Datasets:

tomekkorbak

/

detoxify-pile-chunk3-500000-550000

like 0

[ "Q:\n\nEnergy Stored In A Capacitor (Slowly Moving Parallel Plates Together)\n\nI think this is a canonical problem with capacitors, but I'm having difficulty understanding the paradox. ", " In Purcell's Electricity And Magnetism, problem 3.16 reads:\n\nCalculate the electrical force which acts on one plate of a\n parallel-plate capacitor. ", " The potential difference between the plates\n is 10 statvolts, and the plates are squares 20 cm on a side with a\n separation of 3 cm. ", " If the plates are insulated so the charge cannot\n change, how much external work could be done by letting the plates\n come together? ", " Does this equal the energy that was initially stored\n in the electric field?", "\n\nI ignored what the original question was asking, and tried calculating the energy stored in the capacitor by letting the distance between the plates slowly decrease to zero and finding the energy released. ", " To do this, the electric field between the plates in SI units is $E=\\frac{\\sigma}{\\epsilon_0}$. The electric potential between the plates is $\\phi=Ed=\\frac{\\sigma}{\\epsilon_0}d$, where d is the distance between the plates. ", " Therefore, the energy released by allowing the distance between the plates to slowly decrease to zero is $U=\\phi Q$, where $Q=\\sigma A$ is the charge on the plate of area $A$. ", " Altogether, we get \n$$U=\\frac{1}{\\epsilon_o}\\sigma^2 A \\, d.$$\nThe result of this calculation is twice as large as the energy stored in the capacitor by summing up differential amounts of charge being displaced from one conductor of the capacitor to the other. ", " This second calculation is usually done as follows:\n$$ U=\\int_0^Q\\phi\\,dq=\\int_0^Q\\frac{q}{C}\\,dq=\\frac{1}{2C}Q^2.", "\n$$\nFor a parallel-plate capacitor, $Q=\\sigma A$ and $C=\\frac{Q}{\\phi}=\\sigma A\\,E\\,d=\\sigma A\\frac{\\epsilon_0}{\\sigma d}=\\frac{A \\epsilon_0}{d}$. Substituting into the above, we get:\n$$ U=\\frac{1}{2C}Q^2=\\frac{1}{2\\epsilon_0}\\sigma^2 A \\, d $$\nI'm not sure why the two results contradict each other. ", " Other websites such as this one as well as a post on stack-exchange here seem to indicate that in similar scenarios the energy is dissipated in the form of electromagnetic radiation. ", " However, in the above example, all of the charges can be moved slowly, meaning that the current can be made infinitesimally small. ", " Wouldn't this negate the explanation using radiation? ", " If not, where is the radiation being produced, and can the energy supplied to it be quantified?", "\nAlfred Centauri's answer below points out the mistake that I made in not discounting the electric field of the moving plate when calculating the force on the plate. ", " As mentioned in some of the comments, a related post here addresses the same system of a parallel plate capacitor with variable separation distance between the plates, but does not mention that only the electric field from the second plate should be used when calculating the energy released by the system. ", " After reading Centauri's answer, I realized that Purcell derives a formula for the electric field exerted on a layer of charge on page 30 of his book. ", " Although that layer of charge is part of a spherical charge distribution rather than that of a parallel plate capacitor, he still reaches a similar conclusion to that of Alfred Centauri. ", " Namely, he finds that the electric field which acts on the layer of charge is the average value of the fields (total electric field) both inside and outside of the layer of charge. ", " In this case, it ends up being one half of the magnitude of the field inside of the capacitor, since there is no electric field outside of the capacitor. ", " This was also not mentioned in the other post.", "\n\nA:\n\nTherefore, the energy released by allowing the distance between the\n plates to slowly decrease to zero is U=ϕQ\n\nThis isn't correct. ", " While it is true that the electric field magnitude between the plates is $E = \\frac{\\sigma}{\\epsilon_0}$, this is the sum of the two electric fields from both plates.", "\nBut the force on the charge on one plate is due to the electric field of the other plate only\n$$F_Q = Q\\frac{\\sigma}{2\\epsilon_0} = \\frac{A\\sigma^2}{2\\epsilon_0}$$\nthus, the work associated with slowly moving the Q plate to the -Q plate is\n$$W = -F_Q d = -\\frac{A\\sigma^2}{2\\epsilon_0}d$$\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006146491505205631, 0.0007498104241676629, 0.0006441400619223714, 0.0006648277048952878, 0.0007544904365204275, 0.0006783724529668689, 0.0008394738542847335, 0.0011679772287607193, 0.0013211369514465332, 0.02221810258924961, 0.004567197524011135, 0.0005911274929530919, 0.0006339562823995948, 0.0009648519335314631, 0.0006199816707521677, 0.000647827226202935, 0.0005594751564785838, 0.0006562220514751971, 0.0007090602302923799, 0.0007800128660164773, 0.0008702417835593224, 0.0006138497847132385, 0.0007480618660338223, 0.0008170311921276152, 0.004744672682136297 ]

[ "Alexandra House is a holistic health spa in Huddersfield, close to the Leeds-Manchester M62 corridor, where we offer luxurious beauty spa treatments and pampering, including the wonderful Eve Taylor aromatherapy facials, hot stone back...\n\nThis venue offers discounts on off-peak appointments and last minute bookings.", "\n\nHuddersfield, West Yorkshire, UKShow Map\n\n83 reviews\n\nAt Bea Beautiful you will find a perfect environment that is calming and relaxing atmosphere with a friendly professional team, allowing you to have time for yourself to truly relax. ", "As a therapist working from holistic and a spa...\n\nIndulge yourself, relax and unwind as we attend to your individual needs..... Estetica is committed to providing the very best in anti-ageing, beauty and holistic treatments. ", "Situated in Elland, the salon provides easy access from...\n\nMedusa Holistics offers a range of holistic therapies and natural treatments based at a Huddersfield clinic. ", "All of the products used are hand-blended by Sarah (Holistic Therapist), mostly in front of you, to tailor your personal needs...\n\nCrystal Spa is an idyllic sanctuary where you can leave your hectic world outside - a place to relax, rejuvenate and rebalance your mind, body and soul. ", "With calming facilities and an extensive choice of relaxing treatments all based..." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006922948523424566, 0.0005520441336557269, 0.0008784314850345254, 0.0006194019806571305, 0.01802084594964981, 0.0005893057095818222 ]

[ "Screening for glucose-6-phosphate dehydrogenase deficiency can prevent severe neonatal jaundice.", "\nInfants with the severe variant of glucose-6-phosphate dehydrogenase (G6PD) deficiency may develop hyperbilirubinaemia sufficiently severe to cause kernicterus and death, acute haemolysis on exposure to oxidant stress, congenital non-spherocytic haemolytic anaemia and, rarely, increased susceptibility to bacterial infection. ", "In spite of these potential problems, G6PD deficiency is often not included among screening programmes for inherited disorders. ", "In a comprehensive screening and educational programme, we tested around 34,000 infants for G6PD deficiency. ", "Of the total group, 18.4% (24.5% boys and 11.8% girls) were deficient. ", "Forty-two of the 6246 (0.67%) G6PD-deficient infants required exchange transfusion. ", "None of them developed kernicterus. ", "By contrast, of 4755 infants who had not been screened because they were born at home, three developed kernicterus. ", "In addition, four G6PD-deficient infants had developed kernicterus in the 20-month period prior to the screening programme. ", "None of the hyperbilirubinaemic infants had blood group incompatibility or any other identifiable cause of hyperbilirubinaemia. ", "To avoid this disastrous result, we believe that neonatal screening for G6PD deficiency, together with a comprehensive education programme, is advisable in those parts of the world where the severe variant of G6PD deficiency is prevalent." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.010303543880581856, 0.0014034489868208766, 0.0007625994039699435, 0.0011698361486196518, 0.05356311798095703, 0.0027612231206148863, 0.0014332120772451162, 0.0010928503470495343, 0.003520685713738203, 0.003324628109112382, 0.0012381018605083227 ]

[ "Q:\n\nSAS Time format precision: milliseconds\n\nI have a field in my SAS dataset that contains the number of seconds since midnight. ", "For example:\n34204.050479\n\nI can convert this number in SAS using the format time10. ", "which gives me the following:\n9:30:04\n\nI wish to have greater precision than simply hours,minutes, and seconds. ", "Can I get the following in SAS:\n9:30:04:ms\n\nwhere ms stands for milliseconds? ", "\n\nA:\n\nThanks to Dirk Nachbar, the answer is to format time as time12.3\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007306021871045232, 0.0006045970367267728, 0.0006114755524322391, 0.0030903033912181854, 0.0006383515428751707 ]

