exclusively with radiological worsening until steroids were added to direct therapy at paradoxical iris . we have previously reported the challenges and dangers of using corticosteroids for cm because they may be contraindicated in cases of fluconazole - resistant cryptococcal relapse . surgery , corticosteroids , and interferon - gamma have been tried in iris - like cryptococcomas due cryptococcus gattii \n . empiric tb therapy , including rifampin , could have induced the metabolism of fluconazole , possibly lowering plasma levels by ~50% . these lower levels may have removed the fungistatic control of the cryptococcus , precipitating the perforation . however , after the surgery , the patient was observed on secondary prophylaxis doses of fluconazole , and he did well . to treat a cryptococcoma in the setting of recent initiation of art , where iris versus relapse can not be determined due to the absence of culture results , treatment with a combination of enhanced antifungal therapy and anti - inflammatory therapy gi cryptococcosis has been described as a rare occurrence , with only a few published case reports . we have discussed an hiv - infected patient with profound immunosuppression and recent cm who developed a gi cryptococcoma during initial immune recovery followed by virological failure after initiation of art . the cryptococcoma was not identified and he developed perforation of the ileum , requiring surgery . we anticipate that with the roll out of art in sub - sahara africa , we are bound to see rare presentations of some of common conditions such as cm . we recommend that health workers have a high index of suspicion for unusual complications of opportunistic infections in the setting of art - associated iris . often treatment of iris requires only observation or anti - inflammatory drugs , but the presence of active infection needs to be excluded .", "the authors declared no potential conflicts of interest with respect to the research , authorship , and/or publication of this article ." ]

[ "dermatophytosis is a common clinical entity characterized by the infection of keratinized tissues such as skin , hair , and nails . these dermatophytes are closely related filamentous fungi and cause the disease by virtue of their unique ability to degrade keratin and invade the skin and its appendages . dermatophytic infections are of major importance , as they are widespread and cause discomfort . reactions to dermatophyte infection may range from mild to severe . the mildness and severity depend on a variety of factors such as the host reactions to the metabolic products of the fungus , the virulence of infecting species or particular strain , anatomical location of the infection and local environmental factors . dermatophytic infections are a common clinical problem encountered in more than 50% of patients attending the dermatology outpatient departments . overcrowding , poor hygiene , low standards of living along with high humidity environments are contributing to the increased prevalence of these fungal infections . the present study was conducted to know the prevalence , etiology and common clinical presentations of dermatophytosis involving skin and hair .", "a total of 110 samples which included 101 skin samples and 9 hair samples , from clinically suspected to have dermatophytosis were collected . a detailed history regarding age , sex , occupation , social status , duration of complaint and others were taken . samples were collected after cleaning the affected surface with 70% alcohol . from skin lesions , scales were collected from erythematous growing margins of the lesion with a sterile blunt scalpel , and in case of tinea capitis , hairs were plucked with sterile surgical forceps . samples were collected in sterilized whatman filter paper envelope and transported to the microbiological laboratory . direct examination of fungal elements from skin scales and hair samples was done by using 10% and 20% koh mounts respectively . all the samples were cultured on sabouraud 's dextrose agar ( sda ) with gentamicin and cycloheximide ( sda with actidione ) and dermatophyte test medium ( dtm ) ( hi - media ) . fungal growth was identified by colony morphology ; pigment production and microscopic examination by tease mount technique in lactophenol cotton blue . urease test and in - vitro hair perforation tests were also performed to differentiate trichophyton rubrum and trichophyton mentagrophytes when there was difficulty in identification by microscopic and macroscopic examination .", "samples were collected after cleaning the affected surface with 70% alcohol . from skin lesions , scales were collected from erythematous growing margins of the lesion with a sterile blunt scalpel , and in case of tinea capitis , hairs were plucked with sterile surgical forceps . samples were collected in sterilized whatman filter paper envelope and transported to the microbiological laboratory .", "direct examination of fungal elements from skin scales and hair samples was done by using 10% and 20% koh mounts respectively . all the samples were cultured on sabouraud 's dextrose agar ( sda ) with gentamicin and cycloheximide ( sda with actidione ) and dermatophyte test medium ( dtm ) ( hi - media ) . fungal growth was identified by colony morphology ; pigment production and microscopic examination by tease mount technique in lactophenol cotton blue . urease test and in - vitro hair perforation tests were also performed to differentiate trichophyton rubrum and trichophyton mentagrophytes when there was difficulty in identification by microscopic and macroscopic examination .", "all the samples were cultured on sabouraud 's dextrose agar ( sda ) with gentamicin and cycloheximide ( sda with actidione ) and dermatophyte test medium ( dtm ) ( hi - media ) . fungal growth was identified by colony morphology ; pigment production and microscopic examination by tease mount technique in lactophenol cotton blue . urease test and in - vitro hair perforation tests were also performed to differentiate trichophyton rubrum and trichophyton mentagrophytes when there was difficulty in identification by microscopic and macroscopic examination .", "males were more predominant 74 ( 67.27% ) compared to females 36 ( 32.73% ) . more number of cases were observed between age groups of 2140 years 71 ( 64.54% ) [ table 1 ] . clinical presentations of dermatophytosis observed were tinea corporis 44 ( 40% ) , followed by t. corporis with cruris 28 ( 25.45% ) , tinea cruris 10 ( 9.09% ) , tinea capitis 9 ( 8.19% ) , tinea faciei 7 ( 6.36% ) , tinea manuum 6 ( 5.45% ) , tinea pedis 5 ( 4.55% ) and tinea barbae 1 ( 0.91% ) . t. corporis and t. corporis with cruris were more common in the age groups of 2140 years . age- and sex - wise distribution of cases fungal elements by koh mount were observed in 64 ( 58.18% ) and culture was positive in 62 ( 56.36% ) . of 64 ( 58.18% ) koh positive cases 55 ( 85.9% ) yielded growth in culture . among koh negative 46 ( 41.82% ) cases , 7 ( 15.2% ) were culture positive . culture positivity was highest in t. corporis ( 38.71% ) and no culture positivity was noted in tinea barbae and tinea pedis . dermatophytic species isolated were t. rubrum 58.06% [ figure 1 ] , t. mentagrophytes 22.58% [ figure 2 ] , epidermophyton floccosum 6.45% [ figure 3 ] , trichophyton violaceum 6.54% [ figure 4 ] , trichophyton tonsurans 3.22% [ figure 5 ] and trichophyton schoenleinii 3.22% [ figure 6 ] . \n ( c ) lacto phenol cotton blue mount showing tear drop shaped microconidia ( 400 ) . ( d and e ) lacto phenol cotton blue mount showing pencil shaped macroconidia ( 400 ) \n trichophyton mentagrophytes . ( d ) lacto phenol cotton blue mount showing nodular organ ( 400 ) \n epidermophyton floccosum . ( c and d ) lacto phenol cotton blue mount showing club shaped macroconidia ( 400 ) . ( e ) lacto phenol cotton blue mount showing characteristic chlamydospores ( 400 ) \n trichophyton violaceum . ( a ) growth on sabouraud 's dextrose agar ( obverse with violet color pigmentation ) . ( b ) lacto phenol cotton blue mount showing hyphae with chains of chlamydospores ( 400 ) trichophyton tonsurans . ( d ) lacto phenol cotton blue mount showing match stick like microconidia ( 400 ) . ( e ) lacto phenol cotton blue mount showing macroconidia ( 400 ) \n trichophyton schoenleinii . lacto phenol cotton blue mount showing antler hyphae and chlamydospores ( 400 ) t. rubrum was predominantly recovered in each clinical presentation but t. violaceum was the most common isolate in tinea capitis , followed by t. rubrum , t. tonsurans and t. schoenleinii [ table 2 ] . dermatophyte species causing different clinical presentations all culture positives were grown both on sda with actidione and dtm on primary isolation . on dtm first appearance of growth was within 10 days of inoculation for most of the isolates that is , 56 ( 90.32% ) [ figure 7 ] . but , the appearance of growth was only after 10 days for most of the isolates when grown on sda with actidione 57 ( 91.94% ) . species level identification on primary isolation was possible for 42 ( 67.74% ) of culture positives when grown on sda with actidione . but , no culture positive was identified up to species level from dtm on primary isolation . ( f ) trichophyton violaceum \n among culture positive cases 19.35% were from rural area , and 80.65% were from urban area and 67.74% were from low socio - economic status , 30.65% were from middle socioeconomic status and 1.61% were from high socioeconomic status . in this study , 8.06% of patients were diabetics , 6.45% were anemic , 3.23% of patients had a history of atopy and 1.61% were hiv positive . use of occlusive or synthetic fabric dressing regularly was there in 40.32% of patients and 32.25% of patients were in contact with soil regularly because of their occupation .", "all culture positives were grown both on sda with actidione and dtm on primary isolation . on dtm first appearance of growth was within 10 days of inoculation for most of the isolates that is , 56 ( 90.32% ) [ figure 7 ] . but , the appearance of growth was only after 10 days for most of the isolates when grown on sda with actidione 57 ( 91.94% ) . species level identification on primary isolation was possible for 42 ( 67.74% ) of culture positives when grown on sda with actidione . but , no culture positive was identified up to species level from dtm on primary isolation . ( f ) trichophyton violaceum \n among culture positive cases 19.35% were from rural area , and 80.65% were from urban area and 67.74% were from low socio - economic status , 30.65% were from middle socioeconomic status and 1.61% were from high socioeconomic status . in this study , 8.06% of patients were diabetics , 6.45% were anemic , 3.23% of patients had a history of atopy and 1.61% were hiv positive . use of occlusive or synthetic fabric dressing regularly was there in 40.32% of patients and 32.25% of patients were in contact with soil regularly because of their occupation .", "in this study , highest incidence of dermatophytosis was observed in the age group of 2140 years and in males . this may be due to greater physical activity and increased sweating in this age group favoring the growth of dermatophytes . t. corporis , followed by t. corporis with cruris were common clinical presentations of dermatophytosis in the present study which was in correlation with other studies from india . t. capitis was more common in children below the age group of 10 years , which was also observed in some studies . t. rubrum was the most common dermatophyte to cause all clinical types of dermatophytoses followed by t. mentagrophytes . chronic nature of infection and adaptation to human is mainly responsible for predominance of t. rubrum to cause dermatophytosis . t. violaceum was predominant species to cause tinea capitis , followed by t. rubrum , t. tonsurans and t. schoenleinii . culture positivity was more in koh positive cases 85.9% compared to koh negative cases 15.2% . this difference is statistically significant = 55.29 ; p < 0.001 , this shows that direct microscopy by koh mount is a good screening test in the laboratory diagnosis of dermatophytosis . efficacy of sda with actidione and dtm in isolation of dermatophytes is equal in the present study . this was in correlation with the study of singh and beena who reported that 96.55% of culture positives were grown on sda and 98.3% of culture positives were grown on dtm . but dermatophytes grow earlier on dtm compared to sda with actidione . in the present study even though all 62 culture positive samples yielded growth both on sda with actidione and dtm on primary isolation , appearance of growth was earlier on dtm that is , within 10 days ( 90.32% ) compared to sda with actidione ( 8.06% ) . for species level identification of dermatophytes , sda with actidione is preferable compared to dtm . in the present study , species level identification was possible for 67.74% of isolates on primary isolation on sda with actidione . but species level identification was not possible with the growth on dtm on primary isolation , as conidial production was low on dtm , which is required for identification . moreover , it was not possible to observe pigment production on dtm . for identification of growth on dtm , dermatophytic infections were more common in people living in urban areas ( 80.65% ) compared to rural areas ( 19.35% ) . this may be because the study included patients attending the outpatient department of dermatology of tertiary care teaching hospital , where most of the people were from the urban area . high incidence of dermatophytic infections was observed in the low socioeconomic group of people ( 67.74% ) . this is because of unhygienic living conditions , overcrowding , illiteracy and poor nutrition among them . daily wage workers ( 35.48% ) and students ( 33.87% ) were predominantly affected compared to others . this could be because of increased physical activity and hot environmental conditions which results in increased sweating and excessive moisture favoring the growth of dermatophytes . this is in correlation with the study of prasad et al . in the present study systemic predisposing factors like diabetes ( 8.06% ) , anemia ( 6.45% ) , atopy ( 3.23% ) , and hiv ( 1.61% ) were observed which are in correlation with other authors . local predisposing factors like occlusive or synthetic fabric dressing in 40.32% and contact with soil regularly because of their occupation in 32.25% were noted .", "dtm is a good screening medium in laboratory diagnosis of dermatophytosis compared to sda with actidione .", "", "" ]

[ "gemcitabine is a modified \n cytidine analog having two fluorine atoms \n at the 2-position in the deoxyribose sugar moiety ( scheme 1 ) . for nearly 20 years , it has been widely used \n to treat specifically pancreatic cancer . it has been proposed that gemcitabine inhibits \n ribonucleotide reductase ( rnr ) activity as well as acting as \n a replication stop , thereby affecting dna synthesis \n and elongation . the two highly electronegative \n f - atoms at c2 substantially increase the acidity of h3 \n through the inductive effect . it is well established \n that in the absence of oxygen , thiyl radicals \n are able to abstract hydrogen ( h ) atoms to form neutral c - centered \n radicals . for example , h - atom abstraction by thiyl radicals has been \n shown to induce isomerization of cis-2,5-dimethyltetrahydrofuran \n to the trans-2,5-dimethyltetrahydrofuran . on this basis , stubbe et al . , in their enzymatic and electron \n spin resonance ( esr ) studies with gemcitabine , have proposed that \n inhibition of the rnr activity by gemcitabine should occur via radical \n formation at the c3 site by direct h - atom abstraction to produce \n a c3 via a enzymatic thiyl radical ( reaction 1 ) . subsequently , the c3 intermediate \n has been proposed to form 3-keto c2 via hf \n loss . this c2 is stabilized by an oxy radical resonance \n contribution ( reaction 2 ) . c2 \n and its immediate precursor c3 ( reactions 1 and 2 ) play a key role in \n the rnr inactivation.12 the h - atom abstraction reaction ( reaction 1 ) is not only important in rnr activation but also \n plays a very key \n role toward stable product formation in other biologically damage \n processes in dna , such as oxidative intrastrand cross - link formation and in the formation of sugar radicals that \n are strand break precursors . it is noteworthy that pulse radiolysis \n experiments with a 1,4-anhydro-5-deoxy-6-thio - d - ribo - hexofuranitol \n detected the formation of ribosyl - based carbon - centered radical(s ) \n after h - atom abstraction by thiyl radicals . these studies are supportive of reactions 1 and 2 but unequivocal , and direct detection \n of c3 and c2 employing esr or pulse \n radiolysis during rnr - catalyzed deoxygenation of the natural substrates or during inactivation by gemcitabine still remains elusive . in this work , we report the formation of c2 from \n a likely c3 in a gemcitabine analog which mimics the \n mechanism proposed above . from the structural formula of gemcitabine \n ( scheme 1 ) , it is expected that the negative \n inductive effect ( i ) of two highly electronegative f - atoms \n at c2 should increase the acidity of h3. from our \n previous work on nucleoside cation radicals , the gemcitabine cation radical formed upon one - electron oxidation \n is expected to produce c3 after deprotonation of the \n acidic proton h3. in this work , esr spectroscopy has been \n employed to investigate one - electron oxidation of gemcitabine and \n other 2-modified derivatives , for example , 2-deoxy-2-fluoro-2-c - methylcytidine ( mefdc ( psi-6130 ) ; scheme 2 ) and 2-fluoro-2-deoxycytidine ( 2-fdc , scheme 2 ) , in order to test the influence of 2- \n substituent on radical site formation . it is noteworthy that mefdc \n is a well - known clinically efficacious inhibitor of hepatitis c virus . the esr results clearly identify the c3 formation \n in one - electron oxidized gemcitabine and the production of c2 \n in one - electron oxidized mefdc . these calculations show \n that in the case of one - electron oxidized mefdc , the lowest energy \n path is the rapid formation of c2 from c3 \n via f loss . this f loss is a \n barrierless reaction between the 2-f - atom and the proximate \n h3o which was formed via deprotonation of h3 \n in the cation radical .", "gemcitabine ( scheme 1 ) and 2-fdc \n ( scheme 2 ) were obtained \n from carbosynth ltd . mefdc ( scheme 2 ) was prepared as described or \n purchased from adooq bioscience ( irvine , ca ) . lithium chloride ( licl ) ( ultra \n dry , 99.995% ( metals basis ) ) was \n obtained from alfa aesar ( ward hill , ma , usa ) . 2-deoxycytidine \n ( 2-dc ) was obtained from sigma chemical company ( st louis , \n mo , usa ) . deuterium oxide ( d2o ) ( 99.9 atom % d ) was purchased \n from aldrich chemical co. inc . ( paris , ky , usa ) . cytidine-5,6-d2 ( [ 5,6-d , d]-cyd , 99 atom % d ) was purchased from cdn isotopes ( quebec , \n canada ) . homogeneous solutions \n of gemcitabine were prepared by dissolving 210 mg / ml either \n in 7.5 m licl in d2o or in h2o . solutions of \n other compounds ( 2-dc , 2-f - dc , mefdc , and [ 5,6-d , d]-cyd ) \n were prepared by dissolving ca . k2s2o8 ( 616 \n mg / ml ) was added as an electron scavenger so that only the formation \n of the one - electron oxidized species and its subsequent reactions \n can be followed by employing esr spectroscopy . the above - mentioned \n procedure for preparation of solutions is according to our ongoing \n studies on various model systems of dna and rna . the ph of gemcitabine in 7.5 m licl / d2o was adjusted to the range of ca . the ph of gemcitabine in 7.5 m licl / h2o \n and the ph of other compounds ( 2-dc , 2-f - dc , mefdc , \n and [ 5,6-d , d]-cyd ) in 7.5 m licl / d2o was adjusted at ph \n ca . 10 . these ph adjustments were performed by adding l amounts \n 1 m naoh as per our previous efforts . these solutions have high ionic strength ( 7.5 m licl ) ; therefore , \n the ph meters would not provide accurate ph measurements of these \n solutions . instead , as per our previous works , ph values reported in this work were obtained using ph papers and \n are approximate measurements . as \n per our previous works , these ph - adjusted homogeneous solutions were thoroughly bubbled \n with nitrogen to remove the dissolved oxygen . immediately , these solutions \n were drawn into 4 mm suprasil quartz tubes ( catalog no . buena , nj , usa ) and were rapidly cooled in \n liquid nitrogen ( 77 k ) . the rapid cooling of these homogeneous liquid \n solutions at 77 k leads to the formation of transparent homogeneous \n glassy solutions . these glassy solutions were later used for the irradiation \n and subsequent progressive annealing experiments . all glassy samples \n were stored at 77 k in teflon containers in the dark . all samples \n were ( co)-irradiated ( absorbed \n dose = 1.4 kgy ) at 77 k and stored at 77 k in teflon containers in \n dark following our previous efforts . a variable - temperature \n assembly was employed which passed liquid nitrogen cooled nitrogen \n gas past a thermister and over the sample as described in our earlier \n studies . the glassy samples have been \n annealed anywhere from ( 140170 ) k for 15 min . annealing leads \n to one - electron oxidation of the solute by the matrix radical cl2 thus , forming only the cation \n radical of the solute , e.g. , gemcitabine . following our earlier studies , immediately after -irradiation of the glassy sample at 77 \n k , the esr spectrum was recorded at 77 k. also , immediately after \n each annealing step , the sample was cooled to 77 k by immersing in \n liquid nitrogen ( 77 k ) , and the esr spectrum was recorded at 77 k \n which maximizes signal height and allows for comparison of signal \n intensities . a varian century series x - band ( 9.3 ghz ) esr spectrometer \n with an e-4531 dual cavity , 9 in . magnet , and a 200 mw klystron was \n used , and fremy s salt ( gcenter = 2.0056 , a(n ) = 13.09 g ) was employed for the \n field calibration . all esr spectra have been recorded at 77 k and \n at 40 db ( 20 w ) . anisotropic simulations of esr spectra \n have been performed using the win - epr and simfonia programs of bruker \n as per our previous works . the simulated spectra thus obtained \n were compared to experimental spectra , and esr parameters were adjusted \n for the best fit ( also supporting \n information figure s3 ) . gaussview and jmol programs were used to plot the spin densities \n and molecular structures . the geometries of all the radicals considered \n in the present study were fully optimized using the b97x functional and 6 - 31g(d ) basis set . we note here that b97x \n functional was developed by the group of head gordon and found \n to be very successful for the calculations of various properties of \n molecules in their different spin states . the hyperfine coupling constants ( hfccs ) of the radicals were calculated \n using the same method and basis set , i.e. , b97x/6 - 31g(d ) in \n the gas phase . in order to treat the effect of solvent on hf loss \n from the c3 in gemcitabine and in mefdc , we employ \n the integral equation formalism polarized continuum model ( ief - pcm ) as implemented in gaussian 09 . in \n addition to pcm , for c3 in both systems a h3o is placed in the vicinity of the c3-oh bond \n for c3 in gemcitabine and for c3 in \n mefdc and have optimized the structures . the electronic energy profile \n of f dissociation from c2 site of c3 \n in mefdc as well as the electronic energy profile of f dissociation for each of the two f - atoms from c2 site of \n c3 in gemcitabine were obtained in the presence of \n a single water molecule at the same level of theory ( supporting information figure s4c , d ) . furthermore , employing \n the wb97x/6 - 31++g(d , p ) method along with the ief - pcm model for the \n solvent effect , the pka of the c3-oh \n group for the c3 of gemcitabine and also of the c3-oh \n group for the c3 of 2-dc was calculated .", "in figure 1a , we show the experimentally recorded ( 77 k ) esr spectrum \n ( green ) of one - electron oxidized gemcitabine at ph ( pd ) ca . 7 in a \n homogeneous glassy 7.5 m licl / d2o solution . the one - electron \n oxidation of gemcitabine was induced by cl2 attack after annealing at 155 k in the dark . 912 showed identical spectra after \n one - electron oxidation of gemcitabine by cl2 on annealing at 150155 k. thus , only the spectrum \n obtained from the gemcitabine sample at pd ca . 10 is presented in \n figure 1b along with the simulated spectrum \n in blue . it is evident from figure 1a , b , the \n line shape , total hyperfine splitting , and the center of the simulated \n spectra match with those of the experimentally recorded spectra quite \n well . each of the spectra in figure 1a , b show \n two anisotropic -f - atom hyperfine couplings and a -h - atom \n hyperfine coupling . the -h - atom hyperfine coupling creates \n the doublet splitting in the line components in figure 1a , b . figure 1a is best matched \n with a simulation \n employing the two different anisotropic -f - atom ( nuclear spin \n = 1/2 ) hfcc values of ( 15.0 , 15.0 , 105 ) g and ( 15.0 , 15.0 , 69.0 ) g , \n one -h hfcc as ( 15.0 , 15.0 , 24.0 ) g , gxx , gyy , gzz ( 2.0080 , 2.0050 , 2.0020 ) along with a mixed ( lorentzian / gaussian \n ( 1:1 ) ) line - width of 14 g. the simulated spectrum in blue is superimposed \n on the experimentally recorded spectrum in figure 1a . on the other hand , the best fit for figure 1b is obtained employing the two identical anisotropic -f - atom \n ( nuclear spin = 1/2 ) hfcc as ( 17.0 , 17.0 , 86.0 ) g , one -h hfcc \n as ( 15.0 , 15.0 , 24.0 ) g , gxx , gyy , gzz ( 2.0060 , 2.0050 , \n 2.0020 ) along with a mixed ( lorentzian / gaussian ( 1:1 ) ) line - width \n of 10 g. following our work on the radicals produced in monomers \n of dna \n and rna , the a ( i.e. , \n the azz ) component of each of the two \n anisotropic -f - atoms ( see table 1 ) as \n well as the a of the -h are directly measured \n from the width of the experimentally recorded spectra with an uncertainty \n of 2 g ( see supporting information figure s3 ) . on the other hand , the theoretically obtained values \n of axx and ayy components of each of the two anisotropic -f - atoms and of the \n -h - atom in table 1 were adjusted to \n fit the experimentally recorded spectra with estimated uncertainty \n of 4 g ( see supporting information figure s3 ) . 7 show two nonequivalent anisotropic -f - atom hfccs , whereas , \n the one - electron oxidized gemcitabine spectrum at ph ca . the -h - atom \n hfcc does not show any observable change in the one - electron oxidized \n gemcitabine spectrum throughout the ph range ca . the coupling to two -f - atoms ( c2 ) and one -h - atom \n ( c4 ) is clear evidence for the generation of c3 \n after one electron oxidation of gemcitabine at 150155 k. the \n electron - withdrawing effect of the two electronegative f - atoms at \n c2 increases the acidity of h3 , which leads to deprotonation \n ( see supporting information table t2 ) and \n prevents observation of the initially formed cytosine base -cation \n radical ( c ) in gemcitabine as indicated in reaction 3 . therefore , the mechanism of c3 \n formation due to one - electron oxidation of gemcitabine is proposed \n as follows : one - electron oxidation of gemcitabine results in the formation \n of metastable c , which is unstable even at ca . \n 155 k. the metastable c quickly deprotonates at \n c3 in the sugar moiety producing c3 ( reaction 3 ) via a proton - coupled electron - transfer ( pcet ) mechanism.3 esr \n spectra obtained from matched gemcitabine samples [ concentration \n of gemcitabine in each sample = 2 mg / ml in 7.5 m licl / d2o ] in the presence of the electron scavenger k2s2o8 ( 8 mg / ml in each sample ) . each sample has been -irradiated \n ( absorbed dose = 1.4 kgy at 77 k ) , subsequently annealed to 155 k \n for 15 min in the dark at various phs ( a ) ph ca . 7 ( green ) and ( b ) \n ph ranging ca . 912 ( pink ) . here the blue spectra that are superimposed on the experimentally \n recorded spectra are the simulated spectra of c3. \n see text for the details of simulation . all esr spectra are recorded \n at 77 k. the three reference markers ( open triangles ) in this figure \n and in the subsequent figures show the position of fremy s \n salt resonance with the central marker at g = 2.0056 . the spacing \n separating the markers is 13.09 g. as is evident from the hfcc \n values of the spectra shown in figure 1 and \n also in table 1 , the ph of the solution clearly \n affects the individual -f - atom anisotropic hfcc but not the \n sum of the two -f - atom anisotropic hfcc along with the c4 \n -proton hfcc ( see section above ) . at ph ca . 912 , the two -f - atom anisotropic hfccs \n are equivalent ; whereas , at ph ca . 7 , the sum of the two -f - atom \n anisotropic hfccs remain the same , but they individually differ . the presence of two 2-f - atoms in gemcitabine will lower the \n pka value of both h3 and c3-oh \n hydrogens . for example , the oh in 2,2-difluoroethanol has its pka lowered by 3.5 units in comparison with ethanol . further , radical formation has also been shown \n to lower the pka of the alcoholic oh group \n ( e.g. , pka ( ch3)2choh = 17.1 , pka ( ch3)2coh = 12.03 ) . based on \n these factors , the pka value of the c3-oh \n group for c3 in gemcitabine is estimated to be in \n the range of 79 . employing dft/b97x/6 - 31++g(d , p ) method \n along with the ief - pcm model for the solvent effect , the pka value of the c3-oh group for c3 \n in 2-dc has been calculated as 14.2 . the same level of calculation \n for the c3-oh group of c3 in gemcitabine which \n replaces each of the two hydrogens at c2 with fluorine predicts \n a pka of 6.8 ( see supporting information pages s8 , s9 ) . therefore , the two 2-f - atoms \n are predicted to lower the pka of the \n c3-oh group in c3 by 7 full units . considering \n the sensitivity of the calculations for predicting pka to the small changes in free energy , these results are very reasonable . furthermore , the theoretically \n calculated pka value 6.8 of the c3-oh \n group for c3 in gemcitabine is in good agreement with \n its experimentally estimated value ( 79 ) . the spectrum \n in figure 1a ( ph ca . 7 ) should \n therefore be for c3 in gemcitabine with a c3-oh \n group and the spectrum in figure 1b ( ph ca . \n 912 ) should be for c3 with the deprotonated \n group , i.e. , c3-o ( reaction 4 ) . thus , we attribute the variation of the two -f - atom \n anisotropic hfcc to the deprotonation of the c3-oh group at \n higher phs.4 esr spectral studies \n of one - electron oxidation of gemcitabine in h2o glasses \n ( 7.5 m licl / h2o ) were performed and compared with the results \n found in d2o glasses ( 7.5 m licl / d2o ) . no observable difference in spectra other than a small \n line broadening was observed on formation of c3 in \n h2o glasses versus in d2o glasses . since c3 \n only has the c3-oh as an exchangeable proton at ph 7 and this \n does not contribute to a significant hyperfine coupling , the esr spectrum \n found on formation of c3 is not altered by a change \n of the solvent from d2o to h2o . similar experiments to those performed for gemcitabine \n were carried out for the methyl / fluoro analog mefdc ( scheme 2 ) . using mefdc , we investigated whether the formation \n of c3 observed in gemcitabine bearing geminal difluoro unit at c2 ( figure 1 ) is \n affected by the substitution of one of the f - atoms ( i ) with \n a methyl ( me ) group ( + i ) . ( a ) esr spectrum ( black ) obtained from mefdc [ concentration \n = 2 \n mg / ml in 7.5 m licl / d2o ] in the presence of the electron \n scavenger k2s2o8 ( 8 mg / ml ) , ph ca . \n 10 , -irradiated to a dose of 1.4 kgy at 77 k and subsequently \n annealed to 155 k for 15 min . ( c ) \n spectrum ( black ) obtained after subtraction of 60% of spectrum ( b ) \n from spectrum ( a ) . for comparison , the c spectrum \n ( blue ) in 2-dc ( supporting information figure s2 and pp s3s5 ) is superimposed . ( d ) spectrum ( black ) \n assigned to c2 is obtained after subtraction of 50% \n of spectrum ( c ) from spectrum ( a ) . the simulated c2 \n spectrum ( for simulation parameters see figure 2 and text ) is superimposed \n on the experimentally isolated spectrum for comparison . all the spectra \n are recorded at 77 k. shown in figure 2a is the esr spectrum \n ( black ) \n of a matched sample of mefdc that has been -irradiated ( absorbed \n dose = 1.4 kgy ) , subsequently annealed to 155 k for 15 min in the \n dark , and recorded at 77 k. figure 2b \n was obtained by annealing this \n sample for 15 min to 170 k. comparison of spectrum 2a with spectrum \n 2b shows clearly that a central doublet decreases along with an increase \n of the other line components upon annealing . therefore , the central \n doublet ( black ) shown in figure 2c is isolated \n by subtraction of 60% of the spectrum 2b from \n spectrum 2a . the doublet due to c spectrum ( blue ) in 2-dc ( see supporting information figure s2 and its discussion ( pp s3s5 ) ) \n is superimposed on it for comparison . from the spectral similarities \n of both doublets , the doublet in black shown in figure 2c subtraction \n of 50% c spectrum 2c ( black ) from \n spectrum 2a results in the black spectrum shown in figure 2d . this overall quintet spectrum arises from 4 isotropic \n -proton couplings : three methyl -protons ( ca . 25.5 g due to a -proton \n assigned to the c1-h ( vide infra ) . the experimental ( black ) \n spectrum is simulated using the above - mentioned hfcc values along \n with a 10 g line - width and g - value = 2.0033 ( this g - value is typical for c - centered sugar radicals ) . the simulated spectrum ( red ) in figure 2d \n matches the overall line components of the experimental spectrum well . \n since the c2 ( reaction 5 ) is \n the only likely radical structure that would explain the large hyperfine \n coupling to a methyl group and the additional -proton hyperfine \n coupling ( assigned to c1 ) , the experimental spectrum in figure 2d has been assigned to c2 ( reaction 5 ) . the spectra 2a and 2b are a composite of c ( black , \n figure 2c ) and c2 ( black , figure 2d ) in different amounts . under the same constant \n gain and constant microwave power and upon gradual and stepwise annealing \n of the sample from 155 k ( spectrum 2a ) to 170 k ( spectrum 2b ) , no \n loss of spectral intensity was observed , and our analyses show an \n additional ( ca . 20% ) conversion of the c to c2. consideration of the results presented in figures 1 and 2 suggest that for mefdc , c is produced first and on annealing converts to a transient \n c3 , which is not observed . in contrast , the line shape , \n line width , and the overall hyperfine splitting of the c3 \n spectrum in gemcitabine do not change upon annealing to ca . thus , unlike \n the rapid conversion of c3 to c2 found \n in one - electron oxidized mefdc , a similar conversion of c3 \n to c2 is not observed for one - electron oxidized gemcitabine \n at these low temperatures . the lack of observation of the transient \n c3 in one - electron oxidized mefdc and the low temperatures \n employed in these experiments implies a very low activation barrier \n for the conversion of c3 to c2 ; whereas , \n the activation barrier for the conversion of c3 to \n c2 for one - electron oxidized gemcitabine should be \n 4 kcal / mol . calculations suggest that the proximity of the \n lost h3 proton as h3o to the 2-f - atom \n quite likely provides the driving force for this rapid unimolecular \n reaction ( see figure 3 ) . therefore , we propose \n that c3 in one - electron oxidized mefdc readily converts \n to c2 via a barrierless f loss \n ( see reaction 5 , figure 3 , and supporting information s5 ) . the b97x/6 - 31g(d ) \n calculated hfccs of c3 and c2 found \n in gemcitabine and in mefdc along with experimental hfccs ( in gauss ) \n are presented in table 1 . it is evident from \n table 1 that experimental and theoretically \n calculated hfccs are in reasonably good agreement . estimated errors are of 2 g for \n azz and 4 g for axx and also for ayy . calculated in the presence \n of one \n water molecule only isotropic \n hfcc values have \n been considered . to explore the reaction mechanism of c2 \n formation from c3 in one - electron oxidized mefdc and \n gemcitabine , using the dft b97x/6 - 31g(d ) method , we considered \n three possible reaction paths : ( i ) hf loss due to deprotonation of \n 3-hydroxyl group , ( ii ) hf loss due to fluorine dissociation , and additionally , ( iii ) hf loss in the presence of a hydronium ion \n ( h3o ) . the electronic energy profile \n of hf loss from c3 in mefdc and also from c3 \n in gemcitabine in the presence of a water molecule is shown in figure \n s4 in the supporting information . from supporting information figure s4a , it is evident \n that for c3 of mefdc , the formation of c2 \n via hf loss with deprotonation of 3-oh has a significant barrier \n of ca . 18 kcal / mol . for c3 in gemcitabine , the hf \n loss associated with deprotonation of 3-hydroxyl group was \n calculated to be ca . we have also considered the dissociation of \n fluorine in c3 \n of mefdc and in c3 of gemcitabine and found that stretching \n the c2-f bond up to 1.8 needs ca . this shows that dissociation of fluorine for c3 in \n mefdc occurs at lower energy than dissociation of fluorine for c3 \n in gemcitabine ( supporting information figure \n s4 ) . alternatively , we consider the fact that deprotonation \n of h3 \n will form h3o initially in close proximity \n of the c2-c3 bond which may then induce hf loss ( reaction 5 ) . employing the b97x/6 - 31g(d ) method and \n considering the full solvent effect through the polarized continuum \n model ( pcm ) , this mechanism have been modeled by placing a h3o in the vicinity of the c3-oh bond for c3 \n in gemcitabine and for c3 in mefdc and have optimized \n the structures . from our calculations , we have observed that for c3 \n in gemcitabine , a minimum structure exists in the electronic energy \n profile in which the h3o stabilizes the f-atom \n through forming a hydrogen bond ( 1.57 ) ( see figure 3a and supporting information figure s4c ) . a second minimum structure was also found in the electronic \n energy profile in which the h3o stabilizes \n the f-atom through forming a hydrogen bond of identical length , \n 1.57 ( see supporting information figure s4d ) . a barrier of 5 kcal / mol and the overall reaction energy \n of 7 to 8 kcal / mol were found for hf formation in \n both cases ( see figure 3a and supporting information figures s4c , d ) . however , for c3 \n in mefdc , the h3o reacts with the 2-f - atom \n without a barrier and forms hf and c2 ( see figure 3b ) . the bond distances of c3-o3 \n and o3-h bonds for c3 in gemcitabine are calculated \n as 1.34 ( primarily c o single bond character ) and 0.97 , respectively . the values of \n the corresponding bond distances of c3-o3 and o3-h \n bonds for c3 in mefdc are obtained as 1.28 \n ( mainly double bond character and 1.0 \n respectively ) . thus , these calculations show that the \n hf loss from c3 \n in gemcitabine has a ca . 5 kcal / mol barrier ( supporting \n information figure s4c , d ) while for c3 in mefdc , \n the loss of hf is barrierless , and the c2 production \n is exothermic in nature as shown in figure 3 . these findings support our experimental observations that in mefdc , \n c3 is too unstable to be observed , and only c2 \n is found . in contrast , in gemcitabine only c3 formation \n is observed without any conversion to c2 in the same \n temperature range . pcm-b97x/6 - 31g(d ) calculated structures of c3 \n in ( a ) gemcitabine and in ( b ) mefdc . as indicated in ( a ) the c3 \n in gemcitabine involves a barrier of 5 kcal / mol ( detailed electronic \n energy profiles are provided in supporting information figure s4c , d ) to hf loss in the presence of h3o . in ( b ) , the c3 in mefdc is unstable in the presence \n of h3o and reacts without a barrier to form \n c2 via hf loss . the animations ( movies ) of the optimization steps for reaction involving h3o for c3 in both gemcitabine ( a ) \n and mefdc ( b ) are provided in the supporting information ( s5 ) .", "our \n work has the following two salient findings : ( i ) one electron \n oxidation leads to cytosine base -cation radical ( c ) in 2-dc and 2-f - dc but to c3 \n in gemcitabine . as expected from the one - electron redox potentials \n of the bases and the backbone , one - electron oxidation of 2-dc and 2-f - dc leads \n to c formation as evidenced by the ca . 16 g doublet \n that is characteristic of c. however , gemcitabine \n ( scheme 1 ) leads to the formation of c3 \n on one - electron oxidation . the two highly electronegative f - atoms \n at 2-position , through their negative inductive effect , lead \n to a substantial increase in the acidity of h3. therefore , \n c in gemcitabine is highly unstable toward the \n loss of h3 as deprotonation at 150155 k. this is evidenced \n by the free energy changes of the cation radical for the loss of h3 \n as deprotonation to the surrounding solvent ( see supporting information table t2 ) ; this deprotonation shifts \n the unpaired spin from the cytosine base of metastable c in gemcitabine to sugar at c3 via a pcet \n process . ( ii ) c2 formation does not occur in \n gemcitabine \n but does in its analog mefdc . it has been proposed in the literature \n that in gemcitabine both c3 and c2 \n ( reactions 1 and 2 ) play \n an important role in the rnr inactivation . conversion of \n c3 to c2 takes place via an irreversible \n f loss from c2 during rnr inactivation \n by gemcitabine . however , experimental and theoretical results shown \n in this work have clearly demonstrated that in our system ( supercooled \n homogeneous glassy solutions ) , c3 in gemcitabine does \n not convert to c2 on annealing up to 170 k owing to \n theoretically predicted barrier of greater than 5 kcal / mol . theoretically , \n dft calculations support the mechanism involving a h3o induced barrierless conversion of c3 to c2 \n in one - electron oxidized mefdc . experimentally , c2 \n is observed in one - electron oxidized mefdc upon annealing to ca . 160170 \n k. thus , our study in one - electron oxidized mefdc provides the first \n evidence of formation of c2 ( via the unstable intermediate \n c3 ( reaction 5 ) ) in a nonenzymatic \n system even at low temperature.5" ]

[ "it has a significant impact on the patient s quality of life ( 1 ) . post - prostatectomy urinary incontinence ( ppi ) is a potential complication of prostate surgery and although it is more frequently seen after radical prostatectomy it can also occur after endoscopic or open surgery for benign prostate hyperplasia ( bph ) ( 2 ) . initial management is usually conservative and includes the use of diapers or pads , penile clamps , or various collecting systems ( such as a condom catheter ) . mild degrees of ppi in the early postoperative period may be improved by pelvic muscle exercises , physiotherapy , and pharmacotherapy ( 3 ) . however , for most patients who have moderate to severe ppi , conservative methods are not sufficient to return to their normal lives . the present study reports our intermediate experience in men who underwent implantation of adjustable perineal male sling using a tissue expander for ppi .", "this prospective study was approved by the local ethics committee and a comprehensive informed consent was obtained from all the patients before the surgery . between september 2007 and may 2013 , a total of 21 men with ppi underwent implantation of adjustable perineal male sling using a tissue expander . the underlying etiologies of ppi in patients were : radical prostatectomy for prostate cancer in 13 patients ( open radical retropubic prostatectomy=12 , transperitoneal laparoscopic radical prostatectomy=1 ) , open prostatectomy in 5 patients and transurethral prostate resection for bph in 3 patients . patient evaluation consisted of medical history , physical examination , blood and urine laboratory tests . all the patients underwent a standard urodynamic study including both cystometry and pressure - flow study to evaluate bladder storage and voiding capabilities , and to exclude overactive bladder . also , an urethrocystoscopy was conducted in all the patients to exclude urethral stricture and/or bladder neck contracture . the patients who had a history of previous surgery for ppi were not included in the study . incontinence in the patients was defined according to the use of incontinence pads over a 24 hours period : mild ( using 1 to 2 pads ) , moderate ( 3 to 5 pads ) and severe ( more than 5 pads ) ( 4 ) . the post - operative follow - up was carried out in the second week and every 6 months thereafter consisting of daily pad use , physical examination , maximum urine flow rate ( qmax ) and post - voiding residual urine volume ( pvr ) measurement .", "all patients received prophylactic antibiotics ( 3rd generation cephalosporin ) before the induction of anesthesia . under general or regional anesthesia after the insertion of a urethral catheter , a midline perineal incision of 40 to 50 mm was made . the critical point is not to remove periurethral fat tissues from urethra . both sides of urethra a eurosilicone ( laboratoires eurosilicone , france ) tissue expander device was used with an adjustable male sling in our patients . the device contains a silicone balloon expander , a connecting tube and an inflation component ( injection port ) that allows the expander to gradually fill up to a volume of 25 ml saline solution ( figure-1b ) . \n figure 1a ) both sides of urethra are dissected ; b ) a balloon expander ; c ) a balloon expander between two layers of the mesh ; d ) the mesh is stapled to the pubic bone using autosuture stat tacktm ; e ) prepared scrotal pouch for placing the inflation component . \n a standard polypropylene mesh of 100 x 100 mm was used as the sling material . first , the mesh was folded and a balloon expander was placed between the two layers of the modification . secondly , the balloon was completely filled with the saline solution , and the two layers of the mesh were sutured using 2/0 polypropylene suture to create a pocket between the two layers of the mesh ( figure-1c ) . during this procedure third , the mesh was stapled on both sides of the lower border of the pubic bone using an autosuture stat tacktm ( tyco healthcare , uk ) stapler ( figure-1d ) . the original surgical method defined by inci , et al . ( 5 ) used a polypropylene mesh that was fixed on the pubic bone with non - absorbable sutures . in our case , this method was modified and staples were used to prevent the sutures and the mesh from loosening and moving . after the sling tension was properly adjusted , the sling was placed as tightly as possible in all patients since urinary leakage had been observed in our patients postoperatively . the inflation component has two sides ( figure-1e ) . finally , the wound was closed with careful hemostasis . after the surgery , all the patients were asked to take an oral antibiotic ( 2th generation cephalosporin ) for 7 days . post - operative success was assessed by the number of pads used per 24 hours as follows ; zero to 1 safety pad - dry , 1 to 2 pads - mild , and 3 to 5 pads - moderate . at a minimum of 1 week after surgery , patients were questioned regarding their daily pad use . if incontinence persisted 7 to 10 days after surgery , tension over the urethra was increased by saline injection to expand the tissue expander via the injection port using an insulin needle . injection was started with 3 cc and increased by 2 cc at each injection . in this way the patients were asked to return 2 days after each adjustment to confirm the status of continence . the mean values of the parameters were calculated using the statistical package for social sciences version 13.0 for windows ( spss inc . , chicago , il , usa ) .", "the mean values of the parameters were calculated using the statistical package for social sciences version 13.0 for windows ( spss inc . , chicago , il , usa ) .", "the mean age of the patients was 66.27.3 ( 50 - 79 ) years and the mean pad usage was 6.40.6 ( 6 - 8 ) per day . the mean volume of the postoperatively inflated balloon was 11.65.7 ( 5 - 25 ) ml . after the follow - up period , 16 of the 21 patients ( 76.2% ) were dry ( 11 patients , 0 pads ; 5 patients using safety pads ) , 3 patients ( 14% ) had mild degree ppi and 2 patients ( 9.8% ) had moderate degree ppi . in the last assessment of the patients , qmax and estimated pvr were found to be 15.64.7 ( 10 - 31 ) ml / s and 10 ml , respectively . in these two patients , the polypropylene mesh with balloon , connecting tube and inflation component were removed and they did not undergo any additional intervention . local scrotal infection developed around the inflation component in three patients . in these patients , only the inflation component was removed , the connecting tube was clipped and the polypropylene mesh with inflated balloon was kept in place . in these patients , polypropylene mesh with inflated balloon provided suitable pressure on the urethra . in the follow - up period , they were completely dry . no complications occurred in relation to mesh erosion , voiding dysfunction , voiding difficulty or mechanical failure . six patients reported mild perineal pain in the early postoperative period but this was resolved using non - steroidal anti - inflammatory drugs .", "the rising elderly population and the increasing number of surgical interventions for prostate cancer mean that the incidence of ppi will rise . since its introduction in 1973 , the artificial urinary sphincter ( aus ) has been considered the gold standard treatment for stress urinary incontinence after prostatectomy , offering the patient the greatest chance of a cure ( 6 ) . the success rates of aus range from 59 to 90% ( 7 - 9 ) . although , aus is an effective and durable treatment , many patients are hesitant about implantation or refuse the procedure . most patients could not manipulate the scrotal pump ( 10 ) . furthermore , aus is expensive and requires a complex surgical procedure that is associated with significant rates of complications . a recent systematic review about aus reported that infection or erosion occurred in 8.5% of cases ( 3.327.8% ) , mechanical failure in 6.2% ( 213.8% ) , and urethral atrophy in 7.9% ( 1.928.6% ) . re - operation rate was reported to range from 14.8% to 44.8% ( 11 ) . the proact ( uromedica , us ) system was first described in 2005 by hubner et al . ( 12 ) . in theietlr study , there were 117 patients with ppi followed for a mean period of 13 months , after which 67% of the patients were found to be dry . ( 13 ) reported the results of the proact intervention in 62 men with ppi and found that 71% of the patients wore no pads or used 1 pad per day after 6 months ( following the adjustment ) . however , in 19 men the device was removed due to infection and erosion ( n=5 ) , migration ( n=1 ) , and iatrogenic traumatism ( n=2 ) . moreover , , the authors evaluated the results of proact in 114 men with ppi at a mean follow - up time of 58 months and reported an overall dry rate of 50% . in that study , complications included balloon leakage ( 11% ) , migration ( 5% ) and wound erosion ( 4% ) . the authors reported that there was a total re - operation rate of 27% , and 12% of the patients underwent aus or a urethral sling procedures due to proact not being effective . the argus ( promedon sa , argentina ) sub - urethral sling with an adjustable system is another treatment option in men with ppi that was first described by romano et al . the authors reported a cure rate of 73% and the improvement rate was 10% in 48 men with ppi after a mean follow - up of 7.5 months . ( 16 ) reported mid - term complications after the placement of the argus sling in 29 men with ppi at a mean follow - up of 35 months . overall , 24 patients ( 83% ) experienced complications , consisting of acute urinary retention ( 35% ) and removal of the sling ( 35% ) owing to urethral erosion , infection , system dislocation , urinary retention , and persistent pain . furthermore , 27% of the patients complained of significant perineal pain . the authors concluded that the argustm sub - urethral sling was associated with serious mechanical and infectious complications , and sparse functional results with negative impact on the patient s quality of life . a bone anchored sling ( bas ) compresses the bulbar urethra with a silicone - coated polypropylene mesh by attaching the sling to the inferior pubic ramus with bone screws . following initial reports of degradation of organic materials , synthetic mesh ( invance , american medical systems , us ) has become the most commonly utilized material with the bas ( 17 ) . ( 4 ) reported their results in 46 patients with ppi who undergo bas implantation . in their study , the total cure rate was 37% . furthermore , 37% of the patients significantly improved , and the treatment of 26% patients failed after an average of 24 months follow - up . they concluded that the male sling procedure is an effective and safe procedure for the management of stress urinary incontinence . guimaraes et al . ( 18 ) reported their intermediate results of up to 4 years with the invance sling . their cure rate was 65% and the improvement rate was 23% in 54 men with ppi after a mean follow - up of 28 months . the authors claimed that the invance sling offers a good intermediate cure and improvement rates with acceptably low rate of complications in patients suffering from ppi . another study investigated the use of the invance sling in 40 patients with ppi ( 19 ) . the authors observed perineal pain in 73% of the patients , detrusor overactivity in 5% and sling infection in 15% . the traditional bas procedure does not provide for the adjustment of the tension of the sling material in the post - operative period and this can result in progressive failure over time . in a study by castle et al . social continence was achieved in 67% 50% and 0% of mild , moderate and severe cases , respectively . comiter ( 20 ) speculated that the surgeons left the fatty tissue over the bulbospongious intact , and additionally used a piece of porcine dermis between the urethra and the sling a combination of fat necrosis and absorption of the dermis over time likely contributes to diminution of the compression provided by the sling over the bulbar urethra . ( 21 ) reported a median time to recurrent incontinence as 3 months after bas procedure . similarly , cespedes and jacoby reported an early failure ( within 6 months ) in 5% of their patients ( 22 ) . in another study ( 23 ) , the authors retrospectively reported objective and subjective outcomes in 40 male patients who underwent bas positioning for stress urinary incontinence due to intrinsic sphincter deficiency . patients with stress urinary incontinence due to radical retropubic prostatectomy ( n=32 ) , robot assisted laparoscopic prostatectomy ( n=3 ) and transurethral prostate resection ( n=5 ) underwent the bas procedure over a 5 years period . previous anti - incontinence procedures , radiotherapy and transurethral procedures due to urethral stricture were performed in 5 , 11 and 5 patients , respectively . at a mean follow - up of 35.2 months , 22 patients ( 55% ) were cured , the condition of 5 patients ( 12.5% ) improved and the treatment of 13 patients ( 32.5% ) failed . the authors concluded that bas is a simple and effective procedure that can produce immediate good results with low morbidity , especially when strictly selected patients are treated . an adjustable perineal male sling technique was used for the treatment of ppi as described previously ( 5 ) . in that study an adjustable perineal male sling with a 10 ml tissue expander was implanted in 19 consecutive men with severe ppi . according to the results of that study , at a mean follow - up of 17.3 months 15 patients ( 78.9% ) were completely dry and 2 ( 10.5% ) improved significantly using only 1 to 2 pads per day . a total of 11 patients required volume adjustment injections . the average number of adjustments was 2 ( range 1 to 3 ) and the average injected volume was 6.3 cc ( range 5 to 10 ) . regarding the complications , 1 patient had a superficial wound infection , 1 patient required surgical revision due to infection and 8 patients reported mild to moderate perineal pain . the authors concluded that the short term results indicate that this minimally invasive technique seems to be safe and effective , and patient satisfaction appears to be high . the same group presented their long term results in the international continence society annual meeting 2013 . in a study by ergen and ozdemir the mean follow - up time was 52 months . the completely dry rate decreased from 78.9% to 58% in the long term period . the authors concluded that adjustable male sling using a 10 ml tissue expander is an effective method for severe ppi , in the early period , but the effectiveness gradually decreases in the long term . the review of our intermediate results at 40.1 months showed that 16 of the 21 patients ( 76.2% ) were completely dry , 3 patients ( 14% ) had mild incontinence and 2 patients ( 9.8% ) had moderate incontinence . the success rate of the current study is better than that of the other studies mentioned above ( 5 , 24 ) . a possible explanation for our high success rate may be associated with the high capacity of the silicone balloon . in our patients , we used a larger size of silicone balloon ( 25 ml ) than the other two studies . additionally , we used a stapler which allows the easier attachment of the polypropylene mesh on the lower border of the pubic bone in both sides . although previous pelvic radiotherapy history has also been claimed to be a negative predictor of success rate in ppi surgery ( 19 , 23 ) , 2 patients in current study whom had a previous history of pelvic radiotherapy were dry in the intermediate follow - up . a new device is a perineal sling with a tissue expander , composed of 2 silicone components , a balloon expander and an injection port , connected by a tube . in turkey , this device is relatively cheap compared with aus , proact , argustm ( $ 500 vs. $ 5.000 vs. $ 2330 vs. $ 2400 ) and easy to implant , even in difficult cases .", "although complications occurred in this study , including the removal of the device and the removal of inflation component due to local scrotal infection , our intermediate follow - up study suggests that an adjustable perineal male sling using a tissue expander appears to be an efficient and safe alternative surgical treatment option for patients suffering from ppi . the major limitations of our study were the small number of patients and the duration of the follow - up period . additional follow - up and larger series of patients are necessary to confirm our results ." ]

[ "fibromyalgia syndrome ( fms ) is a prevalent chronic pain condition among middle - aged females \n and is characterized by chronic widespread pain . various comorbid symptoms of fms include \n fatigue , cognitive disturbances , depression , sleep impairments , and weight gain , to name but \n a few . it is a challenging disorder , and thus assessment and diagnosis might pose some \n difficulties in various health care settings . patients may visit their general practitioners \n repeatedly with numerous symptoms before a diagnosis of fms is made1 , 2 . patients are encountered at not only primary but also secondary health care settings and by \n various subspecialities including rheumatologists , pain specialists , physiatrists , and \n psychologists . this has led to debate about whether fms is a clinical or epidemiological \n disease3 . the 1990 american college of rheumatology ( acr ) criteria included 2 major sections : history \n of widespread pain and pain in 11 of 18 tender points on digital palpation . debates over \n reliability , validity , and number of tender points required to make a diagnosis were \n settled . many controversies arose over tender points4 , and some authors argued against tender points , claiming that they \n are a measure of general stress3 , 5 , 6 . it \n was then suggested that dealing with the symptoms rather than tender points would be more \n realistic and that use of 1990 criteria should be stopped7 . the acr 2010 criteria eliminated the controversial tender point examination and included \n the following headings : widespread pain index , including 19 pain locations , and symptom \n severity score for 3 symptoms plus the extent of 41 somatic symptoms in general . 2010 \n criteria further modified to the 2011 modified criteria ( 2011modcr ) with 6 self - reported \n symptoms instead of 41 somatic symptoms . the most recently developed criteria are the \n alternative diagnostic criteria ( acr 2013altcr ) , which include more pain locations than the \n 2011modcr ( 28 instead of 19 ) and 10 symptoms instead of 6 . compared to the 2011modcr , the \n acr 2013altcr have comparable diagnostic sensitivity , better specificity , and a smaller \n number needed to diagnose8 . in addition to the search for best criteria , some other tools were developed for \n epidemiological studies such as the london fibromyalgia study screening questionnaire or \n survey criteria . however , they included only items related to pain and fatigue , neglecting \n other aspects of the condition9 . to \n address these problems , some screening procedures have been suggested ; however , they have \n been argued against due to psychometric validation problems and sensitivity and specificity \n issues10 . thus , a need for a short , easy - to - use , psychometrically validated screening tool has arisen \n in both clinical and research settings . the french rheumatic pain study group decided to \n develop a short , psychometrically sound , self - reported screening tool considering the major \n symptoms and aspects of fms9 . the original \n version of the fibromyalgia rapid screening tool ( first ) was demonstrated to have excellent \n discriminative properties , especially divergent validity in terms of psychological aspect , \n which is an important property for an fms screening tool9 . the spanish version of the first was also demonstrated to have \n acceptable internal consistency , reliability , and criterion validity10 . we aimed to study the reliability and validity of the turkish version of the first by \n correlating this tool with the acr 2013altcr and the hospital anxiety and depression scale \n ( hads ) .", "two hundred and sixty - nine patients ( 257 females and 12 males ) with an average age ( years ) \n of 48.29 12.78 ( range 2279 ) were included in the study . the principles of the declaration of helsinki were followed \n and the study protocol was approved by the uludag university ethical committee ( no : \n fr - hyh-19 ) . subjects were recruited from outpatient physical medicine and rehabilitation \n clinics from 9 medical faculty hospitals and ministry of health research and training \n hospitals . a convenience sample of patients with chronic diffuse pain was included in the study . \n literate patients who could read and understand turkish and who were able to complete the \n questionnaire were invited to participate in the study . patients with psychiatric disorders ( severe depression , schizophrenia ) or systemic or \n neurological disorders that could adversely affect quality of life or social functioning \n ( such as end - stage heart failure , hemiplegia , spinal cord injury , etc . ) were excluded from \n the study . we obtained permission from mapi research trust ( contact information and permission to use : \n mapi research trust , lyon , france . e - mail : proinformation@mapi-trust.org-internet : \n www.proqolid.org . ) cross - cultural adaptation was accomplished according to the suggestions \n of the mapi research institute in 3 steps : forward translation , backward translation , and \n patient testing . the first was translated into turkish by 2 professional native turkish speakers bilingual \n in turkish and english . they discussed on the translated forms with the local project \n manager ( r.c . ) to resolve discrepancies and produced a pooled version , which is the first \n version of the translation ( step 1 ) . then , english back - translation was done by the \n professional native english - speaking translator bilingual in english and turkish . he \n translated the first version of the questionnaire back to english without access to the \n original questionnaire . the local project manager compared the backward version with the \n original during a meeting with the backward translator and prepared the second version ( step \n 2 ) . the second version was tested on 5 patients , all of whom were native turkish speakers , \n and comprehension was determined through face - to - face interviews . after this final step , a \n third version of the questionnaire patients were asked to complete the questionnaire including the first , 2013altcr , and hads . \n they completed the first twice ; the time interval for the 2 first scales was 6 hours . the \n first includes 6 items , and a score of 1 is given for the response of yes and 0 if the \n response is no for each item . the total score is calculated as the sum of scores ; the \n cut - off value is designated as 5/69 . the examiners were physiatrists and they were blinded to the results of first and hads . we \n used the acr 2013altcr8 , which includes \n the pain location inventory ( pli ) including 28 sites and the symptom impact questionnaire \n ( siqr ) consisting of 10 symptom items ( pain ; energy ; stiffness ; sleep ; depression ; memory \n problems ; anxiety ; tenderness to touch ; balance problems ; and sensitivity to loud noises , \n bright colors , odors , and cold ) . pli score is between 0 and 28 , and the siqr range is 0100 \n divided by 2 . for a patient to fulfill the acr 2013altcr criteria , the symptoms and pain \n locations should have been persistent for at least 3 months , pli17 and siqr21 . one for anxiety and the \n other for depression and is a questionnaire completed by the patient . each item has 4 \n possible answers ( range 03 ) , and the maximum possible score is 21 . the validity and \n reliability of the turkish version of the hads was demonstrated previously11 . concurrent validity of anxiety subscale \n with spielberger s trait anxiety inventory , correlation coefficient was 0.7544 and of \n depression subscale with beck depression inventory it was 0.7237 . testing the reliability of \n had scale , cronbach alfa coefficient for anxiety subscale was 0.8525 and for depression \n subscale it was 0.778411 . we analyzed the data using the statistical package for the social sciences ( spss ) version \n 16 ( chicago , il , usa ) . the reliability of the \n hads was tested using cronbach s alpha coefficient . for criterion validity of the first , we \n used the acr 2013altcr for comparison . the \n concordance between the acr 2013altcr and the first was evaluated using a mcnemar test . the sensitivity , specificity , and positive and negative likelihood ratios of the first were \n calculated according to acr 2013altcr criteria .", "we compared \n the 2 first measurements using wilcoxon signed rank test , and the 2 measurements were \n statistically similar ( p=0.169 ) . one hundred fifty - six ( 58% ) patients had score of 5 , which is the cut - off score for the \n first ; 116 of these patients ( 74.4% ) were diagnosed as having fms according to acr 2013altcr \n criteria . one hundred thirteen patients ( 42% ) had first scores lower than 5 , and 93 of these \n patients ( 82.3% ) did not meet the 2013altcr criteria . the first was not statistically \n different from the acr 2013 altcr in defining patients with fms ( table 1table 1.sensitivity , specificity , and positive and negative likelihood ratios of the \n first to discriminate patients with and without fms according to the 2013 \n altcrvalueconfidence intervalsensitivity83.8276.589.6specificity68.4259.876.2+lr2.652.33.0lr0.240.10.4lr : likelihood ratio ) . first total score was correlated with \n subscores of the acr 2013altcr , namely pli ( r=0.619 , p<0.001 ) and siqr scores ( r=0.408 , \n p<0.001 ) . similarly , the first and hads were significantly correlated ( r=0.424 , \n p<0.001 ) ( table 2table 2.the coefficient of determinations between first total score and acr 2013 \n subscores ( pli and siqr score ) and hads scores.plisiqrhadsfirst total score0.383 * 0.166 * 0.18*pli0.196 * 0.131*siqr0.194*data expressed as squared spearman s rho correlation coefficients . first : \n fibromyalgia rapid screening tool ; hads : hospital anxiety and depression scale ; pli : \n pain location inventory ; siqr : symptom impact questionnaire , * p<0.001 statistically \n significant ) . first : \n fibromyalgia rapid screening tool ; hads : hospital anxiety and depression scale ; pli : \n pain location inventory ; siqr : symptom impact questionnaire , * p<0.001 statistically \n significant logistic regression analysis was carried out to find the confounding effect of the hads on \n the first to discriminate the patients with fms . the model was able to discriminate patients \n with fibromyalgia and without fibromyalgia ( 2 log likelihood=274.82 ; =95.29 , \n d.f=2 ; p < 0.001 ; nagelkerke r= 0.4 ) . the first global score explained 30% of \n the proportion of uncertainty ; each point increase in first global score meant 10 times \n greater odds of experiencing fms .", "in this study , we showed that the turkish version of the first is a reliable \n patient - completed instrument for identifying patients with fms . the acr 2013altcr was used \n for comparison , and the first was similar to the acr criteria in terms of defining patients \n with fms . the first demonstrated high correlation with acr 2013altcr subscores and hads \n scores . in our study , we examined the consistency of the first over time . we used the acr 2013altcr because these criteria were equally efficient with somewhat \n better specificity , and a smaller number was needed to diagnose than in the 2011modcr8 . the acr 2013altcr were also marginally more \n efficient in differentiating common chronic pain disorders from fms8 . torres et al.10 used acr 1990 criteria , and perrot et al.9 stated that they diagnosed patients on the basis of acr \n criteria , referring to the article by wolfe et al . , who used the symptom intensity scale , \n which is a combination of pain counts in 19 nonarticular regions with a visual analogue \n scale for fatigue12 . torres et al . reported the sensitivity of the first as 90.5% and its specificity as 85.7% . \n the turkish version demonstrated similar sensitivity and specificity . in this study by \n torres et al . positive likelihood ratio was calculated as 1.99 and negative likelihood ratio \n as 0.2 for cut - off point of 5 which is the established score for the original version of \n first . in our study positive and negative likelihood ratio values were 2.65 and 0.24 \n respectively , with fairly narrow confidence intervals . our study group was similar to torres \n et al.10 ; the majority of the patients in \n the study by torres were female , as in our study group . in the original study of the first \n by perrot et al.9 , first total score was \n not significantly correlated with the beck depression inventory , hads - depression , and \n hads - anxiety scores . in our study , we were able to demonstrate that first scores are \n correlated with hads scores ; however , despite the correlation of first with hads scores , the \n first was still able to discriminate between patients with and without fms . different from previous studies , we included patients with various chronic pain problems at \n a tertiary care level . fitzcharles et al . argued that , if patients in a study have an \n established diagnosis of fms , they may express symptom severity at the extreme end of the \n spectrum , thus increasing construct validity13 . similar to our study , bennett et al.8 included a wide range of common pain disorders as the dominating \n principle of their study and claimed to simulate everyday clinical practice . both rehabilitation specialists and physical therapists are dealing with various pain \n conditions . among these disorders fms is a prevalent condition and can be encountered \n secondarily as in case of rheumatologic disorders . first includes 6 items with either yes or \n no answer , thus enables easy and quick scoring . it can be used as an adjunct to physical \n examination or evaluation of patients undergoing physical therapy . . patients were recruited from tertiary care hospitals however study \n population is not limited to patients referred from primary care clinics . an important consideration for the first is ease of use and scoring in the settings \n involved with chronic pain patients . it can be completed in less than 3 minutes and seems to be acceptable and relevant for the \n patients10 . since it is a single page \n and evaluation requires simple addition , use of the first may be advantageous in a busy \n clinical setting such as surgical units . it was demonstrated that patients with fms were more likely to have surgical \n interventions including back or neck surgery14 . surgeons and interventionalists may also benefit from using an \n easy - to - administer patient - completed screening tool to avoid unnecessary procedures .", "" ]

