Datasets:

tomekkorbak

/

detoxify-pile-chunk3-6050000-6100000

like 0

[ "The epidemiology of candidemia in two United States cities: results of a population-based active surveillance.", "\nWe conducted prospective, active population-based surveillance for candidemia (defined as any Candida species isolated from blood) in Atlanta and San Francisco (total population, 5.34 million) during 1992-1993. ", "The average annual incidence of candidemia at both sites was 8 per 100,000 population. ", "The highest incidence (75 per 100,000) occurred among infants </=1 year old. ", "In 19% of patients, candidemia developed prior to or on the day of admission. ", "Underlying medical conditions included cancer (26%), abdominal surgery (14%), diabetes mellitus (13%), and human immunodeficiency virus infection (10%). ", "In 47% of cases, species of Candida other than Candida albicans were isolated, most commonly Candida parapsilosis, Candida glabrata, and Candida tropicalis. ", "Antifungal susceptibility testing of 394 isolates revealed minimal levels of azole resistance among C. albicans, C. tropicalis, and C. parapsilosis. ", "These data document the substantial burden of candidemia and its changing epidemiology. ", "Continued surveillance will be important to monitor the epidemiology of candidemia and to detect emergence of resistance to azoles." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0005842549726366997, 0.0006335355574265122, 0.0006671160808764398, 0.0010237430687993765, 0.0007443754002451897, 0.0008511773776262999, 0.0010592660401016474, 0.0011624759063124657, 0.0005992779624648392, 0.0006285569397732615 ]

[ "Anne Wojcicki is the cofounder and CEO of 23andMe, which provides direct-to-consumer genetic testing. ", "Sam Altman interviewed Anne for a series called How To Build The Future, which you can check out on our YouTube channel.", "\n\nTranscript\n\nCraig Cannon [00:00] - Hey, how's it going? ", "This is Craig Cannon, and you're listening to Y Combinator's podcast. ", "Today's episode is with Anne Wojcicki and Sam Altman. ", "Anne's the co-founder and CEO of 23andMe, and they provide direct-to-consumer genetic testing. ", "Sam's the president of YC Group. ", "He interviewed Anne for a series called, How to Build the Future, and you can check it out on our YouTube channel. ", "Alright, here we go.", "\n\nSam Altman [00:24] - Today we're here with Anne Wojcicki, co-founder and CEO of 23andMe, thank you very much.", "\n\nAnne Wojcicki [00:28] - Hi, thank you.", "\n\nSam Altman [00:29] - We always like to start with how you came up with the idea, and sort of the founding story of the company.", "\n\nAnne Wojcicki [00:33] - I was working on Wall Street, and--\n\nSam Altman [00:35] - That doesn't sound very fun.", "\n\nAnne Wojcicki [00:36] - It was, actually.", "\n\nSam Altman [00:38] - It was fun?", "\n\nAnne Wojcicki [00:39] - I loved it. ", "I grew up in academia, I always thought I'd end up being an academic. ", "I went to a job fair right out of college, my parents made me go, and I got this job offer to go on Wall Street. ", "And it's one thing I always tell young people, you never really know what's going to come your way, just take every opportunity. ", "I very randomly got this job on Wall Street, I had no idea what it was, but I kind of figured, I actually only took the interview cause they gave me free frequent flyer miles. ", "I won the flight, I won the frequent flyer miles.", "\n\nSam Altman [01:08] - Oh, you had to fly there, but you got to keep the frequent flyer miles.", "\n\nAnne Wojcicki [01:11] - Yeah, no, I was just excited. ", "I was like, it's a free trip, it'll be 5,000 miles, that's pretty awesome. ", "I was on Wall Street for 10 years and I loved it. ", "For me it was, because it wasn't just about trading and making money and doing these things, but it was I got to learn about companies. ", "The one thing that is amazing on Wall Street is that you get to go deep on certain companies when you're really interested in them, and then really broad, knowing a whole sector. ", "I got to know small cap bio-techs and pharma companies and hospital systems and insurance companies. ", "I got to have a really broad landscape of health care. ", "In the beginning I had this eternal optimism, like, \"Health care's going to totally change, there's antibodies, there's all this new, there's technology, there's all these new discoveries coming, it's going to be so different.\" ", "And then when the bubble burst in 2000, a lot of innovation dried up and I started to see more what health care really is. ", "And at the end of the day, health care is an amazing business that really effectively monetizes illness. ", "I used to always say, \"If I successfully get you to never be diabetic, no one makes money. ", "But if you do become diabetic, there's all kinds of ways I can make money.\" ", "At the end of the day when I think about what I care about, what's in the best interest of me, I'd rather just never be diabetic. ", "I'd rather never be sick. ", "There's no one in the system today that really thinks about how to keep me healthy. ", "After 10 years of investing,\n\nAnne Wojcicki [02:40] - I felt like I really understood the system and I also understood that you had all these people with the right intentions who really care but the ship's just pointing in the wrong direction, and that no one's actually focused on keeping people healthy and that I wanted to have a company that was, frankly, somewhat rebellious and was going to inspire people to try to really be healthier. ", "I felt it was, you know, again, it had sort of that, a little bit of a Robin Hood kind of mentality in the beginning of, you can't change the system from within, so we got to do something more radical from outside.", "\n\nSam Altman [03:17] - One of my favorite Charlie Munger quotes is, \"Incentives are a superpower.\" ", "I always believe this and this is the clear problem you just identified. ", "How do you think about how you design a system or a company that is incented to keep people healthy?", "\n\nAnne Wojcicki [03:30] - Well, I realized the main thing in health care is that you don't actually ever have a voice. ", "Because you're not the payer in health care, you the individual, you don't actually make decisions, it's your insurance company, your doctor, the pharmacy benefit manager, there's all kinds of people in the back who actually make decisions and there's all this data now about... You go into surgery and there's doctors coming into the surgery that you've never even met. ", "For me what was transformative, what we did to change the incentives, is to put you in the power seat. ", "You make retail decisions that are in your best interest because you're actually the one paying the bill. ", "For us, what we decided to do that was frankly seen as disruptive is we are direct to consumer.", "\n\nSam Altman [04:15] - I remember when you launched, doctors, or just health care professionals in general, were saying, \"Patients, this is irresponsible. ", "You need a medical professional to do this.\" ", "I remember one quote that really stuck with me, something like, \"We can't have people making their own health care decisions, they don't know how to interpret the data.\"", "\n\nAnne Wojcicki [04:33] - There were all kinds of interesting things. ", "Cause people would publish stuff on Facebook and then doctor would say like, \"Do you have the right?\" ", "And we'd remind people, \"Yeah, it's their own information.\" ", "There's always been, I'd say, a tension a little bit with the medical system. ", "The medical system historically there's tests like the pregnancy test. ", "The pregnancy test when it came out was seen as radical. ", "How could women ever possibly learn, at home, that they're pregnant? ", "If you look at the literature of that era, we look at that today and we'd say it's crazy. ", "One of my favorite papers is there's this JAMA paper, the Journal of American Medical Association, from 1969 I think, where they ask doctors, \"Would you tell your patients that they have cancer if they had a cancer diagnosis?\" ", "Over 90% of them said no. ", "I always put that in context, it helps people understand. ", "Physicians were trained in such a way, and so I don't blame the system or the individuals, it's just that that was the culture. ", "That was thought of what was actually in your best interest. ", "What we do is as we empower consumers, we are showing that people actually can be, people want to be in charge of their health, they want the information, and they actually want to be in control.", "\n\nSam Altman [05:50] - I always like the model of thinking about the world 50 or 100 years from now and looking back, what will we think was just totally ridiculous, and this sure seems like--\n\nAnne Wojcicki [05:59] - Health care that type, because health care's really, as much as it's science and it's data-driven, it's also not. ", "Part of what people don't necessarily always understand is that the practice of medicine is an art. ", "The reason why you can go to five different physicians and get five different ways of treating cancer is because there's the practice of medicine, you can get different opinions. ", "One of the things that we're specifically trying to change is exactly that, is exactly to say that we're trying to get data so that it's no longer a question of like, \"Hey Sam, what's in your best interest?\" ", "There's actually data to say exactly what you should be doing.", "\n\nSam Altman [06:38] - How do you think the medical system, the health care system overall, will eventually get to a place where we don't have this misalignment of incentives you talked about and we have data and we have people in control of their own health care? ", "If you could wave a magic wand and say, \"I'm going to fix the health care system,\" what needs to happen?", "\n\nAnne Wojcicki [06:55] - The reality is what needs to happen is never going to happen, which is like you have a universal payment system. ", "Single-coverage, like the reality is, who cares about keeping you healthy today? ", "Because you could be overweight and you could eat poorly and you could never exercise, and you won't see the consequences of that for the next, let's say, 20 years. ", "The reality is, who's going to benefit from that? ", "The reality is, it's society, and it's you personally, and it's somebody who's willing to invest in you in the long run, and for a single-payer health care system or like a country, they care about actually trying to keep you healthy for as long as possible. ", "Second, people, we don't want, we saw that communism doesn't support the system that we all want. ", "People have to be willing to spend money and they have to step up. ", "The same way you see people stepping up with yoga and vitamins and weight loss studies and all kinds of different alternative care, people at some point have to stop and say, \"Your health is also your responsibility.\" ", "The more that we can give people personalized information about themselves, the more that they are going to be willing to execute on taking care of themselves.", "\n\nSam Altman [08:15] - Speaking of that, you could have started so many different companies in the health care space. ", "How did you decide this was, this was not an obvious choice at the time.", "\n\nAnne Wojcicki [08:23] - For me it was totally obvious. ", "For me there's a couple things that were happening. ", "One, I always loved genetics. ", "It was my first investment in 1996. ", "In some ways it was my first and it was my last. ", "The genetic revolution was happening. ", "Right when I started investing there was the race of getting the cost of the genome down. ", "It was super exciting, and I started looking at those investments again and realizing that you're going to be able to buy essentially a scan of your entire genome pretty inexpensively. ", "That was the first nugget of, okay wow, you can actually start to get huge amounts of genetic information. ", "And second was seeing this world of social networking. ", "That social networking was happening and you don't actually need the old guard to get things to happen, I could crowdsource. ", "It gave me this idea that wow, if I just empowered everyone with their genetic information and I crowdsourced all this information. ", "If I have the world's health information, what could I do? ", "And people were like, \"Well, you could cure, you could save, you'd know a lot.\" ", "The idea really was, well, we should do that. ", "Instead of relying on Stanford or Harvard or Pfizer to go and solve a disease or how to be healthy, we the people, we can do it. ", "In some ways, having grown up in this Google environment and knowing the social networking world that was coming up, it was piecing those things together that was like combine the technology and science with the platform that is really emerging.", "\n\nSam Altman [09:51] - I've noticed that many of the most transformative companies come because the founder sees an intersection of two pretty different but really important trends a few years before everybody else does. ", "This is clearly one of those. ", "It's the fact that crowdsourcing works is still amazing to me.", "\n\nAnne Wojcicki [10:07] - Totally, well, it's also when a founder really wants something personally.", "\n\nSam Altman [10:11] - Did you really want this personally?", "\n\nAnne Wojcicki [10:12] - Oh yeah, to me it was like the whole beauty for me of genes, of genetics is like gene by environment. ", "And I will always love people debating, \"But is it your genes or your environment?\" ", "I'm like, \"No, the whole beauty of it, is that it's both!\" ", "You might be genetically high risk for diabetes, but there's your environment.", "\n\nSam Altman [10:28] - You can do things about it.", "\n\nAnne Wojcicki [10:29] - What can I do? ", "So very few genetic ailments are a 100% deterministic, meaning 100% liklihood that you're going to get it. ", "That means there's an environmental component where you can potentially do something. ", "So let's go figure out what you can do and then tell people.", "\n\nSam Altman [10:45] - What was the reaction when you first announced that you were going to do this? ", "What was it like inside the building?", "\n\nAnne Wojcicki [10:52] - Startups are so fun because you get a bunch of people who are really passionate and people were excited and people knew that there would be controversy. ", "In some ways, we attract people who have all experienced the health care system in their own way and realize it has its limitations. ", "There's people who are excited about 23andme because of the mission and they're looking to contribute in some way, to helping change the system. ", "There was enthusiasm. ", "We had like videos. ", "We were also.. We were super excited to launch and we thought there was going to be this big coming, like everyone and we had tons. ", "We had spit parties. ", "We were on the cover of--\n\nSam Altman [11:37] - I went to one!", "\n\nAnne Wojcicki [11:38] - I know! ", "We had the cover of the style section. ", "We had the spit party in the building. ", "But I have to say, we sold a lot the first day. ", "And then it was slow.", "\n\nSam Altman [11:48] - That happens.", "\n\nAnne Wojcicki [11:51] - We were probably selling 15 to 25 kits a day. ", "Which is not a lot.", "\n\nSam Altman [11:58] - How do you, well I guess two questions. ", "One, how did you eventually fix that? ", "And how do you as a leader keep momentum in the building when you have this great launch, the first day is always awesome, and then you have a week called the trough of sorrow and people get pretty demotivated.", "\n\nAnne Wojcicki [12:15] - There's always a trough of sorrow and it's important to not let people be totally... hoping for immediate success and then to be overly distracted by the trough of sorrow. ", "That actually happens, not just in launches but every time you come up with a product. ", "You have no idea how well it's going to go. ", "I remember when my sister first launched AdSense, and she's like, \"I don't know, we'll see how it goes. ", "It's kind of, it's an experiment, we have no idea.\" ", "And then clearly it went on, but part of it is cause you work hard at it. ", "I feel like for us, and that trough of sorrow, we recognized more, we focused on the long term. ", "What do we need to do to get to this point. ", "As a leader, for me one of the most important things is not to wallow on today, but to wallow on like, okay in two years, this is what it's going to look like and these are the steps I need to do to get there. ", "People love a vision and people love a plan. ", "You just need to outline, this is where we're going. ", "When we saw that sales were slow, we're like, \"People don't understand genetics.\" ", "Some basic market research could have told us that, but people don't know why they want their genetics. ", "And that was like, \"Okay, great. ", "Now we actually need to educate the population about why you would want your genetic information.\"", "\n\nSam Altman [13:31] - And how did you do that?", "\n\nAnne Wojcicki [13:33] - I started changing my talks. ", "I would speak a ton. ", "In the early days, you gave me a conference invite, and I took it.", "\n\nSam Altman [13:42] - I remember that. ", "I remember that for myself too.", "\n\nAnne Wojcicki [13:44] - Yeah, exactly. ", "Any talk, part of it is constant feedback. ", "Again, for the people who want to be entrepreneurs, you're constantly learning something in the feedback. ", "I would change my talks. ", "I never gave the same talk twice. ", "When I look at my inventory of all my talks, it's like, there's like 500 of them because each one was slightly different. ", "I remember, specifically, getting the feedback. ", "People questioned what is the value proposition in what you're doing and I was like, \"Great, I can answer that question.\" ", "Over 50% of my customers get a medically meaningful result. ", "And then I started shifting the conversion. ", "Part of it was getting real time feedback and part of it was helping us define what is it that we have to do to show the value. ", "It was clear people need to understand genetics. ", "They didn't understand the basics. ", "They need to know what is the medical utility of this. ", "Then also, people need to know that they're not the only one, that's not weird. ", "Like, \"Oh this is weird I did it.\" ", "We need to drive social acceptance and part of it also was medical acceptance. ", "We did a ton... It's one thing I always advise science companies, is you can't speak, I can't just tell you, \"Oh we're great, we have great science.\" ", "No one believes that. ", "What you need to do is you need to publish. ", "I never even argue with scientists, I just hand over my publications. ", "Like, here you go. ", "Because that's the reality, you speak with your data. ", "I can make all kinds of claims, but here's my data to actually support it.", "\n\nSam Altman [15:11] - Can you talk about the best decisions you made in the early days? ", "People always ask about the worst, which we can talk about if you want. ", "But I'm curious if you look back, things like that where you learn, \"I need to interact with the scientific community in this way.\" ", "Are there a few decisions you made, that looking back, had been critical to success?", "\n\nAnne Wojcicki [15:27] - Fhe first two hires, the two founding scientists, Just like, Brian and Serge were amazing. ", "In some ways, hiring the right, for me it was such a critical part of the company was the scientific integrity of what we were going to do and it set a bar of the talent that we were going to hire going forward. ", "In some ways, having the right people.", "\n\nSam Altman [15:50] - We've noticed that it is almost impossible to, you can make a lot of mistakes as a company, but if you screw up the first five, seven hires, it's almost impossible to get through that.", "\n\nAnne Wojcicki [16:01] - There's a good number of, when I look at the first 15 people, there's a good, a number of them are still here. ", "The others who have left, we're still very close to.", "\n\nSam Altman [16:14] - How did you find those first two scientists?", "\n\nAnne Wojcicki [16:16] - We found them through a friend of a friend of a friend. ", "They had a similar idea so it was a good, it worked as a partnership. ", "It's hard, I would say hiring is one of the hardest things. ", "One of the things that we've tried really hard here in the company. ", "There are a lot of smart people who have humility and there's a lot of smart people who want to tell you how smart they are. ", "And we have opted for the humility. ", "It's really important to have people who are constantly open to feedback and constantly open to constructive criticism and learning about other areas. ", "That's actually one of the things that did make us successful. ", "Which allowed us to grow and attract other people because it's a group of people who are really eager to learn from others and to keep learning.", "\n\nSam Altman [17:07] - I've noticed, looking back at my own career that the big hire mistakes I've made are people who are really smart, but just awful to work with because they want to tell you how smart they are. ", "The framework that I've finally figured out, is you have to look at the net output that has a person has on the organization as a whole.", "\n\nAnne Wojcicki [17:25] - Correct.", "\n\nSam Altman [17:26] - Even if they do a lot themselves, if they make everybody else miserable.", "\n\nAnne Wojcicki [17:29] - It's one of the things, hiring is always really hard. ", "And I think especially in leadership roles, if you have the wrong person, I just recently watched one of the old documentaries about Steve Jobs and Bill Gates. ", "Jobs' talking about how disastrous it was when Scully came. ", "I kind of forgotten about some of these stories and I realized, I was like yeah, if you hire the wrong senior leadership--\n\nSam Altman [17:52] - And you don't fix it very quickly, it can sink you.", "\n\nAnne Wojcicki [17:53] - It can sink you.", "\n\nSam Altman [17:55] - Yeah. ", "What's it like being in a regulated industry? ", "One thing that a lot of people say when they think about, they want to do this really ambitious startup, like genetic testing, but they are afraid because it's regulated.", "\n\nAnne Wojcicki [18:09] - Regulation, in some ways there's pros and cons. ", "In some ways, when you're regulated, it means there's rules. ", "There's guidelines and you can figure out exactly what that means. ", "In some ways, there's more of a path about actually how you have to execute. ", "It definitely also means that it's more expensive. ", "There's rules. ", "If you don't always agree with all those rules, and when we went from an unregulated company to a regulated company, there was definitely a pretty major transition for us because we were used to, you hire smart people. ", "What do smart people like to do? ", "They like to question and they like to argue! ", "We would question all the time like, \"Ugh, well why do you need that test? ", "Or why do you need this study? ", "Why did you need that number of samples?\" ", "We would question all the time. ", "One of the things, I think, in a regulated environment, again, it's like the DMV, there's rules and you follow. ", "There's a level of obedience. ", "I'd like to encourage people, it's not so overwhelming to be regulated. ", "That said, it requires a lot of communication. ", "And in some ways it requires a communication style that's not prevalent in Silicon Valley.", "\n\nSam Altman [19:19] - Right, yes that is hard. ", "There is an opinions mismatch there.", "\n\nAnne Wojcicki [19:26] - We always said... I'd look at some of my old communication and I'm like, \"Oh wow, that's embarrassing now.\" ", "The way we thought we were communicating appropriately and how it really wasn't. ", "There's a style and there's a form and there's ways. ", "There is actually, there is a path and there's rule. ", "It's not terribly clear. ", "The regulatory world can do a better job of helping outline. ", "One thing I do appreciate from, now having been regulated for a number of years, is that there is a bigger picture that they see. ", "People who work at the FDA or people who work in government, it's a public servant job. ", "They care, they care about public safety. ", "At the FDA, they care about public safety. ", "There's so many companies, we can all see them. ", "There are so many companies trying to dupe the consumer and their job, they are there to keep us safe. ", "I have a lot of respect for what they do. ", "The onus is on us as the startup and the new company. ", "All these people want to do things in a new way, the onus is on us a little bit to explain how we're doing it, how that works, and the way they speak, just like I mentioned about scientists, they speak in data. ", "You can't just say, \"Oh no, no no. ", "Trust me, I'm the good guy.\" ", "You have to show the data and you have to show the data in lots of ways. ", "In that capacity, I don't really mind because they do know, they know a bigger picture story. ", "Some of the people we worked with there have been there for 20 years and were amazing. ", "They have a depth, a breadth of knowledge that I'm never going to have.", "\n\nAnne Wojcicki [21:10] - So learning, there's input to genuinely take.", "\n\nSam Altman [21:14] - As you look back, your vision on the day you signed the incorporation paperwork to now, how much has this all played out like you thought it would?", "\n\nAnne Wojcicki [21:25] - It was remarkable. ", "I have this picture of the day we signed and I always look at it and I'm like, one, I really dressed in a very different way than I do today. ", "But two, our series A documents... and our OKRs from 2007 are remarkably similar to what they are today.", "\n\nSam Altman [21:47] - That's always--\n\nAnne Wojcicki [21:48] - We're unusual. ", "One of our investors, he has said, \"What's amazing, I look back on everything, you're a broken record.\" ", "In some ways that's also why it's so easy to do speaking engagements cause I've said the same thing now for a decade. ", "We have a mission. ", "We have a drive. ", "I know where we're going. ", "We've been continuously executing on it.", "\n\nSam Altman [22:12] - The best companies are remarkably steadfast in that. ", "It's hard to do cause entrepreneurs sort of by definition like to start doing new things.", "\n\nAnne Wojcicki [22:18] - Right, so one of the hardest things for entrepreneurs, and again going back to the era, I forget what you called it, the era of sorrow.", "\n\nSam Altman [22:25] - The trough of sorrow.", "\n\nAnne Wojcicki [22:26] - The trough of sorrow! ", "It's important to stick with it. ", "One of the most important things I've learned at doing this now is the importance of persistence. ", "You have to stick with it. ", "And when you stick with it, you really see a benefit. ", "There's things that I see, now that I've done it for over a decade. ", "One of our missions is to tell people anyone can be a scientist. ", "Anyone, any age level, it's part of the reason we're direct to consumer. ", "I believe anyone, you can be eighth grade level, and you have the ability. ", "I love it now when kids come to me and they're like, \"Oh I saw you speak, and because of you, I really. ", "Even though I had, my parents didn't know anything and I didn't really have that degree, I'm now in a PhD program at MIT.\" ", "I get amazing stories and you never in some ways, it takes a long time to see the consequences of your actions. ", "It's one of the things I emphasize to people. ", "If you really care about something, if you're really passionate, it takes a decade to really see the impact.", "\n\nSam Altman [23:27] - It's like compound growth. ", "It's always misunderstood. ", "It always takes longer and then the magnitude and the out years is always bigger than you think.", "\n\nAnne Wojcicki [23:35] - Right, and I think what happens is that people hear the WhatsApp story, they hear other stories, and the real stories, the companies that continue to persist even if there's challenges. ", "The WhatsApps are the rare, but you can be super consistent and that's one thing, when I see the press about us now, it's overwhelming, we've just persisted.", "\n\nSam Altman [23:57] - Yeah, that's it.", "\n\nAnne Wojcicki [23:59] - We don't go away.", "\n\nSam Altman [24:00] - That is the secret to overnight success is ten years of persistence.", "\n\nAnne Wojcicki [24:02] - Yes, the overnight success is that ten years of persistence.", "\n\nSam Altman [24:06] - You've done all the remarkable things as a company and the one that is most remarkable, or sort of most important to the future of the world, is that I think in the last 11 years, genetic testing, because of you has gone from something people are afraid of, to something that is now accepted as a really important part of putting people in charge of their lives and their health. ", "But I'd love to hear what the next 11 years look like and if we had this conversion in 2029, what would we be talking about and then your proudest accomplishments then?", "\n\nAnne Wojcicki [24:37] - I said my original mission, if you think back to my Wall Street days, I think the system is broken, how am I going to be healthy. ", "Success for me is I would like to be healthy at 100. ", "I now know, I have my genetic information. ", "I can learn about things. ", "I have set up this research machine where I can collect data from all my customers. ", "We can make discoveries. ", "We give those discoveries back to our customers. ", "I have this amazing machine for discovery. ", "Now I want to execute on the vision of I would like to be healthy at 100. ", "So success for me, is how do I now, I just empowered you. ", "I have five million people empowered to learn about themselves and they could keep coming back. ", "We collectively as a five million person community and growing--\n\nSam Altman [25:25] - Is that the biggest genetic dataset in the world?", "\n\nAnne Wojcicki [25:27] - By far, yeah.", "\n\nSam Altman [25:29] - That's awesome.", "\n\nAnne Wojcicki [25:29] - With health information. ", "To me, that's where there's a power in what we an do now to make discoveries about prevention. ", "We have the drug discovery arm. ", "To me, I look at it as, we have two aspects. ", "You're healthy today, you want to keep staying healthy. ", "You have a condition, you just have this. ", "We want to have drug discovery for that. ", "Now we'd like to keep you healthy. ", "I think about who, what are the partnerships I can do. ", "What's the community I can form to actually help you make behavior changes. ", "One thing I see all the time when I meet people, again, all economic levels, all socioeconomic groups, people want to be healthier. ", "They don't necessarily know how. ", "I see this, people don't necessarily know. ", "Like, \"Oh are the Doritos really bad? ", "Is soda really bad?\" ", "It's remarkable how much there's a disconnect between, you hear things, but you don't really know what are the ways that we're going to be able to help people be healthier.", "\n\nSam Altman [26:26] - Have you discovered anything that is, I mean obviously the whole point of this is it's personalized, but general trends that you've discovered that apply to a lot of people they might not already be aware of? ", "Most people know they probably shouldn't drink so much soda.", "\n\nAnne Wojcicki [26:40] - No, but there's probably people who could absorb more sugar than others. ", "Those are the types of things. ", "We're all pretty different. ", "The beauty of humanity is that you're meant to survive. ", "You can look at it from the perception of viruses. ", "You have the 1918 flu, lots of people died. ", "Some people survived, some people are immune. ", "The same thing, foods, some people can just eat a lot of sugar. ", "Some people can't. ", "That's why we are still around on the planet today. ", "The main thing that I would say take away is that there's a lot of variability. ", "100% you shouldn't smoke, you should exercise more, you should eat better, but the reality is there's some people who can smoke and never get cancer. ", "There's some people who can eat a lot and never get overweight. ", "Some people, exercise doesn't really matter.", "\n\nSam Altman [27:25] - How far away are we from someone being able to spit in a tube and you tell them, here's what you need to do to have a good shot at living to 100?", "\n\nAnne Wojcicki [27:32] - That's one of the things that's most exciting. ", "What we can do by having a community of people who are all engaged. ", "We're starting to do what we call these intervention studies. ", "We did our first one on weight loss. ", "We had 70,000 people doing a six arm weight loss study. ", "That's the first time we're doing it in that kind of scale, specifically to see based on your DNA, are there differences in weight loss? ", "I'm also, I'm personally motivated in Parkinson's space. ", "So people who are genetically high risk. ", "Are there behaviors that can lower your risk? ", "And how much then can you lower your risk? ", "We're starting to do those types of studies specifically because that's what our customers want. ", "Our customers specifically want to know exactly what you just asked.", "\n\nSam Altman [28:18] - Tell me what to do.", "\n\nAnne Wojcicki [28:19] - Tell me what to do. ", "When you say, again, success for me, is at the end of this decade, I will tell you what to do.", "\n\nSam Altman [28:24] - At the end of, by 2020?", "\n\nAnne Wojcicki [28:27] - Well I look at it as--\n\nSam Altman [28:28] - 2030?", "\n\nAnne Wojcicki [28:30] - The next ten years of the company. ", "I'm already 10 and 12 years in, so give me another eight years.", "\n\nSam Altman [28:36] - That's pretty exciting.", "\n\nAnne Wojcicki [28:37] - I'm on it, I'm on it, Sam.", "\n\nSam Altman [28:39] - I will follow the instructions to the letter. ", "Thank you very much for taking the time.", "\n\nAnne Wojcicki [28:42] - Oh you're welcome. ", "Any time.", "\n\nSam Altman [28:43] - This was really fun.", "\n\nAnne Wojcicki [28:44] - Super fun." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0008233605767600238, 0.0005891046021133661, 0.0006985311629250646, 0.000753556378185749, 0.0007082761730998755, 0.0006817751564085484, 0.0008424961706623435, 0.0005683180061168969, 0.0006680742371827364, 0.0005906918668188155, 0.0006267948774620891, 0.0005418287473730743, 0.0006999055622145534, 0.0007592019392177463, 0.0007599276141263545, 0.0007133634644560516, 0.0006966633955016732, 0.0011998385889455676, 0.000704130157828331, 0.0006553158746100962, 0.0008670117822475731, 0.0007700029527768493, 0.0006422721780836582, 0.0007087174453772604, 0.0007268801564350724, 0.0005978753906674683, 0.0005614637630060315, 0.0006494122208096087, 0.0006672642775811255, 0.0006141384947113693, 0.0006029032520018518, 0.0016667244490236044, 0.12618957459926605, 0.27178889513015747, 0.001725667854771018, 0.010965543799102306, 0.0007508332491852343, 0.0005494171637110412, 0.0006776506779715419, 0.000755317450966686, 0.0005884063430130482, 0.0007902235956862569, 0.002019376028329134, 0.13254058361053467, 0.0016496330499649048, 0.0008463236736133695, 0.0005612227250821888, 0.0006023920723237097, 0.0012936692219227552, 0.0006664618849754333, 0.0006230845465324819, 0.0008681232575327158, 0.0007086782134138048, 0.0005720641347579658, 0.0007254697848111391, 0.0005893938941881061, 0.1023595929145813, 0.0008387994603253901, 0.0007426635711453855, 0.0008857956272549927, 0.0005383978132158518, 0.0007326143677346408, 0.0005831014714203775, 0.0007646511658094823, 0.0007763262838125229, 0.0007874820148572326, 0.0012637272011488676, 0.0006275175255723298, 0.0006024152389727533, 0.0006692688330076635, 0.0006818748661316931, 0.0008289763936772943, 0.0008528383914381266, 0.23293696343898773, 0.0012070139637216926, 0.001185242086648941, 0.009145497344434261, 0.0007423465140163898, 0.0018353008199483156, 0.0006235624314285815, 0.0006242123781703413, 0.0006551928236149251, 0.0006970977410674095, 0.0005491111078299582, 0.0006173086003400385, 0.0005842630635015666, 0.0009897655108943582, 0.000936180236749351, 0.0005915983929298818, 0.0006716374773532152, 0.38474512100219727, 0.0005965408636257052, 0.0010201046243309975, 0.0005594007670879364, 0.0007644464494660497, 0.0022623171098530293, 0.0006490792729891837, 0.0009106602519750595, 0.0005729833501391113, 0.0006062646280042827, 0.0007947765989229083, 0.0006136979791335762, 0.0006692465394735336, 0.0007424070499837399, 0.0007057394250296056, 0.0007003469509072602, 0.0007241146522574127, 0.007635002490133047, 0.0006627078400924802, 0.0008963732398115098, 0.0076734949834644794, 0.0005995304090902209, 0.0007248512702062726, 0.0007482910295948386, 0.0007640775293111801, 0.0006302293040789664, 0.0005775847821496427, 0.0005280637415125966, 0.0005810556467622519, 0.0012266115518286824, 0.0006593745201826096, 0.004822086542844772, 0.0011049354216083884, 0.0011166469193995, 0.0006868725176900625, 0.0024963240139186382, 0.0006896976847201586, 0.001104922266677022, 0.0008457275107502937, 0.0006785916048102081, 0.0009480986627750099, 0.0006715994095429778, 0.0006689490401186049, 0.0006276523927226663, 0.0006160287884995341, 0.000659436103887856, 0.0007767857750877738, 0.0006096247234381735, 0.0006389946793206036, 0.0010355953127145767, 0.0005275527946650982, 0.0006602832581847906, 0.0007787636131979525, 0.0006101917824707925, 0.0005735029117204249, 0.001048439764417708, 0.0005652158870361745, 0.0007183148409239948, 0.0006307163275778294, 0.0008869158336892724, 0.0006869300850667059, 0.0006450406508520246, 0.0005726513918489218, 0.0006432640366256237, 0.0005755895981565118, 0.0007215338991954923, 0.0005779278581030667, 0.0005558878183364868, 0.0006889766664244235, 0.0006767477607354522, 0.0005501290434040129, 0.000562602945137769, 0.0005599790601991117, 0.0007559997029602528, 0.0006378918187692761, 0.0005701741320081055, 0.0005873047630302608, 0.0008622900932095945, 0.0005981027497909963, 0.0012278850190341473, 0.0013153282925486565, 0.0006340224645100534, 0.0006243120296858251, 0.0015186243690550327, 0.001036258996464312, 0.0007258688565343618, 0.0011801476357504725, 0.000821055262349546, 0.0006658707861788571, 0.0006448323256336153, 0.001137148356065154, 0.0005513573996722698, 0.0006321161054074764, 0.0006115360883995891, 0.0005820750375278294, 0.0005838527576997876, 0.0006211689906194806, 0.0005567342741414905, 0.0006751038017682731, 0.0006573682185262442, 0.0006208482664078474, 0.0005413221078924835, 0.0005960370763204992, 0.0005505169392563403, 0.000685416569467634, 0.000583234301302582, 0.000547784089576453, 0.0007124785915948451, 0.0006159826880320907, 0.0007224500295706093, 0.0005640520830638707, 0.0007680784910917282, 0.0015979055315256119, 0.0006893930840305984, 0.0005415176856331527, 0.0005781514919362962, 0.002117700641974807, 0.027014601975679398, 0.0007571644382551312, 0.0006446221377700567, 0.0005602027522400022, 0.0007109020370990038, 0.0007095328182913363, 0.0005635450943373144, 0.0007429965771734715, 0.0006891466910019517, 0.0008920782711356878, 0.0006387940375134349, 0.0009413209627382457, 0.001760438666678965, 0.000714771100319922, 0.0006700780941173434, 0.0006706751883029938, 0.0005726079689338803, 0.0006342424312606454, 0.0007449743570759892, 0.0005748466937802732, 0.0006469180807471275, 0.0006034128018654883, 0.000735301582608372, 0.0007024629157967865, 0.0007024210644885898, 0.0005722561036236584, 0.0007045328966341913, 0.0006668163696303964, 0.0006642269436269999, 0.0005547709297388792, 0.0005391858285292983, 0.0006577345193363726, 0.030640678480267525, 0.0009707867866382003, 0.0006425838219001889, 0.000786263553891331, 0.0005550620844587684, 0.002318577142432332, 0.0010487351100891829, 0.001010501990094781, 0.0005670013488270342, 0.0007773007964715362, 0.0006291797035373747, 0.0005193969700485468, 0.0007556453347206116, 0.0007073894375935197, 0.0006515153218060732, 0.0006562505732290447, 0.0005590346409007907, 0.0006072274409234524, 0.0006585066439583898, 0.0054307254031300545, 0.0005576281109824777, 0.0007996171480044723, 0.0008197507704608142, 0.0007412402192130685, 0.0005837094504386187, 0.0005936161614954472, 0.0010807522339746356, 0.0006726483115926385, 0.0006338571547530591, 0.0008111761417239904, 0.0007859119214117527, 0.0005570140201598406, 0.004835950210690498, 0.0010594745399430394, 0.0005755671299993992, 0.0005810052971355617, 0.0006070174276828766, 0.019367428496479988, 0.0011820490472018719, 0.0006069786613807082, 0.0007450438570231199, 0.0005696488660760224, 0.000992188579402864, 0.0006460354779846966, 0.0006466681370511651, 0.0007210170151665807, 0.0006700605154037476, 0.0005742014036513865, 0.0007621377590112388, 0.0014095259830355644, 0.0006686226697638631, 0.0006434693932533264, 0.0007873387658037245, 0.0006073794793337584, 0.0006394205265678465, 0.000580929103307426, 0.0006608082330785692, 0.0005933554493822157, 0.0006977457669563591, 0.0005770537536591291, 0.0006030394579283893, 0.0005520436097867787, 0.000652274233289063, 0.0008194572292268276, 0.0007187318406067789, 0.0006972342962399125, 0.000768696831073612, 0.0007265401072800159, 0.00072405522223562, 0.0006014061509631574, 0.0006527300574816763, 0.0005600679432973266, 0.0008055960643105209, 0.0011218639556318521, 0.000580892083235085, 0.0020565062295645475, 0.0005751383141614497, 0.0006449091015383601, 0.0005630446830764413, 0.0007449586992152035, 0.0006332017946988344, 0.02450091764330864, 0.0010670938063412905, 0.0005652212421409786, 0.000605257460847497, 0.0022218218073248863, 0.0007643364369869232, 0.0007945183897390962, 0.0006225908873602748, 0.0029210711363703012, 0.0008198613650165498, 0.7342672944068909, 0.001118159620091319, 0.0009522498585283756, 0.0010261397110298276, 0.0009261195664294064, 0.0005752303404733539, 0.4420185089111328, 0.06283924728631973, 0.0009162421338260174, 0.11044374853372574, 0.0006345982546918094, 0.0005612748791463673, 0.0006034027901478112, 0.00089463428594172, 0.0007666598539799452, 0.0006369134644046426, 0.0005366067052818835, 0.0012547277146950364, 0.0009244309039786458, 0.0010079406201839447, 0.0006015566177666187, 0.0005886626313440502, 0.0008599143475294113, 0.0009475201950408518, 0.0006014296668581665, 0.0007177852094173431, 0.000866856484208256, 0.0006677942001260817, 0.0011989898048341274, 0.0006310855969786644, 0.0011470929021015763, 0.0005916779628023505, 0.0005092795472592115, 0.0006594122969545424, 0.0007278994889929891, 0.000645567721221596, 0.0008351082215085626 ]

[ "TULSA, Okla. (Reuters) - An Oklahoma jury on Wednesday found a white Tulsa police officer not guilty of manslaughter in the fatal shooting of an unarmed black man in a confrontation caught on video last September, stoking a national debate over racial bias in law enforcement.", "\n\nBetty Shelby, 43, was acquitted after a week-long trial. ", "She denied race was a factor in the killing and insisted her actions were driven entirely by the behavior of the man she shot, Terence Crutcher, 40, after his car was left blocking a road.", "\n\nPolice videos of the incident were seen globally, and some civil rights advocates have argued that race was a factor. ", "Rights advocates saw the Crutcher case as another in a string of deaths of unarmed black men at the hands of the police in the United States that has spawned periodic protests and the Black Lives Matter movement.", "\n\nLawyers for Shelby have said she believed that Crutcher may have been trying to reach through a partially open window for a weapon in the vehicle when she shot him.", "\n\n“This is a tough pill to swallow. ", "The facts were there. ", "The elements were there. ", "Terence’s hands were in the air. ", "He was not an immediate threat,” Crutcher’s sister, Tiffany, said after the verdict.", "\n\nJurors were visibly emotional and some cried when the verdict was read by the judge some nine hours after they began deliberating.", "\n\n“What I respect is the process. ", "The true reality is that we all knew it was a difficult case,” said Tulsa County District Attorney Steve Kunzweiler who prosecuted the case.", "\n\nShelby’s lawyers did not comment to Reuters after the verdict was read.", "\n\nAbout 50 protesters gathered outside the courthouse in downtown Tulsa after the verdict was read. ", "They chanted “no justice, no peace” and blocked traffic in an intersection during a peaceful demonstration, media reported.", "\n\nThey also gathered outside a hotel where Shelby was believed to be staying and shouted profanities, the Tulsa World reported.", "\n\nThe case hinged on videos in which Crutcher can be seen with his hands in the air shortly before he was shot. ", "Tulsa police have said Crutcher was unarmed and there was no weapon in his vehicle.", "\n\nShelby told the jury that she was taught during training that if a suspect reaches into an area like a car, an officer does not let them pull their arm back because they might be holding a gun, the Tulsa World reported from the court room.", "\n\nShe said the first time she fired her weapon on duty was when she shot Crutcher, who did not speak during their encounter, according to court testimony from officers on the scene.", "\n\nProsecutors have said there was no reason for Shelby to fire on a man who was walking away from her. ", "They blame her for turning a routine traffic matter into a deadly confrontation by acting unreasonably and escalating the situation.", "\n\nThe Oklahoma Medical Examiner’s Office said that Crutcher had 96 nanograms per milliliter of the hallucinogenic drug PCP in his bloodstream at the time of his death.", "\n\nProsecutors have previously said Crutcher’s drug use was not reason enough for Shelby to resort to deadly force, media reports said." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0017595893004909158, 0.0009186612442135811, 0.004138369578868151, 0.0007141454261727631, 0.010318906977772713, 0.0023521059192717075, 0.003801181213930249, 0.0006659741629846394, 0.0006561923655681312, 0.00711279921233654, 0.024957051500678062, 0.0006770876934751868, 0.0005344248493202031, 0.0006470827502198517, 0.0008427671273238957, 0.0006257345085032284, 0.0008467911393381655, 0.0009765736758708954, 0.014635351486504078, 0.0025945070665329695, 0.000919436221010983, 0.0035029591526836157, 0.011485480703413486, 0.0014616908738389611, 0.0017843854147940874, 0.0019365933258086443 ]

[ "Showbiz and Origins of Symmetry remastered • Unreleased demos • B-sides • Early EPs • Live performances • 13-disc box features 9 CDs & 4LPs\n\nMuse will release a massive vinyl/CD box set called Origin of Muse in November. ", "This package will chronicle the band’s earliest days through to their breakthrough album Origin Of Symmetry.", "\n\n\n\nThe box set features nine CDs, four coloured vinyl records and offers 113 tracks in total with 40 of those previously unreleased. ", "Rare audio includes early demos, first EPs, B-sides, live performances and more. ", "This content is spread across the nine CDs. ", "The coloured vinyl records (ocean blue, light blue, orange and yellow) feature the two studio albums remastered.", "\n\nAll the vinyl and CD content is housed in a 48-page ‘casebound’ book which is slots into a rigid board outer slipcase with anti-scratch and matte laminated finish with a spot gloss. ", "The vinyl resides in four special pockets in the book (two at the front and two at the back).", "\n\nThe book contains an extensive and in-depth interview with Matt Bellamy, Dominic Howard and Chris Wolstenholme (conducted by Mark Beaumont) where they talk about the beginnings of the band, and the recording and release of their debut album Showbiz through Origin of Symmetry. ", "The volume also boasts many ‘inserts’ such as setlists, photos, posters and contact sheets which can be pulled out from the book.", "\n\nOrigin of Muse is released on 6 December 2019. ", "Pre-order from the SDE shop via this link or the button below.", "\n\nCD 1 – NEWTON ABBOT DEMOS (15 previously unreleased first demos by the band including an early version of Plug In Baby)\n\nCave Rain Agitated Crazy Days Coma Connect The Kettle Lead Balloonatic Boredom Sober Jimmy Kane Ashamed Plug In Baby Earthquake Good News Overdue\n\nCD 2 – THE MUSE EPs + SHOWBIZ DEMOS (their debut releases on Dangerous Records and previously unreleased demos for their first album Showbiz)\n\nOverdue Cave Coma Escape Muscle Museum Sober Uno Unintended Pink Ego Box (Muscle Museum) #2 Showbiz (Live, Sawmills Studios, 1998) Do We Need This (Live, Fortress Studios, 1999) Sunburn (Live, Fortress Studios, 1999) Overdue (Live, Fortress Studios, 1999) Uno (Alternate version, Rak Studios, 1999)\n\nCD 3 – SHOWBIZ (remastered debut album)\n\nSunburn Muscle Museum * Fillip Falling Down Cave Showbiz Unintended Uno Sober Spiral Static (Bonus track) Escape Overdue Hate This & I’ll Love You\n\nCD 4 – SHOWBIZ B-SIDES\n\nRecess (Unreleased alternate version, Trident Studios, 1999) Jimmy Kane Forced In Agitated Twin Host Do We Need This? ", "Con-Science Minimum Ashamed Yes Please Recess Nishe\n\nCD 5 – SHOWBIZ LIVE (Previously unreleased recording of live shows broadcast on BBC Radio One in 1999/2000)\n\nUno (Live, The Pyramid Centre, Portsmouth, 1999) Cave (Live, The Pyramid Centre, Portsmouth, 1999) Muscle Museum (Live, The Pyramid Centre, Portsmouth, 1999) Falling Down (Live, The Pyramid Centre, Portsmouth, 1999) Fillip (Live, The Pyramid Centre, Portsmouth, 1999) Do We Need This (Live, The Pyramid Centre, Portsmouth, 1999) Agitated (Live, The Astoria, London, 2000) Sunburn (Live, The Astoria, London, 2000) Plug In Baby (Live, The Astoria, London, 2000) Showbiz (Live, The Astoria, London, 2000) Cave (Acoustic live demo, Airfield Studios, 1999) Muscle Museum (Acoustic live demo, Airfield Studios, 1999)\n\nCD 6 – ORIGIN OF SYMMETRY INSTRUMENTAL DEMOS (Previously unreleased. ", "Recorded at the community centre in Teignmouth)\n\nMicro Cuts Feeling Good Space Dementia Hyper Music Citizen Erased Megalomania Screenager Shrinking Universe Shine\n\nCD 7 – ORIGIN OF SYMMETRY (remastered)\n\nNew Born Bliss Space Dementia Hyper Music Plug In Baby Citizen Erased Micro Cuts Screenager Darkshines Feeling Good Futurism (Bonus track) Megalomania\n\nCD 8 – ORIGIN OF SYMMETRY B-SIDES (every B-side recorded for singles released from the album)\n\nNature 1 Execution Commentary Bedroom Acoustics Shrinking Universe Piano Thing Map Of Your Head The Gallery Hyper Chondriac Music Shine Please, Please, Please, Let Me Get What I Want Dead Star In Your World Can’t Take My Eyes Off You\n\nCD 9 – ORIGIN OF SYMMETRY, LIVE AT READING FESTIVAL (full live version of the band’s headline performance of the entire album recorded at Reading Festival 2011 on the 10th anniversary of its release)" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0007006283267401159, 0.0005423438851721585, 0.0005990298232063651, 0.0005626559723168612, 0.000617268611676991, 0.0005602788296528161, 0.0007255911477841437, 0.0006033400422893465, 0.0005934015498496592, 0.0006155798328109086, 0.0005761252832598984, 0.0006367289461195469, 0.0037165777757763863, 0.0008534245425835252, 0.0035118386149406433 ]

[ "'Govt must explore new subsidy delivery mechanism'\n\nThe government should explore new technology-aided options to improve the mechanism of subsidy delivery and to ensure the subsidies reach the intended beneficiaries, according to a TERI report prepared for International Institute for Sustainable Development. ", "Such measures would also curb inefficient and illegal usage of highly subsidised fuel.", "\n\nThe report revisits and reviews the existing mechanism of subsidy delivery through the Public Distribution System (PDS) and examines the possibility of using cash transfers as an option for fossil fuel subsidy reform. ", "As a country highly dependent on imported crude oil, it is crucial for India to ponder on the appropriate delivery mechanism of petroleum subsidies. “", "The growing cost of underrecoveries and the economy-wide ramifications of the ad hoc pricing policy have brought about the urgent need to reform pricing of petroleum products, since each year of delay is adding significantly to the costs borne by the government, the oil sector and the economy in general,\" the report said.", "\n\nRelated Stories\n\nNo Related Stories Found\n\nWidgets Magazine\n\nOn the basis of some approximate calculation carried out in the report, it has been observed if the price of PDS kerosene had been deregulated in 2010-11 and the sum of under-recoveries and subsidies saved on this fuel was used to finance cash transfers to all BPL families, each household could have potentially received between Rs 1,565.6 ($34.34) annually (if 50 per cent of the amount saved was redistributed) and Rs 3,131.14 ($68.70) (if all of the amount saved was redistributed) per annum.", "\n\nFor domestic LPG, calculations have been made based on the amount of subsidies accruing to each expenditure decile on the basis of household level NSSO data for 2009-10. ", "The figures show that the approximate amount that could be saved by capping subsidised cylinders at 8 a year works out to more than Rs 4,000 crore ($897.21 million), which is 17 per cent of the total subsidies and under-recoveries on LPG incurred in FY11.(PETROLEUM PRICING: HOW IT WORKS IN OTHER COUNTRIES)\n\nIn view of the complex existing system of subsidy delivery and the current state of technology and enabling infrastructure, this report has divided its recommendations into short-term and long-term. ", "The short-term recommendations point to need for more pilot studies, cost benefit analysis on cash transfers and capping of subsidised cylinders. ", "The long-term recommendations suggest implementing cash transfer scheme contingent upon results of pilots, designing better BPL surveys, increasing financial inclusion, indexing payments to changes in price level, calibrated decontrol of LPG prices and improving supply chain of PDS kerosene and domestic LPG." ]

{ "pile_set_name": "Pile-CC" }

[ 0.000538103049620986, 0.0031383156310766935, 0.0005695970030501485, 0.0005271331174299121, 0.0006621191278100014, 0.0005798611673526466, 0.0005557455588132143, 0.0005680375033989549, 0.0005428126896731555, 0.0005840286030434072 ]

[ "INTRODUCTION\n============\n\nCells fuse in developmental processes, such as fertilization, muscle and bone formation, and in pathological processes, including viral infections and carcinogenesis \\[[@B1]--[@B5]\\]. ", "Early stages of membrane fusion driven by specialized protein fusogens \\[[@B2],[@B6]--[@B8]\\] culminate in the opening of nanometre-sized fusion pores that connect the volumes of the two cells \\[[@B9]--[@B11]\\]. ", "The mechanisms that drive subsequent expansion of the fusion pore(s) to a micrometre-sized lumen that allows complete coalescence of cytoplasms are poorly understood. ", "In our recent studies, to uncouple later fusion stages from earlier ones, we explored syncytium formation initiated by well-characterized viral envelope proteins: influenza virus HA (haemagglutinin) \\[[@B12]\\] and baculovirus gp64 \\[[@B13]\\]. ", "Both HA- and gp64-mediated fusion processes are triggered by treating HA- or gp64-expressing cells with a low pH medium that mimics conditions in acidified endosomes during viral entry. ", "In these fusion processes, the opening of nascent fusion pores develop much faster than their expansion to sizes detectable by light microscopy (0.1--1 s compared with tens of min for gp64 \\[[@B14]\\]; 1 min compared with 1--2 h for HA \\[[@B12],[@B15]\\]). ", "Relatively fast and thus almost synchronous opening of fusion pores after low pH application facilitates analysis of the slower process of fusion pore expansion. ", "Using these experimental systems we have established that, in contrast with fusion pore opening, pore expansion and thus syncytium formation are blocked by ATP depletion, indicating that pore growth is not spontaneous, but is rather driven by cell machinery \\[[@B12],[@B13]\\]. ", "Several studies have proposed that the expansion of fusion pores in cell fusion is driven by the cytoskeleton \\[[@B16]--[@B18]\\]. ", "However, modifications of the microtubule cytoskeleton have no effect on syncytium formation initiated by viral fusogens \\[[@B12]\\], and depolymerization of actin cytoskeleton promotes rather than inhibits syncytium formation, suggesting that actin structures restrict rather than drive fusion pore expansion \\[[@B12],[@B13],[@B19]\\].", "\n\nAs long as the fusion pore grows within the tight contact zone, the membrane bilayer at the edge of the pore remains strongly curved and, hence, accumulates the elastic energy of bending ([Figure 1](#F1){ref-type=\"fig\"}, inset). ", "In the course of fusion pore expansion, the length of the pore edge grows and thus the elastic energy increases. ", "The degree of membrane bending at the pore rim is similar to that of intracellular membrane structures such as membrane tubules and endocytic vesicles \\[[@B20],[@B21]\\], all characterized by the curvature radii of a few tens of nanometres. ", "Therefore our search for protein machinery that can power syncytium formation has focused on the cytosolic proteins involved in the cell-controlled bending of intracellular membranes. ", "CGPs (curvature-generating proteins), such as dynamin \\[[@B22]--[@B24]\\], ENTH (epsin N-terminal homology) domain proteins (e.g. epsin 1 \\[[@B25],[@B26]\\]) and BAR (Bin/amphiphysin/Rvs) domain proteins such as GRAF1 (GTPase regulator associated with focal adhesion kinase 1) \\[[@B27]--[@B29]\\] and F-BAR proteins including FCHo2 (FCH domain-only protein 2) \\[[@B25],[@B30]\\] are recruited to membranes, often by protein interaction with PtdIns(4,5)*P*~2~, play an essential role in intracellular processes involving membrane remodelling \\[[@B31]\\]. ", "We have previously hypothesized that these proteins may accumulate at the fusion pore rim, lower its energy and thus promote pore expansion and syncytium formation \\[[@B13]\\]. ", "In principle, CGPs can also promote late stages of syncytium formation by driving vesiculation of membrane material in the vicinity of fusion pore(s) suggested as a possible mechanism of pore growth \\[[@B32],[@B33]\\]. ", "However, other studies suggest that fusion pore expansion does not involve vesiculation \\[[@B13],[@B34]\\].", "\n\n{#F1}\n\nIn the present study we explored whether the efficiency of the late stages of cell--cell fusion initiated by influenza HA and baculovirus gp64 depends on the activity of intracellular CGPs. ", "Analysis of possible mechanisms of such dependence and identification of specific CGPs involved in biologically relevant cell fusion processes will be examined in future work. ", "We modified the activity of the BAR, F-BAR and ENTH domains of several proteins by either transfecting the cells to express these protein active domains or by microinjecting the domains into cells. ", "To minimize indirect effects, we used constructs lacking protein domains which are responsible for interactions with other proteins but not required for membrane shaping. ", "We found that the GRAF1 BAR domain, the FCHo2 F-BAR domain and the epsin ENTH domain promote cell fusion. ", "Late stages of fusion were affected by PtdIns(4,5)*P*~2~-targeting reagents and by modifying the functional activity of dynamin either by expressing different dynamin mutants or by blocking dynamin GTPase activity with cell-membrane-permeant inhibitors. ", "The finding that changes in the concentration and/or activity of diverse proteins involved in shaping intracellular membranes and in the membrane concentration of accessible PtdIns(4,5)*P*~2~, an important regulator of membrane shaping, affect late fusion stages substantiates the hypothesis that CGPs drive fusion pore expansion in cell-to-cell fusion.", "\n\nEXPERIMENTAL\n============\n\nReagents and plasmids\n---------------------\n\nDynasore \\[[@B35]\\] was first supplied by Dr T. Kirchhausen (Harvard University, Boston, MA, U.S.A.) and then purchased from Sigma. ", "Another dynamin inhibitor, MiTMAB (tetradecyl trimethylammonium bromide) \\[[@B36]\\], was also purchased from Sigma. ", "Dynole-34-2 and its inactive derivative Dynole-31-2, used as a negative control \\[[@B37]\\], were purchased from Ascent Scientific. ", "Dynasore \\[[@B35]\\], MiTMAB \\[[@B36]\\] and Dynoles \\[[@B37]\\] were applied as described previously. ", "Polyphosphoinositide-binding peptide PBP10, a rhodamine B-tagged ten-residue peptide derived from the PtdIns(4,5)*P*~2~-binding region in segment 2 of gelsolin \\[[@B38]\\] was purchased from EMD Millipore and was used as suggested by the manufacturer. ", "Alexa Fluor® 594-conjugated 10000 Da dextran was purchased from Invitrogen.", "\n\nWe also used pEGFP \\[enhanced GFP (green fluorescent protein)\\] plasmids containing either the rat ENTH domain of epsin (amino acids 1--164) or its mutant L6E, the F-BAR domain of mouse FCHo2 (amino acids 1--272) or the BAR and PH (pleckstrin homology) domains of GRAF1 (amino acids 1--382). ", "To evaluate PtdIns(4,5)*P*~2~ content in the plasma membrane and to compete for PtdIns(4,5)*P*~2~ binding with endogenous PtdIns(4,5)*P*~2~-binding proteins, we expressed PLCδ1PH (PH domain of phospholipase Cδ1)--GFP construct or, in control experiments, its inactive mutant (R40L) construct, which does not bind to the plasma membrane \\[[@B39]\\]. ", "The recombinant ENTH domain of epsin1 was expressed and purified as described previously \\[[@B25]\\]. ", "Wild-type baculovirus AcNPV was purchased from Invitrogen. ", "Baculoviruses encoding several dominant-negative dynamin mutants of human neuronal dynamin-1 (S61D \\[[@B40]\\], I690K \\[[@B41]\\], K44A \\[[@B42]\\] and S45N \\[[@B43],[@B44]\\]) were provided by Dr S. Schmid (Department of Cell Biology, The Scripps Research Institute, La Jolla, CA, U.S.A.). ", "PKH26 was purchased from Sigma.", "\n\nCell culture and preparation\n----------------------------\n\nHAb2 cells (NIH 3T3 cells stably expressing HA) were cultured as exponentially growing subconfluent monolayers on 90 mm plates in DMEM (Dulbecco\\'s modified Eagle\\'s medium) supplemented with Glutamax (Invitrogen) and 10% (v/v) fetal bovine serum. ", "Exponentially growing cells were dissociated with trypsin (Invitrogen). ", "The cells (2.5×10^5^) were plated and cultured overnight on 30 mm plates. ", "In some experiments, human erythrocyte ghosts were labelled with fluorescent lipid PKH26 (Sigma) as described previously \\[[@B45]\\].", "\n\n*Spodoptera frugiperda* (Sf9) cells and Sf9^Op1D^ cells, i.e. stably transfected Sf9 cells expressing a protein fusogen of baculovirus OpMNPV gp64 \\[[@B14],[@B46]\\], provided by Dr Gary Blissard (Cornell University, Ithaca, NY, U.S.A.), were grown and, in some experiments, labelled with [L]{.smallcaps}-α-phosphatidylethanolamine-*N*-(lissamine rhodamine B sulfonyl) (egg) (Rho-PE, Avanti Polar Lipids) as described previously \\[[@B13],[@B47]\\].", "\n\nTransfection\n------------\n\nTransfections were performed using Lipofectamine™ 2000 (Invitrogen) using the protocol suggested by the manufacturer. ", "Fusion was triggered 24 h after transfection.", "\n\nInfection with baculovirus constructs\n-------------------------------------\n\nTo drive high levels of mutant dynamin expression in Sf9 cells, we infected the cells with different recombinant baculoviruses or with wild-type baculovirus at an MOI (multiplicity of infection) of 1-10 plaque-forming units per cell. ", "We have adjusted the MOI used for each recombinant baculovirus and for wild-type baculovirus to achieve the same level of expression of baculovirus gp64 at the cell surface, as verified 2 days post-infection by Western blotting of cell-surface gp64 isolated using surface biotinylation and streptavidin beads \\[[@B48]\\] and by a cELISA (cell surface ELISA) using antibody AcV1 (Santa Cruz Biotechnology) \\[[@B48]\\]. ", "The levels of expression of exogenous dynamin were similar between different constructs and much higher than the level of endogenous expression of dynamin in Sf9 cells, as verified using Western blotting with the anti-dynamin antibody Hudy 1 (Upstate Biotechnology). ", "We have also confirmed that the cells infected with all of the recombinant baculoviruses used were expressing similar amounts of different dynamin mutants, which were much higher than the amounts of endogenous dynamin observed for non-infected cells.", "\n\nMicroinjection\n--------------\n\nThe microinjection experiments were performed on a Zeiss Axiovert135 with a FemtoJet and InjectMan NI2 (Eppendorf). ", "The microinjected solution was composed of 1 vol. ", "of Alexa Fluor® 594-tagged 10000 Da dextran (5 mg/ml in double-distilled water\\] (Invitrogen), 1 vol. ", "of the protein of interest, 2 vol. ", "of double-distilled water and 1 vol. ", "of microinjection buffer (250 mM Hepes, pH 7.2, 500 mM KCl and 25mM Na~2~HPO~4~). ", "In each microinjection experiment, we injected 20 out of 30--40 cells per field of view with either fluorescent dextran alone or fluorescent dextran mixed with the protein of interest (the average fraction of injected cells per field was 50--70%) and five fields per condition (total of 100 injected cells).", "\n\nApplication of dynamin inhibitors and PtdIns(4,5)*P*~2~-targeting reagent\n-------------------------------------------------------------------------\n\nThe GTPase activity of dynamin in HAb2 and Sf9^Op1D^ cells was inhibited by treating the cells with dynasore, Dynole-34-2 and MiTMAB. ", "The reagents were applied either before (for 30 min) or immediately after low pH application (for 20 min). ", "Dynole-34-2 and its inactive analogue Dynole-31-2 were both applied to Sf9^Op1D^ cells for 20 min immediately after a 1 min application of pH 4.9 medium. ", "PBP10, butan-1-ol and *t*-butanol were both applied to Sf9^Op1D^ cells for 15 min immediately after a 1 min application of pH 4.9 medium.", "\n\nFusion assays\n-------------\n\nIn all of the results presented, the syncytium index for each condition was determined as the number of nuclei in a multinucleated cell divided by the total number of nuclei in the field \\[[@B12]\\]. ", "As verified in Supplementary Figure S1 at (<http://www.BiochemJ.org/bj/440/bj4400185add.htm>), an inhibitor (Dynole 34-2) that lowered the percentage of nuclei in multinucleated Sf9^Op1D^ cells also shifted the distribution of the number of nuclei per cell towards cells with lower number of nuclei.", "\n\nFusion between HAb2 cells was assayed as described previously \\[[@B12]\\]. ", "In brief, HAb2 cells were pre-treated with trypsin (5 μg/ml, 5 min and 37°C) to cleave HA into the fusion-competent conformation. ", "Then the cells were washed once with PBS with Ca^2+^/Mg^2+^ and once with pH 4.9 medium, and then exposed for 5 min to pH 4.9 medium at 37°C, in order to trigger the fusogenic conformational change in HA. ", "Cells were washed two more times with PBS and incubated at 37°C for 2 h in DMEM supplemented with serum. ", "Cells were scored as syncytia if they had multiple nuclei in a single cell volume or if the connections between fusing cells appeared to be large enough to allow the nucleus passage. ", "In some experiments, in order to evaluate the efficiency of early fusion stages, the extents of lipid mixing between HAb2 cells and PKH26-labelled erythrocytes were measured as the ratio of dye redistributed from bound erythrocytes to the total number of bound erythrocytes \\[[@B45]\\].", "\n\nFusion between Sf9^Op1D^ cells and between baculovirus-infected Sf9 cells was assayed as described previously \\[[@B13]\\]. ", "In brief, fusogenic activity of gp64 was triggered at 22°C by a 5 min application of Grace medium with pH adjusted to 4.9. ", "At 30 min after re-neutralization, the percentage of Sf9 cells or Sf9^Op1D^ cells in syncytia (the ratio of nuclei within syncytia to the total number of cell nuclei in the same field) was scored using light microscopy \\[[@B47]\\]. ", "Lipid mixing between either Sf9 cells or Sf9^Op1D^ cells was quantified as Rho-PE transfer from labelled to unlabelled cells \\[[@B13]\\].", "\n\nIn the microinjection experiments, 15--30 min after the microinjection we determined the number of surviving Alexa Fluor® 594-labelled mononucleated cells with nuclei labelled with Hoechst. ", "The fusion was then induced by a 5 min application of pH 4.9 medium at 37°C. ", "At 2 h after inducing fusion, we scored the efficiency of syncytium formation (P~fc~, percentage of fused injected cells) by determining the percentage of Alexa Fluor® 594-labelled mononucleated cells that remained mononucleated (and thus unfused cells, P~ufc~). ", "Since the trauma of injection may influence the fusion rate of injected cells compared with non-injected cells, cell fusion efficiency for the cells injected with protein of interest, which was determined using the expression P~fc~=100−P~ufc~, was compared with that for the cells injected with dextran only.", "\n\nIn the experiments aimed at exploring the effects of the expression of the PLCδ1PH--GFP construct, we focused on transfected Sf9^Op1D^ cells. ", "We quantified the efficiency of syncytium formation by dividing the number of nuclei in GFP-labelled (green) multinucleated cells in the field of view by the total number of nuclei in GFP-labelled cells (both mono- and multi-nucleated cells). ", "The efficiency was then normalized to that observed in a parallel experiment on the cells transfected with the inactive mutant R40L that does not bind PtdIns(4,5)*P*~2~ in the plasma membrane \\[[@B39]\\].", "\n\nEach experiment of the present study was repeated at least three times and all functional dependencies reported were observed in each independent experiment. ", "Statistical analysis was carried out using SigmaPlot for Windows, version 11.0.", "\n\nRESULTS\n=======\n\nThe F-BAR domain of FCHo2 and the BAR domain of GRAF1 promote syncytium formation\n---------------------------------------------------------------------------------\n\nTo explore whether CGP domains of FCHo2 and GRAF1 affect HA-initiated syncytium formation, we transfected HAb2 cells with constructs containing either the F-BAR domain of FCHo2 \\[[@B30],[@B49]\\] or the BAR domain and PH domain of GRAF1 \\[[@B27],[@B28]\\]. ", "Early stages of HA-mediated fusion were unaffected by the transfection, as shown by the same efficiency of lipid mixing between PKH26-labelled RBCs and either control or transfected HAb2 cells ([Figure 1](#F1){ref-type=\"fig\"}A). ", "However, expression of these CGP domains increased the efficiency of HA-initiated syncytium formation ([Figure 1](#F1){ref-type=\"fig\"}B), indicating that CGPs promote the late stages of cell-to-cell fusion.", "\n\nThe ENTH domain of epsin promotes syncytium formation\n-----------------------------------------------------\n\nThe ENTH domain of epsin is also known to induce membrane curvature. ", "We used two experimental approaches, transfection and microinjection, to test the effects of this domain on HA-initiated syncytium formation. ", "In two out of three experiments, we found the extent of HA-mediated syncytium formation to be somewhat higher for HAb2 cells transfected to express the ENTH domain of epsin1 linked to EGFP than for the mock-transfected cells ([Figure 2](#F2){ref-type=\"fig\"}A). ", "However, in one of the experiments we observed no difference in the syncytium formation for transfected and mock-transfected cells. ", "Expression of an ENTH domain of the epsin1 mutant L6E, which is still able to bind to membranes but is defective in membrane bending \\[[@B25]\\], did not affect syncytium formation.", "\n\n{#F2}\n\nIn another approach, we microinjected 19 μM of the recombinant ENTH domain of epsin1 and observed a statistically significant promotion of syncytium formation compared with mock-injected cells (46±7.8% compared with 30.3±7.5%, values are means±S.E.M., *n*=6, *P*\\<0.001 in a paired Student\\'s *t* test). ", "Although some promotion of cell fusion was also observed in the three experiments where we injected 9.5 or 38 μM ENTH domain, the differences between normalized extents of syncytium formation were not statistically significant ([Figure 2](#F2){ref-type=\"fig\"}B). ", "A somewhat weaker promotion of cell fusion at 38 compared with 19 μM of the ENTH domain may reflect the toxicity of the injected protein. ", "Note that, in contrast with early fusion stages, syncytium formation strongly depends on metabolic activity of the fusing cells \\[[@B12],[@B13]\\].", "\n\nDynamin and the late stages of fusion events\n--------------------------------------------\n\nThe GTPase dynamin, a key player in budding and scission of intracellular vesicles, is one of the most abundant cytosolic CGPs \\[[@B22],[@B50]\\]. ", "We explored a possible involvement of this protein in the syncytium formation mechanism using three inhibitors of dynamin GTPase activity and by expression of dynamin mutants. ", "Dynasore, a cell-membrane-permeant inhibitor of dynamin GTPase activity \\[[@B35]\\], inhibited both gp64-initiated syncytium formation by Sf9^Op1D^ cells and HA-initiated syncytium formation by HAb2 cells ([Figure 3](#F3){ref-type=\"fig\"}). [", "Figure 4](#F4){ref-type=\"fig\"} shows the inhibition of syncytium formation by Sf9^Op1D^ cells when the low pH application was followed by the application of another cell-permeant dynamin inhibitor Dynole-34-2 that targets an allosteric site at the GTPase domain. ", "Dynole-34-2 lowered both the percentage of nuclei in multinucleate cells ([Figure 4](#F4){ref-type=\"fig\"}) and the sizes of the syncytia (assayed as the distribution of the numbers of nuclei per cell; Supplementary Figure S2 at <http://www.BiochemJ.org/bj/440/bj4400185add.htm>). ", "No inhibition was observed in the presence of Dynole-31-2, an inactive analogue of Dynole-34-2 \\[[@B37]\\].", "\n\n{#F3}\n\n{#F4}\n\nAnother cell-membrane-permeant inhibitor of dynamin GTPase, MitMAB, that acts by targeting dynamin interactions with anionic phospholipids \\[[@B36]\\], also significantly inhibited gp64- or HA-initiated syncytium formation ([Figure 5](#F5){ref-type=\"fig\"}). ", "MiTMAB is a reversible dynamin inhibitor \\[[@B36]\\], and washing Sf9^Op1D^ cells to remove MiTMAB restored the ability of cells to form syncytia ([Figure 5](#F5){ref-type=\"fig\"}A). ", "Importantly, Dynole-34-2 ([Figure 4](#F4){ref-type=\"fig\"}), MitMAB ([Figure 5](#F5){ref-type=\"fig\"}) and dynasore (results not shown) inhibited syncytium formation when added after the end of the low pH pulse. ", "Taking into account that by this time early fusion stages that yield nascent fusion pores had taken place \\[[@B14],[@B15],[@B45]\\], these findings suggested that the inhibition of the GTPase activity of dynamin blocked the late stages of syncytium formation. ", "Indeed, we found that neither Dynole-34-2 ([Figure 4](#F4){ref-type=\"fig\"}) nor dynasore (results not shown) inhibited lipid mixing in a gp64-mediated fusion.", "\n\n{#F5}\n\nTo explore further the involvement of dynamin in syncytium formation, we infected Sf9 cells with baculoviruses encoding different dominant-negative human dynamin-1 mutants. ", "In contrast with Sf^Op1D^ cells that constitutively express the protein fusogen gp64, Sf9 cells expressed gp64 as a result of baculovirus infection. ", "We adjusted the concentrations of all of the baculovirus constructs used to achieve similar levels of gp64 expression (detected by a cELISA, Supplementary Figure S2; and by Western blotting, results not shown) at the time of fusion experiments. ", "Expression of the dynamin mutants S61D, with reduced GTPase activity \\[[@B40]\\], and I690K, with impaired self-assembly \\[[@B41]\\], lowered the extents of syncytium formation when compared with those observed for the Sf9 cells infected with wild-type baculovirus or a baculovirus construct expressing wild-type dynamin ([Figure 6](#F6){ref-type=\"fig\"}). ", "Intriguingly, expression of K44A and S45N dynamin mutants defective in GTP binding \\[[@B42]--[@B44]\\] promoted syncytium formation. ", "The effects of diverse dynamin-targeting reagents (GTPase inhibitors and dominant-negative mutants) on cell fusion reveal the importance of dynamin and dynamin partners in syncytium formation.", "\n\n{#F6}\n\nPtdIns(4,5)*P*~2~ regulation of syncytium formation\n---------------------------------------------------\n\nMany CGPs, including the BAR, F-BAR and ENTH domain proteins and dynamin are recruited to the plasma membrane at least partially by binding to PtdIns(4,5)*P*~2~ in the inner membrane leaflet. ", "Lowering the concentrations of PtdIns(4,5)*P*~2~ available for interactions with its endogenous effectors by three different PtdIns(4,5)*P*~2~-targeting reagents inhibited syncytium formation. ", "Butan-1-ol reduces stimulation of PtdIns 5-kinase, which generates PtdIns(4,5)*P*~2~ and thus lowers PtdIns(4,5)*P*~2~ content in the plasma membrane \\[[@B51]\\]. ", "PtdIns(4,5)*P*~2~ depletion by applying butan-1-ol inhibited syncytium formation ([Figure 7](#F7){ref-type=\"fig\"}A). ", "In control experiments, *t*-butanol, which does not inhibit PtdIns 5-kinase, had no effect on syncytium formation. ", "Note that, since butan-1-ol depletes PtdIns(4,5)*P*~2~ by lowering the concentration of phosphatidic acid, an important signalling lipid, effects independent of PtdIns(4,5)*P*~2~ cannot be excluded.", "\n\n{#F7}\n\nIn another experimental approach, we transfected Sf9^Op1D^ cells to express the PLCδ1PH--GFP fusion protein. ", "This protein is routinely used to visualize PtdIns(4,5)*P*~2~ but affects PtdIns(4,5)*P*~2~-dependent processes at high levels of expression \\[[@B52]\\]. ", "As seen in [Figure 7](#F7){ref-type=\"fig\"}(B), PLCδ1PH--GFP expression inhibited syncytium formation by Sf9^Op1D^ cells, as compared with that observed for the cells transfected with the non-lipid-binding PLCδ1PH--GFP mutant R40L \\[[@B39]\\].", "\n\nIn our third approach, we used PBP10, a cell-permeant rhodamine-tagged decapeptide from the PtdIns(4,5)*P*~2~-binding region of gelsolin. ", "This peptide, known to potently bind PtdIns(4,5)*P*~2~ and affect PtdIns(4,5)*P*~2~-dependent processes \\[[@B38]\\], inhibited syncytium formation ([Figure 7](#F7){ref-type=\"fig\"}C).", "\n\nTo summarize, lowering the concentration of plasma membrane PtdIns(4,5)*P*~2~ accessible for interactions with CGPs \\[and other PtdIns(4,5)*P*~2~-binding proteins\\] inhibits syncytium formation. ", "Since both PBP10 and butan-1-ol were applied after a low pH pulse, our findings indicate that PtdIns(4,5)*P*~2~ content and accessibility are important for late fusion stages.", "\n\nDISCUSSION\n==========\n\nIn the present study, we have explored the late stages of cell--cell fusion in which the nascent fusion pore(s) generated by viral fusogens baculovirus gp64 and influenza HA expand(s) to form syncytia. ", "Fusion pores that develop with a tight contact between cell membranes have a strongly bent rim accumulating the elastic energy of membrane bending. ", "Thus the pore expansion is an energy-consuming process. ", "Earlier studies indicated that the enlargement of micron-scale pores in syncytium formation does not proceed spontaneously but rather involves the cell machinery \\[[@B12],[@B13],[@B53]\\]. ", "Neither release of membrane lateral tension nor disruption of the force generating intracellular systems such as the actin cytoskeleton and microtubular structures inhibits fusion pore expansion in syncytium formation \\[[@B12],[@B13],[@B19],[@B54]\\]. ", "We hypothesized that large fusion pores grow because the rim of the pore accumulates proteins that relax its bending energy. ", "The shape of a fusion pore developing in a cell--cell contact zone with an inter-membrane distance of \\~20 nm is similar to a half cylinder with a \\~20 nm diameter \\[[@B13]\\]. ", "Since the comparable curvature radii are characteristic for highly curved membrane compartments such as endocytic vesicles, we proposed that the late stages of fusion pore growth involve CGPs that drive intracellular membrane shaping. ", "To test this hypothesis, in the present study we explored whether syncytium formation can be promoted by raising the intracellular concentrations of membrane-binding and -bending domains from three CGPs (GRAF1, FCHo2 and epsin) in cells by either overexpressing these proteins or by microinjecting them. ", "Indeed, these diverse CGPs (with BAR, F-BAR and ENTH domains) promoted the late stages of HA-initiated cell-to-cell fusion. ", "Note that, although this finding is consistent with our hypothesis as a proof of principle, the specific different CGPs that may have the most potent effect in fusion between HAb2 cells or other cells remain to be identified. ", "A recent study indicates that GRAF1 expression in C2C12 cells promotes both myogenic differentiation and fusion between differentiated myoblasts \\[[@B55]\\]. ", "GRAF1-dependent promotion of cell fusion is suggested to involve BAR domain-mediated membrane sculpting. ", "Our findings in a much simpler experimental system are consistent with this mechanism and suggest that it acts downstream of early fusion stages at a stage of fusion pore expansion.", "\n\nThe conclusion that late stages of syncytium formation involve CGPs was strengthened further by experiments with reagents targeting the function of one of the most abundant CGPs: dynamin \\[[@B22],[@B23]\\]. ", "Both free dynamin tetramers and membrane associated dimers, the building blocks of larger oligomers, are rigid elongated structures with a curved shape. ", "Curvature generated by dynamin can result in different membrane shapes. ", "Long helical oligomers constrain the membrane into tubular shapes. ", "Oligomers that are too short to form helices can generate a wider variety of shapes which include tubular and spherical shapes. ", "Blocking of the GTPase activity of dynamin by dynasore \\[[@B35]\\], MiTMAB \\[[@B36]\\] and Dynole-34-2 \\[[@B37]\\] inhibited syncytium formation initiated by either HA or gp64. ", "Dynamin inhibitors did not inhibit lipid mixing and blocked syncytium formation even when applied after a low pH pulse application, that is, at the time when both HA \\[[@B56]\\] and, especially, gp64 \\[[@B14]\\] have already formed initial fusion pores. ", "Thus dynamin plays its role downstream of the opening of fusion pores. ", "Our findings suggest that the recently reported inhibition of HIV env-mediated cell--cell fusion by dynasore \\[[@B57]\\] also reflects dynamin-dependence of late, rather than early, fusion stages.", "\n\nDominant-negative dynamin mutants also affected cell-to-cell fusion. ", "Similar to the experiments using inhibitors, syncytium formation was inhibited by stabilization of the GTP-bound form of dynamin by overexpressing a GTPase-defective S61D mutant \\[[@B40]\\]. ", "Syncytium formation was also inhibited by the assembly-defective I690K mutant of dynamin, which is impaired in membrane surface affinity \\[[@B41]\\]. ", "In contrast, K44A and S45N, two mutants of dynamin defective in GTP binding \\[[@B42]--[@B44]\\], promoted syncytium formation. ", "This promotion may indicate that GTP-free dynamins are more likely than GTP--dynamins to form short arc-like oligomers that facilitate fusion pore expansion. ", "However, this hypothesis remains to be tested. ", "Importantly, since impaired GTP binding for these mutants inhibits GTP hydrolysis, the promotion of syncytium formation argues against the hypothesis that fusion pore expansion is somehow driven by the energy derived from the GTP hydrolysis by dynamin.", "\n\nThe finding that diverse dynamin-targeting reagents have notable effects on the efficiency of syncytium formation suggests the involvement of dynamin in cell--cell fusion. ", "However, although the ability of dynamin to shape membranes is well documented, we cannot at the present time offer a specific mechanism by which curvature generation by dynamin promotes fusion pore expansion. ", "In one scenario, dynamin oligomers, too short to form complete circles or helices and thus shaped as open arcs bind to the curved membrane of a nascent fusion pore rim. ", "Owing to their ability to generate membrane curvature similar to that of the pore edge, binding of these arc-like oligomers drives expansion of the pore edge by bending additional portions of the initially flat membrane of the intracellular contact into the bent shape of the pore rim. ", "Stabilization of the GTP-bound form of dynamin may promote the formation of the long helical structures and therefore the membrane tubules. ", "As mentioned above, short oligomers can be accommodated both in tubules and in the fusion pore rim, and thus competition between the tubules and pore rim for the short-arc dynamins is expected to deplete the pool of short oligomers in the rim and inhibit pore expansion. ", "Further research will either further develop this mechanism to explain the specific effects of different dynamin mutants or bring about alternative mechanisms that may couple membrane shaping by dynamin with fusion pore expansion at late stages of cell-to-cell fusion. ", "Importantly, since dynamin both directly and via interactions with other proteins regulates many different processes in cell physiology, the role of dynamin in syncytium formation might be complex and indirect.", "\n\nThe activity of many intracellular CGPs is regulated by polyphosphoinositides. ", "The present study is the first demonstration that PtdIns(4,5)*P*~2~ content controls syncytium formation. ", "Inhibition of the late stages of cell fusion by lowering the concentration of accessible PtdIns(4,5)*P*~2~ in the plasma membrane is consistent with the hypothesis that CGPs drive the expansion of fusion pores. ", "However, PtdIns(4,5)*P*~2~ can also affect late fusion stages by regulating PtdIns(4,5)*P*~2~-binding proteins other than CGPs.", "\n\nTo conclude, the late stages of cell-to-cell fusion initiated by well-characterized viral fusogens depend on the functional activity of intracellular CGPs, including dynamin and representatives of the BAR, F-BAR and ENTH protein families. ", "However, a number of important questions remain open. ", "To start with, the mechanism underlying this dependence is yet to be clarified. ", "CGPs can directly facilitate fusion pore expansion by accumulating at the pore edge and lowering its energy. ", "In principle, CGPs can also promote vesiculation of the membrane junction at the edge of the fusion pores \\[[@B33]\\]. ", "However, at least in the case of gp64-initiated fusion of Sf9 cells, fusion pores appear to grow by the displacement of membrane material towards the periphery of the contact zone rather than by vesiculation \\[[@B13]\\]. ", "The analysis of the role of CGPs in syncytium formation also has to be extended to biologically important examples of cell fusion such as fusion between myoblasts and between macrophages, and then to the identification of specific CGPs involved in these processes. ", "Better understanding of the mechanism and cell machinery responsible for driving fusion pore expansion in cell-to-cell fusion will bring about new ways of controlling fusion in development and in pathological conditions. ", "The dependence of fusion pore expansion on cell machinery can also be of importance for understanding why transient nanotubular connections between plasma membranes of some cells \\[[@B58],[@B59]\\] do not expand to yield multinucleated cells.", "\n\nThe present study emphasizes an interesting overlap between proteins controlling the late stages of cell-to-cell fusion and proteins that drive the oppositely directed process of membrane remodelling, the fission of one cell membrane into two. ", "Dynamin and curvature-generating domains of GRAF1, FCHo2 and epsin that we found to influence syncytium formation are essential components of different endocytic pathways \\[[@B23]--[@B25],[@B27],[@B28],[@B30]\\] that culminate in membrane fission. ", "Proteins of the dynamin family have been also implicated in mitochondrial fusion \\[[@B60],[@B61]\\] and fusion of ER membranes \\[[@B62],[@B63]\\]. ", "Dynamin is involved in an as yet unclear mechanism in HIV fusion with the endosomal membrane, as suggested by a fusion inhibition using the dynamin GTPase inhibitor dynasore \\[[@B64]\\]. ", "Furthermore, dynasore promotes the release of luminal and membrane biosynthetic cargoes from individual post-Golgi vesicles, suggesting that dynamin redirects fusion pore evolution from expansion to premature closure in 'kiss-and-run' exocytosis \\[[@B65]\\]. ", "A recent study confirms that dynamin regulates the rapidity of fusion pore expansion in exocytosis and suggests that dynamin assembly restricts fusion pore expansion until GTP-hydrolysis-stimulated disassembly \\[[@B66]\\]. ", "Another component of the endocytic machinery, the BAR domain protein amphiphysin, has also been reported to restrict dilation of fusion pores \\[[@B67]\\]. ", "Note that, in terms of membrane curvature and positioning of proteins, the closing of the exocytotic fusion pore by CGPs (dynamin \\[[@B65]\\] and amphiphysin \\[[@B67]\\]) located outside of the pore lumen is topologically similar to fusion pore expansion in syncytium formation by the proteins located inside the lumen of the pore. ", "Further elucidation of the overlap between the protein players involved in the processes that unite and divide biological membranes is important for finding shared mechanistic principles underlying fusion and fission \\[[@B68]\\]. ", "Although our results from the present study demonstrate that different CGPs can control the expansion of fusion pores, we still do not know which of the diverse intracellular CGPs control these stages in biologically important cell-to-cell fusion processes. ", "Our finding that increases in concentration of either of the several CGP domains promote transition from early fusion intermediates to syncytium formation suggests a redundancy of their membrane-bending function.", "\n\nOnline data\n===========\n\n###### Supplementary data\n\nAUTHOR CONTRIBUTION\n===================\n\nJean-Philippe Richard, Evgenia Leikina, Michael Kozlov and Leonid Chernomordik conceived and planned the experiments. ", "Jean-Philippe Richard, Evgenia Leikina and Margarita Popova carried out the experiments and analysed the data. ", "Ralf Langen, Tamas Balla, Harvey McMahon and William Mike Henne advised on specific aspects of the experimental strategies and provided constructs and proteins. ", "Leonid Chernomordik, Jean-Philippe Richard and Michael Kozlov wrote the paper.", "\n\nACKNOWLEDGEMENTS\n================\n\nWe are indebted to Dr S. Schmid (The Scripps Research Institute) and Dr T. Kirchhausen for dynamin constructs and dynasore respectively. ", "We thank Dr K. Melikov and Dr J. Zimmerberg for very helpful discussions prior to submission.", "\n\nFUNDING\n=======\n\nThe research was supported by the Intramural Research Program of the Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institutes of Health and an National Institute of Allergy and Infectious Diseases, National Institutes of Health Intramural Biodefense Research grant (both to L.V.C.) and by the National Institutes of Health \\[grant number 2 R01 GM063915 (to R.L.)\\].", "\n\n[^1]: ^1^These authors contributed equally to this work\n\n[^2]: ^2^Present address: Hugo W. Moser Research Institute at Kennedy Krieger, Department of Neurology, Johns Hopkins School of Medicine, Baltimore, MD 21205, U.S.A.\n\n[^3]: ^3^Present address: Weill Institute for Cell and Molecular Biology, Cornell University, Ithaca, NY 14853, U.S.A.\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.0007969342404976487, 0.0006749918684363365, 0.013240483589470387, 0.0006307034054771066, 0.0007014694856479764, 0.0006765662110410631, 0.000617437472101301, 0.000596136727835983, 0.0008318948093801737, 0.0012542061740532517, 0.0006149880937300622, 0.0006051677046343684, 0.0006742271361872554, 0.0005758348852396011, 0.0008153435192070901, 0.000678741023875773, 0.0006713065668009222, 0.0006639083148911595, 0.0019058462930843234, 0.0006667629932053387, 0.0017770706908777356, 0.0009078147704713047, 0.0007788894581608474, 0.0005866765277460217, 0.0012605745578184724, 0.0006116116419434547, 0.000648584624286741, 0.0006033295067027211, 0.0006671921000815928, 0.0005224588676355779, 0.0007395207649096847, 0.0005769377457909286, 0.0008005881099961698, 0.0009426182368770242, 0.0006088405498303473, 0.0007817019941285253, 0.0009204487432725728, 0.0006652894080616534, 0.0008124382584355772, 0.0007445240044035017, 0.0010956836631521583, 0.0006904348847456276, 0.0007551630842499435, 0.0010364573681727052, 0.001041710958816111, 0.0007635498186573386, 0.0006828157929703593, 0.0007322751334868371, 0.0009146977099590003, 0.0005802725208923221, 0.0009974065469577909, 0.0009853611700236797, 0.0006875175749883056, 0.0007079306524246931, 0.000970575085375458, 0.000596306927036494, 0.0007979506044648588, 0.0007241322309710085, 0.000709695101249963, 0.0006432085065171123, 0.0008293726132251322, 0.0006419677520170808, 0.001327440608292818, 0.000653548282571137, 0.0005605454207397997, 0.0007813128759153187, 0.0006228561978787184, 0.0006837776163592935, 0.000751798739656806, 0.0005985013558529317, 0.0005946354940533638, 0.0008769014966674149, 0.0007652408676221967, 0.0008190437802113593, 0.0006346264271996915, 0.0006587281823158264, 0.000615359575022012, 0.0008662681793794036, 0.0005643739132210612, 0.0006458320422098041, 0.0007496475009247661, 0.0006607043324038386, 0.0005870742024853826, 0.0006292408215813339, 0.0005903915734961629, 0.0006303056725300848, 0.0005903035053052008, 0.0007124579278752208, 0.0005437018116936088, 0.0005729412660002708, 0.0011939717223867774, 0.000615060213021934, 0.000598269805777818, 0.0008100097766146064, 0.0006272182799875736, 0.0006202689255587757, 0.0006209257408045232, 0.0007680707494728267, 0.0019058462930843234, 0.0009002742008306086, 0.0009078147704713047, 0.0008004385745152831, 0.0005978160770609975, 0.0007985423435457051, 0.0005937155219726264, 0.0008098389371298254, 0.0005502658896148205, 0.0005859438679181039, 0.0006721657700836658, 0.0008072997443377972, 0.0006302500842139125, 0.0007283345330506563, 0.000648241606540978, 0.0005981380818411708, 0.0006838362896814942, 0.0019058462930843234, 0.0010759029537439346, 0.0007290130015462637, 0.0005983354058116674, 0.0057748667895793915, 0.0006436104304157197, 0.0006989010726101696, 0.000573194760363549, 0.0010975803015753627, 0.003664394374936819, 0.0005940081318840384, 0.0006662935484200716, 0.0006249755388125777, 0.0019058462930843234, 0.0010914067970588803, 0.0006091458490118384, 0.0006989010726101696, 0.0007943230448290706, 0.0006989010726101696, 0.0008273787098005414, 0.0011134289670735598, 0.0005764752277173102, 0.0007443240028806031, 0.0009216816979460418, 0.0006460687727667391, 0.0019058462930843234, 0.0007161077810451388, 0.0008111177594400942, 0.0007288397173397243, 0.0009257839410565794, 0.0010665551526471972, 0.0006711786845698953, 0.0007425304502248764, 0.0008612177916802466, 0.0006631399737671018, 0.0013666473096236587, 0.0019058462930843234, 0.0006722913240082562, 0.0009883289458230138, 0.0006709410808980465, 0.0006382266292348504, 0.0006989010726101696, 0.0010246343445032835, 0.0006384462467394769, 0.0008358342456631362, 0.0006341112311929464, 0.0008192124660126865, 0.001112522091716528, 0.0007614904898218811, 0.0006173418369144201, 0.0006293280748650432, 0.0006936966674402356, 0.0006764672580175102, 0.0006461866432800889, 0.0007102973177097738, 0.000713459390681237, 0.0006845368770882487, 0.000612776493653655, 0.0005829058936797082, 0.0006614931626245379, 0.000590852927416563, 0.000812764628790319, 0.0006492658867500722, 0.0005736352177336812, 0.0006098537123762071, 0.0007285209139809012, 0.0005696382140740752, 0.0007384996279142797, 0.0007056529866531491, 0.0012043047463521361, 0.0007177766528911889, 0.0012100557796657085, 0.0006296763313002884, 0.0006964781787246466, 0.0011584096355363727, 0.0008747947867959738, 0.0008676621364429593, 0.0007611140026710927, 0.000629718357231468, 0.0006390784401446581, 0.0006554767023772001, 0.0005990454810671508, 0.000863191147800535, 0.0006607598043046892, 0.0006530287209898233, 0.0007267315522767603, 0.0005699461908079684, 0.0005915045039728284, 0.0011256267316639423, 0.000631650909781456, 0.0006499206065200269, 0.0007389768725261092, 0.0006146992091089487, 0.0005387399578467011, 0.0005451866891235113, 0.0006645806133747101, 0.0007695110398344696, 0.0006131193949840963, 0.0005936405505053699, 0.000553533376660198, 0.0006108559900894761, 0.0005571616347879171, 0.0006457868148572743, 0.000690311542712152, 0.0006671625305898488, 0.0008245641947723925, 0.0006875480758026242, 0.000860232743434608, 0.0012144193751737475, 0.0005923892022110522, 0.0005873534828424454, 0.0005809537833556533, 0.0007176952203735709, 0.0006123651983216405, 0.0006369152688421309, 0.0006300669047050178, 0.0006220870418474078, 0.0005333091830834746, 0.0006046039634384215, 0.0006202405202202499 ]

[ "Well, they are not the hardiest fish, I guess they are kinda difficult, but in the end its worth the work. ", "They are so cool! ", "Just DON'T overstock! ", "They are really aggressive! ", "Also, If you decided against the DPs, you could do a pair of blue rams!", "\n\nI was thinking on just having a pair in the tank by themselves. ", "How do determine the gender of the puffer? ", "Any good websites that have good information on dwarf puffer care? ", "I do not want to set up the tank until I am fully read up on their care and such, but how aged does the tank need to be? ", "I will problably get the puffer pair about 3-4 months from now maybe longer so should I set it up now and let the tank age maybe with a few guppies or something?", "\n\nYou could set up a pretty sizable colony of dwarf puffers in a 20L, maybe five or six of them. ", "The substrate doesn't matter much although sand is better (for easier hunting). ", "Lots of plants and driftwood and/or rocks to break up the lines of sight and create territories. ", "You could add a bristlenose pleco or two to take care of algae, so long as you had some driftwood in the tank. ", "They can be picky eaters so be prepared to feed them live foods (although many will eat frozen foods like bloodworms). ", "A source of live blackworms is good, and it'd be a good idea to have a breeding colony of pond snails in another tank as these are pretty much the staple diet of dwarf puffers." ]

{ "pile_set_name": "Pile-CC" }

[ 0.004310582764446735, 0.0008865500567480922, 0.001183790504001081, 0.021813182160258293, 0.07308198511600494, 0.0007841901388019323, 0.0038747466169297695, 0.002096292795613408, 0.0013579755323007703, 0.019067814573645592, 0.0016850773245096207, 0.0006641861400566995, 0.0006436390103772283, 0.00289916037581861, 0.02687601000070572, 0.002912284806370735 ]

[ "Q:\n\nJquery capture click event outside of popup\n\nIm using bPopUp to show a hidden div that is working well. ", "This bPopup is triggered by a DDL when an item is selected. ", "Now, I want to reset my DDL to value 0 when the user clicked outside of popUp. ", "\nPS: Im able to close my popUp, unless I click for two times on html page I cant able to capture that click event.", "\n$(\"html\").click(function () {\n\n if ($('#bPopup').is(\":visible\")) {\n $('#ddl').val('0');\n }\n\n});\n\nA:\n\n $(document).mouseup(function (e) {\n var container = $(your container selector);\n if (!", "container.is(e.target) // if the target of the click isn't the container...\n &&\n container.has(e.target).length === 0) // ... nor a descendant of the container\n {\n container.hide();\n }\n});\n\ntry this code\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007541170343756676, 0.001208153204061091, 0.0010447705863043666, 0.0009997287997975945, 0.0011037335498258471, 0.0014945961302146316 ]

[ "{-# LANGUAGE OverloadedStrings #-}\n{-# LANGUAGE RecordWildCards #-}\n{-# LANGUAGE StrictData #-}\n{-# LANGUAGE TupleSections #-}\n\n-- | http://docs.aws.amazon.com/AWSCloudFormation/latest/UserGuide/aws-properties-msk-cluster-storageinfo.html\n\nmodule Stratosphere.", "ResourceProperties.", "MSKClusterStorageInfo where\n\nimport Stratosphere.", "ResourceImports\nimport Stratosphere.", "ResourceProperties.", "MSKClusterEBSStorageInfo\n\n-- | Full data type definition for MSKClusterStorageInfo. ", "See\n-- 'mskClusterStorageInfo' for a more convenient constructor.", "\ndata MSKClusterStorageInfo =\n MSKClusterStorageInfo\n { _mSKClusterStorageInfoEBSStorageInfo :: Maybe MSKClusterEBSStorageInfo\n } deriving (Show, Eq)\n\ninstance ToJSON MSKClusterStorageInfo where\n toJSON MSKClusterStorageInfo{..} =\n object $\n catMaybes\n [ fmap ((\"EBSStorageInfo\",) . ", "toJSON) _mSKClusterStorageInfoEBSStorageInfo\n ]\n\n-- | Constructor for 'MSKClusterStorageInfo' containing required fields as\n-- arguments.", "\nmskClusterStorageInfo\n :: MSKClusterStorageInfo\nmskClusterStorageInfo =\n MSKClusterStorageInfo\n { _mSKClusterStorageInfoEBSStorageInfo = Nothing\n }\n\n-- | http://docs.aws.amazon.com/AWSCloudFormation/latest/UserGuide/aws-properties-msk-cluster-storageinfo.html#cfn-msk-cluster-storageinfo-ebsstorageinfo\nmskcsiEBSStorageInfo :: Lens' MSKClusterStorageInfo (Maybe MSKClusterEBSStorageInfo)\nmskcsiEBSStorageInfo = lens _mSKClusterStorageInfoEBSStorageInfo (\\s a -> s { _mSKClusterStorageInfoEBSStorageInfo = a })\n" ]

{ "pile_set_name": "Github" }

[ 0.0010827359510585666, 0.0008397835190407932, 0.014875810593366623, 0.0008599188877269626, 0.0008397835190407932, 0.0013025258667767048, 0.0006302744150161743, 0.003280322067439556, 0.0010527436388656497, 0.004829810932278633 ]

[ "Q:\n\n\"for about one year\" or \"for around one year\"\n\nWhich of the following sentences is correct or better?", "\n\nI have been using this software for about one year.", "\nI have been using this software for around one year.", "\n\nSearching in Google gives 14 million hits for \"for about one year\" and 1.5 million hits for \"for around one year\". ", "Seems that \"about\" is better, but my test is not very conclusive.", "\n\nA:\n\nEither one is fine. ", "There is absolutely no meaningful distinction between the two in this case.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0005862748948857188, 0.0005847393185831606, 0.0005853371694684029, 0.0005906611913815141, 0.0006160590564832091, 0.0006910556112416089, 0.0005883656558580697, 0.001994825666770339 ]

[ "Sikhs begin leaving Pakistan’s Orakzai Agency, India concerned (Lead)\n\nIslamabad/New Delhi, May 1 (IANS) Targeted by the Taliban, 35 Sikh families that have been living for decades in Pakistan’s Orakzai Agency have begun migrating from the area after being levied a jaziya or protection tax, an issue New Delhi has now taken up with Islamabad. ", "India said it had taken up with Pakistan the treatment of minorities in the country.", "\n\n“The government of India has taken up the question of treatment of minorities in Pakistan with the government of Pakistan,” external affairs ministry spokesperson Vishnu Prakash said in New Delhi.", "\n\nQuoting sources, Pakistani channel Geo TV said Taliban militants had taken over the shops and homes of the 35 Sikh families and arrested community leaders Klank Singh and Sewa Singh in the Ferozkhel area of Lower Orakzai Agency.", "\n\nFollowing this, a local jirga ruled that the Sikh community should annually pay Rs.15 million ($187,000) as protection money. ", "Earlier reports had said the Taliban had demanded Rs.50 million but that this had been reduced.", "\n\nWhen the Sikh community expressed their inability to pay, the Taliban then auctioned their houses and other belongings, forcing them to migrate from the area.", "\n\nThere are reports the militants had demolished the houses 11 houses of the Sikh community after they failed to pay the jaziya tax.", "\n\nThe Orakzai Agency is situated in the virtually ungovernable Federally Administered Tribal Areas (FATA) along the Pakistan-Afghanistan border where the writ of the Taliban and Al Qaeda largely runs.", "\n\nThe militants in the area are led by Hakeemullah Mehsud, the deputy of Tehrik-e-Taliban chief Baitullah Mehsud, one of the principal suspects in the Dec 27, 2007 assassination of former Pakistani prime minister Benazir Bhutto in a gun and bomb attack in the garrison town of Rawalpindi." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0009552030242048204, 0.006912690121680498, 0.0007962859235703945, 0.0018807629821822047, 0.0022434666752815247, 0.00206473795697093, 0.03372456878423691, 0.00208257045596838, 0.0006935548153705895, 0.0014354814775288105 ]

[ "Background {#Sec1}\n==========\n\nManipulation of light by subwavelength metallic nanostructures \\[[@CR1]\\] is an effective way to harvest solar energy into organic solar cells (OSCs) with thin active layers \\[[@CR2]--[@CR5]\\]. ", "Besides doping chemically synthesized metallic nanoparticles into OSCs \\[[@CR3], [@CR5]\\], it is also very popular to directly pattern the metallic electrode with some subwavelength patterns, i.e., to form a patterned metallic electrode (PME) \\[[@CR6]\\]. ", "It has been reported that PMEs not only can enhance the optical absorption in active layers based on the excitation of the hybridization of plasmonic and photonic modes \\[[@CR7]--[@CR10]\\] but also can bring forward positive electrical and morphological effects \\[[@CR11]--[@CR15]\\], resulting in an overall significantly improved performance of thin film photovoltaic devices.", "\n\nPMEs with one-dimensionally arrayed patterns \\[[@CR8], [@CR9], [@CR14]--[@CR19]\\] (i.e., 2D PMEs) can be easily fabricated based on the two-beam interference technique \\[[@CR20]\\]; however, the absorption enhancement in OSCs is sensitive to polarization since plasmonic modes cannot be excited at the traverse electric (TE) polarized incidence \\[[@CR10]\\]. ", "PMEs with two-dimensionally (2D) arrayed patterns (i.e., 3D PMEs), which can boost light harvesting efficiency polarization insensitively, have been extensively investigated in the past few years \\[[@CR14], [@CR21]--[@CR31]\\]. ", "Most of 3D PMEs working as the back contact are opaque. ", "If PMEs are functioned as the front contact, it must be semi-transparent, realized with corrugated thin films \\[[@CR14], [@CR21]\\] or a film with through holes \\[[@CR22], [@CR25]\\]. ", "Except some electrodes with complicated geometries, e.g., the integrated nanopillar-nanowell PME \\[[@CR31]\\], the opaque 3D PMEs are categorized into two types. ", "The first type is to dress the surface of the metallic electrode with some isolated nanoholes \\[[@CR26], [@CR27]\\], which are filled with organic materials in the real OSCs. ", "In other words, the organic materials contacting the PME are in the form of nanopillars. ", "Such kind of PME can be easily obtained by firstly imprinting the active layer with some nanopillars and then thermally evaporating the contact film. ", "By the nanoimprinting technique, Li et al. ", "have demonstrated that a nanohole-type of 3D PME can increase the power conversion efficiency (PCE) by 24.6% with respect to the planar electrode, much superior to the 2D PME \\[[@CR26]\\]. ", "The nanohole-type of PME can also be made from a polystyrene (PS) nanosphere template based on a colloidal self-assembling technique \\[[@CR27]\\]. ", "The other type of opaque 3D PMEs is to decorate some isolated metallic nanopillars on top of a continuous metallic film \\[[@CR23], [@CR24], [@CR28]--[@CR30]\\], which is exactly the inverse structure of the nanohole one. ", "Le theoretically predicated that there is a great potential of a metallic grating with a 2D array of Ag nanopillars in enhancing the absorption in a thin active layer \\[[@CR24]\\]. ", "We have also theoretically analyzed the influence of the back contact embossed with metallic nanocylinders packed in a hexagonal array on the absorption of a thin OSC device \\[[@CR28]\\]. ", "If the imprinting molds are selected properly, the active layer can be left with some nanoholes, then the following evaporation would make the metal contact protrude into the active layer (i.e., forming the metallic nanopillars) \\[[@CR29], [@CR30]\\]. ", "Zhou et al. ", "showed that the nanopillar PME can increase the PCE of OSC by 9.33% as well as improve the performance of organic light-emitting diodes. ", "Successful applications of the nanopillar-type of PMEs were also witnessed in quantum dot-based solar cells \\[[@CR30]\\]. ", "It is known that nanoholes at a metallic surface excite distinct plasmonic resonances from those of metallic nanopillars loaded on a continuous metal film. ", "Though both types of opaque PMEs were frequently applied in OSCs, there are not enough studies addressing their merit and demerit from a comparison standpoint. ", "Thus, it is of great importance to explore how these two strategies of PMEs work differently from each other in OSCs and which one works better for trapping light into the active layer in theory.", "\n\nIn this work, we constructed models to simulate the two different PMEs applied in a poly\\[(4,4′-bis(2-ethylhexyl)dithieno\\[3,2-b:2′,3′-d\\]silole)-2,6-diyl-alt-(2,1,3-benzothiadiazole)-4,7-diyl\\] (PSBTBT) and \\[6,6\\]-phenyl-C71-butyric acid methyl ester (PC~71~BM) based OSC. ", "The device with nanoholes in the metal electrode is called as Device A and that with metallic nanopillar-type PME is termed as Device B. According to our systematical optimization, it is found that both types of PMEs can produce a 9.9% absorption enhancement in the active layer with respect to the planar electrode, due to the excitation of the hybridization of plasmonic and photonic modes. ", "However, the optimal geometrical parameters of them are completely different and their mechanisms of absorption enhancement are also distinct from each other. ", "Our work provides useful guidance for practical application of PMEs and also contributes to the development of high-efficiency OSCs.", "\n\nMethods {#Sec2}\n=======\n\nFigure [1](#Fig1){ref-type=\"fig\"} shows the configurations of OSCs with different PME profiles (Device A and Device B) and the control with planar metallic electrode. ", "The 3D PME diagrams are also included below the corresponding devices for clarity. ", "For simplicity, we consider the isolated nanoholes/nanopillars arranged in square lattice. ", "It is defined that, at the cross-sectional view, PMEs have a protruded metal region with a width of *D* ~A~ (or *D* ~B~) and a height *h* ~A~ (or *h* ~B~) in Device A (or Device B). *", "p* ~A~ (or *p* ~B~) is the periodicity of the arrayed pattern in Device A (or Device B), and the filling ratio *f* ~A~ (*f* ~B~) of the protruded metal at the cross-sectional planes is defined as *D* ~A~/*p* ~A~ (or *D* ~B~/*p* ~B~). ", "The architecture of the investigated OSCs are ITO/ PEDOT:PSS/PSBTBT:PC~71~BM/Ag. ", "The top ITO layer as the transparent conductive anode has a thickness of 100 nm. ", "The adjacent planar PEDOT:PSS, as the hole transport layer, is 20 nm thick. ", "The active layer is made of PSBTBT:PC~71~BM instead of P3HT:PCBM or PTB7:PCBM because it can absorb more solar energy due to its wide absorption wavelength range (from 350 to 900 nm). ", "Moreover, the calculated results using PSBTBT:PC~71~BM as the active blend can clearly show the potential of absorption enhancement induced by PMEs at long wavelength range when other active blends bear absorption cutoff. ", "The active layer has a thickness of *t*, and its bottom surface follows the pattern of the PME. ", "During the optimization of PMEs, *t* is fixed to 85 nm, the planar control device of the same active layer thickness produces the first absorption peak due to the Fabry--Pérot (FP) cavity resonance. ", "The cathode is made of Ag because it can excite stronger plasmonic modes with comparison of aluminum and copper. ", "In addition, using Ag PMEs, the wavelength range of excited plasmonic modes is broader than that using PMEs made of gold. ", "A thin electron extraction layer which usually locates in-between the active layer and the cathode film is neglected in the optical simulation.", "Fig. ", "12D diagrams of the OSCs with nanohole-type PME (**a**) and nanopillar-type PME (**b**) as well as the control (**c**). ", "At the cross section, both PMEs have a protruded metal region with a width of *D*, height of *h*, and periodicity of *p*. ", "The subscripts of A and B represent devices with nanohole-type and nanopillar-type PMEs, respectively. ", "The 3D diagram of the nanohole-/nanopillar-type PME is shown below the corresponding device\n\nThe proposed OSCs are investigated theoretically by the Finite Difference Time Domain (FDTD) method, which has been verified by repeating the work in \\[[@CR32]\\]. ", "All simulations are carried out with periodic boundary conditions applied along both the *x*-axis and *y*-axis and perfectly matched layer (PML) boundaries applied to the top and bottom surfaces. ", "Light are illuminated from the top ITO side at TM (or TE) polarization, which has the electric component along the *x*-axis (or *y*-axis). ", "The wavelength-dependent refractive indices (*n*) of PSBTBT:PC~71~BM are obtained from \\[[@CR33]\\]. ", "And other refractive indices of the materials used in this work are extracted from \\[[@CR18]\\] and \\[[@CR19]\\]. ", "The absorption efficiency of the active layer (*η*) and integrated absorption efficiency (*η* ~I~) (over the wavelength range between 350 and 850 nm weighted by the AM1.5G spectrum) are calculated.", "\n\nResults and Discussion {#Sec3}\n======================\n\nFigure [2a](#Fig2){ref-type=\"fig\"}, [b](#Fig2){ref-type=\"fig\"} shows the maps of *η* ~I~ with varied grating height and filling ratio under normal incidence for Device A and Device B, respectively. ", "Here, the periodicities of the PME patterns are fixed as 350 nm, which is an optimized value as shown in Fig.", " [5c](#Fig5){ref-type=\"fig\"}, [d](#Fig5){ref-type=\"fig\"}. ", "It is observed that the performance of either device depends on both *h* and *f*. ", "For Device A, a shallow metal ridge with a small filling ratio is preferred, while for Device B, a high metal ridge with a moderate filling ratio produces the optimized performance. ", "In detail, the optimized *η* ~I~ is achieved at *h* ~A~ = 45 nm and *f* ~A~ = 0.1 for Device A (i.e., the point A, as denoted in Fig.", " [2](#Fig2){ref-type=\"fig\"}a) and *h* ~B~ = 65 nm and *f* ~B~ = 0.3 for Device B (i.e., the point B, as denoted in Fig.", " [2b](#Fig2){ref-type=\"fig\"}). ", "It is interesting to find that the optimized *η* ~I~ for the two different devices are the same (both equal to 82.4%), enhanced by 9.9% with respect to that of the control (75.0%), though less active material are used in Device A (or Device B). ", "It is noticed the relatively low filling ratio of the optimized Device A, corresponding to a grating ridge with 35 nm width, results in high fabrication difficulties, while the optimized Device B with a filling ratio of 0.3 (i.e., *D* ~B~ = 105 nm) can be easily processed through the nanoimprinting techniques \\[[@CR17], [@CR29]\\]. ", "In Fig.", " [2a](#Fig2){ref-type=\"fig\"}, [b](#Fig2){ref-type=\"fig\"}, the contour line of the integrated efficiency equal to that of the planar control (75.0%) is also indicated by the dashed curve for comparison. ", "Below the dashed curve, *η* ~I~ is greater than that of the control and vice versa. ", "Here, it is seen that the region with improved *η* ~I~ in Fig.", " [2b](#Fig2){ref-type=\"fig\"} is quite larger than that in Fig.", " [2a](#Fig2){ref-type=\"fig\"}, reflecting that Device B is less sensitive to the geometrical parameters than Device A, which is another merit of the nanopillar-type PME.Fig. ", "2Maps of the integrated absorption efficiency in the active layer (*η* ~I~) versus the filling and the height of the arrayed patterns in Device A (**a**) and Device B (**b**) when *p* ~A~ (or *p* ~B~) = 350 nm. ", "At the denoted point A (with *f* ~A~ = 0.1 and *h* ~A~ = 45 nm) and point B (with *f* ~B~ = 0.3 and *h* ~B~ = 65 nm), Device A and Device B, respectively, produce the optimal *η* ~I~. The dashed curve represents the contour line of the integrated absorption efficiency equal to that of the planar control\n\nIt is also noticed that the grating in the optimized Device A is a bit shallower than that in the optimized Device B. It is well known that with the increase of the grating height, the plasmonic modes could get stronger. ", "However, it also brings forward the decrease in the volume of the active material. ", "The combination of these two factors results in an optimal grating height when the *η* ~I~ is maximized. ", "However, because the cross-sectional area of the metal protrudes in the *xy* plane for the optimized Device A is around four times greater than that for the optimized Device B, increasing the grating height by the same measure could cause a much greater reduction in the volume of the active material in Device A than in Device B. This might be the reason that the optimal height for Device A is smaller than that for Device B. Our calculation also shows that when the grating height of the optimized Device A increases to 65 nm, the absorption at the short wavelength range (\\< 600 nm) decays obviously (not shown) due to the apparent reduction in the volume of the active material, whereas, for Device B, decreasing *h* ~B~ from 65 to 45 nm yields negligible degradation in absorption over the investigated wavelength range because the change of the volume of the active material is very small.", "\n\nFigure [3a](#Fig3){ref-type=\"fig\"}, [b](#Fig3){ref-type=\"fig\"} shows the absorption spectra of the optimal Device A and Device B, respectively. ", "For comparison, the absorption spectrum of the control device is also plotted by the dotted line. ", "It is seen in Fig.", " [3b](#Fig3){ref-type=\"fig\"} that the absorption efficiency (*η*) of Device B is greater than that of the control over the whole wavelength range. ", "But for Device A as shown in Fig.", " [3a](#Fig3){ref-type=\"fig\"}, there is a decrease in absorption at the wavelength range around 650 nm; the reason of the integrated absorption efficiency being as high as that of Device B is due to the relatively greater absorption at the wavelength range shorter than 550 nm. ", "To elucidate the physical origins of the observed absorption enhancement, we calculate the relative absorption change for the two optimized devices over that of the control device (∆*η*) (*η*/*η* ~control~ − 1) at the investigated wavelength range as shown in Fig.", " [3c](#Fig3){ref-type=\"fig\"}, [d](#Fig3){ref-type=\"fig\"}. ", "Again, the spectra of the absorption enhancement factor for the two optimized devices display similarities with each other.", "Fig. ", "3**a** Absorption spectra in the active layer (solid) for Device A (**a**) and Device B (**b**) with respect to that of the planar control (dashed). ", "Spectra of relative absorption change for Device A (**c**) and Device B (**d**). ", "Five enhancement peaks are labeled in **c** with *λ* ~1A~ = 830 nm, *λ* ~2A~ = 724 nm, *λ* ~3A~ = 470 nm, *λ* ~4A~ = 440 nm, and *λ* ~5A~ = 416 nm, and the other five are labeled in **d** with *λ* ~1B~ = 832 nm, *λ* ~2B~ = 720 nm, *λ* ~3B~ = 510 nm, *λ* ~4B~ = 498 nm, and *λ* ~5B~ = 468 nm. ", "Device A and Device B are the devices yielding the optimal *η* ~I~ in Fig.", " [2](#Fig2){ref-type=\"fig\"}\n\nAt the absorption band edge of the active material, there is an apparent enhancement peak with ∆*η* much greater than 1 \\[i.e., *", "λ* ~1A~ = 832 nm (or *λ* ~1B~ = 830 nm) with ∆*η* = 222% (or 219%) as labeled\\]. ", "When the wavelength becomes shorter, there is another minor enhancement peak \\[i.e., *", "λ* ~2A~ = 720 nm (or *λ* ~2B~ = 724 nm) with ∆*η* = 4% (or 10%) as labeled\\]. ", "Figure [4a](#Fig4){ref-type=\"fig\"}, [b](#Fig4){ref-type=\"fig\"} shows the maps of electric and magnetic distributions (under TM polarization) at different cross sections at *λ* ~1A~ and *λ* ~2A~, respectively. ", "From the maps of \\|*E*\\| at *z* = *h* ~A~ (subplots of i in Fig.", " [4a](#Fig4){ref-type=\"fig\"}, [b](#Fig4){ref-type=\"fig\"}), it is seen apparently that the dipole-like localized plasmon resonances (LPRs) are excited along the *y*-axis at *λ* ~1A~ and along the *x*-axis at *λ* ~2A~, respectively. ", "Although the incident polarization is along the *x*-axis, we witness that the dipole-like LPR at *λ* ~1A~ is polarized along the *y*-axis because such a 3D structure can scatter the electric field toward the *y*-axis. ", "From the maps of \\|*H*\\| at *y* = *p* ~A~/2 (subplots of iii in Fig.", " [4a](#Fig4){ref-type=\"fig\"}, [b](#Fig4){ref-type=\"fig\"}), we see that propagating surface plasmon polaritons (SPPs) are excited at the metal/dielectric interface at the plane of *z* = *h* ~A~, being trapped on top of the metallic protruded ridge due to the reflection from the boundary of nanoholes. ", "However, the trapped modes of \\|*H*\\| resonances at these two peaks are of different orders. ", "It is seen that at *λ* ~1A~, the \\|*H*\\| field at *z* = *h* ~A~ (subplot of ii in Fig.", " [4](#Fig4){ref-type=\"fig\"}a) has two nodes (with the minimum amplitude) along the *x*-axis and one node along the *y*-axis, while at *λ* ~2A~, there is only one node along both the *x-* and *y*-axes (subplot of ii in Fig.", " [4b](#Fig4){ref-type=\"fig\"}). ", "Influenced from the propagating SPPs, \\|*E*\\| at *λ* ~1A~ exhibits splitting around the nanohole edge at *x* = 0, which is distorted from the standard dipole-like profile. ", "It is noted at *λ* ~2A~, \\|*E*\\| inside the nanohole is quite strong because the excitation of propagating SPPs at the metal/dielectric interface at the plane of *z* = 0 (i.e., the bottom of the nanohole) brings forward a constructive interference pattern of \\|*E*\\| in the active layer (not shown). ", "For Device B, the maps of electric and magnetic distributions under TM polarization at different cross sections at *λ* ~1B~ and *λ* ~2B~ are also displayed in Fig.", " [4c](#Fig4){ref-type=\"fig\"}, [d](#Fig4){ref-type=\"fig\"}, respectively. ", "It is seen from the \\|*E*\\| maps at *z* = *h* ~B~ that (subplots of i in Fig.", " [4c](#Fig4){ref-type=\"fig\"}, [d](#Fig4){ref-type=\"fig\"}), for either *λ* ~1B~ or *λ* ~2B~, the dipole-like LPR is excited along the *x*-axis, but there is an additional bright spot centered at (*x* = 0, *y* = ± *p* ~B~/2) taking place at *λ* ~2B~. The reason of the generation of this additional bright spot of \\|*E*\\| at *λ* ~2B~ is similar to that of the strong \\|*E*\\| inside the nanohole at *λ* ~2A~. Here, the propagating SPPs excited at the bottom of the nanopillar (at the plane of *z* = 0) can be witnessed in the \\|*H*\\| map at *y* = *p* ~B~/2 (subplots of iii in Fig.", " [4c](#Fig4){ref-type=\"fig\"}, [d](#Fig4){ref-type=\"fig\"}), resulting in an interference node of \\|*H*\\| with minimum amplitude (i.e., a constructive interference region of \\|*E*\\|) a certain distance away from the bottom of the nanohole. ", "The constructive interference pattern of \\|*E*\\| displays as a bright spot when observed at the planes of *z* = *h* ~B~ and of *z* = ± *p* ~B~/2 (not shown) at the peak of *λ* ~2B~. Differently, at *λ* ~1B~, the propagating SPPs are strongly trapped at the plane of *z* = 0 with two nodes formed along the *x*-axis (as shown in the \\|*H*\\| map at *y* = *p* ~B~/2 in Fig.", " [4c](#Fig4){ref-type=\"fig\"}), which is strongly coupled with the propagating SPPs excited at the top surface of metallic nanopillar (as shown in the \\|*H*\\| map at *z* = *h* ~B~) (subplots of ii in Fig.", " [4c](#Fig4){ref-type=\"fig\"}, [d](#Fig4){ref-type=\"fig\"}). ", "Though the propagating SPPs is also excited at the top surface of metallic nanopillar at *λ* ~2B~, its amplitude is much lower with respect to that at *λ* ~1B~ at the plane of *z* = 0. ", "To sum up, at the afore-investigated two peaks for Device A and two peaks for Device B, the hybridization between the dipole-like LPRs and propagating SPPs is responsible for the trapping of light into the OSC devices.", "Fig. ", "4Field maps under TM polarization at different cross sections at the peaks of *λ* ~1A~ (**a**), *λ* ~2A~ (**b**), *λ* ~1B~ (**c**), and *λ* ~2B~ (**d**). ", "First row \\|*E*\\| at *z* = *h* ~A~ or *h* ~B~, middle row \\|*H*\\| at *z* = *h* ~A~ or *h* ~B~, and bottom row \\|*H*\\| at *y* = *p* ~A~/2 or *p* ~B~/2. ", "The peaks are as labeled in Fig.", " [3](#Fig3){ref-type=\"fig\"}\n\nFrom the enhancement spectra as shown in Fig.", " [3c](#Fig3){ref-type=\"fig\"}, [d](#Fig3){ref-type=\"fig\"}, one sees that, at the wavelength range shorter than 600 nm, there is a broad enhancement bump with multiple peaks taking place. ", "If the periodicity of the PME pattern decreases, the multiple peaks disappear while only the broad enhancement bump remains. ", "Thus, before looking into the field distributions at the absorption peaks at the short wavelength range, the influences of the periodicity of the PME pattern (*p* ~A~ or *p* ~B~) on the absorption performance are carried out, with the grating height and filling ratio of the PME for Device A (or Device B) are the same as the corresponding optimal design. ", "Figure [5a](#Fig5){ref-type=\"fig\"}, [b](#Fig5){ref-type=\"fig\"} shows the absorption spectra at tuned periodicities for Device A and Device B, respectively. ", "It is found that, for each device, multiple straight absorption bands which are insensitive to the grating momentum are produced due to localized resonant modes (e.g., the hybridization between dipole-like LPRs and propagating SPPs as presented in this paper). ", "That is exactly the origin of the broad enhancement peak observed at wavelengths shorter than 600 nm. ", "At the same time, there are also some bent absorption bands which are sensitive to the grating momentum formed especially when the periodicity becomes large. ", "It stands to reason that these bent absorption bands are generated due to the phase matching between the propagating constants of SPP modes and reciprocal vectors of the 2D grating (here, there is no in-plane momentum of incident photons at normal incidence). ", "The longer the incident wavelength, the smaller the propagating constant of a certain SPP mode, correspondingly the greater the grating period in order to produce a smaller reciprocal vector for phase matching. ", "When the bent absorption bands cross the straight bands, mode splitting happens, causing the broad enhancement bump with multiple peaks. ", "The integrated absorption efficiency is optimal at *p* ~A~ (or *p* ~B~) = 350 nm when the localized resonant modes are hybridized with the bent surface modes only over the short wavelength range for Device A (or Device B) as shown in Fig.", " [5c](#Fig5){ref-type=\"fig\"} (or Fig.", " [5d](#Fig5){ref-type=\"fig\"}). ", "At off-normal incidences, the surface modes shift with the incident angle to fulfill the phase matching condition (not shown), even though our study reflects that the integrated absorption efficiencies under either TM or TE polarization are almost angle-insensitive for both devices as shown in Fig.", " [5e](#Fig5){ref-type=\"fig\"}, [f](#Fig5){ref-type=\"fig\"}.Fig. ", "5**a**, **b** The absorption spectra when the periodicities of the PME patterns are tuned at normal incidence for Device A (**a**) and Device B (**b**). ", "The integrated absorption efficiency in the active layer (*η* ~I~) versus the periodicity for Device A (**c**) and Device B (**d**) with the dashed line representing *η* ~I~ for the control device. *", "η* ~I~ versus the incident angle *θ* at TM or TE polarization for the optimal Device A (**e**) and Device B (**f**)\n\nHere, we investigate the field distributions of three selected enhancement peaks at the short wavelength range for each device, i.e., *λ* ~3A~ = 470 nm, *λ* ~4A~ = 440 nm, and *λ* ~5A~ = 416 nm as labeled in Fig.", " [3c](#Fig3){ref-type=\"fig\"} and *λ* ~3B~ = 510 nm, *λ* ~4B~ = 498 nm, and *λ* ~5B~ = 468 nm as labeled in Fig.", " [3d](#Fig3){ref-type=\"fig\"}. ", "Figure [6a](#Fig6){ref-type=\"fig\"} displays the field maps (under TM polarization) at different cross sections at the three peaks for the optimal Device A. It is seen that the similarities of the maps at different peaks lie on the dipole-like LPRs (as shown from the \\|*E*\\| maps at *z* = *h* ~A~) (subplots of i--iii in Fig.", " [6a](#Fig6){ref-type=\"fig\"}) as well as the propagating SPPs trapped at the surface of the metallic protruded ridge (as seen from the \\|*H*\\| maps at *z* = *h* ~A~) (subplots of iv--vi in Fig.", " [6a](#Fig6){ref-type=\"fig\"}). ", "Here, we see that the propagating SPPs at the surface of the metallic ridge has only one node along the *x*-axis but no node along the *y*-axis at *λ* ~3A~, *λ* ~4A~, and *λ* ~5A~, which are different from the cases at *λ* ~1A~ and *λ* ~2A~. The differences among the resonances at *λ* ~3A~, *λ* ~4A~, and *λ* ~5A~ can be clearly found in the \\|*H*\\| maps at *z* = 0 (subplots of vii--ix in Fig.", " [6a](#Fig6){ref-type=\"fig\"}). ", "The envelope of the propagating SPPs at the bottom of the nanohole (*z* = 0) seems like a ring at *λ* ~3A~, while an elliptical bar with its long axis directed along the *y*-axis at *λ* ~5A~ and a ring plus two elliptical bars with the long axes along the *y*-axis at *λ* ~4A~. Figure [6](#Fig6){ref-type=\"fig\"}b displays the field maps (under TM polarization) at different cross sections at *λ* ~3B~, *λ* ~4B~, and *λ* ~5B~ for the optimal Device B. At all peaks, the dipole-like LPRs are excited at the top surface of the metallic nanopillar as shown in the \\|*E*\\| maps at *z* = *h* ~B~ (subplots of i--iii in Fig.", " [6](#Fig6){ref-type=\"fig\"}b). ", "In addition, the propagating SPPs at the top surface of the metallic nanopillars (as shown in the \\|*H*\\| maps at *z* = *h* ~B~) (subplots of iv--vi in Fig.", " [6b](#Fig6){ref-type=\"fig\"}) are similar at *λ* ~3B~, *λ* ~4B~, and *λ* ~5B~. Besides a bright spot inside the nanopillar, there is also a bright ring produced at the boundary of the nanopillar at *λ* ~3B~, *λ* ~4B~, and *λ* ~5B~, which are different from the cases at *λ* ~1B~ and *λ* ~2B~. Similar to Device A, the differences among the peaks of *λ* ~3B~, *λ* ~4B~, and *λ* ~5B~ for Device B also lie on the envelopes of the propagating SPPs at the metal/dielectric interface at the plane of *z* = 0 (subplots of vii--ix in Fig.", " [6b](#Fig6){ref-type=\"fig\"}). ", "For both devices, it is the excitations of diverse propagating SPP modes at the bottom of PMEs that cause the broad enhancement bump at the short wavelength range superimposed with multiple tiny peaks.", "Fig. ", "6Field maps under TM polarization at different cross sections at the peaks of *λ* ~3A~, *λ* ~4A~, and *λ* ~5A~ (**a**) and *λ* ~3B~, *λ* ~4B~, and *λ* ~5B~ (**b**). ", "First row \\|*E*\\| at *z* = *h* ~A~ or *h* ~B~, middle row \\|*H*\\| at *z* = *h* ~A~ or *h* ~B~, and bottom row \\|*H*\\| at *z* = 0. ", "The peaks are as labeled in Fig.", " [3](#Fig3){ref-type=\"fig\"}\n\nConclusions {#Sec4}\n===========\n\nIn conclusion, the organic solar cells based on nanohole-type and nanopillar-type patterned metallic electrodes have been investigated systematically by comparing their similarities and differences. ", "It has been demonstrated that both of the patterned metallic electrode-based organic solar cells can outperform the planar control with an enhanced light trapping effect in the active layer if optimal designs are utilized. ", "The integrated absorption efficiencies over the investigated wavelength range for the two optimal patterned metallic electrode-based organic solar cells are approximately the same (82.4%), leading to a 9.9% enhancement factor compared to that of the control. ", "Given that the thickness of the active layer in the organic solar cell with either type of patterned metallic electrode is the same as that of the control (which produces the first absorption peak due to cavity resonance), the organic solar cells with patterned metallic electrodes can maintain the carrier transport properties of the planar control device but with enhanced absorption and less active materials. ", "The improved light trapping effects for the two different organic solar cells have also been clarified by analyzing the field distributions at the enhancement peaks. ", "The nanohole-type patterned metallic electrode can excite the dipole-like localized plasmon resonances and propagating surface plasmon polaritons which are localized at the top of metallic ridges. ", "The nanopillar-type patterned metallic electrode can also excite the dipole-like localized plasmon resonances and propagating surface plasmon polaritons which are localized at the top of metallic nanopillars. ", "In addition, grating-coupled surface plasmon polariton modes at the bottom of patterned metallic electrodes are also excited, yielding multiple peaks superimposed over the broad enhancement bump at the wavelength range shorter than 600 nm. ", "The integrated absorption efficiency is optimized with the periodicity of 350 nm when the localized resonant modes are hybridized with the bent surface modes only over the short wavelength range. ", "In a comprehensive view, the nanopillar-type patterned metallic electrode is suggested to be applied in the present organic solar cell system, since its optimal design has a moderate filling ratio, which is much easier to process than its counterpart. ", "The proposed study is expected to contribute to the development of high-efficiency organic solar cells.", "\n\nThe authors would like to acknowledge the National Natural Science Foundation of China (NSFC) (61475109 and 61775156), the Young Talents Program of Shanxi Province, the Young Sanjin Scholars Program of Shanxi Province, the Key Research and Development (International Cooperation) Program of Shanxi (201603D421042), the Hong Kong Polytechnic University (G-YBPT and 1-ZVGH), the Natural Foundation of Shanxi (2016021051), and the Platform and Base Special Project of Shanxi Province (201605D131038).", "\n\nYC conceived the proposal of the study, and WW carried out all the simulations. ", "Both of them contributed to the analysis of the results and writing of the manuscript. ", "KHF, YZ, TJ, and YH also contributed to analyzing the results and modifying the manuscript. ", "All authors read and approved the final manuscript.", "\n\nCompeting Interests {#FPar1}\n===================\n\nThe authors declare that they have no competing interests.", "\n\nPublisher's Note {#FPar2}\n================\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.0007128432625904679, 0.0006548498058691621, 0.0006749895983375609, 0.0006897249259054661, 0.0006182821816764772, 0.0006937931757420301, 0.000804390583653003, 0.0006472761160694063, 0.0006054405821487308, 0.0006789399776607752, 0.0007371745887212455, 0.0005910052568651736, 0.0006809243932366371, 0.0006722990074194968, 0.0007763137109577656, 0.000619091559201479, 0.0006074668490327895, 0.0006572617567144334, 0.0007232018397189677, 0.0007072327425703406, 0.0006165818776935339, 0.0007159276283346117, 0.0005667887162417173, 0.0005357943591661751, 0.0008112441864795983, 0.0006002717418596148, 0.0005994830280542374, 0.0005668162484653294, 0.000617503363173455, 0.0005450238240882754, 0.0005558146513067186, 0.0006953544216230512, 0.09115348011255264, 0.0007078811177052557, 0.0006856242544017732, 0.0007457925821654499, 0.0006464290199801326, 0.0005668997182510793, 0.02496686391532421, 0.0007156541105359793, 0.0007476687896996737, 0.0007938705966807902, 0.0006393595249392092, 0.000829310214612633, 0.0007367387297563255, 0.0013356946874409914, 0.000637824006844312, 0.0005718016182072461, 0.0005823078099638224, 0.0007174432394094765, 0.0007669930928386748, 0.0007478137849830091, 0.0005853265174664557, 0.0006571358535438776, 0.0005682698101736605, 0.0007008861284703016, 0.43634963035583496, 0.0005898859235458076, 0.026150915771722794, 0.0008952679927460849, 0.0006491486565209925, 0.0005562219303101301, 0.0005836922791786492, 0.0006814723019488156, 0.0005758090992458165, 0.0006681000231765211, 0.0006201654323376715, 0.0006308149313554168, 0.0006451267399825156, 0.0006512334803119302, 0.015268317423760891, 0.0005571228684857488, 0.0006599120097234845, 0.0006853019585832953, 0.0005961262504570186, 0.0005433306214399636, 0.0006285278359428048, 0.0006031952216289937, 0.0006221095682121813, 0.000571848766412586, 0.0005448000156320632, 0.0006981608457863331, 0.0005562876467593014, 0.000829310214612633, 0.0006042032619006932, 0.0006065013003535569, 0.0009970830287784338, 0.0007160539389587939, 0.0006675008335150778, 0.0008037989609874785, 0.0006081405445002019, 0.0007928862469270825, 0.0006101580802351236, 0.001371098100207746, 0.0008422023965977132, 0.0010528272250667214, 0.0016832934925332665, 0.0006865397444926202, 0.0010000221664085984, 0.001047672936692834, 0.0006903161411173642, 0.0006484699551947415, 0.0008112944196909666, 0.0006847548065707088, 0.0005721237976104021, 0.0006636710604652762, 0.0010273761581629515, 0.000939438003115356, 0.0008496903465129435, 0.0011380022624507546, 0.0006680144579149783, 0.0006906251073814929, 0.0006465781480073929, 0.0006211308063939214, 0.000829310214612633, 0.0008381626103073359, 0.012670871801674366, 0.0005962059949524701, 0.0005916578811593354, 0.0005729912081733346, 0.0006068331422284245, 0.0005575515679083765, 0.00059383490588516, 0.0006046362104825675, 0.0005888256710022688, 0.0006066287169232965, 0.0006404024315997958, 0.0006328853196464479, 0.0006510067032650113, 0.0006198088522069156, 0.0006681312224827707, 0.0006619595224037766, 0.0006323466077446938, 0.0007650498300790787, 0.0007667894824407995, 0.0006133298156782985, 0.10423862934112549, 0.000668387277983129, 0.0006286009447649121, 0.0006792409112676978, 0.0007577971555292606, 0.0006418013363145292, 0.0006986024091020226, 0.0006418013363145292, 0.0007661325507797301, 0.0006560313631780446, 0.0006899261497892439, 0.0006867576157674193, 0.0006446593324653804, 0.0006498861475847661, 0.000829310214612633, 0.0008171471417881548, 0.009161034598946571, 0.0005962059949524701, 0.0005739439511671662, 0.0005625326884910464, 0.0005697362939827144, 0.0006227917619980872, 0.0005146244075149298, 0.0008391091832891107, 0.0007856763550080359, 0.0006741269608028233, 0.0006021985318511724, 0.0005412467871792614, 0.0005465577123686671, 0.0005252711125649512, 0.0006251089507713914, 0.000549173157196492, 0.0006192694418132305, 0.0005268279928714037, 0.0006851758225820959, 0.0006349258474074304, 0.001994825666770339 ]