[ "Making an alert() with PHP and ajax\n\nI have an ajax function that submits some data to my PHP file. ", "In my PHP file I have some checks that it does with that data, I then try to make an alert to come up to say something. ", "I can't get any alerts to come up though. ", "All that happens is in the console->network->submit.php->response shows the javascript that should make the alert.", "\n\nFirst you need to get your timestamps in to Date() objects, which is simple using the constructor. ", "Then you can use the below function to calculate the difference in days: var date1 = new Date(1433097000000); var date2 = new Date(1434479400000); function daydiff(first, second) { return (second - first) / (1000...\n\nIn the New PHP code snippet, you are still vulnerable to injections. ", "You are using a prepared statement in the insert part, but you are not actually using the preparations strengths correctly. ", "When creating a prepared statement, you create a query in which you add placeholders instead of the raw...\n\nfile_exists: http://php.net/manual/en/function.file-exists.php is_dir: http://php.net/manual/en/function.is-dir.php Best way to do that is use dirname(__FILE__) which gets the directory's full path of the current file in ether unix of windows format. ", "Then we use realpath() which conveniently returns false if file does not exist. ", "All you have to do is specify a relative...\n\nTwo issues: There is a typo in your click listener code, javascript is case sensitive, infowindow and infoWindow are different objects, so you are not setting the position of the infowindow correctly. ", "infowindow.open(map); infoWindow.setPosition(event.latLng); You are currently placing the infowindow at the place that is clicked infoWindow.setPosition(event.latLng);. ", "If you want...\n\nEMI and CustomerName are elements under json so you can use .find() to find those elements and then text() to get its value. ", "$(data).find(\"json\").each(function (i, item) { var heures = $(item).find(\"CustomerName\").text(); var nbr = $(item).find(\"EMI\").text(); console.log(heures); }); .attr() is used to get the attribute value of an element like in...\n\nIt is because you aren't ending the value attribute, so your selected option becomes <option value=\"optionvalueselected\" -- 'optionvalue' being the value of your selected option, and 'selected' being the attribute you want to set, but won't be set because you never ended value The following should work: <select name=\"course_id\" id=\"course_id\">...\n\nThe client doesn't get to cause arbitrary events to fire on the socket. ", "It is always a message event. ", "Using the same client, try this server code in your connection handler: socket.on('message', function(data) { // data === \"pressed\", since that's what the client sent console.log(\"Pressed!\"); ", "socket.close(); }); ...\n\nIf I understand correctly you have a unix timestamp in a varchar field and you can't change this. ", "If you compare the unix timestamp directly you will only get results that match the exact second of the timestamp. ", "You can use FROM_UNIXTIME() to convert the timestamp in a date value...\n\nA jQuery only way would be to iterate over the nth-child(4n) $('.thumbnail:nth-child(4n)').each(function(){ $(this) .prevAll('.thumbnail').andSelf() .wrapAll($('<div/>',{class:\"new\"})) }); Demo Considering the complexity, not sure whether the prevAll() performs better than the plain for loop. ", "Referring one of my similar answer here...\n\nJavascript is a client-side language. ", "Session are server-side component. ", "If you want to update session when user does something on your page, you should create a ajax request to the server. ", "Or maybe use some client side variables that, for some aspects, are similar to session (they will be forever...\n\nThe handler for each type of event is passed a certain set of arguments. ", "The Catalog of Events has this to say about a \"change\" event: \"change\" (model, options) — when a model's attributes have changed. ", "So if you say this: this.listenTo(members, 'change', this.fetch) then fetch will be called like...\n\nThis is one way to do it, using preg_match: $string =\"SomeStringExample\"; preg_match('/^[b-df-hj-np-tv-z]*/i', $string, $matches); $count = strlen($matches[0]); The regular expression matches zero or more (*) case-insensitive (/i) consonants [b-df-hj-np-tv-z] at the beginning (^) of the string and stores the matched content in the $matches array. ", "Then it's just a matter...\n\nUse onbeforeunload function of javascript window.onbeforeunload = function() { //Declare cookie to close state } This function will be called every time page refreshes Update: To make loop through every value use this $.each this way: var new_value = \"\"; window.onbeforeunload = function() { $.each($('div.box_container div.box_handle'),function(index,value){ new_value = ($(value).next('.box').css('display') ==...\n\nHaving a Line series: To modify the line thickness, change the series format.stroke.size property. ", "Ie: Chart1.series.items[0].format.stroke.size=2; To modify the series color, change the series format.stroke.fill property. ", "Ie: Chart1.series.items[0].format.stroke.fill=\"red\"; ...\n\ndocument.", "GetElementById(\"tombolco\").style = \"display:block\"; That's not the right way. ", "This is document.getElementById(\"tombolco\").style.display = 'block'; Also note that it is getElementById, not with a capital G. Same with 'none',Rest of your code is fine. ", "Fiddle...\n\nNote: You can just make a single file out of it to achieve your wanted output Use mysql_real_escape_string() to sanitize the passed-on value to prevent SQL injections You should use mysqli_* instead of the deprecated mysql_* API Form them in a single file like this (display.php): <html> <form method=\"post\" name=\"display\"...\n\nNo need to use union as it will give a lots of duplicate data What you want to achieve can be done with simple left join or inner join SELECT m.issue_name ,m.issue_type , m.priority ,m.status,m.description , m.start_date,m.end_date,m.duration, s.name as server_name,p.name as product_name from mod_networkstatus as m LEFT JOIN tblservers as...\n\nThe i++ is using post increment, so the value of the expression i++ is what the value was in the variable i before the increment. ", "This code: if(sortedLetters[i] !", "== sortedLetters[i++]) return true; does the same thing as: if(sortedLetters[i] !", "== sortedLetters[i]) return true; i = i + 1; As x !", "==...\n\nWithout custom logic, it's not possible to achieve what you want. ", "However I believe you could find a compromise by using ES6 modules instead of CommonJS modules. ", "You would be able to write export var test = 'test'; which declares and exports a variable test. ", "You can then import it...\n\nAs PM 77-1 suggests, consider using the built–in Array.prototype.sort with Date objects. ", "Presumably you want to sort them on one of start or end: jobs.sort(function(a, b) { return new Date(a.ys, a.ms-1) - new Date(b.ys, b.ms-1); }) ...\n\nI think you can locate the shape pretty accurately with a simple threshold, like this: convert image.jpg -threshold 90% result.jpg and you can then do a Canny edge detection like this: convert image.jpg -threshold 90% -canny 0x1+10%+30% result.jpg The next things I would be looking at are, using the -trim...\n\nThis looks like a job for glob, which returns an array of file names matching a specified pattern. ", "I'm aware of the other answer just posted, but let's provide an alternative to regex. ", "According to the top comment on the docs page, what you could do is something like this:...\n\nYour PHP is checking if $_POST['submit'] contains a value. ", "Your form does not contain a form element with the attribute name=\"submit\", so therefore it fails and moves straight to the else statement. ", "If you want to check if the form was posted then you should instead check for: if (!", "empty($_POST))...\n\nCreate a separate file called app.js. ", "The only purpose of this file would be to run the server. ", "You'll also need to export your app object from server.js. ", "So, your server.js would look like this // set up ====================================================================== var express = require('express'); var app = express(); // create our...\n\nIn your code you have 2 options to solve it first is jquery and second one is css. ", "1) Jquery On load trigger click event. ", "$('#cont-1').click(); OR 2) CSS Add hide class in second tab <div class=\"tabcontent hide\" id=\"cont-2-1\"> and add activeLink class for login <a href=\"javascript:;\" class=\"inactive activeLink\" id=\"cont-1\">Login</a>...\n\nThe way I think you will have to do it is in each element individually and use this jquery small plugin I rewrite here is the code and also fiddle the html <div id=\"parent\"> thisi sthe fpcd <p>p</p> </div> plugin to find the content of the selector text without child...\n\nYou should use the Angular $http.jsonp() request rather than $http.get(). ", "JSONP or “JSON with padding” is the communication technique which allows for data to be requested from a server under a different domain (also known as a Cross Origin Request). ", "Which is what you have used in your jQuery AJAX...\n\n$x and $y are only defined within the scope of the function. ", "The code outside of the function does not know what $x or $y are and therefore will not print them. ", "Simply declare them outside of the function as well, like so: <?", "php function sum($x, $y) { $z =...\n\nobj.roles[0] is a object {\"name\":\"with whom\"}. ", "you cant replace string with object. ", "you need to refer to property \"name\" in the object obj.roles[0].name Another problem is that var finalXML get a new value every line. ", "you need to add a new value to the variable, not replcae it. ", "var finalXML..." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006067360518500209, 0.0006365141598507762, 0.0007545541739091277, 0.0007707002805545926, 0.0005979719571769238, 0.0007467537652701139, 0.0005811852752231061, 0.0006799899274483323, 0.000721055781468749, 0.0006988731911405921, 0.0006810149643570185, 0.0006535053253173828, 0.000998057657852769, 0.0006634547607973218, 0.0007053672452457249, 0.0007049928535707295, 0.0005856071948073804, 0.0007328601204790175, 0.000812590413261205, 0.0007434881408698857, 0.0005646984209306538, 0.0006018984713591635, 0.0005592931411229074, 0.0008490533800795674, 0.0010918336920440197, 0.0007101169321686029, 0.000650503090582788, 0.0017230018274858594, 0.0008278787136077881, 0.0008317246683873236, 0.0008670621900819242, 0.001347704790532589, 0.0038773962296545506, 0.0007449033437296748, 0.0005595341208390892, 0.0006153666181489825, 0.0007086805999279022, 0.0006485116900876164, 0.0006110304384492338, 0.0007366198115050793, 0.0009755850187502801, 0.0008572021033614874, 0.0013005337677896023, 0.0010801433818414807, 0.0011490366887301207, 0.0018928825156763196, 0.0007004761137068272, 0.0016454627038910985, 0.0008054793579503894, 0.000715841306373477, 0.0008448471780866385, 0.0007567515131086111, 0.001151351840235293, 0.00293644517660141, 0.0009956349385902286, 0.0006328519084490836, 0.0011691448744386435 ]

[ "Heterosexual transmission of viral hepatitis and cytomegalovirus infection among United States military personnel stationed in the western Pacific.", "\nA serosurvey of United States military personnel presenting to a sexually transmitted diseases (STD) clinic or reporting for routine physical examination in the Philippines was conducted to determine the risk factors for hepatitis B (anti-HBc), hepatitis C (anti-HCV), and cytomegalovirus (anti-CMV) infection. ", "Among 470 male study subjects, 74 (15.7%) were positive for anti-HBc, five (1.1%) were positive for anti-HCV, and 232 (49.4%) were positive for anti-CMV. ", "A history of a STD (odds ratio [OR] = 7.7) and contact with a female prostitute (OR = 2.3) were significantly associated with anti-HBc seropositivity after adjusting for age, race/ethnicity, foreign birth, and classification as either a STD or routine examination patient. ", "Anti-CMV seropositivity was significantly associated with a history of a STD (adjusted OR = 2.0). ", "These data suggest that in this military population, heterosexual activity was a risk factor for acquiring hepatitis B and CMV infection. ", "United States military personnel stationed in high-risk areas of the western Pacific, particularly patients presenting to STD clinics, may need to be targeted for hepatitis B vaccination." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0008621225715614855, 0.0008633123943582177, 0.0009022342273965478, 0.023275939747691154, 0.0008284777286462486, 0.0007735644467175007, 0.0006818065885454416 ]

[ "KNOX Fastback Gilet Review\n\nDesigned and manufactured in Britain by Knox, the Fastback is fitted with Knox Extreme Short Back Armour that finishes at the waist, so it fits neatly under a leather jacket and is also comfortable to wear with textile riding suits. ", "The lightweight back protector is CE approved to EN1621-2 Level 2 and provides additional coverage over the scapula (shoulder blade) area. ", "Featuring a strong sport mesh construction, which is elastic and breathable, the Fastback is instantly comfortable and allows riders to zip up and go, making it convenient for commuters and tourers alike. ", "Raised channels and vents in the back protector help to keep the wearer cool and avoid the build up of perspiration on clothes.", "\n\nSoft elastic side straps hold the back protector in place and provide additional support to the wearer and an optional CE-approved chest protector can be attached to a Velcro tab on the chest. ", "When it’s time to freshen up the Fastback, simply remove the back protector before machine washing. ", "Produced in five sizes (S- XXL) in Black/Grey, the Knox Fastback retails for £89.99 (including VAT) and the optional Chest Guard upgrade costs £19.99. ", "All Knox back protectors come with a 5-year service life, which is a similar lifespan to top of the range helmets, and not something that all protection brands offer." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006490963278338313, 0.000824374845251441, 0.000600744504481554, 0.0008795065223239362, 0.0007296914118342102, 0.0007490708376280963, 0.0008771430002525449, 0.0008785164682194591 ]

[ "Hess in the Media: World Oil\n\n12.21.2015\n\nDoug Valleau, Hess chief geologist, told World Oil Magazine in its December issue that a slowdown in activity “is the perfect time to go to the gym.\"", "\n\nIt’s time to build technological muscle with investments in research, to ensure that we remain healthy and fit,\" Valleau said. \"", "And it’s time to cross-train our staff to build their intellectual muscle to take broader roles, just as athletes cross train in the gym to improve their overall performance.”", "\n\nHess to Participate in Credit Suisse 24th Energy Summit\n\nHess Reports Estimated Results for the Fourth Quarter of 2018\n\nHess today reported a net loss of $4 million, or $0.05 per common share, in the fourth quarter of 2018, compared to a net loss of $2,677 million, or $8.57 per common share, in the fourth quarter of 2017. ", "On an adjusted basis, the Corporation reported a net loss of $77 million, or $0.31 per common share, in the fourth quarter of 2018, compared with an adjusted net loss of $304 million, or $1.01 per common share, in the prior-year quarter." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006257375353015959, 0.0005789552815258503, 0.0006915395497344434, 0.0005671583930961788, 0.0005803853855468333 ]

[ "Marketers say that one of the most important marketing tools is a good company logo design. ", "It not only provides an easy to recognize identity for your business but also communicates who you are. ", "That’s why every company considering creating or buying a logo design should know the criteria that make for an effective logo.", "\n\nThe first feature of a good and effective logo is that it can immediately “grab” viewer’s attention. ", "Your logo should have an instant impact and hold the viewer’s attention.", "\n\nHowever, if you did manage to catch the viewer’s eye – that doesn’t necessarily mean you are doing good. ", "There might always be some hidden pictures, usually inappropriate ones, that you cannot see at first sight.", "\n\nHere’s a list of Top 15 Funny Logo Fails of all time which probably didn’t look so bad at first glance.", "\n\nLogo of the Catholic Church’s Archdiocesan Youth Commission\n\nThis is an actual logo designed in 1973 for the Catholic Church’s Archdiocesan Youth Commission. ", "It even won an award from the Art Directors Club of Los Angeles.", "\n\nA-Style Logo\n\nThe A-style logo was born well before the line of clothing – designed in 1989 and marketed in Italy since 1999. ", "It was, in fact, an invention of his creator who began to attack Italian cities with stickers on a yellow background with A-Style logo (an example of guerilla marketing), followed by other cities including Miami, Moscow, and London. ", "The newspapers and television began to be interested in the strange appearances of the logo, and soon the company started marketing their products under the brand A-Style.", "\n\nOffice of Government Commerce\n\nThe Office of Government Commerce (OGC) is an independent Office of the Treasury. ", "Sometimes you need to shift your view to realize the error. ", "www.ogc.gov.uk\n\nMont-Sat\n\nNow you know why Mr. Satellite looks so happy. ", "www.mont-sat.pl\n\nArlington Pediatric Center\n\nJust checked their website, and apparently, they have changed their logo to something more pleasing. ", "It’s no longer a pedophilic center. ", "Now it has something to do with crabs (look attentively at letter C). ", "Funny fail again or is it their marketing strategy? ", "www.arlpedcen.org\n\nPepsi\n\nWhile all this might look like a joke, it gets even funnier when you look at the Pepsi Max logo. ", "It has nearly twice the caffeine of Pepsi’s other cola beverages. ", "We’re not sure what drinking Pepsi Max is supposed to do for you, but based on what it did to this guys tummy here, we’d suggest staying away from it.", "\n\nYou’ll never look at the Pepsi logo the same again.", "\n\nClinica Dental\n\nComputer Doctors\n\nLocum\n\nLogo for Locum, a Swedish property management company.", "\n\nCatWear\n\nInstitute Of Oriental Studies\n\nKudawara Pharmacy\n\nKidsexchange\n\nJunior Jazz Dance Classes\n\nOlympic Logo of London 2012\n\nDesigned by Wolff Olins at an expenditure of £400,000 (almost $800,000) the logo has been met with expected ambivalence, and, in some unavoidable cases, hatred – actually, so far, in 11,550 cases.[1]" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0005433492478914559, 0.0006427789921872318, 0.0006199193303473294, 0.0006233381573110819, 0.0008462204714305699, 0.0007049076375551522, 0.0006511500105261803, 0.005753259640187025, 0.0007235183147713542, 0.0006408114568330348, 0.0007152270409278572, 0.0006794817745685577, 0.0005511684576049447, 0.0006178141920827329, 0.0007659233524464071, 0.0006407512701116502, 0.000562438101042062, 0.07200968265533447, 0.0005638316506519914, 0.0045196618884801865, 0.0006259540095925331, 0.0028167616110295057, 0.018028028309345245, 0.000984056736342609, 0.0006747388397343457, 0.0005844463012181222 ]