[ "overweight and obesity are conditions that have been increasing in the united states and these risk factors for diseases are estimated to affect more than one - half of those over the age of 20 . over the last few years obesity is a major public health concern because it increases the risk for many chronic conditions , such as cardiovascular diseases , particularly diabetes , hypertension , coronary artery disease , and cancer [ 1,811 ] . public health officials have begun to monitor the health status of school - aged children because it is believed that many of them exhibit risk factors that create the potential for developing chronic disease as adults . in 1994 , 10.4% among 2 to 5-year - old children , compared to 11.3% and 7.2% respectively for the same age groups in 1988 . this increase in overweight children has underscored the challenges faced by young people as they grow into an adult group where over 50% are overweight , and at significant risk for developing cardiovascular and other metabolic disorders [ 1 , 12 ] . effective management of risk factors among the youth , such as reducing / eliminating improper dietary practices and incorporating adequate physical activity , must become a universal health priority in order to effectively precipitate any noticeable decline in the adult morbidity and mortality statistics . childhood obesity is also associated with several immediate health risk factors , such as orthopedic , neurological , pulmonary , gastroenterological , and endocrine conditions . obesity has been linked to negative psychosocial outcomes in children , such as low self - esteem and depression [ 1523 ] , making obesity indirectly linked to academic performance and adverse social outcomes over time [ 2429 ] . cardiovascular disease is not only the leading cause of death , but also the single greatest contributor to excess mortality in african - americans . unhealthy eating contributes to at least 300,000 preventable deaths each year , and is one of the most identifiable contributors to premature death , second only to tobacco use . premature deaths due to cardiovascular disease remain higher for african americans than any other group [ 3137 ] . the highest rates of premature coronary heart disease in adults age 3564 occurred in the rural southern region of the united states . the rate of cvd for african americans in mississippi was deemed serious enough to compel the national institutes of health ( nih ) to initiate the jackson heart study to focus on identifying risk factors for the development of cvd in african - americans . among the known risk factors for cvd according to tom walden of the north american association for the study of obesity , schools can play a key role in preventing the risk behaviors by providing instruction on proper nutrition and physical activity . based on this premise , this study was designed to examine the students possible role in changing their own negative practices , by first assessing their perceptions of the obstacles to positive dietary practices and increased physical activity . the study also solicited students recommendations for reducing the negative practices that are associated with the rise in obesity and the development of cardiovascular diseases . the implementation of the study was intended to grant the students an opportunity to provide their own ideas , suggestions and recommendations for what they feel could be done to improve their quality of life and to prevent premature morbidity and mortality .", "the sample for this study included 300 students from a high school , located in rural , mississippi . the high school under investigation in this study educates students in grades 912 , and all students enrolled in the health and physical education courses comprised the sample for this project . students were first asked to complete an assent form and to have their parents sign a consent form before they could participate in the survey . only students who returned completed assent and consent forms were permitted to participate in the study . the data for the study were obtained from the administration of the project health high school survey ( phhss ) , which was a modification of the mississippi youth risk behavior survey ( yrbs ) that was developed by the centers for disease control and prevention ( cdc ) . the phhss was designed to measure the prevalence of risk behaviors associated with leading causes of illness and death . the survey was modified to include three additional questions that served to fulfill the objectives of this study . these questions specifically asked students to respond about their perceptions , and were the following : what do you think is keeping you or other students from eating more nutritious , healthier foods ? what do you think is preventing you or other students from taking part in daily physical activity ? what suggestions do you have that would help students to start eating better and exercising more ? these were open - ended questions and the students had the freedom to think and enumerate their perceptions . the students were assured that their responses would be confidential and their honest responses could shed some light on a perplexing health dilemma that currently faced public health officials . all students enrolled in health and physical education classes , which included students in the 912 grades , were administered the phhss survey during the regular classroom session by the regular health and physical education teacher . the students responses on each of these issues were recorded and analyzed to fully understand their perceptions and recommendations .", "this descriptive study sought to ascertain the students perceptions through the use of questions that were presented in the form of a self - administered questionnaire . upon completion of the survey , the statistical package for the social sciences ( spss ) was used to evaluate the student responses . the high school students perceptions about current practices and possible solutions were calculated and presented in the tables that follow . the students perceptions on each of the areas under investigation were recorded and reported based on the rankings ( highest number of responses received and recorded ) from highest to lowest .", "completed phhss surveys were returned for 126 students which represented 42% of the 300 students enrolled in the health and physical education classes . all of the students were between the ages of 14 and 18 , and they were all enrolled in grades 912 . the breakdown according to race was as follows : 94.9% were african american ; 2.5% were hispanic ; 1.3% were asian ; and 1.3% were native americans , the participants were 69% female and 31% male . students at the high school were asked to respond to the question what do you think is keeping you or other students from eating better ( more nutritious foods ? figure 1 provides a graphical image of the students responses about this issue . love of sweets , junk food and fatty foods occupied the highest ranked reason selected by 19.8% of the students . the students also admitted that most of them ate what they were accustomed to eating . they ate what they liked to eat , and the decision about what to eat was made because of the taste of the food without regard for any health consequence or negative health outcomes . the number two reason for not eating healthy was that students believed that the food they were served in the school s cafeteria was of poor quality : 15.7% of the students responses supported this view . the number three reason given for not eating more nutritious foods was family background , family customs and family heritage : 14.1% of the students acknowledged that they ate the way they did simply because they inherited those patterns from their family . in other words , they ate what their parents could afford to buy and prepare for meals . many of them asserted that they were simply not accustomed to eating nutritious foods daily . these students stated that they buy the types of food they want , and , in some instances , they want the fast foods more than anything else . the students placed fast food restaurants as number five among the reasons why they found it difficult to practice positive eating habits . ranked number six as a factor that inhibits them from healthy eating habits is the easy access to junk foods and other unhealthy foods : 6.6% of them blamed the easy accessibility of junk foods as a perpetrator of the unhealthy dietary choices and practices . another 6.6% of the students cited lack of care and guidance from responsible adults as a factor that prevents them from practicing good dietary habits . these students admitted that pressure from videos and corporate advertisements helped to steer them in the wrong direction in reference to the choices they make . the negative influences perpetrated by famous actors , sports personalities and performers usually project the wrong messages and oftentimes influence many students to act spontaneously and without proper judgment . as a result , many of them make the decision to eat daily at fast food restaurants , where they often consume an over abundance of unhealthy meals . several students reported that there was no one in their life to motivate them with positive messages or inspiration , and not many people cared enough . the number eight ranked reason for students not practicing positive eating habits was the presence of snack machines at school , laden with junk food . about 5.0% of the students cited this as a possible obstacle to good eating practices . approximately 19.8% of the students did not express an opinion about what is keeping them and other students from eating better ( more nutritious foods ) . the students were also asked what do you think is keeping you or other students from taking part in sufficient exercise ( daily physical activity ) ? the number one reason offered by students for inadequate participation in physical activity is laziness . some students insisted that there are many students who believe that they are too cute to dress in workout gear , and do not want to sweat during physical activity . approximately 38.9% of the students perceived that as the main reason why many students do not participate in activities today . the next reason cited by 14.3% of the students was that they preferred to hang out with friends rather than participate in physical activity . since it is not required daily many of them would prefer to attend parties , talk on the telephone , ride around in cars or watch television , rather than participate in physical activity . and , besides , as some of them insisted , the school has not been helpful in encouraging them to look at the positive benefits of daily exercising . the third ranked reason was that they simply have no desire to take part in physical activity ( see figure 2 ) . about 6.3% of the students cited self esteem issues and the feeling of embarrassment as a major contributing factor . the number five ranked reason for non - participation was the volume of homework assignments they have . these students felt that they just do not have the time to participate in physical activity . approximately 3.2% of the students explained that their inadequate participation is due to a lack of adequate mixture of games available at school . health problems were cited by 2.4% of the students as obstacles , and 1.6% of them indicated that disagreements with the gym teacher resulted in their non - participation . a small number of students believe that being fat or overweight was a contributing factor to their failure to participate in physical activity . there were approximately 19.0% of the students who had no opinion about what was keeping them and other students from taking part in sufficient exercise ( daily physical activity ) . the students also responded to the question what do you think is needed to help students to start eating better and exercising more ? the number one suggestion given by students for improving their quality of life was that the school should provide better and more nutritious cafeteria food ( see figure 3 ) . this was equaled in number by the need for guidance by school personnel and parents in the area of healthy eating practices . they felt that the adults should show more interest and concern , and do more to provide adequate instruction and direction , possibly implementing new programs or activities and increased time in health class to address these important issues . they also believed that the parents have a major responsibility to lead the way by providing positive alternatives . this was followed by the need for more encouragement and motivation , as expressed by 14.1% of the students . about 11.3% of the students felt that the school should increase the volume of physical activity and exercise offered to students daily . number five among the students suggestions was the recommendation that the school make exercise mandatory for students . the students felt that , as incentives , school officials should use prizes , grades or money to encourage students to participate . another 6.3% of the students suggested that school should make exercise and nutrition programs more fun to encourage students to participate . some students concluded that increased conversation about the topic would lead to heightened motivation among students to participate in activities that are offered in their health and physical education classes . about 4.2% of the students believed that parents and teachers do not care enough to provide them with adequate guidance and opportunity . the students felt that the school needs to implement a healthy life program within its curriculum . approximately 4.2% of the students indicated that the students themselves should eliminate junk food and fast foods from their daily lunch menus . another group of students suggested that more positive advertising of nutritious foods should be encouraged and should be a major part of the plan to improve the students quality of life . students felt that they should be constantly apprised of the dangers of negative practices regarding poor eating practices and inadequate physical activity . this would facilitate their change to healthier daily practices which could possibly add years to their lives . approximately 11.3% of the students said they did not know the answer and could not present any suggestions . the major limitation of this study was the fact that only 42% of the total number of students eligible to participate in the study provided surveys that could be analyzed . . however , their responses are valuable enough to shed some light on obstacles to good health and possible solutions to improve the quality of life and develop ways of helping them to eliminate negative practices and reduce risk factors .", "the major limitation of this study was the fact that only 42% of the total number of students eligible to participate in the study provided surveys that could be analyzed . . however , their responses are valuable enough to shed some light on obstacles to good health and possible solutions to improve the quality of life and develop ways of helping them to eliminate negative practices and reduce risk factors .", "the interpretation of the students responses to these critical health issues identifies certain urgent needs that could and should be addressed by the academic institutions . many students understand that there may be negative consequences resulting from the daily choices that they make . it is clear that culture and family customs have a great influence on the direction students take in their dietary practices , as well as their involvement in physical activity . the convenience and easy accessibility of low nutritious foods is also seen as a contributing factor , as are the negative influences that are presented through advertising of non - nutritious foods . it is evident that adequate support and guidance from adults are not available often enough to facilitate the kind of learning and training that could ensure that students are afforded the opportunity to acquire knowledge to help them make positive responsible choices and decisions . so children have little desire to take the initiative to make improvements in their daily practices . the students suggested that modifying the schools curriculum to address student risk behaviors should become an embedded characteristic of their educational systems . the current absence of learning strategies to adequately address and educate students about the pitfalls of negative dietary and physical behaviors is a major shortcoming of the school s education system . recommendations for future studies should involve examining the responses of students enrolled in predominantly white institutions with those of the predominantly african american canton public school district . studies could also be designed to compare the responses of students from urban schools and rural schools to determine what their perceptions and recommendations are concerning risk factors and ways of reducing them ." ]

[ "vascular diseases are among the most common causes of morbidity and mortality , and both number and severity of morbid vascular conditions increase with age . regulations of angiogenesis , coagulation , and inflammation are very important issues in vascular biology , both in normal physiology and pathology . it is now well established that disruption of endothelial integrity represents a crucial event in the initiation and development of cardiovascular ( cv ) diseases . numerous studies have reported that microparticles ( mps ) play an important role in endothelial dysfunction . endothelial dysfunction occurs when a perturbed homeostatic endothelium disrupts vascular competency resulting in reduced vasodilatation and increased proinflammatory and prothrombotic properties of the vascular network . recently , mps originating from various cells have been found to be associated with several vascular related diseases . moreover , exposed procoagulant phospholipids and specific receptors at the surface of mps act as biomessengers linking inflammation , coagulation , and angiogenesis [ 35 ] . although mps were first described as cellular debris that are believed to have no biological significance , recent studies documented that mps of endothelial and other origins are biological effectors in inflammation , vascular injury , angiogenesis , and thrombosis [ 68 ] . mps isolated from granulation tissue are derived from endothelial cells , monocytes , platelets , erythrocytes [ 913 ] , and myofibroblasts . they exchange biological signals and information intercellularly and each kind of mp carries the antigens and receptors of the cells they originated . mps may transfer part of their components and content to the selected target cells , thus mediating cell activation , phenotypic modification , and reprogramming of cell function . although 70% to 90% of all circulating mps in the peripheral blood of healthy individuals are derived from platelets , marked elevations of all kinds of mps have been observed in many vascular diseases . specifically , endothelium - derived microparticles ( emps ) represent a relatively small ( 515% ) but very important subset of all circulating microparticles [ 1618 ] . this number may vary in different cardiovascular and inflammatory diseases [ 18 , 19 ] . new insights into endothelial dysfunction and alterations in angiogenesis are emerging from studies of vascular microparticles , particularly endothelial microparticles in elderly populations . vascular aging with impairment of endothelial cell function leads to altered angiogenesis , a key factor in the etiology of various cardiovascular disorders . 73% of individuals aged 6079 have a cv disease , including stroke , hypertension , or heart failure , and at > 79 years of age prevalence of these diseases increased to 86% in females and 82% in males ( 2012 nhlbi fact book ) . recently published data have shown that these diseases are the leading cause of death for individuals aged > 65 and morbidity increased from 32% for individuals aged 66 to 48% for individuals aged 85 . an important factor which significantly decreases the incidence of coronary heart diseases in postmenopausal women is estrogen [ 2224 ] . in women already having coronary artery disease or ischemic stroke , the therapeutic benefit of estrogen is not clear [ 25 , 26 ] although it has been reported that estrogen induces rapid vasodilation , exerts anti - inflammatory activity , and regulates vascular cell growth , migration , and protection of cardiomyocytes from injury , all of which prevent atherosclerotic deterioration in vessels . this review focuses on the role of emps in angiogenesis , coagulation , and inflammation during age - related vascular diseases and the contribution of estrogen to these diseases .", "emps are small vesicles that are released from endothelial cells and can be found circulating in the blood . defined by their small size ( 0.1 to 1.0 m ) , they are a heterogeneous population of vesicles which are shed from plasma membranes in response to cell activation , injury , angiogenesis / neovascularization , and/or apoptosis . emps consist of a small amount of cytosol surrounded by a plasma membrane and display negatively charged phospholipids on their surface that can initiate and accelerate coagulation . circulating emps have been demonstrated as a marker of preeclampsia [ 29 , 30 ] , acute coronary syndromes , and severe hypertension [ 30 , 32 , 33 ] suggesting their association with pathological processes within the endothelium . furthermore , circulating emp levels are also implicated in the progression of atherosclerotic lesions , heart failure , arrhythmias , inflammatory vascular disease , sickle anemia , and endotoxemia . jimenez et al . demonstrated that the surface antigens of emps are distinctive depending on the type of endothelial cell injury , as in apoptosis versus activation . high levels of the surface antigens e - selectin , intracellular adhesion molecule-1 ( icam-1 ) , and vascular cell adhesion molecule-1 ( vcam-1 ) are on emps derived from activated endothelial cells . in contrast , the low levels of these antigens are on emps derived from apoptotic endothelial cells . platelet cell adhesion molecule ( pecam-1 ) , endoglin , and vascular endothelial - cadherin ( ve - cadherin ) are at low levels on emps derived from activated ecs [ 3740 ] ( figure 1 ) . additionally , emps generated from apoptotic endothelial cells have higher levels of phosphatidylserine on their surface and different phospholipid composition and oxidation status compared with emps generated from activated endothelial cells [ 41 , 42 ] . these data suggest that there are distinct mechanisms for the formation of emps in apoptotic and activated cells and several studies suggest that these types of emps have different functions in vascular diseases [ 40 , 44 ] . both inflammatory cytokines and coagulation factors participate in the generation of emps ( figure 2 ) . recently , it has been shown that p38 mitogen - activated protein kinase ( mapk ) is a critical molecule in the production of proinflammatory emps and increased icam-1 production by endothelial cells , providing a paracrine loop to enhance the endothelial response to inflammation . in vitro studies have shown that the proinflammatory agent , tnf , activates endothelial cells and induces release of emps ( figure 2 ) . another potent stimulus for emp formation both in vivo and in vitro is angiotensin ii ( ang ii ) . this effect is mediated by ang ii receptor type i that signals through nadph oxidase and rho kinase . furthermore , in ang ii - infused apoliprotein e ( apoe / ) hyperlipidemic mice , a model of significant endothelial dysfunction , ang ii has been shown to increase emp formation by a redox - sensitive and blood - pressure - independent process . another important factor pai-1 ( plasminogen activator inhibitor type 1 ) plays an important role in the formation of emps . it has been shown by brodsky et al . that pai-1 promotes formation of emps with reduced transmembrane asymmetry of phospholipids in a dose dependent manner . these findings could possibly link elevated levels of pai-1 with endothelial dysfunction and tendency toward thrombosis [ 4850 ] . increased levels of pai-1 might serve as an initiator of emp formation followed by increased procoagulant activity and thrombin generation . in addition , it is also known that thrombin stimulates pai-1 synthesis suggesting constant production of these two factors . all these data indicate that formation of emps links together inflammation , coagulation , and angiogenesis and causes the impairment of the last two phenomena ( figure 3 ) . among many signaling molecules , t - cadherin ( t - cad ) on the surface of ecs might be upregulated and may serve as a characteristic marker of ec activation and stress . recently , philippova et al . have demonstrated a mechanism of t - cad - dependent signaling in the vascular endothelium . the authors identified that t - cadherin levels in plasma are increased in early atherosclerosis and correlate with endothelial dysfunction , which may lead to increased release of emps from ecs .", "increasing evidence has also accumulated to implicate an impaired coagulation system in many vascular diseases . this coagulation imbalance is the net result of activation of coagulation , impaired activity of natural coagulation inhibitors , and suppressed fibrinolysis . activation of coagulation proteases , for example , thrombin , is one of the earliest events following tissue injury . thrombin modulates tissue repair responses by altering vascular permeability , stimulating endothelial cell , fibroblast , and neutrophil migration , and promoting their spreading and adhesion . it activates various cell types and induces secretion of several proimmune , profibrotic , and proinflammatory factors [ 45 , 56 , 57 ] . recent studies by sapet et al . have shown that release of emps by endothelial cells in response to thrombin involves a group of genes that regulate angiogenesis and are linked to the cytoskeleton reorganization family . among these genes , rho - kinase rock - ii was transcribed at a high rate and was identified as a target of thrombin in emp generation . the involvement of caspase-2 in rock - ii activation , independent of cell death , points out a novel signaling pathway that emphasizes the proteolytic activity of caspase in emp generation in response to cell activation ( figure 1 ) . however , further studies are needed to determine the molecular mechanisms involved in emp release . emp release is initiated when thrombin binds to its receptor , proteolytically activated receptor-1 ( par-1 ) , which induces gene transcription that is mediated by thrombin via trail / apo2l , a cytokine belonging to the tumor necrosis factor alpha ( tnf ) superfamily . this mechanism of emp generation depends on the nuclear factor ( nf ) b activation and involves the soluble form of trail , which is secreted by the endothelial cells under thrombin or inflammatory stimulation [ 4 , 59 ] ( figure 2 ) . phospholipids expressed on emps bind coagulation factors leading to a prothrombotic state and an increase in procoagulant activity of tissue factor ( tf ) . these phospholipids are exposed on the outer membrane of mp and are considered to be the main initiators of the coagulation cascade . additionally , it has been demonstrated that sphingosine 1-phosphate ( s1p ) strongly potentiates thrombin - induced tf expression in ecs suggesting its role in blood coagulation . s1p has also been shown to be involved in the process of angiogenesis and inflammation [ 6264 ] . another important role of mps is their contribution to the development of platelet- and fibrin - rich thrombi at sites of vascular injury via the recruitment of cells and the accumulation of tf . data suggest that emp - mediated coagulation has clinical significance ; for example , an association between the number of circulating mps and the risk of thrombolytic complication has been reported . because emps interact with coagulation proteins and with inflammatory or vascular cells , their role in cardiovascular diseases has been intensively studied . it has also been observed by jy et al . that emps carry von willebrand factor ( vwf ) and factor viii that promote platelet aggregates and increase their stability ( figure 1 ) . moreover , the authors postulated that emps released during vascular injury may arrest bleeding by rapid interaction with platelets via membrane - associated vwf multimers and adhesions to stabilized platelet aggregates in the microenvironment . sabatier demonstrated that emps also carry tf and bind to monocytes causing further tf expression and resulting in enhanced transmigration of monocytes through endothelial junction [ 66 , 67 ] . one of the important key genes for aging - associated cardiovascular disorders is plasminogen activator inhibitor-1 ( pai-1 ) , a main inhibitor of fibrinolysis . the expression of pai-1 is not only elevated in the elderly but also significantly induced in a variety of pathologies associated with the process of aging . increased levels of pai-1 and its procoagulant activity have been recognized as hallmarks of endothelial dysfunction in vascular aging ( figure 4 ) . furthermore , elevated levels of pai-1 were found in werner syndrome , a disease characterized by premature aging [ 68 , 69 ] and atherosclerosis , which in advanced stages may lead to myocardial infarction and death . recently , it has been shown that emps expressing both activators and inhibitors of coagulation have fibrinolytic properties that counteract their procoagulant activities , which may enable them to contribute to haemostatic balance . it has been observed that endothelial and leukocyte microparticles generate fibrinolytic activity , whereas erythrocyte and platelet microparticles do not have this property . additionally , different plasminogen activators were identified on leukocyte microparticles , urokinase - type plasminogen activator ( upa ) , and emps where tissue plasminogen activator ( tpa ) has been found . the authors provide evidence that microparticles with plasminogen activators are rare in healthy populations but are observed more frequently in pathological conditions suggesting that plasmin generation on microparticles may be important in the modulation of hemostatic balance . therefore , complex functions of emps have an ambivalent role both in physiological and pathological conditions , either promoting or inhibiting coagulation , inflammation , or angiogenesis .", "inflammatory mediators increase several procoagulant factors , inhibit endogenous anticoagulants , and attenuate the fibrinolytic response . however , the interaction between these two systems is bidirectional , as coagulation is also capable of modulating inflammatory activity . thrombin mediated inflammatory molecules such as il-8 and il-1ra and il-1 participate in emp release [ 4 , 59 ] ( figure 2 ) and are key factors involved in coagulation , inflammation , and angiogenesis . inflammation and coagulation are linked processes in many diseases and emps may amplify the responses by activating the endothelium . it has been reported that in addition to activation of d - dimers and c - reactive proteins in coagulation , the inflammatory cytokine il-6 is associated with mortality , declines in all measures of function , and leads to the frailty phenotype in the elderly . recently , it has been shown that increased levels of il-6 are present in aged aortas and that aging induces a proinflammatory phenotype in vascular smooth muscle cells ( vsmc ) due in part to increased signaling of toll - like receptor 4 ( tlr4 ) and its signaling adaptor myd 88 . these observations support the notion of a high prevalence of proinflammatory conditions in advanced age . all of these factors lead to increased generation of emps and impaired coagulation , inflammation , and angiogenesis in cv diseases ( figures 3 and 4 ) .", "the process of angiogenesis is complex and requires endothelial cells ( ecs ) to detach from pericytes and the extracellular matrix ( ecm ) , proliferate , invade the surrounding tissues , migrate , and differentiate to form capillary tubes that connect to newly developed vascular networks leading to vascular stabilization [ 7476 ] . defective angiogenesis has been found in many vascular diseases and it has been established that emps play an important role in this process . mps can act on angiogenesis directly through ligand / receptor interaction or indirectly by modulating production of soluble factors involved in endothelial cell differentiation , proliferation , migration , and adhesion . brodsky et al . have shown that in low concentration , emps did not affect the endothelium . however , increased levels of circulating emps are an important factor in the pathophysiology of cv diseases , directly affecting the endothelium and other circulating cells . brodsky et al . have demonstrated that emps directly impair vasorelaxation via diminishing production and/or bioavailability of nitric oxide . this result was correlated with increased superoxide levels in aortic rings isolated from rats and cultured endothelial cells treated with microparticles . other studies have demonstrated that mps of endothelial origin induce the expression of endothelial cyclooxygenase type 2 , different adhesion molecules , release of cytokines , and impaired release of nitric oxide from vascular endothelial cells . a pathological concentration ( 10 ) of emps affects angiogenesis by diminishing the cell proliferation rate and decreasing the total capillary length of human umbilical vein endothelial cells ( huvec ) plated on a matrigel substrate . moreover , huvecs or human microvascular endothelial cells ( hmvecs ) treated with emps demonstrated disorganized tube formation in the presence or absence of vegf . impairments in the regulation of vascular tone , coagulation , and hemostasis contribute to damage of the vascular system and dysfunctional angiogenesis [ 8183 ] . recently , in vitro studies published by burger et al . have proved that a long term culture of mouse aortic ecs leads to a senescent phenotype with increased rock activity and formation of mps ( figure 4 ) . furthermore , it has been shown that mps promote premature ec senescence through the stimulation of endothelial cell ros production ( figure 4 ) . brodsky et al . demonstrated a significant increase in the number of circulating emps in obesity - induced diabetes rats as well as premature endothelial cell senescence and vasculopathy . this disorder was characterized by impaired vasorelaxation , nitric oxide production , and defective angiogenesis . an increased number of circulating emps have been identified in patients with certain diseases , such as hypertension , coronary artery disease , acute coronary syndrome , and stroke . in patients with established endothelial dysfunction , levels of circulating emps are inversely correlated with the amplitude of flow - mediated dilation , independent of blood pressure [ 11 , 8587 ] . another study published by thomasow et al . has shown elevated levels of cd31 ( pecam-1 ) , which are suggestive of ec apoptosis , in severe and mild chronic obstructive pulmonary disease ( copd ) and emphysema . cd31 emps were positively related to emphysema and were inversely associated with pulmonary microvascular blood flow . in contrast , cd62e ( e - selectin ) emps indicative of endothelial activation were elevated in severe copd and hyperinflation . previous studies have demonstrated an impairment of cell proliferation , migration , tube formation , and sprouting in older individuals ( > 65 years , male or female ) when compared to their younger counterparts ( < 65 years , male or female ) suggesting that these changes contribute to the decrease in effective blood vessel growth and repair mechanisms in the elderly . a decrease of proangiogenic factors and loss of circulating endothelial progenitor cells ( epcs ) have also been observed with increased aging ( > 50 years , male ) , which may lead to compromised angiogenesis . furthermore , age - related changes in epc number and function may directly correlate with the degree of senescent endothelial impairment . furthermore , in older men ( > 60 years ) with myocardial infarction , circulating microparticles selectively impair the nitric oxide transduction pathway in endothelial cells , which contributes to the general vasomotor dysfunction observed after myocardial infarction . additionally , an environmental alteration such as a decrease in ecm proteins particularly fibrillar collagen production and small leucine rich proteoglycans ( slrps ) and changes in the expression of matrix metalloproteinases ( mmps ) have also been observed with increased aging . emps are clearly implicated in the impairment of angiogenesis in vascular diseases associated with aging however , the specific pathways through which emps augment this process are unknown . moreover , emps may be one of the major factors leading to reduced effectiveness of therapies for treating impaired angiogenesis in humans and should be further explored .", "furthermore , estrogen levels have been connected to thrombin generation , a central molecule in the coagulation cascade in postmenopausal women . in particular , estradiol increases migration , proliferation , and formation of capillary - like networks of huvecs by the classic estrogen receptor ( er ) pathway [ 9698 ] . most reports have concentrated on the role of ers in mediating big vessel relaxation and contraction . in a rat model of acute myocardial infarction it has been shown that estradiol promotes myocardial angiogenesis by increasing microvascular density through estrogen receptors . furthermore , in ovariectomized rats it has been demonstrated that an increased number of genes in the aged heart , including tnf and map kinase - activating death domain protein ( madd ) , play a role in the release of emps [ 100102 ] ( figure 4 ) . another in vivo study has shown that ovariectomy in female rats is associated with reduced pai-1 expression , while estrogen replacement counteracts this change promoting emp formation . in vitro studies other mechanisms have also been revealed to be involved in the proangiogenic effect of estrogen including increased expression of both vegf and its receptors [ 104 , 105 ] and bfgf , as well as expression of vascular adhesion molecules . moreover , estrogen is known to enhance nitric oxide production and release by endothelial cells . studies published by reed and edelberg have suggested that a physiological decrease in the concentration of steroid hormones ( e.g. , estrogen and testosterone ) as a result of menopause and chronological aging may contribute both directly and indirectly to subsequent deficits in the synthesis and function of the angiogenic growth factor tgf- . in humans endogenous estrogen contributes to the anticoagulant , anti - inflammatory , and antithrombotic properties of the endothelium . the numbers of endothelium , platelet , and monocyte - derived microparticles have been found to be elevated in low - estrogen menopausal women . the authors implied that increased numbers of procoagulant microparticles provide a resource to study mechanisms for cardiovascular risk development in newly menopausal women . on the other hand , studies demonstrated by rank et al . had shown that hormone replacement therapy in postmenopausal women increased the concentration of mps derived from platelets . the emp levels were unchanged excluding their primary role in the initiation of a thromboembolic event in these women . another study has shown that emp concentration was diminished in older patients ( > 80 years , male or female ) but mp procoagulant activity was preserved in comparison to younger patients . the authors suggested that a decreased emp level was associated with age and any effect of gender was ruled out by multivariate analysis . the study performed by mateos - caceres had shown an increased level of circulating emps in elderly ( > 66 years ) male and female patients with acute stroke and that tnf activated emps were the major player in stroke induction . furthermore , simak et al . demonstrated that circulating emp phenotypes may be associated with the severity , lesion volume , and outcome of acute ischemic stroke ( ais ) in male patients ( > 78 years ) . on the other hand , studies published by williams et al . have shown that in elderly patients of both genders ( > 66 years ) , emp levels were similar in ais and stroke mimic patients . moreover , they demonstrated that emps were generated via activation and not by apoptosis / necrosis of endothelial cells . this suggested that emps may not be an appropriate marker for ais , given the incapability to distinguish between ais and stroke mimic . the tree - city cohort studies have shown that increased thrombin generation is an independent predictor of ais in elderly women suggesting that hypercoagulability may play an important role in the pathogenesis of ais . indicated that elevated plasma pai-1 levels are a strong risk factor for stroke at old age in people of both genders ; however , the 4g/5 g polymorphism variant of pai-1 is associated with reduced incidence of stroke . it has been shown that the single polymorphism pai-1 4g/5 g genotype is associated with higher central systolic , diastolic , and mean arterial blood pressure in women ( > 70 years ) , while no association was found in men suggesting gender specific biology of pai-1 in addition to an advanced age specific factor . moreover , elevated levels of circulating mps have been reported in patients ( > 58 years , male or female ) with acute myocardial infarction and coronary artery disease . studies published by sinning et al . have shown that circulating emps , but not mps of other cellular origin , are a strong predictor of cardiovascular mortality and major cardiovascular events in patients ( > 66 years , male or female ) with coronary artery disease and pulmonary hypertension . all these data may indicate that estrogen probably does not exert its protective effects on cv diseases through the emp axis . however , more analyses are needed in order to confirm if a direct connection occurs between estrogen and emps in age - related vascular diseases ( figure 4 ) .", "endothelial microparticles , as pleiotropic factors , play a role in both physiological and pathological conditions and thus may contribute to regulation of vascular homeostasis . emps not only reflect the stage of disease but also play a causative role in the development of various vascular diseases . they can modulate coagulation , and their elevated levels have been observed in many conditions associated with inflammation and angiogenesis . the prothrombotic properties and proinflammatory effects of microparticles on endothelial cells affect vascular aging and lead to structural changes in the heart and other organs . thrombin and pai-1 seem to be key factors involved in emp generation in age - related vascular disease . furthermore , in age - related vascular diseases , steroid hormones are among the factors that have been shown to have an influence on vascular homeostasis . specifically , estrogen plays a regulatory function on vessel inflammation , injury , and repair . lack of estrogen has been suggested to be directly involved in the endothelial cell injury with emp release that is observed in ischemic diseases . however , the direct link between emp generation , emp release , and estrogen is understudied and the further investigation of cellular and molecular mechanisms of these correlations is imperative for understanding and providing a basis for new translational investigations . furthermore , circulating emps show great promise not only as biomarkers in the diagnostics of vascular diseases but also as a target for the treatment of these disorders , especially in elderly patients ." ]

[ "type 2 diabetes is the most common metabolic disorder worldwide and its prevalence is growing at an alarming rate in both developed and developing countries . it is characterized by abnormalities in carbohydrate , lipid and lipoprotein metabolism , which lead to hyperglycemia and many complications such hyperlipidemia , hyperinsulinemia , hypertension and atherosclerosis . lifestyle changes , weight control , physical activity and healthy nutrition practices are vital for persons with diabetes to maintain quality of life and longevity . also as an alternative approach , medicinal herbs with antihyperglycemic activities are increasingly sought by diabetic patients and health care professionals . cinnamon is the bark of cinnamomum zeylanicum and has been used as traditional folk herbs to treat disease thousands of years in asia . both in vitro and in vivo studies have shown that cinnamon is an insulin sensitizer.[610 ] in 3t3 l1 adipocyte , cinnamon extract stimulates glucose uptake , glycogen synthesis and activated glycogen synthase . in rats cinnamon enhanced glucose uptake by enhancing insulin stimulated tyrosine phosphorylation of insulin receptor , insulin receptor substrate 1 , and phosphatidylinositol 3 kinase in a dose dependent fashion . several clinical trials[1216 ] have investigated the impact of cinnamon on glucose and plasma lipid concentrations in patients with diabetes but yielded conflicting results . khan et al . presented the first data on the effects of cinnamon supplementation in humans . they reported a substantial reduction in fasting serum glucose ( 18 - 29% ) and blood lipid profile after 40 d of daily supplementation with one , three , or six grams of whole cinnamon in patients with type 2 diabetes . more recently , mang et al . reported a 10.3% reduction in fbg after four months of supplementation with a purified aqueous cinnamon extract . however , data from vanschoonbeek et al . shows no effect of cinnamon spice ingestion on whole body insulin sensitivity , oral glucose tolerance or lipid profiles in postmenopausal type 2 diabetic patients . the present study investigated the proposed benefit of cinnamon use in patients with type 2 diabetes . therefore a randomized , placebo controlled , double blind study was performed in 44 patients with type 2 diabetes . in this study , we assessed the effects of eight weeks of three grams per day cinnamon supplementation ( cinnamomum zeylanicum ) on glycemic status , lipid profiles , blood pressure and body composition in type 2 diabetic patients .", "the study was approved by the medical ethical committee of tehran university of medical science ( code p/26/d5/147 ) and was supported by grants from vice chancellor of research ( grant number p/608 ) . a total of 44 individuals with type 2 diabetes were selected to participate in this study . type 2 diabetes was verified according to the criteria set by the who in 1999 . the objectives of study and risks of experimental procedures were explained to the volunteers , after which their written informed consent was obtained . inclusion criteria were non - insulin dependent type 2 diabetes , aged between 30 - 65 years , hba1c between 6 - 8% and fbg levels between 126 - 160 mg / dl . exclusion criteria were cholesterol > 240 mg / dl , triglyceride > 400 mg / dl , smoking and alcohol consumption , pregnancy and lactation , allergy to cinnamon , liver or renal or thyroid diseases and hemolytic anemia . all subjects were stable because medication had not modified over the last month and there were homogeneity regarding their treatments ( metformin : 1 - 1.5 gr / d , gliclazide : 160 - 240 mg / d ) . subjects were selected based on inclusion criteria among patients who came to the endocrinology and metabolism center , tehran university of medical sciences and randomly assigned to cinnamon ( n=22 ) or placebo group ( n=22 ) . cinnamon and wheat flour were ground finely and put into capsules which could not be distinguished by color , odor , or taste . subjects were instructed to ingest two capsules at each main meal ( breakfast , lunch and dinner ) for eight weeks . compliance to the supplementation protocol was supervised by a research technician who contacted the subjects once a week . each subject was required to return the original bottle of their respective supplement for capsule counts and compliance was monitored by counting the unconsumed capsules each week . we chose this dose because it is achievable if we want to use it as a spice in future and there is no side effect for this dose in this target group based on literature.[1316 ] all medication was continued as usual and subjects were advised to maintain their normal diet and continue their habitual physical activity throughout the study . to verify this , subjects completed three day food records ( two weekday and one weekend day ) at baseline and end of study . food records were analyzed by nutritionist iv ( n squared computing , san bruno ca ) . physical activity levels were measured with international physical activity questionnaire at baseline and end of study . two moved and five were unwilling to continue ; so 37 patients completed the study ( 19 patients in the intervention group and 18 in the control group ) . weight , height , body composition and blood pressure were measured in the fasting state with minimal clothing and without shoes in the beginning and end of study . standing height was measured using a wall mounted stadiometer and body composition was measured with e body 205 ( body composition analyzer ) . after 10 - 12 h overnight fasting , blood sample was collected from each subject at the beginning and at the end of eight week trial . all blood samples were taken in the morning at approximately the same time of day to minimize diurnal variation and immediately centrifuged at 3000 g for 10 min at 20c . fasting plasma glucose and hba1c were analyzed immediately ; aliquots of plasma were stored at 70c until lipid profile and insulin analysis . fasting plasma glucose was analyzed by the glucose oxidase method ( pars azmoon kit , iran ) . insulin was analyzed by immunoradiometric assay ( irma ) method ( immunotech co. kit , france ) . serum concentrations of triglyceride and total cholesterol were analyzed using the glycerol-3-phosphate oxidase - phenol+aminophenazone ( gpo pap ) kit as described in our previous study and the cholesterol oxidase - phenol+aminophenazone ( chod pap ) kit , respectively ( pars azmoon kit , iran ) . apo lipoproteins ai and b were analyzed by immunoturbidometry method by using auto analyzer cobas ( pars azmoon kit , iran ) . statistical analyses were performed using statistical package for the social sciences ( spss ) software ( version 14 ; spss inc , chicago , usa ) . qualitative variables , such as physical activity , were analyzed using chi square test . for comparison variables before and after the intervention within each group , paired t test was used . adjustment for differences in baseline covariates and changes in variables during study were performed by analysis of covariance ( ancova ) .", "the study was approved by the medical ethical committee of tehran university of medical science ( code p/26/d5/147 ) and was supported by grants from vice chancellor of research ( grant number p/608 ) . a total of 44 individuals with type 2 diabetes were selected to participate in this study . type 2 diabetes was verified according to the criteria set by the who in 1999 . the objectives of study and risks of experimental procedures were explained to the volunteers , after which their written informed consent was obtained . inclusion criteria were non - insulin dependent type 2 diabetes , aged between 30 - 65 years , hba1c between 6 - 8% and fbg levels between 126 - 160 mg / dl . exclusion criteria were cholesterol > 240 mg / dl , triglyceride > 400 mg / dl , smoking and alcohol consumption , pregnancy and lactation , allergy to cinnamon , liver or renal or thyroid diseases and hemolytic anemia . all subjects were stable because medication had not modified over the last month and there were homogeneity regarding their treatments ( metformin : 1 - 1.5 gr / d , gliclazide : 160 - 240 mg / d ) . subjects were selected based on inclusion criteria among patients who came to the endocrinology and metabolism center , tehran university of medical sciences and randomly assigned to cinnamon ( n=22 ) or placebo group ( n=22 ) . cinnamon and wheat flour were ground finely and put into capsules which could not be distinguished by color , odor , or taste . subjects were instructed to ingest two capsules at each main meal ( breakfast , lunch and dinner ) for eight weeks . compliance to the supplementation protocol was supervised by a research technician who contacted the subjects once a week . each subject was required to return the original bottle of their respective supplement for capsule counts and compliance was monitored by counting the unconsumed capsules each week . we chose this dose because it is achievable if we want to use it as a spice in future and there is no side effect for this dose in this target group based on literature.[1316 ] all medication was continued as usual and subjects were advised to maintain their normal diet and continue their habitual physical activity throughout the study . to verify this , subjects completed three day food records ( two weekday and one weekend day ) at baseline and end of study . food records were analyzed by nutritionist iv ( n squared computing , san bruno ca ) . physical activity levels were measured with international physical activity questionnaire at baseline and end of study . two moved and five were unwilling to continue ; so 37 patients completed the study ( 19 patients in the intervention group and 18 in the control group ) . weight , height , body composition and blood pressure were measured in the fasting state with minimal clothing and without shoes in the beginning and end of study . standing height was measured using a wall mounted stadiometer and body composition was measured with e body 205 ( body composition analyzer ) . after 10 - 12 h overnight fasting , blood sample was collected from each subject at the beginning and at the end of eight week trial . all blood samples were taken in the morning at approximately the same time of day to minimize diurnal variation and immediately centrifuged at 3000 g for 10 min at 20c . fasting plasma glucose and hba1c were analyzed immediately ; aliquots of plasma were stored at 70c until lipid profile and insulin analysis . fasting plasma glucose was analyzed by the glucose oxidase method ( pars azmoon kit , iran ) . insulin was analyzed by immunoradiometric assay ( irma ) method ( immunotech co. kit , france ) . serum concentrations of triglyceride and total cholesterol were analyzed using the glycerol-3-phosphate oxidase - phenol+aminophenazone ( gpo pap ) kit as described in our previous study and the cholesterol oxidase - phenol+aminophenazone ( chod pap ) kit , respectively ( pars azmoon kit , iran ) . apo lipoproteins ai and b were analyzed by immunoturbidometry method by using auto analyzer cobas ( pars azmoon kit , iran ) . statistical analyses were performed using statistical package for the social sciences ( spss ) software ( version 14 ; spss inc , chicago , usa ) . qualitative variables , such as physical activity , were analyzed using chi square test . for comparison variables before and after the intervention within each group , paired t test was used . adjustment for differences in baseline covariates and changes in variables during study were performed by analysis of covariance ( ancova ) .", "the study was approved by the medical ethical committee of tehran university of medical science ( code p/26/d5/147 ) and was supported by grants from vice chancellor of research ( grant number p/608 ) . a total of 44 individuals with type 2 diabetes were selected to participate in this study . type 2 diabetes was verified according to the criteria set by the who in 1999 . the objectives of study and risks of experimental procedures were explained to the volunteers , after which their written informed consent was obtained . inclusion criteria were non - insulin dependent type 2 diabetes , aged between 30 - 65 years , hba1c between 6 - 8% and fbg levels between 126 - 160 mg / dl . exclusion criteria were cholesterol > 240 mg / dl , triglyceride > 400 mg / dl , smoking and alcohol consumption , pregnancy and lactation , allergy to cinnamon , liver or renal or thyroid diseases and hemolytic anemia . all subjects were stable because medication had not modified over the last month and there were homogeneity regarding their treatments ( metformin : 1 - 1.5 gr / d , gliclazide : 160 - 240 mg / d ) .", "subjects were selected based on inclusion criteria among patients who came to the endocrinology and metabolism center , tehran university of medical sciences and randomly assigned to cinnamon ( n=22 ) or placebo group ( n=22 ) . cinnamon and wheat flour were ground finely and put into capsules which could not be distinguished by color , odor , or taste . subjects were instructed to ingest two capsules at each main meal ( breakfast , lunch and dinner ) for eight weeks . compliance to the supplementation protocol was supervised by a research technician who contacted the subjects once a week . each subject was required to return the original bottle of their respective supplement for capsule counts and compliance was monitored by counting the unconsumed capsules each week . we chose this dose because it is achievable if we want to use it as a spice in future and there is no side effect for this dose in this target group based on literature.[1316 ] all medication was continued as usual and subjects were advised to maintain their normal diet and continue their habitual physical activity throughout the study . to verify this , subjects completed three day food records ( two weekday and one weekend day ) at baseline and end of study . food records were analyzed by nutritionist iv ( n squared computing , san bruno ca ) . physical activity levels were measured with international physical activity questionnaire at baseline and end of study . two moved and five were unwilling to continue ; so 37 patients completed the study ( 19 patients in the intervention group and 18 in the control group ) . weight , height , body composition and blood pressure were measured in the fasting state with minimal clothing and without shoes in the beginning and end of study . standing height was measured using a wall mounted stadiometer and body composition was measured with e body 205 ( body composition analyzer ) . after 10 - 12 h overnight fasting , blood sample was collected from each subject at the beginning and at the end of eight week trial . all blood samples were taken in the morning at approximately the same time of day to minimize diurnal variation and immediately centrifuged at 3000 g for 10 min at 20c . fasting plasma glucose and hba1c were analyzed immediately ; aliquots of plasma were stored at 70c until lipid profile and insulin analysis .", "fasting plasma glucose was analyzed by the glucose oxidase method ( pars azmoon kit , iran ) . insulin was analyzed by immunoradiometric assay ( irma ) method ( immunotech co. kit , france ) . serum concentrations of triglyceride and total cholesterol were analyzed using the glycerol-3-phosphate oxidase - phenol+aminophenazone ( gpo pap ) kit as described in our previous study and the cholesterol oxidase - phenol+aminophenazone ( chod pap ) kit , respectively ( pars azmoon kit , iran ) . apo lipoproteins ai and b were analyzed by immunoturbidometry method by using auto analyzer cobas ( pars azmoon kit , iran ) .", "statistical analyses were performed using statistical package for the social sciences ( spss ) software ( version 14 ; spss inc , chicago , usa ) . qualitative variables , such as physical activity , were analyzed using chi square test . for comparison variables before and after the intervention within each group , paired t test was used . adjustment for differences in baseline covariates and changes in variables during study were performed by analysis of covariance ( ancova ) .", "baseline characteristics did not differ between the two groups of the study population [ table 1 ] . energy intake , macronutrient and micronutrient composition of the diet did not differ between groups at baseline and did not change in the placebo or cinnamon group during the intervention period . physical activity levels did not differ between groups at baseline and did not change during the study . table 2 shows the fasting plasma glucose concentrations , hba1c , serum lipids , anthropometric variables and the corresponding differences of these variables for the cinnamon and placebo groups . while the fbg , hba1c and triglyceride levels in the cinnamon group was significantly reduced after the intervention compared with baseline ( p=0.005 , p=0.008 , p=0.038 respectively ) , no such effect were observed in the placebo group . no significant intragroup differences were observed in insulin or lipid profile ( total cholesterol , hdl cholesterol , ldl cholesterol , apo lipoproteins ai and b ) . body weight and bmi in both groups were significantly reduced after the intervention compared with baseline ( p=0.017 , p=0.010 respectively ) . fat body mass was significantly reduced in cinnamon group , ( p=0.047 ) but not in placebo group . no significant intergroup differences were observed in glycemic parameters , lipid profile , anthropometric variables and blood pressure . baseline characteristics of the study population biochemical and anthropometric variables at baseline and after the intervention period", "our findings indicate that consuming three gram per day of cinnamon for eight weeks leads to significant reduction in some biochemical and anthropometric variables compared with baseline ( i.e. , fbg decreased by 9.2% , hba1c decreased by 6.12% , triglyceride decreased by 15.38% , body weight decreased by 1.19% , bmi decreased by 1.54% and fat body mass decreased by 1.36% ) . but these reductions were not significant compare to placebo group . khan et al . studied the effects of one , three , and six grams per day of whole cinnamon powder on fbg and serum lipids in 60 people with poorly controlled type 2 diabetes from pakistan . after 40 days of supplementation , fbg decreased by 18 - 29% , cholesterol decreased by 12 - 26% , ldl cholesterol decreased by 7 - 27% , and triacylglycerol decreased by 23 - 30% . consequently the authors concluded that small amount of cinnamon represent a safe and effective mean to reduce the risk factors associated with type 2 diabetes . in the cinnamon group , we observed a significant reduction of plasma glucose ( 9.2% ) after eight weeks of treatment but not in the placebo group . the observed reduction in fbg in our study is less than that of khan et al . and similar in magnitude to mang et al . who supplemented 79 diabetic patients with three grams per day cinnamon powder or a placebo for four months although no changes in blood lipids or hba1c were noted in their study , researchers did find a 10.3% reduction in fbg . also the decrease in plasma glucose correlated significantly with the baseline concentrations indicated that subjects with a higher initial plasma glucose level may show more reduction after cinnamon intake . however data from vanschoonbeek et al . showed no effect of cinnamon spice ingestion on whole body insulin sensitivity , oral glucose tolerance or lipid profiles in a postmenopausal type 2 diabetes mellitus ( t2 dm ) group . the positive correlation between baseline plasma glucose and the decrease of plasma glucose in mang et al . study and the strong decrease of serum glucose in the poorly controlled pakistani diabetics ( mean fasting glucose ( 140 - 400 mg / dl ) concentrations ) , suggest that subjects with poor glycemic control may benefit more from cinnamon intake . no significant intergroup and intragroup differences were observed in lipid profile except in triglyceride that decreased significantly in cinnamon group compared with the baseline . insulin resistance leads to the overproduction of very low density lipoproteins ( vldls ) and to reduce lipoprotein lipase activity , thereby resulting in dyslipidemia . obviously , the decrease of plasma glucose concentrations in our study was not sufficient to induce an improvement in the lipoprotein concentrations . also our subjects lipid levels were not abnormal , while pakistani subjects in khan et al . no significant intergroup differences were observed in anthropometric variables . there were no changes regarding the systolic / diastolic blood pressure after the intervention compared with baseline in our study . ziegenfuss et al . reported statistically significant decrease in systolic bp ( from 133 to 129 mm hg ) and increases in lean mass ( + 1.1% ) compared with the placebo group . additionally , within - group analyses uncovered small , but statistically significant decreases in body fat ( 0.7% ) in the cinnamon group . it is possible that the improvements in fbg , as well as plasma antioxidant status are responsible , at least in part , for cinnamon 's beneficial effects on body composition and features of the metabolic syndrome like blood pressure . couturier et al . suggested that in animals fed a high fat / high fructose diet to induce insulin resistance , cinnamon alters body composition in association with improved insulin sensitivity . the decreases of plasma glucose and insulin concentrations and weight in our study were not sufficient to induce an improvement of the blood pressure . regarding the limitations of our study , we can point to the duration of study ( eight weeks ) and dose of the cinnamon ( three grams per day ) . there are some studies with longer duration and it would be better if we could have possibility for continuing the intervention which it was impossible because subjects had time limitations to come to the study center ( endocrinology and metabolism center , tehran university of medical sciences ) and compliance was limited if we extend the time . there are some studies that use more than three grams per day cinnamon and detect significant effects and it would be better if we could have another group with higher dose of cinnamon for comparing doses that was impossible because of financial limitations .", "in conclusion , our study shows that in type 2 diabetic patients , the intake of three grams per day cinnamon may lead to a moderate effect on glycemic status indicators , but does not improve blood pressure , blood lipid profile or body composition parameters ." ]

[ ". failed endotracheal intubation and inadequate ventilation with insufficient oxygenation may lead to serious complications , even death . management of an unexpectedly difficult airway consists of laryngeal mask ventilation , gum - elastic bougie and video laryngoscopy - assisted intubation . gum - elastic bougie is the easiest and cheapest tool used in case of an unexpected difficult intubation occurring in the operating room .", "a 53-year - old male patient with hypogonadotropic hypogonadism presented as an unexpected difficult intubation after the induction of anesthesia .", "a difficult airway has been described in patients with a variety of endocrine disorders , including pituitary diseases , but not with hypogonadism . there may be an unrevealed relationship between hypogonadism and difficult airway . gum - elastic bougie is still the most attainable and effective tool in the operation room in this situation .", "anesthesiologists are responsible for maintaining a patent airway in the anesthetized patient . failed endotracheal intubation and inadequate ventilation with insufficient oxygenation may lead to serious complications , as even a few minutes of deoxygenation can result in catastrophic outcome like brain damage or even death.1 anesthesiologists are occasionally faced and challenged with this significant problem in practice . a difficult airway has been described in patients with pituitary endocrine disorders such as acromegaly and dwarfism ; however , airway problems with hypogonadism have not been well identified in the literature.2", "a 53-year - old married man ( weight : 85 kg , height : 187 cm , body mass index : 24 kg / m ) presented with a history of nasal obstruction for two years . he had not had any prior operation under general anesthesia , so he did not have any history of difficult intubation , and he did not have any chronic systemic disease . the patient was evaluated for obstructive sleep apnea syndrome ( osas ) with a comprehensive questionnaire on his sleeping habits and medical history ; no complaints or predictors pertaining to osas were identified . the patient s preoperative airway assessment was normal , mallampati class was ii , thyromental distance was 7 cm , inter - incisor gap was 5 cm , and head extension was > 35. his physical examination was characterized by lack of secondary sexual characteristics and presence of fine facial wrinkles . although , as previously indicated , the patient was married , he had had no children . his hormone profile was : testosterone 0.3 ng / ml ( reference range 1.757.81 ) , free testosterone 0.91 ( reference range 4.542.0 ) , prolactin 1.31 ng / ml ( reference range 2.6426.72 ) , luteinizing hormone ( lh ) 0.33 miu / ml ( reference range 1.24103.03 ) . no other pathological finding was obtained as the result of magnetic resonance imaging of the pituitary gland . he was admitted to the operating theater , and following the induction of anesthesia with a dose of 5 mg / kg intravenous thiopental , bag - mask ventilation was barely sustained . fentanyl ( 12 gr / kg ) and , as a muscle relaxant , rocuronium ( 0.6 mg / kg ) were administered . while the patient s head was in the sniffing position , direct laryngoscopy and intubation of the trachea were attempted three times with different sizes of macintosh and miller blades by an assistant professor of anesthesiology with 5 years experience . however , unfortunately , the intubation failed . the lungs were then ventilated with 100% oxygen via a face mask in order to avoid desaturation . glottic visualization was assessed with cook s modification of the cormack lehane classification ; a grade of 3a ( with direct laryngoscopy , only the epiglottis can be visualized ; the epiglottis can be lifted using an introducer or bougie ) was assigned.3 the patient was subsequently successfully intubated with a gum - elastic bougie . after the operation , the patient was extubated successfully without any complication and then examined by otorhinolaryngologists via fexible laryngoscopy . the epiglottis was found to be in a slightly lower than normal position ( figure 1 ) .", "the overall incidence of unexpected difficult intubation is estimated to be 1%3% , while failed intubation incidence is 0.05%0.35% in europe.1 difficult endotracheal intubation has been described in patients with pituitary diseases like acromegaly , cushing s disease , lh / follicle - stimulating hormone - secreting adenoma , thyroid - stimulating hormone - secreting adenoma , nonfunctional adenoma and prolactinoma.4 difficult airway with dwarfism has also been described . however , difficult airway with a hypogonadotropic patient has not yet been clearly defined . in our case , further , magnetic resonance imaging of the pituitary gland did not reveal any adenoma or mass lesion.2 pulsatile release of follicle stimulating hormone and lh in puberty instigates the development of the male larynx and secondary sexual characteristics . the growth of laryngeal cartilages and maturation of the male larynx is also facilitated by androgen . high - affinity androgen receptors have been found in the human larynx.5,6 in this case , the patient s laryngeal development was compatible with his age and sex . only the epiglottis was located in a slightly lower position than normal , partially leaning toward the laryngeal passage . the patient was infertile and lacked secondary sexual characteristics due to insufficient exposure to androgens . the rate of difficult intubation has been found to be higher in osas patients than the normal , healthy population.7 body mass index , mallampati grading , cormack lehane classification , sternomental distance , and thyromental distance evaluation might be predictive factors for difficult airway in osas patients . as such , anesthesiologists must be aware of this fact and be prepared for difficult intubation in osas patients.7 however , the rate of difficult intubation has not been found to be related to the severity of osas.8 no significant relationship between the apnea hypopnea index and difficult intubation has been found.8 in our patient , no apnea and daytime sleepiness were present in his history . only snoring was present , which might well have been associated with nasal septal deviation . his body mass index was 24 kg / m , mallampati class was ii , thyromental distance was 7 cm , inter - incisor gap was 5 cm , and head extension was above 35. these findings did not suggest any evidence of osas or difficult airway . this multiparameter test reveals the presence and severity of osas.9 in this case , as there was no clinical index of suspicion for osas and to keep costs down , polysomnography was not required by the otorhinolaryngologists .", "thus , anesthesiologists must take into account difficult airway in endocrinological disorders like hypogonadotropic hypogonadism and be prepared for difficult intubation ." ]