[ "Prominent Indigenous elder Joseph Meconse died suddenly at the age of 77 on Sunday.", "\n\nCondolences poured in online after his daughter Renata Meconse confirmed that the Order of Manitoba recipient and Canadian Forces veteran from the Sayisi Dene First Nation had passed.", "\n\n\"My father was a friend to many people and he was very active in the Indigenous community in Winnipeg and Manitoba. ", "You could see him at every powwow,\" she said.", "\n\n\"He's going to be dearly missed by many people. ", "Many people are going to be very sad,\" Renata Meconse said, grief in her voice.", "\n\n\"Of course our family, but I'm getting tons of calls from people expressing their deep condolences of course, but also how much he'll be missed.\"", "\n\nJoseph Meconse was honoured at Portage Place mall in 2016. (", "Erin Brohman/CBC)\n\nHer father had served in a peacekeeping role in Cyprus and Germany, as well as during the FLQ crisis. ", "He was also a corrections officer at Stony Mountain Institution for decades. ", "His Order of Manitoba citation lauds his work promoting awareness of the sacrifices made by Indigenous veterans, including his work on the National Aboriginal Veterans Monument in Ottawa.", "\n\nHe is survived by sisters and daughters, but also by many more in the community who viewed him as a father figure.", "\n\n\"He just showed love to everybody, and extreme patience — especially for those who were down and out,\" Meconse said, adding that he was generous with everybody, often offering people a place to stay.", "\n\nJoseph Meconse lays a wreath on behalf of the Aboriginal Veterans Association at a 2015 Remembrance Day service. (", "Meagan Fiddler/CBC)\n\n\"He was a very kind man, and he had been through many challenges in his life, as a young person as well, but he got through all of those.", "\n\n\"There's so many things I could say about him, but the biggest thing is that he was always present and there for people.\"", "\n\nMeconse sparked change in 2016, after speaking up when he was asked to leave Portage Place mall. ", "Some called for a boycott in response, but Meconse, wanting to be part of the solution, instead participated in a protest and drum ceremony, culminating in a 100-strong round dance in the food court.", "\n\nThe mall later honoured and thanked Meconse for speaking up, and gave him a special Ogichidaa designation, which in Ojibwe means warrior, veteran; a ceremonial headman. ", "They also hired an Indigenous security company.", "\n\n\"Everything is much better now,\" Joseph said at the time. \"", "The way I think, it's yesterday. ", "It happened in the past. ", "I don't worry about it.\"", "\n\nA respected indigenous elder who was kicked out of Portage Place mall in February was honoured there Friday for his role in sparking positive changes and a more culturally inclusive environment. ", "2:22\n\n\"Words can't express how much he will be missed,\" Meconse said." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0013864572392776608, 0.0006944354972802103, 0.0005148641066625714, 0.001108418102376163, 0.0007970489095896482, 0.002859384985640645, 0.0006140018231235445, 0.0005563354352489114, 0.000584828550927341, 0.0007338287541642785, 0.0005497164675034583, 0.0007863014470785856, 0.000886936963070184, 0.0005360794020816684, 0.0006181186763569713, 0.0005352376610971987, 0.0005961790448054671, 0.0007520147482864559, 0.0005688084056600928, 0.0006351821939460933, 0.0005771841970272362, 0.0006272586178965867, 0.0006665635155513883, 0.0006617482285946608, 0.0005359191563911736, 0.000909161230083555 ]

[ "Your suggestion of int[0..1] x f(x) dx suggests you are thinking of\nf(x) as a probability density function, which it isn't because the\nintegral from 0 to 1 of f(x) isn't 1.", "\n\nNow, *if* f(x) is the cumulative distribution function I propose\nabove, then its density function would be f'(x) which is 4x^3 on (0,1)\nand 0 elsewhere. ", "In that case to calculate the expected value you\nwould integrate x * 4x^3 = 4x^5.", "\n\nI'm having a problem finding the mean (U) of this distribution function, f(x) = x to the 4, 0<x<1 How would you solve this problem using the formula:\nu=[xf(x)dx] from 0<x<1?", "\n\nDo you mean f is x cumulative distribution function given by this? :", "\n\nf(x) = 0 for x <= 0\nf(x) = x^4 for 0 < x < 1\nf(x) = 1 for x > 1\n\nYour suggestion of int[0..1] x f(x) dx suggests you are thinking of\nf(x) as a probability density function, which it isn't because the\nintegral from 0 to 1 of f(x) isn't 1.", "\n\nNow, *if* f(x) is the cumulative distribution function I propose\nabove, then its density function would be f'(x) which is 4x^3 on (0,1)\nand 0 elsewhere. ", "In that case to calculate the expected value you\nwould integrate x * 4x^3 = 4x^5." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0008500406402163208, 0.0007559391669929028, 0.0006698897341266274, 0.0010883081704378128, 0.0009395315428264439, 0.0014867944410070777, 0.0007559391669929028, 0.0006698897341266274 ]

[ "<?", "xml version=\"1.0\" encoding=\"UTF-8\"?", ">\n<osd:OSDSpec xmlns:st=\"http://www.w3.org/2007/SPARQL/protocol-types#\"\n xmlns:vbr=\"http://www.w3.org/2007/SPARQL/results#\"\n xmlns:rdf=\"http://www.w3.org/1999/02/22-rdf-syntax-ns#\"\n xmlns:osd=\"http://www.openiot.eu/osdspec\"\n xmlns:xsi=\"http://www.w3.org/2001/XMLSchema-instance\"\n xsi:schemaLocation=\"http://www.openiot.eu/osdspec file:/C:/Development/Eclipse_Worksp/Eclipse_Worksp4.2.2/OpenIoT/GitHub/ait-sensap-develop/openiot/utils/utils.commons/src/main/resources/OSDSpec.xsd\" userID=\"http://www.oxygenxml.com/\">\n <osd:OAMO name=\"name0\">\n <osd:OSMO name=\"name1\">\n <osd:queryControls>\n <osd:QuerySchedule>\n </osd:QuerySchedule>\n <osd:reportIfEmpty>false</osd:reportIfEmpty>\n </osd:queryControls>\n <osd:requestPresentation>\n <osd:widget widgetID=\"http://www.oxygenxml.com/\">\n <osd:presentationAttr name=\"name2\" value=\"value0\"/>\n <osd:presentationAttr name=\"name3\" value=\"value1\"/>\n </osd:widget>\n <osd:widget widgetID=\"http://www.oxygenxml.com/\">\n <osd:presentationAttr name=\"name4\" value=\"value2\"/>\n <osd:presentationAttr name=\"name5\" value=\"value3\"/>\n </osd:widget>\n </osd:requestPresentation>\n <st:query-request>\n <query>query0</query>\n </st:query-request>\n <st:query-request>\n <query>query1</query>\n </st:query-request>\n </osd:OSMO>\n <osd:OSMO name=\"name6\">\n <osd:queryControls>\n <osd:QuerySchedule>\n </osd:QuerySchedule>\n <osd:reportIfEmpty>false</osd:reportIfEmpty>\n </osd:queryControls>\n <osd:requestPresentation>\n <osd:widget widgetID=\"http://www.oxygenxml.com/\">\n <osd:presentationAttr name=\"name7\" value=\"value4\"/>\n <osd:presentationAttr name=\"name8\" value=\"value5\"/>\n </osd:widget>\n <osd:widget widgetID=\"http://www.oxygenxml.com/\">\n <osd:presentationAttr name=\"name9\" value=\"value6\"/>\n <osd:presentationAttr name=\"name10\" value=\"value7\"/>\n </osd:widget>\n </osd:requestPresentation>\n <st:query-request>\n <query>query2</query>\n </st:query-request>\n <st:query-request>\n <query>query3</query>\n </st:query-request>\n </osd:OSMO>\n </osd:OAMO>\n <osd:OAMO name=\"name11\">\n <osd:OSMO name=\"name12\">\n <osd:queryControls>\n <osd:QuerySchedule>\n </osd:QuerySchedule>\n <osd:reportIfEmpty>false</osd:reportIfEmpty>\n </osd:queryControls>\n <osd:requestPresentation>\n <osd:widget widgetID=\"http://www.oxygenxml.com/\">\n <osd:presentationAttr name=\"name13\" value=\"value8\"/>\n <osd:presentationAttr name=\"name14\" value=\"value9\"/>\n </osd:widget>\n <osd:widget widgetID=\"http://www.oxygenxml.com/\">\n <osd:presentationAttr name=\"name15\" value=\"value10\"/>\n <osd:presentationAttr name=\"name16\" value=\"value11\"/>\n </osd:widget>\n </osd:requestPresentation>\n <st:query-request>\n <query>query4</query>\n </st:query-request>\n <st:query-request>\n <query>query5</query>\n </st:query-request>\n </osd:OSMO>\n <osd:OSMO name=\"name17\">\n <osd:queryControls>\n <osd:QuerySchedule>\n </osd:QuerySchedule>\n <osd:reportIfEmpty>false</osd:reportIfEmpty>\n </osd:queryControls>\n <osd:requestPresentation>\n <osd:widget widgetID=\"http://www.oxygenxml.com/\">\n <osd:presentationAttr name=\"name18\" value=\"value12\"/>\n <osd:presentationAttr name=\"name19\" value=\"value13\"/>\n </osd:widget>\n <osd:widget widgetID=\"http://www.oxygenxml.com/\">\n <osd:presentationAttr name=\"name20\" value=\"value14\"/>\n <osd:presentationAttr name=\"name21\" value=\"value15\"/>\n </osd:widget>\n </osd:requestPresentation>\n <st:query-request>\n <query>query6</query>\n </st:query-request>\n <st:query-request>\n <query>query7</query>\n </st:query-request>\n </osd:OSMO>\n </osd:OAMO>\n</osd:OSDSpec>\n" ]

{ "pile_set_name": "Github" }

[ 0.0009998893365263939, 0.0006191950524225831, 0.000910226081032306 ]

[ "Her son, 21-year-old David Anderson was arrested last Thursday. ", "He's charged with the murder of 21-year-old Rashawn Williams. ", "Police said the two men had a heated argument that led to a violent fight at a home on East Muller Avenue in Columbia." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0012804478174075484, 0.018666382879018784, 0.0012392321368679404 ]

[ "Q:\n\nAdding a smaller array to a part of a bigger array?", "\n\nI have a large array of dimension 64x4x45x14.", "\nI initialize it to all zeros as:\nMain = zeros(64,4,45,14);\n\nI have another array S_avg of dimension 45x14 ;\nIf I do something like this, why does Matlab give an error?", "\nMain(chan_no,level,:,:) = Main(chan_no,level,:,:) + S_avg ;\n\nA:\n\nYou have to reshape the matrix S_avg first, try this here\nMain(chan_no,level,:,:) = Main(chan_no,level,:,:) + reshape(S_avg, 1, 1, size(S_avg, 1), size(S_avg, 2)) ;\n\nor if you know the size of S_avg for sure\nMain(chan_no,level,:,:) = Main(chan_no,level,:,:) + reshape(S_avg, 1, 1, 45, 14) ;\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007222745334729552, 0.0005848327418789268, 0.0007411455735564232, 0.001074420870281756 ]

[ "USA: Ruins of Viking Settlement Discovered near Hudson River\n\nStony Point, NY | A team of landscaping workers, proceeding to an excavation near the banks of the Hudson river, has discovered the archeological remains of a Norse village dating from the 9th or 10th Century AD.", "\n\nThe workers were digging with a mechanical shovel near the shores of Minisceongo creek when they stumbled upon the ruins of an ancient building. ", "A team of archaeologists linked to Columbia University was called to the site to inspect the findings, and they rapidly identified the site as a possible Viking settlement. ", "They proceeded to extend the excavation, and have finally discovered the remains of six buildings.", "\n\nThe various structures are believed to have been constructed of sod, placed over a wooden frame. ", "Based on the associated artifacts, the buildings were variously identified as four dwellings and two workshops. ", "The largest dwelling measured 88 by 42 feet (26.8 by 12.8 meters) and consisted of several rooms, while two of the dwellings were much smaller and were identified as living quarters for lower-status crew or slaves. ", "The two workshops for their part were identified as an iron smithy, containing a large forge, and a carpentry workshop.", "\n\nIt is unclear how many men and women lived at the site at any given time, but the archaeological evidence suggests it had the capacity of supporting between 30 to 100 individuals, and that the site was inhabited by the Norse for a relatively short period of time.", "\n\nThe Norse smithy still contained the remains of 10th Century tools and a small quantity of raw iron ore.", "\n\nDuring their search of the site, the archaeologists have discovered nine skeletons, who were identified as four adult males, two adult females and three children. ", "Only one of the male warriors had been given a proper burial, being placed in a tomb with his weapon and belongings. ", "The other skeletons showed traces of violent injuries and seemed to have been simply left on the site of their death by the killers.", "\n\nMany clues discovered on the site suggest that the Vikings could have come into conflict with the indigenous people of the region. ", "Besides the skeletons that were found, who were most likely killed in combat, the numerous remains of native American weapons found on the site suggest the colony suffered a large-scale attack by indigenous warriors.", "\n\nSeveral artifacts were also found on the site, suggesting the inhabitants of the site who survived the attack, must have left hastily. ", "These include a dozen of pieces of jewelry, like brooches, pins, and arm-rings, mostly made of silver and walrus ivory. ", "The archaeologists also unearthed iron pots, potteries, oil lamps, tools, a whetstone, coins, as well as a few broken weapons and pieces of armor.", "\n\nDozens of silex arrowheads were found all over the site, suggesting the settlement could have been attacked by the ancestors of the Lenape tribe.", "\n\nThe Vikings were Germanic Norse seafarers, speaking the Old Norse language, who raided and traded from their Scandinavian homelands across wide areas of northern and central Europe, as well as European Russia, during the late 8th to late 11th centuries.", "\n\nUsing their advanced seafaring skills and their famous longships, they created colonies and trading posts throughout the North Atlantic islands, navigating as far as the north-eastern coast of North America. ", "Another short-lived Viking settlement was already discovered in 1960, in present-day L’Anse aux Meadows, located in the province Newfoundland and Labrador, in Canada. ", "The remains of butternuts found on that site had indeed suggested that other settlements further south because these nuts do not grow naturally north of New Brunswick.", "\n\nThe scientists believe that the settlement could indeed be the legendary Norse colony known as “Vinland”, mentioned in the Icelandic Sagas. ", "Based on the idea that the name meant “wine-land”, historians had long speculated that the region contained wild grapes. ", "Wild grapes were, indeed, still growing in many areas of the Hudson Valley when the first European settlers arrived in the region, so the archaeologists believe that this could really be the colony described in the mythological saga.", "\n\nWho was Colombus? ", "Several countries and several cities have struggeled to be Colomuse’s birthplace. ", "A Norwegian maritime historian, Tor Borch Sannes, who published several books, wrote in 1990 the book: Christopher Colombus – a European from Norway? ", "In this book, he presents several indications that Colombus was an adventurer and seafarers from Norway, and even from the small town of Hyen on the west coast of Norway.", "\nThe fact that Colombus did not speak italian, make him a legend in his time…\n\nThe word VIN was used in place-names to describe that the soil was so good that it could be plowed straight away without removing stones. ", "Like the class of place.names in Norway today called Vin-names. ", "like Vinderen, Bjørgvin\nVinland means land with good soil and have nothing to do with wine or vine. ", "Vikings drank mead and not wine. ", "🙂\n\nWorld News Daily Report assumes all responsibility for the satirical nature of its articles and for the fictional nature of their content.", "\nAll characters appearing in the articles in this website – even those based on real people – are entirely fictional and any resemblance between them and any person, living, dead or undead, is purely a miracle." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005747406976297498, 0.0012015129905194044, 0.0005405744886957109, 0.0005616385024040937, 0.0009106828365474939, 0.0005777893820777535, 0.0012189605040475726, 0.000750265724491328, 0.000574348377995193, 0.0009272184688597918, 0.0006782253622077405, 0.0012304760748520494, 0.0012942594476044178, 0.0006941244937479496, 0.0008011230383999646, 0.0005779680795967579, 0.0007753562531434, 0.000635750824585557, 0.000894943077582866, 0.0008814969914965332, 0.0007687759934924543, 0.000569812604226172, 0.0007499790517613292, 0.0006104015046730638, 0.0006013147649355233, 0.00056213338393718, 0.0012883665040135384, 0.0007813728298060596, 0.0006052932585589588, 0.0005945728626102209, 0.0007864277577027678, 0.0006695239571854472, 0.0010635833023115993, 0.0010234401561319828, 0.0006408835179172456, 0.000849940232001245 ]

[ "\n717 N.E.2d 5 (1999)\nWalter DYE, Appellant (Defendant Below),\nv.\nSTATE of Indiana, Appellee (Plaintiff Below).", "\nNo. ", "49S00-9801-DP-55.", "\nSupreme Court of Indiana.", "\nSeptember 30, 1999.", "\n*9 Teresa D. Harper, Bloomington, Indiana, Attorney for Appellant.", "\nJeffrey A. Modisett, Attorney General of Indiana, Janet Brown Mallett, Deputy Attorney General, Indianapolis, Indiana, Attorneys for Appellee.", "\nBOEHM, Justice.", "\nWalter Dye was convicted of the murder of Hannah Clay, age fourteen, Celeste Jones, age seven, and Lawrence Cowherd III, age two. ", "A jury recommended that the death sentence be imposed, and the trial court imposed the death sentence. ", "In this direct appeal Dye contends that (1) the State committed numerous discovery violations; (2) his right to be free from self-incrimination was violated when he was questioned without Miranda warnings; (3) the trial court erred by excusing a juror for cause on the State's motion and failing to excuse two jurors for cause upon his motion; (4) his jury was not selected from a representative cross-section of the community; (5) the trial court erred when it modified his tendered penalty phase instruction on clemency; and (6) death is not the appropriate sentence based on the weighing of aggravating and mitigating circumstances and the \"residual doubt\" of his guilt. ", "We affirm.", "\n\nFactual and Procedural Background\nMyrna Dye decided to leave Dye, her husband of four years, in early July, 1996. ", "According to Myrna, the couple constantly fought, their sexual relationship had become nonexistent, and Dye had become \"real grouchy\" toward Myrna's daughter Hannah Clay, who lived with the couple. ", "On Monday July 15, Myrna signed a lease for a furnished apartment located seven blocks from where she and Dye resided. ", "That evening Dye confronted Myrna about her plans to leave, and she confirmed his suspicions. ", "According to Myrna, Dye appeared \"kind of angry\" and told her \"I can have something done to you and have an alibi because I would be at work.\" ", "He added, \"I'm going to make sure you suffer the rest of your life, and everybody is going to know who been there.\" ", "The next day, while Dye was at work, Myrna and Hannah moved out.", "\nThe following Sunday, July 21, Myrna and another of her daughters, Potrena Jones, went to work the night shift at a nursing home. ", "Hannah remained at the apartment with Myrna's two grandchildren, Lawrence Cowherd III, age two, and Celeste Jones, age seven. ", "Lawrence was Potrena's son, and Celeste was the daughter of Theresa Jones, another of Myrna's daughters. ", "Theresa was supposed to have worked the afternoon shift at the same nursing home where Myrna and Potrena went to work, but had not shown up for work. ", "Myrna was angry and called Theresa at the home Theresa shared with Potrena and their two children. ", "Theresa's boyfriend, John Jennings, eventually answered the phone, and Myrna had harsh words for both of them.", "\nAt the end of their shift, Myrna and Potrena took the bus home. ", "As they approached *10 the apartment at about 8:00 a.m., they saw several police cars. ", "They soon learned that Hannah's partially nude body had been found in the apartment and that Celeste and Lawrence were missing. ", "An autopsy later revealed that Hannah had been beaten with what the pathologist believed to be a crowbar and a hammer. ", "Her body sustained blunt force injuries as well as ligature strangulation and stab wounds to the neck and hand. ", "The blunt force injuries were applied with such force \"to have crushed the front of the chest wall back toward the spine, crushing the heart and the lungs in between.\" ", "A rape kit was collected during the autopsy. ", "Although the swabs of her body showed no evidence of sperm, a wet washcloth containing seminal fluid was found on a bed near Hannah's body.", "\nA search for Celeste and Lawrence was promptly begun. ", "At about 2:00 p.m., a police officer found a bundled comforter among some tall weeds along an alley near Myrna's apartment. ", "Two trash bags containing the lifeless bodies of Celeste and Lawrence were found in the comforter. ", "Both children had sustained injuries consistent with being hit on the head with a fist. ", "Lawrence had also been hit in the left lower chest and liver, and Celeste had been stabbed with a knife. ", "Lawrence had been strangled with a lamp cord taken from Myrna's apartment, and Celeste had been strangled with an extension cord.", "\nInvestigators collected a great deal of physical evidence that pointed to Dye as the killer. ", "Dye's palmprints were found on a nightstand near Hannah's body. ", "Dye's fingerprint, made in Hannah's blood, was found on a clothing tag near her body. ", "Dye's shoeprints were found on papers strewn on the bedroom floor. ", "One of these papers had the palmprints in Hannah's blood from both Dye and Hannah. ", "Police seized Dye's shoes during the execution of a search warrant at his residence, and Hannah's blood was found in the inner stitching and fibers of the shoes. ", "Finally, analysis of DNA in the sperm found on the washcloth matched Dye's with odds of 1 in 39 billion.[1]\nDye initially told police that he had never been to Myrna's apartment and had not left his residence on the night of the murders. ", "However, he testified at trial that he walked to get cigarettes at about 2:45 a.m. on the night of the killing and kept walking to Myrna's apartment, because Myrna had told him days earlier that she would be off work on Sunday night. ", "He testified that upon his arrival at Myrna's apartment he found the door open, walked inside, saw a foot, walked over to Hannah's body, touched her, concluded she was dead, and left. ", "He did not call the police. ", "He returned home but could not sleep, and clocked in at work at 5:26 a.m.\nA jury convicted Dye of three counts of murder. ", "The jury recommended that the death penalty be imposed, and the trial court followed that recommendation and sentenced Dye to death.", "\n\nI. Alleged Discovery Violations\nDye contends that the State violated the discovery rules of Marion County by belatedly disclosing several pieces of evidence. ", "He also argues that these \"egregious\" violations deprived him of his \"state and federal due process rights and his right to present a defense.", "\"[2] Trial *11 courts are given wide discretion in discovery matters because they have the duty to promote the discovery of truth and to guide and control the proceedings. ", "Braswell v. State, 550 N.E.2d 1280, 1283 (Ind. 1990). ", "They are granted deference in determining what constitutes substantial compliance with discovery orders, and we will affirm their determinations as to violations and sanctions absent clear error and resulting prejudice. ", "Id.; Kindred v. State, 524 N.E.2d 279, 287 (Ind.1988). ", "When remedial measures are warranted, a continuance is usually the proper remedy, but exclusion of evidence may be appropriate where the violation \"has been flagrant and deliberate, or so misleading or in such bad faith as to impair the right of fair trial.\" ", "Kindred, 524 N.E.2d at 287.", "\nA. The Crowbar\nThe day after the killings a crowbar was discovered in the alley running behind Myrna's apartment. ", "The crowbar's existence was promptly disclosed to the defense, as was a report that it had been tested for the presence of human blood and tested positive. ", "On March 13, 1997, detectives, at the direction of the prosecutor's office, again interviewed Myrna and Theresa. ", "Myrna confirmed that Dye had owned a crowbar similar or identical to the one found. ", "The detective promptly advised a deputy prosecutor of what he had learned, and the deputy instructed him to write an interdepartmental memo memorializing the conversation. ", "The detective wrote the memo and gave it to a paralegal in the prosecutor's office. ", "The paralegal apparently misfiled the memo and failed to route it to the prosecutors or defense attorneys who would try the case.[3] As a result, Myrna's statements that the crowbar belonged to Dye were not disclosed to the defense until August 13, 1997, three weeks before Dye's trial was to begin. ", "Upon receipt of the memo, defense counsel filed a motion to exclude any evidence relating to the crowbar, contending that the State's belated disclosure of the interdepartmental memo \"is in total and complete violation of the Rules of Discovery of the Marion Superior Court, is contemptuous, and is deserving of the most severe sanctions.\" ", "The trial court conducted a hearing on the motion and denied the motion to exclude the evidence, observing that \"[t]here are other remedies available to the defendant.\"", "\nDye points to Rule 7 of the Rules of Organization and Procedure of the Marion Superior Court, Criminal Division. ", "Section 1(a) of that rule provides that \"[t]he court at initial hearing will automatically order the State to disclose and furnish all relevant items and information under this Rule to the defendant(s) within twenty (20) days from the date of the initial hearing....\" The information here, however, was not known to exist within twenty days of the initial hearing, but rather was uncovered by the State months later during the course of its preparation for trial. ", "Under these circumstances, the State nevertheless had the obligation to make timely disclosure of the evidence to the defense. ", "The five month delay here can hardly be viewed as timely. ", "Nevertheless, accepting the State's explanation at face value, the belated disclosure was not flagrant or deliberate, and disclosure nevertheless occurred three weeks before trial. ", "This was sufficient time to allow *12 defense counsel to re-depose the necessary witnesses before trial, which was done. ", "Under these circumstances, the trial court's denial of Dye's request to exclude the evidence and motion for continuance was not clear error, and in any event he has not demonstrated any resulting prejudice.[4]Kindred, 524 N.E.2d at 287.", "\nDye also asserts error based on the State's belated disclosure of Theresa Jones' March 13 statement to detectives. ", "Theresa told police that she had owned a crowbar similar to the one described by Myrna, but after being shown the crowbar found near the crime scene told police that it was not hers. ", "She also told police that she could not recall whether her crowbar was in the trunk of her car when it was repossessed. ", "This conversation was also memorialized in the same misfiled memo described above and not disclosed to the defense until the memo surfaced three weeks before trial. ", "Dye argues that, because of the belated disclosure, he had an \"inadequate opportunity to effectively use this information. ", "Had time allowed, the defense could have explored the repossession of Theresa's car and if the crowbar was, indeed, in the trunk.\" ", "He contends that the State's belated disclosure of this evidence constitutes a violation of Brady v. Maryland, 373 U.S. 83, 83 S.Ct. ", "1194, 10 L.Ed.2d 215 (1963). ", "We disagree.", "\nAs a threshold matter, there was no Brady violation because the evidence was disclosed to the defense three weeks before trial, see Williams v. State, 714 N.E.2d 644, 648-49 (Ind.1999), and the defense had ample opportunity to pursue any avenues raised by its disclosure and to adjust its strategy accordingly. ", "Moreover, Brady and its progeny apply to evidence that is \"material\" to guilt or punishment, i.e., evidence that creates a reasonable probability of a different result of a proceeding. ", "See, e.g., United States v. Bagley, 473 U.S. 667, 682, 105 S.Ct. ", "3375, 87 L.Ed.2d 481 (1985). ", "Theresa's statement to the police is hardly exculpatory or material to Dye's guilt. ", "She told police that her crowbar was different from the one found near the crime scene, and questioning those individuals who repossessed her car would, in the best case scenario to the defense, have disclosed that no crowbar was found in her trunk. ", "This would not exculpate Dye nor would it materially add to his defense in light of the overwhelming physical evidence connecting him to the crime.", "\nB. Fingerprints and DNA Testing of John Jennings[5]\nOn August 22, 1997, after her deposition was taken by the defense, fingerprint examiner Diane Donnelly took the fingerprints of Theresa Jones' boyfriend, John Jennings. ", "Donnelly generated a report, dated September 2, the first day of jury selection, that compared a number of unidentified latent fingerprints from the crime scene with those submitted by Jennings, and found no matches. ", "According to the State, it did not receive Donnelly's report until the evening of September 9, and it turned the report over to the defense early the following morning. ", "In addition, the prosecutor's office directed a detective to transport Jennings for a blood draw on August 22. ", "DNA analysis excluded Jennings as the contributor of any of the unknown DNA from the crime scene. ", "Defense counsel objected to both the admission of the fingerprint comparisons and DNA analysis of Jennings on the ground *13 of its late disclosure. ", "The State responded that it requested this analysis after identifying the defense theory that someone else, possibly Jennings, had committed the murders. ", "Dye initially sought exclusion of the evidence, but was instead granted a continuance until the noon hour. ", "The trial court observed that it agreed \"with the State in that I believe that they had a duty and an obligation to try to compare these prints, even at this late date. ", "So although it is a violation of discovery rules, due to the circumstances there will be no sanctions imposed.\"", "\nWe find the State's explanation for the belated disclosure more than adequate under the circumstances. ", "Although its late decision to test these materials was a reasonable response to an expected defense trial theory, it nevertheless ran the risk, in the event of either a fingerprint or DNA match, of providing the defense with powerful evidence to bolster its case. ", "However, the results instead exculpated Jennings. ", "This at most forced a minor adjustment to the defense theory that some unidentified person may have committed the killings.", "\nDye alleges prejudice based on his opening statement to the jury in which he \"hemmed himself in ... by telling the jury that there would be no dispute about the scientific evidence.... [Dye] could not later challenge the scientific evidence about which he did not yet know.\" ", "In addition, Dye's opening statement spoke in generalities about the possibility that someone other than Dye had committed the killings: \"We are not going to be able to tell you who killed these children. ", "We do not know.\" ", "However, Dye made no specific mention of Jennings by name as the possible perpetrator during opening statement. ", "His expressed decision not to challenge the scientific evidence hardly prevented him from challenging scientific evidence not yet known at the time of his opening statement. ", "The trial court granted a continuance to allow Dye's expert to compare the fingerprints. ", "Had Dye's expert concluded that any of the prints found at the crime scene were Jennings', he could have presented this to the jury through his expert and also pointed out the belated disclosure of the State's comparisons in cross-examination of Donnelly. ", "Dye did not offer the testimony of his fingerprint expert, and the obvious inference is that his expert's conclusions were similar to those of Donnelly. ", "The trial court's continuance until the noon hour was an adequate remedy under these circumstances and Dye has demonstrated no prejudice as a result of this ruling.", "\nC. Other Alleged Violations\nAs a final point, Dye quotes from his pretrial motion for continuance, filed days before trial, which alleged other discovery violations. ", "However, Dye makes no separate argument regarding these alleged violations and accordingly any claim of error is waived for the failure to present a cogent argument. ", "Ind. Appellate Rule 8.3(A)(7).[6]\n\nII. ", "Failure to Provide Miranda Warnings\nDye argues that some statements he made to police should have been suppressed because police failed to provide him with the Miranda warnings before questioning him.[7] At about noon on July *14 22, two detectives went to Dye's place of employment to talk to him about Hannah's murder and the disappearance of Lawrence and Celeste. ", "They informed Dye that he was neither a suspect nor under arrest but that they needed to ask him some questions in light of allegations by the family that he had made threats towards Myrna. ", "He agreed to accompany the detectives to the police station, and they explained that police department policy required that he be handcuffed and placed in the backseat during his ride there. ", "The handcuffs were removed upon arrival and Dye was taken to an interview room, where he spoke to detectives for about forty-five minutes. ", "Dye told the detectives that he had never been to Myrna's apartment but had a pretty good idea where it was located. ", "He also said that he had never left his residence on the night of the murder. ", "When asked if he were capable of committing this crime, Dye replied \"[i]f I ever had the thought, never the kids.\" ", "This statement was made before the bodies of Celeste and Lawrence had been discovered. ", "Much later in the day,[8] the detectives arranged a time on Wednesday at which to pick Dye up from work to transport him for a blood draw. ", "Detectives explained that they sought a blood sample because it was possible that Hannah had been raped. ", "At the agreed upon time on Wednesday, a detective picked Dye up at work. ", "Dye rode, unrestrained, in the front seat of the detective's car. ", "En route to the blood draw, the detective heard Dye breathing heavily and asked him what was wrong. ", "Dye replied that he had never given a semen sample before. ", "The detective responded that \"[a]ll we've ever agreed to was you said you would provide a blood sample, nothing more....\"\nMiranda warnings are required only in the context of custodial interrogation. ", "See Miranda v. Arizona, 384 U.S. 436, 444, 86 S.Ct. ", "1602, 16 L.Ed.2d 694 (1966). ", "Custodial interrogation is \"questioning initiated by law enforcement officers after a person has been taken into custody or otherwise deprived of his freedom of action in any significant way.\" ", "Id. The Supreme Court has further explained interrogation as \"either express questioning or its functional equivalent.\" ", "Rhode Island v. Innis, 446 U.S. 291, 300-01, 100 S.Ct. ", "1682, 64 L.Ed.2d 297 (1980). ", "Custody has been described as \"whether there [was] a `formal arrest or restraint on freedom of movement' of the degree associated with a formal arrest.\" ", "Stansbury v. California, 511 U.S. 318, 322, 114 S.Ct. ", "1526, 128 L.Ed.2d 293 (1994) (per curiam) (quoting California v. Beheler, 463 U.S. 1121, 1125, 103 S.Ct. ", "3517, 77 L.Ed.2d 1275 (1983) (per curiam) (in turn quoting Oregon v. Mathiason, 429 U.S. 492, 495, 97 S.Ct. ", "711, 50 L.Ed.2d 714 (1977)) (per curiam)). ", "Based on these authorities, this Court has described the custody issue as whether a reasonable person in the accused's circumstances would believe that he or she is free to leave. ", "Cliver v. State, 666 N.E.2d 59, 66 (Ind.1996). ", "A police officer's unarticulated plan to arrest or suspicions about a suspect has no bearing on the issue; rather, \"the only relevant inquiry is how a reasonable man in the suspect's position would have understood his situation.\" ", "Stansbury, 511 U.S. at 324, 114 S.Ct. ", "1526 (quoting Berkemer v. McCarty, 468 U.S. 420, 442, 104 S.Ct. ", "3138, 82 L.Ed.2d 317 (1984)).", "\nAs to the statements made during the initial interview with police, the State does not contest that the police questioned Dye. ", "Accordingly, the issue turns on whether Dye was in custody at the time. ", "Dye relies on Loving v. State, 647 N.E.2d *15 1123 (Ind.1995), in which this Court reversed a conviction because the defendant was subjected to custodial interrogation without being advised of his Miranda rights. ", "Although the officers in Loving did not consider the defendant a suspect, they never communicated that belief to him. ", "Moreover, Loving was questioned at the crime scene by several police officers, then handcuffed and placed in the back of a marked police car to be taken to the police station where he was questioned without ever being told that he was free to leave. ", "Id. at 1125. ", "This Court held that, \"[p]articularly in view of the initial use of handcuffs, ... a reasonable person in the defendant's circumstances would not have believed himself to be free to leave but would instead have considered his freedom of movement to have been restrained to the `degree associated with a formal arrest.' \"", "Id. at 1126 (quoting Beheler, 463 U.S. at 1125, 103 S.Ct. ", "3517).", "\nUnlike Loving, Dye was told by police that he was not a suspect and was specifically told that he was being handcuffed as a matter of standard procedure during transportation to the police station, where the handcuffs were immediately removed as promised. ", "Both detectives testified at the suppression hearing that Dye was free to leave the interview at any time, and the totality of the circumstances surrounding the interview lead us to conclude that a reasonable person in these circumstances would not have considered his freedom of movement restrained to the degree associated with a formal arrest. ", "Accordingly, the trial court did not err when it denied Dye's motion to suppress the statements made during his initial interview with police.", "\nThe alleged Miranda violation en route to the blood draw presents issues of both interrogation and custody. ", "Here, the detective's asking Dye what was wrong does not constitute interrogation under Miranda or the functional equivalent of questioning under Innis. ", "See Hopkins v. State, 582 N.E.2d 345, 348 (Ind.1991) (\"volunteered statements are admissible absent Miranda warnings\"); see also Loving, 647 N.E.2d at 1126. ", "Moreover, Dye was not in custody at the time the statement was made. ", "The blood draw was arranged in advance to take place over Dye's lunch hour, and he was transported in the front seat of the police car without any type of restraint. ", "The trial court properly denied Dye's motion to suppress.", "\n\nIII. ", "Rulings on Challenges for Cause\nDye argues that the trial court improperly excluded one juror for cause and erroneously denied his motion to exclude two other jurors for cause. ", "He contends that this violated his \"state and federal rights to due process and to an impartial jury.", "\"[9]\nA. Excused for Cause\nThe trial court excluded for cause one juror who expressed strong views opposing the death penalty. ", "In response to a question on the jury questionnaire about the circumstances under which he believed the death penalty would be appropriate, the juror responded \"[t]o save society or mankind as a whole when there is no defense.\" ", "The prospective juror further explained this as \"[t]he Hitler argument\" and was then questioned at some length by the trial court, State, and defense counsel. ", "The prospective juror stated during this questioning that he could recommend the death penalty in a case of an individual similar to Adolph Hitler and possibly Oklahoma City bomber Timothy McVeigh. ", "However, he later observed that this case involved the alleged killing of three individuals and agreed that he \"could never consider\" recommending the death penalty for such a crime. ", "When asked whether he would be able to follow his oath as a juror and consider the death penalty \"as a viable *16 option in this case\" he stated that he would not.", "\n\n1. ", "Juror Exclusion Under the Federal Constitution\n\nThe relevant inquiry for exclusion of jurors for cause under the federal constitution is \"whether the juror's views would `prevent or substantially impair the performance of his duties as a juror in accordance with his instructions and his oath.'\" ", "Wainwright v. Witt, 469 U.S. 412, 424, 105 S.Ct. ", "844, 83 L.Ed.2d 841 (1985) (quoting Adams v. Texas, 448 U.S. 38, 45, 100 S.Ct. ", "2521, 65 L.Ed.2d 581 (1980)). ", "As the Court explained in Witt, \"the quest is for jurors who will conscientiously apply the law and find the facts. ", "That is what an `impartial' jury consists of....\" 469 U.S. at 423, 105 S.Ct. ", "844. ", "The Witt \"standard does not require that a juror's bias be proved with unmistakable clarity. ", "Deference must be paid to the trial court who was able to see the prospective jurors and listen to their responses during voir dire.\" ", "Underwood v. State, 535 N.E.2d 507, 513 (Ind.1989).", "\nIn Indiana, juries in capital cases are instructed that they must consider whether the State has proven an aggravating circumstance beyond a reasonable doubt, and if that is done, they must then weigh the aggravator(s) against any mitigating evidence. ", "Jurors who state at the outset that they will not recommend a death sentence even if the State proves one or more statutory aggravating circumstance are incapable of following the court's instructions and are accordingly properly excused for cause. ", "The questioning described above demonstrated that this prospective juror's views on the death penalty would have prevented him from following the court's instructions and his oath.", "\nDye contends that it was nevertheless error for the trial court to excuse the juror for cause because he stated that he \"could consider the death penalty under certain circumstances and in fact, believed it to be an appropriate penalty.\" ", "As explained above, the relevant inquiry is not whether the prospective juror could recommend the death penalty in any conceivable case, including genocide or the most famous of mass murders. ", "Rather, the issue is whether the jury can follow the court's instructions and the juror's oath in this case.", "\nIn most reported cases, excused prospective jurors have stated blanket opposition to the death penalty. ", "See, e.g., Davis v. State, 598 N.E.2d 1041, 1047 (Ind.1992) (after being asked if there are \"any circumstances\" under which prospective juror could vote to recommend the death penalty, juror responded \"No sir\"); Benirschke v. State, 577 N.E.2d 576, 582-83 (Ind.1991) (prospective jurors indicated they were opposed to the death penalty and \"could not find a case where it would be appropriate\"); Underwood, 535 N.E.2d at 513 (prospective juror \"candidly expressed several times that she could not consider the death penalty\"); Burris v. State, 465 N.E.2d 171, 178 (Ind.1984) (\"all of the excused veniremen stated that under no circumstances would they consider imposition of the death penalty\"). ", "We find no case from this Court directly addressing the issue Dye raises. ", "However, several cases imply that the necessary inquiry is whether the prospective juror could recommend the death penalty in the case on trial, not in any case. ", "In Davis, 598 N.E.2d at 1047, the prosecutor asked if a prospective juror could recommend the death penalty \"[u]nder any circumstances that you can imagine uh, as have been described to you in this case[.]\" ", "The juror responded \"No\" and this Court upheld the removal for cause under Witt. ", "We observed that \"[t]here need be no ritualistic adherence to a requirement that a prospective juror make it unmistakably clear that he or she would automatically vote against the imposition of capital punishment.\" ", "Id. Similarly, in Daniels v. State, 453 N.E.2d 160, 167 (Ind.1983), this Court reviewed the removal for cause of a prospective juror who, after initially stating he did not believe *17 in the death penalty, stated that he thought it might be warranted in the case of the assassination of a president. ", "The following colloquy then took place between the trial court and the prospective juror:\nQ. \"Then other than the president you can't think of any instances or any circumstances involving a murder that you would feel would warrant recommendation of the death sentence?\"", "\nA. \"No.\"", "\nQ. \"And your feelings would preclude you from recommending the death penalty if the Defendant was found guilty, is that right?\"", "\nA. \"Yes, Ma'am.\"", "\nId. at 167. ", "Applying the then-existing federal constitutional standard of Witherspoon,[10] this Court upheld the exclusion.", "\nThe basic logic of Witt is that it is proper to excuse jurors who are unable to carry out their duties in the case before them. ", "A juror's willingness to recommend a death sentence under other circumstances is irrelevant to that inquiry. ", "Because the prospective juror here stated that his views on the death penalty would render him unable to follow the court's instructions and his oath, exclusion was proper under the federal constitutional standard of Witt.", "\n\n2. ", "Exclusion Under Indiana Code § 35-37-1-5(a)(3)\n\nMost of our death penalty cases have been resolved under federal constitutional standards, presumably because that was how the issue was framed at trial and on appeal. ", "See, e.g., Davis, 598 N.E.2d at 1046-47 (applying Witt); Jackson v. State, 597 N.E.2d 950, 961 (Ind. 1992) (applying Witherspoon); Benirschke, 577 N.E.2d at 582-83 (applying Witt); Evans v. State, 563 N.E.2d 1251, 1257 (Ind.1990) (applying Witherspoon while also quoting the statute); Underwood, 535 N.E.2d at 513 (applying Witt). ", "However, Dye also objected at trial on the basis of Indiana Code § 35-37-1-5(a)(3), which provides as one of several \"good causes for challenge\" that \"[i]f the State is seeking a death sentence, that the person entertains such conscientious opinions as would preclude the person from recommending that the death penalty be imposed.\" ", "Accordingly, we must address whether the exclusion of this juror violated the statute, which arguably sets a higher bar than Witt. ", "See generally 16B WILLIAM ANDREW KERR, INDIANA PRACTICE § 21.6d at 151-52 (1998).[11]\nDye suggests that exclusion was improper under the statute because the prospective juror stated that he could consider the death penalty under some circumstances. ", "The statute speaks in terms of preclusion from recommending the death penalty and does not specifically address whether the preclusion must be in the particular case only or in all cases, no matter how far afield their facts may be from the case at bar.", "\n*18 The prospective juror in Dye's case stated opposition to the death penalty with a very narrow exception (Hitler) that did not apply to Dye's case. ", "The juror went on to explain his unequivocal opposition to the death penalty under his limited knowledge of the facts of Dye's case (the killing of three children). ", "Although his opinions may not have precluded a recommendation of death in every hypothetical case, they did preclude a recommendation of the death penalty in this case. ", "For the same reasons already explained, we believe this is all that is required under the statute. ", "Accordingly, because the prospective juror's conscientious opinions precluded him from recommending the death penalty in this case, exclusion was proper under Indiana Code § 35-37-1-5(a)(3).[12]\n\nB. Failure to Excuse for Cause\n\nDye also argues that the trial court erred by failing to excuse two prospective jurors for cause upon his motion. ", "Although both of these jurors at some point expressed the view that they would automatically vote to impose the death penalty in the case of a knowing or intentional murder, their views were tempered by subsequent questioning. ", "Both jurors were told that the law required them to make a recommendation after weighing the aggravating and mitigating circumstances. ", "The first juror agreed that there was a \"possibility\" that she would not recommend the death penalty and agreed she could set aside her personal beliefs and follow the law and her oath. ", "The other juror also stated that it was \"possible\" that he would vote against the death penalty and agreed that he would weigh the aggravators and mitigators in good faith and apply the law as it was given to him.", "\nDye contends that exclusion for cause was required by Morgan v. Illinois, 504 U.S. 719, 112 S.Ct. ", "2222, 119 L.Ed.2d 492 (1992). ", "In Morgan, the Supreme Court held that the trial court's refusal to inquire whether prospective jurors would automatically vote to impose the death penalty upon conviction violated the Due Process Clause of the Fourteenth Amendment. ", "However, in this case the trial court did inquire about the possibility that these jurors would vote automatically to impose the death penalty and defense counsel were afforded the same opportunity to inquire. ", "This questioning revealed that these prospective jurors understood that both the law and their oath were contrary to their view favoring an automatic recommendation of death and agreed that they would follow the law and their oath. ", "The trial court did not err by failing to exclude them.[13]\n\nIV. ", "Fair Cross-Section of the Jury Pool\nDye argues that his jury was not selected from a venire that represented a fair cross-section of the community. ", "Before *19 trial 150 prospective jurors completed questionnaires that included a question about race. ", "After reviewing the questionnaires, Dye discovered that only eighteen of the 150 potential jurors identified themselves as African-American.[14] He filed a \"Motion to Stay Proceedings or Dismiss the Information Based upon Racial Discrimination in the Jury Venire\" which sought either time to allow investigation of the racial disparity, supplementation of the venire pursuant to Indiana Code § 33-4-5-2(d) & (e), or dismissal of the information. ", "The trial court denied the motion.", "\nIn order to make a prima facie showing of a violation of the fair cross-section requirement, a defendant must establish\n(1) that the group alleged to be excluded is a \"distinctive\" group in the community; (2) that the representation of this group in venires from which juries are selected is not fair and reasonable in relation to the number of such persons in the community; and (3) that this underrepresentation is due to systematic exclusion of the group in the jury-selection process.", "\nDuren v. Missouri, 439 U.S. 357, 364, 99 S.Ct. ", "664, 58 L.Ed.2d 579 (1979). ", "Dye acknowledges that he bears the burden of establishing a Duren violation, see, e.g., Bond v. State, 533 N.E.2d 589, 591 (Ind. 1989), and concedes that he cannot meet the third prong of Duren based on the record before us. ", "He nevertheless asserts error based on the trial court's denial of his motion to stay the proceedings or supplement the venire pursuant to Indiana Code § 33-4-5-2(d) & (e). ", "That statute provides that \"[t]he jury commissioners may supplement voter registration lists and tax schedules ... with names from lists of persons residing in the county that the jury commissioners may designate as necessary to obtain a cross section of the population of each county commissioner's district....\" IND.CODE § 33-4-5-2(d) (1998). ", "The supplemental sources \"may consist of such lists as those of utility customers, persons filing income tax returns, motor vehicle registrations, city directories, telephone directories, and driver's licenses....\" Id. § 33-4-8-2(e). ", "As noted above, Dye made no showing that supplementation was necessary to comply with Duren, and we see no basis for requiring trial courts under such circumstances to utilize this discretionary statutory provision for supplementation.", "\nThe use of voter registration lists complied with statute. ", "See IND.CODE § 33-4-5-2 (1998).[15] In addition, the trial court also had a duty to comply the constitutional requirements set forth in Duren, which it did. ", "It was not required to supplement the voter's registration lists. ", "See Bradley v. State, 649 N.E.2d 100, 103-04 (Ind.1995) (\"Absent constitutional infirmity, however, we decline to construe [Indiana Code § 33-4-5-2(d)] so as to convert an option into a mandate.\"). ", "Nor was the trial court required to grant Dye a stay for further investigation of systematic exclusion. ", "Dye did not raise the issue until days before trial when a lengthy continuance would have been required to conduct the study Dye requested.[16] We review a trial court's *20 denial of a continuance for an abuse of discretion. ", "Perry v. State, 638 N.E.2d 1236, 1241 (Ind.1994). ", "Under these circumstances, the denial of Dye's motion for a stay was not an abuse of discretion.", "\n\nV. The Clemency Instruction\nDye contends that the trial court erred when it instructed the jury on clemency. ", "Indiana Code § 35-50-2-9(d) provides, in relevant part, that \"[t]he court shall instruct the jury concerning ... the availability of good time credit and clemency.", "\"[17] Dye tendered an instruction that provided:\nThe Governor of Indiana has the power, under Indiana Constitution, to grant reprieve, commutation, or pardon to a person convicted and sentenced for murder. ", "The Constitution leaves it entirely up to the Governor whether and how to use this power. ", "This power is used sparingly and its imposition, while possible, should not be considered as a likely result.", "\nOver Dye's objection, the trial court struck the last sentence of this tendered instruction. ", "Dye argues on appeal that \"what trial counsel sought to do was eliminate speculation through complete and accurate information about the possibility of clemency.... The speculation that jury could have entertained is endless.", "\"[18]\nA trial court erroneously refuses a tendered instruction, or part of a tendered instruction, when: (1) the instruction correctly sets out the law; (2) evidence supports the giving of the instruction; and (3) the substance of the tendered instruction is not covered by the other instructions given. ", "Byers v. State, 709 N.E.2d 1024, 1028-29 (Ind.1999). ", "The last sentence of Dye's tendered instruction fails on both the first and second prongs.", "\nA correct statement of the law regarding clemency is provided for by the Indiana Constitution and by statute.[19] The part of Dye's tendered instruction that was refused by the trial court was not a statement of law at all. ", "Rather, it was a statement of historical practice surrounding clemency in Indiana. ", "Moreover, not only is this language not legal in nature, there is no basis to conclude that it was correct, if viewed as a prediction of future Governors' actions. ", "Although the exercise of the power to grant clemency may have been rare under current and prior Indiana Governors, there is no way to determine whether a future Governor may alter this trend of executive restraint and grant clemency to a significant number of inmates. ", "See generally Isabel Wilkerson, Clemency Granted to 25 Women Convicted for Assault or Murder, N.Y. TIMES, Dec. 22, 1990, at 1 (discussing the grant of *21 clemency by former Ohio Governor Richard Celeste to women convicted of killing or assaulting husbands or companions alleged to have physically abused them). ", "The trial court did not err by modifying Dye's tendered instruction on clemency.", "\n\nVI. ", "Appropriateness of the Death Sentence\nAs a final point, Dye attacks the appropriateness of his death sentence. ", "According to statute, a death sentence is subject to \"automatic review\" by this Court. ", "See IND.CODE § 35-50-2-9(j)(1998). ", "Although this Court has the constitutional authority to review and revise sentences, IND. ", "CONST. ", "art. ", "VII, § 4, it will not do so unless the sentence imposed is \"manifestly unreasonable in light of the nature of the offense and the character of the offender.\" ", "Ind. Appellate Rule 17(B). ", "The Court has explained this standard as \"not whether in our judgment the sentence is unreasonable, but whether it is clearly, plainly, and obviously so.\" (", "Prowell v. State, 687 N.E.2d 563, 568 (Ind.1997), cert. ", "denied, ___ U.S. ___, 119 S.Ct. ", "104, 142 L.Ed.2d 83 (1998)). ", "In reviewing a death sentence, however, we have noted that \"these harsh requirements `stand more as guideposts for our appellate review than as immovable pillars supporting a sentence decision.'\" ", "Id. (quoting Spranger v. State, 498 N.E.2d 931, 947 n. 2 (1986)).", "\nDye contends that the death sentence is not appropriate when the one aggravating circumstance is weighed against the mitigating evidence presented, particularly the alleged \"residual doubt\" surrounding his guilt. ", "See generally Miller v. State, 702 N.E.2d 1053, 1069 (Ind. 1998) (describing \"residual doubt\" and holding that the failure to argue it to a jury does not constitute ineffective assistance of counsel). ", "The State alleged as an aggravating circumstance that Dye killed Celeste after having murdered Hannah.[20]See IND.CODE § 35-50-2-9(b)(8) (1998). ", "Dye offered the testimony of six witnesses at his penalty phase.[21] The jury found that the aggravator outweighed any mitigators and recommended that the death penalty be imposed. ", "After a sentencing hearing at which Dye presented the testimony of an additional witness, the trial court agreed[22] and imposed the death sentence.", "\nThe trial court's sentencing order explicitly rejected Dye's \"residual doubt\" argument, finding that the evidence \"was more than sufficient to prove beyond a reasonable doubt that the defendant committed the murders with which he was charged. *", "22 There is no `residual doubt' when considering the reasonable doubt standard.\" ", "The trial court's sentencing order recounted some of the evidence against Dye including that his left palmprint was found on a table near where Hannah was found, that his bloody fingerprint was found on a garment tag lying near Hannah's body, and that his semen was found on a washcloth found next to her body.", "\nDye's residual doubt argument on appeal focuses on a few pieces of unidentified evidence, specifically hairs found on Hannah's chest, a dried crusty substance found on her thigh and pubic hair, as well as the absence of Dye's footprints outside the apartment, the absence of his fingerprints in the area where he must have picked up a knife and the absence of fingerprints on the hammer believed to have been used to bludgeon Hannah and Celeste. ", "He also points to a fingerprint that was found on a glass in Myrna's apartment and was compared to twenty people who may have been inside the apartment (including Dye), but remained unidentified. ", "Defense counsel was free to argue—and did argue— these items to the jury in both the guilt and penalty phases and to the trial court at sentencing. ", "However, in light of the significant physical evidence that connected Dye to these murders, the jury and trial court were not persuaded by these few loose ends. ", "Some of this evidence is arguably attributable, as the State points out, to the fact that Myrna's furnished apartment \"was a filthy, oft-rented unit with used carpeting, used furniture and a dirty mattress.\" ", "We are no more persuaded by Dye's residual doubt argument than were the jury and trial court. ", "Residual doubt presents no basis for reversal here.", "\nAs a final point, we observe that Dye points to no other alleged mitigating circumstances, save his lack of a significant criminal history found by the trial court. ", "Considering the nature of the offense and the character of the offender as presented through the proffered mitigating evidence,[23] we are not persuaded to revise this sentence.", "\n\nConclusion\nWalter Dye's convictions for murder and death sentence are affirmed.", "\nSHEPARD, C.J., and DICKSON and SELBY, JJ., ", "concur.", "\nSULLIVAN, J., concurs with separate opinion.", "\nSULLIVAN, Justice, concurring.", "\nI concur in the Court's opinion. ", "I write to provide additional review of the appropriateness of the death sentence imposed here. ", "Cooper v. State, 540 N.E.2d 1216, 1218 (Ind.1989) (\"In contrast to appellate review of prison terms and its accompanying strong presumption that the trial court's sentence is appropriate, this Court's review of capital cases under article *23 7 is part and parcel of the sentencing process. ", "Rather than relying on the judgment of the trial court, this Court conducts its own review of the mitigating and aggravating circumstances `to examine whether the sentence of death is appropriate.' ... ", "The thoroughness and relative independence of this Court's review is a part of what makes Indiana's capital punishment statute constitutional.\") (", "citations omitted).", "\nAs to the appropriateness of the death penalty in this case, the statute guides this Court's review by setting forth standards governing imposition of death sentences. ", "Following completion of the guilt phase of the trial and the rendering of the jury's verdict, the trial court reconvenes for the penalty phase. ", "Before a death sentence can be imposed, our death penalty statute requires the State to prove beyond a reasonable doubt at least one aggravating circumstance listed in subsections (b)(1) through (b)(12) of the statute. ", "Ind.Code § 35-50-2-9 (Supp.1996). ", "Here the State supported its request for the death penalty with the aggravating circumstance that Dye committed multiple murders (those of Hannah Clay and Celeste Jones), id. § 35-50-2-9(b)(8).", "\nTo prove the existence of this aggravating circumstance at the penalty phase of the trial, the State relied upon the evidence from the earlier guilt phase of the trial (with respect to which the jury had found Dye guilty of the two murders, as well as the murder of Lawrence Cowherd). ", "The death penalty statute requires that any mitigating circumstances be weighed against any properly proven aggravating circumstances. ", "The Court's opinion accurately describes Dye's argument in favor of mitigating circumstances. ", "The jury returned a unanimous recommendation that a sentence of death be imposed.", "\nOnce the jury has made its recommendation, the jury is dismissed, and the trial court has the duty of making the final sentencing determination. ", "First, the trial court must find that the State has proved beyond a reasonable doubt that at least one of the aggravating circumstances listed in the death penalty statute exists. ", "Ind.Code § 35-50-2-9(k)(1) (Supp.1996). ", "Second, the trial court must find that any mitigating circumstances that exist are outweighed by the aggravating circumstance or circumstances. ", "Id. § 35-50-2-9(k)(2). ", "Third, before making the final determination of the sentence, the trial court must consider the jury's recommendation. ", "Id. § 35-50-2-9(e). ", "The trial court must make a record of its reasons for selecting the sentence that it imposes. ", "Id. § 35-38-1-3 (1988).", "\nIn imposing the death sentence, the trial court found that the State proved beyond a reasonable doubt a charged aggravating circumstance listed in the death penalty statute—that Dye had committed multiple murders. ", "The record and the law supports this finding.", "\nThe trial court found little in the way of mitigating circumstances to exist. ", "The court found only that Dye's history of prior criminal conduct was not significant (he had been convicted of two Class A misdemeanors—Driving While License Suspended in 1989 and Battery in 1992). ", "However, the court did note that the circumstances surrounding the battery were significant because the victim of the battery was Myrna Dye. ", "The court also considered, but did not find to exist, additional statutory mitigating circumstances and other purported mitigating circumstances offered by Dye. ", "I agree with the trial court's and this Court's analyses of the mitigation in this case and find the mitigating weight to be in the low range.", "\nAs required by our death penalty statute, the trial court specifically found that the aggravating circumstance outweighed the mitigating circumstances. ", "The trial court also gave consideration to the jury's recommendation. ", "The trial court imposed the sentence of death.", "\nBased on my review of the record and the law, I agree that the State has proven beyond a reasonable doubt an aggravating *24 circumstance authorized by our death penalty statute and that the mitigating circumstances that exist are outweighed by that aggravating circumstance. ", "I conclude that the death penalty is appropriate for Dye's murder of Hannah Clay, Celeste Jones and Lawrence Cowherd III.", "\nNOTES\n[1] Dye testified at trial that, in the course of his sexual practices with Myrna, he would sometimes ejaculate in a washcloth and had done so the Wednesday before Myrna left him. ", "Myrna testified that, after Dye had ejaculated on her, she would either take a bath or clean herself with a washcloth. ", "However, she testified that her last sexual contact with Dye was in the early part of June and that she had taken no dirty washcloths with her when she moved.", "\n[2] \"Due process\" is a term found in the Fourteenth Amendment of the U.S. Constitution. ", "It does not appear in the Indiana Constitution. ", "The closest state analog is the \"due course of law\" provision in Article I, Section 12. ", "Dye does not cite that provision, let alone offer a separate analysis based on the state constitution. ", "Accordingly, any state constitutional claim is waived. ", "Valentin v. State, 688 N.E.2d 412 (Ind.1997).", "\n[3] Rule 5.3(b) of our Rules of Professional Conduct require that \"[a] lawyer having direct supervisory authority over [a] nonlawyer shall make reasonable efforts to ensure that the person's conduct is compatible with the professional obligations of the lawyer.\" ", "Although sending a memorandum to the appropriate attorneys is a clerical task appropriately assigned to a paralegal, the prosecutors assigned to a case nevertheless bear the ultimate burden of ensuring compliance with the discovery rules. ", "This is especially true under the circumstances here, where a deputy prosecutor knew of—indeed, requested that detectives take—an important statement from a crucial witness. ", "That this is a death penalty case only heightens the need for attorneys within the prosecutor's office to ensure that paralegals are turning over all discovery in a timely manner.", "\n[4] Dye also suggests that he was misled by some answers given by State's witnesses during pretrial depositions. ", "However, he does not contend that these answers were not correct according to the witness's knowledge at the time of their respective depositions. ", "Moreover, Dye had the opportunity to re-depose these witnesses before trial, in light of the information belatedly disclosed to him on August 13. ", "This presents no basis for reversal.", "\n[5] Dye also mentions evidence of shoeprints but then notes that the trial court excluded this evidence. ", "Accordingly, any belated disclosure of this evidence presents no basis for reversal.", "\n[6] The State does not assert waiver but instead addresses the issue on its merits, pointing out that three of the witnesses mentioned in the motion were not called at trial by the State, the complained of portion of another witness's testimony was not presented at trial, an expert's report was timely disclosed, an amended transcript of a witness's statement was issued merely to correct \"inaudibles\" from an earlier transcript, and Dye learned of the oral statements of two other witnesses more than a week in advance of trial which was sufficient time to render them nonprejudicial to his case.", "\n[7] Dye captions his argument in terms of \"state and federal rights self-incrimination and to counsel\" but merely cites Article I, Sections 11-13 without making any separate analysis based on the state constitution. ", "Any claim of error under the Indiana Constitution is waived. ", "See Valentin v. State, 688 N.E.2d 412 (Ind.1997).", "\n[8] After this interview with police, Dye spent several more hours with police but points to no statements made during this time that should be suppressed. ", "Accordingly, we need not address whether any custodial interrogation occurred subsequent to the initial interview described above.", "\n[9] Once again, any state constitutional claim is waived for the failure to make a separate argument under the Indiana Constitution. ", "See supra notes 2 and 7.", "\n[10] See Witherspoon v. Illinois, 391 U.S. 510, 88 S.Ct. ", "1770, 20 L.Ed.2d 776 (1968). ", "The Witherspoon standard, as commonly applied at the time, permitted excusing only those jurors who make \"unmistakably clear (1) that they would automatically vote against the imposition of capital punishment without regard to any evidence that might be developed at the trial of the case before them, or (2) that their attitude toward the death penalty would prevent them from making an impartial decision as to the defendant's guilt.\" ", "Id. at 522 n. 21, 88 S.Ct. ", "1770 (emphasis in original). ", "In Witt, the Supreme Court made clear that the Court's holding in Witherspoon \"focused only on circumstances under which prospective jurors could not be excluded; under Witherspoon's facts it was unnecessary to decide when they could be.\" ", "Witt, 469 U.S. at 422, 105 S.Ct. ", "844 (emphasis in original). ", "Witt concluded that the quoted footnote language from Witherspoon was \"dicta\" and \"not controlling.\" ", "Id.\n[11] Dye contends that this statute is a codification of the standard set forth by the United States Supreme Court in Witherspoon. ", "This is incorrect. ", "Although the statutory language is somewhat similar to Witherspoon, the statutory provision has been on the books in a virtually identical form for over a century— long before Witherspoon. ", "See KERR, supra § 21.6d, at 149 n. 42.", "\n[12] Dye quotes the following language from this Court's opinion in Baird v. State, 604 N.E.2d 1170, 1185 (Ind.1992), \"[o]nly jurors who state, without equivocation or self-contradiction, that they would not vote for death in any case can be excluded....\" Baird cites Witherspoon and Lamar v. State, 266 Ind. 689, 366 N.E.2d 652 (1977), an Indiana case applying Witherspoon, as support. ", "Baird does not cite the statute, and Lamar cites the statute without quoting the language of subsection (3). ", "Lamar instead cites and applies Witherspoon. ", "As explained above, the federal constitutional standard of Witherspoon has been replaced by Witt. ", "Moreover, Baird did not purport to be interpreting the statute.", "\n[13] As the State points out, even if a trial court erroneously refuses to remove for cause jurors who declare that they will vote to impose death automatically, a death sentence may be affirmed if the jurors were nevertheless removed through the use of peremptory challenges. ", "See Ross v. Oklahoma, 487 U.S. 81, 108 S.Ct. ", "2273, 101 L.Ed.2d 80 (1988). ", "The relevant inquiry is whether any such jurors sat on the jury which ultimately sentenced the defendant to death. ", "Id. at 85-86, 108 S.Ct. ", "2273. ", "In Dye's case, both jurors were excused through the use of peremptory challenges and he does not contend that the use of these challenges prevented him from excusing other prospective jurors who would have voted to impose death automatically.", "\n[14] It was later revealed during voir dire that one of the eighteen was mentally handicapped and had erroneously listed her race as African-American.", "\n[15] In addition, this Court has expressed approval of the use of voter registration lists from which to select a pool of prospective jurors. ", "See, e.g., Fields v. State, 679 N.E.2d 1315, 1318 (Ind.1997); Bradley v. State, 649 N.E.2d 100, 104-05 (Ind.1995); Concepcion v. State, 567 N.E.2d 784, 788 (Ind.1991) (citing Burgans v. State, 500 N.E.2d 183 (Ind. 1986)); Smith v. State, 475 N.E.2d 1139, 1142-43 (Ind.1985).", "\n[16] In his reply brief, Dye asks that this Court take judicial notice of the results of a not-yet-completed study in a pending capital case that examines the possible systematic exclusion of African Americans from jury venires in Marion County. ", "Evidence Rule 201(a) permits courts to take judicial notice of a fact that is \"not subject to reasonable dispute in that it is either (1) generally known within the territorial jurisdiction of the trial court, or (2) capable of accurate and ready determination by resort to sources whose accuracy cannot reasonably be questioned.\" ", "The study alluded to here is not a proper subject of judicial notice. ", "According to the limited information in the reply brief, the study has taken weeks or months and a similar study has never before been done. ", "Its subject matter is neither \"generally known\" within the jurisdiction nor do the conclusions of such a study seem to be \"capable of accurate and ready determination\" by resort to sources that cannot be reasonably questioned.", "\n[17] This language was added to the statute in 1993. ", "See Pub.", "L. 250-1993, § 2, 1993 Ind. Acts 4481.", "\n[18] Dye concedes that giving an instruction that tells the jury that the governor has the power to commute a sentence does not violate the Eighth Amendment, applicable to the states through the Fourteenth Amendment. ", "See California v. Ramos, 463 U.S. 992, 103 S.Ct. ", "3446, 77 L.Ed.2d 1171 (1983).", "\n[19] \"The Governor may grant reprieves, commutations, and pardons, after conviction, for all offenses except treason and cases of impeachment, subject to such regulations as may be provided by law.\" ", "IND. ", "CONST. ", "art. ", "V, § 17. ", "Such applications are to be filed with the parole board, which shall make a recommendation to the Governor after (1) notifying (A) the sentencing court, (B) the victim of the crime or next of kin, and (C) the prosecuting attorney for the county where the conviction was obtained and (2) conducting an investigation and (3) hearing. ", "IND.CODE § 11-9-2-1 to -2 (1998).", "\n[20] The State also alleged, on a separate charging instrument filed on the same day, that Dye killed Lawrence after murdering Hannah. ", "However, the jury was not presented with this second aggravating circumstance nor did the trial court make any mention of it in its sentencing statement or sentencing order.", "\n[21] A Marion County probation officer testified that Dye was compliant during his probationary sentence for a Class A misdemeanor battery offense against Myrna. \"", "He did what he was supposed to do. ", "He finished his counseling and he paid his money and he kept his appointments.\" ", "Dr. Odie Bracy, III, a clinical neuropsychologist, testified that overall Dye \"presented fairly normally.... [H]e was very cooperative, very friendly, presented no problems whatsoever during the entire day.... He showed a good capability to learn, to comprehend, to follow instructions, and exhibited an excellent memory.\" ", "Three Marion County corrections' officers testified that they had never had any problems with Dye during his pretrial incarceration. ", "Finally, a public information officer from the Department of Correction testified that 186 of the 1536 men serving sentences in the general prison population for murder were convicted of multiple killings. ", "She testified that twenty-seven of the fifty men on death row were there for multiple murders. ", "On cross-examination the witness testified that multiple murder means two or more and that she did not have the statistics for those who committed three murders.", "\n[22] The trial court found that the State had proven the aggravating circumstance beyond a reasonable doubt and found as a mitigating circumstance that \"[a]lthough he defendant's history of prior criminal conduct cannot be considered significant, the circumstances surrounding [his] battery conviction [against Myrna in 1992 was] significant.\"", "\n[23] Dye contends that the evidence \"presented to the jury primarily painted [him] as an average Joe with no serious psychopathology.\" ", "He points to his stable work history, compliance with probation terms and corrections officers while awaiting trial, his brother's testimony that he was not capable of the killings, and a letter from his daughter telling him that she missed and loved him. ", "However, Dye points to only one potentially mitigating circumstance alleged to have been overlooked by the trial court based on this evidence. ", "Citing Skipper v. South Carolina, 476 U.S. 1, 106 S.Ct. ", "1669, 90 L.Ed.2d 1 (1986), he contends that the trial court apparently overlooked the testimony from corrections officers about his compliant behavior because \"it does not appear in [the] sentencing order.\" ", "In Skipper, the Supreme Court held that it was error for a state trial court to exclude the testimony of jailers and a \"`regular visitor' to the jail to the effect that petitioner had `made a good adjustment' during his time spent in jail.\" ", "Id. at 3, 106 S.Ct. ", "1669. ", "The Court observed that the exclusion of this \"relevant mitigating evidence impeded the sentencing jury's ability to carry out its task of considering all relevant facets of the character and record of the individual offender.\" ", "Id. at 8, 106 S.Ct. ", "1669. ", "Unlike Skipper's jury, Dye's jury heard this testimony and nevertheless recommended that death be imposed. ", "Skipper presents no basis for reversal here.", "\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0.0007156735518947244, 0.0013787426287308335, 0.0010224676225334406, 0.0008363580564036965, 0.000686268846038729, 0.0006613541627302766, 0.0006523985066451132, 0.0008680815226398408, 0.0012996310833841562, 0.009682211093604565, 0.0011624187463894486, 0.0005888380110263824, 0.0006434792303480208, 0.0031239232048392296, 0.000643822131678462, 0.0007434159051626921, 0.03272160515189171, 0.6668826937675476, 0.001328381011262536, 0.0009103266056627035, 0.0007392068509943783, 0.0011902267578989267, 0.0007444492075592279, 0.004889849107712507, 0.0012630268465727568, 0.0010515220928937197, 0.0007482963846996427, 0.004467898514121771, 0.0012097330763936043, 0.05424782261252403, 0.0012337873922660947, 0.01704929582774639, 0.02206145040690899, 0.0006750159664079547, 0.0009320669923909009, 0.014225033111870289, 0.01882287673652172, 0.07327677309513092, 0.0006674352916888893, 0.000706597464159131, 0.0008985204622149467, 0.006127408239990473, 0.000958325166720897, 0.0019897872116416693, 0.0017527870368212461, 0.0011028880253434181, 0.002755396533757448, 0.0009350908803753555, 0.0011631076922640204, 0.00595431961119175, 0.03643058240413666, 0.0006902825552970171, 0.0008723654318600893, 0.0006624331581406295, 0.0007092890446074307, 0.0006072040414437652, 0.0008388070273213089, 0.0008309780969284475, 0.0007419278263114393, 0.0013547607231885195, 0.001207446213811636, 0.0005897849914617836, 0.0008581096190027893, 0.0006008758791722357, 0.0009959712624549866, 0.0010418950114399195, 0.000809544580988586, 0.0007176757208071649, 0.000642400118522346, 0.0012679591309279203, 0.0006458634161390364, 0.0006013471283949912, 0.00060272280825302, 0.000661293335724622, 0.0006874940008856356, 0.0006099856691434979, 0.0009045613696798682, 0.0011518998071551323, 0.0006276117055676877, 0.000580662046559155, 0.0009740878595039248, 0.0007671100320294499, 0.0007469345582649112, 0.0006458581774495542, 0.000590053794439882, 0.0006094385753385723, 0.0008059988031163812, 0.0007336309063248336, 0.0036277403123676777, 0.0008266611839644611, 0.0011419648071750998, 0.0006139500765129924, 0.0006064908811822534, 0.0006225959514267743, 0.00158500496763736, 0.0005717991734854877, 0.0006178854964673519, 0.0007230123155750334, 0.0006887140916660428, 0.0005396287888288498, 0.0005968897603452206, 0.0005322883953340352, 0.0006534081185236573, 0.0008871584432199597, 0.000972030742559582, 0.0008210422820411623, 0.008054768666625023, 0.0007058476912789047, 0.0007825862849131227, 0.0006231501465663314, 0.0006543946801684797, 0.0005754102603532374, 0.000771326245740056, 0.0007069783750921488, 0.0007360955933108926, 0.0011337024625390768, 0.0006588835967704654, 0.0007519233622588217, 0.0008538637775927782, 0.0005516270757652819, 0.0006861390429548919, 0.0007713005179539323, 0.001004118355922401, 0.002358421916142106, 0.0007731122896075249, 0.0008668081136420369, 0.02692258730530739, 0.0006446390179917216, 0.004775229375809431, 0.005101408343762159, 0.5962364673614502, 0.0011270124232396483, 0.0007305628387257457, 0.000739279028493911, 0.0006791072664782405, 0.0005881828255951405, 0.0008642812608741224, 0.0006471280939877033, 0.0006318369414657354, 0.000877780606970191, 0.0007805909845046699, 0.0007967599085532129, 0.0007382800686173141, 0.0006393407238647342, 0.0008077480015344918, 0.0008745764498598874, 0.0008132809307426214, 0.0008666235371492803, 0.0006904714391566813, 0.0006196467438712716, 0.0008804308599792421, 0.0008018249063752592, 0.0006874680984765291, 0.0009006439941003919, 0.0011651358800008893, 0.000658265664242208, 0.0008535681408829987, 0.0008556906832382083, 0.0008917782688513398, 0.0005723594804294407, 0.0008104047738015652, 0.0009559987229295075, 0.0009260053629986942, 0.0006770880427211523, 0.0009881769074127078, 0.0009152822894975543, 0.0012531249085441232, 0.0012426747707650065, 0.0009172693244181573, 0.0007822142797522247, 0.0010536124464124441, 0.008731109090149403, 0.0032729716040194035, 0.001011706655845046, 0.0009377108071930707, 0.0011848864378407598, 0.0009392039501108229, 0.0008176612318493426, 0.0009234563913196325, 0.0008437675423920155, 0.0007180396933108568, 0.000666617532260716, 0.0009134862921200693, 0.0010032347636297345, 0.0006829173071309924, 0.000700918841175735, 0.0008372287848033011, 0.0006857579573988914, 0.0014053219929337502, 0.0008525349549017847, 0.0009165528463199735, 0.0008051693439483643, 0.0007323204772546887, 0.0009275029296986759, 0.0008029657183215022, 0.0006170621491037309, 0.0006577677559107542, 0.0045555061660707, 0.000864154368173331, 0.0007796491263434291, 0.0007928159320726991, 0.0007356537971645594, 0.0007611383334733546, 0.001978863263502717, 0.0006361681153066456, 0.032640740275382996, 0.0008180029108189046, 0.0009481004090048373, 0.0033351487945765257, 0.0008548956830054522, 0.0011860732920467854, 0.0008248580852523446, 0.0008507804595865309, 0.002111939713358879, 0.0009486940689384937, 0.0007331513916142285, 0.0008019781671464443, 0.000918954552616924, 0.001096988096833229, 0.0007566776475869119, 0.0005958689143881202, 0.0010631269542500377, 0.000889748043846339, 0.0009830002672970295, 0.0008536290843039751, 0.0008868647855706513, 0.0008801021031104028, 0.0007222858257591724, 0.0011151231592521071, 0.000771618913859129, 0.0013267808826640248, 0.0007514409953728318, 0.0006094701820984483, 0.0007598918164148927, 0.0008054559584707022, 0.000988564919680357, 0.0006340124527923763, 0.0009713686886243522, 0.0007293211529031396, 0.0006879610009491444, 0.0007555068004876375, 0.001034661429002881, 0.0005977930268272758, 0.0006742525147274137, 0.000600079249124974, 0.0006151709822006524, 0.0006320962565951049, 0.0006183084333315492, 0.0009184726513922215, 0.0007445598021149635, 0.0008671411196701229, 0.0008308799006044865, 0.0007521140505559742, 0.0008214202825911343, 0.0010409688111394644, 0.0006960976170375943, 0.0006489682709798217, 0.0008234704146161675, 0.0006562205380760133, 0.0006466397899203002, 0.0007886772509664297, 0.0010927789844572544, 0.0006551991100423038, 0.0006000606808811426, 0.0006236702902242541, 0.0006876689149066806, 0.00165387277957052, 0.0007844966021366417, 0.0013798007275909185, 0.002923537278547883, 0.004677389748394489, 0.0005943289143033326, 0.0010245031444355845, 0.0009543687920086086, 0.0013410859974101186, 0.0007796613499522209, 0.000639957666862756, 0.0005929701728746295, 0.0009276270866394043, 0.0008207301725633442, 0.0007050576969049871, 0.0005874726921319962, 0.0008033766644075513, 0.0011106266174465418, 0.0006511345272883773, 0.002210593316704035, 0.0012611966812983155, 0.0019693109206855297, 0.0006993981078267097, 0.0005915420479141176, 0.046831164509058, 0.0012101797619834542, 0.0005620897281914949, 0.0005973814986646175, 0.0008840833907015622, 0.004581066779792309, 0.0007158376392908394, 0.0007478094776161015, 0.0005981216090731323, 0.000652212998829782, 0.0076280515640974045, 0.0006581731140613556, 0.0006778506212867796, 0.0006103997584432364, 0.0006346774753183126, 0.0005690809339284897, 0.0011163492454215884, 0.0006716822390444577, 0.0019364935578778386, 0.0006298320950008929, 0.0006980221369303763, 0.0010048231342807412, 0.0005955492961220443, 0.0026540071703493595, 0.000669373432174325, 0.001945416908711195, 0.0009084923658519983, 0.002360918326303363, 0.000644292333163321, 0.02074444480240345, 0.0006979453028179705, 0.0010559959337115288, 0.000677027041092515, 0.0011450279271230102, 0.0008241411997005343, 0.000616306031588465, 0.0007811658433638513, 0.0005881066317670047, 0.0007079775677993894, 0.005142954643815756, 0.0005595402326434851, 0.0007522767991758883, 0.0008767704130150378, 0.0007046154350973666, 0.0007101098308339715, 0.0005815656622871757, 0.0016453155549243093, 0.0005529746413230896, 0.03115132451057434, 0.0008817846537567675, 0.0028726535383611917, 0.24970470368862152, 0.3537435531616211, 0.10311750322580338, 0.000709769141394645, 0.0006661043153144419, 0.0005896332440897822, 0.0006584322545677423, 0.0006175869493745267, 0.0007315333350561559, 0.0006284350529313087, 0.0006356078665703535, 0.0005544032901525497, 0.0008657454163767397, 0.0007412197301164269, 0.0006179938209243119, 0.0006603921065106988, 0.000736087211407721, 0.0006963468040339649, 0.0006258445791900158, 0.0006956632132641971, 0.0007485831738449633, 0.0007015496958047152, 0.0006477105198428035, 0.0006444363389164209, 0.0005775085301138461, 0.0007942107040435076, 0.0006551481783390045, 0.0009301441605202854, 0.0006819413974881172, 0.0008892709156498313, 0.0009767867159098387, 0.0005981369758956134, 0.0007448071846738458, 0.0008537198300473392, 0.0006094652926549315, 0.000820010609459132, 0.0008659599116072059, 0.000824671471491456, 0.000761315634008497, 0.0006729175802320242, 0.0013782948954030871, 0.0006441946607083082, 0.0010894715087488294, 0.0008420447702519596, 0.0007836195291019976, 0.0014948059106245637, 0.0007384120253846049, 0.000710932828951627, 0.0011323580984026194, 0.0009014492970891297, 0.00104774278588593, 0.002240848960354924, 0.022081850096583366, 0.0006435976247303188, 0.0008016201318241656, 0.0006477892748080194, 0.0005829717265442014, 0.0007100214716047049, 0.0005488047609105706, 0.0006030267686583102, 0.0005659201415255666, 0.0007625718135386705, 0.0007057033944875002, 0.0006970196845941246, 0.0007765404297970235, 0.0007296514231711626, 0.0009056924609467387, 0.0010074308374896646, 0.0009543687920086086, 0.0013410859974101186, 0.0008511542691849172, 0.0006925350753590465, 0.0006533788982778788, 0.008931312710046768, 0.000813950493466109, 0.0010381952160969377, 0.0012554952409118414, 0.0009851317154243588, 0.001093262224458158, 0.000890685711055994, 0.0009007963817566633, 0.0026718887966126204, 0.0007600840763188899, 0.0008394038886763155, 0.0019280764972791076, 0.0006605969392694533, 0.0006484986515715718, 0.0007778009166941047, 0.0007009946275502443, 0.0007342271856032312, 0.0009454835089854896, 0.0010362752946093678, 0.000684424361679703, 0.0009368305909447372, 0.0010362752946093678, 0.008085468783974648, 0.0007125379634089768, 0.001994825666770339 ]

[ "Microsurgical epididymovasostomy.", "\nEpididymal obstruction is found in about 30% of obstructive azoospermic patients. ", "Half of these obstructions are due to unknown etiologies, followed by obstruction due to epididymitis. ", "The development of a specific, mucosa-to-mucosa anastomosis of the epididymal tubule to the vasal mucosa using a surgical microscopy has greatly improved the outcome of epididymovasostomy. ", "The patency and natural pregnancy rates in this study were 79% and 38%, respectively. ", "Side-to-end anastomosis also decreases the technical difficulty in comparison to the end-to-end anastomosis procedure. ", "An anastomosis at the epididymal caput generally results in a poorer outcome than at the corpus or cauda epididymis." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0009622088982723653, 0.0028442912735044956, 0.0010027106618508697, 0.0030113093089312315, 0.0006178489420562983, 0.002310964511707425, 0.0013360172742977738 ]

[ "Atlantic Beach, South Carolina\n\nAtlantic Beach is a town in Horry County, South Carolina, United States. ", "The population was 334 at the 2010 census. ", "Most of the land around the town is annexed into the city of North Myrtle Beach.", "\n\nHistory\nAtlantic Beach is commonly nicknamed \"The Black Pearl\", the rich culture of the town of Atlantic Beach was formed of mostly Gullah people, descendants of slaves who lived for 300 years on the Sea Islands from Wilmington, North Carolina to Jacksonville, Florida. ", "In the early 1930s, defying Jim Crow laws in the segregated south, debunking black stereotypes, and broadening the enterprises of the Gullah people, black men and women opened hotels, restaurants, night clubs, and novelty shops in Atlantic Beach. ", "They would travel along Interstate 95, US 17 and SC 9, coming from nearby southern states, where racial segregation took its toll.", "\n\nGeography\nAtlantic Beach is located at . ", "According to the United States Census Bureau, the town has a total area of , all land.", "\n\nDemographics\n\nAs of the census of 2000, there were 351 people, 132 households, and 83 families residing in the town. ", "The population density was 2,214.5 people per square mile (847.0/km2). ", "There were 244 housing units at an average density of 1,539.4 per square mile (588.8/km2). ", "The racial makeup of the town was 9.69% White, 82.05% African American, 7.12% from other races, and 1.14% from two or more races. ", "Hispanic or Latino of any race were 9.97% of the population.", "\n\nThere were 132 households out of which 39.4% had children under the age of 18 living with them, 18.9% were married couples living together, 37.1% had a female householder with no husband present, and 36.4% were non-families. ", "29.5% of all households were made up of individuals and 6.8% had someone living alone who was 65 years of age or older. ", "The average household size was 2.66 and the average family size was 3.17.", "\n\nIn the town, the population was spread out with 29.6% under the age of 18, 9.7% from 18 to 24, 36.2% from 25 to 44, 15.1% from 45 to 64, and 9.4% who were 65 years of age or older. ", "The median age was 30 years. ", "For every 100 females, there were 98.3 males. ", "For every 100 females age 18 and over, there were 93.0 males.", "\n\nThe median income for a household in the town was $24,375, and the median income for a family was $20,313. ", "Males had a median income of $16,477 versus $17,000 for females. ", "The per capita income for the town was $12,492. ", "About 31.3% of families and 27.6% of the population were below the poverty line, including 37.0% of those under age 18 and 27.6% of those age 65 or over.", "\n\nReferences\n\nExternal links\n\nCategory:Towns in Horry County, South Carolina\nCategory:Towns in South Carolina" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0010158645454794168, 0.000645333668217063, 0.0007201496628113091, 0.0007524946704506874, 0.007175683043897152, 0.002025724621489644, 0.0006049693911336362, 0.0007798853330314159, 0.0006158899632282555, 0.001086296746507287, 0.0012201034696772695, 0.009917864575982094, 0.01371195912361145, 0.0011347623076289892, 0.0021044749300926924, 0.0017599385464563966, 0.002368990099057555, 0.0008878172375261784, 0.011875576339662075, 0.006911986507475376, 0.0006680557853542268, 0.0030022086575627327, 0.0011231369571760297, 0.003487243317067623, 0.0006162584177218378 ]

[ "Cutaneous hemangiosarcoma with pulmonary metastasis in a horse.", "\nA 6-year-old Thoroughbred mare had a 7-cm ulcerated mass on the cranial aspect of the left cervical area. ", "Ultrasonography revealed the mass to be < 1 cm thick and composed of small lobules that were filled by material hypoechoic to the surrounding muscle tissues. ", "Fine-needle aspiration of the mass yielded blood, and cytologic examination revealed a few epithelial cells with neoplastic changes. ", "Thoracic radiography revealed an interstitial pattern with several disseminated nodules. ", "A diagnosis of cutaneous hemangiosarcoma with pulmonary metastases was made. ", "The diagnosis was confirmed at necropsy." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.009239998646080494, 0.0007752251694910228, 0.0007859643083065748, 0.000773980631493032, 0.0006285140989348292, 0.002274348633363843, 0.0007874933071434498 ]

[ "/**\n * Licensed to the Apache Software Foundation (ASF) under one\n * or more contributor license agreements. ", " See the NOTICE file\n * distributed with this work for additional information\n * regarding copyright ownership. ", " The ASF licenses this file\n * to you under the Apache License, Version 2.0 (the\n * \"License\"); you may not use this file except in compliance\n * with the License. ", " You may obtain a copy of the License at\n *\n * http://www.apache.org/licenses/LICENSE-2.0\n *\n * Unless required by applicable law or agreed to in writing, software\n * distributed under the License is distributed on an \"AS IS\" BASIS,\n * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.", "\n * See the License for the specific language governing permissions and\n * limitations under the License.", "\n */\npackage org.apache.hadoop.hdfs.server.namenode;\n\nimport java.io.", "DataInput;\nimport java.io.", "IOException;\nimport java.util.", "ArrayList;\nimport java.util.", "Collection;\nimport java.util.", "Iterator;\nimport java.util.", "LinkedList;\nimport java.util.", "List;\nimport java.util.", "Queue;\nimport java.util.", "Set;\nimport java.util.", "TreeSet;\n\nimport org.apache.hadoop.hdfs.protocol.", "Block;\nimport org.apache.hadoop.hdfs.protocol.", "DatanodeID;\nimport org.apache.hadoop.hdfs.protocol.", "DatanodeInfo;\nimport org.apache.hadoop.hdfs.server.namenode.", "BlocksMap.", "BlockInfo;\nimport org.apache.hadoop.hdfs.server.protocol.", "BlockCommand;\nimport org.apache.hadoop.hdfs.server.protocol.", "DatanodeProtocol;\nimport org.apache.hadoop.io.", "Text;\nimport org.apache.hadoop.io.", "UTF8;\nimport org.apache.hadoop.io.", "WritableUtils;\n\nimport com.taobao.adfs.state.", "StateManager;\n\n/**************************************************\n * DatanodeDescriptor tracks stats on a given DataNode,\n * such as available storage capacity, last update time, etc.,", "\n * and maintains a set of blocks stored on the datanode.", "\n * \n * This data structure is a data structure that is internal\n * to the namenode. ", "It is *not* sent over-the-wire to the Client\n * or the Datnodes. ", "Neither is it stored persistently in the\n * fsImage.", "\n **************************************************/\npublic class DatanodeDescriptor extends DatanodeInfo {\n\n // Stores status of decommissioning.", "\n // If node is not decommissioning, do not use this object for anything.", "\n DecommissioningStatus decommissioningStatus = new DecommissioningStatus();\n\n /** Block and targets pair */\n public static class BlockTargetPair {\n public final Block block;\n public final DatanodeDescriptor[] targets;\n\n BlockTargetPair(Block block, DatanodeDescriptor[] targets) {\n this.block = block;\n this.targets = targets;\n }\n }\n\n /** A BlockTargetPair queue. */", "\n private static class BlockQueue {\n private final Queue<BlockTargetPair> blockq = new LinkedList<BlockTargetPair>();\n\n /** Size of the queue */\n synchronized int size() {\n return blockq.size();\n }\n\n /** Enqueue */\n synchronized boolean offer(Block block, DatanodeDescriptor[] targets) {\n return blockq.offer(new BlockTargetPair(block, targets));\n }\n\n /** Dequeue */\n synchronized List<BlockTargetPair> poll(int numBlocks) {\n if (numBlocks <= 0 || blockq.isEmpty()) { return null; }\n\n List<BlockTargetPair> results = new ArrayList<BlockTargetPair>();\n for (; !", "blockq.isEmpty() && numBlocks > 0; numBlocks--) {\n results.add(blockq.poll());\n }\n return results;\n }\n }\n\n // isAlive == heartbeats.contains(this), This is an optimization, because contains takes O(n) time on Arraylist\n public boolean isAlive = false;\n protected boolean needKeyUpdate = false;\n\n /** A queue of blocks to be replicated by this datanode */\n private BlockQueue replicateBlocks = new BlockQueue();\n /** A queue of blocks to be recovered by this datanode */\n private BlockQueue recoverBlocks = new BlockQueue();\n /** A set of blocks to be invalidated by this datanode */\n private Set<Block> invalidateBlocks = new TreeSet<Block>();\n\n /*\n * Variables for maintaning number of blocks scheduled to be written to\n * this datanode. ", "This count is approximate and might be slightly higger\n * in case of errors (e.g. datanode does not report if an error occurs\n * while writing the block).", "\n */\n private int currApproxBlocksScheduled = 0;\n private int prevApproxBlocksScheduled = 0;\n private long lastBlocksScheduledRollTime = 0;\n private static final int BLOCKS_SCHEDULED_ROLL_INTERVAL = 600 * 1000; // 10min\n private int volumeFailures = 0;\n\n /** Default constructor */\n public DatanodeDescriptor() {\n }\n\n /**\n * DatanodeDescriptor constructor\n * \n * @param nodeID\n * id of the data node\n */\n public DatanodeDescriptor(DatanodeID nodeID) {\n this(nodeID, 0L, 0L, 0L, 0, 0);\n }\n\n /**\n * DatanodeDescriptor constructor\n * \n * @param nodeID\n * id of the data node\n * @param networkLocation\n * location of the data node in network\n */\n public DatanodeDescriptor(DatanodeID nodeID, String networkLocation) {\n this(nodeID, networkLocation, null);\n }\n\n /**\n * DatanodeDescriptor constructor\n * \n * @param nodeID\n * id of the data node\n * @param networkLocation\n * location of the data node in network\n * @param hostName\n * it could be different from host specified for DatanodeID\n */\n public DatanodeDescriptor(DatanodeID nodeID, String networkLocation, String hostName) {\n this(nodeID, networkLocation, hostName, 0L, 0L, 0L, 0, 0);\n }\n\n /**\n * DatanodeDescriptor constructor\n * \n * @param nodeID\n * id of the data node\n * @param capacity\n * capacity of the data node\n * @param dfsUsed\n * space used by the data node\n * @param remaining\n * remaing capacity of the data node\n * @param xceiverCount\n * # of data transfers at the data node\n */\n public DatanodeDescriptor(DatanodeID nodeID, long capacity, long dfsUsed, long remaining, int xceiverCount,\n int failedVolumes) {\n super(nodeID);\n updateHeartbeat(capacity, dfsUsed, remaining, xceiverCount, failedVolumes);\n }\n\n /**\n * DatanodeDescriptor constructor\n * \n * @param nodeID\n * id of the data node\n * @param networkLocation\n * location of the data node in network\n * @param capacity\n * capacity of the data node, including space used by non-dfs\n * @param dfsUsed\n * the used space by dfs datanode\n * @param remaining\n * remaing capacity of the data node\n * @param xceiverCount\n * # of data transfers at the data node\n */\n public DatanodeDescriptor(DatanodeID nodeID, String networkLocation, String hostName, long capacity, long dfsUsed,\n long remaining, int xceiverCount, int failedVolumes) {\n super(nodeID, networkLocation, hostName);\n updateHeartbeat(capacity, dfsUsed, remaining, xceiverCount, failedVolumes);\n }\n\n /**\n * Add data-node to the block.", "\n * Add block to the head of the list of blocks belonging to the data-node.", "\n */\n boolean addBlock(BlockInfo b) {\n // nothing to do for adfs\n return true;\n }\n\n /**\n * Remove block from the list of blocks belonging to the data-node.", "\n * Remove data-node from the block.", "\n */\n boolean removeBlock(BlockInfo b) {\n // nothing to do for adfs\n return true;\n }\n\n /**\n * Move block to the head of the list of blocks belonging to the data-node.", "\n */\n void moveBlockToHead(BlockInfo b) {\n // nothing to do for adfs\n }\n\n void resetBlocks() {\n this.capacity = 0;\n this.remaining = 0;\n this.dfsUsed = 0;\n this.xceiverCount = 0;\n this.invalidateBlocks.clear();\n this.volumeFailures = 0;\n }\n\n public int numBlocks() throws IOException {\n // TODO: should be optimized\n return -1;\n }\n\n /**\n */\n void updateHeartbeat(long capacity, long dfsUsed, long remaining, int xceiverCount, int volFailures) {\n this.capacity = capacity;\n this.dfsUsed = dfsUsed;\n this.remaining = remaining;\n this.lastUpdate = System.currentTimeMillis();\n this.xceiverCount = xceiverCount;\n this.volumeFailures = volFailures;\n rollBlocksScheduled(lastUpdate);\n }\n\n /**\n * Store block replication work.", "\n */\n void addBlockToBeReplicated(Block block, DatanodeDescriptor[] targets) {\n assert (block !", "= null && targets !", "= null && targets.length > 0);\n replicateBlocks.offer(block, targets);\n }\n\n /**\n * Store block recovery work.", "\n */\n void addBlockToBeRecovered(Block block, DatanodeDescriptor[] targets) {\n assert (block !", "= null && targets !", "= null && targets.length > 0);\n recoverBlocks.offer(block, targets);\n }\n\n /**\n * Store block invalidation work.", "\n */\n void addBlocksToBeInvalidated(List<Block> blocklist) {\n assert (blocklist !", "= null && blocklist.size() > 0);\n synchronized (invalidateBlocks) {\n for (Block blk : blocklist) {\n invalidateBlocks.add(blk);\n }\n }\n }\n\n /**\n * The number of work items that are pending to be replicated\n */\n int getNumberOfBlocksToBeReplicated() {\n return replicateBlocks.size();\n }\n\n /**\n * The number of block invalidation items that are pending to\n * be sent to the datanode\n */\n int getNumberOfBlocksToBeInvalidated() {\n synchronized (invalidateBlocks) {\n return invalidateBlocks.size();\n }\n }\n\n BlockCommand getReplicationCommand(int maxTransfers) {\n List<BlockTargetPair> blocktargetlist = replicateBlocks.poll(maxTransfers);\n return blocktargetlist == null ? ", "null : new BlockCommand(DatanodeProtocol.", "DNA_TRANSFER, blocktargetlist);\n }\n\n BlockCommand getLeaseRecoveryCommand(int maxTransfers) {\n List<BlockTargetPair> blocktargetlist = recoverBlocks.poll(maxTransfers);\n return blocktargetlist == null ? ", "null : new BlockCommand(DatanodeProtocol.", "DNA_RECOVERBLOCK, blocktargetlist);\n }\n\n /**\n * Remove the specified number of blocks to be invalidated\n */\n BlockCommand getInvalidateBlocks(int maxblocks) {\n Block[] deleteList = getBlockArray(invalidateBlocks, maxblocks);\n return deleteList == null ? ", "null : new BlockCommand(DatanodeProtocol.", "DNA_INVALIDATE, deleteList);\n }\n\n static private Block[] getBlockArray(Collection<Block> blocks, int max) {\n Block[] blockarray = null;\n synchronized (blocks) {\n int available = blocks.size();\n int n = available;\n if (max > 0 && n > 0) {\n if (max < n) {\n n = max;\n }\n // allocate the properly sized block array ...\n blockarray = new Block[n];\n\n // iterate tree collecting n blocks...\n Iterator<Block> e = blocks.iterator();\n int blockCount = 0;\n\n while (blockCount < n && e.hasNext()) {\n // insert into array ...\n blockarray[blockCount++] = e.next();\n\n // remove from tree via iterator, if we are removing\n // less than total available blocks\n if (n < available) {\n e.remove();\n }\n }\n assert (blockarray.length == n);\n\n // now if the number of blocks removed equals available blocks,\n // them remove all blocks in one fell swoop via clear\n if (n == available) {\n blocks.clear();\n }\n }\n }\n return blockarray;\n }\n\n /** Serialization for FSEditLog */\n void readFieldsFromFSEditLog(DataInput in) throws IOException {\n this.name = UTF8.readString(in);\n this.storageID = UTF8.readString(in);\n this.infoPort = in.readShort() & 0x0000ffff;\n\n this.capacity = in.readLong();\n this.dfsUsed = in.readLong();\n this.remaining = in.readLong();\n this.lastUpdate = in.readLong();\n this.xceiverCount = in.readInt();\n this.location = Text.readString(in);\n this.hostName = Text.readString(in);\n setAdminState(WritableUtils.readEnum(in, AdminStates.class));\n }\n\n /**\n * @return Approximate number of blocks currently scheduled to be written\n * to this datanode.", "\n */\n public int getBlocksScheduled() {\n return currApproxBlocksScheduled + prevApproxBlocksScheduled;\n }\n\n /**\n * Increments counter for number of blocks scheduled.", "\n */\n void incBlocksScheduled() {\n currApproxBlocksScheduled++;\n }\n\n /**\n * Decrements counter for number of blocks scheduled.", "\n */\n void decBlocksScheduled() {\n if (prevApproxBlocksScheduled > 0) {\n prevApproxBlocksScheduled--;\n } else if (currApproxBlocksScheduled > 0) {\n currApproxBlocksScheduled--;\n }\n // its ok if both counters are zero.", "\n }\n\n /**\n * Adjusts curr and prev number of blocks scheduled every few minutes.", "\n */\n private void rollBlocksScheduled(long now) {\n if ((now - lastBlocksScheduledRollTime) > BLOCKS_SCHEDULED_ROLL_INTERVAL) {\n prevApproxBlocksScheduled = currApproxBlocksScheduled;\n currApproxBlocksScheduled = 0;\n lastBlocksScheduledRollTime = now;\n }\n }\n\n class DecommissioningStatus {\n int underReplicatedBlocks;\n int decommissionOnlyReplicas;\n int underReplicatedInOpenFiles;\n long startTime;\n\n synchronized void set(int underRep, int onlyRep, int underConstruction) {\n if (isDecommissionInProgress() == false) { return; }\n underReplicatedBlocks = underRep;\n decommissionOnlyReplicas = onlyRep;\n underReplicatedInOpenFiles = underConstruction;\n }\n\n synchronized int getUnderReplicatedBlocks() {\n if (isDecommissionInProgress() == false) { return 0; }\n return underReplicatedBlocks;\n }\n\n synchronized int getDecommissionOnlyReplicas() {\n if (isDecommissionInProgress() == false) { return 0; }\n return decommissionOnlyReplicas;\n }\n\n synchronized int getUnderReplicatedInOpenFiles() {\n if (isDecommissionInProgress() == false) { return 0; }\n return underReplicatedInOpenFiles;\n }\n\n synchronized void setStartTime(long time) {\n startTime = time;\n }\n\n synchronized long getStartTime() {\n if (isDecommissionInProgress() == false) { return 0; }\n return startTime;\n }\n } // End of class DecommissioningStatus\n\n /**\n * @return number of failed volumes in the datanode.", "\n */\n public int getVolumeFailures() {\n return volumeFailures;\n }\n\n /**\n * @param nodeReg\n * DatanodeID to update registration for.", "\n */\n public void updateRegInfo(DatanodeID nodeReg) {\n super.updateRegInfo(nodeReg);\n }\n\n StateManager getStateManager() {\n return FSNamesystem.getFSStateManager();\n }\n}\n" ]

{ "pile_set_name": "Github" }

[ 0.0006217397167347372, 0.0005401495727710426, 0.0005986080504953861, 0.0005520833656191826, 0.0005548830376937985, 0.0008792848675511777, 0.0009158183820545673, 0.0011156512191519141, 0.0008216958376578987, 0.0008227751241065562, 0.0010193765629082918, 0.0007929761195555329, 0.0008456312352791429, 0.0007924647652544081, 0.001062098890542984, 0.0008409778820350766, 0.0025606444105505943, 0.0007938051130622625, 0.0010750038782134652, 0.001309761544689536, 0.0017585986061021686, 0.0010673184879124165, 0.0008669238304719329, 0.0008044265559874475, 0.0008130911737680435, 0.0008668751106597483, 0.0051868329755961895, 0.0007940741488710046, 0.0007619321695528924, 0.0012075072154402733, 0.077797532081604, 0.005530489142984152, 0.0009627623949199915, 0.005566223058849573, 0.016915468499064445, 0.009116198867559433, 0.0012315636267885566, 0.01200868096202612, 0.00559229776263237, 0.0024858296383172274, 0.0011991753708571196, 0.00549321947619319, 0.009026576764881611, 0.00618572486564517, 0.011633707210421562, 0.001187633373774588, 0.005725079216063023, 0.011633707210421562, 0.0016451675910502672, 0.0026581629645079374, 0.010758811607956886, 0.003646797500550747, 0.016628112643957138, 0.003646797500550747, 0.017983751371502876, 0.003646797500550747, 0.008508832193911076, 0.0023744869977235794, 0.002778282854706049, 0.006303468719124794, 0.012496200390160084, 0.01183654461055994, 0.000942282029427588, 0.006269427016377449 ]

[ "Unique puzzler ‘Fearful Symmetry’ arrives on Xbox One and PC\n\nWhat You Need to Know:\n\nEarlier today, SOEDESCO announced that 2D puzzler Fearful Symmetry & The Cursed Prince will be making its way to the Xbox One store, Steam and Windows 10 on 12 December 2017.", "\n\nFearful Symmetry & The Cursed Prince will be available as an Xbox Play Anywhere title across the entire Xbox One family of devices, including Xbox One X and Windows 10.", "\n\nTo view the trailer and know more about the gameplay, be sure to scroll down below!", "\n\nSource: Official Press Release\n\nGameplay Overview\n\nFearful Symmetry & The Cursed Prince is a puzzle game with a unique brain-teasing twist. ", "Players control two characters at the same time, each in a different dimension; one representing good and one representing evil. ", "This contradiction is not only reflected in the visual style of the game, but also in the gameplay. ", "The characters each move in the opposite direction through treacherous levels filled with traps. ", "It’s up to the player to find a safe path in both dimensions and guide the characters safely through the many levels.", "\n\nControl two characters simultaneously and guide them to safety\n\nOvercome deadly traps while making your way through 30+ levels\n\nDiscover hidden secrets on your journey through the dimensions\n\nGet creative, to figure out the optimal path to reach your goal\n\nEnjoy a timeless pixel art style reminiscent of a classic era of games\n\nOfficial Trailer\n\nFearful Symmetry & The Cursed Prince - Announcement Trailer - ESRB\n\nThis looks really interesting. ", "Controlling two characters at the same time sounds real challenging yet rewarding!", "\n\nKind of reminds me of Link and the Four Swords where you had to take control of each Link in order to solve puzzles. ", "I may try this one out!" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006211530417203903, 0.0008687028312124312, 0.0006146878004074097, 0.0007401200127787888, 0.000999154639430344, 0.0006134277209639549, 0.0006655117031186819, 0.0006411349750123918, 0.001086608273908496, 0.0006083736079744995, 0.0007010868284851313, 0.0007489677518606186 ]

[ "Role of experience and context in learning to diagnose Lyme disease.", "\nA recent review of research in continuing medical education suggests that scholarship should be integrated with practice so that practical problems can be addressed with theoretically derived yet applicable solutions. ", "This project develops a theory describing how physicians learn and formulate decisions in the context of diagnosing Lyme disease in order that educational programs can be designed to improve accuracy in diagnosis of this disease. ", "A qualitative study using grounded theory methodology was performed to explore the learning process of physicians when diagnosing Lyme disease. ", "Nine physicians were interviewed, and the interview transcripts were coded into categories to form a theory about how physicians learn in practice. ", "Patient-physician interactions initiate the learning process by setting a context for which physicians frame a problem according to familiarity. ", "Repetitive, similar, and counter-experiences, combined with cognitive knowledge, contribute to that framework and influence how the problem is framed along a continuum of familiarity. ", "Furthermore, these experiences serve as information that influences diagnostic decisions and physicians' behaviors. ", "For teaching and learning, cases and examples should include sufficient variety, repetition, and counterexperiences that allow a physician to appropriately recognize and categorize a patient's signs and symptoms into a disease category. ", "Resources for information should be readily available and current. ", "Preceptors and physician colleagues should provide timely feedback on diagnostic accuracy, and case studies should be presented with contextual elements that facilitate the diagnosis of Lyme disease." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006267963326536119, 0.0005401724483817816, 0.0006594021688215435, 0.0006111812544986606, 0.0006200236384756863, 0.00061054463731125, 0.000554945960175246, 0.0005615261034108698, 0.000589521718211472, 0.0005339339841157198, 0.0005311511340551078 ]

[ "[Increase in heat production by muscle contraction caused by 2,4-dinitrophenol].", "\nBy means of a highly sensitive thermometric method (1.10--50 C/mm) it was possible to demonstrate that the heat production during a single contraction of the isolated rat diaphragm increased under the influence of 2,4-dinitrophenol (DNP). ", "Low DNP concentrations failed to produce any manifest changes in the resting muscle, but its action was distinct during contraction. ", "With the same muscle contraction force DNP action was followed by an increase (about 1 1/2-fold) of heat production. ", "This fact confirmed a supposition on the leading role of oxidation and phosphorylation uncoupling in the muscle cell respiratory chain in the increase of muscle contraction heat production in the animals after cold adaptation." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0007522118394263089, 0.0008290020632557571, 0.0006359811522997916, 0.0006208535633049905, 0.0006256629712879658 ]

[ "Q:\n\nHow do you login with node-irc?", "\n\nIt is extremely easy to setup and it works fine. ", "But nowhere in the documentation does it say how to \n/msg nickserv identify <pword>\n\nThe closest I could find was \nclient.join('#yourchannel yourpass');\n\nor maybe\nFor any commands that there aren’t methods for you can use the send() method which sends raw messages to the server\nclient.send('MODE', '#yourchannel', '+o', 'yournick');\n\nbut neither seems to get the job done.", "\n\nA:\n\nclient.say(\"nickserv\", \"identify <pword>\"); doesn't work? ", "The API says it should.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0008547799661755562, 0.0005564316525124013, 0.0009314012713730335, 0.0007026801467873156, 0.000720864802133292, 0.001994825666770339 ]

[ "[Not Available].", "\nThe proton concentration resulting from the dissociation of a moderately strong dibasic acid can be precisely determined by means of an acid-base indicator by differential spectrophotometry. ", "The dissociation constants are then calculated by linear regression of the appropriate function. ", "The method was tested on the first two dissociation constants of protonated O-phosphoserine in aqueous solution (25 degrees , KNO(3) 0.1M): the values found are pK(1) = 0.72 (3sigma = 0.08) and pK(2) = 2.14(6) (3sigma = 0.01)." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006217613117769361, 0.0005998688284307718, 0.0006204767269082367, 0.0007394343847408891 ]