[ "Can serum amyloid A or macrophage colony stimulating factor serve as marker of amyloid formation process?", "\nAmyloid formation depends on amyloid precursor production and is influenced by the activity of the underlying disorder and mediated by some proinflammatory cytokines. ", "In this pilot study we tried to find some specific markers that could establish the activity of the disease. ", "We investigated 45 samples of sera and 38 samples of urine from patients (pts) with secondary amyloidosis (AA), primary amyloidosis (AL), systemic autoimmune diseases with renal impairment (Vasc) and healthy controls (Co). ", "Pts with AA had increased plasma levels of TNF alpha (9.97 +/- 4.22 vs. 2.63 +/- 1.34 pg/mL, p < 0.001) and SAA (43.14 +/- 16.0 vs. 3.42 +/- 0.7 ng/mL, p < 0.05) in comparison with Co. Plasma levels of M-CSF in the AA group were significantly increased in comparison with Co (1077.34 +/- 238.6 vs. 137.71 +/- 19.6, pg/mL, p < 0.001) and also in comparison with Vasc (482.24 +/- 86.7 pg/mL, p < 0.05). ", "Urinary excretions of TNF alpha (8.92 +/- 8.1 vs. 0.17 +/- 0.11 microgram/mol creatinine, p < 0.01), sIL-6R (1.39 +/- 1.14 vs. 0.07 +/- 0.05 g/mol creatinine, p < 0.01) and M-CSF (650.2 +/- 153.7 vs. 33.3 +/- 8.6 micrograms/mol creatinine, p < 0.01) in AA were significantly increased in comparison with Co. Pts with AL had increased plasma levels of M-CSF (819.83 +/- 264.2 vs. 137.71 +/- 19.6 pg/mL, p < 0.05) and urinary excretion of M-CSF (865.0 +/- 188.4 vs. 33.3 +/- 8.6 micrograms/mol creatinine, p < 0.01) in comparison with Co. SAA has a low specificity for amyloidosis but is a sensitive acute phase reactant. ", "TNF alpha, a proinflammatory cytokine, may reflect the activity of the underlying diseases in secondary amyloidosis. ", "M-CSF was increased both in plasma and urine in amyloidosis groups and seems to be the most promising (possibly specific) marker of amyloidosis." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.001016286201775074, 0.0008208717918023467, 0.0005398824578151107, 0.0007080720388330519, 0.0008387306588701904, 0.004513377323746681, 0.001366581185720861, 0.000756093009840697 ]

[ "This story was updated May 24, 2018, at 10:33 p.m. with more information.", "\n\nUnemployment in the Chattanooga area fell to an 18-year low last month as local employers added 10,640 jobs over the the past year.", "\n\nThe Tennessee Department of Labor and Workforce Development said Thursday the jobless rate in metropolitan Chattanooga dropped by a half of a percentage point to 3.0 percent — the lowest monthly rate since December 2000.", "\n\nThe jobless rate fell to a similar 3 percent rate in metro Cleveland and dropped to a decade-low of 4.2 percent in metro Dalton.", "\n\nIn Southeast Tennessee, the jobless rate was lowest in Hamilton County at a mere 2.8 percent last month, down from 3.3 percent in March.", "\n\n\"Tennessee, and especially growth areas like Chattanooga, are showing sustained, strong growth, and that helped keep more people on the job and fewer filing for jobless benefits,\" said Dr. Bill Fox, director of the Boyd Center for Business and Economic Research.", "\n\nIn the six-county Chattanooga metro area, employment grew by nearly 4.2 percent in the past 12 months, more than twice the pace for the the country as a whole.", "\n\nThe non-seasonally adjusted unemployment rate across Tennessee fell in all 95 counties of Tennessee last month, lowering the rate in all areas of the state, including traditionally high jobless counties such as Rhea and Meigs counties, to at or below 5 percent.", "\n\n\"Our investments in education and workforce development are showing results in all corners of the state and to have such low unemployment rates in each county is great news for every Tennessean,\" Gov. Bill Haslam said in a statement. \"", "Tennessee will lead in job recruitment because we are focused on developing a high quality workforce.\"", "\n\nWilliamson County continued to have Tennessee's lowest level of unemployment with a rate of 2 percent in April. ", "The new figure reflects a decrease of 0.4 of a percentage point from the previous month.", "\n\nThe counties which saw the highest unemployment during April also experienced a significant drop in unemployment. ", "With a rate of 4.9 percent, Lauderdale County had the second highest unemployment in the state, but that figure is half a percentage point lower than a month ago.", "\n\n\"To see continued low unemployment in our metro areas is great,\" Tennessee Labor Commissioner Burns Phillips said. \"", "But the decreases we are seeing in our rural and distressed counties show there are new job opportunities statewide.\"", "\n\nFor the third consecutive month, Tennessee's statewide seasonally adjusted unemployment rate was 3.4 percent. ", "For the first time in six months, the national unemployment rate decreased in April when it dropped from 4.1 percent to 3.9 percent.", "\n\nDoug Berry, vice president of economic development for the Cleveland/Bradley County Chamber of Commerce, said the the local job market \"is as tight as I have seen it in nearly 30 years of economic development in East Tennessee.\"", "\n\nIndustrial recruitment is being more selective and finding qualified workers is now the hardest challenge for many companies.", "\n\n\"The market is dramatically different from what it was in the past,\" Berry said.", "\n\nContact Dave Flessner at dflessner@timesfreepress.com or at 757-6340." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0005730947596020997, 0.0008875397616066039, 0.0006661922670900822, 0.0008391435840167105, 0.0007183442357927561, 0.0005689599784091115, 0.0005660785245709121, 0.0008249437669292092, 0.0007491372525691986, 0.000503648305311799, 0.0024734442122280598, 0.000578029197640717, 0.0011612207163125277, 0.0008359386119991541, 0.000688977655954659, 0.0005347782280296087, 0.0007206199807114899, 0.0008294449071399868, 0.0005782405496574938, 0.0006356254452839494, 0.0006635489990003407, 0.0006528099766001105 ]

[ "693 F.2d 134\n*Fairv.", "Zant\n81-7508\nUNITED STATES COURT OF APPEALS Eleventh Circuit\n11/15/82\n\n1\nM.D.Ga.", "\n\nAFFIRMED\n\n2\n---------------\n\n\n\n* Fed.", "R.App. ", "P. 34(a); 11th Cir. ", "R. 23.", "\n\n\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0.0010785424383357167, 0.0009047506027854979, 0.0009385102894157171, 0.0009975661523640156, 0.0007620477117598057, 0.0009099835879169405, 0.001995444530621171 ]

[ "Do I think we should teach poker in elementary\nschools?", "\nYes, I think there are elements of the game\nthat you should teach in terms of like—because\nwhat poker really does is teach you how to\ndeal with probabilities and uncertainties,\nand that's so integral to life.", "\nEverything we try to do—“should we take\nthis route or that route”, “should I go\nhere on vacation or there”—it's all about\ndealing with uncertainties and probabilities\nof things happening, and poker is a very fun\nand easy way to teach someone how to do that.", "\nIt's a shame people often put poker in the\nsame ballpark as just general gambling.", "\nJust because some people choose to play it\nfor money, but you don't have to play for\nmoney—it's just about winning.", "\nYou could win anything.", "\nYou could win pride.", "\nYou could win matchsticks or money.", "\nAnd there is so many like core fundamentals\nof the game that I wish I had known at age\nten, these ides, these sort of ways of thinking\nabout expected value and probabilistic thinking\nin general would have sped up a lot of things\nin my life had I been more aware of it.", "\nAnd also learning how to evaluate evidence;\nthat's something that is not taught in school\nor very rarely taught in school, learning\nhow to change our minds, update our beliefs.", "\nWhen we get new information being able to\nweigh is that information reliable or not\nand playing poker has taught me how to do\nthose much more accurately.", "\nSo, if there's a way to teach children through\na game, and children love to learn through\ngames, poker could be one of those methods.", "\nI think being mathematically minded is—there's\nprobably some aptitude involved in it, but\nI still think the vast majority of it is down\nto the determination and practice.", "\nYou can take someone, I mean if you can just\nunderstand the concept of numbers in the first\nplace, which I think the vast majority of\nhumans can, then you can train someone to\nbe more mathematically capable.", "\nIt's like learning a language; it's almost\nlike you have that initial passion and desire\nto get better, then it's those little incremental\njumps.", "\nAnd it makes me so sad when I meet people\nwho are like “I’m no good at math, no\ngood at math” and if you actually keep asking\nthem why and go back in their history it almost\nalways comes down to some bad experience they\nhad when they were probably seven years old\nand the teacher asked them “what's five\ntimes five?” ", "and they screwed up and their\nfriends laughed at them, and then these barriers\nget built and they're like “oh it's not\nmy thing”.", "\nAnd I think it's just a huge tragedy because\nmost humans can learn to be at least competent\nat basic mathematics, especially the mathematics\ninvolved in poker.", "\nIt's really not that complicated.", "\nThere's a lot of approximations you can do\nand I found that I used to actually not be\nvery good at mental arithmetic.", "\nI was fine if I had a pen and paper and algebra,\nthat was, I liked that, but in the moment\nof, mental arithmetic I could never do.", "\nBut I started playing poker and started practicing\nthese things and now it's a skill I'm proud\nof.", "\nSo it's just a willingness to keep plugging\naway at it.", "\n" ]

{ "pile_set_name": "YoutubeSubtitles" }

[ 0.004313098266720772, 0.000808207259979099, 0.0009975158609449863, 0.005288126412779093, 0.0009895773837342858, 0.001104147406294942, 0.0008310731500387192, 0.0010463548824191093, 0.0007566794520244002, 0.0006864778697490692, 0.0007302812882699072, 0.0013145905686542392, 0.0005305634113028646, 0.0005534840165637434, 0.0010819074232131243, 0.0013444152427837253, 0.10258711874485016, 0.0006576793384738266, 0.0007208806346170604, 0.0014440020313486457, 0.0009426662581972778, 0.0007600301178172231, 0.000648151442874223, 0.001995444530621171 ]

[ "# Copyright 2013-2020 Lawrence Livermore National Security, LLC and other\n# Spack Project Developers. ", "See the top-level COPYRIGHT file for details.", "\n#\n# SPDX-License-Identifier: (Apache-2.0 OR MIT)\n\nfrom spack import *\n\n\nclass RSnakecase(RPackage):\n \"\"\"A consistent, flexible and easy to use tool to parse and convert strings\n into cases like snake or camel among others.\"\"\"", "\n\n homepage = \"https://github.com/Tazinho/snakecase\"\n url = \"https://cloud.r-project.org/src/contrib/snakecase_0.11.0.tar.gz\"\n list_url = \"https://cloud.r-project.org/src/contrib/Archive/snakecase\"\n\n version('0.11.0', sha256='998420a58391ac85785e60bcdf6fd6927c82758ad2859a9a73a0e57299e8c1cf')\n\n depends_on('r@3.2:', type=('build', 'run'))\n depends_on('r-stringr', type=('build', 'run'))\n depends_on('r-stringi', type=('build', 'run'))\n" ]

{ "pile_set_name": "Github" }

[ 0.0007252852665260434, 0.000545294547919184, 0.0007867867243476212, 0.0008750090491957963 ]