[ "we reviewed the medical records of patients who had l. monocytogenes isolated from blood and body fluids from sterile sites during 19962008 at the national taiwan university hospital ( ntuh ) , a 2,500-bed hospital in taiwan . we evaluated disease severity using modified acute physiology and chronic health evaluation ii scores ( 8) . incidence of nontyphiodal salmonella bacteremia ( ntsb ) during 20002008 in ntuh was calculated for trend comparison of the 2 foodborne illnesses . only 1 episode was calculated during the same admission for ntsb to avoid the influence of repetitive bacteremia . isolates from patients with fetomaternal listeriosis ( i.e. , paired isolates from mother and neonate who had listeriosis ) were considered to be the same and only 1 of them was analyzed . all isolates were analyzed for their serotype by pcr as described , and genetic relatedness was evaluated by pulsed - field gel electrophoresis ( pfge ) by using pulsenet standardized protocols and 2 restriction enzymes ( asci and apai ) ( 2,9 ) . strains were considered to be of the same cluster if their bands had indistinguishable restriction patterns by both enzymes . strains with pfge patterns with > 80% similarity by asci and apai profiles were considered to be closely related . a forward stepwise model with a p value of 0.1 was used , and p<0.05 was considered statistically significant in the multivariate cox proportional hazards model . during the study period , listeriosis was diagnosed in 48 patients , and 46 nonduplicated isolates were obtained for further microbiological analysis . average annual incidence increased from 0.0287 cases per 1,000 admissions during 19962004 to 0.118 cases per 1,000 admissions during 20052008 ( figure 1 ) . the increase in annual incidence of listeriosis was significantly correlated with years ( p = 0.0045 ) . the average annual incidences of ntsb were 1.189 and 1.118 per 1,000 admissions during 20002004 and 20052008 , respectively ; it was not significantly correlated with years ( p = 0.50 ) . age - specific incidence of listeriosis increased at both extremes of age , but especially among patients > 80 years ( figure 2 ) . all of the patients with listeriosis lived in northern taiwan , and no obvious geographic correlation was observed between listeriosis patients in each year . incidence ( cases per 1,000 admissions ) of human listeriosis and serotype distribution of all isolates , national taiwan university hospital , taipei , taiwan , 19962008 . forty - six isolates were available for analysis , including 2 serotype 4b isolates from fetomaternal transmission in 2005 and 2006 and 1 serotype 4b from a pediatric patient ( 2005 ) . patient distribution and incidence of human listeriosis , by age group , national taiwan university hospital , taipei , taiwan , 19962008 . all 43 patients had underlying predisposing conditions , and 18 ( 42% ) were > 65 years of age . of the 30 patients with malignancies , 23 ( 77% ) one female patient had coexisting non - hodgkin lymphoma and colon cancer ; 1 male patient had coexisting non - hodgkin lymphoma , gastric cancer , and bladder cancer . initial modified acute physiology and chronic health evaluation ii score , mean sd : 18.8 7.3 . among the 46 isolates , serotype 1/2b was identified most frequently ( 46% ) , followed by 1/2a ( 28% ) and 4b ( 26% ) . all 46 isolates were susceptible to ampicillin , ertapenem , meropenem , and vancomycin ; 3 isolates were intermediately susceptible to trimethoprim / sulfamethoxazole ; and 4 isolates were nonsusceptible to linezolid ( 10 ) . sixteen ( 37% ) patients received cephalosporin alone as initial treatment regimens and empirical treatment was effective for only 14 ( 33% ) . the presence of solid - organ malignancies was a significant negative prognostic factor for 14-day mortality in the univariate analysis ( 95% confidence interval [ ci ] 1.16516.694 ; p = 0.029 ) but not in the multivariate analysis . the results of the multivariate analysis for 14-day mortality showed that hepatic decompensation at disease onset was a significant negative prognostic factor ( hazard ratio 12.02 , 95% ci 1.84278.470 ; p = 0.009 ) and that the use of effective antimicrobial drugs after culture results were reported was a significant positive prognostic factor ( hazard ratio 0.014 , 95% ci 0.0020.131 ; p<0.001 ) . log - rank tests performed to compare the difference in survival between patient groups for the 2 variables also had the same results ( p<0.001 ) .", "we observed an upsurge of listeriosis beginning in 2005 in ntuh . the increase might not be attributable to common - source outbreaks because no clustering was detected . the annual incidence of listeriosis has been on the rise in europe since 2000 ( 2,3,11 ) . the reason is not clear because the increase could not be attributed to outbreak clusters and no increase in pregnancy - related listeriosis was observed ( 2,3 ) . wong et al . found that l. monocytogenes was isolated in > 50% of pork samples and chicken carcasses ( 6 ) . semiready foods ( dumplings and meatballs ) and frozen dim sum examined also carried the pathogen ( 34.0% and 4.4% , respectively ) , and > 60% of the isolates were serotype 1 or 4 ( 6 ) . if served undercooked , these foods could be potential transmission sources . taiwan currently has no strict regulatory policy regarding listeriosis in the food industry and no disease surveillance system . in france , serotype 4b was the predominant serotype ( 42%56% ) , whereas serotype 1/2b was more common ( 46% ) in our study ( 2 ) . none of the isolates were resistant to the tested agents , except for 4 isolates , which were resistant to linezolid . the contributions of disease severity and antimicrobial drug treatment are difficult to evaluate in population - based studies ( 12 ) . brouwer et al . reported that up to 30% of adults with l. monocytogenes meningitis did not receive initial adequate antimicrobial drug therapy , and they found no association between that variable and outcome ( 13 ) . a high proportion ( 37% ) of patients in our study initial disease severity and initial adequate antimicrobial drug therapy was not associated with overall mortality . we found that mortality was related to hepatic decompensation and effective antimicrobial drug therapy after culture results were reported . therefore , the incidence of and risk factors for human listeriosis in taiwan could not be determined precisely , and potential outbreaks might have been overlooked . the retrospective design of our study limited the possibility of identifying the potential vehicles and disease - acquiring behaviors . an increase of listeriosis was noted since 2005 in our hospital , and all of the affected patients had predisposing factors that hampered their immunity . dietary education and food management information should be provided to high - risk groups in taiwan . food monitoring and human disease surveillance systems need to be established in taiwan to control this potentially fatal foodborne disease ." ]

[ "three cats , siamese or siamese cross , were presented with a chronic thoracic limb weightbearing lameness . previous anti - inflammatory administrations were unable to improve lameness consistently in the three cats . two of the three cats had undergone onychectomy several years before presentation . a permanent flexion of the proximal interphalangeal joint of one or more digits , associated with a difficult and painful extension of the proximal interphalangeal joint , for all cats , treatment consisted of a tenectomy or tenotomy of the superficial and deep digital flexor tendons in order to release the contracture . the three cats responded well to the surgical treatment and became sound around 24 weeks after surgery .", "it should be considered in a differential diagnosis of feline lameness whenever onychectomy has been performed in the past . the precise etiology that explains this tendon contracture is unknown , but trauma or breed predisposition could represent potential causes .", "digit lesions are most often associated with fractures , luxations , wounds , shearing injuries or tumors , and , less commonly , osteomyelitis or osteoarthritis . various surgical interventions are feasible , and digit amputation or luxation reduction is the most frequently performed treatment . feline onychectomy is also a common surgery in north america , despite debate over the ethics of this procedure . feline digital flexor tendon pathology , especially tendon contracture , is not well described . to our knowledge , the term contracture refers to an abnormal pathologic process resulting in fibrosis and permanent damage to a muscle , characterized by replacement of the muscle and/or associated tendon with fibrous connective tissue . this phenomenon leads to shortening of the tendon or the muscle , and can have functional consequences on the range of motion of adjacent joints . most contractures are associated with a previous trauma , weeks to months before the contracture occurs , but repetitive strains , infectious diseases , ischemia , compartment syndrome or neoplasia may also lead to contracture . this case series reports three different clinical presentations of digital flexor tendon contracture in three cats , all successfully treated by tenectomy .", "a 4-year - old neutered male siamese cat weighing 4.8 kg was presented to a referral hospital for chronic left forelimb weight - bearing lameness of 1 year s duration . the cat showed mild and transient lameness improvement with meloxicam ( 0.05 mg / kg po q24h metacam ; boehringer ingelheim ) , but long - term medication did not show any additional benefits . the cat showed very mild lameness , with the left forelimb constantly non - weight bearing at rest . a permanent flexion of the proximal interphalangeal joint of the left forelimb second digit was noted . extension of the proximal interphalangeal joint was possible but very difficult and palpation of this digit was significantly painful . six months after initial presentation , the cat was presented for follow - up , without improvement . radio - graphic views of the left forelimb extremity revealed an abnormal positioning of the middle phalanx . indeed , the angulation between the middle and proximal phalanges was decreased and reached almost 90 between these two phalanges on the second digit . there was no evidence of retention of remnants , osteomyelitis or hyperostosis of the distal phalanx . following premedication with hydromorphone ( 0.1 mg / kg iv hydromorphone ; summit ) and acepromazine ( 0.02 mg / kg iv atravent ; boehringer ingelheim ) , general anesthesia was induced with propofol ( 4 mg / kg iv diprivan ; astrazeneca ) and maintained with 2% isoflurane ( forane ; baxter ) in 100% oxygen after orotracheal intubation . the cat was placed in dorsal recumbency , and the palmar surface from mid - radius to the extremity of the limb was clipped and aseptically prepared . surgery involved a palmar approach to the proximal interphalangeal joint of the second digit , with a midline skin incision extending from the distal aspect of the carpal pad to the proximal aspect of the metacarpal pad . following blunt dissection , the deep and superficial digital flexor muscle tendons were visualized and elevated , and a portion of the tendons ( 5 mm ) were transected with a # 15 scalpel blade ( figure 1 ) . the surgical wound was copiously lavaged with 0.9% sodium chloride ( 0.9% sodium chloride irrigation ; baxter ) . the subcutaneous tissues were closed with a continuous pattern , using a 4 - 0 absorbable monofilament ( poliglecaprone 25 , monocryl ; ethicon ) . the skin was closed with an interrupted pattern , using a 4 - 0 non - absorbable monofilament ( polyamide 6 , ethilon ii ; ethicon ) . the patient was discharged from the hospital the day after the surgery with strict rest instructions for 3 weeks and meloxicam ( 0.05 mg / kg q24 h po ) for 2 weeks . two weeks after surgery , the owner mentioned that the cat was very active , walking normally at home and was more playful than before surgery . upon follow - up examination no lameness was observed , and manipulation of the left proximal interphalangeal joint of the second digit was normal and pain free . two years after surgery the owner reported that the cat was totally sound , very active and had returned to its usual activity level . intraoperative plantar visualization of the flexor tendons of the third digit before tenectomy ( black arrow ) , exposed with a periosteal elevator ( * ) . left is distal , right is proximal , up is medial , down is lateral )", "a 7-month - old neutered female siamese weighing 3 kg was presented for a lameness of the left forelimb of 2 months duration . the owner reported that the lameness was most likely due to a trauma that occurred 2 months previously and was permanent since the incident . the cat received two different unknown non - steroidal anti - inflammatories before presentation at our hospital and did not show any improvement . the lameness was moderate at a walk and severe and non - weight bearing when the cat was running . at rest , a non - weight bearing stance was also obvious on the left forelimb . a permanent flexion of the proximal interphalangeal joint was noted on the fourth digit of the left forelimb . five months after initial presentation , the cat was presented for the same condition , without any improvement regarding lameness or comfort upon palpation . radiographic views of the left forelimb extremity revealed an abnormal positioning of the middle phalanx compared with the proximal phalanx , characterized by a decreased angulation between these two phalanges on the fourth digit . following premedication with butorphanol ( 0.1 mg / kg iv torbugesic ; pfizer ) , general anesthesia was induced with propofol ( 4 mg / kg iv ) and maintained with 2% isoflurane in 100% oxygen after orotracheal intubation . a tenectomy of the deep and superficial digital flexor muscle tendons was performed as previously described for the first case . the surgical preparation and operative technique were similar to those used in case 1 , except that the surgical site was the tendons of the fourth digit . the cat was discharged from the hospital the day after surgery with strict rest instructions for 3 weeks and meloxicam ( 0.05 mg / kg q24h orally ) for 2 weeks . at the 2 week re - evaluation , the cat still presented a mild lameness of the left thoracic limb , although the extension of the proximal interphalangeal joint of the fourth digit was improved compared with preoperative examination . one month after surgery , the cat was totally sound and manipulation of the digit was not painful . at a 1.5 year postoperative follow - up , the owner reported that the cat was not limping anymore , was pain free and had returned to its normal activity .", "a 7-year - old neutered male siamese cross weighing 6 kg presented with right forelimb lameness , which had appeared a month earlier . the owner also reported that the cat had undergone onychectomy at 6 months of age . the cat received a non - steroidal anti - inflammatory treatment ( 0.05 mg / kg q24h po meloxicam ) for 2 weeks before presentation and did not show any improvement in lameness . upon examination , the cat s right forelimb was non - weight bearing at rest , and the cat was uncomfortable while walking on both forelimbs . a permanent flexion of the proximal interphalangeal joint was noted in all four digits of both forelimbs ( figure 2 ) . moreover , a 3 mm diameter white firm and painful callus was palpable at the craniodistal aspect , bilaterally , of the third and fourth digital pads . radiographic views of the forelimb extremity revealed an abnormal positioning on both limbs between the middle and the proximal phalanx . indeed , the angulation between these two phalanges was decreased and reached almost 90 in all digits . no bony or articular lesion or osteomyelitis of the proximal and middle phalanges was observed . remnants of the distal phalanx were not observed in the radiographs ( figure 3 ) . a digital flexor tendon contracture of both forelimb digits was then suspected , and , after discussion , the owner agreed to surgical treatment . flexor contracture of all digits can be visualized ( left is distal , right is proximal , up is dorsal , down is plantar ) forelimb oblique extremity radiographic view of the left limb in case 3 . an abnormal positioning between the middle and the proximal phalanx is observed in the four digits . the angulation between these two phalanges is decreased and reached almost 90 in all digits following premedication with hydromorphone ( 0.1 mg / kg iv ) , general anesthesia was induced with alfaxalone ( 2 mg / kg iv alfaxan ; abbott laboratories ) and maintained with 2% isoflurane in 100% oxygen after orotracheal tube placement . a local regional anesthetic bloc was performed bilaterally with bupivacaine ( 0.5 mg / kg sc marcane 0.5% ; hospira healthcare corporation ) . the surgical procedure was performed as described in case 1 for digits iii and iv of both forelimbs , and a tenotomy was performed on digits ii and v on both forelimbs ( figure 4 ) . the cat was discharged from the hospital the day after the surgery with strict rest instructions for 3 weeks , meloxicam ( 0.05 mg / kg q24h po ) for 6 days and buprenorphine ( 20 g / kg q8h sublingually buprenorphine ; chiron compounding pharmacy ) for 7 days . perioperative dorsal view of an operated limb ( ol ) and a preoperative limb ( pl ) in case 3 . flexor contracture is well visualized in pl compared with ol ol = on the left ; pl = on the right at the 2 week follow - up , the cat was totally sound and manipulation of the forelimb digits was very comfortable . at rest , digits were in hyperextension ( figure 5 ) . histopathologic examination of some parts of the flexor tendons revealed dense and thick collagen bundles associated with a few non - reactive small fibroblasts . these observations were considered to be consistent with a chronic degeneration or trauma of this tendon . a definitive diagnosis of flexor tendon contracture was made ( figure 6 ) . thoracic limbs of case 3 , 4 weeks after flexor tendon tenectomy and tenotomy photomicrograph of a tendon section from a domestic cat . note the presence of increased well - differentiated fibroblasts ( large arrows ) in the tendon accompanied by few small - caliber blood vessels ( arrowhead ) and thin collagen fibers ( thin arrows ) .", "the three cats reported in this study presented with chronic mild forelimb lameness associated with reduction of the normal extension of the proximal interphalangeal joint of one or more digits . a contracture of the digital flexor tendon was suspected and confirmed by histopathologic analysis in one case . this case series is of particular interest because it describes three different presentations of digital flexor tendon contracture in cats . in case 1 , which involved an onychectomized cat , tendon contracture involved only one digit , which is different from the two cases reported by cooper et al . in case 2 , the cat developed a tendon contracture on a digit , although it had not undergone onychectomy . case 3 is more comparable to the cases reported by cooper et al because this case involved tendon contracture of all digits in both forelimbs after onychectomy . however , such an important delay , as seen in this case , between onychectomy and the development of digital flexor tendon contracture has not been previously reported . we elected to perform only tenotomy on digits ii and v in case 3 because of a satisfactory intraoperative contracture release after tenotomy . however , although we thought that tenectomy was not mandatory to relieve contracture in theses digits , it could have been a valuable option for treatment of contracture . the surgical outcome was excellent in all cats , as in the two cases reported elsewhere . flexor contracture can be painful and disabling and can induce abnormal contact on normally non - contact areas of the digits . contracture release by tenectomy or tenotomy seemed to improve the lameness quickly , while long - term anti - inflammatory treatments failed in each of the cases reported here . the deep and superficial digital flexor tendons provide digital flexion through contraction of the muscle bellies . more precisely , the proximal interphalangeal joint is flexed by the action of the superficial digital flexor and the distal interphalangeal joint is flexed by the deep digital flexor . the superficial digital flexor ( flexor digitorum superficialis ) tendon runs on the palmar surface of the deep digital flexor tendon ( flexor digitorum profondus ) . it splits distally into four parts , which diverge to the second to fifth metacarpophalangeal joints , with the corresponding terminal tendons of the deep flexor tendon . each superficial digital flexor ends on the proximal aspect of the palmar surface of the middle phalanx after being perforated by its respective deep flexor tendon , which ends on the tuberosity of the distal phalanges of digits ii those superficial and deep tendons are bridged by three transverse ligaments , at the metacarpophalangeal joints and at the proximal and middle phalangeal joints , on each of the four main digits . in two of the cases reported here , tendon therefore , the cause of the contracture must have been distal to the common tendon . with the third cat , the contracture could have been located more proximally than the tendon division , but multiple contractures of the distal portion of each superficial digital flexor tendon were confirmed by histopathologic analysis . distal aspect of flexor tendon anatomy on a third thoracic digit ( distal digital annular ligament has been removed ) . * deep flexor tendon ; p1 = proximal phalanx ; p2 = middle phalanx ; p3 = distal phalanx ; ( + ) = superficial flexor tendon a precise etiology is unknown in these cats . however , a traumatic episode was reported by the owner of case 2 , and this could have been the initial cause of the flexor tendon damage that led to a chronic problem . two cats presented for bilateral and painful flexor tendon contracture following onychectomy have been previously reported . both cats underwent onychectomy 6 weeks and 3 months before presentation , respectively , and had all digits of both front paws fixed in flexion . tenectomy of each deep digital flexor tendon successfully resolved the condition , and the cats were sound 2 months after surgery . the authors hypothesized that the postoperative contracture was the result of inflammation due to a suboptimal surgical technique ( excessive or rough tissue manipulation , use of a dull scalpel blade , improper use of tissue adhesives or poor aseptic technique ) . these factors could elicit an abnormal inflammatory response and result in flexor fibrosis , adhesion formation and evolution toward flexor tendon contracture . tobias et al reported that the duration of the surgery , which was potentially secondary to a suboptimal surgical technique , was correlated with the occurrence of postoperative lameness . this association could also be observed with persistent long - term lameness but the number of cases observed was considered too low to determine such an association . the anatomic relation between the deep digital flexor tendon and the middle phalanx could explain the long - term contracture . indeed , traumatic resection of the distal phalanx could be the cause of an inflammatory reaction in the area of the distal extremity of the middle phalanx and the deep digital flexor tendon . in addition to contracture of the digital flexor , other complications have been associated in 040% of cases of onychectomy in cats , such as pain , hemorrhage , lameness , swelling , non - weightbearing , infection , claw regrowth , middle phalanx protrusion and palmigrade stance . lameness is usually an early postoperative complication and is associated with pain , which resolves in 2 days but can persist for up to 2 months . the postoperative flexor contracture was previously reported in the first months after onychectomy but long - term postoperative contracture after onychectomy could explain undiagnosed chronic pain in some cats and particularly in cats 1 and 3 . thus , digital flexor tendon contracture can not be ruled out because of an increased delay from the onychectomy . a trauma was suspected for the second cat , as no previous onychectomy was performed on this patient . digital flexor tendon injuries in dogs and cats are uncommon and most often result from laceration by sharp or penetrating foreign objects . other conditions of digital flexor tendons are rare , and only a few cases have been reported . a report of a 10-month - old male great dane affected by an excessive non - painful exion of the digits of the rightforelimb ( more pronounced on the fourth digit ) has been published . this dog was lame for 2 months . restricted extension of the fourth digit was conrmed under general anesthesia , and a modied z - tenotomy was performed . surgery provided a very good outcome , as postoperative extension of the affected digit was possible and pain free , and no lameness was noted 7 months after surgery . a 5-month - old basset hound was also reported with simple incomplete syndactyly ( fusion of the third and fourth digital pads on a hindlimb ) and secondary contracture of the deep digital flexor tendon of the third and fourth digit . with this dog , the deep digital flexor tendon contracture was suspected to be secondary to the primary congenital anomaly and was treated by palmar tenotomy . the first two cats reported here were middle - aged indoor siamese cats , and the third case was a siamese cross . they are known to be predisposed to many diseases , including cardiovascular , dermatologic , endocrine , gastrointestinal , hematologic , infectious and musculoskeletal conditions , such as congenital myasthenia gravis , mucopolysaccharidosis vi or hip dysplasia . however , this hypothesis needs to be confirmed with additional cases and with tendon histopathologic analysis to find a more specific cause to the digital flexor contracture . this pathology is a flexor tendon entrapment of the digits that is characterized by locking of the fingers , with or without pain . the flexor entrapment is due to hypertrophy , narrowing and relative stenosis of the palmar retinacular sheath ( most often the transverse ligament at the metacarpophalangeal joint ) , which progressively restricts the motion of the flexor tendon . the precise etiology is not well understood and repetitive finger movements or local trauma leading to a progressive loss of fingers extension is currently the most plausible hypothesis . different treatments , such as medical treatment , joint immobilization , or corticosteroid injections , have been tried to manage the disease but surgical treatment is indicated when conservative management fails to resolve the pain and clinical signs . the surgical treatment consists of resection of the metacarpophalangeal transverse ligament , with or without resection of the superficial flexor tendon , and is highly effective with low associated complication and recurrence rates .", "digital flexor contracture can affect an isolated digit or all digits of a limb and is characterized by a chronic lameness and a painful permanent flexion of the affected digit . in contrast to medical management , tenectomy of the deep and superficial flexor tendons is associated with a good - to - excellent surgical outcome for this condition . etiology of this contracture is unknown but trauma , whether related to an onychectomy or not , seems to predispose a cat to this condition . this pathology could therefore be considered as a long - term complication of onychectomy in some cases . however , further cases need to be reported to better understand the pathogenesis of this condition . digit evaluation seems to be of paramount importance when investigating cases of chronic lameness in cats ." ]

[ "one of them , adiponectin , also known as acrp30 , adipoq , gbp28 , and apm1 , was discovered by four independent research teams in 1995/1996 , [ 25 ] as the most abundant product of the adipose tissue . the hormone is a 244-amino acid protein with 30 kda molecular weight that circulates in the serum in different multimeric forms . actions of adiponectin are mediated by two types of receptors : adiponectin receptor 1 ( adipor1 ) and 2 ( adipor2 ) . the receptors are highly related and share 67% sequence identity in mice , but they differ in their tissue distribution and the ability to bind various forms of adiponectin . adipor1 shows high affinity for the globular form of adiponectin , whereas adipor2 is characterized by intermediate binding affinity for both globular and full - length adiponectin . the highest levels of adipor1 expression are observed in skeletal muscles , whereas adipor2 is most highly expressed in the liver [ 7 , 8 ] . due to the extensive distribution of adiponectin receptors in peripheral tissues and organs , adiponectin exerts pleiotropic effects on metabolism , including regulation of homeostasis by fatty acid oxidation , stimulation of glucose uptake and gluconeogenesis inhibition , which leads to intensified thermogenesis and weight loss . consequently , adiponectin level correlates negatively with body fat and positively with insulin sensitivity . the existing evidence points to the presence of a common endocrine system comprising several hormones , including ghrelin , leptin , and orexin that controls metabolism and reproductive functions [ 1215 ] . adiponectin mrna and protein were found in the ovaries of several species , including humans , rats , and cows [ 1619 ] . adiponectin mrna and protein were also detected in the ovaries of prepubertal but not sexually mature gilts . the influence of the hormonal status of swine related to the stage of the oestrous cycle on adiponectin expression in corpora lutea , granulosa , and theca interna cells remains unknown . studies indicating higher concentrations of adiponectin in female than in male blood suggest that ovarian steroids may regulate adiponectin secretion [ 20 , 21 ] . similar conclusions can be drawn from varied plasma levels of adiponectin during the oestrous cycle in pigs . despite the above , the possible influence of adiponectin on the production of steroid hormones by porcine ovarian cells remains unexplored . therefore , the aim of this study was to investigate the expression of the adiponectin gene by real - time pcr , to determine the concentrations of adiponectin protein in the porcine ovary ( corpora lutea , granulosa and theca interna cells ) and to compare gene and protein expression levels during different stages of the oestrous cycle in pigs . additionally , we sought to determine the in vitro effect of adiponectin on the secretion of steroid hormones ( progesterone , oestradiol , testosterone , and androstenedione ) by ovarian luteal , granulosa , and theca interna cells of sexually mature swine .", "all experiments were carried out in observance of the ethical standards of the animal ethics committee at the university of warmia and mazury in olsztyn . the experimental material comprised mature gilts ( large white and polish landrace ) from a private breeding farm , aged 7 - 8 months and weighing 130140 kg . twenty gilts were divided into four experimental groups as follows : days 2 - 3 , 1012 , 1416 , and 1719 of the oestrous cycle . the day of the second oestrus was designated as day 0 of the oestrous cycle . the phase of the oestrous cycle was also determined based on ovarian morphology . additionally , to fully confirm correctness of the evaluation of the oestrous cycle phase , the level of progesterone was determined . dissected corpora lutea ( cls ) from different stages of the oestrous cycle ( days 2 - 3-corpora haemorrhagica , 1012-mature cls , and 1416-regressing cls ) were either immediately frozen in liquid nitrogen and stored at 80c until rna and protein analysis or , similarly to the ovaries from days 1719 of the cycle , placed in cold pbs buffer and transported to the laboratory where luteal , follicular granulosa , and theca interna cells were isolated . granulosa and theca interna cells are precursor cells of large and small luteal cells , respectively . dissected corpora lutea from ovaries on days 2 - 3 , 1012 , and 1416 were minced into small fragments and dispersed in f-12 medium containing bovine serum albumin fraction v ( bsa ; 1% ) and antibiotics . corpora lutea were enzymatically dissociated in 0.125% trypsin solution ( 46 times ) at 37c , centrifuged ( 300 g , 10 min , 4c ) , and washed three times . isolated luteal cells were filtered through nylon mesh ( 40 m in diameter ) and resuspended in fresh f-12 medium . the cells were counted using a haemocytometer , and their viability ( ~90% ) was determined by 0.4% trypan blue dye exclusion . granulosa and theca interna cells were isolated from large follicles ( diameter > 6 mm ) without signs of atresia . granulosa cells were aspirated with a syringe and additionally washed out with a strong stream of media directed to the internal wall of the follicle . the theca interna layer was scraped off from granulosa cells and enzymatically dispersed in 0.25% trypsin solution . dispersed cells were centrifuged ( 800 g for 10 min ) and washed two and three times to isolate granulosa and theca interna cells , respectively . the cells were filtered through nylon mesh ( 40 m in diameter ) and resuspended in eagle 's medium enriched with bsa ( 5% ) and antibiotics . the cells were counted using a haemocytometer , and their viability ( ~98% ) was determined by 0.4% trypan blue dye exclusion . some of granulosa and theca interna cells ( 5 10 viable cells within each experiment ) were immediately resuspended in trizol reagent ( invitrogen , usa ) and stored at 80c until processing for rna analysis . total rna was extracted from luteal tissues from days 2 - 3 , 1012 , and 1416 of the oestrous cycle using the absolutely rna miniprep kit ( stratagene , usa ) . in the case of granulosa and theca cells approximately 1 g of rna was reverse - transcribed into cdna in a total volume of 20 l with 0.5 g oligo ( dt)15 primer ( roche , germany ) using the omniscript rt kit ( qiagen , usa ) at 37c for one hour and was terminated by incubation at 93c for 5 min . quantitative real - time pcr analysis was performed using a pcr system 7300 ( applied biosystems , usa ) . sense and antisense primers ( adiponectin , cyclophilin a ) were chosen according to lord et al . the chosen primers were as follows : adiponectin forward : 5atgatgtcaccactggcaaattc-3 , reverse : 5-gaccgtgacgtggaaggaga-3 ; cyclophilin a , forward : 5-gcactggtggcaagtccat-3 , reverse : 5-aggacccgtatgcttcagga-3 ; gapdh forward : 5-ccttcattgacctccactacatggt-3 , reverse : 5-ccacaacatacgtagcaccagcatc-3. adiponectin primers ( access no : ay135647 ) were complementary to positions 514536 ( f ) and 565584 ( r ) of pig adiponectin gene sequence ; cyclophilin a primers ( access no : ay266299 ) were complementary to positions 219237 ( f ) and 269299 ( r ) of pig cyclophilin a gene sequence , gapdh primers ( access no : u48832 ) were complementary to positions 6185 ( f ) and 219243 ( r ) of pig gapdh . a constitutively expressed genes , cyclophilin a and gapdh , were used as the internal control to verify the quantitative real - time pcr . to ensure that cyclophilin a and gapdh were the suitable reference genes for this study , we revealed that there were no statistically significant differences in ct values between the examined ovarian structures throughout all investigated stages of the oestrous cycle . both of the housekeeping genes were also indicated as suitable reference genes ( internal controls ) in the independent studies . the pcr reaction included 20 ng cdna , 900 nm ( adiponectin forward ) , 300 nm ( adiponectin reverse , cyclophilin a forward and reverse ) and 60 nm ( gapdh forward and reverse ) primers , 12.5 l sybr green pcr master mix ( applied biosystems , usa ) , and rnase free water in a final volume of 25 l . quantitative real - time pcr cycling conditions were as follows : initial denaturation and enzyme activation at 95c for 10 min , followed by 40 cycles of denaturation at 95c for 15 s and annealing at 59 for 1 min . negative controls were performed in which water was substituted for cdna , or reverse transcription was not performed prior to pcr . the specificity of amplification was tested at the end of the pcr by melting - curve analysis . calculation of relative expression levels of adiponectin was conducted based on the comparative cycle threshold method ( ct ) and normalized using the geometrical mean of reference genes expression levels : gapdh and cyclophilin a. western blotting analysis was performed as described by smolinska et al . . briefly , equal amounts of porcine corpora lutea as well as granulosa and theca cells lysats ( 10 g ) were resolved by sds - page on 12.5% polyacrylamide gel and then transferred to a nitrocellulose membranes ( whatman , usa ) . blots were blocked for 5 h at 4c in 1 tbst containing 5% skimmed milk powder and then incubated overnight at 4c with the rabbit polyclonal adiponectin antibodies at the dilution of 1 : 150 ( santa cruz biotechnology , usa ) or rabbit polyclonal actin antibodies ( sigma , usa ) diluted 1 : 200 , which were used as an internal control for equal loading and to quantify porcine adiponectin protein . to identify immunoreactive bands , membranes were incubated for 1.5 h at room temperature with mouse anti - rabbit igg for adiponectin ( sigma , usa ; diluted 1 : 2000 ) , goat anti - rabbit igg for actin ( diluted 1 : 5000 ) conjugated with alkaline phosphatase ( santa cruz biotechnology , usa ) . nonspecific foetal calf serum ( mp biomedicals , usa ) was used instead of primary antibodies to produce negative control blots . the immunocomplexes were visualized using 4-nitroblue tetrazolium chloride ( nbt ) and 5-bromo-4-chloro-3-indolyl phosphate ( bcip ) , according to the manufacture 's protocol ( promega , usa ) . the results of western blotting were quantified by densitometric scanning of immunoblots with gelscan for windows ver . 1.45 software ( kucharczyk , poland ) . data were expressed as a ratio of adiponectin protein relative to actin protein in arbitrary optical density units . luteal cells ( 250000/1 ml medium ) were resuspended in f-12 medium enriched with foetal calf serum ( fcs ; 20% ) , bsa ( 1% ) and antibiotics and preincubated for 48 hours in a humidified incubator with 95% air and 5% co2 atmosphere . the serum - containing medium was discarded , and the cells were washed using serum - free f-12 medium . after washing , luteal cells were cultured for 24 hours in f-12 medium with bsa ( 1% ) and antibiotics , with or without treatment agents . granulosa and theca interna cells ( 250000/1 ml medium ) were resuspended in eagle 's medium supplemented with 10% fcs , 5% bsa , and antibiotics . after 24 hours of preincubation , the medium was discarded , and the cells were washed and cultured for 24 hours in eagle 's medium with 5% bsa and antibiotics , with or without treatment reagents . the cultured cells were treated with 1 or 10 g / ml of recombinant human adiponectin ( biovendor , usa ) alone or in combination with insulin ( granulosa and theca interna cells ; 10 ng / ml ; sigma , usa ) , fsh ( granulosa cells ; 10 ng / ml ; nhpp , usa ) and lh ( theca interna cells ; 10 ng / ml ; nhpp , usa ) , and combination of those treatments ( insulin + fsh for granulosa cells and insulin + lh for theca interna cells ) . adiponectin doses used in the experiment were close to physiological concentrations of this hormone in the porcine blood . those cells are thought to be generally more autonomic than follicular cells which is a reason of luteal cells ' hard response to stimulators [ 3133 ] . the alamar blue test revealed that none of the treatments affected the viability of the cultured cells . following incubation , the media were harvested , centrifuged ( 800 g for 10 min ) , and the supernatants were collected and stored at 20c until analyses of progesterone ( cultures of luteal , theca interna , and granulosa cells ) , oestradiol ( cultures of theca interna and granulosa cells ) , androstenedione , and testosterone ( cultures of theca interna cells ) . progesterone ( p4 ) was analysed according to the method described by ciereszko et al . , oestradiol ( e2 ) was determined according to the method of hotchkiss et al . modified by kotwica , androstenedione ( a4 ) as described by dziadkowiec et al . , and testosterone ( t ) according to kotwica and williams . the specificity of the antibodies against a4 , t , and e2 has been reported by ciereszko et al . and szafranska et al . . the sensitivities of the assays for p4 and a4 were 1 pg / ml and for e2 and t were 0.5 pg / ml . intra- and interassay coefficients of variation of the p4 , e2 , a4 , and t assays were 0.91% , 0.7% , 0.81% , 0.97% and 8.5% , 10.1% , 14.2% , and 7.8% , respectively . data from real - time analysis and western blot were analysed by one - way anova and least significant difference ( lsd ) post hoc test and are reported as the means sem from five independent observations . all data concerning in vitro cell cultures were analysed by anova for repeated measurements and least significant difference ( lsd ) post hoc test and are reported as the means sem from five ( for all types of cells ) independent observations . each experiment was performed on different day using separate pool of luteal or follicular cells .", "the expression of adiponectin mrna was significantly higher in corpora lutea during all investigated days of the luteal phase than in theca interna cells isolated on days 1719 of the cycle ( p < 0.05 ) . no significant differences were noted in adiponectin gene expression in granulosa cells compared with theca interna cells and cls ( figure 1(a ) ) . in general , adiponectin protein concentration in the porcine ovary was higher in the luteal phase than in the follicular phase . in particular , the adiponectin protein content was the greatest in cls from days 2 - 3 in comparison with cls and follicular cells from the remaining stages of the oestrous cycle ( p < 0.01 ) . within the luteal phase adiponectin concentration was the lowest in cls during days 1012 ( p < 0.01 ) . there was no significant differences in protein expression between granulosa and theca interna cells ( figure 1(b ) ) . treatment of luteal cells from days 1012 of the oestrous cycle with adiponectin at both doses ( 1 g / ml ; 10 g / ml ) resulted in significant ( p < 0.05 ) decrease in progesterone secretion ( figure 2 ) . adiponectin at any dose did not affect p4 secretion by luteal cells collected on days 2 - 3 and 1416 ( data not shown ) . adiponectin at the higher dose ( 10 g / ml ) in combination with insulin provoked the increase in p4 secretion in comparison with the cells stimulated by insulin alone ( p < 0.05 ) . in contrast , there was no effect of adiponectin ( both doses ) on fsh- and fsh + insulin - induced production of p4 in porcine granulosa cells ( figure 3 ) . basal secretion of p4 was unaffected independently on adiponectin dose ( data not shown ) . adiponectin at the higher dose ( 10 g / ml ) increased basal secretion of e2 ( p < 0.05 ) ( figure 4 ) . adiponectin did not change secretion of e2 by granulosa cells cultured with insulin and/or fsh ( data not shown ) . adiponectin at both doses reduced basal secretion of t by porcine theca interna cells ( p < 0.05 ) ( figure 5 ) . the effect of adiponectin on basal p4 , e2 , and a4 release was negligible ( data not shown ) . adiponectin ( 10 g / ml ) decreased lh + insulin - stimulated secretion of p4 by theca interna cells ( p < 0.05 ) . there was no effect of adiponectin on lh- or insulin - induced production of p4 by these cells ( figure 6(a ) ) . adiponectin did not influence lh- or insulin - stimulated secretion of e2 by theca interna cells . however , lh + insulin - induced secretion of e2 by the cells was increased in response to the higher dose ( 10 g / ml ) of adiponectin ( p < 0.05 ) ( figure 6(b ) ) . secretion of a4 by theca interna cells was inhibited by combination of adiponectin ( 10 g / ml ) with insulin compared to insulin alone ( p < 0.05 ) . adiponectin at the lower dose ( 1 g / ml ) increased lh + insulin - induced a4 secretion by the cells ( p < 0.05 ) ( figure 6(c ) ) . induced secretion of t was not changed under adiponectin influence ( data not shown ) .", "this is the first ever study to demonstrate the changes in adiponectin gene and protein expression in the porcine ovary throughout the oestrous cycle . our results indicate that adiponectin is more highly expressed in luteal cells derived from ovaries in all examined stages of the luteal phase than in follicular granulosa and theca interna cells . adiponectin was also found to affect basal and stimulated secretion of steroid hormones by porcine ovarian cells . in addition to porcine ovarian structures , adiponectin gene expression and the presence of the hormone protein were also found in woman theca interna cells and in theca interna cells , granulosa cells , corpora lutea , and oocytes of rats and cows [ 18 , 19 ] . singh and krishna localized the adiponectin protein in bat ovarian structures that showed positive immunostaining in theca interna cells , oocytes of growing follicles , and the corpus luteum . the expression of adiponectin gene and protein was also determined in porcine granulosa cells of prepubertal gilts . the levels of adiponectin expression and also its receptors seem to vary subject to cell type and the stage of follicle and corpora lutea development . in the bovine ovary , the expression of adiponectin and its both receptors was lower in granulosa cells than in theca interna cells and oocytes . contrary results were presented by ortega et al . who observed the highest levels of adiponectin expression in granulosa cells of sheep ovaries . throughout follicular development , adiponectin mrna increased in granulosa cells and decreased in theca interna cells of cows . in the corpora lutea , bovine theca interna cells derived from large follicles revealed higher expression of both receptors than cells isolated from medium - sized and small follicles , indicating that follicular growth influences the transcript levels of adiponectin receptors . the synthesis of ovarian adiponectin and the expression of adipor1 and adipor2 are probably hormonally controlled , as suggested by an increase in adiponectin concentrations in ovarian follicular fluid of women administrated lh in the in vitro fertilization procedure . following pmsg pretreatment , an injection of hcg also significantly increased the expression of adiponectin and adipor1 ( but not adipor2 ) genes in rat ovaries . in bovine theca interna cells , lh increased the concentrations of adipor2 mrnas , whereas igf - i suppressed the expression of the above gene . the results of the present study seem to confirm the hypothesis that adiponectin production is regulated hormonally . higher levels of adiponectin gene and protein expression during the luteal phase and lower expression levels during the follicular phase could point to the stimulatory effect of progesterone and the inhibitory influence of oestradiol on ovarian adiponectin production . in our previous study , adiponectin serum concentrations were higher during the luteal phase than the follicular phase , which suggests that ovarian steroids influence plasma adiponectin levels . in this study the results of our in vitro studies and the presence of both adiponectin receptors in porcine ovaries indicate that adiponectin may directly affect ovarian steroidogenesis . in fact , progesterone secretion decreased due to adiponectin 's influence on luteal cells in mid - luteal phase ( days 1012 ) . greater variations in adiponectin action were observed in porcine follicular cells . induced progesterone production increased in granulosa cells and decreased in theca interna cells . basal testosterone output and insulin - induced androstenedione secretion were inhibited , while lh + insulin - stimulated release of androstenedione was enhanced by adiponectin . the effect of adiponectin on ovarian steroidogenesis was also suggested in studies of cows , rats , and humans . adiponectin was found to inhibit insulin - induced secretion of progesterone and oestradiol by bovine granulosa cells . in a study of theca interna cells of bovine ovaries , lagaly et al . observed that adiponectin decreased lh + insulin - induced production of progesterone . the above authors also noted that adiponectin inhibited the mrna expression of lh receptor in granulosa cells . granulosa cells of rats and women treated with igf - i responded to adiponectin by increasing progesterone and oestradiol secretion [ 16 , 17 ] . in the cited studies , adiponectin did not influence fsh - induced production of progesterone and oestradiol in human and rat granulosa cells which is consistent with the response of porcine cells noted in this study . it seems that adiponectin affects ovarian functions by binding adipor1 and adipor2 , in two ways . an experiment where rnai was used to block adipor1 and adipor2 expression in the kgn cell line derived from human granulosa cells contributed to new information about adiponectin 's role in the ovaries . the absence of adipor1 in the analysed cells enhanced apoptosis , whereas the elimination of adipor2 reduced fsh- and igf - i - induced the production of progesterone and oestradiol and inhibited mitogen - activated kinase activity , relative to control , in response to adiponectin or fsh treatment . the above results suggest that adipor1 is more involved in the survival of granulosa cells , whereas adipor2 regulates steroidogenesis through mapk activation . the influence of adiponectin on the ovaries of sexually mature pigs has not been studied to date , but the response of granulosa cells derived from prepubertal gilts to the analysed hormone was described by ledoux et al . . the above authors observed higher levels of cyclooxygenase-2 , prostaglandin e synthase , and vegf gene expression in cells primed with adiponectin , an increase in the expression of the star gene and a decrease in the expression of the p450 aromatase gene . adiponectin treatment contributed to an increase in progesterone levels and a decrease in androstenedione and oestradiol plasma concentrations in comparison with control bats . in the same study , adiponectin treatment increased p450scc and 3-hsd enzyme levels but decreased aromatase , star and lh - r levels in comparison with controls . an in vitro study by caminos et al . demonstrated that adiponectin significantly inhibited basal and hcg - stimulated testosterone secretion by testicular explants . in another study , adiponectin decreased corticosterone secretion by freshly isolated rat adrenocortical cells but did not affect aldosterone production . adiponectin treatment enhanced cortisol secretion , which was accompanied by increased expression of steroidogenic pathway genes , including star protein expression , via erk1/2 and ampk - dependent pathways . in addition to its direct effects on steroidogenesis in the ovary , adiponectin could also indirectly affect gonadal functions by controlling the secretory activity of the hypothalamus and pituitary . a study by wen et al . demonstrated the inhibition of gnrh release from gt1 - 7 hypothalamic gnrh neurons after the administration of adiponectin . in in vivo study by cheng et al . adiponectin also lowered gnrh secretion by activating the ampk and inhibiting the erk pathways . in the lower branch of the hpg axis , the release of lh from rat pituitary cells and the murine lt2 cell line was decreased after the administration of adiponectin alone and in combination with gnrh [ 53 , 54 ] . in vivo observations also demonstrated an inhibitory effect of adiponectin on lh secretion : the intravenous administration of the adenovirus expressing the adiponectin gene to male mice decreased plasma lh levels without changes in fsh levels . the inhibitory influence of adiponectin on lh secretion could be attributed to a decrease in gnrh receptor gene expression in the pituitary .", "the presence of adiponectin mrna and protein in porcine ovaries observed in this study as well as the presence of adiponectin receptors 1 and 2 in the gonads noted in our previous work could provide evidence for auto / paracrine actions of the analysed hormone . the variations in adiponectin gene and protein expression during the oestrous cycle indicate that adiponectin expression is determined by the hormonal status of pigs . the effect of adiponectin on ovarian steroidogenesis suggests that this adipokine influences reproductive functions in pigs . yet for definitive conclusions to be drawn , especially concerning precise localization of adiponectin mrna and protein in different ovarian structures , intracellular mechanisms of adiponectin influence on the gonadal steroidogenesis and its possible effect on other functions of the ovaries , further studies are required to determine the role of adiponectin in ovarian physiology ." ]

[ "molecular and morphological evidence together support the idea that the anterior end of the amphioxus nerve cord contains regions homologous with vertebrate forebrain and hindbrain 1,2 , though it is generally the ventral portion of these regions that are best represented 3 . its most probable position , as defined by gene expression patterns , would be from somewhere forward of the caudal limit of otx expression , which in vertebrates extends through the midbrain , to a point close to the beginning of the zone of hox gene expression . in young amphioxus larvae , this corresponds with a region extending from the infundibular cells , which lie at a level roughly midway along somite 1 , through the posterior part of the cerebral vesicle to a level somewhere near or just beyond the middle of somite 2 ( fig . this domain begins with an anterior zone of ventral neuropile and commissural fibers followed , near the junction between somites 1 and 2 , by a complex of ventrally - positioned somatic motoneurons and interneurons with caudal projections that initiate and control larval swimming behavior 4 . the first members of the visceral motoneuron series lie further back , near the caudal end of somite 2 . from there , visceral motoneurons recur at regular intervals along the anterior nerve cord and innervate the body via an extended series of peripheral nerves . any attempt to identify an amphioxus homolog of the vertebrate midbrain is hampered by the fact that we currently lack unambiguous criteria for recognizing its presence . the quintessential identifying feature in vertebrates is the dorsal optic tectum , but this is absent in amphioxus . in fact , except for a pineal homolog , amphioxus appears to lack all of the dorsal structures of the vertebrate brain . further , because the amphioxus nerve cord is of uniform dimension along its length , there are no morphological constrictions to separate sub - domains in the anterior cord from one another in the way vertebrate isthmus separates midbrain from hindbrain . the isthmus is notable as the site of an important organizing center , the midbrain - hindbrain boundary ( mhb ) , characterized in vertebrates by the expression of a highly conserved set of gene , including fgf8 , engrailed , pax2 , and wnt1 5,6 . the comparable site in amphioxus lies somewhere close to the caudal limit of somite 1 , which is where the anterior zone of otx expression abuts that of gbx 7 . however , though engrailed is expressed in small clusters of cells in the embryonic nerve cord 8 , these lie further forward in the cerebral vesicle , at a level near the midpoint of somite 1 . in addition , wnt1 is not expressed at all in the anterior cord , nor does the expression of the amphioxus pax2 homolog , amphipax2/5/8 , match the vertebrate pattern . instead , the latter is expressed caudally through much of the nerve cord 9 , and though there is a small anterior zone of later expression , it is too far forward for an mhb marker . there is thus no clear molecular evidence for a focal center in amphioxus with the expression profile of an mhb . this is perhaps not surprising , considering that the structures organized by the mhb are primarily dorsal ones not present in amphioxus . the mhb is , however , also required for normal organization of some ventral brain regions in vertebrates 10 . since the ventral midbrain of vertebrates very likely combines vertebrate - specific neuronal cell types along with cell groupings with more primitive organizational features , it would be useful to know whether all of these are mhb - dependent or only the former . it may well be that only vertebrate innovations , whether dorsal or ventral , are under the specific control of the mhb . this leaves open the question of whether the amphioxus pattern differs from that of vertebrates because it reflects an earlier stage in the evolution of a vertebrate - type mhb 7 , or whether amphioxus has secondarily diverged from a pattern that was once closer to the vertebrate one . in addition , the vertebrate midbrain marker dmbx is not expressed in the amphioxus nerve cord 11 . the available molecular data thus argues against the presence , in amphioxus , of precise homologs of either the vertebrate midbrain or mhb . among tunicates , the other group of protochordates , it is the ascidians that are best studied , and for these there is again good molecular evidence for homologs of both forebrain and hindbrain in the larval cns 11,12 , corresponding roughly with the sensory vesicle and caudal ganglion respectively . in addition , cells in the narrow neck region that separates these structures express at least some characteristic mhb genes ( fig . data on pax2/5/8 led initially to the proposal that ascidians had an exact counterpart of the vertebrate mhb and that amphioxus , being a later offshoot of the chordate lineage , must have lost this feature secondarily 12 . however , the precise spatial arrangement of the expression zones for several key genes in ascidians differs from that in vertebrates , e.g. fgf and dmbx in ascidian larvae are expressed in cells immediately caudal to those expressing pax2/5/8 and en , whereas in vertebrates , dmbx lies forward of the other three genes , whose expression overlaps . expression patterns of the same genes in larvaceans , another group of tunicates , is somewhat different yet again 13 , which further complicates the problem of determining the nature of the ancestral pattern . the molecular data is thus somewhat inconclusive regarding protochordate homologs of either the vertebrate midbrain or mhb . if anatomical and functional considerations are taken into consideration , however , a somewhat stronger case can be made that amphioxus may have an approximate counterpart of the midbrain . the key point is that some of the cell types and neural circuits located in the caudal part of the zone of otx expression are similar to those found in the ventral midbrain in vertebrates . in amphioxus , as pointed out above , only ventral markers are available for comparison . of these , the infundibular cells probably mark the anterior limit of any prospective midbrain - like territory , as their homology with the ventral infundibular region of the vertebrate diencephalon seems to be fairly well accepted . immediately behind this point , in amphioxus , there is a zone of ventral neuropile in some ways comparable with the ventral tegmental commissure , which forms part of the early axonal scaffolding in embryonic vertebrate brains . this same region in amphioxus also contains the anterior - most motoneurons in the nerve cord along with populations of large interneurons with descending projections , features found in the tegmentum and the reticulospinal plexus of lower vertebrates beginning at midbrain level . the ventral midbrain in vertebrates is also where dopaminergic neurons with projections to the forebrain first develop , and these are a key component of the motivational circuitry linking basal brainstem centers with the forebrain . dopaminergic neurons are found in the cerebral vesicle in amphioxus and nowhere else in the nerve cord . two main populations develop , one in a dorsal position in the anterior cerebral vesicle , the other more ventrally near the junction between somites 1 and 2 14,15 . further research is needed on these cells to determine their precise pattern of projections and function , but the more caudal of the two populations is well positioned to be a homolog of the midbrain dopaminergic neurons in vertebrates . if the anatomical and functional criteria outlined above are meaningful indicators that amphioxus does indeed have a midbrain homolog , the value of the molecular markers used to date to test this would have to be reconsidered . the same could be said of ascidian larvae , but for a different reason , for here there is an alternative explanation for the expression patterns observed . the cns of adult ascidians consists of a simple brain - like dorsal ganglion , from which nerves radiate to the body musculature and visceral organs . the ganglion is present in only a rudimentary form in the larva , however , and the source of its cells has never been clear . in the few species where this has been investigated in the past , the ganglion develops in contact with the neck region of the larval nerve cord near the site where it contacts the neurohypophyseal duct . the latter is partly a stomodeal derivative , which raises the question of whether a significant part of the ganglion might be derived from stomodeal ectoderm . an analysis of the salp ganglion , compared with the data available on compound ascidians 16,17 , supports the idea that most if not all of the dorsal ganglion is of neural origin and that , in ascidians , it develops as part of the neck region . recent data on ciona 18 tends to support this interpretation , as its ganglion develops in contact with the base of an outgrowth that arises from the caudal part of the sensory vesicle very near the neck . more importantly , experimental work now in progress on ciona is confirming the neck region as the source of major classes of neurons within the adult ganglion , including motoneurons innervating the visceral organs [ j.f . brunet , personal communication ] . evidently then , the cells of the neck region in ascidian larvae serve as a pool of precursors from which most if not all post - metamorphic cns neurons are derived . assuming the genes expressed in the vertebrate mhb include major players in the overall process of neuronal specification and differentiation , one can argue that their expression in the neck region is to be expected , irrespective of any homology between this site and the mhb . one would predict the genes would be expressed in combinatorial patterns and in a few cells at most , which is precisely what is observed . current thinking on the nature of ancestral chordates favors the view that the separation of adult and larval tissues in ascidians is a secondary specialization , and that the ancestral body plan was a more fully integrated one , as in amphioxus 19,20 . this may explain why the expression patterns of some key developmental control genes differ so dramatically between ascidians and amphioxus . consider pax2/5/8 , which has an extended zone of expression in amphioxus , but a very restricted one in ascidians ( cf . figs . paralleling these , there are differences in innervation patterns of , for example , the visceral organs . these are strictly adult structures in ascidians , and the cells responsible for their innervation arise from the neck region , whereas the hox - expressing part of the nerve cord , which innervates the tail , is entirely lost at metamorphosis . in amphioxus , in contrast , visceral motoneurons , along with the rest of the locomotory control system , arise from an extended region of the nerve cord extending well into the hox zone . whether the zone supplying visceral innervation corresponds precisely with that expressing pax2/5/8 has yet to be determined . one can nevertheless predict that any gene essential to the development of the visceral innervation will necessarily be expressed over a much greater length of the nerve cord in amphioxus than in ascidians . for at least some of the genes associated with the mhb , therefore , the reason their homologs have a very restricted expression zone in ascidian larvae likely has less to do with the presence of a vertebrate - type mhb , and more with the functional necessity of generating a full complement of adult neurons from a single site within the nerve cord . what one then wants to know , to determine whether the ascidian pattern and the vertebrate one are more than coincidentally related , is what functional role the genes play in each instance . with regard to pax2/5/8 specifically , a further clue might come from knowing whether its expression in hemichordate embryos is restricted , as in ascidians , or extended , as in amphioxus . if the latter , this would be further evidence for the view that the ascidian pattern is indeed the derived one .", "from the above it is clear that there is a certain plasticity in the way expression patterns of genes identified with the mhb have diverged among chordates . in fact , the vertebrates seem to be most conservative : it is their pattern that most closely resembles that of hemichordates 19,20 , the closest available model for an ancestral deuterostome , and there are remarkably similar patterns in protostomes , e.g. drosophila . in hemichordates an mhb - like region can nevertheless be recognized , consisting of overlapping zones of en , pax2/5/8 , fgf8 and wnt1 expression near the junction between the collar and trunk in a region where otx and gbx expression overlaps 21 . if , however , as argued above , the specific organizer functions of the vertebrate mhb evolved with vertebrates , why are hemichordate expression patterns so close to vertebrate ones ? it could be , that despite the anatomical differences in their nervous systems , homology dictates the position along the body axis at which particular neural functions and cell types are localized . this might be due , for example , to their association with conserved structures like the mouth or the first gill slit . too little is currently known of hemichordate neuroanatomy to speculate much further , though some essential aspect of ectodermal and/or neural patterning is presumably involved . a further problem is to discover why amphioxus and ascidians have altered their mhb - related expression patterns when they are elsewhere so well conserved . in the case of ascidians , there have evidently been major changes in the way key patterning genes , notably those of the hox cluster , are structured and regulated . this probably relates to the presence of alternative mechanisms for cell specification in ascidians , which has relaxed some constraints on genome organization 22 . it is otherwise somewhat surprising that such comparatively distant relatives as vertebrates and hemichordates are so similar in terms of their mhb - related expression patterns when the main protochordate groups are both so different from vertebrates and from each other . there is a second issue integral to any consideration of chordate cns origins that relates to how the main organ systems of the body , including the nervous system , are positioned in relation to the dorsoventral axis . comparatively strong evidence now supports the idea that the body of chordates is dorsoventrally inverted relative to that of insects and the other main groups of protostomes . a full account of how this might have happened has been difficult to piece together , at least until now , because there was little relevant data on the basal offshoots of the lineage leading to chordates , namely hemichordates and echinoderms . their anteroposterior maps are very similar to vertebrates 21 and , while the data on dorsoventral patterning is more ambiguous , it appears that hemichordates are oriented the same way as protostomes , such that the mouth is ventral and the expression domain for homologs of the dorsoventral patterning genes bmp2/4 and bmp7 is dorsal 20 . removal of all influence of the latter in hemichordates results in a much expanded mouth , while over - expression suppresses the mouth and generates radialized embryos . in vertebrates , bmp expression and the mouth are both ventral , but suppressing bmps has equally dramatic radializing effects 23 . the genes thus appear to be performing essentially similar functions in these two groups , which implies that dorsal in basal deuterostomes has become ventral in vertebrates and , hence , in all chordates . inversion must therefore have occurred between the separation of the clade comprising hemichordates plus echinoderms from chordates , possibly in an organism that did not yet have an internalized cns . the transition is somewhat easier to imagine , in fact , if the starting point is an animal with circumferential expression zones of all the key patterning genes ( fig . it should then be equally easy to concentrate both the expression zones and the structures they pattern either to the dorsal surface or the ventral one ( fig . walter garstang 's ideas about chordate origins are fairly typical of hypotheses that predate the renewed interest in dorsoventral inversion . he derived neural tube from the dorsal portion of an ancestral system of larval ciliary bands , in that way preserving the dorsoventral orientation of the ancestor ( fig . if inversion did , in fact , occur , the brain and nerve cord would have had to come instead from the ventral surface of the ancestral body ( fig . 2c ) , an alternative explored by claus nielsen in a 1999 analysis 24 . a major premise of garstang 's hypothesis , that the whole of the neural tube should to arise as a single entity , is no longer widely accepted 19 , but it is still useful to consider the consequence of dorsoventrally inverting his hypothetical ancestor . as nielsen points out , so long as the brain arises at the anterior end of an originally ventral neuraxis , it must necessarily form in the postoral region , most likely immediately caudal to the mouth . this may seem counterintuitive , but the zone of expression for mhb - type genes , which mark a core brain region in vertebrates , is also postoral in hemichordates . the ancestral chordate in this scenario , in its inverted position , would have both its mouth and brain on the dorsal surface of the body . while this may seem peculiar what is then needed to generate the body of more advanced chordates like amphioxus and vertebrates is for differential growth of the ectoderm separating the mouth and brain to move the former forward , over the front or side of the snout , to what is now the ventral surface . the site of the ancestral apical organ must move as well , and will eventually find itself behind the now - ventral mouth , roughly in the position of the adhesive gland , which is also exactly the path the polar bodies follow from the apical pole of the egg during amphibian development 24 . in consequence , the anterior most part of our brain can not be homologous with the anterior - most parts of protostome brains , because the latter are in part derived from apical structures . this is despite the supposed homology between the anterior otx - expressing regions of protostome and deuterostome brains , because in embryos and larvae in both groups , otx can be expressed both pre- and post - orally 25,26 . in summary , though there is good reason to doubt that the chordate neural tube actually derives evolutionarily from larval ciliary bands 19 , nielsen 's point about the site of brain formation being post - oral , though counterintuitive , is largely consistent with current molecular data . in addition , the larvae of hemichordates and echinoderms have neurons at this location , and these form comparatively complex ganglion - like assemblages in some instances . the function of these simple neural centers is to innervate the larval oral region and pharynx , presumably to control basic feeding behaviors and digestion . if these did indeed serve in some way as the core of the evolving chordate brain , then the progressive incorporation of centers for locomotory control into the brain is yet another story , and one that would have unfolded quite independently of the evolutionary process by which a centralized brain and nerve cord arose in the protostome lineage . in this version of events , it is quite unlikely that the internalized neural tube of chordates can be explained by a simple inversion of a protostome - like ancestor with an already - internalized brain and nerve cord , as has sometimes been supposed .", "dorsal views of the larval nerve cords of ( a ) amphioxus and ( b ) ciona , a representative ascidian , showing expression domains for the main cns patterning genes . this is somewhat simplified , as the exact extent of the expression domains can vary with developmental stage , and the ascidian hox genes , in particular , are expressed in non - overlapping domains with some gaps . two alternatives for explaining the origin of a dorsally positioned brain in chordates , using the hemichordate embryo ( a ) as a starting point ; indicates the mouth ( m ) , anus ( a ) , apical plate ( orange ) , and the ancestral dorsal ( a - dorsal ) and ventral ( a - ventral ) surfaces ; the light blue rectangle is the expression hot zone ( hz ) in which homologs of genes characteristic of the vertebrate mhb are expressed , typically in circumferential bands within ectoderm of the collar and anterior trunk . older explanations of chordate origins , e.g. garstang 's hypothesis , retain an ancestral dorsoventral orientation ( as in b ) . this allows the dorsal condensation of tissue that became the brain ( dark blue ) to form within the hot zone of mhb - like expression , co - opting the latter for neural patterning functions . with inversion ( c , left side ) , the ancestral ventral surface becomes dorsal . in contrast with b , any brain - like condensation that forms on the new dorsal surface would necessarily then be post - oral in position , but it could still incorporate the mhb - like hot zone . then , to generate the vertebrate condition ( c , right side ) , with mouth and brain on opposing sides of the body , one needs to move the mouth over the front or side of the snout by differential growth of an expansion zone ( ez ) located somewhere forward of the brain ." ]