[ "Q:\n\nphonegap/cordova - ios - window display shrinks (changes height) - a white line appear in the bottom\n\nI have the strangest thing - I'm using phonegap/cordova 3.3 - ios\nEvery time I use a plugin that is using the display, e.g. camera, video, scanner,\nthe window display shrinks and a white line appear in the bottom of the screen.", "\nIf I uses the plugin several times (e.g. take a few photo) the window is just keep getting smaller and smaller.", "\nIt happens both with phonegap 2.9, and 3.3, only in ios.", "\n\nA:\n\nI had the same problem, with the exact same issue.", "\nHere is how I went about solving it (and now it works):\nI reverted back the viewWillAppear function/method as it was before:\n- (void)viewWillAppear:(BOOL)animated\n{\n // View defaults to full size. ", " If you want to customize the view's size, or its subviews (e.g. webView),\n // you can do so here.", "\n //Lower screen 20px on ios 7\n /*\n if ([[[UIDevice currentDevice] systemVersion] floatValue] >= 7) {\n CGRect viewBounds = [self.webView bounds];\n viewBounds.origin.y = 20;\n viewBounds.size.height = viewBounds.size.height - 20;\n self.webView.frame = viewBounds;\n }\n */\n [super viewWillAppear:animated];\n\n}\n\nand instead went on changing a different function, viewDidLoad, to the following:\n- (void)viewDidLoad\n{\n [super viewDidLoad];\n // Do any additional setup after loading the view from its nib.", "\n\n if ([[[UIDevice currentDevice] systemVersion] floatValue] >= 7) {\n CGRect viewBounds = [self.webView bounds];\n viewBounds.origin.y = 20;\n viewBounds.size.height = viewBounds.size.height - 20;\n self.webView.frame = viewBounds;\n }\n\n self.view.backgroundColor = [UIColor blackColor];\n}\n\nThe difference here is, that the viewDidLoad will be executed only once (what you actually want), while viewWillAppear is executed EVERY time this view is shown/presented to the user.", "\nI hope this helps.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007230619667097926, 0.0006346536101773381, 0.0006137461750768125, 0.0007231509080156684, 0.0008063275599852204, 0.0005603114259429276, 0.0008911751210689545, 0.0008979851845651865, 0.000589175964705646, 0.001994825666770339 ]

[ "Villa Markos Studios and Apartments\n\nBook this hotel in\nPerissa, Santorini, Greece.", "\n\nPhotos of the 3* Villa Markos Studios and Apartments\n\nAbout the 3* Villa Markos Studios and Apartments\n\nVilla Marcos Studios & Apartments are a family run complex comprising of two pleasantly furnished buildings situated either side of a narrow road. ", "Conveniently located approximately 100 metres from the black sandy beach, the Villa Marcos are simple in style and best for those who are seeking a tranquil beach based holiday.", "Please note: Due to the location of this property it is not suitable for guests with wheelchairs." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005777245969511569, 0.0006203788798302412, 0.0006664879620075226, 0.0016385400667786598 ]

[ "Q:\n\nHow do I find the first struct where a particular member has a specific value?", "\n\nBackground\nI have a data vector, called STRUCT_A that contains the following structs. ", " Each of these structs have sub values that are populated from a Jenkins build at random. ", " Below is an example of one instance of this data vector:\nBEGIN STRUCT for STRUCT_A\n somemember_: 4\n anothermember_: 3\n location_: \"New York\"\nEND STRUCT for STRUCT _A\n\nBEGIN STRUCT for STRUCT_A\n somemember_: 6\n anothermember_: 123\n location_: \"South Bend\"\nEND STRUCT for STRUCT_A\n\nBEGIN STRUCT for STRUCT_A\n somemember_: 10\n anothermember_: 6\n location_: \"Baton Rouge\"\nEND STRUCT for STRUCT_A\n\nYou can access any particular member with the following syntax: STRUCT_A.anothermember(2) will return 123 for example.", "\nProblem and attempted solution\nI want to find the very first struct where a 1 occurs in the anothermember_: member, then return the value of somemember_ in that very same struct. ", " I have done some research on the find command, but this focuses on members of one vector. ", "My situation deals with structs that have multiple members. ", "Below is the closest example of what I am trying to do:\n\nThe picture above shows a 4-by-4 magic square matrix called X. What I am trying to do in the example above is find the first 2 in the matrix, which in this case is located at position five. ", "Where this 2 is located will change each time the Jenkins build is run. ", "The example above deals with the first half of my broader issue. ", "However, I am not sure how to translate this method into a struct, hence my question...\nQuestion\nHow do I find the first struct where a a particular member of said struct has a specific value?", "\n\nA:\n\nA possible solution:\n% Reproduction example\na = struct('somemember_',1);\nb = struct('somemember_',2);\nc = struct('somemember_',2);\nstruct_array = [a b c];\n\nelementOfInterest = 2;\n\n% Find index of first occurence of element of interest in the struct array\nfind([struct_array.somemember_] == elementOfInterest,1)\n\nreturns \n2\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007461345521733165, 0.0006256548804230988, 0.0006871104706078768, 0.0009687597630545497, 0.0008701106999069452, 0.000553849502466619, 0.0011959272669628263, 0.0006027303170412779, 0.0006135955918580294, 0.0006053696852177382, 0.0007099217036738992, 0.0007314360700547695 ]

[ "Spontaneous cervical and cerebral arterial dissections: diagnosis and management.", "\nArterial dissections of head and neck arteries were first identified pathologically in the 1950s, but not until the 1970s and the 1980s did they begin to be widely recognized as a clinical entity. ", "Carotid and vertebral artery dissections account for only 2% of all ischemic strokes, but they account for approximately 20% of thromboembolic strokes in patients younger than 45 years. ", "The cause of supra-aortic dissections can be either spontaneous or traumatic. ", "This article addresses spontaneous cervical and cerebral artery dissections." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0005942020798102021, 0.0006339885294437408, 0.0007874261937104166, 0.0006109640235081315, 0.0005647562211379409 ]

[ "Related\n\nArgo star Ben Affleck is putting his money where his mouth is in a poverty-awareness campaign, Fox News reports.", "\n\nThe wealthy Oscar winner is vowing to accept a challenge next week: He will try to live on $1.50 a day.", "\n\nAffleck’s efforts are part of the charity Live Below the Line. ", "For at least one day, Affleck and other stars including Sophia Bush, Josh Groban, Debi Mazar and Hunter Biden will try to keep their food and drink costs below $1.50.", "\n\nLive Below the Line said the purpose is “to give a glimpse into the lives of 1.4 billion people who have no choice but to live below the line every day — and who have to make $1.50 cover a lot more than food.”", "\n\nParticipants will update followers on their Twitter accounts.", "\n\nComments\n\nWe encourage all readers to share their views on our articles and blog posts. ", "We are committed to maintaining a lively but civil forum for discussion, so we ask you to avoid personal attacks, and please keep your comments relevant and respectful. ", "If you encounter a comment that is abusive, click the \"X\" in the upper right corner of the comment box to report spam or abuse. ", "We are using Facebook commenting. ", "Visit our FAQ page for more information.", "\n\nShare\n\nBen Affleck to live on $1.50 a day for a week\n\nVideo\n\nCelebrity News Videos\n\nBest of Postmedia\n\nBe afraid. ", "Be very afraid. ", "Ignore the diversions in the United States: athletes kneeling or standing during the national anthem; Republicans flailing and failing again on health care; a kick-boxing creationist possibly becoming senator from Alabama. ", "Calamity looms elsewhere. ", "We are hurtling toward war with North Korea. ", "It may be as early as next month. […]", "\n\nIt wasn’t in the middle of a farmer’s muddy field or deep in the boreal forest where the Canadian oilsands truly struck pay dirt. ", "It was inside Fort McMurray’s recreation centre. ", "More than 1,400 oilpatch workers, corporate executives, provincial leaders and the country’s prime minister assembled 21 years ago in northern Alberta to grasp a […]\n\nGoogle’s powerful search engine is defeating some court-ordered publication bans in Canada and undermining efforts to protect young offenders and victims. ", "Computer experts believe it’s an unintended, “mind-boggling” consequence of Google search algorithms. ", "In six high-profile cases documented by the Citizen, searching the name of a young offender or victim online pointed to media coverage […]\n\nAlmost Done!", "\n\nPostmedia wants to improve your reading experience as well as share the best deals and promotions from our advertisers with you. ", "The information below will be used to optimize the content and make ads across the network more relevant to you. ", "You can always change the information you share with us by editing your profile.", "\n\nBy clicking \"Create Account\", I hearby grant permission to Postmedia to use my account information to create my account.", "\n\nI also accept and agree to be bound by Postmedia's Terms and Conditions with respect to my use of the Site and I have read and understand Postmedia's Privacy Statement. ", "I consent to the collection, use, maintenance, and disclosure of my information in accordance with the Postmedia's Privacy Policy.", "\n\nPostmedia wants to improve your reading experience as well as share the best deals and promotions from our advertisers with you. ", "The information below will be used to optimize the content and make ads across the network more relevant to you. ", "You can always change the information you share with us by editing your profile.", "\n\nBy clicking \"Create Account\", I hearby grant permission to Postmedia to use my account information to create my account.", "\n\nI also accept and agree to be bound by Postmedia's Terms and Conditions with respect to my use of the Site and I have read and understand Postmedia's Privacy Statement. ", "I consent to the collection, use, maintenance, and disclosure of my information in accordance with the Postmedia's Privacy Policy." ]

{ "pile_set_name": "Pile-CC" }

[ 0.009920955635607243, 0.0012038350105285645, 0.0010447835084050894, 0.001273800851777196, 0.001283411169424653, 0.0005711036501452327, 0.0005320444470271468, 0.0005244179046712816, 0.0010379456216469407, 0.0006345307920128107, 0.0005864598206244409, 0.005386564880609512, 0.006583840120583773, 0.001236691721715033, 0.025822965428233147, 0.3950798809528351, 0.0005626535858027637, 0.0012594722211360931, 0.0007258753757923841, 0.0007270661881193519, 0.0024108984507620335, 0.0006927241920493543, 0.0005763076478615403, 0.0005624093464575708, 0.0005833368632011116, 0.0005980349378660321, 0.0005066610174253583, 0.0005543504375964403, 0.0005763076478615403, 0.0005624093464575708, 0.0005833368632011116, 0.0005980349378660321, 0.0005066610174253583, 0.0005543504375964403 ]

[ "1. ", "Field of the Invention\nThis invention relates generally to the field of ophthalmology and more particularly to a novel ophthalmic kit and ophthalmic method and instrument for use in implanting a foldable intraocular lens in a patient's eye,\n2. ", "Discussion of the Prior Art\nThe human eye has a crystalline lens situated behind the iris including an outer capsule attached by zonules to the ciliary muscle of the eye and a crystalline matrix filling the capsule. ", "The lens capsule has anterior and posterior membrane-like walls referred to as anterior and posterior capsules, respectively. ", "In a normal eye, the lens is optically clear. ", "Light rays entering the eye through its cornea and iris pass through the lens to the retina of the eye, and the lens is automatically shaped by brain control of the ciliary muscle to focus these incoming light rays on the retina.", "\nThe human eye is subject to a variety of abnormal conditions that degrade or totally destroy proper optical functioning of the eye. ", "One of the more common of these conditions is known as a cataract and involves clouding of the crystalline lens matrix which obstructs or blocks passage of light rays through the lens to the retina. ", "Simply stated, the ophthalmic procedure for curing a cataract involves extraction of the cataractous natural lens through an incision in the eye and implantation of an artificial intraocular lens in the eye through the incision.", "\nIn the early days of such cataract surgery, the entire cataractous natural lens was removed by a surgical procedure known as intra-capsular lens extraction. ", "While this procedure is occasionally used today in certain circumstances, it has many disadvantages among the more serious of which is the need to make a relatively large incision in the eye to permit removal of the natural lens through the incision.", "\nThese disadvantages of intra-capsular lens extraction led to the development in the 1970's of an improved procedure for removing a cataractous natural lens. ", "This improved procedure, known as extra-capsular extraction, involves removal of only the anterior capsule or a central portion of the anterior capsule of the natural lens, phacoemulsification of the cataractous natural lens matrix, and aspiration of the emulsified matrix. ", "This extra-capsular extraction procedure with phacoemulsification requires only a relatively small incision on the order of 3 mm in length and thereby reduces or eliminates many of the risks associated with intra-capsular lens extraction.", "\nIt was not until the development of the foldable intraocular lens in 1986, however, that the small incision advantage of extra-capsular lens extraction with phacoemulsification could be utilized. ", "This was due to the fact that up until 1986, the only available intraocular lenses were herd lenses which required an incision on the order of 6-8 mm in length for insertion into the eye. ", "Accordingly, even though the natural lens was extracted through a 3 mm incision, the surgeon had to enlarge the incision to 6-8 mm in order to insert the hard intraocular lens into the eye.", "\nA foldable intraocular lens has a normal unfolded lens configuration in which the lens is conditioned to perform its intraocular lens function. ", "The lens is foldable to a compact folded configuration for insertion into the eye through a small incision, such as the 3 mm incision required by extracapsular lens extraction with phacoemulsification. ", "In its folded configuration, the lens stores elastic strain energy which unfolds the lens to its normal lens configuration when it is released within the eye.", "\nA variety of foldable intraocular lenses and instruments for inserting such lenses into the eye have been developed over the period from 1986 to the present. ", "Among the patents disclosing such lenses and instruments are the following:\nU.S. Pat. ", "No. ", "4,575,998 dated Mar. 4, 1986, to Mazzocco discloses (FIGS. ", "31-61) a variety of foldable intraocular lenses and instruments for inserting the lenses into the eye including instruments having a pair of opposing jaws which are closed about a foldable lens (FIGS. ", "52, 54).", "\nU.S. Pat. ", "No. ", "4,681,102 dated Jul. 21, 1987, to Bartell discloses a foldable lens insertion instrument including a load chamber which is closable longitudinally about a foldable intraocular lens to fold the lens and insertable into a lens insertion device including a plunger movable forwardly through the insertion device and load chamber to push the folded lens through the anterior tip of the device into the eye.", "\nU.S. Pat. ", "No. ", "4,715,373 dated Dec. 29, 1987, to Mazzocco et al discloses an instrument having a pair of jaws for gripping a foldable intraocular lens in its folded configuration, a sleeve for surrounding the jaws to hold them in their closed positions, and means for releasing the folded lens from the instrument into the eye.", "\nU.S. Pat. ", "No. ", "4,765,329 dated Aug. 23, 1988, to Cumming discloses a sterile ophthalmic package or kit containing a tube for holding a foldable intraocular lens and having a slender anterior tip for insertion into the eye, and a probe for pushing the lens from the tube, through the tip, into the eye.", "\nU.S. Pat. ", "No. ", "4,862,885 dated Sep. 5, 1989, to Cumming discloses a sterile ophthalmic package or kit including a tray holding a disposable lens insertion device having a pair of open lens gripping jaws straddling an unfolded deformable intraocular lens supported on the tray with the length of the lens extending lengthwise of the jaws, means on the tray for closing the ,jaws about the lens to fold and grip the lens in its folded configuration, and a handle including means for holding the jaws closed and pushing the folded lens from the jaws into the eye following removal of the instrument and lens from the tray and insertion of the jaws of the insertion device into the eye.", "\nU.S. Pat. ", "No. ", "4,934,363 dated Jun. 19, 1990, to Smith discloses an ophthalmic instrument having a disposable insertion device including a tube insertable into the eye and containing a movable lens holder, a reusable handle removably mounting the insertion device including means for moving the lens holder back and forth in the tube of the insertion device to first draw a foldable lens into the tube and thereby fold the lens and thereafter eject the folded lens from the tube into the eye.", "\nU.S. Pat. ", "No. ", "4,976,716 dated Dec. 11, 1990, to Cumming discloses a sterile ophthalmic package or kit including a tray holding a disposable lens insertion device having a pair of open lens gripping jaws straddling an unfolded deformable intraocular lens supported on the tray with the length of the lens extending lengthwise of the jaws, means on the tray for closing the jaws about the lens to fold and grip the lens in its folded configuration, and a reusable handle for holding the jaws closed and including a plunger for pushing the folded lens from the insertion device into the eye following removal of the instrument and lens from the tray and insertion of the jaws of the insertion device into the eye." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0009392039501108229, 0.0007639108225703239, 0.0006158911273814738, 0.00063307024538517, 0.0005969278863631189, 0.0011059438111260533, 0.0015232001896947622, 0.0007522355299443007, 0.0012940464075654745, 0.000916654709726572, 0.0006127639207988977, 0.0006756116636097431, 0.0006161791388876736, 0.0006312919431366026, 0.0006462907767854631, 0.0006433363305404782, 0.0006802379502914846, 0.000628638721536845, 0.0006084846099838614, 0.0005609483341686428, 0.000541654706466943, 0.0005841349484398961, 0.0013781859306618571, 0.0006628925912082195, 0.0006437359261326492, 0.000863215362187475, 0.0010888158576563, 0.0013781859306618571, 0.0006050621741451323, 0.0010888158576563, 0.0013781859306618571, 0.0005917932721786201, 0.0010888158576563, 0.0013781859306618571, 0.0007383148767985404, 0.0010888158576563, 0.0013781859306618571, 0.0007224817527458072, 0.0010888158576563, 0.0013781859306618571, 0.0006681974628008902, 0.0010888158576563, 0.0013781859306618571, 0.0007175157661549747 ]

[ "Why you should trust us\n\nWe talked to a number of experts about what they look for in a kettle, including Tony Gebely of World of Tea; Michelle Rabin, founder of T Ching; Peter F. Goggi, president of the Tea Association of the U.S.A.; and famed tea expert Bruce Richardson. ", "We also looked at highly rated models on Amazon as well as reviews from Cook's Illustrated (subscription required), Good Housekeeping, and Wired.", "\n\nMichael Sullivan, who contributed to our 2016 and 2017 updates, has spent dozens of hours testing electric kettles in the Wirecutter test kitchen. ", "This guide builds on work by Wirecutter staffers Winnie Yang and Tim Barribeau.", "\n\nWho should get an electric kettle\n\nA variable-temperature kettle can heat water to the correct warmth for making delicious coffee or tea at home. ", "Getting a variable-temperature kettle is the key to immediately improving your caffeinated-drink game, whether you're a tea collector or a scale-grinder-dripper coffee nerd. ", "If you're not a coffee or tea aficionado, you may just want a no-frills basic model that only boils water. ", "In either case, an electric kettle also works for people who hate the alarming sound of whistling kettles and want a fast, more automatic path to their morning cup of caffeine.", "\n\nIf the entirely plastic electric kettle you already own imparts an unpleasant taste or smell to the heated water, you may want to switch to stainless steel or glass. ", "While these models still contain some small plastic components, they generally don't have as many issues when it comes to producing a plastic taste or smell. ", "To avoid plastic entirely, we'd recommend investing in an old-fashioned all-metal stovetop kettle.", "\n\nHow we picked and tested\n\nIn preparing tea, most people just put a kettle on to boil and then pour the resulting hot water over the tea bag, regardless of type or temperature. ", "But the different varieties of tea are meant to be brewed at specific temperatures. ", "While exact temperatures are up for debate and come down to personal preference (see Wirecutter's suggested water temperatures for teas and coffee below), the general rule is that more delicate leaves require cooler water. ", "So green tea, for example, should steep at a temperature markedly lower than the rolling boil that black tea requires.", "\n\nA great electric kettle should have a wide variety of temperature settings to accommodate different types of beverages. ", "Illustration: Elizabeth Brown\n\nCoffee aficionados also pay attention to temperatures. ", "The AeroPress system, for instance, suggests using water that is considerably cooler than freshly boiled: 175 to 185 degrees Fahrenheit. ", "Some dripper owners use 195 °F water while others suggest 205 °F, and both of those temperatures fall under the full-boil temp of 212 °F, too. ", "A great electric kettle should have a wide variety of temperature settings to accommodate different types of beverages. ", "Reasonable accuracy at hitting those temperatures is also important, because there's no point in aiming for 200 °F and hitting 212 °F instead. ", "That said, we realize that not everyone is a coffee or tea aficionado, so we also looked at kettles that do not have variable temperature settings and simply boil water.", "\n\nSpeed is critical—you don't want to wait forever for your water to come to temperature. ", "An electric kettle should also be easy to use, have a handle that doesn't get too hot, and feature automatic shutoff so you don't have to worry about forgetting to turn it off. ", "A large mouth for easy cleaning is another plus, but these days the vast majority of electric kettles conceal the heating element, so you no longer have to contend with scale-covered electrical pieces that never get totally clean.", "\n\nFor 2017, we tested a new round of electric kettles for speed, accuracy, and ease of use. ", "Photo: Michael Hession\n\nAside from technical features, we looked for models that came with decent warranties. ", "Our research has shown (and customer reviews have indicated) that electric kettles have a high failure rate across the board. ", "Boiling water is very hard on appliances, especially those with finicky moving parts or complex settings. ", "Even high-quality kettles have a somewhat short lifespan, so finding a model with a solid warranty is key.", "\n\nWe tested the accuracy of the variable-temperature kettles using a Thermapen thermometer. ", "Photo: Michael Hession\n\nAll of the kettles we tested for our 2017 update were metal or glass. ", "Some people, including our experts, complain about plastic kettles imparting a funny taste or smell to the water. ", "To minimize the possibility of unpleasant flavors in the water, we didn't test any models made entirely of plastic. ", "All of the models we did test, however, contained some minor plastic elements, such as parts of the lid, a filter, or the water-level window. ", "All of the manufacturers of our picks assured us that the plastic components in their kettles were made from heat-resistant plastics; this means they're less likely to leach by-products into your water at high temperatures, even after repeated boilings over prolonged use. ", "Though glass kettles are less likely to impart off flavors to the water, they are more prone to breakage if dropped. ", "In our experience testing kettles, we've found stainless steel models are more durable.", "\n\nIn our tests, we timed how long each kettle took to boil 1 liter of water. ", "Photo: Michael Hession\n\nWe tested each variable-temperature kettle by measuring how long it took to bring a liter of water to a boil and by measuring how accurate the internal thermometer was for non-boiling temperatures. ", "We tested the internal thermometers by heating the water to one of the specific temperature settings (below boiling) and measuring it with a Thermapen thermometer, performing this test multiple times for the various temperatures available on each kettle (with ample time for cooldown in between sessions). ", "For the simple electric kettles we tested, we just measured the time to boil. ", "Some models in the test group had a warming feature that could hold set temperatures, so we checked their accuracy after letting them rest for an extended period of time. ", "We also tested automatic shutoff features and took note of any excessive or annoying beeps. ", "Additionally, we tasted the water from each model after boiling to see if it had any off flavors caused by plastic components.", "\n\nWe tested the automatic shutoff features for each kettle and took note of any excessive or annoying beeps. ", "Photo: Michael Hession\n\nOur pick: Cuisinart CPK-17\n\nThe Cuisinart CPK-17 remains our top pick for the fifth year in a row. ", "Photo: Michael Hession\n\nOur top pick for the fifth year in a row is the Cuisinart CPK-17 PerfecTemp Cordless Electric Kettle, thanks to its ease of use, speed, and accuracy. ", "It has an intuitive interface with a keep-warm option that conveniently holds water at a set temperature. ", "The wide handle is comfortable to hold, and the spout doesn't cause water to dribble when pouring. ", "Unlike many of the kettles we tested, it has a simple streamlined design, so it won't be an eyesore if you store it on your kitchen counter.", "\n\nCompared with all the other variable-temperature models we tested, the Cuisinart CPK-17 was the simplest to operate. ", "It offers six preset temperature settings as buttons on the handle (labeled as 160°, 175°, 185°, 190°, 200°, and Boil), along with a Start button and a Keep Warm button. ", "You add the water, select the temperature you want, hit Start, and wait for the kettle to beep when it's done. ", "It then kicks into an automated keep-warm cycle, where it maintains the temperature for up to 30 minutes in case you can't quite make it to the kitchen in time. ", "In our tests the push button on the handle made for easy one-handed lid opening, and the water poured in an even stream without dripping.", "\n\nThe wide spout on the Cuisinart CPK-17 poured water in an even stream without dribbling. ", "Photo: Michael Hession\n\nAside from its straightforward, easy-to-use design, our testers found the Cuisinart had an extremely consistent boil time. ", "On average, it brought 1 liter of water to a boil in around four minutes. ", "While the CPK-17 wasn't the fastest of the kettles we tested, it was speedier than most. ", "Additionally, the Cuisinart proved to be impressively accurate in our tests: After it held a set temperature of 185 °F for 30 minutes, the water measured just 2 degrees over.", "\n\nThe Cuisinart CPK-17 also has all the other features we look for in an electric model, including a removable scale filter for easier cleaning, a concealed heating element that won't get gunked up by mineral deposits, and a 360-degree swivel base so you can grab it from any angle. ", "Its lid is large enough for you to get inside easily for cleaning (just avoid splashing water on the control buttons located on the handle). ", "And while all of these features are fairly standard, the Cuisinart CPK-17 is the only model we tested that offers them all while managing to avoid the glaring flaws that plague its competition.", "\n\nOur top pick has six preset temperature settings as buttons on the handle (160°, 175°, 185°, 190°, 200°, and Boil), plus a Start button and a Keep Warm button. ", "Photo: Michael Hession\n\nIn contrast to the annoying, excessive beeps that were one of the drawbacks of the KitchenAid KEK1722SX kettle (our former runner-up two years ago), the Cuisinart CPK-17 beeps only once when you press a button on the control panel, or several times when it reaches a temperature setting. ", "Our testers liked that temperature alert—it means you don't have to hover over the kettle in eager anticipation. ", "Be mindful, however, that a raucous beeping will occur if the kettle is on and you return it to the base empty. ", "This is the \"boil-dry protection\" warning, intended to prevent damage to the kettle; just remember to shut it off if it's empty. ", "Since the water-level window allows you to see when it's getting low, we found it easy to avoid this situation.", "\n\nOne feature the Cuisinart CPK-17 has that makes it stand out is a limited three-year warranty, which is substantially better than what you get with all the other models we tested in this price range (most come with only one year of coverage). ", "Given that constantly boiling water can be rough on a gadget, having triple the warranty coverage of the rest of the pack is impressive. ", "For more warranty information or replacements, contact Cuisinart.", "\n\nFlaws but not dealbreakers\n\nAlthough the Cuisinart CPK-17 had better accuracy than most of the other kettles we tested (which measured more than 10 degrees off their temperature settings in some cases), we found it wasn't as accurate at hitting lower temperatures, measuring 8 degrees over when we set it to 160 °F. ", "On temperatures of 175 °F and up, it measured only 3 to 4 degrees off, which is pretty accurate. ", "Since this model has a slew of other noteworthy features and has been consistently reliable over four years of long-term testing, we're willing to forgive its minor temperature variances at the lowest setting.", "\n\nWe have received recent feedback from some of our readers and have seen other reports of this Cuisinart model breaking down after about a year. ", "Some Amazon customers have reported rusting screws on the interior within a couple of weeks, but this problem is rare and should be covered under warranty. ", "We've also heard complaints that the lids on some Cuisinart CPK-17 units have broken off at the hinge. ", "We haven't experienced these issues ourselves; several people on our staff have owned and used this kettle for years and haven't encountered any problems with it. ", "Most say it has been a workhorse. ", "One of our staffers has used it every day, sometimes up to four or five times a day over the past year, and they reported that it has never broken \"or acted up.\" ", "We will certainly keep an eye on the owner reviews for the CPK-17 to see if a quality-control problem has cropped up, but we continue to stand by our pick.", "\n\nRunner-up: Bonavita BV382510V\n\nThe 1-liter Bonavita BV382510V is great for preparing pour-over coffee or heating water to precise temperatures for making tea. ", "Photo: Michael Hession\n\nWe think the stainless steel Bonavita BV382510V 1.0L Digital Variable Temperature Gooseneck Kettle (a design also available in a larger, 1.7-liter version) represents an excellent compromise between a traditional tea kettle and one better suited for making pour-over coffee (see our guide to the best pour-over coffee gear for more). ", "Although this model wasn't the fastest kettle to bring water to a boil, the Bonavita had the most accurate temperature controls among all the models we tested. ", "The long, gooseneck spout provides superior pouring technique, and the interface is easy to use. ", "We also like the looks of this kettle; it's handsome enough for you to keep it on your kitchen counter.", "\n\nThe Bonavita 1-liter kettle had the most accurate internal thermometer of the models we tested. ", "Photo: Michael Hession\n\nOf all the models we tested, the Bonavita BV382510V had the most precise temperature control, impressively measuring just 1 degree off regardless of the temperature setting. ", "It gives you the freedom to set it in 1-degree increments from 140 °F to 212 °F on an easy-to-read digital display. ", "This model also tracks the water's temperature accurately as it rises or lowers, so you always know how hot it is. ", "A Bonavita representative we spoke with said this model's impeccable accuracy was one of the reasons why it's so popular among baristas.", "\n\nWe loved the Bonavita's long, gooseneck spout for precision pouring. ", "Photo: Michael Hession\n\nOur testers also praised it for its long neck, which provided excellent pouring technique for pour-over coffee or a single cup of tea. ", "And while the spout wasn't very handy for pouring into a teapot, we think that isn't an issue since this model is attractive enough for you to serve directly from the kettle.", "\n\nIt has some minor drawbacks, however. ", "This model took about two and a half minutes longer to boil than our top pick, and it doesn't provide a water-level window for you to see when it's getting low. ", "Unlike our top pick, it lacks a boil setting, so you have to manually enter 212 °F using the plus button. ", "Also, the lid doesn't have a push button and needs to be removed, as on a traditional stovetop kettle. ", "But despite those minor flaws, after over two years of using the Bonavita BV382510V daily, we haven't experienced any issues, and we think it's the best for anyone who will use it for both tea and pour-over coffee.", "\n\nThe Bonavita kettle comes with a one-year warranty, which is skimpy next to the three-year warranty of our top pick. ", "Members of the Wirecutter staff, however, have owned this kettle for over four years and say it's still working like new. ", "You should contact Bonavita if you encounter problems or need a replacement.", "\n\nBudget pick: Hamilton Beach 40880\n\nThe Hamilton Beach 40880 offers fast and consistent boiling times at a bargain price. ", "Photo: Michael Hession\n\nWe recommend the Hamilton Beach 40880 Stainless Steel 1.7 Liter Electric Kettle for anyone who wants an affordably priced basic model that quickly brings water to a boil. ", "This kettle lacks the bells and whistles of our other picks—it doesn't have preset temperature controls, or a keep-warm setting—but it does have all the other features we look for in a decent kettle. ", "Most important, perhaps, its handle is easy to hold, and the spout doesn't cause water to drip when pouring.", "\n\nOur testers were impressed with the speed of this kettle, which was on a par with our main pick in boiling time (about four minutes). ", "This Hamilton Beach model is very simple to operate: You flick the tab up on the base of the handle, and the kettle begins heating the water. ", "The red light illuminates on the base once the boiling cycle begins, so you always know that it's on. ", "Once the water reaches a rolling boil, the kettle automatically shuts off, so you don't have to worry about turning it off manually.", "\n\nTo begin boiling water on the Hamilton Beach kettle, you flick the tab up on the base of the handle. ", "Photo: Michael Hession\n\nIn our tests, the spout on the Hamilton Beach 40880 didn't dribble water when pouring, and the wide handle was comfortable to hold. ", "Unlike some models in our test group that require you to open the lid manually, such as the Hamilton Beach 40865 1.7 Liter Glass Electric Kettle, the 40880 conveniently opens with a push of a button located at the top of the handle. ", "This model also boasts two water-level windows, a design that allows you to see how full the kettle is regardless of which way you place it on the base.", "\n\nThe main drawback to the Hamilton Beach 40880 (left) is the lid's plastic hinges, which aren't as durable as the metal on our top pick, the Cuisinart CPK-17 (right). ", "Photo: Michael Hession\n\nThe plastic hinges on the Hamilton Beach 40880's lid are its only significant drawback. ", "Other models, such as our top pick, the Cuisinart CPK-17, have metal hinges that seem more durable. ", "Our testers liked that this model doesn't beep, unlike our previous budget pick, the Chefman RJ11-17-GP, which was plagued by excessive beeping.", "\n\nThe Hamilton Beach 40880 is covered by a one-year warranty. ", "For replacements or other issues, contact Hamilton Beach.", "\n\nCare and maintenance\n\nTo minimize the amount of deposit buildup in your kettle, always empty it after you use it. ", "You'll still need to decalcify your kettle from time to time, though the frequency depends on the hardness of your water. ", "Check the manual for the manufacturer's specific instructions on descaling; otherwise, you can fill the kettle with 1 cup of white vinegar and 3 cups of water, heat it to a boil, turn it off, and allow it to stand overnight. ", "Alternatively, half a teaspoon of cream of tartar with half a kettle of water should also work. ", "After emptying the kettle, refill it with water only, bring it to a boil, and drain; repeat twice more.", "\n\nSome kettles come with a mesh filter for trapping calcium deposits, which you will need to clean periodically—more often if you have hard water. ", "Follow the instructions in the manual for removing the filter, and clean it with a cloth or brush under hot water. ", "For hard-to-remove calcium deposits, let the filter stand overnight in a solution of one part water to three parts white vinegar; rinse thoroughly before returning it to the kettle.", "\n\nThe competition\n\nThe Chefman RJ11-17-GP Precision Electric Kettle was a previous budget pick, but during long-term testing we found its beeping very annoying. ", "This model has also gone up in price since we originally published the guide.", "\n\nAlthough the OXO On Adjustable Temperature Electric Kettle was very accurate in our tests, it had trouble staying closed; as water came to a boil, the lid frequently popped open. ", "A different OXO model, the OXO On Cordless Glass Electric Kettle, is far too expensive for a basic kettle that lacks variable-temperature controls.", "\n\nThe Tribest Glass Raw Tea Kettle GKD-450-B lacks a push button on the handle. ", "Its blue light constantly turns on and off until it reaches the desired temperature, something we found annoying.", "\n\nWe didn't like the lid on the Hamilton Beach 40865 1.7 Liter Glass Electric Kettle, which you have to open manually by squeezing two release buttons. ", "The lid also doesn't stay propped open, so filling this kettle with water was more difficult in our tests.", "\n\nThe 10-cup Hamilton Beach 40870 Stainless Steel Electric Kettle is an older version of the Hamilton Beach 40880 budget pick we currently recommend, so we opted not to test it.", "\n\nThe KitchenAid KEK1722SX Electric Kettle was a runner-up pick previously, but after long-term testing we found its excessive beeping beyond irritating. ", "Also, the kettle always defaults to Celsius; for Fahrenheit temperatures, you have to change the settings every time you use it. ", "And in February 2018, several KitchenAid electric kettles were recalled, including the KEK1722SX, due to burn hazards.", "\n\nWe were disappointed to see the steep price of the Breville BKE820XL IQ Kettle, as it doesn't have any features to differentiate it from the Cuisinart CPK-17 and make it worth the extra cash. ", "We also looked at the glass Breville IQ Kettle Pure, but we preferred the stainless steel model.", "\n\nIn our tests the Chef'sChoice SmartKettle 688 was very precise, but it was incredibly slow at bringing water to a boil. ", "Its customer ratings have also dropped on Amazon due to various malfunctions.", "\n\nThe Chef'sChoice Cordless Electric Kettle 681, a previous budget pick, had one of the fastest boiling times of all the models we tested, but Amazon reviews for this model have dipped considerably due to leaks or auto-off function failures.", "\n\nThe Secura 1.8 Quart Stainless Steel Cordless Electric Kettle did very well in our tests and is currently around the same price as our budget pick, but it lacks a water-level window. ", "According to a Secura representative, the small hole on the interior allows steam to reach the bottom interior of the unit, where the temperature control is located. ", "We found, however, that cleaning in between the walls of the kettle would be impossible, so we dismissed this model.", "\n\nIn our tests, the 1.7-liter Capresso H20 Steel Plus heated water nearly 10 degrees over the preset temperature, but the biggest problem was that the water had a slight plastic taste and smell after boiling.", "\n\nThe Chef'sChoice Cordless Electric Glass Kettle 679 is too expensive for a basic boiler. ", "We dismissed this model, since you can find a slew of other kettles in this range that offer more features at a lower price. ", "We also looked at the Chef'sChoice 691/692, but that version is also a bit pricey for a basic kettle.", "\n\nThe Melitta 40994 1.7 Liter Kettle ranked among the top selling kettles and had decent reviews on Amazon at the time we checked. ", "While we like the damped lid, this model is a bit too expensive for a basic kettle.", "\n\nAlthough the Melitta 1.7-Liter Cordless Kettle has a temperature control knob, it doesn't indicate specific temperatures. (", "The labeling is by tea type: \"oolong\" and so on.) ", "We found this design frustrating, especially when trying to heat the water to a specific temperature for pour-over coffee. ", "This model also has availability issues on Amazon.", "\n\nIn our tests, the Hamilton Beach 40996 Programmable 1.7 Liter Kettle was inaccurate. ", "It was also slow to bring water to a boil, and we found the controls unintuitive.", "\n\nAt the time we checked, the Bonavita BV382517V 1.7 Liter Variable Temperature Kettle had notably poor reviews on Amazon, apparently at least in part due to the handle overheating. ", "We also came across a Pino digital kettle that Cook's Illustrated liked, but the Amazon reviews were poor at the time, and it didn't seem to be widely available.", "\n\nOn the super-cheap end, the Ovente KS96S Stainless Steel Cordless Electric Kettle looks like a promising on/off-style kettle, and it has pretty good ratings on Amazon, but many reviews complain that it is slow to heat up.", "\n\nThe Ovente KG83 1.5 L Glass Electric Kettle has a fairly good rating on Amazon, but we dismissed it since a lot of reviews claim that the plastic warps after several uses.", "\n\nWhile the Ovente KS88S Temperature Control Stainless Steel Cordless Electric Kettle has a few promising features, its LED light—which changes colors to indicate various temperatures—is gimmicky. ", "Additionally, many customer reviews complain that it beeps loudly.", "\n\nThe Adagio Teas varieTEA Variable Temperature Electric Kettle is expensive and has a low rating on Amazon.", "\n\nThe Adagio Teas utiliTEA Variable Temperature Electric Kettle has only a 0.9-liter capacity. ", "On top of that, in testing we weren't fans of its heat control, which lacked temperature markers.", "\n\nThe temperature-controlled Firebox iKettle connects via Wi-Fi to your smartphone, a feature we find unnecessary. ", "This model is also exorbitantly priced.", "\n\nReviews on Amazon reveal that the Aroma Hot H20 X-Press Cordless Electric Water Kettle has problems with rust, shutoff malfunctions, and water leakage.", "\n\nThe Hario EVKB-80U-HSV V60 Power Kettle Buono has an appealing design but doesn't offer anything more than the less expensive Bonavita gooseneck model. ", "The Hario also lacks variable-temperature controls.", "\n\nThe Sharper Image kettle we considered has no variable-temperature control and is too pricey for a basic kettle. ", "Our current top pick has a slew of other features and is much less expensive. ", "In our tests the Sharper Image kettle also took a long time to bring water to a boil, longer than some of our other picks.", "\n\nTwo glass models, the Salton GK1429 Kettle & Tea Steeper and the SMAL WK-0816, have temperature readings only in Celsius, which isn't practical for most American households.", "\n\nThe Epica 1.75 Quart Cordless Electric Stainless Steel Kettle seems like a good contender and has a decent rating on Amazon currently, but some customer reviews say it smells of burning plastic while heating water.", "\n\nAlthough the 1-liter Proctor Silex K2070YA Electric Kettle has a lot of positive reviews on Amazon right now, it lacks a stainless steel interior.", "\n\nYou can find myriad models lacking temperature controls, such as the Breville SK500XL Ikon Electric Kettle, that cost more than what they're worth. ", "And most cheaper models that have some form of temperature control (like the T-fal BF6138 and the Hamilton Beach K6080A) are almost entirely made of plastic; some reviews indicate that these plastic models leave the water tasting and smelling like plastic.", "\n\nSome other models we encountered, such as the Breville BTM800XL One-Touch Tea Maker, were exorbitantly priced. ", "More than $200 is too much to spend on a kettle, especially if it has only a one-year warranty. ", "Even the KitchenAid KEK1522CA Pro Line Series Electric Kettle doesn't have any more to offer than our top pick, which is about half the price currently.", "\n\nThis guide may have been updated by Wirecutter. ", "To see the current recommendation, please go here.", "\n\nWhen readers choose to buy Wirecutter's independently chosen editorial picks, Wirecutter and Engadget may earn affiliate commissions." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.000565673690289259, 0.000548029609490186, 0.0006582907517440617, 0.0006817484390921891, 0.0008079227991402149, 0.3234531283378601, 0.0020649777725338936, 0.009335286915302277, 0.0007692284416407347, 0.0006553186685778201, 0.0008075063233263791, 0.0005962467403151095, 0.0005587253835983574, 0.0005484232679009438, 0.0010280061978846788, 0.0006051911623217165, 0.000580618332605809, 0.0006570578552782536, 0.0006989341345615685, 0.0006051911623217165, 0.0005757747567258775, 0.0006283891852945089, 0.0010484722442924976, 0.003595993621274829, 0.0015069663058966398, 0.0006136388401500881, 0.0005528550827875733, 0.0006480510346591473, 0.0007264082669280469, 0.0006185503443703055, 0.0006184015655890107, 0.0006419056444428861, 0.0007152007310651243, 0.0005583130987361073, 0.0005906884907744825, 0.0005581441218964756, 0.0009971914114430547, 0.0005629279767163098, 0.0006202857475727797, 0.0005602465244010091, 0.0006139109027571976, 0.0006108548259362578, 0.0005139687564224005, 0.003356248140335083, 0.0005652406834997237, 0.0023140194825828075, 0.0007028622785583138, 0.0006223171367309988, 0.0005491577321663499, 0.0008317223400808871, 0.0006952910916879773, 0.0006276111234910786, 0.0006230165017768741, 0.0010422891937196255, 0.0006465744227170944, 0.0007214166689664125, 0.006676633842289448, 0.0005618920549750328, 0.0007267669425345957, 0.0007256049429997802, 0.0006111291004344821, 0.0007147901924327016, 0.00075059465598315, 0.0006789833423681557, 0.0006124337087385356, 0.0015533313853666186, 0.000691061548423022, 0.008715417236089706, 0.005843256134539843, 0.0006025754846632481, 0.0006175910821184516, 0.0007802604231983423, 0.00063119683181867, 0.0006430874927900732, 0.0006279473891481757, 0.0005465816939249635, 0.0005498792161233723, 0.0005820502992719412, 0.0007710114005021751, 0.0006724419072270393, 0.0005737035535275936, 0.0005722465575672686, 0.000536321138497442, 0.0006455621914938092, 0.0005624629557132721, 0.0006496097194030881, 0.0017347346292808652, 0.000806952069979161, 0.0007487264811061323, 0.0005795357865281403, 0.0006090939277783036, 0.0006541000329889357, 0.0005535294185392559, 0.0028568562120199203, 0.0005728211253881454, 0.0010720064165070653, 0.0006018955609761178, 0.0007667321478947997, 0.0006673402385786176, 0.0007939042407087982, 0.0005723258946090937, 0.0009742002002894878, 0.0007764931069687009, 0.0012051579542458057, 0.0005958552937954664, 0.0005764996167272329, 0.0009849477792158723, 0.0007472780998796225, 0.0006821851711720228, 0.0007803101907484233, 0.000676612660754472, 0.0033905403688549995, 0.0010988881113007665, 0.0006532871047966182, 0.0006594926817342639, 0.0006417850963771343, 0.0008481154800392687, 0.0006668090354651213, 0.000616236706264317, 0.0008770745480433106, 0.0005826919805258512, 0.0005795730976387858, 0.0011542277643457055, 0.001037506153807044, 0.0007615761132910848, 0.0013655007351189852, 0.006139872595667839, 0.0006635673926211894, 0.0008384682587347925, 0.0019830085802823305, 0.0006151964771561325, 0.0006053321994841099, 0.0006376340752467513, 0.0008321761852130294, 0.0009381535346619785, 0.0008581078727729619, 0.0008229347295127809, 0.0006545131909660995, 0.0006308323936536908, 0.001140058389864862, 0.00121690658852458, 0.001179657643660903, 0.0007226190064102411, 0.0005792268202640116, 0.0007371773826889694, 0.0009131616679951549, 0.0006963802734389901, 0.0006734545459039509, 0.0005820295191369951, 0.0007412536069750786, 0.0006633668672293425, 0.0017796193715184927, 0.000953547190874815, 0.0005661276518367231, 0.000725319841876626, 0.0009750525932759047, 0.0006451325607486069, 0.0006782886921428144, 0.000555782113224268, 0.0006016377592459321, 0.000822472560685128, 0.0006580455228686333, 0.0009482703171670437, 0.0007479431806132197, 0.0012609335826709867, 0.000742717704270035, 0.0008087953901849687, 0.0009104034979827702, 0.0011167187476530671, 0.0008200316806323826, 0.0006070712697692215, 0.0007924383389763534, 0.0013689211336895823, 0.0013675835216417909, 0.0015782929258421063, 0.0006742094992659986, 0.0007813274278305471, 0.000815894512925297, 0.0006113711860962212, 0.0007023521466180682, 0.0017708447994664311, 0.0007119206711649895, 0.0007387695950455964, 0.0009964429773390293, 0.0008827913552522659, 0.0014742144849151373, 0.0010472458088770509, 0.0006364222499541938, 0.0005304622463881969, 0.0006233268068172038 ]

[ "Marcel Aurousseau\n\nMarcel Aurousseau BSc (Syd.) ", "MC C. de G. (19 April 1891 in Woollahra, Sydney – 22 August 1983 in Sydney) was an Australian geographer, geologist, war hero, historian and translator.", "\n\nAurousseau, who was of French and Irish descent, attended Sydney Boys High School alongside three students who were also later prominent in various fields: Arthur Wheen (a historian and translator), Raymond Kershaw (an economist) and Arthur McLaughlin (a medical practitioner).", "\n\nHe began his scientific career as an \"office boy\" at the Australian Museum in Sydney. ", "While completing the Bachelor of Science course at the University of Sydney, Aurousseau won the University Medal in Geology.", "\n\nIn 1913, he was appointed to the position of assistant lecturer at the newly formed geology department of the University of Western Australia (UWA), in Perth.", "\n\nArmy service \n\nFollowing the outbreak of World War I, Aurousseau obtained leave from UWA, to join the Australian Imperial Force. ", "He was assigned initially to the 28th Battalion (1915), before joining the 51st Battalion on the Western Front.", "\n\nAurousseau first saw action in France at the battles of Fleurbaix (Fromelles), the Pozières and the Mouquet Farm (14–15 August 1916), which resulted in him being severely wounded. ", "He was subsequently awarded the Military Cross.", "\n\nPromoted to Captain, Aurousseau also served at the Battle of Messines, the Third Battle of Ypres (Polygon Wood), the First Battle of Dernancourt (part of the Battle of Villers-Bretonneux), and was wounded again at Hourges, during the Battle of Amiens, in August 1918.", "\n\nAs a result of his war service, Aurousseau was also awarded the French Croix de Guerre (1919).", "\n\nScientific and literary career\nReturning to Perth the war, Aurousseau again taught geology at UWA.", "\n\nHe subsequently moved to the United States, to work at the Geophysical Laboratory of the Carnegie Institution, in Washington DC.", "\nDuring 1923–24, Aurousseau worked for the American Geographical Society in New York.", "\n\nAfter returning briefly to Australia, Aurousseau moved to London to pursue a literary career.", "\n\nBetween 1936 and 1955 he worked as executive secretary of the British Government Permanent Committee on Geographical Names. ", "During World War II, Aurousseau contributed to military geographical dictionaries used by Allied forces. ", "In 1956 he declined the award of an MBE.", "\n\nIn his most influential work, The Rendering of Geographical Names (1957), Aurousseau coined the term exonym: a place name that is the common name only in countries or regions outside the place in question, usually for historical reasons. ", "Usage of \"exonym\" has grown to include non-geographical proper names for things such as languages, cultures or populations. ", "Some significant examples of exonyms therefore include: the English language \"China\" for Zhōngguó; the Spanish word estadounidenses (lit. \"", "unitedstatesians\") for \"Americans\", and; the English \"German\" for Deutsch.", "\n\nIn 1969, the Royal Geographical Society presented Aurousseau with the Victoria Medal, an annual award \"for conspicuous merit in research in geography\".", "\n\nAuthored works\nAurousseau's published works include:\n Travel books \n Highway Into Spain, London, Peter Davies (1930), 1st ed., ", "686 pages.", "\n Highway Into Spain, London, Peter Davies (1931), 2nd ed., ", "294 pages.", "\n Beyond the Pyrenees London, Peter Davies (1931), orig. ", "publ. ", "1930 as part of Highway Into Spain.", "\n Geography/history\n The Rendering of Geographical Names, London, Hutchinson (1957).", "\n The Letters of F. W. Ludwig Leichhardt (transl. & ", "ed.), ", "London, Hakluyt Society/Cambridge University Press (1968).", "\nSound recording\n [http://nla.gov.au/nla.oh-vn3001178 Marcel Aurousseau interviewed by Hazel de Berg for the Hazel de Berg collection] (1977), c. 36 minutes; held by the National Library of Australia.", "\n\nFootnotes\n\nExternal links\n\nCategory:1891 births\nCategory:1983 deaths\nCategory:Australian geographers\nCategory:University of Western Australia faculty\nCategory:People from the Eastern Suburbs (Sydney)\nCategory:People from Sydney\nCategory:Australian Army officers\nCategory:Recipients of the Croix de Guerre 1914–1918 (France)\nCategory:Australian translators\nCategory:Australian military personnel of World War I\nCategory:People educated at Sydney Boys High School\nCategory:20th-century translators\nCategory:Australian people of Irish descent\nCategory:Australian people of French descent\nCategory:20th-century Australian historians\nCategory:Victoria Medal recipients" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0006715913186781108, 0.0009193758596666157, 0.0007069052662700415, 0.0006683713872916996, 0.0006224983371794224, 0.0006850201752968132, 0.0009141750051639974, 0.0007434491417370737, 0.0010945663088932633, 0.001124995294958353, 0.0012190771522000432, 0.0006424436578527093, 0.0007919854251667857, 0.0006399542326107621, 0.0006679526995867491, 0.0008310141274705529, 0.0005594120011664927, 0.0006972691626287997, 0.0006680611986666918, 0.000584296474698931, 0.0006187428953126073, 0.0006189599516801536, 0.0017145313322544098, 0.0005958583788014948, 0.0005877193761989474, 0.0008084856090135872, 0.0006365426816046238, 0.0007332800305448472, 0.0006492382963187993, 0.0011368212290108204, 0.000677709118463099, 0.000566556234844029, 0.0006899020518176258, 0.0007306945044547319, 0.0006732569308951497, 0.0006255675689317286, 0.0005866513238288462 ]

[ "Introduction {#sec1-1}\n============\n\nOpioids are commonly prescribed for chronic cancer pain management ([@ref1]). ", "Opioids are also known to be extremely addictive. ", "The addictive features of morphine lead to its inappropriate use which creates significant medical and socioeconomic problems worldwide. ", "Opioids are co-stored with glutamate in several hippocampal pathways, including the lateral perforant path (LPP) input to granule cells in the dentate gyrus, the LPP input to CA3 pyramidal cells, and the mossy fiber projection to CA3 pyramidal cells ([@ref2]). ", "Several studies have shown that chronic exposure to morphine or heroin leads to the impairment of hippocampal long-term potentiation (LTP) ([@ref3]) and to the impairment of acquisition ([@ref4]) or retention ([@ref5]) of spatial memory.", "\n\nAcetylcholine (Ach) is a major excitatory neurotransmitter in the central nervous system (CNS) of vertebrates and invertebrates ([@ref6]). ", "More recently, a study on the neurobiology of pain has revealed that the brain's cholinergic system, particularly muscarinic acetylcholine receptors (mAChRs), may be involved in the modulation of pain ([@ref7]). ", "This action of ACh is mediated by mAChRs ([@ref8]). ", "In addition, a vast amount of literature has appeared describing the antinociceptive action of both cholinesterase inhibitors and cholinomimetic drugs ([@ref9]). ", "Various mAChRs have also been shown to be potential mediators of pain related neuroplasticity. ", "Intrathecal administration of cholinergic muscarinic agonists or acetylcholinesterase inhibitors produces analgesia in both animals and humans ([@ref10]). ", "Moreover, the analgesic effect of morphine may be mediated by components of the cholinergic system ([@ref11]). ", "Therefore, it can be postulated that morphine or heroin may affect nociceptive neurotransmission in the hippocampus. ", "However, the precise role of ACh in the reinforcement and addiction of abusive drugs is not well understood.", "\n\nThe hippocampus is a region of the mammalian brain that has been extensively studied due to its role in many forms of learning, memory, and pain response. ", "Electrophysiological, pharmacological, behavioral, and clinical data indicate that the hippocampal formation is an integral component of the limbic system and, as such, plays an important role in the affective and motivational aspects of pain perception ([@ref12]). ", "The hippocampus receives cholinergic projections from the medial septal nucleus and Broca's diagonal band, which terminate in the CA1, CA3, and dentate gyrus regions ([@ref13]). ", "Some scholars report that both morphine and AChR agonists can modulate hippocampal neuronal excitability ([@ref14]). ", "Moreover, previous studies have shown that the CA1 and dentate gyrus of the hippocampus are involved in nociception ([@ref6], [@ref15], [@ref16]). ", "However, the interplay of cholinergic and opioid effects for pain evoked responses of PEN and PIN, particularly in the hippocampal CA3, is not well studied. ", "Therefore, in this study, we have evaluated the effects of ACh, the muscarinic agonist pilocarpine, and the muscarinic antagonist atropine on pain related electrical activities in the hippocampal CA3 region of morphine addicted rats.", "\n\nMaterials and Methods {#sec1-2}\n=====================\n\nExperimental animals {#sec2-1}\n--------------------\n\nFemale Wistar rats (Animal Centre of the Second Affiliated Hospital, Harbin Medical University, Certificate No. ", "09-2-1) weighing between 230-260 g were used in this study. ", "Experiments complied with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH publication number 85-23; revised, 1996). ", "Morphine-dependent rats were produced by subcutaneous injection of morphine hydrochloride for 6 days at increasing concentrations ([Table 1](#T1){ref-type=\"table\"}) as previously described ([@ref17]). ", "Morphine hydrochloride was injected subcutaneously three times per day according to a gradually increasing dose scheme, in which the morphine dose increased from 5 mg/kg to 50 mg/kg over five days to produce morphine addicted rats. ", "Morphine-dependent rats were randomly divided into four groups: 1) control group (n=14, 14 neurons of 8 rats were recorded): intra-CA3 administration of 1 µl saline; 2) ACh group (n=15, 15 neurons of 15 rats were recorded): intra-CA3 administration of ACh (2 μg/1 µl); 3) atropine group (n=13, 13 neurons of 12 rats were recorded): intra-CA3 administration of atropine (0.5 μg/1 μl); and 4) pilocarpine group (n=16, 16 neurons of 8 rats were recorded): intra-CA3 administration of pilocarpine (2 μg/1 μl). ", "All injections were completed within 4 min via a microliter syringe.", "\n\n###### \n\nDose (mg/kg) and time of morphine injection\n\n Dose (mg/kg) of morphine injection \n ----------- ------------------------------------ ---- ----\n 1^st^ day 5 5 5\n 2^nd^ day 10 10 10\n 3^rd^ day 20 20 20\n 4^th^ day 40 40 40\n 5^th^ day 50 50 50\n 6^th^ day 60 60 60\n\nNeurosurgery and electrophysiological studies {#sec2-2}\n---------------------------------------------\n\nRats were anesthetized with 20% urethane (IP, 1 g/kg). ", "The right sciatic nerve was isolated and two skull windows were opened and covered with liquid paraffin. ", "The head of the rat was fixed on a stereotaxic frame (SN-2, Narishige, Japan). ", "After 4-10 min, the rat was paralyzed with tubocurarine chloride (IP, 1 mg/kg) and artificial ventilation was maintained. ", "Single-unit recordings were performed with a glass microelectrode (0.5-1.0 μm, DC resistance 10--30 MΩ) filled with KCl (3 mol/l). ", "According to the B coordinate system of Pellegrino's Atlas ([@ref18]), the glass microelectrode was inserted by a micromanipulator (SM-21, Narishige, Japan) into the hippocampal CA3 (A: −3.2 - −3.8 mm; R or L: 5.0-5.5 mm, H: 6.4-7.3 mm) to record the discharges of the CA3 neurons. ", "Another glass microelectrode filled with drugs (ACh, atropine, and pilocarpine) was inserted by a micromanipulator (SM-11, Narishige, Japan) into the hippocampal CA3 (A: −3.5 mm, R: 5.25 mm, or L: 5.25 mm, H: 6.85 mm) for administration of drugs. ", "The electrical activity was amplified by a microelectrical amplifier (MEZ-820, Nihon Kohden, Japan) and recorded by an output isolator (SS-201J-type, Narishige, Japan) in combination with a tape recorder (ST-CH707X type, Panasonic, Japan). ", "Electrical activity was simultaneously monitored with an oscilloscope (VC-9, Nihon Kohden, Japan). ", "As the neural discharges were recorded, the electrical stimulation of the sciatic nerve was performed through a double stainless steel electrode (delay: 0, interval: 5 msesc, duration: 0.3 msec, and train: 5; SEN-3301, Nihon Kohden, Japan) as noxious stimulation. ", "Articular movement and hair touching were set as the non-noxious stimulation to identify the pain reactive neurons. ", "The discharge of each neuron was monitored continuously for 30 min, and typical discharges were recorded three times every two min.", "\n\nHistological identification of the hippocampal CA3 region {#sec2-3}\n---------------------------------------------------------\n\nAt the end of the experiment in order to identify the tip position, pontamine sky blue in the microelectrode was diffused out with a negative direct current (30 mA, 15 min) into the hippocampal CA3 (A: −3.2 - −3.8 mm; R or L: 5.0-5.5 mm, and H: 6.4-7.3 mm) ([Figure 1](#F1){ref-type=\"fig\"}).", "\n\n{#F1}\n\nDefinition of neurons {#sec2-4}\n---------------------\n\nRecording PEN and PIN activity is widely considered as an appropriate electrophysiological read-out of pain ([@ref19], [@ref20]). ", "PENs are defined as the neurons that responded by increasing the discharge frequency to noxious stimulus ([@ref21]), while PINs are defined as the neurons that responded by decreasing the discharge frequency to noxious stimulus ([@ref22]). ", "PEN showed very few spontaneous discharges before noxious stimulation. ", "In contrast, spontaneous discharges were common in PIN, which were readily inhibited by the application of noxious stimulation.", "\n\nObservation index {#sec2-5}\n-----------------\n\nThe net increased value (NIV, in Hz) refers to the difference in the PEN or PIN between the average frequency of evoked discharges after noxious stimulation and the average frequency of the discharges within 2 sec before noxious stimulation. ", "The latency (s) refers to the latency time from the noxious stimulation to the appearance of the PEN discharges. ", "Inhibitory duration (ID, in sec) refers to the latency time from the noxious stimulation to the appearance of the PIN discharges.", "\n\nStatistical analysis {#sec2-6}\n--------------------\n\nData were scanned to a computer with Powerlab/8sec (ADInstruments, Australia) and analyzed with Chart v5.3 software (ADInstruments, Australia). ", "All data were expressed as mean±SEM and were analyzed using SPSS 16.0 software (SPSS, USA). ", "Statistical differences were evaluated by repeated measures ANOVA, while the post hoc test was used to compare the differences between the two groups. *", "P*\\<0.05 was considered statistically significant.", "\n\nResults {#sec1-3}\n=======\n\nEffects of saline on the electrical activities in hippocampal CA3 neurons of morphine addicted rats {#sec2-7}\n---------------------------------------------------------------------------------------------------\n\nIn the control group, the noxious stimulation increased the discharge frequency of PENs while decreasing the frequency of PINs. ", "The average NIV of PENs was 3.15±0.15 Hz, and the latency was 0.26±0.03 sec. ", "The NIV of PENs and the latency showed no significant differences 0-30 min after the intra-CA3 administration of saline compared to values before injection ([Figure 2A](#F2){ref-type=\"fig\"}). ", "The average NIV of PINs was --4.01±0.57 Hz and the average ID of PINs was 0.31±0.04 sec. ", "Zero to 30 min after the intra-CA3 administration of saline, the NIV of PINs and the ID showed no significant differences compared to values before injection ([Figure 3A](#F3){ref-type=\"fig\"}). ", "Administration of saline as a control treatment produced no significant change in the electrical activity of PENs and PINs ([Figure 2A](#F2){ref-type=\"fig\"} and [Figure 3A](#F3){ref-type=\"fig\"}).", "\n\n{#F2}\n\n{#F3}\n\nInfluence of ACh on the electrical activities of the CA3 neurons in morphine-addicted rats {#sec2-8}\n------------------------------------------------------------------------------------------\n\nIn the ACh group, the average NIV of PENs was 3.38±0.37 Hz, and the latency was 0.27±0.03 sec. ", "Immediately after the intra-CA3 administration of ACh, the NIV of PENs began to decline and the latency began to prolong ([Figure 2B](#F2){ref-type=\"fig\"}). ", "These effects reached a peak at 12 min after administration of ACh, with the NIV decreasing to 1.06±0.2 Hz (*F* -statistic= 990.268, *P*\\<0.0001) and the latency being prolonged to 0.50±0.04 sec (*F=* 359.312, *P*\\<0.0001). ", "Between the time points of 0-20 min after administration of ACh, the NIV (*F*= 105.045, *P*\\<0.0001) and latency (*F*= 51.613, *P*\\<0.0001) of PENs showed significant changes compared with those before administration. ", "Between the time points of 2-18 min after administration, the NIV, and between the time points of 2-20 min after administration, latency showed significant changes (*P*\\<0.05 or *P*\\<0.01) compared with those of the saline control group ([Figure 4](#F4){ref-type=\"fig\"}). ", "At 22 min after ACh administration, the NIV and latency of PENs gradually returned to the values observed before treatment.", "\n\n{#F4}\n\nThe average NIV of PINs was −4.41±0.78 Hz, and the average ID of PINs was 0.31±0.06 sec. ", "Immediately after injection of ACh, the average NIV began to increase and ID began to shorten ([Figure 3B](#F3){ref-type=\"fig\"}). ", "These changes reached a peak value at 10 min after injection; with the average NIV at −0.91±0.27 Hz (*F*= 392.202, *P* \\< 0.0001) and the ID decreased to 0.1±0.02 sec (*F*= 257.19, *P*\\<0.0001). ", "The average NIV (*F*= 41.187, *P*\\<0.0001) showed significant differences compared to values before injection between the time points of 0-18 min after injection. ", "Between 0-20 min after injection, the ID (*F*= 12.832, *P*= 0.006) of PINs showed significant differences compared to values before injection. ", "Between the time points of 2-16 min after administration, the NIV, and between the time points of 2-18 min after administration, ID showed significant changes (*P*\\<0.05 or *P*\\<0.01) compared with those of the control group ([Figure 5](#F5){ref-type=\"fig\"}).", "\n\n{#F5}\n\nEffects of atropine on the electrical activities of the CA3 neurons in morphine addicted rats {#sec2-9}\n---------------------------------------------------------------------------------------------\n\nIn the atropine group, at 8 min after the intra-CA3 administration of atropine, the average NIV of PENs significantly increased from 2.92±0.4 Hz to 5.56±0.61 Hz (*F*=515.756, *P*\\<0.0001) and the latency decreased from 0.26±0.05 sec to 0.09±0.02 sec (*F*=391.803, *P*\\<0.0001) ([Figure 2C](#F2){ref-type=\"fig\"}). ", "During 0-18 min after the injection of atropine, the NIV (*F* = 21.246, *P*= 0.001) and the latency (*F*=24.994, *P*\\<0.0001) of PENs showed obvious changes compared to those before administration. ", "Between the time points of 0-16 min after administration, the NIV, and between the time points 0-18 min after administration, latency showed significant changes (*P*\\<0.05 or *P*\\<0.01) compared with those of the control group ([Figure 4](#F4){ref-type=\"fig\"}).", "\n\nThe average NIV of PINs significantly decreased 8 min after the intra-CA3 administration of atropine from −4.15±0.47 Hz to −6.81±0.58 Hz (*F*=119.403, *P*\\< 0.0001) and the ID was prolonged from 0.33±0.04 sec to 0.54±0.08 sec (*F*=136.968, *P*\\<0.0001) compared to values before injection ([Figure 3C](#F3){ref-type=\"fig\"}). ", "At the time points of 0-20 min after the injection, the NIV (*F*=7.242, *P*= 0.023) and ID (*F*=17.395, *P*=0.002) of PINs showed significant changes compared to values before administration. ", "Between the time points of 0-16 min after administration, the NIV, and between the time points of 0-18 min after administration, ID showed significant changes (*P*\\<0.05 or *P*\\<0.01) compared to the saline control group ([Figure 5](#F5){ref-type=\"fig\"}).", "\n\nInfluence of pilocarpine on the electrical activities of the CA3 neurons in morphine addicted rats {#sec2-10}\n--------------------------------------------------------------------------------------------------\n\nIn the pilocarpine group, the average NIV of PENs was 3.03±0.43 Hz and the latency was 0.27±0.04 sec before the injection of pilocarpine. ", "After the intra-CA3 administration of pilocarpine, the NIV of PEN began to decrease and the latency began to prolong ([Figure 2D](#F2){ref-type=\"fig\"}). ", "These effects peaked at 8 min after administration of pilocarpine. ", "The average NIV decreased to 0.94±0.25 Hz (*F*= 550.604, *P*\\< 0.0001), and the latency was prolonged to 0.5±0.08 sec (*F*=193.24, *P*\\<0.0001) compared to values before injection. ", "The NIV (*F*=14.213, *P*=0.002) and the latency (*F*=4.999, *P*=0.041) showed significant differences during the time points of 0-20 min after the injection. ", "Between the time points of 0-18 min after administration, the NIV and latency showed significant changes (*P*\\<0.05 or *P*\\<0.01) compared with those of control group ([Figure 4](#F4){ref-type=\"fig\"}).", "\n\nAfter the intra-CA3 injection of pilocarpine, the NIV of PINs began to increase and ID began to shorten ([Figure 3D](#F3){ref-type=\"fig\"}). ", "These effects also reached a peak value at 8 min after the injection, when the average NIV of PINs significantly increased from -3.97±0.52 to -1.27±0.39 Hz (*F*=507.714, *P*\\< 0.0001), and the average ID decreased from 0.30±0.05 to 0.11±0.03 sec (*F*=526.168, *P*\\<0.0001) compared to values before injection. ", "The time points of 0-20 min after the injection showed significant changes in the average NIV (*F*=21.813, *P*=0.001) and ID (*F*=5.772, *P*=0.04) of PINs compared with measurements obtained prior to injection. ", "Between the time points of 0-16 min after administration, the NIV, and between the time points of 2-18 min after administration, ID showed significant changes (*P*\\<0.05 or *P*\\<0.01) compared with the control group ([Figure 4](#F4){ref-type=\"fig\"}). ", "About 22 min after the administration, the NIV and ID of PINs returned to the values observed before treatment ([Figure 5](#F5){ref-type=\"fig\"}).", "\n\nDiscussion {#sec1-4}\n==========\n\nIn order to investigate the interplay of cholinergic and opioid effects for pain evoked responses in the CNS, we studied the effects of ACh on the electrical activities of PENs and PINs in hippocampal CA3 of morphine-addicted rats. ", "Our study revealed that, in this animal model for morphine dependence, ACh and pilocarpine inhibited the electric activities of evoked discharges of PENs, but potentiated discharges of PINs. ", "On the other hand, atropine potentiated the electric activities of evoked discharges of PENs and inhibited those of PINs. ", "These results demonstrate that intra-CA3 administration of ACh or pilocarpine can produce antinociceptive effects, whereas intra-CA3 administration of atropine can facilitate nociceptive effects in morphine-dependent rats.", "\n\nThese results reveal that cholinergic neurons in the hippocampal CA3 region of morphine-dependent rats are involved in the response to noxious stimuli, and these results are similar to the previously studied effects in control rats ([@ref23]). ", "In the previous study in normal rats, cholinergic substances evoked a peak in electrical activity at 6 to 10 min after injection. ", "In morphine-dependent rats, we observed a peak activity at 8 to 12 min after injection; 2 to 4 min later than in normal rats. ", "Although further studies are needed comparing the effects in normal rats versus morphine-dependent rats, the rather large differences to the previous results ([@ref23]) indicate that morphine treatment delays ACh-dependent electrical activities of PENs and PINs in hippocampal CA3. ", "This may be a sign of delayed sensitivity of pain related neurons towards ACh in the hippocampal CA3 region after morphine treatment.", "\n\nEarly pharmacological experiments have shown that the microinjection of ACh or carbachol into specific brainstem nuclei can produce antinociceptive effects that can be reversed by muscarinic receptor antagonists ([@ref24]). ", "Previous studies, including three studies performed in our laboratory ([@ref6], [@ref15], [@ref23]) provided evidence that the hippocampal formation is involved in pain modulation and that nociceptive stimuli modify the electrical activity of the hippocampus ([@ref25]). ", "Moreover, ACh can mediate some antinociceptive effects, which are produced by other types of receptors or drugs. ", "For instance, the antinociceptive effect of crotoxin is attributed to activation of muscarinic receptors, by action of the toxin on central cholinergic neurons ([@ref26]). ", "Another study showed that atropine blocked the antinociceptive effect of the crotoxin, further confirming that central muscarinic receptors mediate the antinociceptive effect of the toxin ([@ref27]). ", "Our present results, demonstrating that atropine potentiated the electric activities of evoked discharges of PENs and inhibited those of PINs, are consistent with the notion that ACh participates in antinociception in the CNS. ", "On the other hand, centrally administered opioids increase the ACh concentration in cerebrospinal fluid and in spinal cord dorsal horn microdialysates. ", "In this case, analgesia resulting from central opioid injection is partially reversed by spinal injection of mAChR antagonists ([@ref28]). ", "Therefore, it appears that ACh participates in analgesic effects after systemic or central administration of opioids.", "\n\nThe hippocampus receives cholinergic innervation from the medial septum-diagonal band complex. ", "Every hippocampal region is connected by extensive fiber networks. ", "The hippocampal CA3 area receives synaptic input from the granule cells of the dentate gyrus. ", "The pyramidal cells in the CA3 area send their axon collaterals into the strata radiatum and strata oriens of the hippocampal CA1 area. ", "Aside from these major fiber connections, the dendritic shafts of various types of interneurons can build connections with the spines of principal cells. ", "Cholinergic suppression of synaptic transmission has been reported in the CA3 region ([@ref29]). ", "When synaptic transmission in the CA3 region was suppressed, the transmission of noxious stimulus was likely to be inhibited. ", "Our previous study indicates that the hippocampal CA3 area is involved in the modulation of nociception ([@ref23]); the effect in the hippocampal CA3 of morphinistic rats was similar to the effects in normal rats ([@ref23]).", "\n\nCompared to the results of our previous study performed in normal rats ([@ref23]), the peaks of the pain evoked responses in morphine-dependent rats are shifted to later response times. ", "These results are similar to the previously studied effects in the hippocampal CA1 area ([@ref16]). ", "The results indicate that the sensitivity of pain related neurons in the CA1 and CA3 areas to noxious stimulation is attenuated in morphine addicted rats. ", "Thus, morphine addiction seems to attenuate the sensitivity of pain related neurons to the noxious information processed in several hippocampal areas. ", "Altered synaptic transmission and plasticity in brain areas involved in reward and learning are thought to underlie the long-lasting effects of addictive drugs. ", "Data by Kahn *et al* showed a strong reduction of cellular proliferation together with an increase of glutamate decarboxylase-67 mRNA transcription in the dentate gyrus-CA3 region of the adult rat hippocampus after repeated morphine treatment ([@ref30]). ", "It is likely that reducing cell proliferation and neurogenesis and altering neuronal phenotypes, have an impact on ACh-dependent antinociceptive neurotransmission in the hippocampal CA3. ", "However, further investigation is required to determine the precise mechanisms underlying the changes in antinociceptive effects in morphine addicted rats.", "\n\nConclusion {#sec1-5}\n==========\n\nIn conclusion, our results indicate that: 1) ACh or pilocarpine can produce antinociceptive effects, whereas intra-CA3 administration of atropine can facilitate nociceptive effects in morphine-dependent rats; and 2) the hippocampal CA3 area is involved in the ACh-dependent modulation of noxious stimulation in morphine addicted rats. ", "In comparison to ACh effects in normal rats ([@ref23]), morphine addicted rats show delayed responses of pain related neurons to ACh in the hippocampal CA3, which is likely related to adaptive changes of synaptic transmission and plasticity. ", "Further comparative studies on the underlying mechanisms will deepen our knowledge about pain modulation by ACh and morphine and the effects of morphine dependence on pain.", "\n\nThis work was supported by the Union Foundation of Doctoral Students and New Teachers of National Ministry of Education in China (Project No. ", "20112307120029) and the National Natural Science Foundation of China (Grant No. ", "30240058).", "\n\nConflicts of interest {#sec1-6}\n=====================\n\nThe authors declare no conflicts of interest.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.002006148686632514, 0.003197272541001439, 0.004473807290196419, 0.00287238578312099, 0.0024811611510813236, 0.007704573217779398, 0.0007877871976234019, 0.0007084928802214563, 0.0005849372246302664, 0.0016833783593028784, 0.001418640254996717, 0.0011961727868765593, 0.05944141373038292, 0.0010261036222800612, 0.001955584157258272, 0.0007138130022212863, 0.002522231312468648, 0.00246829423122108, 0.01786406710743904, 0.0009804238798096776, 0.0011868480360135436, 0.0016358763677999377, 0.0005886604194529355, 0.0005610269727185369, 0.0009380986448377371, 0.01015583798289299, 0.0013868245296180248, 0.0006325434078462422, 0.0036290851421654224, 0.029304763302206993, 0.006216874811798334, 0.0020565397571772337, 0.0007481834036298096, 0.0006314477068372071, 0.000892902200575918, 0.0005848237778991461, 0.0006150827393867075, 0.0006438034470193088, 0.0006784002180211246, 0.0007232725038193166, 0.0006385989836417139, 0.0019058462930843234, 0.004244768526405096, 0.0008848406723700464, 0.0011088120518252254, 0.004000827204436064, 0.0008280645124614239, 0.0008413741597905755, 0.000853825593367219, 0.0009586922242306173, 0.0006243120296858251, 0.0005678994348272681, 0.0005457146908156574, 0.0020502635743469, 0.004913768731057644, 0.0019683213904500008, 0.0006464358302764595, 0.0011085496516898274, 0.0007585735293105245, 0.0007190319010987878, 0.0019058462930843234, 0.0019394311821088195, 0.0014739021426066756, 0.001306557678617537, 0.000669201894197613, 0.003033464075997472, 0.0012634011218324304, 0.0006364407599903643, 0.0006194740417413414, 0.0019058462930843234, 0.0009739500237628818, 0.0007483256049454212, 0.015998762100934982, 0.0006843588198535144, 0.007487845607101917, 0.01438402570784092, 0.03948759287595749, 0.0006402998697012663, 0.0019058462930843234, 0.0008711444097571075, 0.010584961622953415, 0.00987015850841999, 0.0006404378218576312, 0.0011800937354564667, 0.019457267597317696, 0.0006331914337351918, 0.0012816863600164652, 0.0006546276854351163, 0.000636085111182183, 0.07004255801439285, 0.036931004375219345, 0.0006454683607444167, 0.0006492076790891588, 0.0010818400187417865, 0.002172591397538781, 0.0006391536444425583, 0.0005870165769010782, 0.0010990614537149668, 0.0011807290138676763, 0.0011415727203711867, 0.0016333464300259948, 0.0010483524529263377, 0.0007976977503858507, 0.0011636052513495088, 0.000704426784068346, 0.0017845204565674067, 0.0011097085662186146, 0.0007564678089693189, 0.0008796020993031561, 0.0006648257840424776, 0.0007013719296082854, 0.0006707419524900615, 0.0020277202129364014, 0.00105672562494874, 0.006829909980297089, 0.0016689141048118472, 0.0006087364163249731, 0.048498015850782394, 0.0015863298904150724, 0.0006129684043116868, 0.0007260798010975122, 0.00065669632749632, 0.0009143174393102527, 0.0010075613390654325, 0.0006896556005813181, 0.006820849608629942, 0.008187150582671165, 0.0009220272186212242, 0.0023906310088932514, 0.0010207974119111896, 0.0023694434203207493, 0.001515941577963531, 0.0012899050489068031, 0.0007307794294320047, 0.000608319416642189, 0.0006268471479415894, 0.0006632417789660394, 0.001032870844937861, 0.001995587022975087 ]

[ "The ancient Seleucia was founded along the Tigris river around the year 305 BC, and abandoned in 165 AD, due to the river mutating its course (Wikipedia).", "\n\nHowever in 780 AD the Catholicos (=Patriarch) of Seleucia was the most important Christian authority, overseeing over a quarter of the world's Christians [2]. ", "This fact alone suggests that the city was far from an abandoned site, and rather thriving.", "\n\nSome sources refer to Middle Ages Seleucia as Seleucia-Ctesiphon. ", "So let's assume that the Catholicos was based in Ctesiphon; the destruction of Ctesiphon was perpetrated by the invading Arabs, who later founded Baghdad. ", "However Again there is an inconsistency, as the Arabs burned Ctesiphon (or Seleucia-Ctesiphon) in the VII century, and founded Baghdad one hundred years later. ", "Where were the Catholicoi(?) ", "based meanwhile?", "\n\nAll this is in disagreement with the most common view that Seleucia was abandoned because of Roman attacks and replaced by Ctesiphon in the II century. ", "The neighboring Ctesiphon, was in turn abandoned in the VII century after the Arab invasion, while Baghdad was founded in the VIII century.", "\n\n1 Answer\n1\n\nThe short answer to your question is that the ancient Seleucia and the Medieval Seleucia are in fact two different cities.", "\n\nThe original Seleucia was built in 305 BC as the first capital of the Seleucid empire, as you found in your sources. ", "This city was built on the western bank of the Tigris and was ultimately abandoned in 165 AD, when it was destroyed by the Roman general Avidius Cassius. ", "That Seleucia was never rebuilt, and we have since uncovered a wealth of archaeological evidence from the site.", "\n\nA little over sixty years later, the Persian emperor Ardashir I sought to rebuild the city of Seleucia, as part of his own empire. ", "However, he built it on the opposite side of the river from the original Seleucia. ", "This city was originally referred to as Veh-Ardashir, but it appears that this name fell out of use over time and the city was eventually referred to as Seleucia, even though it was a different city from the original Seleucia.", "\n\nThe city of Ctesiphon was yet another city, distinct from both Seleucias, built on the eastern bank of the Tigris river. ", "In a religious context, however, these two cities together would have been known as Seleucia-Ctesiphon because they shared a single bishop.", "\n\nTo put all of this together on a single map, the three cities are shown in the map below:\n\nSources: This University of Michigan page, and the Wikipedia pages for Seleucia, The Council of Seleucia-Ctesiphon, Al-Mada'in, and Ardashir I. The image was from the Seleucia Wikipedia page, with my own annotations." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0007699420093558729, 0.0006542880437336862, 0.0006770577747374773, 0.0007167557487264276, 0.000946245389059186, 0.00078991410555318, 0.0016018861206248403, 0.0007148187723942101, 0.0008150393259711564, 0.0006192012224346399, 0.0006771445041522384, 0.0006862469599582255, 0.0022982703521847725, 0.0006790331681258976, 0.0007257647812366486, 0.0008621340384706855, 0.0006774492212571204, 0.0010893346043303609, 0.0006203451775945723, 0.0005913912318646908 ]

[ "Health insurance giant Blue Cross Blue Shield of Florida gave more money to Florida campaigns than any other entity during 2012 - $4.8 million. ", "The company says the contribution are an investment in like-minded candidates as Blue Cross works towards implementation of the Affordable Care Act. ", "But the targeted contributions haven't helped Blue Cross convince the legislature to extend Medicaid coverage to more Florida residents. ", "Other large contributors are besides Blue Cross include Florida and the U.S. Chamber, Disney, Florida Power & Light and the U.S. Sugar Corp. Full story at the Tampa Bay Times.", "\n\nSales and Marketing Advice Three things your competition does NOT have\n\nYou have something that your competition doesn’t have. ", "No, I’m not talking about that one-of-a-kind feature built into your product or exclusive new twist you’ve added to your service offering. ", "It’s much more important than these, and I’m sure competitors are in the dark about what you have... »Ron Stein's column continues here.", "\n\nOn the Move\n\nVerizon Wireless names Mariano Legaz president of Florida region\n\nTechnology-industry veteran Mariano Legaz has been appointed Florida region president for Verizon Wireless. ", "Legaz will lead one of Verizon's biggest regions, with 80+ retail outlets and 2,500 employees. ", "A native of Argentia, Legaz also serves on the board of directors for the United States Hispanic Chamber of Commerce. » ", "More\n\nBoca Raton-based investment company Incapital has its sights set on growth. ", "It's expanding in Canada while ramping up a Tampa Bay office, seizing on a talent pool of surplus Raymond James Financial brokers after the St. Petersburg firm's merger with Morgan Keegan. ", "Read an interview with CEO John Radtke at the Tampa Bay Times.", "\n\nColumn: Why Stand Your Ground will still stand after George Zimmerman verdict\n\nRepublicans control the lawmaking body that passed the Stand Your Ground law. ", "They’re not just the defense in this case. ", "They’re the judge and jury in Tallahassee. ", "So if the Florida Legislature actually reviews any legislation that makes the case to change the self-defense law, an acquittal is likely. ", "More at the Miami Herald.", "\n\nSmall Business Advice Why benchmarks are so important for your company\n\nOne of the things that each and every business needs is a systematic way of evaluating their performance. ", "Without quantifiable benchmarks, a firm has no idea if they are swimming ahead of the pack or just treading water. » ", "Read more from Dr. Jerry Osteryoung\n\nThe Real Treasure Coast\n\nTreasure hunters discover gold coins worth $250K off Florida coast\n\nThis past weekend, Brent Brisben, owner of the 1715 Treasure Fleet Queen's Jewels salvage company, and his crew of three found 48 gold coins that date back 300 years. ", "The coins were found near the Sebastian Inlet on Florida's Treasure Coast and are reported to be worth up to $250,000.» ", "Video below is from CNN. ", "More also at WPTV." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005916483351029456, 0.0005246608634479344, 0.0006186927785165608, 0.0005532074719667435, 0.0007421689224429429, 0.0006976507138460875, 0.0006270799203775823, 0.0006425816682167351, 0.0007145739509724081, 0.0006053794641047716, 0.0007292485679499805, 0.0005989379133097827, 0.0006107558729127049, 0.004586518742144108, 0.0008931251359172165, 0.0007762038731016219, 0.0006499763112515211, 0.0006163083598949015, 0.0005937845562584698, 0.0005784783861599863, 0.0006346665904857218, 0.0006088846712373197, 0.0006013313541188836, 0.0006652332958765328 ]

[ "João Antunes\n\nJoão Antunes (1642–1712) was a Portuguese architect and master mason, considered to be one of the most important architects of Baroque architecture. ", "Antunes served as royal architect during the reign of King Pedro II of Portugal and is responsible a number of famous landmarks in Lisbon, such as the Natitional Pantheon at Santa Engrácia, and the tomb of Saint Joana, Princess of Portugal.", "\n\nBiography\n\nAntunes was appointed royal architect (arquitecto Real) in 1699. ", "His main work is the Church of Santa Engrácia (started 1682) in Lisbon, a Greek cross building with curved façades typical of the Baroque architecture of Borromini. ", "Antunes was also responsible for the projects for the Church of Saint Elói (built after 1694, destroyed in the 1755 Lisbon earthquake) and the Church of Menino Deus (1711–1737), both in Lisbon. ", "These churches had the shape of a rectangle with angled edges, thus assuming the shape of an irregular octagon. ", "This floorplan scheme, possibly derived from designs by Guarino Guarini, would greatly influence other churches in Portugal and colonial Brazil. ", "All of these churches were decorated with marble panels of Italian influence, anticipating the dominant role that Roman art would have in the Portuguese court during the 18th century.", "\n\nAntunes was also responsible for the Church of Bom Jesus of Barcelos, started in 1704. ", "The innovative floorplan of this church consists of a Greek cross church (an influence of Santa Engrácia) inserted into a hexagon with four sides of round shape. ", "Another work by Antunes in northern Portugal was the renovation of the sacristy of Braga Cathedral.", "\n\nJoão Antunes also designed several Baroque altarpieces for the private chapels of the nobility and churches like the Santo Antão Church in Lisbon and the Chapel of Saint Vincent in Lisbon Cathedral (the latter was lost in the 1755 earthquake).", "\n\nAnother notable work is the large tomb constructed for Princess Joana in the Convent of Jesus in Aveiro. ", "The tomb consists of a large central chest with cherubs supporting the royal arms at top. ", "All of these works were made of polychromed marble of Italian influence.", "\n\nGallery\n\nReferences\n\nCategory:1642 births\nCategory:1712 deaths\nCategory:Portuguese architects" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0007094161701388657, 0.0006308642914518714, 0.000642104190774262, 0.0006361299310810864, 0.0006979253375902772, 0.0006498845759779215, 0.0006707205320708454, 0.0006977365119382739, 0.0007367657963186502, 0.0007792145479470491, 0.0006792807253077626, 0.000632156734354794, 0.0006435589166358113, 0.0009885423351079226, 0.0006664316751994193, 0.0005691053229384124 ]