[ "The following documents were received today and have been forwarded to you \nfor your immediate attention:\n\nRobert Cawthon d/b/a B.&J. Gas & Oil, et al. ", "v. Enron North America Corp., \nCivil Action No. ", "01-C-38, In the Circuit Court of Lewis County, West \nVirginia. ", " A Summons and Complaint was sent certified mail to NRAI who then \nsent it to Enron North America Corp. by Federal Express. ", " \n\n\n\nPLEASE ADVISE IF NOT RECEIVED WITHIN 1 BUSINESS DAY.", "\n\n\nThank you !!", "\n\nGay Arnold\nEnron Litigation Unit, EB 4829\n(713) 853-6612\n(713) 853-6576 (fax)\nGay.Arnold@enron.com" ]

{ "pile_set_name": "Enron Emails" }

[ 0.0006204717210493982, 0.0008209722582250834, 0.0007035582675598562, 0.0006272831233218312, 0.0005246803630143404, 0.0007223040447570384, 0.48536983132362366 ]

[ "A man’s body was recovered Sunday evening from the Chicago River in the Loop.", "\n\nAround 5 p.m., the Chicago Police Marine Unit responded to a call of a body in the water near Wacker Drive and Van Buren Street, authorities said.", "\n\nA man was pulled from the water near the 400 block of South Wacker Drive, police said. ", "He was pronounced dead at the scene, according to the Cook County medical examiner’s office.", "\n\nThe man has not yet been identified, police said. ", "His exact age was unknown.", "\n\nArea Central detectives are investigating the death." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0007864824146963656, 0.0007810586248524487, 0.0014502931153401732, 0.0011789746349677444, 0.0006831464706920087, 0.0007526496192440391, 0.0008418028010055423 ]

[ "Mal Webb\n\nMal Webb (born 31 October 1966, Melbourne, Australia) is a singer, beatboxer and multi-instrumentalist who has performed in various groups in the Australian music scene. ", "He records his own original songs as well as providing material for other artists. ", "He is a founding member of The Oxo Cubans, Sock, Totally Gourdgeous, and Formidable Vegetable, as well as performing solo and as a duo with Kylie Morrigan. ", "As a composer, he provided the soundtracks for The Adventures of Lano and Woodley (ABC TV series 1997-1999), Woodley (ABC TV series 2012) and Wishworks' puppet show, Whispering Smith (UK 2015). ", "In 2018, he premiered his work, \"Notey and Noisy, a Sound Science Mathemusical\".", "\n\nDiscography\nsolo\nTrainer Wheels (2000)\n3 Cheers for Peace & Quiet (2005)\nDodgy (2008)\nLive and Instructional DVD (2011)\n\"Not Nor Mal\" (2016)\n\nReferences\n\nExternal links\nOfficial website\n\nCategory:1966 births\nCategory:Living people\nCategory:Musicians from Melbourne" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0008650906383991241, 0.0007598096271976829, 0.0015582999913021922, 0.0006267766002565622, 0.0006736908107995987, 0.0005695508443750441 ]

[ "Ulloa's observations of the glory, fogbow, and an unidentified phenomenon.", "\nUlloa's complete print of the glories and fogbows on Mt. Pambamarca in Peru (now Ecuador) is presented. ", "It shows two other phenomena, an erupting volcano and an as yet unidentified optical effect. ", "The glories and fogbow are analyzed to obtain the drop size of the fog, and the unidentified features are discussed." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0005964094889350235, 0.0006228131824173033, 0.000629574351478368, 0.0006234251777641475 ]

[ "**Abstract**\n\n**Objective:** Lower heart rate variability (HRV), a measure of autonomic function, has been noted in depression and linked with cardiovascular disease risk. ", "Evidence suggests that some antidepressants, such as tricyclics and SNRIs, adversely impact HRV (Terhardt et al., ", "2013) while SSRIs appear to have no influence on HRV (Kemp et al., ", "2010). ", "Desvenlafaxine is a newer SNRI used to treat depression, but there are no published studies on its benefits in chronic depression, or its influence on measure of HRV. ", "The objectives of this pilot investigation were to investigate these issues.", "\n\n**Methods:** Twenty-three patients with persistent depressive disorder, who were enrolled in an open-label 8-week trial of monotherapy with desvenlafaxine, were included in this study. ", "HRV was measured at baseline and post-treatment. ", "Differences in HRV parameters were assessed pre-post treatment, as well as between those who responded to treatment (n=15) vs. non-responders (n=8).", "\n\n**Results:** Across the sample, HRV measures of time-and frequency-domains significantly decreased over the course of treatment, including SDNN (p\\<.01), RMSSD (p=.05), RR triangular index (p=.03), as well as total Power (p\\<.01) and LF/HF Power (p=.03). ", "Significant increases in frequency-domain measures such as HF power (p=.04) were also noted. ", "Further, comparisons between responders and non-responders revealed significant differences in time-domain measures (TINN, p=.04), and overall estimates of HRV (RR triangular index) (p=.02) post-treatment.", "\n\n**Conclusions:** The results suggest that treatment response to desvenlafaxine is associated with normalization of sympathovagal balance (HRV). ", "Limitations of this study include small sample size and absence of a control group. ", "Additional investigations are warranted.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.0006339027313515544, 0.0006951992982067168, 0.0006068731308914721, 0.0007440905901603401, 0.0007884961669333279, 0.00056456308811903, 0.0007580152596347034, 0.0005665005883201957, 0.0005895343492738903, 0.0006002411246299744, 0.0005888478481210768, 0.000579028099309653, 0.0008153796079568565, 0.0006445100880227983, 0.0005521125858649611, 0.001995444530621171 ]

