Datasets:

tomekkorbak

/

pile-detoxify

like 1

[ "Q:\n\nJob only scrapes one page and does not work when click all check boxes\n\nI am trying to scrape data of the website below which works for one page. ", " However as soon as I click the check boxes, the job does not work. ", " Earlier on you can see that I only detect 24 elements and have not clicked the checkbox, that is scrapes correctly.", "\nAs soon as I click the check boxes, there are more elements and it does not work correctly as seen below. ", " Why is it doing this? ", " I believe Selenium should generally scrape what it is seeing however in this case it is not doing that...\n\ndriver = webdriver.", "Chrome()\ndriver.set_window_size(1024, 600)\ndriver.maximize_window()\ntry:\n os.remove('vtg121.csv')\nexcept OSError:\n pass\n\ndriver.get('https://www.palmerbet.com/sports/soccer')\n\n#SCROLL_PAUSE_TIME = 0.5\n\nfrom selenium.webdriver.common.by import By\nfrom selenium.webdriver.support.ui import WebDriverWait\nfrom selenium.webdriver.support import expected_conditions as EC\n\n#clickMe = wait(driver, 3).until(EC.element_to_be_clickable((By.", "XPATH, ('//*[@id=\"TopPromotionBetNow\"]'))))\n#if driver.find_element_by_css_selector('#TopPromotionBetNow'):\n #driver.find_element_by_css_selector('#TopPromotionBetNow').click()\n\n#last_height = driver.execute_script(\"return document.body.scrollHeight\")\n\n#while True:\n\n #driver.execute_script(\"window.scrollTo(0, document.body.scrollHeight);\")\n\n #time.sleep(SCROLL_PAUSE_TIME)\n\n #new_height = driver.execute_script(\"return document.body.scrollHeight\")\n #if new_height == last_height:\n #break\n #last_height = new_height\n\ntime.sleep(1)\n\nclickMe = wait(driver, 10).until(EC.element_to_be_clickable((By.", "XPATH, ('//*[contains(@class,\"filter_labe\")]'))))\nclickMe.click()\ntime.sleep(0)\nclickMe = wait(driver, 10).until(EC.element_to_be_clickable((By.", "XPATH,'(//*[contains(@class,\"filter_labe\")])')))\noptions = driver.find_elements_by_xpath('//*[contains(@class,\"filter_labe\")]')\n\nindexes = [index for index in range(len(options))]\nshuffle(indexes)\nfor index in indexes:\n time.sleep(0)\n #driver.get('https://www.bet365.com.au/#/AS/B1/')\n clickMe1 = wait(driver, 10).until(EC.element_to_be_clickable((By.", "XPATH,'(//ul[@id=\"tournaments\"]//li//input)[%s]' % str(index + 1))))\n clickMe1 = wait(driver, 10).until(EC.element_to_be_clickable((By.", "XPATH,'(//ul[@id=\"tournaments\"]//li//input)[%s]' % str(index + 1))))\n driver.find_element_by_tag_name('body').send_keys(Keys.", "UP)\n driver.find_element_by_tag_name('body').send_keys(Keys.", "UP)\n driver.find_element_by_tag_name('body').send_keys(Keys.", "UP)\n driver.execute_script(\"return arguments[0].scrollIntoView();\", clickMe1)\n clickMe1.click()\n time.sleep(0)\n ##tournaments > li > input\n #//*[@id='tournaments']//li//input\n\n # Team\n\n #clickMe = wait(driver, 10).until(EC.element_to_be_clickable((By.", "CSS_SELECTOR,(\"#mta_row td:nth-child(1)\"))))\n time.sleep(5)\n langs3 = driver.find_elements_by_xpath('//*[@id=\"mta_row\"]/td[1]')\n langs3_text = []\n\n for lang in langs3:\n #print(lang.text)\n\n langs3_text.append(lang.text)\n time.sleep(0)\n\n # Team ODDS\n langs = driver.find_elements_by_css_selector(\"#mta_row .mpm_teams_cell_click:nth-child(2) .mpm_teams_bet_val\")\n langs_text = []\n\n for lang in langs:\n #print(lang.text)\n langs_text.append(lang.text)\n time.sleep(0)\n\n # HREF\n #langs2 = driver.find_elements_by_xpath(\"//ul[@class='runners']//li[1]\")\n #a[href*=\"/sports/soccer/\"]\n url1 = driver.current_url\n\n #clickMe = wait(driver, 15).until(\n #EC.element_to_be_clickable((By.", "CSS_SELECTOR, ('.match-pop-market a[href*=\"/sports/soccer/\"]'))))\n try:\n clickMe = wait(driver, 15).until(EC.element_to_be_clickable((By.", "XPATH, \"//*[@class='match-pop-market']//a[contains(@href, '/sports/soccer/')]\")))\n clickMe1.click()\n except TimeoutException:\n print(\"No link was found\")\n elems = driver.find_elements_by_css_selector('.match-pop-market a[href*=\"/sports/soccer/\"]')\n elem_href = []\n for elem in elems:\n #print(elem.get_attribute(\"href\"))\n elem_href.append(elem.get_attribute(\"href\"))\n\n print((\"NEW LINE BREAK\"))\n import sys\n import io\n\n with open('vtg121.csv', 'a', newline='', encoding=\"utf-8\") as outfile:\n writer = csv.writer(outfile)\n for row in zip(langs3_text, langs_text, elem_href):\n writer.writerow(row)\n print(row)\n\nA:\n\nYou can use something like below to get team names. ", "Add more code\nfrom selenium import webdriver\nimport json\nimport time\n\ndriver = webdriver.", "Chrome()\n\ndriver.get(\"https://www.palmerbet.com/sports/soccer\")\n\nvalues = []\ntime.sleep(5)\nfor elem in driver.find_elements_by_css_selector(\"li.sport-grp-filter.filter_item input\"):\n val = elem.get_attribute(\"value\")\n values.append(val)\n\nfor val in values:\n driver.get(\"https://www.palmerbet.com/sports/getroundmatches/socc/\" + val)\n\n json_data = driver.find_element_by_tag_name(\"pre\").text\n data = json.loads(json_data)\n\n for item in data[\"m\"]:\n print (item[\"mta\"][\"cn\"], item[\"mtb\"][\"cn\"])\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007342043682001531, 0.0008715196745470166, 0.0005823261453770101, 0.0006122009363025427, 0.0007884398219175637, 0.0006144936196506023, 0.0007532103336416185, 0.0008188331848941743, 0.0007532807067036629, 0.0007690202910453081, 0.0007295460673049092, 0.0007130165467970073, 0.0006853287341073155, 0.0006853287341073155, 0.0008279532194137573, 0.0007596159703098238, 0.0006465719779953361, 0.0007456241874024272, 0.0007575679337605834, 0.0006671625305898488 ]

[ "Cub cadet 128\n\nThe Cub Cadet 128 was part of the 1x8 1x9 series of Cub Cadets from 1971 to 1974.", "\n\nThey used a Kohler K301A 12 hp 476cc 1-cyl gasoline engine and a three speed gear drive transmission. ", "They were manufactured by International Harvester in their factory in Louisville, Kentucky, USA.", "\n\nSpecification\n\n Fuel capacity: 2 gal [7.6 L]\n Rear Hitch type: sleeve hitch (optional)\n Power Take-off (PTO):\n Rear PTO: transmission (optional)\n Rear RPMs: 515\n Front PTO:\t\n independent\n Clutch: mechanical\n \nDimensions & Tires:\n Wheelbase: 44 inches [111 cm]\n Front tire: 16 x 6.50-8\n Rear tire: 23 x 8.50-12\n\nCub Cadet 128 attachments\n 38\" mid-mount mower deck\n 42\" mid-mount mower deck\n 48\" mid-mount mower deck\n 44\" mid-mount mower deck\n 50\" mid-mount mower deck\n\n128 Serial Numbers\nLocation: tractor's rear-drive housing, or the left side of the tractor frame (after February 1974).", "\n 1971: 400001\n 1972: 417643\n 1973: 457305\n 1974: 495749\n Final: 529811\n\nReferences\n\nExternal links\n Service Manuals for Cub Cadet models 86, 108, 109, 128, 129, 149, and 169\n\nCategory:Lawn and garden tractors" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.000770069716963917, 0.0010501847136765718, 0.0006071343086659908, 0.0008028750889934599, 0.0006628600531257689 ]

[ "Q:\n\nC# - Sort File.", "ReadLines IEnumerable without Memory Overhead?", "\n\nIs this possible?", "\nI have the following code to reduce the total amount of memory usage:\nFile.", "WriteAllLines(\n Path.", "Combine(Path.", "GetDirectoryName(file[0]), \"(Sort A-Z) \" + Path.", "GetFileName(file[0])),\n File.", "ReadLines(file[0]).OrderBy(s=>s)\n);\n\n(file[0] is the input file path).", "\nThis reduces usage from ForEach's e.t.c reducing CPU usage aswell as memory usage (barely).", "\nIts also faster than using a Foreach.", "\nThe issue however, is the .OrderBy(s=>s) causes it to load the entire thing into memory. ", "Its not as bad as normally loading it into memory, but it still rises quite a bit of memory. (", "Im using a 80mb file).", "\nIs there some way to order the IEnumerable/Order by A->Z when saving to a file without using much memory?", "\nI know it sounds vague and unsure what im looking for, because I dont know myself.", "\nRunning with .OrderBy(s=>s) on a 2.7 million line file:\nhttps://i.imgur.com/rUyDeFJ.gifv\nRunning WITHOUT .OrderBy(s=>s) on a 2.7 million line file:\nhttps://i.imgur.com/Ejbnuty.gifv\n(You can see it finish)\n\nA:\n\nIt is necessary for .OrderBy to load the entire contents into memory. ", "It would be impossible for it to work any other way.", "\nOrderBy receives an IEnumerable. ", "Therefore it receives items on at a time. ", "However, consider the scenario where the very last row needs to be sorted before the very first row. ", "This could only be achieved if the last row and first row were both in memory at the same time. ", "Consider the scenario where the entire input were already sorted in the reverse order. ", "Hopefully these examples show why it is necessary for OrderBy to load the entire contents into memory.", "\nAlgorithms exist to partition data sets into individual partitions, on disk, then merge those partitions. ", "However, they are beyond the scope of the Linq OrderBy function.", "\nInternally OrderBy reads everything into a buffer array then performs a quicksort over it. ", "If you're feeling brave, refer to the reference source:\nhttps://referencesource.microsoft.com/#System.Core/System/Linq/Enumerable.cs,2530\n(It's scattered throughout this file, but lines 2534-2542 best illustrate this)\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.000791010505054146, 0.0007434615399688482, 0.0007203164859674871, 0.0008010502206161618, 0.0007871395791880786, 0.0006609773845411837, 0.0007243216969072819, 0.0007573315524496138, 0.0007110958104021847, 0.0006605286616832018, 0.0014379731146618724, 0.0011249915696680546, 0.0005977326072752476, 0.0009263314423151314, 0.0010046412935480475, 0.0006419402197934687, 0.0009392143110744655, 0.0007565976120531559, 0.001561052049510181, 0.0005815537297166884, 0.0006608979892916977, 0.0005793218151666224, 0.0005874368944205344, 0.0006247712299227715, 0.000663400103803724, 0.0007713116356171668, 0.0006318360101431608, 0.0005367553094401956 ]

[ "Robert Levi\n\nRober H. Levi (1916–1995) was a prominent Baltimore businessman and philanthropist. ", "He was president of the Hecht's department store chain at the time of its merger with the May Department Stores Company in 1958.", "\n\nEarly years\nBorn in Baltimore in 1916, Levi attended City College of Baltimore, where he served as the captain of a champion lacrosse team for two years. ", " In 1960, he was inducted in the City College Hall of Fame for the accomplishments he achieved while a student. ", " Granted a full scholarship, he then went on to pursue a bachelor's degree in economics and play lacrosse at Johns Hopkins University, where he received his diploma in 1936.", "\n\nMarriage and career\nLevi married Ryda Hecht in 1939. ", "His wife was the daughter of Alexander Hecht, who owned the Hecht's department store chain. ", "After starting work at Hecht's in 1942, Levi rose through the ranks of the company to become the chairman and president of the Hecht Department Stores in the Baltimore-Washington area in 1955.", "\n\nIn 1958, he negotiated the merger between Hecht's and the May Department Stores Company, then served as the vice-president of the May Company and chairman of its Hecht's division until retiring from the company in 1967. ", "Later, Levi joined the Mercantile Trust and Deposit Company, serving as chairman of the banks executive committee until retiring in 1985.", "\n\nCharitable work\nRobert Levi also well known for contributions to his community. ", "He led the Sinai Hospital Building campaign in the 1950s, served as a trustee of [Goucher College], acted as treasurer and trustee of the Walters Art Museum, directed Associated Jewish Charities, and headed the Federal City Council and the National Capital Downtown Committee in Washington, D.C.\n\nIn 1972, along with the leaders of four other major banks in Baltimore, Levi co-founded the Baltimore Community Foundation. ", " He served as the foundation's first chairman, ensuring the city would always have “a philanthropic organization that was a gathering of all people—no color line, no religious affiliation, no special cause.” ", "\n\nFor 31 years, he served as a trustee of Johns Hopkins University and Hospital. ", "Levi was also an active part of the Greater Baltimore Committee, which worked to revitalize the city through projects such as the Inner Harbor, Oriole Park at Camden Yards, and the Jones Falls Expressway.", "\n\nThe Levi Sculpture Garden at the Baltimore Museum of Art bears his legacy and is the result of his donation of 14 sculptures and funding from the City of Baltimore and the State of Maryland. ", "The garden highlights pieces from the second half of the twentieth-century including works by Louise Nevelson, Joan Mirò, George Rickey, and Alexander Calder Jose de Rivera, Jim Dine, Ellsworth Kelly, Isamu Noguchi, and Scott Burton.", "\n\nReferences \n\nThe Photograph Collection. ", "Baltimore Museum of Art.", "\n\nCategory:1916 births\nCategory:1995 deaths\nCategory:Businesspeople from Baltimore\nCategory:20th-century American businesspeople" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0007677081739529967, 0.000881720392499119, 0.0006476833368651569, 0.000653478258755058, 0.0006438067648559809, 0.0007200861582532525, 0.0010010873666033149, 0.0006593283615075052, 0.0008117974502965808, 0.0006818105466663837, 0.0005465058493427932, 0.000661123194731772, 0.0006378629477694631, 0.000620658858679235, 0.0007211850606836379, 0.0006058251019567251, 0.0006857948610559106, 0.0005663478514179587, 0.0007529143476858735, 0.0006423888262361288 ]

[ "import React from 'react';\nimport PropTypes from 'prop-types';\nimport { Icon, Card } from 'antd';\nimport CountUp from 'react-countup';\nimport styles from './index.module.less';\n\nfunction NumberCard({ icon, color, title, number, countUp }) {\n return (\n <Card\n className={styles.numberCard}\n bordered={false}\n bodyStyle={{ padding: 0 }}\n >\n <Icon className={styles.iconWarp} style={{ color }} type={icon} />\n <div className={styles.content}>\n <p className={styles.title}>{title || 'No Title'}</p>\n <p className={styles.number}>\n <CountUp\n start={0}\n end={number}\n duration={2.75}\n useEasing\n useGrouping\n separator=\",\"\n {...countUp || {}}\n />\n </p>\n </div>\n </Card>\n );\n}\n\nNumberCard.propTypes = {\n icon: PropTypes.string,\n color: PropTypes.string,\n title: PropTypes.string,\n number: PropTypes.number,\n countUp: PropTypes.object,\n};\n\nexport default NumberCard;\n" ]

{ "pile_set_name": "Github" }

[ 0.001186891458928585 ]

[ "name: Updating Code Variations GitHub Issue\non:\n push:\n branches: \n - master \njobs:\n build:\n runs-on: ubuntu-latest\n steps:\n - uses: actions/checkout@v1\n - name: Use Node.js 13.x\n uses: actions/setup-node@v1\n with:\n node-version: '13.x'\n - name: Cache node modules\n uses: actions/cache@v1\n with:\n path: node_modules\n key: ${{ runner.os }}-node-${{ hashFiles('**/package-lock.json') }}\n restore-keys: |\n ${{ runner.os }}-node-\n - name: Updating GitHub Issue ${{ secrets.", "ISSUE_NUMBER }}\n run: |\n npm i\n node checkVariations.js\n env:\n CI: true\n OCTOCAT_KEY: ${{ secrets.", "OCTOCAT_KEY }}\n ISSUE_NUMBER: ${{ secrets.", "ISSUE_NUMBER }}\n" ]

{ "pile_set_name": "Github" }

[ 0.0008840429363772273, 0.0008878946537151933, 0.0008676745346747339, 0.000724057957995683 ]

[ "An assessment of measures to predict the outcome of driving evaluations in patients with cerebral damage.", "\nThe evaluation of the ability of patients to return to driving after cerebral damage stands out as one of the most important tasks confronted by rehabilitation professionals. ", "The present study was designed to critically assess evaluations that were developed at one facility to determine fitness to drive: an offroad, predriver evaluation of skills regarded as important in driving and an on-road, behind-the-wheel evaluation of abilities needed to drive in actual traffic situations. ", "The evaluation results of 3-patients with cerebral damage due to traumatic head injury or cerebrovascular accident were studied retrospectively. ", "Only 4 out of 21 items on the predriver evaluation significantly predicted the outcome of the predriver evaluation and none of the predriver evaluation items predicted the outcome of the behind-the-wheel evaluation. ", "Only 6 of the 26 tasks on the behind-the-wheel evaluation significantly predicted the outcome of the behind-the-wheel evaluation. ", "None of the items on the predriver evaluation or the behind-the-wheel evaluation explained a significant portion of variance related to outcome. ", "The lack of internal and predictive validity of driver evaluations is discussed in light of these findings, and recommendations are given for improving the predictive power of driving evaluations." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006374034564942122, 0.0005455264472402632, 0.0006215148605406284, 0.0006261440576054156, 0.0006998048629611731, 0.00062259950209409, 0.0006489534280262887, 0.0005888186278752983 ]

[ "Sleeping Turtles Preserve North\n\nSleeping Turtles Preserve North includes 173 acres of land in Sarasota County, Florida that were purchased in four parcels during 2003 and 2004 through the Environmentally Sensitive Lands Protection Program (ESLPP). ", "The name \"Sleeping Turtles\" comes from descriptions on naval maps from the 1800s of the Myakka River. ", "The park includes floodplain swamps, pine flatwoods, upland mixed forests and seasonal wetlands; habitats for gopher tortoises, swallow-tailed kites, alligators and song birds. ", "The preserve can be toured on five miles of unpaved hiking trail and is located at 3462 Border Road in Venice.", "\n\nReferences\n\nCategory:Reptile conservation organizations\nCategory:Protected areas of Sarasota County, Florida" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.000639676523860544, 0.0005670648533850908, 0.0009917155839502811, 0.0006084605702199042, 0.0006006199982948601 ]

[ "Q:\n\nDoes anyone know the official rules for Destruct 3?", "\n\nWe've got our hands on an old Destruct 3 game that came without any rules. ", " We contacted the makers (Uncle Skunkle), but oddly enough, they wouldn't send us the rules without documentation of where we got the game. ", "We've made up some rules of our own, but they're not entirely satisfying. ", " Anyone know the real rules, or where we can get them without any paperwork?", "\n\nA:\n\nThis might help. ", "Although it's only a review, it does explain a lot about the scoring and building rules. ", "There obviously are a few rules that are missing (ie. ", "how the dice work).", "\nI assume you do not have any kind of shop receipt for the game. ", "You could suggest to them that you could send them a picture of the game to prove you actually have it. ", "They could describe a specific setup for you to replicate so you can't just pick a picture off the web.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0009041029261425138, 0.0007758914725854993, 0.0008938189712353051, 0.0007413507555611432, 0.000742069270927459, 0.000598765560425818, 0.000558523868676275, 0.0007464837399311364, 0.0007322426536120474, 0.0009314198978245258, 0.0007436220184899867, 0.0006460989243350923, 0.001995444530621171 ]

[ "452 U.S. 926\n101 S.Ct. ", "3063\n69 L.Ed.2d 428\nDavid SAYE and Edward T. Kassingerv.", "Larry WILLIAMS\nNo. ", "80-1123\nSupreme Court of the United States\nJune 8, 1981\n\nOn petition for writ of certiorari to the United States Court of Appeals for the Fifth Circuit.", "\nThe petition for a writ of certiorari is denied.", "\nJustice REHNQUIST, dissenting.", "\n\n\n1\nRespondent was an officer in a university police department. ", "Over the objections of petitioners, his superiors, respondent desired to run for the office of County Sheriff. ", " The chief of the local police force, Chief Brown, also desired to run for that office. ", " Chief Brown was involved in an accident, and respondent approved an accident report which stated among other things that Brown had been drinking. ", " The next morning petitioners, at the request of Chief Brown, had the accident report changed so as to read \"Not known if drinking.\" ", " Respondent objected to the modified accident report, and disclosed these events to his father, who in turn leaked the original and altered accident reports to the press. ", " When petitioners learned of the leak, they fired respondent. ", " Respondent subsequently filed suit alleging that he had been fired for engaging in protected First Amendment activity.", "\n\n\n2\nAfter a jury trial, respondent was awarded compensatory and punitive damages against both petitioners. ", " Relying on the so-called Pickering defenses, see Pickering v. Board of Education, 391 U.S. 563, 88 S.Ct. ", "1731, 20 L.Ed.2d 811 (1968), petitioners had sought to defend the discharge on the grounds that respondent by leaking confidential police material for his own political ends, had destroyed a harmonious working relationship with his superiors. ", " Petitioners also contended that they were entitled to \"official immunity\" from damages, in that they had in good faith discharged respondent for violating the department's policy against disclosing confidential police investigative reports. ", " See Wood v. Strickland, 420 U.S. 308, 95 S.Ct. ", "992, 43 L.Ed.2d 214 (1975); Scheuer v. Rhodes, 416 U.S. 232, 94 S.Ct. ", "1683, 40 L.Ed.2d 90 (1974). ", " The District Court, however, held that evidence of these defenses was inadmissible into evidence, and it declined to instruct the jury as to \"qualified or good-faith\" immunity.", "\n\n\n3\nThe Court of Appeals for the Fifth Circuit affirmed. ", "Williams v. Board of Regents of the University System of Georgia, 629 F.2d 993. ", " It first held that evidence of the confidentiality policy, which went directly to the issue of official immunity, could only be admitted if the policy\n\n\n4\n\"(1) factually existed, (2) was consistent with other state statutes and regulations, (3) was not vague, (4) did not proscribe protected first amendment speech overbroadly, (5) was communicated to the appellee and (6) was not void as a matter of public policy in its instant application.\" ", " Id., at 1000 (footnotes omitted).", "\n\n\n5\nAlthough the court conceded that petitioners had shown enough evidence of the existence of a confidentiality policy to establish a jury question, the court held that the other factors were not present, namely, that the confidentiality policy conflicted with state regulations. ", " Because the evidence of the confidentiality policy was inadmissible, the court concluded that there was insufficient evidence to warrant a jury instruction as to the existence of \"good-faith\" immunity.", "\n\n\n6\nIt seems to me that the Court of Appeals' six-prong \"test\" unjustifiably expands the principles announced in such cases as Wood and Scheuer. ", " In those cases, we held that official immunity is available where there is evidence that the official has a subjective good-faith belief in the lawfulness of his action and where the action is not inconsistent with undisputed and settled law. ", " Accordingly, I believe that the novel test announced by the Court of Appeals warrants review.", "\n\n\n7\nThe court next rejected petitioners' contention that the District Court erred in refusing to permit petitioners to introduce evidence and to charge the jury as to their \"Pickering defenses,\" based on this Court's decision in Pickering v. Board of Education, supra. ", " Petitioners argued that they should have been permitted to show the necessity of maintaining discipline in a organization such as a police department and to show how respondent's conduct leads to a breakdown of that discipline. ", " The Court of Appeals disagreed, finding that the District Court correctly found that respondent's First Amendment interests outweighed petitioners' interests in maintaining discipline. ", " 629 F.2d, at 1003.", "\n\n\n8\nI disagree. ", " In Pickering, the Court held that whether speech of a public employee is protected depends upon \"a balance between the interests of the [employee] as a citizen, in commenting upon matters of public concern and the interest of the State, as an employer, in promoting the efficiency of the public services it performs through its employees.\" ", " 391 U.S., at 568, 88 S.Ct., ", "at 1734. ", " But we also recognized that even accurate public criticism of a superior by a subordinate might warrant dismissal where the relationship between superior and subordinate is of such a nature that public criticism would seriously impair the working relationship between them. ", " Id., at 570, n. 3, 88 S.Ct., ", "at 1735, n. 3. ", " As the late Judge Leventhal explained in Meehan v. Macy, 129 U.S.App.", "D.C. 217, 230, 392 F.2d 822, 835 (1968), cited with approval in Arnett v. Kennedy, 416 U.S. 134, 161-162, 94 S.Ct. ", "1633, 1648, 40 L.Ed.2d 15 (1974):\n\n\n9\n\"We think it is inherent in the employment relationship as a matter of common sense if not common law that an employee in appellant's circumstances cannot reasonably assert a right to keep his job while at the same time he inveighs against his superiors in public with intemperate and defamatory lampoons. ", " We believe that Meehan cannot fairly claim that discharge following an attack like that presented by this record comes as an unfair surprise or is so unexpected and uncertain as to chill his freedom to engage in appropriate speech.\" ", " (Footnote omitted.) ", "In this case, I believe that the Court of Appeals struck the wrong balance. ", " As it itself acknowledged:\n\n\n10\n\"Viewed in the light most favorable to [petitioners], it was established that the 'leak' of the altered report would irreparably damage the working relationship between [petitioners] and Williams. ", " Although Saye was not Williams' immediate superior, there was frequent communication and necessity for working together. ", " It is clear, therefore, that disharmony would result. ", " Additionally, as [petitioners] argue, discipline is a necessary component of a smoothly-operating police force. ", " Although this necessity of discipline does not rise to the same level as required by the military, see Parker v. Levy, 417 U.S. 733, 94 S.Ct. ", "2547, 41 L.Ed.2d 439 (1974), discipline must be maintained between police officers during periods of active duty.\" ", " 629 F.2d, at 1003.", "\n\n\n11\nThough the court observed that \"disharmony would result,\" it nevertheless concluded that evidence of \"this very real threat of disruption, disharmony and breakdown of discipline\" was properly excluded by the trial court, not only as an absolute defense but even as a basis of a good-faith \"official immunity.\" ", " Ibid. ", " In my view, the court gave too little weight to the need for maintaining a close working relationship in a quasi-military organization like a police department. ", " And quite unlike the situation in Pickering, respondent's actions here called into question the integrity of his immediate superiors with whom he worked daily.", "\n\n\n12\nMore significantly, I believe that the decision here conflicts with those of other Circuits. ", " In Sprague v. Fitzpatrick, 546 F.2d 560 (CA3 1976), cert. ", "denied, 431 U.S. 937, 97 S.Ct. ", "2649, 53 L.Ed.2d 255 (1977), the court took a much broader view of the Pickering defenses than did the court here. ", "It concluded that the public criticism of the District Attorney by his first assistant precluded any future working relationship between the parties and hence was unprotected. ", " See Clark v. Holmes, 474 F.2d 928 (CA7 1972), cert. ", "denied, 411 U.S. 972, 93 S.Ct. ", "2148, 36 L.Ed.2d 695 (1973). ", " Likewise in this case, I believe petitioners should have been permitted to introduce evidence as to the breakdown of a minimally acceptable working relationship between the parties as well as to the maintenance of necessary police department discipline.", "\n\n\n13\nViewed in one context, I can understand why this case is not a particularly attractive candidate for review. ", " Like so many other cases, it involves a number of factual disputes, with conflicting evidence on both sides. ", " Nonetheless, the legal issues presented by the case—whether the trial court erred in refusing to admit into evidence material going to \"qualified immunity\" and Pickering defenses—are sufficiently isolated from the factual controversies so as to make this case a suitable vehicle for review. ", " I would grant certiorari to consider those legal issues.", "\n\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0.0010612857295200229, 0.0007682127761654556, 0.0008095402154140174, 0.000770536542404443, 0.0010400365572422743, 0.0007888399995863438, 0.000851727498229593, 0.002217728178948164, 0.0007651811465620995, 0.0009835570817813277, 0.0008527124300599098, 0.0006532453116960824, 0.0018487585475668311, 0.0010363705223426223, 0.0012674658792093396, 0.0006864867173135281, 0.0007991993334144354, 0.0006498979637399316, 0.000711723929271102, 0.0009328564046882093, 0.0006715715280734003, 0.0007253653602674603, 0.0006878789863549173, 0.0008883418631739914, 0.0006263944669626653, 0.0007430167752318084, 0.0006487398059107363, 0.0006686109118163586, 0.000660422898363322, 0.0005997656262479722, 0.0005607823841273785, 0.0007407134980894625, 0.0006019440479576588, 0.0006921655731275678, 0.0008503821445629001, 0.0006848742486909032, 0.0006690334994345903, 0.0007567511638626456, 0.0007161685498431325, 0.0006421574507839978, 0.0010958637576550245, 0.0006747760344296694, 0.0006894393591210246, 0.0008795973844826221, 0.0008409998845309019, 0.0006217349437065423, 0.0005855748313479125, 0.0005990663194097579, 0.0005573366652242839, 0.0006099042948335409, 0.009694375097751617, 0.0005939945694990456, 0.0006854456150904298, 0.0006176801980473101, 0.0008503821445629001, 0.0008127568871714175, 0.000775543216150254, 0.0007364495540969074, 0.0006642380612902343, 0.00060064229182899, 0.0007897414616309106, 0.000851816323120147, 0.0006341871339827776, 0.0006420604768209159, 0.0007026814855635166, 0.0007323525496758521, 0.000735594192519784, 0.0005365923861972988, 0.0005426487186923623, 0.0006739707896485925, 0.0005469326861202717, 0.000611237483099103, 0.001995444530621171 ]

[ "Clinico-pathological observations on the pathogenesis of severe thrombocytopenia and anemia induced by Plasmodium vivax infections during antimalarial drug efficacy trials in Aotus monkeys.", "\nDuring routine antimalarial drug efficacy trials, we observed, for the first time, severe thrombocytopenia developing in Aotus monkeys infected with Plasmodium vivax. ", "Data obtained from 26 Aotus infected with the AMRU-1 strain showed that 77% developed severe thrombocytopenia, whereas only 15% had severe anemia, with hemorrhagic diathesis ensuing in 31%. ", "In general, thrombocytopenic monkeys either failed primary treatment with experimental antimalarial drugs or were found to have higher-density parasitemias, longer patency duration, and lower hematocrits. ", "In these monkeys, severe thrombocytopenia inversely correlated to parasitemia (R = -1.0), and animals that received a blood transfusion had significantly higher platelet counts (P < 0.05) by day 38 after inoculation. ", "In conclusion, the AMRU-1 strain of P. vivax, was considered to be highly pathogenic to Aotus monkeys, and thrombocytopenia rather than anemia should be regarded an early indicator of drug treatment failure with this strain." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0030411076731979847, 0.007435791194438934, 0.0013779569417238235, 0.11363716423511505, 0.017961625009775162, 0.001782296341843903 ]

[ "How climate change can impact your health\n\nDiseases popping up where they never have before — where physicians are less trained to combat them — is just one way Canadians’ health is being impacted by climate change." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0010462939972057939 ]

[ "Clients\n\nI offer SEO consulting services, including site audits and bespoke training. ", "Here are some of my client testimonials.", "\n\n“Mark’s down-to-earth approach to SEO made immediate sense to us and was easy to implement. ", "We noticed instant positive results and now have the building blocks to take our SEO to the next level with the redesign of our site.”", "\n\n“Mark’s approach to SEO was refreshing. ", "His knowledge of the travel industry meant he was quickly able to identify the most relevant search phrases and how to deploy them within our site. ", "Following his concise instructions we saw dramatically improved results on Google within a few weeks. ", "We now have a much better understanding of the elements required to optimise any new pages we add to the site. ", "In fact, Mark’s whole approach has left us feeling more empowered rather than daunted by SEO.”", "\n\n“The effect of Mark’s SEO work on our Google rankings has been remarkable. ", "Within a few days of implementing his changes to the site, our pages were appearing in the Top 10 of Google for the first time… Mark’s approach is plain-speaking and inclusive. ", "He cuts through the jargon, and demystifies the world of SEO.”", "\n\n“Getting insight from Mark, with his expertise, independent outlook and particular awareness of the travel industry, has proved invaluable. ", "I would not hesitate to recommend Mark’s services, even for those who feel well informed about SEO.”", "\n\n“Mark’s honest advice on the need for original content, best website practice, anti-spam-like web building and detailed knowledge of how all the search engines think, especially Google, leads me to believe he is an oasis of wisdom in a desert of snake oil sellers and charlatans that dominate todays SEO world.”" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005436944775283337, 0.0007599062519147992, 0.0005380333168432117, 0.0005471918848343194, 0.0006086302455514669, 0.0005390100996010005, 0.0005565438768826425, 0.0005677565932273865, 0.000702309247571975, 0.0005933876964263618, 0.0006435129907913506, 0.0008194548427127302, 0.0005329268169589341, 0.0005254683783277869, 0.0009153978899121284 ]

[ "Donkey show\n\nA donkey show is a supposed type of live sex show in which a woman engages in bestiality with a donkey, which, according to urban legend and some works of fiction, were once performed in the Mexican border city of Tijuana, particularly in the mid-20th century.", "\n\nGustavo Arellano, in his ¡Ask a Mexican! ", "column, argues that donkey shows are not real.", "\n\nAs late as 2008, they have been mentioned as a reason to visit Tijuana, and naive tourists may seek them out.", "\n\nThe \"donkey show\" myth has been portrayed in several American films, including Losin' It (1983), Bachelor Party (1984), The 40-Year Old Virgin (2005), Clerks II (2006), The Heartbreak Kid (2007), and Cake (2014).", "\n\nIn the 1981 book New West, a Tijuana taxi driver offers tourists a ride to see a donkey show in the red light district. ", "\n\nIn Mark Winegardner's 2005 book The Godfather Returns, set in the late 1950s and early 1960s, Fredo Corleone's wife Deanna Dunn insists on attending one: \"on a whim, they'd headed to Mexico. ", "When they'd gotten there, Deanna Dunn, insisted on going to see a donkey show. ... ", "who thought that watching a donkey fuck a teenage Indian girl was a hoot.\"", "\n\nIn 2005 the term is claimed to be used to describe a situation that has become a \"complete mess\".", "\n\nSee also\n Ping pong show\n\nReferences\n\nCategory:Zoophilia\nCategory:Donkeys\nCategory:Sex industry\nCategory:Tijuana\nCategory:Urban legends" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0472116693854332, 0.012113268487155437, 0.012210536748170853, 0.0005434702034108341, 0.0009497635182924569, 0.0007580344099551439, 0.0006413338705897331, 0.04338802769780159, 0.9940502047538757, 0.0006972611299715936, 0.02731063775718212 ]

[ "Q:\n\nComparing two XML files & generating a third with XMLDiff in C#\n\nI am trying to write a simple algorithm to read two XML files with the exact same nodes and structure but not necessarily the same data inside the child nodes and not the same order. ", "How could I create a simple implementation for creating a third, temporary XML being the differential between the two first ones, using Microsoft's XML Diff .DLL ?", "\nXML Diff on MSDN:\nXML Diff and Patch Tool\nXML Diff and Patch GUI Tool \nsample XML code of the two different XML files to compare:\n<?", "xml version=\"1.0\" encoding=\"utf-8\" ?", "> \n<Stats Date=\"2011-01-01\">\n <Player Rank=\"1\">\n <Name>Sidney Crosby</Name> \n <Team>PIT</Team> \n <Pos>C</Pos> \n <GP>39</GP> \n <G>32</G> \n <A>33</A> \n <PlusMinus>20</PlusMinus> \n <PIM>29</PIM> \n </Player>\n</Stats>\n\n<?", "xml version=\"1.0\" encoding=\"utf-8\" ?", "> \n<Stats Date=\"2011-01-10\">\n <Player Rank=\"1\">\n <Name>Sidney Crosby</Name> \n <Team>PIT</Team> \n <Pos>C</Pos> \n <GP>42</GP> \n <G>35</G> \n <A>34</A> \n <PlusMinus>22</PlusMinus> \n <PIM>30</PIM> \n </Player>\n</Stats>\n\nResult wanted (difference between the two)\n<?", "xml version=\"1.0\" encoding=\"utf-8\" ?", "> \n<Stats Date=\"2011-01-10\">\n <Player Rank=\"1\">\n <Name>Sidney Crosby</Name> \n <Team>PIT</Team> \n <Pos>C</Pos> \n <GP>3</GP> \n <G>3</G> \n <A>1</A> \n <PlusMinus>2</PlusMinus> \n <PIM>1</PIM> \n </Player>\n</Stats>\n\nIn this case, I would probably use XSLT to convert the resulting XML \"differential\" file into a sorted HTML file, but I am not there yet. ", "All I want to do is to display in the third XML file the difference of every numerical value of each nodes, starting from the \"GP\" child-node.", "\nC# code I have so far:\nprivate void CompareXml(string file1, string file2)\n{\n\n XmlReader reader1 = XmlReader.", "Create(new StringReader(file1));\n XmlReader reader2 = XmlReader.", "Create(new StringReader(file2));\n\n string diffFile = StatsFile.", "XmlDiffFilename;\n StringBuilder differenceStringBuilder = new StringBuilder();\n\n FileStream fs = new FileStream(diffFile, FileMode.", "Create);\n XmlWriter diffGramWriter = XmlWriter.", "Create(fs);\n\n XmlDiff xmldiff = new XmlDiff(XmlDiffOptions.", "IgnoreChildOrder |\n XmlDiffOptions.", "IgnoreNamespaces |\n XmlDiffOptions.", "IgnorePrefixes);\n bool bIdentical = xmldiff.", "Compare(file1, file2, false, diffGramWriter);\n\n diffGramWriter.", "Close();\n\n // cleaning up after we are done with the xml diff file\n File.", "Delete(diffFile);\n}\n\nThat's what I have so far, but the results is garbage... note that for each \"Player\" node, the first three childs have NOT to be compared... How can I implement this?", "\n\nA:\n\nThere are two immediate solutions:\nSolution 1.", "\nYou can first apply a simple transform to the two documents that will delete the elements that should not be compared. ", "Then, compare the results ing two documents -- exactly with your current code. ", "Here is the transformation:\n<xsl:stylesheet version=\"1.0\"\n xmlns:xsl=\"http://www.w3.org/1999/XSL/Transform\">\n <xsl:output omit-xml-declaration=\"yes\" indent=\"yes\"/>\n <xsl:strip-space elements=\"*\"/>\n\n <xsl:template match=\"node()|@*\">\n <xsl:copy>\n <xsl:apply-templates select=\"node()|@*\"/>\n </xsl:copy>\n </xsl:template>\n\n <xsl:template match=\"Name|Team|Pos\"/>\n</xsl:stylesheet>\n\nWhen this transformation is applied to the provided XML document:\n<Stats Date=\"2011-01-01\">\n <Player Rank=\"1\">\n <Name>Sidney Crosby</Name>\n <Team>PIT</Team>\n <Pos>C</Pos>\n <GP>39</GP>\n <G>32</G>\n <A>33</A>\n <PlusMinus>20</PlusMinus>\n <PIM>29</PIM>\n <PP>10</PP>\n <SH>1</SH>\n <GW>3</GW>\n <Shots>0</Shots>\n <ShotPctg>154</ShotPctg>\n <TOIPerGame>20.8</TOIPerGame>\n <ShiftsPerGame>21:54</ShiftsPerGame>\n <FOWinPctg>22.6</FOWinPctg>\n </Player>\n</Stats>\n\nthe wanted resulting document is produced:\n<Stats Date=\"2011-01-01\">\n <Player Rank=\"1\">\n <GP>39</GP>\n <G>32</G>\n <A>33</A>\n <PlusMinus>20</PlusMinus>\n <PIM>29</PIM>\n <PP>10</PP>\n <SH>1</SH>\n <GW>3</GW>\n <Shots>0</Shots>\n <ShotPctg>154</ShotPctg>\n <TOIPerGame>20.8</TOIPerGame>\n <ShiftsPerGame>21:54</ShiftsPerGame>\n <FOWinPctg>22.6</FOWinPctg>\n </Player>\n</Stats>\n\nSolution 2.", "\nThis is a complete XSLT 1.0 solution (for convenience only, the second XML document is embedded in the transformation code):\n<xsl:stylesheet version=\"1.0\"\n xmlns:xsl=\"http://www.w3.org/1999/XSL/Transform\">\n <xsl:output omit-xml-declaration=\"yes\" indent=\"yes\"/>\n <xsl:strip-space elements=\"*\"/>\n\n <xsl:variable name=\"vrtfDoc2\">\n <Stats Date=\"2011-01-01\">\n <Player Rank=\"2\">\n <Name>John Smith</Name>\n <Team>NY</Team>\n <Pos>D</Pos>\n <GP>38</GP>\n <G>32</G>\n <A>33</A>\n <PlusMinus>15</PlusMinus>\n <PIM>29</PIM>\n <PP>10</PP>\n <SH>1</SH>\n <GW>4</GW>\n <Shots>0</Shots>\n <ShotPctg>158</ShotPctg>\n <TOIPerGame>20.8</TOIPerGame>\n <ShiftsPerGame>21:54</ShiftsPerGame>\n <FOWinPctg>22.6</FOWinPctg>\n </Player>\n </Stats>\n </xsl:variable>\n\n <xsl:variable name=\"vDoc2\" select=\n \"document('')/*/xsl:variable[@name='vrtfDoc2']/*\"/>\n\n <xsl:template match=\"node()|@*\" name=\"identity\">\n <xsl:param name=\"pDoc2\"/>\n <xsl:copy>\n <xsl:apply-templates select=\"node()|@*\">\n <xsl:with-param name=\"pDoc2\" select=\"$pDoc2\"/>\n </xsl:apply-templates>\n </xsl:copy>\n </xsl:template>\n\n <xsl:template match=\"/\">\n <xsl:apply-templates select=\"*\">\n <xsl:with-param name=\"pDoc2\" select=\"$vDoc2\"/>\n </xsl:apply-templates>\n\n -----------------------\n\n <xsl:apply-templates select=\"$vDoc2\">\n <xsl:with-param name=\"pDoc2\" select=\"/*\"/>\n </xsl:apply-templates>\n </xsl:template>\n\n <xsl:template match=\"Player/*\">\n <xsl:param name=\"pDoc2\"/>\n <xsl:if test=\n \"not(. ", "= $pDoc2/*/*[name()=name(current())])\">\n <xsl:call-template name=\"identity\"/>\n </xsl:if>\n </xsl:template>\n\n <xsl:template match=\"Name|Team|Pos\" priority=\"20\"/>\n</xsl:stylesheet>\n\nwhen this transformation is applied on the same first document as above, the correct diffgrams are produced:\n<Stats Date=\"2011-01-01\">\n <Player Rank=\"1\">\n <GP>39</GP>\n <PlusMinus>20</PlusMinus>\n <GW>3</GW>\n <ShotPctg>154</ShotPctg>\n </Player>\n</Stats>\n\n -----------------------\n\n <Stats xmlns:xsl=\"http://www.w3.org/1999/XSL/Transform\" Date=\"2011-01-01\">\n <Player Rank=\"2\">\n <GP>38</GP>\n <PlusMinus>15</PlusMinus>\n <GW>4</GW>\n <ShotPctg>158</ShotPctg>\n </Player>\n</Stats>\n\nHow this works:\n\nThe transformation is applied on the first document, passing the second document as parameter.", "\nThis produces an XML document whose only leaf element nodes are the ones that have different value than the corresponding leaf element nodes in the second document.", "\nThe same processing is performed as in 1. ", "above, but this time on the second document, passing the first document as parameter.", "\nThis produces a second diffgram: an XML document whose only leaf element nodes are the ones that have different value** than the corresponding leaf element nodes in the first document\n\nA:\n\nOkay... I finally opted with a pure C# solution to compare the two XML files, without using the XML Diff/Patch .dll and without even needing to use XSL transforms. ", "I will be needing XSL transforms in the next step though, to convert the Xml into HTML for viewing purposes, but I have figured an algorithm using nothing but System.", "Xml and System.", "Xml.", "XPath.", "\nHere is my algorithm:\nprivate void CompareXml(string file1, string file2)\n{\n // Load the documents\n XmlDocument docXml1 = new XmlDocument();\n docXml1.Load(file1);\n XmlDocument docXml2 = new XmlDocument();\n docXml2.Load(file2);\n\n // Get a list of all player nodes\n XmlNodeList nodes1 = docXml1.SelectNodes(\"/Stats/Player\");\n XmlNodeList nodes2 = docXml2.SelectNodes(\"/Stats/Player\");\n\n // Define a single node\n XmlNode node1;\n XmlNode node2;\n\n // Get the root Xml element\n XmlElement root1 = docXml1.DocumentElement;\n XmlElement root2 = docXml2.DocumentElement;\n\n // Get a list of all player names\n XmlNodeList nameList1 = root1.GetElementsByTagName(\"Name\");\n XmlNodeList nameList2 = root2.GetElementsByTagName(\"Name\");\n\n // Get a list of all teams\n XmlNodeList teamList1 = root1.GetElementsByTagName(\"Team\");\n XmlNodeList teamList2 = root2.GetElementsByTagName(\"Team\");\n\n // Create an XmlWriterSettings object with the correct options. ", "\n XmlWriter writer = null;\n XmlWriterSettings settings = new XmlWriterSettings();\n settings.", "Indent = true;\n settings.", "IndentChars = (\" \");\n settings.", "OmitXmlDeclaration = false;\n\n // Create the XmlWriter object and write some content.", "\n writer = XmlWriter.", "Create(StatsFile.", "XmlDiffFilename, settings);\n writer.", "WriteStartElement(\"StatsDiff\");\n\n // The compare algorithm\n bool match = false;\n int j = 0;\n\n try \n {\n // the list has 500 players\n for (int i = 0; i < 500; i++)\n {\n while (j < 500 && match == false)\n {\n // There is a match if the player name and team are the same in both lists\n if (nameList1.Item(i).InnerText == nameList2.Item(j).InnerText)\n {\n if (teamList1.Item(i).InnerText == teamList2.Item(j).InnerText)\n {\n match = true;\n node1 = nodes1.Item(i);\n node2 = nodes2.Item(j);\n // Call to the calculator and Xml writer\n this.", "CalculateDifferential(node1, node2, writer);\n j = 0;\n }\n }\n else\n {\n j++;\n }\n }\n match = false;\n\n }\n // end Xml document\n writer.", "WriteEndElement();\n writer.", "Flush();\n }\n finally\n {\n if (writer !", "= null)\n writer.", "Close();\n }\n}\n\nXML Results:\n<?", "xml version=\"1.0\" encoding=\"utf-8\"?", ">\n<StatsDiff> \n <Player Rank=\"1\">\n <Name>Sidney Crosby</Name>\n <Team>PIT</Team>\n <Pos>C</Pos>\n <GP>0</GP>\n <G>0</G>\n <A>0</A>\n <Points>0</Points>\n <PlusMinus>0</PlusMinus>\n <PIM>0</PIM>\n <PP>0</PP>\n <SH>0</SH>\n <GW>0</GW>\n <OT>0</OT>\n <Shots>0</Shots>\n <ShotPctg>0</ShotPctg>\n <ShiftsPerGame>0</ShiftsPerGame>\n <FOWinPctg>0</FOWinPctg>\n </Player>\n\n <Player Rank=\"2\">\n <Name>Steven Stamkos</Name>\n <Team>TBL</Team>\n <Pos>C</Pos>\n <GP>1</GP>\n <G>0</G>\n <A>0</A>\n <Points>0</Points>\n <PlusMinus>0</PlusMinus>\n <PIM>2</PIM>\n <PP>0</PP>\n <SH>0</SH>\n <GW>0</GW>\n <OT>0</OT>\n <Shots>4</Shots>\n <ShotPctg>-0,6000004</ShotPctg>\n <ShiftsPerGame>-0,09999847</ShiftsPerGame>\n <FOWinPctg>0,09999847</FOWinPctg>\n </Player>\n[...]\n</StatsDiff>\n\nI have spared to show the implementation for the CalculateDifferential() method, it is rather cryptic but it is fast and efficient. ", "This way I could obtain the results wanted without using any other reference but the strict minimum, without having to use XSL...\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006070162635296583, 0.0006415689131245017, 0.0007271860376931727, 0.0006190649583004415, 0.0009522676118649542, 0.0006190649583004415, 0.0007988456636667252, 0.0006190649583004415, 0.0006541593465954065, 0.0005837626522406936, 0.0007019268232397735, 0.0008313134894706309, 0.001218466437421739, 0.001090841251425445, 0.000652262126095593, 0.0009479260770604014, 0.0015225274255499244, 0.0013234313810244203, 0.0013252987992018461, 0.000712452398147434, 0.0007408641977235675, 0.09581080079078674, 0.0006392319337464869, 0.000576384540181607, 0.0006124976789578795, 0.0012201546924188733, 0.0010075138416141272, 0.0009363358840346336, 0.000590443320106715, 0.0006183676305226982, 0.0005798755446448922, 0.0007195021025836468, 0.0006134131690487266, 0.0006655139150097966, 0.0008510310435667634, 0.003197301644831896, 0.0016997171333059669, 0.0007166447467170656, 0.0007513646851293743, 0.000673373113386333, 0.0011836455669254065, 0.0006404274608939886, 0.0010464759543538094, 0.0006982985651120543, 0.03272205963730812, 0.0008127700421027839, 0.0007995950290933251, 0.002872287528589368, 0.0024486423935741186, 0.0006151792476885021, 0.0006190649583004415, 0.002530517987906933, 0.0006391557981260121 ]

[ "Bluum Mom & Baby Box Review & Giveaway!", "\n\nBluum is a monthly subscription service that makes finding and discovering great new ESSENTIAL products fun and easy! ", "Each month a new box is set up full of samples of great brands perfect for new and expecting moms as well as babies! ", "This way, you can try the products before you buy! ", "Bluum’s monthly products are picked by an expert mom team looking to find products that will really stand out and help you as your raise your children and enjoy motherhood! ", "Samples are geared towards babies 0-12 months but Bluum hopes to branch into other age ranges soon!", "\n\nWhen my Bluum box arrived I set up my webcam and opened it so you could see the box just like it was being opened! ", "Now, keep in mind I am *not* a video blogger for a reason! ", "But, here is my modest attempt at a vlog! ", "Check out the contents of my Bluum Box!", "\n\nHere’s a recap! ", "My Bluum box included: Episencial Soothing Cream, Yu-Be Moisturizing Skin Cream, Spiffies Cleaning & Teething Tooth Wipes, Dr Sears Baby Wash & Shampoo, Dapple Baby Bottle & Dish Liquid and Plum Organics Tots Peach Mish Mash Organic Fruit Snack. ", "The really cool thing about Bluum is you never know what you will get giving you the chance to learn about great new brands and try products you may not have ever heard of before! ", "While I have heard of 4 out of the 6 brands I received to try, I have only ever tried one of the products (Plum Organics) from my box and I already know that one is a hit with my youngest so it was a welcome treat!", "\n\nI loved that everything that came in my box is totally applicable and something we can and will use! ", "It was fun to read and learn about the products and the first one I couldn’t wait to try was the Dapple dish soap! ", "It promised to remove odors from sippy cups – a big problem here in our home! ", "I really loved Dapple and already plan to pick up a full sized bottle to save our stinky sippy cups of the future! ", "I also had a lot of fun with the Yu-Be Moisturizing Skin Cream! ", "It is for any dry skin, cracks, chapped lips, hard heels, eczema, sunburns, or split cuticles so I applied it everywhere I could think of! ", "While I wasn’t a fan of it on my lips I did love it on my heels and cuticles!", "\n\nYou can start a subscription for Bluum’s monthly sample box for as low as $9/month with month-to-month, 3-month, or an annual subscription option available!", "\n\nWin It!", "\n\nTWO A Mom’s Take readers will win a 3-month Bluum Box Subscription!(Picture is sample only, not actual prize)Ends 1/13/2012 at 11:59 PM ET. ", "Open to US Only.", "\n\n*** GIVEAWAY CLOSED ***\n\nDisclosure: I received a 1-year subscription to Bluum in exchange for my honest review. ", "I was not compensated in any other manner. ", "The opinions expressed above are my own and any claims should be verified on the sponsor’s site.", "\n\nReader Interactions\n\nComments\n\nI actually have been disappointed in my Bluum.com experience so far. ", "There was an initial problem placing my order and it took 4 days for anyone to get back to me, and another week to actually process the order. ", "Then I was super excited to get my first box… and very disappointed in the contents. ", "The cute little fuzzy rattle was the only redeeming product, the food storage bags might be OK but don’t have a use for them now. ", "The diaper rash ointment contains Wintergreen oil/methyl salicylate so NO WAY am I putting that on my baby’s skin (and it’s too chalky for me to use for myself – threw that sample away after one use). ", "They have 2 more boxes to try and win me over, but at this point I definitely won’t be renewing my subscription. ", "Just glad I didn’t pay full price!", "\n\nEmail used for daily emails is yobonks(at)gmail(dot)com – there wasn’t a spot for it on the form.", "\n\nPrimary Sidebar\n\nFind a Post\n\nSearch this website\n\nFooter\n\nHi, I'm Janel! ", "I'm the owner and lead blogger here at A Mom's Take. ", "I stay busy raising four boys age 11 and under. ", "I am a Raleigh based mom blogger that loves to travel. ", "I have been known for planning trips specifically to hit the roller coasters! ", "I'm obsessed with board games. .. ", "Meet the Team .." ]

{ "pile_set_name": "Pile-CC" }

[ 0.10144207626581192, 0.011866000480949879, 0.009302126243710518, 0.0007997775683179498, 0.13380403816699982, 0.0022011506371200085, 0.08416863530874252, 0.012170703150331974, 0.0009400281123816967, 0.34009623527526855, 0.0014465407002717257, 0.02983480878174305, 0.020406590774655342, 0.0005875687347725034, 0.0006123984348960221, 0.0010878148023039103, 0.008056962862610817, 0.15236608684062958, 0.011697071604430676, 0.050268933176994324, 0.16977083683013916, 0.0054892562329769135, 0.004893906880170107, 0.022744260728359222, 0.0006874311366118491, 0.011160067282617092, 0.0007590956520289183, 0.0005798774654977024, 0.007893209345638752, 0.0006176646566018462, 0.0006119068711996078, 0.00145573855843395, 0.048516303300857544, 0.0011309878900647163, 0.02056281641125679, 0.0023413128219544888, 0.0014999897684901953, 0.03931993618607521, 0.003425017697736621, 0.0022395593114197254, 0.0007098892237991095, 0.002910993294790387, 0.000699994619935751 ]

[ "Recent Posts\n\nLast week, the Government of Ontario announced changes to the post-secondary sector. ", "CSA was critical of the announced changes and urged the governmen...\n\nGovernment Announces New Policies: OSAP, Tuition & Ancillary Fees\n\nJanuary 22, 2019\n\n1/10\n\nPlease reload\n\nFeatured Posts\n\nStudent Associations Drive Student Success\n\nApril 22, 2016\n\nThe life of a college student is busy, to say the least. ", "Managing academic priorities, potentially working a part-time job – all while maintaining somewhat of a social life – can be difficult. ", "Student leaders take on additional responsibility by dedicating themselves to their on-campus student association.", "\n\nStudent associations (SA) play a crucial role in student success. ", "They represent the collective student voice and provide a variety of academic supports and resources. ", "SA’s dedicate time and services to providing a safe, social, and rewarding college experience for all students. ", "CSA is proud to highlight some of the significant accomplishments from our member associations.", "\n\nBrockville Students Administrative Council (SAC) supports students at St. Lawrence College (SLC) in Brockville . ", "The council’s goal for the 2015/16 year was to increase overall SAC awareness among students to enhance their college experience. ", "Based on direct requests and feedback regarding events, one-on-one conversations with students, and the biggest SAC Election turnout in history, it is evident SAC has become an important part of the students experience at SLC.", "\n\nCampaigns like Good Mood Food and Positive Body Image Workshops made a direct impact on student satisfaction while creating opportunities for individuals to get involved on campus. ", "Combined with on- and off-campus events, students had more opportunities to get involved than ever before. ", "The SA also worked toward improving student spaces on campus. ", "Funds were designated to new patio furniture, couches for the student lounge and hydration stations throughout the college.", "\n\nAll aspects of student life are equally important and SA’s recognize this. ", "While Brockville SAC worked toward raising awareness and improving student culture, the Northern College Student Association – Timmins (NCSA), from Northern College Timmins campus, focused on enhancing student supports.", "\n\nNCSA’s major initiative for the year was to ensure all students had comprehensive coverage, included mental health resources, finance services, and legal consultation services – regardless of whether or not they opted out of the student insurance benefits package. ", "NCSA accomplished this goal with no extra cost for students, and all three Northern College campuses benefit from this change.", "\n\nAnother objective for NCSA-Timmins was to reposition the SA with college administration to ensure students have an equal voice in policy, finance, and management discussions. ", "Following a full year of on-campus advocacy, the future of the SA as a collaborative partner of Northern College has been ensured.", "\n\nSA’s do tremendous work for college students across the province. ", "They drive student success. ", "Each aspect of student life is crucial, and SA’s are equipped to assist students with the knowledge, resources and services they require for a positive college experience. ", "To student leaders across Ontario, CSA thanks you." ]

{ "pile_set_name": "Pile-CC" }

[ 0.000581244588829577, 0.0006149632390588522, 0.0006828116020187736, 0.000596220837906003, 0.0005728020332753658, 0.0005611200467683375, 0.0006038032006472349, 0.0005227395449765027, 0.0005993536324240267, 0.0005578341078944504, 0.0005363980890251696, 0.000587182177696377, 0.0005635072011500597, 0.0005849695880897343, 0.0005660901078954339, 0.0006196608883328736, 0.0005766180693171918, 0.0006866960902698338, 0.0005973578663542867, 0.0005992625374346972, 0.0005324604571796954, 0.0006054838886484504, 0.0007092113373801112, 0.0005646647769026458, 0.0005352323059923947 ]

[ "Maternal inheritance of plastids and mitochondria in Cycas L. (Cycadaceae).", "\nCycas is often considered a living fossil, thereby providing a unique model for revealing the evolution of spermatophytes. ", "To date, the genetic inheritance of these archaic plants is not fully understood. ", "The present study seeks to document the process of organelle inheritance in an interspecific cross of Cycas species. ", "Extranuclear organelle DNA from chloroplasts and mitochondria was analyzed using both polymerase chain reaction-restriction fragment length polymorphism analysis and microscopy. ", "Here, we show that the chloroplasts and mitochondria in the progeny of interspecific crosses between Cycas taitungensis and Cycas ferruginea were exclusively inherited from the female parent. ", "Epifluorescence microscopic analyses of the pollen cells from Cycas elongata indicated that there was a significant degradation of organelle DNA in male reproductive cells following maturation; the DNA fluorescent signals were only seen after pollen mitosis two, but not detectable at mature stage. ", "Lack of organelle DNA fluorescent signal in prothallial cells was confirmed by the absence of plastids and mitochondria in electronic microscopic images. ", "In conclusion, these data suggest that the maternal plastid and mitochondrial inheritance in Cycas, native to the old world, are the same as seen in seed plants." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006957305013202131, 0.0011736578308045864, 0.0005884662386961281, 0.0005520101985894144, 0.0008399896323680878, 0.0008278723689727485, 0.0006319329841062427, 0.0008209050283767283, 0.0005773533484898508 ]

[ "1. ", "Field of the invention:\nThe instant invention relates to the distribution, either incorporated into a, generally video, program signal (e.g., in the vertical blanking interval (“VBI”) or other portion of the signal not devoted to program information, of the associated or a previous frame) or via a separate channel, of human and/or artificial intelligently generated auxiliary information. ", "The auxiliary information is used to selectively record and/or display one of several subsets of program segments. ", "These subsets comprise options that are progressively abstracted, alternatively rated, selectively limited to particular subject matter, or otherwise diverse versions of the program material. ", "A settop box, advanced, digital or HDTV television, multimedia computer, or other similar device, records and/or displays the selected subset of program segments under control of the auxiliary information and user input.", "\n2. ", "Description of Related Art:\nThose who practice the instant invention are those familiar with, and skilled in, arts such as: electrical, electronic, systems, computer, digital, communications (e.g., digital and analog communications network, telephone, audio, video, radio, television, broadcast, cable, etc.) ", "and other related hardware and software engineering and design disciplines; media technology; production, programming and editing of computer media, interactive media, multimedia, computer graphic and animation, video, audio and other media; interactive media and human interface design; artificial intelligence, neural networks, expert systems, fuzzy logic, etc.; ", "image processing, sound processing, speech recognition and pattern recognition; etc. ", "Nevertheless, the inventive matter does not constitute these arts in and of themselves, and the details of these arts are within the public domain and the ken of those skilled in the arts.", "\nThe instant disclosure will not dwell on the details of system implementation in such arts but will, instead, focus on the novel designs of: systems, data structures, interfaces, processes, functions and program flows, and the novel purposes for which these are utilized.", "\nThe instant application relies on the existence of well-known systems and components including, but not limited to: personal computers; multimedia systems; systems used for the production and broadcasting or cablecasting of analog and digital media including television, multimedia and interactive media; the use of VBI, SAP and other ‘piggybacked’ signals; delivery of information via communications networks, including the internet optical and magnetic recording of analog and digital signals, including computer and video information; settop boxes, advanced, digital and HDTV televisions, multimedia computers, and other consumer electronic devices including TiVo, Replay, the ‘V-Chip’, etc.; ", "professional and home Intercast (VBI insertion/detection) equipment; ‘digital video library’ and other multimedia access and search systems; and, other related devices and technologies, and those which may be substituted for them. ", "In fact, consumer devices now available, such as TiVo, with little to no modification, provide all the necessary elements, except some additional software control functions, to perform many of the embodiments, as described herein; and, the necessary modifications and/or additions are within those skilled in the appropriate arts.", "\nThe intended scope of the instant invention also includes the combination with other related technologies, now in existence or later developed, which may be combined with, or substituted for, elements of the instant invention." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0009391900966875255, 0.0005713187274523079, 0.0006105265929363668, 0.000591164396610111, 0.0006265320698730648, 0.001185585861094296, 0.0005592760280705988, 0.0006661741645075381, 0.0006125963409431279, 0.0006350039038807154, 0.00055577332386747, 0.0006154322763904929, 0.0006072315736673772, 0.0005773373995907605, 0.0006002208101563156 ]

[ "any chance, you could add an option to set Frame strata induvidually per frame, or making \"Blank Space\" able to be clicked through? ", "i made my targetstarget use the blank space of the target frame, looks decent imo, but i cant click it now :/" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005982349975965917, 0.0476609505712986 ]

[ "P1 Weekly Update for 03/08/13\n\nBetsy Brantner Smith brings us this week's update, which includes the life-saving actions of a cop who administered CPR on a man, the loss of an Ark. officer from an on-duty crash, and an officer's good deed caught on camera." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006173712899908423 ]

[ "Impact of Early Invasive Approach on Outcomes of Patients With Acute Coronary Syndrome and Baseline Anemia: Analysis From the ACSIS Registry.", "\nAnemia in patients with acute coronary syndromes (ACS) is strongly related to the increased risk of bleeding and mortality. ", "Whether benefit of early invasive strategy exceeds the risk of bleeding in these patients is unknown. ", "To assess impact of early coronary angiography on outcomes of patients with ACS and baseline anemia. ", "Biennial Israeli ACS registry (ACSIS) prospectively collects data from all 26 public hospitals. ", "The endpoints included rates of in-hospital major bleeding, as well as 30-day and 1-year mortality. ", "Anemia at baseline was present in 1,464 of 5,600 patients with ACS (26.1%). ", "Coronary angiography within index hospitalization was performed less frequently in patients with anemia (76.6% vs. 90.8%, P < 0.001). ", "Non-performance of coronary angiography was associated with older age and higher prevalence of comorbidities. ", "Among patients with anemia who underwent coronary angiography, the majority (95.5%) had obstructive coronary disease, of whom 77.8% were triaged to revascularization. ", "Performance of coronary angiography was associated with significantly lower (P < 0.0001) rates of mortality at 30 days (5.7% vs. 15.6%) and at 1 year (11.9% vs. 34.1%). ", "Major bleeding occurred with similar incidence in groups with and without coronary angiography (3.1% vs. 3.8%, respectively; P = 0.54). ", "By multivariable analysis, performance of coronary angiography was an independent predictor of lower 1-year mortality (hazard ratio [95%CI] = 0.30 [0.21, 0.44]. ", "In the setting of ACS, despite the presence of baseline anemia, early coronary angiography with subsequent revascularization, when indicated, was associated with improved clinical outcomes including 1-year mortality without significant increase in rates of major bleeding." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0005651372484862804, 0.0006953643169254065, 0.0007176309009082615, 0.0005648875958286226, 0.0005809557042084634, 0.0014069671742618084, 0.0006247911951504648, 0.0006495780544355512, 0.0006700643571093678, 0.0007368729566223919, 0.0006304693524725735, 0.0011906990548595786, 0.0005965288728475571, 0.0006323173874989152 ]

[ "Where Are Our Exclusives? ", "Grievances Of An Xbox One Owner\n\nSo I looked at the upcoming console exclusives for the Xbox One. ", "The pure console exclusives, not the ones you can play on the PC as well. ", "Currently, there are about five games waiting to be released. ", "Of those five, I’d heard of none of them. ", "Of the games that have already been released, 35 are true exclusives. ", "With those 35 games, Rare Replay and Sunset Overdrive were the only ‘full games’ that weren’t either an indie / arcade title (though the indie titles have been pretty solid, so far), or a Forza or Halo title.", "\n\nGranted, if you cast the net further. ", "Perhaps start looking at games which release on the PC or are exclusive to the platform. ", "Then the list starts to look passable. ", "But there’s nothing that’s really new. ", "At least no new AAA looking titles. ", "And there’s only one or two that really grab my interest.", "\n\nWill there be many Xbox exclusives in 2017?", "\n\nThere are a few I’ve been looking forward to for a while now, like State of Decay, Cuphead, Below and Sea of Thieves. ", "But the release dates for them are sketchy at best. ", "Maybe they’ll be out this year, maybe they won’t. ", "But when you look at PlayStation’s line-up, it’s a different story.", "\n\nYou’ve got a new Crash Bandicoot, Days Gone, God of War, The Last of Us Part II, Spider-Man, and Deep Down on the way. ", "That’s just the games exclusive to the PlayStation 4, though. ", "Open the net out and you’ve got a tonne of games, waiting to be played. ", "Alex and I discussed it in this week’s GG EZ Live Show, on Facebook. ", "You can check that out here (it’s from about the 10 minute mark).", "\n\nWhere are our exclusives?", "\n\nSo I’d like to know, where are our exclusives? ", "I mean, some of the good ones have been cancelled already. ", "Scalebound and Fable Legends are both gonners. ", "What’s next? ", "Below’s looking pretty ropey and Undead Labs have gone rather quiet about State of Decay 2 (though I’m relatively confident we’ll be seeing it late this year or early next year). ", "It just feels like the Xbox One is lacking excitement at the moment. ", "Though that’s not to say that the PlayStation is killing it with their exclusives – they’re just doing a slightly better job.", "\n\nBut what do you think? ", "Do you wish that the Xbox One had better, or more, exclusives? ", "Or are you happy with the big titles – your Halo Wars, Crackdowns and Forzas? ", "Let me know in the comments below!", "\n\nOh, and before you say it. ", "Yes I do realise that I brought this on myself by buying an Xbox One – cheers.", "\n\nDrunkSuperman\n\nwhere are they? ", "simple, they are most likely being pushed towards the Scorpios library\n\nSnagg Dadon\n\nlol i have all console you sir are a liar ps4 exclusives are awesome right now!!!! ", "check metacritic or sumtn ….i wanted xb1 to be better but i have no games for it…\n\nGamingOnForLife\n\nWait…did you just cite Deep Down as an upcoming game…? ", "DEEP DOWN? ", "That game has not been seen for years. ", "No guarantee it will ever come out.", "\n\nYou’re also dreaming if you think Last Of Us 2 is out in 2017 or even 2018. ", "God of War 4 is a coin toss as to whether it will be 2017 as well. ", "You look at how Sony positions their releases, favouring spring time so 2018 looks likely. ", "So this year you’ve got the excellent Horizon Zero Dawn, Nioh, GT Sport, Nier and potentially Detroit.", "\n\nAnd why are saying State of Decay 2 has gone quiet? ", "Check their twitter, they are regularly posting concept art and teasing their full reveal and release date at E3.", "\n\nPeople are quick to forget in 2016 Xbox had Quantum Break, Recore, Forza Horizon(GOTY contender) Gears 4 and Dead Rising 4 alongside a number of indie games. ", "Xbox user got to play Ark Survival Evolved first. ", "Astroneer first. ", "Will be getting Conan Exciles first and has had We Happy Few first and Elite Dangerous first.", "\n\nJ.j. ", "Barrington\n\nSo much wrong with this comment.", "\n\nLike Dead Rising. ", "Do timed exclusives count? ", "You say “a number of indie games,” but don’t seem to count those towards Sony’s library. ", "And yes, that matters, because it’s an obvious comparison.", "\n\nThere are games left off your Sony exclusive list, like Spider Man, Dreams, and whatever Sucker Punch is working on.", "\n\nFor your Xbox list, Crackdown has been coming out for forever, so has Cuphead. ", "Forza’s yet another Forza, and that’s part of the problem.", "\n\nSimply put, when you look at the number of big exclusives on either console- and Recore’s price alone tells you it’s not in the argument- there’s no comparison.", "\n\nSo what are you so bothered about?", "\n\nGamingOnForLife\n\nThe overwhelming sense of panic the author presents is what gets me. ", "A great game came out on PlayStation, good for PS4 owners. ", "Doesn’t mean the sky is falling and you just forget the games you have literally just been playing on Xbox all year around.", "\n\nI get it’s easy to dismiss Forza because it’s a racing game and it may not be your thing but if your criticising it for being a sequel then could we not say that about God of War 4(technically game 5), Uncharted 4(technically game 5)? ", "I’m not attacking those games, as Forza, GoW and Uncharted are all acclaimed games. ", "Horizon and Motorsport also cater to two very different groups of gamers.", "\n\nYou call out Crackdown for ‘coming out forever’ but then name drop Dreams? ", "Pretty sure they’re close in when they were announced. ", "I’ll take SpiderMan though, that one I did miss out.", "\n\nOn Recore, the price of a game is not an immediate indicator of it’s quality. ", "I happened to enjoy that game as I’m sure PS4 users may have enjoyed the Order or Knack. ", "I might add though that those two games scored lower in reviews than Recore but did cost more.", "\n\nLordCancer Kain\n\nthe sky fell on 360. ", "there is no sky for one, just nothingness.", "\n\nJ.j. ", "Barrington\n\n“Doesn’t mean the sky is falling and you just forget the games you have literally just been playing on Xbox all year around.”", "\n\nIt’s been coming for years. ", "Since last generation. ", "It’s not just “a great game” that came out. ", "It’s multiple such titles. ", "It’s not just Horizon: Zero Dawn, not just about the first party, either. ", "It’s about the overall gap in libraries.", "\n\n“I get it’s easy to dismiss Forza…”\n\nDismissing it, as you call it, because it comes out every year. ", "Even if you split Horizon and Motorsport- and Xbox fans sure don’t; nor do prospective buyers, as they’ll just see another racer- that’s still an entry every other year, which is just TOO frequent. ", "Not strictly because it’s a sequel, but because it’s already caught its biggest rival in numbered titles, and it’s like a decade younger.", "\n\n“You call out Crackdown for ‘coming out forever’ but then name drop Dreams?”", "\n\nCrackdown AND Cuphead. ", "Previously, I would have added Scalebound to that list, but… I’m sure we could list other titles that have just taken a long while to come out on Xbox. ", "There aren’t so many of those on PS4, particularly that Sony has any control over(since you’ve already mentioned Deep Down). ", "And I think we’ve seen far more of Dreams than of Crackdown at this point.", "\n\n“On Recore, the price of a game is not an immediate indicator of it’s quality.”", "\n\nWasn’t speaking of the quality, but rather the status. ", "Simply put, it’s not one of the bigger releases on either console, and the price reflects that. ", "The asking price of all the other titles we’re talking about is full, quality aside.", "\n\n” I might add though that those two games scored lower in reviews than Recore but did cost more.”", "\n\nI might add that in both cases, reviewers seemed to want something in the games that was never meant to be there. ", "But that’s a whole different story.", "\n\nMiamiBeachMedMan\n\nTo be fair, the author only mentioned a few games, but for Sony, my personal list looks like this…\n\nCurrently playing – Gravity Rush 2, Yakuza 0, and Nioh.", "\n\nSoon to be playing – Horizon Zero Dawn, Nier Automata, and Persona 5.", "\n\nWill play later – God of War 4, Uncharted the Lost Legacy, TLOU Part II, Detroit Become Human, Wild, What Remains of Edith Finch, Spider-Man, Dreams, Gran Turismo Sport, Death Stranding, Days Gone, Hellblade, Ni No Kuni II, Gang Beasts, Nex Machina, the list goes on and on, and hopefully one or two games soon to be announced we don’t know about, certainly Sucker Punch’s unannounced title.", "\n\nFor Microsoft?", "\n\nCurrently playing – nothing. ", "Halo Wars II is not my taste as I’m not an RTS fan.", "\n\nSoon to be playing – nothing.", "\n\nWill play later – Crackdown (I can only hope development for this one is going smoothly), Below, Cuphead, State of Decay, and hopefully one or two games soon to be announced we don’t know about.", "\n\nSo while this list caters to my own personal taste, even considering tastes of various gamers, it’s not really a fair fight, and it has not been a fair fight for quite some time now. ", "That much is hard to dispute, and only someone with a closed mind to the reality of the industry at the moment would even try. ", "And I’m not suggesting that is what you’re doing, but I have seen others feebly attempt to pretend like somehow Microsoft is “winning”, or producing better content for consumers. ", "That notion is laughable.", "\n\nThere but 90% of those are third party Japanese niche titles, those company’s could easily release on Xbox one, the reason they don’t it because of how Xbox one is doing in japan , so really if you took away all those niche Japanese titles then Sony would nothing\n\nJ.j. ", "Barrington\n\nThe reason they don’t is because those games don’t do well on Xbox, which is why Xbox doesn’t do well in Japan.", "\n\nDaniel Long\n\nanother bullshit article with no research, what were the media saying when Sony had no games 2014/2015/2016 shit all they were stone cold quiet, typical Microsoft released 5 tripple a titles last year compared with Sony’s like 2\n\nXbox has already released Rise and Shine and Halo Wars 2 and coming soon\n\n“that’s not what real gamers care about”? ", "What games that continually scoring high review scores?", "\nNioh\nGravity Rush 2\nYakuza 0\nHorizon Zero Dawn\nNier Automata\nAll killing it.", "\n8 out of 10 highest rated games this year are available on PS4 but not xbox. ", "Sony are miles ahead.", "\n\nTomaterrrx\n\nDon’t think we’ll get Halo 6 this year.", "\n\nJ.j. ", "Barrington\n\nHalf of what you list is speculation. ", "The rest is DLC or not even exclusive. ", "That’s horrible.", "\n\nDaniel Long\n\nAre you alright man, 20 out of the 25 games I listed are confirmed, and what DLC I have listed, and most of these are exclusive to console on Xbox One do your research before running your mouth\n\nJ.j. ", "Barrington\n\nLol, all that “at this stage” stuff is hilarious. ", "It’s still sad that you list DLC like it’s a full game. ", "The TR game is barely a rumor, let alone exclusive. ", "You just listed developers like that confirms anything. ", "There’s NOTHING to go on for Ion. ", "Conan and The Culling are both multiplats. ", "That’s almost half your list.", "\n\nAnd you seriously think Voodoo Vince is gonna do better than even Gravity Rush?", "\n\nYou would have been better off NOT defending this garbage.", "\n\nDaniel Long\n\nOkay then you enjoy all those Japanese niche titles that none of you play station fans will buy, and enjoy your best Tripple A game that will release this year in Horizon,\n\nnearly forgot about Grand Turismo Sport, how long has this game been in development, since the start of the PS4 cycle, Turn 10 will release Forza 7 this year making that including Forza Horizon games 5 Forza games they will have released this gen, and Polyphony can’t even release 1 GT game.", "\n\nyour the one wasting his time here, I need to get back to finishing mass effect 3 via backwards compatibly before Andromeda comes out, which I will be able to play a week early thanks to EA Access, thanks for telling Sony that you don’t need EA Access, wait it was Sony telling you, don’t need it just like you don’t need Back Compat, LOL\n\nTomaterrrx\n\nFanboy comment of the day goes to you lol.", "\n\nGamez Rule\n\n“Turn 10 will release Forza 7 this year making that including Forza Horizon games 5 Forza games they will have released this gen” = Milking big time IF that is five titles in one gen.", "\n\nTomaterrrx\n\nThat’s nice to know. ", "If the games were getting worse then I’d have an issue with them milking the game. ", "But Forza games aren’t getting worse (not by a lot anyway). ", "I’ll continue to let MS take my money as long as the games are good. ", "FH3 is arguably the highest rated racer this gen and it’s amazing.", "\n\nJ.j. ", "Barrington\n\n“all those Japanese niche titles that none of you play station fans will buy,”\n\nRight, cuz Raiden, Ion, Beacon, Graveyard Keepers and so many other games on that list are big sellers.", "\n\n“enjoy your best Tripple A game that will release this year in Horizon,”\n\nDude, “triple” is a word you learn to spell in elementary school. ", "Not that hard. ", "That aside, there’s already been Nioh, Gravity Rush 2, and Yakuza 0, and I’m probably missing a few. ", "GT Sport IS coming up, and so are Persona, Valkyria Revolution, Crash Bandicoot, FFXII, Hellblade… yeah, nothing of quality to play there. ", "/s\n\n“how long has this game been in development, since the start of the PS4 cycle”\n\nPossibly, but I don’t see how it’s a negative that they don’t rush out a game every year or very other year.", "\n\n“Turn 10 will release Forza 7 this year making that including Forza Horizon games 5 Forza games they will have released this gen,”\n\nAh, so it’s better to run a franchise into the ground having a release every year? ", "I get it.", "\n\n“I need to get back to finishing mass effect 3 via backwards compatibly”\n\nWhat? ", "No current gen games to play right now, and your next current gen game is a multiplat? ", "Yeah, I’m really jealous of you.", "\n\n” just like you don’t need Back Compat”\n\nWell, since I still have a PS3, I actually DON’T need BC. ", "And while there are still plenty of older generations titles that I like to play, I’ve got a backlog of current generation games to get through, too.", "\n\nMan, I know you won’t get it, but you just argued against yourself, there.", "\n\nI own both PS4 and XB1. ", "I’ve been gaming since Atari. ", "Never in my life have I hated an actual console until the XB1. ", "Biggest purchase regret I’ve ever made.", "\n\nGamez Rule\n\nYet again within this generation Sony has shown that they still continue to bring a stronger first party support system on PS4 than what Microsoft offers for the Xbone. ", "MS’s first party efforts have always paled in comparison to Sony’s and it looks like nothing has changed that view either.", "\n\nIMO from being an Xbone owner I believe it’s getting worse for the Xbone supporters, I mean where are our TRUE exclusive games for Xbone and NOT network exclusives that we are being shown all the time, because at this moment where is the incentive to purchase the Xbone if you already have a PC? ", "At least PC users don’t have to pay to play online using the same games Xbone users do.", "\n\nJust look at Quantum Break, I bought the Xbone version which at one time was a classed as a FULL exclusive title for Xbone only, then within weeks of release it become a network exclusive ( Xbone & Windows 10 ), then it was released on Steam in which I bought from their myself too. ", "Why not just make FULL exclusive titles on Xbone like we see on PS4 like *Horizon: Zero Dawn." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0008611558587290347, 0.0006381617859005928, 0.0006626901449635625, 0.0006425207830034196, 0.0007404943462461233, 0.0006814090884290636, 0.0007238358375616372, 0.0007022664649412036, 0.0005701437476091087, 0.0007449104450643063, 0.0009010207722894847, 0.0008347461698576808, 0.0006683111423626542, 0.0009010182111524045, 0.0035243413876742125, 0.0005656483699567616, 0.0014107495080679655, 0.000685326405800879, 0.026042979210615158, 0.0007612108020111918, 0.02483868971467018, 0.0010947202099487185, 0.000549770484212786, 0.0008611558587290347, 0.0007071145228110254, 0.0006091499235481024, 0.00076059449929744, 0.0008947924943640828, 0.0006560483016073704, 0.0006420286372303963, 0.002047022106125951, 0.0007483658846467733, 0.0007517564808949828, 0.0008660300518386066, 0.0006147976382635534, 0.001008972991257906, 0.0008041732362471521, 0.37139466404914856, 0.7018998265266418, 0.0008702973136678338, 0.0009820155100896955, 0.0006552631384693086, 0.0010227711172774434, 0.0006783753051422536, 0.001577169867232442, 0.0005583721213042736, 0.000744881690479815, 0.0008185042534023523, 0.0005492959171533585, 0.0007586764986626804, 0.0009509650408290327, 0.0007265110034495592, 0.021170657128095627, 0.0010347530478611588, 0.0012285197153687477, 0.001752832205966115, 0.0009853490628302097, 0.0006106170476414263, 0.0007444183574989438, 0.00815857108682394, 0.0988948792219162, 0.0789911150932312, 0.0007691002101637423, 0.0010797107825055718, 0.003026224672794342, 0.00079835404176265, 0.004387363791465759, 0.0007264919695444405, 0.0007239327533170581, 0.0006208192207850516, 0.03775390610098839, 0.000563856097869575, 0.0008125114254653454, 0.0008573821396566927, 0.0006418254924938083, 0.0009463779861107469, 0.004189291503280401, 0.0017487021395936608, 0.0010347530478611588, 0.0023229923099279404, 0.0006976915756240487, 0.0006830247584730387, 0.0009763267007656395, 0.0007822172483429313, 0.0006734323687851429, 0.0009234814788214862, 0.0007727005868218839, 0.0006903831963427365, 0.0007094931788742542, 0.03732888400554657, 0.11998848617076874, 0.0006528326775878668, 0.0006625414243899286, 0.0006898890133015811, 0.0013401142787188292, 0.000627163564786315, 0.0006897749262861907, 0.0006999025354161859, 0.0009073352557606995, 0.0005739931366406381, 0.0007418246241286397, 0.0005979294655844569, 0.0007714384119026363, 0.0032026811968535185, 0.0006722669932059944, 0.028457434847950935, 0.0026472818572074175, 0.040192123502492905, 0.0008955392404459417, 0.0008855226333253086, 0.0006393425283022225, 0.012150718830525875, 0.001268199528567493, 0.0009099256130866706, 0.0010412858100607991, 0.7824530601501465, 0.0007504573441110551, 0.0325467549264431, 0.0008510714978910983, 0.0008564305026084185, 0.0008829099824652076, 0.0010347530478611588, 0.0008623188477940857, 0.0007534533506259322, 0.19674773514270782, 0.26854920387268066, 0.0024233125150203705, 0.0036671198904514313, 0.001625736360438168, 0.000599773891735822, 0.007184408139437437, 0.0010815364075824618, 0.10676910728216171, 0.00162622076459229, 0.7993589043617249, 0.0009392567444592714, 0.029544226825237274, 0.0007734019309282303, 0.0008327302639372647, 0.0032640001736581326, 0.000999673968181014, 0.0012293197214603424, 0.0009482639143243432, 0.0010347530478611588, 0.0010885606752708554, 0.023305296897888184, 0.0018696177285164595, 0.0006924733752384782, 0.001643447671085596, 0.0006220289506018162, 0.0006760373944416642, 0.0008286928641609848, 0.0007552987080998719, 0.0011323171202093363, 0.0012520852033048868, 0.010122185572981834, 0.0005749481497332454, 0.0011702976189553738, 0.002162560587748885, 0.0008851193706505001, 0.0017013483447954059, 0.002348345937207341, 0.0006918734288774431, 0.000719008909072727, 0.0008954547811299562, 0.0009549022070132196, 0.0005677874432876706, 0.0007815288263373077 ]

[ "After years of erasure and dehumanization, Indigenous youth will finally have something for themselves in Molly of Denali says Charitie Ropati\n\nIn a country where media continues to misconstrue who we really are, accurate representation becomes almost shocking. ", "​Pocahontas ​was the first film where I saw and heard the word “Indian” on screen and the film wasn’t historically accurate. ", "It played into the narrative of white saviorism, something I wouldn’t understand until I was older. ", "Then it was ​Peter Pan​. Despite feelings of uneasiness as I watched the red caricature play the flute, I saw myself. ", "But it painted my people as if we were of the past. ", "The combination of the fetishization of native women in the film and the reinforcement of racist stereotypes by the color of their skin made me uncomfortable as I gazed at the cartoonish Indians. ", "I asked myself as a six-year old if those that I saw on the screen were my people, growing ashamed of how grotesque the characters were.", "\n\nAs I grew older, I realized that I had to ask myself whether or not these films and television shows perpetuated disparaging stereotypes? ", "Are they harmful? ", "Do they reinforce the harmful narrative of the “red-skinned Indian?” ", "These are the questions that many Native peoples have had to ask themselves because of the long history of erasure and misrepresentation. ", "Molly of Denali was different. ", "I walked into the National Museum of the American Indian with these same questions at the premiere. ", "When the episode titled​ Native Names​ ended I realized that Native youth would finally have a culturally accurate show, a show that they could see themselves in. ", "I was astounded, shocked and even grew emotional because it wasn't another culturally insensitive caricature but was contemporary, modern, and reflected the lives of Alaska Native children.", "\n\nPictured Left to Right: Charitie Ropati Yupi'k, Edith Spear Inupiaq, Alexiah Ahkiviana Inupiaq. (", "Photo: Charitie Ropati)\n\nMolly of Denali has the potential to address stereotypes perpetuated by mainstream media and Hollywood. ", "When people think of Alaska, they think of “Eskimos and igloos” but my people are more than a racist narrative given by colonizers. ", "We are resilient, intelligent, modern, and reflect beyond the preconceived notions of “Eskimos.” ", "We are here and we still exist, this is what the show means. ", "There is a resurgence and revitalization of Indigenous peoples across the country, from the first Native American lead on Netflix, Sivalyna Rose, to an animated series on an Alaska Native girl, spaces previously dominated by Eurocentric ideals are being indigenized.", "\n\nRepresentation matters.", "\n\nI have never truly seen myself in Western media. ", "PBS Kids will broadcast a show with an Alaska Native lead, there is power in that statement. ", "This isn’t “another Dora,” this is Molly of Denali and after years of erasure and dehumanization, Indigenous youth will finally have something for themselves.", "\n\nCharitie Ropati, Yup’ik, is an enrolled member of the Native Village of Kongiganak. ", "She is a 2019 Center for Native American Youth Champion for Change and Columbia University student studying Civil Engineering and Politcal Science." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0008834531763568521, 0.0010357452556490898, 0.0008297429885715246, 0.000872962933499366, 0.0008637806749902666, 0.03862221539020538, 0.005980219691991806, 0.0006897998973727226, 0.0010482416255399585, 0.040709495544433594, 0.0006844433373771608, 0.0008713066927157342, 0.0005436015198938549, 0.0006034447578713298, 0.0006800943519920111, 0.0007908439729362726, 0.0007130457670427859, 0.01803695783019066, 0.002122867153957486, 0.001057360554113984, 0.0005952161736786366, 0.0007897978648543358, 0.0007489373674616218, 0.0005986251635476947, 0.004478749353438616, 0.0010005211224779487, 0.0006481641321443021 ]