[ "Introduction {#s1}\n============\n\nIn the process of regulatory evolution, a finite set of genes are continuously combined to form new gene expression patterns and create a myriad of phenotypes ([@bib15]; [@bib68]; [@bib69]). ", "Acquiring mutations that increase the expression of a single gene can be sufficient to make an individual substantially fitter than its competitors. ", "For example, increased expression of drug target or efflux genes is a common mechanism for the evolution of resistance to antibiotics ([@bib40]; [@bib49]), chemotherapeutics ([@bib18]), and insecticides ([@bib23]; [@bib17]). ", "Increased expression of individual genes also provides access to new nutrient resources ([@bib48]) and tolerance to diverse toxins ([@bib60]). ", "The fitness effect of increased expression of individual genes has mostly been determined in plasmid-based overexpression libraries ([@bib48]; [@bib60]). ", "However, the large majority of genes reside on chromosomes, neighboring other genes, and thus mutations affecting gene expression occur in a specific chromosomal context. ", "Unequal mutation rates along the genome ([@bib28]; [@bib3]) imply that the chromosomal location can affect the adaptive potential of a gene, that is, the probability that adaptive mutations increasing expression of the gene will spread in a population under given selective conditions.", "\n\nAdaptation by increased gene expression can result from mutations of different types ([@bib9]; [@bib41]): point mutations, promoter insertion by mobile elements ([@bib43]; [@bib26]; [@bib61]), promoter capture by chromosomal rearrangements ([@bib6]; [@bib10]; [@bib70]), and gene duplication or amplification, which increases expression by way of gene dosage ([@bib4]; [@bib25]). ", "How the rate of mutation of these individual mutation types depends on chromosomal position has in part been determined experimentally ([@bib28]; [@bib34]; [@bib43]; [@bib21]; [@bib64]; [@bib3]; [@bib57]; [@bib67]). ", "Despite considerable experimental data, we currently lack an understanding of how position biases of the different mutation types together combine across different chromosomal loci, and therefore, how the chromosomal context of a gene under selection affects overall adaptation.", "\n\nHere, we investigate how the complex interplay of different mutation types and mutation rate biases gives rise to an effect of chromosome position on adaptation in *Escherichia coli*. ", "To this end, we use a single chromosomal drug resistance gene as the target of selection and a two-color fluorescence reporter readout for adaptive mutations in evolution experiments. ", "We quantify the effect of the chromosomal position of the selected gene on adaptation and identify the mutation types underlying this effect. ", "We find that a strong effect of chromosome position on adaptation is largely explained by rate differences of gene duplications and fitness effect differences of two types of promoter co-opting mutations (promoter capture deletions and mutations that cause read-through across upstream transcriptional terminators). ", "Both the observed rate differences and fitness effect differences depend on simple features of the chromosomal neighborhood of the gene under selection. ", "This suggests that the adaptive potential of a gene can be estimated by looking for respective features of chromosomal neighborhoods in genomics data. ", "Based on these results, we propose that the chromosomal context of a gene under selection is an important factor in adaptation.", "\n\nResults {#s2}\n=======\n\nA dual-fluorescence reporter cassette for tracking the dynamics of adaptive mutations of different types {#s2-1}\n--------------------------------------------------------------------------------------------------------\n\nWe devised an evolution experiment with *E. coli,* in which we use a single target of selection embedded in a genetic cassette that serves as a reporter of adaptive potential and mutation types. ", "The reporter cassette can be inserted at any chromosomal position ([Figure 1A](#fig1){ref-type=\"fig\"} and [Figure 1B](#fig1){ref-type=\"fig\"}), and it allows us to distinguish amplifications from other adaptive mutations in real-time using two-color fluorescence measurements. ", "The reporter cassette contains a promoterless, translational *tetA-yfp* gene fusion followed by a transcriptional terminator and a constitutively expressed *cfp* gene. ", "Mutations that increase expression of the tetracycline efflux pump TetA-YFP can be selected with antibiotic and monitored through YFP fluorescence ([Figure 1C](#fig1){ref-type=\"fig\"}, left). ", "Due to the immediate proximity of the *tetA-yfp* and *cfp* genes, the large majority of *tetA-yfp* amplifications are expected to contain the *cfp* gene as well. ", "Thus, adaptation by reporter cassette amplification is expected to be distinguishable from other up-mutations by a fluorescence increase of both YFP and CFP ([Figure 1C](#fig1){ref-type=\"fig\"}, right). ", "We integrated the reporter cassette at four different intergenic loci (*A, B, C,* and D) along the chromosome of an *E. coli ΔtolC* strain ([Figure 1A](#fig1){ref-type=\"fig\"}), giving rise to four strains (strain *A*, *B*, *C,* and *D*). ", "The four loci were chosen to lie in intergenic regions between divergently transcribed genes in order to exclude transcription from upstream genes into the *tetA-yfp* gene ([Figure 1B](#fig1){ref-type=\"fig\"}). ", "Loci *A* and *C* are located approximately in the middle of the right and left replichore, respectively. ", "Since we wanted to also include a locus close to the origin of replication, where no pair of divergently oriented genes is present, we chose a locus in the relatively large intergenic region between the co-oriented *rsmG* and *atpI* genes (locus *D*, [Figure 1B](#fig1){ref-type=\"fig\"}), a locus previously used for large insertions ([@bib36]). ", "Locus *B* was chosen based on its vicinity to several insertion sequences (IS).10.7554/eLife.25100.002Figure 1.A dual-fluorescence reporter cassette for real-time tracking of adaptive mutations of different types.(**A**) Reporter cassette construct for chromosomal insertion. *", "p~0~* = 188 bp random DNA sequence, RBS = ribosomal binding site, hairpins = transcriptional terminators, *tetA-yfp* = selected gene, *cfp* = constitutively expressed amplification reporter. *", "A*, *B*, *C*, *D* = intergenic chromosomal insertion loci, *oriC* = origin of replication. (**", "B**) Immediate chromosomal neighborhoods of loci *A-D*. ", "Black arrows = essential genes. ", "White arrows = non-essential genes. ", "Grey arrows = no essentiality data available. ", "Patterned arrow (*yoeD*) = pseudogene. ", "Orange = cryptic prophage CP4-44. ", "Green = origin of replication (*oriC*). ", "Chromosomal neighborhoods of loci *B*, *C*, and *D* are shown reversed with respect to conventional chromosome coordinates, so that the orientation relative to the reporter cassette is shown in the same way for all four loci. ", "Reporter cassette genes are not drawn to scale. (**", "C**) Example fluorescence trajectories of rescued populations with YFP or YFP+CFP (amplification) fluorescence phenotype. ", "RFU = relative fluorescence units (see Methods), yellow and blue lines = YFP and CFP fluorescence, dotted lines = threshold for phenotype classification. (**", "D**) Increase of tetracycline concentration in ten-day experiment, normalized to strain-specific minimal inhibitory concentration (MIC, dotted line). (**", "E**) qPCR validation of CFP fluorescence as an indicator of extent of amplifications. ", "x-axis: *tetA-yfp* copy number as determined by qPCR on genomic DNA of rescued population with a YFP+CFP fluorescence phenotype. ", "Error bars = SD of technical qPCR triplicates. *", "r* is the Pearson correlation coefficient and *P* its p-value. ", "RFU = relative fluorescence units, line = linear fit.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.002](10.7554/eLife.25100.002)10.7554/eLife.25100.003Figure 1---source data 1.Chromosomal coordinates of reporter cassette insertion loci.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.003](10.7554/eLife.25100.003)10.7554/eLife.25100.004Figure 1---source data 2.Source data for [Figure 1E](#fig1){ref-type=\"fig\"}.Mean and standard deviation of chromosomal *tetA-yfp* copy number (qPCR) and final CFP fluorescence (plate reader data).**DOI:** [http://dx.doi.org/10.7554/eLife.25100.004](10.7554/eLife.25100.004)10.7554/eLife.25100.005Figure 1---figure supplement 1.Fine-scale determination of MICs of tetracycline for ancestor strains used in experimental evolution.", "OD~600~ (platereader units) after 24 hr is shown across tetracycline concentrations (triplicates). ", "Panel columns = integration loci of the reporter cassette, panel rows = genetic background. ", "Note the different scaling of the x-axis for *D* strains. ", "We define MIC (dashed vertical lines and inset values) as the lowest concentration that restricts growth to OD~600~ ≤0.075 (= OD~t~, plate reader units, dashed horizontal lines) in all three replicates. ", "We regard the highest replicate value of strain *E* at 2 µg/mL as an outlier uninformative about ancestral drug sensitivity, as this culture showed highly increased CFP fluorescence indicative of reporter cassette amplification. ", "The selective conditions in evolution experiments (i.e., tetracycline concentrations) were adjusted according to strain-specific MICs to make results more comparable between strains. ", "Without such an adjustment in tetracycline concentrations, different MICs would cause large differences in population sizes and consequently in the probability of acquiring beneficial mutations.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.005](10.7554/eLife.25100.005)10.7554/eLife.25100.006Figure 1---figure supplement 1---source data 1.Triplicate OD~600~ values (plate reader units) across tetracycline concentrations.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.006](10.7554/eLife.25100.006)\n\nWe used a *ΔtolC* genetic background in order to constrain the spectrum of possible adaptive mutations to the reporter cassette locus. ", "TolC is an outer membrane porin and an essential part of several *E. coli* multi-drug efflux pumps, which are a frequent target of selection during drug exposure ([@bib40]) and which cause low-level intrinsic resistance of *E. coli* to tetracyclines ([@bib62]). ", "By employing daily increasing levels of tetracycline ([Figure 1D](#fig1){ref-type=\"fig\"}) and constant daily dilution, we created an experimental evolutionary rescue scenario ([@bib14]), in which populations of ancestral cells rapidly undergo extinction. ", "Rescue from extinction requires the spread of adaptive mutations activating *tetA-yfp* expression in a race against population decline.", "\n\nThe probability of evolutionary rescue depends on the size and decline rate of an unadapted population, and on a combination of rate and fitness effect of adaptive mutations ([@bib44]). ", "We chose selective conditions such that the initial population size and decline rate are approximately equal for all strains. ", "In this way, the probability of rescue (estimated by performing a large number of replicate rescue experiments) is expected to be informative about the strain-specific rate and fitness effect of adaptive mutations of all types. ", "Specifically, we adjusted the tetracycline concentrations used in evolution experiments to strain-specific minimum inhibitory concentrations (MICs), which we measured precisely ([Figure 1---figure supplement 1](#fig1s1){ref-type=\"fig\"}). ", "Given the otherwise isogenic background of the strains, we interpret MICs as a proxy for initial expression of *tetA-yfp*. ", "MIC measurements revealed locus-dependent differences in the initial sensitivity to tetracycline, and all strains showed an increased MIC compared to the cassette-free ancestor, which indicates low baseline expression of *tetA-yfp*. ", "For evolution experiments, we used tetracycline concentrations starting at 50% of the strain-specific MICs ([Figure 1D](#fig1){ref-type=\"fig\"}).", "\n\nWe evolved 95 populations of each strain and measured optical density (OD~600~) and fluorescence daily. ", "Populations yielding OD~600~ above a fixed threshold after ten days were regarded as rescued. ", "Rescued populations were assigned to fluorescence phenotypes (YFP or YFP+CFP) based on the increase in fluorescence at the end of the experiment compared to the ancestor ([Figure 1C](#fig1){ref-type=\"fig\"}). ", "We performed qPCR on genomic DNA of populations displaying increased CFP fluorescence and found a good correlation between CFP fluorescence and the chromosomal copy number of the *tetA-yfp* gene ([Figure 1E](#fig1){ref-type=\"fig\"}). ", "Thus, CFP fluorescence is a valid proxy for the extent of high level amplification of the reporter cassette.", "\n\nThe chromosomal location of a selected gene has large effects on adaptation {#s2-2}\n---------------------------------------------------------------------------\n\nThe number of rescued populations differed significantly between strains ([Figure 2A](#fig2){ref-type=\"fig\"}), showing that the chromosomal location of the *tetA-yfp* gene is critical for its adaptive potential. ", "No rescue was observed without the reporter cassette ([Figure 2---figure supplement 1](#fig2s1){ref-type=\"fig\"}), and all rescued populations displayed increased YFP fluorescence, suggesting that rescue depended on the presence and overexpression of *tetA-yfp*. ", "To test if increased expression of *tetA-yfp* was indeed causative for rescue, we deleted the reporter cassette genes in single clones isolated from three different rescued populations. ", "Deletions eliminated growth on tetracycline in all three cases ([Figure 2B](#fig2){ref-type=\"fig\"}). ", "A minority of populations went extinct despite transiently increased YFP fluorescence (37/290 extinct populations), illustrating how our experimental selection filters for mutations that increase *tetA-yfp* expression above a minimum level. ", "Two sets of replicate experiments yielded qualitatively similar results ([Figure 2C](#fig2){ref-type=\"fig\"}), although the number of rescued populations fluctuated considerably between replicates, which likely reflects both technical variability (for example, in the precise amount of transferred inoculum from day to day) as well as the inherent stochasticity of evolutionary rescue processes. ", "Time-trajectories of OD~600~ and OD-normalized YFP and CFP fluorescence of all evolved populations are available in [Supplementary file 1](#SD14-data){ref-type=\"supplementary-material\"} and fluorescence phenotype classifications in [Supplementary file 2](#SD15-data){ref-type=\"supplementary-material\"}.10.7554/eLife.25100.007Figure 2.Large differences in adaptation by amplification depend on flanking homology in the chromosomal neighborhood.(**A**) Numbers of rescued populations by fluorescence phenotype. ", "The numbers of rescued vs. extinct populations and the distribution of fluorescence phenotypes (YFP or YFP+CFP) differ among strains *A*, *B*, *C*, and *D* (p\\<10^−16^ and p\\<10^−7^, Fisher's exact test). (**", "B**) The ability of evolved clones to grow on tetracycline depends on the reporter cassette. ", "Pictures show YFP-fluorescence of cultures spotted at different dilutions on solid medium with and without tetracycline (2.25 µg/mL). ", "Top rows: evolved clones sampled from rescued populations of three different strains. ", "Bottom rows: respective deletion mutants lacking reporter cassette genes. ", "In parentheses: position of the sampled populations on 96-well plates in evolution experiments. (**", "C**) Numbers of rescued populations by fluorescence phenotype in two additional replicate sets of evolution experiments. (**", "D**) IS5 copies flanking locus *B* promote duplication. ", "Left: Cartoon showing the position of the reporter cassette between two copies of IS5 (distances not drawn to scale, genes in between omitted) and the putative unequal crossing over-event causing initial duplications. ", "Right: The expected amplicon junction is present in amplifications in strain *B*, but not in the ancestor or in amplifications in strain *BΔIS5I*. ", "Arrow: junction PCR product obtained with outward facing primers shown as pointers in the cartoon on the left.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.007](10.7554/eLife.25100.007)10.7554/eLife.25100.008Figure 2---figure supplement 1.Survival curves of 95 populations in evolution experiments.", "OD~t~ = threshold OD~600~. Solid lines = IS-wt genetic background, dashed lines = IS-free genetic background, dotted line in Locus *B* panel = strain *BΔIS5I*. ", "Triple solid lines for loci *A-D* represent replicate sets of evolution experiments. ", "Local minima in the number of populations are due to populations that fell below OD~t~ only transiently.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.008](10.7554/eLife.25100.008)10.7554/eLife.25100.009Figure 2---figure supplement 1---source data 1.Numbers of populations with OD~600~\\>OD~t~.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.009](10.7554/eLife.25100.009)10.7554/eLife.25100.010Figure 2---figure supplement 2.PCR products confirming the deletion of reporter cassette genes in clones shown in [Figure 2B](#fig2){ref-type=\"fig\"}.Colony PCR was performed with primers flanking integration loci.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.010](10.7554/eLife.25100.010)\n\nAmplification mediated by flanking homology is a main determinant of neighborhood-dependent adaptation {#s2-3}\n------------------------------------------------------------------------------------------------------\n\nWe next set out to identify which mutation types were responsible for locus-dependent differences in the number of rescued populations. ", "Strain *B* gave the highest number of rescued populations, and 76/77 rescued populations of this strain had reporter cassette amplifications ([Figure 2A](#fig2){ref-type=\"fig\"}). ", "Rescue by amplification in the other three strains was rare ([Figure 2AC](#fig2){ref-type=\"fig\"}), implying that large differences between strains were related to locus-specific amplification. ", "According to the 'canonical' model, formation of amplifications is limited by the rate at which initial duplications are generated ([@bib54]). ", "Rates of spontaneous duplication are elevated between homologous sequences such as rRNA operons or duplicate copies of insertion sequences (IS) due to frequent unequal crossing-over ([@bib3]; [@bib4]). ", "We found homologous copies of IS5 at either side of locus *B* (IS5H and IS5I), but no flanking homology in the chromosomal neighborhood of the other three loci. ", "We verified the presence of IS5 at the boundary of the amplicon in rescued *B* populations by obtaining a PCR product of the expected junction in 16/16 tested clones of evolved populations (PCR products of three populations shown in [Figure 2D](#fig2){ref-type=\"fig\"}). ", "The junction was undetectable in the ancestor. ", "Deleting one of the two flanking IS (strain *BΔIS5I*) gave highly reduced numbers of rescued populations ([Figure 2A](#fig2){ref-type=\"fig\"}) and only a minority (3/9) had increased CFP fluorescence, which was not connected to amplification between the IS5H and IS5I ([Figure 2D](#fig2){ref-type=\"fig\"}). ", "These results confirm flanking homology and its effect on gene amplification as a main factor of chromosomal neighborhood on adaptation by increased gene expression.", "\n\nAdaptation involves a broad diversity of mutation types {#s2-4}\n-------------------------------------------------------\n\nGiven the above result, we expected differences to disappear in the absence of IS and we repeated the evolution experiments with four strains that had the reporter cassette integrated at the same four loci as before, but that are derived from a multiple deletion strain (MDS42) free of all IS elements ([@bib51]). ", "MDS42 lacks around 15% of the MG1655 chromosome, including all prophages and many nonessential genes. ", "Apart from the absence of IS-related mutations, the rates of other mutation types in MDS42 are similar to those in MG1655 ([@bib51]). ", "Loci *A-D* are not immediately next to genes absent in MDS42, the chromosomal neighborhood at a larger scale, however, is different between IS-wt and IS-free versions of the strains ([Figure 3---figure supplement 1](#fig3s1){ref-type=\"fig\"}).", "\n\nDespite the expected absence of frequent amplification of locus *B* in the IS-free genetic background, the fraction of rescued populations was still different among strains (p=3 × 10^−5^, Fisher's exact test), and rescue was observed only in strains *B* and *D* (10 and 8 rescued populations, respectively). ", "To explain these remaining differences, we identified candidate rescue mutations in strains with and without IS. ", "Sequencing \\~1 kb of DNA upstream of *tetA-yfp* revealed mutations of different types: point mutations (including small insertions and deletions), larger deletions, and insertions of mobile elements ([Figure 3AB](#fig3){ref-type=\"fig\"} and [Figure 3---figure supplement 2](#fig3s2){ref-type=\"fig\"}). ", "The relative contribution of the different mutation types to adaptation differed between different chromosomal loci in both IS-containing and IS-free strains (p=10^−9^ and p=0.003, Fisher's exact test). ", "In several cases, mutations co-occurred with other mutations or amplifications (colored dots in [Figure 3A](#fig3){ref-type=\"fig\"}), suggesting interactions between mutations, some of which we explored in more depth later (section 'Chromosomal neighborhood influences adaptation by affecting the fitness cost of amplifications').10.7554/eLife.25100.011Figure 3.Adaptation involves a broad diversity of mutation types.", "Mutation types in rescued populations of IS-wt (**A**) and IS-free (**B**) strains. ", "Colored dots = later mutations occurring on top of other mutations (see Methods). ", "Mutation types differ between loci (p=10^−9^ (**A**) and p=0.003 (**B**), Fisher's exact test). (**", "C--E**) Effect of reconstructed point mutations and IS insertions on reporter expression on plasmids. ", "Plasmids contain mutations reconstructed upstream of a ribosomal binding site (not shown) and a *yfp* reporter gene as shown in cartoons. ", "Empty = auto-fluorescence control (plasmid backbone); *p~0~* = ancestral 188 bp random sequence. ", "Error bars = 95% confidence intervals of six technical replicates. ", "Grey shading: 95% confidence interval of OD~600~-normalized *p~0~* fluorescence. ", "Asterisks = p\\<0.05, two-tailed t-test on mean fluorescence difference in comparison with *p~0~*. (**", "C**) Reporter fluorescence driven by small mutations within *p~0~* (single bp substitutions and small insertions or deletions). ", "Mutation coordinates = distance of mutation to start codon of *yfp*. ", "Blue bars = mutations that co-occur with amplifications and show overlapping peaks in the sequence chromatogram of evolved clones, indicating presence of mutations only in a subset of copies in an amplification. (**", "D**) Reporter fluorescence driven by IS insertions. ", "Plasmids contain the termini of IS which were truncated to 600 bp. ", "5' and 3' refers to the direction of the IS-contained transposase gene. ", "IS2 and IS3 drive strong fluorescence of *yfp* in the plasmid context; IS1 and IS5 do not. (**", "E**) Reporter fluorescence driven by IS in the precise sequence context of *p~0~.* IS1, but not IS5, contains a partial promoter whose activity depends on the adjacent sequence in *p~0~*. ", "Numbers in parentheses = distance between insertion point and the *yfp* start codon. '", "rnd' = random shuffling of 20 bp of *p~0~* downstream of the IS1 insertion point.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.011](10.7554/eLife.25100.011)10.7554/eLife.25100.012Figure 3---source data 1.Source data for [Figure 3C--E](#fig3){ref-type=\"fig\"}.OD~600~-normalized fluorescence values measured in exponential phase (six replicates).**DOI:** [http://dx.doi.org/10.7554/eLife.25100.012](10.7554/eLife.25100.012)10.7554/eLife.25100.013Figure 3---figure supplement 1.Differences in the chromosomal neighborhood (100 kb) of loci *A-D* between IS-wt and IS-free strains.", "White boxes = regions deleted in the IS-free strains derived from strain MDS42 ([@bib51]). ", "Orange arrows = prophages, black arrows = insertion sequences. ", "Chromosomal neighborhoods of loci *B*, *C*, and *D* are shown reversed with respect to conventional chromosome coordinates, so that the orientation relative to the reporter cassette is shown in the same way for all four loci. ", "Reporter cassette genes are not drawn to scale.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.013](10.7554/eLife.25100.013)10.7554/eLife.25100.014Figure 3---figure supplement 2.Graphical overview of mutations identified by sequencing.", "All mutations found within 1 kb DNA upstream of *tetA-yfp* are labeled with their distance to the *tetA-yfp* start codon and the fluorescence phenotype of the population they were found in (YFP or YFP+CFP). ", "Grey-shaded area indicates the 188 bp random DNA sequence common to all strains. *", "Trans* mutations in the Rho protein are shown at the right edge. ", "IS-free *A* and *C* strains are not shown as they did not give any survivors. '", "Heterozygote' indicates overlapping peaks in the sequence chromatogram, which suggests that the mutation is present only in some copies contained in the amplification. ", "Red box frame indicates that for this amplification, we showed by PCR that the junction of this amplification was at the breakpoint between the newly inserted IS3 copy and a second IS3 copy downstream of locus *C*. ", "Mutations identified in additional replicate experiments are not shown.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.014](10.7554/eLife.25100.014)10.7554/eLife.25100.015Figure 3---figure supplement 3.An upstream IS5 insertion in the chromosomal context of the reporter cassette confers resistance to tetracycline and increases *tetA-yfp* fluorescence.", "Pictures show brightfield (top) and YFP-fluorescence (bottom) images of cultures spotted at different dilutions on solid medium with and without tetracycline (2.25 µg/mL). ", "We used an evolved clone isolated from population A09 of strain *A* in which IS5 was found inserted 29 bp upstream of the TetA-YFP start codon as a donor for P1 transduction of the reporter cassette with upstream IS5. ", "MG1655 *∆tolC*, the cassette-free parent strain of strain *A* was used as recipient strain for the transduction.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.015](10.7554/eLife.25100.015)10.7554/eLife.25100.016Figure 3---figure supplement 4.Mutations identified by whole genome sequencing of clones from four rescued populations of IS-wt strain *D*.All mutations identified by the breseq pipeline ([@bib8]) in reference to the strain *D* ancestral genome are shown. ", "Black arrow in magnified box: reporter cassette. ", "Mutations from the same clone are indicated by the same color. ", "Orange (source population C10): 11-fold amplification of a region including *tetA-yfp* and half of the *cfp* gene, explaining why we did not observe increased CFP fluorescence. ", "Notably, this amplification included the origin of replication. ", "Blue, purple, green: Mutations found in sequenced clones of the three remaining populations (blue = A11, purple = D08, green = C08), in which we consider non-synonymous substitutions in *rho* as main adaptive mutations. ", "We interpret missing coverage in one of the rRNA operons as an assembly artifact related to the multiplicity of rRNA operons, rather than as a deletion, as no corresponding junction was detected. ", "The inversion found in the *stfP-stfE* region of prophage e14 is catalyzed by the e14-encoded Pin recombinase ([@bib65]), possibly expressed as a secondary effect of *rho* mutations ([@bib13]). ", "We thus assume that the same inversion was found three times not because it was adaptive, but because it was the consequence of an adaptive mutation in *rho*. ", "Mutations at other sites were not tested for their fitness effect. ", "Fastq files are deposited online: <http://dx.doi.org/10.15479/AT:ISTA:65>.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.016](10.7554/eLife.25100.016)10.7554/eLife.25100.017Figure 3---figure supplement 5.Numbers of rescued populations by mutation type in two additional replicate sets of evolution experiments.", "Each bar represents the number of rescued populations out of 95 started populations per experiment.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.017](10.7554/eLife.25100.017)\n\nWe then continued to identify the mutation types responsible for the remaining differences in adaptation among strains, independent of neighborhood-dependent amplifications as described above. ", "In order to test the effect of mutations on downstream expression independent of chromosomal locus, we constructed *yfp* reporter plasmids with all mutations found within the *p~0~* region of clones from rescued populations of the first replicate set of evolution experiments (IS-wt strains, IS-free strains and strain *BΔIS5I*, [Figure 3CDE](#fig3){ref-type=\"fig\"}). ", "Five of six small mutations altering the sequence of *p~0~* increased *yfp* fluorescence in plasmid reconstructions ([Figure 3C](#fig3){ref-type=\"fig\"}), presumably by increasing the affinity of RNA polymerase to *p~0~*. ", "One mutation (T-145C) did not affect fluorescence and likely did not contribute to adaptation. ", "Instead, rescue of the respective population, which also displayed a YFP+CFP fluorescence phenotype, likely depended on amplification alone. ", "In contrast, two other point mutations identified in conjunction with amplifications (C-31T and G-92T), did increase reporter fluorescence on plasmids, providing examples of a combined beneficial effect of amplifications and additional mutations. ", "Two of four insertions sequences that we had found inserted into *p~0~* increased reporter fluorescence on plasmids greatly (IS2 and IS3, [Figure 3D](#fig3){ref-type=\"fig\"}), which is consistent with the delivery of outward-facing promoters within the termini of IS ([@bib43]). ", "The two other IS (IS1 and IS5) had no or no strong effect on plasmid reporter fluorescence. ", "Since some IS have been reported to contain partial outward-facing promoters that can drive downstream expression after insertion next to a resident complementary partial promoter site ([@bib43]), we tested IS1 and IS5 in the precise sequence context of *p~0~* in which these IS were found in evolution experiments ([Figure 3E](#fig3){ref-type=\"fig\"}). ", "In this sequence context, IS1 indeed increased reporter fluorescence, which depended on the 20 bp downstream of the insertion point within *p~0~* ([Figure 3E](#fig3){ref-type=\"fig\"}), consistent with the delivery of a half-promoter within the terminus of this IS. ", "Insertion of IS5, which we repeatedly observed in evolution experiments, had very weak, but significant effects on downstream fluorescence on plasmids ([Figure 1DE](#fig1){ref-type=\"fig\"}). ", "To confirm the adaptive role of upstream IS5 insertions in the evolution experiments, we transduced one of the observed upstream IS5 insertions into the ancestral background, which restored growth on tetracycline as well as a marked increase in YFP fluoresence ([Figure 3---figure supplement 3](#fig3s3){ref-type=\"fig\"}). ", "Thus, in the chromosomal context, IS5 does increase expression of downstream genes, possibly due to effects on DNA bending ([@bib71]), which may not be recapitulated on the plasmid reconstruction. ", "These results illustrate the diverse ways in which IS can adaptively affect gene expression, both dependent (IS1, IS5) and independent (IS2, IS3) of the insertion context. ", "Given the reporter plasmid results and the fact that the same *p~0~* sequence is part of the reporter cassette at all four chromosomal loci, point mutations and IS insertions likely were not responsible for the observed differences in the frequency of rescue between strains that are not explained by amplifications.", "\n\nProperties of upstream genes determine the availability of two different types of adaptive promoter co-option mutations {#s2-5}\n-----------------------------------------------------------------------------------------------------------------------\n\nWhole genome sequencing of clones from three rescued populations with neither upstream genetic changes nor amplifications ([Figure 3---figure supplement 4](#fig3s4){ref-type=\"fig\"}), as well as subsequent screening of other rescued populations, revealed another candidate type of adaptive mutations, which altered the protein sequence of *rho* ([Figure 4---video 1](#fig4media1){ref-type=\"fig\"}). ", "Unlike mutations of the other types, *rho* mutations occurred in trans with respect to the reporter cassette. ", "The *rho* gene of *E. coli* is an essential gene that encodes a transcriptional termination factor estimated to be required for termination at around half of all termination sites in *E. coli* ([@bib16]). ", "Contrary to point mutations and IS insertions, which we found upstream of all four loci ([Figure 3A](#fig3){ref-type=\"fig\"} and [Figure 3---figure supplement 5](#fig3s5){ref-type=\"fig\"}), Rho mutations and also upstream deletions were only found in evolved clones of strains with the reporter cassette at locus *B* or *D*, with one exception of a Rho mutation co-occurring with an upstream IS insertion in strain *A*. ", "Thus, upstream deletions and Rho mutations provide candidates for locus-dependent adaptive mutations. ", "Comparing the upstream neighborhood of the four different loci revealed the basis of this locus-dependency ([Figure 4A](#fig4){ref-type=\"fig\"} and [Figure 4---figure supplement 1](#fig4s1){ref-type=\"fig\"}). ", "The orientation and expression of upstream transcripts as determined in a different study ([@bib20]) suggests that in strains *B* and *D*, active upstream promoters were co-opted to *tetA-yfp*, either by deletion of intervening genes, or by compromising Rho-dependent termination by partial-loss-of-function mutations in Rho that cause transcriptional read-through into *tetA-yfp*. ", "At loci *A* and *C*, such adaptive mutations were not available because of two kinds of constraints from neighboring genes: either intervening genes were essential (constraining adaptive deletions, [Figure 4A](#fig4){ref-type=\"fig\"}), or no upstream Rho-terminated transcripts were present (constraining adaptive Rho mutations, [Figure 4A](#fig4){ref-type=\"fig\"}).10.7554/eLife.25100.018Figure 4.The fitness effect of promoter co-opting deletions and Rho-mutations depends on properties of upstream neighboring genes.(**A**) Genes and transcripts upstream of loci *A*, *B*, *C,* and *D*. ", "Promoters of intrinsically terminated transcripts (purple) can be co-opted by deletions (purple brackets) if no essential gene (black arrows) is deleted. ", "Promoters of Rho-terminated transcripts (green) can be co-opted by deletions or by partial loss-of-function mutations in Rho. ", "Only putatively expressed transcripts oriented toward the reporter cassette are shown (all transcripts in [Figure 4---figure supplement 1](#fig4s1){ref-type=\"fig\"}). ", "Pointers and numbers on the right = position and size of PCR products shown in (**C**). (**", "B**) Tetracycline dose-response curves of strains with wt (black squares) or transduced mutant Rho (green circles = S153F, green crosses = M416I). ", "Final OD~600~ after 24 hr (platereader units) was measured in three biological replicates. ", "Rho mutants are more tolerant to tetracycline only with the reporter cassette at loci *B* and *D*. (**", "C**) Read-through transcripts spanning upstream terminators in a Rho-mutant background are detectable at loci *B* and *D*, but not at loci *A* and *C*. ", "Bands show PCR products obtained from genomic DNA (+ control) or cDNA from a Rho-wt or Rho mutant (M416I) strain grown with sub-inhibitory levels of tetracycline. ", "Positions of used primers as indicated in (**A**). ", "NRT = negative control (no reverse transcriptase).**DOI:** [http://dx.doi.org/10.7554/eLife.25100.018](10.7554/eLife.25100.018)10.7554/eLife.25100.019Figure 4---source data 1.Source data for [Figure 4B](#fig4){ref-type=\"fig\"}.Triplicate OD~600~ values (plate reader units) across tetracycline concentrations.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.019](10.7554/eLife.25100.019)10.7554/eLife.25100.020Figure 4---figure supplement 1.Fully annotated genes and putatively expressed transcripts of either orientation upstream of the reporter cassette insertion loci.", "Genes and transcripts upstream of loci *A*, *B*, *C,* and *D*. ", "Black arrows = essential genes (see Methods), white arrows = non-essential genes, purple arrows = intrinsically terminated transcripts, green arrows = Rho-terminated transcripts, purple brackets = deletions. ", "Start- and endpoints of expressed transcripts and termination mode (intrinsic or factor-dependent) were taken from a recent dataset ([@bib20]), for which RNA from *E. coli* cells grown in minimal glucose medium was sequenced at base pair resolution. ", "Pointers on the right = position of PCR products shown in [Figure 4C](#fig4){ref-type=\"fig\"}.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.020](10.7554/eLife.25100.020)Figure 4---video 1.Animated structure of the Rho hexamer with mutated residues highlighted.", "Mutations were mapped on the previously published structure of Rho ([@bib59]).**DOI:** [http://dx.doi.org/10.7554/eLife.25100.021](10.7554/eLife.25100.021)10.7554/eLife.25100.022Figure 4---video 1---source data 1.Rho mutations from all replicate evolution experiments.28 unique mutations (substitutions at 22 different amino acid residues, two internal duplications and one upstream insertion) were found in 31 rescued populations. ", "Affected amino acid residues of Rho are highlighted in red in [Figure 4---video 1](#fig4media1){ref-type=\"fig\"}.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.022](10.7554/eLife.25100.022)10.7554/eLife.25100.021\n\nSince active transcripts shown in [Figure 4A](#fig4){ref-type=\"fig\"} were experimentally determined under conditions different from our evolution experiments ([@bib20]), and classification of termination sites as intrinsic or Rho-dependent was done only computationally ([@bib35]; [@bib20]), we experimentally assessed the effect of Rho mutations on transcriptional read-through across candidate upstream terminators at all four loci under experimental conditions approximating those in evolution experiments. ", "We first confirmed the neighborhood-dependent effect of two different Rho mutations (S153F and M416I) on the phenotype of interest, that is, tetracycline resistance, by transduction into the ancestral IS-wt strains, which are isogenic except for the position of the reporter cassette ([Figure 4B](#fig4){ref-type=\"fig\"}). ", "Consistent with the presence of upstream Rho-terminated transcripts as shown in [Figure 4A](#fig4){ref-type=\"fig\"}, an increased tolerance of Rho-mutants to tetracycline was observed only in strains with the reporter cassette at loci *B* and *D*, matching our observation that Rho-mutants were only found in rescued populations of these strains. ", "We then performed PCR on cDNA prepared from a Rho-wt strain and a Rho mutant (M416I) strain grown in sub-inhibitory tetracycline ([Figure 4C](#fig4){ref-type=\"fig\"}). ", "We obtained PCR products consistent with read-through across candidate terminators upstream of locus *B* (downstream of *yeeD*) and locus *D* (*mnmG*), but not upstream of locus *A* (*cysS*) and locus *C* (*xapR*). ", "A read-through transcript at locus *D* was detectable even in the Rho-wt background, which offers an explanation for the higher initial TetA-YFP expression observed in strain *D* ([Figure 1---figure supplement 1](#fig1s1){ref-type=\"fig\"}). ", "Mutations found in rescued populations of additional replicate experiments (fluorescence phenotypes in [Figure 2B](#fig2){ref-type=\"fig\"}) are consistent with the above constraints on promoter co-opting mutations ([Figure 3---figure supplement 5](#fig3s5){ref-type=\"fig\"}). ", "Thus, upstream deletions and *trans* mutations that compromise transcriptional termination are mutation types that depend on the chromosomal neighborhood of the gene under selection. ", "Specifically, the orientation, expression, essentiality, and termination mode of neighboring genes shape the fitness effect of these promoter co-option mutations.", "\n\nChromosomal neighborhood influences adaptation by affecting the fitness cost of amplifications {#s2-6}\n----------------------------------------------------------------------------------------------\n\nAs seen from promoter co-opting mutations, chromosomal neighborhood may affect the adaptive potential of a gene by influencing not only mutation rates (as flanking homology does for duplications that can expand into amplifications), but also mutation fitness effects. ", "We next asked if this applies to amplifications as well. ", "Due to the instability of amplifications and related difficulties in detecting them, quantifying the fitness effect of amplifications is laborious ([@bib1]) and has so far not been done on a genome-wide scale. ", "The benefit of amplifying a selected gene is counteracted by a cost that arises in part due to dosage imbalances in the co-amplified neighboring genes. ", "This cost limits the ability of amplifications to effectively expand at the population level as selection increases, an ability that comes from high rates of expansion of amplifications at the level of the individual chromosome by homologous recombination. ", "The probability of an amplification to contain a costly gene is expected to increase with the length of the amplicon.", "\n\nWe used two-color fluorescence data to extract information on amplification cost and its effect on adaptation. ", "For validating this approach, we used two strains (strain *BΔIS5I*, and the newly created strain *E*, [Figure 5A](#fig5){ref-type=\"fig\"}) that we predicted to form amplifications of higher and lower cost, respectively, when compared to the IS-containing strain *B*, which serves as reference. ", "The IS5 deletion in strain *BΔIS5I*, which reduces the rate of duplications that kick-start amplifications (see above), is also expected to increase the fitness cost of amplifications, since amplicons may be larger than the 35 kb between IS5I and IS5H. In strain *E*, we placed the reporter cassette between two copies of IS1, where duplications are expected to form frequently, and where amplifications, due to small amplicon size (11 kb), are expected to expand at low cost. ", "In our experiment, if cost is negligible, amplifications are expected to expand continuously as tetracycline selection increases, resulting in rescue. ", "In this case, YFP+CFP fluorescence increases in correlation with the level of tetracycline selection ([Figure 5B](#fig5){ref-type=\"fig\"}, left). ", "If amplifications are cost-limited, two outcomes are possible: (i) amplifications fail to expand beyond a certain level below that required for rescue, resulting in extinction -- if the level of expansion before extinction is high enough, it will appear as a transient increase of CFP fluorescence in the fluorescence trajectories of extinct populations ([Figure 5B](#fig5){ref-type=\"fig\"}, middle), (ii) amplifications allow rescue through interaction with other adaptive mutations that increase *tetA-yfp* expression -- resulting in increased YFP/CFP fluorescence ratios in rescued populations ([Figure 5B](#fig5){ref-type=\"fig\"}, right). ", "We compared the numbers of extinct vs. rescued populations with (transiently) increased CFP fluorescence and found, as expected, that amplifications in strain *BΔIS5I* had a significantly higher extinction risk than amplifications in the reference strain *B* ([Table 1](#tbl1){ref-type=\"table\"}, upper part), and rescued amplifications had significantly higher final YFP/CFP ratios ([Figure 5C](#fig5){ref-type=\"fig\"}), confirming that low numbers of rescue in strain *BΔIS5I* were in part due to amplification costs. ", "Contrariwise, populations with increased CFP fluorescence in strain *E* never went extinct ([Table 1](#tbl1){ref-type=\"table\"}, upper part) and had consistently low final YFP/CFP ratios ([Figure 5C](#fig5){ref-type=\"fig\"}), indicating the absence of a cost limitation.10.7554/eLife.25100.023Figure 5.Chromosomal neighborhood influences the fitness cost of amplifications.(**A**) Chromosomal location of reporter cassette in strains *BΔIS5I* and *E* (IS distances not drawn to scale). (**", "B**) Example fluorescence trajectories. ", "Left: low-cost amplifications expand in correlation with the increase in tetracycline concentration over 10 days. ", "Middle: Cost-limited amplifications fail to expand at higher tetracycline concentrations resulting in extinction. ", "Right: Amplifications can escape extinction in combination with other mutations increasing *tetA-yfp* expression, resulting in higher final YFP/CFP. ", "RFU = relative fluorescence units (see Materials and methods), r.c. ", "= relative concentration as multiples of MIC. (**", "C**) Final YFP/CFP ratios of rescued amplifications in strains expected to have a higher (strain *BΔIS5I*) or lower (strain *E*) cost of amplifications compared to strain *B*. ", "n = initial number of replicate populations used for analysis. ", "Crosses = populations rescued by amplifications without additional mutations. ", "Other symbols = secondary mutations (see legend). ", "p*-*values: permutation tests in comparison with strain *B*. (**", "D**) Final YFP/CFP ratios of rescued amplifications in strains *A-D*. ", "n = 285 includes replicate evolution experiments to increase statistical power. ", "Symbols and p*-*values as in (**C**).**DOI:** [http://dx.doi.org/10.7554/eLife.25100.023](10.7554/eLife.25100.023)10.7554/eLife.25100.024Figure 5---source data 1.Source data for [Figure 5C and D](#fig5){ref-type=\"fig\"}.Mutations identified in combination with amplifications and respective final YFP/CFP ratios (points indicated by symbols other than crosses in [Figure 5CD](#fig5){ref-type=\"fig\"}).**DOI:** [http://dx.doi.org/10.7554/eLife.25100.024](10.7554/eLife.25100.024)10.7554/eLife.25100.025Figure 5---figure supplement 1.Rescued populations of strains *BΔIS5I* and *E* by mutation type.", "Number of rescued populations out of 95 replicates, shown by mutation type. ", "Colored dots = later mutations occurring on top of earlier mutations.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.025](10.7554/eLife.25100.025)10.7554/eLife.25100.026Table 1.Differences in amplification cost indicated by the extinction risk of populations with amplifications. ", "Populations with amplifications of higher (strain *BΔIS5I*) or lower (strain *E*) expected cost of amplifications have a higher or lower risk of becoming extinct, respectively. ", "n = initial number of replicate populations used for analysis (n = 285 includes replicate evolution experiments to increase statistical power), 'Extinct' and 'Rescued' = numbers of extinct and rescued populations with amplifications as indicated by (transiently) increased CFP fluorescence (see Materials and methods), sample odds ratio compared to strain *B*, p-values: 2 × 2 Fisher's exact test.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.026](10.7554/eLife.25100.026)nStrainPopulations with (transiently) increased CFP fluorescenceSample Odds Ratio*P-value*ExtinctRescued95*BΔIS5I*12510.110^−4^95*B*18761 (ref)--95*E*095010^−6^285*A*845.810^−3^285*B*581681 (ref)--285*C*010n.s.285*D*070n.s.", "\n\nHaving validated extinction risk ([Table 1](#tbl1){ref-type=\"table\"}) and final YFP/CFP ratios ([Figure 5C](#fig5){ref-type=\"fig\"}) as indicators of amplification cost, we tested if neighborhood-dependent amplification costs had affected adaptation in strains *A*, *C*, and *D*. ", "A significantly elevated extinction risk of populations with amplifications in strain *A* ([Table 1](#tbl1){ref-type=\"table\"}, lower part), and significantly elevated final YFP/CFP ratios in connection with diverse additional mutations in strains *A*, *C*, and *D* ([Figure 5D](#fig5){ref-type=\"fig\"}), support that the costs of amplifications in these strains were higher compared to strain *B*. ", "Thus, amplification costs represent another neighborhood-dependent constraint on adaptation. ", "In this perspective, the availability of neighborhood-dependent promoter co-option mutations, the most prevalent non-amplification mutation types at loci *B* and *D*, is an important determinant of adaptive potential not only in itself, but also in the interaction with amplifications.", "\n\nChromosome neighborhood effects on adaptation in a single-step plating experiment {#s2-7}\n---------------------------------------------------------------------------------\n\nWe next investigated whether our observations of chromosomal neighborhood effects on adaptation transfer to different selective conditions. ", "In particular, we tested the possibility that differences in rescue between strains were due to different population sizes and thus different chances for beneficial mutations to occur, rather than due to different mutation rates or fitness effects as we propose. ", "Our experimental design corrects for population size differences between strains at the first day of selection ([Figure 1---figure supplement 1](#fig1s1){ref-type=\"fig\"}, and first section of the results part), but not necessarily for population size differences at later days of the experiments. ", "Therefore, we performed single-step plating experiments, in which approximately the same numbers of cells are plated for every strain. ", "In these Luria-Delbrück-type experiments, we plated replicate cultures grown under non-selective conditions on solid medium with tetracycline at two-fold MIC levels. ", "We scored the number of colonies on each plate after 2 days, when clearly visible colonies first appeared. ", "These early colonies are expected to result mostly from pre-plating single-step mutations that increase *tetA-yfp* expression (point mutations, IS insertions, and promoter co-option mutations). ", "As in evolution experiments, colony numbers in strains *B* and *D* were higher than in strains *A* and *C* ([Figure 6](#fig6){ref-type=\"fig\"}, left), for both IS-wt and IS-free genetic backgrounds. ", "This result is consistent with neighborhood-dependent availability of promoter co-option mutations as observed also in evolution experiments. ", "High CFP fluorescence, indicative of amplifications, was observed only in a small fraction of early colonies (34 of 1661 across all strains and plates). ", "During longer incubation, the number of colonies on plates of IS-wt strain *B* increased steadily ([Figure 6---figure supplement 1](#fig6s1){ref-type=\"fig\"}) and almost all of these later colonies (1229/1304 on ten plates) showed high CFP fluorescence. ", "Since tetracycline is bacteriostatic rather than bactericidal, the appearance of these late colonies can be explained by a continuous process of reporter cassette amplification expansion and increasing growth rates after plating on selective medium, starting from frequent duplications that have a slight growth advantage over single-copy cells ([@bib5]). ", "After 5 days, colony counts on plates were qualitatively similar to rescue frequencies in evolution experiments, with IS-wt strain *B* giving the highest number of colonies ([Figure 6](#fig6){ref-type=\"fig\"}, right). ", "In all other tested strains, late colonies appeared at much lower rates ([Figure 6---figure supplement 1](#fig6s1){ref-type=\"fig\"}) and did not show high CFP fluorescence in most cases ([Figure 6](#fig6){ref-type=\"fig\"}, right, and [Figure 6---figure supplement 2](#fig6s2){ref-type=\"fig\"}), reflecting the minor role of amplification in strains that lack flanking homology in the chromosomal neighborhood of the selected gene. ", "The consistency between liquid-culture evolutionary rescue experiments and plating experiments supports that strong effects of chromosomal neighborhood on the rate and fitness effect of adaptive mutations extend to different selective regimes.10.7554/eLife.25100.027Figure 6.Tetracycline-resistant mutants arising in a single-step plating experiment.", "For each strain (top panels = IS-wt, bottom panels = IS-free), 10 replicate cultures grown in the absence of tetracycline were plated on agar with tetracycline concentration two times the strain-specific MIC. ", "Left: Colony counts after 2 days of incubation. ", "Right: Colony counts after 5 days of incubation. ", "Horizontal lines show the median colony number from 10 replicate plates. ", "Pie charts = fraction of plates in which a single tested colony appearing at day 2 (left) or at days 4--5 (right) showed high CFP fluorescence indicative of amplification ([Figure 6---figure supplement 2](#fig6s2){ref-type=\"fig\"}).**DOI:** [http://dx.doi.org/10.7554/eLife.25100.027](10.7554/eLife.25100.027)10.7554/eLife.25100.028Figure 6---source data 1.Numbers of colonies on replicate plates at days 2 and 5.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.028](10.7554/eLife.25100.028)10.7554/eLife.25100.029Figure 6---figure supplement 1.Colony appearance over time in plating experiments.", "Each line represents the number of colonies on one of 10 replicate plates per strain. ", "Right panels show the same data as on the left with different y-axis scaling.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.029](10.7554/eLife.25100.029)10.7554/eLife.25100.030Figure 6---figure supplement 1---source data 1.Numbers of colonies on replicate plates (time-course).**DOI:** [http://dx.doi.org/10.7554/eLife.25100.030](10.7554/eLife.25100.030)10.7554/eLife.25100.031Figure 6---figure supplement 2.CFP-fluorescence of cultures spotted on non-selective medium used to obtain pie-chart data in [Figure 6](#fig6){ref-type=\"fig\"}.The leftmost column of spots on each picture is derived from colonies of the ancestor strain plated on non-selective medium. ", "The other spots are derived from colonies that appeared on day 2 (left picture) or on days 4--5 (right picture) after plating. ", "One colony was picked from every replicate plate on which at least one colony had appeared in the respective time interval. ", "White asterisks indicate spots with CFP fluorescence intensity greater than 6 standard deviations above the mean fluorescence intensity of all ancestor spots.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.031](10.7554/eLife.25100.031)10.7554/eLife.25100.032Figure 6---figure supplement 2---source data 1.Mean fluorescence intensity values of culture spots and thresholding for identification of colonies with extensive amplifications.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.032](10.7554/eLife.25100.032)\n\nDiscussion {#s3}\n==========\n\nOur results reveal a complex genetic basis of strong effects of chromosomal position on the adaptive potential of a specific gene ([Figure 7A](#fig7){ref-type=\"fig\"}). ", "By combining time-resolved fluorescence data from the reporter cassette and end-point genetic analysis, we demonstrate how the relative contribution of previously known mutation types to adaptation ([Figure 7A](#fig7){ref-type=\"fig\"}, bottom row) differs between chromosomal loci, how these differences arise, and how a layer of complexity is added by the interaction of mutation types. ", "Thus, the concept of a one-dimensional mutation rate and a focus on point mutations can be misleading ([@bib45]), even for the simple case of adaptation by increased expression of a single gene. ", "Instead, the adaptive potential of a given gene is a system-level property shaped by the local chromosomal genetic neighborhood. ", "Consequently, the organization of genes on a chromosome is both cause and consequence of evolutionary change.10.7554/eLife.25100.033Figure 7.The adaptive potential of a gene under selection for increased gene expression as a complex function of properties of neighboring genes that affect and are affected by mutations of diverse types.(**A**) Top row: Properties of neighboring genes that we identify as main determinants of the adaptive potential of a gene given its chromosomal neighborhood. ", "Round corners indicate 'dynamic' properties that may be environment-dependent or subject to change over short evolutionary timescales. ", "Bottom row: Different mutation types causing increased expression of a gene. ", "Solid arrows: Effects and interactions shown or suggested by data in this study. ", "Dashed arrows: Other effects and interactions that are likely to exist. ", "Pointed arrowheads indicate a positive effect, T-bar ends indicate a negative effect. ", "A sentence equivalent of each arrow is given in [Figure 7---source data 1](#SD12-data){ref-type=\"supplementary-material\"}. ", "As a sum of the above interactions, the adaptive potential of a gene emerges as a system-property. (**", "B**) Classification of chromosomal neighborhoods of *E. coli* genes according to adaptive potential. ", "The chromosomal neighborhood of 4317 genes of *E. coli* MG1655 was assessed using published information on the position of promoters and terminators ([@bib20]) and gene essentiality (see Methods for details). ", "Numbers in parentheses = genes belonging to respective sets or intersections of sets. ", "Genes in the intersection of all three circles (boldface) are expected to have the highest adaptive potential based on their chromosomal neighborhood. ", "Loci *A-E* of this study are placed in the respective areas of the diagram.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.033](10.7554/eLife.25100.033)10.7554/eLife.25100.034Figure 7---source data 1.Extended legend of [Figure 7A](#fig7){ref-type=\"fig\"} explaining each arrow and what loci are affected by respective interactions.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.034](10.7554/eLife.25100.034)10.7554/eLife.25100.035Figure 7---source data 2.List of *E. coli* genes included in the analysis shown in [Figure 7B](#fig7){ref-type=\"fig\"} and their assignment to the three sets shown by colored circles.**DOI:** [http://dx.doi.org/10.7554/eLife.25100.035](10.7554/eLife.25100.035)\n\nImportantly, the effects that we describe arise from several properties ([Figure 7A](#fig7){ref-type=\"fig\"}, top row) of different genetic elements that are present in the vicinity of the selected gene, rather than from more global factors such as distance to the origin of replication or chromosome macro-domain organization ([@bib12]). ", "Therefore, we propose to refer to them as 'chromosome neighborhood effects' that determine the evolution of gene expression, as opposed to 'chromosome position effects' that modulate gene expression per se ([@bib12]; [@bib39]; [@bib2]).", "\n\nDifferent mutation types interact to cause neighborhood-dependent differences in adaptive potential {#s3-1}\n---------------------------------------------------------------------------------------------------\n\nIn our experiments, chromosomal neighborhoods facilitate or constrain adaptation mainly via amplification and promoter co-option mutations, by affecting the rate of mutations (duplication-amplification) or the fitness effects of mutations (promoter co-option mutations and amplifications). ", "For gene amplification, a strong effect of flanking homology as provided by IS, which are often present in multiple copies, has been known for a long time ([@bib50]; [@bib4]). ", "Our data confirm that if flanking homology is present at a given locus, amplification is the main response to selection for increased gene expression. ", "For loci lacking nearby flanking homology, which depending on the distribution of IS elements on a chromosome may be the majority of loci ([@bib11]; [@bib31]), our data show that adaptation by amplification is limited on the level of duplication rate and fitness cost. ", "For these loci, differences in the adaptive potential are largely due to the different availability of deletions and mutations compromising transcriptional termination, both of which co-opt upstream promoters to the selected gene. ", "Such mutations also act in concert with amplifications and can alleviate amplification cost limitations by lowering the required fold-amplification to reach a certain level of expression of the selected gene ([Figure 7A](#fig7){ref-type=\"fig\"}).", "\n\nThe multitude of mutations discovered in the termination factor Rho suggests that the function of this protein may be more 'tunable' than expected from it being an essential gene in *E. coli*. ", "Our results may suggest that adaptation via *trans* mutations in Rho with potentially large pleiotropic effects is more likely than via local mutations that compromise upstream terminators in cis. ", "Given that the sequence-dependence of Rho-dependent termination is poorly understood ([@bib16]), there is no clear expectation of the nature and target size of mutations that would compromise Rho-dependent termination in cis. ", "This makes it difficult to compare adaptation via mutations affecting Rho-dependent termination in cis versus *trans*. ", "The adaptiveness of *trans* mutations in Rho despite their pleiotropic effects is supported by a previously characterized single amino-acid substitution in Rho, which was found to have large-scale effects on the *E. coli* transcriptome and to confer higher fitness in several environments ([@bib29]). ", "We found substitutions at 22 different amino acid residues mapping to various regions of the Rho protein structure ([@bib59]) ([Figure 4---video 1](#fig4media1){ref-type=\"fig\"} and [Figure 4---video 1---source data 1](#SD7-data){ref-type=\"supplementary-material\"}), which largely expands the number of Rho residues found mutated in evolution experiments ([@bib19]). ", "This supports the idea that operons delimitated by factor-dependent terminators may be rather fluid, providing a large source of variation for adaptation to changing environments. ", "It remains to be seen whether different Rho alleles, by revealing 'hidden' transcriptional variation, serve as capacitors of adaptation ([@bib46]) beyond laboratory evolution experiments.", "\n\nAssessing properties of neighboring genes to infer the adaptive potential of a gene under selection {#s3-2}\n---------------------------------------------------------------------------------------------------\n\nFor both amplifications and promoter co-opting mutations, the influence of the chromosomal neighborhood arises mechanistically from several simple properties of neighboring genes---their expression, orientation, transcriptional termination, essentiality, the presence or absence of flanking gene duplicates---and from the cost of neighboring gene co-amplification ([Figure 7A](#fig7){ref-type=\"fig\"}, top row). ", "If these properties are known at a genomic scale, inferring a chromosome-wide 'map of adaptive potential' becomes conceivable. ", "An understanding of adaptive potential may help assess the risk of resistance evolution via overexpression of preexisting chromosomal genes (as opposed to via acquisition by horizontal transfer). ", "Clearly, some properties of neighboring genes can be assessed on a genome-wide scale more easily (e.g. gene orientation) than others (e.g. gene essentiality or cost of genes when amplified). ", "Once it becomes feasible to acquire data on all the main factors shaping adaptive potential, this data may improve efforts to predict specific adaptations.", "\n\nAs a first step toward this goal, we used published information on gene essentiality, and promoter and terminator locations ([@bib20]) to assess how many of *E. coli* genes (strain MG1655) are expected to reside in a chromosomal neighborhood associated with high adaptive potential ([Figure 7B](#fig7){ref-type=\"fig\"}). ", "Based on the most simply assessable properties (colored circles in [Figure 7B](#fig7){ref-type=\"fig\"}), the chromosomal neighborhood of most genes (2295/4317) is expected to have a medium adaptive potential, comparable to that of locus *D* from this study.", "\n\nAdaptive potential as a dynamic property {#s3-3}\n----------------------------------------\n\nImportantly, some properties of chromosomal neighborhoods are dynamic (rounded boxes in [Figure 7A](#fig7){ref-type=\"fig\"})---gene essentiality ([@bib7]) and expression can be environment-dependent, and transposition causes rapid turnover of mobile element positions ([@bib56]; [@bib66]). ", "Therefore, the classification of chromosomal neighborhoods of genes according to adaptive potential as in [Figure 7B](#fig7){ref-type=\"fig\"} needs to be understood as a snapshot in time reflecting particular conditions. ", "Also, how adaptive potential translates into the actual likelihood of adaptation depends on population parameters and the precise selection scenario.", "\n\nOn evolutionary timescales, the dynamics of chromosomal neighborhood properties would rapidly degrade signals that neighborhood-dependent evolution leaves in genome sequences. ", "Nevertheless, neighborhood-dependent evolution could offer mechanistic explanations for phenomena observed in genomic data such as operon organization ([@bib53]; [@bib38]), reductive genome evolution by promoter capture-deletions as suggested previously ([@bib41]), or the chromosomal position of horizontally transferred genes ([@bib64]). ", "Since horizontally transferred genes carrying selective functions are often silenced after initial integration ([@bib47]; [@bib13]), they depend on activating mutations to play out their benefit to the host and become stably maintained in the host chromosome. ", "Thus, the evolutionary fate of horizontally transferred genes will be shaped by the new chromosomal neighborhood they find themselves in. ", "For example, a drug resistance gene entering the genome at loci *B* or *D* via horizontal transfer will be more likely to enable survival of the host under drug selection, compared to insertion at loci *A* and *C*, both because of higher initial expression and the higher adaptive potential associated with these loci as described here. ", "The common association of horizontally acquired genes with flanking mobile elements as in complex transposons and genomic islands ([@bib24]) may not only reflect the high transferability of such configurations, but also their high amplifiability, which may be of particular relevance for mis-expressed foreign genes.", "\n\nChromosomal neighborhood effects beyond prokaryotes {#s3-4}\n---------------------------------------------------\n\nAlthough our results reflect many specifics of prokaryote genome organization, the importance of promoter-capture mutations ([@bib6]), modulation of transcriptional read-through ([@bib32]) and gene amplification ([@bib18]; [@bib30]) extends to cancer evolution and cases of rapid adaptation in higher organisms ([@bib23]). ", "This implies that chromosomal neighborhood effects on evolution may be of wider significance and they could be investigated with similar reporter-based methods.", "\n\nMaterials and methods {#s4}\n=====================\n\nMaterials {#s4-1}\n---------\n\nUnless noted otherwise, we obtained chemicals from Sigma-Aldrich (St. Louis, Missouri) and enzymes from New England Biolabs (Ipswich, Massachusetts). ", "Evolution experiments and phenotyping tests were done in in M9 medium supplemented with 2 mM MgSO~4~, 0.1 mM CaCl~2~, and 0.2% glucose and 0.2% casein hydrolysate as carbon sources (M9CG medium), unless noted otherwise. ", "A list of oligonucleotides, strains, and plasmids is available in [Supplementary file 3](#SD16-data){ref-type=\"supplementary-material\"}.", "\n\nConstruction of the reporter cassette {#s4-2}\n-------------------------------------\n\nThe reporter cassette (*p~0~*-RBS-*tetA-yfp-p~R~-cfp*) was assembled on a plasmid using a combination of standard cloning techniques, ligation chain reaction ([@bib55]), and fusion PCR. ", "For the *p~0~* sequence upstream of *tetA-yfp*, we generated a random 188 bp nucleotide sequence matching the average GC content of *E. coli* (CCGGAAAGACGGGCTTCAAAGCAACCTGACCACGGTTGCG\n\nCGTCCGTATCAAGATCCTCTTAATAAGCCCCCGTCACTGTTGGTTGTAGAGCCCAGGACGGGTTGGCCAGATGTGCGACTATATCGCTTAGTGGCTCTTGGGCCGCGGTGCGTTACCTTGCAGGAATTGAGGCCGTCCGTTAATTTCC). ", "We synthesized the sequence from oligonucleotides in a ligation chain reaction. ", "The *tetA* sequence was taken from strain TKC ([@bib58]), and the *yfp* gene from plasmid pZA21-*yfp* ([@bib42]). ", "At the fusion point, we placed a 3xGS linker peptide between the C-terminus of TetA and the N-terminus of YFP. ", "Between *p~0~* and the start codon of *tetA-yfp* is a sequence containing a restriction site and a ribosomal binding site (GTCGACAGGAGGAATTCACC). ", "We placed the *p~0~-tetA-yfp* sequence on plasmid pAH81-FRT-*cfp* ([@bib33]), upstream of the chloramphenicol resistance gene and the terminator-flanked *p~R~-cfp* gene. *", "p~R~* is a strong constitutive promoter originating from phage λ. ", "We sequenced the full length of the reporter cassette on the resulting plasmid, pMS7. ", "Replication of the pMS7 plasmid depends on the Pir protein and the plasmid was propagated in a *pir*-containing version of strain DH5α.", "\n\nStrain construction {#s4-3}\n-------------------\n\nWe moved the *ΔtolC::kan* allele from *E. coli* strain JW5503-1 into strain MG1655 using P1 transduction. ", "For the IS-free genetic background, the same *ΔtolC::kan* allele was introduced into strain MDS42 ([@bib51]) by recombineering ([@bib63]) with pKD13 ([@bib22]) as PCR template. *", "kanR* cassettes were removed using plasmid pCP20 ([@bib22]). ", "We inserted the reporter cassette from plasmid pMS7 into the two *ΔtolC* strains by recombineering. ", "Precise insertion points are given in [Figure 1---source data 1](#SD1-data){ref-type=\"supplementary-material\"}. ", "All reporter cassette genes point toward the terminus of replication. ", "Recombinants were selected on LB agar with chloramphenicol (10 µg/mL). ", "The chloramphenicol marker was subsequently removed ([@bib22]). ", "We confirmed the presence of the full-length single copy insertion by PCR and verified the sequence of *p~0~-tetA-yfp* by sequencing. ", "The presence of functional *p~R~-cfp* was confirmed by observing fluorescence. ", "To obtain strain *BΔIS5I*, the *camR* cassette from pKD3 ([@bib22]) was recombineered into the IS5I element of strain *B*. ", "Recombinants were selected with choloramphenicol (10 µg/mL) and confirmed by PCR. ", "Deletion of the reporter cassette genes in evolved clones was done by recombineering the *kanR* cassette of pKD13 into the reporter cassette such that the coding regions of both *tetA-yfp* and *cfp* were disrupted. ", "Deletions were confirmed by absence of fluorescence and PCR with flanking primers ([Figure 2---figure supplement 2](#fig2s2){ref-type=\"fig\"}). ", "For P1 transduction of *rho* mutations, we first transduced mutations S153F and M416I from rescued clones of populations of strain *D* into MG1655. ", "As selective marker, we used a *kanR* cassette that we had inserted upstream of *rho* by recombineering. ", "After sequence verification, we transduced *rho* mutations into IS-wt strains *A-D*.", "\n\nMIC measurements and dose-response curves {#s4-4}\n-----------------------------------------\n\nStrains were pre-grown for 16 hr in M9CG medium without tetracycline and transferred to 96-well plates (200 µL/well). ", "From there, we pin-diluted cultures with a VP408 pin replicator (V and P Scientific, San Diego, California, dilution factor \\~1:820, tested with fluorescein) into fresh medium with different concentrations of tetracycline, incubated plates for 24 hr at 37°C on a Titramax plateshaker (Heidolph, Schwabach, Germany, 900 rpm), shook plates for 20 s at 1200 rpm and measured OD~600~ with a H1 platereader (Biotek, Vinooski, Vermont). ", "For obtaining fine-scale MIC measurements we tested tetracycline concentrations at intervals of 0.125 µg/mL. We defined MIC as the lowest drug concentration that yielded OD~600~ ≤ 0.075 (plate reader units) in three replicates performed on different days.", "\n\nEvolution experiments {#s4-5}\n---------------------\n\nAll precultures and evolution experiments were performed in M9CG medium. ", "We transferred an overnight culture of every strain into 95 wells of clear flat bottom 96-well plates (200 µL/well), from where we diluted cultures into medium with tetracycline using VP408. ", "One well contained a growth medium control. ", "As initial concentration of tetracycline, we used half of the strain-specific MIC. ", "For 10 days, we pin-diluted cultures with VP408 every 24 hr into medium with geometrically increasing tetracycline concentrations such that at day 10 the concentration was 10 times the initial concentration ([Figure 1D](#fig1){ref-type=\"fig\"}). ", "During the experiment, the maximum number of generations was set by the daily dilution factor (\\~1:820) and was \\~97. ", "A fresh tetracycline stock solution was prepared from powdered tetracycline-HCl every day. ", "All incubations were done at 900 rpm on a plate shaker at 37°C in the dark and plates were wrapped in plastic bags to mitigate evaporation. ", "Replicate evolution experiments were performed with two additional 96-well plates for each of strains *A*, *B*, *C*, and *D* (IS-wt). ", "Each 96-well plate was started from a culture inoculated with a different colony. ", "At the end of experiments, we froze all rescued populations.", "\n\nOD~600~ and fluorescence measurements {#s4-6}\n-------------------------------------\n\nEvery day during the evolution experiment, after using 24-hr-old cultures for inoculating fresh medium with a higher tetracycline concentrations using VP408, we shook the old plates for 20 s at 1200 rpm to resuspend cells and measured OD~600~ and reporter fluorescence with a H1 Platereader (Biotek, Vinooski, Vermont; excitation/emission: YFP 515/545 nm / gain 100; CFP 433/475 nm / gain 60).", "\n\nData analysis {#s4-7}\n-------------\n\nPopulations were classified as rescued if OD~600~ exceeded 0.075 (plate reader units) at the end of the experiment. ", "Fluorescence values were normalized to OD~600~ and set to zero if OD~600~ fell below 0.075. ", "As reference for calculating the fold-increase in fluorescence, we took the average OD-normalized fluorescence of 95 cultures of the respective ancestral strain, inoculated in the same way as described for the beginning of evolution experiments, and grown in 96-well plates for 24 hr without tetracycline. ", "Rescued populations were classified as YFP or YFP+CFP if the observed fold increase in respective fluorescence over the ancestor was \\>2.77 at the end of the experiment. ", "This threshold corresponds to the lowest observed increase in YFP fluorescence that was sufficient for rescue in the first set of replicate experiments (IS-wt strains *A*, *B*, *C*, and *D*). ", "To identify populations that went extinct despite elevated YFP and/or CFP fluorescence we applied more stringent criteria, requiring increased fluorescence (fold increase \\>2.77) for at least 2 days at which OD was \\>0.3 (platereader units). ", "These criteria were used to exclude extinct populations that were false positive for increased fluorescence due to low OD~600~ values prior to extinction. ", "Rescued populations that met the more stringent criteria for elevated CFP fluorescence, but that did not show elevated CFP fluorescence at the end of the experiment (final fold increase \\<2.77), were counted as amplifications for cost analysis ([Figure 5](#fig5){ref-type=\"fig\"} and [Table 1](#tbl1){ref-type=\"table\"}), but not for [Figure 2](#fig2){ref-type=\"fig\"}. ", "For calculating final YFP/CFP ratios of rescued amplifications, we used internal plate reader fluorescence units directly. ", "A Matlab script used to perform the above analysis is available as a supplementary file along with the platereader raw data used as input for the script ([Source code 1](#SD17-data){ref-type=\"supplementary-material\"}). ", "Plots of fluorescence trajectories of every population can be found in [Supplementary file 1](#SD14-data){ref-type=\"supplementary-material\"} and phenotype classifications in [Supplementary file 2](#SD15-data){ref-type=\"supplementary-material\"}.", "\n\nQuantitative PCR for reporter cassette copy number determination {#s4-8}\n----------------------------------------------------------------\n\nWe inoculated samples of all rescued populations that we had chosen for sequencing from the first set of replicate experiments and that had a YFP+CFP fluorescence phenotype. ", "We inoculated 2 mL M9CG with 10 µL of populations that were frozen at the end of the evolution experiment. ", "The large inoculum was used to maintain amplification-related population diversity. ", "We added the same amount of tetracycline as on the last day of evolution experiments to maintain amplifications. ", "From all cultures that were turbid after overnight incubation, we isolated genomic DNA (gDNA). ", "Ancestor gDNA was isolated from cultures without tetracycline. ", "We performed qPCR using the GoTaq qPCR mastermix (Promega, Madison, Wisconsin) and a C1000 instrument (Bio-Rad, Hercules, California). ", "Using dilution series of one of the gDNA extracts as template, we confirmed that all primer pairs had an amplification efficiency \\>90%. ", "We quantified the copy number of *tetA* in each sample with the ΔΔCq method implemented in the instrument software (Bio-Rad), taking amplification efficiency into account. ", "As reference, we used loci equidistant from the origin of replication and compared ratios of the measured and reference locus to the ratio of the same two loci in the ancestral DNA. ", "qPCR was done in three technical replicates.", "\n\nIdentification of flanking homology {#s4-9}\n-----------------------------------\n\nWe searched 400 kb around loci *A-D* for homologous sequences on either side using REPuter ([@bib37]) with the following search criteria: forward repeats ≥ 200 bp, Hamming distance ≤5.", "\n\nDNA sequencing {#s4-10}\n--------------\n\nWe streaked all rescued populations of strains *A*, *C*, *D* (IS-wt), of strains *B* and *D* (IS-free), and of strain *BΔIS5I* for single colonies on LB agar. ", "For IS-wt strain *B*, we analyzed one rescued population that had a YFP-only fluorescent phenotype, two YFP+CFP populations with unusual fluorescence trajectories and 11 randomly chosen populations from the remaining 74 YFP+CFP rescued populations, which had highly similar fluorescence trajectories. ", "Colony-PCRs were performed on a single representative clone of each streak. ", "We amplified at least 1.5 kb of the region upstream of the *tetA* start codon. ", "The size of PCR products was checked for insertions or deletions on an agarose gel. ", "Sequences were obtained using primer tetA_pseq1_f. ", "If no PCR product was obtained, we performed arbitrary PCR with primer tetA_pseq2_f and a random primer, arb1 or arb6, for upstream binding. ", "We then did a second PCR with a nested primer tetA_arb2 and primer arb2 using the first PCR product as template, and sequenced DNA extracted from the largest distinct band on an agarose gel. ", "The full-length sequence of the *rho* gene was amplified and sequenced with primers rho_seq_f and rho_seq_r. ", "For additional replicate evolution experiments, we sequenced clones of all rescued populations with a YFP fluorescence phenotype and with a YFP+CFP fluorescence phenotype showing high final YFP/CFP ratios. ", "In four cases, we identified the exact same mutation in clones isolated from two populations that had been in neighboring wells during evolution experiments. ", "In order to ensure that a potential cross-contamination between these two wells did not influence results, we excluded one of each pair of such neighboring populations from all analyses.", "\n\nJunction PCR {#s4-11}\n------------\n\nColony PCR for amplification junctions was performed with primers IS5I_flank_f and IS5H_flank_r on single colonies of 16/16 evolved populations of strain *B*. ", "For the data shown in [Figure 2D](#fig2){ref-type=\"fig\"}, we used gDNA previously isolated from populations for qPCR to ensure a comparable amount of PCR template in all reactions.", "\n\nWhole genome sequencing {#s4-12}\n-----------------------\n\nWe isolated gDNA from overnight cultures of single clones of four rescued *D* populations as well as of the ancestral *D* strain grown in LB. ", "A whole genome library was prepared and sequenced by GATC biotech (Konstanz, Germany) on an Illumina sequencer (125 bp reads). ", "Fastq files were analyzed with the breseq script ([@bib8]). ", "We used the MG1655 genome (Genbank accession number U00096.3) as a reference for assembling the ancestral *D* genome, which then served as a reference for analyzing the genomes of the evolved clones. ", "Fastq files are available at: [http://dx.doi.org/10.15479/AT:ISTA:65.](http://dx.doi.org/10.15479/AT:ISTA:65)\n\nCloning of reporter plasmids {#s4-13}\n----------------------------\n\nFor building the reference plasmid pAnc, which reports on expression from the ancestral *p~0~* sequence, we exchanged the pLtetO-1 promoter and RBS of pZA21-*yfp* for the *p~0~*-RBS sequence upstream of *tetA-yfp* in the reporter cassette. ", "Using a Q5 site-directed mutagenesis kit (New England Biolabs) with pAnc as template, we reconstructed small mutations (substitutions and small insertions and deletions, [Figure 3C](#fig3){ref-type=\"fig\"}). ", "We did the same with the terminal 50 bp of IS1 (5' terminus) and IS5 (3' terminus), which we put instead of the 50 bp of *p~0~* in the exact position where insertions were found in the experiment ([Figure 3E](#fig3){ref-type=\"fig\"}). ", "To confirm the IS1-*p~0~* hybrid promoter, we exchanged 20 bp of *p~0~* downstream of the IS1 insertion point in the respective reporter plasmid. ", "The 20 bp were replaced by a randomly shuffled sequence composed of the same nucleotides. ", "For the other IS reporter plasmids ([Figure 3D](#fig3){ref-type=\"fig\"}), we PCR-amplified the last 600 bp of IS and cloned them into the XhoI/EcoRI sites of pZA21-*yfp*. ", "The orientation of the truncated IS corresponds to that found in sequenced clones. ", "As autofluorescence control, we removed the YFP fragment between EcoRI and MfeI restriction sites of pZA21-*yfp* and obtained pZA21-empty by religation of compatible ends. ", "All changes were sequence-verified. ", "Cloning and reporter measurements were done in strain NEB 5 alpha (New England Biolabs).", "\n\nQuantifying YFP reporter fluorescence from plasmids {#s4-14}\n---------------------------------------------------\n\nWe grew six replicate overnight cultures of the reporter plasmid strains in LB Kanamycin (50 µg/mL) in a 96-well plate and diluted them into M9CG supplemented with Kanamycin using a VP407 pin replicator (approximate dilution factor 1:100). ", "Diluted cultures were shaken and incubated at 37°C in the platereader and OD~600~ and YFP fluorescence was monitored every 10 min (YFP gain 120). ", "YFP readings were normalized to OD~600~ and averaged for each replicate at all timepoints at which OD~600~ was between 0.20 and 0.25 (platereader units, that is, mid-exponential phase).", "\n\nTetracycline resistance phenotyping on solid medium {#s4-15}\n---------------------------------------------------\n\nClones and strains to be tested were pregrown overnight in M9CG and diluted as shown in [Figure 2B](#fig2){ref-type=\"fig\"} and [Figure 3---figure supplement 3](#fig3s3){ref-type=\"fig\"}. ", "We spotted 2.5 µL of diluted cultures on M9CG agar plates. ", "After 24 hr incubation at 37°C, we took YFP fluorescence images of plates using a lab-made macroscope (<http://openwetware.org/wiki/Macroscope>). ", "The macroscope uses a Canon EOS 600D digital camera and a Canon EF-S 60 mm f/2.8 Macro USM lense (Canon, Tokyo, Japan). ", "For illumination, we used a Cyan (505 nm) Rebel LED (Luxeon Star LEDs, Brantford, Canada) with a HQ500/20x excitation filter (Chroma, Bellow Falls, Vermont). ", "As emission filter we used a camera-mounted D530/20 filter (Chroma).", "\n\nReverse transcription {#s4-16}\n---------------------\n\nStationary cultures of MG1655 *∆tolC* (*rho*-wt) and of the isogenic strain with the *rho* M416I mutation in LB were diluted 1:100 in M9CG supplemented with tetracycline (0.44 µg/mL, that is, 50% of the MIC of strain MG1655 *∆tolC* and grown overnight at 37°C with shaking. ", "Total RNA was isolated using an Aurum Total RNA Mini kit (Bio-Rad) and DNA removed using an Ambion DNA-free kit (Life Technologies, Carlsbad, California). ", "Isolated RNA was quantified using a Nanodrop spectrophotometer and integrity was checked on an agarose gel. ", "cDNA was synthesized using an iScript cDNA synthesis kit (Bio-Rad) with 1 µg of total RNA as input in a 20 µL reaction. ", "For the non-reverse-transcriptase (NRT) control reaction we used 0.5 µg of each of the two RNA samples.", "\n\nEndpoint PCR on cDNA {#s4-17}\n--------------------\n\nAfter reverse transcription, cDNA samples and the NRT control sample were diluted by adding 150 µL of nuclease-free water. ", "Endpoint PCR to test for the presence of transcripts resulting from possible read-through across Rho-dependent terminators were done with a OneTaq Quick-Load Mastermix (New England Biolabs), using 1 µL of diluted cDNA or NRT control as template in a 50 µL reaction. ", "To detect rare transcripts, we used 45 amplification cycles. ", "As a positive control template in PCR reactions, we used 1 µL of a colony of strain MG1655 *∆tolC* resuspended in 25 µL water and heated to 95°C for 4'. ", "For agarose gel visualization, we loaded 15 µL of cDNA and NRT control PCR reactions and 2 µL of the positive control PCR reactions.", "\n\nInferring the order of two adaptive mutations occurring in the same clone {#s4-18}\n-------------------------------------------------------------------------\n\nIn several cases, fluorescence analysis and sequencing revealed two potentially adaptive mutations in the same clone/population (colored dots on top of bars in [Figure 3A](#fig3){ref-type=\"fig\"} and [Figure 5---figure supplement 1](#fig5s1){ref-type=\"fig\"}). ", "To infer which mutation came first, we proceeded as follows. ", "For amplifications that occurred in combination with point mutations, we examined sequence chromatograms obtained from single clones. ", "In all three cases, point mutations appeared as mixed nucleotide peaks, indicating that amplifications were initiated before the point mutations occurred. ", "In two cases of amplifications co-occuring with upstream IS insertions, insertions occurred first. ", "This is evident since PCR products used for sequencing appear as single bands of larger size than expected on agarose gels, whereas later insertions are expected to give two bands -- a smaller one for copies without the insertion and a larger one for copies having the insertion. ", "In one case, the insertion of IS3 upstream of locus *C* was a prerequisite for amplification initiation, as we could show by PCR that the IS3 insertion was at the amplicon junction. ", "Cases of co-occurrence of amplifications with deletions or Rho-mutations were decided based on fluorescence trajectories. ", "YFP/CFP ratios that remained high and relatively constant throughout the experiment indicate that amplifications expanded only after the other mutation had occurred. ", "YFP/CFP ratios that increase at an intermediate timepoint during the experiment indicate that amplifications were initiated first. ", "Last, we assume that a Rho mutation in strain *A* was selected only after the insertion of an upstream IS5 element, since [Figure 4B](#fig4){ref-type=\"fig\"} indicates that Rho mutations alone would not have been adaptive in strain *A*. ", "Rather, we assume that the Rho mutation enhanced transcriptional read-through from IS5 into the reporter cassette. ", "Dots-on-bar color assignments in [Figure 3---figure supplement 5](#fig3s5){ref-type=\"fig\"} do not reflect the order of mutations, as we did not do such analysis for additional replicate experiments.", "\n\nAssessment of gene essentiality {#s4-19}\n-------------------------------\n\nEssentiality data for upstream protein coding genes ([Figure 4A](#fig4){ref-type=\"fig\"}) was taken from a published dataset ([@bib7]). ", "We did not find data on the essentiality of the *valU* tRNA operon upstream of locus *C* in the literature data. ", "Therefore we tested experimentally, if deletions of the complete *valU* operon are tolerated. ", "We attempted to delete the operon using recombineering with pKD13 as template plasmid for a *kanR* cassette and primers valU_ko_f and valU_ko_r. ", "The number of colonies on the *valU* knockout selection plate was more than tenfold lower than that of a control knockout of the neighboring *xapR* gene with primers xapR_ko_f and xapR_ko_r. ", "To exclude that the low number of recombinants was due to a hairpin structure contained in the valU_ko_r primer, we repeated recombineering with a different reverse primer, valU_ko_r2, and obtained similar results. ", "The low recombineering efficiency was not due to a smaller amount of PCR product used in transformations. ", "Of six tested colonies obtained on the *ΔvalU::kanR* selection plate, only one colony gave a PCR product of the expected size in a test with flanking primers, showing that 5/6 colonies are not true *valU* knockouts. ", "This suggests that *valU* deletion mutants require rare compensatory mutations to restore growth. ", "Therefore the *valU* operon was considered as essential.", "\n\nSingle-step plating experiments {#s4-20}\n-------------------------------\n\nWe inoculated 1 mL of LB with a single colony of strains to be tested. ", "After overnight incubation, saturated cultures were diluted 1:1000 into experimental evolution medium without tetracycline, and then split into 10 wells of a 96-well plate (220 µL / well). ", "The 96-well plate was incubated on a plate shaker at 37°C for 24 hr to obtain saturated cultures, of which 180 µL containing approximately 2 × 10^8^ cells were plated on M9CG medium with tetracycline at a concentration two times the MIC of respective strains (cell numbers were determined by plating dilutions on non-selective medium). ", "Plates were incubated at 37°C in the dark and colonies counted every 24 hr. ", "After 2 days, we picked one colony from every plate that had at least one colony on it and inoculated 200 µL of M9CG medium in a 96-well plate with the picked colony. ", "After 24 hr incubation at 37°C, we used the VP407 pinner to spot approximately 2 µL on M9CG agar plates. ", "After another 24 hr incubation, we took CFP fluorescence images of plates with the macroscope (see 'Tetracycline resistance phenotyping on solid medium'). ", "For illumination, we used a Royal Blue (447.5 nm) Rebel LED (Luxeon Star LEDs) with a D436/20x excitation filter (Chroma). ", "As emission filter we used a camera-mounted D480/40m filter (Chroma). ", "The mean intensity of pixels of each spot was quantified. ", "Spots with intensity six times greater than the mean intensity of all ancestor spots are considered to have amplifications ([Figure 6---figure supplement 2](#fig6s2){ref-type=\"fig\"}).", "\n\nStatistical analysis {#s4-21}\n--------------------\n\nTo test for homogeneity in the distribution of rescued vs. extinct populations, fluorescence phenotypes and mutation types, *r* × c Fisher's exact test for Count Data was used (fisher.test function in R \\[[@bib52]\\]). ", "For testing the distribution of mutation types, we used types indicated in [Figure 3A](#fig3){ref-type=\"fig\"} by bar color, not dot color. ", "For testing 2 × 2 contingency tables, Fisher's exact test was used with an alternative hypothesis of odds ratio ≠ 1. ", "Permutation tests were performed with the perm package ([@bib27]) for R (permTS function, method='exact.mc', 10^4^ Monte Carlo replications, two-sided).", "\n\nIn-silico analysis of adaptive potential of *E. coli* gene neighborhoods (Venn diagram) {#s4-22}\n---------------------------------------------------------------------------------------\n\nWe used the Profiling of *E. coli* Chromosome (PEC) database available at <https://shigen.nig.ac.jp/ecoli/pec/genes.jsp> (accession number UA00096.2) and included all 4317 genes (feature type 'gene') of *E. coli* MG1655 with essentiality information in our analysis, which excludes non-coding genes. ", "The position and orientation of promoters was extracted from Table S2 of the same study used to identify candidate transcripts in [Figure 4A](#fig4){ref-type=\"fig\"} ([@bib20]). ", "We only included promoters annotated as 'primary' promoters in our analysis. ", "The 'Promoter Confidence Score' was not taken into account. ", "The position, orientation, and termination mode (intrinsic or non-intrinsic) of all terminators was extracted from Table S3 of the same study ([@bib20]). ", "In order to identify all genes downstream of Rho-dependent terminators (green circle in [Figure 7B](#fig7){ref-type=\"fig\"}), we identified the closest upstream co-oriented terminator of every gene and evaluated whether it was predicted to be an intrinsic terminator or not, in which case we assumed it is Rho-dependent. ", "In order to identify all genes to which a co-oriented upstream promoter could be co-opted by deletion without disrupting an essential gene, we first identified the next essential upstream gene of every gene, and then evaluated if there is at least one co-oriented promoter and intervening co-oriented terminator between the gene of interest and the next upstream essential gene. ", "If this was the case, the gene of interest was included in the respective set of genes (magenta circle in [Figure 7B](#fig7){ref-type=\"fig\"}). ", "In order to identify genes between flanking duplicates (blue circle in [Figure 7B](#fig7){ref-type=\"fig\"}), we used the online REPuter tool ([@bib37]) to find all forward repeats on the chromosome that satisfied the following criteria: repeat length ≥200 bp, Hamming distance ≤8, maximum distance between repeats 100 kb, minimum distance between repeats 200 bp. ", "In this way, we identified four large regions of the MG1655 chromosome between flanking repeats: between IS1B and IS1C (containing 13 genes and locus *E*), between IS5H and IS5I (containing 42 genes and locus *B*), and between the ribosomal operons *rrnA* and *rrnC* (81 genes), and *rrnB* and *rrnE* (31 genes). ", "We also obtained six genes between closely spaced repeats matching our criteria (*ybfB*, *ybfL*, *yibA*, *ldrA*, *ldrB*, and *ldrC*), which we did not include in the set 'between flanking duplicates', since the behavior of such closely spaced repeats might be different than those studied in our system. ", "The Venn diagram was drawn in Matlab using the 'ChowRodgers' method for sizes of circles and intersection areas. ", "A list of all included genes and their assignment to the three sets is available in [Figure 7---source data 1](#SD12-data){ref-type=\"supplementary-material\"}.", "\n\nData deposited online {#s4-23}\n---------------------\n\nFastq files of whole genome sequencing of IS-free strain *D* (ancestor) and of evolved clones from four evolved populations of this strain (A11, C08, C10, D08) have been deposited in the IST Data Repository, [http://dx.doi.org/10.15479/AT:ISTA:65.](http://dx.doi.org/10.15479/AT:ISTA:65)\n\nWe thank M Ackermann, N Barton, J Bollback, J Jäger, members of the Barton, Bollback, Bollenbach and Guet groups, and especially M Pleška for comments on earlier versions of the manuscript. ", "We thank F Korč for assistance with the data analysis script.", "\n\nAdditional information {#s5}\n======================\n\nThe authors declare that no competing interests exist.", "\n\nMS, Conceptualization, Data curation, Formal analysis, Investigation, Visualization, Methodology, Writing---original draft, Writing---review and editing.", "\n\nCCG, Conceptualization, Supervision, Funding acquisition, Methodology, Project administration, Writing---review and editing.", "\n\nAdditional files {#s6}\n================\n\n10.7554/eLife.25100.036\n\n###### Population trajectories.", "\n\nSet of 96-panel figures showing OD and OD-normalized fluorescence values for each population in each of 18 evolution experiments.", "\n\n**DOI:** [http://dx.doi.org/10.7554/eLife.25100.036](10.7554/eLife.25100.036)\n\n10.7554/eLife.25100.037\n\n###### Source data populations.", "\n\nExcel table containing information on survival, fluorescence phenotypes, sequences, and mutation types of every experimental population, as well as information on which populations where used for further investigation (plasmid reconstruction etc.). ", "This contains the source data of [Figures 2AC](#fig2){ref-type=\"fig\"}, [3AB](#fig3){ref-type=\"fig\"}, [5CD](#fig5){ref-type=\"fig\"}, [Table 1](#tbl1){ref-type=\"table\"}, and respective Figure Supplements.", "\n\n**DOI:** [http://dx.doi.org/10.7554/eLife.25100.037](10.7554/eLife.25100.037)\n\n10.7554/eLife.25100.038\n\n###### Strains, plasmids, oligonucleotides.", "\n\nExcel table with all strains, plasmids and oligonucleotides used in this study\n\n**DOI:** [http://dx.doi.org/10.7554/eLife.25100.038](10.7554/eLife.25100.038)\n\n10.7554/eLife.25100.039\n\n###### Compressed file containing Matlab scripts and OD/YFP/CFP plate-reader raw data files of evolution experiments.", "\n\n**DOI:** [http://dx.doi.org/10.7554/eLife.25100.039](10.7554/eLife.25100.039)\n\nMajor datasets {#s7}\n--------------\n\nThe following dataset was generated:\n\nSteinrueck M,Guet CC,2017,Fastq files for \\\"Complex chromosomal neighborhood effects determine the adaptive potential of a gene under selection\\\",<http://dx.doi.org/10.15479/AT:ISTA:65>,Publicly available at the IST Data Repository (https://datarep.app.ist.ac.at/)\n\n10.7554/eLife.25100.042\n\nDecision letter\n\nLaub\n\nMichael T\n\nReviewing editor\n\nMassachusetts Institute of Technology\n\n,\n\nUnited States\n\nIn the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. ", "A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.", "\n\nThank you for submitting your article \\\"Complex chromosomal neighborhood effects determine the adaptive potential of a gene under selection\\\" for consideration by *eLife*. ", "Your article has been reviewed by three peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Diethard Tautz as the Senior Editor. ", "The reviewers have opted to remain anonymous.", "\n\nThe reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.", "\n\nSummary:\n\nThis paper uses a specially designed reporter to examine the nature of adaptation and the mutations that can drive tetracycline resistance under continual selection. ", "The reviewers were generally enthusiastic about the work as such systematic analyses of mutational spectra during selection have the potential to inform us about evolution at a very detailed molecular level. ", "In particular, this paper presents reasonably strong data to suggest that the local chromosomal context of a tet-resistance gene can influence its adaptation via differences in amplification potential (driven by IS elements) and read-through from other nearby genes. ", "Despite some enthusiasm, the reviewers noted a few important weaknesses that would have to be remedied in a revised manuscript. ", "These issues are detailed below and generally fall into three categories.", "\n\nEssential revisions:\n\n1\\) Some of the suggestions about how adaptation has occurred are incompletely substantiated. ", "Additional experiments are needed to address these concerns; in most, if not all, cases, the necessary experiments are relatively straightforward.", "\n\n-- Results section; \\\"All rescued populations displayed increased YFP fluorescence. ", "Thus, rescue depended on the presence and overexpression of *tetA-yfp*.\\\" The second sentence doesn\\'t logically follow from the first. ", "The authors should test, at least in 1-2 cases, that selective deletion of TetA-YFP in the evolved clone eliminates rescue.", "\n\n-- \\\"...or no upstream Rho-terminated transcripts were present (constraining adaptive Rho mutations, [Figure 4A](#fig4){ref-type=\"fig\"}).\\\" The notion that the Rho mutations allow read-through into *tetA-YFP* is interesting, but the claim that no upstream Rho-terminated transcripts exist in strains A and C needs to be substantiated. ", "Is this information being pulled from some prior study of Rho and if so, how reliable are these data? ", "Or are they simply predictions based on Rho site bioinformatics? ", "If it\\'s the latter, then qRT-PCR data supporting the claims should be generated and shown.", "\n\n-- [Figure 3C](#fig3){ref-type=\"fig\"}: It wasn\\'t clear how the evolved clones examined in a plasmid-based assay in [Figure 3C](#fig3){ref-type=\"fig\"} were chosen. ", "Additionally, it was unclear why 7 of the 14 mutations \\\"reconstructed\\\" on plasmids didn\\'t recapitulate the evolved behavior. ", "This point raises the important concern that the paper is ultimately about how genomic context can influence evolution, but the \\\"reconstruction\\\" experiments involve placing a limited genomic region onto a plasmid to drive YFP, not TetA-YFP, production. ", "Could it be that 7 of the cases in [Figure 3C](#fig3){ref-type=\"fig\"} failed because the genomic context has changed? ", "This should be better discussed. ", "In addition, the authors should, for at least a handful of the \\'failed\\' cases in [Figure 3C](#fig3){ref-type=\"fig\"}, do proper reconstructions by engineering the putatively causal mutation into the ancestral strain background.", "\n\n2\\) The presentation of results could be substantially improved. ", "There is a general lack of primary data provided and many figures lack highly relevant details on the exact nature of the genomic context of each locus, both in the original strains and the evolved isolates.", "\n\n-- The authors should say something in the main text, not just the Materials and methods section, about (i) the rationale for choosing the four sites of insertion that they chose and (ii) the nature/genomic context of the four insertion sites. ", "Genomic diagrams of the four insertion sites with flanking genes, etc should also be provided in the main [Figure 1](#fig1){ref-type=\"fig\"}. ", "One half of these regions is shown in [Figure 4](#fig4){ref-type=\"fig\"}, but the other half is omitted and these diagrams should come earlier in the paper.", "\n\n-- \\\"We verified the presence of IS5 at the boundary of the amplicon in rescued B populations ([Figure 2C](#fig2){ref-type=\"fig\"}).\\\" [Figure 2C](#fig2){ref-type=\"fig\"} appears to contain only a schematic of locus B, with no data supporting the claim that IS5 is at the boundary of the amplified region, nor is there really any primary data demonstrating or validating the notion that the cassette was amplified.", "\n\nSubsection \"Properties of upstream genes determine the availability of two different types of adaptive promoter co-option mutations\": The use of a strain that is apparently free of all IS elements needs more explanation. ", "The strain generated in Posfai et al., ", "2006, has actually been reduced by 15% and so lacks a wide range of genomic features. ", "This could complicate the interpretation that the difference in mutational spectra in the two strains ([Figure 3A](#fig3){ref-type=\"fig\"}) results from a lack of IS elements. ", "The authors should more clearly discuss this issue and its impact on the interpretation of their results.", "\n\n-- In the same section: Without more details, it\\'s difficult to assess or interpret the data in this section of the manuscript. ", "It\\'s not clear whether individual strains only have single mutations or multiple mutations and if it\\'s the latter, were the individual mutations made? ", "And while the nature of \\'point mutations\\' is clear, it\\'s not clear what the authors mean by mutations \\'delivering full or partial promoters\\'. ", "And in the cases where the reconstructed mutation does not increase the reporter, what\\'s the explanation? ", "Is it because there are other mutations?", "\n\n3\\) There was a concern about whether the results depend on the precise way in which the selection was performed. ", "The evolution is done with relatively small populations in microtiter plates that are diluted each day into fresh media whose tetracycline concentration increases by about 25% each day. ", "Consequently, the populations are effectively in a race for increasing the expression of the tetA sufficiently fast to \\'keep ahead\\' of the increasing tetracycline concentration. ", "This suggests that even small differences in the initial expression levels of tetA at the different loci could have a large effect on the probability of survival. ", "Thus, it seems plausible that the increased survival of clones with tetA at the B and D loci might be a result of higher initial expression at these loci. ", "This might also explain puzzling observations like the fact that, in the IS-free case, rescue through point mutations in the promoter are observed 4 times at D but never at A or C, and the fact that rescue rates at the B locus vary across replicates even though CFP increase is observed almost without fail ([table 1](#tbl1){ref-type=\"table\"}). ", "The authors should quantify initial expression levels at each locus and investigate the effect of this on the probability of rescue.", "\n\nRelated to this, the authors should include a panel of 96 figures (one for each well of the plate) showing the time courses of OD, YFP/OD, and CFP/OD across the 10 days. ", "Right now the authors only report numbers of rescued and numbers with YFP or YFP+CFP increase, but it is hard to judge if such a simple classification does justice to the potentially complex dynamics that is observed across populations.", "\n\nApart from the effect of initial expression, to what extent does the selection for \\'fast increase in expression\\' bias the mutations that are observed to one type or another? ", "To argue for the generality of the observations that the authors make, it would be useful to assess the rate of rescue in another setting where the type of selection is different, e.g. using a Luria-Delbrueck type experiment in which many cultures (with tetA at the different loci) are grown in media without tetracycline, with colonies counted on agar plates with tetracycline concentrations beyond the MIC. ", "Does one again find mostly rescue of clones at B and D, even in the IS free case?", "\n\n\\[Editors\\' note: further revisions were requested prior to acceptance, as described below.\\]\n\nThank you for submitting your article \\\"Complex chromosomal neighborhood effects determine the adaptive potential of a gene under selection\\\" for consideration by *eLife*. ", "Your article has been reviewed by two peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Diethard Tautz as the Senior Editor. ", "The reviewers have opted to remain anonymous.", "\n\nThe reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.", "\n\nSummary:\n\nThe reviewers are still generally positive and there was a consensus that no additional experiments or analyses are critical at this stage. ", "However, there was a continued concern, also raised in the first round of review, that the Introduction is somewhat disorienting and excessively abstract. ", "While the reviewers appreciate the effort to place the work in a broad and general context, they also felt strongly that the paper would benefit from a more direct, concrete exposition of what specific questions were addressed, what was done, and what was learned. ", "The use of simple, straightforward language is encouraged. ", "It\\'s not a matter of \\\"dumbing\\\" down the Introduction, but making it clear and accessible. ", "The comments of one reviewer are provided in full below as they will be helpful as you further revise the manuscript.", "\n\nEssential revisions:\n\nAs I suspected the initial MIC\\'s of the different constructs (cassette at locus A, B, C or D) are not the same, but even the initial B and D populations already have elevated MIC. ", "The authors explain that they attempt to normalize for this difference by treating each construct with a concentration profile that is the same relative to the original MIC of that construct. ", "That is, the constructs at locus D will be subjected to time-dependent anti-biotic concentrations that are about twice that of what the construct at locus A are subjected to (based on data presented in [Figure 1---figure supplement 1](#fig1s1){ref-type=\"fig\"}).", "\n\nI understand that this is the most reasonable way to correct for the differences in MIC of the initial populations, but I am not really convinced that it will now make the selective environments directly comparable. ", "That is, it seems likely that, even if no beneficial mutations were to occur at all, substantial differences in the population sizes would remain and these might substantially affect the probability of generating beneficial mutants (i.e. just because of an elevated population size).", "\n\nI think it would be good for the authors to add some discussion of this issue. ", "I personally feel this issue is the main motivation for doing the Luria-Delbrueck like experiments (i.e. to check that the results are not specific to the precise way of performing the selection) and it might be worthwhile to mention this also.", "\n\nFinally, regarding this point, although I feel that it still cannot be definitively said that the increased rescue of B and D constructs is solely due to the increased RATE of generating beneficial mutations rather than an increase in the size of the target population for such mutations, what one could definitely conclude is that, if this cassette were to be inserted in the genome through horizontal transfer, than rescue under selection with antibiotic is clearly highest when it is inserted into loci B or D, rather than at A or C.\n\nThe other comment I have is about presentation. ", "I still find the introductory sections rather disorienting regarding what this paper is going to actually show. ", "My impression is that this is due to a choice of presentation style which seems to aim to present the questions that the work addresses in as general and abstract terms as possible, leaving it typically up to the reader to connect the general abstract description to the actual concrete things that are being done. ", "I find this rather tiresome to read. ", "I believe the paper would become much more pleasant to read if the authors simply removed all attempts at phrasing large general abstract questions about evolution, and instead just say what exactly they do and what they find. ", "The readers will then themselves immediately appreciate the generality of these findings.", "\n\n(As an aside, I found the start of paragraph two in subsection \"Different mutation types and their rate biases\" a particularly striking example of general abstract phrasing that is almost impossible to parse, e.g. I have no idea what it means for mutation types to sustain adaptations.)", "\n\nIn the end it seems to me that the authors have a rather straight-forward and simple message: The rate at which genetic mutations occur that increase the expression level of a gene depends strongly on features of the genomic context of the gene, i.e. the rate at which the region is duplicated, the rate at which deletions or insertions cause promoter sequences to be placed upstream of the gene, and the rate of mutations causing read-through from neighboring genes. ", "In contrast, apart from the read-through mutations, the EFFECT of the observed mutations, once introduced, is largely independent of this chromosomal context (as the experiments with the plasmids show).", "\n\nWhy not stress rather than obscure that these are the concrete results?", "\n\n10.7554/eLife.25100.043\n\nAuthor response\n\nEssential revisions:\n\n*1) Some of the suggestions about how adaptation has occurred are incompletely substantiated. ", "Additional experiments are needed to address these concerns; in most, if not all, cases, the necessary experiments are relatively straightforward.*", "\n\n-- Results section; \\\"All rescued populations displayed increased YFP fluorescence. ", "Thus, rescue depended on the presence and overexpression of tetA-yfp.\\\" The second sentence doesn\\'t logically follow from the first. ", "The authors should test, at least in 1-2 cases, that selective deletion of TetA-YFP in the evolved clone eliminates rescue.", "\n\nWe agree that the logic of this sentence in isolation is incomplete. ", "We now modified this sentence and combined it with the previous one to clarify that in the absence of the reporter cassette, rescue was never observed. ", "We also performed the requested experiments: [Figure 2B](#fig2){ref-type=\"fig\"} shows how resistance to tetracycline is lost in 3/3 cases in which we selectively deleted *tetA-yfp* from evolved clones derived from three different ancestral strains.", "\n\n-- \\\"...or no upstream Rho-terminated transcripts were present (constraining adaptive Rho mutations, [Figure 4A](#fig4){ref-type=\"fig\"}).\\\" The notion that the Rho mutations allow read-through into tetA-YFP is interesting, but the claim that no upstream Rho-terminated transcripts exist in strains A and C needs to be substantiated. ", "Is this information being pulled from some prior study of Rho and if so, how reliable are these data? ", "Or are they simply predictions based on Rho site bioinformatics? ", "If it\\'s the latter, then qRT-PCR data supporting the claims should be generated and shown.", "\n\nTo our knowledge, there is no reliable way of inferring Rho termination sites using bioinformatics, because they show almost no conservation at the sequence level ((Ciampi, 2006), cited also in the revised main text) and only a handful of Rho-termination sites have been studied in detail. ", "Rather, candidate Rho termination sites on a genomic level are found by the absence of signatures of intrinsic termination sites (stem-loop structures), which are more readily identifiable. ", "The RNAseq study from which we drew the information on termination sites as shown in [Figure 4A](#fig4){ref-type=\"fig\"} (Conway et al., ", "2014) used this approach, and combined experimental evidence for the end of a transcript (single-bp RNAseq) with the commonly used bioinformatic algorithm TransTermHP (Kingsford, Ayanbule, and Salzberg, 2007) to detect intrinsic termination sites. ", "Importantly, the level and termination of transcripts can be condition-dependent, and our experimental conditions are not exactly the same as in the RNAseq study. ", "As explained in the revised text and shown in [Figure 4C](#fig4){ref-type=\"fig\"}, we therefore also generated direct RNA-level data to verify that there are transcripts spanning putative Rho-termination sites upstream of loci *B* and *D* in a way that is dependent on the Rho status (i.e. elevated transcript levels across the candidate terminator transcripts in the Rho mutant compared to the Rho wt). ", "While we cannot completely rule out the presence of Rho-terminated active transcripts upstream of loci *A* and *C*, we did not find evidence for them at the level of RNA ([Figure 4C](#fig4){ref-type=\"fig\"}) or at the phenotypic level ([Figure 4B](#fig4){ref-type=\"fig\"}). ", "As suggested by the reviewers, we also attempted to obtain RT-qPCR data to quantify RNA levels directly at candidate terminator sites upstream of all four loci, however we found this data difficult to interpret because of three reasons: ([@bib1]) Despite optimization attempts, several of the qPCR primer pairs had very poor amplification efficiencies, likely because they spanned stem-loop structures that are typical of intrinsic termination sites. ([", "@bib2]) Given the potentially global effect of Rho mutations on the transcriptome (Freddolino, Goodarzi, and Tavazoie, 2012), it is not obvious which genes could be used as valid reference genes to compare transcript levels in Rho-wt vs. mutant backgrounds. ([", "@bib3]) Standard RT-qPCR data using small amplicons does not allow to draw conclusions about the directionality of read-through at two head-to-head facing terminators (see [Figure 4---figure supplement 1](#fig4s1){ref-type=\"fig\"} for such configurations), and it does not give information on whether read-through propagates all the way downstream to the reporter cassette insertion loci. ", "Importantly, even in the absence of quantitative data on Rho-dependent read-through at terminators upstream of loci *A-D*, our interpretation is now supported by four lines of evidence: ([@bib1]) Position and termination mode of transcripts and terminators as found in the RNA-seq study ([Figure 4A](#fig4){ref-type=\"fig\"}). ([", "@bib2]) The integration-locus-dependent effect of Rho mutations on tetracycline resistance, which is the phenotype under selection in our evolution experiments ([Figure 4B](#fig4){ref-type=\"fig\"}). ([", "@bib3]) RNA-level evidence ([Figure 4C](#fig4){ref-type=\"fig\"}). ([", "@bib5]) Restriction of Rho mutations to strains with the reporter cassette at loci *B* and *D* ([Figure 3](#fig3){ref-type=\"fig\"}, disregarding one Rho mutation in strain *A* which co-occurred with an upstream IS5 insertion that changes the upstream neighborhood at locus *A*).", "\n\n-- [Figure 3C](#fig3){ref-type=\"fig\"}: It wasn\\'t clear how the evolved clones examined in a plasmid-based assay in [Figure 3C](#fig3){ref-type=\"fig\"} were chosen.", "\n\nWe agree that the section on mutation reconstructions on plasmids was originally written in a somewhat confusing way. ", "We now placed this information in a separate section 'Adaptation involves a broad variety of different mutation types', which we expanded in order to clarify how and why we chose the mutations that we reconstructed, and how to interpret the results from reporter plasmids. ", "Since in this part, we were interested in context-independent effects of mutations (hence the reconstruction on plasmids), we only reconstructed mutations that affected the sequence of *p~0~*, which is common to all strains. ", "This included point mutations and a small deletion with *p~0~* ([Figure 3C](#fig3){ref-type=\"fig\"}), as well as IS insertions into *p~0~* ([Figure 3D](#fig3){ref-type=\"fig\"}). ", "We only reconstructed mutations found in the first set of evolution experiments (i.e. those shown in [Figure 3A](#fig3){ref-type=\"fig\"}). ", "In [Supplementary file 2](#SD15-data){ref-type=\"supplementary-material\"}, which contains information on every replicate population of every evolution experiment, we included a column 'Reconstructed on reporter plasmid' for easy identification of these mutations.", "\n\nAdditionally, it was unclear why 7 of the 14 mutations \\\"reconstructed\\\" on plasmids didn\\'t recapitulate the evolved behavior. ", "This point raises the important concern that the paper is ultimately about how genomic context can influence evolution, but the \\\"reconstruction\\\" experiments involve placing a limited genomic region onto a plasmid to drive YFP, not TetA-YFP, production. ", "Could it be that 7 of the cases in [Figure 3C](#fig3){ref-type=\"fig\"} failed because the genomic context has changed? ", "This should be better discussed.", "\n\nThe issue of context-dependent mutation effects is indeed very central, and we tried to clarify it better throughout the text. ", "We think that the particular concern of the reviewers here stems from a confusion rooted in the rather misleading way in which [Figure 3](#fig3){ref-type=\"fig\"} and its discussion in the text was originally presented. ", "We split up [Figure 3C](#fig3){ref-type=\"fig\"} of the original submission into three panels ([Figure 3C-E](#fig3){ref-type=\"fig\"}) to aid the understanding of this figure. [", "Figure 3C](#fig3){ref-type=\"fig\"} shows plasmid reconstructions of 6 unique mutations within *p~0~* (one of them a small deletion). [", "Figure 3D](#fig3){ref-type=\"fig\"} shows reconstructions of four different IS sequences that we had found inserted into *p~0~* (IS5 at two different insertion points). ", "For [Figure 3D](#fig3){ref-type=\"fig\"}, we cloned 600 bp of the four IS directly upstream of the *yfp*-reporter to quantify effects on expression independent of the *p~0~* insertion context. [", "Figure 3C and 3D](#fig3){ref-type=\"fig\"} therefore show 10 primary mutations (not 14) analyzed in these experiments. ", "8 out of 10 of these reconstructed mutations did increase reporter fluorescence significantly. ", "In the revised text, we discuss why the lack of reporter fluorescence from one point mutation (T-145C) does not represent a 'failed' reconstruction. ", "The 'failure' of 1-2 IS insertion reconstruction is addressed in [Figure 3E](#fig3){ref-type=\"fig\"}, which is a follow-up of [Figure 3D](#fig3){ref-type=\"fig\"}. ", "In [Figure 3E](#fig3){ref-type=\"fig\"}, we investigate those IS insertions that did not increase *yfp* expression on plasmids when cloned directly upstream of the reporter (IS1 and IS5). ", "For [Figure 3E](#fig3){ref-type=\"fig\"}, we engineered the terminal 50 bp of these two IS within the *p~0~* sequence at the precise point where we had found them inserted in evolved clones (hence, two reconstructions for IS5). ", "For IS1, we observe reporter fluorescence that depends on the precise insertion point, which indicates a hybrid promoter at the insertion point. ", "For IS5, we did not find evidence of a hybrid promoter. ", "The 'failure' of the IS5 reconstruction is discussed in the main text and addressed in the newly included [Figure 3---figure supplement 3](#fig3s3){ref-type=\"fig\"} (see our reply to the next point).", "\n\nIn addition, the authors should, for at least a handful of the \\'failed\\' cases in [Figure 3C](#fig3){ref-type=\"fig\"}, do proper reconstructions by engineering the putatively causal mutation into the ancestral strain background.", "\n\nAs explained above, only one of the 10 tested mutations, the insertion of IS5 upstream of the reporter cassette can be considered as 'failed' in the sense of lacking reporter fluorescence on the plasmid reconstruction. ", "We engineered one of the IS5 insertions from an evolved clone of strain *A* into the ancestral background and showed that it restores growth on tetracycline and *tetA-yfp* fluorescence. ", "Thus, the activating effect of IS5 on downstream gene expression appears to depend indeed on the chromosomal context. ", "The respective data is shown in [Figure 3---figure supplement 3](#fig3s3){ref-type=\"fig\"} and explained in the Results section.", "\n\n2\\) The presentation of results could be substantially improved. ", "There is a general lack of primary data provided and many figures lack highly relevant details on the exact nature of the genomic context of each locus, both in the original strains and the evolved isolates.", "\n\n-- The authors should say something in the main text, not just the Materials and methods section, about (i) the rationale for choosing the four sites of insertion that they chose and (ii) the nature/genomic context of the four insertion sites. ", "Genomic diagrams of the four insertion sites with flanking genes, etc should also be provided in the main [Figure 1](#fig1){ref-type=\"fig\"}. ", "One half of these regions is shown in [Figure 4](#fig4){ref-type=\"fig\"}, but the other half is omitted and these diagrams should come earlier in the paper.", "\n\nWe moved the section on the choice of the loci to the beginning of the Results, in which we explain our experimental system. ", "We also corrected an error on the rational for choosing locus *C*. ", "Genomic diagrams showing flanking genes both up- and downstream of the insertion loci are now shown in main [Figure 1B](#fig1){ref-type=\"fig\"}. ", "The chromosomal neighborhood at a larger scale with the position of insertion sequences that could provide flanking homology is shown in [Figure 3---figure supplement 1](#fig3s1){ref-type=\"fig\"}, which also shows the regions in which the IS-free strains based on strain MDS42 differs from the MG1655-based 'IS-wt' strains.", "\n\n-- \\\"We verified the presence of IS5 at the boundary of the amplicon in rescued B populations ([Figure 2C](#fig2){ref-type=\"fig\"}).\\\" [Figure 2C](#fig2){ref-type=\"fig\"} appears to contain only a schematic of locus B, with no data supporting the claim that IS5 is at the boundary of the amplified region, nor is there really any primary data demonstrating or validating the notion that the cassette was amplified.", "\n\nWe included an agarose gel as part of [Figure 2D](#fig2){ref-type=\"fig\"}, which shows the presence of the PCR product corresponding to the expected IS5I/H junction in evolved populations with increased CFP fluorescence, and the absence of the junction in the ancestral genotype and amplified populations from strain *B∆IS5I*, in which one of the flanking IS is missing.", "\n\nWe validated the amplification of the reporter cassette in populations with increased CFP fluorescence by qPCR on genomic DNA extracted from several populations evolved from different ancestor strains. ", "We agree that using CFP as a marker of amplification is a central pillar of this study and that we needed to make more clear how it was validated. ", "Therefore, for the revised version, we moved the respective figure that shows a correlation between CFP fluorescence and genomic DNA copy number from the supplement to main [Figure 1E](#fig1){ref-type=\"fig\"}. ", "The respectively extended part of the revised text is now at the end of the first section in the Results.", "\n\nSubsection \"Properties of upstream genes determine the availability of two different types of adaptive promoter co-option mutations\": The use of a strain that is apparently free of all IS elements needs more explanation. ", "The strain generated in Posfai et al., ", "2006, has actually been reduced by 15% and so lacks a wide range of genomic features. ", "This could complicate the interpretation that the difference in mutational spectra in the two strains ([Figure 3A](#fig3){ref-type=\"fig\"}) results from a lack of IS elements. ", "The authors should more clearly discuss this issue and its impact on the interpretation of their results.", "\n\nPosfai et al. ", "performed several different tests on mutation rates and spectra of strain MDS41, a close relative of MDS42, the parent strain of our IS-free strains, and compared mutation rates to MG1655, the parent strain of our IS-wt strains. ", "They concluded that the difference in the total mutation rate between the two strains is fully explained by the lack of IS-mediated mutations in MDS41; mutations of all other tested types were found to occur at similar rates in both strains. ", "We now explain this at the beginning of the new Results section \"Adaptation involves a broad diversity of mutation types\". ", "We also added [Figure 3---figure supplement 1](#fig3s1){ref-type=\"fig\"} to show which regions in the larger neighborhood of our insertion loci have been deleted in the MDS42 background. ", "We cannot exclude that the deletions in the MDS42 background have effects on adaptation in our experiments that we are not aware of. ", "For example, deletions may affect regulation of genes in the neighborhood of our loci. ", "Therefore, we have avoided quantitative comparisons of adaptation between IS-wt and IS-free strains. ", "Rather, given that the only difference within the sets of IS-wt and IS-free strains is the integration locus of the reporter cassette, we interpret differences in adaptation within these sets of strains as indicators of neighborhood effects. ", "We then compare the differences found in the set of IS-wt strains and in the set of IS-free strains to rationalize whether these differences are dependent on the local neighborhood (as is the case for promoter co-opting mutations which are locus-specific in both sets) or on the more global neighborhood (as is the case for amplifications mediated by flanking homologous IS elements).", "\n\n-- In the same section: Without more details, it\\'s difficult to assess or interpret the data in this section of the manuscript. ", "It\\'s not clear whether individual strains only have single mutations or multiple mutations and if it\\'s the latter, were the individual mutations made? ", "And while the nature of \\'point mutations\\' is clear, it\\'s not clear what the authors mean by mutations \\'delivering full or partial promoters\\'. ", "And in the cases where the reconstructed mutation does not increase the reporter, what\\'s the explanation? ", "Is it because there are other mutations?", "\n\nAs explained in our reply on mutation reconstructions on plasmids (see above), we have largely expanded the section in the Results to clarify these questions raised be the reviewers. ", "Multiple mutations found in the same clone are indicated by colored dots on bars shown in [Figure 3A](#fig3){ref-type=\"fig\"}, some of these multiple mutations are explained at respective points in the text (e.g. mutations that occur with amplifications are investigated in the section \"Chromosomal neighborhood influences adaptation by affecting the fitness cost of amplifications\" of the Results). ", "By mutations 'delivering full or partial promoters' we mean IS elements that contain promoters, which can drive expression of genes downstream of their insertion point (IS2, IS3), or that contain the upstream part of promoters which require a corresponding sequence downstream at the point of insertion (IS1) ([Figure 3D and E](#fig3){ref-type=\"fig\"}). ", "Cases 'where the reconstructed mutation does not increase the reporter' are discussed above in our reply to the last point of part ([@bib1]) of the decision letter. ", "After our initial sequencing (of clones from rescued populations from IS-wt strains of the first replicate experiment set), which only included the upstream sequence of the *tetA-yfp* gene, we did have four unexplained cases of adaptations without a known candidate causative mutation. ", "We addressed these four cases with whole-genome sequencing, and discovered Rho mutations in three of them -- as explained at the beginning of the section \"Properties of upstream genes determine the availability of two different types of adaptive promoter co-option mutations\" and in [Figure 3---figure supplement 4](#fig3s4){ref-type=\"fig\"}. ", "For all other experiments (IS-free strains and additional replicate experiment sets), candidate adaptive mutations were then found using Sanger sequencing of the *tetA-yfp* upstream region and the *rho* gene. ", "In this way, we found a candidate adaptive mutation for every rescued population, with a few exceptions that we did not follow up on.", "\n\n3\\) There was a concern about whether the results depend on the precise way in which the selection was performed. ", "The evolution is done with relatively small populations in microtiter plates that are diluted each day into fresh media whose tetracycline concentration increases by about 25% each day. ", "Consequently, the populations are effectively in a race for increasing the expression of the tetA sufficiently fast to \\'keep ahead\\' of the increasing tetracycline concentration. ", "This suggests that even small differences in the initial expression levels of tetA at the different loci could have a large effect on the probability of survival. ", "Thus, it seems plausible that the increased survival of clones with tetA at the B and D loci might be a result of higher initial expression at these loci. ", "This might also explain puzzling observations like the fact that, in the IS-free case, rescue through point mutations in the promoter are observed 4 times at D but never at A or C, and the fact that rescue rates at the B locus vary across replicates even though CFP increase is observed almost without fail ([table 1](#tbl1){ref-type=\"table\"}).", "\n\nOur understanding of the evolutionary rescue scenario ('adapt or die out') faced by evolving populations matches exactly what the reviewers describe as a 'race for increasing the expression of *tetA-yfp* sufficiently fast to 'keep ahead' of the increasing tetracycline concentration. ", "We now included a sentence at the beginning of the Results section that explicitly states this: 'Rescue from extinction requires the spread of adaptive mutations in a race against population decline.' ", "We also agree with the reviewers that the initial level of *tetA-yfp* expression is expected to have a large effect on survival, as it sets the decline rate of the unadapted genotype (see (Martin et al., ", "2013) for an accessible description of the mathematical framework used to describe evolutionary rescue and the impact of peculiarities of evolution experiments such as periodic bottlenecking). ", "Since we did not want to study the effect of chromosomal location on initial expression (for which our experiments would have been a very complicated way to do so), but the effect of chromosomal location on adaptive mutations that can change expression, we designed our experiments to account for initial expression differences as best as we can. ", "In the revised text, we have made it more clear why and how exactly we did so. ", "The respective section at the beginning of the Results starts with the sentence \"The probability of evolutionary rescue depends on the size and decline rate...\".", "\n\nConcerning the numbers of rescue by point mutations observed in different IS-free strains, numbers are too low to draw conclusions supported by statistics.", "\n\nWe agree that the variability in the number of rescued populations of strain *B* between replicate experiments is likely an effect of fluctuations in the relatively small population size at the time of daily transfer. ", "Although we did not quantify this explicitly, we think that the largest component causing such fluctuations comes from variability in the amount of liquid (around 2 µL) transferred with the pin inoculator that we used (and of course from the inherent stochasticity of mutations). ", "We mention this also in the revised text (at the end of the section \"The chromosomal location of a selected gene has large effects on adaptation\" in the Results section).", "\n\nThe authors should quantify initial expression levels at each locus and investigate the effect of this on the probability of rescue.", "\n\nSince initial expression levels of *tetA-yfp* are very low (although maybe surprisingly not zero, as might be expected from a randomized upstream sequence as *p~0~*), we could not use YFP fluorescence to quantify initial expression. ", "What is more relevant in our experiments, and apparently also much more sensitive, are differences in tolerance to tetracycline between strains. ", "We quantified these differences by measuring dose-response curves of each strain to tetracycline at a high resolution of tetracycline concentration ([Figure 1---figure supplement 1](#fig1s1){ref-type=\"fig\"}, to which we added explicit MIC values for each strain in the revised version). ", "We consider differences in the MIC as a good proxy for initial expression levels at each locus, given that apart from the integration locus strains are isogenic. ", "To account for initial expression levels in evolution experiments, we adjusted tetracycline concentrations to the initial MIC levels. ", "We made this also more explicit in the main text (starting with \"Given the otherwise isogenic background of strains, ...\").", "\n\nRelated to this, the authors should include a panel of 96 figures (one for each well of the plate) showing the time courses of OD, YFP/OD, and CFP/OD across the 10 days. ", "Right now the authors only report numbers of rescued and numbers with YFP or YFP+CFP increase, but it is hard to judge if such a simple classification does justice to the potentially complex dynamics that is observed across populations.", "\n\nThe requested figures are now found in [Supplementary file 1](#SD14-data){ref-type=\"supplementary-material\"}, which we also refer to in the main text. ", "Certainly, adaptation dynamics are more complex than suggested by the fluorescence phenotype classification and time-resolved fluorescence data across the 10 days can be informative about these dynamics. ", "Since we have sequencing data however only for the endpoint of the experiment (day 10), interpreting these dynamics is hard. ", "We therefore decided to analyze the temporal dynamics of fluorescence only in relation to the specific questions that came up during our investigation and that could be addressed with it (i.e. the section on amplification cost).", "\n\nApart from the effect of initial expression, to what extent does the selection for \\'fast increase in expression\\' bias the mutations that are observed to one type or another? ", "To argue for the generality of the observations that the authors make, it would be useful to assess the rate of rescue in another setting where the type of selection is different, e.g. using a Luria-Delbrueck type experiment in which many cultures (with tetA at the different loci) are grown in media without tetracycline, with colonies counted on agar plates with tetracycline concentrations beyond the MIC. ", "Does one again find mostly rescue of clones at B and D, even in the IS free case?", "\n\nClearly, the precise way in which selection is imposed should matter for the outcome of the experiment. ", "We mention this rather early in the Results section (\"... illustrating how our experimental selection filters for mutations that increase *tetA-yfp* expression above a minimum level.\"). ", "It is known that the precise way in which conditions deteriorate can affect the genetic architecture of adaptations, by making particular routes to adaptation inaccessible (Lindsey et al., ", "2013). ", "In our particular experiment, the gradual increase in tetracycline concentration is expected to favor amplifications, which according to the 'canonical' model are built up in a sequential process that starts from an initial duplication (Romero and Palacios 1997). ", "We included a new section and Figure ('Chromosome neighborhood effects on adaptation in a single-step plating experiment' and [Figure 6](#fig6){ref-type=\"fig\"}), in which we present the results of plating experiments as suggested by the reviewers. ", "Importantly, since selection on tetracycline plates is not stringent, i.e. sensitive clones may grow at very low rates even at tetracycline concentrations above the MIC, the results of these experiments should not be interpreted in the same way as the classical Luria-Delbrueck fluctuation experiment. ", "This is because mutations may occur also after plating, which may cause a misinterpretation of mutation rates calculated using colony counts (Foster 2006). ", "However if colonies are counted at the earliest possible time point (Day 2 in [Figure 6](#fig6){ref-type=\"fig\"}), we expect colony numbers to report mostly on the locus-specific rate of single-step mutations, i.e. point mutations, IS insertions, and promoter co-option mutations. ", "At later time points (Day 5 in [Figure 6](#fig6){ref-type=\"fig\"}), multi-step adaptations such as amplifications (and possibly other multi-step adaptations) become dominant. ", "The dynamics of colony appearance in our plating experiment recapitulates several aspects of Cairns' classic *lacZ* frameshift reversion experiment (Cairns, Overbaugh, and Miller 1988), which has been linked to transient amplification of the selected gene (Andersson 1998) in a process that heavily depends on the position of the *lacZ* gene in a way similar to our system (Slechta et al., ", "2002). ", "Regardless of the temporal dynamics of colony appearance, rescued clones are found mostly with the reporter cassette at loci *B* and *D*, also in the IS-free case, which recapitulates the results from our evolution experiments in liquid culture.", "\n\n\\[Editors\\' note: further revisions were requested prior to acceptance, as described below.\\]\n\nSummary:\n\nThe reviewers are still generally positive and there was a consensus that no additional experiments or analyses are critical at this stage. ", "However, there was a continued concern, also raised in the first round of review, that the Introduction is somewhat disorienting and excessively abstract. ", "While the reviewers appreciate the effort to place the work in a broad and general context, they also felt strongly that the paper would benefit from a more direct, concrete exposition of what specific questions were addressed, what was done, and what was learned. ", "The use of simple, straightforward language is encouraged. ", "It\\'s not a matter of \\\"dumbing\\\" down the Introduction, but making it clear and accessible. ", "The comments of one reviewer are provided in full below as they will be helpful as you further revise the manuscript.", "\n\nWe thank the reviewers and in particular the author of the below review for their specific criticism and their concrete suggestions, which we implemented as detailed in the following.", "\n\nWe largely restructured the Introduction and removed most of the opening paragraph. ", "To improve readability and focus, we also shortened the section on different mutation types and their position biases. ", "The last paragraph of the Introduction now contains a specific exposition of our research question, the methodology, the results and the conclusions.", "\n\nEssential revisions:\n\nAs I suspected the initial MIC\\'s of the different constructs (cassette at locus A, B, C or D) are not the same, but even the initial B and D populations already have elevated MIC. ", "The authors explain that they attempt to normalize for this difference by treating each construct with a concentration profile that is the same relative to the original MIC of that construct. ", "That is, the constructs at locus D will be subjected to time-dependent anti-biotic concentrations that are about twice that of what the construct at locus A are subjected to (based on data presented in [Figure 1---figure supplement 1](#fig1s1){ref-type=\"fig\"}).", "\n\nYes, this is correct.", "\n\nI understand that this is the most reasonable way to correct for the differences in MIC of the initial populations, but I am not really convinced that it will now make the selective environments directly comparable.", "\n\nAgreed. ", "The correction for initial MIC differences is no direct correction for population size differences throughout the experiment. ", "The correction rather addresses the otherwise large population size differences at the beginning of the experiment, making selective environments as comparable as possible in a practical way. ", "We have added an explanatory sentence on the purpose of the MIC correction in the caption of [Figure 1---figure supplement 1](#fig1s1){ref-type=\"fig\"}.", "\n\nThat is, it seems likely that, even if no beneficial mutations were to occur at all, substantial differences in the population sizes would remain and these might substantially affect the probability of generating beneficial mutants (i.e. just because of an elevated population size).", "\n\nI think it would be good for the authors to add some discussion of this issue.", "\n\nWe now discuss this possibility in the section on the Luria-Delbrueck like experiments. ", "We have also modified a sentence earlier in the Results section, which previously may have implied that results from strains are perfectly comparable.", "\n\nI personally feel this issue is the main motivation for doing the Luria-Delbrueck like experiments (i.e. to check that the results are not specific to the precise way of performing the selection) and it might be worthwhile to mention this also.", "\n\nWe have now explicitly mentioned the above concern as a motivation for the Luria-Delbrueck like experiments and explain how these experiments address this potential problem.", "\n\nFinally, regarding this point, although I feel that it still cannot be definitively said that the increased rescue of B and D constructs is solely due to the increased RATE of generating beneficial mutations rather than an increase in the size of the target population for such mutations, what one could definitely conclude is that, if this cassette were to be inserted in the genome through horizontal transfer, than rescue under selection with antibiotic is clearly highest when it is inserted into loci B or D, rather than at A or C.\n\nYes, this conclusion is definitely valid. ", "We have now included it in the Discussion along with the relevance of our results for horizontal gene transfer.", "\n\nThe other comment I have is about presentation. ", "I still find the introductory sections rather disorienting regarding what this paper is going to actually show. ", "My impression is that this is due to a choice of presentation style which seems to aim to present the questions that the work addresses in as general and abstract terms as possible, leaving it typically up to the reader to connect the general abstract description to the actual concrete things that are being done. ", "I find this rather tiresome to read. ", "I believe the paper would become much more pleasant to read if the authors simply removed all attempts at phrasing large general abstract questions about evolution, and instead just say what exactly they do and what they find. ", "The readers will then themselves immediately appreciate the generality of these findings.", "\n\nAs explained in our reply to the reviewing editor's summary, we have removed the respective parts of the Introduction and added a specific summary of our research question and our results at the end of the Introduction.", "\n\n(As an aside, I found the start of paragraph two in subsection \"Different mutation types and their rate biases\" a particularly striking example of general abstract phrasing that is almost impossible to parse, e.g. I have no idea what it means for mutation types to sustain adaptations.)", "\n\nWe removed this sentence.", "\n\nIn the end it seems to me that the authors have a rather straight-forward and simple message: The rate at which genetic mutations occur that increase the expression level of a gene depends strongly on features of the genomic context of the gene, i.e. the rate at which the region is duplicated, the rate at which deletions or insertions cause promoter sequences to be placed upstream of the gene, and the rate of mutations causing read-through from neighboring genes. ", "In contrast, apart from the read-through mutations, the EFFECT of the observed mutations, once introduced, is largely independent of this chromosomal context (as the experiments with the plasmids show).", "\n\nWhy not stress rather than obscure that these are the concrete results?", "\n\nUnderstood. ", "Our main message is now summarized in the last paragraph of the Introduction of our manuscript. ", "We thank the reviewer for these specific suggestions, which helped make our manuscript more accessible.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.000692675996106118, 0.0007255040109157562, 0.0006386007880792022, 0.0005443694535642862, 0.000640156795270741, 0.0006331477779895067, 0.0005898926756344736, 0.0006186402752064168, 0.0006274535553529859, 0.0005782435764558613, 0.0005667409277521074, 0.0005920433904975653, 0.0005473300698213279, 0.0005823976825922728, 0.0005865836865268648, 0.0005621740710921586, 0.0005393516621552408, 0.0007976425695233047, 0.0006138175376690924, 0.0006746670696884394, 0.0005995335523039103, 0.0006771947955712676, 0.0005837075877934694, 0.0005801973165944219, 0.0006055006524547935, 0.05067504197359085, 0.0005466376896947622, 0.0006153583526611328, 0.0006870603538118303, 0.0007585749845020473, 0.007384204771369696, 0.008462858386337757, 0.0006872211233712733, 0.0006168501568026841, 0.0010582625400274992, 0.0007610969478264451, 0.0005760786589235067, 0.0006765430443920195, 0.0005913387867622077, 0.0007955501787364483, 0.0005943631986156106, 0.0006212909938767552, 0.0006473396788351238, 0.0006329631432890892, 0.0006217367481440306, 0.0012213028967380524, 0.0008354746969416738, 0.0006568687967956066, 0.0005638325237669051, 0.0006991029367782176, 0.0005750363343395293, 0.0005847658612765372, 0.0005657438305206597, 0.0006778535316698253, 0.0014621468726545572, 0.0007176695507951081, 0.0006720030214637518, 0.0006053987890481949, 0.0005807804991491139, 0.0005391226732172072, 0.000548448646441102, 0.0005410324665717781, 0.0005961480783298612, 0.0005477209342643619, 0.0006078525329940021, 0.0005772999720647931, 0.0005744558875449002, 0.000607962952926755, 0.0006507619982585311, 0.0006740391836501658, 0.0005946383462287486, 0.0005980075220577419, 0.0006449887296184897, 0.0007036417373456061, 0.0005608879728242755, 0.0006240850780159235, 0.0006614748272113502, 0.0008762304205447435, 0.0006270825979299843, 0.0005957885296083987, 0.0006660656072199345, 0.0005609254003502429, 0.0006452128291130066, 0.0010647207964211702, 0.000622723251581192, 0.0006696244818158448, 0.0006487963837571442, 0.0007080474169924855, 0.0008166221668943763, 0.0009774896316230297, 0.0005519604892469943, 0.0005819515790790319, 0.0005810664733871818, 0.000775171210989356, 0.0007333984831348062, 0.0005572418449446559, 0.000690355256665498, 0.0006591115961782634, 0.0006113758427090943, 0.0006476732087321579, 0.0007899123593233526, 0.0005844864645041525, 0.0006453853566199541, 0.0006063657347112894, 0.000545693386811763, 0.0006290882593020797, 0.0006010096403770149, 0.0005716534215025604, 0.0007537893834523857, 0.0005769064300693572, 0.0007338906289078295, 0.0007961156079545617, 0.0006286231218837202, 0.0008484027930535376, 0.0005930981715209782, 0.0119340680539608, 0.0010778880678117275, 0.0010903037618845701, 0.0006027076160535216, 0.0006507235229946673, 0.0009957976872101426, 0.0006568838143721223, 0.0006167516694404185, 0.0008594085229560733, 0.0007270713103935122, 0.0006049993680790067, 0.0008820976945571601, 0.000601187814027071, 0.000706242339219898, 0.0006765997386537492, 0.0006293508922681212, 0.0006328204763121903, 0.0005787662812508643, 0.0006112741539254785, 0.0323229655623436, 0.0007381682517006993, 0.0005911965272389352, 0.0007055117748677731, 0.0006004467722959816, 0.0006782582495361567, 0.0006027707713656127, 0.0006476136040873826, 0.0006246941047720611, 0.0006206994294188917, 0.000585487752687186, 0.0005941615672782063, 0.0006736198556609452, 0.0008619191939942539, 0.0005941397976130247, 0.0005664271884597838, 0.0006236400222405791, 0.0005829953006468713, 0.0006076637655496597, 0.0006982898921705782, 0.000620341335888952, 0.0006412949878722429, 0.0006546148797497153, 0.0006692037568427622, 0.0007658350514248013, 0.0005835779593326151, 0.0005878193769603968, 0.0006450384971685708, 0.0005487216403707862, 0.000632481649518013, 0.0005494231591001153, 0.0006340344552882016, 0.000701482524164021, 0.0006242816452868283, 0.0006880579749122262, 0.000692712317686528, 0.0006573197315447032, 0.0005906597361899912, 0.0006007960182614625, 0.0006662055966444314, 0.0006810146733187139, 0.0006888788775540888, 0.0005704170907847583, 0.0006679304060526192, 0.0009740540408529341, 0.0006370078772306442, 0.0010310914367437363, 0.0009762154659256339, 0.0006339774117805064, 0.0006190997664816678, 0.0007547230925410986, 0.003469758899882436, 0.0007632373599335551, 0.0005520549602806568, 0.000611374678555876, 0.0006907550850883126, 0.0006574857397936285, 0.0005597749259322882, 0.0005827575223520398, 0.0005738632753491402, 0.0006476198323071003, 0.0005650020902976394, 0.0005918482202105224, 0.0008091388153843582, 0.0005894354544579983, 0.0007625983562320471, 0.0005760281346738338, 0.0006219521746970713, 0.0006741773686371744, 0.0007374201086349785, 0.0008182875462807715, 0.0005979232373647392, 0.0005614528199657798, 0.0007711477228440344, 0.0006574017461389303, 0.000588795926887542, 0.0006365044391714036, 0.000644309853669256, 0.0006806195597164333, 0.0010453580180183053, 0.0007082184893079102, 0.0008623382309451699, 0.0006657254416495562, 0.0006015260005369782, 0.0006098937592469156, 0.000717629212886095, 0.0005782923544757068, 0.0005823053070344031, 0.0005752199213020504, 0.0007290109060704708, 0.0008162339800037444, 0.0006073690019547939, 0.0007491679280065, 0.0005628968356177211, 0.0006764675490558147, 0.0009432161459699273, 0.0007240439299494028, 0.0006000695284456015, 0.000674794428050518, 0.0006510631646960974, 0.0005908390739932656, 0.0006750700413249433, 0.0005348694394342601, 0.0005424770643003285, 0.0005591521039605141, 0.0005525113083422184, 0.0005375842447392642, 0.000586691836360842, 0.0005842983955517411, 0.000574415666051209, 0.0006169424741528928, 0.0005976714310236275, 0.000704586214851588, 0.0005815041367895901, 0.0006356918020173907, 0.0006022700690664351, 0.0005973268416710198, 0.0005755940219387412, 0.0005828363937325776, 0.0005578941782005131, 0.0007309469510801136, 0.0005913292407058179, 0.0007633322384208441, 0.0005962174036540091, 0.0005778482300229371, 0.0007600301178172231, 0.0005524578737094998, 0.0005547511391341686, 0.0006689939764328301, 0.0006265153060667217, 0.0005737746832892299, 0.0006025720504112542, 0.0005608678911812603, 0.0006075148703530431, 0.0007292836671695113, 0.0005729268305003643, 0.0006145887891761959, 0.0006312357145361602, 0.0005632872926071286, 0.0005972491344437003, 0.0005622581811621785, 0.0008228864753618836, 0.0006089020171202719, 0.0007278457633219659, 0.0005520498962141573, 0.0005732685094699264, 0.0006614963058382273, 0.0006863395101390779, 0.0007120489608496428, 0.0007034500013105571, 0.0006107765366323292, 0.0005995033425278962, 0.0006249329308047891, 0.0006081089377403259, 0.0005958632100373507, 0.0006209053681232035, 0.0006314732600003481, 0.0006526790675707161, 0.0005748072289861739, 0.0005712949787266552, 0.0005500241531990469, 0.0005263330531306565, 0.0005434564664028585, 0.0005533297662623227, 0.0006951240939088166, 0.0005358689231798053, 0.0005511592607945204, 0.0006174715817905962, 0.0006384720909409225, 0.000615579541772604, 0.0006076880381442606, 0.0005878939409740269, 0.0005573894595727324, 0.0006781843258067966, 0.0005571988294832408, 0.0006198259652592242, 0.0006099275196902454, 0.0006461722077801824, 0.0006354200886562467, 0.012478753924369812, 0.0007277094409801066, 0.0006593751604668796, 0.0006011883961036801, 0.005245794076472521, 0.0007422362104989588, 0.0008351427968591452, 0.000633522926364094, 0.0006741374963894486, 0.0006932032993063331, 0.0006167843239381909, 0.0013330435613170266, 0.0007773215766064823, 0.0005509144975803792, 0.0005594423273578286, 0.0006439227727241814, 0.0006308639422059059, 0.0005635955603793263, 0.0006832102662883699, 0.0006448245840147138, 0.0005639959126710892, 0.0008978452533483505, 0.0006581007037311792, 0.0007281301659531891, 0.020320722833275795, 0.0007456422899849713, 0.0006151171401143074, 0.0007024716469459236, 0.0005840029916726053, 0.0007252973737195134, 0.0005985774914734066, 0.0005894705536775291, 0.0005930049228481948, 0.0006375468801707029, 0.0005991731304675341, 0.0007227981113828719, 0.0007129679434001446, 0.00060366588877514, 0.0005931394989602268, 0.0005435266648419201, 0.000716423848643899, 0.0006043876055628061, 0.0010221826378256083, 0.0005563168087974191, 0.0006009265780448914, 0.00069173623342067, 0.0006067108479328454, 0.0006800667615607381, 0.0005928385071456432, 0.0006075377459637821, 0.0005671351100318134, 0.0005953352665528655, 0.0006935499259270728, 0.0006998638855293393, 0.0006123208440840244, 0.0006711783353239298, 0.000625627813860774, 0.000711803964804858, 0.000599290244281292, 0.0006492658867500722, 0.0005719850887544453, 0.0005537383840419352, 0.0005905418656766415, 0.0007181988330557942, 0.0007814852870069444, 0.0006200744537636638, 0.0005837158532813191, 0.0006873082020319998, 0.0008010307210497558, 0.0005797755438834429, 0.00060576933901757, 0.0006123389466665685, 0.0006193515146151185, 0.000595121702644974, 0.0005592693923972547, 0.0005401091184467077, 0.000669275876134634, 0.0005301000783219934, 0.0006749944295734167, 0.0005415055784396827, 0.0005884946440346539, 0.0005762752844020724, 0.0006433786475099623, 0.0006085803033784032, 0.0006258433568291366, 0.0006543815834447742, 0.0007022976060397923, 0.0006223999080248177, 0.0006605267408303916, 0.000636971672065556, 0.00057886668946594, 0.0005617118440568447, 0.0007100874790921807, 0.0006595539744012058, 0.0005943791475147009, 0.0008329155971296132, 0.0008115491946227849, 0.0005990997888147831, 0.0007201483240351081, 0.000588072172831744, 0.0006915013655088842, 0.0007069194107316434, 0.0006273032049648464, 0.0006110490066930652, 0.000764794705901295, 0.000621795654296875, 0.0006587740499526262, 0.0005990903009660542, 0.0005793132004328072, 0.0005889533786103129, 0.0006096180877648294, 0.0006172612775117159, 0.0005125492461957037, 0.0007208544993773103, 0.0005902922130189836, 0.0006539698224514723, 0.0006010910146869719, 0.0005951350321993232, 0.0009155491716228426, 0.000567860493902117, 0.0005536265671253204, 0.0006092239636927843, 0.0005629601655527949, 0.0005654020933434367, 0.0005873887566849589, 0.0015690716682001948, 0.001651566824875772, 0.010130836628377438, 0.0015014116652309895, 0.0007758991559967399, 0.0006554601714015007, 0.0006795277586206794, 0.0007699860143475235, 0.0016532383160665631, 0.0006094510317780077, 0.0006627946277149022, 0.0006177164614200592, 0.000665724859572947, 0.0006538669695146382, 0.0006812084466218948, 0.0006011396762914956, 0.0006892455858178437, 0.0007037004688754678, 0.000563975190743804, 0.0006065042107366025, 0.0006430629291571677, 0.0005711354897357523, 0.0006589536205865443, 0.0006074836128391325, 0.0009177348110824823, 0.0005522280698642135, 0.0005891767796128988, 0.0005901597905904055, 0.0005618620780296624, 0.0005597239942289889, 0.0005769077688455582, 0.0005562164005823433, 0.0005535383825190365, 0.0006544729694724083, 0.0006251995218917727, 0.0006750202155672014, 0.0005357475602068007, 0.0006028175703249872, 0.000532643694896251, 0.0007463411311618984, 0.0005700263427570462, 0.0005609272047877312, 0.000985646154731512, 0.0005823341780342162, 0.0007368936203420162, 0.0005652317777276039, 0.0006215835455805063, 0.0009668131242506206, 0.0006610605050809681, 0.0006315524806268513, 0.0005231889081187546, 0.0005350204301066697, 0.0005632824613712728, 0.0005642682663165033, 0.0005213218973949552, 0.0005900056567043066, 0.0005142747540958226, 0.0005622667958959937, 0.0005724491784349084, 0.0005842797691002488, 0.0005784263485111296, 0.0005348292179405689, 0.0006076585268601775, 0.0007961455266922712, 0.0006035209516994655, 0.0005872999900020659, 0.000646326458081603, 0.0007155672064982355, 0.0006916120182722807, 0.0007042784127406776, 0.0007766610942780972, 0.0005725588998757303, 0.0006400150014087558, 0.0005425468552857637, 0.0005609035142697394, 0.0005830331356264651, 0.000588921073358506, 0.0005111024947836995, 0.0005483990535140038, 0.0005633041728287935, 0.0005871279281564057, 0.0005501601845026016, 0.0005834005423821509, 0.0006562749622389674, 0.0006021374720148742, 0.0005081020062789321, 0.0005707292584702373, 0.0006248462595976889, 0.000645741238258779, 0.0006520001334138215, 0.0008685169741511345, 0.0005962094874121249, 0.0006085939821787179, 0.0007425782387144864, 0.0006075252895243466, 0.0006282128160819411, 0.0005784814129583538, 0.0005315177841112018, 0.0005444957641884685, 0.0005573358503170311, 0.000633272051345557, 0.000552329933270812, 0.0006117424927651882, 0.0005421671667136252, 0.0005624736659228802, 0.0005642682663165033, 0.0005213218973949552, 0.0005503592547029257, 0.0005765664391219616, 0.0005039719399064779, 0.0005453782505355775, 0.0026016468182206154, 0.000510209531057626, 0.0005369185237213969, 0.000546580646187067, 0.0006044483161531389, 0.000538614927791059, 0.0005795600591227412, 0.0005085136508569121, 0.0005320103955455124, 0.0005273427232168615, 0.0005946255405433476, 0.000544066249858588, 0.0006656084442511201, 0.0005257735028862953, 0.000524465343914926, 0.000565899652428925, 0.0005678366287611425, 0.0005881433608010411, 0.0007529892609454691, 0.0006058201543055475, 0.0005263361381366849, 0.0006076585268601775, 0.0007629494066350162, 0.0006035209516994655, 0.0005822880775667727, 0.0005562665173783898, 0.0005916686495766044, 0.0005762692308053374, 0.0006465630140155554, 0.0007155672064982355, 0.0006916403654031456, 0.0005570743232965469, 0.0006030856748111546, 0.0005532572395168245, 0.0006130262045189738, 0.0005715945735573769, 0.000566622125916183, 0.0006385825108736753, 0.0005530887865461409, 0.0005644936463795602, 0.0006521427421830595, 0.0005701656918972731, 0.0006137730670161545, 0.0005996004329062998, 0.0006186503451317549, 0.0007042116485536098, 0.0005837976932525635, 0.0005383187672123313, 0.0005680986796505749, 0.0007243302534334362, 0.0005572906811721623, 0.0005452880868688226, 0.0007765012560412288, 0.0005725477240048349, 0.0006399299018085003, 0.0005424630362540483, 0.0005255923606455326, 0.0005483851418830454, 0.0005580786964856088, 0.0007420055917464197, 0.000601479783654213, 0.0005825634580105543, 0.000562601606361568, 0.0006672601448372006, 0.000546736700925976, 0.0007740879082120955, 0.0006028391653671861, 0.0005796849145554006, 0.0005600425647571683, 0.0006038903957232833, 0.0006420383579097688, 0.0005609117797575891, 0.0006154478178359568, 0.0006593136349692941, 0.0006429572240449488, 0.0005627399659715593, 0.0005831748130731285, 0.0005889207823202014, 0.0005111171049065888, 0.0005483754794113338, 0.000563409470487386, 0.0005343751981854439, 0.0054803267121315, 0.0005578341078944504, 0.0006027337512932718, 0.000587135145906359, 0.0006122149061411619, 0.0005712991114705801, 0.0005251223919913173, 0.0005533063085749745, 0.0005714954459108412, 0.0005501229898072779, 0.0005834366893395782, 0.0006561836344189942, 0.0006021882290951908, 0.0005080678965896368, 0.0007501566433347762, 0.0006137049640528858, 0.0005781837389804423, 0.0005357195041142404, 0.0005624257028102875, 0.000607677036896348, 0.001330881379544735, 0.0006010197103023529, 0.0006202230579219759, 0.0005811916780658066, 0.0005707048112526536, 0.0006248397403396666, 0.0006457840208895504, 0.0006519572343677282, 0.0008687041699886322, 0.0005545903695747256, 0.0005817976780235767, 0.0005944722797721624, 0.0005526224849745631, 0.0005675212014466524, 0.0005474528879858553, 0.0006098583107814193, 0.0005396388005465269, 0.0005962608847767115, 0.0006084933411329985, 0.0007425807416439056, 0.0006075308192521334, 0.0006281593232415617, 0.0005784047534689307, 0.0006735193892382085, 0.0005943235591985285, 0.0005310999695211649, 0.0005747415125370026, 0.0005465587601065636, 0.0005441220127977431, 0.000572565128095448, 0.0005658387090079486, 0.000543916889000684, 0.0006066134665161371, 0.0005406318814493716, 0.0005314886220730841, 0.0005994659150019288, 0.0006384392036125064, 0.0005438518128357828, 0.0005314587033353746, 0.0005327368271537125, 0.0005507496534846723, 0.0005444331909529865, 0.0005573831149376929, 0.0005475808284245431, 0.0005665127537213266, 0.000538929714821279, 0.0005333310691639781, 0.0006332219345495105, 0.0005523902364075184, 0.0006117841694504023, 0.0005708473036065698, 0.000544788024853915, 0.0005630395608022809, 0.0007715284009464085, 0.0005699947942048311, 0.000529628130607307, 0.0006354267825372517, 0.0006279179942794144, 0.0005543507286347449, 0.0005832979804836214, 0.000625535671133548, 0.0007575542549602687, 0.0006043285829946399, 0.0005684111383743584, 0.0005765476962551475, 0.0005040319520048797, 0.0005453632329590619, 0.0026023199316114187, 0.0005102180293761194, 0.000499970221426338, 0.000552377023268491, 0.0005449129384942353, 0.0005364277167245746, 0.000536917767021805, 0.00054663245100528, 0.0006044566980563104, 0.0006672384915873408, 0.0005385861732065678, 0.0006539585301652551, 0.000597258796915412, 0.0005761760985478759, 0.0005526361637748778, 0.000579619430936873, 0.0005084748263470829, 0.0005726503441110253, 0.000540449284017086, 0.0005320078926160932, 0.0005593709647655487, 0.0005303525249473751, 0.0005273135029710829, 0.0005872591282241046, 0.0005946663441136479, 0.0005440947716124356, 0.0006654891767539084, 0.0005257835146039724, 0.000524491595569998, 0.0005288177635520697, 0.0005658392910845578, 0.0007234252407215536, 0.0005678033339791, 0.0005880682147108018, 0.0007528342539444566, 0.0007387854275293648, 0.0005455552600324154, 0.0004946044064126909, 0.001996299484744668 ]