[ "Background {#Sec1}\n==========\n\nMaternal mortality remains high in most sub-Saharan African countries, including Tanzania.\\[[@CR1], [@CR2]\\] Even among women who seek care in health facilities for pregnancy-related complications early enough, case fatality rates may be high \\[[@CR3]\\], indicating sub-optimal care and the imperative of improving the quality of care for better maternal survival.", "\n\nThe maternal mortality ratio in Tanzania is 454 deaths per 100,000 \\[[@CR4]\\] and levels have not declined significantly in the past two decades to meet the 5^th^ millennium development goal by 2015. ", "\\[[@CR2]\\] Direct obstetric causes of maternal deaths account for at least three quarters of these deaths \\[[@CR1], [@CR3]\\], and although life-threatening pregnancy-related complications may start at home for some women, most come into contact with the health system before they die \\[[@CR3]\\]. ", "Sub-optimal care is also common in health facilities. ", "\\[[@CR5]\\] Utilization of essential services for maternal and newborn survival such as skilled delivery attendance and emergency obstetric care is not always possible even among women living within 5 km of health facilities. ", "\\[[@CR3], [@CR6]\\].", "\n\nOf the at least 7900 maternal and 39,000 newborn deaths expected to occur in Tanzania in 2013 \\[[@CR2], [@CR7]\\], a significant number could have been saved with better quality of care in health facilities as critical skills, equipment, drugs and other essential commodities for saving maternal and newborn deaths often lack. ", "\\[[@CR8]--[@CR10]\\] Nevertheless, lessons learnt from managing individual cases may be equally important for improving the quality of care women receive in health facilities. ", "For example, gaps identified in a near miss or maternal deaths reviews can inform providers on how to avoid similar future deaths. ", "One strategy advocated to address the latter is health facility maternal death review \\[[@CR11], [@CR12]\\]-defined as a qualitative, in-depth investigation of the causes of and circumstances surrounding maternal deaths occurring at health facilities \\[[@CR11]\\].", "\n\nIn Tanzania, guidelines for maternal and perinatal death reviews (MPDRs) were produced and rolled out in 2006. ", "The guidelines aim to improve the process of maternal death reviews with an ultimate goal of improving case management for better maternal and newborn survival. ", "\\[[@CR13]\\] They also require a review team in each health facility (membership eligibility stipulated) which is supposed to meet within 24 h of the death occurring. ", "Typically, a review session for a maternal death at a health facility takes approximately one to two hours and the process involves presentation of a case summary by someone who was not involved in the case management, identification of gaps and strengths in case management and drafting of an action plan with timelines and specific roles to the identified levels of care to act on the recommendation (s) in order to prevent similar deaths in future. ", "Review committees are also required at all other levels of health administration in the country (district, region and national) to meet at stipulated times. ", "But available evidence suggests that except for health facility and district meetings, regional level meeting are not always convened and no national meeting has ever been convened. ", "\\[[@CR14]\\] Review reports from health facilities are subsequently forwarded to the district where reports are also sent to the region and to the responsible section within the Ministry of Health and Social Welfare.", "\n\nWhilst most deaths in health facilities are possibly reviewed and reported, implementation of these guidelines has not yielded much evidence to support that the maternal death reviews (MDRs), although conducted routinely, provide results that are acted upon to improve the quality of maternal and newborn health services. ", "Maternal and perinatal death forms are filled routinely and sent to various levels as stipulated in the guidelines, but evidence of critical analysis of whether results from such reviews are communicated back, or even facility level recommendations are acted upon is scarce. ", "\\[[@CR14]\\] Furthermore, emerging evidence from epidemiological studies in the country suggests that despite significant improvement in utilization of health facilities among women with life-threatening pregnancy-related complication in recent years \\[[@CR3]\\], maternal deaths have not decreased proportionately \\[[@CR1], [@CR2], [@CR4]\\]; suggesting sub-optimal quality of care. ", "MDRs aim to provide lessons to prevent similar subsequent maternal death events in health facilities, but if women continue to die in health facilities for causes that are identified routinely, doubts are abound for the effectiveness of the current MDR strategy to address the high level of such deaths. ", "Furthermore, the country is currently reviewing the MPDR guidelines to align with the global demand for surveillance and response as the better way of understanding and responding to the levels, causes and trends of maternal mortality. ", "\\[[@CR15]--[@CR17]\\].", "\n\nWe report the results from the analysis of data from maternal death reviews at Bugando Medical Centre 2008--2012, a tertiary hospital in Mwanza Tanzania and discuss how lessons from the results have helped to institute measures to improve care provided to women with maternal complications in the institution. ", "The results from the analysis were also used to inform an on-going review of the existing MPDR guidelines in the country.", "\n\nMethodology {#Sec2}\n===========\n\nThe study is a retrospective analysis of maternal death reviews at a tertiary hospital north-western Tanzania in the period 2008--2012. ", "This is a 900 bed capacity and the main referral hospital for the population in the Lake and western zones constituting almost 37 % of the entire Tanzania mainland population, estimated at 43,625,354 people in 2012. ", "\\[[@CR18]\\] There are about 7000 deliveries at this hospital annually, most being referrals from lower level health facilities.", "\n\nAll copies of the reviewed maternal deaths covering the study period were accessed (80 deaths). ", "Typically, maternal deaths reviews are conducted as they occur, usually within a week of occurring by a team led by senior obstetricians in a morning meeting. ", "Case summaries of deaths are prepared by resident doctors in obstetrics and gynaecology not involved in the case management (usually one such doctor is assigned a case to summarize and present). ", "In contrast to what is stipulated in the national guidelines on who should be involved in the reviews, the circumstance at the hospital demands teaching of both undergraduate medical and nursing students who are invited in such meeting as part of learning the process. ", "Senior midwives in the department are also involved in the review besides clinicians and midwives involved in the case management. ", "However, anaesthetists and pharmacists are rarely invited to participate.", "\n\nOnce the review has been done, copies of the review findings are sent to the hospital Director and the zonal reproductive and child health office housed at the hospital. ", "The latter is responsible for forwarding the filled forms to various levels of reporting; usually to the district reproductive and child health coordinator who also forwards the information to the regional and national offices quarterly.", "\n\nWe reviewed multiple data sources at the hospital for deaths that occurred in this period: labour ward, medical records, theatre registers and emergency and casualty department. ", "Missing information for two deaths not included in the existing maternal deaths review forms were identified. ", "Corresponding review forms were found in the deceased patients' files and included in the analysis.", "\n\nInformation on the forms were entered into an excel spreadsheet and missing information was extracted from case notes in patients' files if available. ", "Data were then transferred into Stata statistical package in windows version 12 (StataCorp LP College Station, Texas, USA) for cleaning, coding and analysis. ", "Categorical data were analysed into frequencies to understand the various components of review that were completed and filled and causes of deaths and associated factors while numerical data into means ± SD, range as well as median with 95 % CI.", "\n\nThe analysis is part of a larger study titled \"Improving quality of maternal and newborn care in Tanzanian health facilities: Lessons from a mixed method assessment of health facility maternal deaths reviews in the Lake zone of north-western Tanzania\" with research permits from the Catholic University of Health and Allied Sciences (CUHAS)/Bugando Medical Centre and National Institute for Medical Research (NIMR) ethical committees (no CREC/018/2013 & NIMR/HQ/R.8a/Vol.", "IX/1543 respectively). ", "Permission for the retrospective access to the deceased patients' hospital records was also requested and obtained from the administration of Bugando Medical Centre, including the head of the department of obstetrics and gynaecology as required by the national regulations. ", "Data extraction was done by one of the authors who was not involved in the management of any of the patients and de-linked the deceased patients' information to ensure data anonymity in the subsequent steps of data handling.", "\n\nResults {#Sec3}\n=======\n\nTable [1](#Tab1){ref-type=\"table\"} shows some characteristics of the maternal deaths. ", "Most were young with the mean age of 27.1 ± 6.2 years (range 15--41 years). ", "The majority were aged 20--35 years (80 %), had unknown level of education (57.5 %) and resided in Mwanza region (83.5 %). ", "The median age was 26 years (95 % CI 25--29) (information not shown in the table). ", "Almost 74 % were housewives or peasant farmers and married (88.8 %).Table 1Characteristics of maternal deaths at Bugando Medical Centre 2008--2012CharacteristicNumber%of totalMean ± SDAge of the diseased in years *n* = 80Overall27.1 ± 6.2\\<20810.020--356480.0\\>35810.0Total80100.0Regional of residence of the diseased *n* = 79Mwanza6683.5Mara78.9Shinyanga56.3Tabora11.3Total79100.0Level of education of the diseased *n* = 80None22.5Primary education2632.5Secondary and above33.8Above secondary33.8Unknown4657.5Total80100.0Recorded occupation of the diseased *n* = 69Housewife2942.0Peasant farmer2231.9Teacher34.4Student34.4Businesswomen22.9Petty trader11.5Housemaid11.5Tailor11.5Police11.5Unknown68.7Total69100.0Religion of the diseased *n* = 67Christian4770.2Muslim1826.9Others22.9Total67100.0Marital status of the diseased *n* = 80Divorced11.3Cohabiting22.5Single67.5Married7188.8Total80100.0\n\nTable [2](#Tab2){ref-type=\"table\"} shows additional characteristics of the deceased women. ", "Few were five times or more pregnant (11.3 %). ", "On average, a patient stayed at Bugando hospital for almost two weeks before death (mean 13.5 ± 5.7 days) and median 11.0 \\[95 % CI 11.0--15.3\\] (not shown in the table) and just 20 % stayed for less than one day.", "Table 2Additional characteristics of maternal deaths at Bugando Medical Centre 2008--2012Number of children ever delivered by the diseasedNumber% of totalMean ± SDOverallNever delivered before911.3≤4 children6277.4≥5911.3Total80100.0Duration of stay at Bugando Hospital (in days)Overall13.5 ± 5.7\\<11620.01--33847.5≥42632.5Total80100.0Some important information recorded during death reviewInformation on whether attended ANC *n* = 802936.2Information on gestation age of the pregnancy resulting into the death *n* = 801923.8Place of delivery documented (those recorded to had delivered) *n* = 613862.3Gestation age at delivery recorded *n* = 612337.7Delivery assistant recorded *n* = 612947.5Mode of delivery recorded (those recorded to had delivered) *n* = 614472.1Highlighted direct causes of deaths7695.0Eclampsia1620.0Sepsis1417.5Postpartum haemorrhage911.3Abortion810.0Anaesthetic complications810.0Severe pre-eclampsia56.2Embolism33.7Mentioned as direct but no specific causes highlighted1316.3Highlighted indirect causes of deaths45.0AIDS related33.8Heart Diseases11.2Total80100.0Identified factors associated with maternal deathsLate referral from another facility2130.9Delay in receiving appropriate treatment1522.1Delay in deciding to seek care1420.6Inadequate provider skills811.8Lack of supplies and equipment in health facilities68.8Inadequate staff in health facilities34.4Poor infrastructure for quick referral11.4Total68100.0Note: Deaths from obstructed labour and anaemia were categorized as contributing factors and not causes and classified as of sepsis or haemorrhage\n\nIn most cases, the review forms were incompletely filled. ", "Of the total 80 reviewed deaths, only 29 (36.2 %) had information on whether the woman attended ANC and 19 (23.8 %) had information on gestation age of the pregnancy resulting into the death. ", "Sixty one deaths (76.3 %) occurred after the women had delivered and of these the mode of delivery was recorded in 44 (72.1), 38 (62.3 %) had place of delivery recorded, 29 (47.5 %) had the delivery assistant recorded and only 23 (37.7 %) had gestation age at delivery recorded. ", "In addition, only 39 (62.9 %) had the outcome of delivery recorded; 25 (41 %) with live birth, 11 (18.0) fresh stillbirth and the remaining three (4.9 %) macerated (information not shown in the tables).", "\n\nHalf of the total deaths (40 out of 80) had information on whether a post-mortem was performed or not. ", "Likewise, filling in the causes of death as required by the forms (both direct and indirect causes) were not always done. ", "Of the total 80 deaths, information was filled for only 72 (90); 58 (72.5 %) with direct causes highlighted but 16.3 % of the deaths although identified as such, specific causes were not filled in the review forms. ", "Eclampsia and severe pre-eclampsia accounted for 26.2 % of all deaths while sepsis and postpartum haemorrhage accounted for 17.5 and 11.3 % of all deaths respectively. ", "Both abortion and anaesthetic complications accounted for one in ten of all deaths. ", "The filled indirect causes of deaths did not provide an in-depth understanding of the individual causes but 5 % of the deaths were attributed to indirect causes with AIDS accounting for 3.8 % of all deaths. ", "Of the total 80 deaths, 68 (85 %) had various factors associated with the deaths identified and recorded on the review forms. ", "Late referral from another health facility, delay in receiving appropriate care at the referring health facility and at Bugando Medical Centre and delay in deciding to seek care were the commonest factors identified.", "\n\nFurthermore, complete data to allow analysis of all deaths on whether they occurred before, during or after delivery as well as on actions that were suggested during the review meetings and possibly taken thereafter were missing, an indication of the quality of the meetings.", "\n\nDiscussion {#Sec4}\n==========\n\nThe study highlights some issues with maternal deaths review at a tertiary health facility in Tanzania. ", "Notably, maternal death reviews are conducted but relevant information is not always recorded as per available guidelines. ", "The missing information includes planned actions to prevent similar deaths in future, thus defeating the purpose of the reviews. ", "Nevertheless, the retrospective analysis allowed for identification of such bottlenecks and institution of appropriate measures such as review of the management for eclampsia and severe pre-eclampsia patients to include admission to a high dependence unit for intensive monitoring and care and review of skills and experience of hospital anaesthetists to ensure that operating theatres coverage is always with competent and experienced people to prevent anaesthetic deaths. ", "Maternal deaths review forms are also reviewed regularly after initial reviews to ensure that they are filled appropriately before they are submitted to appropriate levels of the health system.", "\n\nThe finding of incompletely filled review forms did not provide enough information to understand all circumstances surrounding the deaths as lessons gained would not lead to better understanding of the management provided to women and identification of dysfunctions to address in order to avoid similar deaths in future in the absence of case notes from the deceased patients' files. ", "Two main reasons were identified to explain this finding. ", "In some cases, important information was not recorded at the referring health facility and the situation did not allow obtaining such details after the woman had died (an indication of poor referral details); but in some, extraction of the information from the patient records into the review forms was incomplete. ", "Unfortunately, regular review of all filled forms lacked thus not allowing identification of such weaknesses to recommend appropriate and timely remedies. ", "Although measures to avoid missing information on various actions decided during the reviews and how they are followed-up when they are filled has been addressed at Bugando Medical Centre, similar weaknesses likely occur in other facilities in the country. ", "We recommend that the on-going-review of the national maternal and perinatal deaths review guidelines recognize this as a weakness and include measures to avoid it. ", "Also quarterly, semi-annualy or annually reports may involve few cases for an in-depth analysis and planned analysis after some years may be a more pragmatic option to consider, especially is hospitals with limited caseloads.", "\n\nThe finding that approximately 80 % of all deaths occurred when the deceased had stayed in the hospital for at least a day and almost a third stayed for at least four days highlights the quality of care women receive at this hospital and in other facilities referring such women. ", "Measures to improve the quality of care at health facilities in the lake zone are imperative for better maternal survival. ", "The on-going Lake Zone Maternal Mortality Reduction Initiative by Bugando Medical Centre with over 35 district and regional hospitals aiming at improving the quality of care in these health facilities is a welcome measure. ", "Results from a one year experience of implementing this intervention are encouraging and will be reported separately. ", "Additionally, country level analysis of the coverage, equity and quality of key reproductive, maternal, newborn and under-five children indicators shows that the lake and western zones are the least performing in the country impacting negatively on the overall country MDG4&5 progress. ", "\\[[@CR19]\\] Subsequently, pertinent issues contributing to the sub-optimal progress are being addressed, including but not limited to ensuring availability of essential medicines, equipment and other supplies; recruiting, deploying and retaining of skilled providers; improving community engagement in service availability and utilization and improving basic infrastructure for effective referral through increased regional and council health budgets and the Big Result Now Initiative. ", "The latter is a special presidential initiative to accelerate progress in key national sectors, including health.", "\n\nOf equal note are the relatively low documented AIDS-related deaths in this hospital. ", "Recent estimate suggest that such deaths may account for almost 6 % of all deaths in the country. ", "\\[[@CR20]\\] Effective PMTCT services in this part of the country may partly explain this although errors in ascertaining causes of deaths cannot be ruled out. ", "However, similar to previous studies in the country, direct causes of deaths accounted for most deaths \\[[@CR1], [@CR3]\\].", "\n\nThe finding that late referral of patients from health facilities occurred in almost a third of all deaths indicates that improving the quality of care in the referring facilities is imperative for better maternal survival in this setting. ", "Training of available staffs in these facilities for essential competences in management of pregnancy-related complications and quick referral where required is a short term option but good supportive supervision is vital to reinforce the acquired skills and to identify and address challenges in appropriate skills and within the health system. ", "Ensuring that health facilities have the necessary supplies and equipment for managing maternal complications is another necessary intervention.", "\n\nThe main strength of this assessment is to highlight the causes of maternal deaths and related factors which informed subsequent steps to improve on the management of women with obstetric and related complications in the hospital. ", "As a result, periodic analysis of the filled maternal and perinatal deaths review forms has been included in the hospital quality of care assessment and other measures instituted as required by the current national maternal and perinatal death review guidelines and plan for accelerated reduction of maternal, newborn and child deaths \\[[@CR13], [@CR21]\\].", "\n\nSome limitations of this study are worth mentioning. ", "Collection and analysis of retrospective data posed some challenges. ", "Notably, the quality of data could not be controlled in retrospect but very much depended on the previous practice and mechanism of ensuring good quality data. ", "Additionally, like what has have been reported elsewhere in Africa \\[[@CR22]--[@CR25]\\], we encountered incompletely filled MDR forms, errors we had no control over. ", "The forms were also of different review cycles and possibly done at different times of staff competences and as a result, consistency in case management might have lacked. ", "Routine facility MDRs at Bugando Hospital and indeed in the entire lake zone and countrywide do not involve collecting in-depth community information on factors associated with maternal deaths but highlights of what might have happened before the woman reached the health facility. ", "Subsequently, available data may not allow understanding of factors that might have prevailed before contact with the health system thus unable to comprehensively address challenges women face in accessing available services.", "\n\nConclusions {#Sec5}\n===========\n\nWe conclude that maternal deaths reviews and documentation of information from such reviews at Bugando Medical Centre in the period 2008--2012 were not always comprehensive enough to provide all the necessary information required in the current national guidelines and to understand the quality of care women received before demise. ", "This is currently addressed through improving providers understanding of the essence of the reviews, the review process as well as documentation of information from the reviews, including proposed actions to prevent similar deaths in future. ", "The roll-out of the new national guidelines should also aim to build strong capacity for tertiary institutions like Bugando, so that they function as resource centres for training skilled professionals in maternal and perinatal death reviews.", "\n\n**Competing interest**\n\nWe declare no competing interest.", "\n\n**Authors' contributions**\n\nMM developed the research concept, analysed the data and developed the initial manuscript. ", "AM collected the data and participated in the analysis and writing of the manuscript. ", "CM, RM, AK, BG reviewed the extracted data, contributed to the analysis and writing of the manuscript. ", "All authors approved the final manuscript.", "\n\nData analysis and report writing was supported by Evidence for Action (E4A) project Tanzania, a maternal and newborn health project funded by UKaid through OPTIONS Consultancy LTD UK. ", "The analysis is part of the E4A efforts to understand maternal death reviews in Tanzania and contribute evidence to inform the on-going review of the national maternal and perinatal deaths review guidelines. ", "We offer special thanks to the administration of Bugando Medical Centre for permission to use the hospital data and colleagues in the department of Obstetrics and Gynaecology for providing clarifications on some issues. ", "Our sincere appreciation to all hospital staffs for assisting variously: labour ward, operating theatres, mortuary and medical records.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.0007316978881135583, 0.0006370813935063779, 0.012938815169036388, 0.00060208176728338, 0.001468488946557045, 0.0015771293547004461, 0.0006318300147540867, 0.004870513454079628, 0.000612078991252929, 0.0006440790020860732, 0.0006163662183098495, 0.0005839123041369021, 0.0006488192593678832, 0.0005787298432551324, 0.0005494084907695651, 0.0005600321455858648, 0.0005813454044982791, 0.0005630521918646991, 0.0006172485882416368, 0.000792950508184731, 0.00127974315546453, 0.0005386195261962712, 0.0011404217220842838, 0.0005951772327534854, 0.000529950310010463, 0.0006343164714053273, 0.0007653955253772438, 0.0006455852999351919, 0.0005941030103713274, 0.0007707833428867161, 0.0009189116535708308, 0.0005319359479472041, 0.0006398173281922936, 0.023720571771264076, 0.0006052363896742463, 0.0006221286021173, 0.000523179944138974, 0.0005889544845558703, 0.0005442994297482073, 0.0005528247565962374, 0.0005579869612120092, 0.0005649637896567583, 0.0005495488294400275, 0.0007082141237333417, 0.0006539495661854744, 0.0005479835672304034, 0.0006352835916914046, 0.0006132886628620327, 0.0007012395071797073, 0.0006228185375221074, 0.01484922505915165, 0.0012429185444489121, 0.0007133634644560516, 0.0017188977217301726, 0.0007405038340948522, 0.0008800207870081067, 0.0010861471528187394, 0.0008585110772401094, 0.0006929869996383786, 0.0006204974488355219, 0.0025920183397829533, 0.0007606293074786663, 0.0008979260455816984, 0.0006120133912190795, 0.00065480952616781, 0.0005663062329404056, 0.0005949977785348892, 0.0006071956595405936, 0.0005908934399485588, 0.0006292962934821844, 0.0005760371568612754, 0.000770053593441844, 0.0005813525640405715, 0.00061124621424824, 0.0007719690329395235, 0.000564855057746172, 0.0006569194956682622, 0.0005377782508730888, 0.0014008451253175735, 0.0005803809617646039, 0.0005494694923982024, 0.0005167180788703263, 0.0005639208829961717, 0.0005495185032486916, 0.000550325436051935, 0.005358417052775621, 0.0007173871854320168, 0.0006474538240581751, 0.0006503037293441594, 0.0005528535111807287, 0.0005471104523167014, 0.0005704475333914161, 0.0008408140274696052, 0.0006118208984844387, 0.0005799595965072513, 0.0006214556051418185, 0.0005421250243671238, 0.0007509953575208783, 0.0005722225178033113, 0.0005712362471967936, 0.0034004012122750282, 0.001022498239763081, 0.0005440636305138469, 0.0006127511151134968, 0.0006219827337190509, 0.000588287424761802, 0.0005617156275548041, 0.0005590969230979681, 0.0005398564389906824, 0.0005538936238735914, 0.0005709289689548314, 0.0006228529382497072, 0.0005104524898342788, 0.001995444530621171 ]