[ "Congratulations to HumanTown, who won $500K in production financing and a half-hour special for CBC prime time. ", "For 10 weeks comedy creators from across Canada created hilarious videos and awesome artwork to help develop and package their projects. ", "The Top Teams advanced towards the Big Deal through voting and social support from fans around the world!", "\nCheck out HumanTown!", "\n\nShare Charlie And Yoni. #", "LifeAfter30.", "\n\nRunners-Up\n\nComedy Fans: Stay Tuned!", "\n\nCBC ComedyCoup may be over, but there’s still a half hour comedy special that’s on its way to CBC prime time in 2015 and we’ve got to produce that sh*t! ", "For the latest updates on what’s happening with our 9 optioned projects, sign up!" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005894621135666966, 0.0007162684923969209, 0.0005404005642049015, 0.014458087272942066, 0.0008344721863977611, 0.0017147271428257227, 0.000823078618850559, 0.37187692523002625, 0.0007410431862808764 ]

[ "Tickets for the re-opening concert will go on sale Friday, December 12th at noon over at Ticketmaster. ", "Pricing has not yet been announced, but I imagine this price-tag for a ticket to this special concert will carry at least 3 digits." ]

{ "pile_set_name": "Pile-CC" }

[ 0.000705533311702311, 0.0005579362041316926 ]

[ "In a paper conveying apparatus of an image reading apparatus, image copying apparatus, etc., ", "sometimes a jam occurs when the paper moves along the conveyance path. ", "In general, a paper conveying apparatus is provided with the function of determining whether a jam has occurred by a paper being conveyed to a predetermined position inside the conveyance path within a predetermined time from the start of conveyance of the paper and of stopping the operation of the apparatus when a jam has occurred.", "\nOn the other hand, if a jam occurs, a large sound is generated in the conveyance path, so the paper conveying apparatus can determine whether a jam has occurred based on the sound which is generated on the conveyance path and thereby detect the occurrence of a jam without waiting for the elapse of the predetermined time.", "\nA paper jam detection apparatus which detects a jam sound, converts it to an electrical signal, amplifies the electrical signal, and detects the jam by the specific frequency component which is included in the amplified electrical signal has been disclosed (see Japanese Laid-Open Patent Publication No. ", "2001-302021). ", "By experimenting on various types of jams in advance, sounds which are generated when jams occur are detected, how strong the amplitude is for each frequency component is processed and analyzed, and the frequency component with a large amplitude strength is set as a specific frequency component." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0005852088215760887, 0.0006431187503039837, 0.0006349594332277775, 0.0006752463523298502, 0.0006569226388819516, 0.0007567352731712162, 0.0006113111739978194 ]

[ "It was even more impressive in person. ", "I love getting away from the city to see the stars. ", "I still see them where i live, but the light pollution never lets me get a good enough shot. ", "Plus it is nice to leave the electronics at home and get away. ", "I did have my phone but it didn't get a signal so i was totally cut off from the city." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0005504122236743569, 0.0010387888178229332, 0.0008672113181091845, 0.0008878920343704522, 0.0023629304487258196 ]

[ "Q:\n\nLinking to documentation in a comment\n\nI'd like to provide anyone reading my plugin in Vim a direct link to the help article on command-completion\nAt the moment, I'm simply saying \" :help command-completion but i'd love to do something like\" |command-completion| to allow a user to navigate directrly with C-]. ", "I've tried a few random combinations but nothing seems to work. ", "Is this possible?", "\n\nA:\n\nI assume you're following the advice in the Vim help pages (:h write-local-help) and formatting your links with double-stars and double-bars in the Vim style. ", " However, for vim to recognize them as tags, you have to set the iskeyword option correctly, namely\n:set iskeyword=!-~,^*,^\\|,^\\\"\n\nThe way Vim does this for its own help files is to use a modeline. ", " For an example of this, type :help and go to the last line in the help window. ", "Finally, you'll have to create a tags file for your plugin. ", " Use the :helptags command for that.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0005547783221118152, 0.0006313232006505132, 0.0007203164859674871, 0.0006417324766516685, 0.0007983494433574378, 0.0006238531204871833, 0.0007214081124402583, 0.0006174289155751467, 0.001995444530621171 ]

[ "1. ", "Field of the Invention\nThis invention relates to a molded article, the method for manufacturing the same and the dies therefor. ", "More particularly, this invention relates to an ornamental molded article composed of two synthetic resinous layers, and a nonwoven fabric layer with a multi-colored pattern which lies between the two synthetic resinous layers and the method and dies employed in its manufacture.", "\nThe molded article provided by this invention shows an outer appearance of marble, granite, graining or other desirable patterns of colors, and can be employed for every utility to which conventional synthetic resinous material for structure have been employed, for example, building materials, e.g., case slabs, panels, units such as a desk, a table, a washing stand, a sink or a bathtub or the like, and miscellaneous goods in which natural stones such as marbles or granite or artificial stones are used.", "\n2. ", "Description of the Prior Art\nHitherto, various artificial stones such as artificial marbles have been known and available commercially. ", "These artificial marbles are composed of a thin and transparent resinous layer of so-called gel-coating as a covering which covers a basic layer with a pattern of marble. ", "The coating compensates for the lack of resistance to chemicals, of the basic layer while providing a gloss and hardness on the surface to the basic layer. ", "The basic layer of the conventional artificial marbles comprises resins, fillers and pigments, and their marble patterns are given by utilizing a difference in fluidity of each component in the basic layer. ", "However, one needs a high skill in technique to repeatedly produce an artificial marble having an uniform pattern and quality, because the marble pattern in this technique is changeable according to a slight difference in mixing ratio of each component, to the degree of mixing and the speed of molding of the composition for the basic layer, and other conditions which affect fluidity of the composition." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0009391900966875255, 0.0005636855494230986, 0.0005513663054443896, 0.0005801516817882657, 0.001185585861094296, 0.0005674222484230995, 0.0006685376283712685, 0.0006291067693382502, 0.0005518531543202698, 0.0005460497341118753 ]

[ "Q:\n\nReturning and Summing the Odd Numbers of an Array\n\nI'm trying to add all the odd numbers in an array and return it. ", "Any thoughts on what I'm doing wrong?", "\nExample:\nInput:\nArray- [12,6,7,15,1]\nIt would return 23\n public static int sumOdds(int[] numbers) {\n sum = 0;\n for(int i = 0; i < numbers.length; i++) {\n if (numbers%2==0) \n return 0;\n else (numbers[i] % 2 !", "= 0) {\n sum += numbers;\n return sumOdds; \n }\n }\n\nA:\n\npublic static int sumOdds(int[] numbers) {\n int sum = 0;\n for(int i = 0; i < numbers.length; i++) {\n if(numbers[i] % 2 !", "= 0) {\n sum += numbers[i]; \n }\n } \n return sum;\n}\n\nThis should work. ", "return statements should not be within your if and else statements, as they will end the execution of the program immediately.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0008193771354854107, 0.00066490558674559, 0.001171393902041018, 0.0037291613407433033, 0.0013017284218221903, 0.0006754130590707064, 0.001995444530621171 ]

[ "Effects of metastasectomy and other factors on survival of patients with ovarian metastases from gastric cancer: a systematic review and meta-analysis.", "\nOvarian metastasis from gastric cancer (Krukenberg tumor [KT]) has no consensus treatment and the role of surgical treatment is still controversial. ", "Identifying prognostic factors for KT could help guide the management of this tumor. ", "We used a meta-analysis to evaluate the prognostic value of metastasectomy and other factors in patients with KT to develop a treatment plan. ", "We searched literature in PubMed, Cochrane library and EMBASE. ", "We analyzed hazard ratios (HR) and 95% confidence intervals (CI) with respect to overall survival (OS). ", "The meta-analysis included 12 cohort studies with 1,031 patients associated with longer OS following metastasectomy (HR = 0.41; 95% CI = 0.32-0.53; P < 0.001), R0 resection (HR = 0.37; 95% CI = 0.26-0.53; P < 0.001), metachronous ovarian metastasis (HR = 0.74; 95% CI = 0.58-0.93; P = 0.012), size of KT (<5 cm) (HR = 0.74; 95% CI = 0.58-0.95; P = 0.019), ECOG PS (Eastern Cooperative Oncology Group performance status) 0 to 1 (HR = 0.48; 95% CI = 0.29-0.80; P = 0.004), tumor confined to ovary (HR = 0.40; 95% CI = 0.16-0.99; P = 0.047), and tumor confined to pelvic cavity (HR = 0.36; 95% CI = 0.14-0.92; P = 0.033). ", "Shorter OS was associated with peritoneal carcinomatosis (HR = 2.00; 95% CI = 1.25-3.21; P = 0.004), ascites (HR = 1.66; 95% CI = 1.19-2.31; P = 0.003) and positive CEA (HR = 1.41; 95% CI = 1.10-1.82; P = 0.007). ", "Gastrectomy led to a slight improvement in OS, but without statistical significance (HR = 0.69; 95% CI = 0.47-1.02; P = 0.061). ", "No significant difference in OS was observed in patients with signet-ring cells (HR = 1.17; 95% CI = 0.91-1.51; P = 0.226), bilateral ovarian metastasis (HR = 0.87; 95% CI = 0.70-1.08; P = 0.212), age ≥ 50 years (HR = 0.93; 95% CI = 0.71-1.22; P = 0.619), positive CA19-9 (HR = 1.01; 95% CI = 0.75-1.35; P = 0.960), and positive CA-125 (HR = 0.98; 95% CI = 0.73-1.33; P = 0.915). ", "Various factors affect OS in patients with KT." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0019423150224611163, 0.0013443941716104746, 0.0007178463856689632, 0.0005769498529843986, 0.000568893039599061, 0.000566168047953397, 0.001323477365076542, 0.0018618186004459858, 0.0006625136011280119, 0.0009129694662988186, 0.0010257286485284567 ]

[ "Q:\n\nlog4net filepath is empty\n\nConfig of my log4net:\n<log4net>\n<appender name=\"ItemsChangeLogFileAppender\" type=\"log4net.", "Appender.", "SitecoreLogFileAppender, Sitecore.", "Logging\">\n <file value=\"\\logs\\ItemChangeLogs\\itemLog.{date}.txt\"/>\n <appendToFile value=\"true\"/>\n <layout type=\"log4net.", "Layout.", "PatternLayout\">\n <conversionPattern value=\"%d %m%n\"/>\n </layout>\n</appender>\n<root>\n <priority value=\"ALL\"/>\n <appender-ref ref=\"ItemsChangeLogFileAppender\"/>\n</root>\n<logger name=\"ItemsChangeLogger\">\n <level value=\"ALL\"/>\n <appender-ref ref=\"ItemsChangeLogFileAppender\"/>     \n</logger>\n\nclass:\npublic class LogEvents\n{\n private static readonly ILog log = LogManager.", "GetLogger(\"ItemsChangeLogger\");\n\n public LogEvents()\n {\n XmlConfigurator.", "Configure();\n\n log.", "Info(\"Some message\");\n }\n\n public void Test(object sender, EventArgs args)\n {\n log.", "Info(\"Test\");\n }\n}\n\nI want to read my logs but don't find my file.", "\nIn some question (here) I use answer but filepath is empty. ", "How to solve this problem?", "\n\nA:\n\nYou have to read your configuration:\nlog4net.", "Config.", "XmlConfigurator.", "Configure(\"log4net.config\");\n\nThis assumes the name of you configuration file is log4net.xml. ", "The log4net.xml file has to be in your bin directory.", "\nThe \\logs\\ItemChangeLogs folder must exist on your file system. ", "I would change that to something like: c:\\logs\\ItemChangeLogs, so you know log4net will find the dir on your c drive, instead of an other drive.", "\nlog4net configuration documentation\nI normally configure log4net using an attribute in the assembly.cs file like:\n// Configure log4net using the .config file\n[assembly: log4net.", "Config.", "XmlConfigurator(Watch=true)]\n// This will cause log4net to look for a configuration file\n// called TestApp.exe.config in the application base\n// directory (i.e. the directory containing TestApp.exe)\n// The config file will be watched for changes.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.015177048742771149, 0.0010142409009858966, 0.0025588669814169407, 0.0007966888952068985, 0.0006919713923707604, 0.0023068650625646114, 0.0011642798781394958, 0.0008847884018905461, 0.0008309024851769209, 0.0006742795230820775, 0.001165166380815208, 0.0009552157716825604, 0.0006323502166196704, 0.006529591511934996, 0.0021649952977895737, 0.0008594687678851187, 0.0010138313518837094, 0.0008065077709034085, 0.0009219429921358824, 0.0008340739295817912, 0.006529591511934996, 0.0006961437175050378, 0.001995444530621171 ]

[ "Their outlook is solely shaped by military considerations, looking at the world through soldiers' eyes. ", "But their nationalist xenophobia also has its roots in the style and superstitions of General Ne Win, the country's first military dictator.", "\n\nHe seized power in a coup in 1962 and the military have ruled ever since.", "\n\nReclusive and eccentric, Ne Win shunned contact with the outside world, turning the country then known as Burma into the hermit of Asia.", "\n\nThe first few years of his rule saw pogroms against the Chinese and Indian communities, forcing tens of thousands to flee the country. ", "He also banned the teaching of English in the schools.", "\n\nFear\n\n\"Burma's military regime is extraordinarily xenophobic,\" says Sean Turnell, a Myanmar expert at Australia's MacquarieUniversity. \"", "They are afraid of everything.\"", "\n\nFor years the generals' greatest fear has been that the US planned a strategic strike against them.", "\n\nTo prepare for that, they have built a rabbit-warren of bunkers around their new capital, Naypyidaw, in the hills some 400 kilometres north of Yangon.", "\n\nThey moved the seat of government and the military headquarters to the remote, purpose-built city abruptly in November 2005. ", "Thousands of civil servants were only give a few hours' notice to pack up and move.", "\n\nMyanmar's government says it wants international aid but not aid workers [AFP]\n\nDuring the mass pro-democracy demonstrations in August 1988, which brought the country to a stand still for months, they feared a US invasion when ships of the US Pacific fleet moored off the country's southern coast.", "\n\nThen they turned to Beijing for protection and today China remains Myanmar's most-important diplomatic ally.", "\n\nThe regime is also highly suspicious of the UN and other international aid agencies, fearing they are in cahoots with the West and only want to whip up opposition to military rule inside the country.", "\n\nEven before the current cyclone disaster hit Myanmar, international aid workers found it hard to travel around the country and visit development projects.", "\n\nRejected\n\nLast year the government expelled the United Nation's top representative in the country, Charles Petrie, on the grounds that he was interfering with government policy.", "\n\n\"We must get rid of all the white faces,\" Senior General Than Shwe told his cabinet several times, according to reliable military sources.", "\n\nSince then the government has refused to accept several Western nominees as head of UN agencies.", "\n\nSenior General Than Shwe heads Myanmar's reclusive military government [Reuters]\n\nAn American candidate was rejected last year as head of the United Nations High Commission for Refugees while two western nominees to replace the ousted UN representative were also recently turned down. ", "Both posts have since been filled by an Asian from a developing country.", "\n\nThe restrictions on aid workers' movements are in part because the military regime fears that they will be gathering intelligence that might be used to undermine the government, but also because of the generals' paranoid obsession with being in total control of everything.", "\n\nGiven this mindset, there is no prospect the military regime will allow foreign aid workers to flood into the country, let alone allow foreign troops to enter.", "\n\n\"They're afraid that if foreign soldiers come in, they are the spearhead to overthrow the government,\" says Josef Silverstein, a retired RutgersUniversity professor and Myanmar expert.", "\n\nFrom the generals' perspective, he says, \"aid workers could be carrying weapons to give to the people, they could give them ideas of how to overthrow the government.\"", "\n\nSubversive\n\nThe families of Myanmar's ruling generals enjoy a lavish lifestyle\n\nFor decades, the ruling military regimes have kept Myanmar isolated, fearing that opening the country up would impact both its businesses and culture, and still worse, foster subversive thoughts like freedom of speech and democracy.", "\n\nEven tourists were not allowed access to the country until the 1970s, when visitors were given a strict, seven-day visa.", "\n\nThis changed a decade ago, when the lure of foreign currency spurred a relaxation of the rules. ", "Nonetheless, all visitors are closely controlled and constantly monitored by military intelligence officers.", "\n\nMeanwhile, there has been an almost total ban on journalists, with authorities granting media visas only for largely meaningless army-arranged ceremonies.", "\n\nThe generals' paranoia and distrust extends to all civilians – they believe that only the army has the ability to unite the country and protect it from foreign invaders.", "\n\nFrom their perspective, only the military represents the nation as a whole, not the factional interests of political parties or business people.", "\n\nIntimidation\n\nThe irony is, of course, that they have divided the country as never before – political parties are effectively banned, more than 2,000 political prisoners are languishing in jail, there is strict censorship of the press and the people are beaten into submission through a concerted campaign of harassment and intimidation.", "\n\nLast year they alienated the country's revered Buddhist monks after they brutally cracked down on the saffron-led protests against rising food prices.", "\n\nIn the end, the real issue is one of control – the military government understands that it must remain united or perish.", "\n\nTheir greatest fear now is losing control, losing their wealth, and facing Nuremberg-style trials from a future civilian government bringing them to account.", "\n\nThe current military rulers, especially General Than Shwe and his family, have amassed vast fortunes through corruption and nepotism.", "\n\nLittle wonder then that, despite the overwhelming suffering caused by Cyclone Nargis, the generals seem so anxious to press ahead with their referendum and institutionalise their power." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006153003196232021, 0.009417809545993805, 0.0009697070927359164, 0.001360858092084527, 0.010954662226140499, 0.002372134244069457, 0.00245802104473114, 0.00178315001539886, 0.0010501561919227242, 0.0009953959379345179, 0.0005685699288733304, 0.0009337842930108309, 0.0007103923708200455, 0.0009607354295440018, 0.0015852480428293347, 0.0006377611425705254, 0.000719651288818568, 0.052139513194561005, 0.000787488475907594, 0.0007046651444397867, 0.0006781567935831845, 0.0023795822635293007, 0.0007942977244965732, 0.0026001709047704935, 0.000567300827242434, 0.0006844733143225312, 0.0005924681900069118, 0.0005723813083022833, 0.0006087427609600127, 0.0006113447016105056, 0.002581366803497076, 0.0005643965560011566, 0.0030922326259315014, 0.0017317463643848896, 0.019368743523955345, 0.005360773298889399, 0.0228700190782547, 0.0007461950299330056 ]

[ "Education Research: Physician identification and patient satisfaction on an academic neurology inpatient service.", "\nTo determine the relationship between neurology inpatient satisfaction and (1) number of physicians involved in the patient's care and (2) patients' ability to identify their physicians. ", "A 10-item questionnaire addressing patient satisfaction and identification of physicians on the care team was administered to patients admitted to an academic, tertiary care, inpatient neurology service from May 1 to October 31, 2012. ", "We hypothesized higher satisfaction among patients having fewer physicians on the care team and among patients able to identify their physicians. ", "A total of 652 patients were enrolled. ", "An average of 3.9 (range 3-8) physicians were involved in each patient's care. ", "Patients were able to correctly identify on average 2.4 (60.7%) physicians involved in their care. ", "Patients who were very satisfied correctly identified a larger percentage of physicians involved in their care (63.8% vs 50.7%, p < 0.001), were more likely to identify a physician who knew them best (94.3% vs 43.6%, p < 0.001) and who was \"in charge\" of their care (94.1% vs 57.6%, p < 0.001), and were more likely to have private insurance (82.8% vs 70.5%, p < 0.001) and fewer physicians involved in their care (3.84 vs 4.06, p = 0.02). ", "Neurology inpatients' ability to identify physicians involved in their care is associated with patient satisfaction. ", "Strategies to enhance patient satisfaction might target improving physician identification, reducing actual or perceived disparities in care based on payer status, and reducing handoffs or conducting handoffs at the bedside." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0008660370949655771, 0.0007315360708162189, 0.0005716057494282722, 0.0006569125689566135, 0.0006157596362754703, 0.0005867424770258367, 0.0006055828998796642, 0.0005929438630118966, 0.001053005806170404, 0.0006209470448084176 ]

[ "Rutger Bregman became a social media sensation after his onstage tirade at the gathered elite in Davos this year. ", "His call for higher taxes, open borders and a shorter working week captured the imaginations of millions who viewed the speech online. ", "But can his utopian ideas be translated into realistic policy changes? ", "Plus: J Oliver Conroy on David Buckel, a year on from the climate protester’s death in New York\n\nWhen the Dutch historian Rutger Bregman went on stage at a World Economic Forum event in Davos this year it was as a relatively obscure author. ", "He used his appearance to call for a proper discussion of tax and launched a tirade against what he saw as hypocritical discussions about inequality.", "\n\nBregman’s angry outburst quickly went viral, with the video being watched tens of millions of times, on the back of which he made a series of media appearances in which he continued to enhance his reputation for blunt speaking.", "\n\nHe tells Anushka Asthana about the ideas in his book Utopia for Realists, including a universal basic income, a 15-hour working week and open international borders.", "\n\n\n\nAlso today, the journalist J Oliver Conroy reflects on the first anniversary of the death of the environmental campaigner David Buckel." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0007511653238907456, 0.0007752709207125008, 0.0007070878054946661, 0.0006395226228050888, 0.0060999467968940735, 0.0010646862210705876, 0.0006088759982958436, 0.0006002322188578546 ]

[ "Meatpacking’s French restaurant Bagatelle played host to Gotham Magazine’s celebration of their Fall Fashion Issue with cover stars Paul Giamatti and Maggie Siff. ", "The Showtime stars of Billions were joined by Gotham magazine’s Editor-in Chief Samantha Yanks as well as Billions’ cast mates Toby Leonard Moore and Condola Rashad. ", "The private affair brought VIPs and social influencers out to toast the cover stars while sipping Moet & Chandon champagne and Belvedere Vodka cocktails.", "\n\nToby Leonard Moore, Condola Rashad, Maggie Siff and Paul Giamatti\n\nGiamatti plays U.S Attorney Chuck Rhoades who is determined to take down a hedge fund kingpin, who also employs his wife, Wendy Rhoades, played by Siff. ", "The opening of the Season premiere of Billions was rather intense, with Giamatti gagged and bound, submissive to his dominatrix wife, Siff. ", "And the end of Season 1 has us only guessing what’s in store for the Rhoades’. ", "Inside the feature, Ménage A Deaux, Giamatti discussed the interesting dynamic of Chuck and Wendy’s relationship on the show: “They’re two incredibly smart people who are almost too well matched in some weird way. ", "They both love power, they play off each other’s intensity, and they both hunger for success. ", "We’ve dropped into their relationship near the end of something rather than the beginning, though I do think it was loving at one point. ", "It’s a portrait of people hitting a bad spot in a marriage. ", "How they’re going to work it out, I don’t know. ", "But it is certainly a helluva lot of fun to play.”", "\n\nThe Ménage A Deaux feature was taken at the Bathhouse Studios in New York and highlights Maggie Siff in a gold lace Roberto Cavalli dress, and a Dolce & Gabbana black lace gown. ", "Giamatti is clad in a Joseph Abboud tuxedo coat, shirt and trousers, and in a Dolce and Gabbana tuxedo and shirt. ", "Billions’ Season 2 will premiere February 19 on Showtime." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0008426386630162597, 0.0009601699421182275, 0.0010038447799161077, 0.0022687818855047226, 0.012001304887235165, 0.0007624460849910975, 0.0006405647727660835, 0.0010015496518462896, 0.0005984677118249238, 0.0014151271898299456, 0.0007799318409524858, 0.0064796931110322475, 0.0008427105494774878, 0.0025467469822615385, 0.0008761740755289793 ]

[ "Q:\n\nhow to connect between bootstrap ui modal input to html page with angular\n\nI have two pages of html. ", "one is the main page and the other is the modal page.", "\nI use one angular app to connect between them. ", "I get input in the modal page and i want to show it in the main page. ", "i don't know how to do it, although I think it might work with service.", "\nthe main page:\n<!", "doctype html>\n<html ng-app=\"ui.bootstrap.demo\">\n<head>\n <script src=\"//ajax.googleapis.com/ajax/libs/angularjs/1.4.3/angular.js\"></script>\n <script src=\"//ajax.googleapis.com/ajax/libs/angularjs/1.4.3/angular-animate.js\"></script>\n <script src=\"//angular-ui.github.io/bootstrap/ui-bootstrap-tpls-0.13.3.js\"></script>\n <script src=\"app.js\"></script>\n <link href=\"//netdna.bootstrapcdn.com/bootstrap/3.1.1/css/bootstrap.min.css\" rel=\"stylesheet\">\n</head>\n<body>\n\n<div ng-controller=\"ModalDemoCtrl\">\n <button type=\"button\" class=\"btn btn-default\" ng-click=\"open()\">Open me!</button>\n <table ng-controller=\"tableCtrl\">\n <thead>\n <th class=\"col-lg-3\">Username</th>\n <th class=\"col-lg-3\">Password</th>\n <th class=\"col-lg-3\">First name</th>\n <th class=\"col-lg-3\">Last name</th>\n </thead>\n <tbody>\n <tr ng-repeat=\"User in Users\">\n <td class=\"col-lg-3\">{{User.userN}}</td>\n <td class=\"col-lg-3\">{{User.", "PassW}}</td>\n <td class=\"col-lg-3\">{{User.", "Name}}</td>\n <td class=\"col-lg-3\">{{User.", "LastName}}</td>\n </tr>\n </tbody>\n </table>\n</div>\n</body>\n</html>\n\nthe modal page : \n<!", "DOCTYPE html>\n<html lang=\"en\">\n<head>\n <script src=\"//ajax.googleapis.com/ajax/libs/angularjs/1.4.3/angular.js\"></script>\n <script src=\"//ajax.googleapis.com/ajax/libs/angularjs/1.4.3/angular-animate.js\"></script>\n <script src=\"//angular-ui.github.io/bootstrap/ui-bootstrap-tpls-0.13.3.js\"></script>\n <script src=\"app.js\"></script>\n <link href=\"vandors/bootstrap-3.3.5-dist/css/bootstrap.min.css\" rel=\"stylesheet\">\n <meta charset=\"UTF-8\">\n <title></title>\n</head>\n<body>\n <form ng-app=\"ui.bootstrap.demo\" ng-controller=\"ModalDemoCtrl\" ng-submit=\"ok()\">\n <div class=\"modal-header\">\n <h3>users</h3>\n </div>\n <div class=\"modal-body\">\n <div class=\"panel-body\">\n <div class=\"form-group\">\n <label>Username : </label>\n <input type=\"text\" placeholder=\"Ariel73\" ng-model=\"userN\">\n </div>\n <div class=\"form-group\">\n <label>Password : </label>\n <input type=\"text\" placeholder=\"Aa123456\" ng-model=\"PassW\">\n </div>\n <div class=\"form-group\">\n <label>First name : </label>\n <input type=\"text\" placeholder=\"Ariel\" ng-model=\"Name\">\n </div>\n <div class=\"form-group\">\n <label>Last name : </label>\n <input type=\"text\" placeholder=\"Livshits\" ng-model=\"LastName\">\n </div>\n </div>\n <div class=\"modal-footer\">\n <button type=\"submit\" class=\"btn btn-success\">submit</button>\n </div>\n </div>\n </form>\n</body>\n</html>\n\nthe app page :\napp = angular.module('ui.bootstrap.demo', ['ngAnimate', 'ui.bootstrap']);\napp.controller('ModalDemoCtrl', function ($scope, $modal) {\n\n $scope.open = function () {\n\n var modalInstance = $modal.open({\n templateUrl: 'table.html',\n controller: 'ModalInstanceCtrl',\n });\n };\n});\n\n// Please note that $modalInstance represents a modal window (instance) dependency.", "\n// It is not the same as the $modal service used above.", "\n\nangular.module('ui.bootstrap.demo').controller('ModalInstanceCtrl', function ($scope, $modalInstance) {\n $scope.ok = function () {\n $modalInstance.close($scope);\n };\n\n $scope.cancel = function () {\n $modalInstance.dismiss('cancel');\n };\n});\n\napp.controller('tableCtrl',function($scope){\n $scope.", "Users = [\n {'userN' : 'Ariel', 'PassW' : 'Aa123456', 'Name' : 'Ariel', 'LastName' : 'Livshits'},\n {'userN' : 'Ariel', 'PassW' : 'Aa123456', 'Name' : 'Ariel', 'LastName' : 'Livshits'},\n {'userN' : 'Ariel', 'PassW' : 'Aa123456', 'Name' : 'Ariel', 'LastName' : 'Livshits'}\n ];\n $scope.addRow = function () {\n $scope.", "Users.push({'userN' : $scope.userN, 'PassW' : $scope.", "PassW, 'Name' : $scope.", "Name, 'LastName' : $scope.", "LastName});\n $scope.userN = '';\n $scope.", "PassW = '';\n $scope.", "Name = '';\n $scope.", "LastName = '';\n }\n});\n\nA:\n\nAngular is used with Single Page Applicaton layout, it seems that must only exists a single page for application (ng-app) and it may use multiple partials or templates. ", "\nUsually the main page contais the web layout (header, navbar, content, footer) and with the templates switch the content according to the current state (managed by the url)\nIn your example the main page will be the \"single page\" and the modal will be s partial/template. ", "This template could be request to the server as response of table.html or defined as a template within the main page using <script type='text/ng-template' id='table.html'>.", "\n\napp = angular.module('ui.bootstrap.demo', ['ngAnimate', 'ui.bootstrap']);\r\napp.controller('AppCtrl', function($scope, $modal, $log) {\r\n $scope.", "Users = [{\r\n 'userN': 'Ariel',\r\n 'PassW': 'Aa123456',\r\n 'Name': 'Ariel',\r\n 'LastName': 'Livshits'\r\n }, {\r\n 'userN': 'Ariel',\r\n 'PassW': 'Aa123456',\r\n 'Name': 'Ariel',\r\n 'LastName': 'Livshits'\r\n }, {\r\n 'userN': 'Ariel',\r\n 'PassW': 'Aa123456',\r\n 'Name': 'Ariel',\r\n 'LastName': 'Livshits'\r\n }];\r\n \r\n $scope.open = function() {\r\n\r\n var modalInstance = $modal.open({\r\n templateUrl: 'table.html',\r\n controller: 'ModalInstanceCtrl'\r\n });\r\n modalInstance.result.then(function(newUser) {\r\n $scope.", "Users.push(newUser);\r\n }, function() {\r\n $log.info('Modal dismissed at: ' + new Date());\r\n });\r\n };\r\n});\r\n\r\n// Please note that $modalInstance represents a modal window (instance) dependency.", "\r\n// It is not the same as the $modal service used above.", "\r\n\r\napp.controller('ModalInstanceCtrl', function($scope, $modalInstance) {\r\n $scope.ok = function() {\r\n $modalInstance.close({\r\n 'userN': $scope.userN,\r\n 'PassW': $scope.", "PassW,\r\n 'Name': $scope.", "Name,\r\n 'LastName': $scope.", "LastName\r\n });\r\n };\r\n\r\n $scope.cancel = function() {\r\n $modalInstance.dismiss('cancel');\r\n };\r\n});\n<!", "doctype html>\r\n<html ng-app=\"ui.bootstrap.demo\">\r\n\r\n<head>\r\n <script src=\"//ajax.googleapis.com/ajax/libs/angularjs/1.4.3/angular.js\"></script>\r\n <script src=\"//ajax.googleapis.com/ajax/libs/angularjs/1.4.3/angular-animate.js\"></script>\r\n <script src=\"//angular-ui.github.io/bootstrap/ui-bootstrap-tpls-0.13.3.js\"></script>\r\n <script src=\"app.js\"></script>\r\n <link href=\"//netdna.bootstrapcdn.com/bootstrap/3.1.1/css/bootstrap.min.css\" rel=\"stylesheet\">\r\n</head>\r\n\r\n<body>\r\n\r\n <div ng-controller=\"AppCtrl\">\r\n <button type=\"button\" class=\"btn btn-default\" ng-click=\"open()\">Open me!</button>\r\n <table>\r\n <thead>\r\n <th class=\"col-lg-3\">Username</th>\r\n <th class=\"col-lg-3\">Password</th>\r\n <th class=\"col-lg-3\">First name</th>\r\n <th class=\"col-lg-3\">Last name</th>\r\n </thead>\r\n <tbody>\r\n <tr ng-repeat=\"User in Users\">\r\n <td class=\"col-lg-3\">{{User.userN}}</td>\r\n <td class=\"col-lg-3\">{{User.", "PassW}}</td>\r\n <td class=\"col-lg-3\">{{User.", "Name}}</td>\r\n <td class=\"col-lg-3\">{{User.", "LastName}}</td>\r\n </tr>\r\n </tbody>\r\n </table>\r\n </div>\r\n <script type=\"text/ng-template\" id=\"table.html\">\r\n <form ng-submit=\"ok()\">\r\n <div class=\"modal-header\" >\r\n <h3>users</h3>\r\n </div>\r\n <div class=\"modal-body\">\r\n <div class=\"panel-body\">\r\n <div class=\"form-group\">\r\n <label>Username :</label>\r\n <input type=\"text\" placeholder=\"Ariel73\" ng-model=\"userN\">\r\n </div>\r\n <div class=\"form-group\">\r\n <label>Password :</label>\r\n <input type=\"text\" placeholder=\"Aa123456\" ng-model=\"PassW\">\r\n </div>\r\n <div class=\"form-group\">\r\n <label>First name :</label>\r\n <input type=\"text\" placeholder=\"Ariel\" ng-model=\"Name\">\r\n </div>\r\n <div class=\"form-group\">\r\n <label>Last name :</label>\r\n <input type=\"text\" placeholder=\"Livshits\" ng-model=\"LastName\">\r\n </div>\r\n </div>\r\n <div class=\"modal-footer\">\r\n <button type=\"submit\" class=\"btn btn-success\">Submit</button>\r\n </div>\r\n </div>\r\n </form>\r\n </script>\r\n</body>\r\n\r\n</html>\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006170618580654263, 0.0009521227912046015, 0.000565656169783324, 0.0005581818986684084, 0.0005763150402344763, 0.000883049622643739, 0.0011499662650749087, 0.0008871601894497871, 0.0006821107817813754, 0.0014186855405569077, 0.0016005330253392458, 0.000806736818049103, 0.0009858537232503295, 0.07910554856061935, 0.0008095561061054468, 0.0007836807053536177, 0.0007093282183632255, 0.0009814552031457424, 0.0010537299094721675, 0.0007681941497139633, 0.0006307379808276892, 0.0006284575210884213, 0.0006005269242450595, 0.0006821920396760106, 0.04752976819872856, 0.0008619134896434844, 0.000806736818049103, 0.0008820973453111947, 0.0007836807053536177, 0.0007093282183632255, 0.0030341141391545534, 0.0011469251476228237, 0.0008871601894497871, 0.0006821107817813754, 0.0010691649513319135 ]

[ "Montgomery High School (Montgomery, Texas)\n\nMontgomery High School a high school in unincorporated Montgomery County, Texas, west of the City of Montgomery. ", "A part of the Montgomery Independent School District. ", "It feeds from the town of Montgomery, as well as a large portion of unincorporated Montgomery County, including most of west and south shores of Lake Conroe. ", "In the years of 2013, 2014, and 2015, Montgomery High School was named one of Newsweek's Best schools in America. ", "Montgomery High School offers Dual Credit and Advanced Placement courses for students.", "\n\nHistory\nThe original regional grade school, then called Area Private School, opened in 1850 on what is now the Church Of Christ In Montgomery. ", "After the creation of Montgomery ISD, the first high school opened in 1931 on what is now Montgomery Middle School. ", "The school was moved to a new site in 1967 west of town on Highway 105, where the school still currently stands. ", "A huge increase in local population caused the school to be expanded in 1998 and again in 2005. ", " The 1967 building was razed, and the current school was built at the site. ", "After reaching well above maximum occupancy, a new high school, Lake Creek High School, was built for the district, opening in 2018.", "\n\nIn 2014, the school placed second in the national \"lip-dub\" competition \"Macy’s All School Lip Dub Challenge,\" winning $15,000. ", "The school was cleared by police in 2016 after a bomb threat. ", "In 2017, it was discovered that the Treasurer of the Belles dance-team had embezzled nearly $15,000 over the past two and a half years as she deposited school checks into her personal account.", "\n\nIn 2019, a hazing assault by members of the school's varsity football team occurred on several younger players, who were \"violated in some way with crutches, pool cues, or sports drink bottles.\" ", "An anonymous tip was reported through the Montgomery ISD bullying tip line a day later, and an investigation was launched by the Montgomery County Sheriff's Office. ", "The County DA recused himself due to personal connections. ", "The students were ultimately given informal probation, and the school forfeited the following football game as a result. ", "A school board member claimed that the investigation had been mishandled and that it had the appearance of a \"coverup\". ", "A petition calling for Superintendent Beau Rees's immediate resignation garnered nearly 1000 signatures.", "\n\nDemographics\nAs of the 2018-2019 school year, MHS had 1773 students enrolled.", "\n78.3% were White\n13.5% were Hispanic\n3.8% were African American\n1.5% were Asian\n0.5% were American Indian\n0.2% were Pacific Islander\n2.3% were part of Two or More races\n\n21.4% of students were Economically Disadvantaged, and 0.5% were English Language Learners.", "\n\nAcademics\nAt the beginning of each school year, the Texas Education Agency assigns schools a grade based on three different indices: Student Achievement, School Progress, and Closing the Gaps. ", "For each index, schools are classified as \"Met Standard\" if they receive a grade of at least 60 out of 100. ", "In 2018, Montgomery High School received an overall score of 88 and was classified as \"Met Standard.\" ", "The school received scores of 90 in Student Achievement, 81 in School Progress, and 83 in Closing the Gaps. ", "In addition, the agency also awards schools with \"Distinction Designations\" if they outperform schools with similar demographics. ", "In 2018, Montgomery High School did not receive any of the seven possible Distinction Designations.", "\n\nFeeder patterns\nThe following elementary schools (K-5) feed into Montgomery High School:\n Lincoln\n Madeley Ranch\n Montgomery Elementary\n Stewart Creek (partial) \n\nMontgomery Junior High (6-8) is the sole junior high feeder into Montgomery High School.", "\n\nNotable alumni\n\nBailie Key, Artistic gymnast and Olympic gold medalist\nKyle Bennett, BMX racer and Olympic gold medalist\nQuinton Spears, NFL linebacker\nGreg Smith, NFL lineman-turned local county figure\nMarcus Reed, NFL lineman\nScott Ross, NFL linebacker\n\nReferences\n\nExternal links\n Montgomery High School\n Montgomery High School Layout PDF\n HAR Demographic and School Boundaries Breakdown\n\nCategory:High schools in Montgomery County, Texas\nCategory:Educational institutions established in 1931\nCategory:Hazing" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0006530436803586781, 0.000780442962422967, 0.0008683983469381928, 0.0006199642084538937, 0.0006971276015974581, 0.0006302839610725641, 0.0006964280037209392, 0.0007995459018275142, 0.0005967594916000962, 0.001635965658351779, 0.0006954428390599787, 0.0009042299934662879, 0.0009192277793772519, 0.0006141013582237065, 0.0071191806346178055, 0.000614705088082701, 0.0006418851553462446, 0.0012628247495740652, 0.0008181811426766217, 0.0005895477952435613, 0.0005664133932441473, 0.013496948406100273, 0.0005431149038486183, 0.0006662941304966807, 0.0006397295510396361, 0.0006435237010009587, 0.000625072920229286, 0.0006578159518539906, 0.0006664088577963412, 0.000693313020747155 ]

[ "2011 in Poland\n\nEvents during the year 2011 in Poland.", "\n\nIncumbents\n\nElections \nBold indicates government parties.", "\n\nEvents\n\nJanuary \n 1 January – 5 places: Wolbórz, Nowe Brzesko, Pruchnik, Czyżew and Gościno received city rights.", "\n 9 January – The nineteenth finale of the Great Orchestra of Christmas Charity.", "\n 10 January – A test HD version of TVP1 is launched, named TVP1 HD.", "\n 31 January – President of Poland Bronislaw Komorowski signed a law introducing a 35 percent quota for electoral lists.", "\n\nFebruary \n 7 February – Warsaw summit of the Weimar Triangle.", "\n 19 February – Performance by the famous DJ Armin van Buuren in Poznań.", "\n 25 February – Abolition of the Property Commission of the Catholic Church.", "\n\nMarch \n 1 March – The first time Poland celebrated a new national holiday: National Day of Remembrance \"Soldiers accursed\".", "\n 25 March – The Polish Sejm adopted a government proposal declining pension contributions transferred to open pension funds.", "\n\nApril \n 1 April – Start of the Polish Census 2011.", "\n 29 April – The court annulled the Walbrzych presidential election.", "\n\nMay \n 17 May – Sejm investigative committee for Christopher Olewnik adopted a report on its work.", "\n\nJune \n 5 June – Rebranding of phone company Era to T-Mobile Poland.", "\n 28 June – Lukasz Kaminski sworn in as president of the Institute of National Remembrance.", "\n\nJuly \n 1 July – Poland takes over the Presidency of the Council of the European Union from Hungary for a six-month term.", "\n 29 July – Committee for Investigation of National Aviation Accidents of the Polish National Aviation Authority announced a report on the causes of the Smolensk catastrophe on 10 April 2010.", "\n\nAugust \n 1 August – \"The Law of 5 January 2011 - Election Code\" comes into force.", "\n 4 August – The Polish President, Bronislaw Komorowski, officially announces the Parliamentary election date, set for 5 October 2011.", "\n 12 August – Four people have been killed and 30 people injured after a train derailed between Warsaw and Katowice in Poland.", "\n 18 August – The Gdynia District Court acquitted Adam Darski, the leader of death metal band Behemoth, accused of insulting religious feelings.", "\n\nSeptember \n 3 September – Opening of the Polish National Stadium (Earlier called: Stadium of the Decade)\n 8–9 September – Tenth Jubilee International Ignatius Reimann Festival in Krosnowice.", "\n\nOctober \n 9 October – Polish Parliamentary Elections, 2011.", "\n\nUnknown date \nA Liquefied natural gas (LNG) plant was set up in Swinoujscie.", "\n\nDeaths\n\nJanuary \n\n 2 January – Cezary Kuleszyński, hurdler. (", "b. 1937)\n 7 January:\n Krzysztof Kolberger, Polish actor. (", "b. 1950)\n Włodzimierz Ławniczak, Polish journalist (b. 1959)\n 9 January – Jerzy Woźniak, Polish soccer player, Polish representative (b. 1932)\n 14 January – Zdzisław Szczotkowski, Polish lector (b. 1945)\n 23 January – Tomasz Wełnicki, Polish journalist, politician (b. 1957)\n 24 January – Włodzimierz Kłopocki, Polish actor (b. 1934)\n 25 January – Andrzej Szypulski, Polish screenwriter and novelist (b. 1936)\n 27 January – Jan Baszkiewicz, Polish lawyer, historian, political scientist (b. 1930)\n\nFebruary \n\n 1 February – Stanisław Michalski, Polish actor (b. 1932)\n 4 February – Janusz Pezda, Polish politician and governor of Jelenia Góra (b. 1943)\n 6 February:\n Jerzy Banaśkiewicz – Polish Catholic cleric, poet (b. 1937)\n Magdalena Tesławska – Polish film and theatre costume designer (b. 1945)\n 9 February:\n Andrzej Przybielski, Polish jazz trumpeter (b. 1944)\n Janusz Maciejewski, Polish philologist, literary critic (b. 1930)\n 10 February:\n Józef Życiński, Polish Catholic cleric, Archbishop of Lublin (b. 1948)\n Antoni Halor, Polish film and theatre director, artist literary (b. 1937)\n 15 February:\n Sławomir Radoń, Polish historian, General Director of State Archives (b. 1957)\n Karin Stanek, Polish singer, lead singer of the band Czerwono-Czarni (b. 1946)\n 21 February – Jerzy Nowosielski, Polish painter, illustrator, set designer (b. 1923)\n\nMarch \n\n 3 March – Irena Kwiatkowska, Polish actor (b. 1912)\n 4 March – Lucyna Legut, Polish actor (b. 1926)\n 19 March – Anna Kajtochowa, Polish writer, novelist, journalist (b. 1928)\n 23 March – Antoni Jurasz, Polish actor (b. 1922)\n 26 March:\n Roman Piętka, Polish neounic priest, Archimandrite (b. 1937)\n Paul Baran, American computer scientist of Polish descent (b. 1926)\n\nApril \n\n 3 April:\n Marian Pankowski, Polish writer (b. 1919)\n Andrzej Butruk, Polish actor, lector, satirist (b. 1964)\n 16 April:\n Henryk Zomerski, Polish bass guitarist (b. 1942)\n Tadeusz Pawlusiak, Polish ski jumper (b. 1946)\n 18 April – Andrzej Piszczatowski, Polish actor (b. 1945)\n 20 April – Halina Skibniewska, Polish architect, politician, Deputy Speaker of the Sejm (b. 1921)\n 25 April – Ryszard Nawrocki, Polish actor (b. 1940)\n 27 April – Zdzisław Rutecki, Polish speedway, speedway sports coach (b. 1960)\n 29 April – Waldemar Baszanowski, Polish weightlifter, World and European champion, Olympic champion (b. 1935)\n\nMay \n\n 12 May – Piotr Żyżelewicz, Polish drummer, member of the teams: Armia, Izrael, Voo Voo and 2Tm2, 3 (b. 1965)\n 15 May – Krystyna Dmochowska, Polish actor (b. 1956)\n 17 May – Ewa Szumańska, Polish writer, reporter, satirist (b. 1921)\n 18 May – Włada Majewska, Polish radio journalist, actress, singer (b. 1911)\n 25 May:\n Edward Żentara, Polish actor (b. 1956)\n Marek Nawara, Polish politician (b. 1956)\n 27 May:\n Małgorzata Dydek, Polish basketball player (b. 1974)\n Jacek Puchała, Polish surgeon (b. 1956)\n 29 May – Krystyna Skuszanka, Polish theatre director and principal of theatres (b. 1924)\n\nJune \n\n 4 June – Jerzy Świątkiewicz, Polish lawyer (b. 1925)\n 6 June – Stefan Kuryłowicz, Polish architect (b. 1949)\n 13 June – Onil, Polish rapper (b. 1980)\n 18 June – Marek Szufa, Polish pilot, vice-champion in gliding Aerobatic Flying (b. 1954)\n 25 June – Jan Kułakowski, Polish politician and trade-unionist (b. 1930)\n 27 June – Maciej Zembaty, Polish poet, translator, musician, satirist (b. 1944)\n 30 June – Tadeusz Skutnik, Polish journalist and poet (b. 1947)\n\nJuly \n\n 12 July – Roman Stanisław Ingarden, mathematical physicist (b. 1920)\n 16 July:\n Albin Małysiak, Polish cleric, Roman Catholic Bishop of Kraków (b. 1917)\n Kazimierz Neumann, Polish rower (b. 1933)\n 20 July – Rafał Balcewicz, Polish ice hockey player (b. 1987)\n 21 July:\n Andrzej Zalewski, Polish radio journalist (b. 1924)\n Kazimierz Świątek, Polish Catholic spiritual, Roman Catholic Cardinal (b. 1914)\n 23 July – Janusz Gniatkowski, Polish singer (b. 1928)\n\nAugust \n\n 5 August – Andrzej Lepper, Polish unionist, politician, Deputy Prime Minister, Minister of Agriculture (b. 1954)\n 6 August – Roman Opałka, Polish painter and graphic artist (b. 1931)\n 13 August – Jerzy Masztaler, Polish football coach (b. 1946)\n 19 August – Janusz Kierzkowski, Polish track cyclist (b. 1947)\n 21 August – Maria Kornatowska, Polish film critic, essayist, lecturer at the Łódź Film School (b. 1943)\n 22 August – Andrzej Urbanowicz, Polish painter and visual artist (b. 1938)\n\nSeptember \n 3 September – Andrzej Maria Deskur, Polish Catholic cleric, Cardinal (b. 1924)\n 6 September:\n Janusz Morgenstern, Polish film director (b. 1922)\n Damian Szojda, Polish Franciscan, an interpreter the Bible (b. 1932)\n 15 September – Regina Smendzianka, Polish pianist and pedagogue (b. 1924)\n 16 September – Maria Sawicka, Polish social activist, lawyer (b. 1923)\n 17 September:\n Magda Teresa Wójcik, Polish actress, film director (b. 1934)\n Tomasz Zygadło, Polish film director, screenwriter (b. 1947)\n\nSee also \n 2011 in Polish television\n\nReferences \n\nCategory:2011 in Poland\n\npl:2011#Wydarzenia w Polsce" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0005712704733014107, 0.0006448645726777613, 0.0008461386896669865, 0.0006360029219649732, 0.0006319826934486628, 0.0008836535271257162, 0.0006141220801509917, 0.0006878799758851528, 0.000873649783898145, 0.0006803059368394315, 0.0006821013521403074, 0.0006329016177915037, 0.0010531522566452622, 0.0006141095072962344, 0.0006891056546010077, 0.0006718016811646521, 0.0006349999457597733, 0.0006141812773421407, 0.0006083788466639817, 0.0006814373191446066, 0.0009016675176098943, 0.005593870300799608, 0.0006979905301705003, 0.0006579899927601218, 0.000864079047460109, 0.0008668449008837342, 0.0007627883460372686, 0.0012896193657070398 ]

[ "[\n {\n \"Message\": \"The following variables were not declared: atOtherHomes.\",", "\n \"Code\": null,\n \"Path\": null,\n \"Locations\": [\n {\n \"Line\": 2,\n \"Column\": 17\n }\n ],\n \"Extensions\": {\n \"specifiedBy\": \"http://spec.graphql.org/June2018/#sec-All-Variable-Uses-Defined\"\n },\n \"Exception\": null\n }\n]\n" ]

{ "pile_set_name": "Github" }

[ 0.0007841255865059793, 0.0008795219473540783 ]

[ "#38 Green Thumbs: Radishes (grades 3-8)\n\nRadishes aren't fussy. ", "Provide them with a covered, moist towel, and away they grow. ", "In just a day the seeds will sprout. ", "By the end of the week you'll get sprouts one or two inches tall. ", "Because radishes grow so fast, tropisms are easy to observe: see roots grow toward water, leaves tilt toward light, stems bend against gravity. ", "Kids will draw, measure and graph growth, eat a tiny sun salad, study toxic stress!", "\n\nLesson 17: To observe how the root and hypocotyl of an upside-down radish seedling reorient in response to gravity. ", "To distinguish between positive and negative geotropisms.", "\n\nLesson 18: To observe how radish roots grow in response to abrupt changes in moisture.", "\n\nLesson 19: To compare cotyledons with true leaves according to structure, function and origin.", "\n\nLesson 20: To graph the data collected in activity 14. ", "To interpret radish growth in terms of a sigma curve.", "\n\nOur radish seeds didn't sprout! ", "What did we do wrong?", "\n\nPossibly your seeds are too old, or have been stored in a warm and/or moist environment, using up their energy reserves before you planted them. ", "In any batch, there will be some seeds that simply don't sprout -- packages generally tell you the germination rate (the percentage that are likely to succeed). ", "But if you plant a half-dozen or more fresh seeds, at least half of them should have sprouted. ", "It's mathematically pretty unlikely that you'd have planted only duds from a larger batch. ", "It is frustrating, but seeds are tiny, and often fragile, packets of life subject to changing conditions around them. ", "If your radish seeds were supplied in a kit from another company, please contact them directly. ", "Or purchase a fresh replacement package from your local garden store.", "Our radishes aren't growing true leaves. ", "What's the problem?", "\n\nWithout seeing your arrangement, we can only guess. ", "The sprouts probably aren't getting enough light to develop properly. ", "If this is the case, plants will also become very \"leggy\" (on long, weak, thin stems) and will lean precariously toward the strongest light source. ", "The sprouts may also be quite pale. ", "Classrooms have large windows and bright fluorescent bulbs that usually provide adequate light, but homes are often darker. ", "A south-facing window may help (check sprouts carefully for wilting or sunburn if in direct sunlight). ", "Positioning a desk lamp, either incandescent or fluorescent, as near as possible to the sprouts for several hours a day can also be helpful. ", "Turn the planters around occasionally to correct leaning. ", "If your climate is mild, placing the plants on a porch or patio in dappled shade might help, too, and the fresh air and bright light helps discourage mold and mildew. ", "Be sure to monitor plants carefully for drying or overheating. ", "One other possibility is that your sprouts have become too dry between waterings, or the soil stays too wet. ", "Keep them consistently moist, but not soggy.", "Our radishes are growing too fast/too slow to match your model answers. ", "How do we adapt?", "\n\nHere's where \"cookbook\" science gets real. ", "The results of your experiments will never be precisely average, especially where growing things are concerned. ", "This can be disconcerting, but it is the nature of, well, nature! ", "Our model answers are the best average we could observe from growing plants in typical classroom conditions in a temperate climate (lots of steady light, temperatures moderately warm during the day and cool at night). ", "If your radishes are way ahead of schedule, they're growing in \"better-than-average\" conditions. ", "If they're too slow, they may be getting less light or warmth than our test sprouts. ", "Probably the most important thing to remember is this: science is the process of observing what actually happens, not forcing hoped-for results to match an ideal schedule. ", "Scientists develop hypotheses (tentative assumptions) based on what they observe, and then experiment (design ways to interact with their subjects) to check the accuracy of a hypothesis. ", "If it was wrong, they develop and test a new hypothesis. ", "You're doing good science if you're doing these things, whether or not your results match the answer key.", "Our plants are growing lots of mold. ", "Should we start over?", "\n\nMolds and mildews thrive in warm, humid climates. ", "If this is your situation, try any of the following:• BLEACH! ", "Pre-sterilize containers by dipping in a solution of 10% chlorine bleach and 90% water. ", "If dipping isn't workable, apply generously with a spray bottle or clean sponge. ", "You can also add a couple of drops of bleach to the water in your growing systems. ", "Too much will be toxic to the plants. ", "You can also rinse the seeds for 15 seconds in a 10% bleach solution before you sprout them. ", "Seeds are often \"infected\" with mold spores before you plant them.• AND/OR: Gently lift the seedlings and replace the paper towels as needed. ", "A fuss, but better than the alternative. ", "You might be able to lift out fuzzy clumps of mildew with a toothpick or a small paint brush moistened with slightly chlorinated water.• AND/OR: Open containers to fresh air and dappled sunshine at times you can keep an eye on them. ", "Monitor the plants for wilting, yellow patches, curled or darkened edges - sunshine can be quite a shock to previously sheltered seedlings. ", "Be sure they don't dry out. ", "You might wish to offer extra credit to a responsible student to monitor the seedlings every hour or so.", "NOTE: Because molds can cause allergic reactions, avoid inhaling them when handling your plants. ", "Wear a dust mask or scarf over your nose and mouth to minimize your exposure. ", "Finally, if your plants are growing well, they should survive having some mold growing on or around them.", "EXTENSION ACTIVITY: Do real science on your own! ", "Study mold and mildew! ", "We've read (haven't tried) that spraying seedlings with CHAMOMILE tea discourages mildew on new seedlings. ", "Other kitchen SPICES, such as thyme and oregano, may help, since they are a traditional means of keeping food from spoiling. ", "A weak solution of the widely popular TEA TREE OIL, dispersed in water with a few drops of liquid hand soap, might be very effective. ", "A solution of BAKING SODA (sodium bicarbonate), about one teaspoon per pint of water, has recently been found to fend off certain mildews in the garden. ", "Spray lightly and monitor closely, though, since too much sodium can be deadly. ", "And the latest scoop from the horticultural world is that MILK misted on plants inhibits some garden pathogens. (", "It could foster others, though, so stay observant.)", "\n\n#38 RADISHES IN ACTION!See how one homeschooler has used this lesson (and other TOPS modules!) ", "with great success at this website.", "If you come up with any other great results, we'd love to pass them on to others, so be sure to let us know!", "\n\nNational Science Education Standards (NRC 1996)\n\nTEACHING Standards\n\nThese 20 activity sheets promote excellence in science teaching by these NSES criteria:Teachers of science...A: ...plan an inquiry-based science program. (", "p. 30)B: ...guide and facilitate learning. (", "p. 32)C: ...engage in ongoing assessment of their teaching and of student learning. (", "p. 37)D: ...design and manage learning environments that provide students with the time, space, and resources needed for learning science. (", "p. 43)\n\nCONTENT Standards\n\nThese 20 activity sheets contain fundamental content as defined by these NSES guidelines (p. 109). • ", "Represent a central event or phenomenon in the natural world. • ", "Represent a central scientific idea and organizing principle. • ", "Have rich explanatory power. • ", "Guide fruitful investigations. • ", "Apply to situations and contexts common to everyday experiences. • ", "Can be linked to meaningful learning experiences. • ", "Are developmentally appropriate for students at the grade level specified." ]

{ "pile_set_name": "Pile-CC" }

[ 0.001432756194844842, 0.004279528744518757, 0.0006452699890360236, 0.009357547387480736, 0.0009938882431015372, 0.035663433372974396, 0.0016442256746813655, 0.0007094246102496982, 0.0006003403686918318, 0.0006599535117857158, 0.0006673548487015069, 0.0005799924838356674, 0.001265884842723608, 0.000780185277108103, 0.001761739724315703, 0.0005952577921561897, 0.0006366412853822112, 0.0007026654202491045, 0.0005950814229436219, 0.0005317592294886708, 0.0006865743780508637, 0.006620430387556553, 0.0015181206399574876, 0.0006150537519715726, 0.0007906141108833253, 0.0007008443935774267, 0.0008105124579742551, 0.0006087123183533549, 0.0010016660671681166, 0.0006073860567994416, 0.0007458740146830678, 0.0006509374943561852, 0.0007159709348343313, 0.003213861957192421, 0.0037918267771601677, 0.0050116367638111115, 0.0006765262223780155, 0.0009088590159080923, 0.000630660739261657, 0.0008490991313010454, 0.0005195937701500952, 0.0013694819062948227, 0.001575950998812914, 0.000548420415725559, 0.0006299138185568154, 0.0006477179704234004, 0.0006632995791733265, 0.0009585095685906708, 0.0009209653944708407, 0.0006706735002808273, 0.049367088824510574, 0.0018606616649776697, 0.0008140451391227543, 0.009966091252863407, 0.04533824324607849, 0.0013092522276565433, 0.0006011803634464741, 0.0006827754550613463, 0.0009755614446476102, 0.0006391198839992285, 0.0024225886445492506, 0.0005486067966558039, 0.0006688747671432793, 0.06636911630630493, 0.0009373963112011552, 0.004344054032117128, 0.0020097384694963694, 0.0010001769987866282, 0.0006134309805929661, 0.0006089757662266493, 0.000832890160381794, 0.0008101086132228374, 0.0005784811219200492, 0.0005795581382699311, 0.0008956979727372527, 0.0005750900600105524, 0.0006306932191364467, 0.000674620212521404, 0.0005884991260245442, 0.0006122283521108329, 0.000639556732494384, 0.0006093601114116609, 0.0006855665124021471, 0.0005782308871857822, 0.0007353555411100388, 0.0005571547080762684, 0.0006239363574422896, 0.000533045909833163, 0.0006267930730246007 ]

[ "Q:\n\nPython: How to read stdout of subprocess in a nonblocking way\n\nI am trying to make a simple python script that starts a subprocess and monitors its standard output. ", "Here is a snippet from the code:\nprocess = subprocess.", "Popen([path_to_exe, os.path.join(temp_dir,temp_file)], stdout=subprocess.", "PIPE)\nwhile True: \n output=process.stdout.readline()\n print \"test\"\n\nThe problem is that the script hangs on output=process.stdout.readline() and that the line print \"test\" only executes after the subprocess is terminated.", "\nIs there a way to read standard output and print it without having to wait for the subprocess to terminate?", "\nThe subprocess which I am starting is a Windows binary for which I do not have the source code.", "\nI have found several similar questions, but the answers are only applicable on Linux or in case I have the source of the suprocess I am starting.", "\n\nA:\n\nCheck select module\nimport subprocess\nimport select\nimport time\n \nx=subprocess.", "Popen(['/bin/bash','-c',\"while true; do sleep 5; echo yes; done\"],stdout=subprocess.", "PIPE)\n \ny=select.poll()\ny.register(x.stdout,select.", "POLLIN)\n\nwhile True:\n if y.poll(1):\n print x.stdout.readline()\n else:\n print \"nothing here\"\n time.sleep(1)\n\nEDIT:\nThreaded Solution for non posix systems:\nimport subprocess\nfrom threading import Thread \nimport time\n \nlinebuffer=[]\nx=subprocess.", "Popen(['/bin/bash','-c',\"while true; do sleep 5; echo yes; done\"],stdout=subprocess.", "PIPE)\n\ndef reader(f,buffer):\n while True:\n line=f.readline()\n if line:\n buffer.append(line)\n else:\n break\n\nt=Thread(target=reader,args=(x.stdout,linebuffer))\nt.daemon=True\nt.start()\n\nwhile True:\n if linebuffer:\n print linebuffer.pop(0)\n else:\n print \"nothing here\"\n time.sleep(1)\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007703269366174936, 0.0007907807012088597, 0.001070857630111277, 0.0009055824484676123, 0.0009173759026452899, 0.0006723253172822297, 0.0005676026339642704, 0.0008239480084739625, 0.0010051740100607276, 0.0008097539539448917, 0.001116063678637147, 0.0010051740100607276, 0.0032125257421284914 ]

[ "Q:\n\nWhat sort of check should be used for my frenzy ability's stay-in-control aspect?", "\n\nMy D&D 3.5e character is a half-shark/half-man, and I want to give him a boost ability that allows him to indulge in his frenzy or instinct and gain bonuses during battle. ", "Doing so, however, would run him the chance of losing control and attacking anything, friend or foe. ", "What sort of check would make the most sense as far as maintaining control of/snapping out of the frenzy? ", "A Will Check that gets harder every round, INT vs WIS check, or maybe a Concentration check?", "\nI was looking to create a sort of boost ability for my character since we need another melee fighter and our strongest characters seem to have exactly those. ", "Of course, their boosts cause them some major fatigue after using them and I wanted to try and find a way around that because we've almost been tossed the excrement end of the stick coming out of a tournament or a major fight, and unable to defend ourselves or barely run away from whatever relatively easy troubles happen to us right after. ", "But I suppose a half shark would bring some great non-combat skills too \n\nA:\n\nOne, most tables really hate this kind of thing\nThese kinds of effects tend to ruin, or severely sidetrack, campaigns, to the point that the rampaging character makes it impossible to actually make any kind of progress. ", "Make absolutely certain that every single player in the game is on board with this. ", "It is not enough, in this case, to just check with the DM; just because the DM is OK with it does not necessarily mean your fellow players are, and every one of those players has an expectation and right to enjoying the game. ", "You don't have a right to ruin that enjoyment, which this character very well might.", "\nWe get very many questions from DMs trying to prevent this kind of thing, because it's messing up the game for everyone.", "\nTwo, you can create a character like this without homebrew\nJust so you are aware, the Frenzied Berserker from Complete Warrior behaves like this. ", "Which is a reason why it's frequently banned. ", "But if it's not, and the group is 100% on board with this character, taking levels in Frenzied Berserker is a good way to model this character. ", "It provides fairly substantial bonuses, and reasonably-thorough rules on how the frenzy is triggered and how the berserker behaves while frenzied.", "\nThree, you can and should base your homebrew on the Frenzied Berserker\nThe relevant rules for the Frenzied Berserker are below.", "\n\nThe character can enter a frenzy as a free action. [...] ", "In addition, if she takes damage from an attack, spell, trap, or any other source, she automatically enters a frenzy at the start of her next action, as long as she still has at least one daily usage of the ability left. ", "To avoid entering a frenzy in response to a provoking effect, the character must make a successful Will save (DC 10 + points of damage taken since her last action) at the start of her next turn.", "\nWhile frenzied, the character cannot use any Charisma-, Dexterity-, or Intelligence-based skills (except for Intimidate), the Concentration skill, or any abilities that require patience or concentration, nor can she cast spells, drink potions, activate magic items, or read scrolls. ", "She can use any feat she has except Combat Expertise, item creation feats, or metamagic feats. [...]", "\nShould she run out of enemies before her frenzy expires, her rampage continues. ", "She must then attack the nearest creature (determine randomly if several potential foes are equidistant) and fight that opponent without regard to friendship, innocence, or health (the target's or her own).", "\n\nHere, you see that it's a Will save to avoid going into an unintentional frenzy, and once frenzied it just lasts a certain duration. ", "The bonuses from the frenzy (not quoted) are fairly substantial, so that (arguably) makes some sense. ", "In your case, it may not (probably should not as a racial ability), so probably 1/round make a Will save to end the frenzy.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006437770207412541, 0.0016059605404734612, 0.014638424851000309, 0.0006370640476234257, 0.0007881179917603731, 0.0005503763095475733, 0.06060740724205971, 0.0011360673233866692, 0.0009086779900826514, 0.0007872221176512539, 0.00095589947886765, 0.0007263860898092389, 0.0024559537414461374, 0.0007546019041910768, 0.0010098101338371634, 0.0007094789762049913, 0.0018693694146350026, 0.0005940556875430048, 0.0009129064856097102, 0.0007386924116872251, 0.0016505629755556583, 0.0006624868256039917, 0.001709789503365755, 0.002948854584246874, 0.0006800321280024946, 0.0005965129821561277, 0.0008285795338451862, 0.001995444530621171 ]