[ "a seventy five year old libyan man was seen in the urology department of tripoli medical centre , tripoli , libya with six month history of left loin pain . the patient noted a mass in the left loin two days before he was assessed in the hospital . the urine analysis revealed pus cells , protein , and no sugar , but urine culture yielded no bacterial growth . liver function tests showed slightly elevated alkaline phosphatase at 160 iu / l ( 44 to 147 iu / l ) , and lactate dehydrogenase at 152 iu / l ( 105 - 333 full blood count revealed haemoglobin of 8.3g% , ( 1315g% ) , white cell count of 14.7103/mm3 ( 411103/ mm3 ) , and platelets of 3.4 105/ mm3 ( 1.54.5 105/ mm3 ) . the patient 's vomiting subsided with proton pump inhibitors , but the loin pain showed partial response to analgesic . abdominal ct - scan showed an irregular mass in the upper pole of left kidney . the patient was posted for partial nephrectomy with the provisional diagnosis of renal tuberculosis or renal infarction involving upper pole . pathologically , the kidney was noted to have greyish white soft tissue mass , firm in consistency measuring 6x4x2 cms , with adjacent dilated calyces . the renal resection margin and external surface appeared free of tumour ( figure 2 ) . microscopically , the tumour consisted of pleomorphic squamoid cells arranged in nests and sheets with few foci of epithelial pearl formation and keratinisation . areas of necrosis and frequent mitosis were noted . the malignant cells nore were seen to infiltrate the adjacent renal parenchyma as nests of cells and also focally renal capsule ( figures 3 & 4 ) . the dilated calysis showed areas of squamous metaplasia and severe dysplasia with focal invasion of basement membrane into renal parenchyma to form the tumour ( figure 5 ) . photomicrograph revealing calyseal subepithelial invasion of malignant cells ( left ) and invasion of renal parenchyma adjacent to glomerulus with epithelial pearl formation ( right ) . postoperative chest x - ray ( pre - operative chest x - ray was normal ) revealed massive pleural effusion in the left lower lobe ( figure 6 ) . however , no histological typing is available as tissue showed only necrotic material with scanty malignant cells . he was put on cisplatin and sunitinib on the suspicion of primary lung tumour and showed no response .", "the patient was suspected clinically to have renal tuberculosis and was later found to have renal squamous cell carcinoma with possible lung secondaries .", "the common renal malignancy in adults is of clear cell type , followed by papillary carcinoma and chromophobe cell carcinoma [ 1 , 2 ] . primary neoplasms of the renal collecting system are rare , accounting for less than 5% of urothelial tumours in urinary system [ 4 , 5 ] . the transitional cell type is the most frequent ( 85%95% ) , followed by squamous cell carcinoma ( 6%15% ) and adenocarcinoma ( 7% ) . usually , renal squamous carcinoma is highly aggressive and of a high grade at presentation . haematuria , the classical presenting complaint of renal cell carcinoma , is not common in this entity as in this case . the incidence of co - existing stone was reported in a wide range of 18% to 100% . the present case demonstrates the transition from calyseal urothelium to squamous metaplasia , dysplasia and invasive squamous malignancy . there is a well known association between chronic pyelonephritis , renal pelvic stones , phanecetin ingestion and radiotherapy with squamous cell carcinoma . the case was clinically suspected as renal tuberculosis because of sterile pyuria and past history of cough with fever . the renal malignancy was not considered due to loin pain and absence of haematuria as the renal cell carcinoma classically presents as painless haematuria . the tumour can be difficult to diagnose by imaging modalities as the usual features are the presence of calculi and hydronephrotic changes with ureteral obstruction . filling defects or obstructive lesions in the renal pelvis by intravenous / retrograde urography or detection of a solid mass by ultrasonography can be the signs of the tumour . central renal squamous cell carcinoma presents more with intraluminal components and is usually associated with lymph node metastasis whereas peripheral renal squamous cell carcinoma presents with prominent renal parenchymal thickening and might invade the perirenal fat tissue before lymph node or distant metastasis could be identified . the survival of patients with central renal squamous cell carcinoma was reported to be significantly shorter than those with peripheral renal squamous cell carcinoma . nativ and colleagues reported that patients with locally invasive renal squamous cell carcinomas had 1 and 2 yearsurvival rates of 33% and 22% , respectively . if metastasis develops , adjuvant chemotherapy or irradiation has little effect on the unfavourable prognosis . our patient underwent partial nephrectomy because of suspicion of renal tuberculosis and was later found have pulmonary metastasis . in conclusion , this patient presented with lion pain and a mass without haematuria and was found to have renal squamous cell carcinoma with lung metastasis . as renal calyseal tumours could present with atypical features , a proper preoperative workup may help in better management though outcome is short lived ." ]

[ "medicinal plants have been used for centuries in traditional medicine because of their therapeutic value . mentha piperita , ( family lamiaceae ) is a species found in iran and many parts of the world which has an economical value for its flavoring , odor , and therapeutic properties in foods and cosmetic industrial products . in addition , the leaves and flowers of m. piperita have medicinal properties [ 2 , 3 ] . essential oils are valuable natural products used as raw materials in many fields including perfumes , cosmetics , aromatherapy , phototherapy , spices , and nutrition . peppermint ( m. piperita ) oil is one of the most popular and widely used essential oils , mostly because of its main components , menthol , and menthone . previous studies have shown antiviral , antibacterial [ 6 , 7 ] , antifungal [ 6 , 810 ] , antibiofilm formation [ 1113 ] , radioprotective , antioedema , analgesic , and antioxidant activities of the eo and methanolic extracts of herbal parts and callus cultures of m. piperita . in addition , m. piperita eo has been shown to cause inhibitory effects against radial fungal growth and aflatoxin production by aspergillus species . in the past two decades , azole - resistant candida and aspergillus species are the top pathogens responsible for nosocomial or food - borne infections [ 18 , 19 ] . in addition , the formation of biofilms by candida species have raised concerns due to their increased resistance to antifungal therapy and protects the microbial cells within biofilms from the host immune defenses [ 2023 ] . an alternative approach to overcome antibiotic resistance might be using natural products and phytochemicals . it has also been shown that some plant extracts efficiently inhibit the biofilm formation of c. albicans . moreover , eos especially with known antibacterial effects have the potential to be used in food industry as preservatives and to increase the shelf life of products . therefore , determining the antimicrobial properties of eos might help to overcome microorganism resistance to antibiotics and prevent food spoilage . the chemical composition of aromatic plants depends largely on the individual genetic variability and different plant parts [ 2527 ] . the presence and concentration of certain chemical constituents of eos also fluctuate according to the season , climatic condition , and site of plant growth [ 25 , 26 ] . the goal of this study was to investigate the chemical composition and in vitro antifungal and antibiofilm activities of essential oils of the leaves of m. piperita collected in the region of fars from iran .", "at full flowering stage , the aerial parts of the m. piperita were hydrodistillated for 2.5 h , using an all - glass clevenger - type apparatus , according to the method outlined by the british pharmacopoeia . the sample oils were dried over anhydrous sodium sulfate and stored in sealed vials at 4c before gas chromatography and gas chromatography - mass spectrometry ( gc - ms ) analysis . the analysis was carried out on a thermoquest - finnigan trace gc - ms instrument equipped with a db-5 fused silica column ( 60 m 0.25 mm i.d . , film thickness 0.25 mm ) . the oven temperature was programmed to increase from 60c to 250c at a rate of 4c / min and finally held for 10 min ; transfer line temperature was 250c . helium was used as the carrier gas at a flow rate of 1.1 ml / min with a split ratio equal to 1/50 . the quadrupole mass spectrometer was scanned over the 35465 amu with an ionizing voltage of 70 ev and an ionization current of 150 ma . gc - flame ionization detector ( fid ) analysis of the oil was conducted using a thermoquest - finnigan instrument equipped with a db-5 fused silica column ( 60 m 0.25 mm i.d . , nitrogen was used as the carrier gas at the constant flow of 1.1 ml / min ; the split ratio was the same as that for gc - ms . the oven temperature was raised from 60c to 250c at a rate of 4c / min and held for 10 min . the injector and detector ( fid ) temperatures were kept at 250c and 280c , respectively . retention indexes ( ris ) were calculated by using retention times of n - alkanes ( c6c24 ) that were injected after the oil at the same temperature and conditions . the compounds were identified by comparing their ri with those reported in the literature , and their mass spectrum was compared with those reported in wiley library . the antifungal activities of the eo against 25 standard strains of fungi , including c. albicans ( atcc 5982 , 1912 , 562 , 1905 , 1949 , 10261 , and 2730 ) , c. tropicalis ( atcc 750 ) , c. krusei ( atcc 6258 ) , c. glabrata ( atcc 863 , 2192 , 2175 , 6144 , and 90030 ) , c. dubliniensis ( cbs 8501 , atcc 8500 , 7987 , and 7988 ) , c. parapsilosis ( atcc 4344 ) , c. neoformance ( atcc 9011 ) , aspergillus flavus ( atcc 64025 ) , a. fumigatus ( atcc 14110 , cbs 144.89 ) , a. clavatus ( cbs 514.65 ) , and a. oryzae ( cbs 818.72 ) were determined . in addition , the antifungal activities of the eo against 35 clinical isolates of yeasts identified by polymerase chain reaction - restriction fragment length polymorphism ( pcr - rflp ) were also examined [ 29 , 30 ] . the antifungal susceptibility of clinical isolates of the tested fungi against fluconazole was examined by microdilution and disk diffusion methods [ 31 , 32 ] . minimal inhibitory concentrations of the eo against standard and clinical species of the fungi were determined by the broth microdilution method as recommended by the clinical and laboratory standards institute ( clsi ) , with some modifications [ 31 , 32 ] . briefly , the rpmi-1640 ( with l - glutamine and phenol red , without bicarbonate ) ( sigma , usa ) was prepared and buffered at ph 7.0 with 0.165 mol 3-(n - morpholino)propane sulfonic acid ( mops ) ( sigma - aldrich , steinheim , germany ) . serial dilutions of the eo ( 0.06 to 16 l / ml ) were prepared in 96-well microtiter trays using rpmi-1640 media ( sigma , st . double dilutions of fluconazole were also prepared for each of the tested fungi with the final concentration of 0.25 to 128 g / ml . stock inoculums were prepared by suspending three colonies of the examined yeast in 5 ml sterile 0.85% nacl and adjusting the turbidity of the inoculums to 0.5 mcfarland standard at 630 nm wavelength ( this yields stock suspension of 15 10 cells / ml ) . for moulds ( aspergillus spp . ) , conidia were recovered from the 7-day - old cultures grown on potato dextrose agar by a wetting loop with tween 20 . the collected conidia were transferred in sterile saline and their turbidity was adjusted to optical density of 0.09 to 0.11 that yields 0.45 10 conidia / ml . working suspension was prepared by making a 1/50 and 1/1000 dilution with rpmi of the stock suspension for moulds and yeasts , respectively . after the addition of 0.1 ml of the inoculums to the wells , the trays were incubated at 30c for 2448 h in a humid atmosphere . 200 l of the uninoculated medium was included as a sterility control ( blank ) . in addition , growth controls ( medium with inoculums and 5% ( v / v ) without the eo or fluconazole ) were also included . mics were visually determined and defined as the lowest concentration of the eo that produced no visible growth . in addition , minimum fungicidal concentrations ( mfcs ) of all the examined agents were also determined by culturing 10 l from the wells showing no visible growth onto sda plates . mfcs were of the lowest concentration that showed either no growth or fewer than 4 colonies , which corresponded to 98% killing activity of the initial inoculums . mfcs were determined as the lowest concentration yielding no more than 4 colonies , which corresponds to a mortality of 98% of the fungi in the initial inoculums . according to behnam et al . , c. albicans and c. dubliniensis strains were maintained on sabouraud dextrose agar ( difco ) plates . after 48 hrs one loop of the colonies was transferred to 20 ml sabouraud broth in 250 ml erlenmeyer flasks and incubated overnight in an orbital shaker ( 100 rpm ) at 30c under aerobic condition . yeast cells were harvested and washed twice in sterile phosphate - buffered saline ( pbs ) ( 0.8% [ w / v ] , nacl ( merck ) ; 0.02% [ w / v ] , kh2po4 ( merck ) ; 0.31% [ w / v ] , na2hpo4 + 12h2o ( merck ) ; 0.02% [ w / v ] , kcl ( panreac ) ; ph 7.4 ) . then , they were resuspended in rpmi 1640 supplemented with l - glutamine ( gibco ) and buffered with morpholinopropanesulfonic acid ( mops ) and the cell densities were adjusted to 1.0 10 cells / ml after counting with a hemocytometer . serial dilution of the eos ( 0.0158 l / ml ) in rpmi 1640 was prepared in a presterilized , polystyrene , flat - bottom , 96-well microtiter plates ( nunc ) . after the addition of 0.1 ml of the yeast inoculums to the wells , 200 l of the uninoculated medium was included as a negative control ( blank ) . in addition , rpmi with yeasts but without the eos served as positive controls . a semiquantitative measure of biofilm formation was assayed using a 2 , 3-bis(2-methoxy-4-nitro-5-sulfo - phenyl)-2h - tetrazolium-5-carbox - anilide ( xtt ) reduction assay . xtt ( sigma chemical co. ) was prepared as a saturated solution at a concentration of 0.5 mg / ml in ringer 's lactate . this solution was filter - sterilized through a 0.22 m - pore - size filter , divided into aliquots and then stored at 70c . prior to each assay , an aliquot of the xtt stock solution was thawed and treated with menadione sodium bisulfite ( 10 mm prepared in distilled water ; sigma chemical co. ) to obtain a final concentration of 1 m of menadione . a 100 l aliquot of xtt menadione was then added to each prewashed wells . the plates were then incubated in dark for 2 hours at 37c , and the colorimetric change at 490 nm ( a reflection of the metabolic activity of the biofilm ) was measured with a microtiter plate reader ( titertekplus - ms2 reader , uk ) .", "the qualitative and quantitative compositions of the eo of m. piperita are presented in table 1 . gc / ms analyses showed that the main constituent of the eo was menthol ( 53.28% ) followed by menthyl acetate ( 15.1% ) and menthofuran ( 11.18% ) . the antifungal activities of m. piperita eo against the tested yeasts are shown in table 2 . the eo inhibited the growth of all of the tested yeasts at concentrations of 0.124 l / ml . furthermore , the eo exhibited fungicidal activity ( mfc ) for all of the above - mentioned yeasts at concentrations ranging from 1 to 8 l / ml . no significant differences in inhibitory concentrations were found between azole - resistant and -susceptible strains . in addition , the eo inhibited the growth and killed the standard strain of cryptococcus neoformance at the concentration of 4 l / ml . all of the aspergillus standard strains were susceptible to m. piperita eo at concentrations of 0.54 l / ml ( table 3 ) . as shown in table 4 , the eo completely inhibited the biofilm formation of c. albicans and c. dubliniensis at concentrations of 1 l / ml and 2 l / ml , respectively . the compositions of the eos might be affected by the developmental stages of the plant . although some authors reported alpha terpinen as the dominant component of m. piperita eo ( 19.7% ) , similar to the previous studies [ 4 , 7 , 33 ] , we identified menthol as one of the main constituents of the eos . the higher concentration of menthol in this study as compared to some of those of previous reports [ 4 , 34 ] may reflect variations due to geographical location from which the plants were collected . in this study , the eos exhibited fungistatic and fungicidal activities against both of the standard and clinical strains of candida species at concentrations ranging from 0.5 l / ml to 8 l / ml , which can be best compared to the previous investigations [ 6 , 8 , 9 , 33 ] . one of the encapsulated yeasts , c. neoformance , is a well - known primarily opportunistic pathogen which produces chronic and life - threatening meningitis . according to the findings of this study , the examined oils killed the standard strain of c. neoformance at concentration of 4 l / ml . similar to the previous studies [ 10 , 17 ] the eo of m. piperita exhibited a strong anti - aspergillus activity with mic values ranging from 0.5 to 4 l / ml . mfcs of the eo against the tested fungi were almost similar or two times greater than those of their corresponding mics . since the eos exhibited similar antifungal effect against the tested azole - resistant and azole - susceptible strains , it could be assumed that the mechanism of the action of the eos is different with those of the above - mentioned antifungal drug . one of the main characteristics of eos is their hydrophobicity , which enables their incorporation into the cell membrane . it has been shown that this phenolic monoterpene has a hydroxyl group around the phenolic ring and exhibits its antimicrobial activity through the disruption of the cytoplasmic membrane [ 35 , 36 ] . biofilm formation by candida species is a phenomenon which helps the survival , pathogenesis , and drug resistance . the most commonly candida species associated with biofilm formation is c. albicans . in the present study , the formation of biofilm was inhibited completely at a concentration of up to 2 l / ml in a dose - dependent manner , which was comparable to the study of agarwal et al . .", "as the industries tend to reduce the use of chemical preservatives in their products , eo of m. piperita with potential active antimicrobial properties might be considered as a natural source for the maintenance or extension of the shelf life of products . in addition , delectable taste of the eo at the concentrations needed for antimicrobial properties was a bonus to its antimicrobial effects . on the other hand , these eos might also be considered for developing products for controlling fungal infections . as these tests have all been done in vitro , the next step may be further investigations in animal models to see if infection can be inhibited by the eo ." ]

[ "falls of the elderly always lead to serious health issues as the decline of their physical fitness . fracture is the most common injury in fall of an elderly and there is also a certain possibility to get coma , brain trauma , and paralysis . at most fall situations , the fall process is the main source of injury because of the high impact . but sometimes the late medical salvage may worsen the situation . that means the faster the salvage comes , the less risk the elderly will face . mems ( microelectro mechanical systems ) sensors have simplified the design and implementation of sensor system . location based service ( lbs ) makes it more convenient to locate the elderly in health monitoring . beside these cameras are distributed at limited space to offer pictures or videos of human activities to implement fall detection algorithm . external supports such as motion sensors could be used to enhance computer vision based fall detection method , and a data fusion algorithm can operate the validation and correlation among the two subsystems to raise robust performance of fall detection . these computer based methods work effectively in indoor environment , but they are hard to realize in outdoor environment as the deployment of cameras is always limited . there are several kinds of detection methods which differ in constitution of motion sensors and detection algorithms . a single triaxial accelerometer can provide object 's accelerations in three directions which include the influence of gravity . the influence of gravity or dynamic acceleration is available by using a low pass filter or a high pass filter . some kinds of angular movement information can also be calculated based on the relationship between acceleration components and their vector sum . a triaxial magnetometer can detect magnetic strength in three directions , and it can also provide angular motion information in the horizontal plane . but the environment magnetic field may disturb the geomagnetic field which reduces the reliability of the magnetometer outputs , for instance , in some steel structure architecture or near some objects with strong electromagnetism . as angular information can also be extracted from accelerometer measurements , a state space filter such as the kalman filter is a commonly used technique to combine angular motion information . beside these , sensors such as barometer can also assist pure motion sensors at human gait recognition . but , in fact , using more sensors means more power consumption , and it is a challenge to design a proper algorithm to fuse different kinds of sensors . a single triaxial accelerometer is quite enough for human fall detection as sufficient information could be extracted from its measurements . besides this , the accelerometer coordinate does not have to be fixed if only the magnitude of sum vector is needed , and that is quite convenient for wearable application . in this paper , a fall detection system based on a wearable device is developed . the hardware and software realization of the device is mainly based on a single triaxial accelerometer and gps / gsm module . the device uses an efficient fall detection algorithm with less resource and power consumption , which means that it is a proper design for outdoor application .", "then it will get the elderly 's geographic position and send fall alarm short message to caregivers . so the elderly who has fallen can get timely help to minimize the negative influence .", "information like linear movements ( e.g. , displacement , velocity , and acceleration ) and angular movements ( e.g. , angle , angular velocity , and angular acceleration ) could be obtained directly or indirectly . beside these , frequency domain parameters could be extracted from basic sensor measurements by techniques such as fft and wavelet [ 11 , 12 ] . for single triaxial accelerometer application , accelerations and derived angular parameters could be used as recognition features . fall detection algorithm design according to the recognition feature , fall detection algorithms are classified as threshold based and machine learning based . for threshold based method , threshold of recognition feature is set by the designer before application which makes the algorithm have rapid response and less resource consumption . but the choice of threshold needs both rigorous schemes and adequate experiments . for machine learning based design , the classification of fall and normal activities is available with the assistance of technologies such as support vector machine ( svm ) and neural network [ 14 , 15 ] . machine learning assistance may enhance system robustness to some extent , but its algorithm design is always high computing resource consumed which limits its application in wearable device . as the compact wearable device requires low power consumption and a single triaxial accelerometer could provide effective information , threshold based fall detection algorithm will be used in this system . algorithm used in this fall alarm system when a real fall happens , collision between human 's body and ground will produce obvious peak value at the sum acceleration a which has magnitude as \n ( 1)a = ax2+ay2+az2 , \n where ax , ay , and az present accelerometer measurements of three axes . the system uses the sum acceleration as the first step to distinguish high intensity movements from others . but normal motions such as jumping or sitting also produce peak values , which mean that additional detection features are required . as human 's motion has low acceleration , it is feasible to get gravity component in each axis by using a low pass filter . if gravity components could be separated before and after human 's fall , then it is possible to calculate the rotation angle of accelerometer coordinate in 3d space , which is also equivalent to the rotation angle of gravity vector relative to fixed coordinate . quaternion is an effective tool to describe rotation movement in human 's gait change which also includes falling . a quaternion could be described as \n ( 2)q = q0+q1i+q2j+q3k \n which has magnitude as \n ( 3)q = q02+q12+q22+q32 . unit quaternion which has magnitude q = 1 can be described as \n ( 4)q = cos2+sin2qxi+sin2qyj+sin2qzk. as shown in figure 3 , rotation angle of q equals . the rotation axis is orthogonal to the rotation plane and its direction is in accordance with right hand screw rule . qx , qy , and qz are three components of the unit vector which describes the orientation of the quaternion at the fixed coordinate . besides rotation movement , quaternion can also describe a vector in 3d space , such as the gravity vector g which could be described as a quaternion \n ( 5)g=0+gxi+gyj+gzk.gx , gy , and gz are three components of g which has quaternion magnitude as \n ( 6)g = gx2+gy2+gz2=g . a unit quaternion q is used to describe human 's falling movement , which can also be divided into three rotation quaternions q1 , q2 , and q3 to simplify the calculation as shown in figure 4 . with the help of gravity vector information before and after human 's falling movement as shown in figure 3 , these three separated quaternions are all available . \n q \n 1 could be expressed as \n ( 7)q1=cos12+sin12sini+sin12cosj \n which has rotation angle and rotation axis information as \n ( 8)1=arctangbefore , zgbefore , x2+gbefore , y2,sin=gbefore , ygbefore , x2+gbefore , y2,cos=gbefore , xgbefore , x2+gbefore , y2 . quaternion q2 can be calculated as \n ( 9)q2=cos22+sin22k \n which has rotation angle as \n ( 10)2=arctan2gafter , ygafter , xarctan2gbefore , ygbefore , x . quaternion q3 is \n ( 11)q3=cos32+sin32sini+sin32cosj \n with rotation angle and rotation axis information as \n ( 12)3=arctangafter , zgafter , x2+gafter , y2,sin=gafter , ygafter , x2+gafter , y2,cos=gafter , xgafter , x2+gafter , y2 . then the rotation of the fall movement can be expressed by quaternion multiplication as \n ( 13)gafter = qgbeforeq=q3q2q1gbeforeq1q2q3 , \n where q=q0-q1i -- q2j -- q3k- is the conjugate quaternion of q. quaternion algebra is normally implemented based on basic matrix algebra . quaternion multiplication used above could be realized by matrix multiplication as \n ( 14)qgbefore = mq0gbefore , xgbefore , ygbefore , z = q0q1q2q3q1q0q3q2q2q3q0q1q3q2q1q00gbefore , xgbefore , ygbefore , z . the whole rotation quaternion can also be decomposed as \n ( 15)q = q3q2q1=mq3mq2q1.q1 , q2 , and q3 are all available based on gravity information before and after the falling movement . at last , it is possible to get four elements of quaternion q by the equation above and the rotation angle could be calculated as \n ( 16)=2arctanq12+q22+q32q0 . when an object is falling , magnitude of will approach 90 which is also a character different from most normal activities . the wearable device will be mounted on human 's waist at first to reflect the motion of human body closely , and the device will record gbefore while the elderly is standing still . there is no special requirement of the device orientation but only keep stationary during the wear . athreshold means the threshold of sum acceleration magnitude and tthreshold means the threshold of oscillation time duration after the break of athreshold . when measurements in three different axes have been acquired , the sum acceleration |a| will be calculated . when a real fall happens , sum acceleration will reach peak value of |a| athreshold . in a real falling , the fluctuation of acceleration will stop in time duration tthreshold and then the sum acceleration is |a| g as the elderly will lie on the ground . then the acceleration a is recorded as gafter . , the system will consider it as a fall if the rotation angle || 90.", "ti 's 16 bits mcu msp430f1611 is used to control the whole system and imply the detection algorithm . the measurement range of accelerometer could be set at 2 g , 4 g , 8 g , or 16 g , and the maximal sampling rate is 3.2 khz . as human 's activities are normally at low frequency bands , 100 hz is a proper sampling rate for human fall detection . there is an inner digital filter in adxl345 which could weaken noise and reduce the burden of digital signal processing in mcu to some extent . the measurements will be sent through iic ( interintegrated circuit ) bus communication between the sensor and the mcu . sim908 can offer gps and gsm service on serial port communication with mcu , and it can also work in low power mode . each hardware component of the wearable device is working under low voltage and the detection algorithm does not need complex calculation resource , so the power consumption of the whole device is quite low . a 1200 mah , 3.7 v polymer lithium battery is quite enough to provide the need of the wearable device for a couple of days . hardware structure of the detection device is shown in figure 6 , and the pcb board prototype is shown in figure 7 . one of them is the software design in wearable device , and the other is in the caregiver 's handset . after initialization of the system , gbefore would be extracted from acceleration measurements by using a low pass filter when the elderly is standing . if a fall has been detected , the wearable device will locate the user and send alarm short message to caregivers immediately . if the user withdraws the alarm by pressing a button manually , the device will get back to fall detection state and a short message will be sent to inform the caregivers . there is a url ( universal resource locator ) which links to a web map in the alarm short message . the fall location information will be highlighted on a web map when the caregiver opens this link .", "system test of the fall detection system has been conducted based on the system design described above . the sampling rate of accelerometer is set at 100 hz and the measurement range is 16 g with a maximum precision of 4 mg . mcu will read raw measurements from sensor 's inner fifo and apply the detection algorithm . the test objects are three different volunteers at the ages of 23 , 42 , and 60 , respectively . based on analysis of these volunteers ' experiment data , athreshold and tthreshold are set as 2 g and 2 s , respectively . in order to get g when standing and lying after the fall , sum acceleration a which has magnitude between ( 1 0.3 ) g and ( 1 + 0.3 ) g will be considered as gbefore and gafter . considering that the tilt of the ground or the lying posture of the elderly may affect the rotation angle , rotation angle between ( 90 30) and ( 90 + 30) will infer that the elderly has fallen . system test contains five kinds of activities of daily living ( i.e. , walking , jumping , squatting , sitting , and resting ) and four kinds of fallings ( i.e. , forward , backward , leftward , and rightward ) . each kind of motion has been repeated 20 times on each volunteer , and the detection results of the proposed algorithm and an acceleration threshold based algorithm are listed in table 1 . the sensitivity and specificity [ 21 , 22 ] of the proposed system can be got from the test data in table 1 . test results of acceleration threshold based algorithm show lower sensitivity and specificity at 91.6% and 88.7% , respectively . \n figure 9 shows the accelerations in different kinds of fallings which all trigger the fall alarm correctly and the corresponding rotation angles are 91.9 , 100.5 , 104.7 , and 114.1. \n figure 10 shows acceleration during activity of lying down and resting which has rotation angle of 117.0 and similar waveform to falling , but the peak acceleration is much lower . they all do not have rotation about 90 ; even some of the peak values are quite high , so the fall alarm has not been triggered . an alarm sms ( short message service ) containing a map url has been received by the handset as shown in figure 12 when a fall has been detected . clicking the url will open a map in web browser on which the fall location will be displayed accurately as shown in figure 13 .", "this paper developed a fall detection system based on a single triaxial accelerometer based wearable device . there is no special requirement of the device 's mounting orientation because the algorithm does not claim the axes of accelerometer to be fixed strictly . the system has low power consumed hardware design and highly efficient algorithm which could extend the service time of the wearable device . as normal activity of resting also has similar rotation as falling , it may trigger fall alarm when the body hits ground heavily . so the choice of athreshold is quite important to distinguish falling from heavily lying activity . sufficient sample number collected from subjects with different age and gender will improve the reliability and robustness of the threshold . beside these , technologies such as svm and neural network are considerable to seek out a proper classification method based on the features used in this system ." ]

[ "one radiologist retrospectively reviewed the medical records of the patients who received tfesi using the conventional approach at our department during a 1-year period , from june 2003 to may 2004 . this involved performing tfesi at the location of the exiting nerve root , regardless of the level of the nerve root compression . for example , tfesi for l5 radiculopathy was performed at the neural foramen of l5-s1 even when the l5 nerve root compression was in the paracentral or subarticular region at the level of the l4 - 5 disc . after a consensus meeting between three radiologists who were unaware of the clinical results after tfesi , we selected those cases treated by conventional tfesi with supra - adjacent nerve root impingement . the inclusion criteria were ( a ) the presence of lumbar radiculopathy , ( b ) nerve root compression in the paracentral or subarticular region at the level of the supra - adjacent intervertebral disc ( for example , at the l4 - 5 disc level for the l5 nerve root ) , ( c ) one level tfesi from l1 to s1 , ( d ) no prior therapeutic tfesi , ( e ) no prior surgery , and ( f ) clear identification of the nerve root compression by using a cross - sectional imaging study ( either computed tomography or magnetic resonance imaging ) . thirteen patients who met all the criteria were included and they were referred to as the conventional tfesi group . however , since june 2004 , we have used tfesi with the preganglionic approach at the supra - adjacent intervertebral disc ( for example , at the neural foramen of l4 - 5 for a l5 nerve root ) if the nerve root compression was at the level of the supra - adjacent intervertebral disc . using the same inclusion criteria as mentioned above , a total of 20 patients were consecutively enrolled and they were referred to as the preganglionic tfesi group . ttransforaminal epidural steroid injection using the conventional approach was conducted under biplane fluoroscopic guidance by two radiologists who were very experienced in spinal interventions . all the treatments were performed as outpatient procedures , and written informed consents were obtained from all the patients . with a patient lying in the prone position , the tube was rotated obliquely to ensure injection at the neural foramen . the goal of positioning was to allow a perpendicular needle tract toward the classic injection site underneath the pedicle , in the so - called \" safe triangle \" ( 5 , 7 ) . the safe triangle was defined by the pedicle superiorly , the lateral border of the vertebral body laterally , and the outer margin of the spinal nerve medially . after disinfecting the skin , local anesthetic was administered by using a 25-gauge needle . under fluoroscopic guidance , a 12-cm 22-gauge spinal needle was then advanced into the safe triangle . at the same time , a lateral view was obtained to verify that the anterior - posterior position of the needle tip was appropriate . the needle position was checked by biplane fluoroscopy , and this was followed by the injection of about 1 ml of contrast material ( omnipaque 300 [ iohexol , 300 mg of iodine per milliliter ] ; amersham health , princeton , nj ) . the posteroanterior and lateral spot radiographs were obtained to document the distribution of the contrast material . bupivacaine hydrochloride ( 0.5 ml , marcaine spinal 0.5% heavy ; astrazeneca , westborough , ma ) and 40 mg ( 1 ml ) of triamcinolon acetonide suspension ( tamcelon ; hanall , seoul , korea ) were slowly injected . in terms of tfesi with using the preganglionic approach , the goal of positioning the needle tip was medial and inferior to that used in the conventional approach . in our department , we target injections just lateral to the pars interarticularis on the oblique view during the preganglionic approach ( fig . a fortnight after tfesi , the patients were followed - up at our outpatient department . this length of follow - up has been proposed in the literature and relates to the duration of the therapeutic effect of corticosteroid ( 7 ) . to check the effect of tfesi , all the patients were recommended not take any drugs or to participate in any physical therapy for their sciatica before this 2-week follow - up . the level and cause of nerve root compression on the ct or mr imaging and the level of radiculopathy were documented in the medical charts before performing tfesi . after retrospectively reviewing medical records , we classified the cause of radiculopathy as being due to a herniated intervertebral disc ( hivd ) or it was due to spinal stenosis . the patients ' demographic variables were also detailed at the initial clinical evaluation . for statistical analysis , we classified the patients ' ages into six age groups ; < 29-years - old , 30 - 39 , 40 - 49 , 50 - 59 , 60 - 69 and > 70 . the duration of radiculopathy was also treated as a potential predictive variable , and it was classified as acute or subacute , i.e. , < 6 months or chronic ( > 6 months ) ( 8) . the treatment outcome was assessed using a 5-point patient satisfaction scale , i.e. , 0 ( poor ) , 1 ( fair ) , 2 ( good ) , 3 ( very good ) , and 4 ( excellent ) , and by using a vas ( visual assessment scale ) that ranged from 0 to 100 . a successful outcome required a patient satisfaction score of 3 ( very good ) or 4 ( excellent ) , and a reduction on the vas of > 50% two weeks after the tfesi . the patients with a successful outcome were referred to as having received effective treatment and those patients without a successful outcome were referred to as having received ineffective treatment . logistic regression analysis was performed and the factors included were conventional or preganglionic tfesi , the cause of radiculopathy , the patients ' age and gender and the duration of radiculopathy . the mann - whitney u test was also used to evaluate for age differences between the two groups ( the conventional and preganglionic groups ) . spss , version 10.0 ( spss , chicago , il ) was used throughout the analysis .", "one radiologist retrospectively reviewed the medical records of the patients who received tfesi using the conventional approach at our department during a 1-year period , from june 2003 to may 2004 . this involved performing tfesi at the location of the exiting nerve root , regardless of the level of the nerve root compression . for example , tfesi for l5 radiculopathy was performed at the neural foramen of l5-s1 even when the l5 nerve root compression was in the paracentral or subarticular region at the level of the l4 - 5 disc . after a consensus meeting between three radiologists who were unaware of the clinical results after tfesi , we selected those cases treated by conventional tfesi with supra - adjacent nerve root impingement . the inclusion criteria were ( a ) the presence of lumbar radiculopathy , ( b ) nerve root compression in the paracentral or subarticular region at the level of the supra - adjacent intervertebral disc ( for example , at the l4 - 5 disc level for the l5 nerve root ) , ( c ) one level tfesi from l1 to s1 , ( d ) no prior therapeutic tfesi , ( e ) no prior surgery , and ( f ) clear identification of the nerve root compression by using a cross - sectional imaging study ( either computed tomography or magnetic resonance imaging ) . thirteen patients who met all the criteria were included and they were referred to as the conventional tfesi group . however , since june 2004 , we have used tfesi with the preganglionic approach at the supra - adjacent intervertebral disc ( for example , at the neural foramen of l4 - 5 for a l5 nerve root ) if the nerve root compression was at the level of the supra - adjacent intervertebral disc . using the same inclusion criteria as mentioned above , a total of 20 patients were consecutively enrolled and they were referred to as the preganglionic tfesi group .", "ttransforaminal epidural steroid injection using the conventional approach was conducted under biplane fluoroscopic guidance by two radiologists who were very experienced in spinal interventions . all the treatments were performed as outpatient procedures , and written informed consents were obtained from all the patients . with a patient lying in the prone position , the tube was rotated obliquely to ensure injection at the neural foramen . the goal of positioning was to allow a perpendicular needle tract toward the classic injection site underneath the pedicle , in the so - called \" safe triangle \" ( 5 , 7 ) . the safe triangle was defined by the pedicle superiorly , the lateral border of the vertebral body laterally , and the outer margin of the spinal nerve medially . after disinfecting the skin , local anesthetic was administered by using a 25-gauge needle . under fluoroscopic guidance , a 12-cm 22-gauge spinal needle was then advanced into the safe triangle . at the same time , a lateral view was obtained to verify that the anterior - posterior position of the needle tip was appropriate . the needle position was checked by biplane fluoroscopy , and this was followed by the injection of about 1 ml of contrast material ( omnipaque 300 [ iohexol , 300 mg of iodine per milliliter ] ; amersham health , princeton , nj ) . the posteroanterior and lateral spot radiographs were obtained to document the distribution of the contrast material . bupivacaine hydrochloride ( 0.5 ml , marcaine spinal 0.5% heavy ; astrazeneca , westborough , ma ) and 40 mg ( 1 ml ) of triamcinolon acetonide suspension ( tamcelon ; hanall , seoul , korea ) were slowly injected . in terms of tfesi with using the preganglionic approach , the goal of positioning the needle tip was medial and inferior to that used in the conventional approach . in our department , we target injections just lateral to the pars interarticularis on the oblique view during the preganglionic approach ( fig . a fortnight after tfesi , the patients were followed - up at our outpatient department . this length of follow - up has been proposed in the literature and relates to the duration of the therapeutic effect of corticosteroid ( 7 ) . to check the effect of tfesi , all the patients were recommended not take any drugs or to participate in any physical therapy for their sciatica before this 2-week follow - up .", "the level and cause of nerve root compression on the ct or mr imaging and the level of radiculopathy were documented in the medical charts before performing tfesi . after retrospectively reviewing medical records , we classified the cause of radiculopathy as being due to a herniated intervertebral disc ( hivd ) or it was due to spinal stenosis . the patients ' demographic variables were also detailed at the initial clinical evaluation . for statistical analysis , we classified the patients ' ages into six age groups ; < 29-years - old , 30 - 39 , 40 - 49 , 50 - 59 , 60 - 69 and > 70 . the duration of radiculopathy was also treated as a potential predictive variable , and it was classified as acute or subacute , i.e. , < 6 months or chronic ( > 6 months ) ( 8) . the effectiveness of tfesi was evaluated two weeks after the procedures . the treatment outcome was assessed using a 5-point patient satisfaction scale , i.e. , 0 ( poor ) , 1 ( fair ) , 2 ( good ) , 3 ( very good ) , and 4 ( excellent ) , and by using a vas ( visual assessment scale ) that ranged from 0 to 100 . a successful outcome required a patient satisfaction score of 3 ( very good ) or 4 ( excellent ) , and a reduction on the vas of > 50% two weeks after the tfesi . the patients with a successful outcome were referred to as having received effective treatment and those patients without a successful outcome were referred to as having received ineffective treatment .", "logistic regression analysis was performed and the factors included were conventional or preganglionic tfesi , the cause of radiculopathy , the patients ' age and gender and the duration of radiculopathy . the mann - whitney u test was also used to evaluate for age differences between the two groups ( the conventional and preganglionic groups ) . spss , version 10.0 ( spss , chicago , il ) was used throughout the analysis .", "the study subjects were 22 women and 11 men with a mean age of 55.1 years ( age range : 17 - 76 , standard deviation [ sd ] : 14.1 ) . the mean age was 53.9 years ( sd : 13.4 ) in the conventional tfesi group and it was was 55.8 years ( sd : 14.8 ) in the preganglionic tfesi group . of the 13 patients in the conventional tfesi group , nine showed effective treatment two weeks after tfesi ( 69.2% ) , and 18 of the 20 patients ( 90% ) in the preganglionic tfesi group showed effective treatment , and the difference in the two rates of effective treatment was of borderline significance ( p = 0.056 ; odds ratio 10.483 ) . the cause of radiculopathy , the age of the groups , gender and the duration of symptoms were not found to be statistically related to the effectivness of tfesi ( p > 0.05 ) . these results are summarized in tables 1 , 2 . in the conventional tfesi group , seven patients ( 53.8% ) had spinal stenosis and six patients ( 46.2% ) had hivd , and in the preganglionic tfesi group , 13 patients ( 65% ) had spinal stenosis and seven patients ( 35% ) had hivd . in the conventional tfesi group , the radiculopathy was acute or subacute in eight patients ( 61.5% ) and chronic in five patients ( 38.5% ) ; in the preganglionic tfesi group , radiculopathy was acute or subacute in six patients ( 30% ) and it was chronic in 14 patients ( 70% ) . in the conventional tfesi group , tfesi at l5-s1 was performed in 10 patients and tfesi at l4 - 5 was performed in three patients ; in the preganglionic tfesi group , tfesi was performed at l5-s1 in five patients , at l4 - 5 in 14 patients and at l3 - 4 in one patient .", "lumbosacral radiculopathy is a common and costly medical disease , and its lifetime prevalence has been estimated to be 40 - 60% ( 9 ) . based on the recent concepts of pain generation in the sciatic condition , it 's believed that concomitant chemical irritation of the nerve root that 's caused by disk material is the decisive factor for the development of severe sciatica , rather than the pain being due to mechanical compression alone ( 10 - 16 ) . according to this concept , the local application of corticosteroids in the area of the compressed thus , percutaneous injection based therapies , including tfesi , are being used with increasing frequency to treat the radiculopathy resulting from a herniated disc or degenerative lumbar spinal stenosis ( 17 - 19 ) . in contrast to an interlaminar or a caudal epidural steroid injection , tfesi provides a low volume of concentrated medication to a selected nerve root . medical journals and texts often incorrectly refer to transforaminal epidural injections as \" selective epidural injections \" , \" selective nerve root blocks \" , or \" nerve root sleeve injections \" . however , the international spinal intervention society ( isis ) , has promoted the used of a nomenclature based on precise anatomic descriptors , and it recommends the term \" transforaminal \" ( 5 ) . gajraj ( 4 ) mentioned that to be selective , a nerve root block should be performed extraforaminally and distal to the division of the ventral and dorsal rami ; otherwise , the dorsal ramus and its innervated structures would also be anesthetized . therefore , they suggested that the therapeutic procedure be referred to as a ' transforaminal epidural steroid injection ' and that the diagnostic procedure should be referred to as a ' selective spinal nerve block ' or a ' selective ventral ramus block . ' in the case of tfesi with using the conventional approach , the spinal needle is positioned within the \" safe triangle \" ( bordering the pedicle , the exiting nerve root and the lateral border of the vertebral body ) , with the bevel placed below the inferior aspect of the pedicle ( 5 , 7 ) . using this conventional approach , the injectate typically bathes the epidural space around the dorsal root ganglion and then it descends along the distal aspect of the nerve root . ideally , if there is no stenosis and the needle tip is appropriately positioned , the injectate may spread rostrally to the epidural portion of the preganglionic nerve root as well . however , for most cases of lumbosacral radiculopathy that are secondary to stenosis or a herniated disc , the site of impingement usually lies at the level of the supra - adjacent intervertebral disc , which is rostral to the conventional lumbar tfesi bevel position . in addition , one can not always guarantee a rostral spread of injectate to the epidural / preganglionic portion of the nerve root . thus , performing preganglionic tfesi at the supra - adjacent level may be a more effective method to deliver injectate to a target site . for the preganglionic approach , it is important that the injectate distributes itself predominantly in the epidural space at the disc level ( more inferior than that for the conventional approach ) , and that it does not excessively spread along the spinal nerve at the supra - adjacent level , which is not inflamed or compressed . lew et al . ( 6 ) inserted the needle into the inferior and anterior neural foramen for performing preganglionic tfesi , and we use a modification of this method . the landmark we use for needle insertion is just lateral to the pars interarticularis on the oblique view ; this is medial and inferior to that used for the conventional approach ( fig . first , it is not a controlled , randomized prospective study ; thus , it has the limitations of a retrospective study and so a randomized , prospective study is warranted . third , other factors that probably influenced the therapeutic effect were not included . in conclusion , preganglionic tfesi was found to have a better therapeutic effect on the radiculopathy caused by compression at the supra - adjacent level than did conventional tfesi , and this result had borderline statistical significance ." ]

[ "one of the key challenges \n in the development of novel materials \n is the ability to tune and control their macroscopic physical and \n chemical properties on a molecular level by external stimuli . such a degree of control is challenging but crucial for a wide range \n of applications ranging from catalysis to pharmacological and medical \n applications . in photoactive materials light absorbed by chromophores can be converted \n into directed functionality , typically by means of photoinduced isomerization \n of nitrogen or carbon containing double bonds and pericylic reactions . indeed , e z isomerization \n results in large amplitude changes in structure as well as chemical \n and physical properties . molecular motors based on overcrowded alkenes are particularly \n attractive due to the synthetically tunable properties , such as thermal \n stability , absorption spectra , etc . , and therefore are readily applied \n to a wide range of functional systems . however , although the thermally \n activated step in the unidirectional rotary cycle is well understood \n and is now largely predictable , the photochemical properties and especially \n photochemical quantum yields are less well understood . hence both \n from a fundamental perspective and in achieving the goal of complete \n molecular design , gaining insight into the excited - state properties \n of light driven molecular - sized machines is essential . the overcrowded alkene - based molecular \n rotary motors are composed \n of a central carbon carbon double bond ( the axle ) embedded \n in an intrinsically chiral environment . the unidirectional rotational \n cycle starts with a photoinduced e z isomerization around the central c = c bond , generating \n a metastable isomer p * ( figure 1 ) , which relaxes thermally to the stable isomer p , which in \n the case of a symmetric stator unit is identical to i. this isomer \n marks half of the rotation cycle and is the starting point for a second \n photoinduced isomerization step that leads again to a metastable isomer . \n thermally activated conformational isomerization of this isomer brings \n the system back to its initial state . overall , the rotor part has \n then performed a complete rotation with respect to the stator unit \n of the molecular motor . although the rotation includes both \n photochemical and thermal steps \n that involve different parts of the motor , the structural evolution \n is largely governed by the excited - state properties of the central \n c = c group , which , in turn , are dictated by the potential energy \n surfaces of the excited states that are accessed upon electronic excitation . \n despite the large number of theoretical and experimental studies that have focused on characterizing \n this process , there are several key questions outstanding including \n identification of the main structural coordinates and the role of \n various electronic states involved in the excited - state dynamics . \n time - resolved studies are essential to elucidate these dynamics but \n have thus far focused on probing the change in the electronic structure \n after photoexcitation through uv / vis absorption and fluorescence studies . these techniques offer \n a high time resolution but provide only indirect information as to \n how the structure evolves spatially over time . in the present contribution \n we show that this information can be obtained through a combination \n of picosecond time - resolved vibrational spectroscopy of the electronically \n excited states together with quantum - mechanical calculations .", "the setup for the time - resolved infrared measurements has been \n described in detail previously . mid - ir \n probe pulses were generated using an amplified ti : sapphire system \n ( spectra - physics hurricane , 600 j , repetition rate 1 khz ) pumping \n a commercial bbo - based opa ( spectra - physics opa-800c ) , the signal \n and idler output of which were difference - frequency - mixed in aggas2 . uv pump pulses ( 400 nm , 1 j ) were generated \n by doubling part of the output of the ti : sapphire laser . the diameter \n of the uv pump focus was 180200 m ; that of \n the ir probe focus , 150 m . the sample cell with caf2 windows spaced by 500 m was placed in the ir focus . \n to avoid accumulation of the thermally unstable conformer p * during \n the measurements , the pump probe delay time was scanned by mechanically \n adjusting the beam path of the uv pump . the temporal resolution of \n 200 fs has been determined from the full width at half - maximum of \n the pump probe cross - correlation function . the pump pulse was chopped \n at 500 hz , and transient spectra were obtained by subtracting nonpumped \n absorption spectra from the pumped absorption spectra , both of which \n were recorded by spectrally dispersing the probe pulses using an oriel \n ms260i spectrograph and measuring the frequency - dependent ir intensity \n using a 2 32 hgcdte detector array ( infrared associates ) . compound \n i was available from earlier studies ( see ref ( 44 ) ) . in all experiments we \n investigate a 10 mm solution of compound i in deuterated cyclohexane \n ( aldrich , 99.6 atom% d ) . for the investigation of the ground - state \n conformers ( including \n vertical excitation energies and forces acting at the franck condon \n point ) quantum mechanical calculations were performed using the turbomole \n suite of programs . geometry optimization \n and normal - mode analysis were performed by ( time - dependent ) density \n functional theory ( ( td)-dft ) using the hybrid functional b3lyp . for the geometry optimization the d3 correction \n method of grimme et al . the cc - pvdz or aug - cc - pvdz basis \n sets were employed , respectively . post - hartree fock calculations \n were performed on the basis of spin - component scaled second - order \n mller plesset perturbation theory and the approximate coupled - cluster singles - and - doubles \n model cc2 . all perturbation method calculations were performed using \n the resolution of identity ( ri ) approximation and the efficient ricc2 module implemented \n in the turbomole package together with the standard auxiliary basis \n sets . the gaussian09 program package was employed to study the excited - state properties \n in more detail and in particular to optimize the structure of the \n dark - state species . geometry optimization and normal - mode analysis \n were performed in the framework of td - dft at the b3lyp / cc - pvdz level .", "the structural evolution from the \n initial state i to isomer p * \n ( figure 1 ) was considered first in terms of the spectral properties \n of the initial state and the first metastable product ( p * ) . the steady - state \n uv / vis absorption spectra of the two isomers are distinct , reflecting \n a change in the conjugated system ( figure 1a ) . the ftir spectra of the two isomers ( figure 1c ) show that the \n carbon carbon stretch and ring vibrations couple to a large \n degree as a consequence of the extended system ; however , dft \n calculations enable us to assign the bands in the 15501650 \n cm range as being mainly associated with \n modes involving the central c = c double bond ( supporting information ) . the metastable isomer p * shows a \n shift of these modes to lower frequencies confirming a decrease in \n bond strength . comparison of the optimized geometries of the two isomers \n ( i ( p * ) , cc bond length 1.369 ( 1.377 ) ; cc = cc dihedral \n angle 14.1 ( 29.5 ) ) evidence the corresponding lower \n bond character as well . unidirectional motion of the unidirectional \n motor starting from \n the thermally stable conformer ( i ) via the product of the photoinitiated \n step ( p * ) to the thermally stable conformer ( p ) ( optimized geometries \n on the b3lyp+d / aug - cc - pvdz level ) : ( a ) experimental and calculated \n ( light color and dotted line ) uv vis spectra of conformer i \n and p * ; ( b ) molecular orbitals of the initial conformer ; ( c ) experimental \n and calculated ir spectra ( b3lyp+d / aug - cc - pvdz ) of the initial state \n ( blue ) and final state ( red ) . in both the measured uv / vis absorption \n and ftir spectra at the photostationary state ( pss ) , i and p * are \n present in a 25:75 ratio . time - resolved vibrational spectroscopy was employed to achieve the required temporal resolution as well \n as structural sensitivity to elucidate the structural evolution that \n follows photoexcitation with a short uv - pump pulse ( center wavelength \n 400 nm ) . the resulting structural evolution was followed by time - resolved \n differential absorption spectra in cyclohexane - d12 with a time resolution of 200 fs ( figure 2 ) . the transient ir spectra show , as expected , \n pronounced differences between the ir absorption spectrum of the molecule \n in the initial and excited states . a first point of note is that the \n spectrum does not evolve further after ca . 30 ps , and the difference \n spectrum corresponds perfectly with the difference spectrum obtained \n upon continuous wave excitation ( figure 1 ) ; i.e. , the metastable isomer p * has formed \n fully within the 30 ps after excitation . ftir and time - resolved \n infrared spectra of the molecular motor \n in cyclohexane - d12 : ( a ) ftir spectra of \n the thermal stable conformer ( initial , solvent corrected , top ) , uv - ump / ir - probe \n transient infrared spectra ( uv = 400 nm ) ( middle ) , \n and difference ftir spectra between the two ground - state conformers \n of the molecular motor ; ( b ) kinetics of selected bands and corresponding \n results of the global fit ; ( c ) species associated spectra ( sas ) of \n species 1 and calculated ir spectra ( top ) and sas of the pss ( sp3 ) \n together with ftir spectra ( bottom ) . negative bands indicate ground - state \n bleaching , and positive bands , species created after excitation . the time - resolved ir spectra obtained \n within the first 30 ps exhibit \n several remarkable features . the first and most striking is a broad \n and unstructured absorption over the entire mid - ir range ( 12003000 \n cm ) . this absorption , which decays rapidly , is \n particularly prominent at early time delays ( < 5 ps ) . individual \n absorption bands with remarkably high integrated intensities in the \n 14001600 cm range are superimposed on \n the broad spectral feature . notably , these bands are significantly \n broader than the bleached bands in the transient spectra and bands \n in the ftir spectra . the solvent response and the dependence of the \n uv pump intensity ( supporting information ) confirm that these features are intrinsic to the compound and are \n not due to solvent or two - photon processes . the width and intensity \n of the broad excited - state absorption bands \n excludes that they arise from vibrational transitions . indeed , the \n absorbance is closer to that expected for electronic transitions , \n albeit these typically occur at much higher energies ( in the uv / vis \n range ) . the initial state of the compound \n ( i ) shows an absorption band at 390 nm ( figure 1 ) , which is reproduced well by b3lyp / cc - pvdz \n calculations in the gas phase ( 403 nm ; f = 0.428 ) . \n the s1 s0 transition has predominantly \n homo lumo character ( figure 1 ) . in contrast to previous assignments , however , we find that this electronic transition \n is not localized on the stator but involves to a significant extent \n excitation from the bonding orbital of the central double \n bond to the antibonding * orbital ( figure 1 ) . as a consequence , the double bond character \n of this bond is reduced as well as the barrier to rotation around \n this bond . in line with calculations on ethylene and its derivatives , \n we find a dark state ( s2 ) associated with the homo1 \n lumo excitation at slightly higher excitation energies that \n is not directly accessible from the ground state ( figure 1 , table 1 ) . because the homo1 orbital is localized \n on the aromatic stator unit , s2 has a significantly larger \n dipole moment than s1 ( 4.3 vs 2.2 d at the scs - cc2/cc - pvdz \n level ) . it should be emphasized that the description of the lower - lying \n electronic states in the compound studied here is thus entirely different \n from ethylene and its derivatives where , as discussed by salem and \n others , for torsion angles of around 90 the two low - lying electronic \n states have either a biradical or zwitterionic character depending \n on the occupation of the two central 2p - orbitals and require multireference \n methods for a proper description . in the present study , in contrast , \n we investigate the dynamics occurring at small torsional angles ( vide infra ) for which the employed single - reference methods \n not only have been validated . in addition \n we employ the results of multireference calculations on smaller motor \n molecules as reported by liu and morokuma to make a further comparison with our experimental results . for s0 the optimized \n structure on the b3lyp+d / aug - cc - pvdz level was used to calculate the \n vertical excitation energies . for vertical excitation they thus strongly suggest that the broad \n and structureless absorption feature observed in the time - resolved \n ir spectra is associated with the electronic s1 \n s2 transition . the presence of two close - lying states also \n explains why the induced absorption bands have such high intensities . \n our calculations show that the energy gap between the two states strongly \n depends on structural parameters such as the c = c bond length \n that are involved in the 14001600 cm normal \n modes . for these modes one therefore expects that their transition \n moments will be enhanced by vibronic coupling as is indeed observed . \n the conclusion that the excited - state dynamics of the molecular rotor \n should be described in a multistate model is further supported by \n recent multireference calculations on smaller rotor molecules that \n also find very small energy differences between the s1 and \n s2 states . the excited - state \n dynamics were elucidated further using a global \n analysis of the transient spectra , which shows that the spectra can \n be described well with two exponential decay terms with time constants \n of 1.53 0.03 and 12 1 ps . we note that our experiments \n have a time resolution of 150200 fs and therefore do not allow \n observation and confirmation of the ultrafast dynamics reported previously \n in fluorescence - upconversion studies . species - associated spectra ( sas ) ( supplementary \n figure 2 ) were derived by using a two - step sequential kinetic \n model . the sas of the first species shows an overall background \n signal \n with broad and intense features superimposed on it that indicate vibronic \n coupling . furthermore , the increase ( decrease ) of absorbance in the \n 1550 ( 1600 ) cm region indicates a substantial \n change in bond character of the central double bond ( figure 2c ) . this spectrum was related \n to the structure of this excited - state species using excited - state \n geometry optimizations . \n state without any structural constrains associated with the homo1 \n lumo excitation leads to a stable minimum that can be reached \n from the franck condon excited geometry by relatively small \n structural changes ( supplementary figure 4 ) , and an excited - state ir absorption spectrum that is in good agreement \n with the sas of species 1 ( figure 2 ) . it is notable that for a proper comparison with \n the experimental spectrum , the theoretically predicted stick spectrum \n needs to be convolved with 20 cm gaussian line \n shapes , suggesting that in the dark state a wide range \n of structures is sampled . our experiments and calculations thus demonstrate \n that excitation and excited - state decay involve two different electronic \n states . in earlier studies , time - resolved fluorescence and visible \n absorption data were interpreted in terms of a decay from a single , \n isolated electronic state decaying to the ground state after structural \n relaxation in the excited state . the present data show that the s1 state actually decays to an intermediate , dark electronic \n state , and from there to the ground state . in the sas of the \n second species ( supplementary \n figure 2 ) the broad background is absent , and bands have widths \n comparable to those in the s0 state . the absence of the \n broad background indicates that this species is no longer in an electronically \n excited state but back in the ( vibrationally hot ) electronic ground \n state . indeed , the vibrational activity observed in the 1550 cm region follows closely the ir absorption spectrum \n of p*. in addition , repopulation of the original state ( i ) is observed \n also ( i.e. the quantum yield for isomerization is less than unity ) , and the sas of the second species contains contributions \n from both vibrationally hot ground - state i and metastable p * isomers . \n vibrational cooling of these isomers leads to the sas of the final \n species , which is in excellent agreement with the steady - state ftir \n difference spectrum of room - temperature i and p*. the present \n experimental and theoretical data allow a complete \n picture of the mechanism by which the molecular rotary motor undergoes \n isomerization after electronic excitation ( figure 3 ) . photon absorption brings the motor to \n a bright state from which it decays on an ultrafast \n time scale and within the time resolution of the present experiments \n to a different electronically excited dark state . \n in line with previous calculations on similar systems , our calculations \n indicate that this is a barrierless process proceeding via a conical \n intersection . previously , it was assumed \n that structural evolution on the homo lumo potential energy \n surface is responsible for the observed ultrafast decay of the fluorescence , \n and ( following commonly accepted models on photoisomerization of carbon carbon \n double bonds ) that it primarily proceeds along torsional and pyramidalization \n coordinates . the present study , in contrast , leads to the conclusion \n that the fluorescence decay is mediated by the passage through the \n conical intersection of the homo lumo and homo1 \n lumo potential energy surfaces . inspection of the structural changes \n that occur upon geometry relaxation to the minimum on the homo1 \n lumo potential energy surface show that the central c = c \n bond length increases from 1.381 to 1.461 and that only relatively \n small changes occur in the torsional and pyramidalization coordinates . \n in combination with the forces that act on the molecule at the franck condon \n excited bright state ( supplementary \n figure 3 ) , this suggests that motion along the c = c stretch \n coordinate needs to be taken into account as well for understanding \n the decay of the fluorescence . proposed multistate dynamics of the photoinduced \n unidirectional \n rotation of the molecular motor starting from conformer i to conformer \n p * ( projected into one dimension ) : dotted arrow , ultrafast process \n reported in previous work ; fast ( red arrow ) and slow process ( blue \n arrow ) observed in the present time - resolved infrared study . ( a ) calculated \n energy profile along the torsion coordinate showing how the energies \n of the electronic states change as the molecules evolves to conformer \n p*. ( b ) schematic representation of the proposed model . hence , it can be concluded that \n internal conversion to the electronic \n ground state takes place from the dark state . the \n decay rate for this process indicates that it is mediated by conical \n intersections between the two states as has indeed been proposed in \n previous theoretical studies . these studies \n concluded , however , as well that to reach these intersections a barrier \n needs to be overcome that results from the steric repulsion of the \n methyl group of the rotor unit with the hydrogen of the stator unit . \n previous time - resolved fluorescence measurements reported an ultrafast \n damping mode at 113 cm that was speculated to \n arise from motion along a coordinate involving inversion / pyramidalization \n although no direct support could be found for such an assignment . interestingly , our calculations find in the \n dark state a mode at 119 cm ( b3lyp / cc - pvdz ; \n not scaled , supporting information ) that \n involves motion of the methyl group with respect to the hydrogen of \n the stator unit . one might therefore wonder to what extent this mode \n is related to the oscillatory behavior of the fluorescence . our observed \n s2 decay constant of 1.5 ps matches the slow component \n of the overall fluorescence decay ( 0.91.5 ps ) . our calculation of the excitation energies of \n the bright and dark states along the \n 119 cm normal mode did not show a conical intersection \n between the two states , supporting the previous explanation of the \n oscillations observed in the fluorescence measurements by the movement of wave packets and suggesting \n a scenario in which a coherent oscillation in the dark s2 state periodically partly repopulates the fluorescent s1 state . however , our experimental methods do not provide the time \n resolution to confirm this .", "the photodynamics \n of a unidirectional molecular motor has been \n studied by time - resolved ir spectroscopy in which both vibrational \n and electronic structures are probed . in combination with quantum \n mechanical calculations , the high structural sensitivity and real - time \n character of the technique allows us to understand fundamental aspects \n of the operation mechanism . the results show that conversion of photon \n energy into directed motion proceeds on the potential energy surfaces \n of two different electronic states , which is the more important as \n it implies that the conical intersection between the dark \n electronically excited state and the ground state determines the efficiency \n of the motor . to rationally tune the performance of photoinitiated \n unidirectional rotation thus involves a multicoupled - state optimization \n of nuclear motion ." ]