[ "\"Something wrong?\" \"", "To the man who loves art for its own sake, it is frequently in its least important and lowliest manifestations that the keenest pleasure is to be derived.\" \"", "Oh, if you say so, Holmes.\" \"", "It is pleasant to me to observe, Watson, that you have so far grasped this truth that in these little records of our cases which you have been good enough to draw up, and I am bound to say, occasionally embellish,\" \"that you have given prominence not so much to the many cause celebes and sensational trials in which I have figured, but rather to those incidents which have given room for those faculties of deduction and logical synthesis which I have made my special province.\" \"", "Kind of you to say so, Holmes.\" \"", "You have erred, perhaps \" \"you have erred... in attempting to put color and life into each of your statements, instead of confining yourself to placing upon record that severe reasoning from cause to effect which is really the only notable feature about the thing.\" \"", "You are always in a disputatious mood when you choose that pipe.\" \"", "It seems to me that I have done you full justice in the matter.\" \"", "No, no, no, no, no, no, it is not selfishness or even conceit.\" \"", "If I claim full justice for my art, it is because crime is common;\" \"logic is rare.\" \"", "Therefore, it is upon logic rather than upon crime that you should dwell.\" \"", "You have degraded what should have been a course of lectures into a series of tales.\" \"", "Really, Holmes,\" \"I hardly think my poor scribblings deserve that.\" \"", "They have, after all, made your name a household word.\" \"", "Oh, pshaw, my dear fellow, what do the public, the great unobservant public, who can hardly tell a weaver by his tooth or a compositor by his left thumb, care about the finer shades of analysis and deduction?\" \"", "But, indeed, if you are trivial,\" \"I cannot blame you, the days of the great cases are past.\" \"", "Man, or at least criminal man, has lost all enterprise and originality.\" \"", "Oh, surely not.\" \"", "I fear so.\" \"", "As to my little practice, it seems to be degenerating into an agency for recovering lost lead pencils and giving advice to young ladies from boarding schools.\" \"", "My dear, dear friend, how can you say such a thing?\" \"", "I think I have touched bottom, finally.\" \"", "However, this note I had this morning marks my zero-point, I fancy.\" \"", "Well, goodness, who is it from?\" \"", "Read it.\" \"\"", "Dear Mr. Holmes:\" \"I am very anxious to consult you as to whether I should or should not accept a situation which has been offered to me as a governess.\" \"", "I shall call at half-past ten tomorrow if I do not inconvenience you.\" \"", "Yours faithfully, Violet Hunter.\"\" \"", "I must confess to being somewhat puzzled by the contents of your letter, Miss, uh, Hunter, since the matter on which you seek advice is somewhat outside my usual field of expertise.\" \"", "Yes, I am aware of that.\" \"", "But you will excuse my troubling you, I am sure, since I have recently had a very strange experience.\" \"", "Indeed?\" \"", "As I have no parents or relations of any sort from whom I could ask advice,\" \"I thought perhaps you would be kind enough to tell me what I should do.\" \"", "I shall be happy to serve you in any way I can;\" \"pray, proceed.\" \"", "There is a well-known agency for governesses in the West End, called Westaway's, and I have lately been calling there about once a week in order to see whether anything has turned up which might suit me.\" \"", "It is managed by Miss Stoper.\" \"", "She sits alone in her own office, and the ladies who are seeking employment wait in the anteroom, and are then shown in one by one, when she consults her ledgers and sees whether she has anything which might suit them.\" \"", "Miss Green has been on our books for some years and has excellent references.\" \"", "In fact, were it not for the swift return to Kuala Lampur of her present employer, who finds her most satisfactory, she would not be available today for your consideration.\" \"", "Thank you, Miss Green.\" \"", "Oh, that will do.\" \"", "I could not ask for anything better.\" \"", "Oh, capital, capital.\" \"", "Splendid.\" \"", "Please be seated, Miss Hunter.\" \"", "Now, then, you are looking for a situation, miss?\" \"", "Yes, sir.\" \"", "As a governess?\" \"", "Yes, sir.\" \"", "And what salary do you ask?\" \"", "I had four pounds a month in my last place with Colonel Spence Munro.\" \"", "He has given her an excellent reference, Mr. Rucastle.\" \"", "Oh, doubtless, doubtless, but four pounds a month?\" \"", "If that seems too much \" \"Too much?\" \"", "oh, tut, tut, how could anyone offer so pitiful a sum to a lady with such attraction and accomplishments?\" \"", "My accomplishments, sir, may be less than you imagine.\" \"", "A little French, a little German, music, drawing \" \"Oh, tut, tut, that is quite beside the question.\" \"", "The point is, have you or have you not the bearing and deportment of a lady?\" \"", "I mean, that is it in a nutshell.\" \"", "I would hope to have ladylike qualities, sir.\" \"", "If you have not, then you are not fitted for the rearing of a child whose background and qualities point to a brilliant future.\" \"", "And if you have, why, how can any gentleman ask you to condescend to accept anything under three figures?\" \"", "Three figures, sir?\" \"", "Your salary with me, madam, would commence at a hundred pounds a year.\" \"", "I hardly know what to say.\" \"", "It has also been my custom to advance my young ladies a small portion of their salary beforehand, so that they might meet any little expenses of their journey and their wardrobe.\" \"", "Thank you, sir.\" \"", "May I ask where you live?\" \"", "Oh, Hampshire, charming rural place,\" \"The Copper Beeches, five miles on the further side of Winchester.\" \"", "Oh, it is the most lovely country, my dear young lady, and the dearest old country house.\" \"", "And my duties, sir?\" \"", "I should be glad to know what they would be.\" \"", "One child, one dear little romper just six years old.\" \"", "How charming.\" \"", "Oh, Miss Stoper, if you could only see him killing cockroaches with a slipper, three of them gone before you could wink.\" \"", "Very clever.\" \"", "My sole duties, then, are to take charge of a single child?\" \"", "Oh, no, no, no, no, no, no, not sole, my dear young lady.\" \"", "Oh, what else, then?\" \"", "Well, your duty would be, as I am sure your good sense would suggest, to obey any little commands that my wife might give.\" \"", "You said commands?\" \"", "Provided, of course, that they were such commands as any young lady might with propriety obey.\" \"", "You see no difficulty?\" \"", "None, whatsoever.\" \"", "I should be happy to make myself useful.\" \"", "Quite so.\" \"", "In dress, for example, we are faddy people, you know, Miss Hunter, faddy, but kind-hearted.\" \"", "And if you were asked to wear any dress that we might give you, you would not object to our little whims, huh?\" \"", "Why, um, no.\" \"", "Or to sit here, or to sit there, and that would not be offensive to you?\" \"", "No.\" \"", "Or to cut your hair quite short before you come to us?\" \"", "Cut my hair?\" \"", "Quite short.\" \"", "Well, I am afraid that's quite impossible.\" \"", "And I am afraid it is quite essential.\" \"", "It's a little fancy of my wife's, and ladies' fancies, my dear madam, ladies' fancies must be consulted.\" \"", "So you won't cut your hair?\" \"", "No, sir, I'm afraid I could not.\" \"", "Ah, well, it is a pity, because in other respects you might have done very nicely.\" \"", "In that case, Miss Stoper,\" \"I had best inspect some more of your ladies.\" \"", "Miss Hunter, do you desire your name to be kept upon our books?\" \"", "If you please, Miss Stoper.\" \"", "Well, really, it seems rather useless, since you refused the most excellent offer in this fashion, you could hardly expect us to exert ourselves to find another such opening for you.\" \"", "I'm sorry, Miss Stoper, but my hair \" \"Good day, Miss Hunter.\" \"", "Now, why on earth should he want you to cut your hair?\" \"", "I don't know.\" \"", "A very strange fact.\" \"", "As you may observe, Mr. Holmes, my hair is somewhat luxuriant and a rather peculiar tint of chestnut.\" \"", "And most artistic, if I may so observe.\" \"", "It has been considered so.\" \"", "I simply couldn't think of sacrificing it in such an offhand manner.\" \"", "Well, I should think not, indeed.\" \"", "Oh, such was my feeling at the time.\" \"", "The next day I was inclined to think that I had made a mistake, and the day after I was sure of it, when I received a letter from the gentleman himself.\" \"", "I have it here, and I will read it to you.\" \"\"", "Dear Miss Hunter:\" \"Miss Stoper has kindly given me your address, and I write from here to ask whether you have reconsidered your decision.\" \"", "We are willing to give 30 pounds a quarter, or 120 pounds a year, so as to recompense you for any little inconvenience which our fads may cause you.\"\" \"", "And your hair?\" \"", "He is insistent.\" \"\"", "As regards your hair, it is no doubt a pity, especially as I could not help remarking its beauty during our short interview.\" \"", "But I am afraid I must remain firm upon this point, and I only hope that the increased salary may recompense you for the loss.\"\" \"", "Will it?\" \"", "My mind is made up that I will accept the offer.\" \"", "I thought, however, that before taking the final step,\" \"I should like to submit the whole matter for your consideration.\" \"", "My dear Miss Hunter, as your mind is already made up, the matter is settled.\" \"", "But, if at any time you should find yourself in any doubt or danger \" \"Danger?\" \"", "What danger do you foresee?\" \"", "There seems to be a danger, if we could define it.\" \"", "But at any time, day or night, a telegram will bring me down to your help.\" \"", "Then that is enough.\" \"", "I shall write to Mr. Rucastle at once, and go down to Hampshire quite easy in my mind now.\" \"", "Thank you.\" \"", "Well, Holmes?\" \"", "I should allow no sister of mine to accept such a situation.\" \"", "That's my man, Toller, he likes to keep it secure.\" \"", "But you look apprehensive, Miss Hunter.\" \"", "Not at all, Mr. Rucastle.\" \"", "Good, good.\" \"", "You must be Edward,\" \"I have looked forward to meeting you.\" \"", "Master Edward, this is your new governess, Miss Hunter.\" \"", "Oh, I see you have a present for Miss Hunter.\" \"", "Oh, well done, good shot.\" \"", "Copper Beeches, Mr. Rucastle?\" \"", "All dead, Miss Hunter, mostly dead.\" \"", "Here we are, then, come in, come in.\" \"", "Oh, Mrs. Toller, this is Miss Violet Hunter, who is taking up the position of governess to Master Edward.\" \"", "How do you do, Miss Hunter?\" \"", "Your room is all ready for you.\" \"", "Thank you.\" \"", "Come along now, Toller, fetch the trunk.\" \"", "Oh, Miss Hunter, after you are refreshed from your journey,\" \"I'll take you on a tour of The Copper Beeches.\" \"", "The premises is certainly extensive, Mr. Rucastle.\" \"", "Oh, yes, and the extensive premises need protection.\" \"", "Look in here, isn't he a beauty?\" \"", "Don't be frightened, Miss Hunter, it's only Carlo, my mastiff.\" \"", "I call him mine, but in fact,\" \"Toller is the only man that can do anything with him.\" \"", "He lets him loose at night, and God help any trespasser he lays his fangs upon.\" \"", "We feed him once a day, and not too much then, so that he is always keen as mustard.\" \"", "Oh, for goodness sakes, Miss Hunter, under no pretext set foot across this threshold at night;\" \"it's as much as your life is worth.\" \"", "Mrs. Rucastle will be here shortly, and she will tell you herself how delighted she is you are able to accept this situation.\" \"", "Your offer was a most generous one, sir.\" \"", "Though, well, I am still curious about the conditions.\" \"", "My little fads and fancies, you mean?\" \"", "Yes.\" \"", "But they're nothing at all.\" \"", "My wife is very fond of a particular shade of electric blue, and she would like you to wear such a dress indoors in the morning.\" \"", "But I do not have such a dress.\" \"", "Ah, but we have one.\" \"", "As to sitting here or there or amusing yourself in any matter indicated, well, that need cause you no inconvenience, need it?\" \"", "No.\" \"", "How do you do, Miss Hunter?\" \"", "I'm sorry I was not here to greet you, a slight indisposition.\" \"", "I trust you are feeling better now?\" \"", "Much better, thank you.\" \"", "I was just telling Miss Hunter about the blue dress.\" \"", "Yes, I think it would fit you very well.\" \"", "I wonder what desperate circumstances could occasion such an appeal?\" \"", "I have devised seven separate explanations, each of which would cover the facts as far as we know them.\" \"", "Oh, and which one do you favor, Holmes?\" \"", "At the moment, I have no favorites.\" \"", "Data, data, data, I cannot make bricks without clay.\" \"", "Well, it's nice to get away from the fogs of Baker Street now and again.\" \"", "What delightful little farms these are, don't you agree, aren't they fresh and beautiful?\" \"", "You know, Watson, it is one of the curses of having a mind with a turn like mine that I must look at everything with reference to my own special subject.\" \"", "Well, it doesn't make the scenery any less admirable, does it?\" \"", "You look at these scattered houses, and you are impressed by their beauty.\" \"", "I look at them, and the only thought which comes to me is a feeling of their isolation and of the impunity with which crime may be committed there.\" \"", "Good heavens, who would associate crime with these dear old homesteads?\" \"", "They always filled me with a certain horror.\" \"", "It is my belief, Watson, founded upon my experience, that the lowest and vilest alleys in London do not present a more dreadful record of sin than does the smiling and beautiful countryside.\" \"", "Had this young lady who appeals to us for help gone to live in Winchester,\" \"I should never have had a fear for her.\" \"", "It is the five miles of country which makes the danger.\" \"", "What can it mean, Mr. Holmes?\" \"", "We cannot theorize without data, I'm afraid.\" \"", "Please, continue, Miss Hunter.\" \"", "In the first place,\" \"I may say that I have met, on the whole, with no actual ill-treatment from\" \"Mr. and Mrs. Rucastle.\" \"", "But I am not easy in my mind about them, and I cannot understand them.\" \"", "What can't you understand?\" \"", "The reasons for their conduct.\" \"", "For two days after my arrival at the Copper Beeches, my life was very quiet.\" \"", "On the third, I went downstairs after breakfast to find\" \"Mr. and Mrs. Rucastle in the drawing room.\" \"", "Mr. Rucastle informed me that a dress, an electric blue dress, had been laid out for me in my bedroom, and asked me to put it on.\" \"", "I did as he requested.\" \"", "Oh, superb, Miss Hunter, oh, quite superb.\" \"", "Do you not agree?\" \"", "It could not be a better fit, not if you had been measured for it.\" \"", "Please, be so good as to sit down, Miss Hunter.\" \"", "Oh, perfect, I mean, it's quite, quite perfect.\" \"", "Over here, if you don't mind, Miss Hunter.\" \"", "There, there, there now, excellent.\" \"", "Are you quite comfortable?\" \"", "Yes, thank you.\" \"", "How long do you wish me to remain here, sir?\" \"", "Oh, an hour, perhaps, perhaps longer.\" \"", "An hour?\" \"", "Oh, but not, I assure you, an hour of tedium.\" \"", "Let us see how we can best entertain and divert you.\" \"", "Do you enjoy funny stories, Miss Hunter?\" \"", "Why, yes.\" \"", "Well, then, I shall tell you some, and all of them, I assure you, absolutely true.\" \"", "Let me tell you about George.\" \"", "He is the most extraordinary character.\" \"", "Well, it seems, somebody wanted to find his way to Winchester, and George, he really is such an eccentric, you might mistake him for a scarecrow,\" \"I mean, his legs are all astray, his arms always thrust out like this, his head shaved like a turnip, and on his head he wore the most extraordinary hat \" \"Then Mr. Rucastle, walking up and down on the other side of the room, began to tell me a series of the funniest stories\" \"I've ever listened to.\" \"", "You cannot imagine how comical he was.\" \"", "I laughed till I was quite weary.\" \"", "Two days later this same performance was gone through again.\" \"", "This is the peace of God, that passes all understanding.\" \"", "Oh, bless my soul, is that the hour already?\" \"", "Time has passed very quickly, and most amusingly, sir.\" \"", "Well, I'm glad to hear you say so.\" \"", "But now, it is time for you to attend to your duties, so go and change your dress, and then look to little Edward in the nursery.\" \"", "You can easily imagine, Mr. Holmes, how curious I became as to what the meaning of this extraordinary performance could be.\" \"", "Since my face was always turned away from the window,\" \"I became consumed with the desire to see what was going on behind my back.\" \"", "On the very next occasion,\" \"I managed to conceal a small piece of mirror in my hand.\" \"", "Oh, George, I can't tell you \" \"In the midst of my laughter,\" \"I raised my handkerchief to my eyes, and was able with a little management to see all there was behind me.\" \"", "There was nothing, at least that was my first impression.\" \"", "At second glance, however,\" \"I perceived that there was a bearded man leaning against the railings which bordered our field, and was looking up earnestly at the house.\" \"", "I lowered my handkerchief and glanced at Mrs. Rucastle, to find her eyes fixed upon me in a most searching gaze.\" \"", "She said nothing, but I'm convinced she divined I had a mirror in my hand.\" \"", "Jephro, there is an impertinent fellow who stares up at Miss Hunter.\" \"", "Oh, does he indeed?\" \"", "No friend of yours, Miss Hunter?\" \"", "No, I know no one in these parts.\" \"", "Oh, dear me, how very impertinent.\" \"", "Quite intolerable.\" \"", "Kindly turn around, Miss Hunter, and motion him to go away.\" \"", "Surely it would be better if we took no notice.\" \"", "What, and have him loitering here always?\" \"", "No, turn around, Miss Hunter, and wave him away like this.\" \"", "That was a week ago, and from that time I have not sat in the window, nor have I worn the blue dress, nor seen the man with the beard.\" \"", "But something else occurred, an event which caused you to summon me with such urgency?\" \"", "Yes, yes, oh, Mr. Holmes,\" \"I've never been so frightened.\" \"", "Do not distress yourself, Miss Hunter, compose yourself, and then tell us what it was.\" \"", "There is a turret to the house which appears not to be inhabited at all.\" \"", "A door which faces that which leads into the quarters of the Tollers opens into the turret, but it is invariably locked.\" \"", "It was only yesterday that the chance came for me to pass beyond the door.\" \"", "Toller?\" \"", "Yes.\" \"", "So it was you, then.\" \"", "I thought it must be when I saw the door open.\" \"", "I'm so frightened.\" \"", "Oh, my dear young lady, oh, my dear young lady, what has frightened you, my dear young lady?\" \"", "I\" \" I was foolish enough to go up into the shuttered turret.\" \"", "You noticed it was shuttered then?\" \"", "Yes.\" \"", "Photography is one of my hobbies.\" \"", "I have made my dark room up there.\" \"", "What an observant young lady one has come upon.\" \"", "It was so lonely and eerie in this dim light that I was frightened and ran out again.\" \"", "It's so dreadfully still in there.\" \"", "Only that?\" \"", "Why, yes, what do you think, what other reason?\" \"", "Why do you think I keep that door locked?\" \"", "I'm sure I don't know.\" \"", "It is to keep people out who have no business there, do you see?\" \"", "I'm sure if I had known \" \"Well, you know now.\" \"", "And if you ever set foot across that threshold again,\" \"I'll throw you to the mastiff.\" \"", "I was so terrified that I didn't know what to do.\" \"", "Then I thought of you, Mr. Holmes.\" \"", "I had no difficulty in getting leave to come to Winchester this morning, but I must be back by 3:00 o'clock, for Mr. and Mrs. Rucastle are going on a visit and will be away all evening,\" \"so that I must look after the child.\" \"", "Now I've told you all of my adventures, Mr. Holmes.\" \"", "What does it mean, and what should I do?\" \"", "Does the unspeakable child Edward have a friend?\" \"", "Yes, uh, an equally unpleasant child at one of the farm cottages.\" \"", "Splendid.\" \"", "Dr. Watson and I will arrive at the Copper Beeches at 4:30 precisely.\" \"", "But before then, there are one or two things\" \"I should like you to do.\" \"", "I would not ask this of you, Miss Hunter, if I did not think you were quite an exceptional woman.\" \"", "Mrs. Toller?\" \"", "Mrs. Toller, I think Edward has locked himself in the cellar.\" \"", "The cellar?\" \"", "Well, I can't find him anywhere, and it is past his tea time.\" \"", "Well, just the same, I don't see why Master Edward would have locked himself in the cellar.\" \"", "Well, the door was open earlier,\" \"I saw Toller come out with a bottle.\" \"", "Perhaps he went down to look for cockroaches.\" \"", "It's locked.\" \"", "There you are, miss.\" \"", "After you.\" \"", "Our destination.\" \"", "Holmes, can we be quite sure the mastiff isn't loose?\" \"", "We can be sure of nothing until we reach the house.\" \"", "Good God, what was that?\" \"", "Come quickly.\" \"", "To the left, Mr. Holmes.\" \"", "There has been some villainy here.\" \"", "It looks as though someone has gone across the roof.\" \"", "Alice, Alice, Alice, Alice, Alice.\" \"", "Alice?\" \"", "Where is my daughter?\" \"", "That is for me to ask you that.\" \"", "His daughter?\" \"", "Thieves, you spies, thieves and spies.\" \"", "I have caught you, have I?\" \"", "I have you in my power.\" \"", "I'll serve you.\" \"", "What does he mean?\" \"", "He's gone for the dog.\" \"", "Watson.\" \"", "Someone has loosed the dog.\" \"", "It's not been fed for two days.\" \"", "Quick, before it's too late.\" \"", "Still unconscious.\" \"", "I've done what I can for him, he now needs a surgeon as soon as possible.\" \"", "I've dispatched Toller to Mrs. Rucastle to summon such assistance.\" \"", "Oh, miss, it's a pity you didn't let me know what you were planning,\" \"I could have told you your pains were wasted.\" \"", "It's clear Mrs. Toller knows more of this matter than anyone else.\" \"", "Well, yes, sir, I do, and I'm \" \"I'm ready enough to tell you what I know.\" \"", "But if there's police court business over this, you will remember I was Miss Alice's friend.\" \"", "Miss Alice?\" \"", "Mr. Rucastle's daughter by his first marriage.\" \"", "Ah, the mystery of the shuttered turret.\" \"", "Mrs. Toller, please sit down.\" \"", "Now, tell me all you know.\" \"", "Well, she was never happy at home,\" \"Miss Alice wasn't, from the time that her father married again.\" \"", "She - she was slighted like, and had no say in anything.\" \"", "But - but it didn't became bad for her until after she met Mr. Fowler.\" \"", "And pray, who is Mr. Fowler?\" \"", "Well, he was Miss Alice's young man.\" \"", "You - you might have seen him hanging about, out in the road by the field.\" \"", "Yes.\" \"", "And how did Mr. Fowler's involvement bring Miss Alice to her distressing circumstances?\" \"", "Well, as far as I could learn,\" \"Miss Alice had rights of her own under her late mother's will, but she was so quiet and patient, she was, she never said a word about them but just left everything in Mr. Rucastle's hands.\" \"", "Well, he knew he was safe with her, but when there was a chance of a husband coming forward, who would ask for all the law will give him, well, then, her father thought it time to put a stop on it.\" \"", "He wanted her to sign a paper so that whether she married or not, he could use her money.\" \"", "Well, when she wouldn't do it, he kept worrying her, worrying her, till she got brain-fever;\" \"for six weeks she was at death's door.\" \"", "When she got better at last, all worn to a shadow, and with her beautiful hair cut off, he moved her to the turret room, where she was kept prisoner.\" \"", "But that didn't make no change in her young man, and he stuck to her true as a man could be.\" \"", "And then Mr. Rucastle brought Miss Hunter down from London in order to impersonate his daughter and get rid of the young man.\" \"", "Well, that was it, sir.\" \"", "But Mr. Fowler being a - a persevering gentleman, as a good sailor should be, blockaded the house.\" \"", "And having met you succeeded by certain arguments, metallic and otherwise, in convincing you that your interests were the same as his?\" \"", "Mr. Fowler was a very kind-spoken, free-handed, gentleman.\" \"", "And in this way he managed that your husband should not want for drink, the gates unlocked, thus insuring that the mastiff should remain chained, and that a ladder should be ready to assist him in the rescue of Miss Alice?\" \"", "You have it, sir, just as it happened.\" \"", "And thus was solved the mystery of the sinister house called The Copper Beeches.\" \"", "Mr. Rucastle survived, but was always a broken man, kept solely alive through the care of his devoted wife.\" \"", "They still live with their servants, who probably know so much of Rucastle's past that he finds it difficult to part from them.\" \"", "Mr. Fowler and Miss Rucastle were married by special license, and he now holds a government position on the island of Mauritius.\" \"", "Miss Hunter is now head of a private school in Walsall, where I gather she has met with considerable success.\" \"", "There, Holmes, your verdict?\" \"", "An admirable account, Watson.\" \"", "Oh, you don't think I've put too much color and life into it?\" \"", "Oh, my dear friend,\" \"I humbly defer such considerations to your excellent literature.\" \"", "Good.\"" ]

{ "pile_set_name": "OpenSubtitles" }

[ 0.0007587015279568732, 0.0007387149380519986, 0.00132924469653517, 0.0005520980339497328, 0.0012238024501129985, 0.000861374894157052, 0.00286658201366663, 0.0009700175723992288, 0.002538084052503109, 0.0007180366083048284, 0.0006724076229147613, 0.0008983638253994286, 0.01741264946758747, 0.0021631380077451468, 0.0015270683215931058, 0.001468595233745873, 0.0016190791502594948, 0.0008934192010201514, 0.0008585180621594191, 0.0006608006660826504, 0.0006568637327291071, 0.0006390349008142948, 0.0007172179757617414, 0.0009948849910870194, 0.0006525854696519673, 0.0005942065618000925, 0.0014881069073453546, 0.0008903929847292602, 0.0005790641880594194, 0.0006014551618136466, 0.000923059182241559, 0.0007226110901683569, 0.0005962162395007908, 0.0005413752514868975, 0.0005494338693097234, 0.0007232084171846509, 0.0009391896310262382, 0.0005622062599286437, 0.0005833699251525104, 0.0005669062375091016, 0.0007746809278614819, 0.0006074280245229602, 0.0006530442624352872, 0.0006797595997340977, 0.0006400601123459637, 0.000986245577223599, 0.0006540521280840039, 0.002407427178695798, 0.0006540521280840039, 0.000898293568752706, 0.0007109532016329467, 0.0005601568263955414, 0.0009424808085896075, 0.0008033204358071089, 0.10293248295783997, 0.0006257086060941219, 0.0008179866126738489, 0.001875740010291338, 0.0021718183998018503, 0.0005539556150324643, 0.0014618475688621402, 0.000658424396533519, 0.0007471306598745286, 0.001507264794781804, 0.0007601057877764106, 0.0005675872089341283, 0.0005569527274928987, 0.0021457828115671873, 0.0005917641683481634, 0.0008469033055007458, 0.0007315577240660787, 0.0005557010299526155, 0.02458137646317482, 0.0008250911487266421, 0.7479498386383057, 0.0006943751941435039, 0.0010667528258636594, 0.0007141988608054817, 0.0007515741745010018, 0.0009244979009963572, 0.0007013524882495403, 0.000641514197923243, 0.0006851158104836941, 0.0008022834663279355, 0.0005527288885787129, 0.0006793421925976872, 0.04191677272319794, 0.01658148691058159, 0.0007439051987603307, 0.001081765745766461, 0.000844040943775326, 0.30084285140037537, 0.021567942574620247, 0.0007628737366758287, 0.0006510216044262052, 0.0005882061086595058, 0.0006931597017683089, 0.09173920005559921, 0.0007542989333160222, 0.0006211447180248797, 0.0006820490234531462, 0.0010623742127791047, 0.0007085840334184468, 0.0008694982971064746, 0.0011006235145032406, 0.6523407697677612, 0.0007663238793611526, 0.0007208730676211417, 0.0007389099919237196, 0.0005658074514940381, 0.000579951039981097, 0.0008322332869283855, 0.0006510473322123289, 0.0006663688109256327, 0.0005734151927754283, 0.0005706968950107694, 0.0005979779525659978, 0.006292639300227165, 0.010123470798134804, 0.0006746561848558486, 0.0014749799156561494, 0.0006398640107363462, 0.0009940137388184667, 0.0005573430098593235, 0.0005715469014830887, 0.0005907605518586934, 0.0017848042771220207, 0.0010912955040112138, 0.0005775043973699212, 0.0006976407603360713, 0.0016432090196758509, 0.0006178910261951387, 0.000557182589545846, 0.001466672052629292, 0.0012818523682653904, 0.0006743151461705565, 0.001239741570316255, 0.0008679387392476201, 0.0005851098685525358, 0.0005589490756392479, 0.009168249554932117, 0.0006242555100470781, 0.0009295072522945702, 0.0007463457295671105, 0.011873171664774418, 0.0012819647090509534, 0.0009680119110271335, 0.0010924621019512415, 0.0014903182163834572, 0.000557182589545846, 0.002784207696095109, 0.0006037669372744858, 0.0006362105486914515, 0.0006406899774447083, 0.001668643206357956, 0.3938038945198059, 0.0014366069808602333, 0.1277744621038437, 0.0007699988200329244, 0.029074283316731453, 0.0006383324507623911, 0.0005792423035018146, 0.0005531892529688776, 0.19413742423057556, 0.000697482202667743, 0.010796318762004375, 0.0006813168874941766, 0.0010325186885893345, 0.0006446080515161157, 0.0009846218163147569, 0.000844040943775326, 0.0010924621019512415, 0.0006208547274582088, 0.0006012702942825854, 0.0005510082701221108, 0.0006169691914692521, 0.000554923783056438, 0.0006288484437391162, 0.0005405850242823362, 0.001449941541068256, 0.000590371317230165, 0.0008997857803478837, 0.0011073205387219787, 0.0006304964190348983, 0.0006958097801543772, 0.0006503502954728901, 0.0005372128798626363, 0.000666582549456507, 0.0017098668031394482, 0.004547119606286287, 0.0032605722080916166, 0.0009129581740126014, 0.0011276807636022568, 0.0008330905111506581, 0.0006121916230767965, 0.0006626336253248155, 0.0006218128837645054, 0.0006225464167073369, 0.001204343163408339, 0.0006780453841201961, 0.0005693673738278449, 0.0007702843868173659, 0.0007429463439621031, 0.0006733451737090945, 0.0006671450100839138, 0.0007817377336323261, 0.0006458757561631501, 0.0006602602661587298, 0.0006444864557124674, 0.0013718596892431378, 0.0005924766883254051, 0.0006693865288980305, 0.0005505321314558387, 0.0008331993594765663, 0.0006347636808641255, 0.0008089423063211143, 0.0007211664342321455, 0.0005604852922260761, 0.0006874798564240336, 0.0007110642618499696, 0.0005984243471175432, 0.0007087502162903547, 0.0005927995662204921, 0.0010113375028595328, 0.0007368602673523128, 0.0008486699662171304, 0.000587505754083395, 0.0006734725902788341, 0.0007896371535025537, 0.0006027458002790809, 0.0005747015820816159, 0.001171918585896492, 0.0006240987568162382, 0.0019413982518017292, 0.0006845029420219362, 0.0007906944374553859, 0.0007474190788343549, 0.0005808837595395744, 0.0006248003919608891, 0.000788031262345612, 0.0006811210769228637, 0.0008918397943489254, 0.0012530115200206637, 0.0007802600157447159, 0.0008705005166120827, 0.0007703463779762387, 0.005651750601828098, 0.0005690817488357425, 0.0015920253936201334, 0.009203641675412655, 0.0006983005441725254, 0.0006377629470080137, 0.0009512482793070376, 0.0014238232979550958, 0.0006435684626922011, 0.0007270135101862252, 0.0006482129101641476, 0.001184621243737638, 0.000697482202667743, 0.0015692829620093107, 0.0007135980413295329, 0.0008360226056538522, 0.0006394488736987114, 0.027843693271279335, 0.0006419230485334992, 0.000697482202667743, 0.0007718152482993901, 0.0012715933844447136, 0.0014690224779769778, 0.0006884587928652763, 0.0008397895144298673, 0.000790103105828166, 0.0006902680615894496, 0.002256781794130802, 0.0007183387642726302, 0.0011937313247472048, 0.0006187240360304713, 0.502956748008728, 0.0014360578497871757, 0.0007924968376755714, 0.000994975445792079, 0.0007668983889743686, 0.0007688986952416599, 0.011323828250169754, 0.0006300855311565101, 0.0006797595997340977, 0.0005732903373427689, 0.000564685498829931, 0.0006926822825334966, 0.0011061923578381538, 0.0045954445376992226, 0.0008703786297701299, 0.0008401792729273438, 0.0012305253185331821, 0.0009669334976933897, 0.45839428901672363, 0.0009272630559280515, 0.0010843746131286025, 0.15620557963848114, 0.0006343255518004298, 0.10415069013834, 0.000765644945204258, 0.0014180263970047235, 0.0006693153991363943, 0.0008286201627925038, 0.0007973629981279373, 0.0019084529485553503, 0.0007125417469069362, 0.0008126504253596067, 0.0015245904214680195, 0.0006254462641663849, 0.0010156710632145405, 0.45890533924102783, 0.001355243381112814, 0.004896886646747589, 0.0006190806161612272, 0.0007308765780180693, 0.008650227449834347, 0.0008173146052286029, 0.022726846858859062, 0.0006747912266291678, 0.0035796037409454584, 0.0011980810668319464, 0.0006519500748254359, 0.0007107529672794044, 0.03803879767656326, 0.000694326008670032, 0.0005745410453528166, 0.0006101769395172596, 0.0008482880657538772, 0.0009642177610658109, 0.0006861105794087052, 0.0007363162585534155, 0.0009243974345736206, 0.000767487334087491, 0.0008467331645078957, 0.0006233021849766374, 0.0006990206893533468, 0.0006832060171291232, 0.0009986520744860172, 0.0006975506548769772, 0.0006361684645526111, 0.0006999606266617775, 0.0006832538638263941, 0.0008973944932222366, 0.05180881917476654, 0.001645074225962162, 0.0007110260194167495, 0.0016374875558540225, 0.000759399204980582, 0.0014016751665621996, 0.0006018069689162076, 0.0007126211421564221, 0.00955973844975233, 0.000645924941636622, 0.0005839479272253811, 0.0009683527750894427, 0.0008710335241630673, 0.0005599264986813068, 0.0005812971503473818, 0.0011339006014168262, 0.0006712065078318119, 0.0009316723444499075, 0.0006158799515105784, 0.0006325406720861793 ]

[ "Apparently, back in the day, the focus wasn't really on protecting your youngster.", "\n\nOCT 21, 2015\n\nIf you're a parent, you probably can't imagine life without a car seat. ", "For starters, it ensures your child's safety and it's also a great tool for carrying kids to and from the car. ", "But did you know they didn't once didn't even exist — even when cars did? ", "Here's a look back at how today's car seat came to be:\n\nCar seats appeared on the scene in the 1930s as a way to keep kids contained in moving vehicles.", "\n\nMeaning there was essentially no emphasis on safety — just on convenience for the parent. ", "The Bunny Bear Company designed a model that hooks onto the back of a seat — like this vintage one, which you can buy on eBayright now. (", "Just, please, don't place a real kid in it.)", "\n\nvia eBay\n\nCome the 1940s the chairs were boosted up so kids could see out of the windows.", "\n\nSure, a nice feature if little Billy likes to sightsee. ", "But still not very safe.", "\n\nGetty\n\nIn 1962, two different men designed models that took advantage of seat belts.", "\n\nThe '60s marked the beginning taking car seat safety seriously. ", "American Leonard Rivkin (seen above) created a seat that featured a metal frame surrounded by a buckle, while Briton Jean Ames' design was a rear-facing seat with a Y-shaped strap — which is similar to today's models.", "\n\nCourtesy of Jason Rivkin\n\nADVERTISEMENT - CONTINUE READING BELOW\n\nNot to be outdone, the Ford Motor Company's \"Tot-Guard\" hit the market in 1968.", "\n\nWhich was a plastic chair that had a padded area in front of the child's face and acted as a cushion upon impact.", "\n\nCourtesy of the Ford Motor Company\n\nSoon after, General Motors released their Love Seats.", "\n\nThere was a separate design forchildren and infants, both of which also utilized seat belts to keep them in place. ", "Made from polypropylene and padded with urethane foam, they were touted as lightweight and portable.", "\n\nCourtesy of General Motors\n\nBut this 1969 \"Steel Travel Platform\" proves safety was still an issue.", "\n\nThis advertisement in the Fall/Winter issue of a Sears catalogue for a vinyl-covered foam pad that kids could sleep or play on in the back of the car is both surprising and alarming.", "\n\nCourtesy of Sears\n\nIt wasn't until the '70s that regulations started to be implemented.", "\n\nThe very first standard was set in 1971 by the National Highway Traffic Safety Administration, which required all seats be held by safety belts and include a harness to hold the child into the seat — though, no crash testing was required.", "\n\nBy 1985 the first child passenger safety laws were passed.", "\n\nIn 1995 LATCH systems were introduced.", "\n\nThese are lower anchors and top tether anchor points that improve the stability of the seat if the car gets into an accident.", "\n\nCourtesy of Pinterest/Little Lukas\n\nToday, child safety car seats have strict regulations.", "\n\nSafety seats are required in all states and must be tailored to the age and weight of the child, so your child will almost certainly need more than one in their lifetime (get the scoop on all the different types of car seats here). ", "Today, the seats come with expiration dates and safety recalls are taken very seriously." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0020937116350978613, 0.006607394199818373, 0.0027921360451728106, 0.0010342765599489212, 0.0006114518619142473, 0.000666349777020514, 0.0007280004792846739, 0.000791990605648607, 0.0007185030844993889, 0.0029095569625496864, 0.0007487169350497425, 0.0006007630727253854, 0.0007578831864520907, 0.0006743322010152042, 0.0006495533743873239, 0.0036246757954359055, 0.000573023222386837, 0.0008110273629426956, 0.0007218041573651135, 0.0006015122635290027, 0.0006723608239553869, 0.0006159060867503285, 0.0006795179797336459, 0.0006340750260278583, 0.0006041617598384619, 0.0008666739449836314, 0.0007416956359520555, 0.0007179784006439149, 0.0005992196383886039 ]

[ "PROVIDENCE, R.I. (WPRI) – ShapeUp Inc., one of Rhode Island’s most prominent tech startups, has been bought by a division of British entrepreneur Richard Branson’s Virgin Group.", "\n\nProvidence-based ShapeUp, which markets software to help companies encourage employee wellness, was formally acquired Tuesday by Virgin Pulse, a Framingham, Massachusetts-based wellness company, along with another business, Global Corporate Challenge of Melbourne, Australia.", "\n\nThe three-way merger creates what Virgin Pulse says will be the largest well-being company in the world, with more than $100 million in combined annual recurring revenue, 468 employees and 2,200 customers across 185 countries. ", "Financial terms of the deal were not disclosed.", "\n\nShapeUp CEO Dr. Rajiv Kumar, who co-founded the company in 2006 while attending medical school at Brown University, will be staying on as Virgin Pulse’s president and as chief medical officer at its research arm, the Virgin Pulse Institute.", "\n\n“This has been an incredible and very emotional day for me personally,” Kumar told WPRI.com on Tuesday. “", "In many ways this is a dream come true, and the result of a decade of a lot of blood, sweat and tears. ", "So I’m feeling just about ecstatic.”", "\n\n“I am delighted Virgin Pulse, ShapeUp and GCC are now joining forces to create an even stronger platform and service,” Branson said in a statement. “", "This will ensure our customers can promote health and well-being for their people around the world.”", "\n\nThe ShapeUp deal appears to be the highest-profile tech acquisition in Rhode Island since the 2014 sale of Andera, a banking-software startup founded by Charlie Kroll, another Brown graduate. ", "ShapeUp has raised $15 million from venture capital firms in the decade since it was founded.", "\n\nKumar, 32, said the Virgin Pulse deal grew out of conversations over the last few months with officials at Insight Venture Partners, a New York private-equity firm that led a $92 million investment in Virgin Pulse last year and is providing funds for the merger. ", "He described the opportunity as “a no-brainer.”", "\n\n“For us it was really an obvious choice,” he said. “", "It’s the right move because it allows us to continue pursuing our mission, which is to make workplaces more healthy and successful. ", "It gives us a much larger footprint and much larger financial resources.”", "\n\nShapeUp currently has 134 employees, with 92 at its local office in the Jewelry District, nine at its Boston office, and 33 who work remotely. ", "Kumar said he will remain stationed at the Providence office and he expects the company to continue hiring there as it grows.", "\n\n“From my perspective this is an incredible Rhode Island startup success story, and it has all of the ingredients that people talk about as assets for driving economic development locally,” he said.", "\n\nKumar ticked off a number of ways Rhode Island contributed to ShapeUp’s growth, including its roots at Brown, its victories in the Rhode Island and Brown business-plan competitions, a 2008 innovation tax-credit from what was then the R.I. Economic Development Corporation, and the skills of the local work force.", "\n\n“I think ShapeUp is a case study for how Rhode Island can and should incubate successful technology companies,” he said, adding: “We showed it’s possible to create a company that creates a lot of high-paying jobs and can succeed, and I think this is a model that other companies can follow.", "”Ted Nesi (tnesi@wpri.com) covers politics and the economy for WPRI.com. ", "He hosts Executive Suite and writes The Saturday Morning Post. ", "Follow him on Twitter: @tednesi" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006558240856975317, 0.000575691054109484, 0.0006210257415659726, 0.0005944533040747046, 0.0006307903095148504, 0.0006025386974215508, 0.04419180750846863, 0.000671601970680058, 0.0005548513145186007, 0.0006072014220990241, 0.0006194356246851385, 0.0006164563819766045, 0.0005678556044586003, 0.021049143746495247, 0.0006126869120635092, 0.0005482570850290358, 0.0006069046212360263, 0.0006473464309237897, 0.0005328493425622582, 0.0005216305726207793, 0.0005624511395581067, 0.0005995798273943365, 0.0006521455361507833, 0.0006877912092022598, 0.0007455045124515891 ]

[ "Enzyme based electrochemical sensors are widely used in the detection of analytes in clinical, environmental, agricultural and biotechnological applications. ", "Analytes that can be measured in clinical assays of fluids of the human body include, for example, glucose, lactate, cholesterol, bilirubin and amino acids. ", "Levels of these analytes in biological fluids, such as blood, are important for the diagnosis and the monitoring of diseases.", "\nElectrochemical assays are typically performed in cells with two or three electrodes, including at least one measuring or working electrode and one reference electrode. ", "In three electrode systems, the third electrode is a counter-electrode. ", "In two electrode systems, the reference electrode also serves as the counter-electrode. ", "The electrodes are connected through a circuit, such as a potentiostat. ", "The measuring or working electrode is a non-corroding carbon or metal conductor. ", "Upon passage of a current through the working electrode, a redox enzyme is electrooxidized or electroreduced. ", "The enzyme is specific to the analyte to be detected, or to a product of the analyte. ", "The turnover rate of the enzyme is typically related (preferably, but not necessarily, linearly) to the concentration of the analyte itself, or to its product, in the test solution.", "\nThe electrooxidation or electroreduction of the enzyme is often facilitated by the presence of a redox mediator in the solution or on the electrode. ", "The redox mediator assists in the electrical communication between the working electrode and the enzyme. ", "The redox mediator can be dissolved in the fluid to be analyzed, which is in electrolytic contact with the electrodes, or can be applied within a coating on the working electrode in electrolytic contact with the analyzed solution. ", "The coating is preferably not soluble in water, though it may swell in water. ", "Useful devices can be made, for example, by coating an electrode with a film that includes a redox mediator and an enzyme where the enzyme is catalytically specific to the desired analyte, or its product. ", "In contrast to a coated redox mediator, a diffusional redox mediator, which can be soluble or insoluble in water, functions by shuttling electrons between, for example, the enzyme and the electrode. ", "In any case, when the substrate of the enzyme is electrooxidized, the redox mediator transports electrons from the substrate-reduced enzyme to the electrode; when the substrate is electroreduced, the redox mediator transports electrons from the electrode to the substrate-oxidized enzyme.", "\nRecent enzyme based electrochemical sensors have employed a number of different redox mediators such as monomeric ferrocenes, quinoid-compounds including quinines (e.g., benzoquinones), nickel cyclamates, and ruthenium ammines. ", "For the most part, these redox mediators have one or more of the following limitations: the solubility of the redox mediators in the test solutions is low, their chemical, light, thermal, or pH stability is poor, or they do not exchange electrons rapidly enough with the enzyme or the electrode or both. ", "Additionally, the redox potentials of many of these reported redox mediators are so oxidizing that at the potential where the reduced mediator is electrooxidized on the electrode, solution components other than the analyte are also electrooxidized; in other cases they are so reducing that solution components, such as, for example, dissolved oxygen are also rapidly electroreduced. ", "As a result, the sensor utilizing the mediator is not sufficiently specific." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0006140975747257471, 0.0007427972741425037, 0.0009012406808324158, 0.0005766840768046677, 0.0006324640708044171, 0.0005756323807872832, 0.0006542332121171057, 0.000755174143705517, 0.0006022737361490726, 0.00357593665830791, 0.0005900944815948606, 0.0006316400249488652, 0.0005677167791873217, 0.000619296042714268, 0.0005760588683187962, 0.0005603691097348928, 0.0008982970030046999, 0.0007000449695624411, 0.0007283960585482419, 0.0006791531923227012, 0.0006581609486602247, 0.0006511115352623165 ]

[ "f 13297952?", "\n7\nWhat is the thousands digit of 79910?", "\n9\nWhat is the tens digit of 820057?", "\n5\nWhat is the hundred thousands digit of 333773?", "\n3\nWhat is the hundred thousands digit of 2477172?", "\n4\nWhat is the ten thousands digit of 7357365?", "\n5\nWhat is the units digit of 198104?", "\n4\nWhat is the units digit of 131504?", "\n4\nWhat is the tens digit of 10870174?", "\n7\nWhat is the hundreds digit of 2183711?", "\n7\nWhat is the units digit of 131549?", "\n9\nWhat is the units digit of 7509939?", "\n9\nWhat is the thousands digit of 91950?", "\n1\nWhat is the ten thousands digit of 7409664?", "\n0\nWhat is the units digit of 343260?", "\n0\nWhat is the hundreds digit of 31469511?", "\n5\nWhat is the hundred thousands digit of 152304?", "\n1\nWhat is the hundreds digit of 5099404?", "\n4\nWhat is the ten thousands digit of 1928147?", "\n2\nWhat is the tens digit of 5262053?", "\n5\nWhat is the thousands digit of 11298322?", "\n8\nWhat is the tens digit of 148476?", "\n7\nWhat is the tens digit of 948839?", "\n3\nWhat is the hundred thousands digit of 242909?", "\n2\nWhat is the tens digit of 16509892?", "\n9\nWhat is the ten thousands digit of 296844?", "\n9\nWhat is the tens digit of 62822?", "\n2\nWhat is the tens digit of 7941013?", "\n1\nWhat is the units digit of 656840?", "\n0\nWhat is the millions digit of 2113581?", "\n2\nWhat is the thousands digit of 316855?", "\n6\nWhat is the hundreds digit of 223785?", "\n7\nWhat is the hundred thousands digit of 100565?", "\n1\nWhat is the thousands digit of 266600?", "\n6\nWhat is the thousands digit of 1304252?", "\n4\nWhat is the units digit of 10596?", "\n6\nWhat is the hundreds digit of 733164?", "\n1\nWhat is the millions digit of 3963877?", "\n3\nWhat is the tens digit of 2404598?", "\n9\nWhat is the ten thousands digit of 1747868?", "\n4\nWhat is the tens digit of 3521284?", "\n8\nWhat is the ten thousands digit of 454589?", "\n5\nWhat is the ten thousands digit of 215987?", "\n1\nWhat is the hundred thousands digit of 101162?", "\n1\nWhat is the hundreds digit of 3803075?", "\n0\nWhat is the tens digit of 294573?", "\n7\nWhat is the hundreds digit of 17544337?", "\n3\nWhat is the ten thousands digit of 744805?", "\n4\nWhat is the tens digit of 1282690?", "\n9\nWhat is the tens digit of 219042?", "\n4\nWhat is the tens digit of 187821?", "\n2\nWhat is the units digit of 193257?", "\n7\nWhat is the hundred thousands digit of 9324121?", "\n3\nWhat is the tens digit of 1845918?", "\n1\nWhat is the units digit of 758335?", "\n5\nWhat is the hundred thousands digit of 2915060?", "\n9\nWhat is the ten thousands digit of 1784462?", "\n8\nWhat is the ten thousands digit of 6061156?", "\n6\nWhat is the units digit of 3271854?", "\n4\nWhat is the ten thousands digit of 1047263?", "\n4\nWhat is the hundreds digit of 432980?", "\n9\nWhat is the ten thousands digit of 780825?", "\n8\nWhat is the tens digit of 216619?", "\n1\nWhat is the thousands digit of 416627?", "\n6\nWhat is the units digit of 183164?", "\n4\nWhat is the millions digit of 1900960?", "\n1\nWhat is the tens digit of 15997920?", "\n2\nWhat is the hundred thousands digit of 427610?", "\n4\nWhat is the tens digit of 1377225?", "\n2\nWhat is the millions digit of 7842147?", "\n7\nWhat is the hundreds digit of 204493?", "\n4\nWhat is the units digit of 2447516?", "\n6\nWhat is the ten thousands digit of 526168?", "\n2\nWhat is the tens digit of 376540?", "\n4\nWhat is the hundreds digit of 344175?", "\n1\nWhat is the ten millions digit of 15477566?", "\n1\nWhat is the thousands digit of 920810?", "\n0\nWhat is the ten thousands digit of 88306?", "\n8\nWhat is the units digit of 472278?", "\n8\nWhat is the hundred thousands digit of 19568240?", "\n5\nWhat is the thousands digit of 32183101?", "\n3\nWhat is the ten thousands digit of 595190?", "\n9\nWhat is the tens digit of 11291310?", "\n1\nWhat is the hundreds digit of 1820844?", "\n8\nWhat is the millions digit of 7075206?", "\n7\nWhat is the ten millions digit of 10283882?", "\n1\nWhat is the ten millions digit of 23108000?", "\n2\nWhat is the ten thousands digit of 3092840?", "\n9\nWhat is the units digit of 11213150?", "\n0\nWhat is the ten thousands digit of 20794377?", "\n9\nWhat is the tens digit of 2493456?", "\n5\nWhat is the tens digit of 144224?", "\n2\nWhat is the ten thousands digit of 2876631?", "\n7\nWhat is the tens digit of 260406?", "\n0\nWhat is the hundreds digit of 1028653?", "\n6\nWhat is the tens digit of 3911195?", "\n9\nWhat is the millions digit of 8164930?", "\n8\nWhat is the hundred thousands digit of 407692?", "\n4\nWhat is the hundreds digit of 312825?", "\n8\nWhat is the millions digit of 2951490?", "\n2\nWhat is the thousands digit of 8253705?", "\n3\nWhat is the tens digit of 374781?", "\n8\nWhat is the hundred thousands digit of 3328924?", "\n3\nWhat is the units digit of 1831153?", "\n3\nWhat is the hundreds digit of 650093?", "\n0\nWhat is the thousands digit of 18486827?", "\n6\nWhat is the thousands digit of 1056134?", "\n6\nWhat is the hundreds digit of 636566?", "\n5\nWhat is the tens digit of 10365021?", "\n2\nWhat is the units digit of 1609?", "\n9\nWhat is the ten thousands digit of 115787?", "\n1\nWhat is the millions digit of 6374709?", "\n6\nWhat is the tens digit of 1370755?", "\n5\nWhat is the hundred thousands digit of 13126695?", "\n1\nWhat is the hundreds digit of 409397?", "\n3\nWhat is the millions digit of 1032771?", "\n1\nWhat is the hundred thousands digit of 10093031?", "\n0\nWhat is the ten thousands digit of 733430?", "\n3\nWhat is the ten thousands digit of 13097?", "\n1\nWhat is the tens digit of 1988628?", "\n2\nWhat is the tens digit of 1236815?", "\n1\nWhat is the hundreds digit of 1425505?", "\n5\nWhat is the units digit of 2804021?", "\n1\nWhat is the units digit of 301366?", "\n6\nWhat is the hundreds digit of 475382?", "\n3\nWhat is the thousands digit of 1012881?", "\n2\nWhat is the hundreds digit of 8133822?", "\n8\nWhat is the ten thousands digit of 7466428?", "\n6\nWhat is the ten thousands digit of 10288466?", "\n8\nWhat is the hundreds digit of 2091417?", "\n4\nWhat is the hundreds digit of 392643?", "\n6\nWhat is the tens digit of 205147?", "\n4\nWhat is the ten thousands digit of 437816?", "\n3\nWhat is the millions digit of 3091586?", "\n3\nWhat is the hundreds digit of 8333151?", "\n1\nWhat is the tens digit of 116219?", "\n1\nWhat is the ten thousands digit of 75512?", "\n7\nWhat is the tens digit of 5444308?", "\n0\nWhat is the ten millions digit of 13743794?", "\n1\nWhat is the units digit of 224136?", "\n6\nWhat is the tens digit of 568425?", "\n2\nWhat is the thousands digit of 902759?", "\n2\nWhat is the millions digit of 9366722?", "\n9\nWhat is the hundred thousands digit of 12071779?", "\n0\nWhat is the thousands digit of 1308182?", "\n8\nWhat is the hundred thousands digit of 118544?", "\n1\nWhat is the thousands digit of 3213124?", "\n3\nWhat is the hundreds digit of 339149?", "\n1\nWhat is the thousands digit of 543555?", "\n3\nWhat is the millions digit of 5587444?", "\n5\nWhat is the thousands digit of 622610?", "\n2\nWhat is the thousands digit of 203388?", "\n3\nWhat is the ten thousands digit of 278351?", "\n7\nWhat is the hundreds digit of 2909552?", "\n5\nWhat is the units digit of 3088609?", "\n9\nWhat is the thousands digit of 182536?", "\n2\nWhat is the thousands digit of 941140?", "\n1\nWhat is the units digit of 453573?", "\n3\nWhat is the thousands digit of 2617187?", "\n7\nWhat is the ten thousands digit of 1031195?", "\n3\nWhat is the hundreds digit of 86566?", "\n5\nWhat is the hundred thousands digit of 700106?", "\n7\nWhat is the hundreds digit of 7715850?", "\n8\nWhat is the millions digit of 2272281?", "\n2\nWhat is the units digit of 1220782?", "\n2\nWhat is the tens digit of 555275?", "\n7\nWhat is the hundreds digit of 2347670?", "\n6\nWhat is the thousands digit of 914870?", "\n4\nWhat is the tens digit of 288838?", "\n3\nWhat is the ten thousands digit of 1286265?", "\n8\nWhat is the ten thousands digit of 1889099?", "\n8\nWhat is the thousands digit of 36338?", "\n6\nWhat is the ten thousands digit of 830701?", "\n3\nWhat is the thousands digit of 2012030?", "\n2\nWhat is the hundred thousands digit of 4873255?", "\n8\nWhat is the tens digit of 179069?", "\n6\nWhat is the hundreds digit of 232826?", "\n8\nWhat is the tens digit of 2394840?", "\n4\nWhat is the ten thousands digit of 956534?", "\n5\nWhat is the tens digit of 739593?", "\n9\nWhat is the hundreds digit of 443542?", "\n5\nWhat is the hundred thousands digit of 758527?", "\n7\nWhat is the units digit of 9346?", "\n6\nWhat is the thousands digit of 10212115?", "\n2\nWhat is the ten thousands digit of 1110398?", "\n1\nWhat is the thousands digit of 1205844?", "\n5\nWhat is the ten thousands digit of 44075?", "\n4\nWhat is the tens digit of 4454340?", "\n4\nWhat is the tens digit of 19772981?", "\n8\nWhat is the tens digit of 9316865?", "\n6\nWhat is the hundred thousands digit of 1849318?", "\n8\nWhat is the hundred thousands digit of 2821746?", "\n8\nWhat is the tens digit of 941741?", "\n4\nWhat is the ten millions digit of 18594825?", "\n1\nWhat is the thousands digit of 47780?", "\n7\nWhat is the hundreds digit of 16869142?", "\n1\nWhat is the units digit of 2107294?", "\n4\nWhat is the hundred thousands digit of 15993893?", "\n9\nWhat is the t" ]

{ "pile_set_name": "DM Mathematics" }

[ 0.001335514010861516, 0.0007231488125398755, 0.0006692031165584922, 0.0008181413286365569, 0.0007491608266718686, 0.0007828365196473897, 0.0006661668885499239, 0.0006793920765630901, 0.000683601712808013, 0.000688016414642334, 0.000682434590999037, 0.0006837547989562154, 0.0007078554481267929, 0.0007755502592772245, 0.0006588829564861953, 0.0007585786515846848, 0.0007738449494354427, 0.0007414351566694677, 0.0007219152757897973, 0.0006929919472895563, 0.0007302050944417715, 0.0006940847961232066, 0.0006802116404287517, 0.0007921861251816154, 0.0007216415251605213, 0.0007523759850300848, 0.0006848889752291143, 0.0006854002131149173, 0.000683068297803402, 0.0007408115197904408, 0.0006573591381311417, 0.0006724525010213256, 0.0007608500309288502, 0.0006459773285314441, 0.0006707448046654463, 0.0006691202288493514, 0.0006857183761894703, 0.0007644136203452945, 0.0006980616599321365, 0.0007602325640618801, 0.0006791017949581146, 0.0007815854041837156, 0.0007996636559255421, 0.0007278967532329261, 0.0006670925649814308, 0.0006771806511096656, 0.0006896260310895741, 0.0007630519103258848, 0.0006658025668002665, 0.0006924307672306895, 0.0007380679599009454, 0.0006248948047868907, 0.0007397008594125509, 0.0006978608435019851, 0.0006860707071609795, 0.0007059583440423012, 0.0007008096436038613, 0.0007616599323228002, 0.0006404012092389166, 0.0007381115574389696, 0.0006808903417550027, 0.0007443725480698049, 0.0006950896349735558, 0.0006762061966583133, 0.0006830979255028069, 0.000725419376976788, 0.0007500973297283053, 0.0007752488018013537, 0.0006796339876018465, 0.0007259179255925119, 0.0007049717241898179, 0.0006828694604337215, 0.0007558639044873416, 0.0006900020525790751, 0.0006770931649953127, 0.0008141400176100433, 0.0006904516485519707, 0.0007674997323192656, 0.0006991245900280774, 0.0007691701757721603, 0.0006911949021741748, 0.0007638685638085008, 0.0007002097554504871, 0.0006660624640062451, 0.0007656672387383878, 0.0008203419274650514, 0.0008474284550175071, 0.0007588923908770084, 0.0006874802056699991, 0.0008453585323877633, 0.0006846857140772045, 0.0006826941389590502, 0.0006893057143315673, 0.000707075058016926, 0.0007457095198333263, 0.0006791855557821691, 0.0007887279498390853, 0.0007974990294314921, 0.0006835684762336314, 0.0007683508447371423, 0.0007099444046616554, 0.0006851439247839153, 0.0007592327310703695, 0.000642322120256722, 0.00074691855115816, 0.0007247797911986709, 0.0006854896782897413, 0.0006845339667052031, 0.000708357838448137, 0.0006523255142383277, 0.0007769816438667476, 0.0007471854914911091, 0.0006781985284760594, 0.0007771397358737886, 0.0006819781265221536, 0.0007113933679647744, 0.0007542421808466315, 0.0007603876874782145, 0.000744798278901726, 0.0006646268884651363, 0.0006767371669411659, 0.0006875159451738, 0.000678052194416523, 0.0006480072624981403, 0.0006779393879696727, 0.0007074197637848556, 0.0007051985012367368, 0.0007614205242134631, 0.0007712770602665842, 0.0007205402944236994, 0.0006775556830689311, 0.000671417627017945, 0.000765476084779948, 0.0007361759198829532, 0.0007057505426928401, 0.0006793525535613298, 0.00074052216950804, 0.0006995204603299499, 0.0008718888275325298, 0.0006557913147844374, 0.0006742129917256534, 0.0006739900563843548, 0.0007223676657304168, 0.0008277170709334314, 0.0007208242896012962, 0.000754342065192759, 0.0006508615333586931, 0.000680403842125088, 0.0006790829938836396, 0.0007615837967023253, 0.0006833893712610006, 0.0006980486796237528, 0.0007355567649938166, 0.000701824261341244, 0.0007015229784883559, 0.0007174165803007782, 0.000690312182996422, 0.0006661732913926244, 0.0006991269765421748, 0.0007558721699751914, 0.0006948174559511244, 0.0007844626088626683, 0.0007103751413524151, 0.0007538946811109781, 0.0007047500694170594, 0.0006461438606493175, 0.000738541129976511, 0.0006823145668022335, 0.0007017058087512851, 0.0007295706891454756, 0.0008399304351769388, 0.0007239431724883616, 0.0007673999643884599, 0.0006778273382224143, 0.0007824726053513587, 0.0006970578688196838, 0.0006742451223544776, 0.000701428740285337, 0.0007475551101379097, 0.0007250385242514312, 0.0006880596629343927, 0.0007371570100076497, 0.0006605992093682289, 0.000687466817907989, 0.0007429067045450211, 0.0006619651685468853, 0.000730051368009299, 0.0006827524048276246, 0.0006650738650932908, 0.00069948541931808, 0.0007058449555188417, 0.0007209643954411149, 0.0006769083556719124, 0.0007471975986845791, 0.0006912018288858235, 0.0007548676803708076, 0.0006696943892166018, 0.0009090057574212551, 0.0019451550906524062 ]

[ "Q:\n\nComparar data atual com a salva na database e retornar validação\n\nEstou desenvolvendo um programa onde há um período de teste de 15 dias. ", "\nQuando o usuário registra uma conta no aplicativo, o mesmo pega a data da internet e cadastra a data atual e a data do fim do período de teste, que é 15 dias após a data atual, no banco de dados.", "\n\ndata_registro | data_vencimento\n01/06/2017 | 16/06/2017\n\nComo comparo a data fornecida por este código:\npublic static DateTime DataAtual()\n{\n var myHttpWebRequest = (HttpWebRequest)WebRequest.", "Create(\"http://www.microsoft.com\");\n var response = myHttpWebRequest.", "GetResponse();\n string todaysDates = response.", "Headers[\"date\"];\n return DateTime.", "ParseExact(todaysDates,\n \"ddd, dd MMM yyyy HH:mm:ss 'GMT'\",\n CultureInfo.", "InvariantCulture.", "DateTimeFormat,\n DateTimeStyles.", "AssumeUniversal);\n}\n\nO retorno do código acima é feito por este código: DataAtual().ToShortDateString(); que resulta em: 01/06/2017\nCom a do banco de dados, no campo: data_vencimento para validar se o período de teste acabou ou não?", "\n\nA:\n\nÉ só comparar uma data com a outra, igual é feito com inteiros.", "\nDateTime dataAtual = DataAtual();\nDateTime dataLimite = /* Capturar a data do banco */;\n\nif(dataAtual > dataLimite)\n{\n // O tempo de testes expirou\n}\n\nComo o campo no banco é uma string (deveria ser DateTime, né?) ", "você vai precisar convertê-lo para DateTime.", "\nJá que o formato da data será sempre o mesmo, é possível usar o ParseExact\ndataLimite = DateTime.", "ParseExact(dateString, \"dd/MM/yyyy\", CultureInfo.", "InvariantCulture);\n\nA:\n\nConverte o campo dataLimite para o tipo DateTime\n DateTime dt = Convert.", "ToDateTime(dataStringDoBanco); \n\n DateTime dataAtual = DataAtual();\n\n if(dataAtual > dt)\n {\n // O tempo de testes expirou\n }\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.005623735953122377, 0.024006420746445656, 0.0007353061228059232, 0.0007647433085367084, 0.000945748295634985, 0.0006623254739679396, 0.0016638379311189055, 0.0009238409693352878, 0.0007450378034263849, 0.001229386543855071, 0.015779947862029076, 0.0008259470923803747, 0.027449941262602806, 0.00169912981800735, 0.000820529239717871, 0.0008377275080420077, 0.0008603110909461975 ]

[ "Wouldn’t you say it’s true that the micromanagers of the world also tend to be the anxious worry warts?", "\n\nOn a personal note, I experience anxiety often, and I’m definitely an active member of Team Micromanagement. ", "The idea (probably more subconscious than conscious), is that if I can accurately predict what will happen and control all the details, then it will be safe to relax. ", "Like many of us, I carry with me a rather constant sense that something is about to go wrong. ", "Sometimes it’s stronger than other times, and often I can ignore it all together, but when I can’t, the fear becomes a living breathing monster, always just over my shoulder.", "\n\nIn an effort to understand my own anxiety, I look to astrology. ", "Angst is inherent in all of the signs of course, and every planet brings with it the potential for unease poised to arise if a situation warrants it. ", "For the sake of this conversation, however, I want to focus on the Earth signs: Taurus, Virgo, and Capricorn.", "\n\nThe Earth Signs\n\nThe Earth Signs are practical, pragmatic and have a deep appreciation for “reality”. ", "Although they’re all down to earth in different ways, some common threads include caution, single-mindedness and a downright inflexibility that arises when they’re sure that their way is the right way. ", "It’s important to note that everyone is influenced by Earth Signs and their corresponding planets because they all exist in our personal natal chart pointing to places where we hold ourselves to incredibly high standards and believe ourselves to be right (or wrong) without question.", "\n\nIn other words, the Earth Signs show us where we’re prone to being meticulous and demanding and they trigger the kind of anxiety that results from trying to be right and good. ", "When deep expectations lead to shallow outcomes (when we don’t get it right), we start to fret. ", "Our inner critic kicks in with unsolicited advice on everything we messed up.", "\n\nWhat happens when someone yells at us? ", "It creates stress, and our nervous system reacts by dumping floods of chemicals into our body in a potent concoction called anxiety.", "\n\nSaturn-ruled Capricorn demands discipline and can really hold the bar high. ", "You will be rewarded for a job well done, but for a mediocre performance, Capricorn can be rather punitive and punishing. “", "Scapegoat” is an apt Capricorn key-word and if you treat yourself like the person solely responsible for anything wrong in your life, you may have a big Capricorn influence in your chart.", "\n\nVirgo is ruled by Mercury and has a real attachment to “the details” and also happens to be the most die-hard perfectionist in the Zodiac. ", "For Virgo, the entire point of anything is to create meaning, because only when something is meaningful does it become valuable. ", "With high standards like these, even a miniscule mistake makes it feel as if the whole world is ending. “", "Fault-Finding” is a keyword combination for Virgo, and if you can relate to a deep sense of self-criticism, you may have a heavy Virgo influence in your chart.", "\n\nTaurus isn’t so much about getting it right for the world at large, but rather maintaining “inherent rightness”. ", "In other words, Taurus is stubborn and isn’t often open to new perspectives or ideas. ", "Ruled by either Venus or Ceres (depends on which astrologer you ask), Taurus is connected to self-worth and abundance. ", "If we don’t feel abundant, we aren’t worthy. “", "Obstinate” is a Taurus keyword and if you find yourself refusing to acknowledge what you do have and in turn being overly possessive of what you think you should have, you might find a lot of Taurus influence in your chart.", "\n\nOne of the biggest reasons I equate Earth Signs with anxiety is that “reality” brings with it a sense of right or wrong that simply can’t be tampered with or manipulated easily. ", "It is in those places that we’re up against the cold hard facts, the bottom line (even if that bottom line exists only within our own minds). ", "Mistakes appear obvious for all to see, and that brings shame and a sense of foreboding about future blunders.", "\n\nHow to Manage as an Earth Sign\n\nSo, what can we do to manage the tension? ", "Ironically, reality checking our sense of reality is really helpful. ", "Is this real and is this true? ", "are great questions to ask yourself. ", "Usually, our downward spiral into anxiety comes as a result of information from our inner critic that isn’t the least bit relevant or accurate. ", "Another way to alleviate uncertainty and unease is to feed the signs what they need. ", "Every sign has a creative side and a destructive side and when we fall into the black hole of grasping, self-righteousness, and rigidity, we’re engaging with the destructive side of the Earth Signs.", "\n\nTo activate the creative side of Capricorn, you’ll want to get very meticulous about the tasks need to be completed, make a list that you can check off, this will establish clarity. ", "Break undertakings into small pieces, each with a clear beginning and ending. ", "It’s important to know when you’ve completed a job so you can get the reward.", "\n\nVirgo loves to be helpful and give advice, so create places in your life where you can be the expert. ", "It’s also imperative that you allow other people to appreciate the work you do. ", "Ask for positive feedback and reflection, even if it seems presumptuous. ", "Remind yourself that you’re a critical thinker who is perfectly capable of being discriminating without being pedantic. ", "Take a deep breath and let the freedom of that realization wash through you.", "\n\nTo please the creative side of Taurus, get into your body and become aware of what you feel physically. ", "Be very aware of the kinds of foods that you need, and of your own physical comfort. ", "Get outside and notice the smells, the feels and the colors. ", "Taurus relaxes when the world becomes bigger than the narrowed mind.", "\n\nReality checking looks different from all three perspectives but the goal is to come back down to earth (there’s that idiom again, but you get the point). ", "Remember that anyone can benefit from these techniques, you don’t need an earth Sun sign in order to utilize this information or relate to it. ", "Looking at your anxiety through the lens of the Earth Signs simply brings fresh wisdom and a new perspective along with a few tools that might just guide you into supportive ways to work with the kind of anxiety that results from trying to be right and good.", "\n\nPersonal Information\n\nMahatma Gandhi says\n\nFirst they ignore you, then they laugh at you, then they fight you, then you win.", "\n\nSubscribe\n\nConnect\n\nAbout us\n\nSivana East is a platform created to bring together a unique community, based on mindfulness and spirituality. ", "It's for anyone that wants to enhance their life with health, happiness, wisdom, and yoga. ", "The heart of this community is YOU and hundreds of thousands of people that make this a vibrant place of learning, living, and inspiration." ]

{ "pile_set_name": "Pile-CC" }

[ 0.004966864362359047, 0.0005195456906221807, 0.0005978531553409994, 0.0009103618212975562, 0.0018425006419420242, 0.0005963245639577508, 0.0011139982379972935, 0.0007583010592497885, 0.0006919453153386712, 0.0006486958591267467, 0.0005319082993082702, 0.000654867326375097, 0.0025284846778959036, 0.0015174327418208122, 0.0061273882165551186, 0.000784484320320189, 0.0013214099453762174, 0.014036359265446663, 0.0035812300629913807, 0.002046353882178664, 0.0008077737293206155, 0.0008346665999852121, 0.0006424313760362566, 0.0006880763685330749, 0.0024779201485216618, 0.0006858487613499165, 0.003686519805341959, 0.002835278632119298, 0.0010239400435239077, 0.0007650407496839762, 0.012708389200270176, 0.0006499942974187434, 0.0006734728813171387, 0.000908903602976352, 0.0008481501718051732, 0.0008609010837972164, 0.0006128337699919939, 0.013712352141737938, 0.000763041025493294, 0.0007444098009727895, 0.0007256177486851811, 0.0012145743239670992, 0.00052829080959782, 0.0005543726147152483, 0.3189985156059265, 0.001270683598704636, 0.01520385593175888, 0.000852199096698314, 0.002241170033812523, 0.0017863347893580794, 0.0007157843792811036, 0.0005843944381922483, 0.0004974610055796802, 0.025249935686588287, 0.0005664989585056901, 0.0008076121448539197, 0.0005732832360081375 ]

[ "Double Helix enlarges team to cope with high demand\n\nUK — Double Helix has announced a series of appointments and promtions in a bid to keep up with “ongoing demand for high quality strategic market insight”.", "\n\nThe company has strengthened its London strategic market research team to include Ipsos Healthcare’s Rebecca Walker (pictured) who joins as an associate director and Sofia Lombera and Catherine Davis who both join the firm as senior research executives. ", "Katerina Kelesidi also joins as research executive.", "\n\nMeanwhile, Rebecca Da Cunha is promoted to director and Shaz Iqbal to associate director, while Gavin Harper is promoted to senior research executive in the same unit." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006057041464373469, 0.0006004528258927166, 0.0006313343183137476, 0.000626172695774585 ]

[ "Carl Lewis recently found an old but still interesting piece by Dennis Forbes about the tradeoffs of code reuse. ", "Lewis elaborated a bit on one of the more controversial concepts from Forbes' blog entry: that contrary to conventional wisdom of code as an asset, code has very little value outside the immediate context of the organization that created the code in question. ", "Forbes goes on to assert that if the code asset has not been explicitly engineered for generality, code reuse even within the same organization is also problematic when reuse is attempted across projects.", "\n\nForbes attacks the tendency of many in-house dev teams to spend a lot of time building in-house frameworks and libraries intended for reuse across projects:\n\n\n\nThe greater the bulk of code you accumulate, the more intrinsically you tie yourself to your current developers (and the more they occupy their brain with information that is only applicable in one organization or team), and the more difficult it will be to bring new developers online. ", "Such frameworks and libraries often come with enormous learning curves for new hires - especially as documentation is virtually always ignored - and they can seldom be reused for anything else without significant refactoring (because they likely weren't truly designed for reuse, or they were in only the most arbitrary and superficial of ways…\n\n\n\n… The question every organization needs to ask itself, then, is what value they could sell their \"reusable code\" for - what, realistically, would competitors and new entrants in the field offer for it? ", "The answer, in almost every case, is $0, and they wouldn't want it even at that price. ", "There is extraordinarily little code theft in this industry (even though we're in the era of burnable DVDs and USB keys) because most code - above and beyond the industry-wide frameworks and libraries - has no value at all outside of a specific project with a specific group of developers. ", "Trying to use it for other projects is often worse than starting with nothing at all.", "\n\nForbes concludes that because properly abstracted and generalized frameworks are more expensive to design and develop than one-off solutions, and since the time and cost for a developer to absorb the complexity of a new framework is rarely taken into account when doing a code reuse cost benefit analysis, it makes sense to reuse code a lot less often than one would think. ", "It is notable that Forbes is not against reusing code and frameworks altogether; he is much more positive about reusing code in industry standard libraries for instance. ", "In fact, Forbes advocates the adoption of broad industry-standard frameworks (such as open source) that by necessity have the proper abstraction and encapsulation boundaries built in as an alternative to complex internally developed frameworks.", "\n\nIn Carl Lewis' post on the subject he highlights Forbes' $0 value assessment of most codebases. ", "Lewis shares just one example of when he has encountered an organization that has an inflated sense of the value of their code, calling them “jealously protective” of that code. ", "Predicatively, when Lewis flew thousands of miles to be onsite so that the code wouldn't have to leave the premises, Lewis found that the actual codebase being jealously protected was pretty bad. ", "Due to examples like this Lewis believes that \"in many cases, the risk of [code theft] happening is much less than is generally thought,\" and so companies shouldn't be afraid to share their code in cases where it may make sense.", "\n\n\n\nAnd so Lewis and Forbes present an interesting reality check for us with regard to the value of our code assets, because as Lewis says:\n\nIt seems very counterintuitive that something that is so difficult and expensive to create can have so little value. ", "I guess that's why so many organizations like to pretend that their code is much more valuable than it really is." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0005868644220754504, 0.0005876090726815164, 0.0006037395796738565, 0.0009288383298553526, 0.0006018863641656935, 0.0010835521388798952, 0.0007628123858012259, 0.0010302274022251368, 0.0006229749415069818, 0.0006035157712176442, 0.0006309309974312782, 0.0005819546640850604, 0.000639572273939848, 0.0009095221175812185, 0.0005915882647968829, 0.0005905767320655286, 0.0006657381891272962 ]

[ "Ana Luca FregaA music educator, was the principal of the School of Performing Arts at the Teatro Coln of Buenos Aires, a position from which she retired in 1990. ", "http://www.musicaclasicaargentina.com/frega/index.htm -\n| Travel Details & Reviews\n\nInto the Depths of the AmazonInformation about Amazon Rain Forest, prepared by ThinkQuest, a non profit organization which offers programs designed to advance education through the use of technology. ", "http://library.thinkquest.org/21395/ -\n| Travel Details & Reviews" ]

{ "pile_set_name": "Pile-CC" }

[ 0.000671965884976089, 0.0005639066803269088, 0.0006026719347573817 ]

[ "Arizona Coyotes are the last to awaken in a 5-2 decision for the Boston Bruins\n\n*SUBHEADING: SOMEONE TEACH MARTIN ERAT AND LAURI KORPIKOSKI TO SHOOT THE PUCK*\n\nIn yet another deceptive final score, the Arizona Coyotes shirked all the wrong responsibilities in this 5-2 drop at home to the Boston Bruins.", "\n\nA mess of turnovers on both sides — combined with some lucky goaltending for the visiting team and a gun-shy offense for the game hosts — took a final redemption game for two franchises and turned one of them completely on their heads. ", "It seems that the Arizona Coyotes needed more than just a practice and an optional skate to find their sea legs without Rob Klinkhammer and David Schlemko; with yet another loss in regulation, the Coyotes fell farther out of playoff contention.", "\n\nWith this win, the Coyotes are now 0-5 in their most recent contests against the Atlantic Division franchise, falling to a combined overall score of 16-6. ", "With this loss, they extended to a franchise-record seven game losing streak; with their win, the Bruins managed to salvage the final game of a four-contest road trip through the Pacific Division.", "\n\n*Note: Devan Dubnyk got yanked for the first time this season, dropping the ball on the first half of the game and being bailed out by Mike Smith at the end. ", "Apparently, Arizona just has two really bad goaltenders.", "\n\nFirst Period: Asleep at the Wheel\n\nTo call the first period anything resembling an NHL hockey game would be an insult to the other 22 teams that took the ice tonight.", "\n\nArizona set the tone for the entire night in the face-off circle from the start of the game on, but Boston’s Brad Marchand managed to capitalize on an early turnover by Oliver Ekman-Larsson to fire the first goal of the night just :58 seconds into the game.", "\n\nThe early scoring wouldn’t stop there, as the Bruins took a 2-0 lead exactly five minutes later on a shot by defenseman Kevan Miller. ", "The Coyotes still looked as though they were surprised the game had started; not good when the Boston Bruins all wore matching looks of crazed desperation for the entire sixty minutes.", "\n\nA final goal in the first period by center Joe Vitale at the 13:11 marker earned the Coyotes a one-goal deficit, but the damage had been done; the team would fail to recover from those first two goals before the end of the night.", "\n\nSecond Period: Season of Giving\n\nNeither team deserves credit for a single part of the second period.", "\n\nBoston pulled ahead with three unanswered goals by the grace of the hockey gods, giving Simon Gagne his third goal of the season, Loui Eriksson his fourth, and Brad Marchand his eighth. ", "With these three goals (one coming on the man-advantage for Boston, taking advantage of a tripping penalty against Martin Hanzal), Marchand and his linemate Reilly Smith improved to a monstrous eight points in two games, scoring two goals apiece and assisting on two per as well.", "\n\nThe Coyotes had no excuse to drop another three goals against, though — the home team made inexcusable mistakes that negated the parts of the game they were dominating in and practically handed Boston their final three markers. ", "For a team that absolutely smothered the opposition in the faceoff circle, came off the rush faster by a mile, and blocked an insane number of shots, Arizona managed to collapse through a refusal to take quick shots on goal and poor marksmanship in their own zone. ", "For every turnover the Coyotes forced (which was a considerable number, Boston looked like a mess for the meat of the game), they failed to put enough pressure on Tuukka Rask and wasted yet another opportunity.", "\n\nIt took until about midway through the second period for both teams to start waking up; as Boston woke up faster, they took a sizeable lead.", "\n\nThird Period: Boston [Finishes] Strong\n\nThere’s a reason the Boston Bruins are still regarded so highly across the league.", "\n\nWhile there’s no argument that the Arizona Coyotes are capable of playing good hockey, they have yet to prove they’re capable of consistent hockey — and that was the deciding factor in Saturday night’s matchup.", "\n\nBy the final twenty minutes, Arizona was keeping up with Boston easily; in almost any other game, the Coyotes could probably have forced a comeback. ", "The Bruins finished as strongly as the Calgary Flames did earlier last week, though — and despite a renewed vigor brought upon by Mikkel Boedker‘s ninth goal of the season, the Coyotes were unable to get more than two goals on the game. ", "At the final buzzer, the Coyotes had dropped yet another decision heading into December.", "\n\nTweet of the night:\n\nArizona’s First Star: Michael Stone (1A, 2SOG, 1 HIT, 3 BK)\n\nOnce again, the Arizona Coyotes defensive corps was led without question by Michael Stone — with no penalty minutes (but one solid hit and three blocked shots to add to the 76 he already has on the season) and two unblocked shots on goal, Stone personified the two-way play that Keith Yandle and Oliver Ekman-Larsson are supposed to. ", "The team may consider making bigger roster changes, but it’s almost guaranteed that Michael Stone isn’t going anywhere.", "\n\nArizona’s Worst Star: Every Other Defenseman On The Ice.", "\n\nThe game literally started with a turnover by Ekman-Larsson, and the play for the five other Coyotes blue liners didn’t improve from there. ", "Chris Summers and Connor Murphy did no damage, but certainly weren’t game-changers… and both OEL and Zbynek Michalek were inexcusably off. ", "I would post a screen cap of where Michalek and Ekman-Larsson were for Loui Eriksson’s goal, but it hurts too much.", "\n\nI’m just kidding, this has to be documented. ", "Look:\n\nThis is actually what happened.", "\n\nI blurred everything else, just so you get the full impact of where Loui Eriksson was — and, more importantly, where the two defensemen were.", "\n\nUnacceptable." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0035590813495218754, 0.00170027872081846, 0.0006920924060977995, 0.0007814390701241791, 0.0011764168739318848, 0.0008279572357423604, 0.002067206660285592, 0.007282465696334839, 0.0009020013967528939, 0.0009701211820356548, 0.0007109826547093689, 0.001066907774657011, 0.0008833576575852931, 0.0012659583007916808, 0.0008114238735288382, 0.00222224579192698, 0.008242693729698658, 0.002839756663888693, 0.0007150517776608467, 0.0005980660207569599, 0.0007315824623219669, 0.0008587332558818161, 0.000840241729747504, 0.0006915988633409142, 0.0006685362895950675, 0.0006368873873725533, 0.12618371844291687, 0.0006005899049341679, 0.00406587403267622, 0.0013111938023939729, 0.000635992968454957, 0.0007529720314778388, 0.0007946668192744255, 0.0011099496623501182 ]

[ "11-604-cr\nUnited States v. Jiang\n\n UNITED STATES COURT OF APPEALS\n FOR THE SECOND CIRCUIT\n\n SUMMARY ORDER\nRulings by summary order do not have precedential effect. ", "Citation to summary orders filed on or after\nJanuary 1, 2007, is permitted and is governed by Federal Rule of Appellate Procedure 32.1 and this court’s\nLocal Rule 32.1.1. ", "When citing a summary order in a document filed with this court, a party must cite either\nthe Federal Appendix or an electronic database (with the notation “summary order”). ", "A party citing a\nsummary order must serve a copy of it on any party not represented by counsel.", "\n\n At a stated term of the United States Court of Appeals for the Second Circuit, held at the\nDaniel Patrick Moynihan United States Courthouse, 500 Pearl Street, in the City of New York, on\nthe 18th day of June, two thousand twelve.", "\n\nPRESENT:\n GUIDO CALABRESI,\n JOSÉ A. CABRANES,\n RAYMOND J. LOHIER, JR.,", "\n Circuit Judges.", "\n\n- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -- - - - -- - - - -x\nUNITED STATES OF AMERICA,\n Appellee,\n\n -v.- No. ", "11-604-cr\n\nJUJU JIANG,\n Defendant-Appellant.", "\n- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -- - - - -- - - - -x\n\nFOR APPELLEE: JOHN P. NOWAK, Assistant United States\n Attorney (Susan Corkery, Assistant United\n States Attorney, of counsel), for Loretta E.\n Lynch, United States Attorney for the Eastern\n District of New York, Brooklyn, NY.", "\n\nFOR DEFENDANT-APPELLANT: FRANK H. LANGROCK (Peter F. Langrock, on\n the brief), Langrock Sperry & Wool, LLP,\n Middlebury, VT.", "\n\n\n Appeal from a judgment of conviction of the United States District Court for the Eastern\nDistrict of New York (Nicholas G. Garaufis, Judge) entered December 10, 2010.", "\n\n\n 1\n\f UPON DUE CONSIDERATION, IT IS HEREBY ORDERED, ADJUDGED,\nAND DECREED that the judgment of the District Court is AFFIRMED.", "\n\n Defendant-appellant Juju Jiang appeals a judgment of conviction entered on December 10,\n2010, following his guilty plea, of one count of mail fraud in violation of 18 U.S.C. § 1341.", "\n\n We assume the parties’ familiarity with the factual history and proceedings below. ", "Briefly,\nthe District Court sentenced Jiang to 41 months’ imprisonment, ordered that Jiang’s sentence should\nrun concurrent with a sentence imposed on Jiang in Queens County Criminal Court, and determined\nthat Jiang’s sentence should not be adjusted to account for the period of incarceration that Jiang had\nalready served in connection with the sentence in Queens County Criminal Court. ", "On appeal, Jiang\nargues that the District Court abused its discretion by failing to adjust his sentence pursuant to\nU.S.S.G. § 5G1.3(b)(1) for undischarged time on a related state sentence.", "\n\n We review de novo a district court’s legal determination of whether Section 5G1.3 is\napplicable, United States v. Brennan, 395 F.3d 59, 66 (2d Cir. ", "2005), and its findings of fact in support\nof that determination for clear error, see United States v. Velasquez, 136 F.3d 921, 923 (2d Cir. ", "1998).", "\nWe will not disturb a district court’s sentencing decision under § 5G1.3 absent an “abuse of\ndiscretion.” ", "See Brennan, 395 F.3d at 66; see also Sims v. Blot, 534 F.3d 117, 132 (2d Cir. ", "2008)\n(explaining the term of art “abuse of discretion”).", "\n\n Following this review, we conclude that the District Court did not “abuse its discretion” in\nsentencing Jiang to 41 months’ imprisonment. ", "Section 5G1.3(b) applies only if “a term of\nimprisonment resulted from another offense that is relevant conduct to the instant offense of\nconviction . . . ", "and that was the basis for an increase in the offense level for the instant offense.”", "\nU.S.S.G. § 5G1.3(b). ", "Jiang’s Queens conviction did not form the basis for the increase in his\nGuidelines offense level for the instant offense that is the subject of this appeal and, as a result,\nU.S.S.G. § 5G1.3(b) did not apply. ", "The District Court was free to exercise its discretion under\nU.S.S.G. § 5G1.3(c) in fashioning a partially concurrent sentence.", "\n\n Moreover, even if Jiang’s Queens conviction were considered an undischarged sentence\nunder § 5G1.3(b), the District Court was justified in exercising its discretion not to adjust Jiang’s\nsentence to account for the time Jiang had already served in connection with the Queens conviction.", "\nSee United States v. Cavera, 550 F.3d 180, 189 (2d Cir. ", "2008).", "\n\n\n\n\n 2\n\f CONCLUSION\n We have considered all of Jiang’s arguments on appeal and find them to be without merit.", "\nFor the reasons stated above, the judgment of the District Court is AFFIRMED.", "\n\n\n\n\n FOR THE COURT:\n Catherine O’Hagan Wolfe, Clerk\n\n\n\n\n 3\n\f" ]

{ "pile_set_name": "FreeLaw" }

[ 0.0007056368631310761, 0.0006000440334901214, 0.0005428039003163576, 0.0005614642868749797, 0.0006691977032460272, 0.0007026540697552264, 0.000743523589335382, 0.0012992869596928358, 0.0006940312450751662, 0.0008504744037054479, 0.0006173086003400385, 0.0006440835422836244, 0.0006005218019708991, 0.0008034352213144302, 0.0005225684144534171, 0.0009692516759969294, 0.0007368191727437079, 0.0007169494056142867, 0.0006556403823196888, 0.0007751542725600302, 0.000758747395593673, 0.0006755652721039951, 0.0007050426793284714, 0.0006720712990500033, 0.0009252182790078223, 0.0007237858371809125, 0.0008518804097548127, 0.0008369834977202117, 0.0008289079996757209, 0.0007962078088894486, 0.0006870410870760679, 0.000766111770644784, 0.000610241258982569, 0.000580484454985708, 0.0005884991260245442 ]

[ "Miso glazed eggplant {soy-free, gluten-free, wheat-free}\n\nVegetarian or not, miso glazed eggplant is my go-to at Japanese restaurants. ", "But – like most things – my body doesn’t love it as much as I would like it to. ", "It always leaves me feeling sluggish and unwell.", "\n\nIf you have the same problem, read on, because I have the solution. ", "I’ve been finessing this recipe for a while. ", "I’ve had it for lunch, eaten it as leftovers and served it up to guests at a dinner party, and it went down a treat every time. ", "It is the only way to eat eggplant.", "\n\nThis baked miso eggplant is best enjoyed with a quick pickle of cucumber and red onion, and some steamed basmati rice. ", "That’s all you need. ", "Let the eggplant shine." ]

{ "pile_set_name": "Pile-CC" }

[ 0.006383634638041258, 0.007603145204484463, 0.001006278325803578, 0.0008973294752649963, 0.0006124734063632786, 0.0006113694398663938, 0.01557953655719757, 0.001612176769413054, 0.0017418565694242716, 0.001780231948941946 ]

[ "Steps in Giving Up My Unhappy Story About You\n1. ", "Return to the Present – There are no problems in this moment. ", "It’s only the regrets\n\nof the past and the angst about the future that is capable of generating misery. ", "The ego abducts us into the land of time; the realm of unconsciousness, by occupying us with thoughts of past and future. ", "Neither of these places exist – except in the mind. ", "Core beliefs live in the mind as well – they are deceivers that can not survive in the NOW.", "\n\n2. ", "Use Your Negative Reactions as Messengers – Focus your attention on the places you get hooked in your current life situation and use the negative emotions that arise, to connect you to the unresolved wounds from childhood. ", "Remember, whenever you have a negative reaction, it is always about the unresolved emotional charge that you are carrying from your past. ", "See the triggering person or situation as a messenger who is reflecting an old pattern or core belief within you. ", "Your negative reaction tells you that there is personal unresolved emotion that you are being given the chance to make conscious for release. ", "This is the ultimate route to freedom.", "\n\n3. ", "Conscious Observation – The famous Sufi, Rumi, said, “Don’t go back to sleep!” ", "Staying conscious is the first and most important tool for liberation from our core belief stories. ", "It is not how long we stay conscious, but how often we ‘come-to’ about our stories that matters. ", "Every time we wake up in the middle of an old pattern, without judging ourselves for being there, we have won another round. ", "That’s all that we need to do… see it! ", "As Jung said, “Anything we can make conscious, we can transform.” ", "It is the key to freedom. ", "It is not our job to awaken our loved ones, however. ", "That is their task.", "\n\n4. ", "Shifting My Perception – Changing the way you see something can make all the difference. ", "It won’t change the event but it can affect how you view the event and what it means to you, which changes everything. ", "For example, rather than considering yourself “unimportant” because your parents didn’t have a lot of time to spend with you, you can simply shift the way you are seeing the situation. ", "This completely alters the way you feel about both the situation and yourself.", "\n\n5. ", "Physical Alignment/Daily Practice – Letting go of resistance to what is, as Eckhart Tollé suggests, is the key to peace. ", "Your core belief story can only exist as long as you believe it or resist it with negative reactions! ", "when you fight for or against it, it fights back. ", "When you stop persisting or resisting it, the story has no choice but to fall away. ", "Then the authentic self is revealed. ", "Acceptance comes with surrender. ", "Letting go of resistance includes accepting others in this moment, just as they are. ", "Do it, and watch how full of love and abundance life becomes.", "\n\n6. ", "Practice Gratitude – Appreciation follows on the heels of acceptance. ", "When we accept what is, we automatically raise our level of gratitude. ", "We learn to see what a powerful antidote to fear and all forms of negativity gratitude is. ", "Our limiting core story is abolished when heartfelt appreciation is felt and expressed. ", "In A Course in Miracles, it is said that love and fear can not abide in the same space. ", "Core Beliefs are anchored in fear whereas gratitude is born of love and serves as the great antidote to all negativity. ", "Because whatever we focus on expands, insisting on a grateful state of mind, allows us to bring more abundance and goodness into our personal relationships.", "\n\n7. ", "Forgiveness – By definition, forgiveness means to “let go” (for-go) of our unhappy story about the other. ", "We do this more for ourselves, than for those who have been hurtful to us. ", "Ask yourself who you are helping (or hurting) by refusing to forgive. ", "It also helps to remember that what we judge in others as unforgivable is, inevitably, mirroring something inside of us that is asking to be forgiven. ", "Self forgiveness is the ultimate goal.", "\n\nI went down into the darkness for two whole days recently. ", "It was a VERY dark time emotionally … I felt angry and hopelessly exhausted with no end in sight. ", "I had spiraled into old familiar territory, into the “I’m never going to realize the rewards of my hard efforts” story that has been with me a very long time. ", "It had been years since I went that low … although now as I think about it, I can remember how, in my previous life, I’d lived mostly in that same abysmal story. ", "Actually, I never knew there was a choice!", "\n\nThat I could CHOOSE a more positive way of seeing my life other than as the hopeless, “never-gonna-mount-to- nuthin,” perspective? ", "Impossible!", "\n\nI never thought to question this assessment of myself; I blindly accepted it as being the truth about who I am. ", "And in that way, this trip to hell was different from the onset … because this time I DID know I had a choice. ", "I chose with consciousness. ", "And I chose NOT to use the “good” tools I know, and that I teach, to lighten the inner darkness. ", "I don’t know why exactly. ", "But in retrospect I can see the tremendous value in having made that choice.", "\n\nI consciously CHOSE to sit in the depths of my inner darkness where I ranted and railed against Reality. ", "I gathered evidence against those I blamed for my pain, including the Universe and God. ", "I felt sorry for myself, I cried and whimpered like a scared child, And my mental rant was externalized in my interactions with those closest to me when I pushed them away, and accused them (my poor spouse 🙁 ) of not caring. ", "I knew where I was. ", "I knew that I was playing the Helpless Baby Victim who nobody cared enough about to rescue. ", "I was on the Victim Triangle in full force.", "\n\nI got to watch the whole thing from front row, ringside, with the inner witnessing eye of my Observer, who in spite of the drama going on, stood still, unruffled, and simply watched, with awe and stunned amazement, mostly. ", "I watched myself REFUSE to use the tools I know so well and have perfected through assiduous practice. ", "I couldn’t MAKE myself do the Work. ", "I had no energy for THAT! ", "I used all my energy in resistance instead.", "\n\nI finally fell into bed the second night, still angry, and pleaded for rescue … demanded it really. ", "And then I awoke suddenly, in the wee hours, from a dream. ", "I had been “conversing” with the “Powers-that-Be” in my dream … and had been handed a “note” written in the air, (as in, “the writing is on the wall … ;)) When I received the words I could read them clearly … but within moments of awakening, the words were gone. ", "Nevertheless, I retained the gist of it.", "\n\nBasically the note said … “You belong to Me. ", "Your life is in my hands. ", "You will be on Planet Earth as long as I choose to keep you here, and I will bring you Home when I am ready, when I have decided that you are finished. ", "Until that moment, and not a minute before, you are under My care … You can resist this simple truth, call it unfair, etc. ", "and suffer, as you’ve been doing – or you can accept the simple truth of it, and relax. ", "It’s up to you … Your reaction to this Truth will not alter it in the least.”", "\n\nI felt immediately relieved, if a bit chastised – like a small child whose parents had just told her that she could fight against the rules or cooperate, that her feelings about the rules would not change the Reality of them one little bit … I had just been similarly “set straight” about Reality from the Highest Parent – and BOY, did I ever need the set to!", "\n\nThat next morning I got out of bed ready to pick up my box of mental and spiritual tools! ", "I went back in and questioned my beliefs, using the Four Questions that Byron Katie outlined for us in the Work, along with the Guiding Principles of Reality – as steps up and out of the darkness and began to climb back up out of the hole I’d dug for myself.", "\n\nI’ve noticed that when my unhappy story rules, no matter how true it may seem, I suffer horribly. ", "And I’ve experienced the difference when Reality rules my thinking; my seeing is better and inner peace prevails.", "\n\nI’ve also come to realize that occasional trips down into my inner hell are sometimes the only way to uncover and correct the faulty wiring of old, outdated belief circuitry that needs to be rewired to better plug into Reality and the present moment. ", "When seen in this light, I understand that even my darkest moments are necessary in my walk towards greater Light.", "\n\nSo I find less need to blame myself (and others) for these occasionally necessary detours away from Reality, and choose to see these difficult passages as “inner roads in need of repair” instead. ", "Cuz really, how does one know repair is needed unless one travels down that road? ", "😉\n\nWe CAN begin to ease up on ourselves on this consciousness journey – there’s no race, no first prize for perfection! ", "We’re all here, bumbling along, moving in and out of the darkness, only because it’s the best, perhaps only, way to learn the life lessons essential for our personal growth.", "\n\nBut I also wanna say … PHEW! ", "It sure does feel better to be up here in daylight again, back in the sunshine of NOW… and I like to think that the darkest recesses of my inner self are not quite as dark as they were before my most recent visit there.", "\n\nBlessings,\n\nPS. ", "Remind me to talk to you some more sometime about the importance of going into the dark places where our story holds us prisoner with the guiding principles, that, like cell block keys in hand, unlock the mind and set it free – if it’s of interest to you. ", "🙂\n\nThe mind rules the body. ", "Through my work, I have come to see just how true those words are. ", "What we believe determines not only our health, but the physical stance and posture we assume, and that physicality becomes the way we communicate to others about who we are and what we believe. ", "Our body is a transmitter of the energy we create through the thoughts we believe.", "\n\nEach of us has adopted a bevy of thoughts with a central, most often limiting, belief that rules; these are our core beliefs. ", "Core beliefs generally originate in childhood. ", "Often they come from a thought lineage that has been passed down to us from previous generations and that consists of both positive and negative beliefs. ", "However, when I use the term, core belief, I am referring to the limiting or negative core beliefs since they are the ones that cause us trouble.", "\n\nCore Beliefs act like a magnet by attracting into their orbit other complementary thoughts/beliefs, and creating a belief energy field that becomes our identity. ", "This limited identity often establishes what we call victim consciousness. ", "In other words, we adopt core beliefs that define and shape an often painfully limiting victim consciousness, an energetic pattern of consciousness, or identity, that we then become totally addicted to – even though it may be a sorely dysfunctional and painful one.", "\n\nWe ‘wear’ these patterns in our body. ", "They are carried energetically in the body and are visible through our physical habits and posture; these patterns form what we call our victim posture or stance that, though we may attempt to compensate for it, or hide it, it nonetheless transmits a ‘victim vibe’ that attracts to us people and situations that vibrate at the same low frequency. ", "In other words, through our victim posture we invariably attract to us the people and situations that verify for us what ever victim belief we have adopted and are carrying physically.", "\n\nOur body reflects our beliefs, and because this is so, we can use the body as a doorway to identify our negative, limiting core beliefs, and to clear them. ", "How? ", "By identifying the places in the body where the victim pattern has us out of physical right alignment and using those places of contraction and chronic discomfort to identify the belief that we are carrying there. ", "Through observer consciousness (the antidote for victim consciousness) we investigate the painful beliefs we are carrying in our body and begin to bring ourselves back into a healthier alignment. ", "Years of chronic pain disappears as we begin to release the troubling thought patterns that have been holding our bodies in contorted, painful misalignment and return to an alignment that restores health on all levels, physically, mentally, emotionally, and spiritually\n\nThrough years of researching these ideas in my experiential work with clients (and on myself) I have verified them and continue to discover better ways of moving us out of our victim patterns and into alignment with our Universal Source which, when we are in alignment with it, heals and restores our health and sanity.", "\n\nI do understand the importance of “feeling our feelings” in the process of emotional healing. ", "I DO value the part of the process that recognizes and releases emotion; feelings are energetic impulses that act like messengers whose job is to report to us the state of our current vibrational frequency, and to show us the unhappy thoughts we are believing!", "\n\nI worked in addictions/co-dependency treatment for years where we facilitated anger/shame/grief work with our clients, and I was well-schooled in the popular idea that only by releasing childhood suppressed emotional material can we move past our emotional stuck-ness.", "\n\nThat said, however, I have come to question the widely-held assumption that drumming up an emotional response helps us unload accrued emotional pain. ", "I have not found that doing this sort of emotional venting actually eliminates, or dissipates the emotional energy being regurgitated. ", "Instead I’ve seen that the more we drum up feeling, the more feeling we generate for release. ", "This was confusing to me. ", "If the feelings are old, stored up emotion in need of release, then why, in the releasing process, do we seem to generate even MORE of it?", "\n\nSuch inner seeking and questioning allowed me to develop a radically different way of understanding what the role of feelings is in the healing process; that shift in the way I see feelings served to transform the way I work with others. ", "What I realized was that feelings come from thoughts, or from old imprinted belief patterns – only every time.", "\n\nWhat we feel is determined by what we think and believe! ", "This understanding prompted a huge turn around in me because I realized that, until and unless we begin to intervene at the level of what we believe, the grieving(shame/anger) NEVER ends. ", "Initiating feeling work without addressing the beliefs behind those feelings will not bring true clearing. ", "It cannot, because we will just go on generating the negative emotional states we are trying to eliminate! ", "We must question the beliefs and thoughts that produced the feelings in the first place if we want real relief!", "\n\nIt is in the amygdala, that tiny gland located in the temporal lobe of the brain, where thought impulses convert to emotion, which are then transmitted to the rest of the body, producing the physiological responses associated with the feelings generated there.", "\n\nPlease do not misunderstand. ", "I do not mean to undermine the emotional body. ", "It is very important. ", "Our feelings DO play a critical role, and therefore need to be experienced. ", "But what happens when we understand the true relationship between thoughts and feelings is that we work differently with those feelings.", "\n\nOnce we understand that our thoughts, not our life circumstances, cause our pain, we stop feeling at the mercy of life, of other peoples behavior, and of our own feelings! ", "We come to see that the only thing that can possibly victimize us is our own thinking.", "\n\nUnderstanding that our beliefs are what causes our feelings allows us to use our feelings as the messengers they are meant to be. ", "Feelings alert us that we are thinking painful thoughts. ", "By questioning those thoughts our feelings can TRULY shift (we’re not talking about denial or stuffing feelings here, but genuine emotional shifts). ", "Misery dissipates as we reframe our perception of a situation. ", "This is what I have seen happen, over and again.", "\n\nOf course, this is for you to discover for yourself. ", "I recommend that you experiment with the concept that feelings come from our unhappy thoughts, rather than the old idea that feelings come from what happens “to us.” ", "Try questioning your troubling thoughts about your life happenings, rather than blaming them as being the cause of your unhappy feelings.", "\n\nHere are some helpful tips for grounding and furthering your progress towards peace:\n\n1. ", "Start your day with a deliberate focus on aligning with Source.", "\na. Read something inspirational to set the tone, and go, as if to a secret meeting w/ your beloved, to a private space set up somewhere in your home just for this purpose. ", "Light a candle, play music that soothes and invites you to breathe and relax.", "\n\nc. Set your conscious intention to connect w/ Source through your body energetically and use visualization to see the energy of Source surrounding you and flowing into your body, streaming along the meridians and energy pathways, reaching every organ, every cell in your body.", "\n\n2. ", "Sign up for some kind of gentle yoga (yin yoga. ", "restorative yoga, vinyasa (flow), or basic Iyengar are all good places to start), or a qigong/tai chi/akido/reiki class to learn ways to work in, and with, the body energetically I cannot emphasize enough the body’s role in freeing us from victim consciousness. ", "It facilitates powerful healing.", "\n\na. Is it true?", "\nb. Do you know it absolutely?", "\nc. Who are you when you believe that thought?", "\nd. What would be different w/out that thought?", "\n\nAnd use her Turn Arounds too, by taking the original thought that you are questioning and turn it around to its opposite and look for evidence to support that perspective.", "\n\n5. ", "Work with those four questions as you move through your day. ", "They will help you tap into observer consciousness so that you are less reactive and resistant to life. ", "Look for any little unhappy thought and practice turning it into its opposite to find a more peaceful way of seeing.", "\n\n6. ", "Learn and meditate on the basic guiding principles. ", "Practice seeing the world through them. ", "For instance, when you hear yourself thinking that something should, or shouldn’t, be the way it is, remind yourself of the principle that teaches us there are no mistakes; things are the way they are for a reason and that reason is for our benefit; focus on seeking that growth enhancing reason, rather than railing against the way things are. ", "Observer consciousness is based on seeing life through universal guiding principles of life.", "\n\n7. ", "Pay attention to your feelings, especially to the ones that prompt you to react negatively, for they are like fingers pointing to the troublesome thought inside your mind, the real cause of your distress.", "\n\n8. ", "Suspect your way of seeing things anytime your perception of a situation generates unhappiness. ", "Explore your mindset carefully and question the negative beliefs, one at a time, that surface in your mind – don’t quit until you’ve adjusted your way of seeing things to align with reality, recognizable by its high frequency. ", "You know you have returned to reality when you feel grounded and centered, serene and connected – at peace. ", "Reality is the here and now peace of this moment. ", "Use this work to anchor you in reality.", "\n\nI trust that any of the above mentioned suggestions you choose to follow will bring positive results – your pace and progress is a personal thing. ", "Trust your rhythm." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0011698567541316152, 0.0008245889330282807, 0.05723784491419792, 0.015231981873512268, 0.0008406894630752504, 0.009951882064342499, 0.0011860732920467854, 0.0010616133222356439, 0.0014505769358947873, 0.000706125923898071, 0.0008795136236585677, 0.0008026586729101837, 0.0011743707582354546, 0.0294683575630188, 0.0006041117012500763, 0.0006669431459158659, 0.000938689976464957, 0.0008522161515429616, 0.0008049019379541278, 0.0006522629992105067, 0.004884520545601845, 0.004246000200510025, 0.0012898282147943974, 0.0007098364876583219, 0.0006330867763608694, 0.00594363221898675, 0.0008596669067628682, 0.0013668719911947846, 0.0006569567485712469, 0.0013792600948363543, 0.001759188948199153, 0.0009923739125952125, 0.0006643643719144166, 0.0007691518985666335, 0.0007881029741838574, 0.0007015406736172736, 0.0012023155577480793, 0.0005375701584853232, 0.0005139109562151134, 0.0020073289051651955, 0.00051682791672647, 0.0007158127264119685, 0.0035116367507725954, 0.0005740519845858216, 0.001310544554144144, 0.0011747003300115466, 0.0018396001541987062, 0.002620631828904152, 0.0006365284207277, 0.0010254723019897938, 0.000897607475053519, 0.0014445026172325015, 0.0007034124573692679, 0.0008321856730617583, 0.0008179250289686024, 0.00352898589335382, 0.007728568743914366, 0.0006907263887114823, 0.03286576271057129, 0.0005799844511784613, 0.00104967609513551, 0.000803460949100554, 0.0005324843223206699, 0.0014424372930079699, 0.0008890946628525853, 0.008304480463266373, 0.0011278361780568957, 0.0071390531957149506, 0.0007759046857245266, 0.0006593292928300798, 0.0008931915508583188, 0.0012243061792105436, 0.001144440728239715, 0.0008448415901511908, 0.004339389503002167, 0.0007294887327589095, 0.0008181873126886785, 0.0005669662496075034, 0.007166953757405281, 0.32067814469337463, 0.07002615928649902, 0.0009246710105799139, 0.015045088715851307, 0.0010183951817452908, 0.00248307129368186, 0.03964415192604065, 0.0007114360923878849, 0.02160385064780712, 0.0006456230767071247, 0.015993133187294006, 0.0005698297172784805, 0.0010402421467006207, 0.0009677776833996177, 0.0006309860036708415, 0.0008808568236418068, 0.03017425164580345, 0.0007469412521459162, 0.0006548897363245487, 0.000675148912705481, 0.007905717007815838, 0.000566975912079215, 0.0006013301899656653, 0.0006431883084587753, 0.0005809784051962197, 0.0005668168305419385, 0.0005964990705251694, 0.0006349440081976354, 0.0006253395695239305, 0.0006663357489742339, 0.0007891922141425312, 0.0012767032021656632, 0.0006358644459396601, 0.0005842677783221006, 0.0006192788714542985, 0.0009614024893380702, 0.0005828983848914504, 0.000578338629566133, 0.0009086783975362778, 0.0005514879594556987, 0.000609116570558399, 0.0007654060609638691, 0.0008429370354861021, 0.0011446456192061305, 0.0006191667052917182, 0.0007291561341844499, 0.0006952387047931552, 0.0005503020365722477, 0.0006206813850440085, 0.0006500299205072224, 0.0009847277542576194, 0.0006216007750481367, 0.0008761820499785244, 0.0006074364064261317, 0.017388034611940384, 0.0006575414445251226, 0.0016681802226230502, 0.0005574926035478711, 0.000529505021404475, 0.0005894071073271334, 0.0013315818505361676, 0.003684281837195158, 0.0006684631225652993, 0.0010379173327237368, 0.000579565588850528, 0.036696355789899826, 0.0007478565676137805, 0.000645086751319468, 0.0006532301194965839, 0.017049383372068405, 0.0006946883513592184, 0.000710786902345717, 0.0006825760356150568, 0.001724410685710609, 0.0012396577512845397, 0.0011860732920467854, 0.0006344537250697613, 0.0009461192530579865, 0.0006084382766857743, 0.0008759837946854532, 0.0007819027523510158, 0.0016526143299415708, 0.0007980764494277537, 0.0006316626677289605, 0.0013668719911947846, 0.0007364232442341745, 0.000743289478123188, 0.000625843065790832, 0.0012023155577480793, 0.000597457226831466, 0.000695453432854265, 0.0007062325603328645, 0.0005943828145973384, 0.001310544554144144, 0.001965939998626709, 0.0014589069178327918, 0.004510591272264719, 0.0010615375358611345, 0.0007176640792749822, 0.0007441661437042058, 0.0008033369085751474, 0.0005343917291611433, 0.0007377652218565345 ]

[ "Dwight Willard Taylor\n\nDwight Willard Taylor (1932–2006) was an American malacologist and paleontologist, a researcher on mollusks. ", "His undergraduate work was at the University of California, Berkeley and his PhD was from Harvard University.", "\n\nHe was instrumental in the creation of the malacological journal, Malacologia.", "\n\nTaxa\nTaylor named and described 132 new taxa of gastropods, mostly freshwater snails in the families Hydrobiidae and Physidae, including:\n Mexipyrgus Taylor, 1966, in the Hydrobiidae\n Coahuilix hubbsi Taylor, 1966, in the Hydrobiidae\n\nA number of taxa of non-marine mollusca were named in honor of him, including:\n The freshwater snail genus Taylorconcha Hershler et al., ", "1994, in the Hydrobiidae.", "\n\nPublications\nPublications by Dwight Willard Taylor include:\n\n TAYLOR, D. W., 1949a [19 March], STS winner writes. ", "Science News Letter 55(12): 182 [excerpt of Taylor 1949b].", "\n TAYLOR, D. W., 1949b [November], A malacological survey of Nantucket Island, Massachusetts. ", "Pp.", " 18–21 and back cover, in: How you can search for science talent: a book of facts about the Ninth Annual Science Talent Search for Westinghouse Science Scholarships. ", "Washington, D.C., Science Clubs of America/Science Service.", "\n TAYLOR, D. W., 1950 [11 January], Three new Pyrgulopsis from the Colorado Desert, California. ", "Leaflets in Malacology, 1(7): 27–33.", "\n TAYLOR, D. W., 1952 [10 July], Notes on the freshwater mollusks of Yellowstone Park, Wyoming. ", "Leaflets in Malacology, 1(9): 43–49, 1 pl.", "\n TAYLOR, D. W., 1954a [10 January], A new Promenetus (Planorbidae) from Panama. ", "Revista de la Sociedad Malacólogica \"Carlos de la Torre\" [Havana], 9(2): 37–38.", "\n TAYLOR, D. W., 1954b [May], Some Late Cenozoic Molluscan Faunas from Kansas and Nebraska. ", "Master's Thesis, University of California, Berkeley. ", "188 pp. [", "unpublished].", "\n TAYLOR, D. W., 1954c [June], Nonmarine molluscs from Barstow Formation of southern California. ", "United States Geological Survey, Professional Paper, 254C: 67–80, plate 20.", "\n TAYLOR, D. W., 1954d [13 August], A new Pleistocene fauna and new species of fossil snails from the High Plains. ", "Occasional Papers, Museum of Zoology, University of Michigan, 577: 1–16.", "\n TAYLOR, D. W. & C. W. HIBBARD, 1955, A new Pleistocene fauna from Harper County, Oklahoma. ", "Oklahoma Geological Survey, Circular, 37: 1–23.", "\n TAYLOR, D. W., 1956, Pliocene mollusks from Jackson Hole, Grand Valley, and Star Valley, Wyoming and Idaho. ", "Pp.", " 123–125, 1 pl., ", "in: Guidebook, Wyoming Geological Association, 11th Annual Field Conference, 1956, Jackson Hole. ", "256 pp.", "\n TAYLOR, D. W., 1957a [January], Late Cenozoic paleoecology and molluscan faunas of the High Plains. ", "Ph.D. Thesis, University of California, Berkeley. ", "vii + 351 pp. [", "unpublished; not seen; listed by title only in \"Index to American Doctoral Dissertations 1956–1957\", p. 102 (1958)].", "\n TAYLOR, D. W., 1957b [13 June], Pliocene fresh-water mollusks from Navajo County, Arizona. ", "Journal of Paleontology, 31(3): 654–661.", "\n ROBINSON, G. D., G. E. LEWIS & D. W. TAYLOR, 1957 [December], Eocene continental deposits in Three Forks Basin, Montana. ", "Geological Society of America Bulletin, 68(12) [part 2]: 1786 [abstract of paper presented at GSA meeting, Atlantic City, New Jersey, 1–3 November 1957].", "\n HERRINGTON, H. B. & D. W. TAYLOR, 1958 [15 August], Pliocene and Pleistocene Sphaeriidae (Pelecypoda) from the central United States. ", "Occasional Papers, Museum of Zoology, University of Michigan, 596: 1–128, 1 pl. [", "new taxa by Herrington alone].", "\n TAYLOR, D. W., 1958 [12 December], Geologic range and relationships of the freshwater snail Anisus pattersoni. ", "Journal of Paleontology, 32(6): 1149–1153.", "\n TAYLOR, D. W., 1960a [April?], ", "Distribution of the freshwater clam Pisidium ultramontanum; a zoogeographic inquiry. ", "American Journal of Science, 258A: 325–334, 1 pl. ", "+ errata [note: MCZ issue received on 25 April 1960; USNM issue received on 27 April 1960].", "\n HIBBARD, C. W. & D. W. TAYLOR, 1960 [1 July], Two Late Pleistocene faunas from southwestern Kansas. ", "Contributions from the Museum of Paleontology, The University of Michigan, 16(1): 1–223, pls. ", "1–16 [new mammalian taxa by Hibbard alone].", "\n TAYLOR, D. W., 1960b [July?], ", "Late Cenozoic molluscan faunas from the High Plains. ", "United States Geological Survey Professional Paper, 337: iv + 94 pp., ", "pls. ", "1–4 [note: Library of Congress issue received on 7 July 1960; Univ. ", "of Washington issue received on 21 July 1960].", "\n TAYLOR, D. W., 1961a [1 April], The freshwater clam Pisidium ultramontanum Prime in Modoc County, California. ", "The Veliger, 3(4): 111.", "\n TAYLOR, D. W., 1961b [17 November], Comments on the proposed suppression of Paludina lustrica Say, 1821. ", "Z.N.(S.) 730. ", "Bulletin of Zoological Nomenclature, 18(6): 379.", "\n TAYLOR, D. W. & H. B. HERRINGTON, 1962 [1 January], The freshwater clam Pisidium tremperi (Hannibal). ", "The Veliger, 4(3): 129–131, plate 28.", "\n McKENNA, M. C., P. ROBINSON & D. W. TAYLOR, 1962 [12 September], Notes on Eocene Mammalia and Mollusca from Tabernacle Butte, Wyoming. ", "American Museum Novitates, 2102: 1–33 [description of mollusks by Taylor alone].", "\n LOVE, J. D. & D. W. TAYLOR, 1962 [November?], ", "Faulted Pleistocene strata near Jackson, northwestern Wyoming. ", "United States Geological Survey, Professional Paper, 450-D: D136–D139 [note: Library of Congress issue received on 8 November 1962; Univ. ", "of Washington issue received on 26 November 1962].", "\n TAYLOR, D. W. & N. F. SOHL, 1962 [14 November], An outline of gastropod classification. ", "Malacologia, 1(1): 7–32.", "\n TAYLOR, D. W., 1963a [April], Mollusks of the Black Butte local fauna. ", "Pages 35–41, in: J. A. SHOTWELL, ed., ", "The Juntura Basin: studies in earth history and paleoecology. ", "Transactions of the American Philosophical Society, (n.s.) ", "53(1): 1–77.", "\n TAYLOR, D. W., H. J. WALTER & J. B. BURCH, 1963 [7 August], Freshwater snails of the subgenus Hinkleyia (Lymnaeidae: Stagnicola) from the western United States. ", "Malacologia, 1(2): 237–281, 4 pls.", "\n RUBIN, M. & D. W. TAYLOR, 1963 [16 August], Radiocarbon activity of shells from living clams and snails. ", "Science, 141(3581): 637.", "\n TAYLOR, D. W., 1963b [1 October], Erroneous records of freshwater clams (Spaheriidae) from California. ", "The Veliger, 6(2): 111.", "\n TAYLOR, D. W., 1964 [November], Historical analysis of distribution of west American freshwater molluscs. ", "American Zoologist, 4(4): 436–437 [Abstract of paper presented at American Society of Zoologists meeting, Knoxville, Tennessee, 28 December 1964].", "\n McCULLOCH, D. S., D. W. TAYLOR & M. RUBIN, 1965 [May], Stratigraphy, non-marine mollusks, and radiometric dates from Quaternary deposits in the Kotzebue Sound area, western Alaska. ", "Journal of Geology, 73(3): 442–453.", "\n GREGG, W. O. & D. W. TAYLOR, 1965 [31 August], Fontelicella (Prosobranchia: Hydrobiidae), a new genus of west American freshwater snails. ", "Malacologia, 3(1): 103–110.", "\n TAYLOR, D. W., 1965, The study of Pleistocene nonmarine mollusks in North America. ", "Pp.", " 597–611, in: H. E. WRIGHT & D. G. FREY, eds., ", "The Quaternary of the United States; a Review Volume for the VII Congress of the International Association for Quaternary Research. ", "Princeton, New Jersey, Princeton University Press. ", "x + 922 pp.", "\n HIBBARD, C. W., C. E. RAY, D. E. SAVAGE, D. W. TAYLOR & J. E. GUILDAY, 1965, Quaternary mammals of North America. ", "Pp.", " 509–525, in: H. E. WRIGHT & D. G. FREY, eds., ", "The Quaternary of the United States; a Review Volume for the VII Congress of the International Association for Quaternary Research. ", "Princeton, New Jersey, Princeton University Press. ", "x + 922 pp.", "\n TAYLOR, D. W., 1966a [1 January], An eastern American freshwater mussel, Anodonta, introduced into Arizona. ", "The Veliger, 8(3): 197–198, plate 28.", "\n TAYLOR, D. W. & T. UYENO, 1966 [20 January] [\"December 1965\"], Evolution of host specificity of freshwater salmonid fishes and mussels in the North Pacific region. ", "Venus, 24(3): 199–209 [in Japanese; English abstract].", "\n TAYLOR, D. W., 1966b [18 August], Summary of North American Blancan nonmarine mollusks. ", "Malacologia, 4(1): 1–172, pls. ", "1–8. [", "Note: this journal issue contained three \"papers planned for the VII Congress of the International Association for Quaternary Research\"].", "\n TAYLOR, D. W. & W. L. MINCKLEY, 1966 [August] [\"September–October\"], New world for biologists. ", "Pacific Discovery, 19(5): 18–22, 6 pls., ", "1 map [Library of Congress issue received 29 August 1966; USNM issue received on 8 Sept. 1966].", "\n TAYLOR, D. W., 1966c [1 October], A remarkable snail fauna from Coahuila, México. ", "The Veliger, 9(2): 152–228, pls. ", "8–19.", "\n TAYLOR, D. W., 1966d [1 October], Review [\"A preliminary checklist of invertebrates collected from Lake Tahoe, 1961–1964, by Ted C. Frantz and Almo J. Cardone. ", "Biological Society of Nevada, Occasional Papers, 8: 1–12 (15 January 1966)\"]. ", "The Veliger, 9(2): 253.", "\n TAYLOR, D. W., 1967a [22 February] [\"December 1, 1966\"], A remarkable snail fauna from Coahuila, Mexico. ", "Report of the American Malacological Union for 1966: 70–72 [Abstract of paper presented at meeting of the AMU-Pacific Division, Seattle, Washington, 19–22 June 1966].", "\n TAYLOR, D. W., 1967b [4 August], Freshwater clam Sphaerium transversum (Say) in Arizona. ", "Southwestern Naturalist, 12(2): 202–203.", "\n TAYLOR, D. W., 1967c [1 October], Freshwater mollusks collected by the United States and Mexican Boundary Surveys. ", "The Veliger, 10(2): 152–158.", "\n TAYLOR, D. W., 1967d [October], Late Pleistocene molluscan shells from the Tule Springs area. ", "In: H. M. WORMINGTON & D. ELLIS, eds., ", "Pleistocene studies in southern Nevada. ", "Nevada State Museum Anthropological Papers, 13: 395–399.", "\n TAYLOR, D. W., 1968 [20 March], Late Pleistocene nonmarine mollusks from the State of Puebla, Mexico. ", "Annual Report of the American Malacological Union, 34: 76–78 [Abstract of paper that \"was announced but was not presented\" at meeting of the AMU-Pacific Division, Pacific Grove, California, 28 June – 1 July 1967 (Hanselman, 1968: 66)].", "\n LONG, G. E. & D. W. TAYLOR, 1970 [9 March], Estuarine mollusks of the Cholla Bay, Sonora, Mexico. ", "The Echo (Western Society of Malacologists), 2: 17–18, 39 [Abstract of paper presented at meeting of the WSM, Pacific Grove, California, 18–21 June 1969].", "\n TAYLOR, D. W., 1970a [30 June], West American freshwater Mollusca, 1: bibliography of Pleistocene and Recent species. ", "Memoirs, San Diego Society of Natural History, 4: 1–73, 1 plate.", "\n TAYLOR, D. W., 1970b [14 November], Symposium on the rare and endangered mollusks of North America, 4. ", "Western freshwater mollusks. ", "Malacologia, 10(1): 33–34 [With summary of Taylor's manuscript by Harold D. Murray; Taylor did not attend this symposium (The American Malacological Union, Inc., Annual Reports for 1968, Bulletin, 35: 3)].", "\n TAYLOR, D. W. & A. G. SMITH, 1971 [1 April], Harold Hannibal (1889–1965) with a review of his molluscan research. ", "The Veliger, 13(4): 303–316, 5 pls.", "\n TAYLOR, D. W., 1974 [15 July], The Tertiary gastropod Orygoceras found living. ", "Archiv für Molluskenkunde, 104(1–3): 93–96. [", "Reprinted (1974), with Hungarian title, \"Elö harmadkori Orygocerasok,\" and Hungarian abstract, Soosiana, 2: 37–44].", "\n TAYLOR, D. W., 1975, Index and bibliography of Late Cenozoic freshwater Mollusca of western North America. ", "Claude W. Hibbard Memorial Volume 1. ", "Papers on Paleontology (Museum of Paleontology, University of Michigan), 10: 1–384 [one-page errata issued in 1976].", "\n TAYLOR, D. W., 1978 [February], Comments on the proposed designation of a type-species for Pleurocera Rafinesque, 1818. ", "Z.N.(S.) 83. ", "Bulletin of Zoological Nomenclature, 34(4): 199.", "\n TAYLOR, D. W., 1981 [July], Freshwater mollusks of California: a distributional checklist. ", "California Fish and Game, 67(3): 140–163.", "\n TAYLOR, D. W. & G. R. SMITH, 1981 [31 December], Pliocene molluscs and fishes from northeastern California and northwestern Nevada. ", "Contributions from the Museum of Paleontology, The University of Michigan, 25(18): 339–413, 19 pls.", "\n TAYLOR, D. W., 1983 [31 December], Late Tertiary mollusks from the lower Colorado River Valley. ", "Contributions from the Museum of Paleontology, The University of Michigan, 26(13): 289–298.", "\n TAYLOR, D. W. & E. H. JOKINEN, 1984 [5 November], A new species of freshwater snail (Physa) from seasonal habitats in Connecticut. ", "Freshwater Invertebrate Biology, 3(4): 189–202.", "\n TAYLOR, D. W., 1985a [February], Pecosorbis, a new genus of fresh-water snails (Planorbidae) from New Mexico. ", "New Mexico Bureau of Mines & Mineral Resources, Circular, 194: 1–17.", "\n TAYLOR, D. W., 1985b, Miocene freshwater mollusks from the Clarkia fossil site, Idaho. ", "Pp.", " 73–74, in: C. J. SMILEY, ed., ", "Late Cenozoic history of the Pacific Northwest: Interdisciplinary Studies on the Clarkia Fossil Beds of Northern Idaho. ", "American Association for the Advancement of Science, Pacific Division, San Francisco. ", "417 pp.", "\n TAYLOR, D. W., 1985c, Evolution of freshwater drainages and molluscs in western North America. ", "Pp.", " 265–321, in: C. J. SMILEY, ed., ", "Late Cenozoic history of the Pacific Northwest: Interdisciplinary Studies on the Clarkia Fossil Beds of Northern Idaho. ", "American Association for the Advancement of Science, Pacific Division, San Francisco. ", "417 pp.", "\n CONEY, C. C. & D. W. TAYLOR, 1986 [31 January] [\"1985\"], Systematic position of Quincuncina mitchelli (Simpson, 1896). ", "Annual Report, Western Society of Malacologists, 18: 12–13 [\"Abstract revised November 12, 1985, based on new evidence\"] [Abstract of paper presented by Coney at WSM meeting, Santa Barbara, California, 18–21 August 1985, which Taylor did not attend; after the meeting, Coney added Taylor as a co-author].", "\n TAYLOR, D. W., 1986, Fossil molluscs from the Lake Hill archaeological site, Panamint Valley, southeastern California. ", "Contributions of the Great Basin Foundation (San Diego), 2: 42–54.", "\n TAYLOR, D. W., 1987 [September], Freshwater molluscs from New Mexico and vicinity. ", "New Mexico Bureau of Mines & Mineral Resources, Bulletin, 116: iv + 5–50.", "\n TAYLOR, D. W. & R. C. BRIGHT, 1987, Drainage history of the Bonneville Basin. ", "Utah Geological Association, Publication, 16: 239–256 [paper presented at symposium, \"Cenozoic geology of western Utah\", Lake City, Utah, 23–26 September 1987].", "\n TAYLOR, D. W., 1988a [January], Phylum: Mollusca. ", "Pp.", " 32–57, in: J. GRAY, ed., ", "Evolution of the freshwater ecosystem: the fossil record. ", "Palaeogeography, Palaeoclimatology, Palaeoecology, 62(14): 1–214.", "\n TAYLOR, D. W. & J. GRAY, 1988 [January], Class: Mammalia. ", "Pp.", " 165–175, in: J. GRAY, ed., ", "Evolution of the freshwater ecosystem: the fossil record. ", "Palaeogeography, Palaeoclimatology, Palaeoecology, 62(1–4): 1–214.", "\n TAYLOR, D. W., 1988b [January], Aspects of freshwater mollusc ecological biogeography. ", "Palaeogeography, Palaeoclimatology, Palaeoecology, 62(1–4): 511–576.", "\n TAYLOR, D. W., 1988c [2 December], New species of Physa (Gastropoda: Hygrophila) from the western United States. ", "Malacological Review, 21(1–2): 43–79.", "\n BOUCOT, A. J., H. A. McCLUER, F. ALVAREZ, J. R. P. ROSS, D. W. TAYLOR, W. STRUVE, N. N. SAVAGE & S. TURNER, 1989 [25 September], New Devonian fossils from Saudi Arabia and their biogeographic affinities. ", "Senckenbergiana Lethaea, 69(5–6): 535–597 [Taylor, \"Nonmarine molluscs,\" pp.", " 557–559].", "\n GRAY, J. & D. W. TAYLOR, 1992 [May], Late Tertiary environmental change: pollen and mollusc evidence from the Pacific Northwest. ", "Geological Society of America, Abstracts with Programs, 24(5): 28 [abstract of paper presented at the meeting of the Cordilleran Section, GSA, Eugene, Oregon, 11–13 May 1992].", "\n TAYLOR, D. W., 1994 [June] [\"December 1993\"], Moluscos dulceacuicolas de Costa Rica: introduccion y lista preliminar. ", "Revista de Biología Tropical (San José, Costa Rica), 41(3A): 653–655 [in Spanish; English abstract].", "\n TAYLOR, D. W., 1997a [9 January], An old new species of Polymesoda (Bivalvia, Corbiculidae) from the Pacific coast of Mexico. ", "The Festivus, 29(1): 3–5.", "\n TAYLOR, D. W., 1997b [1 August], A new mussel, Disconaias conchos (Bivalvia: Unionidae) from Rio Conchos of the Rio Grande System, Mexico. ", "Occasional Papers on Mollusks, 5(75): 419–425.", "\n TAYLOR, D. W., 2002a, New data on biogeography, classification and phylogeny of Physidae (Gastropoda: Hygrophila). ", "Visnyk Zhytomyrskoho Pedahohichnoho Universytetu [Proceedings of the Ivan Franko Zhytomyr Pedagogical University] (Zhytomyr), 10: 24–26 [proceedings of malacological conference held in Zhytomyr, Ukraine, 13–15 May 2002].", "\n TAYLOR, D. W., 2002b [\"1998–1999\"], Harold William Harry, 1921–1995. ", "Malacological Review, 31/32: 159–163.", "\n TAYLOR, D. W., 2003 [March], Introduction to Physidae (Gastropoda: Hygrophila); biogeography, classification, morphology. ", "Revista de Biología Tropical, International Journal of Tropical Biology and Conservation (San José, Costa Rica), 51 (Supplement 1): viii + 287 pp.", "\n TAYLOR, D. W., 2004a [August], Morphological revision of freshwater snails, Family Physidae/Revisión morfológica de caracoles dulciacuícolas, Familia Physidae. ", "Comunicaciones de la Socieded Malacologica del Uruguay, 8(82–83): 279–282.", "\n TAYLOR, D. W., 2004b [October], Trans-Pacific relationships in Physidae (Gastropoda, Pulmonata). ", "Pp.", " 155–156, in: O. YA. ", "SEMENIKHINA, ed., ", "Abstracts of the conference \"Mollusks of the Northeastern Asia and Northern Pacific: Biodiversity, Ecology, Biogeography, and Fauna History,\" October 4–6, 2004, Vladivostok, Russia. ", "Vladivostok, Dalnauka. ", "176 pp. [", "abstract] [Taylor did not attend this meeting (K. A. Lutaenko to A. R. Kabat, in litt., ", "May 21, 2007)].", "\n\nReferences\n\nFurther reading \n Scarabino F. (2007). \"", "Dwight W. Taylor (1932-2006): breve semblanza\". ", "Comunicaciones de la Sociedad Malacológica del Uruguay 9(90): 117-118. ", "PDF.", "\n\nCategory:American malacologists\nCategory:1932 births\nCategory:2006 deaths\nCategory:Harvard Medical School alumni\nCategory:University of California, Berkeley alumni" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0007270495989359915, 0.000621990708168596, 0.0006963345222175121, 0.000629774178378284, 0.0006307356525212526, 0.0005898741073906422, 0.0005804761312901974, 0.0006489342777058482, 0.000877159705851227, 0.0006124904030002654, 0.0006080255261622369, 0.0006750099128112197, 0.000625239685177803, 0.0005976090324111283, 0.0006130454712547362, 0.0007962946547195315, 0.0007512125303037465, 0.0006350012263283134, 0.0006017860141582787, 0.0007643597200512886, 0.0006926439818926156, 0.000615062250290066, 0.0006078013102523983, 0.000607128837145865, 0.0005977351684123278, 0.0006361876148730516, 0.0006513815023936331, 0.0006102839834056795, 0.000877159705851227, 0.0007642180426046252, 0.0005861723329871893, 0.0007341326563619077, 0.0006473957910202444, 0.0006680446676909924, 0.0006599183543585241, 0.0005817203200422227, 0.0005986802862025797, 0.0007342635071836412, 0.0006276033236645162, 0.0005614546244032681, 0.0006842385046184063, 0.0005858436343260109, 0.0007059681229293346, 0.0006734867347404361, 0.0007316755945794284, 0.000715139030944556, 0.0006269621080718935, 0.0006450071814469993, 0.0006126968073658645, 0.0006439439603127539, 0.0006303699337877333, 0.0006425762549042702, 0.0006831923965364695, 0.0007383863558061421, 0.0005942457355558872, 0.0009519908344373107, 0.0006682098610326648, 0.00063690374372527, 0.0006548819947056472, 0.0011194166727364063, 0.0006711595342494547, 0.0007622169214300811, 0.0006509595550596714, 0.0006854881066828966, 0.0010132119059562683, 0.0006653426680713892, 0.000640602083876729, 0.0006826372118666768, 0.0006823553121648729, 0.0006504596676677465, 0.0006416878895834088, 0.0006439939024858177, 0.0007644387660548091, 0.0006360984407365322, 0.0006882360903546214, 0.0006188673432916403, 0.0006280323723331094, 0.0008141691796481609, 0.0006590870907530189, 0.0007063267985358834, 0.0006943719927221537, 0.0006963995401747525, 0.0006553686689585447, 0.001053899060934782, 0.0006359474500641227, 0.0005747395916841924, 0.0006670566508546472, 0.0007023015641607344, 0.0006494347471743822, 0.0007773456163704395, 0.0006172062712721527, 0.000877159705851227, 0.0006662122905254364, 0.0005814938340336084, 0.0006679854704998434, 0.000823286478407681, 0.0006988734239712358, 0.000877159705851227, 0.0006496229907497764, 0.0005814938340336084, 0.0006679854704998434, 0.000823286478407681, 0.00071358383866027, 0.0010575756896287203, 0.00065616425126791, 0.0006057384889572859, 0.0006284649716690183, 0.0007411802071146667, 0.000840050051920116, 0.0005487535381689668, 0.0006602309877052903, 0.0006339251413010061, 0.0005811796872876585, 0.0006178589537739754, 0.0009764089481905103, 0.0011021243408322334, 0.0006286935531534255, 0.000626017281319946, 0.0011899576056748629, 0.0006196349277161062, 0.000558697443921119, 0.0006531653343699872, 0.0006746764993295074, 0.0006094800774008036, 0.001333501422777772, 0.0006243796087801456, 0.0006936550489626825, 0.0006330973701551557, 0.0006843343144282699, 0.0006125184008851647, 0.0005636017303913832, 0.0006907181814312935, 0.0005724230431951582, 0.0006313174380920827, 0.0006570957484655082, 0.0006025978946126997, 0.0008924888679757714, 0.0005921153933741152, 0.0006134657887741923, 0.0008272624108940363, 0.0006997418240644038, 0.0008001041715033352, 0.000687464838847518, 0.0006840464775450528, 0.0006553861894644797, 0.0005936767556704581, 0.0006737203802913427, 0.0008296966552734375, 0.0006385731394402683, 0.0006162305362522602, 0.0007954877219162881, 0.0006551687838509679, 0.0006537672597914934, 0.0006320149404928088, 0.0006092044641263783, 0.0006528469966724515, 0.0007723331800661981, 0.000666503794491291, 0.0006316463695839047, 0.000605279637966305, 0.000877159705851227, 0.0007455741288140416, 0.0006344824214465916, 0.0006172845023684204, 0.0007510160794481635, 0.0006123359780758619, 0.000877159705851227, 0.0006844592862762511, 0.0006344824214465916, 0.0006172845023684204, 0.0007510160794481635, 0.0006335576181299984, 0.0005734351580031216, 0.0006533284904435277, 0.00059696746757254, 0.0006211885483935475, 0.0006276150234043598, 0.0006518131121993065, 0.0005729115218855441, 0.0007139327353797853, 0.000877159705851227, 0.0006754649220965803, 0.0005757788894698024, 0.0007744690519757569, 0.0006298834923654795, 0.000877159705851227, 0.0006930540548637509, 0.0005757788894698024, 0.0007608569576404989, 0.0006291604368016124, 0.0007778298459015787, 0.0007184106507338583, 0.0006876667030155659, 0.0007681765710003674, 0.0006778311217203736, 0.0010773225221782923, 0.0006251962040551007, 0.0005440136301331222, 0.0007088714046403766, 0.0005753759760409594, 0.0007860938785597682, 0.0011946697486564517, 0.0008715359144844115, 0.0005982510047033429, 0.0006450677174143493, 0.0007877984317019582, 0.0006479352596215904, 0.0007114445324987173, 0.0006390376365743577, 0.0006000481080263853, 0.000771728518884629, 0.0006660881917923689, 0.0006295098573900759, 0.000877159705851227, 0.0011381724616512656, 0.0011527911992743611, 0.0005674000713042915, 0.0009631064021959901, 0.0007398697198368609, 0.0006148354732431471, 0.0006988468230701983, 0.0006773652858100832, 0.0006367067690007389, 0.000812274927739054, 0.0007907802355475724, 0.0006134087452664971 ]