[ "Tiempo de Amar\n\nTiempo De Amar (1996) is Menudo's 36th album (23rd in Spanish).", "\n\nIt features Abel Talamántez, Alexis Grullón, Andy Blázquez, and new members Didier Hernández from Cuba, and Anthony Galindo from Venezuela. ", "Didier and Anthony replaced Ashley Ruiz and Ricky López after they both decided to leave the group. ", " This was the last album recorded under the Menudo name. ", "Creator Edgardo Díaz had sold the name to a Panamanian company, so the group's name was changed to MDO. ", "After this, Andy Blázquez left the group and was replaced by new member Daniel René Weider.", "\n\nWith Daniel, the group recorded their first album under the group's new name. ", " The album was self-titled MDO. ", "Daniel left the group in 1998. ", "Although management looked for a new member and, in fact, Ricky López rejoined the group for a few months, they finally decided not to replace Daniel. ", "Later that year, the band released their second album under the new name, featuring Abel, Alexis, Didier, and Anthony, titled Un Poco Más. ", "This was the only record the group released with only four members. ", "In 2000, Anthony left the group. ", "That same year management recruited two new members: Pablo Portillo from Mexico and Troy Tuminelli of Italian descent. ", "With these two new boys, the group released their third album under their name MDO, titled Subir Al Cielo. ", "In 2001, management decided to let Troy go because he was not fitting in with the others, he could not sing and was having problems learning the groups choreographies. ", " New member Caleb Avilés joined the band that same year and their first English album under the name MDO was released, titled A Little Piece Of Heaven. ", "Caleb left the group in 2002 and so did long-time member Alexis Grullón, leaving Abel, Didier, and Pablo as a trio. ", "Anthony Galindo rejoined the group in 2002 to help the guys finish with presentations management had already booked and later that year, the guys decided to call it quits for good. ", "In 2005 Menudo/MDO creator, Edgardo Díaz decided to revive MDO and held auditions. ", "The new group consists of four members: Luis Montes, Elliot Suro, Daniel Rodríguez, all from Puerto Rico, and Lorenzo Duarte from Venezuela. ", "Their first album is titled Otra Vez released that same year. ", "An acoustic version was also released titled Onda Acústica. ", "Edgardo Díaz also put together another group with younger kids using the same formula he used with Menudo. ", "The group's name is Tick Tock.", "\n\nTrack listing\nTiempo De Amar\nDónde Está Tu Amor (Alejandro Jaén) [4:42] - Singer: Alexis Grullón\nTe Amaré (Alejandro Jaén) [3:33] - Singer: Alexis Grullón\nTiempo De Amar (Remi Palacios, Joe B. Jacob) [4:24] - Singer: Didier Hernández\nNo Entiendo (Gustavo Márquez) [3:09] - Singer: Didier Hernández\nHe Venido A Pedirte Perdón (Juan Gabriel) [4:38] Singer: Alexis Grullón\nBuscando Un Amor (Alejandro Jaén, William Paz) [3:24] - Singer: Abel Talamántez\nBésame (Alejandro Jaén, William Paz) [3:37] - Singer: Andy Blázquez\nSolos Tú Y Yo (Alejandro Jaén, William Paz) [3:32] - Singer: Andy Blázquez\nMás Y Más (Fernando Osorio) [3:21] - Singer: Anthony Galindo\nHablar De Amor (Crossover Love) (Fernando Osorio) [4:12] - Singer: Didier Hernández\nUna Limosna (Samuel Sosa, Chico Amaral; Versión en Español: Alejandro Jaén) [3:28] - Singer: Anthony Galindo\nSoy Todo Un Enredo (Samuel Sosa, Chico Amaral; Versión en Español: Andrés Blázquez) [3:03] - Singer: Abel Talamántez\n\nCategory:Menudo (band) albums\nCategory:1996 albums" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0008923047571443021, 0.0006929675000719726, 0.0007872284622862935, 0.001154696918092668, 0.0006749401218257844, 0.0008413914474658668, 0.000619404308963567, 0.0007234220975078642, 0.0007917152252048254, 0.0006752588669769466, 0.0007249389891512692, 0.0008201524615287781, 0.0008403790416195989, 0.0005894337664358318, 0.0009333008783869445, 0.0008059657411649823, 0.0007535064360126853, 0.0007603332633152604, 0.0006439954740926623, 0.0006284880801104009, 0.0005773321026936173, 0.0007649664185009897, 0.0006476256530731916, 0.0009933566907420754, 0.02494916506111622, 0.0007401486509479582 ]

[ "Coast Guard Seek Input on Ocean Guardian\n\nMonday, March 10, 2003\n\nThe Coast Guard will hold listening sessions around the country beginning the end of March seeking input from all sectors of the fishing industry on its fisheries law enforcement strategy, especially as it relates to current fisheries trends and future challenges.", "\nAt the listening sessions, the Coast Guard will discuss its fisheries strategic plan, known as Ocean Guardian, which outlines the Coast Guard’s strategy for effective and professional fisheries law enforcement. ", "The Coast Guard enforces fisheries laws and regulations in the 200-mile Exclusive Economic Zone (3.4 million sq.mi.) ", "and on the high seas.", "\nOcean Guardian is revalidated every five years to ensure it is properly aligned with domestic and international enforcement needs. ", "The Coast Guard encourages commercial and recreational fishers, managers, conservationists, and enforcement partners to participate.", "\nThe listening sessions will consist of a brief presentation on Ocean Guardian followed by a facilitated discussion of issues. ", "During the discussion, all participants will be given the opportunity to identify and comment upon important issues affecting the industry now or in the future. ", "They will also be asked to express their ideas for improving the Coast Guard’s fisheries law enforcement strategy. ", "Interested persons who are unable to attend the listening sessions may send comments via e-mail through a special Ocean Guardian website, http://www.uscg.mil/hq/g-o/g-opl/mle/LMR/htm. ", "A copy of the current Ocean Guardian Strategic Plan, and a report on key outcomes from each listening session can also be found at the site." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005125571042299271, 0.0005164460162632167, 0.0006042951135896146, 0.0006760525284335017, 0.0005636178539134562, 0.0005958831170573831, 0.0005129006458446383, 0.0005214334814809263, 0.0005298169562593102, 0.0005314230802468956, 0.0005139663117006421 ]

[ "The present invention relates to an improvement in trace element analyzers utilizing a plasma and used in material and biological sciences for quantitatively determining a trace element such as a plasma source mass spectrometer and a plasma emission spectrometer, and more particularly to an improvement in a plasma generator which utilizes microwave discharge and is used as the plasma sources of the above-mentioned trace element analyzers.", "\nAn example of a conventional microwave induced plasma source is described on pages 583 to 592 of Spectrochemica Acta, Vol. ", "37B, No. ", "7, 1982. ", "FIGS. ", "2A and 2B show the structure of this example. ", "In FIGS. ", "2A and 2B, reference numeral 1 designates a coaxial cable connector for applying a microwave, 2 a microwave coupler, 2' a tuner for the coupler 2, 3 a tuner for adjusting the length g of a gap between the tip of an inner tube 3' and a thin plate 4, 5 a tuner for adjusting the length of a cavity 6, 6' the wall of the cavity 6, 7 a quartz discharge tube, 8 a sample gas, and 9 an inlet for a cooling gas (for example, air).", "\nThis plasma source can be used for analyzing a gaseous sample, but does not pay sufficient attention to the analysis of a liquid sample. ", "Thus, there arises a problem that the kind of a sample to be analyzed is limited. ", "Further, the above example has problems that a sample introduction efficiency is low and the ionization efficiency of an introduced sample is also low.", "\nIn more detail, as is apparent from FIGS. ", "2A and 2B, microwave power for producing a plasma is supplied to the cavity 6 through a coaxial cable. ", "Hence, the microwave power supplied to the cavity is 500 W at most, and it is impossible to analyze a liquid sample directly. ", "Moreover, a large power loss is generated in the coaxial cable. ", "Further, the coupler 2 has a complicated structure, and it is not easy to adjust the coupler 2.", "\nAdditionally, the plasma formed in the above example is based upon a surface wave. ", "Hence, it is impossible to generate a plasma having the form of a doughnut, sufficiently. ", "Further, the mixture of a sample and a plasma gas is supplied to the discharge tube. ", "Accordingly, the sample introduction efficiency is low, and the ionization efficiency of the introduced sample is also low. ", "Thus, the detection limit of a trace element (that is, sensitivity for the trace element) is low." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0005479316459968686, 0.0006386780878528953, 0.0009291517199017107, 0.0007161105750128627, 0.0007230330375023186, 0.0005618060822598636, 0.0006768503226339817, 0.00066744553623721, 0.0005689648678526282, 0.000633697141893208, 0.0006248679710552096, 0.000596481142565608, 0.0007525754044763744, 0.000753800559323281, 0.0008122067665681243, 0.0006012067315168679, 0.000643629755359143, 0.0007198238163255155, 0.0006521794712170959, 0.0005812706076540053, 0.0006671685841865838 ]