[ "the patellofemoral joint is one of the most common sources of knee pain in younger people . maltracking and instability of the patellofemoral joint are responsible for the majority of symptoms and are associated with the development and progression of osteoarthritis1 ) . the position of the patella relative to the trochlea of the femur is not fixed and changes as the knee moves from extension to flexion . differences in the morphology of the patellofemoral joint have been shown to be associated with altered kinematics and patellofemoral instability29 ) . a variety of measurements have been described to identify abnormalities of the patellofemoral joint . on a lateral radiograph , or a sagittal magnetic resonance imaging ( mri ) scan , the insall - salvati index10 ) is measured to assess patella height by comparing the length of the patellar tendon with the length of the patella . the caton - deschamps index11 ) can also be used to determine patellar height and is calculated by comparing the length of the patellar articular surface with the distance from the postero - inferior border of the patellar and the anterior edge of the tibial plateau . on the axial view , the bisect offset can be used to assess medial or lateral displacement of the patella . patellar tilt is also assessed on the axial view and is normally 05 relative to a line connecting the posterior femoral condyles . the position of the knee and its weight bearing status have been shown to influence patellofemoral kinematics and measurement of patellofemoral indices1215 ) . mri is commonly used in the investigation of patellofemoral pain and instability and in many cases is the investigation of choice in preference to plain radiography . mri provides additional information compared to radiographs , such as the condition of the articular surfaces , integrity of ligamentous stabilising structures ( e.g. the medial patellofemoral ligament ) , and rotational alignment ( tibial tuberosity trochlear groove ) , and facilitates better evaluation of trochlear dysplasia5,1620 ) . whilst the patellofemoral indices described above were originally designed for radiographic measurements , they have been applied to mri which has been shown to be an excellent imaging modality for evaluating the patellofemoral joint with good correlation with plain radiographs2124 ) . mri is usually taken with the patient in supine position and the knee in extension1,21 ) . it has been demonstrated that patellofemoral instability typically manifests during the terminal 30 of knee extension with contraction of the quadriceps femoris muscle14 ) . undergoing an mri scan can be an intimidating experience for patients , particularly those prone to claustrophobia25,26 ) . such patients are likely to be anxious and tense during the scan and may inadvertently contract their quadriceps . this quadriceps contraction may alter the relationship of the patella to the femur , overestimating the degree of instability that may be present . the objective of our study was to determine the impact of knee position and quadriceps contraction on patellofemoral indices measured on mri .", "twenty patients undergoing mri scan of the knee were identified from a pool of referrals to the orthopaedic department at our institution . patients were selected based on the absence of patellar or patellofemoral symptoms documented in the clinical notes or on the mri request . inclusion criteria were 2540 years of age , a body mass index less than 30 , a clinical diagnosis of non - patellar or patellofemoral pathology . exclusion criteria were known or suspected patellar or patellofemoral conditions , connective tissue disorders that could cause hyperlaxity , and previous surgery or injury to the knee . axial and sagittal mri sequences were performed with the knee fully extended and quadriceps contracted ; knee fully extended and quadriceps relaxed ; knee flexed 30 with quadriceps contracted ; and knee flexed 30 with quadriceps relaxed . a triangular wedge was placed under the patient s knee to reproducibly create 30 of flexion . when quadriceps contraction was required , subjects were given a rest period between mri sequences to prevent muscle fatigue . bisect offset27 ) and patellar tilt angle28 ) were measured on axial mri images using the slice showing the widest view of the patella . the insall - salvati index and caton - deschamps index were measured on the sagittal view using the slice showing the widest view of the patella . 1 ) was determined by drawing a line connecting the posterior femoral condyles and a perpendicular line was then drawn through the deepest point of the trochlea groove to where it intersects the patellar width line . in cases where the trochlea was flattened , the bisect offset is defined as the proportion of the patella lying lateral to the midline as a percentage of the whole patellar width . patellar tilt was defined as the angle between a line connecting the posterior femoral condyles and the maximum patellar width ( fig . the insall - salvati ratio was determined by comparing the length of the patellar tendon with the length of the patella . the caton - deschamps index was defined as the ratio of the distance between the lower edge of the patellar joint surface and the upper edge of the tibial plateau to the length of the patellar articular surface ( fig . the student t - test ( unpaired ) was used to compare the difference between these values in the various states of knee flexion and quadriceps contraction .", "all 20 patients were assessed with the knee in extension and flexion , with and without quadriceps contraction . the mean values of the patellar tilt , bisect offset , insall - salvati ratio and caton - deschamps index of the patients are detailed in table 1 . the mean patella tilt averaged 9 with the knee flexed and quadriceps in any state . patella tilt increased but remained within normal limits with the knee extended and quadriceps relaxed . however , when the quadriceps was contracted with the knee in extension , the mean patella tilt was 14.6 , the upper limit of the normal range . the mean difference in patella tilt from the flexed , relaxed positon to the extended , contracted position was 5.6 ( range , 9.8 to + 25.9 ) , but this did not reach statistical significance ( p=0.06 ) . the mean bisect offset angle in the flexed position increased from a normal range of 56% and 57% when the quadriceps were relaxed or contracted , respectively , to an abnormal value of 65% with the knee extended and quadriceps contracted ( p=0.012 ) . there were four patients who demonstrated normal patella tilt and bisect offset with the knee flexed and quadriceps relaxed , but abnormally high tilt and bisect offset were observed with the knee extended and quadriceps contracted . the mean values of the caton - deschamps index were within the normal range with knee flexed but were abnormally elevated with the knee extended , both with the quadriceps relaxed and contracted . the difference between the flexed relaxed position and extended contracted position was 0.05 ( range , 0.15 to + 0.31 ) , which did not reach statistical significance ( p=0.34 ) . the mean values of the insall - salvati ratio were normal in all combinations of knee position and quadriceps contraction . the change in the insall - salvati ratio from the flexed , relaxed state to the extended , contracted state was 0.07 ( range , 0.17 to + 0.11 ) , which was not statistically significant ( p=0.97 ) .", "mri evaluation of the knee forms an integral part of the investigation of young patients with knee pain . the patella begins to engage the trochlea during knee flexion , and patellofemoral instability typically manifests during the terminal 30 of knee extension . in the clinical setting of patellofemoral disorders , mri can provide useful information about the bony morphology of the femur and patella as well as the condition of the articular cartilage . numerous patellofemoral measurements or indices have been described to quantify abnormalities of the patellofemoral joint . many of these measurements were originally described on plain radiographs and their use has been extended to mri . they can be of some value when deciding on the most appropriate management for patients with patellofemoral symptoms . significant differences in these measurements exist between patients with patellofemoral instability and asymptomatic patients3,6 ) . quadriceps contraction and weight bearing have been shown to alter patellar height and patellofemoral kinematics1215,29,30 ) . for the majority of patients , mri of the knee is performed with the knee extended . patients undergoing mri scanning of the knee may be anxious and as a result involuntarily contract their quadriceps . this has the potential to lead to inappropriate management decisions or unnecessary surgery . in our study , we aimed to assess the influence of knee position and quadriceps activity on frequently measured patellofemoral indices . in our cohort of patients , none of whom had patellofemoral symptoms , an increase in the measured patellofemoral indices was observed with the knee extended and quadriceps contracted . the mean values of these indices increased above the normally accepted range in some cases with the knee in this position . in the case of the bisect this suggests that the flexed position protects against erroneous or exaggerated patellofemoral measurements caused by inadvertent quadriceps contraction as well as trochlea engagement . thus , it is important that potential confounders ( e.g. quadriceps contraction and knee extension ) are minimised in order to achieve more reliable measurements upon which surgical decision - making is based . we , therefore , recommend , when investigating patients with suspected patellofemoral pathology , mri of the knee should be performed in 30 of flexion to obtain a more accurate view of the patellofemoral joint and avoid the confounding effects of quadriceps contraction .", "patellofemoral indices measured on mri are affected by the position of the knee and quadriceps muscle activity . with the knee in extension and the quadriceps contracted , as may occur in an anxious patient , there was a tendency towards abnormal patellofemoral measurements in our cohort of asymptomatic patients . performing mri of the knee in 30 of flexion helps to reduce the confounding effect of quadriceps contraction and may result in more reliable radiological assessment of the patellofemoral joint ." ]

[ "the knowledge of mechanical materials behaviour is of great importance particularly for some innovative engineering applications , which involve a single material , bimaterials , or multiple materials . some bimaterials are obtained by means of a coating process and consist of coupled layers that may or may not contain filler elements , such as a foaming operation , or may be developed as welded substrates . usually , at the end of the process , the material is identified as a new single material . the coating procedure developed and studied in this work refers to the hot - dip galvanizing treatment , considered as a better treatment to fight against corrosion . the role of a hot - dip galvanizing treatment consists in the deposition of a protective external layer of metallic zinc obtained by immersing the steel in a zinc bath at a temperature of around 460c . when the material ( i.e. , steel ) is introduced into the zinc bath and then removed , several changes in the chemical composition and in the mechanical structure can occur . these changes produce a new structural arrangement on zinc substrate and are usually revealed by the generation of cracks in the zinc layer . the behaviour of materials may change as a result of various events such as fatigue , fracture , wear , fretting fatigue , creep , hydrogen embrittlement , thermal shock processes , or atmospheric attacks . an important role in these failure processes is played by any discontinuity in the material that can appear during the manufacturing process or during working period , or as a result of inappropriate use . in our case it appears as a consequence of the hot - dip galvanizing treatment applied as described above in association with the action of the mechanical loading . recently , krishnan and xu focused on failure mechanics of adhesive joints ( i.e. , considered as bimaterials ) using a fringe pattern concentrations technique to describe the bimaterials interface . as analytical model , they used the fracture mechanics approach , while to compute the stress singularity in the bimaterial layer they took into account the stress intensity factor in mode i. the formula used to express this stress intensity factor is \n ( 1)ki = rekai , \n where k is the stress intensity factor in the case of the bimaterial component : \n ( 2)k = ytaaiei , \n where t = p(3s / w ) and y , are the calibrating factors that depend on a / w , b / w , respectively , dundurs ' parameters . then a , b , and w represent the length of the possible crack , the thickness , and the length of the specimen . is a function of dundurs ' parameters , , and is presented as \n ( 3)=12ln11+ , \n where , dundurs ' parameters material , is expressed by \n ( 4)=112221211122+2121 \n in which 1 and 2 denote the material , while and are the shear modulus and poisson 's ratio , respectively . the elastic fracture theory is a suitable tool to compute the mechanical behaviour in case of coatings , composites , and welded structures . the bimaterial produced by the reactions that occur during the hot - dip galvanized steel process must have the same conditions on the contact surface as the linear spring - like model . the discontinuity of displacement across the interface is assumed to be linearly proportional to the displacement at the interface of the constituent where the stress source is located . the present authors agree that the two materials that form the bimaterial should be considered as a functionally autonomous subsystem with a different young 's modulus and poisson 's coefficients . this implies a strain incompatibility between the two solids and the formation of a periodic distribution of tensile and compressive stress in checkerboard patterns under the uniaxial tensile test . a robust approach was proposed by yu et al . in order to formulate analytical solutions through the use of linear spring - like model . according to this theory we can define the type of contact between the surfaces by the fraction of the adherent area , applying the following formula : \n ( 5)=aacac , \n where is used to quantify the extent of bonding at the interface , a is the total area of the interface , and ac is the area covered by paper ( see example on figure 2 from ) . according to the study made by panin et al . , the interface of solid materials covers a sinusoidal surface layer due to a rotation of successive constraints in tensile and compression stress in the structure . this effect is described by the following equation : \n ( 6)=aysinxlxt2 , \n where t is the thickness of the coating , x is the distance of crack propagation , y is the stress coefficient .", "this paper addresses two goals : first of all , to experimentally characterize the layer of zinc applied during the hot - dip galvanization process , in order to obtain necessary information about the uniformity of the zinc layer and the number of cracks and their length , and finally to estimate the behaviour of the cracks located in zinc layer when the mechanical loading is imposed . secondly , we proposed to corroborate the experimental results with analytical and numerical computations , ascertaining where the crack discontinuities spread while considering the three main possibilities of crack development : arrest at the bimaterial interface , crossing into the second material , in our case steel , and finally creating a deflection between the two materials . in the literature k. m. mrz and z. mrz predicted the behaviour of bi- and multimaterial interfaces according to a simplified approach using the mk - criterion based on the linear elastic fracture mechanics ( lefm ) . in this criterion it is assumed that the crack growth follows the direction of minimum distortion energy density at a distance corresponding to a specified value of dilatation energy . figure 2 shows a specific case in which the crack is considered to propagate perpendicularly to the interlayer and make a bifurcation at the interface . the decohesion phase may present as one of the four possible scenarios whereby the crack will propagate as follows : ( i ) the plastically weaker material ( wm ) to the plastically stronger material ( sm ) , wm - sm , ( ii ) the plastically weaker material ( wm ) to the plastically stronger interlayer ( si ) , wm - si , ( iii ) the plastically stronger material ( sm ) to the plastically weaker material ( wm ) , sm - wm , and ( iv ) the plastically stronger material ( sm ) to the plastically weaker interlayer ( wi ) , sm - wi . in simple terms , the criterion for crack initiation and propagation along the interface could be considered , where the maximum stress , max , is expressed as \n ( 7)max=x+y2+x+y22+xy . to solve the problem of deflection at the interface of two materials , hutchinson proposed the following condition : \n ( 8)gcgc1<gdgp1 , \n where g = gc represents release energy rate of the interface bimaterial . studies , related to the problem of cracks running perpendicular to a bimaterial , yields a different expression for the stress intensity factor that is connected to the stress tensor as follows : \n ( 9)ij = kr1fij. to determine the propagation energy of the crack running perpendicular to the interface , also called energy release rate , the following equation studied by madani et al . can be applied : \n ( 10)gd=(11)/1+(11)/24cosh2k12+k22gp=1222kp2 . \n in ( 8) , ( 10 ) gd and gp are the strain energy release rate for deflection and penetration ; k1 and k2 are the stress intensity factors for the interface crack ; kp is the value of stress intensity factor , for a particular case , when the crack from material 1 penetrates into material 2 ( see figure 2 ) . analytical techniques and the green function can be employed to describe the behaviour of bimaterial compounds by calculating numerical solutions of singular integral equations , as was applied by erdogan et al . and used by pruncu et al . and azari et al . , which yield the following expression : \n ( 11)ki(a)=211+k1a0g(1)kib=211+k1a0g1 . a more general form of such approach could be structured using an algorithm that describes the numerical procedure for obtaining the different values of the function g(ti ) by the following . ( 2 ) for k ranging from 1 to n , we need a computing route for xk and f(xk ) . ( 3 ) for every xk and for i variants from 1 to ( n 1 ) , we have to calculate the first ti that is a weight function of the jacobi polynomials described as follows : \n ( 12)1ng(ti)1tixk+k(xk , ti)=0 withti = cos2i12n , i=1, ,nxk = coskn , k=1, ,n1 . ( 4 ) the computation then yields a matrix relationship expressed as follows:(13)1t1x1+k(x1,t1)1t2x1+k(x1,t2) .... 1tnx1+k(x1,tn) .............................. 1t1xk+k(xk , t1)1t2xk+k(xk , t2) .... 1tnxk+k(xk , tn)gt1gt2 .... gtn = fx1fx2 .... fxk . g are obtained by multiplying the transposed of the matrix by the vector f(xi ) . one has the following : a0 is half - length of the crack ; 1 , 2 are shear modulus for materials 1 and 2 ; c is the distance from the middle of the crack at the interface plane ; r , are polar coordinates , k = 3 4 for the plane strain case and k = ( 3)/(1 + ) for the plane stress case , is poisson coefficient , and g is the parameter that expresses the magnitude of the applied load . another analytical technique , which was employed by chen et al . using complex potential values , was obtained in the following manner : \n ( 14)ki(b)=limr02rx=22k2 + 1a0m=11mmki(a)=22k2 + 1a0m=1m , \n where a0 is half - length of the crack , m = m/b , m = 0,1 , 2,3 , , b is the distance between the interface and the crack front , x is the distribution of stress in front of the crack , k = 3 4 for the plane strain case and k = ( 3 4)(1 + ) for the plane stress case , and 2 is shear modulus for the material in which the crack is located .", "because of its multiple properties , steel is one of the most versatile materials used in industrial engineering applications . the european standard ( en ) reveals different types of steel employed in fields such as the automotive industry and aeronautical design . in this work we considered two steel alloys : he360dr and s420mc . their mechanical characteristics are summarized in table 1 . during the lifetime of service , in contact with the environment this metal may develop problems that could be prevented by applying the above - described process of hot - dip galvanization . the specimens obtained after hot - dip galvanization were submitted in laboratory to fatigue tensile test in order to detect their behaviour under fatigue conditions conforming to real life and to observe the changes that occurred in the metallic zinc layer . the fatigue tests were performed on a servohydraulic testing machine capable of applying axial loads up to 100 kn , using a sinusoidal load wave , with a frequency of 30 hz and a strength ratio r = 0.1 . after the fatigue test the specimens were experimentally analysed by optical microscopy and scanning electron microscopy ( sem ) . during observation with the optical microscope , a sample of length 5328 m was considered . to simplify the management of these optical microscope observations , we divided the sample size into 16 units with a length of about 333 m . the main purpose of this was to analyse ( i ) the number of cracks per unit of length ; ( ii ) whether the evolution of the number of cracks was constant over all layers applied ; ( iii ) which material was prone to develop longer cracks , and finally if the zinc layer was constant over the whole steel surface . the first result was the average number of cracks per unit of length , as summarized in table 2 . the letters b and h in table 2 indicate the time of immersion in the zinc bath , b being 3 minutes of immersion and h 7 minutes . the numbers 9 , 8 , 7 , and 2 indicate the specimen number analysed . from table 2 we can observe that the average number of cracks per unit of length is about 6/11 for he360dr and 7/8 for s420mc . a first remark proves that the number of cracks increases with the time of immersion . the results are plotted in figure 3 and highlight the number of cracks for all 16 units of length . figure 3 shows that the number of cracks on the entire length of zinc layer that encloses each unit is overall scattered ; however , on the local case of two / three consecutive units , the number of cracks per unit seems to be almost uniformly distributed . a key element for determination of the efficiency of the coating process may be deduced from the evolution of cracks lengths before and after the fatigue tests . according to the observations shown in figure 4 , there was a significant change of crack length as a consequence of fatigue test . a gap of about 25 m in crack length before and after cyclic load was found due to the weakened structure of material . this observation was done in a useful sample area ( ua ) and then in the area where the test had less influence on the behaviour of the piece , marked as the nonuseful area ( nua ) . the uniformity of the zinc layer was considered as another issue that can stimulate the crack behaviour . , the zinc layer deposited over the steel alloy is uniformly distributed , having a value of 5080 m . the particularity of the size of substrate of he360dr h8 materials , that is , the thin thickness , may be explained as a consequence of immersion time . so , because the time of immersion within the bath of zinc was less than the time imposed by our methodology , the thickness of substrate was lower ; this means that instead of 7 minutes we found that the real time of immersion was about 5 minutes . the optical measurements confirmed that the thickness deposited over the steel pieces was uniform and show that the zinc layer is composed of several multilayers . the substrates are denominated by gamma ( ) , delta ( ) , zeta ( ) , and zinc eta ( ) , as shown in figure 6 . figure 6 proves that most of the cracks are located in substrate and may occur along the zinc grain boundaries . indeed , from our observations these cracks arise in this substrate and then spread toward the steel - zinc interface . however , the analysis indicates a decrease of the crack magnitude near the interface , which means the crack growth is interrupted before it reaches the interface . observations from scanning electron microscopy ( sem ) exhibit even more clearly that , during the hot - dip galvanized process ( hdg ) , the quality of the bonded layers may influence the direction of the cracks , if the cracks touch the steel - zinc interface . this troublesome problem produces a sort of debonding area which forms a path for surface deflection of the cracks . the debonding area in steel - zinc adhesive layers is illustrated in figure 7 , created by the propagation of cracks at the interface between the zinc and steel and into the zinc substrates zeta ( ) and eta ( ) . for bimaterials , the interface crack problems could be due to the nonhomogeneity of the materials , which develop in the direction parallel to the crack tip . from these preliminary findings we could confirm that during the hdg process the zinc layer is uniformly deposited and the average number of cracks is significant on this layer . it seems that during the fatigue process the cracks get longer and spread toward the bonding interface , arresting at the bimaterial interface . in the worst scenario ,", "numerical computational technique was implemented by abaqus software , in order to corroborate the experimental data with analytical and numerical simulations and to highlight the effects of cracks that develop during the hot - dip galvanizing process . in order to implement the experimental data in the numerical model , besides , this value corresponds with the thickness measured under the s420mc h2 materials ( see figure 5 ) , and it allows making the assumption that the crack / cracks imposed in our models will spread only toward the interface steel / zinc . if we consider a smaller thickness , for example , the size of layer measured under he360dr b9 material , and we adopt in the numerical model the critical size of crack detected after the loading test ( see figure 4 ) , it will be obvious that the crack will cross all the coating substrate . but this issue is far from our experimental observation , since we had observed that the crack growth is only toward interface steel / zinc . experimental data were introduced in our numerical model as the thickness size of zinc layer ( figure 5 ) , while the contour of zinc layer on the entire material surface is considered homogenous and uniform ( figure 5 ) . an initial length of crack and the maximum length of crack ( see figure 4 ) were imposed as constraint in the numerical program . the principles of linear fracture mechanics ( lfm ) were implemented in the numerical model in order to explain behaviour of crack at the interface steel / zinc that is assuming that all the materials contain a minimum flow that will grow during the mechanical loading . so , considering the crack located in zinc substrate ( figure 5 ) that will develop perpendicular to the applied load , it is possible to denote this state by mode i fracture . it should be noted that in the numerical model a mechanical loading of 500 mpa corresponding to an average of ultimate tensile strength of galvanized materials ( see table 1 ) was imposed . a value of about 30 m was selected as the initial length of the crack / cracks before propagation , in agreement with experimental data ( figure 4 ) . however , we know that the crack is bounded by two fronts , a and b. in this model , we assumed that the front of crack b was static and so it could not propagate , whereas the only front of crack a would spread .", "a basic model composed of two materials , m1 and m2 , as shown in figure 8(a ) , which forms the bimaterial body , was implemented . m2 represents the steel and m1 the zinc layer , delimited by the following values : h1 = 0.08 mm , h2 = 19.84 mm , c = 0.045 mm , w = 15 mm , 2a0 = 0.030 mm , and = 0.5 m and submitted to a mechanical load , = 500 mpa . the applied load in this system will have direct consequence to the crack behaviour and define the presence of stress singularity on both fronts of the crack , tips a and b. the configuration for the crack fronts is shown in figure 8(b ) . settlement of the crack propagates performance was evaluated using the stress intensity factor ( sif ) parameter , derived from the singularity 1/r advanced in front of the crack tip . since the value of the stress intensity factor ( sif ) is obtained , we proceed to conclude if the crack crosses into the second material , ends at the bonded interface , or deflects between these two bodies . ( a ) model with one crack in the bimaterial : in this case one single crack of an initial size of 30 m was considered . then the length was increased by 3 m in each simulation up to the maximum of 60 m ( i.e. , close to the experimental analysis shown in figure 4 ) . figure 9 shows how the stress distribution increases with the length of crack , assuming that the initial crack had the same stress value at both fronts a and b. two - dimensional finite - element meshes are virtually symmetrical near this bottom ( crack fronts ) and the symmetry showed almost the same value as the stress distribution , for each of the crack fronts , during the simulation . the shape of the stress - strain curve as a function of the crack length is illustrated in figure 10 . the shape of the curve grows wide with the increasing of crack length in front of crack tip a. the effect of stress distribution in front of crack can be converted into basic parameters that show the impact of crack behaviour , that is , the stress concentration factor ( scf ) . obviously , the stress concentration factor is the ratio of the maximum stress over the nominal stress , denominated kt and expressed as \n ( 15)kt=maxnom. while the front of crack b does change , the main role in this research was played only by the front of crack a located near the interface of the bimaterial . thus , figure 11 shows the effect of scf in the front of crack a. these results were corroborated with the theoretical stress concentration factor ( scf ) obtained with the online software . the results presented in figure 11 show a good agreement and underline that when the crack reaches the interface , there is a sudden increase in the stress distribution value . this sharp rise in values may result in the creation of a surface called a debonding area , as shown in figures 9(c ) and 9(d ) . then , by assessing the crack propagation with lfm using ( crack ) stress intensity factors ( sif ) , k , it is possible to establish where the crack stops . to achieve even better accurate results , a comparison between an analytical model reported by erdogan et al . and the difference between the numerical and analytical results is due to the use of a small number of constants in the analytical model . the results are shown in figure 12 , demonstrating the trend of the ( crack ) stress intensity factors ( sif ) during applied stress , in front of cracks a and b. from the curves drawn below , it can be seen that the value of the sif increases with the crack length , and the crack propagates up to a length of about 50 m . then stabilization and even a decline of the sif value the value of sif will increase sharply only if the flow area denoted as well as since the value of the ( crack ) stress intensity factors ( sif ) is low for the front of both cracks a and b , it seems that the crack can not cross into the second material . \n ( b ) model with two or more cracks : in the second assumption , a multiple cracks model , namely , with 3 cracks , was implemented using almost the correspondent algorithm but specifying 3 initial cracks with an initial size of 30 m for each crack , and then each crack would increase by 3 m , up to the maximum size of 60 m . thus , the maximum cracks value is assigned when the cracks reach the steel - zinc interface . in this model with 3 cracks the applied load ( 500 mpa ) was considered as statement from the case of the model with a single crack . the motivation to implement a model with three cracks aims to detect whether the situation changed due to the increased ( crack ) stress intensity factor ( sif ) values , as a result of the cumulative energy developed by these 3 cracks . related work has been reported by song et al . who declared that the interface crack will propagate if the principal maximum stress at the crack tip exceeds a critical value . thus , confirming our initial supposition , the results presented in figure 14 show an increase for maximum stress value within front of the cracks . at the same time , the surface denominated debonding area appears more pronounced . the tendency was confirmed from the development of the ( crack ) stress intensity factors ( sif ) , k values , where the results are reported in figure 15 . the shapes of the curves in figure 15 show a similar trend obtained by the one in the case with one crack except for the fact that crack 2 shows the highest influence of propagation , derived from the cumulated extension efforts from another two cracks . another thing to note is the gap difference of sif for crack lengths 57 m and 60 m . this difference could be explained by the appearance of the previously mentioned debonding areas ( i.e. , imposed length for debonding area considered in this research was a maximum of two initial crack lengths , because after this size the peeling processes occur ) . although the difference is evident , it does not exceed the critical value of mode i fracture toughness ; for example , the value cited by ashby for steel is about 80170 mpa m. consequently , the crack will not cross into the steel material and in the worst case the crack / cracks will form a large bifurcation at the interface between these two materials .", "this research paper highlights by means of experimental , numerical , and analytical tool the behaviour of a bimaterial zinc / steel interface submitted to mechanical loading . in particular , the case of crack / cracks at the bimaterials interface was considered . the main objectives of this paper were to assess the behaviour of the crack / cracks generated at the end of the hot - dip process and to reveal that the numerical computations are in a good agreement with the experimental outcomes . optical microscopy and scanning electron microscopy ( sem ) techniques were involved to evaluate the experimental performance of the bimaterials compound . postmortem analysis of the fracture surfaces emphasized the uniformity of the zinc layer over the steel surface and provided accurate information related to the average of cracks length ( figure 4 ) . in addition , this technique allows quantifying the number of cracks ( figure 3 ) that forms in the zinc layers . in the meantime , this assessment provides patterns about the evolution of crack from incipient phase , where the cracks arise , and how far they spread . in numerical computations , simulations of the model considered were run in two different situations , namely , when the bimaterial contains just one crack or else 3 cracks , in order to prove the agreement between computation and experimental outcomes . besides , to get even accurate results , the analytical model used by erdogan et al . was also confronted . the sif were calculated to obtain value of the stress singularity that characterizes the crack evolution in the bonding area of bimaterial , for both crack tip values , that is , the fronts of cracks a and b. the analytical , numerical , and experimental assessments prove that the crack / cracks that arise during the hot - dip galvanized steel process will propagate during the mechanical fatigue test . it was also established that the crack / cracks will stop near the steel - zinc interface at a distance of about 3 m and only in particular cases yield a deflection at the bimaterial interface . to summarize , the results may confirm that cracks reduce the life span of the bimaterial but are not responsible for a direct degradation of the steel . this method is therefore useful for employment in damage models that include the safety factor condition . finally , a nondestructive method should be employed to detect the behaviour of bimaterials for a better calibration ." ]

[ "epilepsy is a common and serious chronic neurological disease that affects over 50 million people worldwide . anti - epileptic drugs ( aeds ) are effective at controlling seizures in many patients , acting through a range of neuronal targets , including ion channels , neurotransmitter release , and receptor mechanisms.1 , 2 however , a third of patients with epilepsy fail to achieve seizure freedom , and current aeds do not show disease - modifying properties . future treatments for epilepsy need to differentiate from currently marketed drugs , for example , by having a novel mechanism(s ) of action or providing disease - modifying effects.1 , 2 acquired epilepsy is thought to result from disturbances to the expression and function of neurotransmitters and their receptors , ion channels , and signaling components , as well as altered metabolism , neuronal and glial microstructure , neuroinflammation , and other mechanisms.3 , 4 , 5 it is likely that disease - modifying treatments will need to influence multiple genes within a given pathway or in various independent pathways . potential gene network control points were recently identified and include master regulators of transcription and neuroinflammation , epigenetic factors , and noncoding rnas . micrornas ( mirnas ) are a conserved family of endogenous small noncoding rnas that regulate protein levels in cells by post - transcriptional control of mrna stability and translation.9 , 10 this is achieved by sequence - specific binding of the mirna to complementary bases in the mrna target . since this generally requires only a 7- to 8-nucleotide match , individual mirnas can potentially target large numbers of mrnas . this provides the ability to regulate entire gene networks or multiple biological processes and has been demonstrated in the brain . microrna-134 ( mir-134 ) was identified as a brain - enriched , neuronally expressed mirna that controls dendrite spine morphogenesis , via repression of lim domain kinase 1 and other targets.14 , 15 this is potentially important for disorders of hyperexcitability , since dendritic spines are contact points for excitatory communication and there is evidence that reorganization of dendrites is a feature of experimental and human epilepsy.16 , 17 we identified mir-134 among upregulated mirnas profiled in areas of hippocampal damage following status epilepticus induced by intra - amygdala kainic acid ( ka ) in mice . expression of mir-134 is also upregulated after neuronal stimulation and seizures in various other in vitro and in vivo models,15 , 19 , 20 , 21 , 22 and mir-134 is overexpressed in the resected human neocortex from patients with intractable temporal lobe epilepsy ( tle ) . silencing mir-134 by intracerebroventricular ( i.c.v . ) injection of locked nucleic acid ( lna ) , cholesterol - tagged antagomirs ( ant-134 ) reduced levels of mir-134 for at least a month and rendered mice refractory to the convulsant effects of both ka and pilocarpine.19 , 22 consistent with known mir-134 targets , lim domain kinase 1 and levels of other mir-134 targets were higher in ant-134-treated mice after status epilepticus and the dendritic spine volume was increased.19 , 22 notably , injection of ant-134 after status epilepticus suppressed the later occurrence of spontaneous recurrent seizures in the intra - amygdala ka model in mice . there is significant interest in developing mirna - based therapies.23 , 24 there are also barriers to antisense - based approaches and there has been some disengagement of industry from pursuing such efforts . this is likely to be a problem for any new therapy for epilepsy , particularly one that is not based on traditional small molecule chemistry.1 , 2 pre - clinical development of an mir-134-based treatment for epilepsy might be more attractive if additional important questions are answered . principally , work to date has only tested ant-134 in mouse models of status epilepticus . proof of seizure - suppressive effects of ant-134 in a non - status epilepticus model or in another species would bridge the gap in evidence and facilitate pre - clinical development of ant-134-based treatment for epilepsy.26 , 27 here , we evaluated mir-134 expression in the resected hippocampus from patients with pharmacoresistant tle and we tested ant-134 in three different models . we used the pentylenetetrazol ( ptz ) model in mice , a popular method for screening putative anticonvulsive effects that triggers seizures via -amino butyric acid ( gaba ) blockade.26 , 28 second , the perforant pathway stimulation ( pps ) model , a toxin - free model of acquired epilepsy based on nonconvulsive status epilepticus that avoids the confounding influence of exposing the brain to chemoconvulsants , was used in rats . finally , we used a high - potassium model of epileptiform activity , using ex vivo brain slices from rats pre - treated with ant-134 . our results establish that targeting mir-134 offers broad anticonvulsant and possibly disease - modifying effects in experimental epilepsy , which may encourage pre - clinical development of ant-134 as a treatment for epilepsy .", "for this , we analyzed levels of mir-134 in the surgically obtained hippocampus from adults with pharmacoresistant tle and we compared findings to autopsy hippocampal samples from people who died of causes unrelated to neurological disease . these samples were used previously to analyze expression of other genes , and clinical data for both groups are briefly summarized in tables s1 and s2 . there were no between - group differences in patient age , and each group included males and females . we detected higher levels ( p = 0.037 ) of mature mir-134 in the tle specimens compared to autopsy samples ( figure 1a ) . this difference is unlikely to be an artifact of post mortem delay , since mir-134 levels did not decrease in simulated autopsy experiments lasting up to 12 hr . we began by establishing dosing parameters in the mouse ptz model . generalized tonic - clonic seizures were first reliably elicited at a dose of 60 mg / kg in c57bl/6j mice ( figure 1b ) . a dose of 80 mg / kg elicited generalized tonic - clonic seizures in all mice and with a more consistent and shorter latency than with the 60 mg / kg dose ( figure 1b ) . a dose of 100 mg / kg also produced rapid - onset tonic - clonic seizures in all mice but was associated with high mortality ( figure 1b and data not shown ) . ordinal logistic regression analysis was used to explore the dose dependence of the ptz - induced convulsions . ptz dose was significantly associated with racine scores ( figure 1c ) . a dose of 80 mg / kg was selected for further experiments . to obtain molecular evidence for ptz - induced seizure activity in the model , we measured expression of activity - regulated genes in the hippocampus . transcript levels of fbj osteosarcoma oncogene ( fos ) , a calcium - dependent marker of neuronal activity and activity regulated cytoskeletal - associated protein ( arc ) , another immediate early gene responsive to intense neuronal activity , were strongly increased in the hippocampus 30 min , but not at 4 hr , after ptz - induced seizures ( figures 1d and 1e ) . there was no evidence of irreversible neuronal injury in tissue sections from mice after ptz , as assessed by fluoro - jade b ( fjb ) and neun ( rna binding protein , fox-1 homolog [ c. elegans ] 3 ) staining ( data not shown ) . expression of mir-134 is known to increase in various in vitro and in vivo seizure models.15 , 19 , 20 , 21 , 22 we therefore investigated whether ptz - induced convulsions alter mir-134 levels in mice . taqman mirna assays showed that levels of mature mir-134 were significantly increased in the hippocampus , but not in the cortex , 30 min after ptz - induced generalized tonic - clonic seizures in mice ( figure 1f and data not shown ) . injection of antagomirs targeting mir-134 ( ant-134 ) in mice.19 , 22 previous work has established a dose of these antagomirs that reduces hippocampal mir-134 levels by over 90% by 24 hr after injection . accordingly , we tested ptz responses 24 hr after injection of ant-134 and compared them to responses in mice that received a scrambled antagomir ( scr ) . in scr mice , delay to onset of first tonic - clonic seizure after ptz injection was similar to that observed before in control mice ( figure 2a , and compare to figure 1b ) . thus , the control antagomir did not alter the normal response to ptz in the model . the time to first ptz - induced tonic - clonic seizure was significantly longer in mice injected with ant-134 compared to scr - injected animals ( figure 2a ) . the severity of racine - scored ptz - induced seizures was also significantly lower in ant-134- compared to scr - injected mice ( figures 2b and 2c ) . analysis of electrographically recorded seizure activity determined that electroencephalography ( eeg ) total power was lower in ant-134 mice compared to the control group after ptz ( figure 2d ) . we next analyzed brain tissue samples from scr- and ant-134-injected mice for evidence of mirna silencing and differences in expression of activity - regulated genes . analysis of the hippocampus obtained after ptz - induced seizures confirmed that mir-134 expression was lower in ant-134 pre - treated mice compared to scr - treated animals ( figure 3a ) . ant-134 had no effect on levels of an unrelated mirna ( figure 3b ) . next , we assessed expression of arc and c - fos as molecular markers of recent neuronal activity to support the clinically scored behavior and eeg differences in ant-134 mice . quantitative real - time pcr analysis revealed increased c - fos expression in the hippocampus of scr - injected mice after ptz - induced seizures ( figure 3c ) . in contrast , c - fos levels were lower in ant-134-injected mice , consistent with reduced seizure severity ( figure 3c ) . this difference was also apparent in the neocortex from the same animals ( figure 3c ) . expression of arc was increased in the hippocampus of scr - injected mice that received ptz . arc levels were not significantly different in ant-134 mice compared to scr - injected animals in the hippocampus and neocortex after ptz - induced seizures ( figure 3d ) . we turned next to the pps model in rats , first investigating effects on mir-134 levels . taqman mirna assays showed that levels of mature mir-134 were not significantly modified in the hippocampus of rats at two different time points ( figure 4a ) . next , we assessed the effect of silencing mir-134 before stimulation on seizure severity during status epilepticus . rats were pre - treated with ant-134 or scr ( i.c.v . ) 24 hr before the 8-hr stimulation protocol . analysis of electrographically recorded seizure activity determined that scr - injected rats presented a mean ( sem ) increase of 1,304.3% 94.9% in eeg total power relative to baseline . this was similar to animals that were stimulated but not receiving the oligonucleotide ( data not shown ) . in rats pre - treated with ant-134 , the severity of evoked seizures in the pps model was similar : eeg total power during seizures was a mean ( s.e.m ) of 1,244.6% 82.7% ( percent of baseline ) . despite not seeing an acute anticonvulsant effect of ant-134 in the pps model , we were nevertheless interested in whether silencing mir-134 after status epilepticus in the model would alter the emergence of recurrent spontaneous seizures . a key prior finding was that silencing mir-134 after status epilepticus induced by intra - amygdala ka reduced the subsequent occurrence of spontaneous recurrent seizures by over 90% . for these studies , rats underwent 8-hr stimulation of the perforant pathway to induce epilepsy and the i.c.v . rats were then monitored with video - eeg until a first spontaneous seizure was recorded , typically 1025 days after pps , and they were then followed for a further 8 weeks ( figure 4b ) . epilepsy developed in all scr - injected rats over the expected course , with the first spontaneous seizures appearing 14 weeks after status epilepticus ( figures 4b and 4c ) . scr - injected rats averaged 20 spontaneous seizures recorded during the 8-week recording time ( figures 4d and 4e ) . in contrast , no spontaneous seizures were detected over the 8-week period in six of seven rats injected with ant-134 after status epilepticus ( figures 4d4f ) . epilepsy emerged in only a single rat treated with ant-134 ( figures 4d and 4f ) . the fisher exact test determined that there was a significant difference in epilepsy development between the groups ( p = 0.005 ) . in terms of effect size , ant-134 prevented 86% of the risk of epilepsy , with a 95% confidence interval ( ci ) of 12%98% . an analysis of the duration of spontaneous seizures ( electrographically defined ) revealed that when spontaneous seizures occurred , they were similar between groups . that is , the average duration of a spontaneous seizure in scr - treated rats was 53.7 14.4 s ( n = 20 seizures , from five rats ) , which was similar to the duration in epileptic rats in the pps model that did not receive an i.c.v . injection ( 49.4 15.9 , n = 20 seizures ) . in the ant-134 rat that developed epilepsy , the average duration of a spontaneous seizure was 52.3 16.2 s ( from n = 12 seizures ) . having observed a disparity between the acute anti - seizure effects of ant-134 pre - treatment in the ptz and pps models , we sought to examine the effect of ant-134 on naive , non - epileptic tissue and whether the effects were due to long range networks or if local circuitry was sufficient to mediate any seizure protection . we injected ant-134 in vivo in rats and subsequently prepared ex vivo brain slices ( figure 5a ) . these slices were then exposed to a 9-mm k seizure challenge , to determine whether ant-134 protects against epilepsy in local circuits of the isolated slice in the absence of epileptogenesis . onset of activity was delayed in ant-134-treated slices by 176 s relative to the control ( figures 5b and 5c ) . this effect was statistically significant ( mann - whitney u test , p = 0.002 , = 0.025 , power = 0.87 ) . we also compared the power of epileptiform activity and duration of seizure - like events in these data ; these effects were not statistically significant ( power : t test , p = 0.70 ; duration : mann - whitney u test , p = 0.067 ) . this finding suggests that ant-134 can confer seizure resistance in naive tissue and thus mediate its effect even in the absence of epileptogenesis . in addition , preservation of the seizure resistance in isolated slices indicates that at least some of the effects of ant-134 are due to local changes in activity .", "the present study provides important additional evidence of the anticonvulsant and disease - modifying effects of lna - based antagomirs targeting mir-134 in animal models of epilepsy . our study shows that ant-134 is an anticonvulsant in an acute chemoconvulsant model ( ptz in mice ) and ant-134 had anti - epileptogenic activity in the perforant pathway stimulation model of epilepsy in rats . ant-134 also confers resistance to epileptic activity in naive tissue , reflected as a delay to activity onset following a seizure challenge in ex vivo brain slices . we also report that mir-134 levels are elevated in the hippocampus of patients with pharmacoresistant tle . the therapeutic potential of targeting mir-134 in established epilepsy will require additional studies , but our findings may encourage further research or pre - clinical development of this mirna - based treatment for epilepsy . despite the recent introduction of two additional aeds ( perampanel and brivaracetam ) , new drug development in epilepsy faces significant challenges.1 , 2 , 32 new targets are required that can treat pharmacoresistant patients or have disease - modifying effects that are not served by current therapies . mirnas have emerged as potential targets of the future via their influence on neuronal microstructure , gliosis , neuroinflammation , and ion channels.8 , 33 silencing mir-134 has produced the most convincing anti - seizure effects to date , reducing status epilepticus in pre - treatment paradigms in the intra - amygdala ka and pilocarpine models and exerting potent long - term effects on spontaneous seizure development.19 , 22 this mirna is also an attractive target , since studies show increased levels of mir-134 within the temporal lobe of adult and pediatric patients with intractable epilepsy.19 , 20 we report here that mir-134 is also elevated in the hippocampus of adults with pharmacoresistant tle , although there are potential confounders with comparing resected material from patients to autopsy control samples . the present study has answered key questions that could facilitate pre - clinical development by showing that ant-134 has anticonvulsant effects in non - status epilepticus models and is disease modifying in another species . the first important finding was that pre - treatment with ant-134 strongly suppressed seizures in the mouse ptz model . effects on both clinical behavior , including delaying the time to first convulsive seizure , and electrographic seizure activity were seen . thus , lowering brain levels of mir-134 can exert anti - excitability effects , and this implies that mir-134 has a role in setting excitability thresholds in the brain . this is thought to be due to regulation of proteins that control dendritic morphology,14 , 15 although other targets are known . ant-134 did not fully prevent seizures in the ptz model ; rather , it delayed and minimized their severity , a finding most closely matching the effect of ant-134 in the pilocarpine model of status epilepticus . it may not be possible to fully prevent all seizures using ant-134 in chemoconvulsant models , but further adjustments to antagomir dose or delivery may yield optimal seizure - suppressive effects . ptz triggers seizures via gabaergic blockade ; this differs from the mechanism by which status epilepticus is induced by ka and pilocarpine , which work by promoting glutamatergic and cholinergic transmission , respectively . this suggests that ant-134 may be effective for epilepsies of various etiologies , which , in patients , can vary considerably between trauma , stroke , infection , genetic , and other causes . our studies also show that ptz - induced convulsions increase brain levels of mir-134 , transcription of which is probably mediated by myocyte enhancer factor 2c . we did not observe an increase in mir-134 after perforant pathway stimulation in the rat . this was surprising , although changes to mir-134 levels are not always detected after chemoconvulsive stimuli , and we can not rule out a technical explanation ( e.g. , the time points selected or a subfield - specific effect that was masked by the use of the whole hippocampus ) . our study included an analysis of the short - term effects of ant-134 on neuronal activity - regulated genes in the ptz model . expression of genes such as c - fos and arc is a well - established surrogate marker of recent seizure activity , the protein products of which are involved in coordinating synaptic plasticity and adaptation to excessive neuronal stimulation.38 , 39 unexpectedly , only levels of c - fos , and not arc , showed the expected reductions in ant-134 mice after ptz seizures . it is known that c - fos induction is calcium dependent , whereas arc expression can be induced via calcium - independent pathways.38 , 39 therefore , ant-134 treatment may have reduced seizure severity sufficient to prevent c - fos induction , such as by minimizing n - methyl - d - aspartate ( nmda ) receptor opening , but enough residual neuronal excitation remained to upregulate arc . these findings provide additional evidence of the scale and nature of seizure suppression by ant-134 and suggest molecular markers that can distinguish effects of mirna manipulations on different components of seizure responses . in the present study , we observed that pre - treatment of rats with ant-134 did not protect against perforant pathway stimulation - induced status epilepticus . while there are examples of anticonvulsants producing effects in some but not all models , these findings suggest that ant-134 may have the most clinical value as an anti - epileptogenic treatment . previous work showed that injection of ant-134 after status epilepticus in mice suppressed the later occurrence of spontaneous seizures by 90% , evidence of a disease - modifying effect in the intra - amygdala ka model . here , we found nearly identical anti - epileptogenic effects of ant-134 in a different model in rats . this is the only demonstration , to our knowledge , of any disease - modifying treatment in the pps model in rats . the pps technique induces hippocampal sclerosis and recurrent spontaneous seizures,29 , 40 and it provides a means to trigger epilepsy without the bias or other issues associated with chemoconvulsants . ant-134 was injected shortly after triggering status epilepticus in order to model a reasonably realistic clinical scenario , such as a patient being treated shortly after an initial precipitating injury . ant-134 had dramatic and potent effects , with the majority of ant-134 rats ( six of seven , 86% ) never developing spontaneous recurrent seizures . notably , spontaneous seizures in the study with the intra - amygdala ka model did occur in all ant-134 mice , albeit with dramatically lower seizure frequency . this difference may relate to the extent of hippocampal injury or another aspect of the epileptic phenotype , such as the frequency of spontaneous seizures . thus , presently we see a possible additional therapeutic action of ant-134 , whereby post - treatment is capable of fully preventing epilepsy at least in some models . we can not , of course , exclude that epilepsy might have developed in some of the ant-134 rats at some point in the future . however , we recorded for 8 weeks beyond the standard latent period . we further corroborated the anti - seizure effect of ant-134 by using an acute seizure challenge with high potassium in otherwise healthy ( ex vivo ) tissue . inhibitory neurotransmission is retained in this model ( in contrast to ptz ) and there is no hippocampal sclerosis ( unlike pps ) , further suggesting that ant-134 can be therapeutic in multiple epileptic syndromes with varying mechanisms . we observed a delay in the onset of epileptiform bursts in brain slices that had been pre - treated with ant-134 . this finding suggests that epileptogenesis is not required for ant-134 to mediate its effects on seizure onset . we did not see any significant changes in the power or duration of epileptiform activity ; however , these parameters are highly variable in brain slices , which can obscure potential effects . in addition , we propose that ant-134 can mediate seizure protection in the hippocampus via effects on local circuitry , because long range connections would likely be severed during the slicing process . the anti - epileptogenic actions of ant-134 may be independent of the etiology of the initial precipitating injury , although this will require further testing ( e.g. , in models of trauma or infection - induced epilepsy ) . in addition , upregulation of mir-134 is not essential for ant-134 to produce anti - epileptogenic effects , since mir-134 levels were not altered after pps - induced status epilepticus . thus , epilepsy can be dramatically suppressed in two different in vivo models , and one in vitro , in two different species . this provides strong support for and is an argument for further development of ant-134 for epilepsy treatment or prevention . antagomirs targeting a liver - expressed mirna have been given to humans and were found to be well tolerated and effective against hepatitis c in clinical trials . there are concerns , obviously , that because ant-134 can alter dendritic spines , it could have effects on cognition . studies to date have not identified such problems , with natural exploratory behavior and performance in a hippocampus - dependent task found to be normal in mice a few days after i.c.v . injection of ant-134.19 , 22 however , more demanding tests of cognition or learning will need to be performed . another factor that argues for general safety is that mice and rats have been recorded for at least 2 months after brain injections of ant-134 . nevertheless , pre - clinical development will necessitate an extensive battery of toxicity and safety testing . work to date on ant-134 satisfies certain recommendations for testing and evaluating novel therapies for epilepsy , with seizure - suppressive effects demonstrated in five different models and two different species.1 , 2 , 43 , 44 there are , however , additional seizure models that could be used during any future pre - clinical development . this includes kindling , a popular model that has been successful in identifying aeds with novel mechanisms of action . while this is not an essential step before pre - clinical development , sex differences in mirna inhibitor responses may be worth investigating in future studies and sexual dimorphism in mirna expression has been reported , although not for mir-134.46 , 47 it will also be of value to understand how ant-134 produces its potent seizure - suppressive effects . the most likely mechanism is upregulation of one or more proteins due to de - repression of a mir-134 target . previous work has shown that mir-134 is uploaded into the rna - induced silencing complex after seizures , which facilitates targeting of mrnas , and in vitro studies suggest that the neuroprotective effects of ant-134 are due to de - repression of lim domain kinase 1 . ant-134 treatment also increases dendritic spine volume and changes spine number in the hippocampus,19 , 22 which could influence excitability and would also be consistent with a mechanism involving protection of mir-134 targets such as lim domain kinase 1 or pumilio rna - binding family member 2 . altered spine volume and number is consistent with our observation of a robust local effect of suppressing mir-134 on delaying epileptiform activity , although additional effects on long range connections can not be ruled out . we must also consider that the acute seizure - suppressive effects and long - term anti - epileptogenesis effects may arise from different mechanisms . ultimately , in vivo studies will be necessary to determine the anti - seizure mechanism of ant-134 ( e.g. , by analyzing gene expression networks , quantifying the proteome , and applying techniques to validate antagomir - mirna targeting such as polysome shift assays ) . what are the next steps for translation or pre - clinical development ? an obvious question is whether and how antagomirs could be given to patients . their large size precludes their passing an intact blood - brain barrier ( bbb ) . recent work has explored methods to circumvent the bbb , including conjugating antagomirs with brain - penetrating peptides or administering antagomirs via intranasal injection.19 , 51 the bbb may also be open after certain epilepsy - precipitating injuries or it can be physically breached , such as through use of ultrasound . another question is whether ant-134 injection into already epileptic animals could alter the frequency or duration of spontaneous seizures or attendant hippocampal pathology . success with that approach could provide novel treatment opportunities for the population of drug - resistant patients for whom surgery or other alternatives to aeds are either not possible or not effective currently . in summary , the present study provides important additional validation of the potent seizure - suppressive and possibly disease - modifying effects of ant-134 in two different animal models and one brain slice model . the effectiveness of ant-134 and the potency of seizure suppression suggest a target for drug development in epilepsy that could provide additional effects beyond those provided by any currently marketed drug for epilepsy .", "this study was approved by the ethics ( medical research ) committee of beaumont hospital of dublin ( no . 05/18 ) and written informed consent was obtained from all patients . the control ( autopsy ) hippocampus ( n = 12 ) was obtained from 12 individuals . patients ( n = 12 ) were referred for surgical resection of the temporal lobe by an epileptologist ( n.d . ) following neurological assessment , video - eeg recording , and mri / neuroimaging . each patient was determined to have medically intractable tle with a history of recurring seizures ( table s2 ) . the hippocampus was obtained and a portion of each specimen was frozen in liquid nitrogen and stored at 70c until use . a pathologist ( m.a.f . ) assessed the hippocampus as part of the pathologic evaluation , addressed the degree of hippocampal sclerosis , and described other pathologic changes . all animal experiments were performed in accordance with the european communities council directive ( 2010/63/eu ) . procedures in mice were approved by the research ethics committee of the royal college of surgeons in ireland ( rec-842 ) , under license from the ireland health products regulatory authority ( ae19127/001 ) . procedures in rats were performed under authorization of the philipps university bioethics committee and were approved by the local regulation authority ( regierungsprsidium gieen ) , or they were performed according to the uk animals ( scientific procedures ) 1986 act ( ppl 70 - 7684 ) and approved by local ethical review ( university college london ) . male adult c57bl/6j mice ( 2025 g ) and male sprague - dawley rats ( 325350 g or 200300 g ; all from harlan ) were used in all studies . animals were housed in on - site barrier - controlled facilities having a 12-hr/12-hr light / dark cycle with ad libitum access to food and water . mice were equipped for eeg recordings under surgical anesthesia ( isoflurane ; 5% induction , 1%2% maintenance ) in a mouse - adapted stereotaxic frame . body temperature was maintained within the normal physiological range with a feedback - controlled heat pad ( harvard apparatus ) . after a midline scalp incision , partial craniectomies were performed and animals had skull - mounted recording electrodes placed and fixed with dental cement . a second cohort of mice had eeg electrodes and a guide cannula implanted to allow i.c.v . this cannula was placed on the dura mater with the following coordinates from the bregma : anterior - posterior ( ap ) , + 0.3 mm ; lateral ( l ) , + 0.9 mm ; and ventral ( v ) , 2.0 mm . after recovery from surgery , mice were connected to the lead socket of a swivel commutator , which was connected to a grass twin digital eeg system . ] ) with different doses of ptz ( 60 , 80 , or 100 mg / kg ) . lorazepam ( 8 mg / kg , i.p . ) was administered after the first tonic - clonic seizure to reduce morbidity and mortality . mice were followed for 30 min or 4 hr after ptz administration for the appearance of seizures by electrographic and behavioral methods . after the observation period , mice were deeply anesthetized ( pentobarbital ) and transcardially perfused , and their brains were removed for analysis of gene expression or histological assessment . injection of 0.12 nmol/2 l 3-cholesterol - tagged locked nucleic acid oligonucleotide targeting mir-134 ( ant-134 ) or its respective control , a non - targeting scrambled version of the antagomir ( scr ; 0.12 nmol/2 l ) ( exiqon a / s ) , as previously described.19 , 22 twenty - four hours later , mice were connected to an eeg system and a baseline recording was obtained . next , mice were injected with ptz ( 80 mg / kg , i.p . ) . lorazepam ( 8 mg / kg , i.p . ) was administered after the first tonic - clonic seizure to reduce morbidity and mortality . these mice were followed up for 30 min after ptz administration for the appearance of seizures . after this period , mice were deeply anesthetized ( pentobarbital overdose ) and transcardially perfused ( pbs ) for further assessments . under isoflurane ( 5% induction , 3% maintenance ) anesthesia , bipolar stainless - steel stimulating electrodes ( nex-200 ; rhodes medical instruments ) were positioned in the angular bundles of the perforant pathway and custom unipolar recording electrodes ( crafted from 796000 ; a - m systems ) were lowered into the dorsal dentate gyrus . electrodes and ground screws were connected to miniature wireless transmitters ( ft20 ; data sciences international ) that were implanted subcutaneously on the animal s flank . plastic connectors ( gs09plg ; ginder scientific ) joined the electrodes with stimulation / recording equipment . the pps protocol utilized a paradigm designed to evoke and maintain hippocampal seizure activity throughout the stimulation , but not convulsive status epilepticus , which consisted of continuous , bilateral 2-hz paired - pulse stimuli , with a 40-ms interpulse interval , plus a 10-s train of 20 hz single - pulse stimuli delivered once per minute , generated by an s88 stimulator ( grass instruments ) . all pulses ( 0.1-ms duration ) were delivered at 2024 v , as this voltage reliably evokes granule cell discharging without tissue - damaging hydrolysis.29 , 40 the current associated with these voltages was typically between 15 and 30 a . no samples displayed any signs of hydrolysis ( e.g. , holes around the stimulating electrodes ) . as described previously , stimulation for 30 min ( on 2 consecutive days ) required only isoflurane to terminate seizures . eight - hour stimulation on the third day did not induce convulsive status epilepticus and , therefore , did not require pharmacological termination . rats were randomly divided in three cohorts to assess the following : ( 1 ) mir-134 expression after pps ( 24 hr , 4 days , and 14 days ) ; ( 2 ) the effect of ant-134 on pps - induced status epilepticus , in which rats were pre - treated with ant-134 or scr ( 0.36 nmol/6 l , i.c.v . ; exiqon a / s ) 24 hr before the 8-hr stimulation ; and ( 3 ) the effect of ant-134 on epileptogenesis , in which rats were injected with 0.36 nmol/6 l ( i.c.v . ) of ant-134 or scr ( exiqon a / s ) immediately after 8-hr stimulation . five rats were excluded from this study due to practical issues ( e.g. , blocked cannula ) . for statistical purposes , we pooled samples from 24 hr and 4 days after pps as an early time point , while 14-day samples were considered as the late time point . mouse eeg data were analyzed and quantified using labchart 8 software ( ad instruments ) . ptz - induced seizures were defined as high - amplitude ( > 2 baseline ) high - frequency ( > 5 hz ) polyspike discharges lasting > 5 s. for statistical purposes , we assigned a cut - off time of 1,800 s for those animals that did not present seizures during the observation period . from the eeg recordings , we calculated the delay to first seizure , the total power , and the percentage of total power / spectral bands , as previously described.19 , 54 eeg total power was plotted as the percentage of baseline recording ( each animal s eeg power post - seizure compared to its own baseline eeg ) . clinical behavior was scored using the following adapted racine scale : score 0 , no seizures observed ; score 1 , rhythmic mouth and facial movement ; score 2 , rhythmic head nodding ( bobbing ) ; score 3 , forelimb clonus ; score 4 , rearing and bilateral forelimb clonus ; and score 5 , rearing and falling ( stay fallen on rear side ; tonic - clonic seizures ) . the highest score reached during every 5 min during the 30 min after ptz was recorded . for studies in rats , eeg activity during and after pps was amplified and recorded digitally at 2 khz utilizing a powerlab 16/35 and labchart software versions 7 and 8 ( ad instruments ) . spontaneous granule cell layer activity was recorded continuously ( 24 hr / day ) and stored digitally and automatically in 3-hr epochs . each day , we analyzed the preceding 24 hr of recordings , as well as all events with amplitudes exceeding 120% of average baseline . continuous ( 24 hour/7 day ) video monitoring utilized edimax 7010w infrared cameras . video files were captured at 1215 frames / sec and were time - stamped for integration with the electrophysiological data using securityspy surveillance software ( ben software ) and stored digitally . confirmed seizures were scored according to the racine scale . rats were anesthetized with isoflurane ( 5% induction,2% maintenance as appropriate ) and mounted in a stereotaxic frame . we injected ant-134 ( 0.12 nmol ) in 1 l te buffer ( life technologies ) at coordinates relative to the bregma : ap , 0.92 mm ; medial - lateral ( ml ) , + 1.3 mm , and dorsal - ventral ( dv ) , 3.3 mm to target the lateral ventricle . to allow the rats to fully recover from the analgesic drugs and to coincide with the maximal anti - epileptic effect seen in vivo sodium pentobarbital and transcardially perfused with ice - cold sucrose artificial cerebrospinal fluid ( acsf ; in mm : 205 sucrose , 10 glucose , 2.5 kcl , 0.1 cacl2 , 5 mgcl2 , 26 nahco3 , and 1.2 nah2po4.h2o ; osmolarity , 295 mosm ) . the brain was quickly dissected into ice - cold sucrose acsf and transferred to a campden 700 smz slicer ( campden instruments ) . slices ( 400 m ) were prepared in the horizontal orientation between the bregma at approximately 7.1 and 5.1 mm . for storage , slices were submerged in oxygenated normal acsf ( in mm : 125 nacl , 10 glucose , 3 kcl , 1 mgcl2 , 2 cacl2 , 26 nahco3 , and 1.25 nah2po4.h2o ; osmolarity , 290 mosm ) and allowed to recover at room temperature for at least 60 min prior to recordings . slice recordings were made using a membrane chamber ( scientific systems design ) , a modified submerged chamber , which improves oxygen supply to the tissue and supports greater epileptiform bursts than conventional submerged recording chambers . slices were continually perfused with acsf , heated to 32c , at a flow rate of 16 ml / min . for local field potential ( lfp ) recordings , borosilicate glass recording micropipettes ( resistance , 34 m ) were placed into hippocampal ca1b stratum pyramidale and epileptiform activity was induced by raising the perfusing kcl concentration to 9 mm . total rna was isolated from brain samples using trizol ( invitrogen ) , as described previously.19 , 54 for mrna qpcr , 1 g total rna was used to generate cdna by reverse transcription using the superscript iii reverse transcriptase enzyme ( invitrogen ) . the pcr amplification was performed for 50 cycles on a thermocycler ( applied biosystems ) . quantitative real - time pcr was performed using a lightcycler 1.5 ( roche diagnostics ) in combination with quantitect sybr green pcr kit ( qiagen ) as per the manufacturer s protocol with 25 m of primer pairs used . specific primers for each gene assayed were purchased from sigma and sequences used were as follows : actin , beta ( actb ) ( forward [ f ] , ggttggccttagggttcagg ; reverse [ r ] , gggtgtgatggtgggaatgg ) ; c - fos ( f , cattcagaccacctcgacaa ; r , ggaattaacctggtgctgga ) ; and arc ( f , agcagcagacctgacatcct ; r , gtgatgccctttccagacat ) . data were normalized to actb and relative mrna transcript levels were quantified using the ct method . for mirna , 250 ng rna was reverse transcribed using stem - loop specific primers for mmu - mir-134 ( applied biosystems ) and real - time quantitative pcr was carried out on a 7900ht fast real - time system ( applied biosystems ) using taqman mirna assays . expression of rnu19 was used for normalization . a relative fold change in expression of mir-134 was determined using the ct method.19 , 56 specific mirna assays were obtained from thermofisher scientific for mir-134 ( i d 001186 ) , mir-19a ( i d 000395 ) , and rnu19 ( i d 001003 ) . data were normalized to rnu19 and relative mirna expression levels were quantified using the ct method . statistical analysis was performed using graphpad prism and stata release 14 software , and a p value < 0.05 was considered significant . latencies to tonic - clonic seizures were analyzed by the kruskal - wallis test , followed by the nonparametric dunn multiple comparison test when indicated . total time spent in seizures , mean amplitude , frequency , total power of eeg recordings , and mrna levels were analyzed by the student t test or one - way anova followed by the bonferroni test , depending on the experimental design . ex vivo brain slice data were analyzed using the mann - whitney u test . three comparisons were made from the same data and ( significance level ) was consequently reduced to 0.025 for these experiments .", ", d.f.o . , and n.d . provided human samples and data ; c.r.r . , s.s . wrote the paper and all co - authors contributed to data interpretation , review , and editing of the final paper .", "the royal college of surgeons in ireland filed for a patent on the inhibition of microrna-134 for the treatment of seizure - related disorders and other neurologic injuries ." ]