[ "So, You Say You Prefer Your Partner to be Circumcised? ", "What these Women Say May Change Your Mind… Routine infant circumcision (RIC) has recently been in decline across the U.S., with many parents deciding (correctly, in my opinion) that forcing a permanent body modification on an infant is unethical. ", "Obviously, an infant cannot consent to such a procedure.", "\n\n\n\nThe choice to leave one’s child “intact” is a decision more and more parents are making. ", "Rather than taking the decision away from their newborn son (by permanently altering his body), these parents are giving him the opportunity, when he’s older, to decide for himself. ", "Once the circumcision has taken place, it cannot be undone; by leaving him whole, he can make the decision for himself, as a grown man. ", "One aspect of circumcision rarely touched-on is the impact on lovemaking. ", "Unless one believes male bodies are all formed with an abnormality (the penis’ foreskin), then it stands to reason that the foreskin must serve a purpose. ", "And it does! ", "Many purposes. ", "Read more in this wonderful post by drmomma.org (with an obligatory NSFW warning). ", "If you’re American, much of this information will undoubtedly be new to you. ", "Our culture dictates that uncut penises are “dirty”, “disgusting”, and “smell bad”. ", "This is ridiculous, of course. ", "A snappy washing with soap and water will immediately solve any of those issues. ", "We Americans see cut (circumcised) penises as the norm; a quick look at the rest of the world should remove that bias. ", "In this post, we seek to address what men (and their female partners) are robbed of (with regards to sexual function and pleasure) when male circumcision takes place. ", "I asked the readers of our Facebook page for their experiences. ", "Specifically, I asked women who had experienced both “cut” and “intact” lovers to detail what exactly the differences were, both good and bad. ", "I also asked the opinion of men who’d had homosexual experiences with both “cut” and “intact” men for their input; unfortunately, I received no feedback. ", "But I did get lots and lots of feedback from the women. ", "And, as you’ll see, almost all of that feedback rates the experience of being with an intact male as superior (with all other things being equal, of course). ", "Obviously, this is in no way a rigorous scientific study, nor should you take it as such. ", "Keep in mind, too, that many of the readers of this blog and the Free Your Kids Facebook page are “intactivists” and, as such, could be considered a biased audience. ", "However, all of that aside, I think you’ll find their testimonies to be forthright and informative. **", "Warning** The following passages contain many — many — graphic descriptions of various sexual activities. ", "If you do not wish to read such things, you should probably click the “x” at the top of your browser and carry-on with your G-rated internet preferences. ", "If you’re still here, enjoy the rest of the post. (", "I should add a hearty thank you to the fine ladies who answered our call for feedback. ", "Until MythBusters does a NSFW episode on intact vs. cut, your experiences will help shape the views of many who had never previously considered this issue.) ", "The only modifications I’ve made to the readers’ submissions are minor spelling corrections and formatting issues. ", "Everything else is presented exactly as it was sent to me. ", "Now, on with the show: — Hey there! ", "This is in regards to your request for the nitty-gritty details about being with normal or altered men. ", "All of my previous partners had been cut (save my current one), their penises were rough, and sex was rough. ", "Although I had a great desire for sex, I frequently found myself faking orgasm to get them to hurry up and finish. ", "I had frequent uti’s and bruising, sometimes even bleeding because of the jackhammering that had to be done for them to be pleasured. ", "I sometimes worried I wasn’t tight enough for them, and had to assume unnatural positions to try and clamp down on them during sex. ", "Oral sex was similar, I had my technique down. ", "Close the mouth as tightly as possible, suck hard, lips over teeth til they bled. ", "To this day I have callouses on the inside of my mouth. ", "Bob head up and down as fast and hard as possible til my neck and jaw ached. ", "I never realized how used I felt until I met my current partner. ", "I thought men were just selfish, taking their pleasure without much thought to how it hurt women. ", "With my fiance everything is different. ", "Sex is slow and intimate, we are in tune with each other. ", "His penis slides easily into me, no stretching or tearing feeling. ", "We have never needed lube, and I have never felt that my vagina was “too loose.” ", "Even after having children together, he gets just as much pleasure. ", "Blow-jobs are actually fun for me to give now, although it took me quite awhile to adjust to how sensitive his penis is. ", "I just didn’t know what to do, lol. ", "Then I realized, just treat it like I like my clitoris to be treated. ", "There’s just so much more love and intimacy, I’ve never had to fake anything, and we often climax together. ", "I would never rob my future son’s partners of that kind of experience.", "\n\n\n\n— I’ve always been opposed to circumcision since I first heard what it was. ", "I was like, “Why would someone DO that to a baby boy?!” ", "But when I was pregnant with our first it was a big deal to my (circ’d) husband that he wanted it to be done. ", "So I did some research. ", "When I found out that circumcision could cause chordee (curved penis) I was FURIOUS … this is what my husband has and it has caused us so much grief and pain. ", "I’ve never been with anyone but him, but I know sex wasn’t supposed to be like this. ", "We’ve learned to work with what we’ve got, but it’s been so hard. ", "Worse yet, he is already having trouble reaching orgasm sometimes … and he is only in his 20’s. ", "I can’t imagine how we will be in our 50’s. ", "Luckily, once I shared what I knew with my husband he agreed to leave our baby boy the way God made him. ", "Now I just have to work on forgiving my in-laws … they robbed us both of the sex life we were meant to have. — ", "I’ve been with cut men in the past. ", "My husband and son are both natural uncut. ", "I personally found sex with an uncut man was painful. ", "There is such a thing as too hard (to me anyway) my son will be 11 tomorrow and we have never had an issue with infection or being unclean. ", "As long as they know the proper way to cleab themselves, there will be no issue. — ", "I have been with both circ’d and un-circ’d men. ", "I am lucky in that I enjoyed either way. ", "The sex WAS different. ", "Most of the circ’d men were very much “hard and fast”, very little foreplay or intimacy, and for some reason greater trouble expressing their emotions. ", "The un-circ’d men were much gentler and preferred foreplay and more cuddling. ", "They were also more emotional and expressed it. ", "My husband is circ’d but CHOSE to do it when he was 13 in the late 70’s. ", "He says the healing time was only about 2 weeks, and the sex is a bit of a mix of the previous two. ", "He also is much more emotional and expressive. — ", "Hi! ", "I would like to remain anonymous. ", "I just wanted to share my experience with you. ", "The first guy I was with was circumsized. ", "Sex hurt me and I thought that was just how it was because I didn’t know any different. ", "We had also had a conversation when he told me he had a few UTIs as a kid… yes a circumcised boy had a UTI so the myth of circumcision being cleaner doesn’t make much sense to me. ", "I had a few other circumcised partners and experienced the same discomfort. ", "Then I met my fiance who is intact. ", "When we were intimate he was gentle and it was pleasurable. ", "I wasn’t sore after and couldn’t believe how much of a difference it actually made. ", "I was relieved that sex didn’t have to be painful. ", "We have 2 beautiful children together, a perfect little girl and a perfect INTACT little boy. ", "I wouldn’t have it any other way! — ", "I prefer to remain anonymous please. ", "I only dated one man who was not circumcised. ", "From a woman’s point of view I prefer them to be circumcised, for me it was a matter of cleanliness. ", "I could not get passed the odor of urine. ", "Even after a shower it did not go away. ", "The foreskin did not bother me during actual intercourse. — ", "My add on the circ. ", "talk: for me it was once you ride intact you won’t wanna go back;)\n\n\n\n— Hi! ", "Just thought I would share my experiences with circ’d and intact men and the reasons why I chose to leave all my boys whole. ", "First my boys. ", "I had my first son at the age of 16. ", "I was sooo young. ", "He was born 11 weeks early. ", "When the nurses came to me and asked if I wanted him circ’d I asked them if there was something wrong with his penis..lol..I didn’t know why they would want to do it, he was so tiny. ", "I didn’t have it done. ", "I have had three more boys since then and have not had them cut. ", "With boy number two I actually did research, even though my husband is intact we wanted to make an informed decision..not one based on cultural norms and to make them match daddy. ", "I am glad we stood against my family and did the right thing. ", "I think my boys will thank us when they are older My oldest is 21, my youngest is 18 months. ", "the only trouble we have ever had was youngest had one mild penile infection..not enough reason to circumcise preventivly in my opinion. ", "Now on to my own personal experiences as a woman. ", "I was a ‘troubled’ youth. ", "No father figure, disfunctional mother. ", "I was a bit promiscuous. ", "I have seen a few penises in my time. ", "Thankfully I have since grown and learned and been happily married for 17 years now Its in my experiences that circ’d men tend to be rougher. ", "You have to teach them not to ‘pound’ or ‘jackrabbit’ intact men are more gentle, slower. ", "Intact men tend to be noticeably larger as well. ", "I enjoy sex with intact men because they also can help lubricate, no need for gel. ", "I don’t get sore as easy. ", "I did not like giving oral sex to intact men, it was more difficult to me, more moving parts so to speak. ", "My husband has since shown me how he likes it, and I figured it out, no troubles now Now I enjoy giving him pleasure in that way. ", "I have never noticed a smell, I have never gotten an infection from my husband. ", "He has never had any problems with his forskin. ", "In fact when asked he said “its so sensitive not only can I tell which way the wind is blowing but the humidity and temperature as well, and that our neighbors are having a bbq ” I hope I did not offend or share too much, just trying to give honest account of my point of view, I hope it helps… — I dated a man for four years who was intact. ", "His penis looked longer when it was flaccid. ", "When he was erect there was no difference in the appearance, aside from the lack of scar tissue. ", "It did not take me long to get used to it. ", "I did tell him that he was my “first” and allowed me to inspect his parts after that my curiosity ended. ", "My husband is circumcised. ", "As far as sex is concerned I have not noticed any difference in their parts. ", "We chose to not circumcise our son when he was born 6 years ago. ", "The nurse at our hospital told us that there are more boys intact now than there are “cut”. ", "She also stated that there was no medical reason for having the surgery, and he has never had any problems so far with yeast. ", "I am glad we have allowed him to remain natural, and if he wants to change things when he is an adult, he can. ", "I am used to seeing his au natural and seeing a boy that has been circumcised seems very odd and short to me.", "\n\n\n\n— I’d like to respond to the circumcision post. ", "When I was pregnant we decided not to find out the gender of our baby, but I made sure to have this talk early on. (", "As an intactivist all I could think of was keeping my baby whole, as nature intended) The dialogue brought a level of emotion up in my husband that I hadn’t seen in the 8 years we’ve been together. ", "He was circumcised as a baby, and never thought much about it until we started talking about the function of foreskin. ", "After all these years he confided in me that he does not have feeling in several areas of his penis. ", "He thought it was normal growing up, but as he got older he realized that the circumcision was botched and he feels robbed. ", "I’m glad I finally know, so that I can maximize pleasure in the areas he does have feeling in, but I’m upset that he’ll never get to experience what it feels like to have a fully functional, healthy penis. ", "And furthermore I feel like I got jipped! ", "I personally feel that this is a human rights issue and that no person (parent or not) should have the ability to make such a personal decision. ", "I’d be happy to share our experience and the affects of an all too common botched circ, but kindly ask that you do not use my name. — ", "I have been with the father of my children (who is uncircumcised) for 10 years, and I enjoy the sex much more than any of the circumcised men I had been with before. ", "But to be honest, at this point I don’t know if I could separate his physiology from his person when it comes to us being together. ", "In other words, I do think there are differences-not as much pounding, for instance-that can be attributed to his being intact, but so much more passes between us that his foreskin cannot possibly be the defining aspect of the quality of our union. ", "He does seem to be more sensitive to sensation than those without, but he also is more familiar with his body, less prone to feel shame, tender-hearted, and he cares about me more than any other man I have ever been with. ", "Is it a difference I enjoy? ", "Yes. ", "Is it the definition of him as a man, as a lover? ", "No, of course not. ", "Also, since I just went and re-read your request and the following comments-oral sex with my partner is so much more fun than it ever was with another who did not have his skin. ", "I don’t know what people are talking about, except for hygiene. ", "There is so much more play. ", "It should be clean, but then for me that is always best when engaging the more hidden parts of anyone’s body. ", "Best! — ", "I will tell you, I definitely prefer intact. ", "My experiences with cut men often left me hurt (feeling chaffed and irritated). ", "While experiences with my intact fiancé don’t. ", "Also it is much easier to perform oral sex and hand jobs! ", "Plus there is a sensitive spot on the top of an intact glans that ,when stimulated, produces the most amazing full body twitch I’ve ever seen happen in a man! — ", "I’ve only been with one man who was intact, and I have to say I like it. ", "Nothing bothers me orally, and intercourse-wise it just seems easier since much of the friction happens within his own parts… — prefer circumcised but it could be because my first husband was abuser and it destroyed any fun on sex. ", "This being said after letting myself be talked into circumcising my first son, my second stayed intact. — ", "My current partner is the only circumcised man I’ve been with. ", "Sex is sore!!!! ", "After any more than 5 minutes it gets sore and uncomfortable. ", "I find with intact men it just kind of “flows” naturally and feels fine. ", "Unfortunately he was circ’d due to medical issues when he was about 8. ", "I also find foreplay more difficult, there is no natural lubrication. ", "Hope that helps your blog! ", "Good luck and keep on inspiring!! — ", "To elaborate on some of the problems my cut partners have had: inability to cum during oral (2 of them) difficulty cumming during sex at all (1 of them) overly curved (1 of them) getting dry to the point of bleeding in the winter (2 of them). ", "The only problems the 2 uncut men had was one of them caught a yeast infection from me and was told it was because of his foreskin. ", "Both of the uncut men were very happy with their dicks. — ", "I prefer intact men. ", "I have been with one circumcised man and he could never climax during sex, he would always have to masturbate afterwards. ", "I dont know if this was a result of his circumcision or because he was a furious masturbator haha. ", "My now husband is uncircumcised, and though i prefer penis’ like his, i cant do blowjobs because the foreskin throws me off my game. ", "I don’t think i prefer intact penis’ for their looks, i think i prefer them because circumcision is a barbaric stone age practice that never should have been allowed in the first place, let alone continued once it was proven the cornflakes man was indeed a flake. ", "I have a 6 month old son and he is intact, its not my penis to go cutting. — ", "As far as preference, I have been with both circumcised and un… I don’t have a preference for feeling, but both of the circ that I have been with wished they were not due to having less sensitivity. — ", "I was raised in a very strict catholic household and attended strict catholic schools. ", "So, of course, when it was time for teenage rebellion I became a rabid slut. ", "Looking back now, I am absolutely appalled at myself, but it makes me fairly qualified to offer you some insight into your circumcision inquiry. ", "I didn’t knowingly see an intact penis until I was 19. ", "An acquaintance mentioned his intact status and was thrilled to show it off in all it’s turtlenecked glory. ", "I was intrigued. ", "We ended up having a sexual relationship (rabid slut, remember?) ", "and I didn’t put much stock in it at the time, but it definitely felt better than the many previous encounters with intact penises. ", "Since this guy was slightly older than my previous partners, I just assumed he was better at it and had some slick moves that the guys in their teens and early 20s just hadn’t learned yet. ", "Even though I was 4 years into my rabid slut phase, I still experienced pain and discomfort especially during the relentless pounding that seemed to occur right before the male orgasm. ", "Shortly after this intact experience, I entered into a long-term relationship with a circumcised man. ", "I became obsessed with receiving cunnilingus because it was the ONLY way I could have an orgasm. ", "I thought it was just me and I was just incapable of vaginal orgasm. ", "No biggie though. ", "I mean, who doesn’t like getting head?! ", "After the demise of that relationship, I entered into another long term relationship with another circumcised man. ", "Sex was terrible and so was the oral. ", "I spent a LOT of time pleasuring myself. ", "The sex was so awful I ended up cheating with an intact man. ", "It was wonderful! ", "I chalked it up to the thrill of cheating and being discovered that made it so exciting. ", "I experienced my first vaginal orgasm, but certainly didn’t attribute it to foreskin. ", "Jump ahead a few years and a few generic sexual partners later. ", "I met my husband. ", "We were friends first but the sexual attraction was undeniable. ", "I wasn’t thrilled about the idea of marrying a man with a foreskin (the cultural ideal of circumcised being normal seriously clouded my judgement), but the sex was terrific and I loved him, so married we were. ", "It wasn’t until I was pregnant with our first child, a son, that I even mentioned circumcision to my husband. ", "As an intact male, he was adamant about keeping our boy intact. ", "I fought for having him circumcised. ", "It was a point of contention for a while but i figured I would just send our little boy off to be circumcised while my husband was otherwise distracted and he would get over it. ", "Then, during a birthing class at the hospital where we would deliver our son, they showed a picture of a newly circumcised baby penis while discussing newborn care and how to take care of your new baby (they showed it like it was just normal for all moms and dads of sons to have to do this). ", "That little tiny penis. ", "It was bleeding and purple and pissed the fuck off. ", "I started crying and had to swallow my own vomit. ", "I made the decision then and there that I wouldn’t do that to any child of mine. ", "Skip ahead a few years, my sons pediatrician gave us really shitty advice regarding intact care and our son ended up having issues with his foreskin. ", "His pediatric urologist was adamant about NOT removing his foreskin and I didn’t understand why. ", "He stated, “you cause more problems removing it than by keeping it on.” ", "Well, that started my quest for knowledge. ", "I read everything I could. ", "I started paying attention to my husbands foreskin during sex and foreplay. ", "I finally realized that precious encounters with intact men were awesome because of the foreskin and not because of “slick moves” or the thought of being caught cheating. ", "So yeah, there’s my experience with intact and circumcised. ", "Any questions, feel free to ask. ", "Glad my rabid slut days could be useful. — ", "This message is regarding the circ or non circ. ", "I’m in love with a man who is and he would have liked to have been left intact. ", "Now why I say this is because everyone I’ve had sex with in the past were intact but I never really orgasimed or had as much fun as you do when you are in love with the person. ", "Though from time to time we need lube. ", "which may be the biggest difference. ", "Hope this may help. ", "so I’d prefer if no one was cut, but circed guys can rock it just as well, or maybe they just did not care in pleasuring me as much as my hubby now. ", "LoL. Our son is intact and I hope he is happy he can make his own choice. — ", "I am 36 years old i got married for the first time when i was 16, he was circumcised, i used to have problems with dryness and chafing, he would get like rug burn on his penis, he always blamed me and i never knew why, we did have a very active sex life though, after 10 years we divorced. ", "that year i met my current husband who is not circumcised, right away i noticed i did not have those problems at all, as i was pregnant with a boy i started researching and right away found an article about the functions of the foreskin which explained the reason behind all the problems with my exhusband, because of the extensive research i did i left our son intact. ", "Also because of my research i am now an intactivist so due to experience with both, i very much prefer intact men. — ", "Following up on your request for opinions and experiences regarding circumcision. ", "My partner is uncircumcised and it definitely enhances our sexual experience. ", "He has more sensitivity than other men I’ve been with and it’s so much fun to be able to give him pleasure by using his foreskin to either blunt or intensify sensations. ", "Aesthetically, I think it’s really nice to look at, flaccid or erect. ", "For me, physically, it creates an extra level of sensation during sex because of the way the foreskin slides along his shaft and the head; it feels really good. ", "Being with him has definitely given me a preference for an intact penis. — ", "After being sexually active for 10+ years, I started a relationship with my first intact man this year, and I want to let you know that the sex is orders of magnitude better. ", "I have no idea why. ", "I think because he is more sensitive, he can more easily pinpoint and target the exact areas I need stimulated. ", "He also savors the act much more than anyone else I’ve ever been with, taking his time and exploring me. ", "I don’t mean for this to sound erotic, just trying to make clear that I’ve tried a fairly large number of men, and I believe his intact penis has made a huuuuge difference in our sex life. ", "And it’s wonderful. (", "My son is also intact, although his father wasn’t and I’d never even seen an intact penis in real life.) — ", "Uncircumcised has been a better experience for me because — for lack of better words– it seems to ‘fit’ better and not feel as harsh. ", "With circumsized partners I’ve experienced discomfort..a sharpness?? ", "Regardless of the size or experience of the uncircumcised partner…it’s simply felt more comfortable. — ", "I have been with both intact and circumcised men, and I prefer the intact. ", "For instance: When giving oral, it was much easier to do so with the intact man than the other. ", "I guess there is more to work with so to speak? ", "It seemed like a lot less work with the intact man. ", "It also seemed like the intact man enjoyed sex more (not sure if the person or if because he was intact). — ", "I spent the majority of my young adult years experimenting sexually, I was very open and adventurous, and gained a lot of valuable life experience. ", "I lost count of the number of partners I’ve had, though I remember each man and the experiences vividly. ", "Thankfully, I was in the military for part of that time, and that made the variety of men and their circumcision status more varied, as they were from all over including foreigners. ", "My first several sexual partners were all circumcised, from back home in the south where that was common. ", "I noticed that sex was always quite painful, and thought its because I was not yet very experienced, that it was “supposed to hurt” the first few times. ", "When it continued with subsequent partners, I thought it was somehow *my* fault. ", "I was too dry, needed lube, wasn’t “doing it right” – something, but surely it wasn’t their fault. ", "Then I had my first intact partner. ", "A Caribbean man, much larger than my previous partners, but whole. ", "When I saw it, I just knew it was going to hurt – if all the average sized men had hurt, certainly such a behemoth would be excruciating! ", "But it wasn’t. ", "It was smooth and sensual, it felt amazing. ", "No pain whatsoever, only pure pleasure. ", "At the time, I didn’t put two and two together and realize WHY it was better. ", "I just knew that without a doubt it was. ", "More painful sex with circumcised men, then another intact partner – this time from Italy. ", "Another blissful experience. ", "I remember laying in bed, stroking his penis and examining his foreskin up close – I was fascinated. ", "I started watching the way it moved when I stroked him, how there was no friction and no need for lube at all. ", "All of a sudden, the lightbulb went on! ", "I had a suspicion that THIS was what it was all about, this was why it didn’t hurt! ", "This cut/intact pattern repeated many times, always with the same results. ", "Every time I had sex with a circumcised man, my vagina and labia were sore, chafed, dry, and tender for several days afterward – regardless of whether the sex was slow and easy or rough. ", "Many times, I would chafe until I bled. ", "This never once happened with an intact man. ", "I also noticed a massive difference during oral sex. ", "With circumcised men, not only did it take so much longer to satisfy them orally (which made my mouth, jaw, and neck muscles hurt), but there was such a noticeable texture difference that was very unpleasant. ", "Their glans were rough and dry, sometimes calloused or scaly feeling. ", "It was like licking sandpaper. ", "Not to mention the hairy shafts, curved penises, skin bridges, and scars. ", "It was not at all pleasurable for me and difficult pleasure for them. ", "On the other hand, the intact men were amazing to give oral to. ", "It was smooth and silky, it felt fantastic on my mouth. ", "There was no need to spit in an effort to lubricate it enough to perform oral, and it didn’t take forever to please them. ", "They also had their frenulum still, which made oral sex a mind blowing experience for them, and instead of me suffering through, I actually greatly enjoyed it and looked forward to being able to do it. ", "I’m now married to a tightly circumcised man, who I love dearly. ", "However, the sex is painful and its gotten to the point where I would rather chew my arm off than have to do it. ", "Mentally, this sucks, as I miss being close to him that way – but the pain is at a level that I just cannot possibly suffer it. ", "We now only have sex about 4 times a year, and I dread every second of it. ", "A few months ago, he began manual foreskin restoration. ", "In just 2 months his coverage went from a tight CI-1 to approximately a CI-3 or CI-4, with almost complete forced erect coverage (FEC). ", "I can now give him manual or oral sex with less problems, and will be attempting sex again very soon and we are hoping for marked improvement. ", "It’s a long process, but we are very hopeful. ", "It’s unfortunate that its even necessary though, as it should never have been forced on him. ", "Parents do these horrible things to their children, never considering the feelings of that child as an adult, or how their future partners will feel. — ", "My DH’s erection has a pinch in it when erect, where his scar tissue is, and it literally leaves a deep indent around the circumference when erect. ", "It doesn’t seem to hurt, but it’s quite noticeable. ", "His sex drive is subpar, and I miss the extra lubrication and heat of an intact penis. ", "But I love him completely and it is what it is.", "\n\n\n\n— I only ever had been with cut men up until my boyfriend in 2008. ", "Before then, sex was ALWAYS painful, I felt like I was being cut with a knife every time. ", "Sex with my intact boyfriend was not much different in the sense that everything seemed to work the same way. ", "It didn’t look different when erect, etc.. The only difference I noticed was that we both enjoyed sex. ", "And it didn’t HURT. ", "After we broke up…the boyfriends after him have been cut. ", "I’m in so much pain that I don’t WANT to be intimate. ", "And for all the people that say that cut men are cleaner, that is so untrue. ", "They can be very, very stinky. — ", "Been with both. ", "I prefer circumcised. ", "The smell of uncircumcised ones are gross. ", "I wanted to keep my son natural because what I read but husband thought he should be circumcised like himself. ", "I dated someone for five years who was uncircumcised until he was 18, he tore his penis while having sex with his girlfriend. ", "He said it hurt liked hell to be circumcised at 18 and not been able to get a hard on at that age was really difficult. ", "My grandpa tore his penis having sex with my grandma in his 80’s. ", "I see that being a downfall of being uncircumcised. ", "Don’t use my name please. — ", "I wanted to comment on your request for opinions on circumcision. ", "I have had two long term relationships…’one of each’, I guess you can say. ", "The things that I have noticed, as a woman, is that, first of all, my current partner, who is intact, is up for a second round much quicker than any of the circ’d guys that I have been with. ", "He could go all night (if we had the energy…we have five kids and he works 80 hr weeks, so it’s energy, not stamina that’s the issue). ", "The other guys would ‘have fun and be done’, so to speak. ", "The second thing i’ve noticed is that, even though he’s approaching 40, his sex drive hasn’t slowed a bit. ", "He could easily keep up with any college guy when it comes to desire. — ", "I’ll try and keep it brief. ", "When I was 19 (so still fairly inexperienced) I had a sexual relationship of about 7 months with a circumcised guy. ", "I used to experience dryness and thought it was my “fault” and was worried he would think he wasn’t arousing me enough etc. ", "That said, I did like his thrust technique in that it was exhilarating but it didn’t really induce orgasm as great as it was, so we used to do other stuff so that I could have my turn. ", "Regarding the dryness, however, I hadn’t really considered this till I read your article but I have never experienced anything like this since (my husband is intact and he was the next guy I was with). ", "I have never ever needed any lube or anything like that with my husband. ", "Thrust wise, my husband and I do more of a thing where we intertwine my legs around him and its a more subtle thrust and whilst it didn’t always make me orgasm at first, we now (after 12 years of marriage) have it down to a fine art! — ", "Re circ: As a female, sexually, I have no preference either way. ", "My ex was au naturale and I called it The Hooded Cobra. ", "Um, that may be TMI… >sheepish grin< That was when it was flaccid; when erect it looked the same with no obvious extra skin but when, um, in action, so to speak, the extra skin enabled a smoother piston effect with less need for lubricant, I guess you could say. ", "Whereas a hand sliding up and down a circ would need some saliva, doing the same on an uncirc would cause the extra-as opposed to loose-skin to: easily slide up and over the head then retract on the downstroke to look the same as a circ. ", "You follow me? ( ", "Geez, I’m 52 and blushing! ) — ", "Hi,regarding your circumcised/uncircumcised post today, generally I prefer other ways of support and show of attention to sex, but actually I enjoyed it more with a circumcised partner, quite possibly due to other factors involved like they care for me more than my ex, etc …. ", "just a contribution to your stats. — ", "In regards to your question about circumcision: i have been with a total of 6 men in my lifetime thus far, one being my husband. ", "all of the men i was with before my husband were circumcised, my husband is not. ", "i can honestly say that for me, being with someone that is intact is much more pleasurable. ", "my husband is the only man that has ever made me achieve an orgasm. ", "i don’t think this is entirely because he is intact, but i don’t think its just coincidence either. — ", "Saw your post. ", "Chiming in WHOLEHEARTEDLYwith a strong preference for intact men. ", "I have a unique situation. ", "I’m polyamorous. ", "I have a husband who is cut and a boyfriend (this word is so wrong- he is just as much of a life parter but we don’t share children or a home) who is intact. ", "The difference is CLEAR and profound. ", "I’m not relying on memory. ", "I’m currently experiencing both sides of this coin. ", "There are pheromone glans that are only found on the foreskin- I think besides the mechanical differences, this is a factor. ", "I love both my men very much but there is a “chemistry” factor w the intact man- and it may seem silly but I think that has something to do with it. — ", "When I met my 2nd husband, he is not circumcised and was the first man I had ever been with who wasn’t. ", "It is a much different experience. ", "It’s much better. — ", "I have had 2 intact partners in addition to my circumcised partners, and my current bf is cut. ", "He suffers from delayed ejaculation, and has never been able to orgasm from oral alone in his life. ", "Like the majority of my other circumcised partners, he also has to jackhammer away at me to orgasm. ", "At best, this is awkward and not very pleasurable for me, at worst I’m sore for awhile afterward. ", "I feel lucky however, knowing there are some couples out there who suffer much more because of circumcision. ", "I like foreskin. ", "Probably because its a natural, pleasurable part of a man’s genitals that they all SHOULD have. ", "My intact partners had zero sexual dysfunction issues, infections, or UTIs. ", "And I never had to use artificial lube with them. ", "Neither have any of the other 3 intact men I personally know. ", "Infections and the like in intact males, if frequent, are probably more due to improper care in adolescence. ", "Too many parents and doctors are misinformed and believe you have to retract and clean underneath the foreskin from infancy, when in reality it is fused to the head of the penis until sometime during puberty. ", "The sexual preference of a mother should NEVER be a deciding factor in whether her sons are cut or not. ", "It’s his penis to use for sex, and his sexual partners in the future should certainly not include his mother, so why would anyone decide that? ", "Same thing with the father. ", "I don’t care how much he likes his cut penis. ", "He never knew the difference anyway, and his son may very well grow up to be one of the many men restoring their foreskins today. ", "I resent that my boyfriend was circumcised. ", "He’s the best guy I’ve ever dated, and our sex life isn’t as it should be because his parents cut him in ignorance, probably just trusting what their biased & circumcised doctor told them was right. — ", "I have only been with two guys that weren’t. ", "And the only one I’ve ever had any type of actual pleasure with was my husband, who isn’t. — ", "i experienced sex with both circumcised and non and it was great most of the times. ", "i sincerely felt no difference. ", "maybe the circumcised man, which is my actual husband has a longer organ.. i don’t know if this is due to the surgery or just his nature. ", "we have an excellent sexual life. ", "but we had a baby which i decided not to circumcise, in Egypt.. I was probably the only crazy mom in that hospital, who said no. ", "I am happy that my husband, egyptian citizen, didn’t argue. ", "he just told me that our son will feel embarrassed in a world of circumcised boys but he let me do what i feel is best for our son. ", "i am so proud of my decision. ", "pls don t mention my name. ", "have a great day! — ", "I had never seen an intact penis before I met my husband, and I had never achieved an orgasm during sex with any cut man I had been with. ", "After having sex with my husband for the first time, and having my first orgasm during sex, intact is so much better! ", "We have no need for lube, and my husband has never had any type of genital infection. — ", "My first husband was, which is really unusual here in the uk. ", "He struggled with premature ejaculation — In addition sexually I prefer circ and have had less issues with infections with my second circ’d husband — I am going to give a little over share here I have had my share of partners. ", "Two of them have been intact. ", "My first boyfriend and my current boyfriend. ", "There have been TEN years in between my first and current boyfriends. ", "In that time, I have had the WORST sex of my life. ", "Literally pounded so hard that my thighs hurt, rough dry sex. ", "I always thought it was me. ", "I tried drinking more water (was I dehydrated??) ", "I tried so much. ", "Some guys even blamed me (“Why do you get so dry so fast?”) ", "I met my current boyfriend and not only do I orgasm every time we have sex, it is never ever dry. ", "There is no friction, he moves in and out so easily. ", "It feels good just to have him inside me. ", "I am never sore or in pain. ", "I have literally never had better sex in my life. ", "My first partner was the same way, but I was young and had no experience. ", "He can go two or three more times with little time in between. ", "It feels VERY natural, for both of us. ", "It only magnifies the terrible sex I have had in the past. ", "I feel so bad for what I have taken from my sons, I had no idea circumcision had such an impact on a man!", "\n\n\n\n— When I was a teen I spoke to a teenage boy who was circ’d as a teenager, he hadn’t had sex but had… hmm how do I put this, pleasured himself before and after. ", "He said there was a huge difference and it was a longer, less enjoyable experience after that he wasn’t always able to finish. ", "He was circ’d overseas without his consent shortly after puberty. — ", "I’m not going to get too graphic but I have also been with both circ’d and intact men, and hands down intact is way better every single time. (", "circ’d can be good too, but a foreskin is definitely a plus) Also just judging from the whole experience the intact men just seem to enjoy sex much more and get way more pleasure out of it and have to try much less. ", "Intact men can delay their orgasm and also have multiple orgasms. — ", "I had multiple partners before my husband. ", "My husband is the only intact man I have had sex with. ", "With circumcised men, it would hurt me to have sex. ", "For lack of a better way to describe it, they rubbed me the wrong way. ", "I always assumed it was me. ", "Eventually my body would get used to it, right? ", "Or perhaps I had scar tissue or something…? ", "Everything changed the first time I had sex with my husband. ", "The difference was AMAZING. ", "Not only didn’t it hurt, but I actually orgasmed during sex for the first time ever. ", "Another thing, we don’t need to use lubricant. ", "So, that’s it. ", "7000 words worth. ", "Should give you a lot to think about. ", "Consider the following resources to either educate yourself or those dear to you: Dr.Momma Saving Our Sons Intact America Sex as Nature Intended It (very NSFW, but oh-so-informative) No Circ Your Child May Be Trying to Tell You Something Very Important… Our neighbor is a convicted pedophile. ", "He is currently in state prison for molesting his best friend’s daughter. ", "He began sexually assaulting the child beginning at the age of six until she was in her early teens. ", "I only know this because a friend of mine’s wife is best friends with one of the pedophile’s […] Man Vs Blizzard One might think my workplace would be eager to curtail operations early as to allow their employees to leave before the snow begins piling up on the roads. ", "Alas, this is not the case. ", "If anything, they seem to keep us longer because they fear the next shift of workers will simply say “screw this” […] What is Unschooling? ", "Imagine Every Day is Saturday. ", "You know what a typical day during summer recess looks like? ", "Or a normal Saturday or Sunday morning? ", "Now, imagine that all year long, every day. ", "That’s unschooling. ", "What does this look like in our house? ", "You’ll see mom and dad puttering around the house, tidying here and there, fixing this and that, chatting, giggling, […] “Triggers”, and How to Defeat Them That time of year is upon us — you know, the holidays. ", "For some, it’s a stress-fest; for me, it’s always been an extra special time for family, with one exception — setting up the tree. ", "Growing up, the holiday season was the one time during the year that my dad was happy; as a […] Dear NSA: About those Text Messages Dear NSA: Regarding the recent news that you’ve been collecting all emails, telephone calls, text messages, and most other forms of electronic communications… I trust that you’ve found most of my correspondence to be quite routine – boring, in fact. ", "Telephone calls to my sick mother. ", "Those emails I’ve forwarded with adorable baby animals. […] ", "Older Entries »" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.015495113097131252, 0.0028036797884851694, 0.01639503426849842, 0.0012280154041945934, 0.0011193259852007031, 0.0011210199445486069, 0.0012065160553902388, 0.15270426869392395, 0.0019433366833254695, 0.0006676147459074855, 0.0006624647066928446, 0.007007550448179245, 0.9860755801200867, 0.16348876059055328, 0.0008559385314583778, 0.4907159209251404, 0.01087926421314478, 0.0005344431847333908, 0.001810277346521616, 0.04703643545508385, 0.0030379651580005884, 0.0007902092766016722, 0.0006979951867833734, 0.0010468304390087724, 0.0005920925759710371, 0.021541278809309006, 0.001955938758328557, 0.000982929952442646, 0.0004849632387049496, 0.0006065732450224459, 0.0006728355074301362, 0.0005918361712247133, 0.0011144998716190457, 0.0007053195149637759, 0.9443124532699585, 0.5243768095970154, 0.08152000606060028, 0.1079523116350174, 0.7481628060340881, 0.9924517273902893, 0.38292941451072693, 0.26797980070114136, 0.0008665456552989781, 0.18379026651382446, 0.0007896601455286145, 0.5718694925308228, 0.9685909748077393, 0.8911331295967102, 0.004436322953552008, 0.9718713164329529, 0.005318013485521078, 0.8453096747398376, 0.0006408588378690183, 0.004043410532176495, 0.0012906288029626012, 0.002919913036748767, 0.0011407607235014439, 0.0006086362991482019, 0.5688249468803406, 0.1788555234670639, 0.0006452365196309984, 0.30025607347488403, 0.001979911932721734, 0.0007047134567983449, 0.0778798833489418, 0.0028728079050779343, 0.0009536517318338156, 0.7428159117698669, 0.0021060348954051733, 0.0008137464174069464, 0.00223116809502244, 0.0005534104420803487, 0.09780744463205338, 0.0026473335456103086, 0.013467648066580296, 0.0005855558556504548, 0.0008673935080878437, 0.0019050526898354292, 0.0006338743842206895, 0.001105394447222352, 0.0006193373119458556, 0.0005550369969569147, 0.0007802852778695524, 0.6945658326148987, 0.007281611207872629, 0.0006393894436769187, 0.0006575527368113399, 0.0006096186698414385, 0.0014810459688305855, 0.17305776476860046, 0.0009383135475218296, 0.0013309814967215061, 0.0005553271621465683, 0.001125839538872242, 0.003433628473430872, 0.5751978754997253, 0.0012052968377247453, 0.04505865275859833, 0.0009630357380956411, 0.0010415284195914865, 0.0009663104428909719, 0.0012154493015259504, 0.0008550100610591471, 0.0012172445422038436, 0.001129297656007111, 0.8972720503807068, 0.0007517245830968022, 0.003506486536934972, 0.0006641756626777351, 0.0012299235677346587, 0.0007648752653039992, 0.018137408420443535, 0.0012333207996562123, 0.0014943135902285576, 0.007917262613773346, 0.000944191706366837, 0.8528958559036255, 0.006183489225804806, 0.03407970070838928, 0.0006113650742918253, 0.30129531025886536, 0.0019105105893686414, 0.7756087183952332, 0.0007501020445488393, 0.005921021569520235, 0.0015941885067149997, 0.0005533187068067491, 0.9516955614089966, 0.003486950183287263, 0.0007091119769029319, 0.2996147871017456, 0.03156242147088051, 0.02788383513689041, 0.0012553827837109566, 0.006084554363042116, 0.0006715369527228177, 0.0007304796599783003, 0.0012725566048175097, 0.008271128870546818, 0.0005751536227762699, 0.0006551541155204177, 0.006596029736101627, 0.8139783143997192, 0.0016732965596020222, 0.7593191862106323, 0.16120199859142303, 0.0006583199719898403, 0.0006811974453739822, 0.06449973583221436, 0.0005817173514515162, 0.0008433106122538447, 0.004317886661738157, 0.0007570417947135866, 0.0008940021507441998, 0.0009736546198837459, 0.0011845078552141786, 0.4956356883049011, 0.0007497447077184916, 0.0009183812071569264, 0.002743146847933531, 0.000661128549836576, 0.0005660620518028736, 0.0029345292132347822, 0.0007435877341777086, 0.9779554009437561, 0.0018585949437692761, 0.0006943060434423387, 0.24056440591812134, 0.0008189736399799585, 0.10196880996227264, 0.9657549262046814, 0.0031995882745832205, 0.000555946899112314, 0.0017189476639032364, 0.0015619551995769143, 0.0009294593473896384, 0.0006600560736842453, 0.1647958606481552, 0.009044121019542217, 0.8816206455230713, 0.0007012027781456709, 0.9215252995491028, 0.892710268497467, 0.9554783701896667, 0.5571439862251282, 0.9106478095054626, 0.0007940037176012993, 0.0009616503375582397, 0.8850725889205933, 0.0006366173038259149, 0.7285768985748291, 0.000655374547932297, 0.0005673816776834428, 0.8923770785331726, 0.23396903276443481, 0.0007965917466208339, 0.6450231075286865, 0.02276078425347805, 0.39224973320961, 0.49504178762435913, 0.0014208955690264702, 0.0873018130660057, 0.11094478517770767, 0.922434389591217, 0.2118733823299408, 0.8014931678771973, 0.0007246852037496865, 0.0008509697508998215, 0.140553280711174, 0.41006389260292053, 0.0011778404004871845, 0.012727776542305946, 0.004666497930884361, 0.005472275894135237, 0.000928902009036392, 0.024806123226881027, 0.0022870709653943777, 0.323562353849411, 0.9955001473426819, 0.9897078275680542, 0.46159401535987854, 0.0014560386771336198, 0.48458239436149597, 0.021811071783304214, 0.0009286812273785472, 0.0006262362585403025, 0.0006714486517012119, 0.6769734025001526, 0.0035019973292946815, 0.0011485569411888719, 0.0005772144068032503, 0.8539801836013794, 0.0006787636666558683, 0.0009267159039154649, 0.14518560469150543, 0.09515520930290222, 0.0006862695445306599, 0.0005642424221150577, 0.01803491823375225, 0.0006808320176787674, 0.6699626445770264, 0.0007922013173811138, 0.0005530545604415238, 0.0007475697202607989, 0.2621188461780548, 0.02063070237636566, 0.001930507831275463, 0.2153797298669815, 0.844416618347168, 0.03743767365813255, 0.000920640304684639, 0.0005961034912616014, 0.010948775336146355, 0.4232003390789032, 0.0005709003889933228, 0.32441946864128113, 0.0009507965296506882, 0.0006581330089829862, 0.000814915809314698, 0.000869917101226747, 0.0005592685774900019, 0.0006176393362693489, 0.0006336189107969403, 0.02117854915559292, 0.0008163716993294656, 0.0005514756194315851, 0.0008836312917992473, 0.06772011518478394, 0.05059926211833954, 0.001238620257936418, 0.07551690191030502, 0.0005985227762721479, 0.0006748310988768935, 0.047969892621040344, 0.000872542557772249, 0.0005604494945146143, 0.0029420952778309584, 0.0005649735103361309, 0.0006909228977747262, 0.8132963180541992, 0.0006127878441475332, 0.9558087587356567, 0.01017636526376009, 0.0014791650464758277, 0.0021326858550310135, 0.0005668011726811528, 0.8993291854858398, 0.0260792076587677, 0.0007077569607645273, 0.2667849063873291, 0.08207577466964722, 0.014297785237431526, 0.6044678688049316, 0.863541305065155, 0.001129568787291646, 0.0005474602221511304, 0.0006233467720448971, 0.056536655873060226, 0.19409814476966858, 0.007284948136657476, 0.6661614179611206, 0.8957626223564148, 0.3463273346424103, 0.0006276849890127778, 0.0006469517247751355, 0.8527540564537048, 0.0005537969991564751, 0.0008564199088141322, 0.0434044748544693, 0.4852035343647003, 0.0010056227911263704, 0.9367047548294067, 0.0006524324417114258, 0.06836612522602081, 0.6432589888572693, 0.34879663586616516, 0.022994032129645348, 0.0028614848852157593, 0.019787980243563652, 0.0232786163687706, 0.0026217312552034855, 0.9340910315513611, 0.0008096956880763173, 0.0023084525018930435, 0.7057960033416748, 0.021758034825325012, 0.9704310894012451, 0.09180720895528793, 0.9894422292709351, 0.001688775373622775, 0.0021422123536467552, 0.0006544645293615758, 0.0006212033331394196, 0.0035267602652311325, 0.0016021423507481813, 0.0012346884468570352, 0.19930106401443481, 0.0010017501190304756, 0.000583952700253576, 0.15976502001285553, 0.0012411193456500769, 0.002120077144354582, 0.000587577698752284, 0.15994085371494293, 0.00708325020968914, 0.003140737535431981, 0.0012308774748817086, 0.005035862792283297, 0.0055160499177873135, 0.0020538775715976954, 0.0014999978011474013, 0.05331895500421524, 0.0007572929607704282, 0.0007816680590622127, 0.004549218341708183, 0.0006465732003562152, 0.32508930563926697, 0.0006403520237654448, 0.0010471013374626637, 0.0006107829394750297, 0.0005975070525892079, 0.005713083781301975, 0.015515072271227837, 0.0005824196268804371, 0.0008189088548533618, 0.000609192589763552, 0.02196105383336544, 0.0006325512076728046, 0.002644927706569433, 0.0006108440575189888, 0.0006507979123853147, 0.0007643175194971263, 0.8950058817863464, 0.8016740083694458, 0.0006469932850450277, 0.0018310202285647392, 0.014971384778618813, 0.474541574716568, 0.01954125426709652, 0.12762168049812317, 0.0007355724810622633, 0.00131531385704875, 0.403491348028183, 0.02867109328508377, 0.9287091493606567, 0.0008739137556403875, 0.9796890616416931, 0.0023305758368223906, 0.035313647240400314, 0.1936825066804886, 0.0010074994061142206, 0.011674034409224987, 0.5010883212089539, 0.0006431070505641401, 0.15749265253543854, 0.588702917098999, 0.02077573537826538, 0.0006845747120678425, 0.03875095397233963, 0.0005956775275990367, 0.0013798914151266217, 0.0014675864949822426, 0.8184234499931335, 0.42616647481918335, 0.07605598866939545, 0.0005996135296300054, 0.4880567491054535, 0.0006003332091495395, 0.0014964481815695763, 0.0011605932377278805, 0.35087713599205017, 0.9461929798126221, 0.0006541387410834432, 0.0011047349544242024, 0.0010088663548231125, 0.004289057105779648, 0.20510447025299072, 0.0011666512582451105, 0.023937975987792015, 0.0030869320034980774, 0.32523876428604126, 0.0006056089187040925, 0.0006919462466612458, 0.0005980146816000342, 0.38948071002960205, 0.008171356283128262, 0.06696223467588425, 0.0005910153267905116, 0.05468764528632164, 0.0006993554998189211, 0.03285130858421326, 0.21583151817321777, 0.0012372484197840095, 0.718602180480957, 0.8140032291412354, 0.005631645675748587, 0.0006702926475554705, 0.0007513851160183549, 0.003017314011231065, 0.630552351474762, 0.0006055214325897396, 0.36599001288414, 0.13424324989318848, 0.0013711315114051104, 0.0008141901344060898, 0.0006231266888789833, 0.3472890853881836, 0.15377043187618256, 0.274583637714386, 0.02518884465098381, 0.0010469435947015882, 0.008795572444796562, 0.0008755941526032984, 0.0007844783831387758, 0.0008550300262868404, 0.0007501541404053569, 0.0022634766064584255, 0.0006832747021690011, 0.00184020702727139, 0.0006118468591012061, 0.0007610127795487642, 0.032281097024679184, 0.0006726649589836597, 0.0006669797585345805 ]

[ "Q:\n\nWindows authentication auto login in .net core API\n\nI want to do auto login to .net core API using windows authentication.", "\nI have enabled windows authentication and rest all authentication is kept disabled. ", "now I am trying to run the API. ", "its prompt popup for enter the credentials for login.", "\nI do not want any popup which asks users to enter login details. ", "its should auto authenticate using the current login user. ", "however, if I enter login details in that popup, still it's not getting authenticate, it keep asking me to enter the credentials.", "\nTried approach:\n\nIn IIS, application pool's identity set custom account, (current login account which is administrator)\nEnable Anonymous authentication along with windows authentication. (", "when I do this then API does not give popup for login but its give null object for User.", "Identity.", "Name)\n\nReference:\nI have implemented windows authentication by referring to this article\nNote: When I run API from visual studio (IIS Express) its works fine, but when I host API to local IIS, then I am facing a challenge as I described above\n\nA:\n\nYou have to whitelist a domain specified in the hosts file in order for windows authentication to work:\n\nClick Start, click Run, type regedit, and then click OK.", "\nIn Registry Editor, locate the following registry key: HKEY_LOCAL_MACHINE\\SYSTEM\\CurrentControlSet\\Services\\LanmanServer\\Parameters\nRight-click Parameters, click New, and then click DWORD (32-bit) Value.", "\nType DisableStrictNameChecking and press ENTER.", "\nDouble-click the DisableStrictNameChecking registry value and type 1 in the Value data box, click OK\nIn Registry Editor, locate and then click the following registry key: HKEY_LOCAL_MACHINE\\SYSTEM\\CurrentControlSet\\Control\\Lsa\\MSV1_0\nRight-click MSV1_0, point to New, and then click Multi-String Value.", "\nType BackConnectionHostNames, and then press ENTER.", "\nRight-click BackConnectionHostNames, and then click Modify.", "\nIn the Value data box, type the host name or the host names for the sites that are on the local computer, and then click OK.", "\nQuit Registry Editor, and then restart the IISAdmin service.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006812214269302785, 0.002151238964870572, 0.0006815827800892293, 0.0006373701617121696, 0.0007058564806357026, 0.0005944286822341383, 0.0005595688126049936, 0.0005816241609863937, 0.0008920799009501934, 0.0007690858910791576, 0.000558374566026032, 0.0006763116107322276, 0.0014106519520282745, 0.0010804999619722366, 0.0006806236924603581, 0.0006888568750582635, 0.0006564926588907838, 0.0008597190026193857, 0.001995444530621171 ]

[ "Introduction {#sec1-1}\n============\n\nRhabdomyolysis is a well-known side effect of statin therapy. ", "Manifestations are usually limited to muscle aches and weakness. ", "When statins are used in patient with other risk factors for muscle injury, severe muscle damage may result. ", "We report a case where introduction of simvastatin in a patient with unsuspected hypothyroidism caused severe rhabdomyolysis and acute kidney injury.", "\n\nCase Report {#sec1-2}\n===========\n\nA 52-year-old Indian woman presented at King Abdulaziz University Hospital\\'s emergency department with complaints of generalized, dull and constant myalgia. ", "She expressed an \\'inability to put her weight on her feet\\'. ", "These symptoms persisted for three days and were associated with weakness, fatigue and a decreased urine output for two days. ", "Her medical history included diabetes mellitus under insulin administration, hypertension, anemia secondary to fibroids and coronary artery disease with an inferior myocardial infraction (20 days before). ", "The patient had no history of renal disease with a baseline creatinine of 106 μmol/L. Simvastatin (80 mg daily) was initiated by her cardiologist after she underwent cardiac catheterization 20 days prior to presentation. ", "In addition, she was taking insulin, diuretics, losartan, aspirin and clopidogrel.", "\n\nThe patient\\'s vital signs were as follows: temperature, 37°C; pulse, 60 beats per minute (paced); blood pressure, 130/65 mmHg and respiration, 18 breaths per minute. ", "Physical examination showed paleness, obesity and dull appearance. ", "Her system examination was largely unremarkable. ", "No palpable goiter was observed on neck examination and there was no delayed relaxation of ankle jerk. ", "Laboratory evaluation at admission revealed creatine kinase (CK) of 81,660 U/L; aspartate aminotransferase (AST), 2,497 U/L; alanine aminotransferase (ALT), 1,304 U/L; blood urea nitrogen (BUN), 88 mg/dL; creatinine, 5.1 mg/dL. Arterial blood gases demonstrated mild metabolic acidosis. ", "Her serum potassium was 6.2 mmol/L and thyroid stimulating hormone (TSH), 22.7 U/L (normal range, 0.27-4.2) with a serum free thyroxine (FT~4~) of 12.6 Pmol/L. Her serum cholesterol level was 258 mg/dL; triglyceride, 196 mg/dL and low density lipoprotein (LDL), 134 mg/dL.\n\nShe was diagnosed with rhabdomyolysis and oliguric acute renal failure. ", "Simvastatin was discontinued and she was administered forced alkaline diuresis (intravenous normal saline with bicarbonate). ", "L-thyroxine (25 mcg) was administered initially and subsequently the dose was increased to 50 mcg daily. ", "At discharge (15 days after hospitalization), laboratory results showed CK level of 1865 U/L and creatinine level of 1.8 mg/dL. Thyroxine administration was continued as an outpatient; however, no hydroxymethylglutaryl coenzyme (HMGCoA) reductase inhibitor was restarted in view of severe rhabdomyolysis. ", "After six weeks, her CK was 151 U/L; creatinine level decreased to 1.4 mg/dL; AST level decreased to 186 U/L; and ALT decreased to 51 U/L. FT~4~ was 14.5 Pmol/L with a TSH of 2.06 U/L. On follow-up visit, she continued to report some mild residual weakness one month after hospitalization.", "\n\nDiscussion {#sec1-3}\n==========\n\nHMGCoA reductase inhibitors are effective in primary as well as secondary prevention of coronary disease.[@CIT1] Therefore, these agents are used as the first choice for hypercholesterolemia in this subset of the population, especially atrovastatin and simvastatin.[@CIT2] According to the research firm IMS Health, HMGCoA reductase inhibitors represent the highest class of drugs in the United States with regard to their sale; atorvastatin and simvastatin were the first and second most prescribed statins in 2006, respectively.[@CIT3]\n\nThey are usually well tolerated. ", "However, they can cause a variety of musculoskeletal complications, including clinical mysotis and rhabdomyolysis.[@CIT4] The reported risk of rhabdomyolysis with simvastatin monotherapy is low and dose related (0.02% at 20 mg daily, 0.07% at 40 mg daily and 0.3% at 80 mg daily).[@CIT5] Several factors that increase the risk for both myopathy and rhabdomyolysis have been identified, including advanced age, chronic renal insufficiency, metabolic disorders such as diabetes or hypothyroidism, major surgery, alcohol abuse and medications that inhibit cytochrome P450 (CYP) 3A-4.[@CIT6] Hypothyroidism frequently leads to asymptomatic mild to moderate elevation in the CK level.[@CIT7] Marked elevation in CK with rhabdomyolysis has been reported only in a very small number of cases with unnoticed hypothyroidism using HMGCoA reductase inhibitors.[@CIT8][@CIT9] Our patient received 80 mg of simvastatin without being diagnosed for primary hypothyroidism. ", "The severity of hypothyroidism might be associated with an elevation in CK. ", "The mechanism by which CK elevation occurs in hypothyroidism patients who are also receiving HMGCoA reductase inhibitors remains unclear.[@CIT10] This group of drugs may represent an additional risk factor for myopathy and rhabdomyolysis in patients with hypothyroidism.", "\n\nConclusion {#sec1-4}\n==========\n\nWe describe a case of severe rhabdomyolysis with undiagnosed hypothyroidism receiving a large dose of simvastatin. ", "We emphasize the need to assess the possibility of hypothyroidism not only before treatment with HMGCoA reductase inhibitors but also during treatment, particularly marked increase in CK levels. ", "Furthermore, in order to avoid the deleterious effects of these drugs, we recommend vigilant screening with regard to CK levels both upon initiation and during continued treatment with HMGCoA reductase inhibitors in individuals with hypothyroidism.", "\n\n**Source of Support:** Nil\n\n**Conflict of Interest:** None declared.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.026472728699445724, 0.004394764546304941, 0.0028587242122739553, 0.001358811161480844, 0.037471573799848557, 0.0030417079105973244, 0.0017780698835849762, 0.0009032273082993925, 0.0007515046745538712, 0.0007767976494506001, 0.000651091686449945, 0.01919545978307724, 0.0005841556121595204, 0.5079389810562134, 0.0007650411571376026, 0.0008629891672171652, 0.007865178398787975, 0.0019215625943616033, 0.0016417853767052293, 0.1710418313741684, 0.0006341946427710354, 0.0034740865230560303, 0.28989899158477783, 0.0013972970191389322, 0.00759139284491539, 0.0013828277587890625, 0.0016737186815589666, 0.0007681067218072712, 0.001995444530621171 ]

[ "\"I can't come now.\" \"", "I'm cleaning this up.\" \"", "How are you doing up there?\" \"", "You about done?\" \"", "Lift up.\" \"", "Hey, give me some slack, will you?\" \" ", "What the hell is this thing anyway?\" \" ", "What do you mean, \"What is it?\" ", "It's art.\" \"", "Hurry up, you turkey.\" \"", "Do you think you might possibly be finished before the dedication tomorrow?\" \" ", "Catch.\" \" ", "I can do it.\" \"", "Hey!\" \"", "Okay, people.\" \"", "I don't want any of you to forget there is no extra credit for this.\" \"", "Don't turn into an angry mob.\" \"", "Now, listen.\" \"", "I want the term papers in by Wednesday and tell Becky I want it legible.\" \"", "Okay?\" \"", "Police the area.\" \" ", "I gotta go.\" \" ", "Okay.\" \" ", "You really did it.\" \" ", "Yeah?\" \"", "Yup.\" \"", "I'm really proud of you.\" \" ", "That's really something.\" \" ", "Yeah?\" \" ", "You really made a...\" \" Yeah.\" \"...", "big pile of sticks.\" \"", "I used you as a model.\" \"", "I gotta go.\" \"", "All right, I'm cooking tonight.\" \"", "What do you want?\" \"", "Just a salad or something, you know.\" \"", "How about baked Alaska?\" \" ", "How about a lobster Newburger, baby?\" \" ", "Give me a break.\" \" ", "How about MM's?\" \" ", "MM's sound good.\" \" ", "I'll see you later.\" \" ", "See you tonight.\" \"", "Fly ball to second.\" \"", "This will put it away and that's it.\" \"", "Total of five runs, 10 hits and two errors for the Mariners.\" \"", "Eight runs, nine hits and two errors for the Red Sox.\" \"", "Charlie Snow inviting you to see...\" \"Watch your head, Joe.\" \"", "Gurney coming through.\" \"", "Open it wide.\" \"", "Come on.\" \"", "How you doing now?\" \"", "Take it easy.\" \"", "You all right now?\" \"", "Stay back.\" \"", "Whoa, whoa, whoa.\" \"", "Watch it.\" \"", "That's jagged.\" \" ", "unit 612.\" \"", "We've got a possible broken neck here.\" \"", "Trauma, double fractures, lacerations.\" \"", "The man is cyanotic.\" \"", "BP is 160/90...\" \"Move it.\" \"", "Out of the way.\" \"", "To the right.\" \"", "Off to the right.\" \"", "Lisa, I need your help.\" \"", "Ventilate this guy.\" \" ", "Dorothy, 1 gram of Solu-Medrol.\" \" ", "One gram Solu-Medrol.\" \" ", "Two units of plasma.\" \" ", "Two units of plasma.\" \"", "Type and cross-match.\" \"", "Possible pneumothorax.\" \"", "I can feel at least four fractured ribs in this guy.\" \"", "And fractured pelvis.\" \" ", "Who's the anesthesiologist?\" \" ", "Levinson.\" \"", "Tell him 15 minutes.\" \"", "Get him into X-ray, stat.\" \" ", "Right tibia, left tibia fracture and fibula.\" \" ", "You hang in there, pal.\" \" ", "Come on, you gotta fight.\" \"", "Fight.\" \" ", "Move him out.\" \"", "You have a fractured right rib puncturing the right lung, so a pneumothorax.\" \"", "We have a fractured left tibia and fibula, right tibia and fibula.\" \" ", "God, what didn't he break?\" \" ", "I think this is gonna be our problem here.\" \" ", "Shit.\" \" ", "He's never going to dance again.\" \"", "We'll have to very gently fuse this spinal column together.\" \"", "I can do that.\" \"", "I think the best we can hope for, though, is a quad.\" \" ", "I want him alive, Tony.\" \" ", "I'll do the best job I can.\" \" ", "Get started?\" \" ", "Yeah.\" \" ", "How you doing on your side, baby?\" \" ", "Oh, pretty good.\" \"", "Okay, now one more knot to go and we are in terrific shape.\" \"", "Over easy, please.\" \"", "One, two, three...\" \"Good.\" \" ", "Hi.\" \" ", "Hi.\" \" ", "Thought I recognized those shoes.\" \" ", "Well, I wore them just for you.\" \" ", "Dizzy?\" \"", "You want anything?\" \" ", "I'd like a martini.\" \"", "He wants a martini.\" \"", "Alrighty.\" \"", "Now how's that?\" \" ", "Gin tastes like water.\" \" ", "It is water.\" \"", "I thought everyone in Intensive Care got gin.\" \"", "Well, intravenously.\" \" ", "Hey, honey?\" \" ", "Yeah?\" \"", "You know that dinner dance next Saturday?\" \"", "I think we ought to tell them we'll be late.\" \"", "Okay.\" \"", "You want to come along, Miss Sadler?\" \"", "Yes, ma'am.\" \"", "Good morning, Mr. Harrison.\" \" ", "Good morning, Mr. Harrison.\" \" ", "Morning, Rodriguez.\" \" ", "Here's a new face for you.\" \" ", "Hello, new face, hello.\" \"", "Rodriguez, I thought you were gonna bring me ugly old hags.\" \"", "Going down.\" \"", "Orthopedics, Gynecology, Nurses' Station Rubber Goods, Water Sports.\" \" ", "Get the pillows out from under his arms.\" \"", "Watch it.\" \"", "Arms over chest.\" \"", "Down with the sheets and the spread.\" \" ", "Neatly, neatly.\" \" ", "Why don't you say something nice to her?\" \"", "You need a haircut.\" \"", "That's nice.\" \"", "Ready?\" \"", "And good.\" \" ", "Now...\" \" Hello, darling.\" \" ", "My little flesh pudding.\" \" ", "Align the legs.\" \"", "Up.\" \"", "Over.\" \" ", "Hear the one about the plastic surgeon?\" \" ", "No.\" \"", "He melted in front of the fire.\" \" ", "You get it in the end, don't you?\" \" ", "Terrible.\" \" ", "Thank you very much.\" \" ", "Now rub.\" \"", "I see any bedsores, it's gonna be you and me.\" \"", "Used to dream of situations like this.\" \" ", "Being injured?\" \" ", "Being massaged by two beautiful women.\" \"", "Lay off or I'll keep my student nurses out of here.\" \" ", "You think you can manage?\" \" ", "Yes, ma'am.\" \"", "Well, be careful.\" \"", "We don't wanna have him on the floor.\" \"", "Oh, God.\" \"", "Somebody have me on the floor.\" \"", "I was once had on the floor, Rodriguez.\" \"", "It was incredible.\" \"", "You are impossible.\" \"", "Make that improbable.\" \" ", "So what's your name?\" \" ", "Mary Jo Sadler.\" \" ", "Most of my friends call me Joey.\" \" ", "That's nice.\" \"", "Don't let Rodriguez hear you say that.\" \"", "You're supposed to answer:\" \"\"Miss Sadler,\" with a smile that is filled with warmth but not a hint of sex.\" \" ", "Sorry.\" \" ", "Don't be sorry.\" \"", "I'm gonna call you Joey when we're alone and you're caressing my backside.\" \" ", "I'm rubbing your heels right...\" \" Don't spoil it.\" \"", "I can't feel a thing anyway.\" \" ", "Am I your first back rub, Joey?\" \" ", "Yes, you are.\" \" ", "I graduate in two weeks.\" \" ", "Really?\" \" ", "Anybody home?\" \" ", "Joey, quick!\" \"", "Get under the bed.\" \"", "It's the other woman.\" \" ", "Hi.\" \" ", "Are you going to class?\" \"", "Rehearsal.\" \" ", "Does he ever stop?\" \" ", "Stop?\" \"", "I haven't laid a glove on her.\" \" ", "I don't know.\" \"", "It's my first day with him.\" \" ", "Oh, you'll learn.\" \"", "I'm Pat.\" \" ", "I'm Miss Sadler.\" \" ", "And for you.\" \" ", "Beautiful.\" \" ", "Beautiful.\" \" ", "Well, good morning.\" \" ", "Good morning.\" \" ", "How are you this morning?\" \" ", "Okay.\" \" ", "And how are we doing here?\" \" ", "Fine.\" \"", "Miss Rodriguez, you promised me you wouldn't send cute ones in here.\" \"", "Should've seen the one in here last night.\" \"", "After lights out, she snuck me out.\" \"", "We went skateboarding.\" \"", "Only trouble was, I was the skateboard.\" \"", "No, no, no!\" \" ", "Are you finished, Miss Sadler?\" \" ", "I...\" \"Pillows.\" \"", "Right.\" \"", "And...\" \"One...\" \"Okay, could you straighten my hand out?\" \"", "And bend the hand down palm down into the pillow?\" \"", "That's it, that's it.\" \"", "Now smooth the fingers out.\" \"", "That's it.\" \"", "Perfect.\" \"", "Now...\" \"Now, bend the thumb a little bit in.\" \"", "That's it, that's it.\" \"", "That's it.\" \"", "Now relax the hand just a little bit.\" \"", "That's it.\" \"", "Thank you.\" \"", "I gotta keep going.\" \"", "Give me a kiss.\" \"", "Love you, okay?\" \"", "I got some steps to work out before the rehearsal.\" \" ", "How's your knee?\" \" ", "It's okay, if I warm it up really carefully.\" \"", "Kallis is coming again.\" \"", "He's interested in the large nude.\" \"", "Kallis always was interested in large nudes.\" \"", "Try and make him behave, Rodriguez.\" \"", "Nice meeting you.\" \" ", "Bye.\" \"", "Tomorrow.\" \" ", "Bye.\" \"", "Alrighty.\" \" ", "Are you comfortable, Mr. Harrison?\" \" ", "Rodriguez, you give great sheet.\" \" ", "Go to sleep or something.\" \" ", "What's the \"or something\"?\" \"", "Stay awake.\" \" ", "How long has he been like...?\" \" ", "Six months.\" \" ", "Will he ever be able to...?\" \" ", "Nope.\" \"", "John, Mr. Harrison's ready.\" \"", "You better do him now.\" \"", "Well, he ain't going nowhere, man.\" \" ", "What you say, man?\" \" ", "Uh-oh, a black man with a razor.\" \"", "Okay, fleet-foot, let's see you tap-dance.\" \"", "Okay, here we go.\" \"", "Man, but this is boring, you know.\" \"", "Shaving dudes all day.\" \"", "They won't let me near the girls.\" \"", "All you could get near is the ones with the mustaches.\" \" ", "Bitchy, bitchy.\" \" ", "Envy, envy.\" \" ", "Listen, from where I'm laying...\" \" Yeah?\" \"...", "if I could get off at all, even by myself, that'd be great.\" \" ", "I hear that, man.\" \"", "I hear that.\" \" ", "John.\" \"", "Shake it out.\" \"", "Dr. Emerson's making his rounds this morning.\" \"", "If I shake it any harder, man, it's gonna fall off, you know?\" \" ", "So how's the punk band coming?\" \" ", "Oh, great, man.\" \"", "I even added a xylophone to the band.\" \"", "Punk xylophone?\" \"", "How the hell does that sound?\" \"", "Man, great.\" \"", "We be jamming and I ain't jiving.\" \"", "Listen.\" \"", "Hey, man, this knee needs tuning up, you know.\" \"", "Hey, John, John, John.\" \"", "This isn't your day.\" \" ", "What's going on here?\" \" ", "He was testing my reflexes.\" \"", "Yeah, you see, Dr. Scott, this man's toe bone connected to his knee bone.\" \"", "And I'm just connecting myself to another patient.\" \" ", "Goodbye.\" \"", "Well, we're all bright and chipper this morning.\" \"", "Oh, it's marvelous, the courage of the human spirit.\" \"", "Nice to hear the human spirit's okay.\" \"", "How's the heart?\" \" ", "Then they went to the lobby...\" \" Selling tickets.\" \" ", "You heard that one?\" \" ", "Yes, you told me twice yesterday.\" \" ", "Our relationship must be on the skids.\" \" ", "You're looking great today, Mr. Harrison.\" \"", "Take a deep breath for me.\" \"", "Hold it.\" \"", "Let it out.\" \"", "Okay, I think we can start stepping up your physical therapy now.\" \"", "To what purpose?\" \"", "To what purpose?\" \"", "So that you can feel more comfortable and start leading a more normal life.\" \" ", "More normal, huh?\" \" ", "Yes, more normal.\" \"", "Meaning I can resume my basketball career?\" \"", "No, I think you're a little too short for basketball.\" \" ", "Cute.\" \" ", "Thank you.\" \"", "I see Dr. Emerson is making rounds again this morning.\" \" ", "Yes, he is.\" \" ", "Is he gonna do it in the normal fashion or is he gonna walk on water?\" \"", "Look up for me, please.\" \"", "That isn't fair, you know.\" \"", "You're very lucky to have him.\" \"", "He's the best one around.\" \"", "I'll remember that in my prayers.\" \"", "Okay, see you in a few minutes.\" \" ", "With Emerson?\" \" ", "Right.\" \"", "I won't hold my breath.\" \"", "Miss Rodriguez, Mr. Harrison seems a bit more agitated this morning.\" \"", "He's beginning to realize what he's up against.\" \"", "That's what I thought.\" \"", "Okay, I'm upping his Valium to 5 milligrams.\" \" ", "Valium, 5 milligrams.\" \"", "TID?\" \" ", "Right.\" \"", "Thank you.\" \"", "What, in your enlightened opinion, Mr. Hoffman was Mr. Holmes suffering from?\" \" ", "I'd say pneumonia.\" \"", "No, it wasn't pneumonia.\" \"", "All third-year students say pneumonia.\" \"", "It wasn't pneumonia and it wasn't arthritis.\" \"", "Hello, Jim.\" \"", "How long?\" \"", "About 12 minutes.\" \" ", "What did you do?\" \" ", "Palpated radial artery.\" \" ", "Gave him D5W, bicarb and epinephrine.\" \" ", "Why didn't you transfer him to ICU?\" \"", "Well, his vitals were stable at 6:00.\" \"", "He just went sour real fast.\" \"", "This was Andrew Dryer, age 56.\" \"", "Out of surgery yesterday.\" \"", "Cancer of the colon and liver.\" \"", "What's your name?\" \" ", "Everett, sir.\" \" ", "Well, Mr. Everett how do you feel about this?\" \" ", "Feel, sir?\" \"", "Yes, feel.\" \"", "You feel sick when you look at this?\" \" ", "No, sir.\" \" ", "Why not?\" \" ", "I'm used to seeing bodies, sir.\" \" ", "Oh, I see.\" \"", "You been here, what?\" \"", "Three years?\" \"", "Cut up cadavers with the best of them.\" \"", "Death holds no fear for you does it, Mr. Everett?\" \" ", "Sir...\" \" Let me tell you.\" \"", "This makes me sick.\" \"", "It ought to make you sick too.\" \"", "Look there.\" \"", "That's the enemy.\" \"", "The enemy has won.\" \"", "Mr. Dryer was 56 years old.\" \"", "And I want you, Mr. Everett and I want all of you to feel sick when you see a body that hasn't reached its allotted three-score years and 10.\" \"", "That's if you want to be doctors.\" \"", "Not just money-grubbers.\" \"", "Shit.\" \"", "Oh, sorry.\" \"", "Dr. Arlene Franklin, sixth floor waiting area, please.\" \"", "Did you say something to me, man?\" \"", "I think she likes me.\" \" ", "Hello, hello.\" \" ", "Hi.\" \"", "Is that something to put into my face?\" \"", "It's coffee.\" \" ", "No, it's not.\" \" ", "Yes, it is.\" \" ", "No, it's not.\" \" ", "It is.\" \" ", "It's not.\" \" ", "It is.\" \" ", "It's caca.\" \" ", "No, it's not.\" \" ", "Oh, really?\" \" ", "It's good for you.\" \"", "You have to drink it.\" \" ", "Looks like somebody already drank it.\" \" ", "Take a sip.\" \" ", "I don't want any of it.\" \" ", "It's not that...\" \"Oh, shit, I'm sorry.\" \" ", "I'm sorry.\" \"", "It was my fault.\" \" ", "It's all right, I can clean it up.\" \" ", "I'm sorry.\" \" ", "I'll just change the sheets.\" \"", "Don't panic.\" \"", "How someone who can't move a muscle can screw up a whole bed is...\" \" It's just eating its way through my p. j.'s.\" \" ", "I have to pull you towards me.\" \" ", "Oh, God.\" \" ", "I feel like Charlie McCarthy.\" \" ", "Oh, God.\" \" ", "How did the quadriplegic cross the road?\" \" ", "Oh, I don't know.\" \" ", "It was stapled to a chicken.\" \"", "Joey!\" \"", "Joey!\" \" ", "Help!\" \"", "Nurse!\" \" ", "Oh, God, oh, God...\" \"Nurse, help!\" \"", "Somebody help!\" \"", "Nurse!\" \" ", "Help!\" \" ", "John!\" \"", "Got him.\" \" ", "Somebody help!\" \" ", "I got him.\" \" ", "What happened?\" \" ", "I don't know.\" \" ", "Get him on the floor.\" \" ", "Got him?\" \"", "All right.\" \"", "Ease him down.\" \"", "Let's just set him down.\" \" ", "Take it easy, now, watch it.\" \" ", "Watch your head, man!\" \" ", "Give me a clean sheet.\" \" ", "I just spilled the coffee.\" \" ", "Okay, get ready to lift him.\" \" ", "It wasn't her fault.\" \"", "It wasn't her fault.\" \"", "It was just an accident.\" \"", "Get ready for a lift.\" \" ", "What's going on here?\" \" ", "Get out of here.\" \"", "They're just changing the sheets.\" \"", "That's all for now.\" \"", "See you tomorrow.\" \" ", "Turn him on his back.\" \" ", "Easy, man, watch the head, now.\" \" ", "Easy.\" \" ", "Watch him.\" \"", "You got to be gentle.\" \"", "On the count of three.\" \"", "Okay, one, two, three.\" \"", "Roll the body.\" \" ", "Slowly.\" \"", "Slowly.\" \" ", "Easy now.\" \"", "Out of the way.\" \" ", "You dizzy?\" \" ", "No.\" \"", "Pillow, please.\" \" ", "What happened here?\" \" ", "He almost fell out of bed, doctor.\" \"", "Really?\" \" ", "How do you feel?\" \" ", "Great.\" \"", "It's always good to get out of bed now and again.\" \"", "Let me take a look at you.\" \"", "Now move your head.\" \"", "Gently.\" \"", "Gently.\" \" ", "Does that hurt?\" \" ", "No.\" \" ", "Are you okay?\" \" ", "Oh, yeah.\" \" ", "You'll be fine.\" \" ", "Are you kidding?\" \"", "Have the chart, please?\" \"", "Miss, can I have the chart, please?\" \"", "Just breathe normally.\" \" ", "I see you upped his Valium.\" \" ", "Yes, I did this morning.\" \"", "The dialysis seems to be holding him stable.\" \" ", "Just continue the schedule, all right?\" \" ", "Four hours every other day.\" \" ", "Right.\" \" ", "Okay.\" \"", "Well, Mr. Harrison, we seem to be out of the woods.\" \"", "Now, if we can keep you in that bed, off the accident list, we'll be fine.\" \"", "When do \"we\" get discharged?\" \" ", "Pretty soon now, I expect.\" \" ", "Really?\" \"", "Discharged?\" \"", "Or transferred?\" \"", "This unit is for the critically ill, which, I'm happy to say, you no longer are.\" \"", "I'll send you to a rehab.\" \"", "You'll be comfortable.\" \"", "I get it.\" \"", "You just grow the vegetables here.\" \"", "The vegetable store is somewhere else.\" \" ", "I don't think you understand.\" \" ", "I think I do.\" \"", "What chance do you think I have of my ever being just partly dependent on nursing?\" \" ", "That's difficult to say with any certainty.\" \" ", "I am not asking for a guarantee.\" \"", "I'm asking for a professional opinion.\" \"", "You think I'll ever walk again?\" \"", "No.\" \" ", "Regain the use of my arms?\" \" ", "No.\" \"", "Or my...\" \"Or my hands?\" \"", "No.\" \" ", "Thank you.\" \" ", "What are you thanking me for?\" \"", "Your honesty.\" \"", "We were wondering when you'd ask.\" \"", "Why didn't you tell me before?\" \"", "We didn't think you'd hear us.\" \"", "Look, I know it's difficult but it's surprising how we can come to accept...\" \"You mean, things like falling out of bed?\" \"", "Dr. Scott has prescribed something which I think will help.\" \" ", "Yes.\" \" ", "Fabulous.\" \"", "Get Mrs. Boyle in here.\" \"", "Let's start some meaningful therapy.\" \" ", "Right away.\" \" ", "Isn't that a great idea?\" \"", "All right, Harrison.\" \"", "I'll stop in on you later.\" \"", "Be sure to phone first.\" \" ", "I may not be in.\" \" ", "See you later.\" \"", "Miss Sadler, let's get a clean gown on him.\" \"", "What'd you give him, 5 milligrams of Valium?\" \"", "Yeah, TID.\" \"", "I think we may have to up it to 10.\" \" ", "You might be right.\" \" ", "I want him transferred out one month, tops.\" \"", "I have to go to a board meeting.\" \" ", "Okay.\" \" ", "Talk to some tight-ass tick-tocks about inflation.\" \" ", "I hope you have a wonderful time.\" \"", "I'd rather have my prostrate examined.\" \" ", "Excuse me, Mrs. Cole?\" \" ", "Hold on.\" \"", "Yes, doctor?\" \" ", "Have you given Mr. Harrison his Valium?\" \" ", "No, not until noon.\" \" ", "Give it to him now.\" \" ", "Now?\" \" ", "Yeah.\" \" ", "Hold on, let me call you back.\" \"", "Oh, wait, just a sec.\" \"", "On second thought, let me have it.\" \"", "I'll give it to him myself.\" \"", "Dr. Norton, report to Hydrotherapy, fourth floor.\" \"", "Dr. Norton.\" \" ", "Hello again.\" \" ", "Hello.\" \"", "I was just practicing lying here.\" \"", "I brought you something to help you relax.\" \" ", "What for?\" \" ", "What for?\" \"", "The fall?\" \"", "I'm all right, I'm just angry.\" \"", "I don't blame you.\" \"", "I'm changing the nurse.\" \"", "She's not experienced enough...\" \" Don't do that.\" \" ", "Why not?\" \"", "Because it wasn't her fault.\" \"", "It was just an accident.\" \"", "At least I should have someone around here I could talk to.\" \"", "Here, I think this will help you.\" \" ", "Don't do that.\" \"", "Don't give me that.\" \" ", "Why not?\" \"", "It'll make you feel better.\" \"", "Quieter, you mean.\" \"", "Look, Mr. Harrison your body cannot handle all this excitement.\" \" ", "Now, I think you need this.\" \" ", "Why?\" \" ", "Lf I wanna be mad, I'll be mad.\" \" ", "It's a very small...\" \"If I wanna make noise, I'll make noise.\" \"", "Just because you are upset you can't do anything for me does not mean I'm the one that has to get tranquilized.\" \" ", "However, it is prescribed...\" \" You haven't heard a word I said, have you?\" \"", "Now, you listen to me, Dr. Scott.\" \"", "The only thing that I have left is my consciousness and I don't want that paralyzed as well.\" \"", "You understand that?\" \" ", "Yeah.\" \"", "I hear what you're saying.\" \" ", "Good.\" \"", "Very good.\" \"", "So if you want any tranquility, you eat the pill.\" \"", "You want me to...?\" \"", "Eat it.\" \" ", "We'll see.\" \" ", "Good.\" \"", "That's what I always say.\" \"", "If you're ever in doubt whether to take a tranquilizer sleep on it.\" \"", "Okay.\" \"", "Right.\" \"", "That's bullshit.\" \"", "When he came here all shaken to hell, he didn't protest the IV saline.\" \"", "When he was gasping for breath he didn't say, \"I don't want any Solu-Medrol. \"\" \"", "No, but those were inevitable in emergency situations.\" \"", "So is this.\" \"", "Look, Clare we'll have to help him to accept his condition.\" \"", "Then maybe his consciousness will be of help to him.\" \"", "But how does a depressant drug like Valium really help him to accept his condition?\" \"", "Listen.\" \"", "Ken Harrison is an intelligent sensitive, articulate, wonderful person.\" \"", "Yes, he is.\" \"", "But he's not gonna prescribe for himself.\" \" ", "Will the owner of a blue Cadillac...\" \" Okay.\" \"... ", "licence PWB 112... ... parked in Emergency, please move it immediately?\" \"", "This is Dr. Emerson.\" \"", "I'd like you to prepare Valium.\" \"", "Ten milligrams, IM.\" \"", "I'll be right up.\" \"", "Dr. Jackson, outside call.\" \"", "Dr. Jackson, outside call.\" \"", "They've sent in the godfather.\" \"", "Why are you giving my staff such a hard time?\" \"", "Dr. Emerson, I must insist that you do not stick that needle in my arm.\" \"", "You don't even know what's in it.\" \"", "Well, I assume that it is one of a series of measures taken to keep me alive.\" \"", "That's right.\" \"", "You, pal, are a valuable life.\" \"", "I don't think so.\" \"", "I've decided I don't want to stay alive.\" \" ", "You can't decide that.\" \" ", "Why not?\" \"", "Because you're depressed.\" \"", "Does that surprise you?\" \"", "No.\" \"", "In time, you'll learn to accept.\" \"", "Until then, let us help you.\" \"", "Do not stick that fucking thing in my arm.\" \"", "Goddamn you!\" \"", "I specifically refused you permission to do that.\" \"", "It was necessary.\" \"", "Now, I want you to sleep.\" \"", "I don't wanna goddamn sleep.\" \"", "I wanna goddamn think!\" \"", "When you were sculpting and things weren't coming out right, did you quit?\" \" ", "No, I didn't.\" \" ", "Well, neither do I.\" \"Is that what I am to you, huh?\" \"", "Emerson?\" \"", "Wait a minute.\" \"", "Wait a minute!\" \"", "Is that all I am?\" \"", "Is a lump of clay?\" \"", "Will you come on?\" \"", "I told you my feet hurt.\" \"", "And I've ordered three times already.\" \"", "Don't forget.\" \"", "Oh, my God.\" \"", "My chocolates.\" \"", "You like this one?\" \"", "It's nice.\" \"", "How's this?\" \"", "That's lovely.\" \" ", "Oh, that's it.\" \"", "That's it.\" \"", "Don't move.\" \" ", "This one?\" \" ", "Well, hurry up.\" \" ", "Stay there.\" \"", "Don't...\" \"Rewind.\" \"", "You gotta go back.\" \"", "You like that?\" \"", "Show me the one that's two steps after it.\" \" ", "With the elbow?\" \" ", "Yeah.\" \"", "That's nice.\" \" ", "Sadler, you wanna do some rounds?\" \" ", "Yes.\" \"", "Okay, let's go.\" \" ", "And good morning to you.\" \" ", "Good morning.\" \"", "Back with the sheets.\" \"", "And spread.\" \"", "And voilà.\" \"", "The night nurse said you had a good night's sleep.\" \"", "Well, I had some help, if you remember, from Emerson.\" \"", "Like being hit on the head with a soft baseball bat.\" \"", "But your eyes look bright this morning.\" \" ", "I've been thinking.\" \" ", "Ready?\" \"", "And...\" \"You do too much of that.\" \"", "What other activity would you suggest?\" \"", "Jogging, perhaps?\" \"", "Hey, Rodriguez, you remember that lawyer that came here a few months ago from the insurance company?\" \" ", "His name was something Hill?\" \" ", "Yeah, I remember.\" \" ", "You think you could call him for me?\" \" ", "Sure.\" \"", "Since I'm gonna be around here for some time, I think money would help.\" \"", "Good thinking in there.\" \"", "His card is in my top drawer.\" \"", "You'll call him?\" \"", "Knock, knock.\" \"", "Hi, everybody.\" \" ", "Hi.\" \" ", "Great day, huh?\" \"", "I had to park about four miles away.\" \"", "Oh, you look pretty dry.\" \" ", "Would you ladies excuse us, please?\" \" ", "Yes.\" \"", "I got some new music for you.\" \" ", "How are you today?\" \" ", "Fine.\" \"", "You don't seem the same.\" \"", "You come here every day.\" \"", "It's remarkable.\" \"", "What's so remarkable about it?\" \" ", "I love you.\" \" ", "Oh, I know.\" \"", "And I'm honored by that and moved.\" \"", "What's wrong with you today?\" \"", "I want to ask you a question.\" \"", "We make cute little jokes about nurses and hints of sex you know?\" \"", "Now, obviously, I haven't slept with anyone for over six months.\" \"", "Have you?\" \"", "No.\" \"", "Why not?\" \"", "Not interested in other men.\" \"", "I love you.\" \"", "Without self-pity, I am no longer someone to love.\" \"", "I am an object that has to be taken care of for the rest of his life.\" \" ", "I don't know why you're doing this.\" \" ", "I have to be on a dialysis machine four hours a day.\" \" ", "None of that matters to me.\" \"", "Matters to me.\" \"", "Pat, I know you love me and when I was Ken Harrison, I loved you but that was a long time ago.\" \"", "At least six months and one spine ago.\" \"", "I am not the man that loved you.\" \"", "Now, you have been loyal and you have been loving and you have been self-sacrificing.\" \"", "I don't want any part of it anymore and I want you to walk out of here and not come back.\" \" ", "Hey.\" \" ", "I just want you to find a new life.\" \"", "Find a man and get married and have babies.\" \"", "What am I to do?\" \"", "Go to the Salvation Army?\" \"", "Patty, if you were laying here and I was standing where you are I'd leave you flat.\" \"", "You would, would you?\" \"", "I may still love you, but I'd leave you.\" \"", "Well, you have got a lot of balls to lie there and make decisions without me about our future.\" \"", "Everything we've ever done together everything we've had together, or been to each other everything you've given me that's part of me now, and I won't give it back.\" \"", "I can't give it back.\" \"", "Do you know that every time that you walk into this room you remind me of the way things were?\" \"", "Every time I look at you I see what I cannot do and what I will never do again.\" \"", "And I can't stand it.\" \"", "I know you love me, Patty.\" \"", "But if you don't wanna torture me, you'll go now, please.\" \"", "Don't do that.\" \"", "You know, I always say that if a man can't use his hands he's got to be a real dumb son of a bitch to cry, you know?\" \"", "I mean, it's just another way of getting your gown wet, man.\" \"", "I'm all right now, John.\" \"", "Thank you.\" \"", "Well, I didn't do nothing except save meself the trouble of carrying a wet gown all the way to the laundry.\" \"", "Dr. Greenberg, please call Physical Therapy.\" \"", "Dr. Greenberg, please call Physical Therapy.\" \"", "Stop it.\" \"", "Don't do that.\" \" ", "I can't help meself, me dear.\" \" ", "Oh, God.\" \"", "Now I have to get these instruments sterilized again.\" \"", "Don't say things like that.\" \"", "Just the thought of it makes me crazy, you know.\" \"", "Everything to you here is a big joke, isn't it?\" \"", "Can't take a place like this too serious, you know.\" \"", "I mean, one floor people dying of poison air and water the next floor, ladies having belly tucks.\" \"", "Clean shit.\" \"", "Well, look what they've done for Mr. Harrison.\" \"", "Yeah, and how much does it cost to keep him alive?\" \" ", "Thousands of dollars a week.\" \" ", "That's not the point.\" \"", "Well, the point is, in Africa people die of the measles, you know, little babies even.\" \"", "Only cost a few pennies to keep them alive now.\" \"", "There's got to be something crazy somewhere.\" \" ", "Well, that's wrong too.\" \" ", "Check.\" \"", "So how about going out with me tonight?\" \"", "We could discuss it some more.\" \" ", "I don't think...\" \" Come on.\" \"", "We could get something to eat.\" \"", "Later, my band is rehearsing.\" \"", "It would be fun.\" \"", "We're sounding good.\" \"", "I have an anatomy final.\" \"", "It's a real killer.\" \"", "Anatomy, is it?\" \"", "Well, your problems are over, you lucky girl.\" \"", "You see, I'm an expert on anatomy.\" \"", "I could come over and show you the hard parts.\" \" ", "Yeah, I'll bet you could.\" \" ", "John.\" \" ", "Are you out of work?\" \" ", "This man in this place?\" \"", "Never.\" \"", "I was about to start scrubbing the ceilings don't you know?\" \"", "Miss Sadler, your job is to lower the temperature of the patients not raise the hopes of the orderlies.\" \"", "Yes, ma'am.\" \" ", "So who's my blind date?\" \" ", "Hey, it's a real nice lady, man.\" \" ", "Don't tell me, she's lots of fun.\" \" ", "It's Mrs. Boyle.\" \"", "Mrs. Boyle?\" \" ", "Yeah.\" \" ", "Do I have to see her?\" \"", "Well, Dr. Emerson asked her to stop by, you know.\" \"", "Well, then I will see her.\" \"", "If I refuse he'll dissolve her in water and inject her into me.\" \"", "Excuse me.\" \" ", "Mr. Harrison.\" \" ", "I used to be.\" \" ", "Kate Boyle.\" \"", "John.\" \" ", "Come to cheer me up?\" \" ", "I wouldn't quite say that.\" \" ", "No?\" \"", "Would you like to go over to that corner?\" \" ", "Sure.\" \" ", "John?\" \"", "Anything you say.\" \" ", "How's it going, Ken?\" \" ", "Pretty good.\" \"", "Stick around.\" \"", "This lady's gonna cheer us up.\" \"", "We could use that around here.\" \"", "She's gonna saw us in half or do a belly dance.\" \"", "Not exactly.\" \" ", "Well, if that's not what you do...\" \" If you need me, I'll be over there.\" \"...", "what exactly do you do, Mrs. Boyle?\" \" ", "Come to see if I can help you.\" \" ", "Really?\" \"", "There is a rumor going around that you don't want any more treatment.\" \" ", "Good.\" \" ", "Why good?\" \"", "Because I didn't think anyone around here heard me.\" \"", "I heard you, and that is why I want to know why you don't want any more treatment.\" \"", "Because I don't want to go on living like this.\" \"", "Why not?\" \"", "I mean, it's a lousy break but you'll be surprised at the things you'll be able to do with training and a little patience.\" \" ", "Such as?\" \"", "You're gonna be able to operate a reading machine and I think, an adapted typewriter, maybe even a calculator.\" \"", "Gee and wow.\" \"", "The three R's.\" \"", "Doesn't exactly make for an abundant life, does it?\" \"", "Do you realize that Monet was almost blind when he painted the Water Lilies?\" \"", "And that Renoir's hands were so crippled, they had to tie brushes for him to paint?\" \" ", "And that...?\" \" ", "No, no, no.\" \"", "Don't go on, please.\" \"", "Please don't go on.\" \"", "I know, you're going to read to me from the Reader's Digest \"My Most Unforgettable Lame. \"\" \"", "You're an artist.\" \"", "Sculpting isn't the only art.\" \"", "Have you ever thought about dictating into a tape recorder?\" \"", "You could write a book about sculpture, a novel, poetry.\" \"", "Wait a minute.\" \"", "Wait a minute.\" \"", "Do you think you change your art like you switch your major in college?\" \"", "I'm a sculptor.\" \"", "My whole being, my entire imagination speaks to me through...\" \"Spoke to me through my fingers.\" \"", "I was a sculptor.\" \"", "And that was what my life was all about.\" \"", "Now, you people seem to think that it's about survival, no matter what.\" \"", "Now, if I'd wanted to write a goddamn novel, I would've done it.\" \"", "If I'd wanted to dictate poetry, I would've done that.\" \"", "How do you know you won't wanna do that unless you try?\" \"", "Because trying isn't important.\" \"", "The work is important.\" \"", "The work.\" \"", "And not the credit and not the...\" \"The reward.\" \"", "And it is the work that I will never do again.\" \"", "How do you know you won't find new work?\" \"", "Look, just give it a chance.\" \"", "Let me bring the reading machine tomorrow.\" \"", "One try.\" \"", "You might surprise yourself.\" \"", "Are there many books for that machine?\" \"", "Yeah.\" \"", "Quite a few.\" \"", "You think I could make a request for the first one?\" \"", "Anything.\" \"", "How about Sculpting With No Hands, Self-Taught?\" \"", "Okay.\" \"", "You win.\" \"", "I can see that you are not ready for this discussion so I will just come back when you are.\" \"", "You know, you are amazing, you know?\" \"", "All you goddamn people are the same.\" \"", "Every single time that I say something even a little bit awkward you just pretend I haven't said anything at all.\" \"", "It's amazing.\" \"", "Why can't you try to relate to your patients like human beings?\" \"", "You know what's happening?\" \"", "You're getting very angry.\" \" ", "I can understand your anger...\" \" Oh, Jesus.\" \"", "You're doing it again.\" \"", "Just listen to yourself.\" \"", "I've just said something offensive about you and you have turned your professional cheek.\" \"", "If you were a human being or if you were treating me like a human being you would've told me to screw off.\" \"", "Now, can you understand that is why I don't wanna go on living?\" \"", "And I am more convinced of that now after your visit, than I was before.\" \"", "How do you like them apples?\" \"", "The very exercise of your so-called professionalism makes me want to die.\" \"", "What's happening?\" \" ", "I can't breathe.\" \" ", "Okay, what's wrong?\" \"", "Just go away, please.\" \"", "John.\" \" ", "I'm sorry.\" \"", "I'm sorry.\" \"", "Please, just relax.\" \" ", "John.\" \"", "Is there a nurse?\" \"", "Is there a nurse, please?\" \"", "I'm sorry.\" \"", "Is there a nurse here, please?\" \"", "Relax.\" \"", "Watch out, Mrs. Boyle.\" \"", "Let the nurse take care of it.\" \"", "It happens all the time.\" \"", "Watch out!\" \"", "Relax, man.\" \"", "Relax your body.\" \"", "Get the hell out of the way!\" \"", "Back!\" \"", "Nurse Rodriguez!\" \"", "Nurse Rodriguez, he can't breathe now!\" \" ", "Call Dr. Scott.\" \" ", "He can't breathe, man!\" \"", "You'll be all right, John.\" \" ", "Open your mouth.\" \" ", "All right.\" \" ", "Come on.\" \"", "Come on.\" \" ", "Jesus Christ, fix him now.\" \"", "Hold him, John.\" \"", "Hold him.\" \" ", "Hold your head.\" \" ", "Hold him.\" \"", "Breathe in.\" \"", "Breathe in.\" \" ", "Just take it in.\" \" ", "Okay, just relax.\" \"", "Relax.\" \" ", "He's gonna be all right, yeah?\" \" ", "Relax.\" \"", "Okay, yeah.\" \"", "He'll be all right.\" \" ", "He's going to be all right.\" \"", "Okay.\" \" ", "Okay.\" \"", "Feel okay?\" \"", "Yeah?\" \"", "Yeah.\" \"", "Yeah, he feels okay.\" \"", "Just get him on the bed.\" \"", "Hey, man's in bed with his wife, you know.\" \"", "Turns to the lady and says:\" \"\"Why don't you never let me know when you're having an orgasm?\"\" \"", "She looks over at him and says:\" \"\"Darling, it's because you're never there. \"\" \"", "Two, three.\" \" ", "I think you got a smile, John.\" \" ", "Yeah.\" \" ", "You got a smile.\" \"", "I hear a laugh.\" \" \"", "It's because you're never there. \"\" \" ", "One and...\" \" Yeah.\" \"", "Yeah.\" \"", "All right.\" \"", "This hospital will kill no quad before its time.\" \"", "I called Mr. Hill.\" \"", "He said he'd be here tomorrow.\" \"", "Didn't know exactly when.\" \"", "Well, I'll be in all day.\" \"", "Is everything okay in here?\" \" ", "This must be Grand Central Station.\" \" ", "Is there any obstruction?\" \"", "No, just a spasm.\" \"", "He'll be fine.\" \" ", "Hello there.\" \" ", "Hi.\" \"", "Is your breathing okay now?\" \"", "What was all the fuss about?\" \"", "I had a run-in with Mrs. Boyle.\" \"", "I know I should've just smiled and nodded.\" \"", "The last thing I wanna do is to get Emerson down here again with his pharmaceutical nightstick.\" \"", "Yeah.\" \"", "I'm sorry about that.\" \"", "Well, I don't suppose it was your fault.\" \" ", "I'll be on the floor if you need me.\" \" ", "All right.\" \"", "Thanks.\" \"", "Mr. Harrison do you think perhaps I could give you some advice?\" \"", "Why don't you take the pills?\" \"", "The dose is so small, it's like taking nothing.\" \"", "They're not gonna dull your consciousness, not like the injection will.\" \"", "You have beautiful breasts.\" \" ", "What did you say?\" \" ", "I said, you have beautiful breasts.\" \"", "What an odd thing to say.\" \"", "Why?\" \"", "I know you're a doctor, but you're not gonna tell me that you only regard them as mammary glands.\" \" ", "No.\" \"", "I know.\" \" ", "You're perfectly safe.\" \"", "I'm not gonna jump out of bed and rape you.\" \" ", "Yeah.\" \" ", "Did I embarrass you?\" \"", "No, you didn't embarrass me.\" \" ", "You just surprised me a little bit.\" \" ", "And embarrassed you.\" \" ", "Yeah, just a little.\" \" ", "Why?\" \"", "I admit it's unusual for a man to compliment a woman on her breasts when only one of them is in bed.\" \"", "One of the people, that is.\" \" ", "Not one of the breasts.\" \"", "No.\" \" ", "Not one of...?\" \"", "That...?\" \"", "It's not the reason, is it?\" \"", "Look, I...\" \"I don't really think this is helping you to talk like this, do you?\" \"", "Because I can't do anything about it, you mean.\" \"", "Well, yeah.\" \"", "Right.\" \"", "You know, I've noticed you walking around this room bending over me, examining my body.\" \"", "It's amazing.\" \"", "It's amazing how relaxed a woman can be when she's not in the presence of a man.\" \"", "Yeah.\" \"", "Look, I'm sorry.\" \"", "I mean, I'm sorry if I have provoked you in any way because, believe me, it was not intentional.\" \"", "No, no.\" \"", "You haven't provoked me, as you call it.\" \"", "But you are a woman.\" \"", "And even though I only have a piece of knotted string between my legs I still have a man's mind.\" \"", "Now, the other things I've noticed is that I now engage in sexual banter with young nurses.\" \"", "I'm constantly searching for the double-entendre in the most innocent of remarks.\" \"", "Every time they leave the room, I just go cold with embarrassment.\" \" ", "Is that disgusting?\" \" ", "No.\" \" ", "Pathetic?\" \" ", "It's sad.\" \"", "I'm serious, you know, about wanting to die.\" \"", "Ken, come on.\" \"", "Believe me, you'll get over this feeling.\" \" ", "How do you know?\" \" ", "I know from experience from watching other patients who are worse off than you are who go through the same thing.\" \" ", "We all respond the same?\" \"", "We vegetables?\" \"", "It's probably very difficult for you to know what you want right now.\" \"", "Well, Dr. Scott, I do, with a free and working mind and it is your moral obligation to accept my decision.\" \"", "No.\" \"", "Wait a minute.\" \"", "Not according to my morals.\" \"", "Why?\" \"", "Why are yours better than mine?\" \"", "I'll tell you why.\" \"", "Because you're more powerful than me.\" \"", "I am in your power.\" \"", "Well, I think you should try to get some sleep now.\" \"", "You've had a tough day.\" \"", "I'm afraid I have to get going.\" \"", "I was just in the middle of another patient.\" \"", "Oh, I thought you were just passing through.\" \" ", "Dr. Scott.\" \" ", "Yeah.\" \"", "You still have beautiful breasts.\" \"", "Well, thank you.\" \"", "That's it.\" \"", "That's it.\" \"", "Let's go.\" \"", "Come on.\" \"", "Good.\" \"", "Way to fire it.\" \"", "Playmaker, let's go.\" \"", "All right, good.\" \"", "That's in, that's in, that's in.\" \"", "Mr. Hill.\" \" ", "How are you?\" \" ", "Oh, I'm better.\" \"", "I had a terrible cold last week.\" \"", "I was, you know, flat on my back for...\" \"You know, I couldn't move...\" \"You know, those guys are very good, just like a real team.\" \"", "No, their dribbling sucks.\" \"", "Well, I've got all the papers here, and...\" \"I don't wanna talk about the accident.\" \"", "I can understand that, Mr. Harrison, but I'm afraid that we really must.\" \"", "No, no, no, I don't wanna...\" \"I didn't ask you to come here because of the insurance claim.\" \"", "Mr. Hill, do you think you could wheel me over to that table?\" \"", "Thank you.\" \"", "You have to undo the brake under my right elbow.\" \"", "Okay.\" \"", "Let me ask you a question.\" \"", "You don't work exclusively for the insurance company, do you?\" \"", "No.\" \"", "I'm with a...\" \"A small firm.\" \"", "So there's no reason why you couldn't represent me independently?\" \"", "No.\" \"", "Is this all right?\" \" ", "That's just fine.\" \"", "Thank you.\" \" ", "All right.\" \"", "I'd like you to do something for me, if possible.\" \"", "All right.\" \"", "I'd like you to get me the hell out of here.\" \"", "Well, I'm afraid I don't understand what you mean.\" \"", "It's really very simple.\" \"", "I'd like to be discharged from this hospital.\" \" ", "To another hospital?\" \" ", "No.\" \"", "Well, they wouldn't keep you here any longer than necessary.\" \"", "You wouldn't think so, would you?\" \"", "Mr. Hill, I can't exist outside this hospital.\" \"", "They have to keep me here in order to keep me alive.\" \"", "And they do seem rather intent upon doing just that.\" \"", "But I have decided that I do not wish to go on living like this and so I would like to be discharged so that I could die.\" \"", "And you want me to represent you?\" \"", "Tough luck.\" \"", "Astonishing request.\" \"", "My sculpture isn't very orthodox either.\" \"", "You mean, just lie there somewhere and die?\" \" ", "And die, yes.\" \" ", "Well, what's the hospital say?\" \" ", "They don't know about it yet.\" \"", "But do you realize what you're asking me...?\" \"", "I do realize that I am not asking you to make any decision concerning my life and death.\" \"", "I am only asking you to represent my position to this hospital.\" \"", "Now, lawyers, as a matter of course represent criminals who they know to be guilty, don't they?\" \"", "Yeah.\" \"", "So don't you think I have the same rights as any ax murderer?\" \"", "Mary Jo!\" \"", "Wait!\" \"", "She's such a lovely girl, you know.\" \"", "We'll go for a little extra ride, Mr. Forman.\" \"", "I'm going to Gynecology.\" \"", "Gynecology.\" \"", "He'll love it.\" \"", "Where are you going?\" \"", "Now, why won't you go out with me?\" \"", "Oh, God.\" \"", "I can't.\" \"", "You know, negative thinking never got nobody nowhere.\" \"", "Oh, yeah?\" \"", "Well, I'm busy.\" \"", "Besides, I hardly know you.\" \"", "Right.\" \"", "That's why I think we ought to go out, you know.\" \" ", "Oh, yeah?\" \" ", "Yeah.\" \" ", "Well, ask me next week.\" \" ", "Next week?\" \"", "Yeah.\" \"", "After exams, okay?\" \"", "Okay, it's a deal.\" \"", "And I'll ask you this afternoon as well.\" \"", "Now, wasn't that fun?\" \"", "You want me to kill my patient?\" \"", "No.\" \"", "I'm simply presenting Mr. Harrison's wishes in the matter.\" \" ", "Would you sign this, please?\" \"", "But you do represent Harrison in this matter?\" \"", "No, I told him I had to talk to you before I made that decision.\" \"", "Releasing Harrison to anything but a full-service hospital is tantamount to murder.\" \" ", "No, murder's a legal term.\" \"", "Murder's a legal term, doctor.\" \"", "I'm merely representing my client's needs and wishes if I choose to represent him.\" \" ", "You believe in capital punishment.\" \" ", "Oh, come on.\" \" ", "That's what you're recommending here.\" \" ", "No, I'm not.\" \"", "I'm not recommending anything yet.\" \"", "Yet?\" \"", "Look, Mr. Hill.\" \"", "We've spent six months and a lot of money trying to save this man's life.\" \"", "Good morning.\" \"", "We're not gonna throw that down the drain.\" \"", "That is not the issue, doctor.\" \"", "We're talking about a man's right to determine his life not the quality or expense of your treatment.\" \"", "Mr. Harrison would like to be discharged from this hospital.\" \" ", "Will you do that?\" \" ", "No.\" \"", "Why not?\" \"", "Because it's my sworn duty to preserve life, not to destroy it.\" \"", "I'm not gonna let this man die through any legal chicanery.\" \" ", "He is a voluntary patient here.\" \" ", "This interview is at an end.\" \"", "I do not see any legal basis for you to hold him here against his wishes.\" \"", "Just try to understand one thing.\" \"", "Mr. Harrison is not capable of making any rational decision about his life or his death.\" \"", "He's in a state of depression and using his situation for your personal gain is the lowest form of banality.\" \"", "In your opinion, then, Mr. Harrison is mentally unbalanced?\" \" ", "Correct.\" \" ", "In my opinion he is not.\" \"", "Jesus Christ!\" \"", "You're not a doctor.\" \"", "Well, would you object to my bringing in a qualified psychiatrist who would examine Mr. Harrison?\" \"", "We have several on staff who would be happy to examine Mr. Harrison.\" \"", "I'm sure you'll understand if I ask my own psychiatrist whose opinion you are not so sure of in advance.\" \"", "Goodbye, Mr. Hill.\" \"", "Well, thank you for your time, doctor.\" \"", "Four, five...\" \"You weren't in the SS when you were a kid, were you, Michael?\" \" ", "Come on, you're doing great.\" \" ", "I'm doing great.\" \" ", "Come on.\" \" ", "There we go.\" \" ", "Gently, gently, gently.\" \" ", "Hello.\" \" ", "Hello again.\" \" ", "Hello, hello, hello.\" \" ", "Hey, did you find anything out?\" \" ", "Quite a bit.\" \"", "See if you can find Dr. Jacobs.\" \"", "Ask him to call me.\" \"", "And get me the hospital administrator, stat.\" \"", "Dr. Emerson does not feel that you are in a healthy enough mental state to make a rational decision, especially one of this seriousness and finality.\" \"", "Now, I'm not qualified to decide whether or not he's right.\" \"", "Well, what will help you decide?\" \"", "I'd like to have you examined by an independent psychiatrist...\" \" That's fine.\" \" ", "I will accept his view of the case.\" \" ", "Fine.\" \"", "Has Emerson agreed?\" \" ", "Yes.\" \"", "He already has.\" \"", "That's great.\" \"", "That's a good beginning.\" \"", "Probably, he'll want the hospital psychiatrist to examine you too.\" \"", "I imagine you'll end up with two conflicting views.\" \"", "I would imagine so.\" \" ", "And where would that lead us, exactly?\" \" ", "Well, that's hard to say.\" \"", "Emerson was very adamant.\" \"", "He'll probably use the Mental Hygiene Law.\" \"", "Now, that means that if he can get two psychiatrists to sign statements saying you're mentally unbalanced he can commit you here and give you any treatment he wants.\" \"", "Can he do that?\" \"", "And I have no say in that?\" \"", "Some.\" \"", "You can then request a hearing and see how it goes from there.\" \"", "Well, let's get this show on the road, okay?\" \"", "Let's wheel in your shrink, all right?\" \"", "Dr. Jacobs, please call extension three.\" \"", "Now, are you going to represent me?\" \"", "I don't know.\" \"", "I'd like to get the shrink in here first.\" \"", "I'll be in touch.\" \"", "Okay.\" \"", "Well, call him 11:00 on Wednesday.\" \" ", "Oh, Sandy, thanks for sparing the time.\" \" ", "Never too busy.\" \"", "How do you feel?\" \"", "You want a cup of coffee?\" \"", "No, thanks.\" \"", "Just keeps my heartburn awake.\" \"", "Who's your problem?\" \"", "I have a 32-year-old man.\" \"", "Auto accident, severe trauma C4 transect, nephrectomy, dialysis, usual C4 comps.\" \"", "He wants to be discharged, to go off dialysis to go home and die.\" \"", "Would he?\" \"", "Without dialysis he'd be dead in a week.\" \"", "I gave him steroids, I balanced his electrolytes I stabilized his dialysis.\" \"", "We just about have a viable human being again.\" \"", "Clare.\" \"", "Sandy Jacobs, Clare Scott.\" \" ", "Good to see you, Sandy.\" \" ", "You too.\" \"", "I was just telling Dr. Jacobs about Ken Harrison.\" \" ", "What about him?\" \" ", "He's got a lawyer.\" \"", "Threatens to sue unless we discharge him.\" \"", "If I'm gonna keep him alive we'll have to commit him under Mental Health.\" \"", "Okay, even if I agree, you're still gonna need another consult.\" \"", "That's no problem, is it?\" \"", "Depends if he's clinically depressed, right?\" \"", "Look, if I walk in, he says, \"Hey, I'm a teapot,\" you're in.\" \"", "Depressed?\" \"", "What the hell do you mean?\" \"", "He's suicidal.\" \"", "I can name several prominent psychiatrists who wouldn't accept suicide as evidence of insanity.\" \"", "And I can name several prominent psychiatrists who in themselves are evidence of insanity.\" \"", "I'll accept that.\" \"", "Okay, I will talk to your suicide for you.\" \"", "Good.\" \"", "And do me a favor for the second signature.\" \"", "Try to find an old bastard like me who believes in something better than suicide.\" \"", "I will...\" \"Listen, there is an old bastard at St. Joseph's.\" \"", "Staunch Catholic.\" \"", "Thanks, Sandy.\" \"", "I appreciate it.\" \"", "So will Harrison when he realizes.\" \"", "Right.\" \"", "Doctor.\" \"", "So you're committing Ken Harrison as mentally incompetent?\" \"", "I don't believe this, Michael.\" \" ", "I know it stinks.\" \" ", "Yeah.\" \"", "But he'd be dead in a week if we don't.\" \"", "I don't understand this.\" \"", "Wait a minute.\" \"", "Where do we get the right to commit him?\" \"", "Isn't this his decision?\" \" ", "Aren't we talking about his life here?\" \" ", "But goddamn it, it's our responsibility.\" \"", "Now, I can't accept the fact that a man of Harrison's intelligence would choose suicide.\" \"", "I know what you mean, Michael, but apparently he has.\" \"", "Therefore, I say he's unbalanced.\" \"", "Just because we don't agree with his choice, doesn't make him crazy, does it?\" \"", "I mean, look at him.\" \"", "Does he look crazy to you, Michael?\" \"", "Look at him lying there.\" \"", "Come on.\" \"", "I mean, Christ, he's got no privacy at all, he's got no sense of dignity.\" \"", "I'll tell you, if that happened to me, I don't know if I'd have the courage to live.\" \"", "How about you?\" \"", "Can you stop playing doctor for one second and tell me would you wanna live like that?\" \" ", "Don't give me that right-to-die routine.\" \" ", "We're doctors.\" \"", "We're committed to life.\" \" ", "Don't lecture me, all right?\" \"", "When a patient is brought here in his condition I don't stand around wondering whether his life is worthwhile.\" \"", "I don't have time for that.\" \"", "I try to save it.\" \" ", "I'm a physician, not a judge.\" \" ", "Interesting.\" \"", "You're behaving like a judge.\" \"", "Clare.\" \"", "Clare.\" \"", "I'm sure it's not necessary for me to say this but if Harrison should suddenly sour and die on us I'll order an autopsy and I'll act on whatever's found.\" \"", "You fucker.\" \"", "Here we go, off to dialysis.\" \"", "Oh, dialysis.\" \"", "Why don't we go to a bar?\" \"", "Skip the damn dialysis.\" \"", "Hey, come on, now.\" \"", "Come on, man.\" \"", "You know I can't do that.\" \"", "I need this job.\" \"", "This job's gonna pay for me xylophone, you know?\" \" ", "Yeah?\" \" ", "Band sounds good, you know.\" \"", "We can make a record even.\" \" ", "Oh, yeah?\" \" ", "Yeah.\" \"", "Listen:\" \"Hello, baby.\" \"", "Hello, old man.\" \"", "Old man?\" \"", "Good morning, Roberta.\" \"", "Lissa, anybody ever tell you that you are absolutely gorgeous?\" \"", "Got your hair cut, didn't you?\" \"", "I'm not gorgeous.\" \"", "I have a mirror.\" \"", "And?\" \"", "I'm not gorgeous.\" \"", "Mirrors speak with forked tongue.\" \"", "Harrison speaks the truth.\" \" ", "Guess what.\" \" ", "What?\" \"", "I'm being cut down to once a week.\" \"", "You're kidding.\" \"", "That's great!\" \"", "Oh, Lissa, that's fabulous.\" \" ", "You know what that means, don't you?\" \" ", "What?\" \"", "That means that soon you're gonna be cut down to once every two weeks.\" \"", "And then you'll be cut down to once every none weeks.\" \"", "God.\" \"", "You got a hell of a life ahead of you, kid.\" \"", "Well, you get better, Ken.\" \"", "Oh, I am.\" \"", "I will.\" \"", "I have to.\" \"", "I signed to play shortstop with the Red Sox this spring.\" \"", "Fantastic.\" \"", "Actually, I signed to wear red socks for the shortstops.\" \"", "Actually, I'm dating a shortstop who was wearing red socks.\" \" ", "Bye, Ken.\" \"", "See you.\" \" ", "I have to stop red mark on my socks.\" \"", "And I got my red socks.\" \"\"", "Bye, Ken. \"\" \"", "Lissa, you ever been to a disco?\" \"", "See you, Lissa.\" \"", "Mr. Harrison.\" \"", "The very same.\" \"", "I'm Sandy Jacobs.\" \"", "You're a psychiatrist.\" \"", "Does it show?\" \"", "Thank you, nurse.\" \"", "I'll watch him now.\" \" ", "Okay.\" \"", "I'll see you.\" \"", "I'll be outside.\" \" ", "Thank you, Roberta.\" \"", "You for me or against me?\" \"", "Oh, did that sound like paranoia?\" \"", "You would hardly expect me to make an instant diagnosis.\" \"", "Well, did Dr. Emerson send you?\" \"", "Would you describe yourself as suffering from paranoia?\" \"", "Nope.\" \"", "What would you say paranoia was?\" \"", "Well, I think it would depend on the person, myself but generally speaking, I think it's someone who believes that what they think is right and will brook no denial.\" \"", "Now, if this person were a sculptor we would, indeed, diagnose this condition as paranoia.\" \"", "Lf, however, the person were a doctor, we would call it professionalism.\" \"", "You don't like doctors.\" \"", "You like your patients?\" \"", "Some.\" \"", "I like some doctors.\" \"", "What is it about doctors, then?\" \"", "Oh, I...\" \"I don't think many of them realize that many of their patients can and want to understand what's wrong with them and they're capable of making decisions about their own bodies.\" \"", "And what they need, of course, is information.\" \"", "Well, a doctor doles out information like a kosher butcher doles out pork sausages.\" \"", "That's true, but wouldn't you agree patients need medical knowledge in order to make good decisions?\" \" ", "Absolutely.\" \"", "I would be very grateful for any information so that I might make the proper decision.\" \"", "It would, however, be my decision.\" \"", "Now, let's just say, for example that you came into my studio and you took a look at my pieces and you said:\" \"\"Well, I think I'll take the mother and child,\" and I said, \"No, no, no.\" \"", "You don't know a damn thing about sculpting.\" \"", "You get the flamingo. \"\" \"", "You'd think I was nuts.\" \"", "But we are not talking about a piece of sculpture.\" \"", "We're talking about your life.\" \"", "That's right.\" \"", "That's exactly right.\" \"", "My life.\" \"", "Think about it.\" \"", "And your obvious intelligence weakens your case.\" \"", "I'm not saying that you would find life easy.\" \"", "I'm saying that you have resources an unintelligent person doesn't have.\" \"", "No, no, no.\" \"", "Wait a minute.\" \"", "That's not fair.\" \"", "That's Catch-22.\" \"", "If you're clever enough and sane enough to put forth an invincible argument for suicide that demonstrates that you ought not to die?\" \"", "You know, you've got a nasty little tidiness compulsion there.\" \"", "I was an only child.\" \"", "But enough of me.\" \"", "Well, what about your parents?\" \"", "Are they living?\" \"", "No.\" \"", "No.\" \"", "I have no living relatives, which really isn't bad considering birthdays and Christmas.\" \"", "You know, presents?\" \"", "After all, how many hats can you wear?\" \"", "Listen, I'd like to do some tests.\" \"", "Tests?\" \"", "What kind of tests?\" \"", "I'll tell you right now, my time in the 100-yard dash is rotten.\" \"", "And I'd like to confer with Dr. Emerson.\" \"", "Confer.\" \"", "That's when two doctors support each other's mistakes, right?\" \" ", "You seem very angry.\" \" ", "No shit.\" \"", "What are you gonna do?\" \"", "Put me down as being in the manic phase of a manic-depressive cycle?\" \"", "No, I certainly would not do that, Mr. Harrison.\" \"", "Your lawyer, Mr. Hill, asked me to see you.\" \" ", "Lf anything, I'm on your team.\" \" ", "My team?\" \"", "Dr. Barrows, do you understand the trap that I am in?\" \"", "Can anyone prove that they're sane?\" \"", "Could you?\" \"", "I'll come and see you another time.\" \"", "No, you will not come and see me because each time you see me the more I will get angry and frustrated and depressed.\" \"", "Please just leave me alone!\" \"", "Hello?\" \"", "Pat?\" \"", "Anybody here?\" \"", "Oh, God.\" \"", "Hello?\" \" ", "Hi.\" \" ", "Hi.\" \" ", "Sorry I couldn't meet you.\" \" ", "That's okay.\" \"", "I rehearse and study and perform, and take care of the studio and arrange Ken's business affairs.\" \"", "His work's gone up a lot.\" \" ", "Did you get a look around?\" \" ", "Oh, yeah, I did.\" \"", "It's pretty amazing.\" \"", "He has an incredible talent.\" \"", "Yes.\" \"", "He had.\" \"", "Here's your key.\" \"", "Thank you.\" \"", "The place is really great.\" \" ", "I'm gonna have to close it up.\" \" ", "Really?\" \"", "Turn Ken's work over to a gallery.\" \"", "They're just better equipped to take care of it.\" \"", "I wanna thank you for agreeing to this meeting.\" \"", "You'll have to excuse my rush.\" \"", "I'm late.\" \"", "I have a date.\" \"", "Well, just go ahead.\" \"", "I'll just take a couple minutes.\" \"", "Pat, I could really use your advice.\" \"", "I'm looking for some possible way to help out Ken Harrison.\" \"", "Some way to get through to him.\" \"", "You mean, the late Ken Harrison.\" \" ", "What do you mean?\" \"", "I mean, he's not...\" \" Yes, he is.\" \"", "He may not be to you, but he is to me and to himself.\" \"", "Understand me, doctor.\" \"", "I loved the late Ken Harrison.\" \" ", "And I grieve for his death but...\" \" I'm sorry.\" \"", "I don't understand this.\" \"", "I can't believe you're just giving up on him like this.\" \"", "Giving him up?\" \"", "Ken Harrison is gone, doctor.\" \"", "You wanna see Ken?\" \"", "Look around you.\" \" ", "Take a better look.\" \" ", "Yes, I know.\" \"", "He's...\" \"He's special.\" \"", "That's why we've gotta find a way to change his mind.\" \"", "Look, Pat, I know that if we can just get him to wait a couple of months...\" \"Dr. Scott.\" \"", "I respect Ken's wishes because I respect Ken.\" \"", "Why can't you do that?\" \"", "Why don't you respect him?\" \"", "I do.\" \"", "Then just let him do what he wants to do.\" \"", "Let him go.\" \"", "Wake up, bimbo, it's feeding time.\" \"", "I can't wait.\" \" ", "Dinner is served...\" \" Oh, not leftover Thanksgiving.\" \" ", "Chicken.\" \" ", "Oh, how creative.\" \"", "Chicken instead of turkey, I see.\" \"", "Why are there no bunny rabbits on my bib?\" \"", "I want bunny rabbits on my bib.\" \" ", "I want bunny rabbits...\" \" Shut up.\" \"", "Eat.\" \"", "You eat.\" \"", "Be a good boy.\" \"", "Oh, great.\" \"", "I'm eating the drumstick and you're licking your fingers.\" \" ", "You must be starving.\" \" ", "I'm...\" \"Why don't you eat the drumstick and I will lick your fingers?\" \"", "How about the peas?\" \"", "Wanna try the peas?\" \"", "I hate peas.\" \"", "They're all clones.\" \"", "No, I'm not ready for the peas.\" \"", "I'm not ready...\" \" Come on.\" \" ", "Wasn't totally ready for the peas.\" \"", "Come on, don't be gross.\" \"", "I want you to make a circle with your thumb and your forefinger.\" \"", "My thumb and my forefinger.\" \"", "Like that.\" \"", "Oh, I know what you're gonna do...\" \" Bull's-eye.\" \" ", "Right on the mark, baby.\" \"", "Here, I'll put the peas back in where they came from.\" \"", "Watch out.\" \"", "I'm a quadriplegic, you can't hit me.\" \"", "Yes, you can.\" \"", "Yes, you can.\" \"", "I think the evidence is against me.\" \"", "But I don't think that we're talking about euthanasia.\" \"", "Well, I'm sorry, because I think we are.\" \"", "Well, what would you think if by a sudden miracle Ken gained the use of his arms for 30 seconds and swallowed a bottle full of sleeping pills?\" \"", "What would your reaction be?\" \"", "Look, I told you I'm a doctor and I have a responsibility to my patient.\" \" ", "Yeah...\" \"No.\" \" ", "Okay?\" \"", "You, as you.\" \"", "You mean, how I would really feel about that?\" \"", "I don't know.\" \"", "I guess...\" \"I guess a part of me might be a little relieved, why?\" \"", "Would you try to save his life?\" \"", "With stomach pumps and all that?\" \"", "I...\" \"I don't think I would.\" \"", "Great.\" \"", "So we're not adversaries.\" \"", "No.\" \"", "Well, so I've got a bottle of Rémy at my place waiting for two non-adversaries to open.\" \" ", "No, thank you.\" \" ", "It's very close.\" \"", "No, it would be...\" \"A nightcap after a good dinner.\" \"", "No.\" \"", "Thanks very much but I gotta...\" \"I gotta go.\" \"", "Oh, it couldn't possibly be two hours...\" \"I thought I'd change your position early.\" \"", "I didn't expect to see you here tonight.\" \"", "Yeah, I had some work to finish up in the office.\" \" ", "You look real nice.\" \" ", "Well, thank you.\" \" ", "You been out?\" \" ", "Yeah, I went out to dinner.\" \"", "Good company?\" \"", "You're fishing.\" \"", "You're right.\" \"", "Actually, yes, it was very good company.\" \"", "I had dinner with your lawyer, Carter Hill.\" \"", "Well, well, well.\" \"", "The horny little bugger.\" \" ", "Didn't take him long.\" \" ", "It was just a dinner.\" \"", "I know I asked him to represent me but this is ridiculous.\" \"", "It was just a dinner.\" \"", "Did my surrogate self behave myself?\" \"", "Yes, you were a perfect gentleman.\" \"", "I want you to get another surrogate.\" \"", "Could you, please?\" \"", "Why?\" \"", "Do you really mind?\" \"", "No.\" \"", "Ken, I might've done something that you're not gonna be real thrilled about.\" \"", "Something bad.\" \" ", "Man.\" \" ", "Yeah.\" \"", "This I gotta hear.\" \"", "Well, I went to your studio.\" \"", "You went to my studio?\" \"", "What for?\" \"", "I don't know.\" \"", "I guess because I wanted to know more about you.\" \"", "Know more about me?\" \"", "No woman had ever examined me so thoroughly.\" \"", "I'm really glad I got a chance to see your work.\" \"", "I think you're...\" \"Well, you're okay.\" \" ", "You're good.\" \" ", "Thank you.\" \"", "So I was just thinking maybe you'd wanna have a couple of pieces here.\" \" ", "Well, look, I'll make you a deal.\" \" ", "What?\" \"", "You can take any pieces that you like free of charge.\" \"", "What do you say?\" \"", "You know, I'm very glad you just said that because I just happen to have here with me one of your pieces.\" \"", "An art thief on top of it all.\" \"", "Yeah.\" \"", "It's just so amazing.\" \" ", "You do have excellent taste.\" \" ", "Well, thank you.\" \"", "And it happens to be my favorite piece in the studio.\" \" ", "I think it's the best thing in the studio.\" \" ", "It's beautiful.\" \"", "It's by Michelangelo.\" \"", "What?\" \"", "This...\" \"It's a realization from the Sistine Chapel.\" \" ", "You see, God, who gives life to man...\" \" Oh, shit.\" \"", "This is Michelangelo.\" \"", "Well, it's obvious.\" \"", "Is my face a little red right now?\" \" ", "Look, I'm sorry.\" \" ", "Don't be sorry.\" \"", "Really.\" \"", "Don't be sorry.\" \"", "Actually, come to think of it I wouldn't mind looking at that now and again.\" \"", "Ken, I'm...\" \"I'm getting this very strange feeling that you're really enjoying all this.\" \"", "I'll tell you something, Clare this is the first time in months that I've begun to feel like a human being again.\" \"", "And isn't that the whole point, Ken?\" \"", "I mean, isn't that what all this is about?\" \"", "I'm sorry, I just can't believe you're really fighting for death.\" \"", "I just don't buy that.\" \"", "You're right, in that I had to be sure that I really wanted to win what I was fighting for, you know.\" \"", "That I wasn't just doing it in order to prove to myself that I was still alive.\" \"", "And are you sure?\" \"", "Oh, yeah.\" \"", "Yeah.\" \"", "Yeah.\" \"", "Clare, could you fix these pillows for me?\" \"", "Sure.\" \"", "Clare?\" \"", "Clare.\" \"", "Life for me is over.\" \"", "I cannot do the things I wanna do.\" \"", "I can't even say the things I wanna say.\" \"", "So for me it might as well be over.\" \"", "You do understand that, don't you?\" \"", "Yeah.\" \" ", "So...\" \" So tomorrow, on with the fight.\" \" ", "Right.\" \"", "On with the fight.\" \" ", "Good night.\" \" ", "Good night.\" \"", "Clare?\" \"", "You driving home?\" \" ", "Yeah.\" \" ", "Use your seat belts.\" \"", "Good night.\" \"", "Good night.\" \" ", "I'm gonna lose my job.\" \" ", "You're not gonna lose your job, baby.\" \"", "Not for doing something like this.\" \"", "Hey, come on.\" \"", "Cool it.\" \"", "Be quiet, we're almost there.\" \"", "Okay, now.\" \" ", "You got to be ready, now.\" \" ", "Yeah, okay.\" \" ", "Okay.\" \" ", "Okay.\" \"", "Let's go.\" \"", "What are you doing?\" \" ", "You're not supposed to be on duty tonight.\" \" ", "There's duty and there's duty.\" \" ", "What are you doing?\" \" ", "Hey.\" \"", "Keep that blabber shut closed, okay?\" \" ", "Where are you going?\" \" ", "Dialysis.\" \" ", "Hi, Ken.\" \"", "How you doing?\" \" ", "Pretty good.\" \" ", "But where are you...?\" \" ", "Dialysis.\" \"", "Now that I know we're not going to dialysis, where...?\" \"", "Hey.\" \"", "For one time in your life, man, shut up.\" \" ", "What took so long?\" \" ", "I came as fast as I could.\" \"", "Now, shut up, woman.\" \"", "One, two...\" \"One, two, three, four!\" \"", "Shake, shake.\" \"", "Shake, shake, shake.\" \"", "Shake, shake, shake.\" \"", "Hey, man.\" \"", "Yeah, we was jamming, man.\" \"", "Hey, Ken, I want you to meet the members of the Rebel Rockers, man.\" \" ", "Here on keyboards is G.T., man.\" \" ", "Hey.\" \" ", "We got Red Locks here.\" \" ", "How you doing?\" \"", "Right there, man, Teodoro.\" \"", "And toking on some ganja, Rossan, right here.\" \"", "Herbal inspiration.\" \"", "Is that an illicit narcotic I see?\" \" ", "No, this is herbal.\" \" ", "Herbal, schmerbal.\" \" ", "Get it over here.\" \" ", "On the steel drums there, man is Michael, you know.\" \" ", "What about Sonora?\" \"", "Sonora?\" \"", "Check it.\" \"", "One love.\" \" ", "I think he like that, man.\" \" ", "Hey, John.\" \" ", "I think he like it, now.\" \" ", "John, wait.\" \" ", "Play that song you did last night.\" \" ", "All the rockers, you want to rock, man?\" \"", "Yo.\" \"", "Hey.\" \"", "One, two...\" \"One, two, three, four!\" \"", "Stop.\" \"", "Wait, everybody stop.\" \"", "Listen, stop, somebody's coming.\" \"", "Stop.\" \" ", "Stop it.\" \"", "Somebody's coming.\" \" ", "Somebody's coming.\" \"", "Forget the doobie and get the microphone, man.\" \"", "Hurry, man.\" \"", "Hurry, now.\" \"", "Get the ganja, man.\" \"", "Get the ganja.\" \" ", "Come on back.\" \"", "Let's go.\" \" ", "Hurry it up.\" \"", "Get the door.\" \" ", "Oh, shit, man.\" \"", "I forgot my cymbals.\" \" ", "Okay.\" \"", "What is?\" \"", "What the hell is going on here?\" \"", "Who are you?\" \"", "What are you doing here?\" \"", "Isn't this dialysis?\" \"", "Okay, one, two, three.\" \" ", "All the way over.\" \" ", "Come on.\" \"", "Rodriguez.\" \"", "Rodriguez, my beloved saint.\" \"", "Couldn't you spare me three or four thousand aspirin, please?\" \" ", "How about one Tylenol?\" \" ", "How about two Tylenol?\" \"", "I got my lawyer coming this morning.\" \"", "So, what were you doing in the basement?\" \"", "I was on my way to dialysis.\" \"", "Your breath smells like my whole neighborhood.\" \"", "Who is that?\" \"", "Who is that?\" \"", "It couldn't be a doctor.\" \"", "They all wear Italian loafers and silk socks.\" \"", "Carter Hill.\" \"", "The man who sues, eats, and chases girls for me.\" \" ", "How you doing?\" \" ", "Oh, I'm all right.\" \" ", "How are you feeling this morning?\" \" ", "Just wonderful.\" \"", "Okay.\" \"", "Back over.\" \"", "Turn him slowly.\" \"", "He gets dizzy because of lack of circulation.\" \"", "Yeah, I don't get to circulate very much anymore.\" \"", "So, what's your decision?\" \"", "So, how are you feeling this morning, Mr. Harrison?\" \"", "You slept well last night, did you?\" \"", "Like I got hit in the head by a spade.\" \"", "Oh, cute, man, cute, for a cripple.\" \"", "I'm...\" \"I'm going to represent you.\" \" ", "All right.\" \" ", "When is the hearing?\" \"", "Why?\" \" ", "I haven't applied for it yet.\" \" ", "Two reason...\" \"Excuse me.\" \" ", "Sadler, get the Tylenol, please?\" \" ", "Why not?\" \" ", "Two reasons.\" \"", "Commitment judges usually find for the hospital and I...\" \"I think I have something better.\" \"", "Really?\" \"", "That sounds interesting.\" \"", "Miss Rodriguez.\" \"", "Could it be that Dr. Emerson suggested to you that you hang around while my attorney was here?\" \"", "I'm just here in case you get excited or something.\" \"", "Rodriguez, it's you that excites me.\" \"", "Where are you going?\" \"", "Get away from there, you slut.\" \"", "You Puerto Rican flesh pudding, I love you.\" \"", "Thought I was gonna get lucky there for a second.\" \"", "So, what's better?\" \"", "I wanna go for a writ of habeas corpus.\" \"", "Habeas corpus?\" \"", "I thought that had to do with criminals.\" \"", "Usually it does.\" \"", "It is against the law to deprive anyone of his liberty without due process.\" \"", "And if that happens, he can apply for a writ of habeas corpus which means, \"give us the body. \"\" \"", "That's right on the nose, in my case.\" \"", "And if sufficient cause can't be established to detain the individual the judge will order him released.\" \" ", "How long will this take?\" \" ", "Not long.\" \"", "A couple of days.\" \" ", "And will I have to go to court?\" \" ", "I doubt it.\" \"", "I would think that any judge would allow the hearing to take place right here.\" \"", "Well, well, well.\" \"", "All's well that ends.\" \"", "Well, I'm off to find the judge.\" \"", "See you soon.\" \"", "Be an unusual case for you, won't it?\" \"", "Making a plea for your client's death?\" \"", "Look, I'll be honest with you.\" \"", "This is a case I could bear to lose.\" \"", "Well, if you do, it's a life sentence for me.\" \"", "You're new, aren't you?\" \"", "Yup.\" \" ", "What's your name?\" \" ", "Stella.\" \"", "Stella?\" \"", "Well, Stella, you're very kind.\" \"", "Most of the nurses just yank you around till they wake you up and then they disappear for about two hours.\" \"", "You're trying to be released, aren't you?\" \"", "Be taken off your medication?\" \"", "Everybody knows about it, huh?\" \"", "Oh, yeah.\" \"", "Sure.\" \"", "Aren't you afraid?\" \"", "Yeah.\" \" ", "This what you wanted, now?\" \" ", "Oh, yes.\" \"", "If you'll put it behind this desk.\" \"", "Don't I get a special breakfast or anything?\" \"", "Not for some miserable jive-ass moaning on about wanting to die.\" \" ", "Good luck.\" \" ", "Thank you.\" \"", "Hey.\" \"", "Aren't you gonna wish me luck?\" \"", "No.\" \"", "Hey, I wish you luck.\" \"", "Judge Wyler.\" \"", "Thank you.\" \"", "Please sit down.\" \"", "This is an informal hearing, which I'd like to keep as brief as possible.\" \"", "Mr. Kenneth Harrison?\" \"", "Yes, Your Honor?\" \"", "Mr. Harrison, I've decided in consultation with Mr. Eden and Mr. Hill not to subject you to examination and cross-examination.\" \" ", "Your Honor, there may be things I want to...\" \" Mr. Harrison, if I have any doubts I'll question you myself.\" \"", "Dr. Emerson, we'll start with you.\" \" ", "Will you take the oath, please?\" \"", "Mr. Eden?\" \" ", "Thank you.\" \"", "Raise your right hand.\" \"", "Do you solemnly swear that the testimony you are about to give will be the truth the whole truth, nothing but the truth?\" \" ", "I do.\" \"", "Be seated.\" \"", "Dr. Emerson, what is your position here?\" \"", "I'm chief of medical services.\" \"", "Would you give the court a medical history of the treatment Mr. Harrison has received here?\" \"", "Following an automobile accident on the evening of April 27th of this year Mr. Harrison was admitted to this hospital in shock and suffering from a fractured left tibia, fractured right tibia and fibula fractured pelvis.\" \"", "Four fractured ribs, one of which punctured the right lung.\" \"", "A dislocated fourth cervical vertebrae, which crushed the spinal cord.\" \"", "He suffered internal damage to the spleen and kidney for which we performed a splenectomy and double nephrectomies.\" \"", "He remained unconscious for 30 hours.\" \"", "As a result of treatment here all the bones and ruptured tissue have healed with the exception of the spinal cord.\" \"", "That, together with the mental trauma, are all that remain of the initial injury.\" \"", "Will there be an improvement in the spinal cord?\" \"", "No.\" \" ", "Kidney function?\" \" ", "I regret not.\" \"", "And the mental trauma?\" \"", "It's impossible to violate the body to the extent of Mr. Harrison's without suffering severe mental aberration, depression, even loss of reality.\" \"", "In your view, is Mr. Harrison suffering from such mental aberration?\" \"", "He's depressed.\" \"", "Clinically depressed?\" \"", "Yes, clinically depressed.\" \"", "Thank you, doctor.\" \"", "That's all.\" \"", "Mr. Hill?\" \"", "Just one second, please.\" \"", "Doctor, is there any way you can demonstrate this clinical depression any tests or measurements you can show us?\" \"", "No.\" \"", "Then how do you distinguish clinical depression which might preclude the ability to make informed and logical decisions from a perfectly sane, justified feeling of depression as a result of existing conditions?\" \"", "By relying on my 18 years as a physician dealing with both types.\" \" ", "Are you a psychiatrist, Dr. Emerson?\" \" ", "No.\" \"", "Have you any degrees, credentials or have you any specialized training in psychiatry?\" \"", "No.\" \"", "No further questions.\" \" ", "Mr. Eden?\" \" ", "No further questions.\" \"", "Thank you, doctor.\" \"", "You're excused.\" \"", "Dr. Robert Barrows.\" \"", "Dr. Robert Barrows to the stand, please.\" \"", "Dr. Barrows, what position do you hold?\" \"", "I'm the consulting psychiatrist at the Monroe State Mental Hospital.\" \"", "Then you must see a large number of patients suffering from depressive illness.\" \"", "Yes, I do.\" \"", "All right.\" \"", "You've examined Mr. Harrison?\" \"", "Well, we know that, or else why would he be here?\" \" ", "Remember the word \"informal. \"\" \" ", "Yes, Your Honor.\" \"", "Would you say that Mr. Harrison is suffering from a depressive illness?\" \" ", "No, I would not.\" \" ", "The court has heard evidence that Mr. Harrison is depressed.\" \"", "Do you dispute that?\" \"", "In my opinion, he's reacting in a perfectly rational manner to a very bad situation.\" \"", "No further questions.\" \" ", "Mr. Eden?\" \" ", "Doctor.\" \"", "Are there any objective results that you could produce that would prove that Mr. Harrison is capable?\" \"", "There are clinical symptoms of endogenous depression.\" \"", "Disturbed sleep patterns, loss of appetite, lassitude, and many more.\" \"", "Even if they were present, they'd be masked by Mr. Harrison's physical condition.\" \"", "Then how can you be sure that this is, in fact, a reactive depression?\" \"", "By experience.\" \"", "By discovering when I talked to him that he has a remarkably incisive mind and is perfectly capable of understanding his position and deciding what he wants to do about it.\" \"", "Do you think he made the right decision?\" \"", "Your Honor, is this relevant?\" \" ", "No, not really.\" \" ", "I'd like to answer that, if I may.\" \"", "Go ahead.\" \"", "No.\" \"", "I think he made the wrong decision.\" \" ", "Oh, shit.\" \" ", "Mr. Hill.\" \"", "When I said \"informal,\" I didn't mean uncontrolled.\" \"", "Now be quiet.\" \" ", "I'm sorry.\" \"", "I...\" \" Thank you, doctor.\" \"", "That's all.\" \"", "Dr. Jacobs, the consulting psychiatrist for the hospital, wasn't able to be here today.\" \"", "I have a sworn affidavit.\" \"", "He agrees with Dr. Emerson's position.\" \" ", "Have it entered in the record.\" \" ", "Yes, Your Honor.\" \"", "Mr. Harrison, you feel like answering some questions?\" \"", "Yes, I do.\" \"", "I'll try to keep them uninflammatory.\" \" ", "You're too kind.\" \" ", "Not at all.\" \"", "No, I meant that.\" \"", "I think I'd much prefer a hanging judge.\" \"", "Either way I decide, I am a hanging judge.\" \"", "Now, Mr. Harrison, the medical director and the consulting psychiatrist claim that you're not capable of making an informed, intelligent decision.\" \"", "That's right.\" \"", "They're wrong.\" \" ", "What does that mean?\" \" ", "It means they're good doctors.\" \"", "And they won't let a patient die if they can help it.\" \"", "Do you think you're suffering from depression?\" \"", "Well, I am completely paralyzed.\" \"", "I think I'd be insane if I wasn't depressed.\" \"", "But wanting to die must be strong evidence that your mental state has gone beyond simple depression.\" \" ", "I do not want to die.\" \" ", "Then what the hell is this case all about?\" \"", "Make that read, \"Then what is this case all about?\"\" \"", "There was a \"hell,\" and I think he said \"shit\" before, so maybe you ought to cross...\" \"Sorry.\" \"", "I do not want to die, because as far as I am concerned, I am dead already.\" \"", "I merely want the doctors to recognize that fact.\" \"", "I cannot believe that this...\" \"This condition constitutes life in any real sense of the word.\" \"", "Legally, you're alive.\" \"", "I think I could challenge even that.\" \"", "Any reasonable definition of the word \"life\" must include the idea that it be self-supporting.\" \"", "Now, isn't it true that in heart transplant cases it's legal to take someone's heart if they can only be kept alive by the use of respirators and other medical hardware?\" \"", "There also has to be no brain activity at all.\" \" ", "Yours is certainly working, Mr. Harrison.\" \" ", "Certainly working and certainly sanely.\" \" ", "That's what we're here to decide.\" \" ", "Your Honor I am not asking anyone to kill me.\" \"", "I'm only asking to be discharged from this hospital.\" \" ", "Which will kill you.\" \" ", "And that's exactly my point.\" \"", "I'll spend the rest of my life in this hospital with everything in it geared just to keeping my brain alive.\" \"", "And I'll never have a possibility whatsoever of being able to direct a good goddamn thing.\" \"", "Now as far as I'm concerned, that's an act of deliberate cruelty.\" \"", "Wouldn't it be more cruel for society to let people die when with some effort it could save them?\" \"", "No, because the cruelty is not a question of saving someone's life or letting them die.\" \"", "The cruelty is that the choice is removed from the person concerned.\" \"", "I would like to be able to decide what happens to my own body.\" \"", "A man who is desperately depressed is not capable of making a reasonable choice.\" \"", "Well, as you said, Your Honor, that is the question to be decided.\" \"", "All right.\" \"", "All right.\" \"", "You tell me.\" \"", "You tell us.\" \"", "You tell me why it is a reasonable choice that you decided to die.\" \" ", "All right.\" \" ", "No.\" \"", "All right.\" \"", "All right.\" \"", "The most important part of my life was my work.\" \"", "And the most valuable asset I had for that was my imagination.\" \"", "Now, it's just too damn bad that my mind wasn't paralyzed along with my body because my mind, which had been my most precious possession has become my enemy, and it tortures me.\" \"", "It tortures me with thoughts of what might've been and what might be to come, and I can feel my mind very slowly breaking up.\" \"", "Now, you take women, for example.\" \"", "I used to...\" \"I used to love what they were and how they thought and how they smelled and...\" \"And now I, I dread it when they come into the room because I loathe the way they make me feel.\" \"", "You know, I am filled with an absolute sense of outrage that you, who have no knowledge of me whatsoever have the power to condemn me to a life of torment because you cannot see the pain.\" \"", "There's no blood, there's no screaming.\" \"", "So you can't see it?\" \"", "Your Honor if you saw a mutilated animal on the side of the road, you'd shoot it.\" \"", "Now, I am only asking for the same mercy that you would show that animal.\" \"", "And I am not asking anyone to commit an act of violence.\" \"", "Just take me somewhere and leave me.\" \"", "And if you don't...\" \"If you don't then you come back here in five years and you see what a piece of work that you've done here today.\" \"", "In hearings for a writ of habeas corpus an immediate decision is mandated but I propose to consider the issues carefully.\" \"", "Therefore, I request everyone to please remain here unless a medical emergency preempts your presence.\" \"", "Marjorie.\" \"", "Yeah, I'm still at the hospital.\" \"", "I wonder if you'd look up something for me.\" \"", "A Florida decision.\" \"", "About two years back.\" \"", "I think it was Saikewicz.\" \"", "You look up the holding and read it to me, please.\" \"", "I'll hold on.\" \"", "See this quarter, man?\" \"", "See the quarter, now?\" \"", "Oh, you don't see it no more, huh?\" \"", "Which hand is the quarter in now?\" \"", "Right hand.\" \"", "He's gonna take the right hand.\" \"", "Will everyone please return to your seats?\" \"", "There are precedents aplenty for both sides of this issue.\" \"", "In re:\" \"Karen Ann Quinlan, the supreme court of New Jersey recognized the preservation of a personal right to privacy against bodily intrusions.\" \"", "In Belchertown v. Saikewicz, the court held that the right to refuse medical treatment in appropriate circumstances extends to both competent and incompetent persons.\" \"", "And the law holds that a deliberate decision to embark on an action which will eventually lead to death is not ipso facto evidence of insanity.\" \"", "If it were, society would have to condemn many men to dishonorable burials rather than posthumous medals.\" \"", "Yet we do have to remember Mr. Harrison's mind is affected and we must, in this case, be careful not to allow Mr. Harrison's intelligence to blind us to the fact that he may be suffering from a depressive illness which would diminish his ability to make an informed decision.\" \"", "We must ignore Mr. Harrison's cogently argued plea to be allowed to die if we believe it to be the product of a disturbed or clinically depressed mind.\" \"", "However I am satisfied that Mr. Harrison's a brave and thoughtful man who is in complete possession of his mental faculties and I therefore order that he be set free.\" \"", "That's it, gentlemen.\" \"", "Peggy, let me get that.\" \"", "Hey you got your hanging judge.\" \"", "I think not.\" \"", "Thank you.\" \"", "Thank you very much, Your Honor.\" \"", "I hope so.\" \"", "Thank you.\" \" ", "Goodbye.\" \" ", "Goodbye.\" \"", "Thank you.\" \"", "Where will you go?\" \"", "I'll get a room somewhere, I suppose.\" \" ", "There's no need.\" \" ", "Don't start it again!\" \"", "You can stay here.\" \"", "We'll stop all treatment, no dialysis.\" \"", "Even stop feeding if you like.\" \"", "You'll be in a coma in a few days.\" \"", "Dead in a week, two at most.\" \"", "But you won't be alone.\" \"", "There'll be very little discomfort.\" \"", "No last-minute attempt at resuscitation?\" \"", "Only if you ask for it.\" \"", "Thank you.\" \"", "It would obviously be easier for me if I stayed.\" \"", "Okay, I'll take care of that.\" \"", "Why are you doing this?\" \"", "Because you might change your mind.\" \"", "Oh, don't.\" \"", "Please.\" \"", "Better not, I think.\" \"", "Okay.\" \"", "Okay.\" \"", "Dr. North, you are wanted in Emergency.\" \"", "Dr. North, you are wanted in Emergency.\" \"", "Dr. Keys, please call Dr. Fairbanks in X-Ray One.\" \"", "Dr. Keys, please call Dr. Fairbanks in X-Ray One.\"" ]