[ "Sweet bread pudding’s one thing, but we brought the much-loved dish to the dinner table with this recipe for savory bread pudding. ", "Bites of butternut squash, fresh sage, and Gruyere cheese provide the flavor for this easy to prepare casserole, which bakes in the oven for right around an hour. ", "That window gives you plenty of time to work on the rest of the meal. ", "Or, better yet, make our Butternut Squash Bread Pudding to enjoy with a slow-cooker roast, and you’ll have a blissful hour to relax under a blanket on the couch or sip a hot tea. ", "The perfect antidote to chilly fall evening." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0007223756401799619, 0.0013481412315741181, 0.0007490244461223483, 0.0022268930915743113, 0.0006931626703590155 ]

[ "Q:\n\nSum vector with number by dinamic intervals without looping\n\nI have dinamic intervals in a Data Frame generated by calculation of percentage of my data, like below:\nStart Finish\n 0.00 0.86\n 0.87 0.89\n 0.90 0.98\n 0.99 1.00\n\nI have a vector with about 3000 numbers that I want to obtain how many numbers I have by each interval without using a Loop because is too much slow.", "\nNumbers<-c(0.1,0.2,0.3,0.7,0.8,0.9,0.91,0.99)\n\nExpected result in this case: 5,0,2,1....\n\nA:\n\nYou can use apply() to go though your start-finish data.frame, check if the numbers are between start and finish values and sum up the logical vector returned from data.tables' between() function.", "\nNumbers<-c(0.1,0.2,0.3,0.7,0.8,0.9,0.91,0.99)\n\nsf <-\nread.table(text = \n\"Start Finish\n0.00 0.86\n0.87 0.89\n0.90 0.98\n0.99 1.00\",\nheader = TRUE\n)\n\napply(sf, 1, function(x) {\n sum(data.table::between(Numbers, x[1], x[2]))\n})\n\nThis will return:\n5 0 2 1\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007731045479886234, 0.000755518616642803, 0.0012598226312547922 ]

[ "Pleocoma octopagina\n\nPleocoma octopagina is a species of rain beetle in the family Pleocomidae. ", "It is found in North America.", "\n\nReferences\n\nFurther reading\n\n \n\nCategory:scarabaeiformia\nCategory:Articles created by Qbugbot\nCategory:Beetles described in 1970" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.005179747007787228, 0.0009184936643578112, 0.0006298135267570615 ]

[ "Four Seasons Silver, Middletown, DE Town Information, and Market Report\n\nReal Estate in Four Seasons Silver, Middletown, DE\n\nFour Seasons Silver is a premier housing development on the northwestern outskirts of Middletown, Delaware. ", "The community is a beautifully constructed neighborhood with lovely townhouses and excellent amenities. ", "Properties in Four Seasons Silver are single-family townhouses with ample parking space, multiple rooms, open floor designs, incredible front yards, and spacious backyards. ", "A lovely place to call home perfect for families looking for a move-in ready house in Middletown.", "\n\nProperties for sale in Four Seasons Silver, Middletown, DE.", "\n\nFour Seasons Silver, Middletown, DE Amenities\n\nThe Four Seasons Silver neighborhood is built with amazing amenities included with the homes in the community. ", "Residents can enjoy the beautifully landscaped green spaces mixed with the townhouses as well as paved sidewalks perfect for evening strolls and morning jogs. ", "The clubhouse and swimming pool are available for homeowners who plan on holding casual events. ", "Locals have easy access to a commercial district along Dupont Parkway where grocery stores and eateries are on hand. ", "The community is also a short drive from Downtown Middletown and the many commercial establishments in town.", "\n\nWhat Schools are available for Four Seasons Silver, Middletown, DE Residents?", "\n\nSchool options are abundant in this primarily residential region. ", "Residents can enroll their children in nearby schools west of the neighborhood or in Downtown Middletown. ", "Public Schools in the area are part of the Appoquinimink School District with several schools ranking very well in comparison to other schools in Delaware. ", "You would want to check out Cedar Lane Elementary School, Alfred G Waters Middle School, St. Georges Technical High School, and many more.", "\n\nMiddletown, DE Neighborhood Report\n\nPopulation: 19,910 (2014)\n\nEstimated median household income: $88,554 (2016)\n\nEstimated median house value: $284,172 (2016) Middletown, DE Market Report Properties currently active on the market: 5\n\nMedian Listing Price: $350,000\n\nPrice per square foot: $130\n\nMedian Closing Price: $330,000 There are currently five homes for Sale in Four Seasons Silver, Middletown, DE If you would like to receive a FREE Competitive Market Analysis, contact me today. ", "Let Me Help You Find Your Four Seasons Silver, Middletown, DE Home! ", "Click the link to find a complete list of Homes for Sale in Four Seasons Silver, Middletown, DE. ", "If you are a buyer, it is important to have the assistance of a Buyer's Agent to represent you during the transaction. ", "If you need additional assistance or would like to schedule a showing, contact our office at 302-685-4042. ************************************************************************************", "\n\nPOSTED BY\n\nRay Petkevis\n\nReal Estate Team\n\n755 N. Broad St.\n\nMiddletown, DE 19709\n\n302-685-4042\n\ninfo@derealtygroup.com" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006050849915482104, 0.0005577583215199411, 0.0006211157306097448, 0.0006165809463709593, 0.0005970530910417438, 0.0005597472190856934, 0.0008265564101748168, 0.0006590541452169418, 0.0006132839480414987, 0.0005860868259333074, 0.0006077621947042644, 0.0005650163511745632, 0.0006260023219510913, 0.0007442618953064084, 0.0005658565205521882, 0.000530859048012644, 0.0008676803554408252, 0.0006322860717773438, 0.000547153758816421, 0.04243514686822891, 0.0007358862785622478 ]

[ "A delayed Y2K bug has bitten hard at some 30 million holders of German debit and credit cards, making it impossible for them to use automatic teller machines and point-of-sale terminals since New Year's Day.", "\n\nMultiple news agencies said the outage stemmed from card chips that couldn't recognize the year 2010. ", "The DSGV, an association representing German banks, said engineers were working diligently to fix the problem, but a full resolution might not come until Monday.", "\n\nThe outage affected 20 million EC, or electronic cash, cards, which act as debit cards, and 3.5 million credit cards, according to the DSGV. ", "A separate bank association known as BDB said about 2.5 million of its cards suffered from the same problem and another 4 million cards issued by Germany's cooperative banks were at least partially touched.", "\n\nThe reports are the latest to involve the inability of computers to properly handle the 2010 date. ", "Just after midnight on New Year's Day, Symantec's Endpoint Protection Manager stopped accepting updates after it was hit by its own 2010 date bug. ", "Soon after the first of the year, SpamAssassin began blocking huge amounts of legitimate email because they included the 2010 in their headers, a date so far off the spam filter assumed they had to be junk.", "\n\nKaspersky software also experienced massive update problems on December 30, according to support forums, but it's not clear the new year had anything to do with them.", "\n\nThe German payment card snafu hit a variety of banks, although customers of Deutsche Bank reportedly were not affected. ", "More from the AFP and Dow Jones is here and here. ", "®" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0007528730784542859, 0.00060915487119928, 0.0006096836877986789, 0.0008808827842585742, 0.0006256990600377321, 0.0006743075209669769, 0.0008247657679021358, 0.0037088932003825903, 0.0006410970818251371, 0.0018102946924045682, 0.0007002678466960788, 0.0008392215822823346 ]

[ "BoB’s Johannesburg branch suppressed alerts of suspicious activity in the politically influential Gupta family’s complex web of bank accounts\n\nSenior Bank of Baroda (BoB) officials suppressed numerous alerts filed by junior officials at the Johannesburg branch about transactions in accounts controlled by the Gupta brothers of the Sahara group, whose financial dealings resulted in the resignation of South African President Jacob Zuma.", "\n\nThese alerts or suspicious activity reports (SARs) were voided by BoB managers and thereby never reached the South African Financial Intelligence Centre, an investigation by The Hindu and the Organized Crime and Corruption Reporting Project (OCCRP) has found.", "\n\nCorporate maze\n\nOver 17,000 transactions of the BoB’s South African operations since January 2012, as well as internal communications, show that the bank continued to allow the Gupta brothers to operate a web of accounts to create a complex corporate maze even as the political scandal about their influence on Mr. Zuma was playing out.", "\n\nThis continued even after other banks terminated their dealings with the brothers in 2016. ", "Their accounts received payments from state-run enterprises against bills that are under scrutiny, moved large sums of money abroad and shifted equally large sums between accounts of a clutch of shell companies.", "\n\nPresident Zuma’s fourth wife Bongi Ngema Zuma, who was gifted a house by the Guptas, was on the payrolls of a Gupta firm for a staggering $12,300 monthly salary, making her one of the higher paid private sector executives in the country.", "\n\nThe South African government’s Asset Forfeiture Unit (AFU) told a local court on February 23 that much of the money that the Guptas received in the BoB accounts was illegal.", "\n\nSenior government officials have confirmed to The Hindu that the BoB has sought the Central Vigilance Commission’s nod for initiating “major penalty” proceedings against two of its officials, including the former CEO of South African operations. ", "However, no criminal investigation is under way yet, they say. ", "BoB has decided to shut down its South African operations in the wake of the scandal.", "\n\nIn response to queries from The Hindu-OCCRP, the BoB said: “The South African operations of the Bank have always been, and continue to be conducted in accordance with the laws and regulations of the home and host country regulators.”" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0005851856549270451, 0.0006644058739766479, 0.0005964677548035979, 0.0006302350666373968, 0.0005752032157033682, 0.0007285650353878736, 0.0008583519957028329, 0.0006487082573585212, 0.0007185007561929524, 0.002265722956508398, 0.0005652193794958293 ]

[ "Xena & Gabrielle fighting for solidarity, acceptance and equality. ", "And the best, I went as Xena's Gabrielle this year.", "\n\nPhoto credit: Viki Secrets\n\nVienna Pride flag in front of the famous equestrian statue of Archduke Charles of Austria at Vienna's Heldenplatz (Heroes' Square).", "\n\nHi, Regenbogenparade was a blast. ", "I went as Xena's Gabrielle this year, which was also a premiere for me and Xena. ", "Styling took some time and since we were a bit late ;) we went directly to the Vienna Pride Village at Heldenplatz, which was the start and destination point of the parade. ", "Since 2012 the parade goes in a complete circle (counterclockwise) around the Vienna Ring Street.", "\n\nMe as Xena's Gabrielle ;P\n\nFunny t-shirts in one of the Pride shops at Heldenplatz.", "\n\nRisque outfit on roller skates ;P\n\nTable dance at the Pride village :P\n\nDrinking cocktails :P\n\nMe as Gabrielle ;P Photographed by Xena ♥\n\nI am the truth of who you are. ", "Our souls are united, Xena.", "\n\n— Gabrielle\n\nVienna Pride panorama at Heldenplatz.", "\n\nDid you know that Xena & Gabrielle are often regarded as a couple in the lesbian community and that Xena, the Warrior Princess, is also an icon for many women (and men)?", "\n\nRelated stories\n\nVienna Pride 2011\n\nLife Ball 2013: 1,001 Nights\n\nXena's Photo Art Exhibition" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006392910145223141, 0.0007196063525043428, 0.0005714306025765836, 0.021709686145186424, 0.00068908731918782, 0.0005641636089421809, 0.00064257369376719, 0.0014633001992478967, 0.0014386093243956566, 0.0040098801255226135, 0.0006344013963826001, 0.0012404508888721466, 0.0006914212135598063 ]

[ "Connect+Learn\n\nLos Angeles, CA: In MediaPlanet’s London Technology, Andy Khawaja, discusses the current state of his e-commerce merchant services and payment processing solutions company, Allied Wallet, and his opinions on the fintech industry and London as a global tech hub.", "\n\nIn the Allied Wallet CEO’s interview, he revealed his motivation for starting the business and the challenges he faced in bringing it to life.", "\n\nAndy Khawaja told MediaPlanet, “I didn’t see anything that made [the internet] easy and secure for consumers to conduct online transactions using credit cards or other types of payment. ", "That gave me the motivation to build the technology to make it happen.”", "\n\nKhawaja’s interview is very positive overall, as he tends to be. ", "Khawaja is as inspired as he is inspiring, and he continues to maintain excitement for what is to come.", "\n\n“Technology is about being creative, so when you come up with a great idea, don’t put it off,” Khawaja said, “…there are lots of young, talented and smart international entrepreneurs…give them the chance and these people can change the world.”" ]