[ "it is a common discomfort making to the top ten list of complaints in ambulatory medical care , but our understanding of the epidemiology of headache disorders is still incomplete . most of the recurrent headache cases are due to benign chronic primary headache disorders , such as tension headache and migraine . less frequently , headache could be due to other underlying conditions such as infections , cerebral hemorrhage and brain lesions [ 5 , 6 ] . the study of headache epidemiology can address a number of important questions such as variation in the occurrence and severity of headache in the population , and the relationship between headache and other medical disorders . in addition , these studies may provide clues to abortive treatments and preventive strategies for headache . it is well documented among adults that overuse of headache medication may contribute to the development of chronic headache [ 814 ] . epidemiologic studies indicate that chronic headache ( > 15 days per month ) is common in the adult population with a 25% prevalence rate [ 1521 ] and a prevalence of chronic headache associated with medication overuse of about 1% [ 18 , 20 , 21 ] . in general , self - medicating for headache is highly prevalent and self - care is likely to increase in the era of health - care reform [ 22 , 23 ] . . chronic and inappropriate use of over - the - counter drugs such as analgesics , particularly nonsteroidal anti - inflammatory drugs ( nsaids ) , can lead to overuse syndromes and drug - induced headache [ 25 , 26 ] . in the present study , we sought to estimate the association between analgesic use and headache among adults in a large sample of the jordanian population in relation to age , gender and headache frequency .", "in this study , participants ( age range 1885 ) were approached at their work places , classes or homes . , researchers asked every participant to nominate two other persons until the desired sample size was obtained . the study was ethically approved by the institutional review board ( irb ) at jordan university of science and technology and was carried out in accordance with the principles described in the declaration of helsinki , including all amendments and revisions . the study was conducted in various regions of jordan during the period from january 2007 to november 2008 . the questionnaire was distributed , in person , by the researchers , and was completed in the presence of the researcher . each participant was provided with a full explanation of the study and how to complete the questionnaire . participants were informed that the researcher would be available for any required assistance during scoring of the questionnaire . for the small group of participants who were illiterate , the questionnaire was administered by the researcher in the form of an interview . data were aggregated into groups and only the authors and the investigator were allowed access to the collected data . the questionnaire gathered information that included demographic data , frequency and type of headache , and its impact on everyday activities , analgesic use , consultation of a doctor or pharmacist on the use , increase or decrease in the frequency of headache after painkiller usage , increase or decrease in painkiller dose and family history of headache . every person who was 18 years or older was allowed to complete the survey . retest reliability , 50 subjects were selected randomly ; they answered the questionnaire twice with a 1-week interval . test for each item , correlation coefficients ranged from 0.79 to 0.86 , suggesting that the questionnaire was reliable . the data were coded using the statistical package for the social sciences , version 15.0 ( spss inc . the data were summarized using frequency tables and means and standard deviation for continuous variables .", "to estimate the prevalence of headache among adults in jordan , a sample of participants ( 4,836 participants ; mean age 27 0.4 years , and male : female ratio of 59:41 ) was allowed to complete a self - conducted screening questionnaire . as shown in table 1 , about half of the participants ( 49.2% ) were university students and 78.3% were jordanian citizens . moreover , 70.7% participants were single and 47.4% were smokers.table 1the demographic data of the study samplevariablen ( % ) gender male2,870 ( 59.4 ) female1,966 ( 40.6)age 1829 years3,572 ( 73.95 ) 3039 years506 ( 10.46 ) 4049 years402 ( 8.32 ) 50 years356 ( 7.37)education illiterate83 ( 1.7 ) elementary school65 ( 1.3 ) secondary school213 ( 4.4 ) high school610 ( 12.6 ) diploma344 ( 7.1 ) university student2,378 ( 49.2 ) bachelor901 ( 18.6 ) masters181 ( 3.7 ) ph.d.61 ( 1.3)nationality jordanian3,787 ( 78.3 ) arab ( non - jordanian)841 ( 17.4 ) foreign208 ( 4.3)marital status single3,422 ( 70.8 ) married1,304 ( 27.0 ) divorced55 ( 1.14 ) other55 ( 1.14)monthly income low ( < or = 400 jd)257 ( 5.3 ) medium ( > 400 jd to < or = 1,000 jd)3,831 ( 79.2 ) high ( > 1,000 jd)748 ( 15.5)smoking smoker2,294 ( 47.4 ) non - smoker2,542 ( 52.6)1 jd is equivalent to about 1.4 us dollars the demographic data of the study sample 1 jd is equivalent to about 1.4 us dollars of the 4,836 participants , 82.3% complained of headache at least once per year . for both the 1829 and the 3039-year - old groups , the yearly prevalence of headache was found to be the same ( 82.8% ) , while it was 79.9 and 81.7% for the 4049 and older than 50-year - old groups , respectively . among the participants , 17.2% had daily headache attacks , while 25.7% had fewer than daily to weekly headaches , 21.6% had headaches on fewer than weekly up to monthly basis , 17.8% complained of headaches on a fewer than monthly basis and 17.7% of all participants did not experience headache attacks . moreover , 38.4% of the headache complainers did not know the exact type of headache they were experiencing , 36.9% complained of tension type headache and only 7.7% were diagnosed with migraine headache ; 51.6% of complainers thought that headache affected their daily activities . a large number of participants stated that one or more of their family members complained of headache as well ( table 2).table 2frequency , type , and family history of headachevariablen ( % ) headache frequency daily832 ( 17.2 ) fewer than daily to weekly1,243 ( 25.7 ) fewer than weekly to monthly1,043 ( 21.6 ) fewer than monthly to 1 year860 ( 17.8 ) no headache858 ( 17.7)type of headache migraine372 ( 7.7 ) tension1,749 ( 36.1 ) unknown1,857 ( 38.4 ) no headache858 ( 17.7)headache affects daily activities ( if any ) yes2,051 ( 51.6 ) no1,927 ( 48.4)other family members complaining from headaches father327 ( 6.8 ) mother545 ( 11.3 ) brothers or sisters552 ( 11.4 ) other relatives558 ( 11.5 ) more than one family member860 ( 17.8 ) none1,994 ( 41.1 ) frequency , type , and family history of headache of the migrainers , 37.7% ( n = 140 ) complained of daily headache , 35.6% ( n = 132 ) had fewer than daily up to weekly headaches , and 18.1 ( n = 67 ) and 8.6% ( n = 32 ) complained of headaches on a fewer than weekly up to monthly basis , and on fewer than monthly basis , respectively . additionally , about 75% ( n = 279 ) of migrainers thought that migraine adversely affected their daily activities . concerning tension type headache , 20.3% ( n = 348 ) complained of daily headache , 34.7% ( n = 594 ) had fewer than daily up to weekly headaches , and 24.1% ( n = 413 ) and 20.8 ( n = 356 ) complained of headaches on fewer than weekly up to monthly basis , and fewer than monthly basis , respectively . moreover , about 53% ( n = 907 ) indicated that tension type headache affected their daily activities . the stratified prevalence for both migraine and tension type headache according to age group and gender are shown in table 3.table 3stratified prevalence of migraine and tension - type headache according to age group and genderheadache typetension - type headachemigrainegendermale n ( % ) female n ( % ) male n ( % ) female n ( % ) age category ( years ) 1829652 ( 31.6)586 ( 39.0)158 ( 7.7)97 ( 6.5 ) 3039120 ( 36.1)73 ( 43.7)34 ( 10.2)11 ( 6.7 ) 404972 ( 31.7)68 ( 39.1)17 ( 7.5)18 ( 10.3 ) 50 and above92 ( 37.3)49 ( 40.8)28 ( 11.3)8 ( 6.7)total936 ( 32.6)776 ( 39.5)237 ( 8.3)134 ( 6.8 ) stratified prevalence of migraine and tension - type headache according to age group and gender only 17.3% of participants sought medical care for their headaches . the percentage of participants using analgesics on a weekly basis was 24.5% , less than monthly but more than weekly was 24.8% , monthly usage was 22.5% , and the percentage of participants who never use a analgesics was 14.6% . participants who used analgesics on the advice of a physician were 15.3% , while those who used analgesics on a pharmacist advice compromised 13.6% . those who used analgesics based on the experience of a family member or others were 34.8 and 47.4% , respectively ( table 4 ) . in addition , 13.1% of participants complained of increased headache severity or frequency on medication use . results also revealed that 22.0% of participants had increased their analgesic dose and 78.0% did not change their regimen . the most frequently used analgesic among participants was acetaminophen ( 78.00% ) , and to a lesser extent ibuprofen ( 7.49% ) and aspirin ( 5.58% ) ( table 5).table 4approach to medication use among patients with headachevariablen ( % ) seeking medical help for headaches yes688 ( 17.3 ) no3,290 ( 82.7)advice on using analgesics physician609 ( 15.3 ) pharmacist541 ( 13.6 ) family1,383 ( 34.8 ) others ( friends , co - workers , neighbors , etc.)1,887 ( 36.3)frequency of analgesics usage daily606 ( 15.2 ) fewer than daily to weekly974 ( 24.5 ) fewer than weekly to monthly985 ( 24.8 ) fewer than monthly to 1 year829 ( 22.4 ) no analgesics584 ( 14.6)increase in headache frequency after analgesic use yes520 ( 13.1 ) no3,458 ( 86.9)increase analgesic dose used over time yes877 ( 22.0 ) no3,101 ( 78.0)some participants have sought the advice of more than one categorytable 5frequency of analgesics use among headache patientsname of the analgesic usedn ( % ) acetaminophen3,103 ( 78.0)ibuprofen298 ( 7.5)aspirin222 ( 5.6)diclofenac sodium64 ( 1.6)naproxen25 ( 0.6)metamizole11 ( 0.3)mefenamic acid10 ( 0.3)ergotamine10 ( 0.3)others137 ( 3.5)note that some patients used more than one medication approach to medication use among patients with headache some participants have sought the advice of more than one category frequency of analgesics use among headache patients note that some patients used more than one medication", "in this study , we report for the first time an overall 1-year period prevalence of headache among adults in jordan . a sample ( 4,836 ) of participants were requested to complete a self - conducted screening questionnaire . as much as 82.3% of participants reported that they complained of headache at least once per year . this is much higher than the average global prevalence of headache ( 46% ) [ 27 , 28 ] . similar percentages were obtained from two studies conducted in other middle eastern countries namely oman and qatar , and from other developing and developed countries [ 3234 ] . on the other hand , one study conducted in oman showed a prevalence of headache of about 45% , however , that study was among university medical students and not the general population . in nearby saudi arabia , the prevalence of primary headaches ranged from 8 to 13% [ 30 , 36 , 37 ] , which is much lower than that reported in all other studies from the middle east area . the higher prevalence of headache in jordan indicates that it is one of the major health problem . tension - type headache was found to be the most prevalent among other types of headaches ( 36.9% compared to 7.7% for migraine ) . the prevalence of tension - type headache , in this study , falls within the prevalence range previously reported from studies conducted in the middle east area ( 1139% ) [ 29 , 35 , 38 , 39 ] . additionally , the reported prevalence for tension - type headache , in this study , is lower than its global prevalence ( about 42% ) , which seems to be the case for the whole middle east area . studies on migraine headache from other arab countries reported prevalence that ranged from 10 to 12.2% [ 29 , 39 , 40 ] , which is higher than the migraine prevalence in our studied sample . as in the case of tension type headache , both the global migraine prevalence ( about 11% ) , and the migraine prevalence in western europe ( about 14% ) is higher than that in jordan . therefore , jordan seems to have lower migraine prevalence than many other parts of the world . a recent study from nearby qatar reported a migraine prevalence of about 8.0% , which is very similar to the prevalence reported in the current study . the effect of headache on everyday activities was obvious in our study where a significant percentage ( 51.6% ) of participants ascertained that headache adversely affected their daily activities . our results showed that 82.7% of participants did not seek medical attention for their headaches . in agreement with other s findings [ 29 , 39 ] , 75.6% of our population used analgesics and acetaminophen was the most popular ( 78.0% ) . the popularity of acetaminophen over other analgesics could be related to its availability as an over - the - counter medication , low price , and because it is known to be safe to the gastrointestinal tract . previous studies from jordan and surrounding countries reported smoking prevalence of about 2648% , depending on the gender , age and the specific population group studied [ 4144 ] . worldwide , the overall prevalence of smoking among adult males and females was estimated to ranges from 21 to 37% in the high - income countries , and 8.9 to 49% in low to middle income countries . therefore , the percentage of smokers obtained in this study is comparable to previous studies from the region and to low to middle income countries all over the world . according to data obtained form the jordanian department of statistics , about 38% of jordanian adult population falls into the age range of 1929 year , which is considered a high percentage of young adults . in this study , however , 74% of the studied sample falls within the range of 1829 years , and 47% of them were college students . therefore , the studied sample appears to be not population based , which is one limitation of the current study . another limitation is the fact that the sensitivity and specificity of the questionnaire was not tested . in summary , headache is a major health problem in jordan , where 82.3% of participants experienced troublesome headache attacks at least once per year . analgesic overuse without seeking medical advice is regarded as potential for development of chronic headache . these results indicate the need for public education to ensure safe practices and to make the use and selling of analgesics more stringent ." ]

[ "a 55-year - old woman visited the emergency clinic of hanyang university seoul hospital with chest pain that had persisted for one month and had become aggravated two days earlier . ten years before this admission , the patient had undergone double valve replacement with aortic and mitral mechanical valves due to aortic regurgitation and mitral steno - insufficiency . echocardiography revealed normal motion and function of the mitral and aortic valve prostheses , and coronary angiography findings were also normal . however , coronary computed tomographic angiography revealed three large lobulated aneurysms with calcified walls bulging from the base of the left ventricle ( fig . the leak in the left ventricle was located in the sub - mitral valve prosthesis area . based on this finding , we diagnosed the patient with a pseudoaneurysm of the left ventricle , and surgical treatment was planned . arterial cannulation via the left femoral artery and venous cannulation via the left femoral vein and left pulmonary artery were performed . three communicating aneurysmal sacs were observed in a single plane , identical to that observed in coronary computed tomographic angiography . the neck of the first sac was located at the base of the left ventricle . under cardiopulmonary bypass and fibrillation , a defect measuring 15 mm in diameter was identified in the sub - mitral left ventricular wall with calcification but with no infection . closure of the defect was performed with a supple peri - guard pericardium patch with apex processing ( synovis , st . the walls of the aneurysmal sacs were closed , and the patient was weaned from cardiopulmonary bypass without difficulty . the vital signs of the patient remained stable , and she was extubated six hours after the operation . follow - up echocardiography was performed on postoperative day eight , and no abnormal findings , including cardiac wall motion , were noted . no leakage at the closed aneurysmal neck was observed , and there was no evidence of recurrence of the pseudoaneurysm ( fig . she has remained disease - free for six years postoperatively , with regular coumadin anticoagulation therapy due to the presence of the prosthetic aortic and mitral valves .", "a left ventricular ( lv ) pseudoaneurysm , or false aneurysm , is defined as a contained rupture or perforation of the myocardium . the rupture of the myocardium occurs rarely in clinical practice ; it is most often associated with myocardial infarction or cardiac surgery , such as mitral valve replacement ( mvr ) , and is usually fatal [ 24 ] . in 1980 , cobb et al . roberts and morrow suggested that inadvertent invasion into the lv free wall is possible during excision of the mitral valve if there is poor visualization of the operating field when using the tips of the scissors . other causes of complete or incomplete rupture of the lv free wall include an oversized prosthetic valve , excessive extirpation of calcium in the mitral annulus , myocardial erosion caused by the struts of the prosthetic valve , the untethering of the fibrous structures of the left ventricle during resection of mitral leaflets , an increase in lv contractility after aortic cross- clamping , enhanced lv wall stress with the support of inotropic agents , and other mechanical trauma between the free wall and the papillary muscles , such as rubber catheter wedging or metal pump suction during valve replacement . the wall of a false aneurysm comprises the fibrous obliteration of the pericardial sac , resulting from adhesion between the parietal and visceral layer of the pericardium . while a true aneurysm has nonrestrictive continuity with the lv cavity , a pseudoaneurysm has a defect in the myocardial continuity and a well - defined neck , representing a history of lv wall perforation . thus , such pseudoaneurysms are more likely to undergo rapid enlargement and rupture than true aneurysms . therefore , surgical correction , including the resection of the aneurysmal sac and patch repair or primary closure of the aneurysmal neck , is indicated and recommended for pseudoaneurysms . in the present case , we diagnosed a lv pseudoaneurysm using coronary computed tomographic angiography . myocardial infarction was excluded as a cause of the lv pseudoaneurysm because coronary angiography revealed normal findings and cardiac markers were in the normal range , although electrocardiography revealed myocardial ischemia in the inferior wall . the cause of lv pseudoaneurysm in our patient was a late - term complication of mvr . echocardiography revealed normal function of the mitral valve prosthesis ; therefore , mitral reoperation was not indicated . in such patients , if a repeat sternotomy for entering the operative field is considered , it may be difficult to approach the heart due to massive pericardial adhesions , and the possibility of injury or rupture of the pseudoaneurysm during dissection may be higher . a direct approach to the operative field via a left lateral thoracotomy can avoid these complications and preserve the previously implanted prosthetic valves . further , it has other advantages , such as making it easier to establish cardiopulmonary bypass and obviating the need to cross - clamp the aorta , in contrast to the sternotomy approach . in our operation , a fibrillator was used and the exposure of the operative field was excellent . in the operative field , we found three large lobulated pseudoaneurysms with calcified walls in a line , bulging from the base of the left ventricle . the configuration of the pseudoaneurysms suggested a previous episode of lv rupture , which had developed over time . in patients with lv pseudoaneurysms , there is a well - defined approach to surgical correction . the neck of the pseudoaneurysm is dissected , and the perforated site can be closed by patch repair or primarily . the mortality rate of this surgery is approximately 10% . , we have reported a case of lv pseudoaneurysm that occurred as a late complication after mvr . we performed a left lateral thoracotomy via the fifth intercostal space to approach the operative field directly and successfully repaired the sub - mitral lv pseudoaneurysm using a prosthetic patch . a few cases of lv pseudoaneurysms have been previously reported ; however , no case reports have previously been presented of korean patients with an lv pseudoaneurysm following mvr who were treated with an operative technique employing a left lateral thoracotomy ." ]

[ "posterior urethral valve ( puv ) is the most common cause of congenital bladder outlet obstruction in boys and causes renal failure in 25% to 30% of cases before adolescence . puv is associated with considerable morbidity , including urinary tract infection ( uti ) , chronic renal failure , urinary incontinence , and even death [ 1 - 3 ] . the diagnosis is made on average in 1 in 1,285 fetal ultrasound screenings . as a result of recent prenatal diagnosis , improvements in respiratory support and resuscitation at birth , and adequate management of end - stage renal disease , the mortality rate in patients with puv has significantly decreased in the past four decades . endoscopic ablation of a puv is the current gold standard of therapy , but approximately 10% to 30% of patients require a second procedure to achieve satisfactory valve ablation [ 3,6 - 8 ] . as animal models have proven , even partial outlet obstruction can lead to structural and functional deterioration in the detrusor muscle and bladder if the obstruction is not released soon enough [ 9 - 11 ] , which indicates the need for close follow - up after valve ablation . although studies about prognostic factors for outcome of renal function after puv ablation are available [ 8,12 - 15 ] , to date , the effects of preoperative factors on the rate of residual valves have not been precisely addressed . in this study , therefore , we sought to evaluate any possible relationship between preoperative clinical and imaging findings of patients with puv and remnant leaflets after their valve ablation to identify high - risk patients and achieve purposive follow - up .", "we evaluated 64 patients with clinical evidence of puvs , confirmed by voiding cystourethrography ( vcug ) , who were admitted between 2008 and 2012 at the shiraz university of medical sciences . preoperative evaluation included clinical examination , history of uti , serum electrolytes , urinalysis , complete blood count , urine culture , serum creatinine , and radiographic evaluation ( vcug / ultrasonography and dimercaptosuccinic acid [ dmsa ] scan if necessary ) . of these patients , 9 did not participate in follow - up sessions and were excluded from our study . the median patient age at the time of diagnosis was 10.0 months ( range , 5 days to 120 months ) . surgeon preference was to use an 11-fr pediatric resectoscope ( karl storz gmbh & co. kg , tuttlingen , germany ) . when the urethra was too small for this instrument , a 3-fr ureteric catheter with a metal stylet was used . valves were ablated mainly at the 5 , 7 , and ( in most cases ) 12 o'clock positions . the end point of primary ablation was determined by visual assessment of destruction of the valve . a foley catheter was left in place and was removed 24 to 48 hours after valve ablation . we performed cystoscopy in all patients at a follow - up session , at least 3 months after valve ablation ( range , 3 - 12 months ) . patients were divided into two groups on the basis of observation of obstructive residual leaflets in a second cystoscopy to analyze the possible preoperative factors that were related to obstructive remnant leaflets . group a had no evidence of obstructive remnant leaflets and in group b a second ablation was done owing to obstructive residual leaflets . we evaluated age at surgery , history of uti , level of serum creatinine and blood urea nitrogen , specific gravity of urine , hemoglobin , presence of scarring in the dmsa scan , vesicoureteral reflux ( vur ) and grade of reflux , renal parenchymal thickness , echogenicity of kidney , bladder wall thickness , renal cortical thickness , anteroposterior diameter of the renal pelvis , diameter of the distal ureter , and hydroureteronephrosis and side between groups . for statistical analysis , student t - test and mann - whitney test for quantitative numeric data comparison and chi - square test for categorical variables were adopted by using ibm spss ver . 19.0 ( ibm co. , armonk , ny , usa ) .", "follow - up cystoscopy was performed at least 3 months ( range , 3 - 12 months ) after primary valve ablation in 55 boys with a 6.75-f pediatric cystoscope ( richard wolf gmbh , knittlingen , germany ) . a total of 37 patients ( 67.3% ) had no significant remnant leaflets ( group a ) , whereas 18 boys ( 32.7% ) required a second ablation as a result of valve remnants . the valve remnants were ablated by use of an 11-f pediatric resectoscope ( karl storz gmbh & co. kg ) or a 3-fr ureteric catheter with a metal stylet . a pediatric resectoscope was used in 25 boys ( 67.6% ) in group a and in 11 boys ( 61.1% ) in group b , whereas in the other children a 3-fr ureteric catheter was applied . in both groups of patients , no significant statistical relationship was observed between method of ablation ( resectoscope versus urethral catheter method ) and remnant leaflets ( p=0.764 ) . the median ages at the time of ablation for groups a and b were 15 and 7 months , respectively ( fig . 1 ) . the mann - whitney test revealed a significant difference between the groups ( p=0.017 ) . other clinical data that we assessed demonstrated no significant differences in children with and without remnant leaflets after valve ablation and are summarized in table 1 . radiographic characteristics of patients as shown by ultrasonography , dmsa scan , and vcug were collected retrospectively . sixteen patients had a dmsa scan and scarring was detected in all except one boy , with no significant predictive value for valve remnants ( p=1 ) . in vcug , vur and side and grade of reflux significant differences were shown in the presence of vur and grade 4 or 5 reflux ( p<0.05 ) . our review of the ultrasound studies showed that the echogenicity of the renal parenchyma separated into normal echogenicity and hyperechogenicity , and echogenicity was higher in 94.4% of the preoperative ultrasounds of patients with residual leaflets ( p=0.000 ) . data on renal parenchymal thickness , bladder wall thickness , renal cortical thickness ( in the sagittal plane over a medullary pyramid , perpendicular to the capsule ) , hydroureteronephrosis and side of hydroureteronephrosis , anteroposterior diameter of the renal pelvis , and distal ureteral diameter demonstrated no influence on puv ablation outcome in our patients ( table 2 ) .", "most previous studies have focused on prognostic clinical and imaging factors in relation to the long - term outcome of renal function . to our knowledge , this is the first study to compare preoperative factors regarding the presence of postoperative obstructive leaflets . although endoscopic primary valve ablation is the preferred initial surgical treatment in most patients with puvs , the absence of obstructive residual valve remnants should be confirmed by careful clinical , radiological , and endoscopic evaluation after surgery . some investigators suggest vcug to confirm the adequacy of valve ablation , whereas others recommend cystoscopy follow - up in all patients . both methods have advantages and disadvantages such as transient dysuria , enuresis , hematuria , and toileting anxiety after vcug and the need for general anesthesia in cystoscopy and the more invasive nature of cystoscopy than repeated vcugs . whatever the method of follow - up , the necessity of post - ablation evaluation can not be undervalued owing to the high incidence rate of remnant leaflets of 10%-30% in most studies [ 3,6 - 8 ] , even as high as 51.6% in one case series . to decrease the effect of technical components of the initial resection in the presence of residual valves , all surgeries in our study smeulders et al . reported that micturating cystourethrography alone is inexact for excluding residual valve tissue ( positive and negative predictive value of 56% and 50% , respectively ) , so we routinely perform cystoscopy in all of our patients . given that there are no quantitative guidelines for the adequacy of valve ablation , our criterion was no visible obstructive residual valves in follow - up cystoscopy . the slightly higher rate of residual valves in our patients ( 32.7% ) than in most cited studies ( 10% to 30% ) [ 3,6 - 8 ] may have been because we applied follow - up cystoscopy in all patients after primary valve ablation , whereas others used follow - up cystoscopy only in cases with abnormal clinical or radiological findings . even though controversy exists about the role of age ( at diagnosis and time of puv surgery ) , it has been mentioned as one of the predictive factors for renal outcome after valve ablation . we found no published studies that assessed age as a prognostic factor for remnant leaflets , but in our patients , age ( at the time of surgery ) showed a significant effect on the presence of residual leaflets in follow - up cystoscopy . the cause of this difference may be the narrower urethra in younger children , which limits the surgeon 's visibility and complicates the endoscopic maneuver for puv ablation owing to fear of causing stricture . in any event , careful and closer follow - up in younger children seems necessary to achieve better long - term renal outcomes . besides age at diagnosis , of the other factors that we analyzed , echogenicity of kidney , presence of reflux , and grade of reflux differed significantly between the two groups ( p<0.05 ) . other studies have shown the hyperechogenicity of renal parenchyma as a factor that may help to predict long - time prognosis of renal insufficiency but did not comment on it as a factor affecting the consequences of valve ablation . in our patients , 17 boys ( 94.4% ) with residual leaflets in follow - up cystoscopy showed increased renal echogenicity in comparison with 6 patients ( 16.2% ) in the other group , with a p - value less than 0.05 . in our patients , 33 children showed evidence of vur ( 16 boys in group a and 17 in group b ) and the incidence of grade 4 and 5 reflux was significantly higher in patients with obstructive remnant leaflets ( table 2 ) . to exclude the tendency in infants to have more echogenic kidneys separate from renal function , we analyzed this factor in three age groups ( under 12 , 12 to 48 , and over 48 months ) , which revealed a significant difference in the first two groups ( p<0.05 ) . we suppose that this statistical relationship may be due to longer and thicker valves preoperatively that caused more obstruction initially , which was followed by high grades of vur as well as hyperechoic kidney that persisted after the first ablation . the presence of vur and hyperechogenicity of the kidney can affect the long - term prognosis of renal function and should be considered in the management of patients with puv . method of ablation , renal parenchymal thickness , bladder wall thickness , renal cortical thickness , hydroureteronephrosis , anteroposterior diameter of the renal pelvis and ureter , serum creatinine , and history of uti demonstrated no relationship with residual leaflets in our patients . considering the lack of studies in this field , it seems that more research is inevitable to facilitate proper screening and the detection of patients with residual leaflets . the need for confirmation of complete resection of puv is undeniable because valve remnants may result in persistent outflow obstruction or renal failure through time and should be detected quickly to minimize the deterioration of kidney or bladder function . the timing of follow - up sessions in most studies is 3 to 6 months after ablation . however , owing to decreases in function and structural deformities in the bladder as a result of partial obstruction , even after as short a period as 2 weeks in animal models [ 9 - 11 ] , earlier follow - up in the first month after ablation , especially in patients at high risk of residual valves , seems more advantageous . there may be other operative or preoperative factors , in addition to those we evaluated in our study , with the potential to affect the end result of initial valve ablation and residual leaflets . the results of such research can help to provide a better algorithm for management of puvs and achieve purposive follow - up for high - risk patients instead of invasive procedures .", "younger age at surgery time , hyperechogenicity of the renal parenchyma , presence of vur , and grade of reflux before surgery in our patients had a significant relationship with residual valves , but more research is needed to confirm these results . more studies may result in enhanced management of patients at high risk of residual valves after puv ablation , because the sooner the obstruction is entirely resolved , the better the long - term outcome ." ]

[ "white spot lesions are areas of demineralized enamel that represent an early stage of caries , since they can progress to cavitated lesions if untreated . the demineralization process can be arrested or reversed by noninvasive means , including oral hygiene counselling and/or topical fluoride application [ 2 , 3 ] . therefore , early detection of white spot lesions ( wsls ) is desirable since early preventive treatment can avert the need for future restorative treatment . new technologies such as the diagnodent and quantitative light fluorescence ( qlf ) devices have been developed for the detection of early carious lesions . these techniques are intended to be adjuncts to clinical decision making and aid in planning preventive treatment . despite the potential of these methods , the results from these tools are affected by confounding factors in the oral environment , thereby compromising the sensitivity and/or specificity of these techniques . for example with the diagnodent , stain , calculus , plaque , as well as developmental hypomineralization can produce a fluorescence output that results in false - positive readings . a review of the literature evaluating the diagnodent device found that , compared to visual assessment methods , the sensitivity was consistently higher but the specificity was lower , concluding that the increased risk of false - positives limits its clinical usefulness . for qlf , stain , plaque , fluorosis , or any developmental hypocalcification results in false - positives [ 811 ] . composite resins pit and fissure sealants as well as prophy pastes could also lead to false - positive results . clearly , a new technology is needed that will not be affected by factors in the oral environment . a new optical approach to detect white spot lesions clinically is jointly being developed at the national research council of canada - institute for biodiagnostics , the university of manitoba and dalhousie university , using a combination of optical coherence tomography ( oct ) and polarized raman spectroscopy ( prs ) . oct is a nondestructive technique for high - resolution ( 1020 m ) depth imaging that gives information about the morphology and depth of white spot lesions up to 3 mm into enamel . this method is similar to ultrasound technology , but instead of sound waves , light waves are utilized and the imaging is limited to near - surface tissues . changes in the refractive indices of structures cause light backscattering , creating an image that is different for sound enamel and demineralized enamel . prs is a noninvasive spectroscopic method that provides details on the biochemistry and molecular structure of white spot lesions . the energy difference between the incoming excitation light and scattered photons is proportional to the vibrational energy of molecules within the sample being studied , known as the raman effect . the caries process results in biochemical and structural changes that can be followed by prs , which uses scattered light to determine differences between the mineral matrix of sound enamel and demineralized enamel . our previous studies have shown that oct and prs can be used to distinguish sound enamel from white spot lesions ( wsls ) ex vivo [ 14 , 15 , 17 ] . however , the effects of calculus , hypocalcification , and stain on oct and prs have yet to be established . by combining oct and prs , false - positive results from one technology can potentially be eliminated , thereby increasing the sensitivity and specificity of the new method . calculus consists of an organic matrix with the inorganic components of dicalcium phosphate dehydrate ( dcpd ) , hydroxyapatite ( ha ) , octacalcium phosphate ( ocp ) , and -tricalcium phosphate ( tcp ) . raman spectra of human enamel are characterized by a main peak at ~959 cm arising predominantly from the symmetric phosphate groups in carbonated hydroxyapatite , the major mineral component of dental enamel [ 18 , 19 ] . clinically , hypocalcification appears visually similar ( chalky white ) to a wsl and must be differentiated from a wsl since hypocalcification is a developmental defect that does not need to be treated . in hypocalcified enamel , the crystals are arranged normally but there are pores due to larger spaces between enamel rods . intrinsic stain occurs during tooth development due to alterations in the structure or thickness of enamel or dentin , extrinsic stain accumulates on the acquired pellicle , and internalized stain occurs when extrinsic stain is incorporated into areas of enamel defects after tooth development . the objective of this study was to determine whether calculus , hypocalcification , and stain are confounding factors affecting wsl detection with optical coherence tomography and polarized raman spectroscopy .", "postextraction , the teeth were rinsed with water and clinically examined by two clinicians independently . samples were separated into 5 groups : sound enamel , wsls , calculus , hypocalcification , and stained enamel . figure 1 is a diagrammatic representation of sample sizes and allocation criteria for the above groups . since patient histories were not available , it can not be determined if hypocalcified enamel was caused by excess ingestion of fluoride ; therefore , this category is referred to as hypocalcification . figure 2 is a diagrammatic summary of data collection and analyses with oct and prs . a humphrey 's system 2000 optical coherence tomography scanner ( zeiss humphrey systems , dublin , ca , usa ) operating at 850 nm was used for oct measurements . for all data , the laser was focused to the thinnest line on the tooth surface and the scan length was 2.0 mm . three scans were collected across the area of interest with the proximal surface of interest oriented perpendicular to the laser beam . three vertical scans were also taken of sound enamel on the same tooth surface for comparison . oct images had display resolutions of 500 100 pixels , and transverse resolutions of 1020 m . figure 3(a ) displays a photo of a tooth being scanned with the oct system ( laser scan line circled ) with the corresponding 2-dimensional depth image of sound enamel ( figure 3(b ) ) . matlab software ( the mathworks , natick , ma , usa ) was used to plot oct images . a labramhr raman microspectrometer ( horiba jobin yvon , edison , nj , usa ) the laser excitation was 830 nm and a 10x microscope objective was used ( power at the sample was 125 mw ) with an acquisition time of 5 seconds and 6 accumulations . on each surface , point measurements were taken with parallel- ( p1 ) and cross- ( p2 ) polarizations at a minimum of three different points . raman data were analyzed using matlab software to calculate the depolarization ratios ( i/i ) , where i is the area under the raman band from 9251000 cm for cross - polarization ( p2 ) , and i is the similar area for parallel - polarization ( p1 ) . this wavenumber range was used since it centres at 959 cm ( the main peak due to phosphate groups such as those found in apatite ) .", "two - dimensional oct images are shown of sound enamel ( figure 3(b ) ) and a wsl ( figure 4(a ) ) . in the sound enamel image , there is intense light backscattering at the tooth - air interface , and no significant signal with depth into the enamel . in contrast , the oct image of a wsl shows significant light backscattering beneath the surface with a triangular shape characteristic of a subsurface lesion as observed on histological sections . the two - dimensional oct image displayed as figure 4(b ) shows a deposit of material on the tooth surface that is attributed to calculus . the oct image of hypocalcification in figure 4(c ) shows diffuse light back - scattering and a more irregular subsurface pattern of scattering across the entire region scanned compared to sound enamel . the light back - scattering of hypocalcified regions is also more irregular than wsls , which have a characteristic triangular shape . the oct image of stained enamel in figure 4(d ) demonstrates increased light backscattering when compared to sound enamel , but again there is no triangular - shaped subsurface light back - scattering as observed with wsls . average raman depolarization ratios ( ) from the various groups are depicted in a box - and - whisker plot ( figure 5 ) . in order to determine whether the mean depolarization ratio values of the various groups were statistically significant from one another , a one - way analysis of variance ( anova ) followed by unequal n hsd post - hoc comparisons ( statistica ) was performed ( table 1 ) . it was determined that the mean values were statistically significant in all cases at p < .05 except for three cases . sound enamel was not statistically significant from hypocalcified enamel , carious enamel was not statistically significant from stained enamel , and lastly stained enamel was not statistically significant from hypocalcified enamel . in raman spectra acquired from areas of stain ( figure 6 ) , there is a large background sloping fluorescence that is not observed in spectra from areas of sound enamel or wsls without stain where these spectra have a flat background .", "the development of new technologies for wsl assessment requires that these devices undergo clinical validation prior to becoming an accepted clinical method . in addition to demonstrating the performance of these methods for providing high sensitivity for wsl detection , high specificity is also desirable . optical coherence tomography and polarized raman spectroscopy are methods that potentially can address the need for a technology with high sensitivity and high specificity . to date there are no studies outside our research group that investigate a combination of oct and prs to detect wsls , and in particular the effects of the calculus , stain , or hypocalcification on the utility of these two technologies . oct imaging allows differentiation of sound from demineralized enamel on the basis of the characteristic triangular shape of the back - scattered signal beneath the tooth surface in images of wsls . this subsurface scattering pattern is believed to be due to wsls having porous enamel matrices , allowing incident light to travel further into the enamel and causing more scattering to occur , which is detected by the oct system . when calculus is present , it appears clearly as a deposit in the two - dimensional oct image . similar to conventional caries assessment methods , scaling of calculus is recommended before an assessment is made using oct and prs . oct can possibly be used to alert the clinician when calculus is still present in the region of interest and that further scaling is necessary . oct images of hypocalcification can be differentiated from wsls , since the light back - scattering found with hypocalcification is more irregular than wsls and lacks the characteristic triangular shape . to some extent , hypocalcification can be differentiated from sound enamel with oct since hypocalcification has a more irregular pattern of scattering at the surface and subsurface compared to sound enamel . although areas of stain are not easily distinguishable from hypocalcified enamel or sound enamel with oct , they can be readily differentiated from wsls because areas of stain lack the subsurface triangular - shaped back - scattering pattern characteristic of wsls . further image analysis is required to nonsubjectively distinguish sound enamel from stained and hypocalcified enamel . statistical analysis revealed that mean raman depolarization ratios were statistically significant in all cases at p < .05 except for three cases : ( a ) sound enamel compared to hypocalcified enamel , ( b ) carious enamel compared to stained enamel , and ( c ) stained enamel from hypocalcified enamel . since hypocalcified enamel can be mistaken for wsls upon visual clinical examination , it is reassuring that the raman depolarization values from hypocalcified enamel are distinct from caries , thereby increasing the specificity of the method . based on the analysis focusing on the depolarization ratio of the 959 cm peak , hypocalcified enamel could not be distinguished from sound enamel . this observation indicates that , fundamentally , hypocalcified enamel is like healthy sound enamel and not in need of treatment . in order to make this separation , further studies are needed which include examining the peak positions and peak width of the phosphate hydroxyapatite peak , which have been shown to be affected by the mineral crystallinity . furthermore , other peaks could be surveyed to look for peaks characteristic of specialized forms of hypocalcification such as fluorosis . the analyses indicate that stain complicates the use of prs for discriminating stained sound enamel from carious enamel . in reviewing the raman spectra acquired from areas of stain , it is observed that stained sound enamel spectra show a large background fluorescence that is not found in spectra from areas of sound enamel or wsls without stain . in these preliminary analyses , a straight - line background in the region of the peak was simply subtracted for calculating the areas under the peak . clearly , this initial approach is not enough as the curved background confounds this calculation . further studies are consequently required using various algorithms to robustly fit the fluorescence background for elimination . in addition , there are various instrument - based methods proposed to suppress the background fluorescence in raman spectra . with fluorescence - based devices ( diagnodent , qlf ) , stain chromophores from any source with prs , the fundamental basis of the method is the phosphate moieties specific to the dominant hydroxyapatite component from the mineral matrix . this peak itself is not due to staining and provides information on mineralization states as required for a method to detect demineralization in caries development . therefore , with improved methods for fluorescence background subtraction / suppression , it is anticipated that staining will no longer confound prs analyses . the statistical analyses also indicated that , based on the raman depolarization ratio , stained sound enamel can not be distinguished from hypocalcified enamel . this is also not surprising since both groups are overall noncarious intact enamel with one group containing extrinsic staining . the underlying biochemistry of the enamel matrix is largely similar in both cases as revealed by the raman spectra . subsequent analyses such as those described above for examining spectra of hypocalcified enamel could provide insights for discriminating these two groups . this result suggests that , like regions of demineralization , the apatite in areas of calculus has a disordered crystal structure and orientation as shown by higher depolarization ratio values . calculus is easily observed on the oct image , and therefore oct will be the first technology used with the fibre optic probe to screen for wsls and to determine whether prs analysis of the lesion is necessary . if calculus is detected on the oct image , the area will be scaled before the prs method is applied to determine the raman depolarization ratio . by combining oct and prs technologies , it is possible to rule out false - positive readings that might occur from using raman depolarization ratios alone . furthermore , according to the box- and whisker- plot ( figure 4 ) , setting a depolarization ratio threshold of ~0.18 can help discriminate carious enamel from enamel with a calculus deposit . it is important to note that this study was limited to extracted human teeth . in the oral environment , there will be a combination of many possible confounding factors present , and an additive effect may result in the oral cavity that was not observed when testing the possible confounding factors separately . these issues will be addressed in our subsequent studies as we transition to using fibre - optic - based devices for in vivo measurements with patient volunteers . in conclusion , calculus and hypocalcification stain does not influence wsl detection with oct . with improved analysis methods , the current limitations with prs analysis in the presence of stain the combination of oct and prs technologies can decrease the risk of false - positive reading and increase the potential for the detection of wsls with high sensitivity and specificity . this initial study has pointed out limitations that should be taken into consideration when using these methods and highlighted further analyses that need to be undertaken to better understand the effects of calculus , hypocalcification , and stain on oct and prs technologies ." ]

[ "hematoxylin and eosin - stained slides and formalin fixed paraffin embedded blocks of eight cases of hca were retrieved from the archives of the department of pathology , korea university medical center and seoul national university hospital . the hematoxylin and eosin slides were reviewed , and immunohistochemical stains were performed on the formalin fixed paraffin embedded blocks as followed . hematoxylin and eosin - stained slides of each case were reviewed independently by two authors ( h.k . the histological characteristics of the tumors were evaluated with emphasis on steatosis , sinusoidal dilatation , inflammatory infiltrate , cytological atypia , acinar growth pattern , telangiectasia , and peliosis . histological parameters were recorded as negative if less than 10% of the tumor showed the corresponding morphology . immunohistochemical stainings was performed using the following antibodies : l - fabp ( 1:50 , rabbit polyclonal ) from abcam ( cambridge , ma , usa ) ; -catenin ( 1:50 , mouse monoclonal ) , saa ( 1:50 , mouse monoclonal ) , and glutamine synthetase ( gs ; 1:200 , mouse monoclonal ) from bd biosciences ( san diego , ca , usa ) ; cd3 ( 1:100 , mouse monoclonal ) , cd20 ( 1:100 , mouse monoclonal ) , p53 ( 1:50 , mouse monoclonal ) and ki-67 ( 1:50 , mouse monoclonal ) from dako ( carpentaria , ca , usa ) ; and glypican3 ( 1:50 , mouse monoclonal ) from cell marque ( rocklin , ca , usa ) . cytoplasmic staining of normal hepatic parenchyma served as a positive control for l - fabp immunostaining . focal cytoplasmic staining in the perivenular area of normal hepatic parenchyma served as a positive control for gs immunostaining . diffuse cytoplasmic granular staining with or without membranous staining was recorded as a positive saa immunostaining result . the recent hca classification system proposed by the bordeaux group was used.8 the histologic and immunohistochemical characteristics for each subtype are described below . each case was categorized based on combined clinical , histologic , and immunohistochemical parameters . the histologic characteristics of h - hca are marked steatosis and an absence of cytological abnormalities and inflammatory infiltrate.6,7,13 this subtype shows negative staining for l - fabp because hnf1 positively regulates fabp1 in normal liver tissue . diffuse or focal cytoplasmic staining was interpreted as a positive result for l - fabp immunostaining . the presence of steatosis and negative l - fabp immunostaining were indicators of h - hca . the histological characteristics of -hcas are nuclear atypia , an acinar ( pseudoglandular ) growth pattern , and lack of steatosis.6 -catenin and gs immunostaining was used to detect -hcas.12,13 diffuse or focal cytoplasmic gs staining was interpreted as a positive result . diffuse or focal nuclear -catenin immunostaining was interpreted as a positive result , whereas cytoplasmic -catenin immunostaining was recorded as aberrant expression . characteristic -hca histologic characteristics and positive gs and/or -catenin immunostaining results were indicators of -hca . the histologic characteristics of i - hca are presence of inflammatory infiltrate , marked sinusoidal dilatation , and thick - walled arteries.8 steatosis may be present in patients with i - hca but is not as extensive as that in patients with h - hca.8 diffuse or focal cytoplasmic immunostaining for saa was interpreted as a positive result . hcas without genetic changes in hnf1 or -catenin and without protein expression of the previously mentioned markers are categorized into this group.8 hcas with complete or near - complete necrosis can also be classified in this group.13", "hematoxylin and eosin - stained slides of each case were reviewed independently by two authors ( h.k . the histological characteristics of the tumors were evaluated with emphasis on steatosis , sinusoidal dilatation , inflammatory infiltrate , cytological atypia , acinar growth pattern , telangiectasia , and peliosis . the percentage of steatotic area was recorded . histological parameters were recorded as negative if less than 10% of the tumor showed the corresponding morphology .", "immunohistochemical stainings was performed using the following antibodies : l - fabp ( 1:50 , rabbit polyclonal ) from abcam ( cambridge , ma , usa ) ; -catenin ( 1:50 , mouse monoclonal ) , saa ( 1:50 , mouse monoclonal ) , and glutamine synthetase ( gs ; 1:200 , mouse monoclonal ) from bd biosciences ( san diego , ca , usa ) ; cd3 ( 1:100 , mouse monoclonal ) , cd20 ( 1:100 , mouse monoclonal ) , p53 ( 1:50 , mouse monoclonal ) and ki-67 ( 1:50 , mouse monoclonal ) from dako ( carpentaria , ca , usa ) ; and glypican3 ( 1:50 , mouse monoclonal ) from cell marque ( rocklin , ca , usa ) . cytoplasmic staining of normal hepatic parenchyma served as a positive control for l - fabp immunostaining . focal cytoplasmic staining in the perivenular area of normal hepatic parenchyma served as a positive control for gs immunostaining . diffuse cytoplasmic granular staining with or without membranous staining was recorded as a positive saa immunostaining result .", "the recent hca classification system proposed by the bordeaux group was used.8 the histologic and immunohistochemical characteristics for each subtype are described below . the histologic characteristics of h - hca are marked steatosis and an absence of cytological abnormalities and inflammatory infiltrate.6,7,13 this subtype shows negative staining for l - fabp because hnf1 positively regulates fabp1 in normal liver tissue . diffuse or focal cytoplasmic staining was interpreted as a positive result for l - fabp immunostaining . the presence of steatosis and negative l - fabp immunostaining were indicators of h - hca . the histological characteristics of -hcas are nuclear atypia , an acinar ( pseudoglandular ) growth pattern , and lack of steatosis.6 -catenin and gs immunostaining was used to detect -hcas.12,13 diffuse or focal cytoplasmic gs staining was interpreted as a positive result . diffuse or focal nuclear -catenin immunostaining was interpreted as a positive result , whereas cytoplasmic -catenin immunostaining was recorded as aberrant expression . characteristic -hca histologic characteristics and positive gs and/or -catenin immunostaining results were indicators of -hca . the histologic characteristics of i - hca are presence of inflammatory infiltrate , marked sinusoidal dilatation , and thick - walled arteries.8 steatosis may be present in patients with i - hca but is not as extensive as that in patients with h - hca.8 diffuse or focal cytoplasmic immunostaining for saa was interpreted as a positive result . hcas without genetic changes in hnf1 or -catenin and without protein expression of the previously mentioned markers are categorized into this group.8 hcas with complete or near - complete necrosis can also be classified in this group.13", "the histologic characteristics of h - hca are marked steatosis and an absence of cytological abnormalities and inflammatory infiltrate.6,7,13 this subtype shows negative staining for l - fabp because hnf1 positively regulates fabp1 in normal liver tissue . diffuse or focal cytoplasmic staining was interpreted as a positive result for l - fabp immunostaining . the presence of steatosis and negative l - fabp immunostaining were indicators of h - hca .", "the histological characteristics of -hcas are nuclear atypia , an acinar ( pseudoglandular ) growth pattern , and lack of steatosis.6 -catenin and gs immunostaining was used to detect -hcas.12,13 diffuse or focal cytoplasmic gs staining was interpreted as a positive result . diffuse or focal nuclear -catenin immunostaining was interpreted as a positive result , whereas cytoplasmic -catenin immunostaining was recorded as aberrant expression . characteristic -hca histologic characteristics and positive gs and/or -catenin immunostaining results were indicators of -hca .", "the histologic characteristics of i - hca are presence of inflammatory infiltrate , marked sinusoidal dilatation , and thick - walled arteries.8 steatosis may be present in patients with i - hca but is not as extensive as that in patients with h - hca.8 diffuse or focal cytoplasmic immunostaining for saa was interpreted as a positive result .", "hcas without genetic changes in hnf1 or -catenin and without protein expression of the previously mentioned markers are categorized into this group.8 hcas with complete or near - complete necrosis can also be classified in this group.13", "there were three cases of h - hca , four cases of i - hca , and one cases of -hca . morphologic findings ( table 2 ) and results of immunohistochemical staining ( table 3 ) were analyzed for each case . this was confirmed by negativity for glypican 3 and p53 immunostaining and a ki-67 index < 1% in all eight cases . three cases ( a , b , and c ) were classified as h - hca . morphologically , cases a and b revealed marked steatosis of 30 - 40% and 20% , respectively , and did not show most of the characteristic histologic features of the other subtypes , such as sinusoidal dilatation , inflammatory infiltrate , cytological atypia , acinar pattern , thick - walled arteries , or peliosis ( table 2 ) . case c did not show steatosis but presented with thick - walled arteries and cytological atypia . . there was faint l - fabp staining in the tumoral area , but it was interpreted as negative because the staining intensity was very weak and identical to the non - specific staining of blood vessels . cases a ( fig . 1 ) and b were in accordance with the known characters of h - hca , but case c was not fully concordant and shared some characteristics with i - hca . four cases ( d , e , f , and g ) were categorized as i - hca . three were male and one was female . although these three cases had a negative history of alcohol consumption , cases d and g had high bmis ( 27.8 kg / m and 25.9 kg / m , respectively ) . all three cases had morphological characteristics typical of i - hca , including marked sinusoidal dilation , presence of inflammatory infiltrates , and thick - walled arteries ( table 2 ) . in all four cases l - fabp immunostaining was negative and saa immunostaining was positive ( table 3 ) . glutamine synthetase immunostaining , should be negative in i - hca , was positive in cases e and f. cases d ( fig . morphologic analysis showed lack of steatosis and inflammatory infiltrate , but the presence of an acinar pattern with cytological atypia ( table 2 , fig . satining the tumor cells were positive for l - fabp and glutamine synthetase ( fig . however , -catenin immunostaining showed an aberrant pattern of diffuse cytoplasmic staining and was interpreted as negative because there was no nuclear staining ( fig . this case was classified as -hca because all morphologic and immunohistochemical findings were in agreement with known characteristics of -hca except for the -catenin immunostaining result . all eight cases were determined to belong to the above subtypes therefore none were categorized as an unclassified hca .", "three cases ( a , b , and c ) were classified as h - hca . morphologically , cases a and b revealed marked steatosis of 30 - 40% and 20% , respectively , and did not show most of the characteristic histologic features of the other subtypes , such as sinusoidal dilatation , inflammatory infiltrate , cytological atypia , acinar pattern , thick - walled arteries , or peliosis ( table 2 ) . case c did not show steatosis but presented with thick - walled arteries and cytological atypia . . there was faint l - fabp staining in the tumoral area , but it was interpreted as negative because the staining intensity was very weak and identical to the non - specific staining of blood vessels . based on these findings , these three cases were classified as h - hca . cases a ( fig . 1 ) and b were in accordance with the known characters of h - hca , but case c was not fully concordant and shared some characteristics with i - hca .", "four cases ( d , e , f , and g ) were categorized as i - hca . three were male and one was female . although these three cases had a negative history of alcohol consumption , cases d and g had high bmis ( 27.8 kg / m and 25.9 kg / m , respectively ) . all three cases had morphological characteristics typical of i - hca , including marked sinusoidal dilation , presence of inflammatory infiltrates , and thick - walled arteries ( table 2 ) . in all four cases l - fabp immunostaining was negative and saa immunostaining was positive ( table 3 ) . glutamine synthetase immunostaining , should be negative in i - hca , was positive in cases e and f. cases d ( fig .", "morphologic analysis showed lack of steatosis and inflammatory infiltrate , but the presence of an acinar pattern with cytological atypia ( table 2 , fig . satining the tumor cells were positive for l - fabp and glutamine synthetase ( fig . however , -catenin immunostaining showed an aberrant pattern of diffuse cytoplasmic staining and was interpreted as negative because there was no nuclear staining ( fig . this case was classified as -hca because all morphologic and immunohistochemical findings were in agreement with known characteristics of -hca except for the -catenin immunostaining result .", "all eight cases were determined to belong to the above subtypes therefore none were categorized as an unclassified hca .", "this is the largest korean hca series review of the past several decades and the first to apply the new subtype classification . the incidence of hca in korea is very low and only a few cases of hca have been reported in korea during the past 25 years.19 the recent hca classification was established based on previous studies of genetic and phenotypic characteristics of hca and hepatic nodular hyperplasia.9,10,15,17,18,20 pathologically , the subtype classification enables an accurate diagnosis of this rare entity even with a small biopsy specimen.8,21 l - fabp immunohistochemistry is especially helpful in the identification of h - hca because hnf1 positively regulates fabp1 in normal liver tissue . mutation in the hnf1 gene causes steatosis,22 therefore most cases of h - hca also show marked steatosis.7,11 a correlation study between genotype and phenotype of each subtype revealed a strong association between h - hca and the presence of steatosis , the absence of cytological atypia , and absence of inflammatory infiltrate.6 however , one of our l - fabp - negative cases was not consistent with the description in the new classificat ion system because it did not have steatosis but did have cytological atypia . although a lack of steatosis in an l - fabp - negative case is unusual , similar l - fabp - negative cases without steatosis can be found in other reports.6,23 according to zucman - rossi et al.,6 fewer than 7% of hnf1-mutated adenomas show no or < 10% steatosis and fewer than 2% present with cytological atypia . four cases were categorized as i - hca , and cases showed consistent i - hca findings including positive saa and l - fabp immunostaining in addition to an inflammatory infiltrate . atypia in i - hca does not seem to be uncommon , and occurred at a rate of approximately 50% in one previous report.6 the bordeaux group pointed out the presence of cases with overlapping features of i - hca and -hca.13 i - hcas are have been reported to present with a lower than moderate level of steatosis in 94% of cases.6 in our study , two of the four i - hcas presented with 5% steatosis while the remaining three showed none . case h was categorized as -hca because of cytological atypia , an acinar growth pattern , and positive l - fabp staininng . interpretation of -catenin immunostaining in hca seems to be a common problem ; thus , the bordeaux group reported that they rely more on glutamine synthetase immunostaining as a surrogate marker for detecting -hca than on -catenin immunostaining because of the focal distribution or absence of -catenin positive cells.11 in one japanese report , the authors also recognized a certain case as -hca even if the tumors expressed only gs.24 the discordance between -catenin mutation status and protein expression in hcas is not as striking as that reported in studies of other tumors.25,26 glutamine synthetase , a surrogate marker for -catenin , showed inconsistent results in our series . although positive glutamine synthetase staining is supposed to be characteristics of -hcas , four of our seven cases with non--hca subtypes showed a positive result . similar findings of inconsistent gs staining results are discussed in a review of hca cases from scotland.27 in addition to these difficulties with immunohistochemistry , -hca can be difficult or impossible to be distinguished from well differentiated hcc because of the cytological atypia and acinar growth pattern.8 if used alone , none of the histological or immunohistochemical parameters included in the subtype classification seem to be able to properly categorize a particular tumor subtype . as summarized in a table created by the bordeaux group , a small number of cases from each subtype share histological features with other subtypes.6 furthermore , immunohistochemistry can give inconsistent results in certain cases . however , l - fabp or saa staining alone seemed to be sufficient for discriminating between h - hca and inflammatory hca , respectively . the opinion that there is no single histologic or immunohistochemical parameter sufficient for classification of any subtype has been expressed in a previous report.27 in our cases presenting with hnf1-mutated and inflammatory hca , most , but not all , had intratumoral hemorrhage . moreover , female predominance is typically observed in hca cases , but 50% of the patients in our series , were male . a similar relatively high proportion of males was observed in a japanese study of hca.24 the authors assumed that this was a characteristic of japanese hca cases . when combined with our result , it seems likely that the relatively high proportion of males might be the result of genetic and environmental actors associated with an asian population . overall , our results both support and contradict other reports on hca . in conclusion , the hca subtype classification based on genetic and phenotypic characteristics provides new insight into the pathological and radiological diagnosis and clinical management of these tumors . the diagnostic and clinical implications of the new classification scheme may need to be validated by other studies ." ]