{ "pile_set_name": "OpenSubtitles" }

[ 0.00099384190980345, 0.0008999222191050649, 0.0007273988449014723, 0.0010062054498121142, 0.009940547868609428, 0.019275514408946037, 0.4578014016151428, 0.0007257916731759906, 0.0009593967697583139, 0.585510790348053, 0.0007586852298118174, 0.0015911790542304516, 0.0006741905235685408, 0.00117586855776608, 0.0006160808261483908, 0.001413821941241622, 0.07950450479984283, 0.0007022487698122859, 0.0006834538071416318, 0.0007502299267798662, 0.004866509698331356, 0.0012482604943215847, 0.0006919825682416558, 0.0009696041233837605, 0.0007833876879885793, 0.000634844764135778, 0.0005888590821996331, 0.0006642845110036433, 0.0007833876879885793, 0.0016986331902444363, 0.06385732442140579, 0.0008446971187368035, 0.0012482604943215847, 0.0006612467113882303, 0.0009955210844054818, 0.0007372293621301651, 0.0007566357380710542, 0.0023405111860483885, 0.001042091054841876, 0.0009084744961000979, 0.0005808915011584759, 0.0007141637615859509, 0.000670033332426101, 0.0021195062436163425, 0.0008355582249350846, 0.001184390508569777, 0.0010988006833940744, 0.1719701588153839, 0.0007053749868646264, 0.0009591578273102641, 0.0028070947155356407, 0.0008353107259608805, 0.0007923247176222503, 0.0007884691003710032, 0.17002904415130615, 0.0007574160117655993, 0.0010496610775589943, 0.0006922279135324061, 0.0007585352286696434, 0.012714768759906292, 0.0006350683397613466, 0.1240963563323021, 0.0008068752358667552, 0.0018613515421748161, 0.0007072155131027102, 0.0007591404719278216, 0.000683010381180793, 0.23150289058685303, 0.0008278415771201253, 0.000741889700293541, 0.0006094661075621843, 0.0006094661075621843, 0.0006384708685800433, 0.001800604397431016, 0.0006094495765864849, 0.027713576331734657, 0.03487807884812355, 0.0008094014483503997, 0.000754915876314044, 0.0013303314335644245, 0.0010038834298029542, 0.09974707663059235, 0.5286430716514587, 0.025488389655947685, 0.018536942079663277, 0.16779017448425293, 0.0009248832939192653, 0.0014984323643147945, 0.007182098925113678, 0.9743039608001709, 0.0040711467154324055, 0.000559067411813885, 0.0006534149870276451, 0.0005597085109911859, 0.19027669727802277, 0.0006263726972974837, 0.0009448602795600891, 0.0007149261073209345, 0.00290792528539896, 0.0005866773426532745, 0.0006152302375994623, 0.0006062915199436247, 0.0006879396387375891, 0.000731741776689887, 0.000731741776689887, 0.0006690006703138351, 0.0007132659666240215, 0.0008013784536160529, 0.0012388043105602264, 0.0006167948595248163, 0.0007965606055222452, 0.0006614931626245379, 0.0007952076266519725, 0.030639156699180603, 0.0009777662344276905, 0.006486228667199612, 0.0007013725116848946, 0.0008245005737990141, 0.0007833876879885793, 0.0007043257355690002, 0.002873825840651989, 0.0006919825682416558, 0.0008079489343799651, 0.0006601369241252542, 0.0005938988761045039, 0.0005938988761045039, 0.0006587670650333166, 0.022417496889829636, 0.0008224945049732924, 0.6728807091712952, 0.004931220784783363, 0.0007432561833411455, 0.059415027499198914, 0.0010496610775589943, 0.0024129992816597223, 0.13595274090766907, 0.0007026959210634232, 0.0005656324792653322, 0.01309973280876875, 0.0006120821926742792, 0.0008061600383371115, 0.0006136511219665408, 0.0009202604996971786, 0.021810995414853096, 0.0008150335634127259, 0.0016410695388913155, 0.001009761937893927, 0.0006791554624214768, 0.0008441177778877318, 0.09523990005254745, 0.0019492238061502576, 0.030973339453339577, 0.0005376014159992337, 0.07741184532642365, 0.03647845983505249, 0.0007291912334039807, 0.0008507519960403442, 0.003906747326254845, 0.6616869568824768, 0.000751843152102083, 0.0006601369241252542, 0.0006753834895789623, 0.02618854120373726, 0.004661010578274727, 0.007777341175824404, 0.0006931418902240694, 0.0005980905261822045, 0.015272188931703568, 0.0007662267307750881, 0.0008397682686336339, 0.0008356805192306638, 0.0008690819959156215, 0.0006120821926742792, 0.0011189928045496345, 0.059868551790714264, 0.0007211306947283447, 0.0011444728588685393, 0.868147075176239, 0.027775108814239502, 0.0007711024954915047, 0.10449336469173431, 0.0019096650648862123, 0.0006550867110490799, 0.0008307232055813074, 0.0009356607333756983, 0.0014804820530116558, 0.19297510385513306, 0.001725385314784944, 0.000731741776689887, 0.0022206592839211226, 0.0007378650479950011, 0.0015659224009141326, 0.0012255919864401221, 0.0016445998335257173, 0.0007662306888960302, 0.000785256561357528, 0.0010279160924255848, 0.0007879407494328916, 0.0006867798510938883, 0.0012217748444527388, 0.0007601517718285322, 0.0007601517718285322, 0.0006004997994750738, 0.0006110169924795628, 0.0008642976754345, 0.0006919825682416558, 0.0007402650080621243, 0.0008010737947188318, 0.0013766263145953417, 0.0008650433155708015, 0.0009528759983368218, 0.0009000061545521021, 0.0013709657359868288, 0.0016482318751513958, 0.0009217184851877391, 0.0009951356332749128, 0.0006859576678834856, 0.0009071247186511755, 0.019325731322169304, 0.0011523053981363773, 0.0007539992802776396, 0.0009489973890595138, 0.0007317410781979561, 0.004637338221073151, 0.0011523053981363773, 0.0009489973890595138, 0.0008262076298706234, 0.0009489973890595138, 0.0005571157089434564, 0.000932785274926573, 0.004130702465772629, 0.0006258460343815386, 0.0005881618126295507, 0.02467365562915802, 0.000552449724636972, 0.0029532024636864662, 0.0033218690659850836, 0.0019078245386481285, 0.0015769476303830743, 0.0005785010289400816, 0.0010483075166121125, 0.000784544856287539, 0.0010483075166121125, 0.0006614931626245379, 0.0006431337096728384, 0.004349975381046534, 0.030934220179915428, 0.0006833277875557542, 0.009630677290260792, 0.001109786331653595, 0.0006545069627463818, 0.0015337747754529119, 0.001432268531061709, 0.000713490997441113, 0.0020203948952257633, 0.0013495845487341285, 0.0008309214608743787, 0.2196657508611679, 0.0012738226214423776, 0.0006329411407932639, 0.003808475797995925, 0.19405344128608704, 0.03802696242928505, 0.09793931990861893, 0.978444516658783, 0.018595412373542786, 0.0008436859352514148, 0.0007238058606162667, 0.0006456246483139694, 0.0006510087987408042, 0.000961263373028487, 0.0046985638327896595, 0.0007326800259761512, 0.019630469381809235, 0.0009554236312396824, 0.000652971095405519, 0.0006353844073601067, 0.013652731664478779, 0.5742784142494202, 0.0006553180865012109, 0.009676584042608738, 0.000690011540427804, 0.018860993906855583, 0.0008681017206981778, 0.00540321646258235, 0.0007191744516603649, 0.0076665752567350864, 0.009558677673339844, 0.000644021260086447, 0.0007463535876013339, 0.000657321885228157, 0.0005779755301773548, 0.000609417911618948, 0.0006609102711081505, 0.0008011066820472479, 0.0007157185464166105, 0.0006020863656885922, 0.001002851058728993, 0.0005643753102049232, 0.001567166531458497, 0.0012055897386744618, 0.0016202704282477498, 0.008708938956260681, 0.0008341700886376202, 0.0008341700886376202, 0.0021647389512509108, 0.0008821089868433774, 0.000661198515444994, 0.0010255386587232351, 0.10306324809789658, 0.000654884148389101, 0.0005571157089434564, 0.0006187594262883067, 0.0008612284436821938, 0.0037419951986521482, 0.00060106604360044, 0.0008750390261411667, 0.0007150811143219471, 0.000634284398984164, 0.0005845050327479839, 0.0006668313289992511, 0.0008161164587363601, 0.0006859576678834856, 0.008296272717416286, 0.0006073921686038375, 0.0008098500547930598, 0.000690807995852083, 0.003439849242568016, 0.0010324193863198161, 0.0017627388006076217, 0.0006859576678834856, 0.0005571157089434564, 0.0008642552420496941, 0.0006963314954191446, 0.0007561550009995699, 0.0006086467765271664, 0.0007599725504405797, 0.0008919829269871116, 0.0009310449240729213, 0.0006194175803102553, 0.0009779870742931962, 0.000675393152050674, 0.0034384094178676605, 0.0007849726243875921, 0.0005822898237966001, 0.003421549219638109, 0.0006600815686397254, 0.0007168636657297611, 0.019034376367926598, 0.0009935289854183793, 0.0007077744812704623, 0.0006344358553178608, 0.0008431921014562249, 0.0006900904700160027, 0.09721788018941879, 0.0007832824485376477, 0.0009556325967423618, 0.0014913694467395544, 0.000699492811691016, 0.0008531025378033519, 0.0007263386505655944, 0.0022146652918308973, 0.041456438601017, 0.0007530751172453165, 0.0348726361989975, 0.10842741280794144, 0.0007579521043226123, 0.006737049203366041, 0.002329315524548292, 0.0018517263233661652, 0.1817122995853424, 0.009064005687832832, 0.008153991773724556, 0.9743039608001709, 0.000721231393981725, 0.0005949980113655329, 0.0008883227710612118, 0.0009040380246005952, 0.0006369095062837005, 0.000731741776689887, 0.15241894125938416, 0.000776318134739995, 0.0007660379633307457, 0.0006768722669221461, 0.0007660379633307457, 0.000769348640460521, 0.0007646740996278822, 0.000769348640460521, 0.0007585236453451216, 0.0007660379633307457, 0.0007700275164097548, 0.0005707118543796241, 0.01611223816871643, 0.0008058409439399838, 0.0009038876742124557, 0.0010429616086184978, 0.9296174049377441, 0.0006722756079398096, 0.0017810116987675428, 0.0007953232270665467, 0.0006722756079398096, 0.0011873652692884207, 0.002560030436143279, 0.03957367688417435, 0.03355225548148155, 0.004661010578274727, 0.0007372160325758159, 0.004661010578274727, 0.0008867468568496406, 0.0007908642874099314, 0.001377728651277721, 0.0018125104252249002, 0.0018125104252249002, 0.0006933301337994635, 0.024559786543250084, 0.002059287391602993, 0.0008479776442982256, 0.024559786543250084, 0.0006933301337994635, 0.0024689186830073595, 0.0010007246164605021, 0.0008479776442982256, 0.001008865307085216, 0.0007993318722583354, 0.0007662306888960302, 0.22822800278663635, 0.001251169596798718, 0.0006731597241014242, 0.00246816361322999, 0.00973062589764595, 0.0007414246210828424, 0.47265690565109253, 0.0221474040299654, 0.0006880501750856638, 0.0030312081798911095, 0.001160058774985373, 0.001160058774985373, 0.0009755195933394134, 0.0017448614817112684, 0.0007191744516603649, 0.8540607690811157, 0.0010037238243967295, 0.0007091055740602314, 0.0007014097063802183, 0.3701559007167816, 0.010680761188268661, 0.0007463844958692789, 0.007381272502243519, 0.0006223464733920991, 0.0007287650369107723, 0.0007480732165277004, 0.06008758023381233, 0.0007869074470363557, 0.0007869074470363557, 0.0007081232615746558, 0.0018613515421748161, 0.0024258336052298546, 0.0008441177778877318, 0.0009715737542137504, 0.0007736959960311651, 0.002395954681560397, 0.0008307232055813074, 0.0011986237950623035, 0.0007403651834465563, 0.0024752060417085886, 0.0006061054882593453, 0.29998117685317993, 0.0007718651904724538, 0.0007718651904724538, 0.00805832352489233, 0.0008441177778877318, 0.0008375945617444813, 0.0007153162732720375, 0.0007061608484946191, 0.0019099757773801684, 0.0005931201740168035, 0.0006356809171847999, 0.0013592784525826573, 0.0013972984161227942, 0.0006290384917519987, 0.000606884656008333, 0.0006221543299034238, 0.0007234190125018358, 0.0006859576678834856, 0.0006919825682416558, 0.0007713226368650794, 0.1024080142378807, 0.0009522956097498536, 0.0006278255605138838, 0.0008307232055813074, 0.0007265266613103449, 0.0007570782327093184, 0.07320339977741241, 0.4601743817329407, 0.0005930507322773337, 0.0007668486796319485, 0.0011871113674715161, 0.0006391630740836263, 0.0012319302186369896, 0.0007016232120804489, 0.0007039180491119623, 0.0006064501358196139, 0.0007901667268015444, 0.0005653066909871995, 0.0017211223021149635, 0.0008441177778877318, 0.0007906291866675019, 0.0008441177778877318, 0.0011118350084871054, 0.0008441177778877318, 0.0005571157089434564, 0.0009664660319685936, 0.0012142405612394214, 0.0005775226163677871, 0.0008085527224466205, 0.0008067222079262137, 0.0009950990788638592, 0.0005560978897847235, 0.0006974356365390122, 0.0008383930544368923, 0.027739861980080605, 0.0008620264125056565, 0.0006474238471128047, 0.000727666774764657, 0.000649853958748281, 0.004180558491498232, 0.0007773218676447868, 0.0006991365808062255, 0.0007750482764095068, 0.001468898612074554, 0.0031637148931622505, 0.0010720917489379644, 0.0006501838797703385, 0.0006207029218785465, 0.0006662150844931602, 0.0007734903483651578, 0.0006919825682416558, 0.9036056995391846, 0.0005340304924175143, 0.0035368287935853004, 0.000971485860645771, 0.0010818224400281906, 0.0007075316971167922, 0.0009161595371551812, 0.0008333378937095404, 0.000793546496424824, 0.0008594994433224201, 0.0007149261073209345, 0.01898558996617794, 0.0006980797043070197, 0.0006255306070670485, 0.000797888555098325, 0.0006284925038926303, 0.0007508700946345925, 0.0006744269630871713, 0.0006684535183012486, 0.000987621140666306, 0.0005561797297559679, 0.0008111483766697347, 0.0008111483766697347, 0.0009372641798108816, 0.012458831071853638, 0.006751531735062599, 0.0011172950034961104, 0.0108707956969738, 0.0009556325967423618, 0.001214482355862856, 0.0009755195933394134, 0.0005864484119229019, 0.0005778491031378508, 0.004192053806036711, 0.002425111597403884, 0.0009556325967423618, 0.0005972246290184557, 0.0006834069499745965, 0.026703761890530586, 0.0006344104185700417, 0.0009252536110579967, 0.2748067080974579, 0.001423814450390637, 0.041268762201070786, 0.0007229369948618114, 0.0012047372292727232, 0.0007029068656265736, 0.0008367262198589742, 0.0007149261073209345, 0.0006114770076237619, 0.0006345449946820736, 0.0006095097051002085, 0.08723095059394836, 0.0017085366416722536, 0.0033023233991116285, 0.0006339185056276619, 0.0006345449946820736, 0.0006607336108572781, 0.008681071922183037, 0.0006919825682416558, 0.0006859576678834856, 0.9687854051589966, 0.08062287420034409, 0.0014559722039848566, 0.0005956621607765555, 0.0008139678975567222, 0.0005636003916151822, 0.0005500170518644154, 0.007838343270123005, 0.000690011540427804, 0.000570414646063, 0.0008612284436821938, 0.0008011776953935623, 0.0009492610115557909, 0.0006463926983997226, 0.0006836303509771824, 0.0006871952791698277, 0.0018350047757849097, 0.0006166576058603823, 0.0006329212337732315, 0.0006329212337732315, 0.0006906546768732369, 0.002993217436596751, 0.029371244832873344, 0.0009177584433928132, 0.0009297680226154625, 0.0007137120119296014, 0.015700407326221466, 0.0007113930187188089, 0.002455831039696932, 0.0006907902425155044, 0.0009556325967423618, 0.6280557513237, 0.0010321022709831595, 0.0008441177778877318, 0.0006526457727886736, 0.0006241549272090197, 0.9959467053413391, 0.9939946532249451, 0.0006756586953997612, 0.0006489352090284228, 0.04536798596382141, 0.8861316442489624, 0.8531540036201477, 0.0019722371362149715, 0.0008280155598185956, 0.0044239358976483345, 0.0009286679560318589, 0.000712903740350157, 0.001269387430511415, 0.0010897949105128646, 0.004350156988948584, 0.0013770097866654396, 0.01896393485367298, 0.0006213928572833538, 0.0010729939676821232, 0.001456051249988377, 0.0008665471686981618, 0.0010207847226411104, 0.0005851804162375629, 0.0007917514885775745, 0.0006012995727360249, 0.0008854623301886022, 0.0009489973890595138, 0.009132460691034794, 0.000858575280290097, 0.0007157959626056254, 0.012237556278705597, 0.0009636154281906784, 0.025391889736056328, 0.0012298960937187076, 0.0007609730237163603, 0.0007540344377048314, 0.0007149261073209345, 0.0006120821926742792, 0.0026472429744899273, 0.0006974356365390122, 0.0007145548588596284, 0.0005785834509879351, 0.0006110169924795628, 0.018563566729426384, 0.001261529396288097, 0.0007868039538152516, 0.001593047403730452, 0.0005830409354530275, 0.06101595237851143, 0.0007771126693114638, 0.0006303690024651587, 0.0008061600383371115, 0.05238010361790657, 0.0007049210835248232, 0.0006737695075571537, 0.0006851187208667397, 0.000835596933029592, 0.0006252021994441748, 0.0009743351838551462, 0.0006624902598559856, 0.000569706957321614, 0.0005586494808085263, 0.0008640456944704056, 0.0012429689522832632, 0.03208603709936142, 0.0005863038823008537, 0.000731741776689887, 0.0008579325512982905, 0.0008357896003872156, 0.02787935547530651, 0.0006664450047537684, 0.0006974356365390122, 0.0007477517938241363, 0.0008458250667899847, 0.0008010737947188318, 0.014202730730175972, 0.000983583857305348, 0.0005971782957203686, 0.0006433718954212964, 0.0006640740903094411, 0.000755214539822191, 0.0005670581012964249, 0.0014300082111731172, 0.0006120054749771953, 0.4238021671772003, 0.007669905666261911, 0.0010011466220021248, 0.0008441177778877318, 0.0009556325967423618, 0.0006822342984378338, 0.0006640740903094411, 0.005288565531373024, 0.004665339831262827, 0.0008411165326833725, 0.0008544160518795252, 0.006612927187234163, 0.0008724232320673764, 0.0007214530487544835, 0.0006980347679927945, 0.006053945980966091, 0.01360505260527134, 0.17027117311954498, 0.000756401102989912, 0.0897582471370697, 0.13626046478748322, 0.0013018870959058404, 0.010182400234043598, 0.16785410046577454, 0.0016193806659430265, 0.003905719146132469, 0.30890050530433655, 0.000931172224227339, 0.0008552508661523461, 0.0009504922782070935, 0.0009415519307367504, 0.01051416341215372, 0.0007919355412013829, 0.07708363234996796, 0.004192053806036711, 0.9772088527679443, 0.020958492532372475, 0.0007160003879107535, 0.0005571157089434564, 0.0015680642100051045, 0.0008864242117851973, 0.0008864242117851973, 0.0008813814492896199, 0.004192053806036711, 0.0008547791512683034, 0.004661010578274727, 0.0008770252461545169, 0.0008482172852382064, 0.0021760095842182636, 0.0010341120650991797, 0.001072852872312069, 0.030499132350087166, 0.9702746272087097, 0.0006257082568481565, 0.012174292467534542, 0.0006530741229653358, 0.0009932223474606872, 0.20284825563430786, 0.08263487368822098, 0.0010643820278346539, 0.0006805604207329452, 0.0007726519834250212, 0.0024065144825726748, 0.0005475267535075545, 0.001930509926751256, 0.000717130140401423, 0.0009336909861303866, 0.0005927255260758102, 0.0005588342901319265, 0.0007176648359745741, 0.0012485940242186189, 0.0007723044836893678, 0.04880489781498909, 0.0007861407357268035, 0.001570599153637886, 0.0007532441522926092, 0.000961263373028487, 0.0061068166978657246, 0.000838125532027334, 0.001108837896026671, 0.0015664473176002502, 0.0009871107758954167, 0.0006601369241252542, 0.02340102568268776, 0.0005836596828885376, 0.0014092641649767756, 0.0008003253024071455, 0.0008373938617296517, 0.0007149261073209345, 0.0010228242026641965, 0.0006411768263205886, 0.0006004267488606274, 0.3013682961463928, 0.0014722882770001888, 0.0007118976209312677, 0.0010718655539676547, 0.0008232660475187004, 0.000961263373028487, 0.000970186316408217, 0.0006809209007769823, 0.000862345565110445, 0.003001963021233678, 0.0006624902598559856, 0.001137459184974432, 0.0006401284481398761, 0.0007994022453203797, 0.0005965926102362573, 0.059394754469394684, 0.0008909132448025048, 0.0005769965937361121, 0.015880072489380836, 0.0007591480971314013, 0.0012076918501406908, 0.0008983826264739037, 0.0006486640777438879, 0.0008307232055813074, 0.001082145026884973, 0.0006345449946820736, 0.0006978109595365822, 0.0008363759843632579, 0.0007255828240886331, 0.0019443923374637961, 0.0009556325967423618, 0.0006722563994117081, 0.0007707480108365417, 0.0010218083625659347, 0.0007949909195303917, 0.006593053694814444, 0.0007022901554591954, 0.00415235199034214, 0.0010576058411970735, 0.001058175228536129, 0.0008126217289827764, 0.0010323008755221963, 0.0007417843444272876, 0.049993421882390976, 0.0025983303785324097, 0.002039545914158225, 0.000765081902500242, 0.0006371165509335697, 0.000712903740350157, 0.000712903740350157, 0.005208244081586599, 0.0009487546049058437, 0.000868466158863157, 0.001062861643731594, 0.0008960210834629834, 0.0006275991909205914, 0.7658111453056335, 0.0006237288471311331, 0.0011159100104123354, 0.0007410061662085354, 0.0005742924986407161, 0.0006917985738255084, 0.0007556763594038785, 0.0009720177040435374, 0.0009032032103277743, 0.0006358214886859059, 0.0006572746206074953, 0.0008297354797832668, 0.0011837347410619259, 0.0007944699609652162, 0.0007149261073209345, 0.0006577991298399866, 0.0006082048639655113, 0.000787957280408591, 0.019991807639598846, 0.0006919825682416558, 0.0008470111060887575, 0.0006654095486737788, 0.0006068063084967434, 0.9805024266242981, 0.0007207954186014831, 0.0005788736161775887, 0.005730675999075174, 0.000786531891208142, 0.11312288045883179, 0.12002380937337875, 0.001003241864964366, 0.0030484276358038187, 0.0266936793923378, 0.8752278089523315, 0.0010690183844417334, 0.0006179796764627099, 0.001096630236133933, 0.34404486417770386, 0.0007315643597394228, 0.00470114266499877, 0.0007025706581771374, 0.008316772989928722, 0.000961263373028487, 0.0006722756079398096, 0.0006722756079398096, 0.0005882999976165593, 0.000961263373028487, 0.001104456139728427, 0.0007308688946068287, 0.0006722756079398096, 0.000822877453174442, 0.0006483169854618609, 0.04789212718605995, 0.001576852286234498, 0.000694257440045476, 0.26313307881355286, 0.0006841374561190605, 0.22774207592010498, 0.9308423399925232, 0.0089187016710639, 0.0011881974060088396, 0.03965330123901367, 0.0007444321527145803, 0.07679104059934616, 0.0008081652340479195, 0.8634690642356873, 0.0006731597241014242, 0.0028070947155356407, 0.0028070947155356407, 0.006091926246881485, 0.006193406414240599, 0.027099350467324257, 0.6247283816337585, 0.027099350467324257, 0.015441006049513817, 0.015441006049513817, 0.0006630689022131264, 0.0006330801988951862, 0.0006483169854618609, 0.0007072078296914697, 0.0006483169854618609, 0.0006706971907988191, 0.0007590905879624188, 0.0007849999237805605, 0.0006919825682416558, 0.0006919825682416558, 0.0006506816716864705, 0.0007833876879885793, 0.0007149261073209345, 0.0005789463757537305, 0.09885277599096298, 0.11191960424184799, 0.6168842315673828, 0.0009413675870746374, 0.0008247437654063106, 0.0006318649393506348, 0.0007149261073209345, 0.0007513045566156507, 0.0007070868741720915, 0.0070743379183113575, 0.00073791149770841, 0.0007149261073209345, 0.0006731597241014242, 0.09478799998760223, 0.0007556587224826217, 0.000762445037253201, 0.000689437729306519, 0.0008145118481479585, 0.000654260569717735, 0.0006197550683282316, 0.0007461163913831115, 0.0026896935887634754, 0.0008095892844721675, 0.0005836052005179226, 0.000731741776689887, 0.000962599937338382, 0.0008126228931359947, 0.0007414051797240973, 0.000554489204660058, 0.12082882970571518, 0.0007149261073209345, 0.0006112669361755252, 0.0020706208888441324, 0.0068060774356126785, 0.0006731597241014242, 0.0005748633993789554, 0.0006171789136715233, 0.0015316351782530546, 0.0021402041893452406, 0.0026728303637355566, 0.7657091021537781, 0.0007303289603441954, 0.7831863760948181, 0.0016646594740450382, 0.0009252536110579967, 0.20382268726825714, 0.0008441177778877318, 0.0007598193478770554, 0.0008522490970790386, 0.9117536544799805, 0.0007149261073209345, 0.005709417164325714, 0.002372818300500512, 0.0006398212863132358, 0.014673951081931591, 0.0007187537266872823, 0.0009252536110579967, 0.06517086178064346, 0.000669565168209374, 0.01848938688635826, 0.0008441177778877318, 0.0009776237420737743, 0.0011299254838377237, 0.0008090432966127992, 0.0007251604693010449, 0.0007787565118633211, 0.000675722723826766, 0.0006859576678834856, 0.0030600938480347395, 0.0005788736161775887, 0.0006814905791543424, 0.0007149261073209345, 0.000680978293530643, 0.0011159739224240184, 0.0008099214755930007, 0.0024322348181158304, 0.5933173298835754, 0.009594560600817204, 0.38496601581573486, 0.0007197987288236618, 0.0027995144482702017, 0.3138222098350525, 0.0008441177778877318, 0.7796719074249268, 0.0008247566875070333, 0.355475515127182, 0.0019130791770294309, 0.0006737778312526643, 0.0008884574053809047, 0.03406039997935295, 0.000671818561386317, 0.0009224222740158439, 0.0006228460697457194, 0.000614645890891552, 0.0008441177778877318, 0.000712903740350157, 0.008899245411157608, 0.0009252536110579967, 0.002485437085852027, 0.0008433969924226403, 0.06450590491294861, 0.0045381104573607445, 0.008829355239868164, 0.0012458338169381022, 0.0007308511412702501, 0.0007439758046530187, 0.0006375432712957263, 0.0006837678956799209, 0.0007149261073209345, 0.7988255023956299, 0.0005556764081120491, 0.0009489973890595138, 0.0009489973890595138, 0.0008637221762910485, 0.0028070947155356407, 0.0006345449946820736, 0.024172283709049225, 0.0007790813688188791, 0.0005971447099000216, 0.0010526517871767282, 0.0007676226086914539, 0.001141029759310186, 0.0006566885276697576, 0.001055468455888331, 0.0014364996459335089, 0.967488706111908, 0.0007932864245958626, 0.0006045370828360319, 0.0010156003991141915, 0.0008839899091981351, 0.0005571157089434564, 0.001042314455844462, 0.0006919825682416558, 0.0006289817974902689, 0.0015674222959205508, 0.0008441177778877318, 0.0006702837999910116, 0.0006469643558375537, 0.0008441177778877318, 0.0007216734811663628, 0.0006614194135181606, 0.0005571157089434564, 0.0006731597241014242, 0.0006176832248456776, 0.0006731597241014242, 0.7452361583709717, 0.0007150684832595289, 0.0005945212906226516, 0.01806146465241909, 0.0017743626376613975, 0.0008441177778877318, 0.0016885726945474744, 0.001100746332667768, 0.001973790116608143, 0.01898391917347908, 0.0006215788307599723, 0.0765543282032013, 0.000992747489362955, 0.0005932655767537653, 0.0006215690518729389, 0.0007017055177129805, 0.6469810605049133, 0.6525354981422424, 0.0006457738927565515, 0.0006609682459384203, 0.0007555938791483641, 0.0009793008212000132, 0.0006459037540480494, 0.0009918559808284044, 0.0007149261073209345, 0.02554943785071373, 0.005713140591979027, 0.001869255444034934, 0.0008357876213267446, 0.000858926388900727, 0.002224370837211609, 0.0013266474707052112, 0.000659522193018347, 0.0012255137553438544, 0.010541144758462906, 0.004661010578274727, 0.0010928711853921413, 0.000733829103410244, 0.0006981372134760022, 0.0007216579397208989, 0.0008888765587471426, 0.0006859576678834856, 0.0019041735213249922, 0.0006981372134760022, 0.0007149261073209345, 0.0007404502248391509, 0.0007483320659957826, 0.0007149261073209345, 0.0006650085560977459, 0.000638593512121588, 0.0005870014429092407, 0.0008180279401130974, 0.7557345628738403, 0.0008441177778877318, 0.0005585770704783499, 0.0005979799316264689, 0.0006824774900451303, 0.0005979294655844569, 0.04235238581895828, 0.03148752450942993, 0.036252789199352264, 0.0005619547446258366, 0.0015771616017445922, 0.002285235095769167, 0.0006090332171879709, 0.0009176041348837316, 0.0006082956097088754, 0.000817200168967247, 0.0008394630276598036, 0.0010751171503216028, 0.0006110169924795628, 0.0015090469969436526, 0.0008764108060859144, 0.0008024697308428586, 0.013277791440486908, 0.0010421491460874677, 0.0008441177778877318, 0.0009556325967423618, 0.0013789139920845628, 0.3687838017940521, 0.0012266160920262337, 0.0006280329544097185, 0.0007729303324595094, 0.0006021095905452967, 0.0007883996004238725, 0.016093773767352104, 0.02817033976316452, 0.0006550077232532203, 0.0008184247999452055, 0.010731608606874943, 0.054500143975019455, 0.0007761155138723552, 0.0005326203536242247, 0.000688395812176168, 0.0006755443755537271, 0.00054980005370453, 0.033918384462594986, 0.0006662631058134139, 0.0005797686753794551, 0.0028070947155356407, 0.0006269525620155036, 0.0006732806796208024, 0.0006684535183012486, 0.0006744269630871713, 0.0006207961705513299, 0.0007557130302302539, 0.0006976520526222885, 0.000678415410220623, 0.0010975850746035576, 0.0017522565321996808, 0.03872232884168625, 0.000673245987854898, 0.0006079180166125298, 0.0011738411849364638, 0.0005405893898569047, 0.0008010737947188318, 0.0007377304136753082, 0.0006974356365390122, 0.0007557148346677423, 0.0005957593093626201, 0.0005914670182392001, 0.003151701297610998, 0.0005705055082216859, 0.0006410210044123232, 0.000638478493783623, 0.0006703253020532429, 0.0009349077590741217, 0.07291088998317719, 0.3400464355945587, 0.0008267833618447185, 0.0008653417462483048, 0.0007328419596888125, 0.0005719172186218202, 0.0010114391334354877, 0.012429156340658665, 0.0006188927218317986, 0.0009557796875014901, 0.0007662306888960302, 0.023367363959550858, 0.0006139357574284077, 0.0006919825682416558, 0.0009248229907825589, 0.0006558116292580962, 0.0008587729535065591, 0.0011986237950623035, 0.0011040405370295048, 0.0005983319133520126, 0.008615161292254925, 0.12756437063217163, 0.0008934754296205938, 0.0010782439494505525, 0.6994100213050842, 0.0010512883309274912, 0.040897250175476074, 0.0018083957256749272, 0.0007385527133010328, 0.0007967964047566056, 0.0006657575140707195, 0.0006557487649843097, 0.0007217078818939626, 0.0006060682353563607, 0.0007998617948032916, 0.0010334639810025692, 0.019275275990366936, 0.7630878686904907, 0.0005737943574786186, 0.0007611477049067616, 0.0010356554994359612, 0.0015401262789964676, 0.03792840242385864, 0.4465191066265106, 0.19751325249671936, 0.0012428699992597103, 0.0019898279570043087, 0.0005911196349188685, 0.7995638847351074, 0.0006345449946820736, 0.0006944483611732721, 0.9458260536193848, 0.8540799021720886, 0.0013217523228377104, 0.0006208071135915816, 0.0005628212238661945, 0.0006433403468690813, 0.0006859576678834856, 0.0009057468269020319, 0.3255341649055481, 0.0010178597876802087, 0.8503844738006592, 0.0007149261073209345, 0.05944976955652237, 0.0008098353864625096, 0.000712903740350157, 0.01580617018043995, 0.0007506837719120085, 0.0006746141007170081, 0.8576493859291077, 0.0587451346218586, 0.0007168155279941857, 0.0006753220222890377, 0.0007638594252057374, 0.0006983511848375201, 0.04927973076701164, 0.010574539192020893, 0.0028070947155356407, 0.001473764656111598, 0.0020774255972355604, 0.0009738021763041615, 0.04119701683521271, 0.04967743158340454, 0.0009956994326785207, 0.0006632664008066058, 0.004594491794705391, 0.0010125108528882265, 0.0007022751960903406, 0.0007823772029951215, 0.0010209106840193272, 0.0006337541271932423, 0.007583123631775379, 0.0007967964047566056, 0.0007967964047566056, 0.03549947962164879, 0.9972113966941833, 0.0014080333057790995, 0.000884665350895375, 0.016641490161418915, 0.7806961536407471, 0.0014060818357393146, 0.0021901170257478952, 0.0010871916310861707, 0.0010158196091651917, 0.016047846525907516, 0.0007833876879885793, 0.0005406136042438447, 0.0005754209123551846, 0.0006981372134760022, 0.0007149261073209345, 0.0006773023051209748, 0.0011130552738904953, 0.0016182285035029054, 0.0006148723769001663, 0.0008090752526186407, 0.05872206762433052, 0.001853343565016985, 0.0016469242982566357, 0.0008265190990641713, 0.001853343565016985, 0.0013043240178376436, 0.0006286854622885585, 0.0007249756599776447, 0.0009256881894543767, 0.0008428330183960497, 0.0013210606994107366, 0.000634718278888613, 0.0006376851815730333, 0.0012513406109064817, 0.0009256881894543767, 0.4248289465904236, 0.1904304474592209, 0.0031438847072422504, 0.5592257976531982, 0.001042132847942412, 0.0008404599502682686, 0.001066210214048624, 0.0015557374572381377, 0.0006990799447521567, 0.0007233331562019885, 0.0011176755651831627, 0.008762050420045853, 0.0008638814906589687, 0.0006598051404580474, 0.012000750750303268, 0.014026393182575703, 0.0009340218384750187, 0.0016173581825569272, 0.0006832883809693158, 0.0007118976209312677, 0.002382251899689436, 0.0007938267081044614, 0.08490798622369766, 0.0008861556416377425, 0.0006894138059578836, 0.0032228475902229548, 0.0006919825682416558, 0.0006735415081493556, 0.0010446511441841722, 0.000554554455447942, 0.0069631063379347324, 0.0023058250080794096, 0.0007031859131529927, 0.0006958250305615366, 0.008389865979552269, 0.001432268531061709, 0.0016991881420835853, 0.0006118912133388221, 0.000917786848731339, 0.0006559610483236611, 0.08936554938554764, 0.0009831814095377922, 0.0007328419596888125, 0.0007967049023136497, 0.0007047342951409519, 0.0006956297438591719, 0.0006020686123520136, 0.12901820242404938, 0.0006192113505676389, 0.000684893224388361, 0.0005070574698038399, 0.000603215885348618, 0.0008637711871415377, 0.568920910358429, 0.057928722351789474, 0.13173995912075043, 0.0005844535189680755, 0.0009306304273195565, 0.0007137120119296014, 0.0006489722873084247, 0.0009495115373283625, 0.0007855293224565685, 0.0008864816627465189, 0.0008992038783617318, 0.0030545464251190424, 0.0008126217289827764, 0.000712903740350157, 0.0009464022587053478, 0.000731408188585192, 0.5425839424133301, 0.03330794721841812, 0.001911194296553731, 0.09491968899965286, 0.0014060161774978042, 0.0009888149797916412, 0.0008441177778877318, 0.0008441177778877318, 0.0006023098831064999, 0.0008195379632525146, 0.0013549679424613714, 0.0007248591864481568, 0.0006736856303177774, 0.0007630374166183174, 0.0010570493759587407, 0.0006146629457361996, 0.0007022735080681741, 0.0006498899310827255, 0.06769562512636185, 0.9553388953208923, 0.0011823311215266585, 0.02410385198891163, 0.0007874655420891941, 0.0008287323289550841, 0.0010157538345083594, 0.0007764091133140028, 0.0017713853158056736, 0.0016166593413800001, 0.0009914921829476953, 0.0007818971644155681, 0.17779541015625, 0.00841571856290102, 0.0007577116484753788, 0.001737968879751861, 0.0008158229757100344, 0.004661010578274727, 0.0007577116484753788, 0.000731741776689887, 0.000731741776689887, 0.000693444162607193, 0.0006403496372513473, 0.000640866463072598, 0.0006859246641397476, 0.0007091360166668892, 0.0007118206121958792, 0.0005758258048444986, 0.0005913103232160211, 0.0006974356365390122, 0.0008036155486479402, 0.0022138634230941534, 0.0005571157089434564, 0.0005505619919858873, 0.0010012983111664653, 0.0008307232055813074, 0.001308803795836866, 0.0006294444901868701, 0.0005036845104768872, 0.001072388025932014, 0.0010554046602919698, 0.0008294049766846001, 0.0008293410064652562, 0.0006337170489132404, 0.0006423916202038527, 0.000563478737603873, 0.0010823496850207448, 0.0006500169401988387, 0.0007883428479544818, 0.0014618294080719352, 0.0015457718400284648, 0.0007683171425014734, 0.0005630393279716372, 0.007292414084076881, 0.0008098353864625096, 0.009561806917190552, 0.0013432282721623778, 0.0013266640016809106, 0.0009784605354070663, 0.0023445060942322016, 0.0006316003855317831, 0.0006672095623798668, 0.0009971846593543887, 0.0010871507693082094, 0.0007291644578799605, 0.0005429848097264767, 0.0010352407116442919, 0.0006776819936931133, 0.0007695011445321143, 0.0007811684045009315, 0.02978208288550377, 0.6993957161903381, 0.0008300351328216493, 0.0008282831404358149, 0.08724425733089447, 0.0008528311154805124, 0.0011396479094401002, 0.0507500134408474, 0.21104449033737183, 0.8320018649101257, 0.0030579722952097654, 0.017371758818626404, 0.000673178001306951, 0.0006949747330509126, 0.9430533647537231, 0.07137737423181534, 0.9488607048988342, 0.0006525689968839288, 0.0008170171640813351, 0.19607646763324738, 0.025727760046720505, 0.000620612467173487, 0.0024278643541038036, 0.0006210266728885472, 0.07765639573335648, 0.004030559211969376, 0.001457961741834879, 0.0008904086425900459, 0.5182443857192993, 0.001090125530026853, 0.0006438117125071585, 0.12423259019851685, 0.04400007426738739, 0.0007183312554843724, 0.0007183312554843724, 0.0008838531794026494, 0.0006236034678295255, 0.0006065741763450205, 0.00090466917026788, 0.0009571447735652328, 0.0008127944311127067, 0.0008918266976252198, 0.0007502299267798662, 0.009652145206928253, 0.0006535517168231308, 0.0007662306888960302, 0.0006640393403358757, 0.005972367245703936, 0.0009546516230329871, 0.0011247016955167055, 0.0007403651834465563, 0.0017324051586911082, 0.0008441177778877318, 0.0006488992949016392, 0.0005749617703258991, 0.0006013072561472654, 0.0007971776649355888, 0.0008441177778877318, 0.0006263959803618491, 0.000687016814481467, 0.0006702799000777304, 0.0006359884282574058, 0.0006381335551850498, 0.0005556764081120491, 0.0010639415122568607, 0.0008167128544300795, 0.0006363585707731545, 0.0013428303645923734, 0.0007091879961080849, 0.0005644424818456173, 0.0007704271702095866, 0.0006881554145365953, 0.7873203158378601, 0.000664835621137172, 0.0007421491900458932, 0.12555034458637238, 0.0007421491900458932, 0.0008341177017427981, 0.0007593749323859811, 0.005626179277896881, 0.0006356402882374823, 0.0009252536110579967, 0.0011652263347059488, 0.0008441177778877318, 0.0008404903928749263, 0.0012333884369581938, 0.00105002720374614, 0.0007149261073209345, 0.0006581449415534735, 0.0007636306108906865, 0.0010798712028190494, 0.0008111483766697347, 0.0007662306888960302, 0.0005634843837469816, 0.0008006083662621677, 0.03236640989780426, 0.0005499038961715996, 0.0007294901297427714, 0.0005678602028638124, 0.0005571157089434564, 0.000789803103543818, 0.0007203947170637548, 0.0009256881894543767, 0.002721382537856698, 0.0007329467334784567, 0.029724976047873497, 0.032066263258457184, 0.0007149261073209345, 0.0005993639351800084, 0.0006043002940714359, 0.0005556764081120491, 0.0005719553446397185, 0.0005462405388243496, 0.0006143030477687716, 0.000683121383190155, 0.0009256881894543767, 0.0007992035243660212, 0.9587423205375671, 0.0007107818382792175, 0.0006751681212335825, 0.006713491398841143, 0.000680978293530643, 0.0011444728588685393, 0.0007439999026246369, 0.0011444728588685393, 0.0005943553405813873, 0.0006461127195507288, 0.0006748079904355109, 0.0009803272550925612, 0.0007463969523087144, 0.477105051279068, 0.0008089060429483652, 0.0006683353567495942, 0.0008472766494378448, 0.0007755613187327981, 0.0007153162732720375, 0.0007149261073209345, 0.0007149261073209345, 0.0009094333508983254, 0.0006624902598559856, 0.0007950917351990938, 0.0007967964047566056, 0.005979346577078104, 0.0009628462721593678, 0.0006649341084994376, 0.0008303753565996885, 0.0009108507074415684, 0.0007149261073209345, 0.006030079908668995, 0.0006859576678834856, 0.007785389665514231, 0.0006833281368017197, 0.0006833281368017197, 0.0007950917351990938, 0.0011797138722613454, 0.0007149261073209345, 0.0014598421985283494, 0.0006833281368017197, 0.0006833281368017197, 0.171012744307518, 0.07030866295099258, 0.0007594345952384174, 0.0018153130076825619, 0.0006695389747619629, 0.0007646555313840508, 0.0006993435090407729, 0.0007241491111926734, 0.0006614556186832488, 0.0006919825682416558, 0.0006919825682416558, 0.0008637221762910485, 0.0010587101569399238, 0.0016521911602467299, 0.0008522652206011117, 0.0010587101569399238, 0.000756401102989912, 0.22988513112068176, 0.0012255137553438544, 0.0007741894223727286, 0.0006771697080694139, 0.0008337588515132666, 0.0005965926102362573, 0.0017284646164625883, 0.0007741894223727286, 0.000858084240462631, 0.000756401102989912, 0.8084144592285156, 0.0008410271839238703, 0.0008830718579702079, 0.9766564965248108, 0.003156895050778985, 0.0016017381567507982, 0.0015934433322399855, 0.0015934433322399855, 0.0007709533674642444, 0.0008277316228486598, 0.0009189160773530602, 0.0007084946264512837, 0.000756401102989912, 0.000699344789609313, 0.0008337588515132666, 0.0006857448606751859, 0.010503879748284817, 0.0006133815622888505, 0.0044901445508003235, 0.0006863146554678679, 0.0019622654654085636, 0.004016905557364225, 0.0006338568637147546, 0.0007588760927319527, 0.000834487727843225, 0.0007099149515852332, 0.0008082680869847536, 0.0006729320157319307, 0.0008147198823280632, 0.0006770383333787322, 0.0008259548922069371, 0.0007582801044918597, 0.0035616308450698853, 0.02147163823246956, 0.000756401102989912, 0.003156895050778985, 0.004655381664633751, 0.0010762920137494802, 0.006297531072050333, 0.004655381664633751, 0.0008813814492896199, 0.0029720852617174387, 0.0029720852617174387, 0.009045966900885105, 0.0008105889428406954, 0.0008276937296614051, 0.017997656017541885, 0.02399873547255993, 0.01800631172955036, 0.0008637221762910485, 0.0008032825426198542, 0.07748418301343918, 0.9659312963485718, 0.0012200076598674059, 0.0006919825682416558, 0.0008666319190524518, 0.6824710369110107, 0.003712827805429697, 0.0009183072834275663, 0.0008031352190300822, 0.0007480732165277004, 0.0008057798841036856, 0.0028070947155356407, 0.0007833201088942587, 0.0006152765708975494, 0.0015572862466797233, 0.0007918608607724309, 0.0008457755320705473, 0.0007679525879211724, 0.0036291296128183603, 0.0008285357034765184, 0.5102782845497131, 0.0011236045975238085, 0.0011236045975238085, 0.0007256045937538147, 0.0025848669465631247, 0.0007998716901056468, 0.09895139187574387, 0.0008337588515132666, 0.0006765665602870286, 0.0007872532587498426, 0.0006279434892348945, 0.0006919825682416558, 0.0008714469731785357, 0.006034597288817167, 0.013646440580487251, 0.0008840400842018425, 0.0006723893457092345, 0.0006446547340601683, 0.001164233312010765, 0.025060413405299187, 0.30630218982696533, 0.0007634327048435807, 0.0006731597241014242, 0.0007503722445107996, 0.0009252536110579967, 0.0005974689265713096, 0.0010078379418700933, 0.0008950397605076432, 0.0009556325967423618, 0.00068593182368204, 0.0005509011098183692, 0.0008307232055813074, 0.0005746002425439656, 0.0008177765994332731, 0.0008766166283749044, 0.0006774798966944218, 0.008405959233641624, 0.0012255137553438544, 0.9934224486351013, 0.005895334295928478, 0.000566789589356631, 0.0006527213263325393, 0.21963660418987274, 0.00124579225666821, 0.0007575928466394544, 0.00070544658228755, 0.0008531034109182656, 0.011799684725701809, 0.0006684990366920829, 0.0009860889986157417, 0.001066405326128006, 0.0006823669536970556, 0.000633681716863066, 0.0010751913068816066, 0.0006973322597332299, 0.000597481441218406, 0.0006881554145365953, 0.0006664876127615571, 0.0013188017765060067, 0.0006816425593569875, 0.0007121717790141702, 0.020801391452550888, 0.0006158145843073726, 0.001644811942242086, 0.007949120365083218, 0.005102390423417091, 0.000634844764135778, 0.0009935289854183793, 0.0008285574731417, 0.0008336357423104346, 0.0006151095149107277, 0.05839664489030838, 0.008455331437289715, 0.0039445445872843266, 0.0007733341190032661, 0.0007153162732720375, 0.0006624902598559856, 0.001030329498462379, 0.0007149261073209345, 0.0007486558752134442, 0.0007287487387657166, 0.0011420954251661897, 0.001804294646717608, 0.9771019816398621, 0.000572575256228447, 0.0005571157089434564, 0.000756401102989912, 0.0009131457190960646, 0.0008441177778877318, 0.0005831398302689195, 0.0007074245368130505, 0.0005571157089434564, 0.0006763399578630924, 0.000550824508536607, 0.00067287334240973, 0.0006387151661328971, 0.0006087450892664492, 0.0006232392624951899, 0.0006270285230129957, 0.0006209781276993454, 0.0007267769542522728, 0.0005571157089434564, 0.030925460159778595, 0.0010179431410506368, 0.0007695011445321143, 0.0006169216358102858, 0.000665137602481991, 0.0007073089363984764, 0.0007018403266556561, 0.0010091773001477122, 0.000980967190116644, 0.0008449430461041629, 0.015237806364893913, 0.0006999369361437857, 0.0006905950722284615, 0.0018699539359658957, 0.0006139178876765072, 0.0008441177778877318, 0.0012357161613181233, 0.000763817282859236, 0.003712859470397234, 0.027792343869805336, 0.051092375069856644, 0.14910748600959778, 0.018697097897529602, 0.006675033364444971, 0.0005572877707891166, 0.0008469025488011539, 0.0008548565674573183, 0.0005944645963609219, 0.0013819567393511534, 0.0008441177778877318, 0.0007788066286593676, 0.0006118681048974395, 0.0011013110633939505, 0.0008441177778877318, 0.0011606246698647738, 0.0008441177778877318, 0.000640654528979212, 0.0007267769542522728, 0.000640654528979212, 0.0005572877707891166, 0.0009239941718988121, 0.0006369917537085712, 0.0006164111546240747, 0.0006549094105139375, 0.0009890316287055612, 0.0015595528529956937, 0.000671866990160197, 0.0006731597241014242, 0.0006517668371088803, 0.0006682716775685549, 0.0006038161227479577, 0.0006016426486894488, 0.009408006444573402, 0.0008204479236155748, 0.0015391301130875945, 0.0007323588361032307, 0.0007725731120444834, 0.000640654528979212, 0.0007267769542522728, 0.0009057468269020319, 0.0006925093475729227, 0.0007436610758304596, 0.0006079185986891389, 0.0006544869975186884, 0.0007189356256276369, 0.0006271178717724979, 0.0005547529435716569, 0.0007040029158815742, 0.0006258863140828907, 0.000730224244762212, 0.0005915783694945276, 0.001816426869481802, 0.0008441177778877318, 0.0006052047247067094, 0.9704099893569946, 0.0007676226086914539, 0.0007931060972623527, 0.007907770574092865, 0.0006722756079398096, 0.0005826089764013886, 0.0008469025488011539, 0.0006368433241732419, 0.0006232011946849525, 0.0005718740867450833, 0.0005983103183098137, 0.0006016426486894488, 0.0006236135959625244, 0.000671866990160197, 0.0014110120246186852, 0.009442312642931938, 0.000846406735945493, 0.0007089818827807903, 0.03565867990255356, 0.0019890195690095425, 0.0006932049291208386, 0.0007137120119296014, 0.0010518813505768776, 0.0007240059785544872, 0.0006481298478320241, 0.03311252221465111, 0.08526000380516052, 0.0006391286733560264, 0.008482507430016994, 0.646484375, 0.11678936332464218, 0.3891306519508362, 0.0006562396301887929, 0.82330721616745, 0.021173231303691864, 0.0006913461838848889, 0.0007585468119941652, 0.033123210072517395, 0.0006139175966382027, 0.0005610518273897469, 0.0010924246162176132, 0.0017310811672359705, 0.0006996687734499574, 0.0006103342748247087, 0.0006349267205223441, 0.06868872791528702, 0.001750657451339066, 0.7965301871299744, 0.0006973861018195748, 0.02272709086537361, 0.7973131537437439, 0.0028536601457744837, 0.06449612230062485, 0.12308509647846222, 0.0009765466675162315, 0.014259971678256989, 0.00252430303953588, 0.0006000655121169984, 0.0006731597241014242, 0.0006731597241014242, 0.0011534391669556499, 0.0008366059046238661, 0.4572872817516327, 0.0006731597241014242, 0.0008441177778877318, 0.0006731597241014242, 0.0006731597241014242, 0.0006645197863690555, 0.0005755363963544369, 0.3198833465576172, 0.004385656211525202, 0.11039702594280243, 0.0031404688488692045, 0.059054210782051086, 0.01538794580847025, 0.0008401704835705459, 0.2994365692138672, 0.06056899577379227, 0.0036389490123838186, 0.0012008225312456489, 0.0017210353398695588, 0.0005957366083748639, 0.000599350780248642, 0.0007996636559255421, 0.0007247538887895644, 0.0005859961383976042, 0.0006012439844198525, 0.0006330665783025324, 0.000934971438255161, 0.0005529841873794794, 0.0006618822226300836, 0.0007882583886384964, 0.0006243941024877131, 0.0013607718283310533, 0.0015139218885451555, 0.0013813633704558015, 0.0019676510710269213, 0.0006857686676084995, 0.0005867771687917411, 0.0006603898946195841, 0.0009526458452455699, 0.0010629117023199797, 0.0008977489778771996, 0.0012594469590112567, 0.023363985121250153, 0.006181239150464535, 0.0006594581063836813, 0.0006502947653643787, 0.16582368314266205, 0.0007219937397167087, 0.0005571157089434564, 0.0005521262646652758, 0.0006306249997578561, 0.0005571157089434564, 0.0007463535876013339, 0.0007463535876013339, 0.0005571157089434564, 0.001548829022794962, 0.0008389653521589935, 0.0006937700673006475, 0.018620667979121208, 0.002846706425771117, 0.0006860540597699583, 0.03054649755358696, 0.5577675700187683, 0.0013271858915686607, 0.0014401280786842108, 0.0006189820705913007, 0.0018840079428628087, 0.0006279736990109086, 0.0005571157089434564, 0.0006236647022888064, 0.0005990066565573215, 0.0009005873580463231, 0.0015800378751009703, 0.004315841477364302, 0.0006230224389582872, 0.0007527417619712651, 0.0006919825682416558, 0.0006919825682416558, 0.0007239638362079859, 0.0007239638362079859, 0.0005871069151908159, 0.0005948486505076289 ]