[ "Q:\n\nC++ CRTP class hierarchy\n\nFrom Wikipedia:\n// The Curiously Recurring Template Pattern (CRTP)\ntemplate <typename T>\nstruct base\n{\n // ...\n};\nstruct derived : base<derived>\n{\n // ...\n};\n\nNow if I want derived_from_derived, I can write:\n// The Curiously Recurring Template Pattern (CRTP)\ntemplate <typename T>\nstruct base\n{\n // ...\n};\ntemplate <typename T>\nstruct derived : base<T>\n{\n // ...\n};\nstruct derived_from_derived : derived <derived_from_derived>\n{\n // ...\n};\n\nNow suppose I just want a derived object. ", " This doesn't work:\nderived<derived> obj;\n\nDoes derived have to be abstract, or is there a way to instantiate it?", "\n\nA:\n\nMy own answer is this:\nstruct base\n{\n template <typename T>\n struct type\n {\n // ...\n };\n};\nstruct derived\n{\n template <typename T=derived>\n struct type : base::type<T>\n {\n // ...\n };\n}\nstruct derived_from_derived \n{\n template <typename T=derived_from_derived >\n struct type : derived::type<T>\n {\n // ...\n };\n};\n\nNow I can have a derived::type<> obj. ", " Also, parametized inheritance works (e.g. decorator pattern):\ntemplate <typename whatever>\nstruct derived_from_whatever \n{\n template <typename T=derived_from_whatever>\n struct type : whatever::type<T>\n {\n // ...\n };\n};\n\nderived_from_whatever<derived_from_derived>::type<> obj_whatever;\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007994616753421724, 0.0008953775395639241, 0.004774633329361677, 0.001047364086844027 ]

[ "This is an archived article and the information in the article may be outdated. ", "Please look at the time stamp on the story to see when it was last updated.", "\n\nPlease enable Javascript to watch this video\n\nAlex Sheen started the non-profit \"Because I Said I Would\" in memory of his dad.", "\n\nNot because of something that he said, but because of what his dad did, and that was always keep his word.", "\n\n“He didn't influence me by sitting me on his knee and saying what promises mean; he led by example,\" Sheen said.", "\n\nAfter just three years, Sheen has spoken to thousands of adults and children around the country and started local chapters of \"Because I Said I Would.\"", "\n\nThey've also sent out more than five million promise cards, where people are encouraged to write out a promise for self-improvement, improving their world or holding true to their values.", "\n\nSheen says a promise kept-- no matter how small-- makes the community and that person better. ", "And that message was very well-received by a woman in Las Vegas.", "\n\n“She told me that she had something that she wanted to give me. ", "I ran back to my hotel room to get my stuff because we were going to have lunch because she was already a donor and she said, 'I want to give you this diamond,'\" Sheen said.", "\n\nAnd what a diamond: 5.5 carats, center cut The value? ", "Over $235,000. ", "The diamond is tucked away safely in a bank until it can be sold.", "\n\n\"I literally and I’m not embarrassed to say that I just started crying.\"", "\n\nFor a relatively upstart non-profit, Sheen says this gift will allow them to do more character education in schools though lesson plans and clubs, and expand their adult chapters to encourage keeping personal promises and volunteering in their communities.", "\n\nIt's like a new start and a way for Sheen and his small staff to continue to keep a promise to make things better.", "\n\n“It's something that's ubiquitous across cultures-- politically left or right, religious or non-religious; we all understand the importance of a promise.\"", "\n\nFor more information about \"Because I Said I Would,\" head right here." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006505316123366356, 0.0005246726213954389, 0.0006091858958825469, 0.001721383654512465, 0.0014520799741148949, 0.0005686629447154701, 0.0005569532513618469, 0.0005735490703955293, 0.0006300591048784554, 0.0008103525615297258, 0.02555016241967678, 0.0017674789996817708, 0.0007248194888234138, 0.0006148081738501787, 0.0030325641855597496, 0.0027834014035761356, 0.0005629577208310366, 0.0005773530574515462, 0.0007176576182246208 ]

[ "Field of the Invention\nThe present invention relates to a sheet detecting apparatus which detects a conveyed sheet and an image forming apparatus and an image reading apparatus which include the same.", "\nDescription of the Related Art\nIn general, a sheet conveyor of an image forming apparatus is equipped with a sheet conveying apparatus which conveys a sheet to an image forming portion or a discharge tray. ", "The sheet conveying apparatus is equipped with a sensor which detects a sheet in order to control a sheet conveying speed or detect a jam (for example, see U.S. Pat. ", "No. ", "6,011,948).", "\nA sheet detecting apparatus 620 as a comparative example is illustrated in FIGS. ", "14 to 15C. As illustrated in FIG. ", "14, the sheet detecting apparatus 620 of the comparative example is provided at the downstream side in the sheet conveying direction of a pair of conveying rollers 618 and 619 closest to a transfer position where an image formed in an image forming portion is transferred. ", "The sheet detecting apparatus 620 includes an abutting portion 623 which abuts against a sheet S, a photo sensor 624, a light shielding portion 625 which shields an optical path from a light emitting portion to a light receiving portion of the photo sensor 624, and a stopper 626 which positions the abutting portion 623 at a home position.", "\nThe abutting portion 623 is provided so as to be rotatable about a rotation shaft 627. ", "The abutting portion 623 is formed so as to return to a home position H illustrated in FIG. ", "15C by the pressure of a twist coil spring 628. ", "The light shielding portion 625 is integrally formed with the abutting portion 623, and rotates about the rotation shaft 627 along with the abutting portion 623.", "\nAs illustrated in FIG. ", "15A, when a leading end of the sheet S abuts against the abutting portion 623, the abutting portion 623 rotates about the rotation shaft 627 from the home position H illustrated in FIG. ", "15C in the direction of the arrow a of FIG. ", "15A, and hence the light shielding portion 625 shields the optical path of the photo sensor 624. ", "When the photo sensor 624 detects a state where the optical path is shielded, the sheet detecting apparatus 620 recognizes a state where the leading end of the sheet S reaches the abutting portion 623.", "\nSubsequently, the sheet S is conveyed while contacting a front end of the abutting portion 623. ", "As illustrated in FIG. ", "15B, when a tail end of the sheet S passes by the abutting portion 623, the abutting portion 623 rotates in the direction of the arrow b illustrated in FIG. ", "15C by the biasing force of the twist coil spring 628 so as to return to the home position H. At this time, the light shielding portion 625 is retracted from the optical path of the photo sensor 624, and the light receiving portion of the photo sensor 624 receives the light emitted from the light emitting portion again. ", "Accordingly, the sheet detecting apparatus 620 recognizes a state where the tail end of the sheet S passes by the abutting portion 623.", "\nIn recent years, there has been a demand for improving the throughput (the processing capacity per unit time) in the image forming apparatus. ", "There is a case where a gap (hereinafter, referred to as a “sheet gap”) from the tail end of the precedent sheet S to the leading end of the subsequent sheet S is shortened in order to improve the throughput in the image forming apparatus. ", "In this case, the sheet detecting apparatus 620 needs to handle the short sheet gap.", "\nThe abutting portion 623 of the comparative example rotates while being pressed by the sheet S when the leading end of the sheet S passing through the pair of conveying rollers 618 and 619 abuts against the abutting portion 623. ", "Then, when the tail end of the sheet S is separated from the abutting portion 623, the abutting portion 623 returns to the home position H while being biased by the twist coil spring 628 so that the abutting portion 623 reversely rotates. ", "For that reason, as illustrated in FIG. ", "15B, the distance necessary as the sheet gap D is the sum of a distance D2 and a mechanical loss amount D1 as a temporal loss amount caused by mechanical operation described in the following Equation 1.D=D1+D2   [Equation 1]\nAs illustrated in FIG. ", "15B, the mechanical loss amount D1 is the following distance. ", "That is, the distance corresponds to a distance in which the abutting portion 623 rotates from the position where the tail end of the precedent sheet S passes by the abutting portion 623 about the rotation shaft 627 by the biasing force of the twist coil spring 628 and moves to the home position H illustrated in FIG. ", "15C.\nMeanwhile, the distance D2 is as below. ", "Here, the time until the abutting portion 623 moves by the mechanical loss amount D1 in a manner such that the abutting portion 623 returns to the home position H as illustrated in FIG. ", "15C after the tail end of the sheet S is separated from the abutting portion 623 as illustrated in FIG. ", "15B is indicated by Δt. ", "Then, the distance D2 becomes a distance obtained by multiplying the conveying speed V of the sheet S conveyed while being nipped by the pair of conveying rollers 618 and 619 by Δt as illustrated in the following Equation 2.D2=Δt×V   [Equation 2]\nThen, since Δt is shortened when the mechanical loss amount D1 is shortened, the distance D2 is also shortened depending on the mechanical loss amount D1 from Equation 2. ", "Accordingly, the sheet gap D is shortened depending on the mechanical loss amount D1 from the above-described Equation 1. ", "From the description above, there is a need to shorten the mechanical loss amount D1 in order to shorten the sheet gap D between the precedent sheet S and the subsequent sheet S.\nHere, there are proposed techniques in Japanese Patent Laid-Open No. ", "2008-001465 and U.S. Patent Application Publication No. ", "2012/181,741 A1. ", "In Japanese Patent Laid-Open No. ", "2008-001465, a mechanical loss amount may be shortened by inclining a rotation shaft of a sensor flag with respect to a sheet conveying direction h when seen from a direction of a normal line i of a surface of a sheet S. In this way, when the rotation shaft of the sensor flag is obliquely inclined, the falling amount of the sensor in the sheet conveying direction h at the time in which the sensor becomes an ON state due to the passage of the sheet is smaller than that of the comparative example, and hence the mechanical loss amount may be decreased.", "\nFurther, in U.S. Patent Application Publication No. ", "2012/181,741 A1, a sensor flag is not formed in a swing type as in the comparative example, and the sensor flag rotates by one revolution whenever each sheet S passes by the sensor flag. ", "In this way, the mechanical loss amount is decreased.", "\nHowever, in the configuration of Japanese Patent Laid-Open No. ", "2008-001465, for example, as illustrated in FIG. ", "9C, the rotation shaft of the sensor flag is disposed so as to be inclined by 45° as an actual angle with respect to the sheet conveying direction h when seen from the direction of the normal line i of the surface of the sheet S. In that case, the mechanical loss amount is improved only by about 30% compared to the comparative example. ", "Further, in U.S. Patent Application Publication No. ", "2012/181,741 A1, since almost ten components are used, a space is needed in the sheet conveying direction h.\nIt is desirable to provide a sheet detecting apparatus having a small mechanical loss amount by simplifying a configuration and saving a space." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.000579418963752687, 0.0006319062085822225, 0.0006468049250543118, 0.0013787426287308335, 0.0009035539696924388, 0.0005716920713894069, 0.0006935617420822382, 0.0005837000207975507, 0.0006757852388545871, 0.001143319415859878, 0.0008291560807265341, 0.0006605774397030473, 0.0006620065541937947, 0.0006542381597682834, 0.0009699963266029954, 0.0006268509896472096, 0.0005990538047626615, 0.0006817266694270074, 0.0017654753755778074, 0.0006542381597682834, 0.0008098797989077866, 0.0006649668212048709, 0.0007577072829008102, 0.0005732154822908342, 0.0006704638944938779, 0.0005969557678326964, 0.0009059272124432027, 0.001113429549150169, 0.0006064212648198009, 0.0006595162558369339, 0.0006594527512788773, 0.0008274166029877961, 0.000621932907961309, 0.0008696353761479259, 0.000883590430021286, 0.0007043687510304153, 0.000676838681101799, 0.0005887518636882305, 0.0006503843469545245, 0.0006337780505418777, 0.0007518474012613297, 0.0006864664028398693, 0.0006112604751251638, 0.0006145955412648618, 0.0006410484784282744, 0.0006002168520353734, 0.0007161061512306333, 0.00060943269636482, 0.0006399850244633853, 0.0006145955412648618, 0.0005652056424878538 ]

[ "Priority sector lending\n\nPriority Sector Lending refers to lending to those sectors of the economy which may not get timely and adequate credit in the absence of this special dispensation.", "\n\nPriority Sector Lending is an important role given by the (RBI) to the banks for providing a specified portion of the bank lending to few specific sectors like agriculture and allied activities, micro and small enterprises, poor people for housing, students for education and other low income groups and weaker sections.. This is essentially meant for an all round development of the economy as opposed to focusing only on the financial sector.", "\n\nCategories of Priority Sector\n\nThe broad categories of priority sector for all scheduled commercial banks are as under: \n \n(i) Agriculture and Allied Activities (Direct and Indirect finance): Direct finance to agriculture shall include short, \nmedium and long term loans given for agriculture and allied activities directly to individual \nfarmers, Self-Help Groups (SHGs) or Joint Liability Groups (JLGs) of individual farmers \nwithout limit and to others (such as corporate, partnership firms and institutions) up to Rs. ", "\n20 lakh, for taking up agriculture/allied activities.", "\n\nIndirect finance to agriculture shall include loans given for agriculture and allied activities as \nspecified in Section I, appended.", "\n\nThis distinction between direct and indirect agriculture is dispensed with. ", "Instead, the lending to agriculture sector has been re-defined to include (i) Farm Credit (which will include short-term crop loans and medium/long-term credit to farmers) (ii) Agriculture Infrastructure and (iii) Ancillary Activities,\n\n(ii) Small Scale Industries (Direct and Indirect Finance): Direct finance to small scale \nindustries (SSI) shall include all loans given to SSI units which are engaged in \nmanufacture, processing or preservation of goods and whose investment in plant and \nmachinery (original cost) excluding land and building does not exceed the amounts \nspecified in Section I, appended. ", "\n \nIndirect finance to SSI shall include finance to any person providing inputs to or marketing \nthe output of artisans, village and cottage industries, hand-looms and to cooperatives of \nproducers in this sector. ", "\n \n(iii) Small Business / Service Enterprises: shall include small business, retail trade, \nprofessional & self-employed persons, small road & water transport operators and other \nservice enterprises as per the definition given in Section I and other enterprises that are \nengaged in providing or rendering of services, and whose investment in equipment does \nnot exceed the amount specified in Section I, appended. ", "\n \n(iv) Micro Credit : Provision of credit and other financial services and products of very small \namounts not exceeding Rs. ", "50,000 per borrower to the poor in rural, semi-urban and urban \nareas, either directly or through a group mechanism, for enabling them to improve their \nliving standards, will constitute micro credit. ", "\n \n(v) Education loans: Education loans include loans and advances granted to only individuals \nfor educational purposes up to Rs. ", "10 lakh for studies in India and Rs. ", "20 lakh for studies \nabroad, and do not include those granted to institutions; \n \n(vi) Housing loans: Loans up to Rs. ", "35 lakh in metropolitan cities where population is above 10 lakh and Rs. ", "25 Lakh at other center s for construction/purchase of a dwelling unit per family provided total cost of the unit in metropolitan centres and at other centres does not exceed Rs. ", "45 Lacs and Rs. ", "30 Lacs respectively.", "\n(excluding loans granted by banks to their own employees) and loans given for repairs to \nthe damaged houses of individuals up to Rs.5 lakh in metropolitan centres and Rs. ", "2 Lakh at other centres.", "\n \n(2) Investments by banks in securitised assets, representing loans to agriculture (direct or indirect), \nsmall scale industries (direct or indirect) and housing, shall be eligible for classification under respective \ncategories of priority sector (direct or indirect) depending on the underlying assets, provided the \nsecuritised assets are originated by banks and financial institutions and fulfill the Reserve Bank of India \nguidelines on securitisation.", "\n(3) Under Weaker Sections :\nPriority sector loans to the following borrowers are considered under Weaker Sections category:-\n\n(a) Small and marginal farmers;\n\n(b) Artisans, village and cottage industries where individual credit limits do not exceed Rs 1 Lakh ;\n\n(c) Beneficiaries of Swarnajayanti Gram Swarozgar Yojana (SGSY), now National Rural Livelihood Mission (NRLM);\n\n(d) Scheduled Castes and Scheduled Tribes;\n\n(e) Beneficiaries of Differential Rate of Interest (DRI) scheme;\n\n(f) Beneficiaries under Swarna Jayanti Shahari Rozgar Yojana (SJSRY);\n\n(g) Beneficiaries under the Scheme for Rehabilitation of Manual Scavengers (SRMS);\n\n(h) Loans to Self Help Groups;\n\n(i) Loans to distressed farmers indebted to non-institutional lenders;\n\n(j) Loans to distressed persons other than farmers not exceeding Rs 1 Lakh per borrower to prepay their debt to non-institutional lenders;\n\n(k) Loans to individual women beneficiaries up to Rs 1 Lakh per borrower.", "\n(L) also called or known as priority sector advancement (PSA);\n\n(m) Account holders under Pradhan Mantri Jan Dhan Yojana (PMJDY)\n\n(vii) Renewable energy sector has also been added to priority sector lending in the year 2015.", "\n\nSee also\n Priority Sector Lending Certificates\n\nReferences\n\nExternal links\n\nMaster Circulars\n\nCategory:Economic development policy" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0005943731521256268, 0.0005786156980320811, 0.0005893571069464087, 0.0006024583708494902, 0.0005525194574147463, 0.0005799944046884775, 0.0005826256237924099, 0.0005618666764348745, 0.0006105969659984112, 0.000621141167357564, 0.0016747952904552221, 0.0006498617003671825, 0.0008934533107094467, 0.000681699370034039, 0.0018353566993027925, 0.0007644310826435685, 0.001287162653170526, 0.0006674429751001298, 0.0006731956382282078, 0.0008164591272361577, 0.0005633385735563934, 0.0007084030658006668, 0.0005989499040879309, 0.0006183375953696668 ]

[ "using System.", "Threading;\nusing System.", "Threading.", "Tasks;\nusing FubarDev.", "FtpServer;\nusing Microsoft.", "Extensions.", "Hosting;\n\nnamespace TestAspNetCoreHost\n{\n internal class HostedFtpService : IHostedService\n {\n private readonly IFtpServerHost _ftpServerHost;\n\n /// <summary>\n /// Initializes a new instance of the <see cref=\"HostedFtpService\"/> class.", "\n /// </summary>\n /// <param name=\"ftpServerHost\">The FTP server host that gets wrapped as a hosted service.</param>\n public HostedFtpService(\n IFtpServerHost ftpServerHost)\n {\n _ftpServerHost = ftpServerHost;\n }\n\n /// <inheritdoc />\n public Task StartAsync(CancellationToken cancellationToken)\n {\n return _ftpServerHost.", "StartAsync(cancellationToken);\n }\n\n /// <inheritdoc />\n public Task StopAsync(CancellationToken cancellationToken)\n {\n return _ftpServerHost.", "StopAsync(cancellationToken);\n }\n }\n}\n" ]

{ "pile_set_name": "Github" }

[ 0.0007825386128388345, 0.0008529830956831574, 0.000995909096673131, 0.0007024086662568152, 0.0006860465509817004, 0.0007979196961969137, 0.0008128927438519895, 0.000838151085190475, 0.0007822262123227119, 0.0010065280366688967 ]

[ "Bordetella bronchiseptica infection in the cat.", "\nFeline Bordetella bronchiseptica infection had received little consideration until recent years when it has been increasingly documented in association with respiratory disease. ", "This article reviews current knowledge on the organism; its epidemiology, pathogenesis, and clinical, diagnostic and therapeutic features." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.002250547055155039, 0.0007627978338859975, 0.0005385346012189984 ]

[ "Q:\n\nEntity framework parent -> child linking and foreign key constrain failed error\n\nI'm using entity framework 7 (core) and Sqlite database. ", "Currently using comboBox to change entity category with this method:\n/// <summary>\n/// Changes the given device gategory.", "\n/// </summary>\n/// <param name=\"device\"></param>\n/// <param name=\"category\"></param>\npublic bool ChangeCategory(Device device, Category category)\n{\n if (device !", "= null && category !", "= null )\n {\n try\n {\n var selectedCategory = FxContext.", "Categories.", "SingleOrDefault(s => s.Name == category.", "Name);\n if (selectedCategory == null) return false;\n if (device.", "Category1 == selectedCategory) return true;\n\n device.", "Category1 = selectedCategory;\n device.", "Category = selectedCategory.", "Name;\n device.", "TimeCreated = DateTime.", "Now;\n return true;\n }\n catch (Exception ex)\n {\n throw new InvalidOperationException(\"Category change for device failed. ", "Possible reason: database has multiple categories with same name.\");", "\n }\n }\n return false;\n}\n\nThis function changes the category Id for the device just fine. ", "But is this correct way?", "\nAfter linking and then later on while deleting this category I get an error from the Sqlite database:\n\n{\"SQLite Error 19: 'FOREIGN KEY constraint failed'\"}\n\nThe delete category method\npublic bool RemoveCategory(Category category)\n{\n if (category == null) return false;\n var itemForDeletion = FxContext.", "Categories\n .Where(d => d.CategoryId == category.", "CategoryId);\n FxContext.", "Categories.", "RemoveRange(itemForDeletion);\n return true;\n}\n\nEDIT\nHere are the structures of device and category:\nCREATE TABLE \"Category\" (\n \"CategoryId\" INTEGER NOT NULL CONSTRAINT \"PK_Category\" PRIMARY KEY AUTOINCREMENT,\n \"Description\" TEXT,\n \"HasErrors\" INTEGER NOT NULL,\n \"IsValid\" INTEGER NOT NULL,\n \"Name\" TEXT\n)\n\nCREATE TABLE \"Device\" (\n \"DeviceId\" INTEGER NOT NULL CONSTRAINT \"PK_Device\" PRIMARY KEY AUTOINCREMENT,\n \"Category\" TEXT,\n \"Category1CategoryId\" INTEGER,\n CONSTRAINT \"FK_Device_Category_Category1CategoryId\" FOREIGN KEY (\"Category1CategoryId\") REFERENCES \"Category\" (\"CategoryId\") ON DELETE RESTRICT,\n)\n\nA:\n\nYour SQLite table has a foreign key restriction ON DELETE RESTRICT. ", "This means if any row in Devices still points to the category you are trying to delete, the SQLite database will prevent this operation. ", "To get around this, you can (1) explictly change all Devices to a different category or (2) change the ON DELETE behavior to something else, such as CASCADE or SET NULL. ", "See https://www.sqlite.org/foreignkeys.html#fk_actions\nIf you have used EF to create your tables, then configure your model to use a different on delete behavior. ", "The default is restrict. ", "See https://docs.efproject.net/en/latest/modeling/relationships.html#id2. ", "Example:\n modelBuilder.", "Entity<Post>()\n .HasOne(p => p.Blog)\n .WithMany(b => b.Posts)\n .OnDelete(DeleteBehavior.", "Cascade);\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006512105464935303, 0.0006798023823648691, 0.0007996979402378201, 0.007475007325410843, 0.0012849982595071197, 0.0007344353361986578, 0.000817473919596523, 0.0013380321906879544, 0.0006925875786691904, 0.0006347019807435572, 0.0006553080747835338, 0.0006387371686287224, 0.0007278253324329853, 0.0012835217639803886, 0.0006221955409273505, 0.0010583698749542236, 0.000707111437804997, 0.0010225747246295214, 0.0008968072943389416, 0.0006687402492389083, 0.0007344353361986578, 0.0007485324749723077, 0.0007518334896303713, 0.001010162173770368, 0.000739694107323885, 0.000673331378493458, 0.0006319817621260881, 0.000791689963079989, 0.0014720562612637877, 0.0007306004408746958 ]

[ "Thursday, January 17, 2013\n\nBHEL Recruitment Through GATE 2013 Score\n\nBHEL Recruitment Through GATE 2013 Score\n\nAge Limit: 27 Years as on 01/08/2013commencement of online application of bhel : January 2013Pay Scale: Rs.20600-46500/- (during Training)\n\nSelection Process:It will constitute of GATE 2013 Marks (out of 100) of the candidates in the concerned discipline & performance in Interview.", "\n\nThe candidates will be shortlisted for interview on the basis of GATE 2013 marks (out of 100) in order of merit in the ratio of 1:3 to the number of vacancies in each discipline and category. ", "For Physically Challenged candidates, relaxation of 50% below the cut-off marks will be provided in their respective categories for being shortlisted for interview.", "\n\nFinal selection panels shall be prepared by assigning a weightage of 75% for GATE- 2013 marks (marks out of 100) and 25% to Interview marks.", "\n\nService Agreement Bonds :Rs.2,00,000/ for 3 years\n\nHOW TO APPLY :\n\nRequired to take the GATE 2013.", "\n\nMarks obtained in GATE-2013 (marks out of 100) will be utilized by BHEL for inviting candidates for a Personal Interview for consideration for the position of Engineer Trainees.", "\n\nGATE 2013 Registration No. ", "is required for submission of online application to BHEL\n\nGATE 2013 Registration Number ( BHEL will not be responsible, if a candidate fills up GATE-2013 Registration Number wrongly. )", "\n\nCandidate should bring with him/her the GATE 2013 admit card, GATE 2013 official score card and other relevant documents which will be mentioned in the interview call letter.", "\n\nNote :\n\nCandidates who wish to apply for BHEL should choose their GATE-2013 exam paper code ME for Mechanical and equivalent discipline, EE for Electrical and quivalent discipline EC for Electronics and equivalent discipline only. ", "Candidates taking GATE - 2013 exam in codes other than ME, EE or EC will not be considered." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005822570528835058, 0.0005489669274538755, 0.0006192337023094296, 0.000532862264662981, 0.0005502048297785223, 0.0005370411090552807, 0.0006857928819954395, 0.0005695231375284493, 0.0005430812598206103, 0.0005457299994304776, 0.000538668071385473 ]

[ "من منا لا يعلم ويقدر أهمية عزل الأسطح؟ ", "بل من منا لا يحتاج إلى عزل الأسطح؟ ", "عزل الأسطح يعد من أهم الأمور التي لا غنى عنها لحماية أي منزل أو منشاة من خطر تسرب المياه والحرارة حيث أن هذا التسرب قد يؤدي إلى مشكلات خطيرة بالمبني لا يمكن تلافيها فيما بعد ولذلك يجب الإستعانة بـ شركة تيجان لأنها تعد أفضل شركة عزل شينكو بجدة تقدم لجميع عملائها أفضل أنواع العزل الحديث لحماية جميع منشآتهم من خطر تسربات الحرارة والرطوبة والتي لها آثار سلبية متعددة ليست على المباني فقط بل وعلى الصحة أيضاً وسيتم ذكرها فيما يلي ولذلك شركة عزل اسطح شينكو بجدة توفر أفضل الأيدي العاملة الماهرة المدربة على القيام بتنفيذ جميع أنواع العزل التي يمكن أن يحتاجها عملائنا الكرام كما أن شركتنا تراعي توفير أفضل وأجود أنواع المواد العازلة التي تم استيرادها من أفضل دول العالم المصنعة لتلك المواد بجودة عالية.", "\n\nما هي معلوماتك عن خصائص عزل أسطح شينكو ( Shinku ) بجدة ؟", "\n\nنظام العزل شينكو ( Shinku ) المرشوش يعد من أحدث أنظمة العزل واكفائها وهذا النوع معروف بأنه مقاوم التوصيل للحرارة وهذا في حال إذا ما تم مقارنته بمواد العزل الأخرى التي تتوفر بالأسواق المحلية والعالمية استخدام عزل شينكو ( Shinku ) يساعد في الاستغناء عن استخدام أي مواد عزل اخرى للحصول على مستوى العزل المطلوب أياً كان نوعة عزل حراري او عزل مائي، ولذلك يعد هذا النوع من العزل متكامل من حيث مقاومتة لتسرب المياه ومقاومة تسرب الحرارة، ومن أهم ما يميز هذا النوع من العزل (عزل الفوم المرشوش) أو ما يسمى بعزل الشينكو أنه يحول السقف إلى لوح واحد عازل للحرارة والماء ولا يوجد به أي فواصل تسمح بتسرب الماء أو الحرارة منها، ويعد هذا النوع من العزل من احدث انواع العزل المتعارف عليها عالمياً.\n\nأخطار تسربات المياه والحرارة إلى الأسطح\n\nتسربات المياه تؤثر على البنية الخرسانية لسطح المنشأة ويمكن أن تتلفه تماماً وصدأ الحديد بداخلها. ", "يمتد التلف للجدران ويمكن أن تتراكم المياه داخلها. ", "تسرب المياه داخل الأرضيات يؤدي إلى تلف في أثاث وأعمدة المنزل. ", "حدوث تسربات بالمنزل قد يؤدي إلى العديد من الأضرار الصحية على سكان المنزل نتيجة الي تراكم بيكتريا العفن والميكروبات.", "\n\n’’ شركة تيجان بجدة من أهم شركات العزل بجدة، كما أنها أفضل شركة عزل شينكو بجدة حيث أن تم إنشاء هذا القسم خصيصا لحماية منشأت عملائنا الكرام من خطر التسرب، وتقوم الشركة بتأدية خدمات عزل الاسطح بجميع أنواعه بأفضل وأجود المواد العازلة وبأسعار رخيصة ومميزة جداً فأسعار شركتنا أفضل وأرخص أسعار شركة عزل أسطح شينكو بجدة ,,\n\nأهم ما يميز شركة عزل اسطح شينكو بجدة\n\nشركة عزل اسطح شينكو بجدة تعمل على كسب ثقة ورضاء عملائها الكرام فى المقام الأول.", "\n\nتعمل على كسب ثقة ورضاء عملائها الكرام فى المقام الأول. ", "تستخدم الشركة أحدث الأجهزة والمعدات المصممة خصيصاً للاستخدام فى عمليات العزل.", "\n\nشركة عزل شينكو بجدة لديها فريق عمل مميز بالخبرة والمهارة والمصداقية في تنفيذ جميع مهام العزل على أعلى مستوى.", "\n\nلديها فريق عمل مميز بالخبرة والمهارة والمصداقية في تنفيذ جميع مهام العزل على أعلى مستوى. ", "تتبع الشركة أحدث الأسس والمعايير العالمية فى مجال العزل وهذا ما جعل من شركة عزل الاسطح بجدة تحتل المركز الاول بين الشركات التي تعمل فى مجال العزل.", "\n\nتحتل المركز الاول بين الشركات التي تعمل فى مجال العزل. ", "تقوم شركة عزل اسطح شينكو بجدة بعزل الأسقف مهما كانت مساحتها صغيرة أو كبيرة بأحدث طرق العزل التكنولوجية الحديثة كما أنها تبتعد تماماً عن طرق العزل التقليدية القديمة.", "\n\nبعزل الأسقف مهما كانت مساحتها صغيرة أو كبيرة بأحدث طرق العزل التكنولوجية الحديثة كما أنها تبتعد تماماً عن طرق العزل التقليدية القديمة. ", "تقوم الشركة بتدريب فريق عملها بصورة مستمرة على كل ما هو جديد في عالم العزل لمواكبة ما يجد من المتغيرات العصرية والدراية الكاملة بها حتى نحتفظ بتقدم مستوى الشركة دائماً .", "\n\nتقدم شركة عزل اسطح شينكو خدمتها لجميع العملاء باقل وافضل اسعار عزل شينكو بجدة .", "\n\nخدمتها لجميع العملاء باقل وافضل . ", "من أهم ما تقوم به شركة عزل اسطح شينكو أنها تقوم بتنظيف الاسطح جيدا من أي أتربة أوغبار قبل وضع المواد العازلة عليها.", "\n\nأنها تقوم بتنظيف الاسطح جيدا من أي أتربة أوغبار قبل وضع المواد العازلة عليها. ", "تقوم الشركة باستخدام أحدث أنواع المواد العازلة وافضلها على الاطلاق والتي يتم استخدامها في العديد من اكبر دول العالم.", "\n\nتمتاز الشركة بأفضل خدمة عملاء لتقديم خدمات الرد السريع والتواصل مع العملاء وتنفيذ الخدمات لكسب الثقة بين الشركة والعملاء.", "\n\nهل تعلم ما هي أهم مميزات عزل شينكو؟", "\n\nيمتاز هذا النوع من العزل بمنع تسرب الحرارة والمياه والرطوبة للأسطح نهائيا.", "\n\nهذا النوع من العزل يعد عزل مزدوج أي حراري ومائي في نفس الوقت.", "\n\nيمتاز عزل الفوم بالسرعة فى عملية إنجاز تنفيذه واستخدام السطح المعزول فى فترة قياسية.", "\n\nعزل الفوم يتميز بسهولة التحكم فى سمكة وكثافته بما يناسب احتياجات سطح المنشأة.", "\n\nهذا النوع من العزل يتميز بعدم تأثره بالفطريات أو الحشرات وليس له أي رائحة كريهة.", "\n\nومن أهم ما يميز عزل اسطح شينكو\n\nعزل الفوم أفضل نظام عزل مثالي لجميع الأسطح المعدنية والشينكو.", "\n\nخطوات عملية عزل الشينكو بجدة ؟", "\n\nما يدفعنا إلى عملية عزل المنشآت هو حل مشاكل تسربات مياه الأمطار في فصل الصيف وتخفيف درجة الحرارة العالية صيفاً ونحن في شركة عزل الفوم للشينكو نقوم بعمل احدث عزل شينكو لحماية مزدوجة للمنشآت والمنزل من مشكلات الحرارة وتسرب المياه ويتم العزل من خلال مجموعة الخطوات وتتمثل فيما يلي :-\n\n1- يتم تنظيف السطح من الشوائب والأتربة الموجودة عليها تماماً.\n\n2- ويفضل غسل السطح بالماء إذا أمكن ذلك.", "\n\n3– يمكنا استخدام الهواء لتجفيف السطح المراد إتمام عملية العزل له ويفضل تنفيذ تلك الخطوة لأن مواد العزل تكون أصلب على الأسطح الجافة.", "\n\n4– يتم عمل طبقة أولية قبل العزل تعد بمثابة طبقة أساس لإغلاق الفتحات والصغرات الموجودة في السطح .", "\n\n5- يتم عمل طبقة العزل الأولى بسمك 1,5 سم من المادة العزلة المستخدمة.", "\n\n6- ثم يتم عمل طبقة العزل الثانية بسمك 1,5 سم من المادة العازلة.", "\n\n7- يتم عمل الطبقة الاخيرة من العزل وتكون من مادة مطاطية حماية لطبقات عزل السطح.", "\n\nهل تعلم ما هي أهمية عزل الشينكو للاسطح بجدة ؟", "\n\nعزل الاسطح بالشينكو يزيد من قوة ومتانة الأسطح ويزيد من صلابتها.", "\n\nيزيد من قوة ومتانة الأسطح ويزيد من صلابتها. ", "عزل الاسطح بجدة يمنع تسرب مياه الأمطار فى فصل الشتاء إلى أسقف وجدران المنشآت مما جعل جميع أصحاب المنشآت يقدرون أهمية العزل وضرورته لحماية المنشأة من تسرب المياه شتاءاً و تسرب الحرارة صيفاً.\n\nيمنع تسرب مياه الأمطار فى فصل الشتاء إلى أسقف وجدران المنشآت مما جعل جميع أصحاب المنشآت يقدرون أهمية العزل وضرورته لحماية المنشأة من تسرب المياه شتاءاً و تسرب الحرارة صيفاً. من أهم ما يميز عزل الاسطح شينكو بجدة\n\nمن أهم ما يميز عزل الاسطح الشينكو أن تكلفته أقل بكثير من استخدام طرق عزل الأسطح العادية.", "\n\nأن تكلفته أقل بكثير من استخدام طرق عزل الأسطح العادية. ", "يتميز عزل الشينكو شركة عزل اسطح شينكو بجدة تقدم لجميع عملائها ضمان يمتد للعديد من السنوات، وهذا ما يمزيز مؤسسة تيجان عن بقية شركات العزل بجدة .", "\n\n0553898030" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0009757417719811201, 0.0008434500196017325, 0.002989310771226883, 0.0008750311098992825, 0.002321002772077918, 0.0008571546641178429, 0.0008912145858630538, 0.0012094593839719892, 0.0017900321399793029, 0.0009157113963738084, 0.0010055863531306386, 0.001141420449130237, 0.0010345051996409893, 0.001163297682069242, 0.0008701343322172761, 0.001267826883122325, 0.0011990104103460908, 0.0011881878599524498, 0.0010493581648916006, 0.0007994297193363309, 0.0012379975523799658, 0.0009867016924545169, 0.0012164274230599403, 0.0011764370137825608, 0.0008821745868772268, 0.0010134049225598574, 0.0009748009615577757, 0.001060859183780849, 0.0009924967307597399, 0.0011147047625854611, 0.001137570827268064, 0.0009066271595656872, 0.0018242126097902656, 0.0013183464761823416, 0.0011848114663735032, 0.0009101709583774209, 0.000883183442056179, 0.001017267000861466, 0.0009698097128421068, 0.0009026542538776994, 0.000821309513412416, 0.002276542130857706, 0.0009118932066485286, 0.00126900605391711, 0.0022005359642207623 ]

[ "[Outcome of adolescent suicide attempts].", "\nStudies about the outcome of adolescent suicide attempts have generally shown a bad prognosis. ", "The main short-term risk is the repetition of the attempt which occurs in one case out of three. ", "The main long-term risks are increased rates of mortality, about twenty fold compared to the population of same age, and persisting psycho-social problems. ", "Follow-up care is therefore very necessary, but drop out is frequent. ", "Practician's determination and decisions at the time of the attempt are therefore an important stake." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.002449146704748273, 0.0013175192289054394, 0.0006309460150077939, 0.0007266072789207101, 0.0007914153975434601, 0.0006050659576430917 ]

[ "Erratum: Vol. ", "65, No. ", "26.", "\nIn the report, \"Notes from The Field: Ebola Virus Disease Cluster - Northern Sierra Leone, January 2016,\" the name of a member of The Interagency Investigation Team was incorrect and should have read as follows: \"Matthew Cotten, PhD, Wellcome Trust Sanger Institute, United Kingdom.\"" ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0015579262981191278, 0.0008498883689753711, 0.0010643150890246034, 0.0005583207821473479 ]

[ "using System.", "Collections.", "Generic;\nusing System.", "Linq;\n\nnamespace Wexflow.", "Core.", "ExecutionGraph.", "Flowchart\n{\n /// <summary>\n /// Case.", "\n /// </summary>\n public class Case\n {\n /// <summary>\n /// Case value.", "\n /// </summary>\n public string Value { get; set; }\n /// <summary>\n /// Case nodes.", "\n /// </summary>\n public Node[] Nodes { get; set; }\n\n /// <summary>\n /// Creates a new case.", "\n /// </summary>\n /// <param name=\"val\">Case value.</param>\n /// <param name=\"nodes\">Case nodes.</param>\n public Case(string val, IEnumerable<Node> nodes)\n {\n Value = val;\n if (nodes !", "= null)\n {\n Nodes = nodes.", "ToArray();\n }\n }\n }\n}\n" ]

{ "pile_set_name": "Github" }

[ 0.0007825386128388345, 0.000805516610853374, 0.0007577104843221605, 0.0007460464257746935, 0.0007933752494864166, 0.0007430252735503018, 0.0007783789187669754, 0.0007083359523676336, 0.000814310391433537, 0.0008234065608121455, 0.001107758842408657, 0.0024287456180900335, 0.00094749586423859 ]

[ "Estradiol and phorbol ester cause phosphorylation of serine 118 in the human estrogen receptor.", "\nSerine 118 is definitively identified as a major site of phosphorylation in the human estrogen receptor expressed in COS-1 cells treated with estradiol or phorbol ester. ", "At least 30% of the estrogen receptor appears to be phosphorylated on serine 118 after treatment with estradiol or phorbol ester. ", "Human estrogen receptor was expressed in COS-1 cells and labeled in vivo with [32P]orthophosphate in the presence of estradiol or phorbol ester. ", "Immunopurified receptor was digested with cyanogen bromide. ", "The most heavily labeled peptide (7 kilodaltons) was identified as amino acids 110-174 by microsequencing. ", "Manual Edman degradation released a major portion of the 32P-label in the peptide at serine 118. ", "A mutant with serine 118 replaced by alanine (S118A) had 80% less 32P-label in the 7 kilodalton peptide. ", "Estrogen receptor labeled in vivo with [32P]-orthophosphate in the presence of estradiol or phorbol ester migrates electrophoretically as a doublet. ", "The major difference between the bands is phosphorylation of serine 118 in the upshifted band. ", "The mutant S118A does not show an upshifted band. ", "Labeling of the estrogen receptor with [35S]methionine indicates that > or = 30% of the receptor is upshifted and suggests that > or = 30% of the receptor is phosphorylated on serine 118." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0010470413835719228, 0.0007894702139310539, 0.000739323440939188, 0.0007324021426029503, 0.0026751437690109015, 0.0006172668072395027, 0.0006345900474116206, 0.0009477915009483695, 0.0013879864709451795, 0.0007556572090834379, 0.0014585130847990513, 0.0007613718044012785 ]

[ "The effect of distractors on saccades and adaptation of saccades in strabismus.", "\nThis paper reports two experiments to determine the contribution of the suppressing eye to the generation of saccadic eye movements in constant strabismus. ", "Eye movements were recorded using a Skalar infra-red recorder. ", "Experiment 1 tested six participants with constant strabismus, pathological suppression and no clinically demonstrable binocular single vision (BSV). ", "We explored the effect of visual distractors presented monocularly (to either the fixing eye or the strabismic eye) and binocularly, on saccade latency and accuracy. ", "Saccade latency significantly increased when distractors were presented to the strabismic eye compared to the no distractor condition. ", "In all participants the effect on latency, with distractors presented to the strabismic eye, was maximum when distractors were presented towards the location of the anatomical fovea. ", "Saccade accuracy was reduced with ipsilateral distractors to the target when presented binocularly or monocularly to the fixing eye but not affected by distractors presented to the strabismic eye. ", "Experiment 2 investigated fast disconjugate saccade adaptations in six participants with constant strabismus, pathological suppression and no clinically demonstrable BSV and for comparison 8 with normal bifoveal BSV. ", "Saccade disconjugacy was induced using an electronic feedback system in which the calibrated eye movement position signal could be scaled by a factor (the feedback gain) to move the target visible to one eye during binocular viewing. ", "In all BSV participants and 3 of 6 participants with constant strabismus, saccadic adaptation occurred rapidly such that under conditions of visual feedback saccades became increasingly disconjugate. ", "These disconjugacies persisted when normal viewing conditions were restored. ", "The presence of an adaptive mechanism to adjust the binocular co-ordination of saccades in the presence of constant strabismus with suppression and no clinically demonstrable BSV has been demonstrated. ", "Mechanisms that might explain such results are discussed." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0009224152308888733, 0.0009629852720536292, 0.000644077081233263, 0.0010858823079615831, 0.0006265302654355764, 0.0008352441946044564, 0.0008324621012434363, 0.0007578444783575833, 0.0009572373819537461, 0.0007042499491944909, 0.0007369761005975306, 0.0007069268613122404, 0.000714520167093724, 0.0005534848896786571 ]

[ "Enzymes are the vital activators in life processes, likewise in the soil they are known to play a substantial role in maintaining soil health and its environment. ", "A unique balance of chemical, physical, and biological (including microbial especially enzyme activities) components contribute to maintaining soil health. ", "Healthy soils are essential for the integrity of terrestrial ecosystems to remain intact or to recover from disturbances, such as drought, climate change, pest infestation, pollution, and human exploitation.", "\n\n\n\n\n\nAs soil is the part of the terrestrial environment and supports all terrestrial life forms, protection of soil is therefore of high priority and a thorough application of soil enzymes is a critical factor in assuring that soil remains healthy.", "\n\n" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0005896183429285884, 0.0005920161493122578, 0.0006067785434424877, 0.0005508512840606272, 0.001994825666770339 ]

[ "Q:\n\nIf-statement while loop stopping after first row\n\nI have the following PHP script that takes the selected $empfullname from the user and prints 'timecard_html' based on the selection. ", "I am trying to make it capable that if they select 'All' then the script prints out all of the employees in the list each in a separate timecard_html. ", "Here is the php script:\nif ($empfullname == 'All') {\n $query = \"select empfullname from \".$db_prefix.", "\"employees\";\n $result = mysql_query($query);\n while ($row=mysql_fetch_array($result)) {\n $empfullname = (\"\".$row['empfullname'].\"\");", "\n print timecard_html($empfullname, $local_timestamp_in_week);\n unset($empfullname);\n }\n} else {\n print timecard_html($empfullname, $local_timestamp_in_week);\n\n}\n\nAlso, here is timecard_html in case you need to see it:\nfunction timecard_html($empfullname, $local_timestamp_in_week) {\n // Return html of employee's timecard.", "\n global $show_display_name, $one_week;\n\n // SQL search parameters for one work week.", "\n $begin_local_timestamp = work_week_begin($local_timestamp_in_week);\n $end_local_timestamp = $begin_local_timestamp + $one_week;\n\n // Define helper functions for printing timecard header, footer, and for printing every row.", "\n function print_header($tc) {\n // Print timecard html header.", "\n global $overtime_week_limit, $timecard_display_running_total;\n\n $overtime_col = $overtime_week_limit > 0 ? \"", "\\n <th align=\\\"center\\\" class=\\\"ovt\\\" title=\\\"Overtime hours\\\">OT</th>\" : '';\n $total_col = $timecard_display_running_total == \"yes\" ? \"", "\\n <th align=\\\"center\\\" class=\\\"total\\\" title=\\\"Running total of regular work hours and overtime to date.\\\">Total</th>\" : '';\n print <<<End_Of_HTML\n\n<table class=\"misc_items timecard_list\" border=\"0\" cellpadding=\"2\" cellspacing=\"0\" style=\"margin:0 auto;\">\n <thead>\n <tr>\n <th align=\"left\">In/Out</th>\n <th align=\"center\">Time</th>\n <th align=\"center\">Date</th>\n <th align=\"center\" class=\"hrs\" title=\"Regular work hours.", "\">Hrs</th>$overtime_col$total_col\n <th align=\"left\" class=\"notes\">Notes</th>\n </tr>\n </thead>\n <tbody>\nEnd_Of_HTML;\n }\n\n function print_row($tc) {\n // Configuration variables.", "\n global $timefmt, $datefmt;\n global $overtime_week_limit, $timecard_list_punch_outs, $timecard_display_hours_minutes;\n global $timecard_hours_include_overtime, $timecard_display_running_total;\n static $print_count = 0;\n\n if (($tc->in_or_out == 1) || $timecard_list_punch_outs == 'yes') {\n $h_color = htmlentities($tc->row['color']);\n $h_inout = htmlentities($tc->row['inout']);\n\n $h_time = date($timefmt, $tc->start_time);\n $h_date = date($datefmt, $tc->start_time);\n\n if ($timecard_display_hours_minutes == \"yes\") {\n $h_hours = hrs_min((($timecard_hours_include_overtime == \"yes\") ? (", "$tc->hours + $tc->overtime) : $tc->hours));\n $h_overtime = hrs_min($tc->overtime);\n $h_total = hrs_min(($tc->week_hours + $tc->overtime_hours));\n }\n else {\n $h_hours = sprintf(\"%01.02f\",(($timecard_hours_include_overtime == \"yes\") ? (", "$tc->hours + $tc->overtime) : $tc->hours));\n $h_overtime = sprintf(\"%01.02f\",$tc->overtime);\n $h_total = sprintf(\"%01.02f\",($tc->week_hours + $tc->overtime_hours));\n }\n\n $h_notes = htmlentities($tc->row['notes']);\n\n if ($tc->in_or_out !", "= 1) {\n // Don't display hours on \"out\" records.", "\n $h_hours = $h_overtime = $h_total = '';\n }\n\n $row_class = (++$print_count % 2) ? '", "odd' : 'even';\n $overtime_col = $overtime_week_limit > 0 ? \"", "\\n <td align=\\\"right\\\" class=\\\"ovt\\\">$h_overtime</td>\" : '';\n $total_col = $timecard_display_running_total == \"yes\" ? \"", "\\n <td align=\\\"right\\\" class=\\\"total\\\">$h_total</td>\" : '';\n print <<<End_Of_HTML\n\n <tr class=\"display_row $row_class\">\n <td align=\"left\" class=\"job_code\" style=\"color:$h_color\">$h_inout</td>\n <td align=\"right\">$h_time</td>\n <td align=\"right\">$h_date</td>\n <td align=\"right\" class=\"hrs\">$h_hours</td>$overtime_col$total_col\n <td align=\"left\" class=\"notes\">$h_notes</td>\n </tr>\nEnd_Of_HTML;\n }\n }\n\n function print_footer($tc) {\n global $timecard_display_running_total, $timecard_hours_include_overtime;\n global $timecard_display_hours_minutes, $overtime_week_limit;\n\n // Set flag to print paragraph of totals if they're not already obvious.", "\n $print_totals = ($timecard_display_running_total == \"yes\" || $timecard_hours_include_overtime !", "= \"yes\") ? ", "true : false;\n\n $h_total_hours = sprintf(\"%01.02f\",($tc->week_hours+$tc->overtime_hours));\n $h_totals = ($print_totals) ? \"", "\\n<p>Total for week: \".hrs_min($tc->week_hours + $tc->overtime_hours).\" (", "$h_total_hours hours)</p>\" : '';\n\n $h_ovt_total_hours = sprintf(\"%01.02f\",$tc->overtime_hours);\n $h_overtime_totals = ($print_totals && $tc->overtime_hours > 0) ? \"", "\\n<p>Total overtime: \".hrs_min($tc->overtime_hours).\" (", "$h_ovt_total_hours hours)</p>\" : '';\n\n $h_day_total_hours = sprintf(\"%01.02f\",$tc->today_hours);\n $h_today_hours = ($tc->today_hours !", "== null) ? \"", "<p>Total today: \".hrs_min($tc->today_hours).\" (", "$h_day_total_hours hours)</p>\" : '';\n\n if ($timecard_display_running_total !", "= \"yes\") {\n // Print row of totals \n $total_hours = $timecard_hours_include_overtime == \"yes\" ? (", "$tc->week_hours+$tc->overtime_hours) : $tc->week_hours;\n $h_hours = $timecard_display_hours_minutes == \"yes\" ? ", "hrs_min($total_hours) : $h_total_hours;\n $overtime_col = $overtime_week_limit > 0 ? \"", "\\n <td align=\\\"right\\\" class=\\\"ovt\\\">\".($timecard_display_hours_minutes == \"yes\" ? ", "hrs_min($tc->overtime_hours) : $h_ovt_total_hours).\"</td>\" : '';\n $total_col = $timecard_display_running_total == \"yes\" ? \"", "\\n <td align=\\\"right\\\" class=\\\"total\\\">\".($timecard_display_hours_minutes == \"yes\" ? ", "hrs_min($tc->week_hours+$tc->overtime_hours) : $h_total_hours).\"</td>\" : '';\n print <<<End_Of_HTML\n <tr class=\"total_row\">\n <td align=\"left\"></td>\n <td align=\"right\"></td>\n <td align=\"right\"></td>\n <td align=\"right\" class=\"hrs\">$h_hours</td>$overtime_col$total_col\n <td align=\"left\" class=\"notes\"></td>\n </tr>\nEnd_Of_HTML;\n }\n\n print <<<End_Of_HTML\n </tbody>\n</table>\nEnd_Of_HTML;\n if ($timecard_display_running_total == \"yes\" || $timecard_hours_include_overtime !", "= \"yes\" || $h_today_hours) {\n // Add totals text if totals are not already displayed or if summing the hours column is confusing.", "\n print <<<End_Of_HTML\n\n<div class=\"totals\">\n$h_today_hours$h_totals$h_overtime_totals\n</div>\n\nEnd_Of_HTML;\n }\n }\n // End of helper function definitions.", "\n\n // Print timecard page header.", "\n $h_name_header = htmlentities( ($show_display_name == 'yes' ? ", "get_employee_name($empfullname) : $empfullname) );\n $begin_date = date('l F j, Y',$begin_local_timestamp);\n print <<<End_Of_HTML\n\n<div id=\"punchclock\" class=\"timecard\">\n<h2>Timecard</h2>\n<h3>$h_name_header</h3>\n<h4>Week beginning $begin_date</h4>\nEnd_Of_HTML;\n\n // Print timecard.", "\n $tc = new Timecard($empfullname,$begin_local_timestamp, $end_local_timestamp);\n list($row_count, $total_hours, $overtime_hours, $today_hours) = $tc->walk(print_header, print_row, print_footer);\n if ($row_count <= 0) print error_msg(\"No records were found.\");", "\n\n // Print timecard page footer.", "\n print <<<End_Of_HTML\n</div> <!-- ", "timecard -->\n\nEnd_Of_HTML;\n}\n?", ">\n\nAs of right now if 'All' is selected it prints the results for the first employee in the table, but not any of the other ones. ", "Also, if I just print (\"\".$row['empfullname'].\"\") ", "it prints out all the employees. ", "Do I maybe need to use a for each loop instead of a while loop?", "\nThanks in advance.", "\n\nA:\n\nYour problem is that your are defining functions in your function. ", "That will work the first time when you call your function, but the second time it will cause a fatal error as the function is already defined.", "\nSee a simple example here.", "\nMoving the inner function declarations out of the main function should solve this specific problem.", "\nYou should also always enable error handling and displaying while developing. ", "In this case you would have caught the problem inmediately.", "\nJust put this at the top of the main script:\nini_set('display_errors',1);\nerror_reporting(E_ALL | E_STRICT);\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006796838715672493, 0.0005692027043551207, 0.0006978501915000379, 0.0007228432805277407, 0.0007480636122636497, 0.0006141885532997549, 0.0006989736575633287, 0.0006731379544362426, 0.0007637950475327671, 0.0008486106526106596, 0.0007787951035425067, 0.0008212762768380344, 0.000996988033875823, 0.0008139996789395809, 0.0009113607229664922, 0.0007142511894926429, 0.0009261667728424072, 0.000796357577200979, 0.0008351575233973563, 0.0008620067383162677, 0.0008244087221100926, 0.0006718634394928813, 0.0008373767486773431, 0.0009230737923644483, 0.000834762875456363, 0.0009133805870078504, 0.0014225419145077467, 0.005494715180248022, 0.0006998478784225881, 0.0008987361798062921, 0.000598518701735884, 0.0008055081125348806, 0.0007116859778761864, 0.0007429604884237051, 0.0007125709089450538, 0.0007166997529566288, 0.000877071637660265, 0.0006094197160564363, 0.0008231248357333243, 0.0006853388040326536, 0.0007176056387834251, 0.0009807887254282832, 0.0007217488018795848, 0.0007573856855742633, 0.0009681188385002315, 0.0007347052451223135, 0.0005853153998032212, 0.000646973610855639, 0.0006585288792848587, 0.0007967386627569795, 0.0005687347147613764, 0.03537367284297943, 0.0007807564688846469, 0.0005839810473844409, 0.0006933836848475039, 0.0005790761206299067, 0.000631688570138067, 0.000668283726554364 ]

[ "Validation of a cortisol enzyme immunoassay and characterization of salivary cortisol circadian rhythm in chimpanzees (Pan troglodytes).", "\nMonitoring concentrations of stress hormones is an important tool for behavioral research and conservation for animals both in the wild and captivity. ", "Glucocorticoids can be measured in mammals as an indicator of stress by analyzing blood, feces, urine, hair, feathers, or saliva. ", "The advantages of using saliva for measuring cortisol concentrations are three-fold: it is minimally invasive, multiple samples can be collected from the same individual in a short timeframe, and cortisol has a relatively short response time in saliva as compared with other materials. ", "The purpose of this study was to: (1) conduct an adrenocorticotropic hormone (ACTH) challenge as a physiological validation for an enzyme immunoassay to measure salivary cortisol in chimpanzees and (2) characterize the circadian rhythm of salivary cortisol in chimpanzees. ", "We determined that salivary cortisol concentrations peaked 45 min following the ACTH challenge, which is similar to humans. ", "Also, salivary cortisol concentrations peaked early in the morning and decreased throughout the day. ", "We recommend that saliva collection may be the most effective method of measuring stress reactivity and has the potential to complement behavioral, cognitive, physiological, and welfare studies." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0008605349576100707, 0.0005943631986156106, 0.005649767816066742, 0.0006027561030350626, 0.0009712442988529801, 0.0006413534283638, 0.0006260390509851277, 0.0005504445289261639 ]