[ "microglia account for approximately 10% of the adult brain cell population and represent the first and main form of immune defense in the central nervous system ( cns ; lawson et al . microglia become activated and they can be identified and distinguished from their resting phenotype based on a combination of morphological and immunophenotypic changes ( dheen et al . , 2007 ; ransohoff and perry , 2009 ) . microglia initiate immune responses by enhancing the expression of toll - like receptors ( tlr ) and a wide range of pro - inflammatory mediators such as tumor necrosis factor - alpha ( tnf ) , interleukin ( il)-1 and il-6 for the removal of the cns threat ( suzumura et al . , 1996 ; microglia may also fulfill a neuroprotective role via the release of neurotrophic factors and promotion of neurogenesis for the restoration of normal physiology ( stadelmann et al . , 2002 ) . hence , the acute inflammatory response is generally beneficial , as it tends to minimize injury and promotes tissue repair . however , chronic neuroinflammation is closely related to various neurodegenerative disorders such as parkinson s disease ( pd ) , huntington s disease ( hd ) , dementias , and multiple sclerosis ( ms ) , although the consequences of sustained microglial activation in these diseases is unclear . activated microglia upregulate expression of the 18-kda translocator protein ( tspo ; chen and guilarte , 2008 ; cosenza - nashat et al . tspo are found in abundance throughout the body in peripheral organs ( i.e. , liver and adrenals ) , and hematogenous cells , but are present at very low levels in the normal healthy cns ( banati , 2002 ) . functionally , tspo has several biological functions including the control of cholesterol transport and neurosteroid synthesis ( papadopoulos et al . , 2006 ) , and may also be involved in the release of pro - inflammatory cytokines during inflammation ( choi et al . , 2002 ; wilms et al . , enhanced tspo expression can be detected in vivo by using positron emission tomography ( pet ) imaging with the selective tspo radioligand c - pk11195 ( benavides et al . , 1993 ; banati et al . , 1999 ) , with evidence that increases in c - pk11195 binding potential ( bpnd ) correspond to activation of microglia ( stephenson et al . , 1995 ; conway et al . although tspo is also expressed by reactive astrocytes , a c - pk11195 pet study of patients with hippocampal sclerosis , a condition histopathologically characterized by marked astrogliosis , did not yield results that were significantly different to healthy normal controls ( banati et al . this is consistent with the view that reactive astrocytes , in vivo , do not significantly contribute to the c - pk11195 signal . therefore , in the absence of invading blood borne cells or severe focal leakage of blood - brain barrier , the increased pk11195 binding is likely to indicate the transition of microglia from a resting to an activated state , and is due to an increase in the number , rather than the affinity , of tspo ( banati et al . , 2000 ) . hence , the measurement of tspo uptake using pet provides an in vivo tool to monitor progression and severity of neuroinflammation and is a useful indicator of active cns disease . this article aims to review the use of pet imaging to promote the understanding of activated microglia in neurodegenerative disease .", "parkinson s disease is the second most common neurodegenerative disorder of the elderly and is associated with the motor symptoms of tremor , bradykinesia , and rigidity . it is characterized by the extended loss of dopaminergic neurons in the substantia nigra pars compacta , resulting in a deficiency of dopamine in the striatum ( braak et al . , 2006 ) , and the presence of alpha - synuclein ( -synuclein)-containing lewy bodies . pd is the most common of a group of parkinsonian movement disorders that also includes multiple system atrophy ( msa ) , corticobasal degeneration ( cbd ) , and progressive supranuclear palsy ( psp ) . the presence of activated microglia close to dopaminergic neurons in post - mortem pd patient brains ( mcgeer et al . , 1988a ; mogi et al . , 1994 ; langston et al . , 1999 ; imamura et al . , 2003 ) , and pd animal models ( czlonkowska et al . , 1996 ; kim et al . , 2009 ) suggests a close relationship between neurodegeneration and neuroinflammation in pd . numerous investigations have proposed a deleterious role of microglial activation in pd based on the vulnerability of dopaminergic neurons to various microglia - derived pro - inflammatory cytokines ( ferrari et al . , 2006 ; stone et al . , 2009 ; de lella ezcurra et al . , 2010 ) , while -synuclein can directly induce activation of microglia ( zhang et al . , 2005 ) . however , it seems that the plasticity of microglia must be considered with regards to their contribution in pd , and their role ; whether beneficial or detrimental , it may depend on the stimuli present and the stage of disease ( li et al . , 2007 ; michelucci et al . , 2009 ; sanchez - guajardo et al . , further clues regarding the role of activated microglia has also come from in vivo pet imaging studies ( table 1 ) . significant microglial activation , as reflected by an increase in c - pk11195 bpnd was reported in the midbrain and putamen of pd patients when compared to controls , and was found to correlate positively with the motor severity of parkinsonism ( ouchi et al . , 2005 ; bartels et al . , 2010 these findings suggest that activated microglia has a pathogenic importance in the disease and indicate that the early introduction of a neuroprotective drug to suppress microglial activation could be favorable in pd . additionally , pd patients exhibited significantly increased c - pk11195 bpnd in the basal ganglia , pons , and frontal and temporal cortical regions ( gerhard et al . , 2006a ) . in this study , the increased microglial activation remained unchanged for 2 years , while the patients deteriorated clinically during this period . hence , it is likely that microglia are activated early in pd , where they remain activated for longer periods and possibly drive progression of the disease ( gerhard et al . , 2006a ) . bpnd , binding potential ; cbd , corticobasal degeneration ; msa , multiple system atrophy ; nc , normal control ; pd , parkinson s disease ; psp , progressive supranuclear palsy . multiple system atrophy is a sporadic neurodegenerative disorder involving a progressive akinetic - rigid syndrome , autonomic failure , and cerebellar dysfunction . it is associated by the appearance of abnormal glial cytoplasmic inclusions ( gci ) containing ( -synuclein aggregates and neuronal loss within the nigrostriatal and olivopontocerebellar regions ( lantos and papp , 1994 ) . the presence of activated microglia is also a prominent feature of msa ( schwarz et al . , 1998 ) . in an in vivo pet study of msa patients , significant c - pk11195 bpnd was observed in the putamen , pallidum , pons , substantia nigra pars compacta , and dorsolateral prefrontal cortex , reflecting the known distribution of neuropathological changes in msa ( gerhard et al . , 2003 ) . although the role of microglia in msa is inconclusive , microglial activation localization correlated significantly with the locations of gcis in specific neuroanatomical systems affected in msa ( ishizawa et al . , 2004 ) . a correlation between extent of microglial activation and dopaminergic neurodegeneration has also been reported ( stefanova et al . , 2007 ) . progressive supranuclear palsy is an adult - onset progressive neurodegenerative disease of unknown cause , characterized by pd - like symptoms such as postural instability and bradykinesia . the pathological hallmark of the disease is neurofibrillary tangles consisting of hyperphosphorylated tau , accompanied by neuronal loss in the thalamus , basal ganglia , and specific brainstem regions ( hauw et al . several early studies including immunohistochemical investigations have confirmed the possible involvement of activated microglia in psp ( kida et al . , 1992 ; komori et al . , 1998 ; ishizawa et al . , 2000 ; ishizawa and dickson , 2001 ) . c - pk11195 pet have also reported significant levels of activated microglia in brain regions known to be affected by the disease process such as the midbrain , cerebellum , pons , frontal lobe , and basal ganglia ( gerhard et al . , 2006b ) . although these results were unable to support a direct causal contribution to neurodegeneration in psp , they are at least suggestive of a role of microglia in the disease . corticobasal degeneration is a neurodegenerative disorder that affects both cortical and basal ganglial regions , with considerable clinical heterogeneity between patients . typically , cbd features an asymmetric hypokinetic - rigid syndrome , coupled with alien limb phenomenon and cortical sensory impairment that is unresponsive to dopaminergic therapy ( rebeiz et al . , 1968 ; gibb et al . , 1989 information on the association of activated microglia in cbd is limited , and mainly coming from immunohistochemical - based assessments ( armstrong et al . , 2000 ; ishizawa and dickson , 2001 ) . however , more recent in vivo pet investigations have attempted to quantify microglial activation in cbd patients . increased c - pk11195 bpnd was observed in regions such as the caudate nucleus , putamen , substantia nigra pars compacta , pons , and pre- and post central gyrus ( gerhard et al . 2004 ) that correspond to the expected neuropathological changes seen in cbd ( ishizawa and dickson , 2001 ; dickson et al . , 2002 ) .", "huntington s disease is an autosomal , dominant inherited progressive neurodegenerative disorder associated with motor , cognitive , and psychiatric symptoms . it is caused by an abnormal polyglutamine - repeat expansion on the it15 gene that codes huntingtin , and involves the progressive loss of medium spiny dopaminergic receptor - bearing striatal gaba - ergic neurons ( vonsattel and difiglia , 1998 ) . although the role of chronic neuroinflammation in the hd pathogenesis is not fully understood , post - mortem assessments have reported high levels of activated microglia close to degenerating neurons ( mcgeer et al . upregulated inflammatory cytokines have also been detected in the striatum and plasma , indicative of an inflammatory component in hd ( dalrymple et al . , 2007 ; imaging studies using c - pk11195 pet have found increased microglial activation in both premanifest hd gene carriers and manifest hd patients when compared to healthy controls ( table 2 ; pavese et al . , 2006 ; tai et al . , 2007 ; politis et al . , 2008 , 2011 ) . in premanifest hd patients , significant increases in c - pk11195 bpnd in the striatum and hypothalamus was reported , which correlated inversely with neuronal dysfunction as measured by c - raclopride ; a marker of dopaminergic d2/d3 receptor availability ( tai et al . , 2007 ; politis et al . , 2008 ) . interestingly , microglial activation in the striatum , and regions related to cognitive function has been shown to predict the 5-year disease clinical onset in premanifest hd patients ( tai et al . these results imply that microglial activation is an early event in the hd disease course , with a possible pathogenic involvement that is associated with a subclinical progression of the disease . bpnd , binding potential ; hd , huntington s disease ; nc , normal control . in manifest hd patients , significant c - pk11195 bpnd in the striatum , hypothalamus , and various cortical regions was found , that correlated with greater disease burden and higher motor disability ( pavese et al . the cortical microglial activation is likely to indicate the involvement of cortical neurons in hd , a well - recognized phenomenon as the disease progresses . collectively , these findings are consistent with the post - mortem studies ( messmer and reynolds , 1998 ; sapp et al . , 2001 ) and suggest a detrimental microglial contribution to the ongoing neuronal degeneration in hd .", "dementias are a group of disorders that are expected to affect more than 100 million people by 2050 raising remarkable financial costs for healthcare ( wimo et al . , 2003 ) . ad is the most common cause of dementia and is the most common neurological disorder of the elderly . ad is characterized by the presence of amyloid plaques , neurofibrillary tangles , and activated microglia ( for review , see hardy and selkoe , 2002 ) . there is a plethora of evidence from post - mortem human ad studies ( mcgeer et al . , 1988a ; venneti et al . , 2009 ) and animal models ( frautschy et al . , 1998 ; stalder et al , 1999 ; leung et al . , 2011 ) reporting a high accumulation of activated microglia in close proximity with the amyloid plaques , and upregulated levels of pro - inflammatory cytokines ( akiyama et al . , 2000 ; eikelenboom et al . , positron emission tomography enables a broad range of functional processes to assess the ad brain in vivo ( table 3 ) . c - pk11195 has been used to demonstrate increased levels of activated microglia in both ad animal models ( venneti et al . , 2009 ) and ad patients ( cagnin et al . , 2001 ; edison et al . , 2008 ; yokokura et al . , 2011 ) . in ad patients , significant c - pk11195 bpnd was consistently observed in the temporal , parietal , and occipital cortices , regions known to be affected by ad pathology ( cagnin et al . , 2001 ; the increased activated microglia also inversely correlated with the patient mini - mental state examination ( mmse ) scores , which is compatible with a role of microglia in neuronal damage ( edison et al . , 2008 ) . interestingly , elevated levels of activated microglia were also detected in patients with amnestic mild cognitive impairment ( mci ; okello et al . , 2009a ) , although this was not observed in another study assessing mci patients ( wiley et al . mci could represent an early precursor stage of ad , since it was found that mci patients with increased amyloid load were significantly more likely to clinically convert to ad within 3 years ( okello et al . , 2009b ) . therefore , microglial activation could be an early event in the ad pathogenesis that begins at the mci stage . ad , alzheimer s disease ; bpnd , binding potential ; ftld , frontotemporal lobar degeneration ; mci , mild cognitive impairment ; mmse , mini - mental state examination ; nc , normal controls . despite the evidence suggestive of a pathogenic role of activated microglia in ad , it is hypothesized that the accumulation of amyloid plaques is actually due to a failure in microglial clearance mechanisms that would normally remove the protein ( bornemann et al . , 2001 ; this indicates a beneficial , rather than detrimental role of microglia in ad . notwithstanding the abundance of activated microglia close to senile plaques , they maybe inefficient in the clearance of amyloid , hence , resulting in aggregate formation ( bolmont et al . , 2008 ) . it has been shown that in the presence of pro - inflammatory cytokines , phagocytic functions of microglia are compromised ( koenigsknecht - talboo and landreth , 2005 ) . therefore , microglia may confer a dichotomous role in ad , where early microglial activation is possibly neuroprotective involving the removal of amyloid . however , chronic neuroinflammation may downregulate amyloid clearance mechanisms , thus , promoting aggregation and progression of disease . frontotemporal lobar degeneration ( ftld ) which includes frontotemporal dementia is the name given to a group of pathologically , clinically , and genetically heterogeneous disorders involving focal atrophy of the frontal and temporal lobes , while unlike ad , with sparing of the parietal and occipital regions ( neary et al . , 1998 ) . another important dissimilarity between ad and ftld pathology is the absence of amyloid plaque formation ( paulus et al . , 1993 ; rather , the key histopathological features of ftld , depending on subtype , includes tau deposition ( including pick bodies ) and ubiquitin - positive , tau - negative inclusions ( munoz et al . , 2003 ; uchihara et al . , 2003 ) . in vivo pet imaging of ftld patients detected enhanced microglial activation in the expected frontotemporal regions ( cagnin et al . , 2004 ) . in the same study , significant c - pk11195 bpnd in the bilateral putamen is also consistent with previous neuropathological data showing the involvement of the basal ganglia in ftld ( mirra and hyman , 2002 ) . these observations indicate the presence of an active microglial response that reflects progressive neuronal degeneration . importantly , the detection of increased microglial activation in affected regions in ftld suggests that microglial responses occur independently of amyloid deposition , and that neuronal loss alone is enough to induce activation ( cagnin et al . , 2004 ) .", "multiple sclerosis is a disease characterized pathologically by inflammatory demyelination and axonal transection , and is the most common cause of non - traumatic disability in young adults ( compston and coles , 2008 ) . the involvement of activated microglia has long been proposed in ms ( benveniste , 1997 ) . post - mortem investigations have detected activated microglia in the cortical gm of ms patients ( de groot et al . 2002 ) , while histopathological studies have implicated microglia in lesion pathogenesis ( for review , see lassmann , 2008 ) . an observed correlation between neuronal loss and microglial activation was reported in animal experimental ms ( rasmussen et al . , 2007 ) . significant levels of activated microglia was also found in ms patients , especially in the progressive forms of disease that are associated with neurodegeneration ( kutzelnigg et al . , 2005 ; magliozzi et al . , 2010 ) , and selective ablation of parenchymal microglia was able to prevent demyelination and axonal damage ( heppner et al . , 2005 ) . pathological aspects of ms such as neuroinflammation , demyelination , and neurodegeneration may be explored in vivo with pet ( for review , see kiferle et al . , 2011 ) . pet with c - pk11195 and other tracers has demonstrated inflammatory processes with microglial involvement in ms ( figure 1 ; table 4 ) . in animal experimental ms and human post - mortem brains it has been shown that c - pk11195 uptake corresponds to the distribution pattern of activated microglia ( banati et al . , 2000 ) . it has also been demonstrated that there is increased c - pk11195 bpnd in areas of focal pathology identified by t1- and t2-weighted mri ( vowinckel et al . , 1997 ; banati et al . , 2000 ) and in gadolinium - enhanced t1-weighted mri ( debruyne et al . , 2003 ) . increased c - pk11195 bpnd was observed in normal - appearing gray and white anatomical structures ( banati et al . this is in line with the hypothesis that inflammatory processes initiated by microglia early in ms may constitute the real burden of disease , associated with invisible microglia - mediated damage that occur independently of relapses ( kesselring , 1990 ; confavreux et al . , 2000 ) . a positive correlation has been suggested between ligand uptake and disease duration , disability , and brain atrophy ( banati et al . , 2000 ; however , recent data from our group found a significant association between high c - pk11195 bpnd in the cortical gray matter and disability in patients with secondary progressive ms , and with higher c - pk11195 bpnd in the secondary progressive group than the relapse - remitting ms group ( politis et al . enhanced microglial activation in ms has also been detected using the more recently developed tspo tracers c - vinpocetine and c - pbr28 ( vas et al . , 2008 ; oh et al . , 2011 ) . positron emission tomography images showing increased c - pk11195 bpnd in a multiple sclerosis patient ( a ) when compared to a healthy normal control ( b ) . color bar represents intensity of c - pk11195 tracer binding ( bpnd ) . bpnd , binding potential ; gm , gray matter ; mri , magnetic resonance image ; ms , multiple sclerosis ; nawm , normal - appearing white matter ; nc , normal control ; pp , primary progressive multiple sclerosis ; rr , relapse - remitting multiple sclerosis ; sp , secondary progressive multiple sclerosis . microglial activation may contribute to the mechanism of axonal injury via the release of soluble factors that may either directly or indirectly cause neuronal dysfunction ( peterson et al . , 2001 ; barnett and prineas , 2004 ; dutta and trapp , 2006 ; zipp et al . , 2006 ; dal bianco et al . , 2008 ; lassmann , 2008 ; magliozzi et al . , 2010 ) , however , activated microglia may also exert protective functions with ms through the release of neurotrophic factors ( stadelmann et al . , 2002 ; napoli and neumann , 2009 ) , and triggering of remyelination mechanisms ( li et al . , 2005 ; setzu et al . ,", "c - pk11195 was the first tracer to be consistently used for the study of activated microglia and neuroinflammation in vivo . however , limitations associated with the application of c - pk11195 include a high level of non - specific binding ( petit - tabou et al . , 1991 ) , and a poor signal to noise ratio , which complicates its quantification ( boutin et al . , 2007 ) . this has prompted the search for novel pet tracers ( termed , second generation radioligands ) with improved capacities to quantify tspo expression . radioligands such as c - pbr28 , c - daa1106 , f - fedaa1106 , and f - pbr111 have recently been developed to image tspo in vivo ( gulys et al . , 2002 ; ikoma et al . , 2007 ; , 2011 ; for a review , see chauveau et al . , 2008 ) . published data using the second generation ligands c - daa1106 ( ikoma et al . , 2007 ) and f - fedaa1106 ( fujimura et al . , 2006 ) in humans were promising , with both tracers showing significantly higher cerebral uptake than c - pk11195 . furthermore , increased c - daa1106 binding was reported in ad patients ( yasuno et al . , 2008 ) that were similar to the previous studies that used c - pk11195 ( cagnin et al . , 2001 ) . the only published study using the second generation radioligand c - pbr28 found areas of focal increases in radiotracer binding in the brain of ms patients ( oh et al . , 2011 ) interestingly , the increased focal c - pbr28 binding preceded the development of some gadolinium - enhancing lesions . brain parenchymal c - pbr28 binding in ms patients was positively correlated with the duration of the disease , however it was not significantly higher than that of healthy volunteers . interpretation of these results is limited by the lack of characterization of the binding affinity pattern , which might have significantly affected the comparison between subjects . it has been recently demonstrated that there are three different affinity patterns for second generation tspo ligands in healthy volunteers as well as patients with ms , which was evident with all the ligands tested ( c - pbr28 ; c - pbr06 ; f - pbr111 ; owen et al . , 2010 ) . this presents a methodological problem , as differences in pet signal across subjects can not be safely interpreted as differences in target density , but may reflect differences in the affinity pattern . a possible approach to solve this problem is based on the use of peripheral binding affinity , which can be characterized to classify subjects into one of the groups , as differences in affinity status between individuals have been shown to be present on peripheral cells as well ( owen et al . interestingly , the difference in binding patterns observed with second generation radioligands was not observed with c - pk11195 . also , in vitro autoradiography data using c - pk11195 suggest a receptor density ( bmax ) significantly higher than that found using second generation ligands . it could be speculated that c - pk11195 and newer ligands bind to distinct sites within the tspo molecule . although , data obtained from first generation studies have been promising and suggested that c - pk11195 could be useful to image acute inflammatory lesions and microglial activation in ms , a conclusive demonstration of the potential of tspo imaging for the application as disease biomarker , indicative of microglial activation in ms , is still lacking . furthermore , despite second generation ligands constituting a potential improvement relative to c - pk11195 at least from a methodological point of view , a clear advantage in their clinical application as disease biomarkers has not been demonstrated yet . for these reasons , we aim to characterize a second generation tspo pet radioligand in vivo in humans , and to evaluate its application as a disease biomarker in ms . among second generation tspo tracers , f - pbr111 presents different advantages , as there is low difference in its affinity for tspo between high , medium , low affinity binders . also , it could be potentially used in clinical applications as it is labeled with fluorine-18 . promising preclinical data , and ongoing studies in neurological patients , suggest it could be a good choice amongst second generation tspo ligands to progress into studies in ms patients .", "inflammation coupled with the presence of activated microglia seems to be a common feature of a wide range of cns diseases . however , despite a large number of research studies , the exact role of microglia in chronic neurodegenerative diseases remains uncertain . in line with the high plasticity of microglia that allows them to perform numerous cns functions , microglia are likely to play a dichromatic role in disease , depending on signals present in their microenvironment and the duration of activation . while early microglial activation could represents a beneficial response ( i.e. , removal of cns threat , promoting tissue repair and removal of misfolded protein ) , chronic exposure could induces detrimental effects by promoting neuronal death ( i.e. , through the sustained release of neurotoxic factors ) , thus , contributing to progression of disease . pet imaging with the use of tspo radioligands provides a valuable tool that allows us to track the progression and severity of neuroinflammation in the living brain , and is a useful indicator of active cns disease . therefore , the early detection of microglia using pet could offer opportunities for pharmacological interventions to limit the potential disruptive effects of chronic microglial activation . furthermore , with the development of newer tspo tracers , the potential for pet imaging research to promote our understanding of activated microglia in cns disease can only increase .", "the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest ." ]

[ "rheumatoid arthritis ( ra ) is a chronic systemic inflammatory disease affecting predominantly joints , synovial membranes , articular cartilages , and subchondral bones . disease progression is attributed to increases in reactive oxygen species ( ros ) and oxidative stress ( os ) in the lesion sites . proinflammatory cytokines , such as tumor necrosis factor- ( tnf- ) , interleukin-1 ( il-1 ) , and il-6 , regulate the inflammatory and immune responses and play a pivotal role in the disease . overproduction of nitric oxide ( no ) , as a result of induction of inducible nitric oxide synthase ( inos ) due to enhanced production of these cytokines , is associated with persistent inflammation and tissue destruction in experimental arthritis models , including rheumatoid arthritis [ 4 , 5 ] . a number of inflammation stimuli , including tnf- , il-1 , il-6 , or ros , can activate proinflammatory pathways involved in ra pathogenesis , concerning predominantly nuclear factor-b ( nf-b ) , mitogen activated protein kinases ( mapks ) , or janus kinases / signal transducers and activators of transcription ( jak / stat1/3 ) [ 68 ] . this results in translocation of relevant downstream transcription factors from the cytoplasm to the nucleus , where they activate messenger rna ( mrna ) expression of target genes , including il-1 , tnf- , inos , and 12/15-lipoxygenase ( lox ) , leading to overproduction of corresponding proteins . cytokines released into the synovium reach also the systemic circulation and act in other tissues and organs such as lungs , vascular tissue , liver , and heart . several recent investigations reported damage of vital organs with various degrees of impairment , considered to be secondary complications of ra and a major predictor of mortality in ra patients . increasing evidence is pointing to the critical role of the liver in modulating the immune response in autoimmune and chronic inflammatory diseases including ra [ 5 , 11 , 12 ] . the hepatic biochemical and immunological alterations are associated with and influenced by changes in the oxidative state of liver cells . adjuvant - induced arthritis ( aa ) in rats not only is an experimental model of polyarthritis but also induces pathological changes in a variety of other tissues , including the liver and spleen . it is a useful tool to study immunopathologic processes , autoimmune chronic inflammation , and inflammatory cachexia in rodents . in addition , at the molecular level , mrna profiling suggests that this model is also similar to human ra , particularly in tissue gene expression and in the activation of regulatory pathways [ 11 , 14 ] . numerous studies reported natural polyphenols as potential therapeutic agents of diseases caused by os and inflammation [ 1517 ] . n - feruloylserotonin ( n - f-5ht , n - feruloyl-5-hydroxy - tryptamine ) is a conjugated serotonin , a member of the indole hydroxycinnamic acid amides , with serotonin ( 5-ht ) and ferulic acid ( fa ) as representative components of its structure . hydroxycinnamic acid amides of serotonin , synthesized by serotonin n - hydroxycinnamoyltransferase , are present in several vegetables and wild - growing plants whose seeds are used in herbal medicine in eastern countries [ 1820 ] . in cell - based studies , under short - term high - glucose conditions , n - f-5ht exerted an inhibitory effect on overproduction of mitochondrial superoxide by acting as scavenger of superoxide . n - f-5ht attenuated the upregulation of mrna and proteins of ros - dependent adhesion ( vascular cell adhesion protein-1 ( vcam-1 ) ) and migration factors ( monocyte chemoattractant protein-1 ( mcp-1 ) ) , crucial in early atherosclerosis lesions in human aortic endothelial cells , and inhibited the activation of transcription factor nf-b . furthermore , n - f-5ht showed a protective effect on ros - related neuronal damage by decreasing the activity of proapoptotic caspase-3 . n - f-5ht isomers isolated from seeds of leuzea carthamoides were shown to inhibit protein kinase c / ii activation and decrease the oxidative burst of human whole blood and isolated neutrophils in vitro . n - f-5ht was also found to have a protective effect against ldl oxidation and atherogenesis in experimental animals and in human studies [ 2426 ] . methotrexate ( mtx ) , used as a standard drug in our study , represents the most frequently used pharmacotherapy of ra in clinical practice . its administration is , however , limited due to its toxic side effects [ 27 , 28 ] . yet application of a combination therapy of mtx with other potential immunomodulators , synthetic drugs or natural substances [ 3032 ] , might elevate the therapeutic efficacy : decrease the dose of mtx and thus its side effects . in our previous study , we showed that administration of n - f-5ht to mtx - treated arthritic rats lowered the dose of mtx for the required sustained antirheumatic impact . in this study , we focused on the therapeutic impact of n - f-5ht and mtx administered in monotherapy and on details of the inflammatory state in the arthritic rat liver with the aim to elucidate the molecular mechanisms of their effect . one of the possible clarifying approaches is to study the mrna expression of key proinflammatory markers ( il-1 , tnf- , and inos ) in the liver of treated and untreated arthritic rats . further , it is of particular interest to expand our knowledge on the effect of n - f-5ht and mtx in the aa model , which in turn should allow extrapolations of these results to ra patients . to this aim we evaluated also conventional arthritic parameters ( hpv , arthritic score , body weight change , and weight of the liver ) along with changes in plasmatic levels of il-1 and crp and the activity of 12/15-lox in the liver .", "adult male lewis rats weighing 160180 g were obtained from charles river wiga , germany . the experimental protocol was approved by the ethics committee of the institute of experimental pharmacology and toxicology and by the slovak state veterinary and food administration in accordance with the european convention for the protection of vertebrate animals used for experimental and other scientific purposes and was in line with slovak legislation . to induce a rat model of adjuvant arthritis ( aa ) , rats were intradermally injected with a suspension of heat - inactivated mycobacterium butyricum in incomplete freund 's adjuvant ( difco laboratories , detroit , mi , usa ) . the third group comprised adjuvant arthritis rats treated with methotrexate ( methotrexat ebewe sol inj 20 mg/2.0 ml ) in oral dose of 0.4 mg / kg twice a week ( aa - mtx ) . \n the fourth group comprised adjuvant arthritis rats treated with n - feruloylserotonin dissolved in suspension of methylcellulose tween 80 at a dose of 3 mg / kg / day orally ( aa - n - f-5ht ) . drugs were administered orally by gastric gavage from day 0 ( the day of treatment ) to day 28 of the study . blood for plasma preparation was taken by retroorbital puncture on day 14 and by cardiac puncture on day 28 under deep ketamine / xylazine anesthesia . after the animals had been sacrificed under deep ketamine / xylazine anesthesia , tissues for liver and spleen homogenate preparation were taken at the end of the experiment ( day 28 ) . blood in heparinized tubes for plasma preparation was centrifuged at 3000 rpm for 15 minutes at 4c . fraction of four isomers of n - f-5ht ( table 1 ) was isolated from the seeds of leuzea carthamoides ( wild ) dc by solvent extraction . this was then followed by column chromatography on silica gel and hplc separations under conditions previously reported [ 35 , 36 ] . the hind paw volume ( hpv ) was recorded on days 14 , 21 , and 28 with the use of an electronic water plethysmometer ( ugo basile , comerio , varese , italy ) . calculation of the increase in hind paw volume in ml assessed the intensity of the edema . the arthritic score was measured as the total score of hpv ( ml , max . points 5 ) + diameter of scab in the site of mb application , measured in parallel to the spinal column ( mm , max . body weight change ( bwc ; g ) was measured on days 1 , 14 , 21 , and 28 . bwc was calculated as the difference of the body mass measured on days 14 , 21 , and 28 to the body weight measured at the beginning of the experiment ( day 1 ) . for the determination of rat crp concentration in plasma ( g / ml ) , the elisa kit from immunology consultant laboratories , inc . the reaction of secondary biotin - conjugated anti - rat crp antibody was evaluated by streptavidin - hrp . the tetramethylbenzidine reaction with hrp bound to immune complex was measured at 450 nm ( microplate reader , labsystems multiskan rc ) . for the determination of il-1 concentration in plasma , the elisa kit from r&d systems quantikine was used . rat cytokine present in the samples binds to anti - rat cytokine antibodies absorbed in the microwells . the reaction of secondary biotin - conjugated anti - rat cytokine antibody is evaluated by hrp . the tetramethylbenzidine reaction with hrp bound to immune complex was measured at 490 nm in comparison with the reference wavelength of 620 nm ( microplate reader mrx ii ) . concentration of proteins in liver homogenates was determined by using the bradford method and expressed in mg / ml of enzyme preparation ( cytosolic fraction from rat lung and liver tissues ) . linoleic acid ( 99% , sigma - aldrich , usa ) was used as a substrate prepared in solubilized state as described in the concentration of 0.2143 100.7143 10 m. the assay of lox was monitored for 60 seconds as an increase in the absorbance at 234 nm , reflecting the formation of hydroperoxylinoleic acid . for the lox activity assay , an uv / vis spectrometer perkin - elmer lambda 35 ( usa ) was used . the reaction medium contained a 50 mm tris - hcl buffer ( ph 7.0 ) , 2.5 l of the enzyme , and solubilized linoleic acid . total rna was isolated from the rat liver and spleen using rnazol rt ( sigma - aldrich ) and converted into complementary dna ( cdna ) using the primescript rt reagent kit ( takara ) following the protocols of the manufacturers . amplification and detection of cdna of reference and target genes were performed on a 7300 real - time pcr system ( applied biosystems ) using hot firepol evagreen qpcr mix plus ( rox ) ( solis biodyne ) . relative mrna expressions of il-1 , tnf- , and inos were analyzed using the ct value method . the sequences of the primers were designed and checked using primer3 and oligo analyzer 1.0.3 ( table 2 ) . mean and sem values were calculated for each parameter in each group ( 810 animals in each experimental group ) . statistically significant differences among treated , untreated , and control groups were tested using parametric analysis of variance ( anova ) . post hoc tests ( tukey - kramer ( anova ) ) were applied in situations where differences among groups were significant at the level of significance = 0.05 . after post hoc testing , the following significance levels were specified : extremely significant ( p < 0.001 ) , highly significant ( p < 0.01 ) , significant ( p < 0.05 ) , and not significant ( p > 0.05 ) .", "antioxidant properties of polyphenols including n - f-5ht have been reported [ 21 , 40 , 41 ] . nevertheless , the n - f-5ht impact on chronic inflammatory and os - inducing arthritis , which could widen the possibilities of the ra therapy , remains to be elucidated . in our previous study in the model of aa , n - f-5ht in the dosage of 15 mg / kg markedly potentiated the therapeutic effect of low - dose ( nontherapeutic dose ) mtx ( 0.3 mg / kg ) on arthritic ( hind paw volume and arthritic score ) and inflammatory parameters ( il-17 , mcp-1 , and crp ) , yet it resulted in insignificant effect in monotherapy . as data about the optimal n - f-5ht dose in the rat model are scarce , we decided to study two doses of n - f-5ht : ( i ) when 15 mg / kg exceeded the physiologically acceptable concentration , we used 3 mg / kg , and ( ii ) when 15 mg / kg was too low to reach the maximal effect , we used 30 mg / kg . unexpectedly , contrary to the lower dose of n - f-5ht , the higher dose exhibited minor effect on the parameters examined and/or these varied strongly among the animals . for this reason , this report shows only the data evaluating the lower dose of n - f-5ht . in this study , we used the therapeutic dose of mtx ( 0.4 mg / kg ) with the intention to compare each mechanism of action of mtx and n - f-5ht , both evaluated in monotherapy . the significant rise in arthritic parameters , arthritic score , and hpv confirmed the arthritis in our model in rats . the arthritic score showed an increase in the untreated arthritic group compared to the control group on all days monitored ( aa versus co , day 14 , p < 0.01 ; day 21 and day 28 , p < 0.001 ; table 3 ) . at the end of the experiment , the arthritic score was almost doubled in the aa group compared to controls . a trend toward reduction was observed after administration of n - f-5ht to aa animals on day 28 , but the effect was not statistically significant . the treatment with mtx significantly reduced the arthritic score on observation days 21 and 28 , compared to the untreated arthritic group , proving the therapeutic potential of the applied dose of mtx ( aa - mtx versus aa , day 21 , p < 0.05 ; day 28 , p < 0.01 ; table 3 ) . similarly , the change in hpv showed an increase in the untreated arthritic group compared to the control group on days 21 and 28 ( aa versus co , day 21 , p < 0.01 ; day 28 , p < 0.05 ; table 3 ) . the administration of n - f-5ht induced no modification of hpv of the arthritic animals on any day monitored . mtx therapy significantly reduced the observed swelling on days 21 and 28 compared to the untreated arthritic group ( aa - mtx versus aa , day 21 and day 28 , p < 0.001 ; table 3 ) . the muscle wasting condition due to high catabolic activity , known as rheumatoid cachexia , occurring in approximately two - thirds of all patients with ra , is mediated by tnf- and il-1 in ra . papers published over the past years confirmed that oxidative metabolism was considerably enhanced in the liver of adjuvant - induced arthritis in rats [ 4346 ] . rats used in this study revealed signs of cachexia ( table 3 ) . a significant decrease in body weight change ( bwc ) the bwc of the arthritic rats was 56% on day 14 , 19% on day 21 , and 27% on day 28 ( aa versus co , days 14 , 21 , and 28 , p < 0.001 ; table 3 ) of the bwc of healthy controls . n - f-5ht treatment led to a significant increase of bwc on day 28 ( aa - n - f-5ht versus aa , p < 0.05 ; table 3 ) . the administration of n - f-5ht in arthritic animals did not change these parameters on any of the days observed . the liver weights were significantly lower ( aa - mtx versus aa , p < 0.05 ; table 3 ) only in the group of rats treated with mtx . the reduced weight of the liver in mtx - treated rats was assumed to be the result of inhibition of the pathway of de novo dna synthesis by mtx [ 47 , 48 ] . in summary , the statistical significance of 3 mg / kg of n - f-5ht treatment was determined only for bwc . the arthritic score revealed a trend toward the positive effect increasing with time , indicating a late onset of n - f-5ht action ( table 3 ) . as expected , significant differences were found in the arthritic score and hpv in the arthritic animals treated with the therapeutic dose of 0.4 mg / kg mtx compared to those treated with the low dose of 0.3 mg / kg mtx . il-1 , a prototypic proinflammatory cytokine , is a major mediator of the inflammatory cascade in ra , which is involved in the mechanisms leading to progressive joint destruction . in the model of aa , the early phases of the disease seem to be characterized by a systemic increase of il-1 . the plasmatic level of il-1 , a protein of multiorgan origin , was significantly increased in arthritic animals compared to the control group in the early phase of aa , on day 14 ( aa versus co , p < 0.001 ; figure 1(a ) ) , ascertaining the presence of inflammation . administration of mtx did not lead to a significant change of plasmatic il-1 concentration ; only a trend toward reduction was observed on day 14 . it is noteworthy that n - f-5ht treatment resulted in a significant decrease of il-1 level in plasma ( aa - n - f-5ht versus aa , p < 0.05 ; figure 1(a ) ) . this result is interesting , as this molecule was reported to be relevant in driving the transition from the acute phase to the chronic irreversible phase of the disease and it has been suggested that it could be the target of early intervention to stop the course toward the chronic form of the disease . the blocking il-1 protects bone and cartilage from progressive destruction in ra and its inhibition could be effective in the treatment of this disease . activation of t and b cells , macrophages , and inflammatory mediators tnf- , il-1 , and il-6 aggravates the oxidative damage of the vital organs in rheumatoid arthritis , such as the liver . the liver , in turn , influences the systemic inflammation via producing inflammatory cytokines and mediators such as tnf- , il-1 , il-6 , no , crp , and lox . il-6 , il-1 , and tnf- promote the synthesis of crp in hepatocytes via stat3 [ 51 , 52 ] and nf-b pathways . the level of the systemic inflammatory parameter crp in plasma , resulting from liver synthesis , was increased significantly in the group of arthritic animals compared with control animals in the chronic phase of the disease on experimental day 28 ( aa versus co , p < 0.001 ; figure 1(b ) ) . administration of n - f-5ht and mtx significantly reduced the plasmatic levels of crp on day 28 compared to the untreated group of arthritic animals ( aa - n - f-5ht versus aa , p < 0.05 ; aa - mtx versus aa , p < 0.05 ; figure 1(b ) ) . interaction of crp with fc - gamma receptors ( fcr ) fcri and fcriia is known to promote the production of proinflammatory cytokines , resulting in the amplification loop of inflammatory reaction . these processes are initiated through the induction of the receptor activator of nuclear factor-b ligand ( rankl ) protein and direct stimulation of osteoclastogenesis , causing a loop between inflammation and bone destruction in ra . crp enhances both the proinflammatory response and bone destruction . in the treatment of ra , a lowered crp level thus not only is a significant parameter in terms of disease progression elimination but also has a direct impact on decreasing the degree of bone destruction . alterations in the oxidative state lead to the activation of nf-b and nf-b - dependent genes , such as lox . the enzyme 5-lox catalyzes the conversion of arachidonic acid to leukotrienes , whose production has been associated with inflammation in arthritis . suppression of 5-lox expression ameliorates clinical parameters in ra and aa [ 56 , 57 ] . increased levels of nf-b in the lung and liver as well as increased activity of lox in the lung highlight the importance of extra - articular manifestations of aa . in our experiment , liver 12/15 lox activity increased in arthritic animals in comparison to healthy animals ( aa versus co , p < 0.001 ; figure 1(c ) ) . the effect of n - f-5ht on the activity of 12/15-lox in liver homogenate was comparable with that of mtx . after administration of mtx or n - f-5ht , a significant decrease to control levels was assessed in the liver of the aa group ( aa - n - f-5ht versus aa , p < 0.001 ; aa - mtx versus aa , p < 0.001 ; figure 1(c ) ) . thus the anti - inflammatory effect of n - f-5ht in aa was supported by the ability of the molecule to inhibit 12/15-lox activity . similar to this result , recent observations also reported that several other flavonoids may act as lox inhibitors . in aa , the gene expression levels of tnf- and inos produced in the liver were reported to increase [ 60 , 61 ] . also , in our study , the levels of tnf- and inos mrna expressions were significantly increased in arthritic animals ( both p < 0.001 , aa versus co ; figures 2(a ) and 2(b ) ) . it was proposed that these modifications in the liver of arthritic rats not only were a consequence of the metabolic alterations caused by the disease , especially the increased oxidative metabolism , but also depended on increased inflammatory parameters in the liver . the same agents that increase oxidative metabolism , tnf- , il-1 , il-6 , and others , are responsible for increasing the activity of inos in several tissues . an increase of inos activity as a consequence of elevated inos mrna expression was considered to play a dominant role in the pathogenesis of ra . no generation by inos induced in chondrocytes in the initial stage of aa may play a key role in triggering the subsequent events in arthritis . in general , the use of nos inhibitors has been shown to exert beneficial effects in experimentally induced arthritis . however , which types of cells expressing inos are associated with the induction or progression of adjuvant - induced arthritis via no generation remains uncertain . mrna expression of inos in rat liver was reduced following mtx ( aa - mtx versus aa , p < 0.001 ; figure 2(a ) ) and n - f-5ht treatment ( aa - n - f-5ht versus aa , p < 0.01 ; figure 2(a ) ) . the effect of mtx treatment on tnf- protein and mrna expression differs among studies , depending on the conditions of the given study , concerning gender of patients , type of cell line , duration of treatment , mtx dose , and so forth . in our study in the rat aa model , administration of mtx attenuated significantly the mrna expression of tnf- ( aa - mtx versus aa , p < 0.01 ; figure 2(b ) ) . in many patients , however , mtx treatment does not result in lower tnf- plasma concentration . when mtx fails to produce an adequate response , newer therapies are used in combination with mtx . blocking tnf- with anti - tnf- monoclonal antibodies significantly decreased the signs and symptoms of ra compared to placebo in ra patients with active disease receiving mtx [ 65 , 66 ] . thus , the n - f-5ht - driven significant reduction of tnf- mrna expression ( a - n - f-5ht versus aa , p < 0.01 ; figure 2(b ) ) suggests an intriguing effect on ra treatment , calling for deeper investigation . increase of mrna expression was observed for il-1 in the liver of arthritic animals ( aa versus co , p < 0.001 ; figure 3(a ) ) as expected . administration of mtx did not lead to significant attenuation of il-1 transcription in the liver . this is in concert with previous studies of mtx function in different types of cells ( e.g. , human peripheral blood mononuclear cells and murine peritoneal and splenic cells ) [ 67 , 68 ] . on the other hand , mtx exhibits another mechanism of il-1 function inhibition , which involves blocking the binding of il-1 to il-1 receptor in the membrane of peripheral blood cells ( monocytes , lymphocytes , and granulocytes ) . contrary to mtx , treatment with n - f-5ht led to a substantial inhibition of il-1 gene expression ( aa - n - f-5ht versus aa , p < 0.01 ; figure 3(a ) ) . further , we examined il-1 mrna expression in the main immunocompetent organ , in the rat arthritic spleen , which has not been studied previously in terms of the aa model , related to il-1 expression . we observed il-1 mrna expression activation comparable to that in the liver ( aa versus co , p < 0.001 ; figure 3(b ) ) . interestingly , both mtx and n - f-5ht exhibited a significant and remarkably stronger inhibition of il-1 mrna expression in comparison to that in the liver ( aa - mtx versus aa , p < 0.01 ; aa - n - f-5ht versus aa , p < 0.001 ; figure 3(b ) ) . in the spleen of n - f-5ht treated rats , the relative mrna expression decreased even to control level . besides other events , mtx treatment leads to suppression of nf-b , a heterodimer consisting of two subunits p65 and p50 , one of the most prominent inflammatory transcription factors activated in ra . this was confirmed in our previous work , along with the finding that also n - f-5ht ( 15 mg / kg ) suppressed the activation of nf-b ( p65 ) in the arthritic rat liver [ 21 , 33 ] . interestingly , combination therapy ( mtx + n - f-5ht ) potentiated the effect of a single drug , suggesting different mechanisms leading to nf-b inhibition . mtx driven reduction of cytokine transcription was attributed to abrogation of ib kinase activation and thereby suppression of ib ( nf-b inhibitor ) phosphorylation and degradation , resulting in retaining the inactive nf-b form in cytoplasm . however , the contribution of n - f-5ht to nf-b pathway suppression needs to be further investigated . studies of the proposed pathways involved in the transcription of tnf- , il-1 , and inos in ra could help evaluate the mechanism of action of these drugs [ 68 , 71 , 72 ] . the gene expression of inos is mostly under the control of synergistically activating nf-b ( il-1 and tnf- stimulated ) and stat1 ( ifn- stimulated ) key proinflammatory signals in the liver . in contrast to inos , tnf- does not contain the stat binding element in its promoter region . the inhibition of tnf- and inos transcription observed in our study might be mostly attributed to the suppressed nf-b pathway for both mtx and n - f-5ht [ 33 , 64 , 70 ] . however , the contribution of ap-1 to tnf- and stat1 for inos can not be excluded . mtx - dependent suppression of nf-b was reported [ 33 , 70 , 73 , 74 ] , but in other cases mtx was not found to be effective in the attenuation of arthritic - increased mrna expression of il-1 [ 68 , 75 ] . taking into account our results , where mtx treatment did not lead to inhibition of il-1 mrna expression in the arthritic liver in contrast to the significant n - f-5ht impact , yet treatment of both mtx and n - f-5ht decreased the presumably nf-b - dependent lox activity and inos and tnf- transcription to a similar extent , the involvement of n - f-5ht in another pathway for transcription regulation of this cytokine in the arthritic liver should be considered . after analysis of the reported pathways involved in the regulation of il-1 mrna expression , we hypothesized that tnf--driven ap-1 transcription factor activation or jak / stat3 pathway activated via il-6 or ifn- might play a role ( [ 7 , 8 , 71 , 72 , 76 , 77 ] , figure s1 in supplementary material available online at http://dx.doi.org/10.1155/2016/7509653 ) . papers reporting involvement of other polyphenols in anti - inflammatory regulation , for example , resveratrol , claim that these compounds exhibit their anti - inflammatory effect through suppression of nf-b and jak / stat signaling pathways [ 78 , 79 ] . the enhanced influence of mtx and n - f-5ht on il-1 transcription in the spleen in comparison to the liver may be the consequence of different predominance of inflammatory pathways in this organ , presumably with a stronger nf-b contribution . details about the relevance of these pathways and the role of n - f-5ht in the transcription regulation of il-1 , inos , and tnf- in the liver and other organs in ra are to be further elucidated .", "the present study contributed additional evidence about the beneficial effect and mechanism of action of n - f-5ht and of mtx on a systemic inflammatory process in the liver and its association with the pathogenesis of adjuvant arthritis . n - f-5ht treatment led to amelioration of inflammatory parameters tested ( plasmatic crp and il-1 protein levels , liver lox activity , and liver and spleen cytokine expression ) . however , this did not result in a significant change of hpv , although a trend of improvement of the arthritic score was observed after 28 days . a synergistic effect of tnf- and il-1 was shown to influence the balance between protein degradation and protein synthesis causing among others an increase in resting energy expenditure and net efflux of amino acids from muscle to liver . the significant increase of bwc in n - f-5ht treated rats , probably sign of the partial improvement of rheumatoid cachexia , might be the result of lowered mrna expression of tnf- and il-1 determined in the arthritic liver . moreover , taking into account the reported association of weight loss with the il-1 production by splenic cells , the n - f-5ht mediated attenuation of increased il-1 mrna expression in the arthritic spleen might contribute to this complex process . the contribution of the affected expression of tnf- and il-1 originating from other organs can not be excluded and is to be further elucidated . unexpectedly , chronic daily treatment with a high concentration of n - f-5ht ( 30 mg / kg ) exhibited either a minor effect on the parameters examined and/or a strong variation among the animals ( not shown ) and that in contrast to a much lower concentration ( 3 mg / kg ) . since n - f-5ht possesses a serotonin ( 5-hydroxytryptamine , 5-ht ) moiety , the question if there might be some interplay between effects of these two molecules on ra pathogenesis is to be raised . since n - f-5ht inhibited the increase of cytosolic free ca concentration in rat vascular smooth muscle cells induced by serotonin mediated by 5-ht2 receptors , it was hypothesized that at a sufficient concentration n - f-5ht may act as a competitive antagonist , which displaces serotonin from its binding site . intake of a high concentration of a 5-ht2 receptor antagonist may lead to a variety of effects : it may influence the receptor density , even enhance the effect of serotonin , or lead to desensitization and with time to receptor resistance ( through inhibitory feedback due to binding - induced enhanced production of serotonin ) . interestingly , serotonin is known not only as a neurotransmitter . increasing but contradictory reports associate serotonin with immunoinflammatory pathways in the periphery . serotonin , via its 5-ht2a , 5-ht2b , and 5-ht3 receptors , has been implicated to have both proinflammatory and anti - inflammatory roles in a number of studies of rheumatoid arthritis [ 8488 ] . the reported effects of 5-ht receptor antagonist on macrophage - like synovial cells encourage the interest to study the effect of n - f-5ht from this point of view . to confirm this hypothesis , a precise characterization of interaction between n - f-5ht and 5-ht receptors is to be done . on comparing the effects of the two drugs , administration of mtx ( 0.4 mg / kg ) or n - f-5ht ( 3 mg / kg ) was found to lead to a decrease of the main plasma marker of systemic inflammation crp , the liver origin protein , and to inhibition of proinflammatory lox in the liver . the impact of mtx and n - f-5ht on mrna expression of tnf- , il-1 , and inos in the liver and on the level of crp in plasma was mentioned at the conference . mtx and n - f-5ht reduced the arthritis - increased transcription of tnf- and inos in the liver to a comparable extent . we suppose that the inhibition of tnf- and inos transcription might be mostly attributed to the suppressed nf-b pathway for the two drugs [ 21 , 33 , 70 ] . as previously reported [ 67 , 68 ] and also proven by our study , mtx was not able to diminish the arthritic - induced il-1 mrna transcription in the liver . this handicap might be compensated by coadministration of n - f-5ht , since this drug was shown to lower the level of proinflammatory cytokine il-1 in plasma in the acute phase of aa and to attenuate significantly the elevation of il-1 mrna expression in the arthritic rat liver and spleen in the chronic phase . detailed studies are required to confirm the hypothesis that n - f-5ht might function through potentially different mechanisms of inhibition of the inflammatory pathway nf-b and not through mtx , as well as the possibility of an additional pathway influencing il-1 transcription under control of n - f-5ht but not mtx . the confirmation would support n - f-5ht as a promising agent for the treatment of ra in combination therapy with mtx . the positive effect was shown in our previous study , where n - f-5ht markedly potentiated the therapeutic effect of low - dose mtx . as the therapeutic dose of mtx was used in this study and the purpose of combination study is to lower the mtx dose to decrease the side effects of this drug , the effect of combination therapy was not included . oral daily intake of n - f-5ht could overcome the inconvenient administration and high costs of biological therapy using il-1 monoclonal antibody , which was shown in clinical trials to be superior to placebo in combination with mtx in reducing signs , symptoms , and radiographic progression in patients with advanced ra [ 91 , 92 ] . future studies of n - f-5ht mechanisms of action should shed more light on the immunomodulatory function of this natural polyphenol . it is to be expected that n - f-5ht is able to positively affect the activity of other markers of inflammation and oxidative stress not only in the liver and spleen but also in other organs ( lung , brain , etc . ) , a hypothesis to be tested by future work . however , to establish the optimal dosing in light of the effects achieved is of primary importance ." ]

[ "although studies on the effects of children s use of computers are still undetermined , some initial studies showed positive and negative effects in this regard . children commonly use computers for playing games , completing school assignments , sending / receiving e - mails , and connecting to the internet . this may sometimes interfere with other activities such as homework or normal social interchange ( 1 ) . studies showed that internet addiction positively correlated with depression , novelty seeking , harm avoidance , and reward dependence . on the other hand , internet addiction negatively correlated with persistence , self - directness , cooperativeness , and self - transcendence . in several studies it was demonstrated that significant factors affecting internet addiction were depression , gender , novelty seeking , and self - transcendence ( 2 , 3 ) . computer game addiction is excessive or compulsive use of the internet , computer , and video games that may interfere with daily life . it is not clear whether internet and video game playing meets the diagnostic criteria of diagnostic and statistical manual of mental disorders , 4 edition ( dsm - iv ) ( 4 ) . previous studies about internet addiction have investigated several associated psychological variables such as shyness , loneliness , self - consciousness , anxiety , depression , and interpersonal relations ( 5 ) . some studies revealed a significant association between internet addiction and depressive symptoms in adolescents and high school students . many investigations suggest the necessity of the evaluation of the potential underlying depression in the treatment of internet - addicted adolescents ( 6 ) . moreover , the level of internet addiction correlated positively with the level of depression and suicidal ideation among high school students . based upon several studies , there were significant positive correlations among internet addiction , depression , and suicidal ideation in adolescents ( 7 ) . kim et al . showed that the levels of depression and suicide ideation were highest in the internet - addicts group than other students . they advised future studies to investigate the direct relationship between psychological health problems and internet dependency ( 8) . in this study we tried to investigate the prevalence of internet , computer games , and dvd and video addiction among high school students in southern iran , shiraz , and its relation to depression and anxiety", "during the years 2008 and 2009 and in a cross - sectional study 1020 high school students ( males and females ) were selected randomly by area and cluster sampling from different areas of shiraz in southern iran . an informed consent was received from each participant and they were assured of the confidentiality of the data . the students were given a full explanation of the reasons for the implementation of the study and were informed that their responses would be confidential . they were asked to express their personal comments and recommendations at the end of the interview . special attention was paid to ensure that the students clearly understand the instructions of the interview . in addition , they were asked not to say their name or student number in order to encourage them to provide more open and honest answers . demographic data ( age , sex , and economic status according to income of the family ) , duration of internet usage , computer games playing , tv and satellite watching , dvd and video cd usage , and the reasons of the usages were asked at the interviews . the students were interviewed for addiction , generalized anxiety disorder , and major depressive disorder according to the dsm - iv criteria . \n mild depression : decreased mood , presence of anxiety symptoms , and increased symptoms in the afternoon , without suicidal idea . \n moderate depression : decreased activity , depressed mood , agitation , decreased energy , and decreased concentration , sense of guilt , hypochondriacs , sleep disturbance , depersonalization symptoms , decreased appetite , and decreased sexual activities . \n dependent : dysfunctional , and withdrawal symptoms ( restlessness , anxiety , decreased concentration , insomnia , irritability , fatigue , and craving ) after discontinuing . \n the obtained data were analyzed using descriptive indices and the analytic methods of the chi - squared and pearson regression . the data were analyzed with statistical package for social sciences ( spss ) for windows15.0 ( chicago , il .", "277 students ( 27.2% ) were in the first year of high school , 242 ( 23.7% ) were students of the second year , and 501 ( 49.1% ) were in the third year of high school . 140 students ( 13.7% ) had low economic status ( defined as family monthly income of less than 3000000 rials income ) , 807 ( 79.1% ) had moderate economic status ( 3000000 - 1000000 rials income per month ) , and 62 ( 6.1% ) had high economic status ( more than 10,000,000 rials income per month ) . \n table 1 shows the prevalence of depression and anxiety among students according to sex , economic state , and internet , computer , or dvd usage , and history of medical disease . 13 students ( 1.3% ) were computer games abusers , and 634 students ( 85% ) reported playing computer games for amusement . 215 ( 21.1% ) of student did not use dvd or video cd . 1 student ( 0.1% ) was dvd or video cd abuser , and 576 students ( 77.7% ) reported using dvd or video cd for amusement . 22 ( 2.2% ) students did not watch tv or satellite , 4 students were abusers , and 190 ( 18.6% ) students were dependent to tv or satellite . 455 ( 53.6% ) students reported watching tv or satellite for film and football , and 306 ( 36.2% ) for amusement . 94 students ( 9.2% ) had medical problems , and 71 ( 7% ) used some medications regularly . prevalence of anxiety and depression were significantly higher in females ( p < 0.05 ) . the prevalence of anxiety and depression was significantly lower in students of the third year compared to other grades ( p < 0.05 ) . the prevalence of anxiety was significantly higher in students with lower family monthly income status ( p < 0.05 ) . the prevalence of depression was significantly higher in students with lower economic status ( p < 0.05 ) . the prevalence of depression was significantly higher in students who were internet abusers or dependents ( p < 0.05 ) , but we did not detect a significant relation between anxiety and internet usage . the prevalence of anxiety was significantly higher in the students who used the internet for chatting , amusement ( such as downloading music , films , and pictures ) , and reading the news compared to the students who used the internet for other reasons ( p < 0.05 ) . there was no significant correlation between depression and reason of internet use among the students . the prevalence of anxiety and depression were significantly higher in students who were computer games abusers or dependents ( p < 0.05 ) . the prevalence of anxiety and depression did not show a relationship with the reason of playing computer games . the prevalence of anxiety was significantly higher in students who were dvd or video cd dependents(p < 0.05 ) . the prevalence of depression did not relate to the level of dvd or video cd use . students who used dvd or video cd for resting had higher levels of anxiety and depression ( p < 0.05 ) . the prevalence of depression and anxiety did not relate to the usage of tv or satellite ( p < 0.05 ) . students who watched tv or satellite for film , football , and music had lower levels of anxiety ( p < 0.05 ) . students who watched tv or satellite for film and football had lower levels of depression ( p < 0.05 ) . the students who used some medications regularly or had medical problems had higher rates of depression and anxiety ( p < 0.05 ) .", "the problem of excessive computer and internet usage is increasing more rapidly and it can occur together with other kinds of addiction . the causes of internet addiction do not have only habitual bases , but also demographic and socioeconomic aspects . the behaviors related to internet addiction may be a symptom of depressive disorders in adolescents ( 9 - 11 ) . prevalence of depression and anxiety among students according to sex , economic state , and internet , computer , or dvd usage , and history of medical disease batthyany et al . reported excessive computer playing and internet usage corresponding to addictive behaviors were found in 12.3% of the adolescents in austria ( 12 ) . . showed the rate of internet addiction in the high school students to be about 7% which was more prevalent among males ( 13 ) . hur in study on korean adolescents reported significant correlations among internet addiction , depression , and suicidal ideation ( 14 ) . ha et al . found that almost one third of subjects in their study diagnosed as internet addicts had a significant level of depressive symptoms that required psychiatric intervention ( 15 ) . these users use the internet to such an extent that it interferes with their academic studies and they are very much preoccupied with it . it is still very much a matter of debate whether internet addiction is a distinct disorder or a behavioral problem secondary to another disorder . suggested that internet communication with people can alleviate depression , at least among socially isolated and moderately depressed populations such as college students ( 11 ) . they added that the behaviors related to internet addiction may be a symptom of depressive disorders in adolescents . educationists and parents should try to understand the root causes of any isolation in the youth . it is alarming that excessive internet users are more likely to report having felt sad or depressed most of the days in the past year . they opined that the possible co - morbidity of major depressive disorder among internet - dependent adolescents could be explained by the internalizing tendency of the adolescents . internalized depressive adolescents can escape from the reality or problems of the real world by losing themselves in the cyber world . purposeful activities on the internet , which are focused , for example on academics - related research or discussing a project online , can be completed in relatively shorter periods of time through good planning . however , use of the internet for entertainment may not have a time limit and some activities like multi - player games can be highly compulsive . parental rules in such situations can set the limit , and thereby reduce excessive use and limit negative outcomes . the rate of internet , computer games , and dvd addiction in our study were significantly lower than reports from other parts of the world . the prevalence of anxiety was significantly higher in students who did not use the internet . these abnormal results may be due to lower economic states among the students who did not use the internet . the prevalence of anxiety was significantly higher in the students who used internet for chat , amusement , and news . similar to other studies , the prevalence of anxiety and depression was significantly higher in students who were computer game abusers or dependents , although it did not have any relation with the reason of playing of the computer games . for example , ha et al . reported that one third of subjects in their study diagnosed as internet addicts had a significant level of depressive symptoms that required psychiatric intervention ( 15 ) .", "while internet addiction is a new phenomenon , it has already become a subject of numerous studies . on the other hand , it is a very complicated problem and it is difficult to state whether it is more accurate to treat the problem totally as an addiction or not ( 15 - 17 ) . in summary , it can be concluded that the results presented in this study are for the most part in accordance with those of other authors and other studies on this subject . some differences could be the result of different conditions , instruments , and differences in the number and structure of the studied group .", "ja conceived and designed the evaluation and helped to draft the manuscript and its revision and re - evaluated the clinical data . aa participated in the evaluation and collection of the clinical data , and helped to draft the manuscript . agh participated in conceiving and designing the evaluation and helped to draft the manuscript and re - evaluated the clinical data . mkh , zkh , and zgh participated in the evaluation and collected the clinical data .", "\n declaration of interest : none . \n citation : ahmadi j , amiri a , ghanizadeh a , khademalhosseini m , khademalhosseini z , gholami z , et al . prevalence of addiction to the internet , computer games , dvd and video and its relationship to anxiety and depression in a sample of iranian high school students ." ]