[ "The role of magnetic resonance imaging and spectroscopy in transplantation: from animal models to man.", "\nCritical success factors in solid organ and vascular transplantation are the assessment of graft status/viability as well as stringent monitoring of transplant recipients, preferentially using noninvasive techniques. ", "This review addresses the application of magnetic resonance imaging (MRI) and spectroscopy (MRS) in the field of transplantation. ", "The first section is devoted to the description of the main MR techniques used for monitoring the status of the graft noninvasively. ", "Subsequently, the role of MRI/MRS in the analysis of the viability of organs for transplantation is discussed. ", "Since chronic rejection remains a major difficulty, development of new therapies is still ongoing. ", "Thus, the third part is devoted to the use of MRI/MRS for monitoring graft rejection in animal models of transplantation. ", "This is followed by a discussion of clinical studies of transplantation involving MRI/MRS. ", "Finally, a general appraisal is made on available imaging techniques for the non-invasive characterization of grafts in situ, highlighting the role of MR methods in the field of transplantation." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0005777436308562756, 0.0005722440546378493, 0.0005494868382811546, 0.0005823693936690688, 0.00054200179874897, 0.0006387864705175161, 0.0005970439524389803, 0.0005848720320500433, 0.0005309946718625724 ]

[ "Dębowa\n\nDębowa may refer to the following places:\nDębowa, Opole Voivodeship (south-west Poland)\nDębowa, Pomeranian Voivodeship (north Poland)\nDębowa, Subcarpathian Voivodeship (south-east Poland)" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0006605727830901742 ]

[ "Q:\n\nCrittercismIOS conflict with MvvmCross\n\nI'm integrating crash reporting via CrittercismIOS and i have used component on Xamarin Component store \nhttps://components.xamarin.com/view/crittercism\nbut app crash with error reported.", "\n2015-11-25 10:49:50.621 MyApp[40227:2065265] critical: Stacktrace:\n\n2015-11-25 10:49:50.621 MyApp[40227:2065265] critical: at <unknown> <0xffffffff>\n2015-11-25 10:49:50.621 MyApp[40227:2065265] critical: at System.", "Reflection.", "MonoCMethod.", "InternalInvoke (object,object[]) [0x00016] in /Users/builder/data/lanes/2356/9ce9e8b9/source/maccore/_build/Library/Frameworks/Xamarin.iOS.framework/Versions/git/src/mono/mcs/class/corlib/System.", "Reflection/MonoMethod.cs:650\n2015-11-25 10:49:50.621 MyApp[40227:2065265] critical: at System.", "RuntimeType.", "CreateInstanceMono (bool) [0x000ca] in /Users/builder/data/lanes/2356/9ce9e8b9/source/maccore/_build/Library/Frameworks/Xamarin.iOS.framework/Versions/git/src/mono/mcs/class/corlib/ReferenceSources/RuntimeType.cs:113\n2015-11-25 10:49:50.622 MyApp[40227:2065265] critical: at System.", "RuntimeType.", "CreateInstanceSlow (bool,bool,bool,System.", "Threading.", "StackCrawlMark&) [0x0001a] in /Users/builder/data/lanes/2356/9ce9e8b9/source/maccore/_build/Library/Frameworks/Xamarin.iOS.framework/Versions/git/src/mono/mcs/class/corlib/ReferenceSources/RuntimeType.cs:87\n2015-11-25 10:49:50.622 MyApp[40227:2065265] critical: at System.", "RuntimeType.", "CreateInstanceDefaultCtor (bool,bool,bool,System.", "Threading.", "StackCrawlMark&) [0x0002a] in /Users/builder/data/lanes/2356/9ce9e8b9/source/maccore/_build/Library/Frameworks/Xamarin.iOS.framework/Versions/git/src/mono/external/referencesource/mscorlib/system/rttype.cs:5734\n2015-11-25 10:49:50.622 MyApp[40227:2065265] critical: at System.", "Activator.", "CreateInstance (System.", "Type,bool) [0x00040] in /Users/builder/data/lanes/2356/9ce9e8b9/source/maccore/_build/Library/Frameworks/Xamarin.iOS.framework/Versions/git/src/mono/external/referencesource/mscorlib/system/activator.cs:214\n2015-11-25 10:49:50.622 MyApp[40227:2065265] critical: at System.", "Activator.", "CreateInstance (System.", "Type) [0x00000] in /Users/builder/data/lanes/2356/9ce9e8b9/source/maccore/_build/Library/Frameworks/Xamarin.iOS.framework/Versions/git/src/mono/external/referencesource/mscorlib/system/activator.cs:147\n2015-11-25 10:49:50.622 MyApp[40227:2065265] critical: at Cirrious.", "MvvmCross.", "Touch.", "Views.", "MvxTouchViewsContainer.", "CreateViewOfType (System.", "Type,Cirrious.", "MvvmCross.", "ViewModels.", "MvxViewModelRequest) <IL 0x00077, 0x002fb>\n2015-11-25 10:49:50.622 MyApp[40227:2065265] critical: at Cirrious.", "MvvmCross.", "Touch.", "Views.", "MvxTouchViewsContainer.", "CreateView (Cirrious.", "MvvmCross.", "ViewModels.", "MvxViewModelRequest) <IL 0x0003e, 0x0018f>\n2015-11-25 10:49:50.623 MyApp[40227:2065265] critical: at Cirrious.", "MvvmCross.", "Touch.", "Views.", "MvxCanCreateTouchViewExtensionMethods.", "CreateViewControllerFor (Cirrious.", "MvvmCross.", "Touch.", "Views.", "IMvxCanCreateTouchView,Cirrious.", "MvvmCross.", "ViewModels.", "MvxViewModelRequest) <IL 0x00007, 0x0004a>\n2015-11-25 10:49:50.623 MyApp[40227:2065265] critical: at Cirrious.", "MvvmCross.", "Touch.", "Views.", "Presenters.", "MvxTouchViewPresenter.", "Show (Cirrious.", "MvvmCross.", "ViewModels.", "MvxViewModelRequest) <IL 0x00003, 0x00037>\n2015-11-25 10:49:50.623 MyApp[40227:2065265] critical: at Cirrious.", "MvvmCross.", "Touch.", "Views.", "MvxTouchViewDispatcher/<>c__DisplayClass4.<ShowViewModel>b__3 () <IL 0x00028, 0x00090>\n2015-11-25 10:49:50.623 MyApp[40227:2065265] critical: at Cirrious.", "MvvmCross.", "Touch.", "Views.", "MvxTouchUIThreadDispatcher.", "RequestMainThreadAction (System.", "Action) <IL 0x00028, 0x000e8>\n2015-11-25 10:49:50.623 MyApp[40227:2065265] critical: at Cirrious.", "MvvmCross.", "Touch.", "Views.", "MvxTouchViewDispatcher.", "ShowViewModel (Cirrious.", "MvvmCross.", "ViewModels.", "MvxViewModelRequest) <IL 0x00024, 0x0015b>\n2015-11-25 10:49:50.623 MyApp[40227:2065265] critical: at Cirrious.", "MvvmCross.", "ViewModels.", "MvxNavigatingObject.", "ShowViewModelImpl (System.", "Type,Cirrious.", "MvvmCross.", "ViewModels.", "IMvxBundle,Cirrious.", "MvvmCross.", "ViewModels.", "IMvxBundle,Cirrious.", "MvvmCross.", "ViewModels.", "MvxRequestedBy) <IL 0x00030, 0x00145>\n2015-11-25 10:49:50.623 MyApp[40227:2065265] critical: at Cirrious.", "MvvmCross.", "ViewModels.", "MvxNavigatingObject.", "ShowViewModel (System.", "Type,Cirrious.", "MvvmCross.", "ViewModels.", "IMvxBundle,Cirrious.", "MvvmCross.", "ViewModels.", "IMvxBundle,Cirrious.", "MvvmCross.", "ViewModels.", "MvxRequestedBy) <IL 0x00006, 0x0004f>\n2015-11-25 10:49:50.624 MyApp[40227:2065265] critical: at Cirrious.", "MvvmCross.", "ViewModels.", "MvxNavigatingObject.", "ShowViewModel<T_REF> (Cirrious.", "MvvmCross.", "ViewModels.", "IMvxBundle,Cirrious.", "MvvmCross.", "ViewModels.", "IMvxBundle,Cirrious.", "MvvmCross.", "ViewModels.", "MvxRequestedBy) <IL 0x0000e, 0x0005b>\n\nMvvmCross version is 3.5.1 and Crittercism 2.4 on Xamarin Component Store.", "\nIf i remove in FinishedLaunching this code\nCrittercismIOS.Crittercism.", "Init(\"00ac4950703d418c9cef9b7818cc307300444503\");\n\nApp works fine (it works fine also with Xamarin.", "Insight, but it is not possible to use both dll).", "\n\nA:\n\nVersion 2.5 resolve this issue \nhttps://components.xamarin.com/view/crittercism\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0008231844403780997, 0.0010849889367818832, 0.0006697237258777022, 0.0020982229616492987, 0.0007919404306448996, 0.0007035462185740471, 0.0007306283223442733, 0.0008404835825785995, 0.0007306283223442733, 0.0009680870571173728, 0.0009957521688193083, 0.0010014137951657176, 0.0007306283223442733, 0.0015060596633702517, 0.0009957521688193083, 0.0010078081395477057, 0.0010025979718193412, 0.0007023334037512541, 0.0009357825038023293, 0.0010025979718193412, 0.0007023334037512541, 0.0008622449240647256, 0.0009506660862825811, 0.0034094250295311213, 0.0006527045625261962, 0.002646417124196887, 0.0007329156505875289, 0.0007138116634450853, 0.0009506660862825811, 0.0007229566108435392, 0.0009391028434038162, 0.0009506660862825811, 0.0034094250295311213, 0.0006527045625261962, 0.002646417124196887, 0.0007224152213893831, 0.0009506660862825811, 0.0007229566108435392, 0.0009918938158079982, 0.0009506660862825811, 0.0034094250295311213, 0.0006527045625261962, 0.0009329203749075532, 0.0008720534387975931, 0.0009506660862825811, 0.0034094250295311213, 0.0006527045625261962, 0.0010200575925409794, 0.0009506660862825811, 0.0007229566108435392, 0.0009580955957062542, 0.0009506660862825811, 0.0034094250295311213, 0.0006527045625261962, 0.0007718921406194568, 0.0008848929428495467, 0.0007718454580754042, 0.0009506660862825811, 0.0007229566108435392, 0.0008928715251386166, 0.0009506660862825811, 0.0034094250295311213, 0.0006527045625261962, 0.0009874945972114801, 0.0009506660862825811, 0.0034094250295311213, 0.0006527045625261962, 0.028348518535494804, 0.0007592652691528201, 0.0009613439324311912, 0.0009506660862825811, 0.0034094250295311213, 0.0006527045625261962, 0.00119570002425462, 0.0007605495629832149, 0.0009506660862825811, 0.0007229566108435392, 0.0008885568240657449, 0.0009506660862825811, 0.0007229566108435392, 0.0020969214383512735, 0.0007255070959217846, 0.0007138116634450853, 0.0009506660862825811, 0.0007229566108435392, 0.0013403324410319328, 0.0009506660862825811, 0.0007229566108435392, 0.0013403324410319328, 0.0009506660862825811, 0.0007229566108435392, 0.0010353378020226955, 0.0009506660862825811, 0.0007229566108435392, 0.0020969214383512735, 0.0006931857788003981, 0.0007138116634450853, 0.0009506660862825811, 0.0007229566108435392, 0.0013403324410319328, 0.0009506660862825811, 0.0007229566108435392, 0.0013403324410319328, 0.0009506660862825811, 0.0007229566108435392, 0.0011268050875514746, 0.0009506660862825811, 0.0007229566108435392, 0.0020969214383512735, 0.000686906510964036, 0.0009506660862825811, 0.0007229566108435392, 0.0013403324410319328, 0.0009506660862825811, 0.0007229566108435392, 0.0013403324410319328, 0.0009506660862825811, 0.0007229566108435392, 0.0008484210702590644, 0.01198817789554596, 0.0008084799046628177, 0.0005735551239922643, 0.0008063678396865726 ]

[ "Coronary vascular responsiveness to adenosine is impaired additively by blockade of nitric oxide synthesis and a sulfonylurea.", "\nWe sought to define effects of glibenclamide, a sulfonylurea known to block ATP-dependent potassium (KATP) channels, and Nomega-nitro-L-arginine methyl ester (L-NAME), an L-arginine analog known to block nitric oxide (NO) synthesis, on coronary vascular responsiveness to adenosine. ", "The role of adenosine in coronary flow regulation becomes increasingly important when KATP channel function or NO synthesis is impaired. ", "Both variables are potentially altered in patients with coronary artery disease taking a sulfonylurea. ", "Dose-response curves relating coronary conductance to plasma adenosine concentration were obtained by using intracoronary infusions of adenosine (10 to 1,000 microg/min) in chronically instrumented dogs. ", "ED50, the plasma concentration of adenosine needed to produce 50% of the maximal increase in conductance under baseline conditions, increased threefold after either 1 or 10 mg/kg of L-NAME. ", "ED50 also increased in response to glibenclamide in a dose-related fashion (5.7-fold increase per 1 mg/kg body weight of glibenclamide). ", "Effects of combined blockade of KATP channels and NO synthesis were additive, with increases in ED50 as high as 15-fold. ", "Both L-NAME and glibenclamide increased systemic pressure and reduced coronary conductance, confirming the roles of NO and KATP channels in regulating coronary and systemic vascular tone under rest conditions as well as during stress. ", "Coronary vascular responsiveness to adenosine is blunted in vivo by both L-NAME and glibenclamide. ", "Effects of the sulfonylurea and blockade of NO synthesis are additive and can limit coronary vasodilation as well as other responses involving KATP channels and NO." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0013415745925158262, 0.0006673033349215984, 0.000620346050709486, 0.0010603321716189384, 0.0006235612090677023, 0.0006539988098666072, 0.0007666770252399147, 0.0006318643572740257, 0.0006107747904025018, 0.0008157880511134863, 0.0011782870860770345 ]

[ "Geography of Gaelic games\n\nThe two dominant sports of the Gaelic games are traditionally played in separate regions of Ireland. ", "Hurling is traditionally played mainly in the provinces of Munster and Leinster, whereas Gaelic football is played in every county but is dominant in Ulster and Connacht and certain parts of the other provinces.", "\n\nMunster\nThe traditional hurling-football divide in Munster runs along a line from Tubber in north County Clare through Corofin to Labasheeda. ", "Across the Shannon in County Limerick the line divides the footballing territory in the hilly west Limerick from the hurling territory in the lush lowlands of east and central Limerick. ", "In County Cork the line also divides east from west, starting at Mallow and extending south towards Cork city and on to the coast. ", "Further west beyond the footballing west Cork is the almost entirely footballing territory in County Kerry, with only a very small hurling region north of Tralee in Ardfert, Ballyheigue and Causeway. ", "The entire counties of Tipperary and Waterford are considered to be traditionally hurling regions.", "\n\nLeinster\nIn Leinster the traditional hurling region is located in the south west of the province. ", "The entire County Kilkenny is considered hurling territory, with very little football activity. ", "Most of County Wexford is in the hurling region along with Counties Carlow, Laois and Offaly. ", "The other Leinster counties are considered footballing counties.", "\n\nConnacht\nConnacht is almost entirely Gaelic football territory, with only Galway competing in the Liam MacCarthy Cup. ", "In County Galway the hurling-football divide follows a line from Galway City to Ballinasloe. ", "The divide in Galway probably stands out more than in other counties. ", "The hurling territory in Galway stands out strongly from the rest of the province; as a result, the Galway team plays in the Leinster Championship. ", "Another very small hurling region is in eastern County Mayo around Ballyhaunis.", "\n\nUlster\nUlster is also almost entirely a footballing region; the hurling region is located in the Glens of Antrim.", "\n\nLinks\n Gaelic Athletic Association county\n Gaelic games\n Hurling\n Football\n Dual county\n\nSee also\n Geography of Australian rules football\n Geography of association football\n\nReferences\n\nCategory:Gaelic games\nCategory:Gaelic games terminology" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0005939144757576287, 0.0006391722126863897, 0.000638157594949007, 0.0006853169179521501, 0.0007794359116815031, 0.0007836280856281519, 0.0006473627872765064, 0.0006170247797854245, 0.0006776926456950605, 0.0008408540743403137, 0.0009236750192940235, 0.0006212291191332042, 0.000628117413725704, 0.0006306451396085322, 0.0006032385863363743, 0.0008110826602205634, 0.0007173269987106323, 0.0007072371663525701 ]

[ "var searchData=\n[\n ['index',['index',['../structguac__layer.html#a686a85d9d758ba5f2f4426a4c4ae13ba',1,'guac_layer::index()'],['../structguac__stream.html#a487951c2cc77b2e1637e3aa0b5faaa60',1,'guac_stream::index()']]],\n ['info',['info',['../structguac__client.html#ab67a82a9f940360dac0ec0ca96d446cf',1,'guac_client']]],\n ['init_5fhandler',['init_handler',['../structguac__client__plugin.html#af650493e50e6abd9b0bb33c917bd0b95',1,'guac_client_plugin']]]\n];\n" ]

{ "pile_set_name": "Github" }

[ 0.002138907089829445 ]

[ "\"Previously on Bones:\" \"(woman shrieking)\" \"I'm not a criminal, I'm a hacktivist.\" \"", "Christopher Pelant, socially marginalized,\" \"I.Q. off the charts...\" \"This will show that I never left my house.\" \"", "He made a cipher out of spine.\" \"", "And he wrote malware on bone.\" \"", "I think he can get around an ankle monitor.\" \"", "CAROLINE:\" \"He's not a hacker anymore.\" \"", "Now he's a murderer.\" \"", "As far as any government agency is concerned,\" \"Pelant is clean, Seeley.\" \"", "I know this man.\" \"", "Pelant killed my friend.\" \"", "He's framing you.\" \"", "The evidence is piling up against Brennan.\" \"", "You gotta make a run for it, honey.\" \"", "He thinks he's smarter than us.\" \"", "That big brain of yours isn't much help now, hmm?\" \"", "If we can just figure out how he put her in the security footage, we can clear her.\" \"", "You got him.\" \"", "Christopher Pelant, you are under arrest.\" \"", "Even a genius can make a few mistakes.\" \"", "What did you mean when you said Pelant is not Pelant?\" \"", "That man is Basam Alfayat.\" \"", "BOOTH:\" \"You're saying that he wiped out his identity and created a new one?\" \"", "CAROLINE:\" \"That's right.\" \"", "Pelant isn't Pelant anymore.\" \"", "We can't touch him.\" \"(", "baby crying)\" \"(crying continues)\" \"(groans)\" \"(crying continues)\" \"Ange...\" \"Angie.\" \"(", "crying continues)\" \"(yelling)\" \"(screaming)\" \"Michael, Michael\" \" Vincent!\" \"", "Oh, God... (wailing)\" \"Come here, baby.\" \"", "Come here.\" \"", "Come here, come here.\" \"(", "screams)\" \"BRENNAN:\" \"Angel said they were drugged.\" \"", "BOOTH:\" \"How?\" \"", "Gas.\" \"", "Hodgins found a hole in the vent to their bedroom.\" \"", "What else did they tell you?\" \"", "To get Christine somewhere safe.\" \"", "Well, your father's... he-he's not gonna let her out of his sight, all right?\" \"", "Angel was scared.\" \"", "I've never heard her like this before.\" \"", "She says that we're the only ones she trusts with this.\" \"", "Trusts with what?\" \"", "She thinks Pelant is back.\" \"", "The skin was almost completely removed.\" \"", "As was the mandible, the internal and sexual organs...\" \"The superior lateral corner of the eye orbits indicates the victim was male.\" \"", "BOOTH:\" \"Was it Pelant?\" \"", "Come on-- who else would cut someone up like this?\" \"", "The technique used on these tissue incisions could help determine that.\" \"", "Cam would be the one to assess it.\" \"", "Assess what?\" \"", "Look at it-- it's Pelant.\" \"", "I'm not saying it isn't.\" \"", "We need proof.\" \"", "Here, here-- he left these petals in Michael's crib.\" \"", "HODGINS:\" \"They're from Egypt.\" \"", "Crocus Sativus.\" \"", "The Egyptians revered the crocus as a symbol of the rebirth of the sun.\" \"", "HODGINS:\" \"Yeah, and last we knew, Pelant was in Egypt.\" \"", "Flaying and flowers...\" \"Okay, that settles it;\" \"it's Pelant.\" \"", "Pelant is back from Egypt.\" \"", "The real question is why.\" \"", "I almost killed him a few months ago.\" \"", "He's trying to get back at me.\" \"", "Well, that definitely factors into it, but with Pelant, there's always something more.\" \"", "BRENNAN:\" \"We can't keep Cam out of this.\" \"", "We have to examine this cadaver in the lab.\" \"", "Call the Bureau and get a tech team out here.\" \"", "Wait, no, no-- no, no teams.\" \"", "No one can know about this but us.\" \"", "That's not how I work.\" \"", "The game has changed, Booth.\" \"", "Pelant is targeting us, directly.\" \"", "We have to hit him back now, before one of us is dead.\" \"", "Pelant touched our son.\" \"", "Isn't there a way to just get rid of him?\" \"", "Morally, I have no problem with killing a killer, but Booth is the only one of us who has the skills and the training to do it.\" \"", "The burden would fall on him.\" \"", "The decision needs to be his.\" \"", "How many kills do you have?\" \"", "My kills were battlefield decisions, all right?\" \"", "They were green-lit from above.\" \"", "There is a chain of command.\" \"", "Did any deserve to die more than Pelant?\" \"", "We stay in the system.\" \"", "In lockdown, but in the system.\" \"", "That's final.\" \"", "Are we good?\" \"", "Yeah, we're good.\" \"", "All right, I'm going to call a tech team now.\" \"", "I'll call Cam.\" \"", "Are you all right?\" \"", "Yeah.\" \"", "♪ Bones 8x12 ♪ The Corpse on the Canopy Original Air Date on January 21, 2013\" \"♪ Main Title Theme ♪ The Crystal Method == sync, corrected by elderman ==\" \"♪\" \"It's an EFT shield.\" \"", "Military-grade, counter-surveillance.\" \"", "CAROLINE:\" \"Same idea as a tin foil hat.\" \"", "That is a lot of highly-trained squintspertise you are sending on government- paid vacation.\" \"", "The investigation is need-to-know only.\" \"", "All calls are on burner cells;\" \"no computers.\" \"", "I've got as much blood as you've got tests.\" \"", "Potentiometer assay, gamma count,\" \"Don't leave anything out.\" \"", "Okay, ooh, there is a needle in your radial artery, Dr. Hodgins.\" \"", "Try not to bounce around so much.\" \"", "You are running a gamma count, aren't you?\" \"", "If the hematology warrants it.\" \"", "Gamma count gives us the GGT levels, okay?\" \"", "Those puppies bark loud enough, we're gonna know Pelant used Phenobarbital to knock me and Angela out.\" \"", "Now, if we can I.D. the gas, we may be able to narrow it down to the supplier.\" \"", "And that's gonna get us one step closer to Pelant.\" \"", "Well, that is how a forensic investigation works.\" \"", "Yeah, just trying to help.\" \"", "Don't you have flower petals to examine?\" \"", "Hey, if I'm in your way, just say so.\" \"", "Petals.\" \"", "Go.\" \"", "MONTENEGRO:\" \"I just don't understand how someone can do this to another human being.\" \"", "Oh, you'd have to have a strong knowledge of anatomy, a well-balanced cutting implement being.\" \"", "that really holds its edge;\" \"a floor drain would be helpful.\" \"", "That clears it up.\" \"", "Thank you.\" \"", "What do we have?\" \"", "Victim is male, 185.4 centimeters tall, 56.7 kilograms, without skin, bodily fluids, mandible, or viscera.\" \"", "So, that puts his original weight at 210, give or take a mandible or two.\" \"", "The wear to the maxillary teeth suggests late 30s.\" \"", "The width of the fourth sternal rib indicates Caucasian ancestry.\" \"", "Lack of putrefaction suggests he's been dead less than 24 hours, so Missing Persons won't have anything yet.\" \"", "Pelant is sending us a message.\" \"", "There has to be some logic to these cuts.\" \"", "The selective flaying, the missing mandible,\" \"I'm just... not seeing it.\" \"", "What about the X rays?\" \"", "There were some small lesions to the scapula.\" \"", "And some fragments embedded in the muscle near the victim's pelvis.\" \"", "Yeah, it looks like the iliacus.\" \"", "BRENNAN:\" \"What are those?\" \"", "I'm not sure, but muscle remodeling indicates they've been in there over a year.\" \"", "Okay, I'll get these to Dr. Hodgins.\" \"", "Cam is treating this like it's just any other case.\" \"", "No, she's just being professional.\" \"", "Brennan, Pelant was holding Michael in his arms.\" \"", "When... when I was on the road with Christine,\" \"I was scared.\" \"", "Yeah, of course you were.\" \"", "You were alone.\" \"", "No, you don't understand.\" \"", "I've been alone most of my life.\" \"", "I've never been scared.\" \"", "This... this was different.\" \"", "How did you get through it?\" \"", "I've met victims of war crimes in Central America,\" \"Africa, Southeast Asia, they've gone through a lot more than us.\" \"", "They manage to keep going by finding something to focus on;\" \"a clear achievable goal that gets them through the day.\" \"", "I could use one of those.\" \"", "You got one for me?\" \"", "Stopping Pelant.\" \"(", "camera clicks, computer beeps)\" \"(beeping)\" \"(blipping)\" \"Christopher Pelant, born in 1986, in Denmark, raised in United States until he wipes out that identity and becomes Egyptian National Basam Alfayat.\" \"", "Right-- now, all records of Alfayat have now vanished, too.\" \"", "So we have no idea who we are looking for.\" \"", "First victim was Carol Morissey.\" \"", "SWEETS:\" \"Pelant's high school guidance counselor.\" \"", "She was going to write him a bad recommendation to Stanford, so he killed her.\" \"", "It was utilitarian.\" \"", "He disposed of the body...\" \"...and got into Stanford.\" \"", "Word is, that's what it takes these days.\" \"", "Next, is was Inger Johannsen and Ezra Krane.\" \"", "SWEETS:\" \"Now, here we see concurrent patterns.\" \"", "Pelant had no personal connection to Inger, and a minimal one to Krane.\" \"", "He opportunistically used their bodies to tell the story.\" \"", "BOOTH:\" \"Then we have good old Ethan Sawyer, who Pelant immobilized, so he could be eaten by wolves.\" \"", "I'll say this for the evil little troll:\" \"he always manages to top himself.\" \"", "So, what's he up to with his latest?\" \"", "BOOTH:\" \"Does Flynn know about this?\" \"", "He's an FBI agent, he figures things out.\" \"", "Hey.\" \"", "What's going on?\" \"", "FBI work.\" \"", "Does this FBI work have anything to do with Pelant?\" \"", "Pelant-- he doesn't exist.\" \"", "No, we're looking at a killing done by an individual who manifests a malignant antisocial personality disorder.\" \"", "It helps to pull up old cases to compare, that's all.\" \"", "Thank you for the insight.\" \"", "I run the major crimes here, and I'm investigating one, so...\" \"CAROLINE:\" \"I'd hate to have to drop a report on the H.E.'s desk that you were getting in the way.\" \"", "That sort of politics appalls me.\" \"", "Fine.\" \"", "Seeley, run your investigation.\" \"", "It's just that, if I were you,\" \"I'd want all the help that I could get.\" \"", "But I'm not you.\" \"", "I did some reconstructions.\" \"", "Wow, three sets.\" \"", "Yeah, since there's no mandible, there's just an element of uncertainty here.\" \"", "BRENNAN:\" \"These lesions on the scapula are most likely the remnants of a case of cutaneous leishmaniasis.\" \"", "SAROYAN:\" \"Well, that's not a domestic disease.\" \"", "But I've seen it on soldiers.\" \"", "The troops in Iraq get it from sand flea bites.\" \"", "MONTENEGRO:\" \"Oh, well, that makes sense.\" \"", "Hodgins thinks the metal fragments you gave him are shrapnel.\" \"", "He's doing a compositional analysis to determine the source.\" \"", "Stress fractures to the victim's metatarsals were consistent with parachute jumping, and... there are osteophytes present in the intercondylar fossa of the femur, which comes from nitrogen buildup in the blood.\" \"", "Which could mean he did a significant amount of diving.\" \"", "Diving, parachute training, and shrapnel wound.\" \"", "Sounds like our victim was Special Forces.\" \"", "I hear the lab thinks your victim was Special Forces.\" \"", "Okay, why do you want any part of this?\" \"", "This is nothing but a headache for you, right?\" \"", "Whatever.\" \"", "That's the job, right?\" \"", "I'm offering my help.\" \"(", "sighs)\" \"FLYNN:\" \"But if you don't want it...\" \"That doesn't leave the Pentagon.\" \"", "How did you get these records?\" \"", "Called in a favor.\" \"", "It must have been some favor.\" \"", "The guy you're looking for served in Iraq, built up major dive hours, and managed to get wounded by an RPG in Central Africa.\" \"", "Well, if he pulled an assignment in Africa, that would be off the record.\" \"", "Exactly.\" \"", "That's why we've never seen these.\" \"", "You still want me off this one?\" \"", "Ah, it's too late for that.\" \"", "SAROYAN:\" \"I just heard from Leah Kressin.\" \"", "She is the best hematologist I know, top expert in her field.\" \"", "I completely trust her work, and... she couldn't I.D. the gas that Pelant used.\" \"", "I'm sorry.\" \"", "But you're not giving up on this, right?\" \"", "Well...\" \"I don't know what else to do.\" \"", "There's no residue in your blood, there's no residue on the victim.\" \"", "The tech team went over every inch of your place.\" \"", "Well, then they go over it again.\" \"", "I mean, every millimeter.\" \"", "Someone missed something.\" \"", "Given the time and resources we have,\" \"I have to go with what has the highest probability of...\" \"If it's about resources, just tell me how much you need me to give you.\" \"", "Money isn't the issue.\" \"", "Please.\" \"", "Money is always the issue.\" \"", "It's a good thing that I'm rich.\" \"", "Half the funding for the Jeffersonian comes from the Cantilever Group.\" \"", "We have to stay focused on what's important.\" \"", "He was in my bedroom.\" \"", "He threatened my wife, my child.\" \"", "Nothing is more important than that.\" \"", "SWEETS:\" \"Xavier Freeman-- did five tours as a SEAL, mustered out in 2008.\" \"", "Nothing on him since.\" \"", "Well, not many seals worked both Central Africa and Iraq, you know.\" \"", "He's the only hit Flynn and I could find.\" \"", "No job, no surviving family.\" \"", "Then I guess we won't have to notify anyone.\" \"", "SWEETS:\" \"New furniture.\" \"", "Hardly any food in the fridge.\" \"", "No movies, music, books.\" \"", "BOOTH:\" \"Looks like he's got a family, after all.\" \"", "I saw this exact same photo in an apartment I almost rented.\" \"", "Yeah.\" \"", "See, stagers cut these out of magazines to prep open houses.\" \"", "Freeman didn't want to form any attachments.\" \"", "He was ready to leave at any time.\" \"", "There's a lot of hotel receipts here from\" \"Cairo, Dubai...\" \"Wait, wait...\" \"Look at this.\" \"", "He... left his gun locker open.\" \"", "No, he didn't.\" \"", "A SEAL would never do that.\" \"", "Pelant wanted us to find this open.\" \"", "These are all proprietary weapons.\" \"", "I've seen some of these weapons in Iraq, but our boys, they never got this kind of stuff.\" \"", "Who does?\" \"", "The ones who kill for money, that's who.\" \"(", "auto-dialing beeps)\" \"(phone rings) Yeah.\" \"", "It's Booth.\" \"", "Listen, our man Freeman, he was working for Serberus.\" \"", "You know what we're in for?\" \"", "Yeah.\" \"", "What's Serberus?\" \"", "It's the world's biggest provider of mercenaries.\" \"", "Not only do they supply the arms, but... they supply the men who use them.\" \"", "So Pelant killed a highly-trained professional soldier.\" \"", "A target like that is a huge risk, even for him.\" \"", "He's escalating.\" \"", "Yeah, but the question is why.\" \"", "I ran a tox screen-- no poisons, but I found highly elevated levels of adrenocorticosteroids.\" \"", "Have you found any signs of... torture?\" \"", "Look at these antemortem striations on the fourth and fifth cervical vertebrae.\" \"", "They were made by needles.\" \"", "SAROYAN:\" \"That would have pierced the nerve ganglions on either side of the vertebrae.\" \"", "The pain would be intense, but it-it wouldn't kill him.\" \"", "Not in one session, but this could've gone on for days.\" \"", "The body would continue to pump out adrenaline, stressing his heart until he suffered a lethal bradyarrhythmia.\" \"", "He literally died from pain.\" \"", "BOOTH:\" \"Xavier Freeman was tortured and killed by a man we're tracking.\" \"", "FLYNN:\" \"So we'd like Freeman's records.\" \"", "Every operation that he's had access to.\" \"", "I'm sorry, gentlemen.\" \"", "It's company policy to maintain the confidentiality of our operatives.\" \"", "This is your company.\" \"", "I mean, you can change that policy with one phone call.\" \"", "That's not going to happen.\" \"", "FLYNN:\" \"I don't think you understand\" \"Mr. Molnor-- our target's killed five people already.\" \"", "He's on the hunt.\" \"", "I think I understand very well-- you had five shots at this guy, and you missed every time.\" \"", "Now you want my help.\" \"", "If he's the one who killed our man, we'll find out.\" \"", "By ourselves.\" \"(", "sighs) Hey.\" \"", "Got a minute?\" \"", "For what, Sweets?\" \"", "You've been through a lot.\" \"", "Thought you might want to talk.\" \"", "I mean, you suffered a major trauma.\" \"", "Okay, I get it, I get it-- \"trauma,\" \"stress\"-- these are just buzzwords because you think that I'm not up to my job.\" \"", "Listen, you've got to calm down, okay?\" \"", "Let the team do its job.\" \"", "Look, I know you think that because you choked Pelant you brought all this down on your family...\" \"Okay, thank you for stopping by.\" \"", "This isn't you, Hodgins, all right?\" \"", "Y-You need some perspective.\" \"", "Just... take a breath.\" \"", "Take a breath.\" \"", "Take a breath.\" \"", "Take a breath.\" \"", "Hodgins...?\" \"", "What?\" \"", "CAROLINE:\" \"I'm sorry to tell you this, but there's nothing in the Justice's guidelines on searches, seizures, and practical jokes that will get you back into Serberus with a warrant if you can't tell me what you're looking for.\" \"", "We can't tell you what we're looking for until we go back there and find it.\" \"", "You have no idea what Freeman was working on?\" \"", "No, none.\" \"", "Come on, Caroline.\" \"", "It's just a piece of paper.\" \"", "You think I can just foxtrot into a judge's chambers with my winning smile and girlish figure and get whatever I want?\" \"", "I appreciate the compliment, cherie, but it doesn't work that way.\" \"", "You know what?\" \"", "You don't want to help?\" \"", "Fine.\" \"", "You can just foxtrot out of here.\" \"", "Slow your roll, Seeley Booth.\" \"", "Pelant screwed me over, too.\" \"", "I want him as badly as you do.\" \"", "So you come back with something I can work with and I will get you that warrant.\" \"", "Dr. Sweets.\" \"", "What is it?\" \"", "I just spoke with Dr. Hodgins, and I'm concerned about him.\" \"", "You need to check with me in advance before you assess any of my people.\" \"", "That wasn't my intention, okay?\" \"", "He's a friend, he suffered a shock.\" \"", "And yet you feel compelled to see me about it.\" \"(", "sighing):\" \"He's obsessive.\" \"", "He's manic, he's not evincing good judgment.\" \"", "I don't think it's healthy for Hodgins or this investigation for him to be working right now.\" \"", "You should just...\" \"send him home.\" \"", "Let him get some rest.\" \"", "I'm not gonna do that.\" \"", "Why?\" \"", "Because Pelant is afraid of Jack Hodgins.\" \"", "That's why he put the body in his house.\" \"", "He wants him off the case.\" \"", "MONTENEGRO:\" \"What are you doing?\" \"", "Snorting lidocaine.\" \"", "Why?\" \"", "Suppresses the gag reflex.\" \"", "I need to biopsy my lung.\" \"", "Oh, no, no, no.\" \"", "No, you don't.\" \"", "No-Nobody biopsies their own lung.\" \"", "There is a chance that some of the gas Pelant used on us is still in the tissue.\" \"", "Then let Cam do it.\" \"", "I mean, she's an MD.\" \"", "I don't think she trusts my professional opinion right now.\" \"", "Besides, it's-it's, it's painful, there's a risk of complications, and there's only this slim chance that it's even gonna work.\" \"", "But there is actually...\" \"a chance?\" \"", "Maybe.\" \"", "The odds aren't good.\" \"", "Let's double them.\" \"", "Biopsy my lung, too.\" \"(", "snorting)\" \"(phone rings)\" \"Booth.\" \"", "PELANT:\" \"Guess again, Dr. Brennan.\" \"", "What do you want?\" \"", "I want to register my disappointment with you.\" \"", "I left you a masterpiece of a body, and you still haven't read it properly.\" \"", "Then why don't you just tell me what it means?\" \"", "I already have-- you just don't get it yet.\" \"", "Which surprises me, frankly.\" \"", "I mean, yeah, maybe it's true what they say about motherhood.\" \"", "What are you talking about?\" \"", "That it makes you dumber.\" \"", "You didn't just call to insult me.\" \"", "Tell me what you want.\" \"(", "chuckles) I'm not telling you anything, Temperance.\" \"", "But... as a goodwill gesture, one neurological freak to another,\" \"I'll give you a hint.\" \"(", "Saroyan dialing) What's the hint?\" \"", "You'll know soon enough.\" \"(", "sighs) No time for a trace.\" \"", "What did he say?\" \"", "That he sent me something.\" \"", "A clue.\" \"(", "shouts):\" \"Oh, gah...!\" \"", "The finger was mailed to the Jeffersonian, and Pelant knew how to reach me on my burner cell.\" \"", "How?\" \"", "I don't know, but he knows I haven't figured out his code on the victim's remains yet.\" \"(", "sighs)\" \"That's not good.\" \"", "He's unscrambled our signal.\" \"(", "sighs) Is that human?\" \"", "It'll take me some time to do a proper analysis.\" \"", "Right, well, I'm staying right here with you.\" \"", "You don't need to protect me, Booth.\" \"", "Pelant doesn't want to kill me, at least for now.\" \"", "If that's supposed to make me feel better, it doesn't.\" \"", "Just go.\" \"", "I'll be fine.\" \"", "All right.\" \"", "You need me, just call.\" \"(", "clears throat) You okay?\" \"", "Yeah.\" \"", "Fine.\" \"", "Ah, nothing beats old-school technology.\" \"", "It's beautiful, isn't it?\" \"", "What is that?\" \"", "It's an Enigma machine.\" \"", "The Germans used them to send coded messages in World War II.\" \"", "This one was my grandfather's.\" \"", "There's only one other, and I just had it sent to Booth.\" \"", "From now on, any important information we have for the FBI goes over it.\" \"", "Okay, uh, Booth said that we could set up a proprietary landline.\" \"", "No, no, no.\" \"", "Ph-Phones run on the power supply.\" \"", "Pelant could've sent a...\" \"a worm in through the grid.\" \"", "Honey, that is not possible.\" \"", "Of course it's possible.\" \"", "I can't believe that you're questioning that.\" \"", "Wait a minute.\" \"", "I just let you cut out a piece of my lung.\" \"", "Every breath that I'm taking feels like I swallowed an ice pick.\" \"", "I'm sorry, I shouldn't have said that.\" \"", "It's okay.\" \"", "I-I get it, I get it.\" \"(", "whirring, beeping)\" \"Mass spec's warmed up.\" \"", "Did you get anything?\" \"", "Carbon dioxide, nitrogen, oxygen, nitrous oxide... a few stray molecules of C4, H3, F7, O1.\" \"", "Okay, what-what does that mean?\" \"", "Sevoflurane-- it's an anesthetic gas.\" \"", "It's the one that Pelant used to knock us out.\" \"", "I bet he figured we could never trace it.\" \"", "Oh, this is our one advantage.\" \"", "Thank God I am a pack rat.\" \"", "There are two suppliers who are licensed to sell the amount of sevo Pelant used to fill our bedroom.\" \"", "Okay.\" \"", "So?\" \"", "They're both divisions of Cantilever.\" \"", "I own them.\" \"", "I'm gonna take care of this one myself.\" \"(", "sighs)\" \"SAROYAN:\" \"Taxonav puts it at primate to start, but the knuckles indicate the suborder is simian.\" \"", "The finger belongs to a monkey or an ape.\" \"", "Nail is flat, indicates the family Cercopithecidae, which limits the geographic range to Northern Africa.\" \"", "The hair follicles indicate genus macaque.\" \"", "Relation of the proximal to the distal phalanges indicates...\" \"Macaca Sylvanus.\" \"", "Commonly known as a Barbary ape.\" \"", "SAROYAN:\" \"Well, and it's an index finger.\" \"", "That's got to have some significance.\" \"", "Pelant said that he left me a \"masterpiece.\"\" \"", "The Roman anatomist Galen dissected Barbary apes as his models for how the human body works.\" \"", "His work was widely accepted until the 16th century, when Vesalius, the father of modern anatomy, proved that Galen had made some significant errors.\" \"", "We have to show Angela.\" \"", "That finger was pointing us to Vesalius.\" \"", "Okay, so this is the best I could do without my usual tools.\" \"", "I'm impressed.\" \"", "This is the body from above our bed.\" \"", "Now, I went through all of Vesalius's illustrations and found the one that most closely resembles... plate 34\" \" De Humani Corporis Fabrica.\" \"", "Both corpses are flayed, eviscerated, missing mandibles.\" \"", "But the bodies are positioned so differently, it's difficult to make a comparison.\" \"", "Well, Vesalius looped a rope around the back of the cranium and up through the orbital cavity to pull the body up to a standing position.\" \"", "So I did the same with the photo.\" \"", "BONES:\" \"They're almost an identical match.\" \"", "But what does it mean?\" \"", "I don't know what he's trying to tell us, but...\" \"I'm pretty sure the guy's enjoying this.\" \"", "I'm not seeing what you're seeing.\" \"", "SWEETS:\" \"Pelant's been deliberately macabre before.\" \"", "But this is artistic.\" \"", "You know, there's ego gratification here.\" \"", "He's building to something.\" \"", "Something's burning.\" \"(", "machine clicking) FLYNN:\" \"What the hell is that?\" \"", "It's an Enigma machine-- Hodgins sent it over.\" \"", "Why?\" \"", "Why?\" \"", "Because it's Hodgins.\" \"", "It looks like it's actually working.\" \"", "What does it say?\" \"\"", "Traced Pelant's gas supplier,\" \"\"Bertand Chemical.\" \"", "Has new alias.\" \"", "Justin Trimple.\"\" \"", "What kind of name is that?\" \"", "Pelant always has to be singular, even with his fake identities.\" \"", "I'll run it through the database.\" \"", "It's got to be a paper search, no computers.\" \"", "Come on.\" \"", "We don't have a choice.\" \"", "If we run it, Pelant will know.\" \"", "Fine.\" \"", "There's another way we can find him.\" \"", "Pelant won't see it coming.\" \"(", "beeping, clicking)\" \"Flynn says that we should spam Pelant?\" \"", "You know, that's so low-tech, it might actually work.\" \"", "How?\" \"", "Permission to use?\" \"", "No.\" \"", "Listen, Pelant might flag a search for the name, but if we blast him with spam, it could distract him just long enough for us to run a check on Trimple before Pelant can suspect that we're in.\" \"", "Angela thinks it'll work.\" \"", "Okay.\" \"", "Okay.\" \"", "And the neat thing is, some helpful Nigerian has already written all the spam for us.\" \"", "SAROYAN:\" \"Why won't Pelant know you're sending it?\" \"", "I'll route it through a proxy chain and send it to every possible Justin Trimple.\" \"(", "electronic tones sounding)\" \"(electronic tones continue sounding)\" \"Excuse me for one minute.\" \"(", "typing)\" \"He blocked us.\" \"", "Oh, that's bad.\" \"", "No.\" \"", "It's good.\" \"", "Tell Booth I know what server he's using.\" \"", "The lab traced Justin Trimple to the in-house server at Serberus.\" \"", "That's Pelant, right?\" \"", "He's there right now?\" \"", "Yes.\" \"", "When he killed Freeman he took his security chip.\" \"", "That's what got him access.\" \"", "What do you have to tie him to Freeman's murder?\" \"", "The start of the chain, okay?\" \"", "Hodgins has got a eyewitness who sold him massive amounts of sevoflurane gas.\" \"", "That's the stuff he used to knock 'em out.\" \"", "You trust Hodgins with this?\" \"", "Yes.\" \"", "FLYNN:\" \"Listen to me.\" \"", "We may not catch another break here-- we need to go in there with a tac team and take him now.\" \"", "Look, I need that warrant.\" \"", "You want to take on a private army with an FBI tac squad?\" \"", "Yeah.\" \"", "Yes.\" \"", "You come up empty, and I will not be there to cover your sorry asses on account of I'll be too busy covering my own, understood?\" \"", "I'll take that chance.\" \"", "Great.\" \"", "Okay, then.\" \"", "Suit up.\" \"(", "sighs)\" \"(indistinct chatter)\" \"(indistinct radio transmissions)\" \"BOOTH:\" \"Right.\" \"", "So, how we doing?\" \"", "We've got Gatlings at each entry and exit.\" \"", "6,000 rounds per minute.\" \"", "They're hidden behind grates.\" \"", "First order of business, we get him offline, and make sure we get every man past the kill zone.\" \"", "What are you doing here?\" \"", "I want to go in with you.\" \"", "No.\" \"", "I can help you in there;\" \"I understand Pelant.\" \"", "You're staying outside.\" \"", "Doesn't make any sense.\" \"", "It makes complete sense, because if I go in there and I don't make it out, you're the only one who understands Pelant, how he ticks.\" \"", "You're gonna have to be the one that follows through with all this\" \" I need to know you'll be there for me if that happens.\" \"", "Okay.\" \"", "Okay, I'll be here.\" \"", "Right.\" \"", "Over here.\" \"(", "tapping keys)\" \"(taps key)\" \"(taps key)\" \"(taps key)\" \"SAROYAN:\" \"Freeman's corpse is not a perfect copy of the Vesalius.\" \"", "Pelant made some errors.\" \"", "What kind of errors?\" \"", "The cuts.\" \"", "Some of them are identical, but others don't correspond.\" \"", "BRENNAN:\" \"If those aren't errors, but purposeful anomalies, then the deviation between the two would be his code.\" \"", "Clear the lobby!\" \"", "Everybody move!\" \"", "Lock down every exit, get those Gatlings offline.\" \"", "Roger that.\" \"", "Sweep every room from the ground up.\" \"", "MAN:\" \"Over here.\" \"", "Move!\" \"", "Move!\" \"", "Let's go!\" \"", "FBI.\" \"", "Weapons on the ground.\" \"", "Guys... seriously?\" \"", "MAN:\" \"Stand down.\" \"", "Pelant excised pieces of several muscles from Freeman's corpse that are intact in the Vesalius.\" \"", "Teres major, middle scalene, rhomboid major, brachioradialis, omohyoid, iliocostalis lumborum.\" \"", "Can you magnify the Vesalius?\" \"", "MONTENEGRO:\" \"He labeled each muscle with a different letter.\" \"", "Those letters match up perfectly with the holes.\" \"", "HODGINS:\" \"M-E-L\" \"Y-C-U.\" \"What does it mean?\" \"", "Everybody out!\" \"", "Move!\" \"", "Move!\" \"(", "beep)\" \"(blipping)\" \"Quickly!\" \"", "Let's go!\" \"", "Everyone to the lobby!\" \"", "Keep moving!\" \"(", "beeping)\" \"FBI!\" \"", "Let's go.\" \"", "Out.\" \"", "Do you have any idea what you're doing?\" \"", "Yeah, saving your ass.\" \"(", "indistinct talking)\" \"(blipping)\" \"(beeping)\" \"Team B headed to the server room.\" \"(", "beeping)\" \"Clear!\" \"", "Server room clear!\" \"", "Out of 720 combinations, this is the only one that makes sense.\" \"", "SAROYAN:\" \"\"Lyceum.\"\" \"", "It's the only one that makes sense.\" \"", "What does it mean?\" \"", "It means school.\" \"", "Derived from the Greed Lukeion, where Aristotle taught.\" \"", "Right.\" \"", "But what does it mean to Pelant?\" \"", "If Pelant's in the building, he'll show up on a security camera.\" \"", "Got him.\" \"", "No, we don't.\" \"", "He can't be everywhere at once.\" \"", "We've got every exit covered.\" \"", "We don't.\" \"", "There's another way out.\" \"", "Hey.\" \"", "Building like this there's always an off-map evac route.\" \"", "Where is it?\" \"", "Pelant could crash this whole place down.\" \"", "He's got the tool set.\" \"", "You lose contact with all 5,000 of your special guys out there for God knows how long, how's that gonna go over with your clientele?\" \"", "It's not in the blueprints.\" \"", "He couldn't know about it.\" \"", "He knows.\" \"", "Pelant!\" \"(", "levers clacking, Pelant grunts with effort)\" \"(grunts)\" \"(creaking)\" \"(creaking)\" \"Pelant!\" \"(", "blipping)\" \"(whirring)\" \"Down!\" \"(", "rapid gunfire, grunting)\" \"(rapid gunfire continues)\" \"(grunts)\" \"(grunting)\" \"(breathing weakly)\" \"Stay with me, okay?\" \"", "Just stay with me. (", "groaning)\" \"(engine starting)\" \"(tires squealing)\" \"(engine revving)\" \"Agent down.\" \"", "Agent down.\" \"(", "tires squealing, engine revving)\" \"(tires squealing)\" \"(shouts)\" \"(engine revving)\" \"(indistinct radio communication, siren sounding) Hey, you okay?\" \"", "I just had to tell the squints that Pelant got away.\" \"", "Flynn?\" \"", "Flynn?\" \"!\" \"", "My last shot-- it hit Pelant.\" \"", "All right, it hit him.\" \"", "It didn't kill him, but there was damage.\" \"(", "sighs) You couldn't have seen that shot hit Pelant.\" \"", "I hit him.\" \"", "If that's so, he's gonna need medical attention, right?\" \"", "There's already an all-points.\" \"", "There's no way he gets away this time.\" \"", "If it was anyone else, I'd believe you, but...\" \"TOM:\" \"Agent Booth?\" \"", "What's going on?\" \"", "Every work station on the eighth floor just went on.\" \"", "Why?\" \"", "I don't know.\" \"", "All right, bring it up for me.\" \"", "Here we are.\" \"", "Here it is.\" \"", "SWEETS:\" \"What are those numbers?\" \"", "I have no idea.\" \"", "Booth just called.\" \"", "We're back online, and I'm patched into the Serberus system.\" \"", "You need to see what it's doing.\" \"", "It's got to be a code.\" \"", "Of course it's a code.\" \"", "It's Pelant.\" \"", "He's showing us he still controls the board.\" \"", "It's not a series, not a sequence, not a progression.\" \"", "There's no mathematical consistency here.\" \"", "They have to correlate to something.\" \"", "BOOTH:\" \"Wait a second.\" \"", "I recognize these numbers from Afghanistan.\" \"", "They're coordinates on the MGRS.\" \"", "What's that?\" \"", "Military Grid Reference System.\" \"", "GPS standard for air-delivered weapons.\" \"", "That means Pelant has got a target.\" \"", "MONTENEGRO:\" \"The coordinates are for Kandahar Province.\" \"", "BRENNAN:\" \"The landscape is shifting at 237 miles per hour.\" \"", "Is that speed constant?\" \"", "Yeah.\" \"", "Too slow for a missile or a jet.\" \"", "HODGINS:\" \"Too fast for a copter.\" \"", "MONTENEGRO:\" \"It's an MQ-9 Predator Drone.\" \"", "Target?\" \"", "Uh, no idea.\" \"", "This is Pelant.\" \"", "We have to assume the worst.\" \"", "The MQ-9 carries enough ordnance to take out a city block.\" \"", "Any habitable area in the vicinity would be densely populated.\" \"", "A hit would be devastating.\" \"", "Booth!\" \"", "You got to turn this drone around now.\" \"", "Redirect the drone.\" \"", "I can't get onto its nav.\" \"", "We're locked out.\" \"", "The drone's system has been corrupted.\" \"", "It won't acknowledge anything I send it.\" \"", "Try \"Lyceum.\"\" \"(", "beeping)\" \"MONTENEGRO:\" \"We've got the drone's video feed.\" \"", "Can you get us a satellite image of the nearest populated area?\" \"", "Yeah.\" \"", "The drone's flight path will take it directly to those buildings.\" \"", "SAROYAN:\" \"What are those dots?\" \"", "They're head scarves.\" \"", "They're girls.\" \"", "I'm enhancing.\" \"", "SAROYAN:\" \"They're young.\" \"", "Based on the size differentials, they're pre-teens.\" \"", "Lyceum.\" \"", "Pelant is taking out a school.\" \"(", "indistinct conversation)\" \"(speaking native language)\" \"Okay, what's that other data that he's throwing at us?\" \"", "Okay, I'll work on that.\" \"", "You stay on the drone.\" \"", "Wait a second-- why is Pelant giving us the target in advance?\" \"", "He doesn't do that.\" \"", "He wants us to feel helpless when the drone blows up that school.\" \"", "You have any other aircraft in the area?\" \"", "Do we?\" \"", "Navy has a pair of Hornets in flight, 93 miles out.\" \"", "Request a redeploy.\" \"(", "whispering)\" \"Oh, my God.\" \"", "HODGINS:\" \"This can't be happening.\" \"", "Oh, God.\" \"", "No, no, no.\" \"", "What?\" \"", "What-what is it?\" \"", "That word \"salad\"\" \"is the passwords to my accounts-- personal portfolio, corporate, the works.\" \"", "Pelant-- he's draining every account.\" \"", "We'll be broke in a minute.\" \"", "No, no, no.\" \"", "It's running off of Serberus's network;\" \"I can shut it down.\" \"", "No, you can't, Angie.\" \"", "You can't.\" \"", "Why not?\" \"", "Because if you shut down Serberus, we're gonna lose contact with the drone.\" \"", "Pelant is forcing me to choose.\" \"", "Keep our money, or save those girls.\" \"", "Oh, my God.\" \"", "Save the girls.\" \"", "Go.\" \"(", "engine whirring)\" \"(beeping)\" \"(chirping)\" \"(shouting in native language)\" \"(laughter)\" \"Drone is one minute out.\" \"", "Hornets?\" \"", "Five minutes and counting.\" \"", "They're not gonna make it.\" \"", "Pelant sequestered his kernel with direct anonymous attestation.\" \"", "Meaning?\" \"", "I'm in.\" \"(", "engine whirring)\" \"(drone approaching)\" \"(girl shouting)\" \"(gasps)\" \"(beeping)\" \"(engine whirring)\" \"(screaming)\" \"(screaming, shouting)\" \"(computer trilling)\" \"(blipping)\" \"(drone approaching, all shouting)\" \"(rapid beeping)\" \"Got it.\" \"", "Oh!\" \"(", "beeping)\" \"(sighs)\" \"(laughs quietly, sighs)\" \"(footsteps approaching)\" \"Hey.\" \"", "Been looking for you.\" \"", "It suddenly hit me, I haven't eaten all day.\" \"", "How long have those been here?\" \"", "Well, absence of bug infestation indicates less than two days.\" \"", "And I am not about to turn down a free muffin.\" \"", "Not now, anyway.\" \"", "You know, we're gonna be all right.\" \"", "We don't need the money.\" \"", "I know.\" \"", "But it was a lot of money.\" \"", "It sure was.\" \"", "You know, there's a bag of frozen bagels downstairs.\" \"", "It's been there for weeks.\" \"", "Really?\" \"", "Oh, that's our breakfast.\" \"(", "laughs)\" \"(both laugh)\" \"Love you.\" \"", "I love you, too.\" \"(", "crickets chirping)\" \"Hi.\" \"", "How's Flynn?\" \"", "He's stabilized, but we still don't know.\" \"", "I didn't get a chance to say good night to her.\" \"(", "sighs)\" \"It's about more than that, isn't it, Booth?\" \"(", "sighs)\" \"Pelant is still out there.\" \"", "You said you hit him.\" \"", "If he's injured, that helps us.\" \"", "But we're still waiting for him to make the next move, and I'm not okay with that.\" \"", "Whatever's next, we'll handle it.\" \"", "We always do.\" \"(", "groans)\" \"(barking)\" \"(dog barking)\" \"(dog whines)\" \"(barking)\" \"== sync, corrected by elderman ==\"" ]

{ "pile_set_name": "OpenSubtitles" }

[ 0.005125773139297962, 0.0008949737530201674, 0.0010964736575260758, 0.020524920895695686, 0.0008848861325532198, 0.004453268367797136, 0.848707914352417, 0.0006562930648215115, 0.0006235375185497105, 0.09185542911291122, 0.0008236906141974032, 0.0011707134544849396, 0.009097924456000328, 0.0017092330381274223, 0.38311251997947693, 0.0007193092023953795, 0.001159975305199623, 0.012521632947027683, 0.0006336958613246679, 0.0007396684377454221, 0.0009838617406785488, 0.0012373810168355703, 0.0007960048387758434, 0.001019997289404273, 0.019069986417889595, 0.0008340973872691393, 0.0009403640287928283, 0.025345008820295334, 0.0033055974636226892, 0.0022556064650416374, 0.0007747591007500887, 0.0008587991469539702, 0.013290554285049438, 0.012221117503941059, 0.000817851338069886, 0.0008194891852326691, 0.10709719359874725, 0.0009737260406836867, 0.0008075439836829901, 0.0007218898390419781, 0.0007657540263608098, 0.001192855997942388, 0.0006453696405515075, 0.009302530437707901, 0.0007837117300368845, 0.1220032125711441, 0.0005327772232703865, 0.0006770654581487179, 0.0007119607180356979, 0.0007468124967999756, 0.0007095598266460001, 0.0008752541616559029, 0.0027344778645783663, 0.0011588234920054674, 0.0018792249029502273, 0.0007550723967142403, 0.0006999229080975056, 0.0017918189987540245, 0.0011852809693664312, 0.0007588124717585742, 0.16817544400691986, 0.0017913738265633583, 0.0005928311729803681, 0.0010382150067016482, 0.0006039942963980138, 0.002082809107378125, 0.0007920597563497722, 0.0007639006362296641, 0.0008645592024549842, 0.0006795141962356865, 0.000999250216409564, 0.3551768362522125, 0.0009946953505277634, 0.0009363710996694863, 0.05194663256406784, 0.0011091574560850859, 0.0006422672886401415, 0.23828616738319397, 0.008197247050702572, 0.0006932528922334313, 0.0006453616661019623, 0.47790080308914185, 0.0006795059889554977, 0.000817956228274852, 0.0007821889594197273, 0.0006052684038877487, 0.0005637398571707308, 0.0006222426891326904, 0.0012455008691176772, 0.000788505538366735, 0.0007149261073209345, 0.0007606162689626217, 0.000708632345777005, 0.0011539546540006995, 0.00196985830552876, 0.0006273746257647872, 0.0035168114118278027, 0.05194603279232979, 0.0018743646796792746, 0.000989836291410029, 0.009888680651783943, 0.06162721663713455, 0.0013796765124425292, 0.0014751702547073364, 0.1775188148021698, 0.0006663866224698722, 0.0011125999735668302, 0.0006704150000587106, 0.0006220037466846406, 0.0009220786159858108, 0.001036019646562636, 0.0007958752103149891, 0.016748322173953056, 0.0008298279135487974, 0.0006114766583777964, 0.0007345949416048825, 0.0006702853715978563, 0.0005571157089434564, 0.0008134879171848297, 0.01967541314661503, 0.0016497272299602628, 0.0006571589619852602, 0.0006412226357497275, 0.0009170848643407226, 0.0009218932827934623, 0.0006404057494364679, 0.003890978405252099, 0.0007003889768384397, 0.0035326569341123104, 0.01367985550314188, 0.0023898999206721783, 0.0006880062283016741, 0.0005877429503016174, 0.0007340962765738368, 0.0007082158117555082, 0.0007749905926175416, 0.0010316063417121768, 0.0008117038523778319, 0.0019526277901604772, 0.0035343440249562263, 0.003247576067224145, 0.0007809722446836531, 0.0008134844829328358, 0.0007837707526050508, 0.0007696478278376162, 0.0005592206143774092, 0.0005767184193246067, 0.0005714295548386872, 0.0010433322750031948, 0.0008059476967900991, 0.0007932006265036762, 0.000639416859485209, 0.0006130618858151138, 0.0006687577697448432, 0.0005970436614006758, 0.24066467583179474, 0.0006688129506073892, 0.0021979683078825474, 0.0007083939271979034, 0.0006142043857835233, 0.0005774078308604658, 0.0008297057938762009, 0.003898181952536106, 0.16773582994937897, 0.19738756120204926, 0.0006706926506012678, 0.0008317555766552687, 0.0006717319483868778, 0.000756401102989912, 0.0007497607148252428, 0.000658024859149009, 0.0007861923659220338, 0.006752584595233202, 0.24515314400196075, 0.0006797618698328733, 0.0005246316432021558, 0.0016277940012514591, 0.004287825431674719, 0.0008010737947188318, 0.001054334337823093, 0.0006269080913625658, 0.004752684850245714, 0.0006297988584265113, 0.0006782185519114137, 0.0007684891461394727, 0.0070707350969314575, 0.0008961695712059736, 0.0007213661447167397, 0.010205099359154701, 0.0006053667748346925, 0.007697573397308588, 0.0005577131523750722, 0.0070798033848404884, 0.0005777535261586308, 0.0007375392597168684, 0.00075644685421139, 0.0008997168042697012, 0.0009586844826117158, 0.02013763226568699, 0.0007016386371105909, 0.0007514377357438207, 0.0005586458137258887, 0.0007916137692518532, 0.0006891920347698033, 0.0007984141120687127, 0.0006441037985496223, 0.0006893214886076748, 0.000755158718675375, 0.0006443908787332475, 0.0006513700354844332, 0.02144707553088665, 0.0009216632461175323, 0.0006527294171974063, 0.001307056751102209, 0.0007721797446720302, 0.0006722756079398096, 0.0008531374623999, 0.0011323133949190378, 0.1723061054944992, 0.0009972858242690563, 0.000646425352897495, 0.0006457779090851545, 0.0007206800510175526, 0.0005864212871529162, 0.0008365269750356674, 0.0006230224389582872, 0.0008848546422086656, 0.0006075979908928275, 0.0006191809079609811, 0.0005489766481332481, 0.021158337593078613, 0.017780732363462448, 0.0007066883845254779, 0.000548672687727958, 0.0008115282980725169, 0.0006301677785813808, 0.07281121611595154, 0.0007732529775239527, 0.0006474210531450808, 0.0006450213259086013, 0.0007900643395259976, 0.000697146519087255, 0.000964950246270746, 0.0005847633583471179, 0.0007149261073209345, 0.0008166186744347215, 0.0007024438236840069, 0.0008166700135916471, 0.0006523621850647032, 0.007074727211147547, 0.0008562959264963865, 0.0007675685337744653, 0.0006345205474644899, 0.0022843186743557453, 0.0009791646152734756, 0.00114382931496948, 0.24437294900417328, 0.0009997868910431862, 0.0008380261133424938, 0.0008379637729376554, 0.0011938723037019372, 0.0007149261073209345, 0.006123884115368128, 0.0008290912955999374, 0.0008904723217710853, 0.09877568483352661, 0.0007925965473987162, 0.001610328326933086, 0.0006859367131255567, 0.013378667645156384, 0.004308953415602446, 0.0007221681298688054, 0.0007300357101485133, 0.0009565408108755946, 0.013561269268393517, 0.000633685034699738, 0.0009668325074017048, 0.06744378060102463, 0.012139253318309784, 0.0005795045872218907, 0.0006890718941576779, 0.000605476729106158, 0.0005727425450459123, 0.0010456707095727324, 0.0006161676719784737, 0.0008311737328767776, 0.032071568071842194, 0.007351158652454615, 0.0009026156039908528, 0.001166921341791749, 0.13573633134365082, 0.0007145392009988427, 0.0006701307720504701, 0.0009710666490718722, 0.0007643065764568746, 0.01856893114745617, 0.0005723482463508844, 0.009789550676941872, 0.0011148342164233327, 0.0008103927248157561, 0.0009586945525370538, 0.0010227394523099065, 0.00975498091429472, 0.0005846081185154617, 0.02950930967926979, 0.020001661032438278, 0.020001661032438278, 0.020001661032438278, 0.0018748198635876179, 0.0009256881894543767, 0.001604916644282639, 0.0006755318026989698, 0.0006930348463356495, 0.0008827211568132043, 0.004398028366267681, 0.0006847659242339432, 0.05131334066390991, 0.0005830031004734337, 0.000998054863885045, 0.0012969940435141325, 0.0008010737947188318, 0.623483419418335, 0.02433669939637184, 0.25750309228897095, 0.011410591192543507, 0.0014248995576053858, 0.0007369255763478577, 0.0008812680607661605, 0.0006090906681492925, 0.0005926125450059772, 0.0007401679758913815, 0.0013445651857182384, 0.0005519359838217497, 0.16184711456298828, 0.058333199471235275, 0.0006090062670409679, 0.06764702498912811, 0.004866447299718857, 0.0009647286497056484, 0.0009252536110579967, 0.004108397755771875, 0.007125900126993656, 0.011155936866998672, 0.000666111009195447, 0.0364161916077137, 0.0009252536110579967, 0.03624127432703972, 0.053354162722826004, 0.0008965296437963843, 0.004932096228003502, 0.011828732676804066, 0.0008780992939136922, 0.0009889426873996854, 0.0014096273807808757, 0.000674985465593636, 0.0006646090769208968, 0.0006682328530587256, 0.0006905648042447865, 0.0009186345851048827, 0.001016095862723887, 0.0013085065875202417, 0.0012207889230921865, 0.0006492636748589575, 0.0009955210844054818, 0.0011251018149778247, 0.0027067852206528187, 0.0008048851159401238, 0.0007473371806554496, 0.0007676990353502333, 0.0026499887462705374, 0.000781067181378603, 0.8867661952972412, 0.001860221615061164, 0.0009891960071399808, 0.0009385487646795809, 0.010805286467075348, 0.0007589708548039198, 0.0006264909170567989, 0.0007229107432067394, 0.0007280909921973944, 0.0007142563117668033, 0.0009078294970095158, 0.000954317394644022, 0.0016807687934488058, 0.000912305957172066, 0.0008055054349824786, 0.0007572402828373015, 0.0007029487169347703, 0.0011906338622793555, 0.0005705024814233184, 0.0006543397903442383, 0.006101866718381643, 0.12565727531909943, 0.0006587234674952924, 0.0020660264417529106, 0.0006473461398854852, 0.0006731597241014242, 0.0010151042370125651, 0.0008041023975238204, 0.0007149261073209345, 0.0008010737947188318, 0.0008426989079453051, 0.0006628534174524248, 0.0008723227074369788, 0.002676307922229171, 0.0008093478973023593, 0.0007847714587114751, 0.000643421895802021, 0.0005732944118790329, 0.0006307926960289478, 0.0008126217289827764, 0.0006945324712432921, 0.0037128084804862738, 0.0007448394317179918, 0.0006308068404905498, 0.0006843367009423673, 0.000712903740350157, 0.5423274636268616, 0.0019289384363219142, 0.0006472168606705964, 0.0006131533882580698, 0.0008514263899996877, 0.0007784312474541366, 0.0008894746424630284, 0.0008878121734596789, 0.0006983594503253698, 0.005869563203305006, 0.005367850884795189, 0.0006675600307062268, 0.0008657214348204434, 0.021578343585133553, 0.001607295940630138, 0.0006919825682416558, 0.0008715952280908823, 0.0008303879876621068, 0.016303250566124916, 0.0006871454534120858, 0.0006534187705256045, 0.09277216345071793, 0.0006574872531928122, 0.008155306801199913, 0.0007234079530462623, 0.005105078220367432, 0.006986634340137243, 0.000592543394304812, 0.0007129448349587619, 0.0008054667268879712, 0.000760168768465519, 0.0007559925434179604, 0.003687818069010973, 0.0006027320050634444, 0.0006099769379943609, 0.006479116156697273, 0.0006637779879383743, 0.0576593391597271, 0.0005864014383405447, 0.03583301603794098, 0.0006075800629332662, 0.0009299309458583593, 0.0007418338791467249, 0.0006358684040606022, 0.0008650078671053052, 0.03365581855177879, 0.0007153741898946464, 0.043772369623184204, 0.001177250873297453, 0.019151685759425163, 0.41712626814842224, 0.001404946786351502, 0.0009252536110579967, 0.0009252536110579967, 0.0013444192009046674, 0.0006379541591741145, 0.0008433620096184313, 0.0007192210759967566, 0.0007162965484894812, 0.0010137013159692287, 0.0007925409590825438, 0.001027420163154602, 0.0006031920202076435, 0.000725498131942004, 0.0028070947155356407, 0.0007552860770374537, 0.0007955964538268745, 0.0008010737947188318, 0.0012024552561342716, 0.0007129581063054502, 0.001459872117266059, 0.0007309556240215898, 0.000912305957172066, 0.0006778970710001886, 0.0008441177778877318, 0.00791421439498663, 0.0007088441052474082, 0.0006919825682416558, 0.0006919825682416558, 0.0014968450414016843, 0.0008449116139672697, 0.0009548554662615061, 0.0005686135264113545, 0.0008995539974421263, 0.0015136379515752196, 0.0008441177778877318, 0.0005837868666276336, 0.0007428108365274966, 0.0006567247910425067, 0.0007466146489605308, 0.0006878784042783082, 0.0006974356365390122, 0.022742584347724915, 0.0007263735751621425, 0.0022238472010940313, 0.0006554475985467434, 0.009717282839119434, 0.011982858180999756, 0.0009319413220509887, 0.0006974356365390122, 0.0011789011768996716, 0.0007173194899223745, 0.0006359432591125369, 0.0031517029274255037, 0.0007149261073209345, 0.0006974356365390122, 0.9286264777183533, 0.0006010474171489477, 0.0007403651834465563, 0.0006661186343990266, 0.0007106743869371712, 0.0006413060473278165, 0.0007813709671609104, 0.000654337927699089, 0.0006545740179717541, 0.0032816489692777395, 0.01900908537209034, 0.0009183072834275663, 0.0012577782617881894, 0.0008441177778877318, 0.0005686040967702866, 0.0011610276997089386, 0.0007345350459218025, 0.009619532153010368, 0.01082564052194357, 0.0006919825682416558, 0.0006606426322832704, 0.0006859576678834856, 0.0010283025912940502, 0.0007293503731489182, 0.0008613954414613545, 0.0011053101625293493, 0.0011697141453623772, 0.0005973487277515233, 0.0006911494419910014, 0.07139444351196289, 0.010502745397388935, 0.1176425963640213, 0.0006971422699280083, 0.002522371942177415, 0.0009515877463854849, 0.026197761297225952, 0.026197761297225952, 0.0015730282757431269, 0.000711631728336215, 0.0009527793736197054, 0.0018655093153938651, 0.007314491551369429, 0.001120882690884173, 0.001084077637642622, 0.003087251912802458, 0.0006227632984519005, 0.0006216469337232411, 0.06849922239780426, 0.09678108990192413, 0.026197761297225952, 0.0019715023227036, 0.0009204117814078927, 0.0015730282757431269, 0.0039886790327727795, 0.0012125837383791804, 0.0007626278093084693, 0.0008637221762910485, 0.014352280646562576, 0.0009029075736179948, 0.9154341220855713, 0.0007192663033492863, 0.0008234174456447363, 0.0007872123387642205, 0.0006049394141882658, 0.0008779428899288177, 0.0007164948619902134, 0.0007345840567722917, 0.0007504218956455588, 0.000618562160525471, 0.0006859576678834856, 0.0007357649155892432, 0.004302979912608862, 0.0010007246164605021, 0.0007430103723891079, 0.0012414745287969708, 0.0008243332849815488, 0.0007861722260713577, 0.0018113815458491445, 0.000756401102989912, 0.0006807787576690316, 0.0009231677977368236, 0.05098696053028107, 0.0006977993180043995, 0.00215812842361629, 0.000649457739200443, 0.000690460903570056, 0.0011088422033935785, 0.0014618870336562395, 0.010284111835062504, 0.0018184107029810548, 0.0006975409924052656, 0.003460097359493375, 0.0007745517650619149, 0.0015980356838554144, 0.0008270268444903195, 0.008964099921286106, 0.0011419049696996808, 0.0019674384966492653, 0.004424652084708214, 0.0007243672152981162, 0.0013390469830483198, 0.0017901090905070305, 0.12521497905254364, 0.026023773476481438, 0.0006224306998774409, 0.0019516169559210539, 0.0009592647547833622, 0.0007497607148252428, 0.0006745657883584499, 0.0009252536110579967, 0.0007662306888960302, 0.0006452291272580624, 0.0007238493417389691, 0.0007063560769893229, 0.0006596714956685901, 0.000710067804902792, 0.0007785874186083674, 0.0007596344221383333, 0.0006152387359179556, 0.0007256935350596905, 0.0007570807938463986, 0.0009177142637781799, 0.0006842727889306843, 0.000673568167258054, 0.0006259582005441189, 0.0006149353575892746, 0.0007681011338718235, 0.0005593242822214961, 0.0006654343451373279, 0.000806340656708926, 0.0006090514943934977, 0.000620686449110508, 0.0012108790688216686, 0.0005704929935745895, 0.0005884584388695657, 0.0007108806748874485, 0.0007149261073209345, 0.0015067510539665818, 0.006925770081579685, 0.0011325916275382042, 0.0007889745174907148, 0.0006723989499732852, 0.0007770661031827331, 0.026150614023208618, 0.0016779372235760093, 0.0005694455467164516, 0.0012071552919223905, 0.008821909315884113, 0.001337488298304379, 0.0006729525630362332, 0.0007174250786192715, 0.003592887194827199, 0.0007885713130235672, 0.0006526671932078898, 0.00536084221675992, 0.0006641377112828195, 0.0007047359831631184, 0.0007149261073209345, 0.000654521572869271, 0.0006856801919639111, 0.08018456399440765, 0.08034960925579071, 0.0006167422397993505, 0.0010462312493473291, 0.015932582318782806, 0.0011185425100848079, 0.002422292483970523, 0.0006833590450696647, 0.0005767821567133069, 0.004460311494767666, 0.0006941876490600407, 0.0008357816841453314, 0.005505876149982214, 0.0008471914334222674, 0.0009857217082753778, 0.0005746276001445949, 0.0006485530757345259, 0.0007513320888392627, 0.0008909913594834507, 0.004661010578274727, 0.0008126217289827764, 0.0009256881894543767, 0.0008879068773239851, 0.0006868783966638148, 0.0012701910454779863, 0.0006020020227879286, 0.0008126217289827764, 0.06229739263653755, 0.0027126302011311054, 0.005050093401223421, 0.0009556325967423618, 0.6429134607315063, 0.0011065476574003696, 0.018544679507613182, 0.001456051249988377, 0.0153196407482028, 0.0016191963804885745, 0.0007634814246557653, 0.0007573722978122532, 0.0007061400101520121, 0.00190616468898952, 0.0007455552695319057, 0.0006953563424758613, 0.000654641364235431, 0.0007951318984851241, 0.0010672203497961164, 0.0006498737493529916, 0.0008864368428476155, 0.0007947955746203661, 0.0007974116015248001, 0.0014017565408721566, 0.0012157416203990579, 0.0008297137101180851, 0.0007347052451223135, 0.0008613552199676633, 0.0007598193478770554, 0.0007689876365475357, 0.0006802252028137445, 0.0012348543386906385, 0.0006364301079884171, 0.0008307232055813074, 0.0008653145050629973, 0.0006960505270399153, 0.0006196756730787456, 0.0007527773268520832, 0.0008110296912491322, 0.0007930917199701071, 0.00061638472834602, 0.0007041767239570618, 0.0008323208894580603, 0.04207741096615791, 0.0006216321489773691, 0.0006492463289760053, 0.0006367820897139609, 0.0006371669587679207, 0.0008135367534123361 ]

[ "(M1.PH.44)\nA 62-year-old male is rushed to the emergency department (ED) for what he believes is his second myocardial infarction (MI). ", "His medical history is significant for severe chronic obstructive pulmonary disease (COPD) and a prior MI at the age of 58. ", "After receiving aspirin, morphine, and face mask oxygen in the field, the patient arrives to the ED tachycardic (105 bpm), diaphoretic, and normotensive (126/86). ", "A 12 lead electrocardiogram shows ST-elevation in I, aVL, and V5-V6. ", "The attending physician suspects a lateral wall infarction. ", "Which of following beta-blockers should be given to this patient and why?", "\nReview Topic" ]

{ "pile_set_name": "Pile-CC" }

[ 0.021523872390389442, 0.00113042036537081, 0.0010553699685260653, 0.0006762422854080796, 0.0015670603606849909, 0.0024661992210894823, 0.0006430559442378581 ]