[ "WEBVTT\n00:00:00.540 --> 00:00:05.260\nAnyway, let's get things going\nand talk about cloud nirvana.", "\n00:00:05.310 --> 00:00:11.570\nI mean that's what the cloud is,\nisn't it? ", "You guys, all you\n00:00:11.620 --> 00:00:15.890\nguys professionals, what\ndoes professionals mean?", "\n00:00:16.880 --> 00:00:18.310\nAre you all professionals?", "\n00:00:19.450 --> 00:00:22.890\nYeah, you get paid for it so you\nmust be professionals. ", "I presume\n00:00:22.940 --> 00:00:27.490\nyou're interested in the transition\nfrom on premises Exchange.", "\n00:00:27.540 --> 00:00:29.630\nAre you looking for good reasons\nwhy you are not going to go\n00:00:29.680 --> 00:00:31.280\nto the cloud? ", "That's\nwhy you are here.", "\n00:00:31.940 --> 00:00:35.920\nWe'll talk a lot about all the\nthings that you need to figure\n00:00:35.970 --> 00:00:38.920\nout, factor into your\ntransition plan.", "\n00:00:40.660 --> 00:00:41.290\nTo begin,\n00:00:43.800 --> 00:00:45.490\ndo you remember Exchange 4.0?", "\n00:00:47.290 --> 00:00:50.990\nAnybody? ", "It was good, wasn't it?", "\n00:00:53.430 --> 00:00:56.400\nEspecially when you install it\non Pentium-class systems.", "\n00:00:57.610 --> 00:00:58.260\nThat was fun.", "\n00:01:00.340 --> 00:01:05.720\nThe one great thing 4.0 did a long,\nlong time ago, 19 years ago,\n00:01:06.530 --> 00:01:10.080\nis it proved Microsoft's credentials\nin the enterprise.", "\n00:01:10.440 --> 00:01:13.590\nBecause up to that point in time\nMicrosoft was essentially a\n00:01:13.640 --> 00:01:17.290\ndesktop company, a PC company,\nExcel, Word et cetera.", "\n00:01:17.850 --> 00:01:22.150\nBut then Exchange 4.0 came out\nand it was so much better then\n00:01:22.200 --> 00:01:26.680\nMS Mail and people turned around\nand said these guys can actually\n00:01:26.730 --> 00:01:28.440\nbuild enterprise applications.", "\n00:01:30.890 --> 00:01:32.950\nNineteen years ago Exchange 4.0\n00:01:34.210 --> 00:01:39.100\nhelp to launch Microsoft into the\nenterprise space and now Exchange\n00:01:39.150 --> 00:01:44.750\nOnline is helping prove the same\nkind of credentials in the cloud\n00:01:44.800 --> 00:01:47.950\nbecause e-mail is the easiest workload\nto move to the cloud.", "\n00:01:48.610 --> 00:01:51.360\nIt's the reason why an awful lot\nof people are moving to the\n00:01:51.410 --> 00:01:54.710\ncloud and it's very successful\nin the cloud.", "\n00:01:56.050 --> 00:02:02.000\nIn short, Exchange is the gateway\ndrug to the cloud.", "\n00:02:02.050 --> 00:02:06.670\nAnd it's gathering pace, this move.", "\n00:02:07.190 --> 00:02:09.270\nAnd there are many, many influences.", "\n00:02:10.210 --> 00:02:13.280\nSome of it is because of the enormous\ninvestment that Microsoft\n00:02:13.330 --> 00:02:15.790\nis making in spreading data\ncenters around the world.", "\n00:02:16.420 --> 00:02:23.170\nRecent additions for Office 365 were\nin Austria in Vienna and Finland.", "\n00:02:24.370 --> 00:02:25.070\nThat's good.", "\n00:02:26.110 --> 00:02:31.860\nI think also we've got much better network\nbandwidth, generally speaking.", "\n00:02:31.910 --> 00:02:34.140\nI mean there are some parts of the\nworld where you still can't\n00:02:34.190 --> 00:02:37.410\nget decent bandwidth, but generally\nspeaking the vast bulk of\n00:02:37.460 --> 00:02:40.760\nthe world is better connected than\never before. ", "And you've got\n00:02:40.810 --> 00:02:45.360\nthings like Express Route and things\nlike that are coming and\n00:02:45.410 --> 00:02:49.510\nmaking it easier to get data over\nto the cloud. ", "I think then\n00:02:49.560 --> 00:02:52.090\nalso there is no doubt that we\nhave had a lot of opportunity\n00:02:52.140 --> 00:02:56.730\nto learn about the cloud, and this\nmeans that most large corporations\n00:02:56.780 --> 00:03:00.250\nnow have actually signed up to become\none of the over 1 million\n00:03:00.300 --> 00:03:02.660\ncloud tenants in Office 365.", "\n00:03:03.320 --> 00:03:07.490\nThey may not be using it, but they\nare sniffing at the edges.", "\n00:03:07.540 --> 00:03:08.490\nThey're interested.", "\n00:03:09.440 --> 00:03:12.690\nAnd they're interested because\ngenerally speaking within the\n00:03:12.740 --> 00:03:16.060\nindustry, people are\nsaying this works.", "\n00:03:16.900 --> 00:03:18.310\nAnd economics work.", "\n00:03:19.360 --> 00:03:23.570\nI tweeted something the other day\nwhen Perry Clark talked about\n00:03:23.620 --> 00:03:28.480\nthis in the Office 365 inside the\ncurtain session. ", "He said that\n00:03:28.530 --> 00:03:29.380\nin his view\n00:03:30.710 --> 00:03:35.360\na mailbox in Office 365 is always\ngoing to be cheaper than it\n00:03:35.410 --> 00:03:36.870\nis on premises.", "\n00:03:37.990 --> 00:03:41.790\nAnd he's actually right, because\nwhen you nest out all of the\n00:03:41.840 --> 00:03:45.860\ncosts of delivering something like\na 50 gigabyte mailbox and\n00:03:45.910 --> 00:03:51.710\n100 gigabyte archive and all of\nthe other functionality that's\n00:03:51.760 --> 00:03:55.310\nin Office 365 and you compare it\nto what it would cost you to\n00:03:55.360 --> 00:03:58.050\nprovide that on prem,\n00:03:59.610 --> 00:04:01.000\nit's a hard, hard\n00:04:02.500 --> 00:04:06.700\ncase to make that on prem is going\nto be cheaper, because it's not.", "\n00:04:07.390 --> 00:04:12.290\nThe scale that Microsoft buys hardware,\nthe scale that they operate\n00:04:12.340 --> 00:04:17.670\nat allows them to get down to a\npoint where a gigabyte of data\n00:04:17.720 --> 00:04:21.440\nto them costs a couple\nof pennies per month.", "\n00:04:23.740 --> 00:04:25.630\nYou can't operate at\nthat kind of scale.", "\n00:04:27.590 --> 00:04:30.820\nI think another important thing\nis that the SLA performance is\n00:04:30.870 --> 00:04:33.380\ngenerally Excellent. ", "Now there\nhave been big outages.", "\n00:04:33.430 --> 00:04:34.790\nThere's no doubt about that.", "\n00:04:35.790 --> 00:04:40.190\nBy big I mean well-publicized outages,\nsuch as the one last July\n00:04:41.200 --> 00:04:44.470\nwhen parts of the United States,\nin particular were affected.", "\n00:04:44.520 --> 00:04:45.980\nBut let me tell you this.", "\n00:04:47.590 --> 00:04:50.280\nBecause Office 365 is now so big\n00:04:51.540 --> 00:04:57.480\nthat even an outage that might\naffect 100,000 mailboxes is no\n00:04:57.530 --> 00:05:03.550\nmore than a little insignificant\nblip in the overall performance\n00:05:03.600 --> 00:05:04.660\nof the service.", "\n00:05:05.510 --> 00:05:09.570\nGenerally speaking, and I have been\nin Office 365 user for the\n00:05:09.620 --> 00:05:13.810\nlast four years, I've received\nnothing but Excellent service.", "\n00:05:13.860 --> 00:05:20.730\nI could not make on prem Exchange run\nat the same kind of service level.", "\n00:05:20.780 --> 00:05:26.820\nI couldn't simply because updating\na DAG member server is so\n00:05:26.870 --> 00:05:29.420\ndestructive, something like\nthat, simple stuff.", "\n00:05:29.980 --> 00:05:32.130\nAnd don't get me going\nabout server security.", "\n00:05:33.660 --> 00:05:34.700\nThey are disruptive.", "\n00:05:35.880 --> 00:05:38.320\nAnd then, of course, you've got these\npundits. ", "Who are these pundits?", "\n00:05:38.370 --> 00:05:41.630\nDoes anybody know what the word pundit\nmeans or where it came from?", "\n00:05:45.400 --> 00:05:46.270\nFox News.", "\n00:05:50.270 --> 00:05:54.010\nIs there a Republican supporter\nhere? ", "Can we have him removed?", "\n00:05:57.740 --> 00:06:01.200\nHe's making jokes, okay. ", "That's good.", "\nYou can Tweet that. ", "That's good.", "\n00:06:01.250 --> 00:06:06.120\nI'll give you that. ", "Pundit is actually\na name that comes from India.", "\n00:06:06.170 --> 00:06:09.010\nIt comes from India and\nit's a wise person.", "\n00:06:10.230 --> 00:06:13.840\nThe pundit, no. ", "It's not\nFox News. ", "You're right.", "\n00:06:15.310 --> 00:06:20.200\nAnyway, these wise people have now\nsaid that Office 365 is okay,\n00:06:20.250 --> 00:06:23.870\nso it's okay. ", "Once you've got approval,\nyour CIOs will be reading\n00:06:23.920 --> 00:06:26.080\nabout this in the newspapers.", "\n00:06:26.770 --> 00:06:33.600\nWe know how dangerous an article was\nin the hands of a reckless CIO.", "\n00:06:37.020 --> 00:06:39.750\nAnyway, some news about the\ncurrent public status.", "\n00:06:41.830 --> 00:06:46.600\nThis is frustrating to me. ", "Microsoft\nwon't tell me how many mailboxes\n00:06:46.650 --> 00:06:47.900\nthey are actually running.", "\n00:06:49.940 --> 00:06:53.150\nIt's competitive information. ", "It's\nconfidential. ", "But you know what?", "\n00:06:53.200 --> 00:06:56.710\nThey have to tell the SEC how much\nmoney they're making out of it.", "\n00:06:56.760 --> 00:06:59.040\nSo the only way you can actually\ngo interpret this and this is\n00:06:59.090 --> 00:07:01.600\nwhat I do. ", "I've been doing it for\nthe last couple of years is\n00:07:01.650 --> 00:07:05.690\nyou take the financial run rate, the\nannual run rate for commercial\n00:07:05.740 --> 00:07:09.200\ncloud services, which is right\nnow according to quarter three\n00:07:09.250 --> 00:07:14.400\nfiscal '15 results,\n6.3 billion a year.", "\n00:07:16.170 --> 00:07:17.230\nThat includes Azure\n00:07:18.700 --> 00:07:22.660\nand it includes Dynamics CRM, but\nI reckon a good chunk of it\n00:07:22.710 --> 00:07:24.350\nis Office 365.", "\n00:07:25.410 --> 00:07:28.480\nAnd then you have to figure out\nhow much an average subscriber\n00:07:28.890 --> 00:07:33.160\nis paying for Office 365 per month,\nand you divide it into that\n00:07:33.210 --> 00:07:34.150\nbig number.", "\n00:07:35.190 --> 00:07:37.670\nRight now I figure\n00:07:39.210 --> 00:07:42.450\nthat between 80 and 90 million,\nmaybe 100 million, it depends\n00:07:42.500 --> 00:07:47.780\non how many academic, free and school\nmailboxes are there, but\n00:07:47.830 --> 00:07:51.910\nI think there's quite a lot of mailbox\nthere. ", "Here's the thing.", "\n00:07:51.960 --> 00:07:56.030\nYou guys that are all the on prem\ncommunity, you are still in\n00:07:56.080 --> 00:07:56.900\nthe majority.", "\n00:07:57.930 --> 00:08:00.880\nAnd you are still going to be in\nthe majority or at least another\n00:08:00.930 --> 00:08:01.690\ntwo years.", "\n00:08:02.530 --> 00:08:07.260\nAfter that, I can't tell because a\nlot of it depends on the velocity\n00:08:09.020 --> 00:08:13.620\nthat Office 365 maintains. ", "If he\nkeeps on going the way it is,\n00:08:13.670 --> 00:08:17.750\nthe tipping point could be sooner.", "\nOn the other hand, if let's\n00:08:17.800 --> 00:08:21.640\nsay Exchange 2016 comes out and\nis a roaring success from the\n00:08:21.690 --> 00:08:26.090\nget-go, you might all migrate overnight\nand say we are happy\n00:08:26.140 --> 00:08:31.270\ncampers and it might take a little\nbit longer, but the salient\n00:08:31.320 --> 00:08:37.410\nfacts are that Office 365 is doing\nextremely well and is accumulating\n00:08:37.460 --> 00:08:41.190\nmailboxes fast, at a very\nsignificant rate.", "\n00:08:42.790 --> 00:08:45.670\nLet's talk a little bit about\nExchange Online itself.", "\n00:08:46.930 --> 00:08:53.460\nLet's try to identify what's different\nthan on prem. ", "I'm sure\n00:08:53.510 --> 00:08:55.800\nyou've heard the fact\n00:08:57.010 --> 00:09:02.600\noften repeated that Exchange Online\nand Exchange on prem are\n00:09:02.650 --> 00:09:03.780\nkissing cousins.", "\n00:09:05.380 --> 00:09:08.640\nThey share the same code base.", "\n00:09:09.680 --> 00:09:10.350\nYeah, they do,\n00:09:11.850 --> 00:09:16.460\nbut there's a lot of little if then\nelse's in there because when\n00:09:16.510 --> 00:09:21.410\nyou think about it a massively scalable\nmultitenant environment\n00:09:21.890 --> 00:09:24.400\nis very, very different than the\nkind of on prem environment\n00:09:24.450 --> 00:09:25.030\nthat you've run.", "\n00:09:25.830 --> 00:09:29.560\nAnd Exchange 2013 and Exchange\n2016 are going to have to deal\n00:09:29.610 --> 00:09:30.220\nwith that.", "\n00:09:31.770 --> 00:09:33.500\nExchange Online, what you get today,\n00:09:34.860 --> 00:09:37.740\nlet's say if you went and\nstarted off Outlook\n00:09:39.110 --> 00:09:40.080\nwere back today.", "\n00:09:40.630 --> 00:09:42.560\nYou log on to your tenant.", "\n00:09:43.600 --> 00:09:44.540\nHave a look at the URL\n00:09:45.750 --> 00:09:49.410\nand you probably see tacked onto\nthe end of the URL a little\n00:09:49.460 --> 00:09:53.890\nversion string and the version string\nmight just start with 16.", "\n00:09:55.960 --> 00:10:00.570\nExchange Online is already running\ncode that will be delivered\n00:10:00.620 --> 00:10:04.570\nlater on this year because it's\nalways ahead of what you see\n00:10:04.620 --> 00:10:06.420\nin the latest cumulative update.", "\n00:10:07.220 --> 00:10:12.060\nIt's already running bits\nof Exchange 2016.", "\n00:10:13.090 --> 00:10:16.030\nAnd Exchange Online, this is unpublishable,\n00:10:17.320 --> 00:10:18.910\nbut you have to accept it as fact.", "\n00:10:19.630 --> 00:10:25.840\nExchange Online will always be feature\nrich compared to Exchange\n00:10:25.890 --> 00:10:30.210\non prem. ", "There are some things that\nare always going to be only\n00:10:30.260 --> 00:10:31.460\navailable in the cloud.", "\n00:10:32.050 --> 00:10:33.530\nWe will talk about that later on.", "\n00:10:35.030 --> 00:10:36.350\nSo that's the current status.", "\n00:10:37.500 --> 00:10:41.600\nIn terms of its deployment, it's\nin data centers around the world\n00:10:41.650 --> 00:10:42.710\nwhich is fantastic.", "\n00:10:43.330 --> 00:10:47.210\nThere are nine separate regions.", "\nThink of nine regions as nine\n00:10:47.920 --> 00:10:50.740\nin our mess active directory forests.", "\n00:10:51.410 --> 00:10:56.250\nI'm putting it in on prem terms.", "\nNine enormous instances of\n00:10:56.300 --> 00:10:59.680\nthe Exchange directory store because\nthey have a separate Exchange\n00:10:59.730 --> 00:11:04.880\ndirectory which is used to hold\ninformation used by Exchange.", "\n00:11:05.850 --> 00:11:08.850\nAnd then there are all these mailboxes\nand all these tags.", "\n00:11:08.900 --> 00:11:09.680\nHow many tags?", "\n00:11:10.470 --> 00:11:14.350\nHundreds and hundreds and hundreds.", "\n00:11:15.170 --> 00:11:21.030\nOne piece of data given out the other\nday, 1.2 million database copies.", "\n00:11:22.640 --> 00:11:25.270\nEach databases four copies.", "\n00:11:26.010 --> 00:11:28.110\nYou now know how many\ndatabases they have.", "\n00:11:29.560 --> 00:11:34.120\nAnd because Exchange supports 100\ndatabases per DAG, you not\n00:11:34.170 --> 00:11:37.410\na good idea about how many DAGs\nthey have, and it's a lot.", "\n00:11:41.540 --> 00:11:44.790\nSome of the figures that are being\nthrown out, one was given\n00:11:44.840 --> 00:11:48.270\nthe other day, about 50,000 servers\nrunning for Exchange Online.", "\n00:11:48.320 --> 00:11:49.770\nThey are the mailbox servers.", "\n00:11:50.520 --> 00:11:53.850\nBut as you are all well aware and infrastructure\nis not just mailboxes.", "\n00:11:54.320 --> 00:11:58.920\nIn fact, the entire infrastructure\nfor Exchange Online is around\n00:11:58.970 --> 00:12:02.470\nabout 100,000 servers.", "\nThat's a lot.", "\n00:12:04.420 --> 00:12:06.760\nThat's a few little blinking\nred lights to look at.", "\n00:12:09.160 --> 00:12:12.570\nThanks be to God that managed availability\nis there. ", "I'll bet\n00:12:12.620 --> 00:12:15.950\nyou thought that you would never\nhear anybody say that, but the\n00:12:16.000 --> 00:12:19.500\nsalient fact is that manageability\nis absolutely a great example\n00:12:19.770 --> 00:12:23.630\nof technology transfer from the cloud\nto on prem, because without\n00:12:23.680 --> 00:12:26.150\nmanaged availability they couldn't\nrun at this scale.", "\n00:12:27.800 --> 00:12:33.790\nI mean I have a whole pile of other\npieces and if you went behind\n00:12:33.840 --> 00:12:36.860\nthe curtain session the other day you\nwould have learned about them.", "\n00:12:36.910 --> 00:12:39.130\nThey have a phenomenal workflow engine.", "\n00:12:39.900 --> 00:12:44.800\nThey have a great capacity to go\nand catch systems, to detect\n00:12:44.850 --> 00:12:48.420\nproblems, to fix problems, but without\nmanaged availability they\n00:12:48.470 --> 00:12:52.200\nwouldn't be able to deal with Exchange.", "\nIt is a great, great thing.", "\n00:12:54.570 --> 00:12:58.550\nWhen you look at it, some of the\ncharacteristics of what users\n00:12:58.600 --> 00:13:00.660\nget, huge mailboxes,\n00:13:02.200 --> 00:13:06.980\nindeed the new Office 365 import\nservice that was announced the\n00:13:07.030 --> 00:13:12.050\nother day is the thing where you\nput all your PSTs on drive,\n00:13:12.100 --> 00:13:14.940\nship them off to Microsoft data\ncenters and have them ingested\n00:13:14.990 --> 00:13:19.940\ninto the service. ", "It's a great way to\nfill up all of those big mailboxes.", "\n00:13:20.470 --> 00:13:24.120\nLet's get rid of PSTs for\nonce and for all, please.", "\n00:13:24.770 --> 00:13:28.670\nThe most insecure, the most unreliable,\nthe most horrible file\n00:13:28.720 --> 00:13:31.860\nformat known the man, please.", "\n00:13:35.310 --> 00:13:36.610\nThank you. ", "You're all very nice.", "\n00:13:37.680 --> 00:13:40.440\nSeriously, this is a good way to\ndo it. ", "If you are doing the\n00:13:40.490 --> 00:13:43.180\nOffice 365 import service and you\nare getting rid of PSTs like\n00:13:43.230 --> 00:13:49.200\nthis, please, please direct the important\nto the archive mailboxes\n00:13:49.800 --> 00:13:54.520\nfor one very good reason and that\nis you do not want output to\n00:13:54.570 --> 00:13:58.120\nsuddenly wake up in the morning and say\nI've got 100 gig to synchronize.", "\n00:13:58.540 --> 00:14:00.330\nPlease let me get on\nwith that for you.", "\n00:14:01.020 --> 00:14:02.530\nThis will be a bad thing.", "\n00:14:03.850 --> 00:14:05.110\nPut them in the archives.", "\n00:14:07.370 --> 00:14:10.770\nMy favorite decision of all time\nwas reached recently when they\n00:14:10.820 --> 00:14:18.460\nremoved the processing of the deleted\nitems tag out of the MRM policy.", "\n00:14:20.980 --> 00:14:24.580\nThis is a great example of\nwhere a decision is taken\n00:14:25.950 --> 00:14:30.060\nI think to help very small tenants,\nbut it gets in the way of\n00:14:30.110 --> 00:14:31.880\nlarge tenants, large enterprises.", "\n00:14:33.480 --> 00:14:36.630\nWhat this actually means, if you\nhaven't been following along,\n00:14:37.620 --> 00:14:41.940\nis that once an item goes into the\ndeleted items folder, it stays\n00:14:41.990 --> 00:14:48.020\nthere, forever and ever\nand ever and ever,\n00:14:49.600 --> 00:14:54.920\nunless the user decides to go and\nremove it by emptying the folder.", "\n00:14:55.460 --> 00:14:59.800\nAnd the reason why this is done\nis because so many people lost\n00:14:59.850 --> 00:15:03.430\nstuff and there are no backups\nin Exchange Online.", "\n00:15:04.880 --> 00:15:09.310\nSo once stuff in the old way, it\nwas cleared out after 30 days\n00:15:09.360 --> 00:15:13.950\nby the deleted items tab and the\ndefault MRM policy it would\n00:15:14.000 --> 00:15:17.730\ngo into recoverable items. ", "It would\nstay there for 30 days and\n00:15:17.780 --> 00:15:19.970\nthen it would be removed from\nthe database and that was it.", "\n00:15:21.890 --> 00:15:26.200\nNo backups, and if you are a CIO\ncame down to you or your CEO\n00:15:26.250 --> 00:15:31.660\nand said by the way. ", "I seem to have,\nin a fit of temper, deleted\n00:15:31.710 --> 00:15:36.380\nsome e-mail from two months ago\nand it's gone. ", "I can't find it.", "\n00:15:36.430 --> 00:15:38.810\nThat would be it. ", "And\nthat's a bad thing.", "\n00:15:40.560 --> 00:15:43.450\nIt is a bad thing when you don't\nhave backups, at least. ", "So they\n00:15:43.500 --> 00:15:45.200\ndecided to keep everything there.", "\n00:15:48.470 --> 00:15:53.630\nThe interesting thing is if you\nare in a hybrid configuration\n00:15:54.300 --> 00:15:57.990\nand you move one of these mailboxes\nthat has a ginormous deleted\n00:15:58.040 --> 00:16:01.930\nitems folder back to on\nprem, what happens?", "\n00:16:02.700 --> 00:16:05.670\nThe first night, what happens?", "\n00:16:07.800 --> 00:16:09.330\nMFA wakes up\n00:16:10.760 --> 00:16:14.260\nand on the on prem server and says\nexcuse me, sir. ", "I seem to\n00:16:14.310 --> 00:16:18.260\nrealize that you have got 100,000 items\nin your deleted items folder.", "\n00:16:18.310 --> 00:16:21.270\nLet me take care of that for\nyou and cleans them all out.", "\n00:16:22.740 --> 00:16:25.220\nThey are still there. ", "They are\nstill recoverable and you will\n00:16:25.270 --> 00:16:28.270\nhave backups on prem, so that's okay,\nbut it's just kind of interesting\n00:16:28.320 --> 00:16:33.090\nhow they just go away when you move people\nback. ", "Okay. ", "Hybrid connectivity.", "\n00:16:33.140 --> 00:16:37.250\nThis is Microsoft's great differentiator.", "\nIt's a thing that\n00:16:37.300 --> 00:16:39.230\nnobody else has and it's fantastic.", "\n00:16:39.880 --> 00:16:44.750\nThe hybrid creates a unified GAL,\ngives you unified mail flow\n00:16:45.370 --> 00:16:49.090\nand it gives you unified organization\nall created by the hybrid\n00:16:49.140 --> 00:16:50.580\nconfiguration wizard.", "\n00:16:52.490 --> 00:16:55.020\nBut the thing about it is, that\nI have to point out to you, is\n00:16:55.070 --> 00:16:58.170\nmanagement is not always unified\nbecause there are some things\n00:16:58.220 --> 00:17:01.390\nthat don't flow across the connector.", "\n00:17:02.700 --> 00:17:05.640\nIt's a thing that you have to enormous\ndetail to, especially\n00:17:05.690 --> 00:17:10.400\nthings like transport rules and,\nindeed, MRM policies because\n00:17:10.450 --> 00:17:12.780\nif you make a change on one side\nyou have to make sure that the\n00:17:12.830 --> 00:17:15.600\nchange is echoed on the other. ", "Otherwise\nyou will have different\n00:17:15.650 --> 00:17:19.100\nprocessing occurring in on\nprem and in the cloud.", "\n00:17:20.690 --> 00:17:24.960\nI'll also say that hybrid connectivity\nis really only the start.", "\n00:17:25.820 --> 00:17:31.290\nThere's so much more that you have\nto think about because if\n00:17:31.340 --> 00:17:34.890\nyou really want to have a unified\nOffice 365 environment, you're\n00:17:34.940 --> 00:17:37.710\ngoing to have Federation for single\nsign-on and that sort of\n00:17:37.760 --> 00:17:40.230\nstuff, and you're probably going\nto be thinking about things\n00:17:40.280 --> 00:17:43.460\nlike using some of the advanced\nfeatures that are available in\n00:17:43.510 --> 00:17:47.460\nOffice 365 that are so much easier\nin the cloud than they are\n00:17:47.510 --> 00:17:49.670\non prem, like rights management.", "\n00:17:50.190 --> 00:17:53.680\nYou have to figure that kind of\nstuff out. ", "I also point out\n00:17:53.730 --> 00:17:56.490\nthat there is AAD connect coming.", "\n00:17:57.270 --> 00:17:59.340\nThis is going to be\nthe preferred tool\n00:18:01.000 --> 00:18:05.830\nfor helping with hybrid systems\nbecause it will facilitate, for\n00:18:05.880 --> 00:18:11.390\nexample, the synchronization of\nOffice 365 Groups back into\n00:18:12.680 --> 00:18:14.420\nin on prem environment.", "\n00:18:17.940 --> 00:18:23.490\nA point I make continually to people\nis that sure, Exchange Online\n00:18:23.540 --> 00:18:27.760\nis great, but you pay for more\nthan Exchange Online when you\n00:18:27.810 --> 00:18:29.630\nbuy an Office 365 license.", "\n00:18:30.260 --> 00:18:34.380\nNow if you want to give Microsoft\nor money for free or you want\n00:18:34.430 --> 00:18:37.190\nto give Microsoft too much money\nfor the license, that's okay,\n00:18:37.860 --> 00:18:41.460\nbut it seems to me that if you are\ngoing to transition workload\n00:18:41.510 --> 00:18:42.200\nto the cloud\n00:18:43.440 --> 00:18:48.260\nthat you owe it to the company,\nyour employers, to look at what\n00:18:48.310 --> 00:18:52.270\nelse can be dumped. ", "You are paying\nfor this functionality so\n00:18:52.320 --> 00:18:55.780\nyou should at least think about\nusing it. ", "I'm just pointing\n00:18:55.830 --> 00:18:59.520\nout a couple of things here. ", "Clearly,\nSharePoint online, pretty\n00:18:59.570 --> 00:19:03.160\ngood, I use it a lot for\ndocument storage.", "\n00:19:03.990 --> 00:19:08.000\nI particularly use OneDrive for\nbusiness. ", "I think that's okay.", "\n00:19:08.670 --> 00:19:11.750\nIt's got some synchronization\nissues, but that's life.", "\n00:19:12.840 --> 00:19:14.690\nI use Skype for business\nall the time,\n00:19:15.990 --> 00:19:17.350\nbut I'm a small\n00:19:19.240 --> 00:19:22.620\ntenant, if you will. ", "Some of the\nlarger enterprises still need\n00:19:22.670 --> 00:19:24.720\nsome functionality that has\nyet to be delivered.", "\n00:19:25.360 --> 00:19:27.890\nI don't use Yammer because I can\ncommunicate quite happily with\n00:19:27.940 --> 00:19:29.520\nmyself through e-mail.", "\n00:19:32.190 --> 00:19:35.240\nI do use Office Delve because I\nthink it's a fantastic way of\n00:19:35.290 --> 00:19:36.980\nfinding things that I have forgotten.", "\n00:19:38.450 --> 00:19:42.640\nIt is kind of creepy at times that\nOffice Delve is so good at\n00:19:42.690 --> 00:19:46.040\nfinding things that I've forgotten\nor things that I didn't want\n00:19:46.090 --> 00:19:50.750\nto keep, but I really think that's\ngood. ", "And then there's this\n00:19:50.800 --> 00:19:54.540\nnew things that they have put\nout, the Video Portal. ", "What a\n00:19:54.590 --> 00:19:58.020\nfantastic way of doing internal\ntraining videos.", "\n00:19:59.580 --> 00:20:03.060\nIt's a fantastic integration between\nOffice 365 and Azure media\n00:20:03.110 --> 00:20:07.010\nservices and it's so simple to hook\nup your videos and make them\n00:20:07.060 --> 00:20:12.410\navailable to end-users including\nhaving those videos discoverable\n00:20:12.460 --> 00:20:13.720\nand shown through Delve.", "\n00:20:14.230 --> 00:20:17.560\nThe point I'm making to you is there's\na lot more. ", "Don't restrict\n00:20:17.610 --> 00:20:20.430\nyour horizons to just Exchange.", "\n00:20:23.060 --> 00:20:26.510\nI think it's also important to\nsay that Office 365 is not the\n00:20:26.560 --> 00:20:30.480\nsame for everybody. ", "I guarantee you\nin this room there are probably\n00:20:30.530 --> 00:20:34.400\nrepresentatives for tens, maybe hundreds\nof tenants and we might\n00:20:34.450 --> 00:20:37.740\nall see different things, so there\nare a couple of things I will\n00:20:37.790 --> 00:20:40.890\ngo through fairly quickly here.", "\nThe first thing is multitenant\n00:20:40.940 --> 00:20:44.720\nversus dedicated. ", "The largest customers\nuse dedicated tenants.", "\n00:20:44.770 --> 00:20:48.690\nThat gives them more control over\ncustomization and feature rollout\n00:20:48.740 --> 00:20:52.280\nstuff like that. ", "The vast bulk\nof us use multitenant. ", "We get\n00:20:52.330 --> 00:20:55.090\nwhat Microsoft gives us when\nMicrosoft gives us.", "\n00:20:55.820 --> 00:20:59.530\nThis first release versus standard\nrelease. ", "First release, I'm\n00:20:59.580 --> 00:21:02.340\non it because I want to see\nnew functionality early.", "\n00:21:03.710 --> 00:21:08.460\nYou see new functionality anytime\n2 to 6 weeks maybe even six\n00:21:08.510 --> 00:21:12.430\nmonths before the general population\nsees it. ", "I like that.", "\n00:21:13.120 --> 00:21:16.590\nThere are E-SKUs, SKUs and P-SKUs.", "\n00:21:17.110 --> 00:21:19.760\nE is for enterprise. ", "P is for personal.", "\n00:21:20.950 --> 00:21:22.770\nP are the small guys.", "\n00:21:23.500 --> 00:21:27.290\nE are the enterprise. ", "There is a\nlot more functionality in the\n00:21:27.340 --> 00:21:30.970\nenterprise SKUs, but you pay a lot\nmore for it. ", "There's government\n00:21:31.020 --> 00:21:32.290\nand academic plans.", "\n00:21:35.700 --> 00:21:39.450\nAnd they have their own pricing arrangements\nand there are other\n00:21:39.500 --> 00:21:41.910\ndifferences that we're not going\nto go into here. ", "There are\n00:21:41.960 --> 00:21:45.850\nstandalone plans like SharePoint\nonline in case some people think\n00:21:45.900 --> 00:21:49.740\nof that as Office Online. ", "There's stuff\nthat's delivered by Microsoft\n00:21:50.110 --> 00:21:52.070\nand their stuff that's\ndelivered by partners.", "\n00:21:52.980 --> 00:21:55.690\nMicrosoft and HP, for example, have\ngot an arrangement that they\n00:21:55.740 --> 00:21:59.040\nare going to deliver Office 365\nout of HP data centers.", "\n00:21:59.090 --> 00:22:02.570\nOffice 365 in China, it's\ndelivered by a partner.", "\n00:22:03.660 --> 00:22:06.110\nThere are different places that you\nare going to get Office 365.", "\n00:22:06.160 --> 00:22:08.410\nAnd then there is the\nlast thing here.", "\n00:22:08.960 --> 00:22:10.140\nFlighting and straggling,\n00:22:11.700 --> 00:22:16.410\nflighting is the way Microsoft\ndeploys different features out\n00:22:16.460 --> 00:22:17.670\nto tenants.", "\n00:22:18.970 --> 00:22:22.320\nSome people might have slightly different\nversions of code because\n00:22:22.370 --> 00:22:25.560\nthey have been flighted at different\ntimes or they have been\n00:22:25.610 --> 00:22:27.900\nflighted at different versions.", "\nI know this is an interesting\n00:22:27.950 --> 00:22:32.100\nuse of the word flight. ", "It's a\nnew way to use this word, but\n00:22:32.150 --> 00:22:35.720\njust go along with me. ", "Basically\nit's a way of distributing code\n00:22:35.770 --> 00:22:36.650\nto tenants.", "\n00:22:37.790 --> 00:22:41.380\nYou see this all the time in\nthe Yammer support groups.", "\n00:22:42.640 --> 00:22:46.030\nI don't see this feature but you\nsee this feature but we are\n00:22:46.080 --> 00:22:49.100\npaying the same or we're on the\nsame plan. ", "It's simply because\n00:22:49.370 --> 00:22:53.500\nif we think about it with all of\nthe servers it's impossible\n00:22:53.550 --> 00:23:00.480\nto update them all at the same time.", "\nYou never, ever see a common\n00:23:00.530 --> 00:23:05.180\nview of Office 365 across the\nentire infrastructure.", "\n00:23:06.060 --> 00:23:08.590\nIt's understandable. ", "Just think\nhow long it takes you to deploy\n00:23:08.640 --> 00:23:11.340\na new version of office server products.", "\n00:23:12.120 --> 00:23:14.810\nNow imagine what it's like to do\nit across millions of servers.", "\n00:23:15.810 --> 00:23:20.190\nStraggling is also in the same\nbucket because sometimes some\n00:23:20.240 --> 00:23:21.620\nservers are overlooked.", "\n00:23:22.460 --> 00:23:23.730\nThey have this incredible\n00:23:24.990 --> 00:23:28.920\nworkflow engine. ", "They have this incredible\ncapability to do automated\n00:23:28.970 --> 00:23:34.190\nupdates, but sometimes servers are\noverlooked and you might connect\n00:23:34.240 --> 00:23:37.160\nto a slightly outdated server and\nsee a different view from what\n00:23:37.210 --> 00:23:37.690\nI see.", "\n00:23:38.440 --> 00:23:43.190\nThat's kind of interesting. ", "And it's\npart of just the characteristics,\n00:23:43.440 --> 00:23:46.460\nthe unique characteristics\nof running in the cloud.", "\n00:23:48.330 --> 00:23:50.850\nLet's talk about everybody's\nfavorite topic.", "\n00:23:50.900 --> 00:23:56.090\nI seem to have been doing migration\nfor most of my career.", "\n00:23:57.320 --> 00:23:59.720\nOne of these days I'll get\nto where I'm going.", "\n00:24:05.400 --> 00:24:09.680\nBefore we go, I think you have to\nknow what we're going to move.", "\n00:24:11.770 --> 00:24:14.190\nI see a lot of people just starting\noff. ", "We moved a couple of\n00:24:14.240 --> 00:24:16.600\nmailboxes, but there's so much more.", "\n00:24:17.600 --> 00:24:22.250\nClearly, if you're going to go\nto Office 365 remember what I\n00:24:22.300 --> 00:24:25.630\nsaid before. ", "It's much more than\nExchange. ", "It's a good idea\n00:24:25.680 --> 00:24:29.520\nto think about I've got the mailboxes\nbut what about all of this\n00:24:29.570 --> 00:24:30.240\nother stuff?", "\n00:24:31.280 --> 00:24:35.120\nAm I interested in public folders, moving\nthem across? ", "Am I interested\n00:24:35.170 --> 00:24:37.450\nin eliminating public folders, perhaps?", "\n00:24:39.090 --> 00:24:39.980\nNobody said yes.", "\n00:24:41.380 --> 00:24:46.330\nSomebody did. ", "You want to\nget rid of them tomorrow?", "\n00:24:55.840 --> 00:24:59.390\nI don't know if you heard that. ", "This\nis the new migration technique\n00:24:59.980 --> 00:25:01.250\nfor public folders.", "\n00:25:01.810 --> 00:25:05.960\nJust lie and tell people they are not\nsupported anymore. ", "They're gone.", "\n00:25:09.490 --> 00:25:10.170\nWell done.", "\n00:25:10.950 --> 00:25:12.790\nI'll use that again.", "\n00:25:14.300 --> 00:25:22.700\nThere's lots of stuff. ", "And clients\ntend to be a bit of a problem.", "\n00:25:22.750 --> 00:25:26.490\nYou are going to need to use the\nlatest clients, so that means,\n00:25:26.540 --> 00:25:30.610\nessentially, you are going to have\nto get up to Outlook 2010,\n00:25:31.970 --> 00:25:37.060\nservice pack whatever it is, whatever\nthe latest is that's the\n00:25:37.110 --> 00:25:41.910\ngeneral rule. ", "There are various\nthings on the website to tell\n00:25:41.960 --> 00:25:44.040\nyou exactly what it is\nat any point in time.", "\n00:25:44.660 --> 00:25:49.570\nWhat I want to point out here is in\nthe prem world you have control\n00:25:49.620 --> 00:25:53.460\nover clients much more, so you\ncan always make sure that you\n00:25:53.510 --> 00:25:56.560\nmatch the server functionality\nthat you're deploying with the\n00:25:56.610 --> 00:26:00.570\nclient functionality. ", "Remember\nnow, you're not in control of\n00:26:00.620 --> 00:26:01.970\nthe servers anymore.", "\n00:26:02.560 --> 00:26:05.430\nAs those servers keep on getting\nupdated, you have got to make\n00:26:05.480 --> 00:26:08.050\narrangements that your clients\nare getting updated.", "\n00:26:08.100 --> 00:26:09.630\nOtherwise, you are in danger\n00:26:11.110 --> 00:26:13.660\nof becoming out of date\nand out of support.", "\n00:26:14.240 --> 00:26:17.930\nBrowsers are a particular issue,\nor have been a particular issue\n00:26:17.980 --> 00:26:18.980\nover the last year.", "\n00:26:20.160 --> 00:26:24.080\nChrome, which is a pretty\ndecent browser,\n00:26:25.550 --> 00:26:29.510\nGoogle in their wisdom went and deprecated\nthe show modal dialog\n00:26:29.560 --> 00:26:31.520\nAPI last September.", "\n00:26:32.250 --> 00:26:36.240\nHalf of OWA stopped working. ", "Half\nof the Exchange administration\n00:26:36.290 --> 00:26:42.310\ncenter stopped working. ", "Half of the Office\n365 admin port stopped working.", "\n00:26:42.650 --> 00:26:48.530\nThat wasn't very kind of them. ", "So\nyou have to be able to I think\n00:26:48.580 --> 00:26:52.980\nreally, really get yourself in a\nframe of mind that clients are\n00:26:53.030 --> 00:26:57.350\nnow going to be updated much, much\nfaster than they were before\n00:26:57.980 --> 00:27:00.000\nto match what's going\non with the servers.", "\n00:27:02.370 --> 00:27:04.860\nIn terms of the knowledge that you\nneed to go and approach this\n00:27:04.910 --> 00:27:09.390\nmigration, clearly you need a lot\nof Office 365 knowledge, but\n00:27:09.440 --> 00:27:13.560\nyou also need project management.", "\nIf ever there was a migration\n00:27:13.610 --> 00:27:18.020\nthat needed solid project management\nsupport, it's the move to\n00:27:18.070 --> 00:27:24.270\nOffice 365. ", "Go get a good project\nmanager, a good technology\n00:27:24.320 --> 00:27:27.500\nproject manager, one that has appreciation\nfor what you are going\n00:27:27.550 --> 00:27:31.840\nto and use them to help you get\nthere. ", "It will be good for you.", "\n00:27:32.680 --> 00:27:34.990\nSwitching over, the big bang approach,\nthe one that you do on\n00:27:35.040 --> 00:27:40.350\nthe weekend, that's fine for small\nenterprises, absolutely hopeless\n00:27:40.400 --> 00:27:42.510\nfor the large guys. ", "You are going\nto be doing this for months.", "\n00:27:42.560 --> 00:27:47.450\nThat's why hybrid is so important.", "\nIt's so critical to prepare\n00:27:47.500 --> 00:27:52.360\nfor that. ", "Your network, in particular,\nis going to need some attention.", "\n00:27:53.120 --> 00:27:54.260\nAnd it's really simple.", "\n00:27:55.900 --> 00:28:01.150\nOn prem, where is all your data flowing?", "\nIt's to your data centers,\n00:28:02.960 --> 00:28:08.860\nespecially all the client interaction\nis to your data centers.", "\n00:28:09.550 --> 00:28:14.620\nOffice 365, you've got a couple\nof things to move first, like\n00:28:14.670 --> 00:28:18.990\nmailboxes, and then you want all\nof your users to have really\n00:28:19.040 --> 00:28:24.520\ngood response time back from the\nservice, not only for mailboxes\n00:28:24.570 --> 00:28:28.700\nbut also for OneDrive,\nSharePoint et cetera.", "\n00:28:30.560 --> 00:28:34.370\nThis is an opportunity for you to\nhave a conversation with your\n00:28:34.420 --> 00:28:38.250\nnetwork team and figure out how\nyou're going to re-architecture\n00:28:38.300 --> 00:28:43.330\nnetwork so that instead of being\ninward focusing you're outward\n00:28:43.380 --> 00:28:44.900\nfocusing especially\n00:28:46.150 --> 00:28:47.280\ntowards Microsoft.", "\n00:28:48.120 --> 00:28:53.370\nThat's just the way it is. ", "ExpressRoute\noption which essentially\n00:28:53.420 --> 00:28:57.400\nallows you to have a very fast connection\nto Office 365 is being\n00:28:57.450 --> 00:29:01.870\nupgraded to support Office 365.", "\nI think that's a good thing to\n00:29:01.920 --> 00:29:04.370\nlook after if you are you interested.", "\n00:29:05.340 --> 00:29:09.190\nIn terms of migration toolkits, they\nare improving all the time.", "\n00:29:10.650 --> 00:29:11.520\nSome of the\n00:29:13.560 --> 00:29:15.850\npublic folder scripts are a bit outdated.", "\n00:29:16.910 --> 00:29:21.500\nIf you take them off the Exchange\nkit, that's a bad idea.", "\n00:29:21.550 --> 00:29:24.340\nGo and get the latest versions\nthat are online. ", "In terms of\n00:29:24.390 --> 00:29:29.400\nthe commercial toolkits, there are\nlots of people out there that\n00:29:29.450 --> 00:29:34.050\nadvertise a capacity, capability\nof moving mailboxes and other\n00:29:34.590 --> 00:29:36.960\npieces of data to Office 365.", "\n00:29:38.060 --> 00:29:40.310\nI'm not going to endorse\nanybody here.", "\n00:29:42.070 --> 00:29:44.040\nWhat I will say is test.", "\n00:29:44.920 --> 00:29:49.590\nGo ask the folks that are down in\nthe exhibition area. ", "Ask them\n00:29:49.640 --> 00:29:52.900\nfor test versions and go and test\nthem in your environment and\n00:29:52.950 --> 00:29:55.070\nyou'll find the best one for you.", "\n00:29:56.030 --> 00:29:59.850\nThe ones that, some of them have great\nproject management capabilities\n00:29:59.900 --> 00:30:03.080\nso you can plan and automate mailbox\ntransition. ", "Some of them\n00:30:03.130 --> 00:30:06.370\nare only Exchange and some of them\nwill do Exchange and SharePoint.", "\n00:30:06.420 --> 00:30:08.680\nSome of them will also\nhave Active Directory.", "\n00:30:09.450 --> 00:30:12.440\nYou've really got to go and do some\n00:30:13.670 --> 00:30:17.960\nplanning and some testing and also\nthink about cost because they\n00:30:18.010 --> 00:30:19.890\ndo vary enormously in cost.", "\n00:30:22.360 --> 00:30:25.630\nLet's pretend that we've got\nOffice 365. ", "That was quick.", "\n00:30:25.680 --> 00:30:29.080\nThat was called the Big Bang migration.", "\nIt happened just there.", "\n00:30:30.590 --> 00:30:31.940\nDidn't you see the\nmailboxes go by?", "\n00:30:31.990 --> 00:30:39.810\nZoom. ", "Might appeal to you as I\nsaid earlier is that you want\n00:30:39.860 --> 00:30:43.480\nto start thinking about using more\nof Office 365. ", "But this is\n00:30:43.530 --> 00:30:46.630\nactually an interesting thing because\nyou have an opportunity\n00:30:46.680 --> 00:30:50.690\nto influence how your company\ndeals with information.", "\n00:30:53.760 --> 00:30:57.270\nThe classic on prem environment\nprobably has Exchange,\n00:30:58.470 --> 00:31:02.110\nFileShares, file servers, that\nkind of stuff. ", "There are some\n00:31:02.160 --> 00:31:04.270\nother applications out there\nthat you are using.", "\n00:31:05.960 --> 00:31:09.440\nAgain, you are paying for Office\n365, so let's maximize the use\n00:31:09.490 --> 00:31:12.210\nof Office 365 by using the\nfeatures that are there.", "\n00:31:12.910 --> 00:31:16.230\nThat means that you are going to have\nto rethink how your organization\n00:31:16.920 --> 00:31:22.410\nshares information, collaborates,\nuses documents, shares documents,\n00:31:22.460 --> 00:31:25.480\nbacks up documents, classifies documents.", "\n00:31:26.130 --> 00:31:29.940\nIn short, it's an opportunity to\nthink about the information\n00:31:29.990 --> 00:31:31.550\nflow within your organization.", "\n00:31:32.890 --> 00:31:36.200\nThis is a point I've made to several\ncompanies that I have been\n00:31:36.250 --> 00:31:37.060\nworking with.", "\n00:31:37.970 --> 00:31:41.120\nIt's also an opportunity to clear\nup a lot of the sins of the\n00:31:41.170 --> 00:31:45.070\npast, because let's face it, if\nyour he still running a 1990s\n00:31:46.300 --> 00:31:50.660\nera file sharing environment and\nusing that for document storage,\n00:31:51.350 --> 00:31:55.620\nyou probably don't have an earthly\nchance of being able to resist\n00:31:55.670 --> 00:31:57.710\nsomething like an eDiscovery action\n00:31:59.350 --> 00:32:01.110\nfrom an offended third-party.", "\n00:32:02.530 --> 00:32:06.800\nIt's time to protect. ", "There are some\nthings easier and some things\n00:32:06.850 --> 00:32:08.550\nare much harder in the cloud.", "\n00:32:10.410 --> 00:32:15.160\nEasier, encryption is enormously\neasier in prem,\n00:32:16.460 --> 00:32:19.600\nsome forms of encryption. ", "S/MIME\nisn't particularly easier.", "\n00:32:20.170 --> 00:32:24.470\nPGP isn't particularly easier, but\nif your interest is in things\n00:32:24.520 --> 00:32:30.380\nlike rights management and OME the\noffice 365 messaging encryption\n00:32:30.790 --> 00:32:34.830\nkind of technology, it's like click,\nclick, click a couple of\n00:32:34.880 --> 00:32:38.750\nPowerShell commands and it's done.", "\nThe reason is because Microsoft\n00:32:38.800 --> 00:32:41.960\nis done all of the heavy lifting\nbehind it. ", "It's the kind of\n00:32:42.010 --> 00:32:44.080\nthing when you set up AD\n00:32:45.300 --> 00:32:49.260\nrights management on prem and you\nneed a server, maybe a couple\n00:32:49.310 --> 00:32:53.230\nof servers. ", "You need about 42 hours\njust to read the documentation.", "\n00:32:53.980 --> 00:32:58.360\nYou need a test plan and all the\nrest. ", "Just do it. ", "5 minutes\n00:32:58.410 --> 00:33:03.190\nand you will have AAD rights\nmanagement going.", "\n00:33:03.900 --> 00:33:04.810\nThat's really good.", "\n00:33:05.990 --> 00:33:08.590\nSharePoint document libraries and\nthe base functionality are\n00:33:08.640 --> 00:33:09.620\nalso very easy.", "\n00:33:10.290 --> 00:33:11.690\nWorkflow isn't so easy.", "\n00:33:12.650 --> 00:33:15.230\nDedicated applications that you\nfilter and SharePoint aren't\n00:33:15.280 --> 00:33:15.970\nso easy.", "\n00:33:16.900 --> 00:33:19.790\nSkype is very easy, again, because\nall of the heavy lifting is\n00:33:19.840 --> 00:33:22.940\ndone except for things like enterprise,\nvoice, outside calling\n00:33:22.990 --> 00:33:25.430\nand those things are kind of tough.", "\nThe biggest thing that's\n00:33:25.480 --> 00:33:27.270\neasier is flexing capacity.", "\n00:33:28.540 --> 00:33:31.060\nWhen you need to move more mailboxes\nyou just do them.", "\n00:33:31.110 --> 00:33:34.260\nThere's nothing about bringing up\nuse service and all the rest.", "\n00:33:34.310 --> 00:33:38.340\nIt's done. ", "They are bringing\non new servers all the time.", "\n00:33:38.860 --> 00:33:43.160\nHundreds of new servers are added\nto Office 365 every week and\n00:33:43.210 --> 00:33:47.280\nthat's to add capacity for existing\ntenants and new tenants.", "\n00:33:47.880 --> 00:33:51.100\nThe hardest things are dealing\nwith third-party applications.", "\n00:33:52.200 --> 00:33:55.290\nIn fact, the whole industry is\ngoing through a transformation\n00:33:55.340 --> 00:33:58.490\nhere, because when you think about\nit, Exchange, part of the\n00:33:58.540 --> 00:34:01.370\nreason why Exchange is very successful\nin the non-prem world\n00:34:02.210 --> 00:34:04.170\nwas because we have had this enormously\n00:34:05.640 --> 00:34:11.280\nrich ecosystem built up around the\nproduct of third-party products\n00:34:11.640 --> 00:34:14.420\nthat fill in all the gaps\nthat Microsoft left.", "\n00:34:15.880 --> 00:34:19.200\nThe essential thing that all of\nthose third-party products rely\n00:34:19.250 --> 00:34:20.520\non his access to data.", "\n00:34:21.150 --> 00:34:23.770\nIf they don't have access to\ndata they can do anything.", "\n00:34:24.700 --> 00:34:29.190\nIt's really, really difficult at times\nto get that data for third-party\n00:34:29.820 --> 00:34:31.230\nout of your tenant.", "\n00:34:33.010 --> 00:34:36.940\nThere is a lot of third-party\nISPs out there who are\n00:34:38.250 --> 00:34:40.990\nfiguring out how they are going to\ndeal with the new cloud work.", "\n00:34:42.780 --> 00:34:46.850\nMicrosoft is releasing new APIs and\nthey have made an announcement\n00:34:46.900 --> 00:34:49.560\nto the new REST API which looks very,\nvery promising. ", "It's going\n00:34:49.610 --> 00:34:53.690\nto replace Exchange Web Services,\nbut essentially, there is still\n00:34:53.740 --> 00:34:59.330\nsuch a lot of data that the ISPs\ndepend on, things about all\n00:34:59.380 --> 00:35:02.630\nthe auditing records and stuff\nlike that, accounting records\n00:35:02.680 --> 00:35:05.260\njust can't get, so they\nare dealing with it.", "\n00:35:06.660 --> 00:35:10.930\nAnd of course, it's also a little\nbit harder to integrate Exchange\n00:35:10.980 --> 00:35:15.750\nOnline with on premises software.", "\nIf you've got Exchange built\n00:35:15.800 --> 00:35:21.710\ninto something like workflow and a new\nuser comes into the organization\n00:35:21.760 --> 00:35:24.650\nand you set up a new mailbox and\nyou send them a welcome message\n00:35:24.700 --> 00:35:28.000\nand all that, it's a little bit\nharder, not very much harder,\n00:35:28.050 --> 00:35:30.860\njust a little bit.", "\n00:35:31.690 --> 00:35:34.710\nWe've got to the cloud and now\nwe have to deal with it.", "\n00:35:39.440 --> 00:35:42.060\nThis is probably the biggest thing\nthat people struggle with.", "\n00:35:43.910 --> 00:35:46.700\nThe cloud today is not\nthe cloud tomorrow.", "\n00:35:48.250 --> 00:35:52.990\nThe old ways of developing software\nare gone. ", "They are dusted.", "\n00:35:53.040 --> 00:35:56.100\nThey are not coming back. ", "There is\nno point in complaining about it.", "\n00:35:56.150 --> 00:35:59.000\nThis is just what we have to deal\nwith today until somebody comes\n00:35:59.050 --> 00:36:00.100\nup with a better plan.", "\n00:36:00.800 --> 00:36:03.520\nNew features are going to\nappear all the time.", "\n00:36:04.510 --> 00:36:08.060\nNew features are written by Microsoft\nas a response to customer\n00:36:08.110 --> 00:36:12.100\nrequests and to remain competitive\nin the market and so forth\n00:36:12.150 --> 00:36:15.980\nand that's great. ", "They delight users.", "\nThey dismay administrators\n00:36:16.030 --> 00:36:16.620\nat times.", "\n00:36:17.680 --> 00:36:19.650\nAnd we will talk a little\nmore about that.", "\n00:36:20.940 --> 00:36:22.720\nBut it's the same everywhere\nin the cloud.", "\n00:36:23.930 --> 00:36:28.480\nA really good example of that is\nthe ex accompli apps that have\n00:36:28.530 --> 00:36:33.710\nbecome Outlook for iOS and Outlook\nfor android. ", "Every two weeks\n00:36:34.420 --> 00:36:37.230\nthese clients are updated. ", "Every\ntwo weeks something different\n00:36:37.280 --> 00:36:37.910\nis there.", "\n00:36:38.530 --> 00:36:41.350\nMy gosh, you could be on iTunes\nall the time, give me new, give\n00:36:41.400 --> 00:36:44.900\nme new, give me new just to keep\nup to date, but that's the world\n00:36:44.950 --> 00:36:45.560\nwe live in.", "\n00:36:46.930 --> 00:36:49.940\nThe challenges I think for admins,\nand I guess most of you are\n00:36:49.990 --> 00:36:53.620\nadmins in this room. ", "I don't think\nmany users have survived this far.", "\n00:36:56.320 --> 00:36:59.940\nThey probably feel insulted or maligned\nor something like that.", "\n00:37:01.530 --> 00:37:06.530\nThe challenge for us as the admins\nis to understand the change,\n00:37:07.040 --> 00:37:10.510\nto know what's coming before users\nsee it. ", "It's a really bad\n00:37:10.560 --> 00:37:13.930\nidea when a user comes in on Monday\nmorning and sees something\n00:37:13.980 --> 00:37:17.020\nand starts ringing and you don't\nknow anything about it.", "\n00:37:18.360 --> 00:37:23.920\nAlso, to think about some of these\nuser features can have some\n00:37:23.970 --> 00:37:28.140\nlevel of administrative control\nof plight if required.", "\n00:37:28.630 --> 00:37:30.500\nThese are the challenges\nwe have to deal with.", "\n00:37:32.520 --> 00:37:37.160\nIt's all a factor of losing control,\nbecause when you are on\n00:37:37.210 --> 00:37:40.670\nprem you can do anything you like. ", "The\nservers are under your control.", "\n00:37:40.720 --> 00:37:43.850\nAD is under your control. ", "The clients\nare under your control.", "\n00:37:43.900 --> 00:37:45.660\nThe network is under your control.", "\n00:37:47.110 --> 00:37:49.140\nManagement isn't under your control.", "\nBut you get the idea.", "\n00:37:49.190 --> 00:37:52.060\nYou have control of everything\nand you can tweak stuff.", "\n00:37:54.080 --> 00:37:55.940\nYou can tweak anything you want.", "\n00:37:56.490 --> 00:37:59.490\nBut Office 365 gives you no control.", "\n00:38:00.470 --> 00:38:02.680\nThey have a roadmap.", "\nIt's very clear.", "\n00:38:03.500 --> 00:38:06.690\nThey do a good job of publishing\nit and that's what you're going\n00:38:06.740 --> 00:38:07.150\nto get.", "\n00:38:10.920 --> 00:38:13.940\nDetails because of some of that\nflighting stuff and straggling\n00:38:13.990 --> 00:38:17.010\nstuff can vary from time to time,\nbut essentially what's on the\n00:38:17.060 --> 00:38:20.900\nroadmap is what you get. ", "And you\ncan look and see what's coming\n00:38:20.950 --> 00:38:23.250\nup and you can try to figure\nout what's going to happen.", "\n00:38:26.720 --> 00:38:30.300\nIt's also true that Microsoft sometimes\nmakes decisions that\n00:38:30.350 --> 00:38:31.840\nyou are going to disagree with.", "\n00:38:32.770 --> 00:38:36.140\nI fundamentally disagree with the\ndecision not to clean out the\n00:38:36.190 --> 00:38:40.650\ndeleted items folder. ", "I think that's\nstupid, but I'm looking\n00:38:40.700 --> 00:38:43.090\nat it from the perspective\nof an enterprise admin.", "\n00:38:44.070 --> 00:38:48.000\nFor somebody who's running as a\ntenant who's serving 20 users\n00:38:48.050 --> 00:38:50.730\nand they don't have the time to\ndeal with users telling them\n00:38:50.780 --> 00:38:55.440\nthat they can't find a deleted message,\nit's the greatest innovation\n00:38:56.760 --> 00:38:58.040\nin the last 20 years.", "\n00:39:02.590 --> 00:39:05.850\nPart of losing control is this\never-changing interface.", "\n00:39:08.050 --> 00:39:11.080\nBecause we don't have formal\nrelease cycles,\n00:39:12.300 --> 00:39:15.600\nwith Exchange you think that there\nis a cumulative update coming\n00:39:15.650 --> 00:39:19.480\nevery 13 weeks in something might\nchange in the UI of OWA in\n00:39:19.530 --> 00:39:22.130\nthat stage or even Outlook or whatever,\n00:39:23.860 --> 00:39:30.020\nbut the UI in Office 365 is in\nthis constant flux. ", "Things are\n00:39:30.070 --> 00:39:33.930\nchanging all the time underneath\nof it. ", "So you can see stuff\n00:39:33.980 --> 00:39:38.120\nhappening that is totally unpredictable.", "\nMy example here is\n00:39:38.170 --> 00:39:43.390\nin January 2015, this year, they were\npreparing for the new compliance\n00:39:43.440 --> 00:39:47.100\ncenter which is the new area where all\nof the things about preservation,\n00:39:47.590 --> 00:39:51.720\narchiving, retention policies comes\nfrom. ", "There were changes\n00:39:51.770 --> 00:39:54.530\nthat were going to be made to the\nExchange administration console\n00:39:54.580 --> 00:39:58.060\nand also to the Office 365 administration\nconsole. ", "All of a\n00:39:58.110 --> 00:40:01.320\nsudden we started to see things\nlike duplicate items showing\n00:40:01.370 --> 00:40:05.240\nup in menus. ", "We started to see menu\nitems being missing. ", "It was\n00:40:05.290 --> 00:40:06.750\nthere a moment ago and now it's gone.", "\n00:40:07.360 --> 00:40:09.930\nThat's quite disconcerting when\nyou think about it. ", "You start\n00:40:09.980 --> 00:40:13.830\nwondering to yourself what kind\nof mind altering drugs did I\n00:40:13.880 --> 00:40:15.080\nhave at lunchtime.", "\n00:40:15.940 --> 00:40:18.190\nIt was there before lunch and now\nit's gone, but that's the type\n00:40:18.240 --> 00:40:22.830\nof thing. ", "You also saw things like\noptions being grayed out all\n00:40:22.880 --> 00:40:26.540\nof a sudden and this is all because\ndata is being refreshed and\n00:40:26.590 --> 00:40:29.680\ndata elements are being refreshed and\nUI elements are being refreshed\n00:40:29.730 --> 00:40:30.770\nand it just happens.", "\n00:40:32.640 --> 00:40:34.630\nIt's something we have\nto factor in.", "\n00:40:35.410 --> 00:40:37.600\nHere are some other examples\nof UI changes.", "\n00:40:38.270 --> 00:40:42.330\nThe app launcher came in. ", "See this\nthing here? ", "All the apps.", "\n00:40:42.380 --> 00:40:45.920\nWhy did that come in? ", "Simple. ", "It\nwas needed because there wasn't\n00:40:45.970 --> 00:40:50.820\nenough space on the bar, the browser\nbar to fit all of the options\n00:40:50.870 --> 00:40:53.570\nthat a user could use. ", "I think\nit's a pretty good idea.", "\n00:40:54.750 --> 00:40:57.260\nYou should've seen the hate\nmail that came out of this.", "\n00:40:58.840 --> 00:41:04.260\nUsers hated it. ", "The next one. ", "Another\nhate mail blizzard, the\n00:41:04.310 --> 00:41:06.320\nicon for Outlook.", "\n00:41:07.730 --> 00:41:11.730\nMicrosoft changed the text underneath\nof it for mail from Outlook\n00:41:11.780 --> 00:41:12.400\nto mail.", "\n00:41:13.150 --> 00:41:14.970\nEverybody thought that was a disaster.", "\n00:41:16.640 --> 00:41:19.380\nYou see the type of people we have\nto work with? ", "I mean, my God.", "\n00:41:20.790 --> 00:41:25.700\nGroup notifications, so Office 365\nyou can like things in Office\n00:41:25.750 --> 00:41:30.910\n365 Groups. ", "I am of an age when\nlike means something specific\n00:41:30.960 --> 00:41:31.500\nto me.", "\n00:41:32.210 --> 00:41:35.400\nI'm not into Facebook likes. ", "I'm\nnot into Twitter likes, any\n00:41:35.450 --> 00:41:39.660\ntype of likes. ", "But anyway, apparently,\nit's part of being social.", "\n00:41:39.710 --> 00:41:43.490\nI guess I'm not very social, so\nI don't like them, but anyway\n00:41:43.540 --> 00:41:46.600\nyou can like stuff in groups. ", "When\nyou like stuff in groups you\n00:41:46.650 --> 00:41:50.050\nget notifications that somebody\nreally likes you. ", "I'm so this\n00:41:50.100 --> 00:41:53.630\npopped up and it wasn't working\nof course because nobody was\n00:41:53.680 --> 00:41:57.840\nreally using groups. ", "And then they\nsaid we've got to take that\n00:41:57.890 --> 00:42:01.910\naway and so it appeared. ", "It was there\nfor about six hours and disappeared.", "\n00:42:01.960 --> 00:42:08.980\nConfusion. ", "Distribution groups, you\nknow in on prem, OWA, you've\n00:42:09.030 --> 00:42:12.560\ngot an option where users can manage\nfor their own distribution groups.", "\n00:42:14.000 --> 00:42:17.010\nSo that option disappeared for a\nwhile and that wasn't so good.", "\n00:42:17.750 --> 00:42:20.780\nBut essentially, at the end of the\nday the point you've got to\n00:42:20.830 --> 00:42:24.460\nfigure out, if you can't learn to\nlive with cloud cadence, should\n00:42:24.510 --> 00:42:25.750\nyou be going to the cloud?", "\n00:42:26.480 --> 00:42:29.430\nIf your organization can't live\nwith this, should they be going\n00:42:29.480 --> 00:42:30.150\nto the cloud?", "\n00:42:34.450 --> 00:42:37.110\nSome examples to a fairly major\n00:42:38.400 --> 00:42:39.930\nrecent new functionality,\n00:42:41.190 --> 00:42:45.150\nthis new functionality is introduced\nto first release tenants\n00:42:45.200 --> 00:42:46.380\nfirst, naturally.", "\n00:42:47.240 --> 00:42:50.950\nThey get to see it. ", "However, Microsoft\nwill tell you that it's\n00:42:51.000 --> 00:42:54.690\nabout two weeks before general availability\noccurs. ", "That's not\n00:42:54.740 --> 00:42:55.580\nactually true.", "\n00:42:56.400 --> 00:42:58.740\nThat's what's on the website.", "\nIt's not true. ", "And the reason\n00:42:58.790 --> 00:43:02.350\nis because once stuff goes into first\nrelease it's an opportunity\n00:43:02.400 --> 00:43:05.780\nfor Microsoft to experiment with\nit. ", "It's an opportunity to\n00:43:05.830 --> 00:43:09.960\ntweak it. ", "It's an opportunity to\nsee what users like and dislike.", "\n00:43:10.650 --> 00:43:14.910\nSome things and Delve is the best\nexample of it were in first\n00:43:14.960 --> 00:43:17.480\nrelease status for a very long\ntime. ", "For Delve it was about\n00:43:17.530 --> 00:43:18.510\nsix months.", "\n00:43:19.340 --> 00:43:24.340\nEventually, they will say this is ready.", "\nAt that point new functionality\n00:43:24.390 --> 00:43:27.180\ngoes into general release\nand everybody gets it.", "\n00:43:28.170 --> 00:43:32.300\nEverybody gets it if you're on the\nright plan because some plans\n00:43:32.350 --> 00:43:36.690\ndon't have some of this stuff in it.", "\nIn the last number of months,\n00:43:36.740 --> 00:43:39.950\nI think this is the list since last\nNovember. ", "We've had Delve,\n00:43:40.000 --> 00:43:44.440\nOffice Video, Office 365 Groups,\nClutter and People View.", "\n00:43:45.310 --> 00:43:47.000\nThat's a lot of new functionality.", "\n00:43:48.410 --> 00:43:50.730\nThat's a lot of new functionality\nfor users to deal with, but\n00:43:50.780 --> 00:43:52.910\nit's also a lot of new functionality\nfor admittance to figure\n00:43:52.960 --> 00:43:55.270\nout how they're going to use. ", "This\nis the kind of cadence that\n00:43:55.320 --> 00:43:56.420\nyou're going to have to deal with.", "\n00:43:57.960 --> 00:44:01.320\nOffice Delve is an interesting\nexample of what happens.", "\n00:44:01.370 --> 00:44:03.950\nRemember I said it takes about\nsix months? ", "I think this is a\n00:44:04.000 --> 00:44:08.890\ngreat interface. ", "I think it's a\ngreat way to liberate people\n00:44:08.940 --> 00:44:12.560\nfrom information silos that too often\nexist inside organizations.", "\n00:44:12.590 --> 00:44:15.820\nI really like it. ", "I think there\nis some tweaking that could be\n00:44:15.870 --> 00:44:19.660\ndone with the Office Graph database,\nespecially from Europe,\n00:44:19.710 --> 00:44:21.970\nbut we'll get to that\nin another place.", "\n00:44:22.800 --> 00:44:26.750\nEssentially, everything that you do\nin Office 365 has been tracked\n00:44:26.800 --> 00:44:30.070\nand it goes into the Office Graph\ndatabase which is where Delve\n00:44:30.120 --> 00:44:31.680\ngets its information from.", "\n00:44:32.630 --> 00:44:35.970\nYou look about some of the things that\nthey have to do over that period.", "\n00:44:36.020 --> 00:44:39.290\nIf you were using Delve first release\nand you went through all\n00:44:39.340 --> 00:44:44.000\nof this, so you didn't know about,\nfor example, SharePoint holds.", "\n00:44:44.050 --> 00:44:47.660\nIf a document was put on hold or\na document library was put on\n00:44:47.710 --> 00:44:52.910\nhold and a change was made in it,\nup popped the preservation\n00:44:52.960 --> 00:44:56.410\nlibrary in a Delve view. ", "That shouldn't\nhappen because that's\n00:44:56.460 --> 00:44:57.540\na hidden library.", "\n00:44:58.050 --> 00:44:59.910\nIt wasn't very hidden for\nyou, but there you go.", "\n00:45:00.930 --> 00:45:04.560\nIt couldn't cope with any documents\nthat were in groups, private\n00:45:04.610 --> 00:45:08.390\ndocument libraries. ", "They remain\ninvisible even to people who\n00:45:08.440 --> 00:45:11.780\nowned those documents, so that\nshouldn't have happened.", "\n00:45:13.090 --> 00:45:16.760\nInitially, out of the box it didn't\nprovide any way to hide documents\n00:45:16.810 --> 00:45:20.510\nfrom Delve. ", "You can now do it by making\na change to the SharePoint\n00:45:20.560 --> 00:45:26.310\nschema in the libraries. ", "You can\nsay all the documents in the\n00:45:26.360 --> 00:45:29.800\nHR document library I don't want\nthem to ever show up in Delve,\n00:45:29.850 --> 00:45:30.860\nso that's pretty good.", "\n00:45:32.130 --> 00:45:36.410\nThen boards were added. ", "There's this\nthing of being able to very\n00:45:36.460 --> 00:45:40.920\nquickly set up a collection of\ndocuments by pinning them all\n00:45:40.970 --> 00:45:41.670\nto a board.", "\n00:45:42.270 --> 00:45:46.150\nIt's a nice idea, but there is no administrative\ncontrol whatsoever.", "\n00:45:46.840 --> 00:45:50.960\nYou could have 42 different boards\nwith approximately the same\n00:45:51.010 --> 00:45:54.680\nname, which doesn't seem to be\na good thing, but it's the way\n00:45:54.730 --> 00:45:55.410\nthat it's done.", "\n00:45:56.390 --> 00:45:58.490\nAnd then you have e-mail\nattachments were added.", "\n00:45:59.420 --> 00:46:02.770\nWhat this means is that if somebody\nsends you an attachment and\n00:46:02.820 --> 00:46:07.970\nyou are in Exchange Online mailbox,\nthose attachments can be\n00:46:08.020 --> 00:46:12.280\nsurfaced in Delve. ", "Not all attachments\nwill be surfaced.", "\n00:46:12.330 --> 00:46:15.750\nDelve will make a calculation as\nto which are the most relevant\n00:46:15.800 --> 00:46:17.540\nto you and show you them.", "\n00:46:18.160 --> 00:46:19.420\nBut here's the kicker.", "\n00:46:19.960 --> 00:46:25.000\nIt depends on those messages containing\nthe attachments remaining\n00:46:25.050 --> 00:46:26.020\nin the inbox.", "\n00:46:26.820 --> 00:46:30.410\nIf you go and refile the document\nsomewhere and then you say\n00:46:30.460 --> 00:46:32.510\noh Delve. ", "That's a very interesting\nattachment and I would like\n00:46:32.560 --> 00:46:35.210\nto see that and you click\non it, you won't see it.", "\n00:46:36.570 --> 00:46:37.770\nIt is still an open the bug.", "\n00:46:39.000 --> 00:46:41.490\nI'm not picking on Delve, because\nI think a Delve is great.", "\n00:46:42.390 --> 00:46:45.720\nWhat I'm trying to do here is illustrate\nthe kind of dynamics\n00:46:45.770 --> 00:46:47.160\nthat you actually see\n00:46:48.700 --> 00:46:52.160\ninside the service. ", "These\nare exposed to end-users.", "\n00:46:54.550 --> 00:46:57.100\nIt's not like you're running in\na test environment. ", "You figure\n00:46:57.150 --> 00:47:00.120\nall of this stuff out and make sure\nit's ready and then release.", "\n00:47:00.170 --> 00:47:02.150\nThis all happens in live time.", "\n00:47:03.440 --> 00:47:04.510\nIt's very different.", "\n00:47:05.660 --> 00:47:09.800\nAnother example, Office 365 Groups, I\nthink this is a great innovation too.", "\n00:47:10.470 --> 00:47:14.500\nIt's the first innovation in the\narea of distribution groups\n00:47:14.550 --> 00:47:17.840\nthat we have had since dynamic distribution\ngroups were introduced\n00:47:17.890 --> 00:47:21.890\nin Exchange 2003. ", "It's the future\nof distribution groups and\n00:47:21.940 --> 00:47:22.830\nso that's good too.", "\n00:47:24.110 --> 00:47:29.470\nHow can I begin? ", "I got very upset\nwhen these were introduced.", "\n00:47:29.520 --> 00:47:33.810\nI did. ", "I may have said words that\nstarted with F and ended with\n00:47:33.860 --> 00:47:34.700\nsomething else.", "\n00:47:36.680 --> 00:47:37.940\nWhat do you think I said?", "\n00:47:38.520 --> 00:47:40.630\nFun, yeah, fun,\n00:47:42.890 --> 00:47:45.420\nthere you go. ", "Fun for\nthe Republican Party\n00:47:47.260 --> 00:47:51.020\nand Fox News. ", "I could\nhave said Fox News.", "\n00:47:52.760 --> 00:47:54.660\nYou missed that one, eh?", "\n00:47:56.830 --> 00:48:00.260\nThat's a queue for go fast. ", "Anyway\nI may have said words.", "\n00:48:05.400 --> 00:48:10.170\nBasically, groups leverage a lot of\ndifferent parts of Office Online.", "\n00:48:10.220 --> 00:48:13.680\nYou got Exchange contributing to\nshared mailbox and a calendar.", "\n00:48:13.730 --> 00:48:16.930\nYou have OneDrive. ", "You have OneNote.", "\nAnd you're going to have\n00:48:16.980 --> 00:48:20.290\nother stuff that's going to be put in\nthere. ", "It's really, really good.", "\n00:48:21.000 --> 00:48:23.700\nBut what I really got upset about\nwas the fact that there was\n00:48:23.750 --> 00:48:27.660\nabsolutely no management control\nover groups. ", "Anybody could\n00:48:28.710 --> 00:48:34.710\ncreate a group. ", "I realized that this\nis a clash between my fuddy-duddy\n00:48:34.760 --> 00:48:38.640\nmanagement style, which is where\nI would like control because\n00:48:38.690 --> 00:48:41.760\nI remember what happened when public\nfolders were introduced\n00:48:42.520 --> 00:48:46.420\nand people forgot. ", "There are probably\na few of you in this room\n00:48:47.450 --> 00:48:51.600\nwho forgot to put any control\non the public folder route.", "\n00:48:56.440 --> 00:49:00.440\nCome on. ", "There are a couple\nof you here. ", "There you go.", "\n00:49:00.490 --> 00:49:03.820\nThere you go. ", "So what happened when\nyou didn't control the public\n00:49:03.870 --> 00:49:07.120\nfolder route and the user could\ncreate a public folder?", "\n00:49:07.170 --> 00:49:10.830\nThis is a reason why some companies today\nhave 2 million public folders.", "\n00:49:13.330 --> 00:49:16.290\nI pointed this out to the development\nengineers and said maybe\n00:49:16.340 --> 00:49:20.340\nit would be a bad idea to replicate\nthe faults of the past.", "\n00:49:20.390 --> 00:49:24.810\nI was told I am too old. ", "I don't\nunderstand. ", "It's the way of\n00:49:24.860 --> 00:49:29.670\nthe cloud. ", "We're making users collaborate\nbetter. ", "They say they\n00:49:29.720 --> 00:49:32.380\nare going to be collaborating so\nmuch that they will be creating\n00:49:32.430 --> 00:49:34.910\ngroups from here to the end of eternity\nand then we will be trying\n00:49:34.960 --> 00:49:36.830\nto delete them until the end of eternity.", "\n00:49:38.920 --> 00:49:42.550\nAgain, it's an example. ", "It's a clash\nof the kind of on prem environment\n00:49:42.600 --> 00:49:44.910\nand the clash with the cloud environment\nthat you have to get\n00:49:44.960 --> 00:49:47.290\nyour head around. ", "I still like it.", "\n00:49:48.390 --> 00:49:51.400\nThe next thing we have to discuss\nis how do you know when any\n00:49:51.450 --> 00:49:52.920\nof this stuff changes.", "\n00:49:54.430 --> 00:50:04.180\nWhispery clouds are extraordinarily\ndifficult to stand on our document.", "\n00:50:05.710 --> 00:50:11.300\nTechNet, our friend, your source\nof wisdom for years, boy it\n00:50:11.350 --> 00:50:12.530\nstruggles with the cloud.", "\n00:50:14.150 --> 00:50:16.490\nThe writers or human and\nthey are like us.", "\n00:50:17.290 --> 00:50:20.500\nThey find it difficult to know what's\ngoing on and so you can't\n00:50:20.550 --> 00:50:23.990\ndepend on TechNet. ", "It really,\nreally struggles.", "\n00:50:24.550 --> 00:50:29.740\nAnd you can't take Exchange on prem\ncontent and read it directly\n00:50:29.790 --> 00:50:32.570\ninto the cloud because of the\ndifferences that exist.", "\n00:50:32.620 --> 00:50:33.880\nThat's a health warning.", "\n00:50:36.400 --> 00:50:43.160\nWhen you have features like Delve\nor Office 365 Groups or Clutter\n00:50:43.210 --> 00:50:47.640\nor People View are introduced, they\nare normally introduced with\n00:50:47.690 --> 00:50:49.440\na total lack of documentation.", "\n00:50:50.450 --> 00:50:53.540\nThey are normally introduced with\nthe total lack of advice or\n00:50:53.590 --> 00:50:55.900\nguidance or whatever. ", "You\nmight get a blog post.", "\n00:50:57.750 --> 00:51:02.580\nI like a lot of the people, some\nof whom are in this room who\n00:51:02.630 --> 00:51:04.800\nwrite for blogs.office.com.", "\n00:51:06.010 --> 00:51:07.670\nI do really like you guys.", "\n00:51:08.770 --> 00:51:13.070\nBut let's face it. ", "You are marketeers\nand you sometimes don't\n00:51:13.120 --> 00:51:15.920\nwrite at the level that\ntechnologists require.", "\n00:51:16.730 --> 00:51:18.730\nIt would be nice if you\ndid, but you don't.", "\n00:51:20.020 --> 00:51:25.660\nA post on the office.com site is\nnot exactly documentation.", "\n00:51:25.970 --> 00:51:29.670\nAnyway, blogs are like dead fish.", "\nWhy are blogs like dead fish?", "\n00:51:32.270 --> 00:51:35.370\nThree days, yeah, after three\ndays they're out-of-date.", "\n00:51:36.100 --> 00:51:39.550\nIn the clouds a blog is out of\ndate after three days, so you\n00:51:39.600 --> 00:51:42.830\nhave to bear that in mind. ", "And\nthere are lots of great blogs.", "\n00:51:44.210 --> 00:51:48.130\nMVPs, Microsoft customers, other\nfolk, they go and they write\n00:51:48.180 --> 00:51:52.200\nblogs and it's great, lots of advice,\nbut really, really you\n00:51:52.250 --> 00:51:58.110\nhave to take account of the fact that\nthe time they write something\n00:51:58.770 --> 00:51:59.940\nis not necessarily\n00:52:01.230 --> 00:52:03.470\nreporting exactly what you\nsee in front of you.", "\n00:52:04.970 --> 00:52:08.540\nI won't even start talking about\nall of the troubles of keeping\n00:52:08.590 --> 00:52:09.650\nbooks updated.", "\n00:52:10.880 --> 00:52:11.370\nHow do\n00:52:13.880 --> 00:52:17.840\nwe track change? ", "First thing is,\nI think that any of you, it\n00:52:17.890 --> 00:52:23.360\nwould be very wise that you take\na trial domain. ", "Go and get\n00:52:23.410 --> 00:52:29.020\na test domain in Office 365 and go\nand only by a couple of licenses\n00:52:29.070 --> 00:52:33.080\nin it, but put it into the\nfirst release program.", "\n00:52:34.230 --> 00:52:37.320\nYou can keep your production domain.", "\nThat's standard release,\n00:52:37.370 --> 00:52:40.620\nbut at least that first release\ndomain will allow you to see\n00:52:40.670 --> 00:52:44.020\nwhat's coming. ", "It will allow you\nto play with the stuff and it\n00:52:44.070 --> 00:52:46.580\nwill allow you to figure out what's\nhappening and it will allow\n00:52:46.630 --> 00:52:48.250\nyou to prepare for your users.", "\n00:52:49.130 --> 00:52:53.260\nSecond place, definitely keep an\neye on the Office 365 roadmap.", "\n00:52:53.820 --> 00:52:57.420\nIn particular, look at the part\nthat says in development.", "\n00:52:58.300 --> 00:53:02.190\nThat gives you advanced warning.", "\nAnd then look at the part saying\n00:53:02.240 --> 00:53:07.510\nrolling out. ", "That tells you what\nshould be rolling out to first\n00:53:07.560 --> 00:53:10.540\nto the first release people and\nthen general availability.", "\n00:53:10.870 --> 00:53:12.170\nYou need to keep an eye on that.", "\n00:53:12.780 --> 00:53:17.520\nDefinitely look at the Office 365 blog\nto see all of the information.", "\n00:53:18.880 --> 00:53:21.790\nIt can give you a heads up. ", "Today,\nthey talked about the new\n00:53:21.840 --> 00:53:25.260\nOffice 365 port service,\nso that's a good thing.", "\n00:53:26.100 --> 00:53:27.940\nThere are lots of other good blogs\nout there, but remember the\n00:53:27.990 --> 00:53:28.990\nhealth warning.", "\n00:53:29.850 --> 00:53:31.420\nAnd then here's a good thing.", "\n00:53:32.190 --> 00:53:35.340\nYou should be part of the Office\n365 Yammer network.", "\n00:53:35.970 --> 00:53:39.240\nI never thought I would say you should\nbe part of and then Yammer\n00:53:39.290 --> 00:53:40.870\nnetwork in the same sentence.", "\n00:53:43.000 --> 00:53:48.170\nI really didn't. ", "Anyhow, now that\nI've purged my soul on that\n00:53:48.220 --> 00:53:52.090\none I'm sure I'll hear about that\none in Twitter later on.", "\n00:53:53.380 --> 00:53:57.780\nThere is actually a very nice group\nin Yammer called Change Alerts\n00:53:57.830 --> 00:54:03.290\nwhich is driven by members of the\nnetwork who have noticed things\n00:54:03.340 --> 00:54:07.110\nchanging in their Office 365 tenant.", "\nThey are bringing it to\n00:54:07.160 --> 00:54:11.190\nthe notice of others that are there.", "\nThat's a great public service\n00:54:11.240 --> 00:54:13.230\nand you should be part of\nthat public service.", "\n00:54:13.790 --> 00:54:15.390\nAnd then there is Twitter.", "\n00:54:16.590 --> 00:54:20.050\nTwitter at one stage was called\nthe only reliable indication\n00:54:20.100 --> 00:54:24.420\nof service health a cause if something\nwent down in Office 365\n00:54:24.470 --> 00:54:27.770\nyou found out about it quickest in\nTwitter. ", "I still think Twitter\n00:54:27.820 --> 00:54:31.560\nis a very good place to find out\nwhat's happening and you should\n00:54:31.610 --> 00:54:32.890\nprobably think about that.", "\n00:54:34.190 --> 00:54:35.550\nSomething about interfaces,\n00:54:38.220 --> 00:54:42.360\nstarting off with how you\ninteract with Office 365.", "\n00:54:42.950 --> 00:54:47.030\nIt's important to say that the administration\ninterfaces do occur\n00:54:47.080 --> 00:54:51.040\nin different places. ", "You form tasks\ntwo different interfaces.", "\n00:54:51.090 --> 00:54:56.270\nIt is sometimes frustrating to see\nthat there are so many different\n00:54:56.320 --> 00:55:00.290\nways of doing it. ", "I is doing a lot\nof work to try to bring all\n00:55:00.340 --> 00:55:02.700\nof those interfaces together, but\nI think it's inevitable because\n00:55:02.750 --> 00:55:06.620\nlet's face it. ", "We're still only a\ncouple of years down this cloud\n00:55:06.670 --> 00:55:10.990\njourney and a lot of the interfaces\nthat we see out there are\n00:55:11.040 --> 00:55:15.130\ninterfaces that are inherited from\nthe on premises environment.", "\n00:55:15.180 --> 00:55:19.570\nLook at the Exchange Administration\nConsole. ", "It's going to take\n00:55:19.620 --> 00:55:23.920\ntime for us to see a truly unified\nview of Office 365 administration.", "\n00:55:23.970 --> 00:55:27.840\nJust be prepared to do things\nin different places.", "\n00:55:30.050 --> 00:55:33.120\nSome tools that you can use, clearly\nthere is the Admin Portal\n00:55:33.170 --> 00:55:36.980\nand the Exchange Administration Center,\nthat in particular should\n00:55:37.030 --> 00:55:39.510\nbe very useful to you.", "\n00:55:40.390 --> 00:55:43.310\nThere's the Azure Active Directory\nPortal with full figure out\n00:55:43.360 --> 00:55:45.810\nstuff about what's being\nreplicated up to Azure.", "\n00:55:46.560 --> 00:55:50.480\nAnd then there's this Office 365\nAdmin App. ", "I was talking to\n00:55:50.530 --> 00:55:53.580\nthe program manager of this app\nthe other day. ", "He gave me a\n00:55:53.630 --> 00:55:57.510\nbit of a shock because he came\nup to me and he said I wanted\n00:55:57.560 --> 00:56:00.250\nto talk to you about what you have\nbeen writing about my application.", "\n00:56:00.700 --> 00:56:03.280\nAnd I thought I was going to get\nhit or something like that.", "\n00:56:03.330 --> 00:56:04.290\nWhat had I said?", "\n00:56:04.850 --> 00:56:08.630\nI was frantically thinking who have\nI offended in the last six months?", "\n00:56:10.120 --> 00:56:12.660\nThat was a long list,\nactually. ", "That was\n00:56:15.370 --> 00:56:19.620\na very long list. ", "Anyhow, we talked\na bit and then I said how\n00:56:19.670 --> 00:56:21.840\nold are you? ", "And he said 23.", "\n00:56:22.990 --> 00:56:24.840\nAnd that's when I felt old.", "\n00:56:27.050 --> 00:56:30.050\nThis is a great app. ", "It's\nupdated every two weeks,\n00:56:31.310 --> 00:56:34.180\nso there are new versions of it\nevery two weeks. ", "And it is nice\n00:56:34.230 --> 00:56:36.130\nto be able to carry it\naround in your pocket.", "\n00:56:37.320 --> 00:56:39.940\nAn app that shows you what is happening\non the service and what\n00:56:39.990 --> 00:56:43.630\nservice messages are coming up and\nthey're adding more and more\n00:56:43.680 --> 00:56:47.390\nbits to it. ", "It's still got a way\nto go, but this is definitely\n00:56:47.440 --> 00:56:51.560\na thing to track. ", "Then there is\nPowerShell. ", "Of course there\n00:56:51.610 --> 00:56:55.760\nis PowerShell. ", "PowerShell always\nworks and it's great.", "\n00:56:56.440 --> 00:56:59.380\nAnd you should use it.", "\n00:57:00.370 --> 00:57:01.310\nIt's reduced.", "\n00:57:02.240 --> 00:57:03.360\nWhy is it reduced?", "\n00:57:04.000 --> 00:57:05.960\nThere is so much stuff that is\nso behind the scenes that you\n00:57:06.010 --> 00:57:08.500\ndon't need to get involved with,\nbut there is still a lot of\n00:57:08.550 --> 00:57:09.770\nPowerShell there that you can use.", "\n00:57:10.620 --> 00:57:16.050\nIt is important that you look at\non prem scripts and test them\n00:57:16.100 --> 00:57:19.230\nbefore attempting to use them in\nproduction with Exchange Online\n00:57:19.280 --> 00:57:22.460\nbecause it's likely the stuff will\nbreak. ", "It's very likely that\n00:57:22.510 --> 00:57:24.860\nstuff will break. ", "In particular,\nyou are going to have to think\n00:57:24.910 --> 00:57:28.270\nabout authentication, things like\nif you want to send e-mail\n00:57:28.320 --> 00:57:30.680\nand stuff like that, think\nabout authentication.", "\n00:57:31.390 --> 00:57:35.600\nThe general routine inside your\nscripts or inside a PowerShell\n00:57:35.650 --> 00:57:37.980\nsession you are going to be connecting\nto Exchange Online.", "\n00:57:38.030 --> 00:57:44.190\nThat's very similar to connecting\nto PowerShell inside on prem\n00:57:44.240 --> 00:57:46.940\nbecause it's remote PowerShell. ", "Remember\nthat PowerShell started\n00:57:46.990 --> 00:57:49.810\nit off and it was just a direct\nconnection to the server you\n00:57:49.860 --> 00:57:52.360\nare on? ", "And then it went\nto a remote connection?", "\n00:57:53.620 --> 00:57:57.480\nYou use the exact same technology\nin Exchange Online. ", "It will\n00:57:57.530 --> 00:58:01.050\nthen load all of the Exchange cmdlets.", "\n00:58:01.720 --> 00:58:04.530\nNote that there are some special\ncmdlets if you want to deal\n00:58:04.580 --> 00:58:08.990\nwith the client center. ", "That's documented\nonline. ", "You may also\n00:58:09.040 --> 00:58:13.800\nwant to load a set of cmdlets to deal\nwith Microsoft online services.", "\n00:58:14.100 --> 00:58:17.280\nIf you want to deal with licenses\nor you want to deal with user\n00:58:17.330 --> 00:58:22.560\naccounts, you need those cmdlets,\nand then there are other ones\n00:58:22.610 --> 00:58:24.130\nlike Azure Active Directory.", "\n00:58:26.250 --> 00:58:29.500\nTerms of clients, I said the latest\nare strongly recommended.", "\n00:58:30.320 --> 00:58:34.250\nA thing to remember about Outlook web\napp is that it is the experimental\n00:58:34.300 --> 00:58:41.440\nplatform for Exchange Online. ", "New features\nshow up here all the time.", "\n00:58:42.400 --> 00:58:51.990\nIt's because Outlook it can't just\nchange its user interface\n00:58:52.040 --> 00:58:55.800\nquickly enough to deal with the\nnew functionality, but they can\n00:58:55.850 --> 00:58:58.160\nmake changes behind the scenes for\nOutlook Web App and a bang,\n00:58:58.210 --> 00:59:00.000\nthere you go.", "\n00:59:01.060 --> 00:59:05.300\nIt's a really nice client now. ", "I\ndidn't really like it when it\n00:59:05.350 --> 00:59:08.970\ncame out first in Exchange 2013, but\nI think it has evolved tremendously.", "\n00:59:09.500 --> 00:59:13.800\nI especially like it if you are\non a flaky connection because\n00:59:13.850 --> 00:59:17.460\nit's so much less demanding on\nthe network then Outlook is.", "\n00:59:18.640 --> 00:59:23.350\nInterestingly, Outlook is still\nthe most prevalent client used\n00:59:23.400 --> 00:59:25.020\nto connect to Exchange Online.", "\n00:59:26.870 --> 00:59:33.260\nIOS is the most popular mobile client\ndespite the fact that android\n00:59:33.690 --> 00:59:34.840\nhas the market share.", "\n00:59:36.780 --> 00:59:42.550\nIt's clear that the mobile client strategy\nis in flux at the moment.", "\n00:59:42.600 --> 00:59:45.740\nWe have seen that the client, the\nOutlook for iOS and Outlook\n00:59:45.790 --> 00:59:48.590\nfor android client evolving\nvery quickly.", "\n00:59:49.380 --> 00:59:53.350\nWindows 10 will bring universal\nclient for Windows Phone.", "\n00:59:54.910 --> 00:59:57.690\nIt's hard to keep up with times.", "\nIt is really hard to keep up.", "\n01:00:00.060 --> 01:00:03.560\nSecond most popular thing, we've had\nmigration. ", "Let's talk about support.", "\n01:00:05.840 --> 01:00:09.470\nGenerally, Office 365 has a\nvery good SLA record, but\n01:00:10.900 --> 01:00:16.390\nthings will happen. ", "The DevOps model,\nwhich means that the developers\n01:00:16.440 --> 01:00:20.760\nactually work on the service, they\nsupport the service. ", "If a\n01:00:20.810 --> 01:00:24.190\ncode goes bad they go fix it. ", "It\nhelps keep people very focused,\n01:00:24.240 --> 01:00:25.420\nbut things happen.", "\n01:00:26.470 --> 01:00:29.370\nIt's important to say that if you\ngo and look at the service\n01:00:29.420 --> 01:00:35.010\ndashboard and you see a red mark\nagainst something like Exchange\n01:00:35.060 --> 01:00:38.230\nor SharePoint or something like\nthat, that may not necessarily\n01:00:38.280 --> 01:00:42.430\nbe of any consequence to you. ", "It may\naffect something in a completely\n01:00:42.480 --> 01:00:43.550\ndifferent region.", "\n01:00:44.240 --> 01:00:46.940\nThere might be millions of mailboxes\nbut you don't care because\n01:00:46.990 --> 01:00:48.240\nyou just keep on working.", "\n01:00:49.520 --> 01:00:52.040\nThat's one of the problems that\nwe've got that Microsoft has\n01:00:52.090 --> 01:00:55.810\nto work on is to be able to filter\nall of the signals that they\n01:00:55.860 --> 01:00:59.260\ngather which allow them to\nknow when I have problems.", "\n01:01:00.050 --> 01:01:04.230\nInstead of providing you with a\nglobal view of how it is across\n01:01:04.280 --> 01:01:09.070\nthe entire service, to give you a view\nof what affects a particular tenant.", "\n01:01:09.120 --> 01:01:11.270\nThat would be really nice. ", "I believe\nthey're working on that,\n01:01:11.320 --> 01:01:12.510\nso that's good.", "\n01:01:14.050 --> 01:01:18.020\nThe dashboard tells you what's going\non in any particular instance.", "\n01:01:19.760 --> 01:01:21.860\nI said to one of the engineers\nworking on this that it would\n01:01:21.910 --> 01:01:24.530\nbe nice if some of the explanations\nwere in English from time\n01:01:24.580 --> 01:01:25.170\nto time.", "\n01:01:25.780 --> 01:01:29.660\nSome of them are written in engineereez\nwhich is a special language\n01:01:29.710 --> 01:01:31.200\nused by support people.", "\n01:01:33.480 --> 01:01:34.310\nFor you guys,\n01:01:35.570 --> 01:01:38.820\nhere's one that we have when we\nare working on the book, just\n01:01:38.870 --> 01:01:40.740\nto show you how it happens.", "\n01:01:41.790 --> 01:01:44.500\nI collaborated with Michael van\nHornenbig in Belgium and Paul\n01:01:44.550 --> 01:01:45.770\nCunningham in Australia.", "\n01:01:46.340 --> 01:01:49.190\nPaul gets up early because he's\nin Australia and they get up\n01:01:49.240 --> 01:01:52.980\nin the middle of the night or something\nlike that. ", "Anyway, 7 A.M.\n01:01:53.030 --> 01:01:56.220\nOn 7th of April, a week before we\nclose off the text of the book,\n01:01:56.750 --> 01:02:00.120\nPaul sends me a message, I can't\nfind any of the files.", "\n01:02:00.170 --> 01:02:01.360\nThey've all gone away.", "\n01:02:01.960 --> 01:02:05.300\nThis is in our SharePoint\ndocument library.", "\n01:02:05.810 --> 01:02:08.480\nThat wasn't a good start to the\nday, as you can imagine.", "\n01:02:08.530 --> 01:02:12.580\nThere was absolutely nothing available\non Twitter. ", "There was\n01:02:12.630 --> 01:02:16.910\nabsolutely nothing available on the service\ndashboard. ", "It just happened.", "\n01:02:18.140 --> 01:02:22.290\nThat's a very recent example of how\nthings can happen. ", "You know why?", "\n01:02:23.210 --> 01:02:27.040\nDespite the mild panic that we\nwent through it was just that\n01:02:27.090 --> 01:02:30.700\nbehind the scenes somebody was changing\na network appliance in\n01:02:30.750 --> 01:02:31.840\na data center.", "\n01:02:32.580 --> 01:02:36.740\nBecause that network appliance\nchange was, let's put it like\n01:02:36.790 --> 01:02:41.580\nthis, was slightly screwed up and\ndidn't work, all of a sudden\n01:02:41.630 --> 01:02:45.510\nservice disappeared to a select\ngroup of tenants including the\n01:02:45.560 --> 01:02:48.340\none we were using. ", "So\nthese things happen.", "\n01:02:49.530 --> 01:02:50.590\nIt's just part of life.", "\n01:02:52.990 --> 01:02:56.640\nThis is the detail.", "\nWe don't need that.", "\n01:02:57.430 --> 01:02:58.650\nSupport is different.", "\n01:02:59.170 --> 01:03:02.500\nRemember, you don't have any control\nover all of the stuff that\n01:03:02.550 --> 01:03:04.820\nis happening. ", "Here is\nsome advice for you.", "\n01:03:06.080 --> 01:03:10.450\nWhen you get on the phone and talk\nto a front level support person\n01:03:11.640 --> 01:03:14.500\ntry to make the experience as pleasant\nfor both of you as you\n01:03:14.550 --> 01:03:20.370\npossibly can. ", "Please. ", "They will\nappreciate it and so will you.", "\n01:03:21.080 --> 01:03:25.190\nIt's going to be entirely exasperating\nif you get on the phone\n01:03:25.240 --> 01:03:29.670\nwith these guys and you don't have\ndetails about your environment.", "\n01:03:31.180 --> 01:03:34.520\nThey can't go behind the scenes and\nstart looking up stuff about\n01:03:34.570 --> 01:03:37.620\nyour data. ", "That is not\nthe way things happen.", "\n01:03:38.410 --> 01:03:42.380\nThey are there at the first level\nto filter, to eliminate the\n01:03:42.430 --> 01:03:46.770\neasy cases, to help you understand\nwhat's going on so that maybe\n01:03:46.820 --> 01:03:49.970\nyou can solve the problem, so prepare.", "\n01:03:50.570 --> 01:03:55.650\nUnderstand what's happening and be\nprepared to give that information\n01:03:55.700 --> 01:03:56.580\nto support.", "\n01:03:57.240 --> 01:03:58.970\nDocument everything.", "\n01:04:00.250 --> 01:04:04.580\nDocument all interactions you have\nand understand that it's going\n01:04:04.630 --> 01:04:07.670\nto take time to resolve things\nif they need to escalate.", "\n01:04:08.620 --> 01:04:14.200\nDon't hesitate to ask for a support\nproblem to be escalated,\n01:04:14.970 --> 01:04:18.010\nbut be fair with people, with\nthese guys. ", "If you go and ask\n01:04:18.060 --> 01:04:20.970\nfor everything to be escalated,\nthat's not going to be helpful.", "\n01:04:21.690 --> 01:04:24.710\nAsk to escalate if you need escalation,\nif it's a really important\n01:04:24.760 --> 01:04:27.330\nproblem, because you are the only\none that understands the full\n01:04:27.380 --> 01:04:32.580\ncontext of the problem. ", "And do remember\nto cover all those basics.", "\n01:04:33.230 --> 01:04:39.550\nA little thing about reporting, out-of-the-box,\nOffice 365 gives\n01:04:39.600 --> 01:04:44.040\nyou basic reports for many aspects of\nthe service, which is pretty good.", "\n01:04:44.810 --> 01:04:47.960\nThere is a very interesting data\nmark behind the scenes.", "\n01:04:48.350 --> 01:04:51.920\nThis is where all of the information\nis gathered and stored for\n01:04:51.970 --> 01:04:53.080\nup to 90 days.", "\n01:04:56.010 --> 01:04:58.820\nYou can then use it, there is a\nset of PowerShell cmdlets to\n01:04:58.870 --> 01:05:02.980\nget that information out of it or\nyou can export stuff to Excel\n01:05:03.030 --> 01:05:05.420\nand play around with it and all\nthe rest of it. ", "There's also\n01:05:05.470 --> 01:05:09.730\na group of third parties that do\na good job of making sense of\n01:05:09.780 --> 01:05:13.300\nit, so if you are interested in grabbing\nstuff out of the service,\n01:05:13.350 --> 01:05:15.980\ngo and talk to some of them and\nI think some of them, most of\n01:05:16.030 --> 01:05:17.860\nthem here, I'm not sure about\nthe rest of them here.", "\n01:05:18.520 --> 01:05:23.790\nIn terms of monitoring it's really\ndifficult or impossible to\n01:05:23.840 --> 01:05:26.470\nbe looking at Office\n365 all the time.", "\n01:05:27.510 --> 01:05:31.380\nI think you probably want to consider\nsome third-party monitoring\n01:05:31.430 --> 01:05:36.430\ntools to help you automate the process\nand I mentioned a couple here.", "\n01:05:36.480 --> 01:05:37.990\nSome of these folks are here today.", "\n01:05:38.770 --> 01:05:42.910\nImportant, as I said earlier with\nthe migration tools, test and\n01:05:42.960 --> 01:05:44.330\nfigure out what's good for you.", "\n01:05:47.350 --> 01:05:52.850\nA lot of people wonder is Microsoft\njust going away from on premises?", "\n01:05:52.900 --> 01:05:55.540\nIs there any benefit whatsoever\nof this cloud stuff?", "\n01:05:55.590 --> 01:05:58.400\nActually, there is, because there\nis lots of technology that\n01:05:58.450 --> 01:06:00.830\nhas been transferred from the cloud.", "\n01:06:02.260 --> 01:06:06.020\nSpecifically in these areas, lots\nof automation stuff, lots of\n01:06:06.070 --> 01:06:10.200\neasier debugging, MAPI over HTTP\nis much easier to figure out\n01:06:10.250 --> 01:06:14.640\nwhat's going on than the old way.", "\nThere's a lot more administrative\n01:06:14.690 --> 01:06:17.880\nflexibility that is being built-in,\nRole-based Access Control,\n01:06:17.930 --> 01:06:18.830\nfor example.", "\n01:06:19.670 --> 01:06:22.230\nThat would probably exist unless\nwe were going for cloud.", "\n01:06:22.790 --> 01:06:29.870\nClient flexibility, the fact that can OWA\ncan change with new functionality.", "\n01:06:30.470 --> 01:06:34.580\nAnd even things like the way Autodiscover\nhas expanded its capabilities\n01:06:34.630 --> 01:06:38.230\nover the last couple of years so\nthat's able to provide back\n01:06:38.280 --> 01:06:42.290\nin its XML manifest a complete snapshot\nof all of the resources\n01:06:42.340 --> 01:06:43.750\nthat the client is able to have.", "\n01:06:44.260 --> 01:06:48.010\nThis has all come as a result\nof cloud technology.", "\n01:06:49.080 --> 01:06:50.200\nIt's been pretty good.", "\n01:06:51.170 --> 01:06:54.880\nSome features are never going to\ntransition and here's why.", "\n01:06:54.930 --> 01:07:00.820\nThey are either too complex, too\ncostly, too many moving parts,\n01:07:01.600 --> 01:07:07.580\ntoo many things to tweak or too\nmuch inertia in enterprise IT.", "\n01:07:07.630 --> 01:07:12.010\nI don't think that many enterprise\nIT departments will be capable\n01:07:12.060 --> 01:07:15.820\nor would be capable of setting up\nthe kind of environment that's\n01:07:15.870 --> 01:07:19.110\nrequired to drive something like\nDelve or the Office Graph.", "\n01:07:21.000 --> 01:07:23.870\nNobody's going to pay for the amount\nof hardware that's used\n01:07:24.640 --> 01:07:28.670\nto do the machine learning that's\nrequired to figure out how\n01:07:28.720 --> 01:07:32.820\nto filter mail messages for Clutter.", "\nIt's just not going to happen.", "\n01:07:32.870 --> 01:07:35.610\nAnd let's face it. ", "None of\nus like upgrading stuff.", "\n01:07:37.880 --> 01:07:41.780\nEnterprise IT generally breaks\nout in boils any time it aches\n01:07:41.830 --> 01:07:43.190\nabout an upgrade.", "\n01:07:44.230 --> 01:07:46.940\nWhereas, in the cloud everything\nis being upgraded all the time\n01:07:46.990 --> 01:07:48.700\nbecause it's a constant feedback.", "\n01:07:50.030 --> 01:07:53.970\nFor all of these reasons, you are\nnot going to see some things\n01:07:54.540 --> 01:07:57.540\non premises.", "\n01:07:58.500 --> 01:08:03.210\nThose things are things like Delve,\nlike Clutter, like People\n01:08:03.260 --> 01:08:06.690\nView maybe. ", "I don't know. ", "The Microsoft\npeople used to say I\n01:08:06.740 --> 01:08:08.790\ndon't know. ", "But definitely Delve,\n01:08:10.670 --> 01:08:14.150\nClutter and the Office Graph because\nthey all depend on this\n01:08:14.200 --> 01:08:15.490\nOffice Graph technology.", "\n01:08:19.030 --> 01:08:23.950\nAs we aim towards the finish line\nhere, I think it is important\n01:08:24.000 --> 01:08:25.910\nto think about a back-out plan.", "\n01:08:25.960 --> 01:08:30.520\nI think it really is because the\ncloud may not work for you.", "\n01:08:31.650 --> 01:08:32.670\nIt may not work\n01:08:34.350 --> 01:08:38.420\nfor you. ", "The situation may be that\nit will work for you in five\n01:08:38.470 --> 01:08:40.950\nyears time, but won't\nwork for you now.", "\n01:08:42.180 --> 01:08:46.290\nMaybe you think about how if you\ndo go to Office 365 how are\n01:08:46.340 --> 01:08:49.610\nyou going to get back out. ", "As it\nturns out, mailboxes are easy.", "\n01:08:50.140 --> 01:08:53.440\nIt's all the other stuff that you\nmove across that isn't so easy\n01:08:53.490 --> 01:08:56.980\nbecause whereas, Microsoft is giving\nyou things like the mailbox\n01:08:57.030 --> 01:09:00.700\nreplication service and the Hybrid\nConfiguration Wizard for Exchange,\n01:09:01.080 --> 01:09:05.640\nthere's nothing really there for\nSharePoint or OneDrive or videos\n01:09:05.690 --> 01:09:06.470\nor whatever.", "\n01:09:07.350 --> 01:09:10.350\nSo before you move, maybe one to\nthink about what is the back-out\n01:09:10.400 --> 01:09:14.420\nplan just in case. ", "I hope you never\nget to here. ", "Very few people\n01:09:14.470 --> 01:09:18.620\nonce they go over to Office 365 want\nto come back out, but there\n01:09:18.670 --> 01:09:20.360\nare going to be situations.", "\n01:09:23.600 --> 01:09:27.670\nIn closing, there are some\nkeys to success I think.", "\n01:09:29.600 --> 01:09:31.970\nClearly, it's good to know what\nyou are getting into, good to\n01:09:32.020 --> 01:09:36.220\nknow how you want to use the service,\n01:09:37.540 --> 01:09:40.500\nand you can only do that by figuring\nout exactly how you use\n01:09:40.550 --> 01:09:44.560\non premises software today, and how\nyou can map that into the cloud.", "\n01:09:46.520 --> 01:09:50.140\nMake the decision to go to the\ncloud for the right reasons.", "\n01:09:50.190 --> 01:09:54.470\nDon't just go because some sales\nguy tells you it's six dollars\n01:09:54.730 --> 01:09:59.590\na mailbox a month. ", "That is\nthe worst possible reason.", "\n01:10:00.860 --> 01:10:06.090\nHave good business, yes economic,\nbut also technology and business\n01:10:06.140 --> 01:10:09.020\ncentric reasons for going to the\ncloud and you will be okay.", "\n01:10:10.000 --> 01:10:12.590\nI said earlier solid project management\nis important. ", "I will\n01:10:12.640 --> 01:10:17.840\nrepeat it again. ", "Solid project management\ngets you to the cloud successfully.", "\n01:10:18.940 --> 01:10:22.620\nDon't underestimate the migration\neffort because it is the detail\n01:10:22.670 --> 01:10:26.170\nthat catches you. ", "Moving mailboxes\nis easy. ", "It's all the detail\n01:10:26.220 --> 01:10:29.950\naround it, like making sure all of\nthe users have the right clients,\n01:10:30.000 --> 01:10:31.060\nthat kind of thing.", "\n01:10:32.480 --> 01:10:36.590\nMove workload at a rate that is\nacceptable to the company.", "\n01:10:38.020 --> 01:10:41.310\nSome parts of the company might be more\namenable to change then others.", "\n01:10:41.360 --> 01:10:44.660\nThey are great candidates to go\nfirst. ", "And remember, by the\n01:10:44.710 --> 01:10:49.310\nway, the old thing that we've done\nfor years was on premises\n01:10:49.360 --> 01:10:53.890\nmigrations, always move\ndelegates together.", "\n01:10:56.350 --> 01:11:00.730\nIf somebody has got a delegated\naccess to a mailbox, they go\n01:11:00.780 --> 01:11:05.650\nwith that mailbox. ", "Don't try to\ndo cross premises delegation.", "\n01:11:06.550 --> 01:11:10.350\nDon't try it. ", "Something will break.", "\nIt may not break immediately,\n01:11:10.400 --> 01:11:13.350\nbut you can be guaranteed it will\nbreak over time and you will\n01:11:13.400 --> 01:11:14.310\nbe responsible.", "\n01:11:16.750 --> 01:11:21.120\nAfter all of that, that was quite\na quick run through. ", "I really\n01:11:21.170 --> 01:11:24.980\nthink that Office 365 is on a roll.", "\nIt's got tremendous velocity.", "\n01:11:25.260 --> 01:11:28.310\nIt's a tremendous service. ", "There\nis no doubt about that.", "\n01:11:28.360 --> 01:11:31.480\nExchange is by far the easiest\nworkload to move\n01:11:32.890 --> 01:11:37.230\nand it's the reason why I think Office\n365 has that velocity today.", "\n01:11:37.280 --> 01:11:38.720\nAnd that's pretty good.", "\n01:11:39.460 --> 01:11:42.300\nThere is lots of potential once you\nare over there. ", "There's lots\n01:11:42.350 --> 01:11:43.550\nof good stuff happening,\n01:11:44.900 --> 01:11:48.030\nbut planning is absolutely critical.", "\n01:11:48.540 --> 01:11:51.560\nWith that, and with one minute left,\n01:11:52.810 --> 01:11:53.540\nI'm done.", "\n01:12:00.680 --> 01:12:03.720\nBut there's more. ", "There's more.", "\nWe have two T-shirts to give\n01:12:03.770 --> 01:12:07.010\nout to those that ask questions.", "\nYou have to ask questions.", "\n01:12:07.720 --> 01:12:08.390\nWho is first?", "\n01:12:09.130 --> 01:12:11.060\nWho's first? ", "There's a microphone.", "\n01:12:12.050 --> 01:12:16.350\n>> I have a question. ", "You said that\nwhether so many 365 servers\n01:12:16.400 --> 01:12:19.060\nand so any new updates\nrollout over time.", "\n01:12:19.750 --> 01:12:22.710\nHow long before the first update\nis applied to the last one for\n01:12:22.760 --> 01:12:23.960\na particular build?", "\n01:12:24.010 --> 01:12:27.480\n>> Okay. ", "Given that we have this\nhuge infrastructure, tons and\n01:12:27.530 --> 01:12:31.620\ntons and tons of servers, how long\ndoes it take to get out an update?", "\n01:12:33.210 --> 01:12:37.150\nI don't do the updates and someone\nelse would be in a better\n01:12:38.160 --> 01:12:43.020\nposition, but my observation is\nthat it probably could take up\n01:12:43.070 --> 01:12:47.090\nto a couple of months depending on\nthe complexity to get everywhere.", "\n01:12:47.140 --> 01:12:49.800\nI mean there are some people and\nDelve is a good example.", "\n01:12:49.850 --> 01:12:52.860\nIt went general availability in\nmid-April. ", "I was talking to\n01:12:52.910 --> 01:12:55.430\na guy today and he still hasn't\nseen it in his tenant.", "\n01:12:56.440 --> 01:12:58.320\nSo it can take a while.", "\n01:12:59.240 --> 01:12:59.590\nSir?", "\n01:13:00.730 --> 01:13:04.800\n>> We are in the process right now of\nintegrating the online archiving\n01:13:05.090 --> 01:13:07.320\nand we are going through the hurdle\nof getting rid of all the\n01:13:07.370 --> 01:13:08.140\nPST files.", "\n01:13:08.700 --> 01:13:13.090\nOne of the things that we are facing\nright now is a lot of the\n01:13:13.140 --> 01:13:16.920\npeople that are using Apple Mail\nand they are having inbox files\n01:13:16.970 --> 01:13:20.140\nas their archives. ", "Have you ever\nrun across any situations where\n01:13:20.190 --> 01:13:23.290\nyou have had to try to get those\ninbox files moved over to the\n01:13:23.340 --> 01:13:24.410\nonline archiving?", "\n01:13:25.910 --> 01:13:27.060\n>> Their inbox files?", "\n01:13:27.820 --> 01:13:30.980\n>> It's .mbox is the extension.", "\n01:13:32.020 --> 01:13:35.100\n>> It's a different format.", "\nI don't do that.", "\n01:13:36.370 --> 01:13:37.280\nSorry, no.", "\n01:13:38.940 --> 01:13:40.230\nBut you can have a T-shirt.", "\n01:13:41.780 --> 01:13:49.250\nThe wonderful Exchange team tells me\nthat there are books, printed books?", "\n01:13:51.190 --> 01:13:53.630\nThere are still some printed books\nat the Expo floor for people\n01:13:53.680 --> 01:13:55.410\nwho would want them.", "\nThank you Brian.", "\n01:13:56.150 --> 01:13:59.600\nExpo floor. ", "Next question?", "\nIt's downstairs.", "\n01:13:59.650 --> 01:14:04.790\n>> Is dedicated Office 365\nstaying or going away?", "\n01:14:06.090 --> 01:14:08.380\n>> Did you have an impression\nthat I work for Microsoft?", "\n01:14:10.030 --> 01:14:12.710\nAs an observer, as an independent\nobserver, I think.", "\n01:14:12.760 --> 01:14:15.630\n>> Because if I talk to Microsoft\nthey are pushing me towards\n01:14:15.680 --> 01:14:17.320\nmultitenant, that is\nwhy I am asking.", "\n01:14:17.370 --> 01:14:20.920\n>> Okay. ", "I would think that there\nare particular advantages to\n01:14:20.970 --> 01:14:24.060\nusing a dedicated Office 365 tenant.", "\nIt's going to cost you\n01:14:24.110 --> 01:14:27.060\nmore money, but you will have more\ncontrol, specifically, about\n01:14:27.110 --> 01:14:29.990\nwhat hardware you use and what\nstorage you use et cetera, and\n01:14:30.040 --> 01:14:34.590\nyou get what they call the white\nglove service. ", "People are making\n01:14:34.640 --> 01:14:37.190\nsure that your every wishes\nare taking care of.", "\n01:14:38.010 --> 01:14:42.670\nWhether or not there is significant\nadvantage in that, you're\n01:14:42.720 --> 01:14:46.170\ngoing to have to tell me. ", "For me,\nI think a couple of years ago\n01:14:46.220 --> 01:14:50.270\nthere was great advantage in it.", "\nNow as we have had a really\n01:14:50.320 --> 01:14:55.480\ngood success rate with the\nmultitenant service,\n01:14:56.770 --> 01:14:59.550\nI don't know. ", "It's a good question\nto have a discussion about,\n01:14:59.600 --> 01:15:03.120\nbut you need context. ", "I don't\nhave enough context.", "\n01:15:03.170 --> 01:15:06.850\n>> Okay. ", "At least Microsoft is pushing\nme towards multitenant\n01:15:06.900 --> 01:15:10.270\nsaying that dedicated would be deprecated\nsometime, but to avoid\n01:15:10.320 --> 01:15:12.140\nthose surprises for users.", "\n01:15:12.190 --> 01:15:16.370\n>> Yeah. ", "A Microsoft person making\nthis is a bold statement that\n01:15:16.420 --> 01:15:21.250\ndedicated Office 365 will be deprecated\nin the future is an interesting\n01:15:21.300 --> 01:15:22.840\nposition for them to take.", "\n01:15:23.640 --> 01:15:26.920\nI haven't heard that from any of\nmy contacts, but what I suggest\n01:15:26.970 --> 01:15:29.970\nyou do, because I don't work for\nMicrosoft, is you go down to\n01:15:30.020 --> 01:15:33.620\nthe Expo floor, go to the Office\n365 area and find somebody who\n01:15:33.670 --> 01:15:35.270\ncan give you an official answer.", "\n01:15:35.830 --> 01:15:36.340\nThat's what I would do.", "\n01:15:36.390 --> 01:15:37.300\n>> Can I ask one more question?", "\n01:15:37.350 --> 01:15:41.330\n>> Well, there are lots of people waiting.", "\nWe will be going outside\n01:15:41.380 --> 01:15:44.230\na moment because they are\ngoing to turn me off.", "\n01:15:44.280 --> 01:15:49.760\n>> Compliance, like international companies,\nGermany in particular,\n01:15:50.180 --> 01:15:53.910\nthey all want to get the data outside,\nbut we share the same namespace.", "\n01:15:53.960 --> 01:15:57.800\nHow do we move to the cloud?", "\nMicrosoft doesn't have.", "\n01:15:57.850 --> 01:16:01.660\n>> So this is a common problem when\nyou have country boundaries\n01:16:01.710 --> 01:16:05.480\nand you want to maintain data inside\na country. ", "The Microsoft\n01:16:05.530 --> 01:16:08.160\nanswer is they are putting data centers\nout as quickly as possible\n01:16:08.210 --> 01:16:11.330\nto try to get around that. ", "For Germany,\nI guess they are going\n01:16:11.380 --> 01:16:14.110\nto have the Austria data center.", "\nNow that might be helpful,\n01:16:15.390 --> 01:16:18.080\nbut it's really a thing to sit down\nwith the Microsoft guys in\n01:16:18.130 --> 01:16:20.540\na particular country and figure\nout what is going to happen.", "\n01:16:21.190 --> 01:16:25.500\nI don't have a great answer for it.", "\nAnd every country is different\n01:16:25.550 --> 01:16:29.930\nand every company is different\nbecause, you know, if you are\n01:16:29.980 --> 01:16:33.200\nin the pharmaceutical industry you\nare going to be under specific\n01:16:33.600 --> 01:16:37.070\nregulatory requirements and it\nis different if you are in the\n01:16:37.120 --> 01:16:39.720\nfinance industry or working in\nagriculture or something like\n01:16:39.770 --> 01:16:41.760\nthat and so it's kind\nof hard to say.", "\n01:16:41.810 --> 01:16:46.580\nSorry. ", "Did you notice me dancing\naround the answer there? ", "I was\n01:16:46.630 --> 01:16:48.000\na consultant for years.", "\n01:16:48.600 --> 01:16:54.430\nSorry, yeah? ", "Here. ", "You can\nhave the last T-shirt.", "\n01:16:55.840 --> 01:16:57.760\n>> What about AV and anti-spam?", "\n01:16:58.480 --> 01:16:58.820\n>> What about?", "\n01:16:58.870 --> 01:17:02.090\n>> AV and anti-spam.", "\n01:17:03.100 --> 01:17:03.850\n>> Anti-spam.", "\n01:17:06.240 --> 01:17:08.150\n>> Specific rules, did\n01:17:09.390 --> 01:17:11.820\nwe lose control of that?", "\n01:17:11.870 --> 01:17:14.770\n>> If it's a third-party cloud service\nyou can always keep on\n01:17:14.820 --> 01:17:16.710\nrouting stuff to that.", "\n01:17:17.420 --> 01:17:18.260\nYou can keep it.", "\n01:17:18.990 --> 01:17:21.390\nOut-of-the-box Microsoft is going\nto give you Exchange Online\n01:17:21.440 --> 01:17:25.600\nprotection, but if you decide that\nExchange Online section isn't\n01:17:25.650 --> 01:17:29.240\nfor you, then you just wrap your mail\nstream through the third-party\n01:17:29.290 --> 01:17:32.820\nservice, have it cleansed and have\nit then be delivered to Office\n01:17:32.870 --> 01:17:36.430\n365 and it will be as clean as a\nwhistle. ", "And you'll be as happy\n01:17:36.480 --> 01:17:37.440\nas the day is long.", "\n01:17:37.490 --> 01:17:42.950\n>> What about the other way? ", "From,\ncan you configure your e-mail\n01:17:43.000 --> 01:17:49.910\nflow from your Exchange tenant through\ncloud service third-party?", "\n01:17:50.800 --> 01:17:54.600\n>> It depends on the cloud service\nand it depends if you are hybrid\n01:17:54.650 --> 01:17:57.080\nor pure cloud. ", "Are you\nhybrid or pure cloud?", "\n01:17:57.130 --> 01:17:58.350\n>> No. ", "We are on prem.", "\n01:17:59.030 --> 01:18:00.930\n>> Right. ", "So you are on prem, so\nyou are probably going to be\n01:18:00.980 --> 01:18:04.730\nhybrid eventually, so in that case\nyou can figure stuff so that\n01:18:04.780 --> 01:18:07.450\nis always going to go back through\nyour on prem servers.", "\n01:18:07.900 --> 01:18:10.680\nOnce a goes to those servers you\ncan put it wherever you like.", "\n01:18:10.730 --> 01:18:16.880\n>> Sure, but when we go up to the\ncloud do they have flexibility\n01:18:17.830 --> 01:18:20.350\nfor your e-mail to go through.", "\n01:18:20.400 --> 01:18:23.020\n>> I don't have a good answer for\nthat straightaway, but again,\n01:18:23.070 --> 01:18:25.910\ndown on the Expo floor you actually\nhave realized engineers.", "\n01:18:26.490 --> 01:18:28.320\nThey are the ones wearing the pointy\nhats. ", "Now. ", "They are not\n01:18:28.370 --> 01:18:30.660\nthe ones wearing the pointy hats.", "\nThey are great guys down on\n01:18:30.710 --> 01:18:33.320\nthe floor. ", "And I would ask\nthem. ", "Is that fair?", "\n01:18:33.370 --> 01:18:33.720\n>> Yes.", "\n01:18:35.820 --> 01:18:41.730\n>> No. ", "It's not fair. ", "All right.", "\nI am going to close down now\n01:18:41.780 --> 01:18:44.920\nbecause they are going to get the\nroom ready for the next session.", "\n01:18:45.530 --> 01:18:46.210\nThank you." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006255463813431561, 0.0007121677044779062, 0.0008523639407940209, 0.0007584068807773292, 0.0006801208364777267, 0.0006058322614990175, 0.0008555671665817499, 0.0054223560728132725, 0.0006912094540894032, 0.000715391244739294, 0.001293755485676229, 0.0006243123207241297, 0.0007784957415424287, 0.0008496527443639934, 0.0006409736815840006, 0.0007142614340409636, 0.0007336504640989006, 0.0006741243414580822, 0.000642216473352164, 0.0009442124282941222, 0.0006862799637019634, 0.0006179511547088623, 0.0006859294953756034, 0.0005765979876741767, 0.0006442048470489681, 0.0006607631803490222, 0.0007847396773286164, 0.0007213575881905854, 0.0005890184547752142, 0.0005966189783066511, 0.0006136877345852554, 0.0005633796681649983, 0.0007008099346421659, 0.0006243399693630636, 0.0007938463822938502, 0.0011401730589568615, 0.004359315615147352, 0.0009032062371261418, 0.0005794051103293896, 0.0009753068443387747, 0.0007624478894285858, 0.0006615177262574434, 0.0007918121409602463, 0.0008665344212204218, 0.0006047947099432349, 0.0006259913207031786, 0.0012802704004570842, 0.001006535836495459, 0.0043748593889176846, 0.0008095302619040012, 0.0076353237964212894, 0.0008644859190098941, 0.0008127862820401788, 0.0014989539049565792, 0.0010153497569262981, 0.0012823169818148017, 0.0006436080439016223, 0.0007513081654906273, 0.0006436080439016223, 0.0009213313460350037, 0.0010741015430539846, 0.0005827003624290228, 0.0008857989450916648, 0.000831673969514668, 0.0007508976850658655, 0.0006071528187021613, 0.0007013952708803117, 0.0030621225014328957, 0.0006287333671934903, 0.00068434770219028, 0.0007492386503145099, 0.0006854145904071629, 0.0007250540656968951, 0.0008858774090185761, 0.0008414724143221974, 0.0009669882128946483, 0.0006250410224311054, 0.0006525456556119025, 0.0008542886353097856, 0.0006770696491003036, 0.0008240721072070301, 0.00832323357462883, 0.0030859329272061586, 0.0006492831744253635, 0.000666032312437892, 0.0006706610438413918, 0.0005986528121866286, 0.0006588688120245934, 0.0008026100695133209, 0.000660638848785311, 0.005164434667676687, 0.0007115689804777503, 0.0009501776075921953, 0.0008384906686842442, 0.0007300002034753561, 0.0006177129107527435, 0.0006981285405345261, 0.0007256993558257818, 0.0006903506582602859, 0.0006265762494876981, 0.0005889056483283639, 0.0008125400054268539, 0.0006090712849982083, 0.0006774142966605723, 0.0006564498180523515, 0.0006892975070513785, 0.0006597102037630975, 0.0007296124822460115, 0.000834074744489044, 0.0012657636543735862, 0.0006778993410989642, 0.000695842900313437, 0.0007791481330059469, 0.0012249973369762301, 0.000627921661362052, 0.0011248431401327252, 0.0006844980525784194, 0.0006950973183847964, 0.0010546307312324643, 0.0007455190643668175, 0.000639443111140281, 0.0006374825024977326, 0.0007869434193708003, 0.0006746510043740273, 0.0008188327774405479, 0.000591299613006413, 0.0008468940504826605, 0.001346971490420401, 0.0010030746925622225, 0.009426413103938103, 0.0006190608255565166, 0.0005753205623477697, 0.0007398704183287919, 0.0010117205092683434, 0.0006512704421766102, 0.005578448995947838, 0.0009709459263831377, 0.0006500299205072224, 0.0006395819946192205, 0.0008494110661558807, 0.0009111440740525723, 0.0006713536567986012, 0.0007446800591424108, 0.0008805764373391867, 0.0015047036577016115, 0.0007469316478818655, 0.0010046906536445022, 0.0021601777989417315, 0.0010219811229035258, 0.0009530031820759177, 0.000874450197443366, 0.001376657746732235, 0.0007974097388796508, 0.0008584984461776912, 0.0011381085496395826, 0.0008868157747201622, 0.0006738957017660141, 0.0008893839549273252, 0.0007225006120279431, 0.0009922878816723824, 0.0006935033015906811, 0.0008043564739637077, 0.0006384397856891155, 0.0006769045139662921, 0.0006218267953954637, 0.0006415655952878296, 0.0006396625540219247, 0.0006793282809667289, 0.0006256581982597709, 0.000612814212217927, 0.0007960347575135529, 0.0007088920101523399, 0.0006740932003594935, 0.0006054914556443691, 0.0005882776458747685, 0.0008224897901527584, 0.000601588748395443, 0.0007440201006829739, 0.0006822905270382762, 0.0005747730028815567, 0.0008426716085523367, 0.0007695198873989284, 0.0007511413423344493, 0.0006605610833503306, 0.0023271911777555943, 0.0006628995179198682, 0.0007567157736048102, 0.0007877342868596315, 0.0006571902777068317, 0.0006373482174240053, 0.0008001060923561454, 0.0005883729318156838, 0.0007678234251216054, 0.0015323464758694172, 0.0007712538936175406, 0.000693236303050071, 0.0005630137748084962, 0.0006661544903181493, 0.000691380409989506, 0.3436063826084137, 0.0007603528792969882, 0.0012680231593549252, 0.0009319250239059329, 0.0010284127201884985, 0.0011653584660962224, 0.0006233886233530939, 0.0007603579433634877, 0.0006152911810204387, 0.0006184244994074106, 0.0006750780739821494, 0.0005948427133262157, 0.0006366510060615838, 0.0018785388674587011, 0.0009215266909450293, 0.0006759958923794329, 0.0006179602351039648, 0.000713893270585686, 0.0006459797732532024, 0.0007708483026362956, 0.0008702442864887416, 0.0006271238089539111, 0.0007315151742659509, 0.0006978402379900217, 0.0006732941255904734, 0.0008841095841489732, 0.0010855895234271884, 0.0007226314628496766, 0.0006770067848265171, 0.000671965884976089, 0.0006074474658817053, 0.0005886651924811304, 0.000726262922398746, 0.0008060202817432582, 0.0007618890376761556, 0.000697121664416045, 0.0006682229577563703, 0.0007431613048538566, 0.0007645505829714239, 0.0006696362979710102, 0.0006544118514284492, 0.0005893306224606931, 0.0011320022167637944, 0.0008519725524820387, 0.0030345458071678877, 0.0007097471388988197, 0.0006257243803702295, 0.0013663956196978688, 0.01074274629354477, 0.0007317080162465572, 0.0007798318401910365, 0.0009465862531214952, 0.0007077296613715589, 0.0006534377462230623, 0.0006229559658095241, 0.0006399597623385489, 0.0011040758108720183, 0.0006544801290147007, 0.008480149321258068, 0.000758326321374625, 0.0007570188026875257, 0.008450252003967762, 0.0007196419755928218, 0.0018892904045060277, 0.001150806318037212, 0.0009232360753230751, 0.0006121037877164781, 0.0005944578442722559, 0.0005862563848495483, 0.0005608262144960463, 0.0008541445131413639, 0.0009706583223305643, 0.000675912422593683, 0.0006777685484848917, 0.0006341611151583493, 0.0007694245432503521, 0.0007107537239789963, 0.0006357396487146616, 0.0006127703818492591, 0.0007107547135092318, 0.0009215942700393498, 0.0006430846988223493, 0.0005688897799700499, 0.0006368509493768215, 0.0009091104730032384, 0.0011638818541541696, 0.0008380444487556815, 0.000704109959769994, 0.000899987353477627, 0.0009438328561373055, 0.0007321853772737086, 0.0006458720890805125, 0.0007076669717207551, 0.0006482898024842143, 0.0006679755751974881, 0.0008555215317755938, 0.0006346091395244002, 0.0008286340162158012, 0.0008369902498088777, 0.000627639819867909, 0.0010069409618154168, 0.0009451902587898076, 0.0006159311160445213, 0.0006334939389489591, 0.0007440782501362264, 0.0006357720703817904, 0.000612105242908001, 0.0007126751588657498, 0.0006143598002381623, 0.0007063598022796214, 0.0018662216607481241, 0.0009677491034381092, 0.0006005876348353922, 0.000698793213814497, 0.0008828880963847041, 0.0007272726506926119, 0.0006642431253567338, 0.0008957317913882434, 0.0005908877938054502, 0.0008793594315648079, 0.00202915258705616, 0.000624131818767637, 0.0006171585991978645, 0.0006883272435516119, 0.0007741650333628058, 0.0013327649794518948, 0.0006346741574816406, 0.0006555410800501704, 0.001158237922936678, 0.0008800534997135401, 0.0008095341036096215, 0.0008400420192629099, 0.0006957928417250514, 0.0006429400527849793, 0.000655761337839067, 0.000761756906285882, 0.0008201809250749648, 0.001064162002876401, 0.0007522269734181464, 0.000654376286547631, 0.0007296044495888054, 0.0006561701884493232, 0.0008253499399870634, 0.0007439207984134555, 0.005434324499219656, 0.0008749065455049276, 0.001847446896135807, 0.0009235201869159937, 0.004248611629009247, 0.0011494160862639546, 0.0009159967885352671, 0.0008285815129056573, 0.0007027297397144139, 0.0012739330995827913, 0.0006935333367437124, 0.0005749379633925855, 0.0007019917829893529, 0.0007393872365355492, 0.000651554437354207, 0.0006240577204152942, 0.0022672403138130903, 0.0011452973121777177, 0.0007786938222125173, 0.008253713138401508, 0.0006747770821675658, 0.0012885493924841285, 0.0006505793426185846, 0.0007917623734101653, 0.0009707174613140523, 0.001522288890555501, 0.0018459942657500505, 0.0012725299457088113, 0.0010669861221686006, 0.0013337287819013, 0.0011418642243370414, 0.004641894716769457, 0.002741168485954404, 0.0009459262946620584, 0.0006700778030790389, 0.0006269498844631016, 0.0009056156850419939, 0.000866188551299274, 0.0008779813651926816, 0.0006872880039736629, 0.0007894280715845525, 0.1913912147283554, 0.0007683977019041777, 0.0010220351396128535, 0.0006429670611396432, 0.0007593141053803265, 0.0006847515469416976, 0.0005845939158461988, 0.0006044668261893094, 0.0007449142867699265, 0.0006151428679004312, 0.0008466842118650675, 0.0006759160314686596, 0.0019782353192567825, 0.0012879782589152455, 0.0006795303197577596, 0.0006614084122702479, 0.0006490465602837503, 0.0006595275481231511, 0.0006800975534133613, 0.0007741554290987551, 0.0008581680594943464, 0.001002696342766285, 0.0007084122044034302, 0.0005624830373562872, 0.017011554911732674, 0.01579303853213787, 0.0009182276553474367, 0.005499396938830614, 0.0007644813740625978, 0.005868533626198769, 0.0006498313741758466, 0.0007729955250397325, 0.0006712666363455355, 0.0006087326328270137, 0.0021828263998031616, 0.0008252853876911104, 0.0008396062767133117, 0.0007728522759862244, 0.0011152771767228842, 0.0007081610965542495, 0.0007280868594534695, 0.0007315691909752786, 0.000977037474513054, 0.0006948055233806372, 0.0007494364399462938, 0.0006846677279099822, 0.001297993934713304, 0.0007371127721853554, 0.0006958584999665618, 0.0005982481525279582, 0.0007853111601434648, 0.0008674935670569539, 0.0011742135975509882, 0.000687692838255316, 0.0007167513249441981, 0.0013884532963857055, 0.0006021374720148742, 0.0006446128827519715, 0.0005899941315874457, 0.00071666797157377, 0.000851436925586313, 0.0006032728706486523, 0.0006137733580544591, 0.0006486362544819713, 0.0006384875741787255, 0.0017913704505190253, 0.0007014557486400008, 0.0008742577629163861, 0.0006897397106513381, 0.0015906791668385267, 0.0007300134748220444, 0.0005859801894985139, 0.0007449253462255001, 0.000666030973661691, 0.0006509741069748998, 0.0006637861370109022, 0.0009228847338818014, 0.0008986004977487028, 0.0006918799481354654, 0.0006614518933929503, 0.0007549339206889272, 0.000649121415335685, 0.0006109788664616644, 0.0007728717755526304, 0.0008848933503031731, 0.0006580608314834535, 0.0006717969081364572, 0.0007089735008776188, 0.0007469345582649112, 0.0009142529452219605, 0.0007410862599499524, 0.0009958730079233646, 0.0007321840384975076, 0.0011399275390431285, 0.0005927958409301937, 0.0014926163712516427, 0.0008191308588720858, 0.0006736564682796597, 0.0007090815925039351, 0.0011256872676312923, 0.0007368117803707719, 0.0008274989668279886, 0.0006741628749296069, 0.0005860732053406537, 0.0006529609090648592, 0.0005966395256109536, 0.0008236630819737911, 0.00056713807862252, 0.0012178237084299326, 0.0007264296873472631, 0.0010153111070394516, 0.0008682680199854076, 0.0009355511283501983, 0.0006157526513561606, 0.0010022412752732635, 0.0010873362189158797, 0.0005793391610495746, 0.0006303347763605416, 0.0006363164284266531, 0.0009040741133503616, 0.0009135364089161158, 0.000806707248557359, 0.0005862351972609758, 0.0007493171724490821, 0.0007822258048690856, 0.011232167482376099, 0.0007793341646902263, 0.0010769027285277843, 0.0008918283856473863, 0.0008212249958887696, 0.000978956581093371, 0.0007755085243843496, 0.0007382540497928858, 0.000690445420332253, 0.0032075957860797644, 0.0015005128225311637, 0.0008447695872746408, 0.0005620117299258709, 0.000770492129959166, 0.0009492726530879736, 0.0011635880218818784, 0.0007588504231534898, 0.0007527299458160996, 0.0008407626883126795, 0.0006765436846762896, 0.0011741342023015022, 0.0007868909742683172, 0.0007015590090304613, 0.0006107130902819335, 0.0013389488449320197, 0.0008489449974149466, 0.0007224826840683818, 0.0007696442189626396, 0.0006454191752709448, 0.0008580032736063004, 0.003831529524177313, 0.0012046367628499866, 0.0008846530690789223, 0.0006932911928743124, 0.08007986098527908, 0.041290659457445145, 0.0008242672774940729, 0.0008455370552837849, 0.0006063356995582581, 0.0009467932977713645, 0.0007196392980404198, 0.0008707199594937265, 0.0006293553742580116, 0.0007189866155385971, 0.0008106016321107745, 0.0006562361377291381, 0.000712034001480788, 0.0006060791783966124, 0.0006283224793151021, 0.001478419522754848, 0.0007026383536867797, 0.0006102173356339335, 0.0007526108529418707, 0.0005638201255351305, 0.0007236286182887852, 0.0005669383681379259, 0.0007182378321886063, 0.0007421215996146202, 0.0011883231345564127, 0.001995393307879567, 0.0018081847811117768, 0.001262111123651266, 0.0007443480426445603, 0.0006760451360605657, 0.0006728967418894172, 0.0007477881154045463, 0.0006636868929490447, 0.0006051264936104417, 0.0006705604027956724, 0.00067881093127653, 0.0008600802975706756, 0.0006647880654782057, 0.001018836279399693, 0.0006528644589707255, 0.0006417307304218411, 0.0005739201442338526, 0.000605393317528069, 0.0006100897444412112, 0.0006396801327355206, 0.0008272490231320262, 0.0006100147147662938, 0.0005938052199780941, 0.12380653619766235, 0.0009685067343525589, 0.0009240919025614858, 0.0008190801599994302, 0.0008174953400157392, 0.06618620455265045, 0.0008768288535065949, 0.0024652937427163124, 0.000694042828399688, 0.0006323143607005477, 0.0006843056762591004, 0.0007564822444692254, 0.0006206582766026258, 0.0008299335022456944, 0.0007332499953918159, 0.0006770145264454186, 0.0006997595191933215, 0.0007866919040679932, 0.0009062992758117616, 0.0006958632147870958, 0.0006226900150068104, 0.0011400997173041105, 0.0006475633126683533, 0.000660956313367933, 0.0008259415626525879, 0.001312476466409862, 0.0006975891883485019, 0.0006923515466041863, 0.0011697777081280947, 0.0007029835833236575, 0.0006054065888747573, 0.0008729587425477803, 0.0008954527438618243, 0.0005801036022603512, 0.0006650453433394432, 0.0006638127961196005, 0.000969817629083991, 0.0006560607580468059, 0.0006375523516908288, 0.012786468490958214, 0.0006394765805453062, 0.0008337199105881155, 0.0005755739402957261, 0.00063325185328722, 0.000746266741771251, 0.0007385003264062107, 0.0007969086873345077, 0.0006753490306437016, 0.0005680429167114198, 0.00065998500213027, 0.0005943148280493915, 0.001932253479026258, 0.0006357068778015673, 0.0006187685648910701, 0.00060549087356776, 0.010074158199131489, 0.001394899096339941, 0.0006519572343677282, 0.0005747245741076767, 0.0005689602694474161, 0.0006462670862674713, 0.0006162575446069241, 0.0006232804735191166, 0.0006238992209546268, 0.0006452536908909678, 0.0018493297975510359, 0.0007589940214529634, 0.0038054990582168102, 0.0006830872152931988, 0.0007757073035463691, 0.0009308994631282985, 0.0006556176231242716, 0.0007762116147205234, 0.000675720744766295, 0.000875503639690578, 0.0007281259750016034, 0.0006697425851598382, 0.0007418780005536973, 0.0015139717143028975, 0.0007315368275158107, 0.000680226250551641, 0.0006596916355192661, 0.0009741472895257175, 0.0006263595423661172, 0.0007854323484934866, 0.0007220223196782172, 0.0005398428183980286, 0.0007565334090031683, 0.0008308478281833231, 0.0008604007889516652, 0.0009359763353131711, 0.0006590149132534862, 0.0008486126316711307, 0.0006126888911239803, 0.0006270105368457735, 0.0007782346801832318, 0.0007115815533325076, 0.0006079886807128787, 0.0005958129768259823, 0.0005909672472625971, 0.0007405097712762654, 0.0012078655418008566, 0.0006662631058134139, 0.0006176661117933691, 0.0005501083214767277, 0.000766906829085201, 0.0005886130384169519, 0.0007660183473490179, 0.000713896646630019, 0.0007076372858136892, 0.0006825747550465167, 0.0006631953292526305, 0.0007236627861857414, 0.0007144003175199032, 0.0006201687501743436, 0.0006904562469571829, 0.0006245485856197774, 0.0007193831261247396, 0.0017281799810007215, 0.0007587865111418068, 0.0011347747640684247, 0.0009033276000991464, 0.0018815848743543029, 0.001717103412374854, 0.0007553037139587104, 0.0006958545418456197, 0.0007333323592320085, 0.0010263959411531687, 0.0009699160000309348, 0.0006959214806556702, 0.0007438304601237178, 0.0006064946646802127, 0.0007333697867579758, 0.001186601584777236, 0.0006647573318332434, 0.001538286916911602, 0.0006546523072756827, 0.0008851438178680837, 0.0006949876551516354, 0.3351536989212036, 0.0007783963810652494, 0.0006044419715180993, 0.0006018516723997891, 0.0007765433983877301, 0.0007544541731476784, 0.13056951761245728, 0.000646506086923182, 0.000576582329813391, 0.0007704770541749895, 0.000576546648517251, 0.0008127138717100024, 0.0007178706582635641, 0.0007601369288749993, 0.0005954598309472203, 0.0006450824439525604, 0.0006578608881682158, 0.0006129631656222045, 0.000735907640773803, 0.0009878375567495823, 0.0017731450498104095, 0.003070622216910124, 0.0006706897984258831, 0.000674000708386302, 0.0008763903169892728, 0.0005823216633871198, 0.0006561508635058999, 0.0006333360797725618, 0.0006402809522114694, 0.0006254346226342022, 0.0006333044148050249, 0.0005992719088681042, 0.000833951577078551, 0.0007879219483584166, 0.0008352855802513659, 0.0033886926248669624, 0.0008625604677945375, 0.0009119783062487841, 0.0011497061932459474, 0.0008097319514490664, 0.0007297713309526443, 0.0006233429303392768, 0.0007563283434137702, 0.0009904899634420872, 0.000777685025241226, 0.0006507827201858163, 0.000707932747900486, 0.0006695948541164398, 0.0006282763206399977, 0.0006419368437491357, 0.0009104064083658159, 0.0006959075690247118, 0.0007702506263740361, 0.0007837837911210954, 0.0009303573169745505, 0.0010269299382343888, 0.0008469654712826014, 0.0009760341490618885, 0.0008601212757639587, 0.04792977496981621, 0.0006674493197351694, 0.0006721302052028477, 0.0006376489764079452, 0.0008289206889458001, 0.0007564864936284721, 0.0008932429482229054, 0.0009926235070452094, 0.0009045402985066175, 0.0006326256552711129, 0.0006845679017715156, 0.0010908590629696846, 0.0005705628427676857, 0.0034657660871744156, 0.0008151212823577225, 0.0014893478946760297, 0.0005725016235373914, 0.0006150971748866141, 0.000563980545848608, 0.0006836550892330706, 0.0010605186689645052, 0.0006765036378055811, 0.001231477246619761, 0.0006013941019773483, 0.0008625210612080991, 0.0010379060404375196, 0.0008889053133316338, 0.0007035140879452229, 0.0050491830334067345, 0.0006122924969531596, 0.0007384883356280625, 0.0007431725389324129, 0.0007544875843450427, 0.0007111093727871776, 0.0005622448516078293, 0.0006308339070528746, 0.0008811610168777406, 0.0005960551789030433, 0.0009084430057555437, 0.0008916750084608793, 0.0007303794263862073, 0.0008439130615442991, 0.001163747743703425, 0.05854310095310211, 0.0010229372419416904, 0.0010246919700875878, 0.0010350060183554888, 0.001634633750654757, 0.0009552958654239774, 0.0006594345322810113, 0.0013709167251363397, 0.0007086880505084991, 0.000710227235686034, 0.0011420192895457149, 0.0007016479503363371, 0.000734215893317014, 0.0025963205844163895, 0.0013569890288636088, 0.0018581023905426264, 0.0012343862326815724, 0.0007797252619639039, 0.0006611276185140014, 0.0006496214773505926, 0.0006763344863429666, 0.004684553947299719, 0.0016326592303812504, 0.0016113313613459468, 0.0008223068434745073, 0.0007122742244973779, 0.0007669079350307584, 0.0010929914424195886, 0.0009962293552234769, 0.0012319977395236492, 0.0007856034208089113, 0.0013557191705331206, 0.0006509986124001443 ]

[ "Very hot request to tie up my balls while fucking myself with a giant Chode dildo. ", "I did as I...\n\nIn different positions, the young guy fucks me very hard with his big cock. ", "It also break my...\n\nI got turned on and had to play with my butt today. ", "Sorry I'm so shaky, it happens when I get this horny. ", "Stick around till the end and I'll give you a kiss. ", "If you want to see more content, check out my tumblr www.xtube.com\n\nI got turned on and had to play with my butt today. ", "Sorry I'm so shaky, it happens when I get this horny. ", "Stick around till the end and I'll give you a kiss. ", "If you want to see more content, check out my tumblr www.xtube.com" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.9975606203079224, 0.9962921142578125, 0.9459626078605652, 0.1726800501346588, 0.07202720642089844, 0.8067409992218018, 0.1726800501346588, 0.07202720642089844, 0.0007699640118516982 ]

[ "GH’s Bertucci on verge of state title at 103 pounds\n\nThe Buccaneers’ 103-pounder scored a 12-5 win over Trevor Zdebski of Class A state champion Detroit Catholic Central in Friday’s semifinal round. ", "Bertucci, now 46-3 on the season, will meet Davison’s Lincoln Olson, a freshman who boasts a 45-0 record on the year.", "\n\nGrand Haven’s Connor Moynihan also reached the semifinal round on Friday before suffering a 13-6 loss to Drew Garcia of Detroit Catholic Central. ", "Moynihan won his opening two matches, including a 5-2 win over Hartland’s Justin Charleski on Friday. ", "Moynihan (44-3) will wrestle in the consolation bracket semifinals today.", "\n\nTwo other Buccaneers’ wrestlers — Dakota Juarez and Garrett Kelly — still have a chance to place at the state meet, which is being held at The Palace of Auburn Hills.", "\n\nLAKERS MOVE ON\n\nThree of Spring Lake’s four state qualifiers are still alive in the Division 2 tournament, including 189-pounder Andrew Hissom.", "\n\nHissom suffered a 7-5 loss to unbeaten Jordan Thomas of Greenville in the second round, but bounced back with a 7-3 win over Hunter McCoy of Dearborn Heights Annapolis in the consolation bracket. ", "Hissom will wrestle Brandin Schultes of Warren Woods Tower in today’s consolation bracket quarterfinals.", "\n\nLakers’ 119-pounder Tyler Nietering scored an exciting 1-0 win over Ali Ayache of Dearborn Heights Crestwood in the second round, but was defeated by Tim Lambert of Forest Hills Eastern in the semifinal round, 7-0.", "\n\nSpring Lake’s Harry Kriger also won his second match of the finals, beating Travis Dragomer of Stevensville Lakeshore, 9-6, before getting pinned by Ben Whitford of St. Johns. ", "Kriger will wrestle in the consolation bracket semifinals today.", "\n\nRead more of this story in today's print edition or e-edition of the Grand Haven Tribune." ]

{ "pile_set_name": "Pile-CC" }

[ 0.001422221539542079, 0.0008916122023947537, 0.002170287538319826, 0.001883899443782866, 0.00100426422432065, 0.0007412282866425812, 0.0007948463317006826, 0.0011274322168901563, 0.006207607686519623, 0.0007767080678604543, 0.0016121623339131474, 0.002351850736886263, 0.000603783642873168 ]

[ "\n                                                                                    NO. ", "12-04-00283-CV\n \nIN THE COURT OF APPEALS\n\nTWELFTH COURT OF APPEALS DISTRICT\n\nTYLER, TEXAS\n§APPEAL FROM THE \nIN THE INTEREST OF\n§COUNTY COURT AT LAW\nJ.P.M., A CHILD\n§ANDERSON COUNTY, TEXAS\n                                                                                                                                                            \nMEMORANDUM OPINION\n            Appellant Misty Laine McLelland (formerly Mobley) appeals the trial court’s order\r\nmodifying the parent-child relationship. ", " In her sole issue, Misty contends that the trial court abused\r\nits discretion by granting Daniel Paul Mobley’s petition to modify because he presented no evidence\r\nor insufficient evidence that a material change of circumstances had occurred or that the modification\r\nwas in the best interest of the child. ", " In three issues, Appellant-Intervenor James Stacey Mason\r\nappeals the trial court’s order dismissing his petition in intervention. ", " We affirm.", "\n \nBackground\n            Misty is the mother of J.P.M., born March 10, 1998. ", " At the time, Misty and Daniel had a\r\nsexual relationship, and Daniel was named as the father on J.P.M.’s birth certificate. ", " On\r\nDecember 4, 1998, Misty and Daniel were married, but, on February 1, 2000, Misty filed for divorce. ", "\r\nIn the divorce decree dated January 23, 2001, the trial court found that Misty and Daniel were the\r\nparents of J.P.M. Misty and Daniel were appointed joint managing conservators of J.P.M. with\r\nDaniel having the right to establish the child’s primary residence. ", " Misty was granted possession of\r\nJ.P.M. each week from 8:00 a.m. Thursday until 12:00 p.m. Sunday. ", " Daniel was granted possession\r\nof J.P.M. each week from 12:00 p.m. Sunday until 8:00 a.m. Thursday. ", " Misty and Daniel evenly\r\ndivided holidays. ", " Neither parent was ordered to pay child support, although Daniel was ordered to\r\nprovide health insurance for J.P.M. \n            On October 17, 2003, Daniel filed an amended petition to modify the parent-child\r\nrelationship, alleging that the January 23, 2001 order was not workable and that the circumstances\r\nof the child, a conservator, or other party affected by the order had materially and substantially\r\nchanged since the order. ", " Daniel requested that Misty be granted standard visitation and be ordered\r\nto pay child support. ", " Misty answered and filed a counter petition to modify, specifically requesting\r\nthat she be appointed the person with the right to designate the child’s primary residence and that\r\nDaniel be ordered to pay child support. ", " Further, Misty filed a motion for enforcement, alleging that\r\nDaniel had not maintained a policy of health insurance for J.P.M. \n            A hearing on Misty’s and Daniel’s respective petitions and motions was held on April 6,\r\n2004. ", " On May 25, the trial court found that the material allegations in the petition to modify were\r\ntrue and that the requested modification was in the best interest of the child. ", "The trial court appointed\r\nMisty and Daniel joint managing conservators with Daniel having the exclusive right to designate\r\nthe primary residence of the child within seventy-five miles of Palestine as long as Misty resided\r\nwithin seventy-five miles of Palestine. ", " Misty was granted standard visitation of J.P.M. The trial\r\ncourt denied Misty’s motion for enforcement.", "\n            On the same date as the modification order, Misty filed a motion for genetic testing. ", " Further,\r\non June 14, James filed a petition in intervention for conservatorship, alleging that DNA testing\r\nrevealed he was J.P.M.’s biological father. ", " James requested that the court order additional genetic\r\ntesting to confirm the DNA test results and a new birth certificate changing J.P.M.’s last name to\r\nreflect that Daniel was not J.P.M.’s father. ", " Moreover, James requested that the trial court appoint\r\nhim and Misty as joint managing conservators of J.P.M. Daniel filed a motion to dismiss, alleging\r\nthat James had no standing to intervene, that estoppel prevented James from asserting his parentage,\r\nthat it would be inequitable to disprove his relationship with J.P.M., and that the issue of paternity\r\nwas barred by res judicata. ", " On August 5, the trial court conducted a hearing on James’s intervention\r\nand Daniel’s motion to dismiss. ", " The trial court found that Daniel was the presumed father of J.P.M.\r\nand that the prescriptive period in section 160.607 of the Texas Family Code had expired. ", " Although\r\nthe trial court found that Daniel was the adjudicated father of J.P.M., it also found that J.P.M.’s\r\npaternity was first established under the statute for a presumed father and, thus, section 160.607\r\ncontrolled. ", " The trial court granted Daniel’s motion to dismiss James’s petition in intervention. ", "\n            In its findings of fact and conclusions of law, the trial court found, in part, that Misty alleged\r\nin her divorce petition that Daniel was the father of J.P.M. and that Daniel sought relief in his\r\ncounter petition for divorce premised on his paternity of J.P.M. The trial court found that, in her\r\ncounter petition to modify, Misty alleged that Daniel was J.P.M.’s father. ", " The trial court noted that\r\nwhen Misty orally asserted that Daniel was not J.P.M.’s father in open court on May 25, 2004, “[t]his\r\n[was] the first time that [Misty] has in any way questioned paternity in these court proceedings or\r\nanywhere else since before the birth of the child.” ", " The trial court found that, from J.P.M.’s birth to\r\nthe present, Daniel voluntarily and continuously asserted his paternity of J.P.M., that a loving,\r\nsupportive, and nurturing parent-child relationship existed between Daniel and J.P.M., and that\r\nJ.P.M. had known only one person, Daniel, as his father. ", "In its conclusions of law, the trial court\r\nstated that Daniel was the presumed father of J.P.M., that the prescriptive period in section\r\n160.607(a) of the Texas Family Code was applicable, that the petition in intervention was barred by\r\nlimitations, and that the motion to dismiss should be granted. ", " This appeal followed.", "\n \nModification\n            In her sole issue, Misty contends that the trial court abused its discretion by granting Daniel’s\r\npetition to modify because he presented no evidence or insufficient evidence that a material change\r\nof circumstances had occurred or that the modification was in the best interest of the child. ", " Daniel\r\nargues that the trial court’s decision was supported by significant and ample evidence. ", "\nApplicable Law\n            A trial court’s modification of conservatorship is reviewed for abuse of discretion. ", " In re\r\nP.M.B., 2 S.W.3d 618, 621 (Tex. ", "App.–Houston [14th Dist.] ", "1999, no pet.). ", " It is an abuse of\r\ndiscretion for a trial court to rule without supporting evidence. ", " Id. The best interest of the child is\r\nthe primary consideration in determining conservatorship or residency of a minor child. ", " Villasenor\r\nv. Villasenor, 911 S.W.2d 411, 419 (Tex. ", "App.–San Antonio 1995, no writ).", "\n            According to section 156.101 of the Texas Family Code, the trial court may modify an order\r\nor portion of a decree that provides for the appointment of a conservator of a child, that provides the\r\nterms and conditions of conservatorship, or that provides for the possession of or access to a child\r\nif (1) modification would be in the best interest of the child and (2) the circumstances of the child,\r\na conservator, or other party affected by the order have materially and substantially changed since\r\nthe date of the rendition of the order. ", " Tex. ", "Fam. ", "Code Ann. § ", "156.101 (Vernon 2002). ", " Whether\r\nthere has been a material and substantial change of circumstances affecting the child is normally to\r\nbe determined by an examination of the evidence of changed circumstances occurring between the\r\ndate of the order or judgment sought to be modified and the date of the filing of the motion to\r\nmodify. ", "Gibbs v. Greenwood, 651 S.W.2d 377, 379 (Tex. ", "App.–Austin 1983, no writ).", "\nThe Evidence\n            Daniel had worked in the Bacon Autoplex service department for two and one-half years and \r\nearned approximately $1,000 every two weeks. ", " At the time of trial, Daniel, his wife, Dora, J.P.M.,\r\nand Dora’s son by a previous relationship lived in a two bedroom mobile home on three and one-half\r\nacres next to Daniel’s mother, Teresa Mobley, and brother. ", "In September 2003, Daniel discovered\r\nthat Misty was moving seventy miles away or forty-eight miles plus the distance to the Slocum\r\nSchool. ", " He also learned that Misty was going to be living with a man, but was not married. ", " Daniel\r\nbelieved that he should be the primary caretaker of J.P.M. because he wanted to ensure that J.P.M.\r\nwas in a stable home.", "\n            From the date of the divorce until Daniel filed suit in this matter, the longest period of time\r\nthat J.P.M. had been out of his or Teresa’s house was two nights. ", " After the divorce, he and J.P.M.\r\nlived with Teresa about eight to nine months. ", " During that time, Misty picked up J.P.M. at Teresa’s\r\nhouse on Saturday morning about twice a month and returned him either Saturday night or Sunday\r\nmorning. ", " After Daniel married Dora on November 9, 2001, Daniel, Dora, Dora’s son, and J.P.M.\r\nmoved to Palestine. ", " When J.P.M. began pre-kindergarten at the Slocum School, Daniel and his\r\nfamily moved to their present home, and Misty maintained the same possession schedule. ", " After\r\nschool, J.P.M. rides the bus to Teresa’s house with Daniel’s brother’s three children. ", " Usually, Daniel\r\nor Dora picks up J.P.M. between 5:00 p.m. and 5:30 p.m. According to Daniel, in 2002 when J.P.M.\r\nwas in pre-kindergarten, Misty went approximately two months without visiting the child. ", "\n            In the summer of 2003, Daniel enrolled J.P.M. in the YMCA. ", " Misty refused to pay a portion\r\nof the enrollment fee although she had court ordered possession of J.P.M. on Thursdays and Fridays.", "\r\nShe also changed her possession schedule. ", " According to Daniel, Misty began picking up J.P.M. on\r\nThursday afternoon at the YMCA and returning him on Friday afternoon or Saturday morning. ", "\r\nWhen school began, Misty returned to her usual possession schedule, which was one and one-half\r\ndays instead of three and one-half days as ordered by the court. ", " After Daniel filed for modification,\r\nMisty began exercising the maximum possession ordered by the court, even taking J.P.M. for spring\r\nbreak for the first time since the divorce. ", " At that time, Daniel noticed J.P.M. changed, his behavior\r\nworsened, he became more rebellious, and he did not sleep on Wednesday nights. ", " Once, Daniel\r\nreceived a note from the school regarding a behavior problem with J.P.M. He admitted that J.P.M.\r\nhad more problems in school this year even though he was doing well academically. ", " Daniel believed\r\nit was good that Misty took J.P.M. to counseling and stated that he was willing to pay for part of the\r\ncosts.", "\n            Daniel admitted that he was a body builder, but denied ever using steroids. ", " He admitted that\r\nwhen he and Misty were separated, she filed a protective order against him, but stated that it was\r\ndenied. ", " He testified that he was arrested for a moving violation for not paying a ticket and admitted\r\nthat he was charged with assault causing bodily injury. ", "However, Misty filed an affidavit of\r\nnonprosecution on the assault charge. ", " Daniel admitted that he and Dora separated in September or\r\nOctober 2003 for a few days. ", " Daniel explained that he did not have a telephone because Misty\r\ncontinued to call and argue with him, attempting to interfere with his life. ", "\n            Misty testified that she lived in Tyler with her new husband, Ty. ", " She and Ty began living\r\ntogether in October 2003. ", " She agreed that it was not good for J.P.M. to be in the house with her and\r\na man who was not her husband. ", " She and Ty married on December 19, 2003. ", " Misty had another\r\nchild, an older son, by a previous relationship. ", " According to Misty, her older son had lived with his\r\nfather since he was about six years old and was currently living with his father until summer. ", " In\r\nSeptember 2002, she began school to become a licensed vocational nurse and completed her training\r\nin August 2003. ", " Because she was unable to find employment in Palestine, she began working for\r\nMother Frances Hospital in Tyler in September 2003. ", " Misty earned $2,400 per month. ", " At the time\r\nof trial, she worked nights in the medical-surgical unit, 7:00 p.m. to 7:00 a.m., three days one week\r\nand four days the next week. ", " However, Misty obtained her schedule a month in advance and would\r\nbe able to make proper arrangements for babysitters if needed. ", " During the school year, she would\r\nbe awake when J.P.M. came home from school. ", " Misty admitted that J.P.M. would be spending a lot\r\nof time with her husband, but stated that J.P.M. loved Ty. ", " Misty stated that, when she is not\r\navailable to care for J.P.M., Ty, Ty’s parents, or a babysitter can care for him. ", " Misty also testified\r\nthat, in September 2004, she would be working for Doctor’s Clinic, Monday through Friday, from\r\n7:00 a.m. to 3:00 p.m. \n            Misty stated that J.P.M. was about three months old when he went to live with Daniel and\r\nTeresa and that she accompanied him. ", " Misty testified that, after the divorce, she saw J.P.M. every\r\nThursday through Sunday and never missed a week of her court ordered possession. ", " Misty admitted\r\nthat when it was her time of possession and she was in school, Teresa would look after J.P.M. Misty\r\nstated that, on her day of possession, she travels to Teresa’s house to pick up J.P.M. when she gets\r\nout of school or off work. ", " If she arrives after Daniel gets off work, Daniel picks up J.P.M. Then,\r\nMisty is unable to contact Daniel to pick up J.P.M. because Daniel has no telephone. ", " Misty admitted\r\nthat, on a few occasions, she may not have picked up J.P.M. on Thursday and may have returned him\r\nearly on Saturday night. ", " In the summer of 2003, Misty never took J.P.M. to the YMCA on Fridays. ", "\r\nShe testified that she was not allowed possession of J.P.M. on holidays or spring break because\r\nDaniel refused to deviate from his weekly time of possession. ", "\n            According to Misty, Daniel did not cooperate with her. ", "While in nursing school, she\r\nattempted to switch days with him to study, but Daniel refused. ", "Misty discovered that, on the school\r\nemergency contact, Dora was listed as J.P.M.’s mother until the week before trial. ", " She believed that\r\nDaniel was poisoning J.P.M.’s mind against her, i.e., telling him he did not have to mind her. ", " Misty\r\ntook J.P.M. to see a counselor because he began to have problems at school, to kick and hit her, and\r\nto tell her she was stupid, that he did not have to mind her, and that she was not his real mother.", "\r\nWhen she attempted to talk to Daniel about J.P.M.’s problems, he walked away. ", " Misty was very\r\nconcerned about J.P.M.’s education and wanted him to go to college. ", " If she obtained custody, she\r\nplanned for J.P.M. to attend Chapel Hill schools. ", " If Daniel were granted custody, she did not believe\r\nhe would help her maintain a close relationship with J.P.M. \n            Misty testified that Daniel had been violent toward her during the marriage. ", " Although she\r\nfiled criminal charges against him, she admitted signing an affidavit for nonprosecution because she\r\nwas intimidated by Daniel. ", " She also admitted that her application for protective order was denied. ", "\r\nMisty stated that Daniel has been seriously involved with body building for one year and admitted\r\nto her that he had been offered steroids. ", " She denied dating Joshua San Miguel who testified that he\r\nand Misty had a relationship one summer. ", " Misty admitted that she and Ty smoked, but disagreed\r\nthat J.P.M. was allergic to smoke or had asthma.", "\n            Dora Mobley testified that she is Daniel’s current wife. ", " Throughout her marriage until\r\nDaniel’s petition to modify, Misty spent two days and one night with J.P.M. Dora admitted that\r\nJ.P.M. calls her “mommy,” although she insisted that J.P.M. knows she is his stepmother. ", "\r\nAccording to Dora, Misty’s possession schedule was not working because J.P.M. was becoming\r\nconfused and it interrupted his home and family schedule. ", "\n            Teresa Mobley testified that she is Daniel’s mother and J.P.M.’s grandmother. ", " According\r\nto Teresa, J.P.M. began to live with her and Daniel when he was approximately one month old and\r\nMisty moved in a few months later. ", " After Misty and Daniel divorced, J.P.M. and Daniel lived with\r\nher about eight months. ", " Misty visited J.P.M. about twice a month, usually getting him on Friday\r\nafternoon and returning him on Saturday or Sunday. ", " For the past two years, J.P.M. has ridden the\r\nschool bus to her house after school. ", " Teresa testified that J.P.M. stays with her until Daniel gets off\r\nwork. ", " During these two years, Misty visited J.P.M. about once or twice a month. ", " At one point,\r\nMisty told Teresa that she was busy and planning to live with a friend. ", " Teresa testified that it was\r\ntwo months before Misty saw J.P.M. again. ", " According to Teresa, she believed that if Daniel was\r\nawarded visitation only with J.P.M., he would become sick from not seeing his father. ", "\n            Ty testified that he is married to Misty and is employed by Lone Star Steel on a rotating\r\nschedule. ", " If he was working the swing shift and Misty was working nights, he could not say what\r\nwould happen to J.P.M. Ty testified that Daniel did not cooperate when Misty tried to work with\r\nhim about swapping time or talking to him about J.P.M.’s problems. ", " Ty believed it was in J.P.M.’s\r\nbest interest for Misty to have custody because J.P.M. would be allowed a relationship with Daniel.", "\n            Beverly Womack, a director of an outpatient program for mental health and substance abuse,\r\ntestified that she met with J.P.M. on December 1, 2003 at Misty’s request regarding J.P.M.’s\r\nproblems at school and his emotional instability. ", " Womack met with J.P.M., individually or with\r\nMisty, seven times through March 2004. ", " Womack agreed that if, in December 2003, J.P.M. began\r\nto see his mother more frequently in a different city with a new man in her life, that would be an\r\nadjustment for him and could contribute to his acting out in school. ", " Womack observed that J.P.M.\r\nshowed aggressiveness, anxiety, and features of attention deficit hyperactivity disorder and attention\r\ndeficit disorder. ", " Womack was aware that, for the majority of J.P.M.’s life, he lived with Daniel.", "\r\nWomack stated that J.P.M. was often reluctant to talk about his father’s household and never\r\nspontaneously brought up his father. ", " In her professional opinion, Womack believed that J.P.M.’s\r\nreluctance to talk about his father indicated that he was told not to talk about his father. ", " However,\r\nWomack did not know that Daniel was unaware of her visits with J.P.M. until February 2004. ", "\n            According to Womack, J.P.M. always referred to Misty as his mother and was very attached\r\nto her. ", " J.P.M. understood Misty’s difficult work schedule and felt very secure that she would not\r\nleave him. ", " Womack did not believe it would be appropriate or healthy for Daniel to insist that\r\nJ.P.M. refer to his stepmother as “mother.” ", " She did not observe anything about J.P.M.’s relationship\r\nor interaction with his mother that gave her any cause for concern about Misty’s having custody and\r\nprimary possession of him. ", "Based on her observations, Womack believed that the most significant\r\nperson in J.P.M.’s life was his stepfather, Ty.", "\n            Robert Mobley, Jr. is Daniel’s brother and J.P.M.’s uncle. ", " He testified that J.P.M. was at\r\nevery Christmas Eve and Christmas Day family gathering for the last three years. ", " Joshua San Miguel\r\ntestified that he lived in the same apartment complex as Misty in the summer of 2002. ", " That summer,\r\nhe and Misty had a relationship and J.P.M. was present when he stayed overnight with Misty. ", " From\r\nhis observations, J.P.M. was at Misty’s house for a day at the most. ", "Joshua admitted that he and\r\nDaniel worked security together.", "\n            The amicus ad litem stated that J.P.M.’s life in Slocum was a big portion of his life. ", " He\r\ncommended both parents, but stated it disturbed him that Misty had another child who had lived with\r\nhis father most of his life. ", " The amicus ad litem opined that J.P.M. needed a place where he lived and\r\nwent to school five days a week while the other parent received standard visitation. ", " In his opinion,\r\nbased on the testimony and visit with J.P.M., the child’s strongest bond was with Daniel’s family,\r\nand he recommended that the trial court grant primary custody to Daniel. ", " However, the amicus ad\r\nlitem stated that his recommendation was a “close call” and that the child would be safe if primary\r\ncustody was with either parent. ", "\n            At the conclusion of the hearing, the trial court stated that both parents were “screwing\r\n[J.P.M.] up” equally.", "\r\n\r\n\r\n The trial court stated that Daniel resented any relationship J.P.M. had with\r\nMisty and tried to discourage it. ", " However, the trial court observed that Daniel’s family environment\r\nwas positive, including his school and relationships with extended family. ", " The trial court noted that\r\nDaniel was not entirely negative, but stated that, if he were less so, the decision would be easy. ", " The\r\ntrial court agreed that Misty should be commended for her advancements, but that the relief she\r\nrequested would require changes for J.P.M. After identifying the choice as a “tough call,” the trial\r\ncourt appointed both parents joint managing conservators, awarding Daniel primary conservatorship.", "\r\nThe trial court granted Misty standard possession and ordered her to pay child support.", "\nAnalysis\n            From this evidence and the record, the trial court reasonably could have concluded that\r\nMisty’s new job and work hours, her husband’s rotating work schedule, and her moving some\r\ndistance from J.P.M.’s school since the rendition of the final decree of divorce constituted a material\r\nand substantial change of circumstances. ", " See In re P.M.B., 2 S.W.3d at 621-22. ", " Thus, the trial\r\ncourt did not abuse its discretion in finding that the material allegations in Daniel’s petition to\r\nmodify were true.", "\n            Regarding J.P.M.’s best interest, the trial court could have considered evidence showing that\r\nJ.P.M. was very attached to Daniel and his extended family even though he appeared to be attached\r\nto Misty and her new family. ", " The trial court could have found that J.P.M. had been attending school\r\nsome distance from his mother’s new home for two years and that his daily schedule with Teresa was\r\nlongstanding and ongoing. ", " Moreover, the amicus ad litem recommended that the trial court grant\r\nprimary custody to Daniel and emphasized the importance of Daniel’s family. ", " Although the decision\r\nwas “tough,” the trial court interviewed J.P.M. and recognized that Daniel’s family, school, and\r\nextended relationships were positive. ", " The court also noted that granting the relief Misty sought\r\nwould require changes in J.P.M.’s life. ", " Moreover, the trial court could have considered Misty’s\r\nchanged circumstances noted above as factors when determining J.P.M.’s best interest. ", " All this\r\nevidence supports a finding that modification was in the child’s best interest. ", " Although there was\r\nsome evidence in the record that was favorable to Misty, we conclude that the trial court did not\r\nabuse its discretion in finding that modification was in J.P.M.’s best interest. ", " See id. Accordingly,\r\nMisty’s sole issue is overruled.", "\n \nIntervention\n            In three issues, which are identical in substance, James argues the trial court erred in finding\r\nthat Daniel is the presumed father of J.P.M. and that the intervention is barred by limitations.", "\r\nFurther, James contends that the trial court erred in granting Daniel’s motion to dismiss the\r\nintervention. ", " More specifically, James argues that Daniel is the adjudicated, not the presumed, father\r\nof J.P.M. and, therefore, the applicable statute of limitations is found in section 160.609 of the Texas\r\nFamily Code. ", " James contends that his intervention is timely under section 160.609 and that the trial\r\ncourt should have allowed genetic testing and an evidentiary hearing on his petition. ", " Daniel argues\r\nthat he is the presumed father of J.P.M. As such, Daniel contends the trial court correctly concluded\r\nthat the statute of limitations in Texas Family Code section 160.607(a) applies and that James’s\r\nintervention is barred. ", "\nApplicable Law\n            An “adjudicated father” is a man who has been adjudicated by a court to be the father of a\r\nchild. ", " Tex. ", "Fam. ", "Code Ann. § ", "160.102(1) (Vernon 2002). ", " A “presumed father” is a man who, by\r\noperation of law under section 160.204, is recognized as the father of a child until that status is\r\nrebutted or confirmed in a judicial proceeding. ", " Tex. ", "Fam. ", "Code Ann. § ", "160.102(13) (Vernon 2002). ", "\r\nA man is presumed to be the father of a child if he married the mother of the child after the birth of\r\nthe child in apparent compliance with the law, he voluntarily asserted his paternity of the child, and\r\nhe is voluntarily named as the child’s father on the child’s birth certificate. ", " Tex. ", "Fam. ", "Code Ann.", "\r\n§ 160.204(a)(4)(B)(Vernon Supp. ", "2005). ", " A man is also presumed to be the father of a child if,\r\nduring the first two years of the child’s life, he continuously resided in the household in which the\r\nchild resided and he represented to others that the child was his own. ", " Tex. ", "Fam. ", "Code Ann.", "\r\n§160.204(a)(5) (Vernon Supp. ", "2005). ", " Further, a presumption of paternity established under this\r\nsection may be rebutted only by an adjudication or the filing of a valid denial of paternity by a\r\npresumed father in conjunction with the filing of another person of a valid acknowledgment of\r\npaternity. ", " Tex. ", "Fam. ", "Code Ann. § ", "160.204(b) (Vernon Supp. ", "2005). ", " A proceeding brought by\r\nanother individual to adjudicate the parentage of a child having a presumed father shall be\r\ncommenced not later than the fourth anniversary of the date of the birth of the child. ", " Tex. ", "Fam.", "\r\nCode Ann. § ", "160.607(a) (Vernon Supp. ", "2005). ", "\nAnalysis\n            Daniel is named as J.P.M.’s father on the birth certificate, and nothing in the record suggests\r\nthat this was not voluntary. ", " J.P.M. was born in March 1998, and Misty and Daniel married in\r\nDecember of that same year. ", " In her original petition, Misty stated that she and Daniel were the\r\nparents of J.P.M. In his counter petition for divorce, Daniel asserted that he was J.P.M.’s parent. ", "\r\nOn May 12, 2000, the trial court found that J.P.M. was “born to the parties.” ", " In all his motions and\r\npetitions in the record, Daniel asserted that he was J.P.M.’s parent. ", " At the modification hearing,\r\nDaniel testified that J.P.M. was his son. ", " From this evidence, we conclude that Daniel married the\r\nmother of J.P.M. after the child’s birth in apparent compliance with the law, voluntarily asserted his\r\npaternity of J.P.M., and was voluntarily named as J.P.M.’s father on the birth certificate. ", " Thus,\r\nDaniel is J.P.M.’s presumed father under section 160.204(a)(4)(B) of the Texas Family Code. ", " See \nTex. ", "Fam. ", "Code Ann. § ", "160.204(a)(4)(B).", "\n            After J.P.M.’s premature birth, Misty lived with her mother, but at some point, moved in with\r\nDaniel and Teresa. ", " Although Misty stated that she and J.P.M. lived with her mother for three months\r\nbefore moving, Teresa testified that J.P.M. moved in with them a month after he was released from\r\nthe hospital. ", " Daniel testified that, after the divorce, he and J.P.M. lived with his mother while Misty\r\nvisited J.P.M. twice a month. ", " In fact, Daniel testified at the modification hearing that the longest\r\nperiod of time since the divorce that J.P.M. had been out of his or Teresa’s house was two nights.", "\r\nFrom this evidence, we conclude that for the first two years of J.P.M.’s life, Daniel continuously\r\nresided in the household in which J.P.M. resided and he represented to others that the child was his\r\nown. ", " Thus, Daniel is also J.P.M.’s presumed father under section 160.204(a)(5) of the Texas Family\r\nCode. ", " See Tex. ", "Fam. ", "Code Ann. § ", "160.204(a)(5). ", " Therefore, the trial court did not err in finding\r\nthat Daniel was J.P.M.’s presumed father. ", "\n            Although Daniel was adjudicated to be J.P.M.’s father in the divorce proceeding, he was\r\nJ.P.M.’s presumed father first. ", " Moreover, at no time was Daniel’s presumption of paternity properly\r\nrebutted. ", " See Tex. ", "Fam. ", "Code Ann. § ", "160.204(b). ", " As such, the statute of limitations for a presumed\r\nfather applies. ", " See Tex. ", "Fam. ", "Code Ann. § ", "160.607(a). ", " Because James brought his petition in\r\nintervention more than four years after J.P.M.’s date of birth, his intervention is barred by the statute\r\nof limitations. ", " See Tex. ", "Fam. ", "Code Ann. § ", "160.607(a). ", " Therefore, the trial court did not err in\r\ngranting Daniel’s motion to dismiss. ", "Accordingly, James’s first, second, and third issues are\r\noverruled.", "\n \nConclusion\n            Based upon our review of the record, we conclude that the trial court did not abuse its\r\ndiscretion in finding that the circumstances of the child, a conservator, or other party affected by the\r\norder had materially and substantially changed since the date of the final decree of divorce and that\r\nmodification was in J.P.M.’s best interest. ", " Further, we conclude that the trial court did not err in\r\nfinding that Daniel was J.P.M.’s presumed father and that James’s petition in intervention was barred\r\nby limitations or in granting Daniel’s motion to dismiss. ", " Therefore, the judgment of the trial court\r\nis affirmed.", "\n \n \n                                                                                                    DIANE DEVASTO \n                                                                                                                 Justice\n \n \nOpinion delivered January 31, 2006.", "\nPanel consisted of Worthen, C.J., Griffith, J., and DeVasto, J.\n\n\n\n\n\n\n\n(PUBLISH)\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0.0013787426287308335, 0.0007057440816424787, 0.0006747828447259963, 0.0006120431353338063, 0.0005888380110263824, 0.0007351660169661045, 0.0064430246129632, 0.0007879039039835334, 0.0006178822368383408, 0.0006732476176694036, 0.0007529989816248417, 0.0006132629350759089, 0.0008228750666603446, 0.001126748276874423, 0.0009273200412280858, 0.0006341154803521931, 0.0007774907862767577, 0.0006765091675333679, 0.0006902134628035128, 0.0005904377321712673, 0.000738541828468442, 0.0007853152928873897, 0.0007720572757534683, 0.0007718196720816195, 0.0007781501044519246, 0.0009084351477213204, 0.0009848098270595074, 0.0007321062730625272, 0.0007471192511729896, 0.0009378278045915067, 0.0006478785071521997, 0.0007604568381793797, 0.0006485932390205562, 0.0006088997470214963, 0.0006828555488027632, 0.0007318815914914012, 0.0007822273182682693, 0.0006860494613647461, 0.001058537745848298, 0.0009407412144355476, 0.0007583346450701356, 0.0007981170783750713, 0.0006744745769537985, 0.0008617998100817204, 0.02993074432015419, 0.0007581976824440062, 0.0006622500950470567, 0.0006206006510183215, 0.0007393882842734456, 0.0006855589454062283, 0.0006206970429047942, 0.0010873755672946572, 0.0010438453173264861, 0.0006604393129236996, 0.0006687341956421733, 0.0009810704505071044, 0.0010806940263137221, 0.0006408914923667908, 0.0009197420440614223, 0.0012792118359357119, 0.0033195901196449995, 0.0006921361782588065, 0.0005999290733598173, 0.0008766960818320513, 0.0006526772049255669, 0.0005786129040643573, 0.0007407455705106258, 0.0005838891956955194, 0.0008521155104972422, 0.0008079908438958228, 0.0006019710563123226, 0.0013913069851696491, 0.0006265947595238686, 0.001361464150249958, 0.0007009876426309347, 0.0006089534726925194, 0.000951245951000601, 0.0009730281890369952, 0.0007420593756251037, 0.0009288516012020409, 0.0008474066271446645, 0.0007591900648549199, 0.0008263663039542735, 0.0006654133903793991, 0.0006508748629130423, 0.0008173538953997195, 0.0007397448644042015, 0.0007211932097561657, 0.001080194371752441, 0.0013176051434129477, 0.002763537224382162, 0.000647617329377681, 0.0006937594152987003, 0.000743867305573076, 0.0009591508423909545, 0.0006151041598059237, 0.0006508837686851621, 0.0007578751537948847, 0.0007712877122685313, 0.000834162172395736, 0.0008125075255520642, 0.0026670393999665976, 0.48147323727607727, 0.0009897805284708738, 0.0009385098237544298, 0.0007971825543791056, 0.0009905191836878657, 0.0011806952534243464, 0.0006804304430261254, 0.0007675666129216552, 0.000703996978700161, 0.007476401049643755, 0.0009702297393232584, 0.0034564179368317127, 0.0006520355818793178, 0.004003716167062521, 0.0007534142350777984, 0.0008541371789760888, 0.0006503915064968169, 0.0008687488152645528, 0.0012094865087419748, 0.0005943903815932572, 0.0007736027473583817, 0.0006578410975635052, 0.0033261848147958517, 0.0006930718082003295, 0.0006784707074984908, 0.0028392246458679438, 0.0013326635817065835, 0.0006482224562205374, 0.0007469473639503121, 0.0019818979781121016, 0.0010269508929923177, 0.0006852023070678115, 0.0006947310757823288, 0.0007430989644490182, 0.0008599262800998986, 0.0006906175403855741, 0.0013637915253639221, 0.0009262752719223499, 0.0009052545647136867, 0.0010546633275225759, 0.0006276287604123354, 0.0005886962753720582, 0.0006101944018155336, 0.000592575001064688, 0.0005765380919910967, 0.008924052119255066, 0.0006064203917048872, 0.000876520702149719, 0.0006674731848761439, 0.000677489850204438, 0.0010726582258939743, 0.0006318824598565698, 0.0005721287452615798, 0.0005740656633861363, 0.000560473243240267, 0.0021974495612084866, 0.000598427199292928, 0.0006634361343458295, 0.0008211925160139799, 0.00058649672428146, 0.0007388684316538274, 0.0006309968302957714, 0.0005672491970472038, 0.0007499743951484561, 0.0005513192736543715, 0.0006155325681902468, 0.000590893963817507, 0.0009747861186042428, 0.0006143521750345826, 0.0007330836961045861, 0.0006396360113285482, 0.0005936221568845212, 0.0007796502322889864, 0.0029202697332948446, 0.0008617998100817204, 0.02993074432015419, 0.0007581976824440062, 0.0006375964148901403, 0.0012377299135550857, 0.0008617998100817204, 0.02993074432015419, 0.0007581976824440062, 0.0006414793897420168, 0.0016979807987809181, 0.0008617998100817204, 0.02993074432015419, 0.0007880465709604323, 0.0007774552213959396, 0.0007665717857889831, 0.000854326062835753, 0.0008617998100817204, 0.02993074432015419, 0.0007880465709604323, 0.0007306001498363912, 0.0007665717857889831, 0.0016104617388918996, 0.0008617998100817204, 0.02993074432015419, 0.0007581976824440062, 0.0008028387674130499, 0.0007665717857889831, 0.000750762817915529, 0.0008617998100817204, 0.02993074432015419, 0.0007581976824440062, 0.0008185351034626365, 0.0007665717857889831, 0.0006952632684260607, 0.0006560917245224118, 0.0007247604662552476, 0.000679538759868592, 0.0006757549126632512, 0.000664491904899478, 0.0008081151754595339, 0.000803516071755439, 0.000749652914237231, 0.02993074432015419, 0.0007581976824440062, 0.0008085595909506083, 0.0011966873425990343, 0.0007568629225715995, 0.0007900192285887897, 0.0007257488323375583, 0.0006425963947549462, 0.000764941971283406, 0.000749652914237231, 0.02993074432015419, 0.0007581976824440062, 0.0007673754007555544, 0.0009575192234478891, 0.001453804667107761, 0.0019055405864492059, 0.000749652914237231, 0.02993074432015419, 0.0007581976824440062, 0.0007961967494338751, 0.0008983488660305738, 0.000749652914237231, 0.02993074432015419, 0.0007581976824440062, 0.0007767718052491546, 0.0007351194508373737, 0.000749652914237231, 0.02993074432015419, 0.0007581976824440062, 0.0007767718052491546, 0.0010049677221104503, 0.0006840426358394325, 0.0005983958253636956, 0.0007779195439070463, 0.0006052398239262402, 0.0006921708700247109, 0.000677028379868716 ]