[ ", it must develop tolerance to paternal antigens to avoid a lethal immunologic attack against the fetus . on the other hand , it must preserve the ability to fight infections from a multitude of commensal and environmental pathogens . disruption of this balance can have devastating consequences , including preterm labor and death of the fetus and/or mother . the normal maternal immune response to pregnancy is increasingly recognized as a dynamic process , with changes in the maternal pro / anti - inflammatory profile occurring at different stages of gestation [ 13 ] . despite this recognition , a complete , longitudinal immunologic profile of normal such analyses are critical for understanding the response to specific infectious and immunologic diseases that show disproportionately negative outcomes during pregnancy , such as influenza and ulcerative colitis . one approach to such immune profiling is through the use of multiplex cytokine arrays , allowing for simultaneous quantification of many proteins with a very small amount of plasma or serum . others have used multiplex arrays to study the maternal cytokine milieu , but the studies have been predominantly limited time point cross - sectional [ 68 ] or case - control [ 911 ] in design . the results of some longitudinal studies have been published in recent years , although results have been based on relatively few time points ( 5 or fewer ) [ 13 ] . in this study , we applied the multiplex array approach to evaluate the changes in 42 cytokines in rich detail during pregnancy . the samples are from a cohort of 16 pregnant women , with each subject sampled a median of 18 times . because this represents a significant increase in the number of tests per subject compared to previous studies , we also describe a strategy addressing within - subject correlation with repeated measurements using unconditional growth modeling . with this approach , we have been able to detail the typical longitudinal variation of serum cytokines throughout pregnancy in this cohort of women .", "each participant had a serum sample collected and cryopreserved biweekly from study enrollment during the first trimester ( average of 9.7 weeks ' gestation for first samples ) until 34 weeks ' gestation , then weekly from 34 weeks until delivery . as a result of this repeated sampling , a median of 18 samples per participant were obtained longitudinally throughout pregnancy . samples were collected under a protocol approved by the mayo clinic institutional review board ( irb ) that accrued participants from 1987 to 1988 . information regarding date of the blood draw , date of delivery , outcome of the delivery , and any major complications that the woman experienced during pregnancy ( hypertensive disorders , preterm labor , and infections ) was available and helped identify appropriate participants to include . only women who carried their pregnancies to term and experienced no pregnancy complications were included in this study . we only used samples from subjects who had specimens obtained throughout the entire course of pregnancy and whose complete , longitudinally collected specimens appeared intact and nondesiccated . most cytokines are stable in storage at 80 degrees c for up to 2 years , but stability beyond that time is not well known . therefore , before proceeding with studies on the samples of interest , we first tested protein levels of a small number of individually stored serum aliquots from other subjects archived on this protocol . since we found detectable levels of cytokines in the pregnant serum samples that were within range of control samples , we proceeded with the entire study involving a cohort of 16 healthy , primigravid women who completed a term pregnancy without any significant complications . samples were assayed when freshly thawed to avoid freeze - thaw cycles , which are known to degrade cytokines . contemporary plasma samples from 11 nonpregnant control subjects were collected under a separate irb - approved protocol for collection of biospecimens from healthy individuals within the same health system in 2010 and similarly assessed on the same 96-well plates for comparison and as a quality control measure . for contemporary nonpregnant control samples , peripheral venous blood was drawn into heparinized vacutainer tubes that were processed and separated into plasma and peripheral blood mononuclear cells ( pbmcs ) following gradient centrifugation using ficoll - paque ( ge healthcare , uppsala , sweden ) . plasma was collected and immediately frozen at 80c in 1 ml aliquots until use . protein levels for 42 cytokines , chemokines , and growth factors ( table 1 ) were measured using the milliplex map human cytokine / chemokine kit ( millipore , billerica , ma , usa ) per manufacturer 's instructions . to minimize the potential for interassay variability , each subject had all of their longitudinal specimens analyzed on the same plate . protein concentrations were determined using a linear regression standard curve from each plate generated using the high pmt concentrations with sensitivity from 3.2 to 2,000 pg / ml . all samples were tested in duplicate with the mean value of the measurements used for statistical analyses . comparison of baseline ( first trimester ) and end of pregnancy levels of cytokines / growth factors was carried out between the 16 primigravid subjects and the 11 nonpregnant control subjects using the kruskal - wallis tests . there were extremes of values that fell outside of the limits of the multiplex array . for cytokines below the limit of detection ( ld ) , we assigned a value that was half the lowest detectable value for the assay as previously described . analytes above the detectable range were assigned a threshold concentration . to obtain a visual representation of overall patterns in the highly dimensional raw data as an additional multivariate technique to identify patterns within the data , principle components analysis ( pca ) was also completed on the raw values obtained from the multiplex array . to assess the within - subject correlation , we determined change of cytokines and growth factors from a baseline time point the values obtained from the participants ' first blood draw in the first trimester by taking the log of 1 plus fold change from the baseline value : log(1 + x ) , where x = ( cytokine concentration of the sample of interest / cytokine concentration of the baseline sample ) to analyze trends over time . first , we graphically assessed the growth trajectory for the 42 cytokines using smoothing splines . we then fit unconditional mean models ( umm ) for the 42 cytokines in order to estimate the variance components : the within - subject variance ( ) and the between - subject variance ( 0 ) . estimating the two variance components helps to determine whether there is sufficient variation to warrant further analysis and enabled computations of the intraclass correlation coefficient , , which describes the proportion of the total outcome variation that lies between subjects . next , we fit unconditional growth models ( ugm ) , which allowed random slope but not random intercept because the starting value of all patients was the same ( baseline value = 0.3 ) due to normalization to each individual 's baseline value . as both gestational age in weeks and trimester can be used as the time covariate for growth curve models , and as the trimester can be treated as either a continuous or a categorical variable ( depending on whether we assume linear relationship between trimester and outcome variables ) , six different models were fitted for each cytokines as follows : ( 1 ) model with only the gestational age in weeks as the time covariate , ( 2 ) model with only the trimester ( continuous ) as the time covariate , ( 3 ) model with only the trimester ( categorical ) as the time covariate , where the variance - covariance pattern was assumed to be autoregressive , ( 4 ) model with both gestational age in weeks and continuous trimester as covariates , allowing random slope for gestational time in weeks , ( 5 ) model with both gestational age in weeks and continuous trimester as a covariate , allowing random slope for trimester , and ( 6 ) model with both gestational age in weeks and continuous trimester as a covariate , allowing random slopes for both gestational age in weeks and trimester . we then compared the six models and the unconditional mean model for each of the cytokines based on logic and statistical fitness , using akaike information criteria ( aic ) . because of the exploratory nature of this study , there was no correction for multiple comparisons .", "the multiplex was designed to assess 42 factors , but the limits of detection were exceeded with three factors , and there were 5 cytokines that fell below the limit of detection in > 50% of the samples . pdgf - aa , pdgf - ab / bb , and rantes had cytokine levels above detection limits of the assay in 9.9% , 11.2% , and 34.9% of the samples , respectively ( table s1 ; see supplementary material available online at http://dx.doi.org/10.1155/2015/952571 ) . il-2 , il-3 , il-4 , il-13 , and tnf had > 50% of the samples below the detection limit ( table s1 ) . differences in cytokine profiles between baseline ( first trimester ) pregnancy samples and nonpregnant control samples could be identified by pca ( figure 1 ) . specifically , we identified significantly higher levels of gro , tgf , egf , pdgf - aa , and pdgf - ab / bb and significantly lower levels of scd40l , ip-10 , il-6 , il-17 , il-13 , and mcp-1 in the baseline pregnancy samples ( table 1 ) . when all longitudinal samples were included in a pca , no difference next , we evaluated whether those differences apparent in early gestation were also present at the end of pregnancy . when comparing the final independent samples obtained at the end of pregnancy to the healthy control samples , the following remained significantly elevated in pregnant women : egf ( 330.6 versus 24.8 pg / ml , p = 0.0013 ) , gro ( 1,153.6 versus 341.6 pg / ml , p < 0.001 ) , sil-2ra ( 17.9 pg / ml versus lld , p = 0.02 ) , and tgf ( 15.8 versus 1.8 pg / ml , p = 0.0006 ) meanwhile , only eotaxin was lower in women at the end of pregnancy compared to normal controls ( 33.4 versus 330.0 pg / ml , p < 0.001 ) . to begin to assess within - subject variation , we clustered the raw data ( figure 2 ) , where the issue of correlation within subjects becomes visually apparent . empirical growth plots demonstrated that the within - subject variation differs among different women ( figures 3 and 4 show a representative example using il-15 , and the remainder of the plots can be viewed in supplementary figures ) . for example , patient o displays very large variation in the majority of the cytokines tested , whereas patients b , c , f , and g have comparatively steady levels for most cytokines . also , high variability in one cytokine does not imply high variability in other cytokines for the individual women . high interclass correlation ( 0.7 ) was observed for scd40l , rantes , il-10 , tnf , il-7 , and gm - csf ( table s2 ) . this means that the majority of the variability in these cytokines is attributed to variance between subjects . the interclass correlations were comparatively low ( < 0.3 ) for il-3 , il-4 , mcp-3 , and ip-10 , suggesting more variation within subjects for these cytokines . the final model for mdc ( table 2 ) was ugm with gw , with a decreasing trajectory . the estimated variance for the random slope is 0.000001632 , suggesting that the variability of slope among patients is quite small . on the other hand , the average scatter of an individual 's outcome around her own trajectory is larger ( the estimated variance is 0.000937 , p < 0.0001 ) , suggesting that there might be some other important covariates that are not included in the model . however , including gestational age in weeks as a covariate does substantially improve the fit of the model . when comparing the estimated within - subject variance of the ugm with that from the umm , we found that the linear gestational age in weeks helps to explain 34% of the within - subject variation in mdc . the estimated fixed effect suggests that mdc decreases over time ( the estimated slope is 0.00163 , with p 0.0001 , suggesting that the slope is significantly lesser than 0 , figure s2 ) . eight other cytokines demonstrated statistical significance , although with increasing trajectories , with ugm and gw as a covariate : il-1 , il-6 , il-8 , il-12p70 , il-13 , il-15 , ip-10 , and flt3-ligand ( table 2 ) . six cytokines showed association with trimester as a linear variable : il-1ra , il-3 , il-9 , il-12p40 , ifn2 , and scd40l ( table 3 ) . il-1ra showed the greatest percent explanation by inclusion of linear trimester in the model . when comparing the estimated within - subject variance of the umm with that from the ugm , we found that the linear trimester helps to explain 27% of the within - subject variation in il-1ra . seven other cytokines showed significant associations with trimester as a categorical variable : il-4 , ifn , g - csf , tgf- , tnf- , sil-2ra , and mip-1 ( table 4 ) . the final model for both egf and vegf was umm with intercept only , leading to the conclusion that both egf and vegf do not change over time . time - dependent ugm models were identified but did not meet statistical significance for the following cytokines : il-2 , il-5 , pdgf - aa , pdgf - ab , mip-1 , gro , mcp-1 , mcp-3 , rantes , il-17 , il-7 , eotaxin , fgf-2 , il-10 , tnf , il-1ra2 , fracktalkine , and gm - csf . therefore , approximately 50% of cytokines measured by multiplex array did not show any association with gestational week or trimester .", "our results suggest that the third trimester of pregnancy is characterized by an increasingly inflammatory ( e.g. , il-1 , il-6 , il-12 , il-15 , ip-10 , and scd40 ligand ) as well as counterregulatory ( e.g. , il-1ra and flt3-ligand ) milieu compared to earlier stages of pregnancy . our superimposed growth curves of il-15 ( figure 4 ) and il-1 ( figure s3 ) , the cytokines with the strongest association with gestational week as a linear covariate , suggest that this change begins at approximately week 20 and peaks just after week 30 . this is consistent with other reports of systemic immune activation as well as counterregulation in the latter part of pregnancy [ 3 , 1719 ] . increasing il-1 and il-15 may predominantly be related to production from placental tissues [ 20 , 21 ] or mononuclear phagocytes [ 22 , 23 ] in late gestation . the precise immunologic mechanisms responsible for this shift can not be determined by our study , but if the source of these cytokines is predominantly the innate immune system , one potential stimulus to these cytokines ' secretion is cell - free fetal dna . a recently proposed model links rising circulating levels of fetal dna to maternal innate immune activation via toll - like receptor- ( tlr- ) 9 on neutrophils and macrophages , leading to increasing inflammatory cytokine release , that may result in an immune cascade ultimately leading to parturition . a novel finding of this study is the decline in mdc levels throughout pregnancy ( figure 5 ) . mdc is chemoattractant for immature dendritic cells and type 2-biased t cells , and it is possible that decreasing mdc levels may reflect a gradual shift away from a self - amplifying type 2 immune response as pregnancy progresses . il-9 is cytokine that has been recognized for decades but only recently had its cell of origin identified : the innate lymphoid cell ( ilc ) . the role of il-9 , which has historically been categorized as a th2 cytokine prior to the recognition of ilc , is currently unknown in normal pregnancy . because only serum was available for analysis , we can not confirm the cellular source of the changes observed with this cohort . nonetheless , increasing transcription levels of several innate immune components , including cd14 , multiple tlr genes , and il-1b , have been observed in peripheral blood leukocytes of women in the third trimester , suggesting that the changes in concentrations of the cytokines identified in our study could plausibly be due to changes in peripheral blood cellular composition . further studies will be necessary to determine whether placental tissues , circulating leukocytes , stromal cells , or other sources also contribute to the changes reflected in our results . although these results show statistical significance , it is also noteworthy that the slopes of the variance were all fairly small for each of the analytes and that gestational week did not explain any more than 40% of the variation observed in any of the cytokines . pregnancy clearly alters the maternal immune milieu , but the changes from baseline in the setting of normal pregnancy are subtle and more variable in some women than in others . what clinical factors contribute to this variation observed between women in the setting of a normal first pregnancy is not entirely known . blood draws and resulting data were relatively sparse in the first trimester due to women not returning as frequently for study blood draws , even though they were scheduled per protocol , relative to the second and third trimesters . it is also important to note that many analytes were not detectable in samples ; therefore , it is possible that a different method besides multiplex array on serum or plasma , for example , elisa for individual cytokines / growth factors , may be more sensitive to detect change over time . previous longitudinal studies of maternal cytokines during pregnancy have shown some concordance with our results . investigated the change of maternal plasma cytokines from early to midgestation in a large cohort ( approximately 1,000 patients ) and found that il-12 and ifn levels increased , while il-2 and gm - csf levels decreased as pregnancy progressed . our results confirmed increasing il-12 levels , as well as an increase of ifn in the third trimester compared to the first . however , kraus et al . published maternal multiplex elisa results from 50 women tested at each trimester as well as postpartum and showed that ifn levels decreased throughout gestation . denney et al . also found that basal levels of ifn decreased throughout gestation , as did levels of tnf , il-1 , and il-6 in serum samples of 45 healthy pregnant women collected during each trimester . another recent study demonstrated decreasing il-1 levels throughout gestation . while our study did not confirm any time - dependent change of tnf , we instead observed increases in il-1 and il-6 throughout pregnancy , in contrast to these studies . clearly , individual heterogeneity exists , and our smaller sample size may account for some of these differences with prior studies . although not the original focus of this study , we also identified several differences in cytokine / growth factor milieu when comparing pregnant women to healthy controls . notably , the first trimester of pregnancy was characterized by an increase in several growth factors ( gro , egf , tgf , and pdgf ) and a relative decrease in inflammatory markers ( scd40l , il-6 , il-17 , ip-10 , eotaxin , and mcp-1 ) . eotaxin , a potent chemoattractant for eosinophils during allergic reactions , has been similarly described to be suppressed during pregnancy by kraus et al . . overall , the tolerance induction required for successful pregnancy at the level of the fetomaternal interface may also be observed in a relatively tolerogenic , growth factor - rich maternal systemic environment . the difference in sample source when comparing the archived samples from healthy pregnant women ( serum ) and normal controls ( plasma ) may contribute to these findings . for example , eotaxin , pdgf , egf , vegf , and soluble cd40 ligand have previously been shown to be significantly different in serum postclotting as compared to plasma samples . because of this potential source of variation in comparing our historical to contemporary samples , our results will require validation with similarly processed samples of the same source . however , egf levels have been reported to be approximately 65 pg / ml in serum of healthy individuals , well below our median 489.4 pg / ml in our samples obtained from pregnant subjects , suggesting that our results may hold true despite differences in sample source . similarly , serum levels of cd40l have been shown to be 830-fold higher in serum as compared to plasma , suggesting again that the very low levels identified in the serum of our cohort of pregnant women may indeed be reflective of the pregnancy state . our study is unique in that the longitudinal samples were obtained frequently throughout the course of pregnancy . because of this , our study has the potential to more richly describe individual maternal immune variation over time . however , our study is limited by the relatively small sample size , the lack of pre- or postpartum samples , and potentially the age of the specimens . to address these limitations , we have recently conducted a larger longitudinal study of maternal immune changes during pregnancy , with peripheral blood samples obtained monthly throughout gestation as well as 6 weeks postpartum . tolerance at the fetomaternal interface is complex and technically challenging to study in humans longitudinally . as a result , many recent studies have sought to understand how pregnancy changes maternal systemic immunity . the possibility exists of maternal peripheral blood not completely or accurately reflecting the local changes within decidual tissues . an example of such a discrepancy in our study is that of ip-10 , which was low in first - trimester pregnancy compared to healthy controls in this cohort . ip-10 is secreted by decidual natural killer cells and is key to trophoblast migration and thus has previously been shown to be elevated during pregnancy [ 31 , 32 ] . on the other hand , the decidual t cell compartment at parturition has recently been shown to closely reflect that of peripheral blood , suggesting that for some components of the immune system the maternal peripheral blood is reasonable to study . furthermore , sampling maternal peripheral blood is much more feasible to perform longitudinally as compared to more invasive means and may still lend insight into the maternal adaptation to pregnancy .", "successful pregnancy has previously been described as predominantly a type 2 immune response - biased phenomenon [ 3436 ] . in light of the collective evidence , it seems that the description of pregnancy in terms of type 2 immune responses may be oversimplified , both in the overall description of key cytokines / growth factors as well as in the temporal dynamics , and it is in need of further refinement ." ]

[ "sarcoidosis - related granulomatous reaction of the immune system could be attributed to environmental factors . however , data supporting this hypothesis remain controversial \n . clinical features of this disease include the following nonspecific symptoms : cough , dyspnea , erythema nodosum , febrile arthritis , uveitis , and parotitis sarcoidosis commonly targets hilar and mediastinal lymph nodes , which are found in more than 90% of the patients \n . the diagnosis is established on the basis of compatible clinical and radiological findings and supported by histological evidence in one or more organs of noncaseating epithelioid cell granulomas in the absence of organisms or particles \n . the correlation between sarcoidosis and malignancy remains unclear , despite that this topic has been increasingly investigated . in this article , we report a case of non - luminal her-2/neu - positive breast cancer in a patient without history of sarcoidosis and initially suspected to have metastatic disease . \n", "a 52-year - old woman was presented to our hospital . she noted a lump in her left breast during self - examination . palpation revealed a nodular lump of tight , elastic consistency in the upper inner quadrant of the left breast . mammography scan demonstrated a 19 mm 18 mm mass on the border of the inner quadrants on the left breast ( \n\n figure 1 \n ) . ultrasound examination revealed enlarged lymph nodes in the left axilla ( 10 mm in diameter ) , left supraclavicular lymph node ( 18 mm 10 mm ) , and multiple right enlarged supraclavicular lymph nodes , with a maximum size of 16 mm 7 mm . plain chest x - rays showed no abnormal findings ( \n\n figure 2 \n ) . the suspected diagnosis was breast cancer at t \n 1n \n 3 cm \n 0 . excisional biopsy of the left supraclavicular lymph node was performed to verify the diagnosis and differentiate the nature of the lesion . histological examination of the obtained material revealed no cancer but multiple epithelioid cell granulomas . based on these results , lumpectomy with urgent histology of resection margins urgent histodiagnosis revealed clear margins and demonstrated a lump in the breast , which was identified as infiltrative carcinoma . routine histological examination revealed infiltrative , moderately differentiated ( g \n 2 ) breast carcinoma with microcalcifications ( \n\n figure 3 \n ) . noncaseating epithelioid cell granulomas of sarcoidosis without tumor growth were found in 6 of 15 lymph nodes ( \n\n figure 4 \n ) . the molecular type of breast cancer was identified as non - luminal her-2/neu - positive through immunohistochemistry . therefore , the post - operative diagnosis of the patient was left breast cancer ( t \n 1n \n 0 m \n 0 ) , with sarcoidosis of left axillary and right supraclavicular lymph nodes . at the time of writing this article , the patient had been undergoing radiation therapy and directed to immunologist for sarcoidosis management and follow - up . \n mammography scan demonstrating a 19 mm 18 mm mass on the border of the inner quadrants of the left breast ( white arrow ) . ( a ) craniocaudal . ( b ) mediolateral oblique view . plain chest x - ray revealed no abnormal findings . infiltrative moderately differentiated ( g \n 2 ) breast carcinoma with microcalcifications ( h&e staining , 200 ) . \n lymph nodes with noncaseating epithelioid cell granulomas of sarcoidosis without tumor growth ( h&amp;e staining , 200 ) .", "the correlation between sarcoidosis and carcinogenesis remains unproven , although such relation has been described in numerous studies . brincker and wilbek \n first found this link in their study on 2544 sarcoidosis cases ; the incidence rates of lymphomas and lung cancer were 11 and 3 fold higher , respectively , in patients with sarcoidosis than those in the population . reported 21 cases of sarcoidosis developing after primary malignancies , including 10 cases after breast cancer . blank et al . \n defined breast cancer , cervical cancer , and b - cell lymphoma as the most common malignancies in patients with sarcoidosis . \n positron emission tomography ( fdg - pet / ct scan ) is one of the most advanced and precise diagnostic tools for such diseases . however , the application of this method in the assessment of regional and distant metastasis spread is limited \n . in cases of simultaneous sarcoidosis and malignancies , the functions of fdg - pet / identified that the maximal standardized uptake value ( suv ) in patients with maligna- ncies is significantly higher than in patients with benign diseases . nevertheless , in patients with granulomatous process , the maximal suv is similar to that in patients with malignant diseases . therefore , fdg - pet / ct scan may only be an additional diagnostic tool used to assess the extent of disease spread without differentiation between malignant and granulomatous disorders ; this tool could also create diagnos- tic difficulties and misunderstandings in patients with such simultaneous comorbidities \n 9 , \n 10 . this study reports a case of non - luminal her-2/neu - positive breast cancer in a patient presenting non - caseating epithelioid cell granulomas of sarcoidosis after treatment and initially suspected to have metastatic disease . a very recent retrospective study described the clinical biological and radiological characteristics of 12 patients presenting sarcoidosis associated with solid tumor ; sarcoidosis frequently affects patients with breast cancer ( 32.3% ) and thus must be considered in the differential diagnosis of the disease \n . in the current study , a review of literature is also presented and included 61 other patients showing similar association between cancer and sarcoidosis . \n this case report emphasizes the importance of differential diagnosis of lymph node involvement in cancer patients . diagnosis of sarcoidosis denied that the presence of metastasis could lead to changes in the post - operative management of the patient . although several epidemiological studies reported the association between cancer and sarcoidosis , further studies , including case reports , may represent an opportunity to obtain additional biological and clinical information to clarify the mechanisms underlying the association of cancer and sarcoidosis . furthermore , the present case report highlights the importance of histological determination in lymph nodes for distinguishing metastasis from sarcoidosis .", "" ]

[ "this retrospective observational study was approved by the western institutional review board ( olympia , washington , usa ) . it complied with the health insurance portability and accountability act of 1996 and followed the tenets of the declaration of helsinki . informed consent was obtained from the subjects after explanation of the nature and possible consequences of the study . patients with ga were identified from the tertiary practice of retinal specialists ( kbf , js , and ly ) if they exhibited plateau signatures in at least one eye ( study eye ) on oct imaging and if they also had at least 3 years ' follow - up with consecutive eye - tracked spectral - domain ( sd)-oct scans taken at least every 6 months . eyes with macular neovascularization , other retinal pathology , or media opacity preventing adequate imaging were excluded . medical records and multimodal imaging , including color fundus photography ( cfp ) , red - free photography ( rf ) , fundus autofluorescence ( faf ) , near - infrared reflectance scanning laser ophthalmoscopy ( nir ) , and sd - oct was performed on all the patients . cfp and rf were performed with a trc-50ix flood - illuminated fundus camera ( topcon medical systems , oakland , nj , usa ) . faf was performed with either the spectralis hra + oct ( heidelberg engineering , heidelberg , germany ) or the topcon trc-50ix fundus camera . oct scans taken before the acquisition of eye - tracked spectralis scans were assessed qualitatively but not included in the quantitative analysis . the sd - oct protocol used in all eyes comprised 20 horizontal raster line scans over the area of interest , ranging from 19 to 49 b - scans per eye , with each scan spaced 115 to 250 m apart , and automatic real - time averaging set between 4 and 23 . to study the origin and progression of plateaus , the most recent sd - oct with this signature was identified . then , serial eye - tracked b - scans of the region of interest were tracked back to baseline . in cases in which the scanning protocol varied during the course of follow - up , the b - scan closest to the area of interest was matched manually and extracted for analysis . these extracted sd - oct images were then stacked , aligned , and saved as a video file using the fiji distribution ( fiji is just image j , http://fiji.sc ; in the public domain ) for the qualitative analysis of the progression of the lesion ( see supplementary video ) . at each time point , the plateau appearance on sd - oct was correlated to the appearance in cfp , nir , and faf . three patients had en face oct and oct angiography ( octa ) imaging with 3 3-mm macular cubes ( rtvue xr avanti ; optovue , fremont , ca , usa ) . the review software ( revue , version 2015.1.0.90 ; optovue , fremont , ca , usa ) displays flow signals superimposed in red on a cross - sectional structural sd - oct image . in a healthy eye , the fourth outer retinal hyperreflective band includes the rpe and brm . in a ped , by definition in the course of this separation , either a basal lamina ( bl ) of 0.15-m thickness or a blamd of variable thickness adheres to the rpe and not to the brm . therefore , we call the hyperreflective band that anteriorly delimits a ped the rpe - bl complex . the definition of a plateau was a distinct oct signature where a mound - like structure with a flattened apex and a wide base was observed within an area of ga after complete loss of the overlying rpe . to determine the volume of the drusenoid ped and ensuing plateau ( fig . 2 ) , the cavalieri principle of stereology was applied to sd - oct volumetric data acquired at each visit , as follows . ( 1 ) each b - scan in the volume was scaled to a 1:1 pixel aspect ratio . the caliper function within the heidelberg eye explorer software ( version 6.3.4.0 ; heidelberg engineering ) was used to measure the area between the outer boundary of rpe+bl and the inner boundary of brm . ( 2 ) the volume between two consecutive oct slices ( hereafter called a segment ) was then determined using the following formula : \n \\}\\begin{document}$$d\\left ( { \\left ( { a\\_x + a\\_\\left ( { x + 1 } \\right ) } \\right)/2 } \\right),$$\\end{document}where d is the distance between consecutive slices in m , a is the area between the rpe+bl and brm in m , and x is the oct slice number . ( 3 ) total ped volume was calculated by summing the volumes of individual segments . the number of segments in the oct volume was ( n 1 ) , where n is the total number of slices that spanned the ped . graphical plots of ped volume with respect to time were generated using interval data . \n origin and evolution of a plateau , as revealed by nir ( a ) and oct ( b ) images . green arrows on nir images show the levels of corresponding oct cross - sectional images . baseline images show several elevations of the rpe with largely hyporeflective interiors . at 3 years after baseline , punctate hyperreflectivity ( red arrowhead ) , progressive loss of the onl has caused the opl ( yellow arrows ) to approach the surface of the ped . also at 4 years , a mons hyperreflective wedge ( blue arrowheads ) appears at the ga border . at 5 years , the downwardly deflected opl is seen to move progressively toward the edge of the plateau following the advancing border of ga . formation of the plateau at 5 years was characterized by the loss of the overlying rpe causing marked thinning of the hyperreflective rpe - basal lamina complex now reduced to just blamd , compared with at 4 years . at 7 years the institutional review board at university of alabama at birmingham ( uab ) approved the laboratory study , which complied with the health insurance portability and accountability act and adhered to the tenets of the declaration of helsinki . amd eyes were identified through an ex vivo imaging screen of eyes accessioned for research purposes from nondiabetic white donors to the alabama eye bank during the period 1996 to 2012 . median death - to - preservation time was 3:49 hours ( range , 0:4011:40 hours ) . eyes were preserved by immersion in 1% paraformaldehyde and 2.5% glutaraldehyde in 0.1 m phosphate buffer following anterior segment excision . after vitreous removal , maculas were photographed in color on a stereomicroscope ( smz - u ; nikon , melville , ny , usa ) . when prepared for histology ( 20112013 ) and uploaded to the project macula web site ( http://projectmacula.cis.uab.edu , in the public domain ) , eyes underwent additional multimodal ex vivo imaging . from each globe , an 8-mm - diameter full - thickness tissue punch containing the fovea and temporal portion of the optic nerve head was held in a tissue holder mounted on a spectralis , as described . a 30 20 sd - oct volume ( 143 scans , 30-m spacing , automated real - time averaging [ art ] = 25 ) was captured along with red - free and near - infrared reflectance scanning laser ophthalmoscopic images . tissue punches were postfixed by osmium tannic acid paraphenylenediamine to accentuate extracellular lipid and embedded in epoxy resin ( polybed 812 ; polysciences , warrington , pa , usa ) . sub - micrometer - thick ( 0.8 m ) sections at 25- to 30-m intervals were stained with 1% toluidine blue for polychromaticity , scanned with a 40 objective , and reviewed and photodocumented with a 60 oil - immersion objective ( numerical aperture = 1.4 ) and digital camera ( xc10 ; olympus , center valley , pa , usa ) . images were adjusted for exposure , contrast , and sharpness ( photoshop cs6 , adobe , san jose , ca , usa ) .", "patients with ga were identified from the tertiary practice of retinal specialists ( kbf , js , and ly ) if they exhibited plateau signatures in at least one eye ( study eye ) on oct imaging and if they also had at least 3 years ' follow - up with consecutive eye - tracked spectral - domain ( sd)-oct scans taken at least every 6 months . eyes with macular neovascularization , other retinal pathology , or media opacity preventing adequate imaging were excluded .", "medical records and multimodal imaging , including color fundus photography ( cfp ) , red - free photography ( rf ) , fundus autofluorescence ( faf ) , near - infrared reflectance scanning laser ophthalmoscopy ( nir ) , and sd - oct was performed on all the patients . cfp and rf were performed with a trc-50ix flood - illuminated fundus camera ( topcon medical systems , oakland , nj , usa ) . faf was performed with either the spectralis hra + oct ( heidelberg engineering , heidelberg , germany ) or the topcon trc-50ix fundus camera . oct scans taken before the acquisition of eye - tracked spectralis scans were assessed qualitatively but not included in the quantitative analysis . the sd - oct protocol used in all eyes comprised 20 horizontal raster line scans over the area of interest , ranging from 19 to 49 b - scans per eye , with each scan spaced 115 to 250 m apart , and automatic real - time averaging set between 4 and 23 . to study the origin and progression of plateaus , the most recent sd - oct with this signature was identified . then , serial eye - tracked b - scans of the region of interest were tracked back to baseline . in cases in which the scanning protocol varied during the course of follow - up , the b - scan closest to the area of interest was matched manually and extracted for analysis . these extracted sd - oct images were then stacked , aligned , and saved as a video file using the fiji distribution ( fiji is just image j , http://fiji.sc ; in the public domain ) for the qualitative analysis of the progression of the lesion ( see supplementary video ) . at each time point , the plateau appearance on sd - oct was correlated to the appearance in cfp , nir , and faf . three patients had en face oct and oct angiography ( octa ) imaging with 3 3-mm macular cubes ( rtvue xr avanti ; optovue , fremont , ca , usa ) . the review software ( revue , version 2015.1.0.90 ; optovue , fremont , ca , usa ) displays flow signals superimposed in red on a cross - sectional structural sd - oct image", "in a healthy eye , the fourth outer retinal hyperreflective band includes the rpe and brm . in a ped , by definition , the rpe is separated from the brm . in the course of this separation , either a basal lamina ( bl ) of 0.15-m thickness or a blamd of variable thickness adheres to the rpe and not to the brm . therefore , we call the hyperreflective band that anteriorly delimits a ped the rpe - bl complex . the definition of a plateau was a distinct oct signature where a mound - like structure with a flattened apex and a wide base was observed within an area of ga after complete loss of the overlying rpe .", "2 ) , the cavalieri principle of stereology was applied to sd - oct volumetric data acquired at each visit , as follows . ( 1 ) each b - scan in the volume was scaled to a 1:1 pixel aspect ratio . the caliper function within the heidelberg eye explorer software ( version 6.3.4.0 ; heidelberg engineering ) was used to measure the area between the outer boundary of rpe+bl and the inner boundary of brm . ( 2 ) the volume between two consecutive oct slices ( hereafter called a segment ) was then determined using the following formula : \n \\}\\begin{document}$$d\\left ( { \\left ( { a\\_x + a\\_\\left ( { x + 1 } \\right ) } \\right)/2 } \\right),$$\\end{document}where d is the distance between consecutive slices in m , a is the area between the rpe+bl and brm in m , and x is the oct slice number . ( 3 ) total ped volume was calculated by summing the volumes of individual segments . the number of segments in the oct volume was ( n 1 ) , where n is the total number of slices that spanned the ped . graphical plots of ped volume with respect to time were generated using interval data . \n origin and evolution of a plateau , as revealed by nir ( a ) and oct ( b ) images . green arrows on nir images show the levels of corresponding oct cross - sectional images . baseline images show several elevations of the rpe with largely hyporeflective interiors . at 3 years after baseline , punctate hyperreflectivity ( red arrowhead ) , progressive loss of the onl has caused the opl ( yellow arrows ) to approach the surface of the ped . also at 4 years , a mons hyperreflective wedge ( blue arrowheads ) appears at the ga border . at 5 years , the downwardly deflected opl is seen to move progressively toward the edge of the plateau following the advancing border of ga . formation of the plateau at 5 years was characterized by the loss of the overlying rpe causing marked thinning of the hyperreflective rpe - basal lamina complex now reduced to just blamd , compared with at 4 years . at 7 years , a closed ort ( pink arrowhead ) is present adjacent to the plateau .", "the institutional review board at university of alabama at birmingham ( uab ) approved the laboratory study , which complied with the health insurance portability and accountability act and adhered to the tenets of the declaration of helsinki . amd eyes were identified through an ex vivo imaging screen of eyes accessioned for research purposes from nondiabetic white donors to the alabama eye bank during the period 1996 to 2012 . median death - to - preservation time was 3:49 hours ( range , 0:4011:40 hours ) . eyes were preserved by immersion in 1% paraformaldehyde and 2.5% glutaraldehyde in 0.1 m phosphate buffer following anterior segment excision . after vitreous removal , maculas were photographed in color on a stereomicroscope ( smz - u ; nikon , melville , ny , usa ) . when prepared for histology ( 20112013 ) and uploaded to the project macula web site ( http://projectmacula.cis.uab.edu , in the public domain ) , eyes underwent additional multimodal ex vivo imaging . from each globe , an 8-mm - diameter full - thickness tissue punch containing the fovea and temporal portion of the optic nerve head was held in a tissue holder mounted on a spectralis , as described . a 30 20 sd - oct volume ( 143 scans , 30-m spacing , automated real - time averaging [ art ] = 25 ) was captured along with red - free and near - infrared reflectance scanning laser ophthalmoscopic images . tissue punches were postfixed by osmium tannic acid paraphenylenediamine to accentuate extracellular lipid and embedded in epoxy resin ( polybed 812 ; polysciences , warrington , pa , usa ) . sub - micrometer - thick ( 0.8 m ) sections at 25- to 30-m intervals were stained with 1% toluidine blue for polychromaticity , scanned with a 40 objective , and reviewed and photodocumented with a 60 oil - immersion objective ( numerical aperture = 1.4 ) and digital camera ( xc10 ; olympus , center valley , pa , usa ) . images were adjusted for exposure , contrast , and sharpness ( photoshop cs6 , adobe , san jose , ca , usa ) .", "plateau signatures were observed in eight eyes of seven patients , of whom six were female . mean age was 75 years ( range , 6089 ) and mean follow - up period was 7.7 years ( range , 3.711.6 ) . baseline visual acuity ( va ) was logmar 0.42 ( snellen equivalent 20/52 ) ( range , 0.181 ) . final va was logmar 1.16 ( snellen equivalent 20/289 ) ( range , 0.182.3 ) . in two eyes , ga spared the fovea throughout the entire course of the follow - up . at baseline , the presence of a drusenoid ped with homogeneous hyperreflective contents and an intact overlying rpe was noted in six eyes ( 75% ; figs . 2 , 3 ) . one eye ( patient 5 , left eye ) had an extremely large ped measuring 2.24 mm with mostly hyporeflective contents and an overlying vitelliform lesion . in another eye ( patient 4 , left eye ) , the plateau was already present at baseline . pigmentary changes noted on cfp were also found on nir , rf , and faf in six eyes , and these corresponded to intraretinal hyperreflective foci on oct ( fig . 3 ) . overlying the ped surface , the ellipsoid zone and outer nuclear layer ( onl ) were thin , with the opl nearly apposed to the surface of the ped . b ) at baseline and follow - up ( a , 4 years ; b , 7 years ) . ( a ) at baseline , patient 3 has a drusenoid ped with overlying pigment hyperplasia and hyperautofluorescent vitelliform material . the oct b - scan shows intraretinal hyperreflective foci ( red arrowhead ) and loss of outer retinal bands over the apex of the ped . four years later , a region of hypoautofluorescent ga contains a plateau that can not be appreciated in the cfp , nir , rf , or faf . the oct b - scan shows a plateau with a shape similar to the baseline ped . the downwardly deflecting opl ( yellow arrow ) has moved laterally as it follows the border of the advancing ga . there was marked attenuation and decreased reflectivity of the rpe - bl band . ( b ) at baseline , patient 6 has a drusenoid ped with overlying pigment hyperplasia that is located inferior to an area of ga . bottom row : seven years later , the ga has markedly enlarged , and the ped is no longer visible on cfp , nir , rf , or faf . the oct b - scan shows that following progressive loss of the onl , the opl ( yellow arrow ) appears draped over a plateau with a shape similar to the baseline ped . hyporeflective areas ( blue arrowhead ) are visible within the plateau interior . during follow - up , onl thinning resulted in the opl approximating the surface of the ped in all cases in which the ped was present at baseline ( figs . 2 , 3 ) . as ga progressed , this point of approximation moved toward the edges of the ped base , following the advancing border of ga ( supplementary video ) . in all eyes , there was also progressive thinning of the hyperreflective rpe - bl complex and diminution of its reflectivity , beginning at the apex of the ped and advancing toward its edges . after rpe loss occurred over the entire ped surface , the plateau ( i.e. , a thin hyperreflective inner surface and an interior of heterogeneous and overall reduced reflectivity ) appeared . the plateau surface was highly reflective on both cross - sectional and en face oct ( fig . 4 , en face oct surface ) and showed the presence of focal defects ( fig . 4 , blue arrows ) that were usually accompanied by smaller hyperreflective foci seen beneath the hyperreflective border . these hyperreflective foci also could be observed within the area of ga as hyperautofluorescent foci on faf and hyperreflective foci on en face oct ( fig . 4 , green arrows ) . accordingly , on en face oct , plateau contents were seen as honeycomb - like structures with hyporeflective spaces interspersed with hyperreflective foci ( fig . 4 , green arrows ) increased in abundance within the plateau interior during follow - up in all eyes as seen on cross - sectional and en face oct ( figs . 2 , 3 , 4 ) . on both cross - sectional and en face octa , no abnormal flow signals were noted within plateaus ( fig . ( a ) a plateau located within the area of ga features internal hyporeflective areas on cross - sectional oct ( blue arrowhead ) , which appear to be organized in a honeycomb - like pattern on en face oct ( blue arrowhead ) . on cross - sectional oct , octa , and on oct surface ( an en face oct slab at the level of the rpe - bl atop the plateau ) , the plateau interior is bounded by a distinct hyperreflective band that continues as a thick and highly reflective rpe band . this hyperreflective surface shows transient hyporeflective defects ( yellow arrows ) during the evolution of these lesions . an en face oct image of the plateau surface allows better appreciation of the focal defects ( yellow arrow ) . ( b ) a plateau located within the area of ga features internal hyporeflective areas on cross - sectional oct ( blue arrowhead ) , which appear to be organized in a honeycomb - like pattern on en face oct ( blue arrowhead ) . on cross - sectional oct and octa , a distinct hyperreflective surface surrounds the plateau interior and focal defects ( yellow arrows ) can be seen in some areas . an en face oct taken at the plateau surface allows better appreciation of focal defects in this hyperreflective layer ( en face octa : surface yellow arrow ) . deep to these focal defects are hyperreflective features ( faf and en face oct : green arrowheads ) that are also seen on faf as punctate hyperfluorescence within the confluent area of hypoautofluorescence . a single plateau was seen in all eyes except for one ( patient 2 ) that had two separate plateaus ( fig . patient 6 had one plateau in each eye . in the seven eyes with a baseline ped , the thinning of the hyperreflective band over the ped surface after rpe loss ( at which point we consider the plateau to be formed ) was preceded by a sharp decrease in ped volume ( fig . subsequently , the volume of the residual plateau appeared very stable over time ( fig . the point at which the plateaus form ( complete loss of rpe from the hyperreflective rpe - bl complex over the ped ) is shown by the dotted line . patient 2 has two separate peds that evolve to two separate plateaus ( a , b ) . patient 6 has a plateau in both the right eye ( r ) and the left eye ( l ) . only patients with an intact hyperreflective rpe - bl complex baseline were included in this analysis . when the plateau signature is first observed ( black dotted line ) , a decrease in the volume that stabilizes on further follow - up . figure 6 shows histology of a donor eye with ga , for which local relationships and cellular processes in the interior of outer retinal corrugations were particularly clear yet also representative of other ga eyes available for review . atrophy spared the fovea in this eye , as seen with ex vivo cfp and 488-nm autofluorescence , and small reflective puncta in the atrophic area were apparent on nir ( figs . 6e ) , blamd was seen as discontinuous , being present at three separate locations . pigmented cells were of the subducted phenotype , that is , rpe - originated cells located external to blamd , in contact with brm . for reference , in the henle fiber layer of a normal eye , obliquely oriented mller cell processes are parallel to , and interleaved with , inner fibers of cone and rod photoreceptors . in the presence of severe photoreceptor degeneration , including ort in this ga eye , the trajectories of gliotic mller cell processes were oriented in many directions , as indicated by arrows in figure 6e . in one instance , processes seemed to enter an outer retinal corrugation horizontally through an opening in the blamd and sweep the subducted cells off brm ( fig . 6d ) . persistent bl deposit and mller cell processes in ga in a 95-year - old white man . cfp ( top row left ) shows a large area of atrophy of rpe extending to the optic nerve head but sparing the fovea . green arrowheads approximate the level of the histologic section shown in the top far right and bottom . ( b ) ex vivo 488-nm autofluorescence shows loss of signal in the atrophic area . ( c ) ex vivo nir imaging shows small and highly reflective puncta in the atrophic area . detailed ( d ) and panoramic ( e ) views of the atrophic area in histology . nfl , nerve fiber layer ; gcl , ganglion cell layer ; ipl , inner plexiform layer ; dr , calcified druse . ( d ) processes from mller cells under a corrugation of persistent blamd in the atrophic area . this corrugation overlies subducted cells of rpe origin ( teal arrowheads ) , which contain nuclei , spindle - shaped melanosomes , and lipofuscin , and are located external to blamd , on brm . mller cell processes appear to enter the corrugation horizontally from the left ( yellow arrow ) and sweep the pigmented cells away . ( e ) blamd is discontinuous and present at three separate locations ( red arrows ) . in the normal henle fiber layer , mller cell processes are obliquely oriented ( outer - center to inner - periphery ) , and they are parallel to , and interleaved with , inner fibers of cone and rod photoreceptors . in the presence of severe photoreceptor degeneration , the trajectories of gliotic mller cell processes and remaining photoreceptors are oriented in many directions ( yellow arrows ) .", "plateau signatures were observed in eight eyes of seven patients , of whom six were female . mean age was 75 years ( range , 6089 ) and mean follow - up period was 7.7 years ( range , 3.711.6 ) . baseline visual acuity ( va ) was logmar 0.42 ( snellen equivalent 20/52 ) ( range , 0.181 ) . final va was logmar 1.16 ( snellen equivalent 20/289 ) ( range , 0.182.3 ) . in two eyes ,", "at baseline , the presence of a drusenoid ped with homogeneous hyperreflective contents and an intact overlying rpe was noted in six eyes ( 75% ; figs . 2 , 3 ) . one eye ( patient 5 , left eye ) had an extremely large ped measuring 2.24 mm with mostly hyporeflective contents and an overlying vitelliform lesion . in another eye ( patient 4 , left eye ) , the plateau was already present at baseline . pigmentary changes noted on cfp were also found on nir , rf , and faf in six eyes , and these corresponded to intraretinal hyperreflective foci on oct ( fig . 3 ) . overlying the ped surface , the ellipsoid zone and outer nuclear layer ( onl ) were thin , with the opl nearly apposed to the surface of the ped . multimodal imaging of two patients ( a , b ) at baseline and follow - up ( a , 4 years ; b , 7 years ) . ( a ) at baseline , patient 3 has a drusenoid ped with overlying pigment hyperplasia and hyperautofluorescent vitelliform material . the oct b - scan shows intraretinal hyperreflective foci ( red arrowhead ) and loss of outer retinal bands over the apex of the ped . four years later , a region of hypoautofluorescent ga contains a plateau that can not be appreciated in the cfp , nir , rf , or faf . the oct b - scan shows a plateau with a shape similar to the baseline ped . the downwardly deflecting opl ( yellow arrow ) has moved laterally as it follows the border of the advancing ga . there was marked attenuation and decreased reflectivity of the rpe - bl band . ( b ) at baseline , patient 6 has a drusenoid ped with overlying pigment hyperplasia that is located inferior to an area of ga . bottom row : seven years later , the ga has markedly enlarged , and the ped is no longer visible on cfp , nir , rf , or faf . the oct b - scan shows that following progressive loss of the onl , the opl ( yellow arrow ) appears draped over a plateau with a shape similar to the baseline ped .", "during follow - up , onl thinning resulted in the opl approximating the surface of the ped in all cases in which the ped was present at baseline ( figs . 2 , 3 ) . as ga progressed , this point of approximation moved toward the edges of the ped base , following the advancing border of ga ( supplementary video ) . in all eyes , there was also progressive thinning of the hyperreflective rpe - bl complex and diminution of its reflectivity , beginning at the apex of the ped and advancing toward its edges . after rpe loss occurred over the entire ped surface , the plateau ( i.e. , a thin hyperreflective inner surface and an interior of heterogeneous and overall reduced reflectivity ) appeared . the plateau surface was highly reflective on both cross - sectional and en face oct ( fig . 4 , en face oct surface ) and showed the presence of focal defects ( fig . 4 , yellow arrows ) . on cross - sectional oct , the inner contents of the plateau consisted of round , hyporeflective areas ( fig . 4 , blue arrows ) that were usually accompanied by smaller hyperreflective foci seen beneath the hyperreflective border . these hyperreflective foci also could be observed within the area of ga as hyperautofluorescent foci on faf and hyperreflective foci on en face oct ( fig . 4 , green arrows ) . accordingly , on en face oct , plateau contents were seen as honeycomb - like structures with hyporeflective spaces interspersed with hyperreflective foci ( fig . 4 , green arrows ) increased in abundance within the plateau interior during follow - up in all eyes as seen on cross - sectional and en face oct ( figs . 2 , 3 , 4 ) . on both cross - sectional and en face octa , no abnormal flow signals were noted within plateaus ( fig . ( a ) a plateau located within the area of ga features internal hyporeflective areas on cross - sectional oct ( blue arrowhead ) , which appear to be organized in a honeycomb - like pattern on en face oct ( blue arrowhead ) . on cross - sectional oct , octa , and on oct surface ( an en face oct slab at the level of the rpe - bl atop the plateau ) , the plateau interior is bounded by a distinct hyperreflective band that continues as a thick and highly reflective rpe band . this hyperreflective surface shows transient hyporeflective defects ( yellow arrows ) during the evolution of these lesions . an en face oct image of the plateau surface allows better appreciation of the focal defects ( yellow arrow ) . ( b ) a plateau located within the area of ga features internal hyporeflective areas on cross - sectional oct ( blue arrowhead ) , which appear to be organized in a honeycomb - like pattern on en face oct ( blue arrowhead ) . on cross - sectional oct and octa , a distinct hyperreflective surface surrounds the plateau interior and focal defects ( yellow arrows ) can be seen in some areas . an en face oct taken at the plateau surface allows better appreciation of focal defects in this hyperreflective layer ( en face octa : surface yellow arrow ) . deep to these focal defects are hyperreflective features ( faf and en face oct : green arrowheads ) that are also seen on faf as punctate hyperfluorescence within the confluent area of hypoautofluorescence .", "in seven of eight eyes , the plateau was located in the macula . in one eye , a single plateau was seen in all eyes except for one ( patient 2 ) that had two separate plateaus ( fig . patient 6 had one plateau in each eye . in the seven eyes with a baseline ped , the thinning of the hyperreflective band over the ped surface after rpe loss ( at which point we consider the plateau to be formed ) was preceded by a sharp decrease in ped volume ( fig . subsequently , the volume of the residual plateau appeared very stable over time ( fig . the point at which the plateaus form ( complete loss of rpe from the hyperreflective rpe - bl complex over the ped ) is shown by the dotted line . patient 2 has two separate peds that evolve to two separate plateaus ( a , b ) . patient 6 has a plateau in both the right eye ( r ) and the left eye ( l ) . only patients with an intact hyperreflective rpe - bl complex baseline were included in this analysis . when the plateau signature is first observed ( black dotted line ) , a decrease in the volume that stabilizes on further follow - up .", "figure 6 shows histology of a donor eye with ga , for which local relationships and cellular processes in the interior of outer retinal corrugations were particularly clear yet also representative of other ga eyes available for review . atrophy spared the fovea in this eye , as seen with ex vivo cfp and 488-nm autofluorescence , and small reflective puncta in the atrophic area were apparent on nir ( figs . 6e ) , blamd was seen as discontinuous , being present at three separate locations . pigmented cells were of the subducted phenotype , that is , rpe - originated cells located external to blamd , in contact with brm . for reference , in the henle fiber layer of a normal eye , obliquely oriented mller cell processes are parallel to , and interleaved with , inner fibers of cone and rod photoreceptors . in the presence of severe photoreceptor degeneration , including ort in this ga eye , the trajectories of gliotic mller cell processes were oriented in many directions , as indicated by arrows in figure 6e . in one instance , processes seemed to enter an outer retinal corrugation horizontally through an opening in the blamd and sweep the subducted cells off brm ( fig . 6d ) . persistent bl deposit and mller cell processes in ga in a 95-year - old white man . ( a c ) ex vivo imaging of postmortem fundus . ( a ) cfp ( top row left ) shows a large area of atrophy of rpe extending to the optic nerve head but sparing the fovea . green arrowheads approximate the level of the histologic section shown in the top far right and bottom . ( b ) ex vivo 488-nm autofluorescence shows loss of signal in the atrophic area . ( c ) ex vivo nir imaging shows small and highly reflective puncta in the atrophic area . detailed ( d ) and panoramic ( e ) views of the atrophic area in histology . nfl , nerve fiber layer ; gcl , ganglion cell layer ; ipl , inner plexiform layer ; dr , calcified druse . ( d ) processes from mller cells under a corrugation of persistent blamd in the atrophic area . this corrugation overlies subducted cells of rpe origin ( teal arrowheads ) , which contain nuclei , spindle - shaped melanosomes , and lipofuscin , and are located external to blamd , on brm . mller cell processes appear to enter the corrugation horizontally from the left ( yellow arrow ) and sweep the pigmented cells away . ( e ) blamd is discontinuous and present at three separate locations ( red arrows ) . in the normal henle fiber layer , mller cell processes are obliquely oriented ( outer - center to inner - periphery ) , and they are parallel to , and interleaved with , inner fibers of cone and rod photoreceptors . in the presence of severe photoreceptor degeneration , the trajectories of gliotic mller cell processes and remaining photoreceptors are oriented in many directions ( yellow arrows ) .", "through a retrospective review of amd patients with long - term serial eye - tracked sd - oct , we identified a series of eyes in which drusenoid peds progressed into plateau signatures within areas of ga . plateaus were seen on oct to contain heterogeneous reflectivity enclosed by a thin overlying hyperreflective surface . a focal defect in the hyperreflective surface , in addition to intraretinal and sub - rpe hyperreflective dots , was observed during the evolution of ped into plateau signatures . opl subsidence was noted to begin at the surface of the ped and progress toward the edge following the areas of expanding atrophy . there was a gradual increase in volume due to an increase in hyporeflective contents initially , followed by complete loss of the rpe and a sharp decrease in ped volume , at which time the plateau was considered to have formed . the study of drusen life cycles and ped evolution are important to improve our understanding of the pathogenesis of amd . understanding the origins and evolution of various oct findings and correlating these findings to histology enable the in vivo study of microscopic cellular changes occurring in these eyes with progressive ga . the development of ga has been previously reported to occur in 19% of eyes with drusenoid peds and to be associated with specific features such as subsidence of the opl and inner nuclear layer and the development of a hyporeflective wedge - shaped band within the henle fiber layer described by mons et al . the appearance of plateaus should be distinguished from other signatures previously described in ga , such as ort , ghost drusen , hyperreflective crown - like structures , hps , and refractile drusen ( figs . 1 , 2 ) . plateau boundaries are difficult to distinguish from the surrounding atrophy using cfp , nir , rf , and faf ( figs . 1 , 3 , 4 , 6 ) . previous studies have reported focal areas of hyperautofluorescence within ga , and in our study these correlated with hyperreflective foci seen on en face oct ( fig . the presence of many pigmented cells of apparent rpe origin within atrophic areas is now well - documented ( fig . 6 ) , and such cells could give rise to both autofluorescence and oct hyperreflectivity signals . plateaus do not contain the highly refractile material as seen on cfp and nir in eyes with spherules in calcifying drusen . 1 ) have a similar overlying thin hyperreflective layer consistent with an overlying blamd drape , as previously observed in oct and in histology ( fig . our current data support a previous study that suggested that plateaus occur at a low frequency in eyes with ga ( 7.5% ) . the plateau is a signature of a residual structure seen on oct once the rpe has progressed into complete atrophy . in our study , after plateau formation as defined by loss of the overlying rpe layer exposing the underlying blamd that then persists , minimal changes in plateau volume were observed on subsequent follow - up , as previously seen . in all eyes of our series , a drusenoid ped was noted to precede the appearance of the plateau . in a prior description , plateaus were thought to evolve in the outer retina and the hyperreflective line that is likely persistent blamd was attributed to the opl . in contrast , serial eye - tracked oct imaging in our cases shows that changes occurred in the sub - rpe compartment , defined in atrophic eyes as the space external to persistent blamd . during development of a plateau , its thin hyperreflective surface , having emerged after rpe atrophy , is readily distinguishable from the overlying subsiding opl ( figs . 1 , 2 ) . plateaus are one route from drusenoid ped to atrophy , and they can be contrasted with a route via ped growth and collapse , which we recently described . growth and collapse of large ped appear to be on a continuum with similar changes described for smaller drusen . why a ped in any one eye proceeds to a plateau or to collapse is not known at present . our detailed description of plateaus will facilitate mechanistic thinking and guide the design of future studies with more patients to investigate associated risk factors that may have prognostic value . evolution of a plateau entails at least four processes that are discernible at the histologic level and also in sd - oct . in approximately chronologic order , the sequence of the evolution is as follows : loss of rpe , persistence of blamd , followed by concurrent clearing of druse contents and occupation of druse space by cellular processes . the loss of rpe is the point at which a drusenoid ped becomes a plateau , and it is marked by a thick , roughened , and highly hyperreflective band becoming thinner , smoother , and moderately hyperreflective . hyperreflective foci over ped destined for plateaus were noted in our series , suggestive of anterior rpe migration , as also seen over ped destined for collapse . the development of ga is hypothesized to proceed via two main pathways of rpe fate , including migration of fully pigmented and nucleated rpe into the retina ( called sloughed and intraretinal ) and shedding of non - nucleated granule aggregates , possibly apoptotic remnants , into underlying blamd . our previous studies correlated intraretinal hyperreflective foci seen on in vivo and ex vivo oct with anteriorly migrating rpe cells . thus , we have good reason to suspect that the spherical hyperreflective intraretinal foci directly internal to the plateaus are also migrating rpe cells . the thin , moderately hyperreflective band draped over plateaus blamd is a stereotypically structured thick layer of basement membrane material that was initially used by sarks et al . to stage amd eyes and a basement membrane is a defining feature of an epithelium , as is the rpe . it is crossed by lipoprotein particles en route to brm and choriocapillaris for apparent egress to the systemic circulation . when blamd is thick enough to be visible , it is observable as a hyporeflective layer . after the rpe atrophies and can no longer cast a shadow , blamd emerges as a moderately hyperreflective line of overall horizontal orientation that is sometimes corrugated . outer retinal corrugations were proposed to be contraction folds of persistent blamd created by loss of neovascular tissue or drusen / basal linear deposit previously located in the sub - rpe space . here we extend this model to large drusenoid ped , on the grounds that corrugations and plateaus represent a continuum of oct signatures involving persistent blamd . further , we propose on the basis of prior pathology literature a possible mechanism for how sub - rpe material may be cleared and the shape of persistent blamd established . our clinical series showed that most of the peds that evolved into plateaus were drusenoid , and druse contents ( e.g. , lipids , proteins , and minerals ) appear to be removed , replaced , or both , over time . the cells and secreted factors ( e.g. , metalloproteinases , lipases ) responsible for druse removal are not established . mller cells are candidates , because previous studies have shown that mller cell processes may protrude into the sub - rpe space , extend over brm , and break up persistent blamd . gliosis indicated by intense glial fibrillary acidic protein immunoreactivity is prominent in areas of severe photoreceptor loss and rpe atrophy , and mller cells remain when all photoreceptors have died . in our exemplar histologic case , we hypothesize that plateau and corrugation formation requires extension of mller cell processes through defects in the rpe / blamd complex ( figs . 4 , 6 ) that occur during the life cycle of drusenoid peds . we further hypothesize that increasing hyporeflectivity observed within the sub - rpe space during the progression of drusenoid peds represents a change in composition of the sub - rpe material that encourages the entry of these processes . the strength of this research is the long follow - up period for our patient cohort , with serial eye - tracked sd - oct imaging for up to 7 years and notably dating back to before the development of ga in all but one eye . another strength is the availability of up to nine separate imaging technologies , each specifically highlighting different tissue features in any one case and the availability of one illustrative histology case . limitations include the small number of eyes and the absence of direct correlation of in vivo imaging to postmortem histology ; hence , although our hypothesis of mller cells involvement in plateau formation is credible and testable , whether these cellular activities are directly visible in oct is currently unknown . our technique of volume measurement may be subject to variations according to oct b - scan density between patients , but for our purpose of studying progression on a per - patient basis , this limitation was acceptable . to minimize inconsistencies , all patients in our study had eye - tracked scans at each follow - up visit with similar density scan patterns available for analysis . our study adds value to existing literature on ped by suggesting a role of mller cell gliosis , elongation , and elaboration in the pathogenesis of amd , which should be further explored in future studies . it is important for clinicians to be aware of plateaus and to distinguish them from oct findings related to neovascular amd , such as vascularized peds or signs of exudation , as octa imaging of three eyes in our study showed no evidence of neovascular flow within plateaus ( fig . plateau structures should not be confused with areas of subretinal fluid and treatment is not indicated for this finding . finally , the distinctive reflectivity of persistent blamd in outer retinal corrugations , and , now , plateaus , provides strong motivation for renaming the fourth outer retinal hyperreflective band of normal eyes , which is currently called the rpe - brm complex , to the rpe - blam - brm complex ( abbreviated as rbb ) to accommodate the appearance of ped and persistent blamd in eyes with amd .", "" ]

[ "endocarditis of the right side of the heart is uncommon by virtue of the low hemodynamic pressure and lack of isolated or significant right - sided valvular deformities . the valves fall prey to an infective process in settings of congenital heart disease or endothelial injury . pulmonary arterial endarteritis is a rare event , even in patients with congenital heart disease ( chd ) . further , a combination of pulmonary endarteritis with a systemic suppuration in chd invites greater attention .", "a 4-year - old male child , born from a non - consanguineous marriage , was admitted with the history of fever and progressive right - sided weakness for 1 week and cyanosis noted since 6 months of age . the patient 's mother had noted dyspnea on feeding since 1 year of age . on admission , the patient had dyspnea on exertion ( grade iii / iv , ats grading ) . the cardiac apex was at left 5 intercostal space , 3 cm outside the mid - clavicular line . an ejection systolic murmur ( grade iii / vi ) was audible in the pulmonary area . a right - sided complete hemiparesis with extensor plantar was noted . an ecg revealed right atrial enlargement , extreme right axis , and poor progression of r wave . chest x - ray revealed cardiomegaly with reduced pulmonary vascular markings [ figure 1 ] . a full - segmental echocardiography revealed a single ventricle of the double - inlet left ventricle type [ figure 2 ] . a rudimentary right ventricle was connected to the main ventricle by a non - restrictive foramen . the aorta arising from the rudimentary chamber and pulmonary artery from the main chamber [ figure 3 ] . a 7 mm 5 mm fixed structure on the wall of the main pulmonary artery with erratic movement , indicative of a vegetation , suggested pulmonary endarteritis [ figure 4a and b ] . a small osteum - secundum atrial septal defect was present , but patent ductus arteriosus was not present . ct scan of the brain revealed bilateral multiple cerebral abscesses [ figure 5 ] , with the largest one present superficially in the left parietal region . chest x - ray showing cardiomegaly with decreased pulmonary flow echocardiography ( subcostal anatomically corrected view ) showing both mitral and tricuspid valves opening into a single ventricle of lv morphology . a rudimentary rv type of ventricle is also visualized echocardiography ( subcostal anatomically corrected view ) showing aorta arising from a rudimentary right ventricle which is connected to the left ventricle through a nonrestrictive foramen ( a ) and ( b ) shows the pulmonary vegetation suggesting pulmonary endarteritis ct scan of the brain showing bilateral cerebral abscesses the child was started on parenteral ceftriaxone 80 mg/ kg / day ( plus , gentamicin 3 mg / kg / day for 2 weeks ) for the endarteritis and was continued for 6 weeks for optimal treatment of the cerebral abscess . an attempted drainage of the largest cerebral abscess resulted in some improvement of the hemiparesis . the patient became afebrile in 2 weeks and was able to walk after 4 weeks of therapy . repeat echo before discharge showed substantive decrease in size of the pulmonary artery vegetation and cardiac symptoms . the patient has been referred to the cardiac surgery department for corrective surgery for single ventricle .", "the risk of infective endocarditis is considerably increased in children with congenital heart disease , and the disease can occur with almost any lesion , more so with cyanotic congenital heart disease ( cchd ) . right - sided infective endocarditis is rare by virtue of the low hemodynamic pressure and lack of isolated or significant right - sided valvar deformities . in adults , right - sided infective endocarditis usually follows prolonged intravenous catheterization or intravenous drug - abuse , affecting the tricuspid valve alone or in combination with the pulmonary valve . a similar valvar involvement also occurs in infants and in children , but here congenital cardiac anomalies with their accompanying interventions are important pre - disposing factors . pulmonary endarteritis as an entity of right - sided endocarditis is rare , even in patients of congenital heart disease . most of the reported pulmonary endarteritis cases have been associated with a patent ductus arteriosus ( pda ) . there are less than 30 reported cases of pulmonary endarteritis associated with pda in the adult , and overall incidence has dramatically decreased over the last 30 years . bilge et al . , in their case report of pulmonary endarteritis in pda , underlines the importance of echocardiography in not only making this rare diagnosis but also as an effective means of following up such a case . apart from pda , a single report exists of pulmonary endarteritis occurring after anatomical correction of complete transposition of the great arteries . to the best of our knowledge and available resources , our case report of pulmonary endarteritis in a child of single ventricle is probably the first such so far . the onset of pulmonary endarteritis and the formation of vegetation can be explained by several factors , including an obstacle of a valve or bloodstream jet and venturi effect , the formation of a platelet fibrin thrombus , transient bacteremia , and adhesion factor for infection . in the present case , an untreated infection in the child could have led to multiple episodes of bacteremia . the presence of multiple , bilateral cerebral abscesses is a corroborative evidence to the bacteremia . the pulmonary artery in this case arose from the main ventricle ( morphological double - inlet lv ) and was hypoplastic . turbulent blood flow distal to the stenotic lesion may increase the risk of developing infective endarteritis in an already hypoplastic pulmonary artery . the intima is also damaged in these areas , predisposing to formation of platelet fibrin thrombus , and thus making the region more susceptible to colonization by pathogens . congenital heart disease ( chd ) has a reported incidence of 9596/million live births ( 0.95% ) , out of which 14.5% ( 1391/million live births ) have cyanotic congenital heart disease ( cchd ) . single ventricle ( 106/million live births ) accounts for 7.6% of cchds and 1.1% of all chds . meticulous full - segmental echocardiographic approach is required to diagnose and delineate the specific type of single ventricle . single ventricle is a complex cchd and is considered a high risk condition for an infective endocarditis . trans - thoracic echocardiography ( tte ) is more sensitive in the pediatric population than in the adult population for detection of vegetation . tte is more likely to identify vegetations in children with normal anatomy or isolated valvular pathology than in those with complex cchd . the importance of a carefully - performed tte or trans - esophageal echocardiography is , therefore , essential in a complex cchd like single ventricle states . cyanotic heart disease accounts for 12.8%-69.4% of all cases of brain abscesses , with the incidence being higher in children . the incidence of brain abscess in patients with cyanotic heart disease has been reported to range between 5 and 18.7% . in our case , bacteremia from an unknown source could have bypassed the pulmonary circulation by entering the double - inlet lv ( the dominant ventricle ) and moved through the aorta and seeded in the brain . patients with cyanotic heart disease could have low - perfusion areas in the brain due to chronic severe hypoxemia and metabolic acidosis as well as increased viscosity of blood due to secondary polycythemia . these low - perfusion areas commonly occur in the junction of gray and white matter , and they are prone to seeding by microorganisms that may be present in the bloodstream . the advent of ct scans and their use in the management of these abscesses has resulted in a fourfold decrease in the mortality rate in patients with brain abscesses , secondary to cyanotic heart disease - from 40%-60% in the pre - ct era to ~10% . the threshold for ct scans in a cchd should be low , and regular ct scans should be obtained to monitor the size of the abscess . in conclusion , this case report aims to highlight the considerable and varied morbidity associated with cyanotic congenital heart diseases ( cchd ) . the presence of a relatively common infectious complication ( cerebral abscesses ) and a rare infectious complication ( pulmonary endarteritis ) in the same child with a cchd ( single ventricle ) validates the need for a heightened clinical awareness and a prompt and meticulous investigational approach for diagnosis and therapy in this group of patients ." ]