[ "Fianna Fáil and Fine Gael/Labour governments are known quantities. ", "The civil service really runs the State, using elected politicians as spokesmen - and it is usually men - and change comes at a snail’s pace. ", "As soon as one of the parties get too big for its boots, we switch to the other, and the cycle continues.", "\n\nAs the current Government argues that our choice is stability or chaos, we are at risk of returning to this tired formula at this month's General Election, and for the foreseeable future. ", "Insider would argue that this “stability” also comes with risks – Fianna Fáil brought the country to its knees through cutting taxes and increasing spending, while Fine Gael was calling from the sidelines for even lower taxes and even higher spending!", "\n\nSo what is the alternative? ", "The political Left in Ireland is often written off as the “loony left” - well meaning, but unable to govern ,and not credible on the economy. ", "This political narrative is unusual in Europe, where there are typically large centre-left parties that lead governments. ", "Galway West could lead the country in showing this is possible in Ireland - we are unique in having many credible centre-Left candidates in Seamus Sheridan (Green Party ), Niall Ó Tuathail (Social Democrats ), Catherine Connolly (Independent ), and Trevor Ó Clochartaigh (Sinn Féin ).", "\n\nAs a result, Insider will try to divine what a resultant centre-Left programme for government could look like, and how Galway’s candidates would represent this.", "\n\nPublic services\n\nA common belief across the Left is that the basic public services – health, education, childcare, and housing – should be mostly financed and run by government. ", "How would Team Galway contribute?", "\n\nNiall Ó Tuathail has experience in major health reform in the NHS in England and has outlined detailed policy on how to fix the Irish health service. ", "He also has former minister of state at the department of health Róisín Shortall as a party leader. ", "Independent Catherine Connolly is a clinical psychologist who has also spent many years challenging the local HSE leadership in her role as a councillor.", "\n\nInsider would argue that a smart investment in our public services would create a fairer society and is in everyone’s long-term interests – even those paying the most tax. ", "For example, for every euro invested in primary care we save six euros in hospitals. ", "This would be better for our health and better for our pockets.", "\n\nSupporting business and the marginalised\n\nIn politics, you are either pro-society or pro-business. ", "Anyone outside politics knows that to have a strong society you need to have strong businesses. ", "So how does the Galway Left stack up on business?", "\n\nSeamus Sheridan is arguably the most credible business candidate in the country on business. ", "He and his brother have built cheese empire Sheridan’s over the past few decades, employing more than 100 people. ", "Ó Tuathail is more recently on the entrepreneurial path, setting up a software design firm working in healthcare and news. ", "Previously, he worked at McKinsey & Company, a prestigious consulting firm trusted for advice by CEOs and governments across the world.", "\n\nWith two TDs with real experience of starting businesses, Ireland could better support Irish businesses to get set up and improve our society by providing jobs, improving our quality of life with products and services, and paying taxes.", "\n\nThe Left argues there is a minimum standard below which no person should have to live, and therefore aims to protect the most marginalised in society. ", "What are the credentials of the Galway candidates on these issues?", "\n\nSen Trevor Ó Clochartaigh has a credible track record of raising the issues of Traveller ethnicity, direct provision, and campaigning for the survivors of State institutions in the Seanad. ", "Cllr Connolly has been outspoken on supporting victims of domestic violence and single mothers. ", "All four candidates canvassed for a Yes during the recent marriage referendum, with Ó Tuathail leading the Yes Equality campaign in Galway.", "\n\nThe environment and Gaeilge\n\nStorm Imogen was the ninth storm this year – an average of one every four days. ", "This is not normal and Insider believes climate change must be tackled. ", "A Green TD like Seamus Sheridan in government would force the environment up the agenda – not just climate change but other local environmental issues such as large-scale fish farms and sustainable agriculture. ", "Cllr Connolly has been a relentless campaigner against a new road for Galway, in favour of improving public transport first.", "\n\nDepending on who you talk to, the Irish language is somewhere between on the edge of extinction and potentially on the cusp of a mini-revival. ", "Wherever we are on this, most would agree the language needs some support to survive and thrive. ", "Three of our candidates – Ó Clochartaigh, Connolly, and Ó Tuathail - are Gaeilgeoirs, with Trevor being the Sinn Féin spokesman for the language and Gaeltacht. ", "With such a team in government, we would have strong advocates for our native tongue in the Dáil.", "\n\nThe catch - no massive tax cuts\n\nThere is always a catch! ", "With an emphasis on State-funded public service, such a government would not be able to promise the short-term tax cuts on offer from Fianna Fáil, Fine Gael, and Labour.", "\n\nWhat would Insider say to those who turn red looking at their paycheck each month? ", "She would ask them to take the short-term pain for long-term gain. ", "Investing smartly in our public services will reduce the long-term cost of the services and improve the value for money we get from our taxes. ", "Supporting local businesses will provide employment and make our economy less dependent on multinationals. ", "Protecting the most marginalised will allow us to create a more equal society that will be a source of pride and will reduce future costs for the State. ", "Ireland playing a leading role in tackling climate change globally could secure our environment for future generations. ", "Keeping our teanga beo will allow future generations the option of making it the main language on this island.", "\n\nGalway West can lead the State in returning a majority of credible centre-left TDs with integrity and competence – Insider recommends we do it!" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0007051068241707981, 0.0006810698541812599, 0.0006489181541837752, 0.0005822053644806147, 0.0010713509982451797, 0.0008387095294892788, 0.0008447759319096804, 0.00062540452927351, 0.0006633856100961566, 0.0005814356845803559, 0.0006591640412807465, 0.000686177343595773, 0.0006933714612387121, 0.0006528389640152454, 0.0006296298815868795, 0.0006395012605935335, 0.0009619587217457592, 0.0005812869057990611, 0.0034694718196988106, 0.0005814855685457587, 0.0008474200149066746, 0.0005820836522616446, 0.0006765942671336234, 0.0007019533077254891, 0.0005773899029009044, 0.000590388779528439, 0.0012962926412001252, 0.0006323318229988217, 0.0006673106690868735, 0.0021054567769169807, 0.0006233969470486045, 0.0008368849521502852, 0.0006449539796449244, 0.0006588217802345753, 0.0006583011127077043, 0.0007448888500221074, 0.0005098223336972296, 0.0020588100887835026, 0.0005202915635891259, 0.0023332650307565928, 0.0009194183512590826, 0.005801124032586813, 0.0008953021024353802, 0.000677068717777729, 0.0005375250475481153, 0.0009424099116586149, 0.0005711907288059592, 0.0007658766699023545, 0.0005599320866167545 ]

[ "Q:\n\nhow to trigger the click event without clear default click event on jstree \n\nusing jstree, i use the next code to Trigger click , but , i can not see the defalut click event, like : the blue background when i click , \nthis is my code :\n<div id=\"wrap\">\n <div id=\"header\">header</div>\n <div id=\"main\">\n <div id=\"demo1\" style=\"float:left;width:50%;\">\n <ul>\n <li>\n <a id='a' href=\"\">aaa</a>\n <!-- ", "UL node only needed for children - omit if there are no children -->\n <ul>\n <li><a id=\"a_1\" href=\"#\"> bbb</a></li>\n <li><a id=\"a_2\" href=\"#\"> ccc</a></li>\n </ul>\n </li>\n </ul>\n\n </div>\n <div id=\"content\">www</div>\n </div>\n</div>\n\n<div id=\"footer\">\n footer\n</div>\n<script type=\"text/javascript\">\n $(function () {\n $(\"#demo1\").jstree({\n \"themes\": {\n \"theme\": \"default\",\n \"dots\": true,\n \"icons\": true,\n \"url\": \"themes/default/style.css\"\n },\n\n \"plugins\" : [ \"themes\", \"html_data\" ]\n });\n $('#a_1').click(function(){\n $('#content').html('bbb \\'s content')\n //return false;\n })\n $('#a_2').click(function(){\n $('#content').html('ccc \\'s content')\n //return false;\n })\n});\n</script>\n\ni find some code like this :\n.bind(\"create.jstree\", function (e, data) {\n alert(data)\n })\n\nits mean is : alert data when someone cerate a new file ,\nso\ndoes jstree has a method like \"click.jstree\" ?", "\nthanks\n\nA:\n\nWhat you have is fine on the events side, you're just missing a plugin...in the new 1.0 model the ui bits are a separate plugin, if you just change your plugins from this:\n\"plugins\" : [ \"themes\", \"html_data\" ]\n\nTo this:\n\"plugins\" : [ \"themes\", \"html_data\", \"ui\" ]\n\nYou'll get the current node selection coloring, you can give it a try here.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0008297587628476322, 0.0016821030294522643, 0.0005628695362247527, 0.001995444530621171 ]

[ "Q:\n\nCannot create JavaScript breakpoints in Visual Studio 2017\n\nI cannot insert breakpoints into JavaScript files in visual studio 2017. ", "Anyone else having this issue and has anyone found a solution?", "\nedit:\nThe other questions were related to breakpoints not being HIT. ", "I can't even insert breakpoints into JS to begin with. ", "The option is not in the context menu in Visual Studio.", "\nedit 2: Even if I create a brand new JS file (since this project was created in VS2015) I still can't insert a breakpoint. ", "The option just isn't listed in the context menu. ", "\n\nA:\n\nI test it using a simple JavaScript app in VS2015 and VS2017 Enterprise version.", "\nIt really has this menu item in VS2015, but not in VS2017:\nVS2015:\n\nVS2017:\n\nOne workaround is that just as Jimmy's suggestion, use the F9 or add it in A with mouse in above screen shot.", "\nOther community members also submitted this feedback to the product team here:\nhttps://developercommunity.visualstudio.com/content/problem/25474/right-click-add-breakpoint-option-not-in-list.html\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007090690778568387, 0.0007462443900294602, 0.0006414317176677287, 0.0006506103090941906, 0.000615266035310924, 0.0006158606265671551, 0.0005981412250548601, 0.000588960072491318, 0.0007095301407389343, 0.0005738364416174591 ]

[ "To continue, please select:\n\nYour information has been submitted successfully!", "\n\nCONSUMER GOODS\n\nConnected Vending Quenches Consumers’ Thirst\n\nThe Challenge\n\nAs soda sales in retail outlets wane, beverage distributors must find new channels to get products to consumers. ", "One major global food and beverage company also saw an opportunity to improve the profitability of its vending machines, soda fountains and coolers by relying on the Internet of Things (IoT) technology.", "\n\nThe company asked Cognizant to help address challenges such as out-of-stock situations and equipment theft. ", "It also wanted to increase insights about consumer behavior and lower restocking costs.", "\n\nOur Approach\n\nCognizant managed a multivendor effort to build an equipment network that would leverage connected services. ", "We also oversaw technology prototyping and selection. ", "Our recommendation: an IoT technology solution that included both data analytics and software to interpret sensor data, which could in turn send automated alerts to management.", "\n\nNow, when supplies in individual locations are low, the company’s new IoT solution automatically orders new products and its drivers avoid visiting locations that have sufficient supply. ", "Sensors issue alerts on potential malfunctions in equipment. ", "If equipment is moved, security personnel are able to constantly monitor its location.", "\n\nCan Do: Smart Vending Machines Stay Stocked and Safe\n\nBetter intelligence about vending equipment means the beverage company can optimize the product mix in any given location while preventing stock-outs. ", "Sensors in the equipment recognize potential malfunctions and flag possible theft, which also lessens downtime, enables preventive maintenance and lowers costs." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005289513501338661, 0.0006142043857835233, 0.0005659442394971848, 0.0006481613381765783, 0.0008309662225656211, 0.0005705579533241689, 0.0005732313147746027, 0.0005475367070175707, 0.0006301782559603453, 0.0007585847633890808, 0.0006331176264211535, 0.0006440510624088347, 0.0009244283428415656 ]

[ "Ever wanted your own self-driving car? ", "You can buy one today—but it may be a while until it officially becomes your personal chauffeur.", "\n\nTesla recently announced that all vehicles currently in production have full self-driving hardware pre-installed. ", "To illustrate, they released a video from the driver’s perspective “behind the wheel” of a self-driving Tesla in action.", "\n\nWhile private companies make headlines publicly testing fully autonomous vehicles, no one has yet offered a product anybody can buy. ", "Tesla is closer, but not quite there yet either.", "\n\nWe’re still a ways away from a fully worked out set of laws and regulations. ", "And the software still needs perfecting before it takes over the wheel of thousands of cars. ", "But over time, the regulatory environment will be forced to adapt as more cars hit the road and other companies follow in Tesla’s footsteps. ", "Most of the big automakers are also working on their own tech.", "\n\nOnly time will tell how that unfolds.", "\n\nRegulations aside, you can still buy a Tesla today in anticipation of the day a software update makes it self-driving. ", "Or for a first-person taste of the future, you can take a ride in a self-driving Tesla right now in the video below.", "\n\nImage credit: Tesla/Vimeo" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.01021498255431652, 0.0017785826930776238, 0.0006031140801496804, 0.0006728862063027918, 0.0005816923221573234, 0.0008578941342420876, 0.0006052344106137753, 0.0009489408112131059, 0.0005875664646737278, 0.0007188924355432391, 0.0006909327930770814, 0.0007832007249817252, 0.0006716467905789614, 0.0006162510835565627 ]

[ "Wernicke\\'s encephalopathy (WE) is a potentially fatal, neuropsychiatric syndrome and absolutely a neurological emergency caused most commonly by thiamine deficiency\\[[@CIT0001]\\]. ", "It is recognized by the constellation of symptoms including ataxia, confusional state, and diplopia. ", "The disorder is still significantly missed, leading to death or to the chronic form of the encephalopathy recognized as Korsakoff\\'s syndrome\\[[@CIT0002]\\]. ", "Herein, we describe the disease in a girl who suffered from acute myeloblastic leukemia (AML).", "\n\nA 12-year-old female, known case of AML M4 was consulted due to mild confusion, diplopia, and ataxia. ", "Her disease had started 6 months prior to admission. ", "She had received bone marrow transplantation from her brother 40 days before. ", "On neurological examination, she was mildly confused with right sixth nerve palsy and truncal ataxia; also, she demonstrated gait ataxia and impaired finger to nose test prominently on the right side. ", "For the better evaluation, brain MRI was recommended. ", "On T2 weighted axial brain MRI ([Fig. ", "1](#F0001){ref-type=\"fig\"}), parts A and B), hyperintense lesions in middle cerebellar peduncles, and similar intensities in the tectum and tegmentum of midbrain on the left side were detected; furthermore, on brain T1 weighted MRI with contrast ([Fig. ", "1](#F0001){ref-type=\"fig\"}, part C), severely intense enhancement in mammillary bodies was seen; on the other hand, diffusion weight brain MRI revealed hyperintense lesions in the medial portions of thalami ([Fig. ", "1](#F0001){ref-type=\"fig\"}, part D).", "\n\n{#F0001}\n\nAccording to the clinical findings in conjunction with imaging studies, the diagnosis of WE was made and thiamin was started. ", "In the next day visit, ocular palsy had resolved completely.", "\n\nWe believe that malnutrition stemming from persistent loss of appetite as a result of the chemotherapeutic agents or the leukemia itself may have provoked thiamin deficiency and had caused WE.", "\n\nThe clinical settings in which WE takes place is growing; conspicuously, in conditions like alcohol consumption, prolonged feeding through parenteral routes, hyperemesis gravidarum, AIDS, anorexia nervosa, thyrotoxicosis, malabsorption states, dialysis, malignancy, and gastroplasty with postoperative vomiting\\[[@CIT0003]\\].", "\n\nPreviously, few authors have described the association of acute lymphoblastic leukemia (ALL) and Wernicke\\'s encephalopathy\\[[@CIT0004]--[@CIT0009]\\]; likewise, on the subject of AML, the reports are scarce, too\\[[@CIT0010], [@CIT0011]\\]. ", "Baek et al\\[[@CIT0010]\\], described a case of acute WE arising following allogeneic peripheral blood stem cell transplantation accompanying with prolonged administration of total parenteral nutrition. ", "Also, Pitella et al\\[[@CIT0011]\\] reported a 30-year-old female suffering from WE associated with promyelocytic leukemia which was detected at autopsy.", "\n\nIn WE, characteristic radiologic findings on brain MRI consist of symmetric signal changes in the thalami, mamillary bodies, tectal plate, and periaqueductal area\\[[@CIT0012]\\]. ", "Atypical MRI findings comprise symmetric alterations of the cerebellum, vermis of cerebellum, cranial nerve nuclei, red nuclei, dentate nuclei, caudate nuclei, splenium, and cerebral cortex\\[[@CIT0012]\\].", "\n\nIn conclusion, the possible occurrence of Wernicke\\'s encephalopathy should be regarded in young patients encountering confusion or other neurological deficits who are suffering from malignancies especially when concurrent chemotherapy is administrated. ", "It is significant that clinical suspicion is of utmost importance in the diagnosis and treatment of WE since delayed diagnosis may potentially cause devastating results.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.033172350376844406, 0.004462177399545908, 0.003353228559717536, 0.0012948366347700357, 0.004477737937122583, 0.00171164539642632, 0.000810353783890605, 0.002164987148717046, 0.0006952533149160445, 0.0007301734294742346, 0.0009036171832121909, 0.000679994816891849, 0.0006488828803412616, 0.0019055769080296159, 0.0006733121117576957, 0.0006360547849908471, 0.0011884005507454276, 0.0020432325545698404, 0.001556182629428804, 0.0006557363667525351, 0.005472720135003328, 0.0009119188180193305, 0.0010400970932096243, 0.0008858715882524848, 0.00054416578495875, 0.001995444530621171 ]

[ "The invention relates to an improved container construction and more particularly to a four-sided plastic box and lid particularly useful in automatic packaging operations.", "\nWhen packaging small hardware items for sale particularly at consumer outlets, it is desirable to utilize packages which may be conveniently suspended from display racks. ", "Additionally, the packages may include a window so that the contents of the package are viewable by the potential customer. ", "Another feature desired in such packages is compatibility with automatic filling equipment. ", "Thus, a container may be automatically filled with materials at one station and moved to a distinct station where a lid for the container is positioned and attached to the container.", "\nVarious prior art packaging items and equipment have been suggested to accomplish the desired objectives. ", "The present invention constitutes an improvement over such prior art." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0006011706427671015, 0.0005630929954349995, 0.000535256345756352, 0.0005687650409527123, 0.0005376865155994892, 0.0005438790540210903, 0.0006775608635507524 ]

[ "Mulugeta Buli\n\nMulugeta Buli (1917–1960), was an Ethiopian military general and politician.", "\n\nBiography \nAfter completing mission school Buli attended the Tafari Makonnen School and the Holeta Military Academy, and was the only Oromo officer cadet in the latter institution. ", "He was an opponent of Italian fascism, and fled to Kenya and Djibouti during the Italian occupation of Ethiopia. ", "He fought in the Battle of Maychew as an officer in Haile Selassie's elite Guard contingent which was better trained and equipped than most other Ethiopian units. ", "As commander of the Imperial Body Guard from 1941 until 1955, he established the Kagnew Battalions and the Ethiopian Public Security Department. ", "He served as chief of staff of the armed forces, chief of staff of the emperor, and as a member of the Ethiopian government, in which capacity he created a private security cabinet for Emperor Selassie.", "\n\nOrganizers of the 1960 Ethiopian coup attempt wanted Buli to become Chief of Staff because of his popularity among members of the armed forces. ", "After refusing he was taken hostage (along with 20 other government officials) by the rebels. ", "When it became apparent that the take-over was doomed to fail General Buli was killed with 14 others on 17 December 1960 by forces under Brigadier-General Mengistu Neway, a leader of the coup - and a fellow veteran of the battle of Maychew.", "\n\nIvo Strecker of Johannes Gutenberg-Universität Mainz called Buli \"one of the most charismatic figures among the young Ethiopian elite\" of his era. ", "Author Bahru Zewde suggests that Buli was rumoured to be engineering a coup of his own to depose Selassie in the early 1950s, but had never substantiated these rumours. ", "There is now a technical college in Addis Ababa named in honour of Buli.", "\n\nReferences \n\nCategory:Ethiopian generals\nCategory:1917 births\nCategory:1960 deaths" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0014694675337523222, 0.0006291074096225202, 0.0034458928275853395, 0.0010536832269281149, 0.0006390577182173729, 0.0007473724544979632, 0.0006794817745685577, 0.0012368448078632355, 0.0023660766892135143, 0.0006642462685704231, 0.0009553172276355326, 0.0006709141889587045, 0.0006019489374011755 ]

[ "Section: Development\nPriority: optional\nHomepage: https://buck.build\nStandards-Version: 3.9.2\n\nPackage: buck\nVersion: v<VERSION>\nMaintainer: team@buckaroo.pm\nRecommends: watchman, nailgun\nDepends: openjdk-8-jre-headless, python3, python3-distutils\nArchitecture: all\nCopyright: LICENSE\nReadme: README.md\nChangelog: Changelog\nFiles: buck /usr/local/bin\nDescription: A fast build system that encourages the creation of small, reusable modules over a variety of platforms and languages. ", "https://buck.build\n" ]

{ "pile_set_name": "Github" }

[ 0.0006786142475903034, 0.0013101415242999792 ]

[ "While fans are still reeling from the October announcement that Rage Against the Machine frontman Zack de la Rocha is quitting the band over artistic differences, Rage releases a towering collection of cover tunes as their swan song.", "\n\nIn this 14-song collection, Rage covers Springsteen, the Stooges and Cypress Hill as well as Bob Dylan and the Rolling Stones. ", "Under the direction of wonder producer Rick Rubin, the band attempts to get at each song’s essence not through imitation, but interpretation.", "\n\nOn this record, the Rage boys prove to be innovative stylists.", "\n\nTheir thrash ‘n’ burn version of Dylan’s “Maggie’s Farm” is outstanding, as Rage adjusts the tempo and arrangement to reflect the song’s angry-no-more roar.", "\n\nThey do the same for the Stones’ “Street Fighting Man,” again wresting possession of a well-known song from the originator and claiming it as their own.", "\n\nBut their cover of Detroit’s MC5’s “Kick Out Jams” doesn’t equal the original’s hard-core center. ", "Still that’s a small complaint for a great rock album that at least for now is going to be the final studio opus from the broken down Machine.", "\n\nNINE INCH NAILS\n\n“Nineinchnails: Things Falling Apart”\n\nNothing Records\n\nFor five years there wasn’t an electronic, metallic, or even gothic peep out of Nine Inch Nails, making many believe the band was unofficially deceased. ", "Then in 1999 all that changed. ", "The band released the incredible double disc “The Fragile” with which Trent Reznor and company reclaimed and polished NIN’s reputation as one of the sharpest blades in cutting edge music.", "\n\nA year, a successful world-wide tour and a pair of Grammy nominations later, Reznor – a studio rat at heart – has taken the time to produced “Nineinchnails: Things Falling Apart,” a re-mixed inside-out retooling of some of the excellent “Fragile” pieces.", "\n\nThe new record includes six of the original’s best, as well as a cover of Gary Numan’s “Metal” and Trent’s own “The Great Collapse” (a song written for “The Fragile” that didn’t make the final cut).", "\n\nFor most bands this would be unusual, but in fact it’s the third time Reznor has re-examined his work in re-mixed versions.", "\n\nUnfortunately, on “Thing’s Falling Apart,” the re-mixes are less auspicious than either “Fixed” or “Further Down the Spiral” – his past re-mix efforts. ", "The new disc is further sucked down the spiral by three separate versions of “Starf-kers, Inc.” none of which tops the original featuring Marilyn Manson.", "\n\nThe basic problem is this disc never comes close to bettering “The Fragile,” making Reznor seem rather like an artist who paints a mustache on the Mona Lisa because he doesn’t know when to lay the brush down.", "\n\nSTEVIE RAY VAUGHAN and DOUBLE TROUBLE\n\n“SRV”\n\nLegacy/Epic\n\nEyes clamped shut, his face contorted in the classic ugly face and his fingers flying in the high stratospheric range of his beat-up Fender Stratocaster is how you want to remember Stevie Ray Vaughan, the Texas guitar slinger, dead 10 years now.", "\n\nThe helicopter crash that took the man’s life didn’t stop his music, which has remained in catalog since and is now being celebrated on a terrific four-disc tribute “SRV.”", "\n\nThe set’s 54 tracks are gleaned from Vaughan’s performances and studio work with his band Double Trouble between ’77 and his final concert at Alpine Valley in Wisconsin August 25, 1990, the night of his death. ", "While the studio work is interesting and a pleasure to listen to, Vaughan was a player who lived for the stage. ", "His Carnegie Hall tracks and the trio of Alpine Valley songs are testament to that.", "\n\nWhile the three discs of music are all very fine, it’s the brief fourth disc fans will appreciate most. ", "Here Vaughan is captured on a DVD featuring five un-aired, never released TV performances from the PBS music series “Austin City Limits.”", "\n\nCollections such as this have in the past relied on liner notes and photographs to bring their subjects to life. ", "On “SRV,” the inclusion of concert performance in DVD format may be the smartest box set innovation of the year, and sets the standard for future collections.", "\n\n3LW\n\n“3LW”\n\n½ Epic\n\nIf one cute teenage girl who can sing is good, two has to be better and three is even better. ", "With that kind of marketing behind 3LW (Three Little Women) how can this pop infused R&B/hip-hop trio miss?", "\n\nThe Lil’ Women, who range in age from 14 to 17, display some solid vocal abilities on their debut disc.", "\n\nWhile they are technically a superior ensemble that at times is remarkably reminiscent of the early Supremes, they are stylistically scattered. ", "The trio seems artistically divided as it delves into Britney-pop, soul-lite ballads and even hip-hop.", "\n\nThe trio is best when they tackle straight-ahead contemporary R&B like the song “I’m Gonna Make You Miss Me.” ", "This disc’s other standout is “I Can’t Take It,” on which the girls sing with gangsta rapper Nas." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0007949758437462151, 0.000873465440236032, 0.0006017742562107742, 0.0016358676366508007, 0.0030585627537220716, 0.0014367705443874002, 0.002138880779966712, 0.0008234625565819442, 0.0009113620035350323, 0.0006316150538623333, 0.0007497014012187719, 0.0008438527584075928, 0.0007718001725152135, 0.0006012528319843113, 0.0007372613181360066, 0.01988467574119568, 0.0013267359463497996, 0.0555502213537693, 0.0007878232281655073, 0.0007010764675214887, 0.0005974643281660974, 0.0006353338249027729, 0.0005270628025755286, 0.000621416256763041, 0.0005796591867692769, 0.0005603997851721942, 0.0011292863637208939, 0.0010913724545389414, 0.001646480755880475, 0.0006636103498749435, 0.0006948879454284906, 0.0013199337990954518, 0.015413873828947544 ]

[ "Introduction\n============\n\nThe Wisconsin glaciation, as well as earlier glacial periods, caused substantial expansions, contractions, and shifts in the ranges of plants and animals of North America ([@b39]) and throughout the temperate regions. ", "This caused strong but sometimes latent effects on the evolutionary trajectories of these species. ", "This has resulted in patterns of lineage endemism and speciation among glacial refugia, though the pattern is often quite complex (see review in [@b48]. ", "Phylogeographic studies of mammal distributions in the Pleistocene have alternately found genetic structure pointing to refugia in unexpected places ([@b11]) and a surprising lack of genetic structure in other species ([@b34]). ", "An understanding of how past distributions influenced the present diversity within and among lineages is important for understanding both the processes that promote the generation of biodiversity and the range of genetic variation within species, which is particularly important in taxa of conservation concern.", "\n\nResearch to date has not explored the potential distribution of *Myotis lucifugus* ([Fig. ", "1](#fig01){ref-type=\"fig\"}) during the last glacial maximum (LGM). *", "Myotis lucifugus* is among the most widely distributed bats in North America ([@b40]) and one that has been quite well studied ([@b20]), with a range extending from the coastal southeastern United States through the Yukon and central Alaska. ", "As many as six subspecies are recognized ([@b20]), though *M. l. occultus* appears to represent an independent lineage ([@b38]) and neither nuclear genes nor morphology appear to be able to diagnose *M. l. carissima* and *M. l. lucifugus* ([@b32]). ", "Recent genetic research indicates that \"*Myotis lucifugus*\" as it has historically been defined may be paraphyletic, with members of the western long-eared bats sister to some recognized subspecies of *M. lucifugus* ([@b13]; [@b6]). ", "The relationships among these lineages are still poorly understood and require further research, but it has been accepted that a single, monophyletic mitochondrial lineage of the little brown bat, *M. l. lucifugus*, ranges across North America east of the Great Plains ([@b13]). ", "This lineage is currently being annihilated by white-nose syndrome, a disease which models predict will cause the species to be regionally extinct in eastern North America in as few as 16 years ([@b21]). ", "This has resulted in a group of prominent bat biologists and conservation organizations petitioning the U.S. Fish and Wildlife Service for an emergency listing as an endangered species under the federal Endangered Species Act ([@b31]), and states have begun undertaking similar action ([@b35]). ", "There are many cases in which thorough examinations of \"subspecies\" have revealed that there was little genetic basis for that designation ([@b56]) or conversely that there were actually more species than previously recognized that were in need of protection due to undescribed diversity ([@b42]). ", "Therefore, research that can help elaborate the boundaries of this species is increasingly prudent as we move to determine what taxon or taxa are in need of protection, and to ensure that conservation efforts and resources are expended judiciously.", "\n\n{#fig01}\n\nHere, I present the results of a study that explores how glacial refugia during the Pleistocene may have influenced the phylogenetic and population genetic structure in this specie(s), with particular emphasis on the purportedly phylogenetic eastern subspecies *M. l. lucifugus*.", "\n\nMethods\n=======\n\nSample collection\n-----------------\n\nAs part of a broader study of the population genetic structure in this species, female *M. lucifugus* were sampled at 12 maternity colonies were throughout the state of Minnesota during the summers of 2010 and 2011. ", "These colonies ranged from 5 to 585 km apart. ", "Three of the sampled colonies were in or adjacent to Voyageurs National Park (MI: 48°37″17′N, 93°12″33′W; RLC: 48°35″88′N, 93°09″04′W; KF: 48°30″05′N, 92°38″64′W), six separate colonies were sampled in Gooseberry Falls (GF: 47°08″57′N, 91°28″28′W), Itasca (IT: 47°13″04′N, 95°11″31′W), St. Croix (SC: 45°56″65′N, 92°36″24′W), William O\\'Brien (WO: 45°13″06′N, 92°45″51′W), Whitewater (WW: 44°03″74′N, 92°02″71′W), and Great River Bluffs (GRB: 43°56″25′N, 91°24″31′W) State Parks, one colony was in Doyle-Kennefick Regional Park (DK: 44°36″49′N, 93°26″15′W), and two colonies were in private residences (NF: 44°29″61′N, 93°6″60′W; LV: 44°42″84′N, 93°18″51′W). ", "Bats were captured in mist nets during emergence from roost structures or hand collected from bat houses or from buildings during the day. ", "Colonies were only sampled once to avoid the possibility of sampling the same individual twice. ", "A sanitized holding bucket was used to contain bats for up to 1 hour to facilitate processing. ", "Individuals were sexed and weighed, their reproductive status recorded, and they were aged by viewing the wings with a backlight to determine the presence of visible cartilaginous areas of the finger bones ([@b3]). ", "Only adult females were included in the analyses described below.", "\n\nA sterile 3-mm biopsy punch was used to take a tissue sample from the plagiopatagium of each bat. ", "Wing punches were performed on a gridded, sterilized board to minimize risk of cross-infection of bats or cross-contamination of samples, and a new biopsy punch was used for each bat. ", "Wing punch wounds in lactating female *M. lucifugus* heal within approximately 2 weeks ([@b52]), so the use of this technique to gain genetic data is likely fairly benign. ", "Samples were placed immediately into 100% ethanol and then stored at --80 °C pending lab work. ", "It has been suggested to take a voucher specimen when sampling with wing punches in case of problems arising from field misidentification ([@b47]), however, I chose not to take voucher specimens because of the relatively small size of the sampled maternity colonies (12--200 individuals) and as only one lineage of the *M. lucifugus*/*evotis* species complex is thought to occur in eastern North America ([@b13]; [@b6]). ", "Individuals were released following sampling and were handled in accordance with guidelines of the American Society of Mammalogists ([@b24]) and the Institutional Animal Care & Use Committee of the University of Minnesota.", "\n\nDNA extraction, amplification, and sequencing\n---------------------------------------------\n\nDNA was extracted from wing punches using a Qiagen DNEasy Blood & Tissue Kit (Qiagen Inc., Valencia, CA, USA) following the manufacturer\\'s protocol, except that tissue samples were digested for up to 48 h in lysis buffer with 20--40 µL of proteinase K. A 654 base-pair (bp) fragment of the mitochondrial gene cytochrome b was amplified and sequenced for each individual using the forward primer F504 (GTGAATCTGAGGTGGCTTTTCCG) and the reverse primer R1181 (CATCTCCGGTTTACAAGACCAGT). ", "Polymerase chain reaction (PCR) was carried out in 12.5-µL reaction volumes using 1 µL of undiluted template DNA, 0.5 µL of each primer, 6.25-µL GoTaq Master Mix (Promega Inc., Madison, WI, USA), and 4.25 µL of nuclease-free water. ", "PCR began with an initial denaturing step of 2 min at 95°C, followed by five cycles each of 30 sec at 56°C, 55°C, and 54°C, then 25 cycles of 30 sec at 53°C, and concluded with a final elongation step of 7 min at 72°C. ", "PCR products were cleaned of unincorporated nucleotides prior to sequencing using Exonuclease I and Shrimp Alkaline Phosphatase ([@b25]). ", "PCR products were sequenced in both directions with amplification primers using an ABI 3730 automated sequencer (Applied Biosystems Inc., Carlsbad, CA, USA). ", "Sequencher 4.7 (GeneCodes Inc., Ann Arbor, MI) was used to compile and edit the sequences. ", "All sequences have been deposited in GenBank (JF899346--JF899527).", "\n\nGenetic data analysis\n---------------------\n\nI reconstructed a phylogeny for my samples to confirm that they comprised a single mitochondrial lineage. ", "The presence of multiple mitochondrial lineages in the sample would suggest that the subspecies was isolated in multiple refugia in the past, while a single lineage would support those individuals having arisen in a single refugium. ", "I used the program TCS 2.1 to create a minimum spanning network to reconstruct the hypothetical evolutionary relationships of mitochondrial haplotypes. ", "To understand the relationships among the clades detected in the haplotype network, as well as to confirm that all of my samples were from *M. lucifugus* rather than the grossly similar *M. setentrionalis*, I constructed a maximum likelihood tree for the haplotypes in Garli 0.951 using a Genbank cytochrome b sequence of *M. septentrionalis* (AY883911) as an outgroup. ", "I used MrModeltest ([@b36]) to identify the best fitting model of nucleotide substitution, HKY +Г. Support for nodes between branches was calculated using 1000 bootstrap replicates.", "\n\nTo test for population growth, I used Arlequin 3.11 ([@b19]) to generate mismatch distributions that compare the observed number of pairwise differences among individuals compared to the expected numbers of pairwise differences if the population size had historically been constant or if it had increased or decreased ([@b41]). ", "I also calculated Fu\\'s *F~s~* ([@b22]) and Tajima\\'s *D* ([@b50]), negative values of which can indicate population expansion. ", "Because these negative values can also indicate selection, I calculated *F*\\* and *D*\\* ([@b23]) using DnaSP 5.10 ([@b43]). ", "If these values are not statistically significant but Fu\\'s *F~s~* is, the data support population expansion, while the opposite pattern would be evidence of selection ([@b22]).", "\n\nTo complement these population growth tests, and to test whether that growth followed the close of the Wisconsin glaciations, I used BEAST v1.6.1 to produce a Bayesian skyline plot ([@b15]), which uses a coalescent method to estimate changes in the effective population size over time given genetic data and user-specified parameters to characterize sequence evolution. ", "A likelihood-ratio test failed to reject a molecular clock hypothesis for these data so a strict clock was used, scaled with the *Myotis*-calibrated divergence rate of 4.8% per million years ([@b44]). ", "Operators were left at default values and 10 × 10^6^ Markov Chain Monte Carlo steps were used.", "\n\nIf the measures of population growth were insignificant and/or the Bayesian skyline plot were indicated a more recent or more ancient period of population change, it would indicate that the population had not undergone a period of expansion following the close of the Pleistocene.", "\n\nEnvironmental niche modeling\n----------------------------\n\nTo explore how past environmental change and resulting isolation in glacial refugia may have influenced the population genetic structure of this species, I used the correlative environmental niche model (ENM) technique implemented in Maxent ([@b37]). ", "Maxent models the probability that a given pixel is suitable for a species given the environmental conditions at that pixel as well as those across pixels where the species is known to occur. ", "This probability is expressed as a map depicting the species' predicted range. ", "These environmental conditions can be any categorical or continuous variable that the user chooses, but because my purpose was to hindcast the distribution of *M. lucifugus* during the LGM, I was limited to those variables for which data are available for that time period. ", "I chose to use the 2.5 arc-minute resolution BIOCLIM variables for the present and LGM (the latter data were based on the Community Climate System Model) from the Worldclim database ([@b27]) because these climatic variables (e.g., temperature seasonality) have been found to be related to the ecological and physiological tolerances of organisms, and thus effective at predicting the past and present ranges of species using Maxent ([@b28]). ", "In addition, niche models based on reconstructed paleoclimate data consistently produce projected LGM distributions that are concordant with other data sources ([@b51]). ", "Maxent implicitly performs model selection and choosing among variables in advance using a model selection procedure such as stepwise regression can degrade the performance of the model ([@b18]), so I used the full set of 19 bioclimatic variables.", "\n\nLocality information for presence training data were compiled from the MaNIS database of museum specimens (manisnet.org), correspondence with additional museums whose collections are not georeferenced, and communication with researchers who had captured and positively identified *M. lucifugus* during fieldwork in portions of Canada that are poorly represented in museum collections. ", "I removed localities that occurred in what was likely to be the range of *M. occultus* rather than *M. lucifugus*. ", "Because sampling bias and intensity can strongly influence model output and lead to overfitting, I selected only localities that were greater than 10 km apart (R. Anderson, pers. ", "comm. ", "2010). ", "A total of 360 localities was included, of which 10% were randomly reserved to serve as test data for the model. ", "The model was validated using the area under the curve (AUC) for training and test data. ", "AUC refers to the Receiver Operating Curve, a commonly used metric of distribution model evaluation that essentially measures how successfully a model discriminates between sites where a species is present and where it is absent ([@b17]).", "\n\nResults\n=======\n\nGenetic data\n------------\n\nA total of 37 mitochondrial haplotypes was recovered from the 182 bats. ", "The vast majority of these individuals had one of four haplotypes, so most of the genetic diversity comprised one, two, or three individuals that possessed a sequence differing by one or two mutations. ", "This resulted in a series of connected star-like patterns in the haplotype network ([Fig. ", "2](#fig02){ref-type=\"fig\"}), representing a handful of closely related lineages. ", "This star-like pattern is suggestive of rapid population expansion ([@b30]), as it shows that a large number of single-point mutations are being maintained in the population rather than lost due to drift as would be expected when neutral mutations enter a population at low frequency in a stable population. ", "The relationship among these haplotypes is also apparent from the maximum-likelihood tree ([Fig. ", "2](#fig02){ref-type=\"fig\"}). ", "Poorly supported nodes were left in place for the purposes of comparing the concordance between the tree and the network, but if one were to collapse these nodes there would be a single clade nested within a polytomy, suggesting that the samples are all derived from a single mitochondrial lineage, or at least illustrating the absence of a second molecularly diagnosable lineage in the sampled population.", "\n\n{#fig02}\n\nThe mismatch distribution ([Fig. ", "3](#fig03){ref-type=\"fig\"}) exhibited a bimodal distribution that was very different from that expected under a constant population size, and its low and (marginally) insignificant raggedness index (*r*= 0.0526, *P*= 0.06) fails to reject the null hypothesis of population growth, if just barely. ", "Tajima\\'s *D* was negative, though insignificantly so (--1.16532, *P*= 0.10700), and Fu\\'s *F~s~* was significantly negative (--12.88349, *P*= 0.00400). ", "Neither Fu and Li\\'s *D*\\* (--0.06838, *P*= 0.46800) nor *F*\\* (--0.11037, *P*= 0.51900) were significant, so these neutrality tests likely indicate demographic expansion in the sampled population rather than natural selection. ", "The Bayesian skyline plot ([Fig. ", "4](#fig04){ref-type=\"fig\"}) strongly suggests rapid population expansion beginning approximately 18 kya.", "\n\n{#fig03}\n\n![", "Bayesian skyline plot of the median effective population size of *M. lucifugus* (log N~e~) versus absolute time in years before present, scaled by the *Myotis*-specific mutation rate determined by [@b7]. ", "Shaded area indicates 95% confidence intervals surrounding the median.](ece30001-0191-f4){#fig04}\n\nPleistocene niche model\n-----------------------\n\nThe current distribution predicted by Maxent ([Fig. ", "5A](#fig05){ref-type=\"fig\"}) very closely mirrors the accepted range of *M. lucifugus* ([@b40]), though it seems to under-predict the presence of the species in northern Québec and Newfoundland, most likely because of sampling bias. ", "The AUC for training data was 0.903 and for test data was 0.872, both much higher than the random prediction of 0.5. ", "The variables with the most important effect on AUC following permutation of their values in training and background data were the minimum temperature of the coldest period (25.3%), precipitation of the driest period (11.8%), mean temperature of the driest quarter (10.5%), and the mean temperature of the coldest quarter (9.3%). ", "Permutation of each of the remaining variables changed the overall AUC by 5% or less. ", "However, because many of the climatic variables are correlated, interpretation of the effects of permuting individual variables should proceed cautiously.", "\n\n![", "Environmental niche models of: (A) The present distribution of *M. lucifugus* based on 360 known occurrence records; and (B) A projection of suitable habitat for the species during the last glacial maximum (18 kya). ", "Presence localities are shown as dark triangles. ", "The darkness of shading indicates the relative suitability: light gray is unsuitable, intermediate represents the minimum training presence threshold, and dark gray represents the more conservative fixed cumulative value 10 threshold. ", "The stippled area in (B) represents the ice extent at the LGM (data from [@b16]).](ece30001-0191-f5){#fig05}\n\nThe projection for the species range during the LGM ([Fig. ", "5B](#fig05){ref-type=\"fig\"}) shows a large contiguous band of suitable habitat across the southeastern United States and lower Great Plains, with fragmented or tenuously connected habitat scattered throughout western North America. ", "The presence of suitable habitat in Newfoundland is questionable, as it was at least partially glaciated during the LGM, but the extent of its ice cover is debated ([@b39]) and it was not included in the dataset of glaciated area used in this figure ([@b16]). ", "Intriguingly, the model also shows strong support for a widespread refugium in unglaciated Beringia.", "\n\nDiscussion\n==========\n\nThe physical (and thus likely the ecological) conditions of North America have never been completely homologous with current conditions, nor does the current interglacial represent a return to \"things as they were\" ([@b39]). ", "Thus, it is appropriate to critically view the projection of species' ranges into past or future climates in which there may be combinations of climate conditions without a contemporary analog. ", "That said, the niche model does appear to accurately approximate the range of the species in the present day, including its absence in portions of the Great Plains, California\\'s Central Valley, and the southeastern United States; these bioclimatic variables are likely to have some bearing on the species physiological tolerances during the LGM. ", "Genetic data and the predictions from LGM ENM appear to be strongly concordant. ", "The lack of deep genetic divisions within the eastern mitochondrial lineage/subspecies *M. l. lucifugus* from previous, comprehensive phylogenetic analyses and this denser sample of limited area are consistent with the model output, which predicts a large continuous refuge in the lower Great Plains and the \"Floridian\" thermal enclave reviewed in [@b46]. ", "Numerous accounts of fossil evidence support the presence of several species of *Myotis* including *M. lucifugus,* and members from many other genera in this region during Pleistocene glaciations ([@b8]; [@b33]; [@b10]; [@b46]), and thus it probably represents an important biogeographic area for the maintenance of diversity in multiple bat taxa. ", "It is likely that this refugium maintained a substantial population for the species, as the tests for population expansion in this study gave mixed results, with more sensitive Fu\\'s *F~s~* and Bayesian skyline plot indicating population expansion, but only marginal support for it based upon Tajima\\'s *D* and the mismatch distribution. ", "This large refugium is supported by findings for the southern red-backed vole, which was found to have had a large, stable population in its southern-central U.S. glacial refugium in the same location as that predicted in this study ([@b45]).", "\n\nUnsurprisingly, it appears that *M. lucifugus* likely persisted in several isolated refugia in the intermountain and coastal western North America. ", "These are largely concordant with those refugia suggested by phylogeographic research in other species, including western North American shrews ([@b12]), voles in southeast Alaska and coastal Canada ([@b9]), and black bears ([@b5]) and weasels ([@b4]) in the vicinity of the Queen Charlotte Islands. ", "The suitable habitat predicted in Beringia is interesting, in that it is thought that Beringia was mostly either a steppe habitat ([@b54]) or tundra during that period ([@b39]) and *M. lucifugus* is generally associated with proximity to some type of tree cover. ", "However, it is possible that small spruce woodlands persisted there during the height of the glacial episodes ([@b26]; [@b55]), and thus it is not impossible that Beringia harbored both a suitable climate and trees which could have served as roosts. ", "However, discovering the role of isolated Pacific coastal and Beringian refugia in producing the current array of lineages/species within the *M. lucifugus*/western long-eared bat complex will require a more thorough phylogeographic study, such as that undertaken to test refugial hypotheses in singing voles ([@b53]). ", "The western subspecies of *M. lucifugus* (*alascensis, carissima, relictus*) and the apparently closely related *M. evotis*, *M. keenii*, and *M. thysanodes* form a paraphyletic group that occurs both in sympatry and allopatry throughout western North America, and most of the divergence within this clade appears to have occurred within the Pleistocene ([@b6]). ", "Given the probable fragmentation among Pleistocene glacial refugia that was predicted in this study, it is likely that much of the genetic differentiation observed by Carstens and Dewey occurred in allopatry during repeated Pleistocene glacial advances. ", "Previous research has shown that closely related *Myotis* bats are capable of rapidly evolving morphological adaptations that allow them to form convergent ecomorphs to exploit open niche space ([@b44]; [@b49]). ", "Since, much of what is now the *M. lucifugus--thysanodes--evotis--keenii* species complex went through repeated vicariance events followed by range expansion, there could well have been the evolution of short- and long-eared *M. lucifugus* ecomorphs and lineages that have never fully speciated, either because of recurring gene flow, incomplete lineage sorting, or some combination thereof. ", "Disentangling these phenomena is notoriously challenging. ", "Different methods of estimating gene flow have given quite different results in this species complex ([@b6]). ", "However, there is evidence of contemporary nuclear gene flow in the hybrid zone between the fairly well-resolved mitochondrial lineages of *M. l. lucifugus* and *M. l. carissima* ([@b32]), and thus it is possible, even probable, that the boundaries between these recently divergent lineages are fuzzier than current taxonomy would suggest. ", "The presence of eastern mtDNA haplotypes in western North America ([@b13]) most likely derives from either incomplete lineage sorting or modern or past interglacial dispersal as there appears to have been less contact between areas of suitable habitat in the glacial periods than during the present era.", "\n\nThe finding of weak but significant population expansion in *M. l. lucifugus* approximately coinciding with the end of the Wisconsin glaciation was expected, as many taxa dramatically expanded their ranges ([@b39]) and thus their populations as the Laurentide ice sheet retreated. ", "The pace of this expansion is unclear, though there is fossil evidence of *M. lucifugus* in Pennsylvania just over 11 kya ([@b33]). ", "The rapidity and recentness of post-Pleistocene expansion has left conflicting patterns of phylogeographic structure in eastern North America within other mammal species that expanded from southeastern forest refugia. ", "The eastern fox squirrel ([@b34]) shows no geographic mitochondrial structure across its range, while the northern and southern flying squirrels display a more classic pattern of increasing genetic diversity nearer to the likely glacial refugiua ([@b2]; [@b1]). ", "Whether or not a detailed phylogeographic study of *M. lucifugus* would uncover the latter or former pattern, or something different altogether, is outside the scope of this study. ", "However, it is worth noting that the sampled populations in Minnesota are in the middle of the continental range in an area that was nearly entirely glaciated during the LGM, and yet mitochondrial haplotype and nuclear microsatellite diversity in each sampling locality was quite high and there is no isolation by distance detectable among the sites that are as far as 600 km apart ([@b14]) probably due to the species' ability to disperse over hundreds of kilometers ([@b29]), suggestive of the maintenance of high genetic diversity in its glacial refugium, rapid expansion, and possibly frequent modern dispersal.", "\n\nThese results suggest that the little brown bat *M. lucifugus* maintained a relatively large geographic distribution during the Pleistocene glaciations, and that habitat expansions and contractions from glacial refugia in western North America likely explain the complex evolutionary history of the *M. lucifugus*/western long-eared bat species complex. ", "The eastern subspecies *M. l. lucifugus* likely persisted in a single refugium in which it has evolved independently of other lineages. ", "The facts that both sparse but widespread sampling in previous studies ([@b13]; [@b6]) and dense, local sampling in this study found the eastern subspecies to be monophyletic, and that it appears to have diverged from the other lineages in a large southeastern refugium, argue that this widespread subspecies may be an evolutionarily significant unit of *M. lucifugus*. ", "If indeed the U.S. Fish and Wildlife Service deems in necessary to list *M. lucifugus* under the U.S. Endangered Species Act, then that analysis should consider managing *M. l. lucifugus* as a distinct population segment. ", "While one could certainly debate the potential benefits of Endangered Species Act protection in this instance, I think that there is no question that the potential extinction of this formerly abundant and widespread subspecies would represent a tragic loss for North American biodiversity.", "\n\nThis manuscript represents a portion of my dissertation research, for which my advisor S. Jansa provided invaluable support through a variety of stages. ", "Thanks to the Associate Editor, an anonymous reviewer, and B. Fenton for their thoughtful comments. ", "F.K. Barker provided input on the genetic analysis. ", "T. Giarla, A. Blake, J. Diaz, and B. Severud assisted with field work. ", "A. Nosal and J. Fernandez helped with portions of the lab work. ", "C. Lausen, M. Brigham, R. Poulin, and J. Coleman for providing locality information for *M. lucifugus* in Canada. ", "K. Kozak and R. Anderson provided expert advice on environmental niche modeling. ", "This research was funded by a Theodore Roosevelt Fund grant from the American Museum of Natural History, A Dayton Natural History Fund grant from the Bell Museum of Natural History, and Alexander and Lydia Anderson and Doctoral Dissertation Fellowships through the University of MN Graduate School.", "\n\n[^1]: Funded by a Theodore Roosevelt Fund grant from the American Museum of Natural History, a Dayton Natural History Fund grant from the Bell Museum of Natural History, and Alexander and Lydia Anderson and Doctoral Dissertation Fellowships through the University of MN Graduate School.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.0006198693881742656, 0.0006629431736655533, 0.0005404286785051227, 0.0005682847113348544, 0.000528313685208559, 0.00080345559399575, 0.0005862871767021716, 0.0007496429025195539, 0.0006790891638956964, 0.000897467602044344, 0.0006202600197866559, 0.0010396160650998354, 0.0005857674404978752, 0.0005663972115144134, 0.0005708298995159566, 0.0019055769080296159, 0.0017827564151957631, 0.0005868289154022932, 0.0006421249709092081, 0.0006652449956163764, 0.0007971153827384114, 0.001030944986268878, 0.0006315886275842786, 0.0014050871832296252, 0.005128716584295034, 0.0008967974572442472, 0.0012030962388962507, 0.0016110814176499844, 0.006138313096016645, 0.0005488863680511713, 0.0006116308504715562, 0.0005298586329445243, 0.002801966154947877, 0.0006035523256286979, 0.0006698389770463109, 0.0006388244801200926, 0.0005623833858408034, 0.0005958055844530463, 0.000611783005297184, 0.0006036751437932253, 0.0005734482547268271, 0.0005808469140902162, 0.0006084649357944727, 0.0005676502478308976, 0.0006011900841258466, 0.32486170530319214, 0.01373430248349905, 0.029263172298669815, 0.0005806437693536282, 0.0006298074731603265, 0.0006237323977984488, 0.0005876306095160544, 0.0006082362378947437, 0.000623815692961216, 0.0006188334082253277, 0.0005750670097768307, 0.0005596316768787801, 0.0005848477594554424, 0.0005609189392998815, 0.0005600564763881266, 0.0007278488483279943, 0.0005779253551736474, 0.0010744172614067793, 0.0007440905901603401, 0.0006073808763176203, 0.000522241520229727, 0.0005953378276899457, 0.000783027964644134, 0.0006496100104413927, 0.0006311219185590744, 0.0005688423407264054, 0.0006023822352290154, 0.0006330134929157794, 0.0006616725586354733, 0.000589656294323504, 0.0019055769080296159, 0.0005749272531829774, 0.0007277274853549898, 0.0005947494064457715, 0.0006598089239560068, 0.0006933585391379893, 0.19040872156620026, 0.1455877721309662, 0.0006173933506943285, 0.0005897939554415643, 0.0019055769080296159, 0.0006792894564568996, 0.0006381928105838597, 0.0005977913388051093, 0.0006215610774233937, 0.0005791625007987022, 0.0006309063755907118, 0.0006384282605722547, 0.0007232745992951095, 0.0005690277903340757, 0.0019055769080296159, 0.0005730778211727738, 0.000675889546982944, 0.0005780250648967922, 0.0006458634161390364, 0.0005619483417831361, 0.0005618176073767245, 0.0006772755295969546, 0.0006098804296925664, 0.0005612502573058009, 0.0005883367266505957, 0.0005807597190141678, 0.0005781082436442375, 0.0006336491205729544, 0.028289631009101868, 0.0015554900746792555, 0.0006066125934012234, 0.0007876385352574289, 0.0005652878317050636, 0.0005897142109461129, 0.0007024997612461448, 0.0007496110629290342, 0.0005993763916194439, 0.0006934708799235523, 0.0008414391777478158, 0.0006377559620887041, 0.0005676843575201929, 0.0006012519588693976, 0.0006052101962268353, 0.0006456705159507692, 0.0005966832977719605, 0.0006182274082675576, 0.0006849999190308154, 0.0006246274570003152, 0.0005708919488824904, 0.000857326143886894, 0.0006882957532070577, 0.0006417728727683425, 0.0006508394726552069, 0.0005777028854936361, 0.0005228123045526445, 0.000520098430570215, 0.0005746426759287715, 0.0006389404879882932, 0.000587305286899209, 0.0005879889358766377, 0.0005581715377047658, 0.0006000131834298372, 0.0005771142896264791, 0.001995444530621171 ]

[ "Abstract\n\nIndividual variation in stable behavioral traits may explain variation in ecologically-relevant behaviors such as foraging, dispersal, anti-predator behavior, and dominance. ", "We investigated behavioral variation in mountain chickadees (Poecile gambeli), a North American parid that lives in dominance-structured winter flocks, using two common measures of behavioral profile: exploration of a novel room and novel object exploration. ", "We related those behavioral traits to dominance status in male chickadees following brief, pair-wise encounters. ", "Low-exploring birds (birds that visited less than four locations in the novel room) were significantly more likely to become dominant in brief, pairwise encounters with high-exploring birds (i.e., birds that visited all perching locations within a novel room). ", "On the other hand, there was no relationship between novel object exploration and dominance. ", "Interestingly, novel room exploration was also not correlated with novel object exploration. ", "These results suggest that behavioral profile may predict the social status of group-living individuals. ", "Moreover, our results contradict the idea that novel object exploration and novel room exploration are always interchangeable measures of individuals' sensitivity to environmental novelty.", "\n\nTo fully understand the significance of variation in behavioral profiles, it is crucial to investigate how variation in behavioral profile may affect behaviors directly linked to individual fitness (Smith and Blumstein 2008). ", "In socially living animals, social dominance may strongly influence fitness (e.g., Desrochers 1985; Ekman 1989; Mennill et al. ", "2004; Otter et al. ", "2007), and it is thus important to establish whether variation in behavioral profile might be linked to the acquisition of dominance status. ", "Although social interactions are necessary for the formation of dominance hierarchies, individual variation in attributes may also play a significant role in hierarchy formation (Chase et al. ", "2002). ", "While most work on hierarchy formation has focused on variation in physical attributes, there are reasons to expect that behavioral profiles might also play a substantial role. ", "For example, both aggressiveness and response to social defeat can be determinants of individuals' dominance ranks, and these factors are correlated with exploration-based measures of behavioral profile (Verbeek et al. ", "1996; Verbeek et al. ", "1999; Dingemanse and de Goede 2004).", "\n\nDominance status can affect both survival (e.g., Piper and Wiley 1990) and reproductive success (e.g., Mennill et al. ", "2004). ", "Among parids, many of which live in dominance-structured flocks for at least part of the year (Ekman 1989), dominant individuals may benefit from greater access to food resources (Hogstad 1989), access to foraging locations that are safer from predators (Desrochers 1985; Ekman 1989), increased likelihood of siring both within-pair and extrapair offspring (Mennill et al. ", "2004), greater attractiveness to the opposite sex, and higher mate retention (Otter and Ratcliffe 1996). ", "Recent evidence also shows that subordinate black-capped chickadees (Poecile atricapillus) may be disproportionately affected by food limitation in poor habitats (Otter et al. ", "2007).", "\n\nIt is also clear that among parids (as well as other birds and mammals), dominants differ both behaviorally and physiologically from subordinates (Verbeek et al. ", "1999; Barnard and Luo 2002; Pravosudov et al. ", "2003; Arakawa et al. ", "2006). ", "Unsurprisingly, dominant black-capped chickadees are more aggressive than subordinates, and are also more likely to approach a feeder when other birds are present (Ficken et al. ", "1990). ", "In the laboratory, subordinate mountain chickadees (Poecile gambeli) cache less food, are less efficient at cache retrieval, show poorer performance on a memory task and have lower rates of hippocampal cell proliferation than dominants (Pravosudov et al. ", "2003; Pravosudov & Omanska 2005). ", "Subordinate males also show lower maximal corticosterone levels following acute stress (Pravosudov et al. ", "2003). ", "However, it is not clear whether these behavioral differences between dominants and subordinates reflect pre-existing variations in behavioral profile or arise as a result of social rank acquisition. ", "Work in mice suggests that the acquisition of dominance status may change exploratory behavior (Arakawa 2006) and learning ability (Barnard and Luo 2002). ", "However, Boogert et al. (", "2006) demonstrates that in starlings (Sturnus vulgaris), dominant and subordinate birds differ in learning speed prior to the establishment of dominance relationships between birds. ", "Additionally, studies of great tits (Parus major) also demonstrate that individual differences in exploratory behavior and stress responsiveness may predict aggression toward conspecifics (Verbeek et al. ", "1996), and dominance following pairwise encounters, in aviary groups, and in the wild (Verbeek et al. ", "1996; Verbeek et al. ", "1999; Dingemanse and de Goede 2004). ", "Similar results have been found in salmonid fish (Pottinger and Carrick 2001; Schjolden et al. ", "2005).", "\n\nThe objectives of the current study were to characterize behavioral profiles in a North American parid, the mountain chickadee (Poecile gambeli), and to test whether individual differences in behavioral profile relate to the acquisition of dominance status. ", "We chose the mountain chickadee as a study species because we were specifically interested in how behavioral profile relates to the acquisition of dominance status in a species with fixed flock membership and a rigidly linear dominance hierarchy (by contrast, flocks of great tits, the other parid species in which the relationship between behavioral profile dominance has explicitly been studied, are fluid in both membership and dominance structure, with reversals of dominance status being common; Ekman 1989). ", "Such differences in social structure may be extremely important when considering the effect of behavioral profile on the acquisition of dominance status. ", "In great tits, a species in which challenges to dominants and dominance reversals are common (Ekman 1989), sensitivity to social defeat (which is correlated with exploratory behavior; Verbeek et al. ", "1999) is crucially important in determining whether individuals are able to maintain their dominance status. ", "In mountain chickadees, the dominance hierarchy appears to be rigid and challenges to dominant birds are exceptionally rare (Ekman 1989), so sensitivity to social defeat seems likely to be far less important in relation to the acquisition and maintenance of dominance status, and thus (assuming that social defeat is generally related to exploration), the relationship between exploration and dominance may be different.", "\n\nTo classify behavioral profiles in mountain chickadees, we chose to use measures of exploratory behavior (both exploration of a novel flight room and behavior toward an unfamiliar object placed in the home cage) because similar measures have been used in studies of dominance in another parid species (Verbeek et al. ", "1996; Verbeek et al. ", "1999). ", "Although we relied on measures of exploration collected at a single time point and did not explicitly evaluate the repeatability of exploratory behavior in mountain chickadees, we are confident that exploratory behavior remained reasonably consistent over the time scale of the experiment. ", "No more than three weeks elapsed between testing in the novel room and dominance testing, and a number of studies examining exploration in nonhuman animals have shown that within individuals, exploratory behavior and other indices of “boldness” typically show substantial repeatability over periods of weeks to months, and in many cases much longer (e.g., Verbeek et al. ", "1994; Dingemanse et al. ", "2002; Armitage and van Vuren 2003; Schjolden et al. ", "2005; Quinn and Cresswell 2005).", "\n\nBehavior in novel environments has been linked to the establishment of dominance relationships in both birds and fish, although the direction of the relationship between exploration of or adjustment to a novel environment and the acquisition of dominance status varies. ", "In great tits, birds that explore a novel environment more quickly generally become dominant in staged dyadic encounters (Verbeek et al. ", "1996), but are subordinate to slow-exploring birds when housed in multi-individual groups in aviaries (Verbeek et al. ", "1999). ", "This is thought to be related to the fact that fast-exploring birds are more aggressive, but take longer to recover from social defeat (Verbeek et al. ", "1999). ", "In rainbow trout (Oncorhynchus mykiss), individuals that acclimate more quickly to a novel tank dominate fish that are slower to acclimate (Schjolden et al. ", "2005). ", "Among chickadees, dominant individuals are typically more risk-averse than subordinates and prefer to forage in less exposed locations (e.g., Desrochers 1985; Ekman 1989). ", "Assuming that this behavioral difference between dominants and subordinates in fact exists prior to the establishment of dominance relationships, we predicted that mountain chickadees that showed lower levels of exploratory behavior would dominate more exploratory birds, based on the finding that exploration and other indices of what is commonly referred to as “boldness” are generally positively correlated with risk-taking (Sih et al. ", "2003; van Oers et al. ", "2004; Quinn and Cresswell 2005; Bell 2005).", "\n\nMethods\n\nAnimals\n\nSubjects were 48 juvenile male mountain chickadees that were captured around Sagehen creek, Tahoe National Forest, California (near Truckee, CA) on September 11-12 2007 using mist nets near feeders. ", "Birds for this study were captured at a network of forty feeders situated at spatially distinct locations spread over a distance of approximately 11 km along two forest roads. ", "Based on extensive observations at these feeders over the last eight years, it is highly unlikely that birds trapped at different feeders on the same day belonged to the same flock (Pravosudov, unpublished data). ", "We captured birds at sixteen feeders (eleven feeders on Sept. 11 and five different feeders that were separated from the original eleven by several km on Sept. 12), and thus the birds that we captured are almost certainly from at least sixteen distinct flocks with non-overlapping membership. ", "Birds were transferred to the laboratory at the University of Nevada, Reno, and were housed individually in wire-mesh cages (60 × 42 × 60 cm) which were visually, though not acoustically, isolated from one another by solid metal partitions between cages. ", "Birds were maintained on a 10h:14h light-dark cycle at a constant 20 C temperature and a mixture of pine nuts, shelled and unshelled sunflower seeds, crushed peanuts, and Roudybush bird pellets (Roudybush Inc., Woodland, CA) was available ad libitum. ", "Each bird was also given 6-10 mealworms daily, and ad libitum water was provided.", "\n\nAfter 7 days in captivity, we collected 1 capillary tube (75 μl) of blood from the brachial vein of each bird for genetic sex determination. ", "DNA was extracted from samples using a Qiagen DNEasy kit (Qiagen Inc., Valencia, CA). ", "Sex was determined by amplifying a portion of the sex-linked CHD genes (CHD-W in females only and CHD-Z in both sexes) in a polymerase chain reaction using microsatellite primers P2 and P8 (Griffiths et al. ", "1998). ", "Sex was confirmed by visual examination of the gonads after birds were sacrificed with an overdose of sodium pentobarbital as part of another experiment. ", "Results of the visual and genetic sexing matched 100%.", "\n\nExploration Tests\n\nAfter birds had been housed in individual cages and visually isolated from other birds for three weeks, each bird was given two tests of exploratory behavior based on the methods of Verbeek et al. (", "1994). ", "We waited three weeks to administer behavioral tests because our previous research has shown that the level of the stress hormone, corticosterone, returns to its normal, undisturbed level after three weeks in captive settings, suggesting that the birds become habituated to captive housing in approximately three weeks (Pravosudov et al. ", "2003).", "\n\nThe first test measured exploratory behavior in an unfamiliar room. ", "Each bird was released into an experimental room (325 × 218 × 312 cm) and its behavior observed through a one-way Plexiglas window. ", "The room contained two artificial “trees” with 20 perching sites. ", "Additionally, 36 wood blocks with attached perches were attached by Velcro to two opposite walls (18 perches on each wall). ", "No food was available in the testing room. ", "Every home cage was connected to the experimental room by a door covered by a flap, so that birds could enter the experimental room without handling. ", "The experimenter manipulated the lights and opened the flap so that the bird could enter or leave by flying from the dark to the light. ", "Birds remained in the room until they had visited both trees and at least one perching site on each wall, or for 30 minutes, whichever was sooner. ", "For each bird, we measured the number of perching sites visited during the 30 minute time period. ", "Birds could therefore visit a minimum of 0 sites (if the bird hung from the ceiling or a wall without perches for the entire test period) and a maximum of 4 sites (if the bird visited both “trees” and both walls containing perches). ", "For those birds that visited all four perching sites, we recorded exploration time (the time required for a bird to visit all four perching locations). ", "We also recorded the number of hops a bird made between perches during each visit to a given tree or wall (hereafter “hops per site visit”). ", "Our testing technique differs somewhat from the technique employed by Dingemanse et al. (", "2004) to assess exploratory behavior in wild-captured great tits. ", "Dingemanse et al. (", "2004) used the number of flights and hops (which in great tits are known to be tightly correlated with arrival time) during the first two minutes in the novel room as a proxy for exploratory behavior. ", "As we did not know a priori whether activity in the novel room would be correlated with arrival time in mountain chickadees, we also measured the number of sites visited during the testing period as an alternative index of exploration. ", "Birds were considered high-exploring if they visited all four perching locations within 30 min, and low-exploring if they did not. ", "Additionally, although 30 minutes is longer than the time typically allotted for novel-environment tests (Verbeek et al. ", "1994 allotted 10 min, as did Martins et al. ", "2007), we argue that the environment was still likely to have been quite novel to the chickadees even after half an hour. ", "It typically takes 2-3 1 h sessions in the flight room for birds to become habituated enough to the room to perform well on memory tasks (e.g., Pravosudov et al. ", "2003). ", "Additionally, 12 birds failed to visit all four perching locations, suggesting that they may still have been somewhat neophobic.", "\n\nThe second test measured novel object exploration. ", "Birds were videotaped for ten minutes following the introduction of a novel object (a plastic Pink Panther keychain, approximately 8 cm long by 1.5 cm wide) into the home cage. ", "An experimenter hung the novel object from the perch at the front of each bird's home cage, approximately 10 cm from the cage wall. ", "Birds could easily reach the object while standing on the perch. ", "We scored approach behavior toward the novel object during a ten minute time period on a scale of 1 to 4. ", "Birds assigned a score of 1 never landed on the perch with the novel object. ", "Birds assigned a score of 2 landed on the perch with the object but did not approach it. ", "Birds assigned a score of 3 approached to within less than a body length of the novel object, and birds assigned a score of 4 approached the object and made bill contact with it (most birds did so while standing on the perch on which the object was hanging). ", "Timing began immediately after the experimenter placed the object in the cage. ", "To control for the possibility that differences in birds' behavior toward the novel object actually reflected something other than sensitivity to the novel object (e.g., differences in sensitivity to the experimenter's manipulation of the home cage or differences in innate motivation to interact with objects placed in the home cage), birds were first given a control test with a familiar object. ", "A balsa wood toy for small birds (Balsa Buddies Sun, Birdalog.com) was hung from the front wall of each bird's home cage for three days to habituate birds to the object. ", "Following the habituation period, each bird was videotaped for ten minutes after the experimenter hung the familiar object from the front perch of the home cage, and we again scored approach behavior.", "\n\nTo analyze temperament structure in mountain chickadees, we examined the relationship between sites visited in the novel room, novel object approach scores, and average number of hops per perching site visit. ", "We used nonparametric measures because the data were not normally distributed (Shapiro-Wilk test of normality: sites visited, W = 0.56, p < 0.0001; novel object approach score, W = 0.80, p = < 0.0001; hops per visit, W = 0.72, p < 0.0001). ", "P-values ≤ 0.05 were considered to be statistically significant. ", "All tests were 2-tailed. ", "SAS was used for all statistical analyses (SAS Systems, Cary, NC).", "\n\nDominance Tests\n\nNo more than three weeks after birds were tested in the novel room, pairs of males underwent staged dyadic encounters. ", "Pairs of unfamiliar males taken from known different non-overlapping social groups were introduced into the experimental flight room (the same room used during the initial novel environment exploration tests) to determine within-pair dominance rank. ", "There is some possibility that birds may not have been totally unfamiliar with one another in the lab prior to testing because they were housed in visual but not acoustic isolation and thus may have learned about each other via vocalizations; however, birds used in the dominance tests had never been in visual or physical contact with one another.", "\n\nBirds were allowed to enter the room without handling, and were observed through the one-way Plexiglas window. ", "We determined dominance rank by recording typical dominance interactions including aggressive interactions (the dominant bird attacked the subordinate while the subordinate bird offered no resistance) and passive displacements (the subordinate bird always gives way to the dominant bird; Lahti et al. ", "1998; Pravosudov and Lucas 2000; Pravosudov et al. ", "2003). ", "We always observed birds for at least five minutes (allowing for multiple interactions) before ending the dominance test, despite the fact that dominance in pairs of male mountain chickadees is generally apparent after a single interaction, and reversals are never seen following multiple interactions (Pravosudov and Lucas 2000; Pravosudov et al. ", "2003). ", "In chickadees, dominance hierarchies are strictly linear without reversals and the relationship between any two given birds reflects their dominance relationship within a social group (Ekman 1989; Hogstad 1989; Lahti et al. ", "1998; Pravosudov and Lucas 2000; Ratcliffe et al. ", "2007). ", "After we established the dominance status of each bird, birds were returned to their home cages. ", "Because we recorded which bird behaved in a subordinate fashion (i.e., was chased by the other male or repeatedly yielded perching locations to the other male), the outcomes of these dyadic encounters represent a measure of dominance status, rather than a simple measure of aggression, per se. ", "In fact, in several cases, the dominance relationship appeared to be established (i.e., one bird was repeatedly displaced by the other) with little or no overt aggression toward the subordinate bird on the part of the dominant individual.", "\n\nWe tested 12 pairs of birds consisting of one lower-exploring bird and one higher-exploring bird (i.e., birds that had visited 4 sites were paired with opponents that had visited either 2 or 3 sites). ", "We also staged encounters between thirteen pairs consisting of two high-exploring birds (i.e., birds that had visited all four sites within the novel room) with different exploration times. ", "The outcomes of dyadic encounters between birds of different exploration types and the outcomes of dyadic encounters between high-exploring birds with different exploration times were analyzed separately, and birds were used only once in a given set of dyadic encounters. ", "Birds were at least loosely size-matched by wing length (average difference in wing length between opponents differing in exploration type: 1.33 ± 0.48 mm; average difference in wing length between high-exploring opponents differing in arrival time: 0.45 ± 0.16 mm). ", "Wing lengths of birds tested ranged from 68.5 to 74.5 mm.", "\n\nEthical Note\n\nBirds were collected under the U.S. Federal Fish and Wildlife (MB022532) and California State (802017-05) scientific collecting permits. ", "All experiments were performed under Animal Care and Use Protocol #A05/06-39, approved by the University of Nevada, Reno Institutional Animal Care and Use Committee.", "\n\nResults\n\nBehavioral Traits\n\nAll birds visited at least two perching sites in the novel room. ", "Twelve birds failed to visit all four perching locations during the 30 minute observation period and were classified as “low-exploring” (Fig. ", "1a). ", "Of these 12 low-exploring birds, nine birds visited only two locations in the room, while the remaining three birds visited three perching sites. ", "The remaining 36 birds visited all four perching locations within the room and were classified as “high-exploring.” ", "Among high-exploring birds, latencies to visit all four perching locations within the room (i.e., exploration time) ranged from 4.38 min – 27.3 min, and appeared to follow a roughly bimodal distribution (Fig. ", "1b).", "\n\nFigure 1a. ", "Distribution of exploration scores for 48 mountain chickadees. ", "Exploration was scored based on the number of perching sites visited in a novel room during a 30 minute time period. ", "There were four possible perching sites. ", "Nine birds visited...\n\nThe association between the number of sites visited in the novel room and the average number of hops that a bird made during a single site visit was not statistically significant, though it did approach significance (Kruskal-Wallis test: 2 d.f., ", "χ2 = 5.19, P = 0.075), with low-exploring birds (those with novel-room scores of 2 and 3 sites visited) tending to make more hops during a single site visit and high-exploring birds tending to make fewer hops during a single site visit (Fig. ", "2). ", "Two outliers were excluded from this analysis: among 46 of the males tested, the average number of hops per visit ranged from 0.33 – 9.87, while the two outlier males (a high-exploring male and a low-exploring male, respectively) had average numbers of hops per visit of 17.70 and 51.30.", "\n\nThe association between exploration score and the average number of hops per site visit in the novel room approached statistical significance (P = 0.075). ", "Low-exploring birds tended to make more hops per site visit than high-explorers. ", "N = 46 (novel environment...\n\nWith regard to behavior toward a novel object, all birds received a score of at least 2, indicating that they, at minimum, landed on the perch with the novel object. ", "Novel object scores were fairly evenly distributed within the population (Fig. ", "3), with 12 birds receiving a score of 2 (landed on the perch with the object), 19 birds receiving a score of 3 (approached within one body length of the object), and 17 birds receiving a score of 4 (contacted the object with the bill). ", "There was no association between novel object approach score and the number of sites visited in the novel room (Kruskal-Wallis test: 2 d.f., ", "χ2 = 1.60, P = 0.45). ", "There was no difference between birds with novel object approach scores of 2, 3, or 4 with regard to their approach scores when tested with the familiar object (Kruskal-Wallis test: 2 d.f., ", "χ2 = 0.87, P = 0.64), indicating that novel object approach scores were unlikely to be confounded with variation in how birds responded to the experimenter or with differences in innate motivation to explore objects placed in the cage. ", "However, birds were apparently habituated to the familiar object: only 17 birds actually contacted the novel object with their bills, while 34 birds touched the familiar object. ", "This difference was highly significant (χ2 = 12.09, 1 d.f., ", "P = 0.001).", "\n\nDistribution of novel object approach scores for 48 male mountain chickadees. ", "A novel object was suspended from a perch in each bird's home cage for 10 min, and each bird was scored according to how closely it approached the novel object. ", "A score of 1...\n\nBehavioral Profile and Dominance\n\nIn staged dyadic encounters between birds of different exploration type, birds with lower exploration scores were more likely to become dominant. ", "Birds that became dominant following these encounters had previously visited an average of 2.5 ± 0.23 sites in the novel room, while birds that became subordinate had visited an average of 3.58 ± 0.23 sites in the novel room (Fig. ", "4). ", "This difference was significant (Wilcoxon two-sample test: N1 = N2 = 12, U = 106.00, P = 0.005). ", "We used a binomial test to test whether, across pairs, low-exploring birds were more likely to win dominance encounters with high-exploring birds. ", "In 10 of 12 dyadic encounters between birds of different exploration score, the lower-exploring bird became dominant, a significantly greater proportion than expected by chance (binomial test: N = 12, x ≥ 10, P = 0.038).", "\n\nDiscussion\n\nCharacterization of Behavioral Profile in Mountain Chickadees\n\nMountain chickadees exhibit considerable inter-individual variation in exploratory behavior. ", "Individuals show substantial differences in the extent to which they explore a novel environment (i.e., number of perching sites visited in the novel room), the extent to which they explore individual perching sites within the novel environment (i.e., number of hops per site visit), and their behavior toward novel objects. ", "A relationship that approached significance between number of perching sites visited during the novel room test and the average number of perch hops per site visit suggests that low-exploring birds may explore individual perching sites more thoroughly than high-exploring birds. ", "This finding may be parallel to the results of Verbeek et al. (", "1994), who showed that great tits that took longer to explore a novel room did so in part because they explored the room more thoroughly. ", "However, we note that in our data, this finding could also simply be an artifact of low-exploring birds visiting fewer sites in the novel room than high-exploring birds, causing their perch hops to be spread among fewer possible sites.", "\n\nThe distribution of exploration types among the 48 males tested, with only three males exhibiting what might be considered an intermediate level of exploration (i.e., visiting three of the possible four locations in the room), parallels the roughly bimodal distribution of exploratory behavior and other measures of “coping style” that have been widely reported in studies of fish (e.g., Schjolden et al. ", "2005), birds (e.g., Verbeek et al. ", "1994), and mammals (e.g., Benus et al. ", "1991). ", "Four times as many males in our laboratory population were classified as high-exploring as were classified as low-exploring. ", "Whether this finding reflects the actual distribution of behavioral profiles within the wild population from which these birds were drawn or merely reflects the fact that high-exploring birds may have been more likely to enter our mist nets is unknown.", "\n\nBehavior toward novel objects is another measure that is commonly used in studies of behavioral profiles or “personalities” in animals. ", "Novel object approach scores were much more evenly distributed than exploration types among our male mountain chickadees. ", "Moreover, we found no relationship between exploration type and novel object scores: high-exploring birds were no more likely than low-exploring birds to make physical contact with an unfamiliar object placed in their home cage. ", "This finding does not simply reflect a broad-based insensitivity to the novelty of objects: twice as many birds touched the familiar object with their bills as touched the novel object, suggesting that birds were in fact more fearful of the unfamiliar object. ", "Therefore our results suggest that while mountain chickadees are in fact sensitive to whether or not an object is familiar, and while individual birds vary in their willingness to approach unfamiliar objects, this variation is not predicted by exploration type. ", "It seems likely that in mountain chickadees, exploration type and novel object approach score are proxies for two different stable behavioral traits. ", "Martins et al. (", "2007) found an identical result in zebra finches (Taenopygia guttata), in which the correlation between the scores from novel environment and novel objects tests was not significantly different from zero. ", "Similarly, Moretz et al. (", "2007) found that in zebrafish (Danio rerio) various measures of “boldness” were not consistently correlated across laboratory strains. ", "Additionally, in another parid species, research has shown that novel environment exploration and novel object exploration may have different genetic bases, though both traits are at least moderately heritable and show some correlation with one another (van Oers et al. ", "2004). ", "Both our findings and the results of Martins et al. (", "2007), Moretz et al. (", "2007), and van Oers et al. (", "2004) suggest that researchers should be cautious in assuming that various measures of “boldness” or “exploration” are interchangeable – an assumption that seems to be fairly pervasive in reviews and meta-analyses dealing with the ecological implications of behavioral profile or temperament in animals (e.g., Gosling 2001; Reale et al. ", "2007; Smith and Blumstein 2008).", "\n\nBehavioral Profiles and Dominance in Mountain Chickadees\n\nWhile some research has shown that behavioral differences between dominants and subordinates may arise as a result of the establishment of dominance relationships (Arakawa 2006; Barnard and Luo 2002), our results suggest that dominant individuals may also differ behaviorally from subordinates prior to the establishment of social rank. ", "Specifically, birds that were classified as low-exploring prior to the staged dyadic encounters dominated high-exploring birds in almost all cases. ", "Parallel results have been seen in fish, though the direction of the relationship between reactivity to the stress of being in a novel environment and dominance may be different. ", "In juvenile rainbow trout, fish that mount a low plasma cortisol response to being moved to a novel tank are significantly more likely to become dominant in staged dominance encounters with high-responding conspecifics (Schjolden et al. ", "2005). ", "While we do not know for certain whether differences in exploration type may be associated with differences in stress responsiveness in mountain chickadees, this seems like a reasonable hypothesis: in Japanese quail (Coturnix japonica), chickens (Gallus domesticus), and great tits, birds that behave more fearfully in tests of novel environment exploration typically mount a greater corticosterone response to acute stress (reviewed in Cockrem 2007).", "\n\nIt is also entirely possible that there is no direct causal link between exploration type and the acquisition of dominance status, or even between stress responsiveness and the acquisition of dominance status. ", "Instead, as suggested by Pottinger and Carrick (2001), stress responsiveness and exploratory behavior may simply covary with some other trait that more directly affects competitive ability, such as aggression (e.g., Verbeek et al. ", "1996; Armitage and van Vuren 2003; Bolhuis et al. ", "2005) or response to social defeat (Verbeek et al. ", "1999). ", "In captive-reared great tits, more-exploratory birds are more aggressive and tend to dominate less-exploratory birds in dyadic encounters (Verbeek et al. ", "1996). ", "However, less-exploratory birds take less time to recover from social defeat and are more likely to acquire high status when housed in larger groups (Verbeek et al. ", "1999). ", "Dingemanse and de Goede (2004) found similar results in wild great tits: while “fast”-exploring territorial males dominate “slow”-exploring territorial males at feeding trays, among flock-living nonterritorial males, the “slow” males dominate, presumably because they are better able to cope with the stress of living in a large group. ", "Because the social structure of mountain chickadee flocks is so different from that of great tits (Ekman 1989), it is a bit difficult to interpret our results in the context of what has been observed in great tits, though it is certainly possible that low-exploring male mountain chickadees, while they are apparently more reactive to environmental novelty than high-exploring males, may also be better able to cope with social stress and therefore might perform better in dyadic encounters. ", "It is also quite possible that low-exploring chickadees are more aggressive than high-exploring males. ", "Both of these hypotheses warrant further testing. ", "However, what is clear from the results of the present study is that, at least in mountain chickadees, some of the behavioral differences that have been observed between dominant and subordinate birds exist prior to the establishment of dominance relationships. ", "Specifically, dominant chickadees have been shown to be more risk-averse than subordinate birds (Desrochers 1985; Ekman 1989) and it now seems likely that this behavioral difference may actually precede the establishment of social relationships within winter flocks.", "\n\nIt is also worth noting that, at least in terms of the establishment of dominance relationships, difference in exploration type is apparently more salient than are differences in exploration time (i.e., latency to visit all four perching locations) between high-exploring birds, despite the fact that differences in exploration time can be substantial. ", "While exploration type is a significant predictor of dominance in encounters between low- and high- exploring birds, latency to visit all four perching locations in the novel room does not predict dominance status in encounters between two high-exploring birds. ", "This suggests that low explorers and high explorers are more different from one another behaviorally than are high explorers with very different exploration times.", "\n\nTaken together, the results of the present study suggest that variation in behavioral profile may affect the establishment of dominance relationships and that measurements of exploratory behavior are a potentially useful tool for characterizing behavioral profiles in parids. ", "Additionally, our results strongly suggest that the observed differences in risk sensitivity between dominant and subordinate chickadees may be present before dominance relationships are established. ", "In a broader sense, the present study adds further weight to a substantial body of research that suggests that behavioral profiles or animal “personalities” affect behaviors directly linked to fitness, including the acquisition of dominance status, antipredator behavior, and dispersal (Verbeek et al. ", "1996; Wilson 1998; Armitage and van Vuren 2003; Dingemanse et al. ", "2003Quinn and Cresswell 2005) and that therefore the study of behavioral profiles is important for understanding the evolutionary maintenance of behavioral variation both within and between species and populations, as suggested by Dingemanse and Reale (2005).", "\n\nNumber of staged dyadic encounters in which the low-exploring bird became dominant (N = 10) versus the number of staged dyadic encounters in which the high-exploring bird became dominant (N = 2). ", "N = 12 dyadic encounters.", "\n\nAcknowledgments\n\nThis study was supported by grants from the National Science Foundation (IOB-0615021) and from the National Institutes of Health (MH079892 and MH076797) to Vladimir Pravosudov. ", "We thank Geniveve Hanson, Kathleen Cornfield and Ashley Rolfe for help in bird maintenance and in running the experiment.", "\n\nFootnotes\n\nPublisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. ", "As a service to our customers we are providing this early version of the manuscript. ", "The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. ", "Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.", "\n\nReferences\n\nArakawa H. Changes in the pattern of exploratory behavior are associated with the emergence of social dominance relationships in male rats. ", "Developmental Psychobiology. ", "2006;48:39–47.[PubMed]" ]