[ "Conventional doghouses are available in different sizes, shapes, and materials. ", "Doghouses also differ in the way in which they are manufactured and assembled.", "\nOne type of conventional doghouse is one that is built board-by-board from scratch using nails and other non-removable permanent fasteners for connecting the walls and roof. ", "Building a doghouse from scratch involves excessive amounts of time and effort to plan and construct. ", "Furthermore, such a doghouse is usually further limited by a lack of mobility once the house is built, since the nails and other non-removable fasteners for connecting the adjoining walls are permanently fixed to the doghouse. ", "Any holes created by nailing the boards together may become worn and loose once the nails are removed from the doghouse, thereby preventing the nails from being reinserted into the holes. ", "Thus, this type of doghouse is not typically built to be disassembled and reassembled.", "\nAnother type of conventional doghouse is prefabricated in two pieces and has a separate roof that is fastened to a body of the doghouse. ", "This type of doghouse uses a large amount of space to store or transport due to the bulkiness of the body and the roof, especially if the doghouse provides a large amount of interior space.", "\nSome conventional doghouses use pegs for connecting walls or other portions of the doghouse. ", "These types of fasteners do not provide a sufficient amount of strength and reliability, since the pegs can slip out of their respective holes.", "\nWhat has heretofore not been available is a sturdy and reliable prefabricated doghouse that can be assembled and reassembled without excessive wear and tear. ", "Additionally, what has heretofore not been available is a doghouse that can be stored and transported using a minimal amount of space while providing a large amount of interior space for the pet after the doghouse is assembled." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0006010399665683508, 0.0007141801179386675, 0.000838270818348974, 0.0007935906760394573, 0.0007634588982909918, 0.0014862974639981985, 0.0007441824418492615, 0.0010195315117016435, 0.0008594802347943187, 0.0007332192035391927, 0.0006910411757417023, 0.0010301164584234357, 0.000615952187217772 ]

[ "Is isomerism a risk factor for intestinal volvulus?", "\nIsomerism, or heterotaxy syndrome, affects many organ systems anatomically and functionally. ", "Intestinal malrotation is common in patients with isomerism. ", "Despite a low reported risk of volvulus, some physicians perform routine screening and prophylactic Ladd procedures on asymptomatic patients with isomerism who are found to have intestinal malrotation. ", "The primary aim of this study was to determine if isomerism is an independent risk factor for volvulus. ", "Kid's Inpatient Database data from 1997 to 2012 was utilized for this study. ", "Characteristics of admissions with and without isomerism were compared with a particular focus on intestinal malrotation, volvulus, and Ladd procedure. ", "A logistic regression was conducted to determine independent risk factors for volvulus with respect to isomerism. ", "15,962,403 inpatient admissions were included in the analysis, of which 7970 (0.05%) patients had isomerism, and 6 patients (0.1%) developed volvulus. ", "Isomerism was associated with a 52-fold increase in the odds of intestinal malrotation by univariate analysis. ", "Of 251 with isomerism and intestinal malrotation, only 2.4% experienced volvulus. ", "Logistic regression demonstrated that isomerism was not an independent risk factor for volvulus. ", "Isomerism is associated with an increased risk of intestinal malrotation but is not an independent risk factor for volvulus. ", "Prognosis study. ", "Level III." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0008378967177122831, 0.0011914166389033198, 0.0017696298891678452, 0.0016984812682494521, 0.0006949121598154306, 0.0005866398569196463, 0.0008194114780053496, 0.0006276210187934339, 0.000709761690814048, 0.0007490276475436985, 0.0029467621352523565, 0.0008157141273841262, 0.001320079667493701, 0.0006289479788392782, 0.0007989548612385988 ]

[ "Q:\n\nHow do I apply a texture in Blender Render without it being influenced by the object it's applied to?", "\n\nOk, I'm not sure if I'm even asking the question correctly, and what I'm trying to do might be a bit on the weird side. ", " So, I'll try to explain what I want to do, without sounding like a madman.", "\nI have an image, shown below:\n\nNow, I know how to apply the texture in the usual way. ", " Getting it to look like this is easy:\n\nWhat I want to do though, is this:\n\nI can achieve that effect in the compositor simply enough, but I want to avoid using the compositor if at all possible. ", " I was wondering if there was a way to do this with BI?", "\nThe reason I'm trying to do something so silly, is that I am primarily a pixel-artist, and I've been experimenting with trying to generate decent-looking pixel art via Blender. ", " Once I'm able to do the above, I can then produce something like this:\n\nThanks in advance for any advice or nudges in the right direction!", "\n\nA:\n\nIts quite easy, just pick the \"Window\" coordinate in the texture panel under \"Mapping\"\n\nOne bit of advice though is that during animation, when you move the object or camera, the texture will move with it. ", "i.e. your \"pixels\" wont stay in the same spot, so you will potentially have a flicker in your \"dithering\".", "\nFor stills though this is totally fine.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006266966229304671, 0.0011218313593417406, 0.0021079890429973602, 0.0005539791309274733, 0.0005809058784507215, 0.012589956633746624, 0.004595769569277763, 0.0005620993324555457, 0.0005540321581065655, 0.003058438887819648, 0.0005840684752911329, 0.001994825666770339 ]

[ "Has the darkness of the night sky changed at your observing site? ", "Would you like to know your naked-eye magnitude limit? ", "Find out using both traditional and digital ways.", "\n\nWe all like to know how dark the sky is at our favorite observing sites. ", "It makes it easy to compare one place to another and helps us decide how deep we might go with our telescope that night. ", "A set of stars with stable brightnesses (no variables please!) ", "running the gamut of magnitudes from bright to faint and positioned at a comfortable viewing angle fits the bill. ", "The faintest one visible determines the NELM, or \"naked-eye limiting magnitude,\" for that location.", "\n\nTransparency can be highly variable, dependent on the amount of haze, smoke, and humidity in the air as well as your elevation. ", "Long-term monitoring of limiting magnitude can reveal information about trends in local and regional light pollution or even the variability of airglow, caused by the recombination of atoms and electrons in the upper atmosphere that were ionized by the Sun's UV light earlier that day.", "\n\nDetermining the best part of the sky to pick a standard set of stars isn't always easy. ", "Ideally, you should have a different set for each season. ", "Maybe even a set for each direction since for most of us the sky is rarely uniform but instead brighter here and darker there due to variations in local light pollution levels.", "\n\nThe object's altitude is also important so we must factor in atmospheric extinction. ", "The closer a star is to the horizon the more air you have to look through and the more its light is dimmed or extinguished by the atmosphere and its brew of natural and synthetic aerosols.", "\n\nThe amount of air directly overhead is called 1 air mass. ", "For a star 30° above the horizon, you're looking through 2 air masses. ", "At 10°, 5.6 air masses, and for an object on the horizon, 40 air masses. ", "A star seen 5° above the horizon will be dimmed by 3.5 magnitudes compared to the same star at the zenith assuming identical, ideal atmospheric conditions.", "\n\nWith this in mind, let's pick a set of stars of known magnitude at a high enough altitude (to avoid the worst of atmospheric extinction) and visible over much of the year. ", "The celestial poles are ideal for mid-latitude observers, which is why you'll often see Ursa Minor used as an example. ", "But to be fair to the Southern Hemisphere and with a nod to observers around Earth's middle, I've included three maps: Ursa Minor, Octans (Ursa Minor's equivalent in the Southern Hemisphere), and a familiar seasonal asterism, the Great Square of Pegasus.", "\n\nI encourage you to create your own limiting magnitude maps by selecting what you feel is more appropriate for your location. ", "Avoid the zenith, which has an unfair advantage, and areas within 40° of the horizon. ", "At 40°, extinction amounts to about 0.2 magnitudes.", "\n\nA darker sky means more satisfying views of our favorite cosmic objects. ", "If you live where light pollution gets you down, check out the interactive Light Pollution Atlas to help you find the darkest possible area in your region reachable by car. ", "Color-coded zones of light pollution overlay detailed road maps that you can zoom into in great detail. ", "Click anywhere and you'll get details about the site including its Bortle class — our next topic. ", "Very handy!", "\n\nDetermining your NELM and including it in descriptions of what you see through your telescope provides a standard for comparing observations. ", "A more comprehensive standard that uses limiting magnitude as its basis is the Bortle Dark-Sky Scale created by amateur astronomer and Sky & Telescope writer John Bortle. ", "It first appeared in the February 2001 issue of Sky & Telescope magazine. ", "Bortle considered NELM alone too dependent on individual eyesight and the variable amounts of time people put into the effort of seeing the faintest star.", "\n\nHis nine-level scale bundles several factors including NELM, the appearance of the zodiacal light and Milky Way, telescope magnitude limit, and naked-eye visibility of familiar deep-sky objects like M33 and M31. ", "Observer Nirvana is rated Class 1 with stars of magnitude 7.6–8.0 visible and M33 obvious with the naked eye. ", "A rural sky, the best many of us who live near cities can reach, rates a Class 3. ", "A Class 9, or inner-city sky, has a limiting magnitude of 4.0 or less.", "\n\nThere are also new apps for both Android and iPhone that let you use the phones' cameras to help navigate to and determine how faint a star you can see. ", "For more information, check out the Dark Sky Meter (iPhone) and the Loss of the night (Android) on Google Play. ", "Observers have the option with either app of sending their observations to international databases used to monitor night-sky brightness across the planet.", "\n\nAny of these methods makes us more aware of what's happening to our sky, information we can use to better educate city councils on managing lighting to preserve the night or simply to inform our observing." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.000695079390425235, 0.29273101687431335, 0.0006714630872011185, 0.000999861746095121, 0.0005151262157596648, 0.0006307236035354435, 0.0006642712978646159, 0.0006582662463188171, 0.0005626380443572998, 0.0005616845446638763, 0.0006094408454373479, 0.0005623259930871427, 0.0005511395866051316, 0.0005991745856590569, 0.0006657413323409855, 0.0006079089944250882, 0.0006342040142044425, 0.0006728419102728367, 0.0006818872061558068, 0.0005840450758114457, 0.0005525887245312333, 0.0005586843471974134, 0.0006342949927784503, 0.0007411702536046505, 0.0006893063546158373, 0.0005859070224687457, 0.007061460986733437, 0.000582435168325901, 0.0006534364656545222, 0.0008444395498372614, 0.0006985571817494929, 0.0005869762971997261, 0.0006255112821236253, 0.0007309323409572244, 0.0006355321384035051, 0.0007540624355897307, 0.0005982843576930463, 0.0006706732092425227, 0.0005995281389914453, 0.0005610748194158077, 0.0005646456265822053, 0.0005511695635505021 ]

[ "Tag Archives: social justice\n\nA vehicular homicide case near the intersection of Fourth and Water streets in Charlottesville, Virginia, is international news. ", "I regret the loss of life, particularly since the driver apparently intended to harm or kill the victims. ", "I’ll get back to … Continue reading →\n\nLike this:\n\nI think being concerned about air quality, recycling, and other environmental issues, makes sense. ", "But I don’t think only being concerned about the environment is a good idea. ", "People matter, too. ", "I don’t think it’s an either/or thing. ", "Technology, history, … Continue reading →\n\nLike this:\n\nI picked a mix from ‘science news’ this week: tardigrade genes, fertility fears, and what is probably the world’s oldest living culture. ", "Folks in Western civilization have known about our neighbors in Australia for about four centuries. ", "Understanding their beliefs … Continue reading →\n\nArchives\n\nCatholic Blogs on Google+\n\nAdvertisement\n\nACWB Contributor\n\nNewEvangelists.org Contributor\n\nSponsored links\n\nAdvertisement\n\nDisclaimers\n\nThe opinions expressed in this blog are my own. ", "As a Catholic layman, I make an effort to be informed about the teachings of the Church, and will repeat what I have found. ", "For more 'official' statements, I suggest that you talk to a priest or deacon in your area. ", "Or check out the ‘Official’ websites on my Blogroll page.", "\n\nAlthough I make an effort to select meaningful and qualified information for the external links I create, I have no control over content on websites or blogs other than mine, and cannot be held responsible for their contents.", "\n\nI have limited control over the advertisements and video links appearing on this blog. ", "I do not necessarily endorse any of them." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005874729831703007, 0.045076608657836914, 0.0005119608831591904, 0.0005935924709774554, 0.005828021094202995, 0.0008304952061735094, 0.0005817738710902631, 0.0005667520454153419, 0.0007636494701728225, 0.0006116949371062219, 0.0008757513132877648, 0.0006226063705980778, 0.0005553470691666007, 0.0006724313134327531, 0.0006560300826095045 ]

[ "Kraaker Kiessee\n\nKraaker Kiessee is a lake in the Ludwigslust-Parchim district in Mecklenburg-Vorpommern, Germany. ", "At an elevation of 32.4 m, its surface area is 0.068 km².", "\n\nCategory:Lakes of Mecklenburg-Vorpommern" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0028834366239607334, 0.000671601970680058, 0.0007000927580520511 ]

[ "Mark Waggoner\n\n\n\nHey, there. ", "Dave, right? ", "Nice to meet you. ", "I'm Mark Waggoner, I work in sales, over by the file cabinets. ", "Enjoying your first week on the job? ", "Great, glad to hear it. ", "Well, I just decided to stop by because I noticed that a little earlier you were watching a funny video on your computer and you invited a few of our coworkers over to check it out. ", "You were all really laughing it up, must have been four or five of you, all told. ", "I'm glad you guys had such a great time. ", "However, I just wanted to come over here because I need you to know right now that here, in this office, I'm the guy whose computer people huddle around to watch funny online videos.", "\n\n\nMe, and nobody else.", "\n\nI'm not mad or anything. ", "Really, I'm not. ", "I know you're new here, and obviously you're still learning the ropes, so I'm not going to come down on you for overstepping your bounds just because you didn't know any better. ", "But as a courtesy to you, before things go any further, I want you to understand that when it comes to the exhibition of humorous, weird, or completely crazy videos, I'm the man in charge of that, and whenever we get together as a group to watch these videos, it's going to be my desk that people form a close semicircle around.", "\n\n\nThat's my territory. ", "And everyone around here respects that.", "\n\nAnd don’t get me wrong, I appreciate the effort on your part. ", "We all work hard around here, as you realize by now, and sometimes it's nice to break up the daily routine with a 30-second clip of a cat getting its head stuck in an empty milk carton or some nerdy kid twerking. ", "It's all in good fun, and I'm certainly not trying to put a damper on any of that.", "\n\n\nBut in order for this office to function, we all need to respect each other's roles. ", "And in this case, my role is pulling up comical videos on YouTube, and calling the people in my immediate vicinity to crowd around so they can watch a baby bonk his dad on the head with a toy mallet or some crazy German beer commercial. ", "That's what I do here. ", "And, frankly, I’m great at it. ", "There’s a reason why people come to my desk to watch humorous videos and not to, you know, Jeff’s desk. ", "Or Carrie’s desk.", "\n\nAnd, so we're clear, everything I’m saying here also goes for videos of people trying to chug Tabasco sauce, local news anchors flubbing their lines, those \"Bad Lip Reading\" things, or a really cute Japanese kid who can absolutely wail on guitar.", "\n\n\nShould you have maybe asked before you started playing a funny video on your laptop, just to make sure you weren’t usurping someone else’s duly earned office function? ", "I mean, again, I don’t want to come down hard on you here since you’re the new kid on the block, so I’m willing to just let this go, but we do have a delegation of duties here and you need to learn it.", "\n\nThey are as follows: Kevin is the one who pins up those funny photoshops around the office. ", "Lisa is the one who sends light-hearted softball game results emails. ", "Jeff, well, I guess Jeff doesn’t really do anything. ", "Carrie is the one who brings her lunch in a tupperware container from home and heats it up in the microwave. ", "And I, and only I, am the one around whom people gather to watch videos of teenagers totally botching skateboard tricks. ", "That's always been my turf. ", "And I’ll be honest with you, it always will be.", "\n\n\nAlso, I’m the one who uses a cool desk lamp that he brought from home. ", "That’s my other thing.", "\n\nAnd hey, I'm not trying to be a hardass here. ", "I like a good laugh as much as the next guy, as evidenced by that hilarious mashup of Sesame Street clips with that Daft Punk song I had everybody watch yesterday. ", "So, please, if you find a video on College Humor or Break.com that you think the office should see, feel free to send it my way and I’ll consider it. ", "If I think it's right for our crew, I'll call everybody over and before you know it, we'll all be enjoying it together, as a team. ", "I'll even make sure to let you know about it first, so that you get a good view.", "\n\n\nBut you make sure to send it to me first.", "\n\nSo, anyway, that's how things work around here. ", "Hopefully this little chat will just be a minor road bump in your otherwise happy and productive career at this company. ", "Really, as long as you work hard and make sure not to step on anybody's toes, you'll be just fine. ", "So good luck, and welcome to the team.", "\n\n\nDon’t fuck it up." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.003441775217652321, 0.0009919335134327412, 0.0006035339320078492, 0.0011034838389605284, 0.00128680479247123, 0.0005795647739432752, 0.0009767457377165556, 0.0013174075866118073, 0.0006232686573639512, 0.0008616240229457617, 0.0013658375246450305, 0.0021536240819841623, 0.0010870388941839337, 0.01107032224535942, 0.0007533664465881884, 0.0014496439835056663, 0.0005929029430262744, 0.0007951879524625838, 0.022508932277560234, 0.0007945486577227712, 0.0005483830464072526, 0.08882150799036026, 0.0009775067446753383, 0.0007247604662552476, 0.0022580772638320923, 0.0011286964872851968, 0.008820224553346634, 0.0010184699203819036, 0.013835619203746319, 0.0006327996379695833, 0.0006975712021812797, 0.000788819626905024, 0.0011761614587157965, 0.05140683799982071, 0.0037548248656094074, 0.0006131776026450098, 0.0007440909976139665, 0.0009065462509170175, 0.31407663226127625, 0.0007861995254643261, 0.0005545750609599054, 0.0005794686730951071, 0.0005593522801063955, 0.0007408069795928895, 0.0006402034778147936, 0.0006060523446649313, 0.0009996178559958935, 0.000550482829567045, 0.9918310046195984 ]

[ "Suspension packaging cell lines for the simplified generation of T-cell receptor encoding retrovirus vector particles.", "\nThe transfer of T-cell receptor (TCR) genes into primary human T-cells to endow their specificity toward virus-infected and tumor cells is becoming an interesting tool for immunotherapy. ", "TCR-modified T cells are mainly generated by retrovirus-mediated gene transfer. ", "To produce TCR-retrovirus particles, fibroblast packaging cell lines are the most common tool. ", "We constructed two packaging cell lines based on the human suspension T-cell lymphoma line Deltabeta-Jurkat, which lacks endogenous TCRbeta-chains and is therefore unable to express CD3 complexes on the cell surface. ", "After supply of gag-pol (murine leukemia virus (Mo-MLV)) and env (GALV or MLV-10A1) genes, a green fluorescent protein (GFP)-encoding retrovirus vector was transduced into both packaging cell clones, which then stably produced GFP-retroviruses with titers of up to 4 x 10(5) infectious particles (IP)/ml. ", "After transfer of a TCRalpha/beta-encoding retrovirus vector, Deltabeta-Jurkat/GALV and Deltabeta-Jurkat/10A1 cells expressed CD3 molecules on the cell surface. ", "CD3-high expressing packaging cells were enriched by fluorescence-activated cell sorter sorting. ", "In these cells, the CD3 expression level directly correlated with the titer of vector particles. ", "TCR-retroviruses efficiently transduced human T-cell lines and primary T cells. ", "In conclusion, the method allowed the fast and easy generation of high virus titer supernatants for TCR gene transfer." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0005953055224381387, 0.0007533689495176077, 0.0009193994919769466, 0.0006371702766045928, 0.000819467706605792, 0.00071761041181162, 0.000643051287624985, 0.0006632325821556151, 0.0006732646143063903, 0.0011209921212866902, 0.0006623059744015336 ]

[ "Q:\n\nBoost Asio how to read/write on a SSL socket that doesnt use SSL?", "\n\nThe title is my question.", "\nI already found a topic related to this here -> Using SSL sockets and non-SSL sockets simultaneously in Boost.", "Asio?", "\nand basically I'm in the same situation but for some reason I couldn't comment there and/or contact the questioner directly so I'm doing this as a new question.", "\nI have a set up ssl socket ssl::stream<ip::tcp::socket> socket_; where clients can connect just fine with \nsocket_.async_handshake(ssl::stream_base::server, session::handle_handshake)\n\nand then read/write with \nasync_write(socket_, buffer(send_data, send_length), session::handle_read)\nsocket_.async_read_some(buffer(recieved_data, max_length), session::handle_read)\n\nHowever now I want to use the same type of socket to build up connections that dont use SSL.", "\nFirst of all I'm unsure how to do the \"handshaking\" as it is done with a SSL connection as I mentioned above. ", "By looking at some normal boost.asio example I assume that I dont have to do that for non-ssl connections and just directly read/write to the socket once it has been accepted?", "\nThen as a next step I tried to do it as decsribed in the topic I mentioned above, I added a boolean ssl to session to check whether its a SSL connection or not. ", "Then instead of using socket_ in the async functions, I used socket_.lowest_layer().", "\nHere's the suggested code: \nif ( sslEnabled )\n boost::asio::async_write( secureSocket_ );\n} else {\n boost::asio::async_write( secureSocket_.lowest_layer() );\n}\n\nHowever it seems that the compiler doesnt accept this solution. ", "When I try to compile the code with an async function that has socket_.lowest_layer() as a stream this error shows up (its only for async_read, async_write has a similar one):\nboost\\asio\\impl\\read.hpp(263): error C2039: 'async_read_some' : is not a member of 'boost::asio::basic_socket<Protocol,SocketService>'\n with\n [\n Protocol=boost::asio::ip::tcp,\n SocketService=boost::asio::stream_socket_service<boost::asio::ip::tcp>\n ]\n boost\\asio\\impl\\read.hpp(255) : while compiling class template member function 'void boost::asio::detail::read_op<AsyncReadStream,MutableBufferSequence,CompletionCondition,ReadHandler>::operator ()(const boost::system::error_code &,size_t,int)'\n with\n [\n AsyncReadStream=boost::asio::basic_socket<boost::asio::ip::tcp,boost::asio::stream_socket_service<boost::asio::ip::tcp>>,\n MutableBufferSequence=boost::asio::mutable_buffers_1,\n CompletionCondition=boost::asio::detail::transfer_all_t,\n ReadHandler=boost::_bi::bind_t<void,boost::_mfi::mf2<void,CSocket,const boost::system::error_code &,size_t>,boost::_bi::list3<boost::_bi::value<CSocket *>,boost::arg<1>,boost::arg<2>>>\n ]\n boost\\asio\\impl\\read.hpp(527) : see reference to class template instantiation 'boost::asio::detail::read_op<AsyncReadStream,MutableBufferSequence,CompletionCondition,ReadHandler>' being compiled\n with\n [\n AsyncReadStream=boost::asio::basic_socket<boost::asio::ip::tcp,boost::asio::stream_socket_service<boost::asio::ip::tcp>>,\n MutableBufferSequence=boost::asio::mutable_buffers_1,\n CompletionCondition=boost::asio::detail::transfer_all_t,\n ReadHandler=boost::_bi::bind_t<void,boost::_mfi::mf2<void,CSocket,const boost::system::error_code &,size_t>,boost::_bi::list3<boost::_bi::value<CSocket *>,boost::arg<1>,boost::arg<2>>>\n ]\n c:\\asio_test\\source\\server.cpp(131) : see reference to function template instantiation 'void boost::asio::async_read<boost::asio::basic_socket<Protocol,SocketService>,boost::asio::mutable_buffers_1,boost::_bi::bind_t<R,F,L>>(AsyncReadStream &,const MutableBufferSequence &,const ReadHandler &)' being compiled\n with\n [\n Protocol=boost::asio::ip::tcp,\n SocketService=boost::asio::stream_socket_service<boost::asio::ip::tcp>,\n R=void,\n F=boost::_mfi::mf2<void,CSocket,const boost::system::error_code &,size_t>,\n L=boost::_bi::list3<boost::_bi::value<CSocket *>,boost::arg<1>,boost::arg<2>>,\n AsyncReadStream=boost::asio::basic_socket<boost::asio::ip::tcp,boost::asio::stream_socket_service<boost::asio::ip::tcp>>,\n MutableBufferSequence=boost::asio::mutable_buffers_1,\n ReadHandler=boost::_bi::bind_t<void,boost::_mfi::mf2<void,CSocket,const boost::system::error_code &,size_t>,boost::_bi::list3<boost::_bi::value<CSocket *>,boost::arg<1>,boost::arg<2>>>\n ]\n\nBuild FAILED.", "\n\nSo now I'm pretty much stuck and I really hope you can help me. ", "Searching for the error brought up nothing and since it should supposedly work I dont know what the mistake could be...\n\nA:\n\nActually I think I solved it now.", "\n1) The \"handshaking\" on a non-ssl is indeed not necessary, I immediately do async_reading after the accept\n2) Instead of async_read/write( socket_.lowest_layer(), ... ) I had to use socket_.next_layer().async_read_some( buffer, handler) and async_write( socket_.next_layer(), ... )\nI still dont know why it doesnt work with socket_.lowest_layer() (if someone knows, please explain) but at least it works just fine with the above methods. ", "And I hope this will help other people with a similar problem too ;-)\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.001110951416194439, 0.0008585340692661703, 0.0005800884100608528, 0.0014770177658647299, 0.0005905680009163916, 0.0007971601444296539, 0.0005801865481771529, 0.0006002359441481531, 0.0006332355551421642, 0.0007266101310960948, 0.0006979425670579076, 0.0013304061722010374, 0.0005985564203001559, 0.0007673213258385658, 0.0007186198490671813, 0.0007294459501281381 ]

[ "Gadissie Edato\n\nGadissie Edato (born 15 March 1973) is an Ethiopian long-distance runner. ", "She competed in the women's marathon at the 2000 Summer Olympics.", "\n\nReferences\n\nCategory:1973 births\nCategory:Living people\nCategory:Athletes (track and field) at the 2000 Summer Olympics\nCategory:Ethiopian female long-distance runners\nCategory:Ethiopian female marathon runners\nCategory:Olympic athletes of Ethiopia\nCategory:Place of birth missing (living people)" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.00177046749740839, 0.0006835550884716213, 0.0005621687741950154 ]

[ "EXCLUSIVE: While most know Patty Jenkins was responsible for the direction of Wonder Woman, and Gal Gadot portrayed the beloved superhero, not many folks are aware that writer Jason Fuchs was partially responsible for the story.", "\n\nFuchs was recently announced as the person who will finally bring DC’s Lobo to the big screen. ", "LRM‘s own Gig Patta spoke with Fuchs on the red carpet of the USC Libraries Scripter Awards and talked about the direction he is heading in for Lobo:\n\n“I think when you’re working on comic book characters, especially ones that are near and dear to my heart, like Wonder Woman and Lobo are, you want to create something that’s true to what the original text are. ", "I think Wonder Woman really captures the feeling of — not only the original Moulton Marston comics, but the George Perez run in the late-80s. ", "It feels like reading those comics up on the big screen. ", "So for something like Lobo, without saying too much about it, it’ll feel, I imagine, quite different, because the Lobo comic itself is quite different. ", "What Keith Giffen and Alan Grant put together was something really unique, and hopefully we’ll capture some of that same spirit when we make the movie.”", "\n\nFuchs did a wonderful job with Wonder Woman, and seems to have a personal attachment to the character of Lobo. ", "His vision appears to be both genuine and unique, and hopefully his writing and thought process from Wonder Woman will carry over into Lobo and we will have another great entry into the DC extended universe.", "\n\nAs mentioned above Fuchs has a story credit on Wonder Woman, he is also attached to pen Minecraft: The Movie along with Rob McElhenney. ", "He also appeared as an actor in the Oscar-winning film, La La Land.", "\n\nWhat do you think of Fuchs’ direction for Lobo? ", "Let us know your thoughts in the comments down below!", "\n\nDon’t forget to share this post on your Facebook wall and with your Twitter followers! ", "Just hit the buttons on the top of this page." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0005902160191908479, 0.0007513335440307856, 0.0007169616874307394, 0.0006387654575519264, 0.0008384834509342909, 0.0006416065734811127, 0.0005655168206430972, 0.0006614571902900934, 0.0005753441364504397, 0.0006803922005929053, 0.0008043315028771758, 0.0011085743317380548, 0.0005739302723668516, 0.0027567546349018812, 0.0008124947780743241 ]

[ " IN THE SUPREME COURT OF MISSISSIPPI\n NO. ", "95-CA-00272-SCT\nPATRICIA EDWARDS GARRETT\nv.\nCHARLES DOUGLAS GARRETT, SR.", "\nTHIS OPINION IS NOT DESIGNATED FOR PUBLICATION AND MAY NOT BE CITED,\n PURSUANT TO M.R.A.P. 35-A\n\n\n\n\n BEFORE SULLIVAN, P.J., McRAE AND ROBERTS, JJ.", "\n\n\n SULLIVAN, PRESIDING JUSTICE, FOR THE COURT:\n\n\n\n\nCharles and Patricia Garrett were married in 1971, and lived in the East Tate community. ", "During\ntheir twenty-three year marriage they had three sons. ", "On September 27, 1993, Patricia left her\nhusband and moved to Texas. ", "Patricia filed her complaint for divorce upon grounds of habitual cruel\nand inhuman treatment or irreconcilable differences on March 24, 1994, and Charles filed his\ncomplaint for divorce upon grounds of adultery and/or habitual cruel and inhuman treatment or\nirreconcilable differences on January 24, 1995.", "\n\nDuring the marriage both Charles and Patricia worked full time. ", "Charles' income was approximately\n$28,000.00 to $29,000.00 per year, and Patricia earned between $11,000.00 and $12,000.00\nannually. ", "At the time of trial, Charles had been laid off and was only working in his part-time auto\nrepair business in Independence, Mississippi. ", "Patricia quit her job when she left Charles and moved to\nTexas, and at the time of trial she was unemployed and had made little attempt to secure a new job in\nthe eighteen months since the separation. ", "Patricia stated that she lacked one year of college to finish\nher degree and planned to finish school before seeking employment.", "\n\nTestimony differed as to which spouse took care of the housework and child rearing, but it appears\nthat Patricia and Charles shared the household chores and were both involved in raising their three\nsons. ", "Patricia and Charles both testified that the family bills were paid out of a joint account into\nwhich both of them deposited their paychecks. ", "The marital home, valued at $55,000.00, was\npurchased in both of their names, apparently from that joint account.", "\n\nAt the time of trial all three sons were living in the marital home with Charles. ", "The older two sons\nwere working full time, but were also attending college and making car upkeep payments. ", "According\nto Charles's testimony and financial declaration, his monthly expenses at the time of trial totaled $1,\n669.67, and the older sons were only able to contribute occasionally toward the living expenses. ", "He\n\falso testified that the remaining debt on the home mortgage totaled $17,000.00, but Patricia\ndisagreed, stating that five years ago, the remaining amount owed was $17,000.00.", "\n\nPatricia withdrew her complaint for divorce, so the chancellor granted Charles a divorce upon the\nuncontested grounds of adultery. ", "The parties stipulated that Charles would receive custody of\nCharles Jr. and that the marital home had a value of $55,000.00. ", "They also reached an agreement on\nthe distribution of their personal property, including the automobiles. ", "The remaining issues before the\ncourt were the division of the equitable interest in the marital home, child support, alimony, and legal\nfees. ", "The chancellor ordered Patricia to continuing paying Charles 14% of her adjusted gross monthly\nincome, or no less than $105.00 per month in child support. ", "The chancellor determined that the\nremaining valuation of home equity in the marital home equaled $38,000.00. ", "He adjudicated that\nCharles was entitled to 75% of that interest, totaling $28,500.00, with Patricia receiving the\nremaining 25%, or $9,500.00. ", "The court decided that Charles was entitled to $10,000.00 in lump\nsum alimony, so he vested title in the marital home to Charles, with Patricia owing Charles a total of\n$500.00 of remaining lump sum alimony after divesting her $9,500.00 interest in the home. ", "The\nchancellor further ordered Patricia to pay all court costs, with each party being responsible for their\nown attorneys' fees.", "\n\n I.\n\n THE CHANCELLOR COMMITTED MANIFEST ERROR BY APPLYING INCORRECT\n LEGAL CRITERIA TO THE EQUITABLE DIVISION OF JOINTLY ACQUIRED\n MARITAL ASSETS/PROPERTY OF THE PARTIES.", "\n\n II.", "\n\n THE CHANCELLOR ABUSED HIS DISCRETION AND COMMITTED MANIFEST\n ERROR IN AWARDING LUMP SUM ALIMONY TO THE APPELLEE.", "\n\nEquitable division of the marital property and awards of alimony should be considered together by\nthe chancellor. ", "Brooks v. Brooks, 652 So.2d 1113, 1120-21 (Miss. 1995) (citing Ferguson v.\nFerguson, 639 So.2d 921, 929 (Miss. 1994)).", "\n\n Division of marital assets is now governed under the law as stated in Hemsley and Ferguson.", "\n First, the character of the parties' assets, i.e., marital or nonmarital, must be determined\n pursuant to Hemsley. ", "The marital property is then equitably divided, employing the Ferguson\n factors as guidelines, in light of each parties' nonmarital property.", "\n\nJohnson v. Johnson, 650 So.2d 1281, 1287 (Miss. 1994) (citing Hemsley v. Hemsley, 639 So.2d\n909 (Miss. 1994) and Ferguson, 639 So.2d 921). ", "In this case, the only marital property in issue was\nthe home equity on the marital home. ", "The chancellor determined that Charles was entitled to 75% of\nthe net equity, which the chancellor calculated at $38,000.00, with Patricia receiving the remaining\n25%.", "\n\nEquitable distribution is governed by the guidelines set out by this Court in Ferguson, 639 So.2d at\n928. ", "Those guidelines include: (1) economic and domestic contributions by each party to the\nmarriage, (2) expenditures and disposal of the marital assets by each party, (3) the market value and\n\femotional value of the marital assets, (4) the value of the nonmarital property, (5) tax, economic,\ncontractual, and legal consequences of the distribution, (6) elimination of alimony and other future\nfrictional contact between the parties, (7) the income and earning capacity of each party, and (8) any\nother relevant factor that should be considered in making an equitable distribution. ", "Id.\n\nIn this case, the chancellor stated that his distribution of marital property was based upon the factors\nin Hemsley and Ferguson. ", "The testimony was undisputed that Charles earned approximately twice\nas much money during the course of the marriage as Patricia, but that Patricia enjoyed an adequate\nearning capacity, which was likely to increase with her pending graduation from college. ", "It also\nappears from the record that the couple both contributed toward home upkeep and child rearing.", "\nSince all three of the couple's sons were living with Charles at the time of the divorce, he had a\ngreater need for stability and financial security, including possession of the marital home. ", "Apparently,\nthe chancellor found Charles's testimony credible that the home equity equaled $38,000.00, and he\ndistributed the value accordingly. ", "This Court has previously stated that for purposes of divorce, it is\npresumed that the contributions of the parties, whether economic or otherwise, are equal. ", "Hemsley,\n639 So.2d at 915. ", "However, the chancellor in this case correctly found this presumption to be\nrebutted based upon his findings of fact and conclusions of law.", "\n\nThe chancellor stated that his decision to award Charles $10,000.00 in lump sum alimony was based\nupon Carrow v. Carrow, 642 So.2d 901, 904-905 (Miss. 1994), and Crowe v. Crowe, 641 So.2d\n1100, 1103 (Miss. 1994). ", "In Crowe, this Court stated that the factors to be considered in awarding\nlump sum alimony are \"(1) the existence of substantial contributions to the accumulation of wealth of\nthe payor either by quitting a job to become a housewife or by assisting in the payor's business, (2)\nthe length of the marriage, (3) the lack of separate income or the existence of comparatively meager\nincome for the recipient, and, (4) lack of financial security in the absence of an award.\" ", "Crowe, 641\nSo.2d at 1103 (citing Tilley v. Tilley, 610 So.2d 348 (Miss.1992); Retzer v. Retzer, 578 So.2d 580,\n592 (Miss.1990); Cheatham v. Cheatham, 537 So.2d 435, 438 (Miss.1988)).", "\n\nThe Garretts' marriage was twenty-three years long, and Charles successfully argued that his financial\nsecurity would be unstable without an award of lump sum alimony in light of his maintaining a home\nfor the couple's three sons with only his part-time auto repair work. ", "Patricia is capable of earning\nenough money to support herself, but has simply failed to seek employment since their separation.", "\nPatricia could afford to pay the $10,000.00 lump sum alimony award with her 25% share of the home\nequity.", "\n\nThis Court has stated that chancellors may consider marital misconduct as a factor in determining\nwhether to award alimony. ", "Carrow, 642 So.2d at 904-905 (citing Ferguson, 639 So.2d at 927)). ", "In\nthis case, Patricia did not contest the allegation of adultery, so the chancellor was correct in\nconsidering Patricia's adultery as a factor weighing in favor of Charles on the issue of alimony.", "\n\nConsidering the division of the Garrett's home equity and the award of alimony together, the\nchancellor's ruling in this case was not an abuse of discretion.", "\n\nAFFIRMED.", "\n\nLEE, C.J., PRATHER, P.J., PITTMAN, BANKS, McRAE, ROBERTS, SMITH AND MILLS,\nJJ., ", "CONCUR.", "\n\fDATE OF JUDGMENT: 02/22/95\nTRIAL JUDGE: HON. ", "PERCY LEE LYNCHARD JR.", "\nCOURT FROM WHICH APPEALED: TATE COUNTY CHANCERY COURT\nATTORNEY FOR APPELLANT: GODFREY RONALD TILLMAN\nATTORNEY FOR APPELLEE: JOHN THOMAS LAMAR, JR.", "\nNATURE OF THE CASE: CIVIL - DOMESTIC RELATIONS\nDISPOSITION: AFFIRMED - 3/20/97\nMOTION FOR REHEARING FILED:\nMANDATE ISSUED: 6/5/97\n\f" ]

{ "pile_set_name": "FreeLaw" }

[ 0.0007269196794368327, 0.0007142760441638529, 0.0006208180566318333, 0.0005853555630892515, 0.001276827766560018, 0.0009075159905478358, 0.0024954325053840876, 0.0006361199775710702, 0.0007220476982183754, 0.0009712711325846612, 0.0010225961450487375, 0.000816208659671247, 0.0008163016173057258, 0.0006570644327439368, 0.0005841776146553457, 0.000728164566680789, 0.0007060953066684306, 0.0005494563956744969, 0.0006127000087872148, 0.007979629561305046, 0.0006696497439406812, 0.0005875430069863796, 0.0006718183285556734, 0.0017896847566589713, 0.0005880258977413177, 0.0006900507141835988, 0.0010205727303400636, 0.0007599797681905329, 0.0006515631685033441, 0.0011521351989358664, 0.0015666740946471691, 0.0006126462831161916, 0.0006940080784261227, 0.0005952141364105046, 0.00061552703846246, 0.0006390020134858787, 0.0007387938094325364, 0.0006000185967423022, 0.0006388540496118367, 0.0006154871080070734, 0.0005614086403511465, 0.0006462833262048662, 0.000609604932833463, 0.0010978208156302571, 0.0006655615288764238, 0.0005762414657510817, 0.0006405434687621891, 0.00079143769107759, 0.0006104198400862515, 0.0008226351346820593, 0.0006950671086087823, 0.0008027289877645671, 0.0008049706229940057, 0.0005712868296541274, 0.0009303130791522563, 0.0007837528246454895, 0.0007018914329819381, 0.0012638127664104104, 0.000638516154140234, 0.0007905274978838861, 0.0008250258979387581, 0.0006778506212867796, 0.0006476204143837094, 0.0009467301424592733, 0.0006270998856052756, 0.0006355996592901647 ]

[ "In human color vision, color constancy is the ability of the visual system to preserve the appearance of an object under a wide range of light sources. ", "For example, because of color constancy in human color vision, colored objects are perceived such that they largely maintain their color appearance even under illuminants that differ greatly.", "\nImaging systems, either film or electronic photo-sensors, lack this ability and thus do not exhibit color constancy. ", "It is therefore incumbent on the operator to ensure that an image is captured with good color balance, for example, white balance.", "\nIn shooting film, color balance is typically achieved by using color correction filters over lighting for the scene or over the camera lens. ", "Image data acquired by imaging photo-sensors must be transformed from the acquired values to new values that are appropriate for color reproduction or display. ", "Several aspects of the acquisition and display process make such color correction important, including the facts that the acquisition sensors do not match the sensors in the human eye; that the properties of the display medium must be accounted for; and that the ambient viewing conditions of the acquisition differ from the display viewing conditions.", "\nIn photography and image processing, color balance is sometimes thought of as the global adjustment of the intensities of the colors (typically red, green, and blue primary colors). ", "An important goal of this adjustment is to render specific colors, in particular neutral colors, correctly; hence, the general method is sometimes called gray balance, neutral balance, or white balance. ", "Color balance changes the overall mixture of colors in an image and is used for color correction. ", "An image that is not color balanced is said to have a color cast, or to exhibit color failure, as everything in the image appears to have been shifted towards one color or another. ", "Color balancing may be thought in terms of removing this color cast.", "\nAlgorithms and techniques used to attain color constancy are frequently used for color balancing. ", "Conceptually, color balancing consists of two steps: first, determining the illuminant under which an image was captured; and second, scaling the channels of the image to eliminate the color cast. ", "There is a large literature on how one might estimate the ambient illumination from the camera data and then use this information to transform the image data. ", "A variety of algorithms have been proposed such as Bayesian method, artificial neural network, or retinex. ", "An example of a Bayesian method is provided at G. Finlayson, P. M. Hubei and S. Hordley, “Color by correlation: a simple, unifying framework for color constancy”, IEEE Transactions on Pattern Analysis and Machine Intelligence 23, 1209-1221 (2001). ", "An example of artificial neural network is provided at B. Funt, V. Cardei and K. Barnard, “Learning color constancy”, in Proceedings of the Fourth IS&T/SID Color Imaging Conference, pp. ", "58-60, 1996. ", "An example of retinex is provided at E. H. Land and J. McCann, “Lightness and retinex theory”, J. Opt. ", "Soc. ", "Am. ", "61, 1-11 (1971).", "\nCurrently, the most common implementation of illuminant estimation in digital cameras is based on variations of Bayesian method by calculating ratios of the channels, for example, red/green or red/blue and estimating the illumination based on statistics of these ratios." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0006851448561064899, 0.0006425449973903596, 0.0006725828861817718, 0.0005895441281609237, 0.000586293579544872, 0.0005827539134770632, 0.0005688341916538775, 0.0005650699022226036, 0.0006001461297273636, 0.0006413353839889169, 0.0008325335220433772, 0.000583349377848208, 0.0005896455841138959, 0.0005918970564380288, 0.0005409092409536242, 0.0005792980082333088, 0.0005887583247385919, 0.0006051409291103482, 0.0006932915421202779, 0.0006655814941041172, 0.0007812372641637921, 0.0013431349070742726, 0.0006952688563615084, 0.0005747283576056361 ]

[ "Making his first start since the 2010 season, the 49-year-old left-hander surrendered five hits and four runs (three earned) in five innings Saturday evening against a light-hitting Astros lineup.", "\n\nMoyer’s control was fine — he walked just one and fanned two — but his slow-moving deliveries looked far too hittable at times and he was taken deep by both Jordan Schafer and J.D. Martinez.", "\n\nThe Rockies aren’t expecting the veteran southpaw to be anything more than an innings-eater this year, but it’s not a given that he’ll be able to meet those already-low expectations. ", "Then again, it’s way too early to say anything definitive. ", "How’s that for hard-hitting analysis?", "\n\nJon Heyman of FanRag Sports reports Thursday that the Orioles “are said to have begun fielding calls of interest” on superstar Manny Machado and “are close to the point of seriously weighing whether to trade him.”", "\n\nYou’d think it would be a no-brainer for the last-place O’s to flip Machado — an impending free agent — for prospects, but Heyman notes there is “still a question whether or not longtime Orioles owner Peter Angelos” will give the go-ahead. ", "One person familiar with the situation put it a “50-50” likelihood. ", "Another suggested that it would take a massive return, which, sure.", "\n\nMachado entered play Thursday with a sensational .328/.405/.635 batting line, 15 home runs, and an MLB-leading 43 RBI in 49 games. ", "It’d be a real shock if he’s still wearing an O’s uniform by the end of July.", "\n\nHeyman reported previously that at least nine teams made aggressive plays for Machado this winter, including the Cubs, Phillies, Dodgers, Indians, Diamondbacks, Yankees, Red Sox, White Sox, and Cardinals. ", "A whole lot of those teams still make sense here in late May — maybe all of them except the White Sox." ]

{ "pile_set_name": "Pile-CC" }

[ 0.008429489098489285, 0.0009141279733739793, 0.0019887753296643496, 0.0006226787809282541, 0.0005951315979473293, 0.0006869055214338005, 0.004385289736092091, 0.0006019578431732953, 0.0006650815485045314, 0.0011101685231551528, 0.0029441015794873238, 0.000701378914527595, 0.0005806396366097033 ]

[ "The gorgeous campus Charité\n\nThere is a spot amidst the city’s heart that measures 180.000 m2, has its own street map, its own transportation system and, as some say, its own governmental structures with councils, committees authorities. ", "Forming a little universe, the somewhat isolated Charité Campus Mitte has its own history and its own stories to tell.", "\n\nWithin a stone’s throw of Hauptbahnhof, Friedrichstraße and the government district lies Campus Mitte of Berlin’s university hospital Charité. ", "Forming a little universe, the somewhat isolated Charité has its own history and its own stories to tell. ", "Since the faculty is my alma mater, I roamed the historical campus to see what I may find.", "\n\nThe history of the Charité\n\nOn paper, the hospital has a glorious history: So far, the Charité spawned eight Nobel Prize laureates. ", "Countless internationally famed doctors worked here throughout its 300 yeas spanning history. ", "The roads on the spacious campus in the district of Mitte bear names of some of the most famous physicians that ever lived: all of them worked here. ", "The layers of dust are thick here: gold dust shimmering in the bright sun light.", "\n\nBut it all started when in 1710 the plague threatened Berlin and king Frederick I decided to build a special hospital outside of then city walls. ", "The plague never hit Berlin and so it was converted into a sick bay, later a public hospital for the training of military doctors. ", "It was Frederick I, too, who decided to name the facility “Charité”, charity.", "\n\nMore than a century later – the Charité had already developed into a university hospital – Rudolf Virchow established his famous cellular pathology, thus profoundly revolutionising medical practice worldwide, essentially paving the way for a modern, scientific medicine. ", "It was at this time around 1850 and for many decades to come, that the Charité united the most talented and visionary doctors and researches known to the continent. ", "What Oxford, Cambridge and MIT mean to science in general, was Charité for medical research. ", "The campus was no less than a huge think-tank: Many new medical specialities developed (pathology, psychiatry, anaesthesia, infectiology, graft surgery), others, such as vast parts of surgery, were set on scientific, modern standards.", "\n\nHowever, when Berlin’s fate changed, it also affected the Charité. ", "Throughout the centuries, the university hospital reflected every major political and social change; the Third Reich was no exception. ", "Race politics and eugenics formed a new professional consent and led to much suffering both for staff and patients. ", "The role of Charité physicians from most medical fields in the performing of many of the Nazi’s atrocities is undisputed.", "\n\nSoon, Berlin was divided. ", "The Mitte campus fell into East German property, bordering the Berlin Wall to Moabit. ", "The Charité was announced the leading hospital of the “capital of the GDR” and soon received a new building, which still dominates the skyline over Northern Mitte. ", "The “Bettenhochhaus” (bed high rise) with its twenty-one floors and connected sections still rises high above the campus. ", "After the Wall came down and when financial issues affected local politics, the Charité gradually merged with the former West-Berlin campi in Wedding and Steglitz.", "\n\nExploring the Charité campus today\n\nToday, the Charité and its own facility management company employ 15.000 people who are engaged in primary care for more than a million patients annually, extensive and world-class research and the education of 7.000 students enrolled in fifteen courses.", "\n\nStrolling around the Mitte campus, all this is still visible. ", "Most of the 19th century buildings are still intact and administered. ", "The roads bear the names of the famous physicians and researches who worked here and a multitude of monuments honours the feats accomplished there. ", "The air is suffused with an academic spirit that, on a bright and sunny day, resembles the mood evoked by cliché movies set on American campuses. ", "Picture every imagination of academic medicine you have and you will most certainly find it here. ", "Behind the facades of these historical and modern buildings works a machinery that surprises in its extent and that I wished to have caught in pictures. ", "As a matter of course I couldn’t disturb neither care, research nor education, though I can only wish to give an impression. ", "Time-honoured places, especially the institutes for anatomy and pathology along with their vast specimen collections still bear a lot of both dignity and awe.", "\n\nIf you find some time, take my advice and visit the medical-historical museum located in the northwesternmost corner of the grounds. ", "In any case, take an evening walk around the campus to capture the spirit of this isolated space amidst Berlin’s city centre.", "\n\nPosted by:Matthias\n\nBorn and raised in Berlin, Matthias' true love lies in this city. ", "It's a deep relationship: passionate about all the charming parts and in affectionate acceptance of what lies beyond the much lauded spots. ", "Whenever he's not strolling through Kreuzberg or Marzahn, he plunges into art, often writing about it at Castor & Pollux." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005896026268601418, 0.0007224183646030724, 0.0008473537745885551, 0.0009896481642499566, 0.0005223410553298891, 0.0006649816641584039, 0.0007676778477616608, 0.000612083647865802, 0.0007033983711153269, 0.0007618610397912562, 0.0022050689440220594, 0.0008390876464545727, 0.0008723874343559146, 0.0006027868366800249, 0.000632690847851336, 0.000648553716018796, 0.0009410707280039787, 0.0006540128379128873, 0.002600583015009761, 0.0016114609315991402, 0.0007015045848675072, 0.002654020907357335, 0.0012609835248440504, 0.0008423850522376597, 0.0009340125834569335, 0.0006540770409628749, 0.0007570570451207459, 0.0007393668056465685, 0.0005502084386534989, 0.0014596552355214953, 0.000745916273444891, 0.0005485338624566793, 0.0006479760049842298, 0.000534711463842541, 0.0006076733116060495, 0.0005544732557609677, 0.0006251661689020693, 0.0005971022765152156, 0.000663536018691957 ]

[ "(CNN) In late June, 11-year-old Alizay Kashif set up a lemonade stand in her family's neighborhood in Naperville, Illinois, a suburb on the western outskirts of Chicago.", "\n\nShe was selling refreshments to benefit Feeding America , a national network of food banks.", "\n\nBut after she took in nine bucks, a group of teenagers grabbed the money basket and drove off with it. ", "She was devastated.", "\n\nThat's when her father posted on the neighborhood social media platform Nextdoor, explaining how sad his daughter was and asking what he should do about the theft.", "\n\nNeighbors come to help\n\nRead More" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.000682738667819649, 0.0008950607152655721, 0.006649453658610582, 0.001408164156600833, 0.001058664871379733, 0.0006992388516664505 ]

[ "Amino acid transport systems modulate human tumor cell growth and invasion: a working hypothesis.", "\nInteractions between the extracellular matrix (ECM) and the neoplastic cells they envelop are thought to play a fundamental role in those cells' ability to invade, one of the key events in the metastatic cascade. ", "Cellular transport of amino acids, in turn, is known to be mediated by functionally distinct membrane transport systems and is modulated by substrate bioavailability in the microenvironment. ", "We postulate that certain advantages enjoyed by a neoplastic cell population over their normal counterparts (for example, increased proliferating capability and invasiveness across ECM barriers) are linked to changes in the cells' differential control of amino acid transport (aaT) via host ECM-tumor cell generated signals. ", "Our studies suggest that active transport of neutral amino acids modulates a cells' functional behavior among phenotypically distinct human transformed cell types, irrespective of whether they are categorized as a sarcoma, melanoma, or carcinoma. ", "We present preliminary laboratory evidence which has lead us to formulate a series of working hypotheses as follows: 1. ", "aaT systems operating in both non-transformed and transformed human cells exhibit differential transport kinetics; 2. ", "adaptive regulation of certain amino acids via cell-specific aaT systems alters a cell's ability to invade human ECM; and 3. ", "aaT induction involves changes both at the cellular and molecular levels. ", "This report, therefore, provides experimental support, and suggests a possible mechanism, to explain how neutral amino acids, acting as nutrient signalling factors (along with other biologic elements) within the cell milieu, have the capability of regulating the phenotypic nature of human neoplastic cells." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006715536583214998, 0.0005752315046265721, 0.0005861321114934981, 0.0006089449743740261, 0.0007827437366358936, 0.0006245747790671885, 0.000694461923558265, 0.0007005765801295638, 0.0006181552889756858, 0.0005975933745503426 ]

[ "2016_4_Takács\n\nIn the Pull of the West: Resistance, Concessions and Showing off from the Stalinist Practice in Hungarian culture after 19561\n\nRóbert Takács\n\nInstitute of Political History, Budapest\n\nThe article explores the representation of Western culture in Hungarian journalism, print media, and public life in the months following the 1956 revolution, when the party lost its strict control over Hungarian society and only gradually was able to reassert its dominance in all spheres of life. ", "Did representations of Western culture really constitute a kind of resistance, or should they perhaps be understood as concessions to prevalent public opinion? ", "Or did they in fact harmonize in some way with the actual intentions of the people who crafted cultural policy? ", "How did the content of newspapers begin to change in November 1956, clashing with the earlier “socialist cultural canon” by presenting formerly censured or anathematized Western cultural products and actors? ", "How was the supply of movies adjusted to public opinion and then slowly readjusted to correspond to former norms? ", "How did theater programs and plans for book publishing reflect the uncertainty of the period, resulting in the publication of works and performance of productions later criticized for bringing values to the stage that were contrary to the spirit of socialism? ", "In this paper, I analyze a provisional period in which earlier norms of journalism, print media, and cultural life were partially suspended and the party made little or no real attempts to reassert Stalinist norms. ", "Moreover, in this period the party did not deny or bring a stop to the de-Stalinization of cultural life, although it did repress open forms of cultural resistance to the Kádár-government.", "\n\nSoon a ‘new voice’ joined the buzz of the different languages. ", "Jazz music rang out, and the dance started. ", "First a black pair in white pullovers and britches started to follow the sound of the music with a miraculous sense of rhythm. ", "In a little while, other dancers joined them... People laughed when a black fellow invited a Soviet girl to dance boogie-woogie. ", "The Soviet girl, however hard she tried, could not follow her partner.2\n\nThis is how the daily Népszabadság reported the rest-day of the summer Olympic Games in Melbourne in 1956. ", "This coverage was the first in Hungary to mention the Western fashion frenzy, boogie (and rock and roll), in a positive way since 1948, only a few weeks after the violent suppression of the revolution. ", "But it harmonized well with the policy of peaceful coexistence of the Khrushchev regime. ", "This short report was also the first occasion when Népszabadság came out from behind the closed world of politics (strikes, declarations, condemnations of resistance) and slowly started to act like a newspaper again instead of a political fly-bill.", "\n\nThe report was printed at a moment when the Kádár government gave up its last efforts to try to find a compromise with the representatives of the workers and intellectuals and was about to finalize its resolution of December 4.3 The forums of publicity were narrow: only a few editorships were functioning, and the re-launch of any newspaper had to be allowed by the leading bodies of the Hungarian Socialist Workers’ Party.4 The book publishing industry was paralyzed, and cinemas and theaters were closed for weeks, and later only opened in the afternoon because of the curfew, which lasted until April of the following year.", "\n\nThere were spectacular and well-explored cases of open resistance, from the “not a single word to Kádár” strike led by journalists5 to the production of illegal newspapers and leaflets.6 Even the central organ of the party tried to protest against defining the relationship between party leadership and communist journalists in a pre-1953 way. ", "Others drew back into passive resistance and refused to publish. ", "The Hungarian Writers’ Association and the Association of Hungarian Journalists became important bases of resistance until the suspension of their autonomy, while their representatives also parleyed with the government.7\n\nAfter November 4, Hungarian intellectuals followed a variety of trajectories and adopted an array of attitudes towards the government. ", "Some left the country and continued to fight from abroad. ", "Some undertook open resistance, risking imprisonment or even the death penalty. ", "Others tried to cooperate with the new regime, hoping to preserve some of the achievements of 1956 and the de-Stalinization process, while many people decided to fall silent as a form of passive resistance. ", "There were also intellectuals who cooperated with Kádár, whether wholeheartedly or striving for position and influence, or convincing themselves they were more useful to the people in these positions than others would be.", "\n\nIn this article I explore a particular way of assuming distance from official ideological framings and expressing criticism: the reception of Western pop-culture in post-1956 Hungarian public life. ", "I examine Western pop-culture (i.e. what was characterized as “bourgeois” culture) in the Hungarian media and the debates to which it gave rise. ", "Did it really constitute a kind of resistance, or could it rather be understood as a series of concessions to public opinion? ", "Or did it actually help the regime achieve the goals of its cultural policy? ", "In fact, all of these interpretations are valid. ", "First, the references to Western culture in the early press of the Kádár era were intended to create distance from the cultural policy of Hungarian Stalinism, which Kádár’s propaganda tried to dismiss as hopelessly and unnecessarily orthodox and dictatorial. ", "However, the re-importation of images from Western popular culture into official socialist debates created new ways of developing criticism and critical attitudes towards Kádár’s cultural policy too. ", "I explore this double reception in thematic order by focusing on commercial culture, film, theater, literature, jazz, and art in two of the most important newspapers of the time: the party daily Népszabadság and the official youth magazine Magyar Ifjúság.", "\n\nWestern Commercial Culture in the Press\n\nNépszabadság sarcastically noted the shift that took place between November 1956 and February 1957: “Nobody was enthusiastic about the gray journals of the Rákosi regime, while—lo!—the new, democratic press is received with such huge interest. ", "Recently, they were burning newspapers on the streets, but now they keep queuing.", "”8 The author pointed out that the popularity of the youth weekly Magyar Ifjúság was not based on cultural value. (", "Magyar Ifjúság was allegedly so popular that it was sold on the streets in record time and after that one could get it only from under the counter, when buying an issue of the official party paper Népszabadság or the trade union paper Népakarat).", "\n\nWhat was the secret of Magyar Ifjúság? ", "The first issue of the paper was released on January 5 1957, at a time when there were still many youth organizations and the Hungarian Communist Youth League, which later came to own the paper, had not yet been founded. ", "On the front, children sleighing and Miss France were smiling at the reader. ", "A genre that had previously been rebuked as the quintessence of American trash culture returned. ", "The first comic strip in Magyar Ifjúság was a French translation (Misi and Döme Meet the Dragon), but in the second issue Hungarian characters appeared: The Adventures of the Dogs Blöki and Csöpi.9 This constituted a surprising concession, since even in 1954 official cultural policy labelled comics as a tool that had been used to teach violence and condition people for war: “These books contain depictions of murders, sadistic stories, terrifying adventures, cruelty and bloodcurdling horror, and they are illustrated”. ", "They were even associated with fascism: “Many of these adventures are based on one single supernatural hero, who—as fascists suggested—is the only one able to save the crowd from their troubled situation by using power.", "”10\n\nAmong the novelties of Magyar Ifjúság was a Tarzan serial, which was also banned after 1948 as inferior American mass culture. “", "Tarzan Wins” was published as a promotion of the newly launched Tarzan series of Kossuth Publishing House. ", "The first part, Tarzan of the Apes, had already been published in late 1956 by Budapest Press, and was continued by the party publishing house in 1957.11 Further Tarzan volumes only arrived in the mid-1960s. ", "The plans of Európa Publishing House for 1957 included the crime stories of Agatha Christie and Arthur Conan Doyle, and Európa planned to print open-end crime stories following Western patterns: “In other countries, separate clubs are organized to solve such books, so we can hope that this idea will be welcome here, too,” heralded the youth paper.12\n\nThe first issue also introduced Gina Lollobrigida and Luis Procuna, a Mexican actor-toreador. ", "With this, an avalanche of Western stars began.13 Over the course of the upcoming weeks, people were able to read about the cultic James Dean, the rock and roll icon Elvis Presley, actresses Elisabeth Taylor and Marylin Monroe (who in November 1964 could only be seen on the silver screen in The Misfits). ", "Népszabadság tried to catch up with this tempo: in early 1957, it portrayed Kim Novak besides Monroe and Taylor.", "\n\nThe January 5 issue of Magyar Ifjúság also launched a column on world fashion, and it included an interview with András Bágya, head of department of light music at Magyar Rádió, about jazz.14 Even stranger things happened: sexuality was seen as one of the opiates of the decadent West, but not reporting on it. “", "Wow, how pretty,” proclaimed the Christmas edition of Népszabadság in a caption above a picture of Miss France in a bikini. ", "The typist from Nice greeted the Hungarian readers from the back of a donkey.15Magyar Ifjúság also captured the attention of its readership with a beauty queen in issue one, and it continued with a portrait of actress Francoise Arnoul in a bikini and a handsome French in tabloid style.16 Allegedly “decadent” and “commercial” Western habits also penetrated the Hungarian environment: the weekly showed the winner of the beauty contest of the National Association of Hungarian Students.17 However, a month later the same newspaper condemned “bourgeois hypocrisy” for surrounding beauty contests with fame and glitter while the winner could be rejected as a teacher in FRG.18 A national beauty contest was not held again until 1985.", "\n\nKádár himself spoke highly critically of the work of Népszabadság on the session of the Budapest party activists on January 16 1957:\n\nBut it is inequitable for the central organ of the party to report murder cases with mighty letters on the front page and [spice up] the article, which is of theoretical importance, with a picture of a half-naked dancer, while they move the important declarations of the party and the government and the important manifestations of the international workers’ movement to different pages so that you can’t find the sequel.19\n\nWe can surely add the report from Paris to the “bourgeois tendencies.” ", "The report invited Hungarian readers to popular striptease bars like Foliés Bergére and Venus to offer accounts of “colourful” shows and dancers covered by fig-leaves. ", "However, for the sake of order, the report added that a French worker cannot afford such fun (“my friend, Beuval, earns this money [the price of 3 bottles of champagne] for a week’s worth of work at Renault”), and it made specific mention of homeless people lying under newspapers by the Seine River.20\n\nAt the end of January, the Provisional Executive Committee of Hungarian Socialist Workers’ Party (HSWP) discussed the work of Népszabadság and Magyar Ifjúság and concluded that, though their work was not flawless, they could be regarded as supportive of the government, unlike the Hungarian News Agency and Népakarat.21 It was not easy to achieve a balance: people who wanted to make a newspaper different from Stalinist times had to follow the expectations of the party and the audience at the same time, the majority of which would not bother listening to talk of any of the outstanding Soviet achievements, but rather thirsted for news and information about the West. ", "It seemed that interesting journals could only be edited with Western star-portraits, technical novelties, and a pinch of eroticism in the first months of 1957. ", "However, even after this, exprobatory path-seeking efforts were paved with some piquant circuits. ", "What else could have explained the fact that two months later the notion of the lascivious nightlife of the West was again “debunked” in a lengthy article. ", "The journalist (a protocol guest of the newly launched Budapest–Brussels flight) balanced his report on Boeuf sur le Toit club by visiting an anti-fascist place of memory, the fortress of Brendonk.22\n\nConcessions and Renewed Cultural Policy: Ideology Disappears\n\nKádár also accused the editors of Népszabadság of smuggling a characterization of the West as the “greater world” into the newspaper.23 Nevertheless, the government assumed that there were anti-Soviet emotions among the population, which is best illustrated by the films that were offered after November 1956. ", "Soviet films disappeared for months: they were cautiously reintroduced beginning in February 1957 by local movie companies. ", "Népszabadság printed the first cinema program on November 29, when cinemas were open between 11am and 4pm, according to the curfew. ", "The selection of films was based on the 169 films confirmed by the General Directorate for Films: 29 Hungarian, 33 from socialist countries, and the rest (107 films, i.e. 63% percent, well over half) were from Western countries. ", "Felszabadulás played Fan-Fan the Tulip, Csillag played The Red and the Black, Tinódi played the comedy Papa, Mama, My Woman and Me (presented for the French Film Days in 1956), and Toldi opted for The Thief of Bagdad. ", "The list of licensed Soviet films was compiled only in January “with the political caution justified by the political atmosphere.” ", "Salaries for employees in the movie theaters depended in part on the number of people who actually came to see the movies. ", "However, this factor was no longer taken into consideration in the case of Soviet films.24\n\nThe audiences for Western films, in contrast, were huge in 1957. ", "The share of the viewers of Soviet films fell back significantly, even compared to 1956, when this tendency had begun. ", "In 1957, every second cinema-goer opted for a Western film, while the number of Soviet films did not reach 10 percent of the total.", "\n\nHungarian\n\nSoviet\n\nSocialist\n\nOther\n\nMixed\n\n1956\n\n18\n\n19\n\n18\n\n42\n\n3\n\n1957\n\n22\n\n9\n\n13\n\n52\n\n4\n\nChart 1. ", "Distribution of Hungarian audience by the place of origin of films in 1957 (Source: Hungarian National Archives (MNL OL) – The report of the Executive Committee of the Metropolitan Council on the operation of cinemas)25\n\nAs the General Directorate for Films put it: “we strove to restore the tranquility of mind of the audience with films.” ", "In the name of tranquility, 40 films were presented from capitalist countries, along with 12 Hungarian and 63 socialist films. ", "The composition of the 98 films of the previous year was the following: 9 Hungarian, 59 socialist, and 31 Western. ", "In 1958, 33.3 percent and in 1959 28.4 percent of the film premiers were imported from the non-socialist countries, so opening to Western cultural products had begun earlier, actually as early as 1954. ", "In 1956/57, the proportion of the films from socialist countries dropped temporarily.26Magyar Ifjúság reported that the negotiations would begin with the Motion Picture Export Company in Paris at the end of January 1957.27 Moreover, the negotiations were successful, and three films were accepted in 1957.28 The first one was the most commercial: Trapeze, starring Gina Lollobrigida, Tony Curtis, and Burt Lancaster. ", "So Hollywood returned to Hungary a year after the fall of the revolution with a spectacular feature film.", "\n\nNagyvilág, the Hungarian journal for international literature, which had been founded on the model of the Soviet Inostrannaya Literatura, underwent a similar shift. ", "Its first issue was published in October 1956, and its programmatic editorial was written by György Lukács, who had been marginalized under the policy of Andrey Aleksandrovich Zhdanov known as Zhdanovism, according to which the government should exert strict control over cultural policy and foster extreme anti-Western bias. ", "The philosopher-aesthete emphasized that the seclusion after 1948 was the continuation of earlier Hungarian provincialism and was a consequence of weakness and uncertainty, both under Horthy and Rákosi: “Only one kind of struggle can be effective against provincialism: real, first-hand knowledge about the real state of the world, and the evaluation and of the present phenomena and streams of literature based on the autonomous procession and sophisticated arrangement of the seriously collected store of learning.", "”29 The journal was not abolished, but it was relaunched in the spring of 1957. ", "Of course, the editorial in the April issue was not written by Lukács, who was being held in Snagov as a member of the Imre Nagy group, but by László Kardos, the leader of the Department of World Literature at University of Budapest. ", "However, the program remained unaltered: “The literature that secludes itself from the inspirations, lessons, and experience of the brotherly beauty of contemporary world literature is threatened by the danger of withering, dehumanization, graying, and monotony. ", "Wide-open windows all around are a precondition of the real development of our national culture.", "”30\n\nAt the same time, the programs of the theaters were similar to those of the cinemas. ", "The spring program had already been decided before the revolution. ", "The new performances continued the de-Stalinization line. ", "Soviet plays were not performed. ", "Theaters were just as eager as cinemas to avoid sparking public protests. ", "In the spring of 1957, Népszabadság summarized the mentality of the months after the suppression of the revolution as the negative culmination of the process started in 1953: “slowly they ‘adjusted’ the ‘old, good, certain-success’ operettas, appealing classics, and in the best case new Hungarian slapstick comedies, which are evasive in content and low-grade in performance.” ", "After November, “the shudder from the messages (even progressive bourgeois messages!) ", "and the service of philistine illusions and lies” were palpable.31\n\nThe tendencies were similar in theaters and cinemas: Soviet plays disappeared, earlier Hungarian “blockbusters,” classical plays, and several Western light comedies appeared. ", "József Révai, the ideologist in charge of cultural affairs during the Rákosi era in his notorious March article attacked “ideological clarity” in theater life through a revival of the plays of Ferenc Molnár and Ferenc Herczeg.32\n\nWhat was playing in the theaters on that day? ", "In addition to three classical plays (Victor Hugo: Ruy Blas; G. B. Shaw: Mrs Warren’s Profession and You Can Never Tell), there were also two post-World War I Italian comedies: one by Dario Niccodemi and Pirandello’s unconventional Six Characters in Search of an Author. ", "The latter was premiered in 1957. ", "According to a critic writing for Nők Lapja, an illustrated weekly, the director highlighted Pirandello’s playfulness and subdued his philosophical turbidity.33 Four of the remaining five productions were operettas: three Hungarian plays (Nuptials of Ipafa; Legend of Tabán; Graf of Luxembourg) and one Austrian play (Benatzky: The King with the Umbrella). ", "The fifth was Olympia by Ferenc Molnár. ", "So the offer was restricted to comedies and light musical performances, complemented with two operas (Bánk bán, Don Juan). ", "László Németh’s Galilei and two social critical comedies (a contemporary French satire in crime-story form by Marc-Gilbert Sauvajon and a Yugoslav comedy by Branislav Nušić), which were first performed before the revolution, had been cancelled since January.", "\n\nAccording to a March 15 article in Élet és Irodalom demanding order in culture, the situation at the houses of culture was even worse:\n\nIn the Young Guard Cultural Home One Kiss and Nothing Else is played. ", "Danuvia Cultural Home plays the comedy by László Fodor. ", "The István Pataki House of Culture plays The Moonlight Groom. ", "MOM House of Culture plays Let’s Dance Mambo, the Zsigmond Móricz House of Culture plays Drum Duel and Rock and Roll, and the House of Culture of the Duna Shoe Factory played a comedy entitled Bubus by Gábor Vaszary.34\n\nIn the subsequent months the popular French playwright, Jean Anouilh, also known in Hungary between 1945 and 1948, returned to the stage with Eurydice and Rendezvousin Senlis, along with other entertaining plays, such as Dario Niccodemi’s Morning, Noon and Night, which the reviewer of Népszabadság found a “real Italian orange juice, does not bemuse, does not intoxicate, does not have strength or alcoholic content, but is bland and refreshing.", "”35\n\nIn the case of theaters, there was no such central body as for film import decisions: theaters as creative workshops composed their own yearly plans and submitted them to the Ministry of Culture. ", "Of course, they paid regard to proportions, and the necessity of including an appropriate number of contemporary Hungarian, Soviet, socialist, and classical plays in their programs. ", "These program plans were discussed by the leaders of the Ministry of Culture in the second half of 1957, and plays were accepted which later caused the biggest problems. ", "However, the conference emphasized that the number of Soviet and socialist plays should be raised and propagated more intensely (Vsevolod Vishnevsky’s Optimist Tragedy was the core drama in that year), and plans were also made to cut back the number of “products of low-level bourgeois literature.” ", "They also criticized theaters for trying to win over audiences by compromising principles: “theater directors in the capital have been fighting for a recent Western play for weeks.” ", "Nevertheless, after the revolution theaters could not help offering numerous foreign plays: most of the writers did not write, so there were not enough new contemporary Hungarian plays. ", "The theater with the worst proportion offered 11 premiers of which only 2 were Hungarian.36\n\nIn 1957, the inclusion of earlier discredited leftist authors was continued with Frederico Garcia Lorca. ", "In April, the National Theater in Budapest showed Blood Wedding, in the autumn the National Theater of Miskolc opted for The House of Bernarda Alba. ", "Several theaters included Of Mice and Men by Steinbeck and Before Sunset by Gerhart Hauptmann. ", "The Attila József Theater selected an Italian play by Gian Paolo Callegari (The Girls Who Burned out Early), which reflected on the so called Montesi-scandal. ", "Some other plays added to the Western socially critical pieces (The Little Foxes by Lilian Hellmann and The Diary of Anne Frank), while Naples Millionaire byEduardo di Filippo and a comedy by Victorien Sardou represented the lighter line.", "\n\nThe two problematic plays might have passed as critical plays by Western authors, one targeting the circumstances in capitalist society and the other slamming the American occupation of Japan. ", "As reviews make clear, the cultural watchdogs only attacked these plays after they had been brought to the stage. ", "The Egg by Félicien Marceau was heralded as a drama unveiling the lies of “bourgeois society,” in which one must sacrifice all moral values in order to prosper.37 However, cultural policy makers and critics soon realized that it represented Existentialism, which was only tolerated in very small doses after 1953.38 Later criticism tried to insist that the drama was harmful since it allegedly propagated nihilism and cynicism, and the way it typified “petty bourgeois points of views” as characteristic of all mankind and gave up hope for change was not acceptable.39As a critic writing for Népszabadság contended,\n\n[t]his writer’s approach does not know humanity, benignity, or moral sense, he does not believe in anything anymore. ", "Its ideal is the perspective of a wood louse, where nothing but instincts remain, you do not have to care for anything, you must not think... This is the denial of everything that is human, this is animal life, it reveals the last moments of a culture. ", "That is why this anti-human art is unacceptable to us, even if it draws a harsh picture of the gray petty bourgeois soul and offers several well-crafted characters. ", "It is unacceptable because it reflects the anarchist worldview against which we are fighting a hard, passionate, and enduring struggle.40\n\nTheater critic Ferenc Gy. ", "Simon directly blamed the actors and actresses for elevating such an equivocal play by doing an outstanding performance with great enthusiasm.41\n\nThe other play in the crossfire was an American one depicting life in occupied Japan after 1945 with a sense of irony. ", "Some theater experts thought it was appropriate,42 but partisan critics found The Teahouse of the August Moon too “back-slapping.” ", "Indeed, in their contention it is embodied the propagation of the American occupation: “the holder of the Pulitzer Prize and the voluntary PR-manager of the US Army makes very tricky propaganda about the humanitarian goodness of the occupying army of imperialism.", "”43\n\nBook publishing was similar in its practices and the shifts it underwent. ", "The medium-term plans of workshops were accepted by a central body. ", "One can observe the rise of commercial culture here, too, i.e. the influence of considerations of profitability and public demand. ", "However, the plans were compiled in a situation of unrest, and the Ministry of Culture could only discuss the quarterly plans of the publishing houses as of the second half of 1957.44 It was too late, however, to make significant changes. ", "The plans of Európa Kiadó, the publishing house with the profile of world literature, had 28 foreign operas for the third quarter of 1957: six Soviet, eight “socialist,” and fourteen “Western” works. ", "The five volumes of “contemporary” “people’s democratic” literature included Franz Kafka and Bertold Brecht. ", "However, the Ministry intervened in the first case. ", "Kafka only began to become acceptable to the cultural organs of the regime in the mid-1960s, as was signaled by a Kafka-study and the publication of one of his novels.45 The long-time “exiled” Brecht was permitted to return with the Threepenny novel, and in April The Good Person of Szechwan was staged in the József Katona Theater,46 followed by further Brecht plays in 1958. ", "Among the fourteen Western authors, six were contemporary. ", "The Hungarian audience may well have remembered Charles-Ferdinand Ramuz, W. Somerset Maugham, and Jean Cocteau from before 1948, while novels by the Indian Mulk Raj Anand had been published under Rákosi, too. ", "The first Hungarian translation by Alberto Moravia (The Roman Stories) was published in 1957, but the real sensation was the publication of the novel by Françoise Sagan. ", "Her first novel, Hello Sadness, was a strange composition even in the French cultural landscape at the time, so its Hungarian publication was really surprising, though Polish audiences had been able to read it since 1956. ", "Nevertheless, it had become common practice by then for publishers to bring out works from the West that were questionable according to the ideology of the regime, although these works were only available to small readership because of issues of circulation. ", "Sagan, who introduced her readers to the world of rebel teenagers, was usually labelled an existentialist, but her book was much better received than the two abovementioned plays. ", "Its novelty, strange honesty, and credible reportage could be emphasized, and this constituted an advantage. ", "It could be characterized as a presentation of “the whole disturbing and mysterious field, about which we only know the outbursts: from rock and roll to the matricides, patricides, and infanticides committed out of boredom”.47 However, the publication of Sagan was not the general rule, but rather the exception, a kind of peculiarity which was much desired by the intellectuals to satisfy rather than whet the appetite. ", "As László Kardos put it when writing about the treatment of the new phenomena of Western literature in earlier years, “curiosity slowly distorted into actual thirst, and thirst spelled illusions about value for the thirsty which were not proportional to the real values of Western literature.", "”48\n\nThe Return of Banned Genres\n\nOfficial cultural policy made its first timid steps toward the acceptance of jazz after Stalin’s death. ", "This tendency continued after 1956, although it did not lead to the support of “decent” jazz smoothly. ", "Jazz and other practically banned forms, genres, and products of Western culture were regarded as destructive and decadent. ", "As a consequence of the anti-jazz campaign, which began as early as 1946 in the Soviet Union, many jazz musicians were sent to labor camps. ", "Jazz was condemned as a tool of dehumanization, the very opposite of a form of art that was culturally valuable, and even a weapon of American imperialism, since it allegedly killed human feelings and thoughts therefore turned the individual into a cog-wheel of American war machinery. ", "In Hungary, popular jazz melodies did not entirely disappear. ", "Some of them were still played at bars. ", "A circular letter of the Union of Working Youth (Dolgozó Ifjúság Szövetsége, or DISZ) proves that even the communist youth organization had to make concessions to the interests of youngsters: some American songs (“In the Mood,” “Chattanooga Choo-Choo”) were even accepted in DISZ clubs.49\n\nThe shift in jazz policy in the Soviet bloc began in 1953. ", "Jazz was also included in radio programs, and more and more jazz hits were played in bars and clubs. ", "New ideological explanations were given: the roots of the genre allegedly were found in folk music, jazz was understood as the music of the American black population, so it was the music of the oppressed.50 Jazz of course remained part of the cultural palate after 1956. ", "The magazine Rádióújság recommended the music of the American Gerry Mulligan sextet for listeners who “had been denied the opportunity to form their own opinions,” and it criticized the earlier “narrow-minded” and “hard-shell” cultural policy.51 However, jazz had deeper roots—and larger audiences—in Poland and Czechoslovakia. ", "Jazz bands from these two countries took part in some of the biggest jazz concerts of 1957, too. ", "In July, Polish Hot Jazz performed in Budapest, followed by the Karel Vlach Orchestra from Prague in September and the American Hot Shots in January 1958.52\n\nWhen Népszabadság emphasized that Elisabeth Charles, the Scottish singer of Hot Jazz, was an extraordinary example of “true jazz singing without unnecessary writhing or false, external tools,” it targeted some spontaneous tendencies in Budapest bars. ", "A phenomenon that the Metropolitan Council had already detected between 1953 and 1955 began to return to the places of entertainment: “The bands, seeing the lack of orientation, thought everything is possible, and they can smuggle American songs into their shows without any restriction. ", "Moreover, they tried to score and perform the Hungarian songs in Western styles.", "”53 “Wildings,” as this performance style was called, also appeared after 1956, although cultural policy demanded an aesthetic jazz style without wild improvisation. ", "The embrace of official jazz was set back by the events of the international jazz festival in Budapest in the summer of 1958, when some of the groups and members of the audience did a “dervish St. Vitus’s dance’: “some of the youngsters in the hall forgot themselves, and forgot about their fellows, and they improvised a turbulent, wild fury under the rock and roll music,” lamented the party daily, rebuking both the participants and the organizers.54\n\nRock, or as it was often called beat, was only fostered by the Hungarian Young Communist League (Magyar Kommunista Ifjúsági Szövetség, KISZ) around 1964, after a comprehensive survey on youth pastimes. ", "From this point on, efforts were made to shepherd the “guitar bands” within the walls of KISZ clubs and houses of culture. ", "However, 1956/57 was still a time of reluctance, even in the West. ", "In addition to generational conflicts, this reluctance was nourished by the century-long opposition of highbrow and lowbrow culture,55 and also the averseness of European elites to Americanization.56 Nonetheless, in Western Europe Bill Haley’s and Elvis Presley’s music made its way through, while cultural mass production quickly exploited the new craze in the pursuit of its material interests. ", "Expresso Bongo, a 1958 musical by Wolf Mankowitz (which was also performed in Hungary in 1963), showed this process from a critical perspective, though it was in fact a successful part of the same music industry at the time.", "\n\nAt the level of official cultural policy, in the mid-1950s the typical attitude toward rock and roll music was rigid rejection, so it was rather surprising that rock and roll was mentioned in a relatively gentle, almost positive context after November 1956. ", "In January 1957, Hungarian journalists started to introduce the greatest Western stars to the Hungarian public, and they left behind the usual pejorative insinuations. ", "József Vető’s report from Vienna described the so-called “Halbstarke” (rock hooligans) almost as waggish music fans, who were called “jampec” in Hungary, which meant a kind of swaggering dandy. ", "Vető emphasized the irresistible ancient power of the music, a notion that would only return in the second half of the 1960s: “Even if I do think hard, I cannot remember a tune, one cannot memorize even a tune from this music, but one still feels saturated with it, and one feels that one must follow the astoundingly inflammatory rhythm.", "”57 He even wrote appreciatively of how the Austrian audience of the Bill Haley film Rock Around the Clock had stomped, clapped, whistled, and stood up to dance in the projection room. ", "After the film, he was not looking for broken shop windows, but rather noticed that “cheerfulness rings through the neighborhood around the cinema, hundreds, even thousands of people came out dancing in the streets.", "”58Magyar Ifjúság also described rock and roll as “thrilling” music in its portrait of Elvis Presley. ", "However, the article downgraded the music of the American idol. ", "The author was rather sympathetic with the enthusiastic youth, and he reminded members of the older generations that they had had their own craze, which also had been intolerable as far as their parents had been concerned.59 Moreover, the rhythms of Elvis also could be heard on the radio thanks to the journalist Kitty Havas, who did reports during the New York trip of the Hungarian UN-delegation and purchased some trendy records, among them Elvis and Harry Belafonte, to be broadcast over the Hungarian Radio in June.60\n\nIn addition to popular music, genres of the visual arts that had long disappeared from public spaces were also revived. ", "In the spring of 1957, the lovers of fine arts (some 71,000 people),61 could enjoy a peculiar experience. ", "After eight years, works of abstract art were displayed again in an exhibition called the Spring Salon. ", "Officially it was not organized by the ministry, and four juries of artists made selections from the materials that had been submitted. ", "One of the juries was assigned to assess abstract works by artists led by Dezső Korniss, who had been expelled from the university in 1948 and had worked with little hope of ever having any public exposure until 1956. ", "A separate room was arranged for abstract pieces, among them Miska, a painting by Korniss. ", "It depicted a Hungarian peasant constructed out of geometric shapes. ", "It was not a non-figurative painting in the narrow sense, much like those of Picasso, but the vision of the half and full oval and round plane figures was met with such aversion that Péter Rényi, deputy editor-in-chief at Népszabadság could quote disparaging remarks from the guest book: “If artistic freedom means Miska and co., then Révai was right.", "”62\n\nMost critics welcomed the initiative, but did not argue in favor of the equality of abstract or “naturalist” styles. ", "Rather, they espoused the idea also prevalent in other cultural spheres like literature and book publishing, according to which any denial of exposure to the public will only lead to overvaluation of undesirable tendencies.", "\n\nHowever, even those who were receptive to the exhibition and its aims could not help noticing that politics—and “socialist realism”—had almost disappeared. ", "Anna Oelmacher wrote on behalf of those criticizing the government from the left in Élet és Irodalom. ", "This group held the plethora of neutral topics and the absolute lack of political commitment as the greatest problem. ", "But from Oelmacher’s view, it was seen as anti-socialism, revisionism, and conscious resistance. “", "The Spring Salon is a manifestation of petty bourgeois revisionism in the fine arts. [", "It is an expression of] anarchist freedom that claims independence from the foundations and motion of society.", "”63\n\nShe also played the “national card,” underscoring that deniers of forced Sovietization were adopting foreign (Western) patterns: “But today people claim to be modern who operate with esoteric shapes. ", "And people who kept inciting against Soviet patterns, why have not they turned to our lively and still vibrant traditions, and why make our ‘most modern’ ones outworn Bauhaus art, French surrealism, Dutch constructivism, etc.?” ", "The author representing the platform of Révai jumped to general conclusions from the return of “withered streams”: the call for freedom in art is the denial of party control and socialist cultural policy. ", "In this debate, both sides often referred to the Hundred Flowers Campaign of Mao Zedong, launched in May 1956. ", "It could serve as an argument for openness; it was the idea behind the decisions of the four juries of the Spring Salon, which embraced the idea of separate salons for different streams. ", "And this was the formula used by the leftist equation of artistic freedom with libertinage, denial of party control as an outcry against resistance and revisionism. ", "In their metaphors, they referred to gardens instead of meadows of wildflowers: “Let it be ten or twenty salons, flowers would grow wild without a careful gardener.", "”64 Or as Károly Kiss, secretary of the Central Committee of the HSWP put it in the parliament: “Now they say we should let all flowers bloom and all birds sing, following the example of our Chinese comrades. ", "Our party agrees with the Chinese comrades that all nice, useful, and odorous flowers can bloom, except for poppy flowers. ", "And our party is supportive if all songbirds with a good voice sing, but harmony demands the silencing of ‘good-birds.", "’”65 Journalist and former minister of information Ernő Mihályfi, summarizing the debate in Élet és Irodalom, suggested that the policies that might be appropriate in Chinese environment were not applicable in post-(counter)revolutionary Hungary, because the Spring Salon had dredged up streams of thought and art that had already been transcended: “So it is not about deciding the future of newly emerging streams and styles, but tested and well-known old weeds had come to light.", "”66\n\nHowever, the standpoint of the government remained unclear for contemporary actors. ", "The hardline supporters of the government would have expected greater severity and ideological consistency. ", "However, the cultural policy of the post-1956 communist government directed by György Aczél opted for a more open cultural life and the continuation of the de-Stalinization policies in culture. ", "Paradoxically, the goal of this cultural opening up was to reestablish and strengthen the party’s authority and position in cultural life. ", "This complicated situation provided the background for the relaunch of the monthly literary journal Nagyvilág which mediated contemporary Western high culture, as well as for the successful negotiations with Hollywood and the approval of Spring Salon, the forum in which contemporary Western-influenced works of the fine arts were exhibited. ", "In this regard, even official cultural policy tried to represent itself as resistance to the former Stalinist practices. ", "Promoting the transfer of Western culture could be understood as a defense of the de-Stalinization process in culture.", "\n\nDecision makers on the intermediary levels (at editorial boards, theater offices, organizing committees etc.) ", "found themselves in a situation in which they could try to shape the cultural processes in Hungary. ", "Their contributions were inevitable in the selection, promotion, and publishing of works of Western arts and culture. ", "However, while on the one hand accepting one of these roles after November 1956 was tantamount to an acknowledgement of the Kádár government, on the other hand the people who were in these positions were able to work to ensure the survival of the de-Stalinization tendency and the preservation of some degree of openness. ", "This was important, since it was not clear at all whether or not the Kádár regime would (be able to) continue in this direction. ", "Many of them were against a re-Stalinization process in culture and resisted a supposed move away from the result of de-Stalinization. ", "In other words, they worked against attempts by the regime to slow the relatively still narrow process of cultural openness.", "\n\nIn this mix-up, earlier displaced and allegedly “transcended” contents returned, both from the “bourgeois past” of national culture and the “bourgeois present” of the West. ", "In this regard, Western culture, which was to some extent readmitted after 1953 and then not rejected by the Kádár government, could serve a different role from the place it had been given as a subservient form of culture in the controlled de-Stalinization process. ", "What was received from Western culture was far from being entirely “progressive.” ", "Re-opened channels of transfer created a situation in which some kinds of counterculture could be nourished. ", "This counterculture included ideological and artistic streams alien to Marxism, such as existentialism and abstract art, as well as the spread of popular mass culture.", "\n\n1 The study was written with the support of the National Research, Development and Innovation Office (NKFIH) (project no. ", "PD 109103) and the János Bolyai Fellowship of the Hungarian Academy of Sciences.", "\n\n3 The December 4 resolution of the Hungarian Socialist Workers’ Party was the first official document to define the factors behind the “counterrevolution.” ", "It named four responsible agents: 1. ", "the Rákosi–Gerő wing; 2. ", "Imre Nagy and his circle; 3. ", "the “reactionary forces” of the Horthy and capitalist regimes; 4. “", "international imperialism.”", "\n\n23 “What ‘greater world’ is something without the Soviet Union, without the socialist world? ", "That is the capitalist world, and don’t write ‘greater world’, but write news from the capitalist world. ", "After reading the paper, I have the feeling that Dulles is fighting heroic battles for the peace of mankind and only dark forces hinder him.” ", "Némethné Vágyi and Urbán, A Magyar Szocialista Munkáspárt ideiglenes vezető testületeinek jegyzőkönyvei II, 40.", "\n\n38 Jean-Paul Sartre was accepted in the Soviet bloc first on a political basis and only afterwards as artist, and hardly at all as an ideologue. ", "Sartre supported peaceful coexistence and visited Moscow in 1954. ", "In January 1956, his play Nekrassov, a satire of the anti-communist hysteria of the West, was also shown in the József Katona Theater. ", "György Kemény, “J. P. Sartre: Főbelövendők klubja,” Szabad Nép, February 15 1956. ", "However, the following reminiscence tells of the variety of responses: “June 27, 1956, József Katona Theater, Sartre: Nekrassov, the moment of the first act caused earthquake in the theater. ", "The swindler who climbed into the flat of the communist journalist through the window escaping from the police is trying to explain the weird situation: Violetta Ferrari is interestedly listening to Zoltán Várkonyi and gives cool-headed, clever, surprising and confusing answers. ", "And then the wizard-of-words swindler loses his temper and cries out: ‘You are a bitch!’ ", "In 1956, in Hungary a bad-egg phony calls the communist journalist a bitch. ", "Scandal! ", "After these words, the ceiling almost foundered in the downtown theater [...] Some people’s delicate palate was hurt by something rude having been said publicly, some were appalled by the fact that a communist journalist had been called a bitch... And many thought: at last somebody aired it...” Gábor Szigethy, “Vilcsi.”", "\n\n42 “And if we accepted this play as a witty comedy, we should be happy—and lately there have been such occasions more and more frequently—that we could get to know an interesting theater play from the West again.” ", "István Gábor, “Teaház az augusztusi Holdhoz,” Magyar Nemzet, October 26, 1957.", "\n\n55 Western European—mostly state-run—radios were also unwilling to play rock. ", "Change was enforced by pirate radios in the mid-1960s, while in socialist countries music programs of RFE and Luxembourg Radio had similar effects. ", "Brugge, “Swinging Sixties made in Czechoslovakia,” 143–55.", "\n\n56 Poiger, “Rock ’n’ Roll, Female Sexuality and the Cold War Battle over German Identities,” 579–83.", "\n\n61 According to the records of the host institution Műcsarnok. ", "Accessed: September 6, 2016, https://www.facebook.com/mucsarnokidogep/photos/a.603456473069603.1073741828.603442449737672/640994929315757/?type=1&theater." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0007139195222407579, 0.0006395067903213203, 0.0006740516982972622, 0.0006961387698538601, 0.0006563903298228979, 0.0006265977863222361, 0.0005818697973154485, 0.0009651263244450092, 0.0007323501049540937, 0.0007812574040144682, 0.0014715343713760376, 0.006502150557935238, 0.0006614808808080852, 0.0006709452718496323, 0.0006848370539955795, 0.00172290182672441, 0.0008126519969664514, 0.000675812887493521, 0.002782815136015415, 0.0008606299525126815, 0.008722104132175446, 0.004694067873060703, 0.0007054543239064515, 0.0007240293780341744, 0.0006362245767377317, 0.000575020385440439, 0.0006724233389832079, 0.0006420653662644327, 0.000645405612885952, 0.0024159899912774563, 0.000728982500731945, 0.0006627062684856355, 0.0008513055508956313, 0.004793619737029076, 0.0007130719604901969, 0.0009248291025869548, 0.001385311596095562, 0.0006364774890244007, 0.0009832297218963504, 0.0741305872797966, 0.002146342536434531, 0.0035078662913292646, 0.001433030585758388, 0.0006166570819914341, 0.0005958467372693121, 0.0005472468328662217, 0.0008436525822617114, 0.00063420704100281, 0.0015501347370445728, 0.0009928098879754543, 0.004929041024297476, 0.0005984383169561625, 0.0018500488949939609, 0.0006547477678395808, 0.0005855449708178639, 0.0007345711346715689, 0.0008694995194673538, 0.0007152337348088622, 0.0005948971374891698, 0.0010428980458527803, 0.0006275970372371376, 0.0018429679330438375, 0.0005678704474121332, 0.0005401549860835075, 0.0006079915910959244, 0.000639281002804637, 0.0006500373128801584, 0.0008716991287656128, 0.0005701202899217606, 0.0006825276068411767, 0.0007030888227745891, 0.0006104727508500218, 0.0006368897738866508, 0.0006977490847930312, 0.0006908047362230718, 0.0007359234150499105, 0.0006716403295286, 0.0005729784024879336, 0.000588545692153275, 0.001158422790467739, 0.0007965007098391652, 0.000643168343231082, 0.0006099185557104647, 0.0007656300440430641, 0.0009129255195148289, 0.00074164685793221, 0.0007394876447506249, 0.0009420364513061941, 0.0010802390752360225, 0.0008531188359484076, 0.0006320751854218543, 0.0006270419107750058, 0.0008046960574574769, 0.0007859632023610175, 0.000653595372568816, 0.0006787125603295863, 0.0010002399794757366, 0.0008073936332948506, 0.0006529730162583292, 0.001040393253788352, 0.0005711512640118599, 0.0006176796741783619, 0.0005493925418704748, 0.0005904582212679088, 0.0005933234933763742, 0.0007439073524437845, 0.001150723546743393, 0.0007142070098780096, 0.0008633791003376245, 0.0009628183324821293, 0.0007551781600341201, 0.000734596629627049, 0.0006111063994467258, 0.0010492102010175586, 0.003485213965177536, 0.0011283863568678498, 0.0007662898860871792, 0.0009103097254410386, 0.0008791252039372921, 0.0007501627551391721, 0.0006131510017439723, 0.0005452563636936247, 0.0005422976682893932, 0.0005593840032815933, 0.0006012485246174037, 0.0008309951517730951, 0.0005616535199806094, 0.0008234952110797167, 0.0006515491404570639, 0.0006145284860394895, 0.0005903929704800248, 0.0005673830164596438, 0.000635128584690392, 0.0009820637060329318, 0.0005884587299078703, 0.0006706134299747646, 0.0006073530530557036, 0.0009339689859189093, 0.0006038978463038802, 0.014206363819539547, 0.0006099275196902454, 0.00304399779997766, 0.0005876774084754288, 0.0008513246430084109, 0.0008818880305625498, 0.0006735884235240519, 0.0012611295096576214, 0.0007314765243791044, 0.0005641456227749586, 0.0006308844313025475, 0.0006243078969419003, 0.0008106452878564596, 0.0006655088509432971, 0.0008171125082299113, 0.0007406365475617349, 0.0005742082139477134, 0.0008117626421153545, 0.000639026053249836, 0.0005591209628619254, 0.0011273242998868227, 0.0017301382031291723, 0.0006003864691592753, 0.0006237063207663596, 0.0006416524411179125, 0.0008646250935271382, 0.0006266972050070763, 0.0005992699298076332, 0.0005480990512296557, 0.0006099984748288989, 0.0006705572013743222, 0.0006861965521238744, 0.0005801959196105599, 0.0006239140639081597, 0.000706307590007782, 0.0006037128623574972, 0.0006284083938226104, 0.0007844466017559171, 0.0011548333568498492, 0.0007504323148168623, 0.0009296183125115931, 0.0007946262485347688, 0.0008813911117613316, 0.0009409604826942086, 0.0012469455832615495, 0.0008933655917644501, 0.0005550856585614383, 0.000603152671828866, 0.0016312111401930451, 0.0006987482192926109, 0.0008281287737190723, 0.0006259537185542285, 0.0006519265007227659, 0.0006437687552534044, 0.0005708223325200379, 0.0005817320197820663, 0.0007523444946855307, 0.0007951311417855322, 0.0006386214517988265, 0.0008039012900553644, 0.0007007061503827572, 0.0005345015088096261, 0.0006363795255310833, 0.0005845822161063552, 0.0005729112890549004, 0.0005754052544943988, 0.0008461583638563752, 0.000670696550514549, 0.0007360875606536865, 0.0006116034346632659, 0.0007680546841584146, 0.0007612166809849441, 0.000873439246788621, 0.0005702643538825214, 0.0006299497908912599, 0.0007211217889562249, 0.0006963656633161008, 0.0008411838207393885, 0.0009768179152160883, 0.0016693335492163897, 0.03974252566695213, 0.0011291276896372437, 0.0014635802945122123, 0.0008925206493586302, 0.010098272934556007, 0.0007602550904266536, 0.0005817962810397148, 0.0008152269874699414, 0.0008890379103831947, 0.0005817538476549089, 0.009238121099770069, 0.9791720509529114, 0.8825472593307495, 0.08546701818704605, 0.45416462421417236, 0.0005736453458666801, 0.0022185344714671373, 0.0014157297555357218, 0.0007058802875690162, 0.000826799136120826, 0.03945554792881012, 0.0006385143497027457, 0.0007384773925878108 ]

[ "Q:\n\nWhy numpy.histogram try to get value with index -9223372036854775808 (min number of int64)?", "\n\nMy task is count histogram for different arrays of numbers (I don't know in advance). ", "And I have troubles with array of same double number, for example:\ndouble_numbers = np.array([1e20] * 20)\nnp.histogram(double_numbers, bins=100)\n\nI get an error:\nIndexError Traceback (most recent call last)\n<ipython-input-37-51958daa5f2c> in <module>()\n 1 double_numbers = np.array([1e20] * 20)\n----> 2 np.histogram(double_numbers, bins=100)\n\n/home/oleksandr/.pyenv/versions/2.7.8/envs/dr2.7.8/lib/python2.7/site-packages/numpy/lib/function_base.pyc in histogram(***failed resolving arguments***)\n 795 # The index computation is not guaranteed to give exactly\n 796 # consistent results within ~1 ULP of the bin edges.", "\n--> 797 decrement = tmp_a_data < bin_edges[indices]\n 798 indices[decrement] -= 1\n 799 # The last bin includes the right edge. ", "The other bins do not.", "\n\nIndexError: index -9223372036854775808 is out of bounds for axis 1 with size 101\n\nWhy numpy.histogram try to get value with index -9223372036854775808 (min number of int64)? ", "Is there a bug of numpy?", "\n\nA:\n\nThis is a known bug https://github.com/numpy/numpy/issues/8627, exists already about 2 years\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0010268213227391243, 0.0006560694891959429, 0.0009128241799771786, 0.0008350942516699433, 0.0012263288954272866, 0.00092910515377298, 0.005019542295485735, 0.0009244265384040773 ]

[ "Q:\n\n.htaccess не работает\n\n.htaccess напрочь игнорируется апачем. ", "Почитал гугл, прописал AllowOverride All в /etc/apache2/sites-available-default - получил 500 ошибку. ", "Почитал гугл, прописал\nsudo a2enmod rewrite\n\nи, в общем, ничего. ", "Та же 500 ошибка, гугл больше ничего не знает.", "\n\nA:\n\nВсё, разобрался. ", "Нужно utf8 без BOM для файла .htaccess.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.013644233345985413, 0.0010910641867667437, 0.0025013466365635395, 0.0012118869926780462, 0.001223252504132688, 0.012859516777098179, 0.001994825666770339 ]

[ "Approach to en bloc resection and reconstruction of primary masticator space malignancies.", "\nThe aim of this study was to present our experience with management of malignant lesions arising within the masticator space, and to describe a technique of en bloc resection and reconstruction. ", "Case series and case report. ", "Eight cases of masticator space malignancies treated surgically with en bloc resection and free flap reconstruction were retrospectively reviewed. ", "Tumor extirpation was carried out through a parotidectomy approach with mobilization and protection of the facial nerve. ", "Primary reconstruction was accomplished with vascularized bone containing free flaps, fibula (n = 4), scapula (n = 2), and scapula with latissimus dorsi muscle (n = 2). ", "Mean follow-up was 62.5 months (range, 18-132 months). ", "En bloc resection of masticator space malignancies can be consistently accomplished through an extended parotidectomy approach. ", "The defect is best reconstructed with a vascularized bone and soft tissue free flap. ", "Favorable functional and aesthetic outcomes can be successfully achieved using the techniques described in this series. ", "4." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.03943445533514023, 0.0007902759243734181, 0.0006104244384914637, 0.0010674160439521074, 0.0013474328443408012, 0.001770711038261652, 0.0005658603040501475, 0.0057671209797263145, 0.0008787077385932207, 0.000528313685208559, 0.0012898282147943974 ]

[ "fileFormatVersion: 2\nguid: bdb971f731803a343a50d19dd561c3bf\nTextureImporter:\n internalIDToNameTable:\n - first:\n 213: 21300000\n second: oil1_0\n - first:\n 213: 21300002\n second: oil1_1\n - first:\n 213: 21300004\n second: oil1_2\n - first:\n 213: 21300006\n second: oil1_3\n externalObjects: {}\n serializedVersion: 10\n mipmaps:\n mipMapMode: 0\n enableMipMap: 0\n sRGBTexture: 1\n linearTexture: 0\n fadeOut: 0\n borderMipMap: 0\n mipMapsPreserveCoverage: 0\n alphaTestReferenceValue: 0.5\n mipMapFadeDistanceStart: 1\n mipMapFadeDistanceEnd: 3\n bumpmap:\n convertToNormalMap: 0\n externalNormalMap: 0\n heightScale: 0.25\n normalMapFilter: 0\n isReadable: 1\n streamingMipmaps: 0\n streamingMipmapsPriority: 0\n grayScaleToAlpha: 0\n generateCubemap: 6\n cubemapConvolution: 0\n seamlessCubemap: 0\n textureFormat: 1\n maxTextureSize: 2048\n textureSettings:\n serializedVersion: 2\n filterMode: 0\n aniso: -1\n mipBias: -100\n wrapU: 1\n wrapV: 1\n wrapW: 1\n nPOTScale: 0\n lightmap: 0\n compressionQuality: 50\n spriteMode: 2\n spriteExtrude: 1\n spriteMeshType: 0\n alignment: 0\n spritePivot: {x: 0.5, y: 0.5}\n spritePixelsToUnits: 32\n spriteBorder: {x: 0, y: 0, z: 0, w: 0}\n spriteGenerateFallbackPhysicsShape: 1\n alphaUsage: 1\n alphaIsTransparency: 1\n spriteTessellationDetail: -1\n textureType: 8\n textureShape: 1\n singleChannelComponent: 0\n maxTextureSizeSet: 0\n compressionQualitySet: 0\n textureFormatSet: 0\n platformSettings:\n - serializedVersion: 3\n buildTarget: DefaultTexturePlatform\n maxTextureSize: 2048\n resizeAlgorithm: 0\n textureFormat: 4\n textureCompression: 1\n compressionQuality: 50\n crunchedCompression: 0\n allowsAlphaSplitting: 0\n overridden: 0\n androidETC2FallbackOverride: 0\n forceMaximumCompressionQuality_BC6H_BC7: 1\n - serializedVersion: 3\n buildTarget: Standalone\n maxTextureSize: 2048\n resizeAlgorithm: 0\n textureFormat: 4\n textureCompression: 1\n compressionQuality: 50\n crunchedCompression: 0\n allowsAlphaSplitting: 0\n overridden: 0\n androidETC2FallbackOverride: 0\n forceMaximumCompressionQuality_BC6H_BC7: 1\n spriteSheet:\n serializedVersion: 2\n sprites:\n - serializedVersion: 2\n name: oil1_0\n rect:\n serializedVersion: 2\n x: 0\n y: 0\n width: 32\n height: 32\n alignment: 0\n pivot: {x: 0, y: 0}\n border: {x: 0, y: 0, z: 0, w: 0}\n outline: []\n physicsShape: []\n tessellationDetail: 0\n bones: []\n spriteID: b16489681e753a24ab39d1f4a26cd82a\n internalID: 21300000\n vertices: []\n indices: \n edges: []\n weights: []\n - serializedVersion: 2\n name: oil1_1\n rect:\n serializedVersion: 2\n x: 32\n y: 0\n width: 32\n height: 32\n alignment: 0\n pivot: {x: 0, y: 0}\n border: {x: 0, y: 0, z: 0, w: 0}\n outline: []\n physicsShape: []\n tessellationDetail: 0\n bones: []\n spriteID: b16489681e753a24ab39d1f4a26cd82a\n internalID: 21300002\n vertices: []\n indices: \n edges: []\n weights: []\n - serializedVersion: 2\n name: oil1_2\n rect:\n serializedVersion: 2\n x: 64\n y: 0\n width: 32\n height: 32\n alignment: 0\n pivot: {x: 0, y: 0}\n border: {x: 0, y: 0, z: 0, w: 0}\n outline: []\n physicsShape: []\n tessellationDetail: 0\n bones: []\n spriteID: b16489681e753a24ab39d1f4a26cd82a\n internalID: 21300004\n vertices: []\n indices: \n edges: []\n weights: []\n - serializedVersion: 2\n name: oil1_3\n rect:\n serializedVersion: 2\n x: 96\n y: 0\n width: 32\n height: 32\n alignment: 0\n pivot: {x: 0, y: 0}\n border: {x: 0, y: 0, z: 0, w: 0}\n outline: []\n physicsShape: []\n tessellationDetail: 0\n bones: []\n spriteID: b16489681e753a24ab39d1f4a26cd82a\n internalID: 21300006\n vertices: []\n indices: \n edges: []\n weights: []\n outline: []\n physicsShape: []\n bones: []\n spriteID: 280b93732caf29f42b334a277f625760\n internalID: 0\n vertices: []\n indices: \n edges: []\n weights: []\n secondaryTextures: []\n spritePackingTag: \n pSDRemoveMatte: 0\n pSDShowRemoveMatteOption: 0\n userData: \n assetBundleName: \n assetBundleVariant: \n" ]

{ "pile_set_name": "Github" }

[ 0.012031279504299164 ]

[ "By Kody Fairfield\n\nAccording to a report out of the The Business Standard News (BizStandard), quoting from an his interview with The Conservative Chronicle, former presidential candidate Pat Buchanan, is feeling nostalgic about the 1950’s America where, as he puts it, different races “knew their place.”", "\n\n“Back in the ‘50s everyone knew their place, whites over here, blacks over here, Mexicans over here and the women were at home raising the kids,” said Buchanan. “", "Things functioned better when everyone understood where they needed to be.” (", "UPDATE: The above quote is from a satire piece, however the following quotes are factual and sourced in their hyperlinks.)", "\n\nThis is not the first time that Buchanan has made controversial remarks, or even the first time he has looked back fondly on times of racial segregation and discord.", "\n\nIn 1983, Buchanan wrote in a column and spoke to his view point of women stating, “Women are simply not endowed by nature with the same measures of single-minded ambition and the will to succeed in the fiercely competitive world of Western capitalism, women deserve an equal chance at the starting line. ", "But, for women, there is an honorable and honored exit from the rat race – home, hearth and family.”", "\n\nIn regards to fondness for racial divide, beyond his latest comments, he has said this on National Public Radio (NPR),\n\nRACHEL MARTIN (HOST): A decade ago, you wrote in your book, State of Emergency, on the issue of immigration, speaking of the world changing and America changing, you wrote that “if we do not get control of our borders, by 2050, Americans of European descent will be a minority in the nation their ancestors created and built.” ", "Do you still stand by that statement? ", "And do you think ideas like that resonate? ", "PAT BUCHANAN: I would amend it. ", "That period will be reached in 2042, now, or 2041. ", "So we’re about 25 years away from the fact where Americans of European descent will be a minority in the United States. ", "MARTIN: Why do you see that as a problem? ", "BUCHANAN: Well, because I look at Europe and I look all over the world, and I see peoples everywhere at each others’ throats over issues of ethnicity and identity. ", "Again, the United States of America — we had an enormous success, we had high immigration from 1890 to 1920. ", "Then we had a timeout where all those folks from eastern and southern Europe were assimilated and Americanized. ", "They learned English. ", "I went to school with the sons and daughters of these folks, and we created a really united country where 97 percent of us spoke English in 1960. ", "Now, in half the homes in California, people speak a language other than English in their own homes. ", "Anybody that believes that a country can be maintained that has no ethnic core to it or no linguistic core to it, I believe is naive in the extreme. ", "MARTIN: But you understand how that language feels very incendiary to many people? ", "BUCHANAN: I don’t care how that language sits with people. ", "My job is not to make people happy, it’s to tell the truth as I see it. ", "MARTIN: Explain to me what having a diverse cultural identity and a diversity of languages, how that undermines the American identity. ", "I think it’s important to try to understand why you think that this is such a threat. ", "BUCHANAN: Well first, it seems that the American people tend to agree with us, does it not? ", "MARTIN: But, what you are laying out is an America that is white, or if not exclusively white. ", "BUCHANAN: It’s an America like the country I — It’s an America like the country I grew up in, which was a pretty good country. ", "MARTIN: So how do you make that case in 2016? ", "BUCHANAN: Well, first off, the voters, apparently, in the Republican Party, have voted pretty conclusively for Donald Trump. ", "And we’re going to find out in the fall whether he has won it with the nation. ", "Because, I think Hillary Clinton will raise the issue that she disagrees with him sharply on this.", "\n\nIt appears that some of the Republican Presidential nominee Donald Trump’s supporters see the campaign slogan of “Make America Great Again,” as a reference to the sentiments sent forth by Buchanan’s words.", "\n\nOn CBS’s Face The Nation, a Nevada voter and supporter of Trump said that she wanted to the country to return to a past era of “moral values.”", "\n\n“I think that the laws that Obama has passed, the way the country has — I call it down turning. ", "Some of the other people are proud of it and happy for it. ", "I personally am against it, the homosexuals, the abortions. ", "All the stuff, I am against,” she said." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006478118011727929, 0.03785043954849243, 0.0005209469236433506, 0.0005650222301483154, 0.0011208582436665893, 0.0011661502066999674, 0.044033441692590714, 0.0007996506756171584, 0.0010110152652487159, 0.0006559972534887493, 0.000629992748145014, 0.0006010497454553843, 0.0015616919845342636, 0.0008896657964214683, 0.0005841052043251693, 0.0005773442680947483, 0.0009864893509075046, 0.0007211132324300706, 0.0008090849150903523, 0.0007130674785003066, 0.0006598604377359152, 0.0006712775211781263, 0.055687256157398224, 0.0012715649791061878, 0.0007288973429240286, 0.001665943069383502, 0.0005934524233452976, 0.008010277524590492, 0.0006679017678834498, 0.0006461302982643247, 0.0006582042551599443, 0.0041696857661008835, 0.0005950952763669193, 0.0006356333033181727, 0.001017074566334486, 0.0007458108011633158, 0.0005563178565353155, 0.24097201228141785, 0.0009586138185113668 ]