{ "pile_set_name": "Pile-CC" }

[ 0.000612841104157269, 0.0008764671511016786, 0.005121617112308741, 0.0005876516806893051, 0.0006765472353436053, 0.0006004857132211328, 0.000581196101848036, 0.0005637621507048607, 0.0005543253500945866, 0.0006260494701564312, 0.0007057925686240196, 0.0005537993274629116, 0.0006126234657131135, 0.0007574596675112844, 0.0005481598782353103, 0.00067156768636778, 0.0007491965079680085, 0.0006702383980154991, 0.0006176970200613141, 0.0007574253831990063, 0.0007209558389149606, 0.001920545008033514, 0.0017387127736583352, 0.0007779169827699661, 0.0007144915289245546, 0.0007034996524453163, 0.0006711719324812293, 0.0007848869427107275, 0.0021895074751228094, 0.0007575322524644434, 0.001941267866641283, 0.0006868629716336727, 0.0050095971673727036, 0.0007573907496407628, 0.0005889889434911311, 0.0005785495159216225, 0.0007194383651949465, 0.0009033869719132781, 0.0013491797726601362, 0.0006393571384251118, 0.0007491965079680085, 0.0006702383980154991, 0.000965427840128541, 0.0007664414006285369, 0.0008124850573949516, 0.0009600601042620838, 0.0005563147715292871, 0.0019237183732911944, 0.0005939724505878985, 0.0008895921055227518, 0.000891807081643492, 0.0007491965079680085, 0.0007397858425974846, 0.0006534738931804895, 0.00071831134846434, 0.0007060700445435941, 0.0008586996700614691, 0.0007011540001258254, 0.000575797283090651, 0.001109177595935762, 0.0007245813030749559, 0.0007397858425974846, 0.0008543141884729266, 0.0007397858425974846, 0.0012508275685831904, 0.0007664414006285369, 0.0032820904161781073, 0.0009172605932690203, 0.0008079562103375793, 0.0006887393537908792, 0.0012387949973344803, 0.0005378330824896693, 0.00054712820565328, 0.0005526429740712047, 0.0006053050747141242, 0.0007725117029622197, 0.0009337402298115194, 0.0010088427225127816, 0.0005945516168139875, 0.0011780456406995654, 0.0007752228993922472, 0.003072971710935235, 0.0011257012374699116, 0.0005984112503938377, 0.0007681447314098477, 0.0006356787635013461, 0.0007573907496407628, 0.0006918549770489335, 0.000588662049267441, 0.0008526425808668137, 0.000811677542515099, 0.000726036902051419, 0.0007044942467473447, 0.000737827445846051, 0.0006595106096938252, 0.0005223562475293875, 0.0006235490436665714, 0.0005238038720563054, 0.00058088538935408, 0.0005780454375781119, 0.02611136995255947, 0.0006195885362103581, 0.001036223373375833, 0.0006051003001630306, 0.0005538954283110797, 0.0006323489942587912, 0.0006333139608614147, 0.002591577125713229, 0.0006574791623279452, 0.0007573907496407628, 0.0007081530638970435, 0.0006094890995882452, 0.0006604156806133687, 0.0006337481900118291, 0.0006651274161413312, 0.0005582885933108628, 0.0006169489352032542, 0.0006263228133320808, 0.0007077370537444949, 0.0005827347631566226, 0.0006053120014257729, 0.0009398297988809645, 0.0005679575842805207, 0.0006336847436614335, 0.0007158260559663177, 0.0005737623432651162, 0.000665457802824676, 0.0005649344529956579, 0.0008922762935981154, 0.0010522166267037392, 0.0006254703621380031, 0.0007767795468680561, 0.0006658317288383842, 0.0007295981631614268, 0.0007573907496407628, 0.001056250068359077, 0.0007573907496407628, 0.001765281194821, 0.0007754257530905306, 0.0007779169827699661, 0.0006472903187386692, 0.000782436050940305, 0.0006906116032041609, 0.0005904185236431658, 0.0005503319553099573, 0.0006241549272090197, 0.0006136680603958666, 0.0005761008942499757, 0.0005644670454785228, 0.0006113490089774132, 0.000570694450289011, 0.0006412789225578308, 0.0008093956275843084, 0.0005976337706670165, 0.0005736500024795532, 0.0005918200477026403, 0.0007449128897860646, 0.0007205674191936851, 0.0007986199343577027, 0.0005578739801421762, 0.0006876725819893181, 0.0005973686929792166, 0.0006384194130077958, 0.0008871195605024695, 0.0007328803767450154, 0.0005774504970759153, 0.0006212255684658885, 0.0005852584727108479, 0.0005800261860713363, 0.0007075283792801201, 0.0006186332320794463, 0.0008319022599607706, 0.0006161524215713143, 0.0006076055578887463, 0.0006038291030563414, 0.0006169592379592359, 0.0008642071043141186, 0.006147046573460102, 0.0005991000216454268, 0.000641531078144908, 0.0006232900195755064, 0.0008993846131488681, 0.0006000918219797313, 0.0006208100239746273, 0.0006570788682438433, 0.001139231608249247, 0.0005781088257208467, 0.0005713165155611932, 0.0005776698235422373, 0.5877111554145813, 0.0005578178679570556, 0.0006126541411504149, 0.0006386128952726722, 0.0006172915454953909, 0.00074430659878999, 0.0012770546600222588, 0.0006165953236632049, 0.0006926921778358519, 0.0067191109992563725, 0.0006154135335236788, 0.0006862175068818033, 0.0009609190165065229, 0.0010690622730180621, 0.000622564519289881, 0.000680263212416321, 0.000603899301495403, 0.0006503623444586992, 0.0006453167297877371, 0.0007574253831990063, 0.0005373964668251574, 0.0006144304061308503, 0.0006623125518672168, 0.0005829466972500086, 0.0006702489918097854, 0.0011075441725552082, 0.0006472789100371301, 0.0005884848069399595, 0.0009067661594599485, 0.0007664414006285369, 0.0008884345297701657, 0.0006107879453338683, 0.000736575573682785, 0.0007937767659313977, 0.0007766866474412382, 0.0007397858425974846, 0.0018968036165460944, 0.0007602093974128366, 0.0007770571392029524, 0.0007397858425974846, 0.0039054446388036013, 0.0015598484314978123, 0.05161658301949501, 0.000643567240331322, 0.0007399352616630495, 0.0010411350522190332, 0.000545776856597513, 0.0006509672966785729, 0.0006108132656663656, 0.000560656248126179, 0.0013914593728259206, 0.0005852447939105332, 0.000817673746496439, 0.0006111655384302139, 0.0006707384018227458, 0.0009211356518790126, 0.0005796559271402657, 0.000535176950506866, 0.0006330530159175396, 0.0005326205864548683, 0.0006312464829534292, 0.0005820983205921948, 0.0014572455547749996, 0.04789048060774803, 0.000784669304266572 ]

[ "That's actually the way I do it at the moment.", "\nBut it is clumsy to expose an interator class/struct for that.", "\nCalling opApply with additional arguments\nwould result in a more native and simpler solution.", "\nThere would be also only stack allocated memory (not sure, but I give that\nargument a shot :P).", "\nIt's also seems to be an artificial limitation. - ", "Does someone know if I'm\nright here?", "\nclass Foo\n{\nint opApply(int delegate(ref Type [, ...]) dg, uint arg = 0)\n{\nint ret = 0;\nforeach(V item; items)\n{\nif(item.size <= size) break; //use of an additional argument for filtering\nif(uint ret = dg(item)) break;\n}\nreturn ret;\n}\n}\nDaniel Keep Wrote:\n\nMandel wrote:\n\nHi,\nI like to know if this feature request is even feasible\nand what others think of it, of course.", "\nclass Foo {\nint opApply(int delegate(ref Type [, ...]) dg, float f, char[] s) {\n/*...*/\n}\n}\nfloat f = 1.5;\nchar[] s = \"abc\";\nforeach(x; xs; foo; f, s)\n{\n}\nThe idea is to pass additional values from foreach to opApply.", "\nWould be great to filter values in opApply for example.", "\n(or even chaining foreach in opApply...)" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006199518102221191, 0.0009235897450707853, 0.0006975147407501936, 0.0005867762956768274, 0.0005729437107220292, 0.0009379154071211815, 0.0010362209286540747, 0.0015830964548513293, 0.0006721660611219704, 0.0034933548886328936 ]

[ "---\nabstract: 'We investigate temperature reservoir effects in a lossy Kerr nonlinear resonator considering selective excitation of ooscillatory mode driven by a sequence of Gaussian pulses. ", "In this way, we analyze time-dependent populations of photon-number states and quantum statistics on the base of the second-order photon correlation function in one-photon and two-photon transitions. ", "The effects coming from thermal reservoirs are interesting for performing more realistic approach to generate Fock states and for study of phenomena connecting quantum engineering and temperature. ", "We also study the role of pulse-shape effects for selective excitation of oscillatory mode.'", "\nauthor:\n- 'G. H.  Hovsepyan'\n- 'G. Yu.", " Kryuchkyan'\ntitle: 'Excitations of photon-number states in Kerr nonlinear resonator at finite temperatures '\n---\n\nIntroduction {#intro}\n============\n\nAnharmonic oscillators or resonators involving Kerr-type nonlinearities have been an interesting research topic due to their broad applications in technology and fundamental physics [@kov], [@dyk]. ", "Recently, this systems with strong parameters of the nonlinearity are also attracting considerable attention for investigation of various quantum effects. ", "The quantum dynamics of the Kerr nonlinear resonator (KNR) is naturally described by Fock states, which have a defnite number of energy quanta. ", "For systems with strong Kerr nonlinearity, leading to the photon-photon interaction in QED systems, the nonlinearity makes frequencies of transitions between adjacent oscillatory energy levels different, i.e. nonlinearity effects in an anharmonic oscillator break the equidistance of oscillatory energy levels. ", "Thus, in the case of strong nonlinearity the oscillatory energy levels are well resolved and spectroscopic selective excitation of transitions between Fock states at the level of a few quanta becomes to be possible. ", "This regime has been demonstrated in the photon blockade (PB) [@Liu; @A; @Mir; @gor; @nori], generation of Fock states and superposition states in KNRs [@nori; @gev2; @mod; @sup] and on changing PB into electromagnetically-induced transparency [@nori1]. ", "Note, that nonstationary PB in a context of Fock states generation was predicted in [@schmid] for short-time evolution of a kicked KNR and then in [@imam6]. ", "The nonstationary Kerr PB is often referred to as a nonlinear optical-state truncation or nonlinear quantum scissors [@leon25].", "\n\nThe important parameter responsible for KNR to reach quantum regimes is the ratio between the parameter of the Kerr-type nonlinearity and damping of the oscillatory mode. ", "Thus, efficiency of quantum nonlinear effects requires a high nonlinearity with respect to dissipation. ", "In this respect, strong nonlinearities on a few-photon level can be produced by interaction between photons and an atom in a cavity [@Birn2; @Bish; @Fink; @Far], in systems with interacting photons or polaritons in arrays of cavities coupled to atoms or qubits [@Hart; @Utus; @Schm; @Tom], in optomechanical systems and Kerr type nonlinear cavities [@Lia; @Ferr]. ", "An important implementation of Kerr-type microwave resonator has been recently achieved in the context of superconducting devices based on the nonlinearity of the Josephson junction revealing nonlinear behavior even at the single-photon level [@lang; @hof; @kir].", "\n\nNote, that most theoretical proposals on investigation of quantum effects in nonlinear Kerr resonators are focused on using idealized cases of zero temperature reservoirs since they can lead to the study of pure quantum effects. ", "However, consideration of the reservoir at finite temperatures leads to applications in simulating of more realistic systems as well as to study of unusual quantum phenomena connecting quantum engineering and temperature.", "\n\nIn this paper we investigate finite temperature reservoir effects in the dissipative KNR considering selective excitation in transitions between Fock states. ", "For this goal we investigate selective excitation in the pulsed regime, considering KNR driven by a sequence of classical Gaussian pulses separated by time intervals. ", "This system has been used in the field of PB and generation of Fock states [@gor; @gev2; @mod] as well as for production of superpositions states in a mesoscopic range [@gev1] and for demonstration of chaos at a low level of quanta [@chaos1; @chaos2].", "\n\nIt has been demonstrated in the cited papers, that in the specific pulsed regime the obtained results considerably differ from those derived for the case of continuous-wave driving. ", "On the whole, the production of the Fock states as well as the superposition of the Fock states can be controlled by shape of pulses and is realized for time-intervals exceeding the characteristic time of decoherence. ", "Thus, the other goal of the present paper is investigation of various regimes of selective excitation in dependence from the parameters of pulses. ", "In this way, we demonstrate improving of the degree of quantum effects in KNR by applying the sequence of tailored pulses. ", "This approach was recently exploited for formation of high degree continuous-variable entanglement in the nondegenerate optical parametric oscillator [@adam; @adam2]\n\nOur consideration is based on the Hamiltonian of KNR coupled with finite temperature reservoir and the master equation for the reduced density matrix. ", "We focus on analysis of the mean photon number, the probability distributions of photons and the second-order correlation functions of photons for zero-delay time that describes quantum statistics of oscillatory mode in thermal Kerr resonator. ", "It should be mentioned that thermal reservoir effects have been widely investigated in nonlinear optical processes, particularly, for the resonance fluorescence in monochromatic field [@res; @kry; @env] and for the resonance fluorescence in bichromatic field [@kry1; @kry2; @kry3].", "\n\nThe paper is arranged as follows. ", "In Sec. ", "II we describe periodically pulsed KNR coupled with a finite temperature reservoir. ", "In Sec. ", "III we consider one-photon and two-photon selective excitations on the base of populations of photon-number states and the second-order correlation functions. ", "In subsection 3.3 we also discuss dynamics of Fock states populations in dependence from both the duration of pulses and amplitude of pump field. ", "We summarize our results in Sec. ", "IV.", "\n\n Kerr nonlinear resonator coupled with thermal reservoir\n========================================================\n\nIn this section, we give the theoretical description of the system. ", "The Kerr nonlinear resonator driven by the field at the central frequency $\\omega$ and interacting with a reservoir is described by the following Hamiltonian: $$\\begin{aligned}\nH=\\hbar \\omega_{0}a^{+}a + \\hbar \\chi a^{+{2}}a^{2}+ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\\nonumber\\\\ \n + \\hbar f(t)({\\Omega} e^{-i\\omega t}a^{+} + {\\Omega^{*}}e^{i\\omega t}a)+H_{loss}.~~~~~\n\\label{H}\\end{aligned}$$ Here, time-dependent coupling constant $\\Omega f(t)$ proportional to the driving field amplitude consists of the Gaussian pulses with the duration $T$ separated by time intervals $\\tau$ $$f(t)=\\sum{e^{-(t - t_{0} - n\\tau)^{2}/T^{2}}}, \\label{driving}$$ while $a^{+}$, $a$ are the creation and annihilation operators, $ \\omega_{0} $ is an oscillatory frequency, $\\chi$ is the nonlinearity parameter.", "\n\n$H_{loss}=a \\Gamma^{+} + a^{+}\\Gamma $ is responsible for the linear losses of oscillatory states, due to couplings with heat reservoir operators giving rise to the damping rate $\\gamma$. We trace out the reservoir degrees of freedom in the Born-Markov limit assuming that system and environment are uncorrelated at initial time t = 0. ", "This procedure leads to the master equation for the reduced density matrix. ", "The master equation within the framework of the rotating-wave approximation, in the interaction picture corresponding to the transformation $\\rho \\rightarrow e^{-i\\omega a^{+} a t}\\rho e^{i\\omega a^{+} a t} $ reads as\n\n$$\\frac{d \\rho}{dt} =-\\frac{i}{\\hbar}[H_{eff}, \\rho] +\n\\sum_{i=1,2}\\left( L_{i}\\rho\nL_{i}^{\\dagger}-\\frac{1}{2}L_{i}^{\\dagger}L_{i}\\rho-\\frac{1}{2}\\rho L_{i}^{\\dagger}\nL_{i}\\right)\\label{master},$$\n\nwhere $L_{1}=\\sqrt{(n_{th}+1)\\gamma}a$ and $L_{2}=\\sqrt{n_{th}\\gamma}a^+$ are the Lindblad operators, $\\gamma$ is a dissipation rate, and $n_{th}$ denotes the mean number of quanta of a heat bath, $n_{th}=\\frac{1}{e^{\\hbar \\omega/ kT_{B} }-1}$. The effective Hamiltonian reads as\n\n$$H_{eff}=\\hbar \\Delta a^{+}a + \\hbar \\chi a^{+2}a^{2} +\n\\hbar f(t)(\\Omega a^{+} + \\Omega^{*}a),\\label{Hamiltonian}$$\n\nwhere $\\Delta=\\omega_{0} -\\omega$ is the detuning between the mean frequency of the driving field and the frequency of the oscillator.", "\n\nNote, that analytical results for a dissipative driven nonlinear oscillator in continius-wave, steady-state regimes have been obtained in terms of the solution of the Fokker-Planck equation for the quasiprobability distribution function $P(\\alpha, \\alpha^{*})$ in complex P-representation [@drum]. ", "This approach based on the method of potential equations leads to the analytic solution for the quasiprobability distribution function $P(\\alpha, \\alpha^{*})$ within the framework of an exact nonlinear treatment of quantum fluctuations. ", "In this way, the probability distribution of photon-number states and Wigner functions have been also obtained [@a33; @a34; @kh].", "\n\nThis model seems experimentally feasible and can be realized in several physical systems. ", "Particularly, the effective Hamiltonian (\\[Hamiltonian\\]) (with $f(t)=1$ ) describes a qubit off-resonantly coupled to a driven cavity. ", "In fact, it is well known that the Hamiltonian of a two-level atom interacting with the cavity mode in the dispersive approximation, if the two-level system remains in its ground state, can be reduced to the effective Hamiltonian (\\[Hamiltonian\\]). ", "This model also describes a nanomechanical oscillator with $a^{\\dagger}$ and $a$ raising and lowering operators related to the position and momentum operators of a mode of quantum motion. ", "The other implementation is a transmission-line resonator involved the Josephson junction with quadratic part of the Josephson potential. ", "In this case the $a^{+}$ and $a$ raising and lowering operators describe the normal mode of the resonator junction circuit [@bias]. ", "Kerr-like systems seems to be important also for production of quantum correlation and maximally entangled stated. ", "They were discussed, for instance, in [@leonski1; @said; @leonski2; @said2].", "\n\nSelective excitation of Fock states {#SecPD}\n===================================\n\nIn the absence of any driving, states of the Hamiltonian (\\[Hamiltonian\\]) are the Fock photon states $|n\\rangle$ which are spaced in the energies $E_{n} = E_{0} +\n\\hbar\\omega_{0} n + \\hbar\\chi n(n-1)$ with $n = 0, 1, ...$. ", "The levels form an anharmonic ladder with anharmonicity that is given by $E_{21}-E_{10}=2\\hbar\\chi$. For strong nonlinearities $\\chi/\\gamma >1$ the nonlinear shifts of oscillatory energetic levels exceed the radiative widths of these levels. ", "In this case the selective resonance excitations of Fock states in the transitions $|m\\rangle\\rightarrow|n\\rangle$ are possible due to interaction with driving field. ", "Considering the various selective excitations from vacuum state, in the multiphoton transitions $|0\\rangle\\rightarrow|n\\rangle$, we obtain the resonance n-photon transitions between oscillatory initial and final states on the frequencies $n\\omega_n=E_{n0}=n\\omega_0+\\chi n(n-1)$. Thus, the detuning for the resonant frequencies $\\Delta_{n}=\\omega_{0} -\\omega_{n}$ is calculated as $\\Delta_{n}=-\\chi(n-1)$. For one-photon transition, $n=1$, and $E_{10}=\\hbar \\omega_0$, the resonance frequency is $\\omega_1=\\omega_0$, for two-photon transition, $n=2$, and $E_{20}=2 \\hbar \\omega_0 + 2 \\chi $, the two-photon resonance frequency is $\\omega_2=\\omega_0+ \\chi $, while for $n=3$ , $E_{30}=3 \\hbar \\omega_0 + 6 \\chi $, the resonance frequency is $\\omega_3=\\omega_0+ 2\\chi $. ", "Below, we concentrate on quantum regimes for the parameters leading to resolved oscillatory energy levels calculating the mean photon number, the photon-number distributions and the second-order correlation functions for photonic mode.", "\n\nConsidering the pulsed regimes of Kerr nonlinear reservoir we assume that the spectral widths of pulses should be smaller than the nonlinear shifts of the oscillatory energy levels. ", "It means that the duration of pulses should be larger than $1/\\chi $. ", "Thus, for strong nonlinearities $\\chi/\\gamma >1$, we arrive to the following inequalities for the duration of Gaussian pulses $1/\\gamma > T > 1/\\chi$. Note, that the temporal pulse separation is larger than the cavity photon lifetime.", "\n\nWe solve the master equation Eq. (", "\\[master\\]) numerically based on quantum state diffusion method. ", "The applications of this method for studies of driven anharmonic oscillator can be found in [@gev2; @mod; @gor; @chaos1]. ", "In the calculations, a finite basis of number states $|n\\rangle$ is kept large enough (where $n_{max}$ is typically 50) so that the highest energy states are never populated appreciably. ", "In the following the main photon number and the distributions of photon numbers $P(n)=\\langle n|\\rho|n\\rangle$ will be analyzed for various level of thermal photons. ", "We also turn to calculation of the normalized second-order correlation function for zero delay time $ g^{(2)}$ defined as: $$g^{(2)}(t)=\\frac{\\langle a^{\\dagger}(t)a^{\\dagger}(t)a(t)a(t)\\rangle}{(\\langle a^{\\dagger}(t)a(t)\\rangle)^2}$$ for observation of photon statistics and photon correlation effects. ", "Moreover, the correlation function is expressed through the mean photon number fluctuations as $\\langle (\\Delta n)^2\\rangle = \\langle n\\rangle + \\langle n\\rangle ^2(g^{(2)}-1)$. Thus, the condition $g^{(2)}<1$ corresponds to the sub-Poissonian statistics, $\\langle (\\Delta n)^2\\rangle < \\langle n\\rangle$ .", "\n\nIn the pulsed regime these quantities are nonstationary and exhibit a periodic time-dependent behavior, i.e. repeat the periodicity of the pump laser in an over transient regime. ", "Besides this, the results depend on the parameters of Gaussian pulses such as the amplitude, the duration of pulses and the time-interval between them, dissipation rates and Kerr-interaction coupling. ", "Thus, we investigate production of photonic states for an arbitrary interaction time-intervals including also time-intervals exceeding the characteristic time of dissipative processes, $t\\gg\\gamma^{-1}$. In the cited paper [@gor], only the case of KNR with the mean number of reservoir photons $ N=0.001$ has been considered. ", "In addition to this investigation, bellow we present systematic analyse of KNR for the wide range of thermal photon numbers including also vacuum case, $N=0$.\n\nThe case of reservoir at zero temperature\n-----------------------------------------\n\nIn this subsection, we consider the case of reservoir at zero temperature when only pure quantum effects occur. ", "The typical results at the detuning $\\Delta=\\Delta_{1}=0$, i. e. at the frequency $\\omega = \\omega_{0}$, corresponding to one-photon transition $|0\\rangle\\rightarrow|1\\rangle$ are depicted in Figs.1 for $T = 0 K$.\n\nThe populations $P_0, P_1$ of the photon-number states $|n\\rangle$ versus time-intervals is shown in Fig.\\[0\\] (a), while the mean photon number and the correlation function are displayed in Fig.\\[0\\] (b) for zero detuning $\\Delta=0$. These results show the selective excitations of the Fock state $|1\\rangle$. In this case the excitation power is also small therefore the high excitation numbers have not been occupied. ", "In the result only the $|1\\rangle$ is effectively excitated. ", "As we see, the population $ P_1$ reachs up to 0.8 at the maxima of the average number of photons. ", "The nonstationary correlation function versus dimensionless time intervals is shown in Fig.\\[0\\] (b) with the curve of mean photon number. ", "As we see, the average number of photons at frequency $\\omega_{0}$ follows almost the train of Gaussian pulses. ", "The second small peak corresponds to Rabi oscillations and the broadening of the shapes in comparisson with Gaussian envelopes are due to the radiative decays of the mode in a resonator. ", "The mean photon number equals to $\\langle n\\rangle$=0.9 and is approximatelly presented as $\\langle\nn\\rangle=P_1+2P_2$=0.9 in this regime. ", "Thus, time-dependence of ${\\langle n(t)\\rangle}$ repeats the behaviour of the population $ P_1$.\n\nDuring the pulses, if $P_1$ reachs to the maximum, the probability of generation of a second photon in the mode at the frequency $\\omega = \\omega_{0}$ is suppressed that is demonstrated in the behavior of $g^{(2)}(t)$. In this case oscillatory mode acquires sub-poissonian statistics with the second-order correlation function $ g^{(2)}<\n1$. As calculations show, $g^{(2)}=0.12$ at the maximum values ${\\langle n(t)\\rangle}=0.9$ and is zero at the second small peak. ", "This results are in accordance with the result that for the pure $|1\\rangle$ Fock state the normalized second-order correlation function is zero.", "\n\nThe results for the other operational regime for zero-temperature reservoir are depicted in Fig.1 (c),(d). ", "Here, we assume the regime of two-photon excitation of resonator mode, choosing $\\Delta=\\Delta_{2}=\\omega_{0} -\\omega_{2}$, at the frequency of resonance transition $\\omega_2=\\omega_0+ \\chi $. ", "Thus, in this case the detuning is $\\Delta/\\gamma=-\\chi/\\gamma$. These results indicate an effective two-photon selective excitation as illustrated in Fig.1 (c). ", "As we see, in this regime of two-photon excitation the maximal population $P_2=0.64$ exceeds the maximal population of one-photon state $P_1=0.3$ . ", "The time evolution of the mean photon number versus dimensionless time is depicted in Fig. ", "\\[0\\] (d) with the plot of the second-order correlation function. ", "In this case, the maximal value of mean photon numbers reachs to ${\\langle n(t)\\rangle}=1.9$ while the level of photon-number correlation at this time interval is $g^{(2)}=0.6$ and the variance of photon number fluctuations equals to $\\langle (\\Delta n)^2\\rangle =0.24 \\langle n\\rangle $, i.e. the oscillatory mode has sub-poissonian statistics. ", "The result on the second-order correlation function is in accordance with analytical result for pure state $|2\\rangle$. Indeed, it is easy to calculate that $\\langle 2|(a^{+})^2 a^2|2\\rangle = 2$ and thus $g^{(2)}=0.5$ for $|2\\rangle$ Fock state.", "\n\nReservoir effects in selective excitations of Fock states\n---------------------------------------------------------\n\nConsidering the reservoir at finite temperatures we realize that temperature effects can lead to decreasing of the populations in comparison to the case of zero-temperature reservoir on one side and change photon statistics of mode on the other side. ", "The results for thermal photons with $n_{th}=0.1$ are shown in Fig. ", "\\[01\\] (a),(c). ", "In order to illustrate the difference between the case of zero-temperature resonator we assume here the parameters as in the previous case depicted in Fig.\\[0\\] (a),(c). ", "As we see, the populations only are slightly decreased in the presence of temperature noise with $n_{th}=0.1$ for two considered regimes (a) and (c). ", "We show in Fig. ", "\\[01\\] (b), (d) how the mean photon numbers and the second-order correlation function explicitly depend on the time-interval. ", "As it can be seen, the maximal values of mean photon numbers are approximately the same as in the case of pure resonator, while quantum statistics of oscillatory mode is considerably changed due to the thermal noise. ", "Indeed, in this case initial time-evolution of the system until a time-interval corresponding to the first pulse coming to cavity is described by the master equation without the interaction part, $\\Omega f(t)=0$. Thus, in this range the quantity $g^{(2)}$ describes the statistics of mode of an anharmonic oscillator in thermal reservoir. ", "It displays time-dependent fluctuations around the level $g^{(2)}=2$ that correspond to the statitics of thermal light mode. ", "From the results in Fig. ", "\\[01\\] (b), (d) it can also be infered that the correlation function is sharply increasing in the fronts of pulses. ", "However, the peak values strongly depend on the parameters of nonlinearity and amplitude of pump field. ", "So, for Fig.\\[01\\] (b) the maximal value is observed as $g^{(2)}=0.45$, while for Fig.\\[01\\](d) the correation function equals to $g^{(2)}=7$, (for ${\\langle n(t)\\rangle}=0.5$), and corresponds to super-poissonan statistic of mode, $\\langle (\\Delta n)^2\\rangle =4 \\langle n\\rangle $ at this time-interval.", "\n\nIt is interesting to analyse excitations of resonator mode for high levels of thermal photon numbers. ", "In this way, in Fig. ", "\\[Stat\\] we plot the maximal values of the population $P_1$ in dependence on $n_{th}$ for the operational regime of KNR depicted in Fig.\\[0\\] and Fig.\\[01\\]. ", "As we see the population $P_1$ is strongly decreasing with increasing of the thermal photon level.", "\n\nThe correlation functions and the mean photon numbers for high levels of thermal photons are considered in details for two cases, with $n_{th}=0.58$ and $n_{th}=1.9$, in Fig. ", "\\[05819\\]. ", "We analyse finite temperature reservoir effects for one-photon and two-photon excitation regimes, corresponding to two values of the detuning: $\\Delta_{1}=0$ and $\\Delta_{2}=\\omega_{0} -\\omega_{2}=-\\chi/\\gamma$. As we see, in both these cases $g^{(2)}$ describes mainly the statistics of dissipative oscillatory mode with the dips that correspond to the peaks of the averaged photon numbers. ", "Particularly, for the regime depicted in Fig. ", "\\[05819\\] (a) the peak of mean photon number $n=0.8$ while the corresponding dip on $g^{(2)}=0.3$ shows subpoissonian staistics of mode, $\\langle (\\Delta n)^2\\rangle =0.56 \\langle n\\rangle $. ", "The location of these dips and peaks in Fig. ", "\\[05819\\] are determined by time-intervals of Gaussian pulses. ", "We also found that these dips and peaks deacrese, if the level of thermal noise increases.", "\n\nPulse-parameter effects in dynamics of the populations\n------------------------------------------------------\n\nIt should be mentioned that the parameters of the Gaussian pulses in above consideration are free parameters and they might be chosen in order to control pulsed selective excitation of resonator mode. ", "In the end of this section we shortly illustrate behavior of the populations by increasing the duration of pulses on one side and by increasing the amplitude of driving field on the other side for zero-temperature reservoir. ", "In this way, we describe two regimes of excitation: one-photon and two-photon excitations of oscillatory mode.", "\n\nFor the case when the detuning $\\Delta=\\Delta_{1}=0$, i.e. the frequency of driving field $\\omega = \\omega_{0}$ and only one-photon transition $|0\\rangle\\rightarrow|1\\rangle$ is effectively realized, the results for the population of $|1\\rangle$ Fock state are shown in Fig. ", "\\[08T\\] (a) for the duration of pulses $T=0.8{\\gamma}^{-1}$. In this case, only two energetic levels of mode are effectively involved in the Rabi-like oscillations of the populations $P_0$ and $P_1$ of vacuum and first excitation number states that is demonstrated in Fig.\\[08T\\] (a). ", "Comparing this result with analogous one depicted in Fig. ", "\\[0\\](a) we conclude that the number of Rabi oscillations increases with increasing of the duration of pulses. ", "The population $P_2$ is shown in Fig. ", "\\[08T\\] (b) for the case of two-photon excitation assuming $\\Delta=-\\chi$. As we see, time-dependence of the population displays Rabi oscillation in difference from the population shown in Fig.\\[0\\] (c) for the case of more short pulses. ", "The analogous situation takes place for photon populations in increasing of the amplitude of pump field in comparisson with the case of Fig. ", "\\[0\\](c). ", "The results for the case of more strong pump field, $\\Omega/\\gamma =14$ and $\\Omega/\\gamma =25$ are presented in Figs. ", "\\[pulse\\_effect\\]. ", "As we see, the Rabi-like oscillations of the populations increase if the pump amplitude increases.", "\n\nConclusion {#Conclusion}\n==========\n\nIn conclusion, we have investigated selective excitation of photon-states in a lossy Kerr-nonlinear resonator at finite temperatures driven by a sequence of Gaussian pulses. ", "In quantum regime realized for strong Kerr nonlinearities with respect to the rate of damping of the oscillatory mode one-photon excitation $|0\\rangle\\rightarrow|1\\rangle$ at the frequency $E_{10}=\\hbar \\omega_0$, as well as two-photon excitation $|0\\rangle\\rightarrow|2\\rangle$ at the frequency $E_{20}=2 \\hbar \\omega_0 + 2 \\chi $ have been analyzed in details.", "\n\nWe have demonstrated that the larger photon-number populations of the resonator can be reached if shaped pulses are implemented. ", "The dynamics of mean number of photons and populations of Fock states follow almost to the train of Gaussian pulses and display Rabi oscillations and the broadening of the shapes in comparison with Gaussian envelopes. ", "These oscillations are due to the radiative decays of the mode in a resonator for time-intervals between pulses. ", "We have illustrated the increasing of the number of Rabi oscillations with increasing of the duration of pulses as well as with increasing of the amplitude of driving field.", "\n\nWe have demonstrated that temperature effects leads to decreasing of the populations in comparison with the zero-temperature case on one side and also change cardinally photon statitics of mode on the other side. ", "Particularly, this behaviour on the maximal values of the population $P_1$ in dependence on $n_{th}$ has been illustrated in Fig. ", "3 for wide range of the thermal photon level. ", "The quantum statistics of mode is described on the framework of non-stationary second-order correlation function $g^{(2)}$ and the mean photon number fluctuations $\\langle (\\Delta n)^2\\rangle$. In this way, we have studied engineering of photon statistics via a thermal reservoir that is illustrated in Fig. ", "2(b), (d) and Fig. ", "\\[05819\\]. ", "In case of high level of reservoir photons, $g^{(2)}$ describes mainly the statistics of dissipative mode of the anharmonic oscillator in thermal reservoir with the dips that correspond to the peaks of the averaged photon numbers. ", "The location of these dips showing photon antibunching are determined by time-intervals of Gaussian pulses.", "\n\nWe acknowledge support from the Armenian State Committee of Science, the Project No.13-1C031. ", "G. Yu. ", "K. acknowledges discussions with Lock Yue Chew, I. A. Shelykh and S. R. Shahinyan.", "\n\n[0]{} I. Kovacic and M. J. Brennan, The Duffing Equation: Nonlinear Oscillators and Their Behaviour (Wiley, Hoboken, NJ, 2011). ", "M. Dykman, Fluctuating Nonlinear Oscillators, (Oxford University Press, Oxford, 2012).", "\n\nY. X. Liu, A. Miranowicz, Y. B. Gao, J. Bajer, C. P. Sun, and F. Nori, Phys. ", "Rev. A [**82**]{}, (2010) 032101.", "\n\nA. Faraon, A. Majumdar, and J. Vu$\\check{c}$ković, Phys. ", "Rev. A [**81**]{},(2010) 033838 .", "\n\nA. Miranowicz, M. Paprzycka, Y. X. Liu, J. Bajer, and F. Nori, Phys. ", "Rev. A [**87**]{}, (2013) 023809 .", "\n\nG. H. Hovsepyan, A. R. Shahinyan, and G. Yu. ", "Kryuchkyan, Phys. ", "Rev. A [**90**]{},(2014) 013839 .", "\n\nA. Miranowicz, J. Bajer, M. Paprzycka, Yu-xi Liu, A. M. Zagoskin, and F. Nori, Phys. ", "Rev. A [**90**]{},(2014) 033831.", "\n\nT. V. Gevorgyan, A. R. Shahinyan, and G. Yu. ", "Kryuchkyan, Phys. ", "Rev. A [**85**]{},(2012) 053802.", "\n\nT.V. Gevorgyan and G.Yu. ", "Kryuchkyan, Journal of Modern Optics [**60**]{},(2013) 860.", "\n\nA. Miranowicz, M. Paprzycka, A. Pathak, and F. Nori, Phys. ", "Rev. A [**89**]{}, (2014) 033812 .", "\n\nYu-xi Liu, Xun-Wei Xu, A. Miranowicz, and F. Nori, Phys. ", "Rev. A [**89**]{}, (2014) 043818 .", "\n\nW. Leoński and R. Tanaś, Phys. ", "Rev. A[**49**]{}, (1994) R20.", "\n\nA. Imamoglu, H. Schmidt, G. Woods, and M. Deutsch, Phys. ", "Rev. Lett. [**", "79**]{}, (1997) 1467; ibid [**81**]{}, (1998) 2833.", "\n\nW. Leoński and A. Kowalewska-Kudłaszyk, Progress in Optics, [**56**]{}, (2011) 131.", "\n\nK. M. Birnbaum, A. Boca, R. Miller, A.D. Boozer, T. E. Northup, and H. J. Kimble, Nature (London) [**436**]{},(2005) 87.", "\n\nL. S. Bishop, J. M. Chow, J. Koch, A. A. Houck, M. H. Devoret, E. Thuneberg, S.M. Girvin, and R. J. Schoelkopf, Nature Phys. [**", "5**]{},(2008) 105 .", "\n\nJ. M. Fink, M. Goppl, M. Baur, R. Bianchetti, A. Leek, P. J. Blais, and A. Wallraf, Nature (London) [**454**]{},(2008) 315.", "\n\nA. Faraon, I. Fushman, D. Englund, N. Stoltz, P. Petro, and J. Vu$\\check{c}$ković, Nature Phys. [**", "4**]{},(2008) 859 .", "\n\nM. J. Hartmann, F. G. S. L. Brandao, and M. B. Plenio, Laser Photon. ", "Rev. [**2**]{},(2008) 527 .", "\n\nN. Na, S. Utsunomiya, L. Tian, and Y. Yamamoto, Phys. ", "Rev. A [**77**]{},(2008) 031803 .", "\n\nS. Schmidt and G. Blatter, Phys. ", "Rev. Lett. [**", "103**]{},(2009) 086403 .", "\n\nA. Tomadin, V. Giovannetti, R. Fazio, D. Gerace, I.Carusotto, H. E. Tureci, and A. Imamoglu, Phys. ", "Rev. A [**81**]{},(2010) 061801.", "\n\nJ. Q. Liao and C. K. Law, Phys. ", "Rev. A [**82**]{}, (2010) 053836.", "\n\nS. Ferretti, L. C. Andreani, H. E. T[ü]{}reci, and D. Gerace, Phys. ", "Rev. A [**82**]{},(2010) 013841.", "\n\nC. Lang, D. Bozyigit, C. Eichler, L. Steffen, J. M. Fink, A. A. Abdumalikov, M. Baur, S. Filipp, M. P. da Silva, A. Blais, and A. Wallraff, Phys. ", "Rev. Lett. [**", "106**]{},(2011) 243601. ", "A. J. Hoffman, S. J. Srinivasan, S. Schmidt, L. Spietz, J. Aumentado, H. E. T[ü]{}reci, and A. A. Houck, Phys. ", "Rev. Lett. [**", "107**]{}, (2011) 053602 . ", "G. Kirchmair, B. Vlastakis, Z. Leghtas, S. E. Nigg, H. Paik, E. Ginossar, M. Mirrahimi, L. Frunzio, S. M. Girvin, and R. J. Schoelkopf, Nature (London) [**495**]{}, (2013) 205.", "\n\nT. V. Gevorgyan, A. R. Shahinyan, and G. Yu. ", "Kryuchkyan, Phys. ", "Rev. A [**79**]{},(2009) 053828.", "\n\nT. V. Gevorgyan, A. R. Shahinyan, Lock Yue Chew and G. Yu. ", "Kryuchkyan, Phys. ", "Rev. E [**88**]{},(2013) 022910. ", "A. R. Shahinyan, Lock Yue Chew, G. Yu. ", "Kryuchkyan, Phys. ", "Lett. ", "A [**377**]{}, (2013) 2743.", "\n\nH. H. Adamyan and G. Yu. ", "Kryuchkyan, Phys. ", "Rev. A [**74**]{}, (2006) 023810.", "\n\nN. H. Adamyan, H. H. Adamyan, and G. Yu. ", "Kryuchkyan, Phys. ", "Rev. A [**77**]{},(2008) 023820.", "\n\nG.P. Hildred, S. S.Hassan, R. R. Puri and R. K. Bullough, J. Phys. ", "B: At. ", "Mol. ", "Phys. [**", "16**]{} (1983) 1703.", "\n\nG. Yu. ", "Kryuchkyan, JETP [**82**]{} (I), (1996) 60.", "\n\nG. Yu. ", "Kryuchkyan, N. T. Mouradyan, A. S. Sargsian, Optics Communications [**152**]{}, (1998) 175.", "\n\nG. Yu. ", "Kryuchkyan, M. Jakob, A. S. Sargsian, Phys. ", "Rev. A [**57**]{},(1998) 2091.", "\n\nM. Jakob, G. Yu. ", "Kryuchkyan, Phys. ", "Rev. A [**58**]{},(1998) 767.", "\n\nM. Jakob, G.Yu. ", "Kryuchkyan, Phys. ", "Rev. A [**57**]{},(1998) 1355.", "\n\nP. D. Drummond and D. F. Walls, J. Phys. ", "A: Math. ", "Gen. [**13**]{},(1980) 725 .", "\n\nG. Yu. ", "Kryuchkyan and K. V. Kheruntsyan, Opt. ", "Comm. [**", "120**]{},(1996) 132 .", "\n\nK. V. Kheruntsyan, D.S. Krahmer, G.Yu. ", "Kryuchkyan, K.G. Petrossian, Opt. ", "Comm. [**", "139**]{},(1997) 157.", "\n\nK. V. Kherunstyan, J. Opt. ", "B: Quantum Simclassical Opt.[**1**]{}, (1999) 225.", "\n\nJ. Bourassa, F. Beaudoin, Jay M. Gambetta, and A. Blais, Phys. ", "Rev. A [**86** ]{},(2012) 013814 .", "\n\nA. Miranowicz and W. Leoński, J. Opt. ", "B: Quantum Semiclass. ", "Opt. [**", "6**]{} (2004) S43. ", "R. S. Said et al, J. Phys. ", "B: At. ", "Mol. ", "Opt. ", "Phys. [**", "39**]{},(2006) 1269. ", "A. Kowalewska-Kudłaszyk and W. Leoński, J. Phys. ", "B: At. ", "Mol. ", "Opt. ", "Phys. [**", "43**]{}, (2010) 205503. ", "R.S. Said, M.R.B. Wahiddin, B.A. Umarov, Phys. ", "Lett. ", "A [**365**]{}, (2007) 380.", "\n" ]

{ "pile_set_name": "ArXiv" }

[ 0.0006798661779612303, 0.0005730108823627234, 0.0032226773910224438, 0.0005941346753388643, 0.0007530782022513449, 0.0006401098216883838, 0.0005561898578889668, 0.0176401250064373, 0.0006817195098847151, 0.005299536511301994, 0.004910074174404144, 0.015939805656671524, 0.0006282350514084101, 0.0006082883337512612, 0.0006217394256964326, 0.0006706697167828679, 0.0006288831355050206, 0.0005956724053248763, 0.0005209039081819355, 0.01409473642706871, 0.000598859682213515, 0.004390622489154339, 0.0005610855296254158, 0.016595209017395973, 0.0005843930994160473, 0.0005677955341525376, 0.0005986279575154185, 0.0006160279735922813, 0.0006609861738979816, 0.0005727496463805437, 0.0007872022106312215, 0.0005542577710002661, 0.0007872022106312215, 0.0006156258750706911, 0.019191699102520943, 0.0006265598349273205, 0.0013316390104591846, 0.0008136600372381508, 0.005798217374831438, 0.0010925406822934747, 0.0006310666212812066, 0.007620539516210556, 0.000630003516562283, 0.0006137877353467047, 0.0006387684843502939, 0.0005617967108264565, 0.0009504220215603709, 0.0006657508783973753, 0.0007502002990804613, 0.0007023216458037496, 0.0006770690670236945, 0.0005495043005794287, 0.000589693954680115, 0.5128249526023865, 0.0011855197371914983, 0.06259767711162567, 0.0012702824315056205, 0.0005566451582126319, 0.0005854397895745933, 0.0007031859131529927, 0.0007756327395327389, 0.0006092410767450929, 0.0006755025824531913, 0.0007005074876360595, 0.0006373776705004275, 0.0007793917320668697, 0.000932718685362488, 0.000975167378783226, 0.000693809415679425, 0.0005974436062388122, 0.0007095165201462805, 0.0006455615512095392, 0.012534712441265583, 0.0015219496563076973, 0.0007152222096920013, 0.0006808335892856121, 0.0007094979519024491, 0.0007693102234043181, 0.001175855053588748, 0.0012785096187144518, 0.057150986045598984, 0.0005656931316480041, 0.000811413861811161, 0.0007811233517713845, 0.0007111954619176686, 0.000583553162869066, 0.0007956491899676621, 0.0009203600930050015, 0.028610600158572197, 0.013264897279441357, 0.0006581490160897374, 0.0011472158366814256, 0.0006394933443516493, 0.0005802119849249721, 0.0006412550574168563, 0.0007011432899162173, 0.0006554870051331818, 0.0006763638230040669, 0.0006309878081083298, 0.0006158991018310189, 0.0006425318424589932, 0.0005860559176653624, 0.000977440271526575, 0.0005699467146769166, 0.0006522015319205821, 0.0007610037573613226, 0.0005791395669803023, 0.000582036969717592, 0.002514271065592766, 0.0006073634722270072, 0.0006220013601705432, 0.0035996397491544485, 0.0006592161953449249, 0.0007994220359250903, 0.0007174463244155049, 0.000633634568657726, 0.0005822659004479647, 0.0007050057174637914, 0.02715633437037468, 0.0011874563060700893, 0.0006017051637172699, 0.0008598475833423436, 0.0007282283040694892, 0.0007372771506197751, 0.0005973940715193748, 0.0018378901295363903, 0.0005746711394749582, 0.0009613397414796054, 0.0007259179255925119, 0.0007200192776508629, 0.0007100168149918318, 0.0005652105319313705, 0.019276469945907593, 0.0011130212806165218, 0.0005675372085534036, 0.0005830070003867149, 0.0006466860068030655, 0.0005848196451552212, 0.0006301669054664671, 0.0006810886552557349, 0.002514271065592766, 0.0006480294978246093, 0.0006602265639230609, 0.0005212394753471017, 0.001338259782642126, 0.0006235312903299928, 0.0006648399867117405, 0.0006907899514771998, 0.000921725993975997, 0.0007922045770101249, 0.0010279209818691015, 0.0008162891026586294, 0.0009116412256844342, 0.0008328139083459973, 0.000943048158660531, 0.001126971561461687, 0.0007657489622943103, 0.0009490493102930486, 0.0008075378718785942, 0.0010672920616343617, 0.001126971561461687, 0.0008035129867494106, 0.0012977311853319407, 0.0008230542880482972, 0.0010179392993450165, 0.0008006182033568621, 0.0007393382838927209, 0.0008071981719695032, 0.0009288971778005362, 0.0007527141715399921, 0.000987027189694345, 0.0009571398259140551, 0.0008754727896302938, 0.0007460644701495767, 0.0007407551165670156, 0.0008149120258167386, 0.0008541436982341111, 0.0007478209445253015, 0.0008422333048656583, 0.0008364421664737165, 0.0007480186759494245, 0.0007834873395040631, 0.0008348698611371219, 0.0008192412788048387, 0.0010496340692043304, 0.0009571398259140551, 0.0009101267787627876, 0.0010711576323956251, 0.0007810724200680852, 0.0008471693145111203, 0.0008036933722905815, 0.0009635263122618198, 0.0007756219711154699, 0.0010194143978878856, 0.0009571398259140551, 0.0008588015916757286, 0.0011223673354834318, 0.0009571398259140551, 0.0009088727529160678, 0.0012868004851043224, 0.0010672920616343617, 0.001126971561461687, 0.0008141912403516471, 0.0011194683611392975, 0.001126971561461687, 0.000822773901745677, 0.0028599274810403585, 0.001126971561461687, 0.0019435402937233448, 0.0008733231807127595, 0.0009475129772908986, 0.001126971561461687, 0.000805628311354667, 0.0009078891598619521, 0.001126971561461687, 0.000804066366981715, 0.001029093866236508, 0.0008466108120046556, 0.002802213653922081, 0.001444116816855967, 0.0007963413372635841, 0.001338259782642126, 0.0007995257619768381, 0.001338259782642126, 0.0007295554969459772, 0.001338259782642126, 0.0009109366219490767, 0.0007684200536459684, 0.0007939239148981869, 0.001126971561461687, 0.0007734129321761429, 0.0007939239148981869, 0.001126971561461687, 0.0007610817556269467, 0.0009135437430813909, 0.0007831603870727122, 0.0008601532899774611, 0.001338259782642126, 0.0008871449390426278, 0.00120817800052464, 0.0010192003101110458, 0.0011108895996585488, 0.0008310577250085771, 0.00120817800052464, 0.0010091459844261408, 0.0009044649195857346, 0.0007944736862555146, 0.0008988069021143019, 0.0008001511450856924, 0.0007761431625112891, 0.0007761853630654514, 0.0010680259438231587, 0.0009693056927062571, 0.0008248078520409763, 0.0008466108120046556, 0.002802213653922081, 0.00123882619664073, 0.001444116816855967, 0.0009238366037607193, 0.0009154179133474827, 0.0008466108120046556, 0.002802213653922081, 0.00123882619664073, 0.001444116816855967, 0.000849845411721617, 0.0008584472816437483, 0.0019435402937233448, 0.0006921428721398115, 0.001995444530621171 ]

[ "In some situations, including emergencies, an incapacitated telephone user may be unable to reach the phone to make or take a call. ", "The state of affairs may be even more complicated when a cellular telephone is used, since the phone does not operate to receive calls if it is turned off. ", "Given these circumstances, incapacitated users may be unable to communicate with others to receive help when assistance is most needed." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0006019690190441906, 0.0005751440767198801, 0.0006732928450219333 ]

[ "{\n \"images\" : [\n {\n \"filename\" : \"fall_promo_menu_left.png\",\n \"idiom\" : \"universal\",\n \"scale\" : \"1x\"\n },\n {\n \"filename\" : \"fall_promo_menu_left@2x.png\",\n \"idiom\" : \"universal\",\n \"scale\" : \"2x\"\n },\n {\n \"filename\" : \"fall_promo_menu_left@3x.png\",\n \"idiom\" : \"universal\",\n \"scale\" : \"3x\"\n }\n ],\n \"info\" : {\n \"author\" : \"xcode\",\n \"version\" : 1\n }\n}\n" ]

{ "pile_set_name": "Github" }

[ 0.0007049019332043827 ]

[ "/* crypto/rsa/rsa_pk1.c */\n/* Copyright (C) 1995-1998 Eric Young (eay@cryptsoft.com)\n * All rights reserved.", "\n *\n * This package is an SSL implementation written\n * by Eric Young (eay@cryptsoft.com).", "\n * The implementation was written so as to conform with Netscapes SSL.", "\n *\n * This library is free for commercial and non-commercial use as long as\n * the following conditions are aheared to. ", " The following conditions\n * apply to all code found in this distribution, be it the RC4, RSA,\n * lhash, DES, etc., ", "code; not just the SSL code. ", " The SSL documentation\n * included with this distribution is covered by the same copyright terms\n * except that the holder is Tim Hudson (tjh@cryptsoft.com).", "\n *\n * Copyright remains Eric Young's, and as such any Copyright notices in\n * the code are not to be removed.", "\n * If this package is used in a product, Eric Young should be given attribution\n * as the author of the parts of the library used.", "\n * This can be in the form of a textual message at program startup or\n * in documentation (online or textual) provided with the package.", "\n *\n * Redistribution and use in source and binary forms, with or without\n * modification, are permitted provided that the following conditions\n * are met:\n * 1. ", "Redistributions of source code must retain the copyright\n * notice, this list of conditions and the following disclaimer.", "\n * 2. ", "Redistributions in binary form must reproduce the above copyright\n * notice, this list of conditions and the following disclaimer in the\n * documentation and/or other materials provided with the distribution.", "\n * 3. ", "All advertising materials mentioning features or use of this software\n * must display the following acknowledgement:\n * \"This product includes cryptographic software written by\n * Eric Young (eay@cryptsoft.com)\"\n * The word 'cryptographic' can be left out if the rouines from the library\n * being used are not cryptographic related :-).", "\n * 4. ", "If you include any Windows specific code (or a derivative thereof) from\n * the apps directory (application code) you must include an acknowledgement:\n * \"This product includes software written by Tim Hudson (tjh@cryptsoft.com)\"\n *\n * THIS SOFTWARE IS PROVIDED BY ERIC YOUNG ``AS IS'' AND\n * ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE\n * IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE\n * ARE DISCLAIMED. ", " IN NO EVENT SHALL THE AUTHOR OR CONTRIBUTORS BE LIABLE\n * FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL\n * DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS\n * OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION)\n * HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT\n * LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY\n * OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF\n * SUCH DAMAGE.", "\n *\n * The licence and distribution terms for any publically available version or\n * derivative of this code cannot be changed. ", " i.e. this code cannot simply be\n * copied and put under another distribution licence\n * [including the GNU Public Licence.]", "\n */\n\n#include \"constant_time_locl.h\"\n\n#include <stdio.h>\n#include \"cryptlib.h\"\n#include <openssl/bn.h>\n#include <openssl/rsa.h>\n#include <openssl/rand.h>\n\nint RSA_padding_add_PKCS1_type_1(unsigned char *to, int tlen,\n const unsigned char *from, int flen)\n{\n int j;\n unsigned char *p;\n\n if (flen > (tlen - RSA_PKCS1_PADDING_SIZE)) {\n RSAerr(RSA_F_RSA_PADDING_ADD_PKCS1_TYPE_1,\n RSA_R_DATA_TOO_LARGE_FOR_KEY_SIZE);\n return (0);\n }\n\n p = (unsigned char *)to;\n\n *(p++) = 0;\n *(p++) = 1; /* Private Key BT (Block Type) */\n\n /* pad out with 0xff data */\n j = tlen - 3 - flen;\n memset(p, 0xff, j);\n p += j;\n *(p++) = '\\0';\n memcpy(p, from, (unsigned int)flen);\n return (1);\n}\n\nint RSA_padding_check_PKCS1_type_1(unsigned char *to, int tlen,\n const unsigned char *from, int flen,\n int num)\n{\n int i, j;\n const unsigned char *p;\n\n p = from;\n if ((num !", "= (flen + 1)) || (*(p++) !", "= 01)) {\n RSAerr(RSA_F_RSA_PADDING_CHECK_PKCS1_TYPE_1,\n RSA_R_BLOCK_TYPE_IS_NOT_01);\n return (-1);\n }\n\n /* scan over padding data */\n j = flen - 1; /* one for type. */", "\n for (i = 0; i < j; i++) {\n if (*p !", "= 0xff) { /* should decrypt to 0xff */\n if (*p == 0) {\n p++;\n break;\n } else {\n RSAerr(RSA_F_RSA_PADDING_CHECK_PKCS1_TYPE_1,\n RSA_R_BAD_FIXED_HEADER_DECRYPT);\n return (-1);\n }\n }\n p++;\n }\n\n if (i == j) {\n RSAerr(RSA_F_RSA_PADDING_CHECK_PKCS1_TYPE_1,\n RSA_R_NULL_BEFORE_BLOCK_MISSING);\n return (-1);\n }\n\n if (i < 8) {\n RSAerr(RSA_F_RSA_PADDING_CHECK_PKCS1_TYPE_1,\n RSA_R_BAD_PAD_BYTE_COUNT);\n return (-1);\n }\n i++; /* Skip over the '\\0' */\n j -= i;\n if (j > tlen) {\n RSAerr(RSA_F_RSA_PADDING_CHECK_PKCS1_TYPE_1, RSA_R_DATA_TOO_LARGE);\n return (-1);\n }\n memcpy(to, p, (unsigned int)j);\n\n return (j);\n}\n\nint RSA_padding_add_PKCS1_type_2(unsigned char *to, int tlen,\n const unsigned char *from, int flen)\n{\n int i, j;\n unsigned char *p;\n\n if (flen > (tlen - 11)) {\n RSAerr(RSA_F_RSA_PADDING_ADD_PKCS1_TYPE_2,\n RSA_R_DATA_TOO_LARGE_FOR_KEY_SIZE);\n return (0);\n }\n\n p = (unsigned char *)to;\n\n *(p++) = 0;\n *(p++) = 2; /* Public Key BT (Block Type) */\n\n /* pad out with non-zero random data */\n j = tlen - 3 - flen;\n\n if (RAND_bytes(p, j) <= 0)\n return (0);\n for (i = 0; i < j; i++) {\n if (*p == '\\0')\n do {\n if (RAND_bytes(p, 1) <= 0)\n return (0);\n } while (*p == '\\0');\n p++;\n }\n\n *(p++) = '\\0';\n\n memcpy(p, from, (unsigned int)flen);\n return (1);\n}\n\nint RSA_padding_check_PKCS1_type_2(unsigned char *to, int tlen,\n const unsigned char *from, int flen,\n int num)\n{\n int i;\n /* |em| is the encoded message, zero-padded to exactly |num| bytes */\n unsigned char *em = NULL;\n unsigned int good, found_zero_byte;\n int zero_index = 0, msg_index, mlen = -1;\n\n if (tlen < 0 || flen < 0)\n return -1;\n\n /*\n * PKCS#1 v1.5 decryption. ", "See \"PKCS #1 v2.2: RSA Cryptography Standard\",\n * section 7.2.2.", "\n */\n\n if (flen > num)\n goto err;\n\n if (num < 11)\n goto err;\n\n em = OPENSSL_malloc(num);\n if (em == NULL) {\n RSAerr(RSA_F_RSA_PADDING_CHECK_PKCS1_TYPE_2, ERR_R_MALLOC_FAILURE);\n return -1;\n }\n memset(em, 0, num);\n /*\n * Always do this zero-padding copy (even when num == flen) to avoid\n * leaking that information. ", "The copy still leaks some side-channel\n * information, but it's impossible to have a fixed memory access\n * pattern since we can't read out of the bounds of |from|.", "\n *\n * TODO(emilia): Consider porting BN_bn2bin_padded from BoringSSL.", "\n */\n memcpy(em + num - flen, from, flen);\n\n good = constant_time_is_zero(em[0]);\n good &= constant_time_eq(em[1], 2);\n\n found_zero_byte = 0;\n for (i = 2; i < num; i++) {\n unsigned int equals0 = constant_time_is_zero(em[i]);\n zero_index =\n constant_time_select_int(~found_zero_byte & equals0, i,\n zero_index);\n found_zero_byte |= equals0;\n }\n\n /*\n * PS must be at least 8 bytes long, and it starts two bytes into |em|.", "\n * If we never found a 0-byte, then |zero_index| is 0 and the check\n * also fails.", "\n */\n good &= constant_time_ge((unsigned int)(zero_index), 2 + 8);\n\n /*\n * Skip the zero byte. ", "This is incorrect if we never found a zero-byte\n * but in this case we also do not copy the message out.", "\n */\n msg_index = zero_index + 1;\n mlen = num - msg_index;\n\n /*\n * For good measure, do this check in constant time as well; it could\n * leak something if |tlen| was assuming valid padding.", "\n */\n good &= constant_time_ge((unsigned int)(tlen), (unsigned int)(mlen));\n\n /*\n * We can't continue in constant-time because we need to copy the result\n * and we cannot fake its length. ", "This unavoidably leaks timing\n * information at the API boundary.", "\n * TODO(emilia): this could be addressed at the call site,\n * see BoringSSL commit 0aa0767340baf925bda4804882aab0cb974b2d26.", "\n */\n if (!", "good) {\n mlen = -1;\n goto err;\n }\n\n memcpy(to, em + msg_index, mlen);\n\n err:\n if (em !", "= NULL)\n OPENSSL_free(em);\n if (mlen == -1)\n RSAerr(RSA_F_RSA_PADDING_CHECK_PKCS1_TYPE_2,\n RSA_R_PKCS_DECODING_ERROR);\n return mlen;\n}\n" ]

{ "pile_set_name": "Github" }

[ 0.0006688024150207639, 0.0007292033988051116, 0.0006899527506902814, 0.0006388156907632947, 0.0006050054216757417, 0.0006852235528640449, 0.0005867203581146896, 0.0006802404532209039, 0.0005583979655057192, 0.0005353657179512084, 0.0006097714649513364, 0.0006156472954899073, 0.0011040889658033848, 0.0005860704113729298, 0.001155321253463626, 0.0006039229338057339, 0.001207580789923668, 0.000562547123990953, 0.0007719656568951905, 0.0006020943983457983, 0.0006171900313347578, 0.006053773686289787, 0.0023734108544886112, 0.0008592313388362527, 0.005750058218836784, 0.010721265338361263, 0.0007594584603793919, 0.01142080407589674, 0.0006415554671548307, 0.0010763519676402211, 0.002178184688091278, 0.001421587192453444, 0.0010696123354136944, 0.0007514567114412785, 0.0008520379778929055, 0.0009399434202350676, 0.0005937624955549836, 0.0030064117163419724, 0.0014743296196684241, 0.0016204094281420112, 0.007173311896622181 ]

[ "GFI Russia\n\nGFI Russia is a Russian video game developer. ", " It was founded in 1996 as MiST Land South by a group of friends and located in Zelenograd, Moscow. ", "It was purchased in 2003 by Game Factory Interactive and reorganize into GFI Russia in 2006.", "\n\nMiST Land South was chosen by Game Factory Interactive (GFI) to develop the next two installments in the Jagged Alliance series: Jagged Alliance 3 and Jagged Alliance 3D. The MiST Land South has't completed the development because of Strategy First (the owners of the Jagged Alliance intellectual property) had withdrawn the license from GFI.", "\n\nGames\n\nMiST Land South \nMiST Land South released three strategy games since its inception:\nHistory of Wars: Napoleon (2000)\nParadise Cracked (2002)\nThe Power of Law (2004)\nThe Power of Law: Police stories (2004)\nAlfa: Antiterror (2005)\nАlfa: Antiterror. ", "Male work (2005)\n\nGFI Russia \n Gluc'Oza: Action! (", "2007)\n Hired Guns - The Jagged Edge (2007) (game-engine and idea from cancelled Jagged Alliance 3D)\n 4th Batalion (cancelled in 2007)\n Warfare (2008)\n\nReferences\n\nExternal links\n GFI Russia at MobyGames\n\nCategory:Video game companies established in 1996\nCategory:Video game companies of Russia\nCategory:Zelenograd\nCategory:1996 establishments in Russia" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0022426494397222996, 0.0006319702952168882, 0.0006195764290168881, 0.000633416639175266, 0.0007635108777321875, 0.008390013128519058, 0.0005779361235909164 ]

[ "---\nabstract: 'Faraday waves in a cigar-shaped Bose-Einstein condensate are created. ", "It is shown that periodically modulating the *transverse* confinement, and thus the nonlinear interactions in the BEC, excites small amplitude *longitudinal* oscillations through a parametric resonance. ", "It is also demonstrated that even without the presence of a continuous drive, an initial transverse breathing mode excitation of the condensate leads to spontaneous pattern formation in the longitudinal direction. ", "Finally, the effects of strongly driving the transverse breathing mode with large amplitude are investigated. ", "In this case, impact-oscillator behavior and intriguing nonlinear dynamics, including the gradual emergence of multiple longitudinal modes, are observed.'", "\nauthor:\n- 'P.'\n- 'C.'\n- 'M. A.'\ntitle: 'Observation of Faraday Waves in a Bose-Einstein Condensate'\n---\n\n[^1]\n\nIn 1831, Faraday studied the behavior of liquids that are contained in a vessel subjected to oscillatory vertical motion [@Faraday1831]. ", "He found that fluids including alcohol, white of egg, ink and milk produce regular striations on their surface. ", "These striations oscillate at half the driving frequency and are termed Faraday waves. ", "They are considered to be an important discovery. ", "Since then, the more general topic of pattern formation in driven systems has been met with great interest, and patterns have been observed in hydrodynamic systems, nonlinear optics, oscillatory chemical reactions, and biological media [@Cross1993].", "\n\nIn this paper we study pattern formation by modulating the nonlinearity in a Bose-Einstein condensate (BEC). ", "Nonlinear dynamics arise from the interatomic interactions in this ultracold gas. ", "In the past the observation of interesting phenomena has motivated researchers to propose and implement various techniques to manipulate the nonlinearity. ", "Such control has been accomplished for example by exploiting Feshbach resonances [@Inouye1998]. ", "In our experiment we investigate an alternative technique, namely periodically modulating the nonlinearity by changing the radial confinement of an elongated, cigar-shaped BEC held in a magnetic trap. ", "The radial modulation leads to a periodic change of the density of the cloud in time, which is equivalent to a change of the nonlinear interactions and the speed of sound. ", "This can, in turn, lead to the parametric excitation of longitudinal sound-like waves in the direction of weak confinement. ", "This process is analogous to Faraday’s experiment where the vertical motion of the vessel produced patterns that were laterally spread out.", "\n\nIt has been shown theoretically that for a BEC, a Faraday type modulation scheme in the case of small driving frequencies leads one to the same type of analysis as would the direct modulation of the interatomic interaction, e.g., by a Feshbach resonance [@Staliunas2002; @Staliunas2004]. ", "In both cases, the dynamics are governed by a Mathieu equation that is typical for parametrically driven systems. ", "Floquet analysis reveals that a series of resonances exist, consisting of a main resonance at half the driving frequency, and higher resonance tongues at integer multiples of half the driving frequency [@Staliunas2002].", "\n\nIn our experiment we exploit this transverse modulation scheme for three different applications. ", "First, we apply a relatively weak continuous modulation, demonstrate the emergence of longitudinal Faraday waves, and study their behavior as a function of the excitation frequency. ", "Second, we investigate longitudinal patterns that emerge as a consequence of an initial transverse breathing mode excitation without the presence of a continuous drive. ", "This has important consequences in the context of damped BEC oscillations and has been studied theoretically in [@Kagan2001]. ", "Since the first experiments with BECs, the study of collective excitations has been a central theme [@Jin1996; @Mewes1996]. ", "The transverse breathing mode, which we exploit in our experiments, plays a prominent role: Chevy et al. [", "@Chevy2002] showed that this mode exhibits unusual properties, namely an extremely high quality factor and a frequency nearly independent of temperature. ", "Finally, in a third set of measurements we study the situation of a relatively strong modulation, resonantly driving the transverse breathing mode. ", "We show that the condensate responds as an impact oscillator, which leads to intriguing multimode dynamics.", "\n\nThe experiments were carried out in a newly constructed BEC machine that produces cigar-shaped condensates of $^{87}$Rb atoms in the $|F=1,m_{F}=-1\\rangle$ state. ", "The typical atom number in the BEC is $5 \\cdot10^{5}$, and the atoms are evaporatively cooled until no thermal cloud surrounding the condensate is visible any more. ", "The atoms are held in a cylindrically symmetric Ioffe-Pritchard type magnetic trap with the harmonic trapping frequencies of $\\{\\omega_{xy}/(2\\pi),\\omega_{z}/(2\\pi)\\}=\\{160.5,7\\}$Hz. ", "The weakly confined z-direction is oriented horizontally. ", "For the experiments described below, the following collective mode frequencies are of particular importance: first, there exists a high-frequency transverse breathing mode. ", "For our trap geometry, this mode has a frequency of $\\omega_{\\bot}/(2\\pi) = 321$ Hz [@Stringari1996; @Garcia1996], very close to the limit of vanishing axial confinement $2\\cdot\\omega_{xy}/(2\\pi)$. The second set of modes in which we are interested here consists of axial modes which, for large quantum numbers, correspond to sound waves in the z-direction. ", "The frequencies of this discrete set of modes can be approximately calculated as given in [@Fliesser1997; @Stringari1998].", "\n\nIn order to investigate the parametric driving process mentioned above, we first performed a set of “spectroscopy” experiments in which we continuously modulated the transverse trapping confinement at a fixed modulation frequency and observed the subsequent emergence of longitudinal Faraday waves. ", "For each excitation frequency the modulation amplitude was adjusted such that the longitudinal patterns emerged typically at some point after 10 to 30 oscillations. ", "On the breathing mode resonance, a trap modulation of 3.6% was used, while at many other frequencies trap modulations of up to 42.5% were chosen to obtain clearly visible patterns [@trapmodulation]. ", "This range of modulation depths is similar to the range used in numerical simulations in [@Staliunas2004]. ", "Representative examples for the resulting patterns are shown in Fig.", " \\[faradaypatterns\\]. ", "All experimental images in this manuscript were taken by destructive in-trap imaging.", "\n\nThe average spacing of adjacent maxima in the resulting pattern is plotted against the driving frequency in Fig.", " \\[spectroscopy\\]. ", "The data lie on a clear curve, with the exception of the points near a driving frequency of 160.5 Hz, corresponding to the transverse dipole mode resonance (i.e. transverse slosh motion)[@Stringari1996]. ", "However, inspection of our experimental images reveals that, at this frequency, we also excite the transverse breathing mode at 321 Hz. ", "Excitation of the breathing mode is a very effective way of creating longitudinal patterns. ", "Therefore the patterns obtained at 160.5 Hz are actually the same as those produced at 321 Hz. ", "In order to rationalize the data, we first note that parametric excitation with a certain driving frequency excites oscillations predominantly at half the driving frequency, the main resonance also observed in Faraday’s experiments. ", "The dispersion relation of longitudinal collective modes that become sound-like for high quantum numbers is given in [@Fliesser1997; @Stringari1998] and is used to calculate the expected spacing between density maxima. ", "The resulting spacings are plotted as the step-like curve in Fig.", " \\[spectroscopy\\] and are in excellent agreement with our experimental data, corroborating the assumption and theory of a parametric driving process.", "\n\n=3.375in\n\n=3.375in\n\nIn a second set of experiments we show that the longitudinal modes are driven by the transverse breathing motion even without the presence of a continuous external drive. ", "In particular, this disproves the influence of any tiny residual axial trap modulation that has existed during the presence of our continuous drive due to experimental imperfections [@trapmodulation]. ", "For this, we excited the transverse breathing mode at 321 Hz by driving the transverse trap confinement for a few cycles, and then let the condensate evolve without the presence of the drive. ", "For a gentle excitation, we do not see longitudinal patterns immediately after the end of the drive, but can observe them emerge at later times. ", "A weaker excitation delays the emergence of longitudinal modes out to later times, while in the case of strong excitations the patterns can emerge within the first three cycles. ", "In order to follow the evolution, we quantify the presence of longitudinal patterns as described in [@Patternquantify]. ", "Fig.", " \\[onset\\] shows the evolution after the end of a moderate excitation. ", "For this data, we excited the condensate for only two cycles, varying the transverse trap frequency by 9% with a modulation frequency of 321 Hz during the modulation. ", "Immediately after the excitation, the obtained images showed no longitudinal waves, and our pattern visibility measure, plotted in the figure, is initially picking up high frequency noise along the longitudinal axis. ", "A main contribution to this noise is the imaging noise of our detection system. ", "Weak pattern formation is observed starting at five periods after the end of the modulation, and strong longitudinal patterns then appear after about nine periods. ", "A similar behavior is known for example from parametric amplifiers in optics: if no input signal amplitude is present, a signal emerging from noise (or zero point energy) can form if the amplification is large enough. ", "This behavior is also found by our numerical simulations based on the Gross-Pitaevskii equation. ", "In simulations with similar parameters as in the experiment, no pattern formation is observed for several breathing mode periods. ", "From the onset of pattern formation, it takes just three periods for patterns to grow to their full strength. ", "We find that the onset time of pattern formation in the simulations is earlier when more noise is added to the initial relaxed wave function.", "\n\n=3.375in\n\nThis experiment is closely related to the theoretical situation described in [@Kagan2001], where a single and sudden jump in the transverse trap frequency was used to excite the breathing mode, instead of a sinusoidal trap frequency modulation. ", "We have used a trap jumping excitation in the case of very elongated BECs to demonstrate a second observation about the onset of longitudinal patterns, namely the fact that these patterns can start to emerge in spatially localized domains, rather than uniformly across the whole cloud. ", "To show this effect, we produced condensates in a very elongated cigar-shaped trap with trapping frequencies of $\\{\\omega_{xy}/(2\\pi),\\omega_{z}/(2\\pi)\\}=\\{286.1,2.8\\}$Hz. ", "We temporarily jumped to a different trap of $\\{\\omega_{xy}/(2\\pi),\\omega_{z}/(2\\pi)\\}=\\{88.4,5.1\\}$Hz for the duration of 1.3 ms, then jumped back to the first trap and let the cloud evolve. ", "After about 10 ms, we observed BECs in which a perfectly periodic density modulation was stretching over almost the entire cloud; but it is also not uncommon to observe patterns in several separate domains, as shown in Fig.", " \\[domains\\]. ", "Considering that the speed of sound in the elongated cloud is only about 2 mm/s [@Zaremba1998; @Stringari1998], it is plausible that over the time scale of this experiment different regions of the BEC can get independently excited and evolve into longitudinal patterns independently from each other.", "\n\n=3.375in\n\nIn the experiments described so far, our parametric excitation has led to longitudinal modes oscillating at half the frequency of the parametric driving frequency. ", "In the case of strong parametric amplification, it is theoretically expected that modes at other frequencies (higher resonance tongues), in particular modes at the driving frequency, can be excited, too [@Staliunas2002]. ", "This motivated our third set of experiments in which we started again with a condensate in a trap with trap frequencies of $\\{\\omega_{xy}/(2\\pi),\\omega_{z}/(2\\pi)\\}=\\{160.5,7\\}$Hz. ", "We then continuously modulated our transverse trap frequency by about 19% with a modulation frequency of 321 Hz. ", "The resulting breathing motion is seen in Fig.", " \\[impactosci\\] where we plot the Thomas-Fermi radius of the cloud in the transverse direction versus time. ", "The graph clearly shows that the cloud, upon strong excitation, gradually starts behaving as an impact oscillator, i.e., as an oscillator bouncing off a stiff wall during each period. ", "A classical impact oscillator, realized for example by a ball bouncing off a stiff surface, is a paradigm for nonlinear dynamics, nonlinear resonances and chaotic behavior. ", "In the present case, the role of the stiff wall was played by the strong mean-field repulsion during the slim phase of the oscillations when the BEC is strongly compressed in the transverse direction. ", "Theoretically, the instability of the breathing mode upon strong driving and the impact oscillator behavior have been analyzed in [@Ripoll1999]. ", "The behavior of the cloud radius in the transverse direction was also reproduced in our numerical simulation of the azimuthally symmetric 3D Gross-Pitaevskii equation, displayed as the solid line in Fig.", " \\[impactosci\\]. ", "However, the numerics, when starting with a thoroughly relaxed wave function in the initial trap, show a sign of longitudinal pattern formation only after 18 ms, while in the experiment, longitudinal patterns clearly formed already during the third period (9 ms). ", "This, again, hints at the importance of initial noise in the condensate that seeds the parametric amplification. ", "In the experiment, the patterns start out similar to those displayed in Fig.", " \\[faradaypatterns\\] for the case of a weak drive at 321 Hz. ", "But, upon the action of the strong drive, they quickly evolve into more complicated patterns, involving the excitation of several other modes. ", "The inset of Fig.", " \\[impactosci\\] shows an image taken after 5.2 driving periods (a), together with the Fourier transform (b). ", "The Fourier spectrum reveals that several modes corresponding to the first resonance tongue of longitudinal modes with nearly half the driving frequency are excited. ", "In addition, modes at twice the distance from the central Fourier peak are visible. ", "Those modes belong to the second resonance tongue of the main resonance.", "\n\n=3.375in\n\nIn conclusion, we have experimentally observed the effects of parametric resonances in a BEC. ", "The observed resonances lead to Faraday waves along the long BEC axis. ", "These results advance the understanding of collective mode behavior in a condensate, which is one of the key tools to study BEC dynamics. ", "In addition, we have shown that strongly driving the transverse breathing mode leads to an instability whereupon the mode amplitude increases exponentially, accompanied by the strong excitation of multiple sound-like modes.", "\n\n[Hi!]{}", "\n\nThe study is contained in the appendix of the paper M. Faraday, Philos. ", "Trans. ", "R. Soc. ", "London [**121**]{}, 299 (1831).", "\n\nFor a comprehensive review, see M. C. Cross and P. C. Hohenberg, Rev. Mod. ", "Phys. [**", "65**]{}, 851–1112 (1993).", "\n\nS. Inouye, M. R. Andrews, J. Stenger, H.-J. Miesner, D. M. Stamper-Kurn, and W. Ketterle, Nature (London) [**392**]{}, 151 (1998).", "\n\nK. Staliunas, S. Longhi, and G. J. de Valcárcel, Phys. ", "Rev. Lett. [**", "89**]{}, 210406 (2002).", "\n\nK. Staliunas, S. Longhi, and G. J. de Valcárcel, Phys. ", "Rev. A [**70**]{}, 011601(R) (2004).", "\n\nYu. ", "Kagan and L. A. Maksimov, Phys. ", "Rev. A [**64**]{}, 053610 (2001).", "\n\nD. S. Jin, J. R. Ensher, M. R. Matthews, C. E. Wieman, and E. A. Cornell, Phys. ", "Rev. Lett. [**", "77**]{}, 420 (1996).", "\n\nM.-O. Mewes, M. R. Andrews, N. J. van Druten, D. M. Kurn, D. S. Durfee, C. G. Townsend, and W. Ketterle, Phys. ", "Rev. Lett. [**", "77**]{}, 988 (1996).", "\n\nF. Chevy, V. Bretin, P. Rosenbusch, K. W. Madison, and J. Dalibard, Phys. ", "Rev. Lett. [**", "88**]{}, 250402 (2002).", "\n\nS. Stringari, Phys. ", "Rev. Lett. [**", "77**]{}, 2360 (1996).", "\n\nV. M. Pérez-García, H. Michinel, J. I. Cirac, M. Lewenstein, and P. Zoller, Phys. ", "Rev. Lett. [**", "77**]{}, 5320 (1996).", "\n\nM. Fliesser, A. Csordás, P. Szépfalusy, and R. Graham, Phys. ", "Rev. A [**56**]{}, R2533 (1997).", "\n\nS. Stringari, Phys. ", "Rev. A [**58**]{}, 2385 (1998).", "\n\nSinusoidally modulating our bias field strength led to a modulation of the transverse confinement $\\omega_{xy}/(2\\pi)$ between 155 Hz and 166.7 Hz in the case of a 3.6% modulation depth, and between 122 Hz and 303 Hz for our strongest modulation depth of 42.5%. ", "Even with our strongest transverse modulation, the longitudinal confinement was modulated by less than 0.6%.", "\n\nWe integrate the observed density along the tight direction, and determine the standard deviation of the resulting cross section from a Thomas-Fermi shape in the central region. ", "We normalize the result by dividing by the number of atoms in the same region. ", "The Thomas-Fermi shape is obtained by eliminating all but the low frequency Fourier components that correspond to the overall shape of the BEC. ", "This procedure provides a good measure for the excitation of the longitudinal modes, which we have checked also by visual inspection of the data.", "\n\nE. Zaremba, Phys. ", "Rev. A [**57**]{}, 518 (1998).", "\n\nJ. J. G. Ripoll and V. M. Pérez-García, Phys. ", "Rev. A [**59**]{}, 2220 (1999); J. J. García-Ripoll, V. M. Pérez-García, and P. Torres, Phys. ", "Rev. Lett. [**", "83**]{}, 1715 (1999).", "\n\n[^1]: Contribution of the U.S. Government. ", "Not subject to copyright.", "\n" ]

{ "pile_set_name": "ArXiv" }

[ 0.0006508565274998546, 0.0006835759850218892, 0.0005887456936761737, 0.0005682613700628281, 0.0005804531974717975, 0.0006139316246844828, 0.0007765438058413565, 0.0011997317196801305, 0.0005175922997295856, 0.0005457157385535538, 0.0006045117625035346, 0.0006402898579835892, 0.0005674723070114851, 0.0006193254957906902, 0.0006269328878261149, 0.0005733343423344195, 0.0007737096166238189, 0.0005804128013551235, 0.0005533450748771429, 0.0005979431443847716, 0.0005798283382318914, 0.0005283821956254542, 0.0005841845413669944, 0.000600888510234654, 0.0005812706076540053, 0.0005767851835116744, 0.0005574620445258915, 0.0005599996075034142, 0.0005317032337188721, 0.0006046543712727726, 0.0008859019726514816, 0.0008786077960394323, 0.0010088594863191247, 0.0005894132191315293, 0.0005537713877856731, 0.0006656277691945434, 0.0006499193259514868, 0.0005578947020694613, 0.0006220692885108292, 0.0005763716180808842, 0.0006018947460688651, 0.0005393929895944893, 0.001711368327960372, 0.0007064692326821387, 0.0006803435971960425, 0.0016623083502054214, 0.000646425352897495, 0.0005573356174863875, 0.0005939339753240347, 0.0006148515385575593, 0.0006243837415240705, 0.0006323956768028438, 0.0007250654161907732, 0.000581899716053158, 0.0006207145052030683, 0.0006194615853019059, 0.0005589773063547909, 0.0005222492618486285, 0.0005680283065885305, 0.0005237063160166144, 0.0008292015991173685, 0.0006858223350718617, 0.0005641854368150234, 0.0006481140735559165, 0.0006451660883612931, 0.0005854004994034767, 0.0006104556377977133, 0.0006123138591647148, 0.0005829714355058968, 0.0005520083359442651, 0.0006141065969131887, 0.0006161456694826484, 0.0006051310920156538, 0.0009543706546537578, 0.0008296244195662439, 0.0005801019142381847, 0.0010676657548174262, 0.0005745178204961121, 0.000637619465123862, 0.0005833238246850669, 0.0011730525875464082, 0.0007178634405136108, 0.0006469183717854321, 0.0006240246584638953, 0.000821672729216516, 0.0007995193009264767, 0.000658621487673372, 0.0006118597229942679, 0.0006004141760058701, 0.0030904600862413645, 0.0005778995109722018, 0.0006547945667989552, 0.000586892943829298, 0.0006934361881576478, 0.0005756233003921807, 0.0007770038209855556, 0.0006516649737022817, 0.0005889002932235599, 0.0006517857545986772, 0.0006792221101932228, 0.0005829508882015944, 0.0006139231263659894, 0.0005546461907215416, 0.0006400430575013161, 0.0008495656657032669, 0.0007324632024392486, 0.0008856820641085505, 0.0008150925859808922, 0.0007257048855535686, 0.0006144672515802085, 0.001444116816855967, 0.0008132988004945219, 0.0006795171066187322, 0.0008878468070179224, 0.0009571398259140551, 0.0007971240556798875, 0.0008878468070179224, 0.0007192419725470245, 0.0013277383986860514, 0.0010780678130686283, 0.0007245418382808566, 0.0008593332604505122, 0.0009571398259140551, 0.000788035336881876, 0.0010323431342840195, 0.0009571398259140551, 0.0008334863814525306, 0.000882496649865061, 0.0009571398259140551, 0.0008026761934161186, 0.0008566349279135466, 0.0009571398259140551, 0.0008263276540674269, 0.0009344156715087593, 0.0009571398259140551, 0.0008089612238109112, 0.0010001570917665958, 0.0007125200354494154, 0.0008566349279135466, 0.0007244214066304266, 0.0007005465449765325, 0.0006104867206886411, 0.0005479713436216116, 0.0006437049014493823, 0.0006430145585909486, 0.0005341941141523421, 0.0008618818828836083, 0.0007116130436770618, 0.0008870152523741126, 0.0007440594490617514, 0.0009571398259140551, 0.0007173478370532393, 0.0005943482392467558, 0.0007042072829790413, 0.001995444530621171 ]

[ "A mosaic pattern of INI1/SMARCB1 protein expression distinguishes Schwannomatosis and NF2-associated peripheral schwannomas from solitary peripheral schwannomas and NF2-associated vestibular schwannomas.", "\nThe INI1/SMARCB1 gene protein product has been implicated in the direct pathogenesis of schwannomas from patients with one form of schwannomatosis [SWNTS1; MIM # 162091] showing a mosaic pattern of loss of protein expression by immunohistochemistry [93% in familial vs. 55% in sporadic cases]. ", "To verify whether such INI1/SMARCB1 mosaic pattern could be extended to all schwannomas arising in the sporadic and familial schwannomatoses [i.e. to SMARCB1-related (SWNTS1) or LZTR1-related (SWNTS2) schwannomatosis or to SMARCB1/LZTR1-negative schwannomatosis] and whether it could be involved in classical NF2 or solitary peripheral schwannomas METHODS: We blindly analysed schwannoma samples obtained from a total of 22 patients including (a) 2 patients (2 males; aged 38 and 55 years) affected by non-familial SMARCB1-associated schwannomatosis (SWTNS1); (b) 1 patient (1 female; aged 33 years) affected by familial schwannomatosis (SWTNS1/ SMARCB1 germ line mutations); (c) 5 patients (3 males, 2 females; aged 33 to 35 years) affected by non-familial (sporadic) LZTR1-associated schwannomatosis (SWNTS2); (d) 3 patients (3 males; aged 35 to 47 years) affected by familial schwannomatosis (SWTNS2/ LZTR1 germ line mutations); (e) 2 patients (1 male, 1 female; aged 63 and 49 years, respectively) affected by non-familial schwannomatosis (SWTNS, negative for SMARCB1, LZTR1 and NF2 gene mutations); (f) 4 patients (3 males, 1 females; aged 15 to 24 years) affected by classical NF2 (NF2: harbouring NF2 germ line mutations; and (g) 5 patients (3 males, 2 females; aged 33 to 68 years) who had solitary schwannomas. [", "follow-up = 15-30 years; negative for constitutional/somatic mutation analysis for the SMARCB1, LZTR1 and NF2 genes] were (blindly) analyzed. ", "The INI1/SMARCB1 immunostaining pattern was regarded as (1) diffuse positive nuclear staining [= retained expression] or (2) mosaic pattern [mixed positive/negative nuclei = loss of expression in a subset of tumour cells]. ", "All solitary peripheral schwannomas and NF2-associated vestibular schwannomas showed diffuse nuclear INI1/SMARCB1 staining in 97-100% of neoplastic cells; schwannomas obtained from all cases of non-familial and familial schwannomatosis and NF2-associated non-vestibular schwannomas showed a mosaic pattern ranging from 10 to 70% of INI1/SMARCB1-positive expression. ", "We did not record a complete lack of nuclear staining. ", "The present data suggests that (a) mosaic loss of immunohistochemical INI1/SMARCB1 expression, despite the interlesional variability, is a reliable marker of schwannomatosis regardless of the involved gene and it might help in the differential diagnosis of schwannomatosis vs. solitary schwannomas and (b) INI1/SMARCB1 expression is not useful in the differential with mosaic NF2, since NF2-associated peripheral schwannomas show the same immunohistochemical pattern." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.002125355415046215, 0.0006993431597948074, 0.0010531326988711953, 0.0006402352009899914, 0.0005845287814736366, 0.0018979007145389915, 0.0010102377273142338, 0.0007127831922844052 ]

[ "1. ", "Field of the Invention\nThe present invention relates to a semiconductor memory device and a control method thereof, and particularly relates to a semiconductor memory device including a plurality of sense amplifiers that can be connected to any of a plurality of bit lines and a control method thereof.", "\n2. ", "Description of Related Art\nCurrently, there are various types of semiconductor memory devices, and DRAM (Dynamic Random Access Memory) can be mentioned as a representative thereof. ", "Most of DRAMs are of a synchronous type in which data is inputted and outputted in synchronization with a clock signal, and can be randomly accessed with a cycle of about 7 ns.", "\nHowever, DRAM is a volatile memory, and therefore there are problems as follows. ", "Stored data is lost once the power supply is disconnected, and thus DRAM is not suitable for storing a program or archival data that should be saved for a long period of time. ", "Further, even when the power supply is being inputted, a periodic refreshing operation needs to be performed to maintain the data, and thus there is a limit to lowering of power consumption and also complicated control by a controller is necessary.", "\nA flash memory is well-known as a large-capacity non-volatile semiconductor memory. ", "However, even in the flash memory, there are disadvantages such that a large current is necessary for writing or deleting data, and also it requires a very long time for writing and erasing data. ", "Therefore, it is not appropriate to use flash memory as an alternative to DRAM as a main memory. ", "In addition, non-volatile memories such as MRAM (Magnetoresistive Random Access Memory) and FRAM (Ferroelectric Random Access Memory) have been proposed; however, these memories have a difficulty in obtaining the memory capacity equivalent to that of DRAM.", "\nMeanwhile, as a semiconductor memory to be an alternative to DRAM, PRAM (Phase Change Random Access Memory) that performs recording using a phase change material has been proposed (see Japanese Patent Application Laid-open Nos. ", "2006-24355, 2005-158199, 2006-31795, and 2006-294181). ", "In the PRAM, data is stored by a phase state of the phase change material included in a recording layer. ", "That is, in the phase change material, an electric resistance in a crystal phase and that in an amorphous phase differ vastly, and the data can be recorded by utilizing this characteristic.", "\nTo change the phase state, the phase change material is heated by a writing current that is applied to the phase change material. ", "On the other hand, to read the data, a resistance value is measured after sending a reading current to the phase change material. ", "The reading current is set to a value that is sufficiently smaller than the writing current so that no phase change occurs. ", "Due to this, unlike DRAM, PRAM can perform a non-destructive reading operation. ", "Further, the phase state of the phase change material does not change unless high heat is applied, and thus, even when the power supply is disconnected, the data is not lost.", "\nDRAM is a semiconductor memory device of a voltage sensing type, and thus a potential difference occurring in a bit line pair is amplified by a sense amplifier to read the data. ", "In contrast thereto, PRAM is a semiconductor memory device of a current sensing type, and thus, to read the data, it is necessary to convert a retained content to a potential difference by sending a reading current to a memory cell, and also to amplify this potential difference.", "\nTherefore, in the sense amplifier of PRAM, the circuit scale is much larger than that of the sense amplifier of DRAM. ", "Accordingly, it is not practical to arrange the sense amplifier for each bit line like DRAM, and this requires sharing the same sense amplifier for a plurality of bit lines.", "\nHowever, when the same sense amplifier is shared for the plural bit lines, if consecutive read operations are requested, it requires starting a next sensing operation after the completion of the current sensing operation. ", "As a result, a data reading cycle is restricted by an operation speed of the sense amplifier. ", "Hence, it has a problem that the data reading cycle becomes much longer as compared to that of the DRAM, which in turn cannot keep the compatibility with the DRAM.", "\nSuch a problem similarly occurs not only in PRAM but also in semiconductor memory devices of other types (for example, RRAM: Resistive Random Access Memory), in which a sensing operation takes a long period of time." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0009391900966875255, 0.000567941926419735, 0.001185585861094296, 0.0005677459994331002, 0.0008344149682670832, 0.0006661001825705171, 0.0007412885897792876, 0.0005951860803179443, 0.0007231336203403771, 0.0007906389655545354, 0.000845664762891829, 0.0006815542583353817, 0.0006221065996214747, 0.0007134841871447861, 0.0006873692036606371, 0.0005877375951968133, 0.0006195335881784558, 0.0006180208874866366, 0.0006630015559494495, 0.002375752665102482, 0.0006308302981778979, 0.0006916348356753588, 0.0006682162638753653, 0.0006598331383429468, 0.0006516044377349317, 0.0005813309689983726, 0.0006007988704368472, 0.0007314901449717581, 0.0007715971441939473 ]

[ "#/u/GoldenSights\nimport praw\nimport time\nimport sqlite3\nimport datetime\n\n'''USER CONFIGURATION'''\n\nAPP_ID = \"\"\nAPP_SECRET = \"\"\nAPP_URI = \"\"\nAPP_REFRESH = \"\"\n# https://www.reddit.com/comments/3cm1p8/how_to_make_your_bot_use_oauth2/\nUSERAGENT = \"\"\n#This is a short description of what the bot does. ", "For example \"/u/GoldenSights' Newsletter bot\"\nSUBREDDIT = \"Cinemasins\"\n#This is the sub or list of subs to scan for new posts. ", "For a single sub, use \"sub1\". ", "For multiple subreddits, use \"sub1+sub2+sub3+...\"\nPRINTFILE = \"userflair.txt\"\n#The file where the flairs will be shown\n\nMAXPOSTS = 100\n#This is how many posts you want to retrieve all at once. ", "PRAW can download 100 at a time.", "\nWAIT = 30\n#This is how many seconds you will wait between cycles. ", "The bot is completely inactive during this time.", "\n\n\n'''All done!'''", "\n\n\n\nWAITS = str(WAIT)\nlastwikiupdate = 0\n\ntry:\n import bot\n USERAGENT = bot.aG\nexcept ImportError:\n pass\n\nsql = sqlite3.connect('sql.db')\nprint('Loaded SQL Database')\ncur = sql.cursor()\n\ncur.execute('CREATE TABLE IF NOT EXISTS users(NAME TEXT, FLAIR TEXT)')\nprint('Loaded Completed table')\nsql.commit()\n\nr = praw.", "Reddit(USERAGENT)\nr.set_oauth_app_info(APP_ID, APP_SECRET, APP_URI)\nr.refresh_access_information(APP_REFRESH)\n\n\n\ndef scan():\n print('Scanning ' + SUBREDDIT)\n subreddit = r.get_subreddit(SUBREDDIT)\n posts = []\n posts += subreddit.get_new(limit=MAXPOSTS)\n posts += subreddit.get_comments(limit=MAXPOSTS)\n for post in posts:\n try:\n pauthor = post.author.name\n try:\n pflair = post.author_flair_text\n if pflair is not None:\n cur.execute('SELECT * FROM users WHERE NAME=?', [", "pauthor])\n fetched = cur.fetchone()\n if not fetched:\n cur.execute('INSERT INTO users VALUES(?, ?)', [", "pauthor, pflair])\n print('New user flair: ' + pauthor + ' : ' + pflair)\n else:\n oldflair = fetched[1]\n if pflair !", "= oldflair:\n cur.execute('UPDATE users SET FLAIR=? ", "WHERE NAME=?', [", "pflair, pauthor])\n print('Updating user flair: ' + pauthor + ' : ' + pflair)\n sql.commit()\n else:\n print(post.id, \"No flair\")\n except AttributeError:\n print(post.id, \"No flair\")\n except AttributeError:\n print(post.id, \"Author is deleted\")\n\n flairfile = open(PRINTFILE, 'w')\n cur.execute('SELECT * FROM users')\n fetch = cur.fetchall()\n fetch.sort(key=lambda x: x[0])\n flaircounts = {}\n for item in fetch:\n itemflair = item[1]\n if itemflair not in flaircounts:\n flaircounts[itemflair] = 1\n else:\n flaircounts[itemflair] += 1\n print('FLAIR: NO. ", "OF USERS WITH THAT FLAIR', file=flairfile)\n presorted = []\n for flairkey in flaircounts:\n presorted.append(flairkey + ': ' + str(flaircounts[flairkey]))\n presorted.sort()\n for flair in presorted:\n print(flair, file=flairfile)\n print('\\n\\n', file=flairfile)\n print('NAME: USER\\'S FLAIR', file=flairfile)\n for user in fetch:\n print(user[0] + ': ' + user[1], file=flairfile)\n flairfile.close()\n\n\nwhile True:\n try:\n scan()\n except EOFError:\n print(\"Error:\", e)\n sql.commit()\n print('Running again in ' + str(WAIT) + ' seconds')\n time.sleep(WAIT)" ]

{ "pile_set_name": "Github" }

[ 0.0007246064487844706, 0.0006844745948910713, 0.0006835056119598448, 0.0007843986386433244, 0.004146730061620474, 0.0007792870164848864, 0.0006885011098347604, 0.0011447923025116324, 0.0011167400516569614, 0.0009515868732705712, 0.0009108746307902038, 0.0008020025561563671, 0.0009106862707994878, 0.0007072088192217052, 0.0007551907910965383, 0.0010049447882920504 ]

[ "People ask me how I get it all done. ", "They assume I’m extremely organized. ", "In reality I’m pretty ADD. ", "On top of that, I have 3 small children at home and I only work part time. ", "But the truth is I do get a lot done.", "\n\nHere’s why… I’m no longer addicted to approval but I’m still an addict.", "\n\nI am addicted to goals.", "\n\nI love them. ", "I love creating them. ", "I love thinking about them. ", "I love working towards them. ", "I love realizing them.", "\n\nI will never say to myself, “I have finally arrived!” ", "because I know there will always be another thing for me to strive for.", "\n\nBecause there is so much joy for me in the striving. ", "Goals, to me, are play– creative, daring, adventurous, experimental play.", "\n\nLike all good play, my goals teach me all kinds of stuff in the process. ", "How to be proud of my accomplishments and my failures, how to persist, to persevere, problem solve, innovate, risk, have a sense of humor to name a few.", "\n\nGood goals? ", "Or bad goals?", "\n\nBut it didn’t always used to be this way. ", "I used to take my goals very seriously. ", "I used them as a measuring stick, a way to quantify my self worth.", "\n\nI had a list of things I was supposed to accomplish by the age of 30. ", "I was supposed to speak four languages, graduate with honors from Columbia University, solve the hunger problem, win the Nobel Peace Prize, etc., ", "etc.…", "\n\nAs you can guess I fell short.", "\n\nSo the goals I created back then were really more like intangible torture devises. ", "Each time I came up short, I used the goal to figuratively whack myself on the head …\n\nThe anatomy of a good goal\n\nNine years later, there’s a different energy behind my goals. ", "The stakes are not so high yet, ironically, I’m achieving my goals more often and I’m much happier.", "\n\nPart of it has to do with permission. ", "I now give myself permission to just be happy. ", "Not happy if… Not happy when. ", "The by product, I have found, is that when I can Just. ", "Be. ", "Happy, I don’t judge what I want as stupid, frivolous or just plain crazy. ", "And my goals get to be for me not about me.", "\n\nSecond, I am way more willing to fail than I used to be. ", "Since my goals are now my source of joy – a gift I give to myself really – and not a measuring stick with which to beat myself over the head, I can afford to be creative, daring and at times downright cray-cray.", "\n\nGetting high off goals\n\nHuman beings are built for goals. ", "We are like bicycles. ", "When we are not in motion, we fall down.", "\n\nI just read Eat that Frog by Brian Tracy. ", "It’s a book about productivity. ", "He says that task completion actually triggers the release of endorphins and dopamine in the brain.", "\n\nYes, you can literally get high off goals. ", "And I’m all about getting high without drugs.", "\n\nAre your goals working for you?", "\n\nBut if your goals feel bad or you’re just plain stuck, my guess is you’ve got to do a bit of work first to make sure those goals are working for you and not against you.", "\n\n3 Tips to Clean Up (and get high off) Your Goals:\n\n1. ", "What is your WHY?", "\n\nA few weeks ago I heard Danielle LaPorte speak at the World Domination Summit. ", "She says, when you feel inspired ask yourself, are you moved on a cellular level or do you just want to be like the person who inspires you?", "\n\nPut another way, are you in integrity with your goals? ", "Are they a true reflection of Who You Really Are or just another gold star used to elicit ewwws and ahhhs?", "\n\n2. ", "Reframe failure.", "\n\nJeff Olsen author of The Slight Edge, says “successful people are willing to do what unsuccessful people are not willing to do.” ", "It’s as simple as that. ", "Stop believing that failure somehow reflects upon your worth. ", "When you no longer see it this way, roadblocks stop meaning failure and start providing the feedback you need to reach your goals.", "\n\n3. ", "Go with good enough.", "\n\nPerfectionism is just a form of procrastination in disguise, I’ve heard it said. ", "Go with good enough. ", "And just do something!", "\n\nSo there you have it. ", "I dare you to post 1 goal in the comments below. ", "Because I LOVE THAT.", "\n\nLove the article, Amy! ", "Thank you for the insight that my goals are for me, not anyone else. ", "And that my failures and mistakes are not a reflection on who I am, they are feedback…. ", "fabulous! ", "Okay, here goes a personal goal… I choose a richly healthy relationship with food and nourishment like I have never experienced before. ", "I wanna be a woman who knows how to make fabulous smoothies, the best place and time to visit the local farmer’s markets, and how to help my body glow with radiant energy from my food choices. ", "I want to develop a love affair with fresh when it comes to food. ", "I want concepts of ripe, juicy, nourishing and fragrant to fill my culinary experience every day. ", "And I want to share this experience joyfully with family and friends.", "\n\nGreat article, Amy! ", "My goal is to continue to become one with my body – loving, accepting and honoring it – by eating nutritious foods that are right for ME, exercising in a way that is right for ME, and saying kind words to myself that support this journey. (", "I eat grain/gluten/sugar-free, I have released an extra 20 pounds in four months, I work with an excellent personal trainer, and I don’t sabotage myself by calling myself unkind names.) ", "I do these things for ME, and I love it!", "\n\nYou dare me, do you? ", "Well alright then! ", "MY goal is to actually retire for the day at 9:30 pm to read for a half hour before bed. ", "OK, that may sound sweet & simple but it’s actually scary to proclaim it because I have not succeeded in the past. ", "I will examine why and what I can do differently. ", "Also I plan to add empathy, affection and relaxation to my treatment of myself around goals, rather than the reflexive and debilitating self-pressure that tempts me to avoid them altogether. ", "Consistent bedtime (and reading fun time), I hope, will support all the other goals in my mix, from daily to-do’s to long-term struggles.", "\n\nThanks for the inspiration, Amy, I especially loved reading about how we are wired… like bicycles!", "\n\nHey Amy. ", "I just wanted to thank you for all you write. ", "You inspire me. ", "There isn’t one time I don’t have a smile on my face when seeing I got an email/update from your blog. ", "I LOVE the “I don’t need your approval” classes. ", "You make me trust my self (or would it be “myself”? ", "Sorry for my bad English – Portuguese, my mother language, sound a lot easier to me, ha!). ", "You make me happy. ", "A big hug your way." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006766400765627623, 0.0006727005238644779, 0.0007532839081250131, 0.0013540649088099599, 0.0011853876058012247, 0.016573946923017502, 0.0013049292610958219, 0.000700871110893786, 0.0006986340740695596, 0.000552623241674155, 0.0005542691214941442, 0.0005965621676295996, 0.000998005853034556, 0.0006175478338263929, 0.0011731096310541034, 0.0007589245215058327, 0.0006566146621480584, 0.0006506571662612259, 0.0006592315621674061, 0.0009230139548890293, 0.0006213454762473702, 0.0006317908992059529, 0.0011195328552275896, 0.0006174971931613982, 0.0006198865012265742, 0.000683582853525877, 0.0008454689523205161, 0.020458150655031204, 0.013619604520499706, 0.0006146866362541914, 0.0007431870908476412, 0.0005925563164055347, 0.0007628228631801903, 0.0006220734212547541, 0.009285823442041874, 0.5582590103149414, 0.001841582590714097, 0.004778060130774975, 0.00994984433054924, 0.003377001965418458, 0.0015019959537312388, 0.005390502978116274, 0.003073089988902211, 0.0009734611958265305, 0.008851123042404652, 0.0015431708889082074, 0.0932229533791542, 0.000856108614243567, 0.025797704234719276, 0.0010043804068118334, 0.0014394951285794377, 0.00056203588610515, 0.0006481372402049601, 0.0010492067085579038, 0.013174540363252163, 0.001185585861094296, 0.0013072820147499442, 0.001165290828794241, 0.0007140205707401037, 0.13026416301727295, 0.0010812542168423533, 0.00117425003554672, 0.001491905772127211, 0.0008022513939067721, 0.001491905772127211, 0.013489345088601112, 0.0007717740372754633, 0.03883756324648857, 0.0006506877834908664, 0.0012025933247059584, 0.000514557003043592, 0.0008469767635688186, 0.003099076682701707, 0.002295898972079158, 0.0008269203826785088, 0.0008049936150200665, 0.004011567682027817, 0.0005200505838729441, 0.0017702162731438875, 0.0006750028696842492, 0.002913636853918433, 0.0006488164654001594, 0.33878183364868164, 0.000948373693972826, 0.0010002137860283256, 0.0005669883685186505, 0.0005556395626626909, 0.000963765021879226, 0.0007458392065018415, 0.000550431665033102, 0.0036965408362448215, 0.0005658799782395363, 0.0029722871258854866, 0.0010420727776363492, 0.00087707833154127, 0.0017386118415743113, 0.0010591616155579686, 0.0006470232619903982, 0.0007641955162398517 ]

[ "I didn't win the powerball now i have to keep going to college\n\n364 shares" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0015980075113475323 ]

[ "// <cstdint> -*- C++ -*-\n\n// Copyright (C) 2007-2014 Free Software Foundation, Inc.\n//\n// This file is part of the GNU ISO C++ Library. ", " This library is free\n// software; you can redistribute it and/or modify it under the\n// terms of the GNU General Public License as published by the\n// Free Software Foundation; either version 3, or (at your option)\n// any later version.", "\n\n// This library is distributed in the hope that it will be useful,\n// but WITHOUT ANY WARRANTY; without even the implied warranty of\n// MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. ", " See the\n// GNU General Public License for more details.", "\n\n// Under Section 7 of GPL version 3, you are granted additional\n// permissions described in the GCC Runtime Library Exception, version\n// 3.1, as published by the Free Software Foundation.", "\n\n// You should have received a copy of the GNU General Public License and\n// a copy of the GCC Runtime Library Exception along with this program;\n// see the files COPYING3 and COPYING.RUNTIME respectively. ", " If not, see\n// <http://www.gnu.org/licenses/>.", "\n\n/** @file include/cstdint\n * This is a Standard C++ Library header.", "\n */\n\n#ifndef _GLIBCXX_CSTDINT\n#define _GLIBCXX_CSTDINT 1\n\n#pragma GCC system_header\n\n#if __cplusplus < 201103L\n# include <bits/c++0x_warning.h>\n#else\n\n#include <bits/c++config.h>\n\n#if _GLIBCXX_HAVE_STDINT_H\n# include <stdint.h>\n#endif\n\n#ifdef _GLIBCXX_USE_C99_STDINT_TR1\n\nnamespace std\n{\n using ::int8_t;\n using ::int16_t;\n using ::int32_t;\n using ::int64_t;\n\n using ::int_fast8_t;\n using ::int_fast16_t;\n using ::int_fast32_t;\n using ::int_fast64_t;\n\n using ::int_least8_t;\n using ::int_least16_t;\n using ::int_least32_t;\n using ::int_least64_t;\n\n using ::intmax_t;\n using ::intptr_t;\n \n using ::uint8_t;\n using ::uint16_t;\n using ::uint32_t;\n using ::uint64_t;\n\n using ::uint_fast8_t;\n using ::uint_fast16_t;\n using ::uint_fast32_t;\n using ::uint_fast64_t;\n\n using ::uint_least8_t;\n using ::uint_least16_t;\n using ::uint_least32_t;\n using ::uint_least64_t;\n\n using ::uintmax_t;\n using ::uintptr_t;\n} // namespace std\n\n#endif // _GLIBCXX_USE_C99_STDINT_TR1\n\n#endif // C++11\n\n#endif // _GLIBCXX_CSTDINT\n" ]

{ "pile_set_name": "Github" }

[ 0.0007089977734722197, 0.000670812267344445, 0.0006137873861007392, 0.0005824837135151029, 0.0006200185744091868, 0.0006102444604039192, 0.0006150282570160925, 0.0008238715236075222, 0.01006175484508276 ]

[ "Broken Arm\n\nThe Broken Arm,[1] also known as the Broken Arm of Dorne,[2] is a region in eastern Dorne where the Dornish peninsula juts into the narrow sea. ", "East of the jagged coastline are the islands of the Stepstones.[3]" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0011069440515711904, 0.0006339856190606952 ]

[ "370 F.2d 976\nUTAH SALT COMPANY, Inc., Appellant,v.Roland V. WISE, District Director of Internal Revenue, Appellee.", "\nNo. ", "8535.", "\nUnited States Court of Appeals Tenth Circuit.", "\nJanuary 6, 1967.", "\n\n1\nDale E. Anderson, Salt Lake City, Utah (Fabian & Clendenin, Salt Lake City, Utah, with him on the brief), for appellant.", "\n\n\n2\nThomas L. Stapleton, Atty., ", "Dept. ", "of Justice (Mitchell Rogovin, Asst. ", "Atty. ", "Gen., Lee A. Jackson, Melva M. Graney, Attys. ", "Dept. ", "of Justice, and William T. Thurman, U. S. Atty., ", "of counsel, with him on the brief), for appellee.", "\n\n\n3\nBefore MURRAH, Chief Judge, SETH, Circuit Judge, and CHILSON, United States District Judge.", "\n\n\n4\nCHILSON, District Judge.", "\n\n\n5\nThe appellant taxpayer instituted this action in the lower Court seeking a refund of corporate income taxes paid for the years 1960 and 1961. ", "Appellant claims it is entitled to a deduction for depletion of mineral deposits under § 611 and § 613 of the Internal Revenue Code of 1954, which deduction was not allowed.", "\n\n\n6\nThe appellant appeals from the judgment of the District Court denying its claims for refund.", "\n\n\n7\nThe essential facts are not in dispute. ", "Bonneville, Ltd. was the owner of several thousand acres of land in a low area in the Great Salt Lake Desert in which storm waters containing potash and salt collected. ", "The evaporation of the water deposited the potash and salt on and under the surface of this area. ", "For many years prior to the years in question, Bonneville had been engaged in the extraction of potash from this area by the following processes. ", "Beneath the surface of the area is a brine which contains potash and salt. ", "Bonneville constructed large ditches twenty feet in depth and six to ten feet wide to collect this brine. ", "At the upper end of these ditches, shallow ponds were constructed by the erection of dikes and the brine was pumped from the ditches into the ponds. ", "Seepage from the ponds was prevented by a protective ditch also filled with brine which encircles each pond.", "\n\n\n8\nDuring the summer months when the brine is pumped into the ponds, the water in the brine evaporates causing the salt to precipitate on the pond bottom. ", "At a certain point, potash also begins to precipitate out of the brine. ", "At this juncture, the brine is pumped into the Bonneville processing plant and the potash is allowed to precipitate out in what is known as the froth flotation process.", "\n\n\n9\nThe salt which is deposited on the pond bottom creates an annual layer of approximately six inches. ", "During the winter months when the pond lies dormant, this layer adheres to the previous layer and becomes so hard that it forms a concrete like mass and cannot economically be removed. ", "This annual deposit of salt gradually decreases the depth of the evaporation pond to a point where it becomes economically unfeasible to continue to build up the dikes and at that point a new pond must be constructed.", "\n\n\n10\nIn order to avoid this attrition of ponds, Bonneville in 1957 began to experiment with various methods of removing the salt from the ponds, one of which was scraping the pond bottom by a drag prior to the deposit of a new layer of salt. ", "This provided a cleavage line between the new and old layers of salt and the new layer did not adhere to the old and could then be scraped and placed in piles or windrows.", "\n\n\n11\nOne Roberts, who knew of Bonneville's experiments, realized that by using this process, Bonneville would have large quantities of salt for which it would have no use. ", "On April 29, 1958, Roberts and three associates executed an agreement with Bonneville which was thereafter assigned to the appellant, which provided, among other things, that appellant would have the right for five years to extract and process salt from the Bonneville properties; Bonneville to provide sufficient salt to meet the reasonable needs of appellant in piles and windrows on the property; appellant to construct a processing plant on ground provided by Bonneville; appellant to process and sell a minimum number of tons of salt in each year and pay Bonneville a royalty based on the selling price within ninety days after shipment to purchasers; and Bonneville agreed not to sell salt in competition with the appellant.", "\n\n\n12\nIn the spring of 1958, Bonneville scraped the bottom of the evaporating pond to prepare a cleavage line and in the winter of 1959, Bonneville, at its expense, employed a company to bulldoze the new layer of salt into piles and windrows. ", "The same process was repeated the next year. ", "The salt which the appellant processed during the tax years in question came solely from these piles and windrows and was transported by appellant from the piles and windrows to its processing plant by trucks.", "\n\n\n13\nPrior to appellant's taking the salt from the piles and windrows, it had no control and it did not exercise any supervision over the salt or Bonneville's processes and operations in extracting the salt from the brine or its removal from its place of deposit in the evaporating pond.", "\n\n\n14\nSection 611 of the Internal Revenue Code provides:\n\n\n15\n\"In the case of mines * * * or other natural deposits * * * there shall be allowed as a deduction in computing taxable income a reasonable allowance for depletion * * *\",\n\n\n16\nand Section 613 establishes the percentage depletion allowances.", "\n\n\n17\nThe Treasury Regulations on Income Tax (1954 Code) § 1.611-1(b) (1) provides:\n\n\n18\n\"Annual depletion deductions are allowed only to the owner of an economic interest in mineral deposits or standing timber. ", "An economic interest is possessed in every case in which the taxpayer has acquired by investment any interest in mineral in place * * * and secures, by any form of legal relationship, income derived from the extraction of the mineral * * * to which he must look for a return of his capital. ", "But a person who has no capital investment in the mineral deposit or standing timber does not possess an economic interest merely because through a contractual relation he possesses a mere economic or pecuniary advantage derived from production.\" (", "Emphasis supplied.)", "\n\n\n19\nBeginning in 1933 with the case of Palmer v. Bender, 287 U.S. 551, 53 S. Ct. ", "225, 77 L.Ed. ", "489, the Supreme Court has consistently recognized that one having an \"economic interest\" in minerals in place is entitled to a depletion deduction. ", "The Court said in Palmer:\n\n\n20\n\"The language of the statute (authorizing depletion deduction) is broad enough to provide, at least, for every case in which the taxpayer has acquired, by investment, any interest in the oil in place, and secures, by any form of legal relationship, income derived from the extraction of the oil, to which he must look for a return of his capital.\" (", "287 U.S. at 557, 53 S.Ct. ", "at 226.)", "\n\n\n21\nThe Court also said that the deduction is not \"dependent upon the particular legal form of the taxpayer's interest in the property to be depleted * * *\" (287 U.S. at 557, 53 S.Ct. ", "at 226).", "\n\n\n22\nHelvering v. Bankline Oil Co., 303 U. S. 362, 58 S.Ct. ", "616, 82 L.Ed. ", "897 (1938), reaffirmed the test laid down in Palmer and said:\n\n\n23\n\"But the phrase `economic interest' is not to be taken as embracing a mere economic advantage derived from production, through a contractual relation to the owner, by one who has no capital investment in the mineral deposit.\" (", "303 U.S. at 367, 58 S.Ct. ", "at 618).", "\n\n\n24\nIn Parsons v. Smith, 359 U.S. 215, 79 S.Ct. ", "656, 3 L.Ed.2d 747 (1959), the Court pointed out that the principles declared in the Palmer case have been recognized and applied by every subsequent decision of the Court that has treated with the subject and that the first Regulations prescribed under the Internal Revenue Act of 1939 adopted almost literally the language we have quoted from Palmer and Bankline as the test to be administratively applied in determining what interest in mineral deposits are entitled to the depletion allowance. ", "Those regulations are essentially the same as the present applicable regulations § 1.611-1(b) (1), supra.", "\n\n\n25\nIn 1965, the Supreme Court in Paragon Jewel Coal Company, Inc. v. Commissioner of Internal Revenue, 380 U.S. 624, 85 S.Ct. ", "1207, 14 L.Ed.2d 116, again expressed its approval of the \"economic interest\" test by stating\n\n\n26\n\"This test was first enunciated in Palmer v. Bender, 287 U.S. 551, 557 [53 S.Ct. ", "225, 226, 77 L.Ed. ", "489] (1933), and has since become the touchstone of decisions determining the eligibility of a party to share in the depletion allowance.\" (", "380 U.S. at 633, 85 S.Ct. ", "at 1211).", "\n\n\n27\nWe conclude, therefore, that if appellant had an \"economic interest\" in the salt in question, as that term is defined in the foregoing case law and administrative regulations, it should prevail. ", "If not, its claim should be denied. ", "As we have noted, one of the requirements of an \"economic interest\" is the acquisition by investment of an interest in the mineral in place.", "\n\n\n28\nFrom the evidence, it is clear that the appellant had not \"acquired by investment\" any interest in the salt \"in place.\" ", "Whether we consider the salt as being \"in place\" in the brine or as being \"in place\" in the bottom of Bonneville's evaporation pond is immaterial. ", "The appellant \"acquired by investment\" no interest in the salt in either place.", "\n\n\n29\nThe investment in the salt \"in place\" was solely Bonneville's investment. ", "It was Bonneville which owned the land and dug the ditches to collect the brine, constructed the evaporation ponds and provided the pumps to convey the brine to the ponds. ", "It was Bonneville which extracted the salt from its place of deposit in the evaporation ponds and piled it where it became available to appellant for processing and sale.", "\n\n\n30\nAppellant asserts that under the agreement it has the right to perform each of these processes which were performed by Bonneville in extracting the salt from the brine and removing it from the evaporation pond and that this right gives it an economic interest.", "\n\n\n31\nWhether or not the agreement is subject to appellant's construction is immaterial. ", "The point is that the appellant in or prior to the years in question made no investment in the salt in place. ", "The salt which it processed was obtained by it not by virtue of any ownership or interest in the salt in place but by virtue of a provision of the agreement that Bonneville would extract the salt from its \"in place\" deposit in the brine and evaporation pond and place it in piles and windrows for the use of the appellant.", "\n\n\n32\nThe appellant's investment was in the plant and equipment to remove the salt from the piles, process and ship it and this investment is recoverable by depreciation not depletion. ", "Parsons v. Smith, supra, 359 U.S. p. 225, 79 S.Ct. ", "656.", "\n\n\n33\nWe conclude the appellant had no economic interest in the salt in question and is not entitled to a deduction for depletion.", "\n\n\n34\nThe judgment of the District Court is affirmed.", "\n\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0.0007588610169477761, 0.0013785817427560687, 0.0009640961070545018, 0.0009840787388384342, 0.0007568694418296218, 0.0006104549975134432, 0.0008812436717562377, 0.000799002475105226, 0.001353682018816471, 0.002001298824325204, 0.0008582710870541632, 0.000799002475105226, 0.0009224077221006155, 0.0005846702260896564, 0.0007504480890929699, 0.0008115151431411505, 0.0006733551272191107, 0.0006570190307684243, 0.0006828646291978657, 0.000622738094534725, 0.001076403772458434, 0.0008817001944407821, 0.0006119649624451995, 0.005980222951620817, 0.011506245471537113, 0.0023121896665543318, 0.003239572048187256, 0.0007167140720412135, 0.0036654022987931967, 0.0013308876659721136, 0.0007089707651175559, 0.0007211959455162287, 0.0007754755788482726, 0.000662366219330579, 0.0008462067926302552, 0.0005836844793520868, 0.0006164464284665883, 0.0008844399126246572, 0.0005989923956803977, 0.0006730551831424236, 0.0006705520791001618, 0.0007160999812185764, 0.0006294220220297575, 0.0007094364264048636, 0.0006904809270054102, 0.0006163814687170088, 0.0006906395428813994, 0.0008223467157222331, 0.0006118908640928566, 0.000633372226729989, 0.0007157008512876928, 0.000704797450453043, 0.0007372121326625347, 0.0007137657376006246, 0.0010045565431937575, 0.000846377806738019, 0.0005812899908050895, 0.0007944165845401585, 0.000736284302547574, 0.0008626320632174611, 0.0005985820316709578, 0.0006567937089130282, 0.0007444215007126331, 0.0007565683918073773, 0.0008285677176900208, 0.0006054291152395308, 0.0007146471762098372, 0.0007130016456358135, 0.0005634389817714691, 0.0006329350871965289, 0.0005400051595643163, 0.0006187685648910701, 0.0006761843105778098, 0.000639068428426981, 0.0006325602298602462, 0.001421145861968398, 0.0006492516258731484, 0.0005939456168562174, 0.0006359572289511561, 0.0006730590248480439, 0.0006605639355257154, 0.000635768985375762, 0.0008809217833913863, 0.0010931247379630804, 0.0007397900335490704, 0.0006526517099700868, 0.001995444530621171 ]

[ "The reason bananas are curved has to do with how they grow. ", "Bananas grow in bunches known as \"hands.\" ", "As the bananas in a hand mature and grow larger, they eventually curve upwards so that instead of pointing towards the ground, they bend up and point towards the sky! ", "The ability to do this is pretty neat, and it's known by the complicated-sounding term \"negative geotropism.\" ", "Most likely, the reason that bananas have evolved to have negative geotropism is that it allows them to reach out towards the sun and get more light!" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0007965139811858535, 0.008004887029528618, 0.0008021428948268294, 0.000638580706436187, 0.0015090550296008587 ]

[ "337 F.2d 614\nJoaquin Cantera CORDOVA, Appellant,v.UNITED STATES of America, Appellee.", "\nNo. ", "21401.", "\nUnited States Court of Appeals Fifth Circuit.", "\nOctober 19, 1964.", "\n\nJoaquin Cantera Cordova, Atlanta, Ga., pro se.", "\nRobert C. Josefsberg, Asst. ", "U. S. Atty., ", "William A. Meadows, Jr., U. S. Atty., ", "Miami, Fla., for appellee.", "\nBefore RIVES and BELL, Circuit Judges and SPEARS, District Judge.", "\nPER CURIAM.", "\n\n\n1\nAppellant, having been convicted and sentenced to serve ten (10) years imprisonment for violating Section 4744(a), Title 26, United States Code, contends in his \"Motion to Correct Illegal Sentence\" that his sentence was excessive, relying upon the provisions of Section 7237, Title 26, United States Code, which, before amendment, permitted a maximum sentence for first offenders of five (5) years imprisonment. ", "It appears, however, that Section 7237 was amended prior to the time appellant committed the offenses for which he was convicted and, as amended, authorizes a maximum sentence for first offenders of ten (10) years. ", "The judgment is, therefore, affirmed.", "\n\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0.0007740053115412593, 0.0013785817427560687, 0.0009403980220668018, 0.0009328857413493097, 0.000743550481274724, 0.0006724755512550473, 0.012636496685445309, 0.00093490956351161, 0.0008520428673364222, 0.0006794222281314433, 0.000767266086768359, 0.0009821122512221336, 0.0009280572412535548, 0.0010798557195812464, 0.0006481150048784912, 0.001995444530621171 ]

[ "Carbon nanotube multilayered nanocomposites as multifunctional substrates for actuating neuronal differentiation and functions of neural stem cells.", "\nCarbon nanotubes (CNTs) have shown potential applications in neuroscience as growth substrates owing to their numerous unique properties. ", "However, a key concern in the fabrication of homogeneous composites is the serious aggregation of CNTs during incorporation into the biomaterial matrix. ", "Moreover, the regulation mechanism of CNT-based substrates on neural differentiation remains unclear. ", "Here, a novel strategy was introduced for the construction of CNT nanocomposites via layer-by-layer assembly of negatively charged multi-walled CNTs and positively charged poly(dimethyldiallylammonium chloride). ", "Results demonstrated that the CNT-multilayered nanocomposites provided a potent regulatory signal over neural stem cells (NSCs), including cell adhesion, viability, differentiation, neurite outgrowth, and electrophysiological maturation of NSC-derived neurons. ", "Importantly, the dynamic molecular mechanisms in the NSC differentiation involved the integrin-mediated interactions between NSCs and CNT multilayers, thereby activating focal adhesion kinase, subsequently triggering downstream signaling events to regulate neuronal differentiation and synapse formation. ", "This study provided insights for future applications of CNT-multilayered nanomaterials in neural fields as potent modulators of stem cell behavior." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006477612187154591, 0.0005465353024192154, 0.0005599985015578568, 0.0005561599391512573, 0.000649662280920893, 0.0006221033399924636, 0.000601191830355674, 0.000543316884431988 ]

[ "// ------------------------------------------------------------\n// Copyright (c) Microsoft Corporation. ", " All rights reserved.", "\n// Licensed under the MIT License (MIT). ", "See License.txt in the repo root for license information.", "\n// ------------------------------------------------------------\n\nnamespace Microsoft.", "Azure.", "IIoT.Modules.", "OpcUa.", "Twin.v2.Supervisor.", "StartStop {\n using Microsoft.", "Azure.", "IIoT.OpcUa.", "Testing.", "Fixtures;\n using Xunit;\n\n [CollectionDefinition(Name)]\n public class WriteCollection : ICollectionFixture<TestServerFixture> {\n\n public const string Name = \"Supervisor.", "StartStop.", "Write\";\n }\n}\n" ]

{ "pile_set_name": "Github" }

[ 0.0015655674505978823, 0.0006133938441053033, 0.0006108734523877501, 0.0006146928062662482, 0.0014547968748956919, 0.0008478763629682362, 0.0008269157260656357, 0.0024395729415118694, 0.0008358704508282244, 0.0007179165259003639, 0.0008478763629682362, 0.00466531328856945, 0.0007098527275957167, 0.0007232511998154223, 0.0008497308008372784, 0.001318377093411982 ]

[ "Published: Wednesday, February 13, 2013 at 11:36 a.m.\n\nLast Modified: Wednesday, February 13, 2013 at 11:36 a.m.\n\nHouse of Flowers staff member Randy Boudreaux, 51, assembles a\nValentine's Day floral arrangement Monday in the Houma shop.", "\n\nAnd your friendly neighborhood florists are the people putting in the legwork to help produce that happiness.", "\n\nOwner of House of Flowers in Houma, Denise Bourg, 53, has known the holiday no other way, she said, since she was born into the floral industry.", "\n\n“I've been in this business my whole life,” she said. “", "I was born into this shop.”", "\n\nHer mom, Sadie Toups, 85, the previous owner of the floral shop, confirms Bourg's claim. ", "Toups has been a florist for about 70 years.", "\n\n“She's right. ", "She was born here. ", "I accidentally got this place,” Toups said, referring to the way she came into ownership of House of Flowers. “", "I was just helping out with arrangements for a funeral and did such a good job, the owner was ready to sell and asked me to take it.”", "\n\nBourg has taken over handling the bulk of the business, with help from her mom and several other employees. ", "She gets so busy, she said, that celebrating Valentine's Day with her husband of 35 years is out of the question.", "\n\n“He knows how it is,” she said. “", "We celebrate it with a phone call where he says ‘how's it going?' ” ", "she said. “", "And my answer is ‘Oh you know. ", "You know how it's going.' ”", "\n\nHouse of Flowers creates 600 to 700 arrangements in the week or so leading up to Valentine's Day, most of which are handmade.", "\n\nThey can make about 200 deliveries a day using from four to five vans and drivers, a maximum they sometimes reach or come close to reaching on Feb. 14.", "\n\n“People call that day still wanting deliveries,” she said. “", "By that point we just can't. ", "You have to know your limit. ", "We also do not take weddings on Valentine's Day. ", "Weddings are such a special day, and I can't focus on them, which isn't fair to the bride. ", "The volume is too large on the day of Valentine's to really devote time to a wedding, so you have to know the limit of what you can do and just stop taking orders.”", "\n\nEach year for Valentine's Day, House of Flowers takes on from five to eight additional staff members due to the volume of orders. ", "The other holiday that comes fairly close to the abundant amount is Mother's Day, Bourg said, adding that the number of orders usually falls just below that of Feb. 14.", "\n\nWhen asked if the amount of flower bouquet orders has decreased with the arrival of edible arrangements and similar alternative product deliveries, the long-time florist said flowers are “still as popular as ever.”", "\n\n“The way people order is a lot different with online and third-party websites,” she said. “", "For example, we get a lot of orders through 1-800 FLOWERS. ", "Not everyone calls me or comes in. ", "The way they do it has drastically changed.”", "\n\nAnd, Bourg said, the use of credit cards was an industry changer.", "\n\n“Back in the ‘70s, it was all about house accounts,” Bourg said. “", "But people still appreciate the value of what flowers do to people. ", "Flowers immediately cheer you up.”", "\n\nOne tip Bourg said is important for guys to keep in mind when ordering flowers year round, but especially for Valentine's Day, is to “send a woman flowers where she works so everyone else can see.”", "\n\nShe said the flowers must pass as many women as possible in the woman's office on the way to her desk.", "\n\nThat's why this year, House of Flowers has had a lot of deliveries outside of the 14th of the month, especially for women who work in places closed this week for Mardi Gras.", "\n\n“We have just as many on the 13th and had quite a few Monday and even last week,” Bourg said. “", "For example, those guys were sending them to ladies that maybe didn't have work this week, like teachers, and they knew they'd better get those flowers to where she works.”", "\n\nAs for her love life, “My husband definitely does not send me flowers, but he does give me a gift,” she said. “", "For us now, after being married so long, it's like a card and candy thing. ", "We do not go out. ", "By the time the night of the 14th comes around, I just want to go home, take a bath and rest.”", "\n\nStaff Writer Kris Johnson can be reached at 857-2207 or kris.johnson@houmatoday.com. ", "Follow her on Twitter @krisLjo.", "\n\nReader comments posted to this article may be published in our print edition. ", "All rights reserved. ", "This copyrighted material may not be re-published without permission. ", "Links are encouraged." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006862963200546801, 0.0007766518392600119, 0.0006100882892496884, 0.0007379198796115816, 0.0012183627113699913, 0.0014651525998488069, 0.0007664863369427621, 0.0008283912320621312, 0.0011969329789280891, 0.0006453173700720072, 0.0007191905751824379, 0.0044512758031487465, 0.002417099429294467, 0.0007452516001649201, 0.0005724243819713593, 0.0009284520638175309, 0.0030105765908956528, 0.0007294671377167106, 0.0005880214157514274, 0.0005863601109012961, 0.0006535573047585785, 0.0007052133441902697, 0.011428316123783588, 0.0008002796093933284, 0.0009510584641247988, 0.002825846429914236, 0.0006657400517724454, 0.0007117114146240056, 0.0005662522744387388, 0.0006561849149875343, 0.000628556648734957, 0.0012150753755122423, 0.0006451841909438372, 0.000739611336030066, 0.0006878271815367043, 0.0005229802336543798, 0.0006502514006569982, 0.0007963451207615435, 0.0050866324454545975, 0.0018349260790273547, 0.0006575282895937562, 0.0007898825570009649, 0.0006757739465683699, 0.0010010622208938003, 0.001291263266466558, 0.002066447399556637, 0.0006712404428981245, 0.0008260072791017592, 0.0005322126089595258, 0.0006133938441053033, 0.0006102115730755031, 0.000539837870746851 ]

[ "South Australia\n\nTasmania\n\nFlinders Ranges\n\nOverview\n\n293064633\n\nHead into the arid heart of the Australian Outback and traverse one of the oldest geological landscapes in the world. ", "The 1200km Heysen Trail is rated as one of the world’s premier long distance trails and begins in the stunning Flinders Ranges, the Heysen’s spiritual birthplace. ", "We have selected the best walking in the Northern Flinders, from the trailhead to Black Gap and other not to be missed highlights. ", "This is an unforgettable rust coloured landscape with many hidden secrets, that can only be discovered on foot.", "\n\nThis is a world class experience where you will be supported all of the way. ", "At the end of each day you’ll have the luxury of having a hot shower, a chef prepared dinner and breakfast (see inclusions) and a good night’s sleep in a comfortable bed, rising refreshed and primed for each day’s fabulous pack free walking.", "\n\nTrip Length\n\nDays\n\nFrom\n\n$\n\nper person twin/double share\n\nSingle Supplement\n\n$795\n\nper person\n\nSingle Supplement\n\nAustralian hotel accommodations charge the same price per room regardless of whether there is one or two people occupying it.", "\n\nIn order to cover the cost of the accommodation when occupied by one person we need to charge the single supplement fee, a cost that we make no margin on.", "\n\nDAY 1\n\nStart at Rawnsley Park in the late afternoon where you will be transferred to Angorichina Village.", "\n\nWalking: Easy walking around Angorichina, including the Blinman Pools walk / 3km or more\n\nMeals: Dinner at Angorichina\n\nAccommodation: Angorichina Village in the Heysen Cabins with an ensuite\n\nDAY 2\n\nThis Flinders Ranges walk begins from the Heysen trailhead at Parachilna Gorge with a gentle 19km saunter deep in the valley between the ABC and Heysen Ranges all the way to Aroona Ruins. ", "The day’s walking starts with a very gentle stroll along various creek beds, then onwards over a procession of creek crossings as you slowly make your way uphill. ", "The last 7km you amble very gently back down the same beautiful valley to Aroona Ruins.", "\n\nWalking: Moderate / 19km / 5–6 hrs\n\nMeals: Cooked breakfast, walkers lunch and a chef prepared a la carte dinner at the Blinman\n\nAccommodation: Angorichina Village in the Heysen Cabins with ensuites\n\nDAY 3\n\nFull of ascents and descents, today’s walk traverses the ABC Range with incredible panoramic views of the mountains. ", "You walk across the Brachina Formation, one of the oldest rock formations on the planet. ", "This walk includes one of the most intact and rich Ediacara fossil sites in the world. ", "These 600-million-year-old rock formations are older and were once higher than the Himalayas, but have been worn down by time. ", "The last section of walking is through an open flat valley typical of the Flinders region with lots of wildlife viewing opportunities along the way.", "\n\nWalking: Challenging / 25km / 6–7 hrs / shorter 14km option available\n\nMeals: Chef-prepared cooked breakfast, walkers lunch and a chef-prepared a la carte dinner at the Woolshed\n\nAccommodation: Rawnsley Park Station in rooms with ensuites\n\nDAY 4\n\nToday’s walking is characterised by a great variety of landscapes, beautiful forest and gullies, including an exploration of the beginnings of Bunyeroo Gorge. ", "Take in great views of the Heysen Range and St Mary Peak. ", "The Flinders Ranges is also home to more than half of South Australia’s 3100 plant species, and famous for the wildflowers that carpet the plains and foothills during spring.", "\n\nDAY 5\n\nToday’s climb will take us to rewarding views back over the ABC and Heysen Range and over the pound (a huge natural amphitheatre) are one of a kind. ", "We will stop here for have lunch to take real time to take in the view.", "\n\nDAY 6\n\nWalking through Wilpena Pound you’ll get to really appreciate even more what this place is all about and the sheer scale of it. ", "Continue your journey across the valley floor totally surrounded by the impressive Wilpena Pound walls. ", "Prior to European settlement, the indigenous people hunted here. ", "The Aboriginal word Wilpena means ‘cupped hand’. ", "Holding tremendous cultural significance and spiritually uplifting, this is an ancient place offering unparalleled sanctuary and tranquillity to disconnect from the world and reconnect with yourself.", "\n\nWalking: Easy to Moderate / 11km / 4–5 hrs\n\nMeals: Chef-prepared cooked breakfast, Walkers Lunch and a chef-prepared a la carte dinner at the Woolshed\n\nAccommodation: Rawnsley Park Station in rooms with ensuites\n\nDAY 7\n\nThis is the last of the Flinders Ranges walks and is a fantastic way to bid farewell to the Flinders Ranges with views looking back inside Wilpena Pound and over to St Mary Peak. ", "Then as you progress to the Bluff, enjoy the views of the expansive plains below and the Chace and Elder Ranges to the south.", "\n\nMeals: Chef-prepared cooked breakfast, Walkers Lunch and a chef-prepared a la carte dinner at the Woolshed\n\nAccommodation: Rawnsley Park Station in rooms with ensuites\n\nDAY 8\n\nThis holiday finishes in Rawnsley after breakfast.", "\n\nMeals: Chef-prepared cooked breakfast\n\nWalk Grading\n\nThe Flinders Ranges walks are mostly easy to negotiate and generally the tracks are well graded. ", "The parts that aren’t are still walk-able but require a little more effort. ", "Full day walks average about 18km. ", "There are opportunities for fit walkers to challenge themselves on rather lengthy walks of up to 25km.", "\n\n*Walk grading and map are not to scale and indicative only.", "\n\nWalking Track\n\nAll inclusive 8 day pack free walking holiday\n\n7 nights’ accommodation in rooms with ensuites\n\nAll meals, including chef-cooked breakfasts, walkers lunches and a la carte two course dinners\n\nCamp fire bbq dinner under the stars on first night\n\nAll luggage transport and vehicle transfers\n\nWe shift you along the track from accommodation to accommodation to limit time in a vehicle, creating more time to relax and enjoy the region\n\nOn this Flinders Ranges tour on foot you’ll stay in the Heysen Cabins in Angorichina, at award winning Rawnsley Park Station and in the luxury glamping tents at Ikara Wilpena. ", "All of these private accommodations are located in inspired locations and provide a welcoming and comfortable base to rest, relax and reflect on the day’s walking. ", "The single supplement of $795.00 is for your own private ensuite on all 7 nights. ", "If you’re happy to share a bathroom (not your room) for 4 nights on the trip then the single supplement can be reduced down to $410.00.", "\n\nThe two course a la carte dinners and cooked breakfasts at Rawsley and Ikara are prepared by their in-house chefs.", "\n\nEach day whilst you’re walking you’ll be provided with a substantial walkers lunch, more importantly you’ll get to eat it at a fabulous location on the track. ", "A walkers lunch may include a high protein type salad, a roll or a wrap, a muesli bar, cake or muffin and a piece of fruit. ", "Each day is varied. ", "The 2 course a la carte dinners and cooked breakfasts are all prepared by professional chefs.", "\n\nThere is also a focus on regional food and wine. ", "Good wholesome food with kangaroo and emu occasionally on the menu. ", "The region is remote, but world-class South Australian wine and a cold lager are within easy reach. ", "We suggest that if you like wine then bring some for the first night at Angorichina ( or for the whole trip if you want your own pre dinner drinks).", "\n\nAlcohol or drinks with meals are not included (except tea/coffee and juice with breakfast).", "\n\nThis holiday starts and finishes in Rawnsley Park. ", "Transport information is available on request.", "\n\nThe Flinders Ranges walks are moderate to challenging with some rough tracks, where you’ll cover shorter distances. ", "Full day walks average about 19 km and 5-7.5 hours walking each day. ", "The walking is over mostly flat, well-walked paths and bush tracks with some rocky sections. ", "There are two days with steep sections. ", "This is a great opportunity for fit walkers to challenge themselves, however easier options are available on some days. ", "This is a reasonably long and tough walk and we highly recommend that you incorporate a rest day.", "\n\nThe best time to go is April through to September as it is the best weather for hiking in the Flinders Ranges. ", "The temperature is still very comfortable to walk in but warm clothes are necessary as the temperature drops at night. ", "This holiday is not available over the hot summer months of December to February.", "\n\nSee the Bureau of Meteorology’s information about average temperatures and rainfall at different times of the year.", "\n\nINSURANCE\n\nWe strongly recommend purchasing a travel insurance policy as we charge a cancellation fee if you cancel your Auswalk holiday after we have confirmed it. ", "We offer a 30% discount on travel insurance booked via our website. ", "Get an instant quote and purchase online now.", "\n\nINFORMATION PACK\n\nFor nearly 30 years we have taken pride in providing seamlessly organised walking holidays, but we know, even with that in mind, that you’ll have many more questions. ", "You will receive a very detailed information pack and itinerary approximately 6 weeks out from departure outlining all the fine detail and much more.", "\n\nCONTACT\n\nIf you have any questions about the Flinders Ranges walks., ", "tracks or the Flinders Ranges tour as a whole, feel free to ask one of our destination consultants or to speak with one of our guides. ", "You can get in touch with us via our contact form, email us at info@auswalk.com.au, or call us on +61 3 9597 9767.", "\n\nREQUEST TO BOOK\n\nSubmitting this completed form along with your deposit is a tentative booking only.", "\n\nPlease do not book flights until receiving a confirmation from Auswalk" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0007622630801051855, 0.0006069280789233744, 0.000531177909579128, 0.000715935486368835, 0.0005377979250624776, 0.0008994917734526098, 0.0006975011201575398, 0.0006507727666758001, 0.0007955631008371711, 0.0007128124125301838, 0.0006158427568152547, 0.004502146039158106, 0.0006057254504412413, 0.0011374223977327347, 0.0006972801056690514, 0.0006707191932946444, 0.0005689038662239909, 0.0006153012509457767, 0.000745118479244411, 0.0006459410069510341, 0.0009039841243065894, 0.0006141903577372432, 0.0007578358636237681, 0.0010678534163162112, 0.0009364073048345745, 0.0013650896726176143, 0.0006377283134497702, 0.0006277592037804425, 0.0008118060068227351, 0.000645032967440784, 0.0005374702159315348, 0.0007041565841063857, 0.0006600010092370212, 0.0006611748831346631, 0.0006481270538643003, 0.0006444486207328737, 0.0005536990938708186, 0.003356112400069833, 0.0008644936606287956, 0.0006418870179913938, 0.0007231333293020725, 0.0007641114061698318, 0.0005705217481590807, 0.0006743691628798842, 0.0005942943971604109, 0.0013552190503105521, 0.0008917994564399123, 0.000675784598570317, 0.0006157447351142764, 0.0006999231991358101, 0.0005340424249880016, 0.0005395020125433803, 0.0007084321114234626, 0.0006703163380734622, 0.0005978448316454887, 0.0006319932290352881, 0.0006120970938354731, 0.0005338999326340854, 0.0006498867878690362, 0.0006768816383555532, 0.0005533951916731894, 0.0005723913782276213, 0.000632053823210299, 0.0007294939132407308, 0.0005333760054782033, 0.0005374751053750515, 0.0005461364053189754, 0.0005061320262029767, 0.0006535925203934312, 0.000571574957575649, 0.000677667441777885 ]

[ "As just about any regular Reg reader knows, the Hitchhikers' Guide to the Galaxy states authoritatively that this planet Earth lies \"far out in the uncharted backwaters of the unfashionable end of the western spiral arm of the galaxy\". ", "However, it appears that in this case the Guide is probably wrong.", "\n\nWe learn this from new research carried out by astronomers who have been probing the heavens with the aid of the mighty five-thousand-miles-wide Very Long Baseline Array (VLBA) radio-scope.", "\n\nAn announcement from the US National Radio Astronomy Observatory, highlighting the new boffinry, has this to say:\n\nOur Solar System's Milky Way neighborhood just went upscale. ", "We reside between two major spiral arms of our home galaxy, in a structure called the Local Arm. ", "New research using the ultra-sharp radio vision of the National Science Foundation's Very Long Baseline Array (VLBA) indicates that the Local Arm, previously thought to be only a small spur, instead is much more like the adjacent major arms, and is likely a significant branch of one of them.", "\n\nFar from an unfashionable backwater, then, it would seem that our local stellar neighbourhood is in fact a comparatively desirable and bustling bit of galactic real estate.", "\n\n\"The Local Arm should appear as a prominent feature of the Milky Way,\" contends enthusiastic galactic estate agent Alberto Sanna, of the Max-Planck Institute for Radio Astronomy.", "\n\n\"The Local Arm is not a spur. ", "It is a major structure, maybe a branch of the Perseus Arm, or possibly an independent arm segment,\" he adds.", "\n\nSanna and his colleagues found this out by using the VLBA to obtain ranges to naturally occurring microwave-laser (maser) energy emissions beaming out of faraway clouds of water and alcohol. ", "Such localities are where hot young stars are to be found, an unfailing indicator of trendiness in galactic neighbourhood terms.", "\n\nEarth's 'hood, according to Sanna and his fellow astronomers' results as interpreted by the NRAO outreach staff, deserves \"more respect\" than it has received thus far.", "\n\nThough perhaps not enough even so to prevent our planet being demolished, ostensibly in order to make way for a hyperspace bypass (but actually in order to safeguard the psychiatric industry by preventing the planet - in fact a vast supercomputer controlled by mice - from finding out the Ultimate Question of the universe, the answer to which is, of course, 42.) ", "®" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.009925663471221924, 0.0005797755438834429, 0.000576713471673429, 0.0005525192245841026, 0.0005920000257901847, 0.00057370332069695, 0.001469615031965077, 0.0005780418869107962, 0.0007793541881255805, 0.0007259193225763738, 0.0006952082621864974, 0.0006799128605052829, 0.0005402283277362585, 0.0009799354011192918, 0.0008392215822823346 ]

[ "Tag Archives: mini stories\n\nI found some evidence of my 40 days lost dated October 17th when I was in the Royal Inland Hospital which comes in the form of writing. ", "I was not alone in my stay, others were with me as we … Continue reading →" ]

{ "pile_set_name": "Pile-CC" }

[ 0.000599282793700695, 0.0007855989970266819 ]

[ "[Development of Animation Projector System and Usefulness in Pediatric Head CT].", "\nThe restlessness of young children often causes motion artifacts on CT images. ", "We devised a new animation projector system (CT Theater) that enables a child to view an animation during a pediatric head CT examination. ", "The purpose of this study is to assess the usefulness on a children of a video viewed during a head CT scan. ", "Children of 3-10 years old who underwent head CT (SOMATOM Definition Flash, SOMATOM Force; Siemens) were analyzed for a period from 6 months before, to 6 months after, introduction of the projector system (before: n=46, after: n=29). ", "Mobile projector (MP-CL1; Sony) connected with tablet device (iPad; Apple) was put on the CT table near the child's head. ", "An animation was projected on the child's line of sight inside the gantry. ", "The animation is projected on the line of sight of the child such that the projector moves with the child on the table. ", "The number of requests for use made by children was 28/29 (96.6%). ", "The presence of images without motion artifacts decreased significantly after introduction (before/after introduction: 84.8% vs 100%, p=0.03). ", "The overall examination success rate tended to increase after introduction (84.8% vs 92.9%, p=0.26). ", "The overall examination time was significantly reduced (92.4±42.4 s vs 65.1±47.3 s, p<0.001). ", "We developed an animation projector system that shortened examination time and decreased motion artifacts in pediatric head CT." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006314182537607849, 0.0006633172743022442, 0.0007430581608787179, 0.0007646416779607534, 0.00230711093172431, 0.0010653188219293952, 0.000867110094986856, 0.0009901262819766998, 0.0009670813451521099, 0.0005696757580153644, 0.0005931572522968054, 0.0005856046918779612, 0.0006235428736545146 ]

[ "Q:\n\nCan we have MathJax back?", "\n\nIt's been a couple years since PPCG voted against MathJax. ", "Since then, the vote ratio has changed significantly, and most seem to be in favor of MathJax. ", "However, it is status-completed and no change will be enacted on the current votes.", "\nThe issue then was weird-looking search results, odd indentation and broken stack snippets due to $ being used in code. ", "There are solutions to most of these, however. ", "One solution is to escape all instances of $ in code (like it's done with < and >), which sounds fairly tedious but most of the work could automated if TIO were to do it. ", "Not a great solution but some might believe having MathJax outweighs the cons.", "\nWe've had a lot of math questions (and answers) since and they would greatly benefit from having actual mathematical expressions that look ridiculously better than if they were done with meek markdown formatting.", "\nI'd like to revisit this issue with another vote as opinions and ideas have changed since then.", "\nShould MathJax be enabled again?", "\nPlease vote on the answers with approaches, not on the question based on your opinion on Mathjax.", "\n\nA:\n\nYes, bring MathJax back\nAdvantages of having MathJax on Programming Puzzles & Code Golf:\n\nA lot of math, number and number-theory challenges and answers (and not only those!) ", "would benefit from having it back. ", "This is a lot – At the time of writing, about 12.19 percent of the challenges are mathematics-related, not to mention that math is our third most frequented tag.", "\n\nRather than having to type our maths using third-party services, and then uploading pictures which would clutter the entire page, while still not being completely aesthetically pleasant, we would have a built-in way to use these equations that would overall bring a design improvement to the entire site.", "\n\nDisadvantages of having MathJax (mostly those that were mentioned in the 2015 post that has disabled it) and their possible solutions (but they no longer seem to apply):\n\nSnippets that contain $ would mess up the search query and / or markdown. ", "As pointed out by Doorknob, the fix is easy. ", "Use \\$ or other separators instead of $ for starting / ending MathJax passages.", "\nCode snippets containing $$ are a problem – unless the escaping issue has been addressed since 2015, not sure – the separators for non-inline, centred expressions are not site-settable. ", "I am sure we would find a work-around, though, because stack-snippets and the search query are still two very important features of this site. ", "If this would still be a problem, we could simply just use inline math with \\$. However, the fix is rather easy as discussed in chat.", "\n\nExample Answers and Challenges that would take advantage of it\n\nCalculate the number of primes up to N by Dennis.", "\n\n(-a) × (-a) = a × a by Wheat Wizard.", "\n\nAbsolute Sums of Sidi Polynomial Coefficients by Dennis.", "\n\nSome answers to One OEIS after another by caird coinheringaahing.", "\n\nLargest Number Printable by Vereos, and all its answers.", "\n\nDeterminant of an Integer Matrix by Leaky Nun.", "\n\nHow lit is this mountain? ", " by Mr. Xcoder.", "\n\nCoprimes up to N by Dennis.", "\n\nGolf a transcendental number by xnor.", "\n\nApproximate definite integrals using Riemann sums by Mr. Xcoder.", "\n\nAnd the list goes on. ", "As you might have seen, challenges and answers from various tags, not only code-golf would have a benefit from re-enabling it. ", "Now, we can’t just exempt this site from having nicely-rendered mathematical insights, purely due to some separators, right?", "\n\nA:\n\nAdd support back, but change the delimiter\nI think MathJax would be fine, and see Xcoder's answer for more reasons why. ", " However, the reasons it were disabled still stand:\n\nMessed up regexes, since MathJax can trigger inside code blocks for whatever reason\n\nOdd-looking search results (though in general I think this applies to regexes in search results)\n\nBreaks stack snippets that we have, including the leaderboard one.", "\n\nBut as far as I can tell, all of these would be fixed by changing the delimiter. ", "Something like \\$ would work, but I'm open to other suggestions.", "\n\nA:\n\nAdd support back, but make it not trigger in code blocks.", "\nAs far as I can see, this is the root of all problems. ", "@200_success on CodeReview Meta says (emphasis mine):\n\nMathJax is currently enabled with $ … $ as delimiters. ", "However, that breaks existing posts that contain two dollar signs within the same paragraph, but where the code is not formatted using backticks or a code block.", "\n\n...which makes me think that this, IMO proper, fix is easily achievable.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.004434647038578987, 0.0007695371750742197, 0.0006419643759727478, 0.0005785608664155006, 0.0017183192539960146, 0.0005916556692682207, 0.0007302144658751786, 0.0010129305301234126, 0.0007038195035420358, 0.0005543150473386049, 0.0013986836420372128, 0.000583278713747859, 0.0008854137267917395, 0.0007080662762746215, 0.0006063735345378518, 0.0006333849742077291, 0.000871372758410871, 0.0009700592490844429, 0.00338729377835989, 0.0010895172599703074, 0.0006294336635619402, 0.0006023196619935334, 0.0006281619425863028, 0.0006944252527318895, 0.0006375930970534682, 0.0012134930584579706, 0.0006848116172477603, 0.00569954002276063, 0.01017179898917675, 0.0006613453151658177, 0.0009807845344766974, 0.001235602074302733, 0.0006201684009283781, 0.0045567648485302925, 0.0006343908025883138, 0.0006362700369209051, 0.0006388695328496397, 0.0009972117841243744, 0.0006230177241377532, 0.0006473473622463644, 0.000727177073713392, 0.0007392195402644575, 0.0006774488720111549, 0.0007263123407028615, 0.0007340344018302858, 0.001995444530621171 ]

[ "- Większość mieszkańców chce tej figurki. ", "Tylko nielicznym ona przeszkadza, dlatego zbieram podpisy i będę wnioskować o pozostawienie Maryi przed naszym blokiem - mówi Bernadetta Palkij.", "\n\nFigurę Matki Bożej ustawiła jedna z mieszkanek boku przy ul. ", "Broniewskiego w Rzeszowie. ", "Ma to być miejsce modlitwy. ", "Administrator bloku zażądał usunięcia figury, ponieważ ustawiono ją bez wymaganej zgody.", "\n\nNiewielka figura Matki Bożej pod blokiem przy ul. ", "Broniewskiego 21 pojawiła się w ostatni piątek. ", "Stanęła niedaleko wejścia do klatki schodowej, w miejscu ogrodzonym i szczególnie wypielęgnowanym. ", "W ogródku są krzewy, kwiaty, niewielka pergola i sporo urokliwych ozdób. ", "Figura Świętej Pani przed drzwiami do klatki O miejsce to dba Bernadetta Palkij, mieszkanka bloku nr 21, która sama postanowiła ustawić figurkę. ", "Zamówiła ją u rzeźbiarza z Jarosławia. - ", "Pomysł chodził mi po głowie od dawna, bo chciałam, żeby Maryja opiekowała się mieszkańcami naszego bloku, żeby starsze osoby, które i tak siadają na ławce obok ogródka i odmawiają różaniec, miały swoje miejsce modlitwy - opowiada. - ", "Chciałam, żeby obecność Matki Bożej w tym miejscu dawała nam siłę. ", "A teraz mamy Rok Miłosierdzia, więc tym bardziej czas jest odpowiedni - dodaje.", "\n\nI zaznacza, że z prośbą o poświęcenie figurki zwróciła się do proboszcza parafii pw. ", "Podwyższenia Krzyża. ", "Ten zgodził się pobłogosławić to miejsce i wyznaczył nawet termin na sobotę, 1 października. ", "I to właśnie niepokoi niektórych mieszkańców bloku, którzy podzielili się z nami swoją opinią. - ", "Mimo iż jesteśmy osobami wierzącymi, perspektywa modlących się staruszek przy wejściu do klatki schodowej nieco nas przeraża. ", "O zgodę na wspomnianą figurę inicjatorka tego przedsięwzięcia nie pytała nikogo z mieszkańców - zdradziła nam jedna z mieszkanek bloku, prosząc o anonimowość. - ", "W niedzielę rano figurę przyszedł oglądnąć nasz proboszcz, a na mszy zapowiedział, że mieszkańcy bloku poprosili go o poświęcenie figury. ", "My jako część mieszkańców nie zgadzamy się na takie praktyki, zwłaszcza za naszymi plecami - dodaje.", "\n\nI pyta, czy na terenie bloków, którymi zarządza MZBM Rzeszów, możliwe jest samodzielne decydowanie o ustawianiu małej architektury. ", "Z pytaniem tym zwróciliśmy się do zarządcy bloku. ", "Jak usłyszeliśmy, teren, na którym zorganizowano ogródek i postawiono figurę, należy do miasta. - ", "Bez uzyskania odpowiedniej zgody na takiej działce nie można robić nic na własną rękę. ", "Zresztą, wcześniej ta sama mieszkanka bez naszej zgody utworzyła w tym miejscu oczko wodne, które musiała później zlikwidować - mówi Janusz Szydło, administrator bloku nr 21. - ", "I tym razem wezwaliśmy tę panią do usunięcia figury, ale oświadczyła, że tego nie zrobi. ", "Zaznaczyła, że będzie zbierać podpisy i pisać petycję z prośbą o pozostawienie figury w tym miejscu - dodaje. ", "Pani Bernadetta potwierdza, że podpisy zbiera. ", "Na ten moment z 44 mieszkańców bloku jej pomysł pochwaliło i poparło swoim podpisem ponad 20.", "\n\nChcemy tej figury! ", "Jedną z osób popierających jest Maria Łyżka. - ", "Przecież w tym, że figura tu stoi, nie ma nic zdrożnego ani gorszącego. ", "To podobizna Matki Bożej, a nie diabła czy jakichś bożków - dodaje pani Maria. - ", "Również miejsce nie jest niegodne, bo przecież nie stoi przy śmietniku. ", "Ja chętnie będę się tu modlić - dodaje. ", "Pani Bernadetta zaznacza, że nikogo do modlitwy nie zmusza. - ", "Ja nie wiem, komu przeszkadza niewielka zresztą figura. ", "Fakt, może i powinnam zacząć od formalnej strony, czyli zebrać podpisy i poprosić administrację o zgodę, ale pomyślałam, że skoro mam już u siebie figurę, to nic się nie stanie, jeżeli ją ustawię - wyjaśnia Bernadetta Palkij." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.013050065375864506, 0.07203023135662079, 0.011574438773095608, 0.006742862053215504, 0.11878389865159988, 0.02760840393602848, 0.07828321307897568, 0.056702520698308945, 0.06169285252690315, 0.2630048096179962, 0.031731631606817245, 0.005346011370420456, 0.015830347314476967, 0.09404517710208893, 0.1817331612110138, 0.13801448047161102, 0.0024936979170888662, 0.025646017864346504, 0.06357531249523163, 0.3283342719078064, 0.037481293082237244, 0.20034781098365784, 0.08915412425994873, 0.14020037651062012, 0.13466152548789978, 0.027531757950782776, 0.2081201672554016, 0.011652669869363308, 0.09915219247341156, 0.030012933537364006, 0.007642654702067375, 0.1265420764684677, 0.02689271979033947, 0.011588341556489468, 0.2006485015153885, 0.01121521182358265, 0.2429468333721161, 0.06709673255681992, 0.007349151652306318, 0.09420016407966614, 0.429129421710968 ]

[ "Various types of garage ventilation systems are known in the prior art. ", "However, what is needed is a garage ventilation system including a housing body having a pair of side walls and rear and front mounting plates with louvered vents on the front mounting plates. ", "Support frames vertically disposed on the rear mounting plate have a channel longitudinally disposed therein and a stop body disposed within an outer end thereof. ", "A mount bracket engages each of the channels. ", "Legs disposed on each side of a central pivot member engage the respective channel with termination at the stop body. ", "The mount brackets extend outwardly and away from the rear mounting plate. ", "A fan casing, having a fan disposed therein, is rotatingly mounted to the mount brackets allowing rotation of the fan into an exhaust position and an alternate intake position to direct airflow away from or alternately into a garage. ", "A heater contained within the housing body generates heated airflow directed by the fan." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0005992642836645246, 0.0006525089265778661, 0.0006167208193801343, 0.000715643516741693, 0.0007135930354706943, 0.000747737183701247, 0.0009821881540119648, 0.000888179405592382 ]

[ "But all these types of porn share things in common. \"", "I think we are all outcasts,\" Trouble told me when I ask if there's a big difference between queer and mainstream actors. \"", "You have to be pretty courageous and strong to be in the porn industry. ", "I think even Jenna Jameson would admit to being a total weirdo.\"", "\n\n\"I'D LIKE TO THANK MY ASSHOLE\"\n\nThe weekend's climax for queer porn did not take place at a podium. ", "Best Alternative Website didn't win its category, which turns out is among the B-list honors that are announced in a quick scrolling of names on a Jumbotron at the AVN ceremony's terminus anyways.", "\n\nThe high point instead, was the red carpet. \"", "That's where I shine the most,\" Trouble told me. ", "Arms draped around each other's tuxes and sequined mini-dresses, queer porn stalked the lane in front of the flashbulbs and broadcast press with aplomb. ", "It looked like they'd been doing it for years, which speaks to their professional talent — actors James Darling and Charlie Spats were walking as the second and third trans men ever on the AVNs' carpet (Buck Angel, winner of 2007's AVN for Best Transsexual Performer, was the first).", "\n\nQueer dominatrix Princess Donna of San Francisco's Kink.com walked the gauntlet arm-in-arm with Bobbi Starr, who would later accept the AVN for Best Female Performer. ", "Hartley was there with her husband, and chatted with me about her role in queer porn education. \"", "It helps that I can pass for a normie,\" she laughed. \"", "The presence of my physical self allows the message to sink in. ", "I believe in this [queer porn] to my core.\"", "\n\nIn the moment, it seemed that queer porn was truly a force in the industry. ", "The week after the awards, I forwarded Trouble a photo of herself with an arm around a beaming Ron Jeremy on the red carpet. ", "She cropped and lightened it before reposting on her Facebook page with the note \"Ron Jeremy, you have made some seriously hot porn. ", "I am a fan!\"", "\n\nBut when it came time to watch the awards themselves — a drawn-out, logistically disastrous affair whose 2012 highlight was Best Anal Scene champ (and winner of seven awards in total) Asa Akira's acceptance speech: \"I'd like to thank my asshole for putting up with all my shenanigans!\" — ", "the core queer porn team was nowhere to be found. ", "Beat from hours on their high heels in front of the cameras, Horn, Trouble, and co-stars went out for a \"steak and a Manhattan,\" rather than settling in with overpriced drinks to watch teleprompter flubs and malfunctioning clip reels.", "\n\nOnce again, the queer porn stars were taking what they wanted from the adult industry and leaving the rest. ", "Explains Horn: \"everyone was on their magic phones and on Twitter people were saying how terrible everything was. ", "I was putting marrow on toast and I was like, eh, I don't think I'm going to make it.\"", "\n\nBut they met up with those who did attend the awards for the after-party. ", "And yes, there was a hot tub involved.", "\n\nSpecial thanks to Broke Ass Stuart for supplying the headline of this article. ", "Porn + words = Stuart." ]

{ "pile_set_name": "Pile-CC" }

[ 0.22944305837154388, 0.03743831068277359, 0.16702060401439667, 0.1738807111978531, 0.9551991820335388, 0.0006746957660652697, 0.0006129488465376198, 0.0009468338685110211, 0.5222355127334595, 0.00126568169798702, 0.06319215148687363, 0.07388610392808914, 0.0009216562029905617, 0.0008167093619704247, 0.4198146462440491, 0.33943748474121094, 0.0006669873255304992, 0.7015489339828491, 0.0009132199920713902, 0.6319379806518555, 0.5015277862548828, 0.007041798904538155, 0.6647626757621765, 0.000930718204472214, 0.0008083863067440689, 0.000559360021725297, 0.0006344522116705775, 0.5063626170158386, 0.5507202744483948 ]

[ "Blennerhassett Hotel\n\nBlennerhassett Hotel is a historic hotel located at Parkersburg, Wood County, West Virginia. ", " It opened in 1889 and is in the Queen Anne style. ", "The hotel was listed on the National Register of Historic Places in 1982. ", "A full restoration took place in 1986. ", "The Blennerhassett Hotel is also a member of Historic Hotels of America, the official program of the National Trust for Historic Preservation. (", "The hotel website states that the property is \"registered as a national historic landmark\". ", "This is undoubtedly a mistake for it being placed on the National Register of Historic Places. ", "Only about three percent of Register listings are NHLs.)", "\n\nIn the late 1800s, money from the oil and natural gas industries flooded into Parkersburg, West Virginia, and the town quickly became a vivacious city that welcomed businessmen and visitors from all over the country. ", "Designed and built by William Chancellor, a prominent Parkersburg businessman, Blennerhassett opened in 1889 and quickly became a grand showplace for what would later be known as the Gaslight Era. ", "The original hotel had approximately 50 guest rooms around a central staircase. ", "Restrooms were common places on each of the four guest floors and the kitchen was located on the fifth floor. ", "What is now the hotel's game room originally housed the First National Bank of Parkersburg and had the luxury of electricity.", "\n\nThe property was named after Harman and Margaret Blennerhassett, who settled on an island in the Ohio River in 1798 and built a Palladian mansion on their European-style estate (the island now called Blennerhassett Island). ", "Their property was the envy of all locals, but they didn't rise to national fame until they allowed former Vice President Aaron Burr to use the island as the base of operations for his controversial military exhibition. ", "Labeled as a conspiracy by some, the Blennerhassetts fled down the Ohio River to escape when militia invaded the island.", "\n\nSee also\n List of Historic Hotels of America\n\nReferences\n\nExternal links\n\nBlennerhassett Hotel website\n\nCategory:Hotel buildings on the National Register of Historic Places in West Virginia\nCategory:Queen Anne architecture in West Virginia\nCategory:Buildings and structures in Parkersburg, West Virginia\nCategory:National Register of Historic Places in Wood County, West Virginia" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0010441780323162675, 0.0007709173951297998, 0.0008797469781711698, 0.0005444078124128282, 0.0005932946223765612, 0.0006818923866376281, 0.0008589423377998173, 0.0007180048269219697, 0.0006749783642590046, 0.0008596067782491446, 0.0006078974693082273, 0.0006818605470471084, 0.0006788131431676447, 0.0008189567597582936, 0.000956761883571744, 0.0012558576418086886, 0.0006146365194581449 ]

[ "The detection of microscopic disease in breast cancer has been evaluated in lymph nodes, bone marrow (primary breast cancer), and peripheral blood (metastatic disease) \\[[@B1],[@B2]\\]. ", "Most of these studies demonstrated that the detection of microscopic disease in breast cancer patients contributes prognostic information and, in selected cases, can predict the efficacy of treatments \\[[@B1],[@B2]\\]. ", "In primary breast cancer, the detection of microscopic disease in lymph nodes and bone marrow has led to a better understanding of the role of minimal residual disease (MRD). ", "In metastatic breast cancer (MBC) reliable detection of circulating tumor cells (CTCs) had been obtained by using immuno-magnetic separation and subsequent analysis by the CellSpotter™ analyzer (Veridex LLC, a Johnson & Johnson company, Warren, NJ, USA). ", "This technology is becoming a standard tool for the \\'real-time\\' assessment of prognosis and response to treatment. ", "This is particularly important in the context of advanced disease management, considering the incurable status of the disease and the increasing therapeutic options available that could at least contribute to improve palliation and impact on overall survival.", "\n\nIn fact, despite years of clinical research, the odds of achieving complete response, and hence major survival benefit, for patients with MBC remain extremely low. ", "Only a few patients who achieve a complete response after chemotherapy remain in this state for prolonged periods of time, with some remaining in remission beyond 20 years. ", "There are presently no reliable biological markers that can predict prognosis and monitor therapy effects in MBC.", "\n\nThe detection of CTCs in patients with MBC about to start a new line of treatment has been shown to predict progression-free survival (PFS) and overall survival (OS). ", "This prognostic value was independent of the line of therapy (e.g. first-line versus second-line or more) \\[[@B2],[@B3]\\]. ", "Moreover, in multivariate analysis CTCs demonstrated superior value compared with site of metastasis (e.g. visceral versus soft tissue/bone), type of therapy, and length of time to recurrence after definitive primary surgery. ", "In recent analysis, detection of CTCs has also been found to be prognostic in patients with bone-only disease (not measurable disease). ", "CTCs have been shown to be superior to standard tumor markers (e.g. Ca27-29) in predicting prognosis. ", "Furthermore, the efficacy or benefit to systemic therapy could be predicted by the level of CTCs as early as 3--4 weeks after initiation of therapy. ", "Patients with persistent of ≥ 5 CTCs demonstrated lack of response or progressive disease at the time of restaging by standard imaging modalities. ", "Conversely, patients with \\< 5CTCs showed objective remission. ", "These data clearly suggest that CTCs can be used as an early predictor of treatment efficacy and be extremely useful in sparing patients from futile therapy early in the course of their treatment.", "\n\nProspective clinical trials are presently being conducted in MBC to validate further the prognostic value of CTCs, possibly to use this diagnostic tool to better stratify patients with metastatic disease, eventually modifying the current staging system (International Stage IV Stratification Study \\[ISSS\\]). ", "Patients with metastatic disease could be divided into the subcategories IV~A~and IV~B~, depending on the presence or absence of CTCs. ", "Additional studies are presently assessing the survival benefit of early change in treatment based on the persistence of CTCs and the possibility of collecting the cells, after sorting for evaluation of biomarkers (RT-PCR, gene profiling). ", "Exploratory studies in PBC are also being conducted.", "\n\nThis technology could be integrated with other new investigation tools to develop blood-based integrated platforms that will facilitate screening, diagnosis, prognosis and target discovery. ", "A recent acquisition is represented by the use of glycan arrays \\[[@B4]\\].", "\n\nMalignant transformation and tumor progression are associated with the specific changes in the complex surface carbohydrates known as tumor-associated carbohydrate antigens (TACAs). ", "Production of autoantibodies against these abnormal carbohydrates during cancer progression is expected. ", "A robust printed glycan array was recently fabricated that employs a library of over 200 well defined structures comprising carbohydrate sequences of *N*-glycans, *O*-glycans, glycolipids, and glycoproteins. ", "This printed glycan array was used to simultaneously detect multiple specific antiglycan autoantibodies in sera from breast cancer patients.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.0008970350027084351, 0.0006440166616812348, 0.0008180747390724719, 0.000641003018245101, 0.0006487203063443303, 0.0005546009633690119, 0.0006286228308454156, 0.0005768363480456173, 0.0006625439273193479, 0.00059714779490605, 0.0007759867585264146, 0.0006282266112975776, 0.0006334547069855034, 0.0006452389643527567, 0.0005719918408431113, 0.0007135643973015249, 0.0006661869119852781, 0.0006484282785095274, 0.0005607313360087574, 0.0006072430987842381, 0.0005338671035133302, 0.0005367660778574646, 0.0006350108305923641, 0.0006037168786861002, 0.0007925425306893885, 0.0024903067387640476, 0.0008535334491170943, 0.0007936038891784847, 0.001995444530621171 ]

[ "Joy comes in many different shapes and sizes, and that is exactly what you will be able to show with our Square Joy Holiday Cards. ", "Don’t let someone else’s images tell your story. ", "Every time you send out one of these family photo cards, you are sending a story of the past year and the joy your family has experienced. ", "There are plenty of photo spots on the front side of these photo holiday cards as squares are placed in a grid pattern. ", "The word ‘JOY’ is written across the grid. ", "The back layout is a solid color background with your family’s holiday message centered on it. ", "Alternate back designs may be available. ", "All cards printed on recycled paper." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006096392753534019, 0.015930764377117157, 0.0006463295430876315, 0.0005838149227201939, 0.0006081652245484293, 0.0007071380387060344, 0.0005552705843001604, 0.0006506230565719306 ]

[ "Monotonous tales and incoherent thoughts of a seething brain…Read at your peril\n\nOur Elders Have Failed Us!", "\n\n“We have a powerful potential in our youth, and we must have the courage to change old ideas and practices so that we may direct their power towards good ends.", "”Mary McLeod Bethune\n\nWhen we were young, we were taught to respect our elders. ", "We looked upon them with exalted admiration and appreciation. ", "Whoever they were, wherever they came from or whatever clan they hailed from, we were expected to treat them with utmost respect. ", "We were admonished for calling them by their own name. ", "By Lord; we received rigorous reprimands for not emptying our seats for them when they arrived. ", "We were expected to display a decent decorum at all times.", "\n\nCould these elders whom we’ve grown to fear and, at the same time, admire so much be the cause of our destruction, one would ask. ", "But these elders, still remarkably agile despite senility and strenuous predicaments, are versed in poetry and recite it with extreme vitality, enriched with cunning dexterity and clever choice of words. ", "And they are scandalmongers; their days spent on frivolous jokes and heated feuds between clans, by the tip of their tongue! ", "With their enticing and scintillating poems, they infest the minds of susceptible and oblivious adolescents. ", "Through this sham poetry and witty repartee, they earn a name only one could yearn; held in high veneration, whilst heaps of praises are hurled their way. ", "There is, however, pathos in their false pretence and sham poetry as they narrate melancholic tales of yesteryear to stir up emotions and provoke the psyche of the unsuspecting folks. ", "What a Travesty! ", "What a travesty!", "\n\nThe rest of the elders, not involved in the political disarray, live beyond care for today. ", "They dread the day that follows, and after years of endurance and fortitude, their dismal faces radiate no more. ", "They lay down in the dumps, desolate, any trace of anticipation they had had evaporated. ", "Days they spend wandering aimlessly with one thing on their mind – Qat – and a bottle of water to quench their thirst. ", "The same routine is exercised cyclically without cessation.", "\n\nThanks to the benevolent Somali women. ", "The once social nonentities are now the pride and joy. ", "Their homes, full of waifs and strays, serve as sanctuaries for the poor and dispossessed. ", "Relentlessly they support young and old, rationing the supplies if need be. ", "Thanks to their unremittingly labours, many now survive. ", "From the break of dawn they work diligently supporting entire lineages by the sweat of their brows; selling with much dexterity anything they could find. ", "By night they take a breather, and demurely await their husband’s arrival just to get hauled over the coals for the slightest inaccuracy. ", "Oh! ", "How magnanimous they are to put up with their ne’er-do-well husbands!", "\n\nIt’s quite disheartening how the Qabiil Syndrome has got us by the short and curlies and with majority of the population in Somalia being illiterate, there is little to expect of them. ", "So, we have the Somalis in Diaspora who, regrettably, have no nostalgic sentiments. “", "Somalia can never be” they proclaim wistfully and leave her to lament her sorry states alone! ", "They expect their seniors back home to amend the state of affairs and resolve their issues. ", "With the waning distance, they lose touch with every intrinsic quality, faith and culture they had while the Nomads in Somalia turn a sympathetic eye towards the ones in Western countries “Qurbaha” and plead for them to save them from the self-destruction. ", "Their youth spent on selfish desires, deludes them from reality and cocoons them from unpleasant imagery. ", "There they dwell despondently with the notion that a better future lies ahead of them. ", "They laze and lounge, graze (Qat) and grouch constantly. ", "Their families lost amidst all this upheaval and perplexity, and then they wonder why even their partners often abscond from them!", "\n\nWhat our elders have yet to learn is that wars have no happy endings; always cruel and catastrophic. ", "Whether a winner or a loser, expect no glad tidings, no immortal kisses, no heaps of welcomes await you! ", "Ileen Odayaashu waxaysan garaneyn, Dagaal wiil kuma dhashee, wiil baa ku dhinta!", "\n\nAs for the warlords, despair not, Somaliyeey, despair not! ", "Tyrants and murderers always fall; and so they will!", "\n\nInsha-Allah Xamdi – All we can do at this moment is pray that this coming Generation – the ones back home adn the ones in Diaspora – can outwit their fathers and grandfathers and mend the situation for the better!" ]

{ "pile_set_name": "Pile-CC" }

[ 0.4111093282699585, 0.0005565655883401632, 0.0005742358625866473, 0.0005378702189773321, 0.0005027577863074839, 0.0009362627170048654, 0.0006521529867313802, 0.0026999253313988447, 0.0007519086939282715, 0.0006149503169581294, 0.16306495666503906, 0.023856990039348602, 0.014566306956112385, 0.029708540067076683, 0.9302582144737244, 0.9302582144737244, 0.000809192075394094, 0.031046200543642044, 0.00780935725197196, 0.005730787292122841, 0.0006122919730842113, 0.00605169078335166, 0.00263043656013906, 0.3185032606124878, 0.0019828558433800936, 0.000806083669885993, 0.0038451915606856346, 0.003649615915492177, 0.00398053415119648, 0.28161147236824036, 0.019573776051402092, 0.001481096027418971, 0.013239860534667969, 0.0006300065433606505, 0.0008098442922346294, 0.01535781193524599, 0.0008203415782190859, 0.030729210004210472, 0.0015989815583452582, 0.005581732839345932, 0.12444785982370377, 0.12719640135765076, 0.002306243870407343, 0.7220013737678528, 0.018610341474413872 ]