{ "pile_set_name": "Pile-CC" }

[ 0.000556180311832577, 0.0005498745013028383, 0.0006397185497917235, 0.0006089681992307305, 0.0005527575849555433, 0.0005335112218745053, 0.0006951751420274377 ]

[ "Q:\n\nWhats the proper tab order for invalid inputs?", "\n\nFor accessibility reasons, the first invalid input in a form ought to be focused upon form submission. ", " This prevents the non-sighted user from being forced to hunt for the invalid inputs.", "\nMy question pertains to tab order. ", " After the first invalid input is focused, when the user clicks tab again, should the focus go to the next invalid input or just the next element in the normal tab order?", "\nTake this pseudo code for example. ", " If input numbers 2 and 4 have errors, when the form is submitted then focus will be moved to input number 2. ", " The next time the user presses the tab key does the focus go to input 3 or 4?", "\n<input id=\"1\">\n<input id=\"2\"> <-- invalid\n<input id=\"3\">\n<input id=\"4\"> <-- invalid\n<input id=\"5\">\n<button type=\"submit\">\n\nA:\n\nFocus the next element in the normal tab order. ", "Tab order should remain 1-2-3-4-5.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.000771468912716955, 0.000558734405785799, 0.0008640000596642494, 0.0006425199098885059, 0.0006002191221341491, 0.0009598475298844278, 0.0006082855397835374, 0.0008380124345421791, 0.0008840754744596779, 0.0007146610878407955, 0.001995444530621171 ]

[ "Ofta när jag blir överväldigad av antalet män i samma rum eller lokal som mig visar det sig vara cirka 50/50 män/kvinnor. ", "Det är bara att ja..." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.16389577090740204, 0.03793126344680786 ]

[ "1. ", "Field of the Invention\nThe present invention relates to a gas compressor for air conditioning in automobiles, buildings, etc. ", "which is adapted to compress a gas, such as a refrigerant gas, and discharge it.", "\n2. ", "Description of the Related Art\nExamples of a gas compressor for air conditioning in automobiles, buildings, etc. ", "include a vane rotary type gas compressor, which will be described with reference to FIG. ", "13. ", "The vane rotary type gas compressor includes a gas compressing portion, which has a cylinder 5 whose inner periphery is cylindrical, a front side block 6 and a rear side block 7 which are situated at the axial ends of the cylinder 5, a rotor 11 rotatably arranged in the cylinder 5, and vanes 15 accommodated in vane grooves in the rotor 11 so as to be capable of advancing and retreating. ", "The rotor 11, the vanes 15, and the cylinder 5 define cylinder compression chambers. ", "The above components are contained in a front housing 1a and a rear housing 1b. ", "The front housing 1a has a refrigerant suction port 2, and the rear housing 1b has a discharge port 3. ", "Provided in the front housing 1a is a suction chamber 4 communicating with the suction port 2, and the suction chamber 4 communicates with the cylinder compression chambers. ", "Further, a discharge chamber 8 communicating with the cylinder compression chambers is provided in the space defined by the rear side block 7 provided in the front portion of the rear housing 1b and the rear portion of the rear housing 1b. ", "\nFormed in the rear side block 7 are discharge holes 7a communincating with the cylinder compression chambers, discharge passages 7b, and a release hole 7c provided to the discharge chamber 8. ", "The gas compressed in the cylinder compression chambers is released to the discharge chamber 8 through the release hole 7c. ", "In the discharge chamber 8, it is necessary to separate oil contained in the compressed gas released from the release hole 7c. ", "In this regard, the gas compressor is provided with a screw type compressor using a demister 30 in order to enhance the efficiency in oil separation. ", "The demister 30 is provided perpendicularly with respect to the direction in which the gas flows, and, while having a certain thickness, is formed as a flat plate when seen in section taken along the gas flow direction.", "\nIn the gas compressor shown in FIG. ", "13, when the rotor 11 is rotated, the volume of the cylinder compression chambers is varied, and a refrigerant introduced through the suction port 2 and the suction chamber 4 is compressed in the cylinder compression chambers. ", "The compressed refrigerant is discharged from the compression chambers, and released to a release-portion-side space 8a of the discharge chamber 8 through the discharge holes 7a, the discharge passages 7b, and the release hole 7c, the oil contained in the compressed gas being separated by the demister 30. ", "The separated oil drips and gathers in an oil sump 18, and the compressed gas from which the oil has been separated is discharged to a discharge-port-side space 8b of the discharge chamber 8, and is further carried from the discharge port 3 to an external air conditioning system through discharge piping (not shown). ", "The refrigerant which has been discharged to the exterior circulates through the air conditioning system and returns to the suction port 2 of the gas compressor to be compressed again in the cylinder compression chambers and further discharged into the air conditioning system. ", "By repeating this operation, air conditioning is continuously effected. ", "Due to the difference in pressure between the suction chamber 4 and the discharge chamber 8, the oil in the oil sump 18 is sent from an oil supply hole 9 provided at the bottom of the rear side block 7 to sliding portions and gap portions of the gas compressing portion, serving to prevent wear in the compressor and functioning as a seal in the form of an oil film. ", "In this process, part of the oil joins the compressed gas and moves with the same. [", "Patent Document 1 JP 11-294362 A]\nAs compared with the other types of compressors, e.g., the swash plate type, scroll type, and screw type ones, the vane rotary type compressor is smaller and lighter in weight. ", "However, due to the large difference in pressure between the adjacent compression chambers, it is subject to leakage of the refrigerant gas (inner leakage) between the adjacent compression chambers. ", "Thus, in the vane rotary type compressor, it is necessary to effect sealing by using high viscosity oil in order to prevent this inner leakage. ", "As a result, the mixture gas consisting of the refrigerant gas and oil mist and discharged from the compression chambers exhibits high viscosity. ", "Due to its high viscosity, the mixture gas undergoes, when it strikes the demister, an increase in frictional force when passing therethrough due to the oil adhering to the demister, with the result that the load on the demister due to the jet stream thereto increases. ", "As a result, there may be a case where the demister fails to maintain its form and is pushed away in the gas flow direction (to the downstream side) to undergo a reduction in its density, resulting in a marked deterioration in oil separation efficiency. ", "Further, when the oil exhibits an extremely high viscosity because of its low temperature as in the case of operation start or when a liquid refrigerant is compressed, the oil from the compression chambers strikes the demister in the liquid state. ", "In such case, due to the large force of the jet stream, the demister undergoes not only deformation but breakage. ", "Generally speaking, oil used in a refrigerant compressor exhibits a kinematic viscosity as follows. ", "The viscosity of the mixture of oil and refrigerant during operation varies according to the kind of refrigerant, temperature, pressure, etc. ", "The ratio of the viscosity of the mixture of oil and refrigerant during operation in a vane rotary type compressor to that in other types of compressor is much the same as the ratio of the kinematic viscosity of the oil alone (refrigeration oil) in a vane rotary type compressor to that in other types of compressor as shown in Table 1. ", "The temperature of the mixture gas after compression in normal operation is approximately 70 to 110° C., whereas the temperature thereof at the operation start ranges from −35 to 40° C.\nTABLE 1KinematicOil for vane rotaryOil for swash plate type,viscosity of oiltypescroll type and screw type 40° C. 60-350 mm2/s15-55 mm2/s100° C.13-25 mm2/s  5-12.5 mm2/s" ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0009391900966875255, 0.0005584480240941048, 0.002303800778463483, 0.001185585861094296, 0.0005505903973244131, 0.0005821094382554293, 0.0011604013852775097, 0.0006620835047215223, 0.0005938080721534789, 0.0006298320950008929, 0.0013362475438043475, 0.0006917326827533543, 0.0006596045568585396, 0.0007839036406949162, 0.0006358665996231139, 0.0006707761203870177, 0.0006492602988146245, 0.0005702023627236485, 0.000672012974973768, 0.0006501597235910594, 0.0007458278560079634, 0.0007137589855119586, 0.0007945074466988444, 0.000606769579462707, 0.0008464015554636717, 0.0005984437884762883, 0.0006373965297825634, 0.0007305541075766087, 0.000782053277362138, 0.0008685422362759709, 0.0008004187257029116, 0.0006070894305594265, 0.0007284213788807392, 0.0007175304344855249, 0.0008257216541096568, 0.0008460367098450661, 0.0007318369462154806, 0.0006544096977449954 ]

[ "Il peut être frustrant d'être un fan de Nick Kyrgios\n\nNick Kyrgios is extremely talented. ", "The world No. ", "24 just won his second title this year, at the Citi Open, defeating his double partner and good friend, another next gen sensation, Stefanos Tsitsipas. ", "His relationship with the Greek talent is one of many that speaks to his likeable side on the Tour.", "\n\nHe’s also been spotted cheering on another ‘mate,’ Andy Murray, in his first singles match after his second hip surgery, in Cincinnati.", "\n\n❌ Seats reserved for ❌\n\nPresident and Vice President of the @andy_murray” fan club western southern open>\n\nThe 24-year-old Australian also has a side to him that is quite endearing, such as his entertaining antics during the final in Washington, D.C.\n\nThis week has been a better love story than Twilight. ", "pic.twitter.com/zEoz8ptvzX” ben rothenberg>\n\nKyrgios has spent plenty of time through his foundation on children’s mental health and has been caught plenty of times hanging out with young players and taking time out to spend with kids.", "\n\nFor all his faults, he is liked by plenty in the locker room, although I doubt that includes Rafael Nadal or Novak Djokovic.", "\n\nBut being a fan of this prodigious talent can be extremely frustrating, after watching his latest tirade during the Karen Khachanov match.", "\n\nOne can’t help feeling exasperated that he is throwing away his enormous talent. ", "There’s no excuse for the litany of abuse that was expressed during the event, which began with ball abuse, culminating with calling the chair umpire Fergus Murphy a “f****ing tool”.", "\n\nThe multitude of fines totaled a record $113,000, assessed by the ATP. ", "You can see the full list here:\n\nATP statement on NK….@CincyTennis” rob koenig>\n\nAnd it’s not over, with the ATP still considering if an additional fine will be levied.", "\n\nThe six-time ATP title winner may be looking at a ban from the sport. ", "A two-month ban would knock him out of running at the U.S. Open. ", "Since the ATP now sanctions the Laver Cup—where he is being heavily marketed as a big draw at the team event—it will be interesting if he will be prevented from participating.", "\n\nAll of his titles have been won on hard courts and if he’s banned for the rest of the year, it will be a big blow to his tennis season. ", "Nick Kyrgios has collected two ATP titles this year, but with each flash of brilliance, a litany of tantrums has followed, including violations at Roger’s Cup last week, Queen’s Club in June, an eight-week ban in 2016, just to name a few.", "\n\nThe paradox of Kyrgios can be found in his running list of code violations. ", "Will Nick Kyrgios be banned from the sport? ", "News on the situation should be forthcoming in the next few days. ", "It’s clear that the ATP is looking to send a strong message to the Australian.", "\n\nHis fans are hoping that at some point the childish antics will cease and the disciplined version of the world talent will emerge again, evidenced at Citi Open and Acapulco earlier this year. ", "Once can only hope, because the outbursts are not only irritating his fans, they are also destroying all the success he’s achieved." ]

{ "pile_set_name": "Pile-CC" }

[ 0.008035802282392979, 0.0013351204106584191, 0.0007998267537914217, 0.0007128290017135441, 0.0008499150862917304, 0.0007423759088851511, 0.011231908574700356, 0.0017810617573559284, 0.0008283648057840765, 0.0010578411165624857, 0.7184741497039795, 0.0005908691673539579, 0.0008245139033533633, 0.000925833301153034, 0.004800820257514715, 0.0006667194538749754, 0.021840538829565048, 0.0006805835291743279, 0.0007009021355770528, 0.0018961437745019794, 0.0007140610250644386, 0.0006476216367445886, 0.0007046852842904627, 0.0009641062351875007 ]

[ " \n# Johnnie\n\n### Dorothy B. Hughes\n\n_for Holly_\n\n_who also writes mysteries_\n\n_for Tony_\n\n_who reads them_\n\n# Contents\n\nOne\n\n2.", "\n\nTwo\n\n2.", "\n\n3.", "\n\nThree\n\n2.", "\n\n3.", "\n\nFour\n\n2.", "\n\n3.", "\n\nFive\n\n2.", "\n\n3.", "\n\nSix\n\n2.", "\n\n3.", "\n\nSeven\n\n2.", "\n\n# One\n\nTHERE WASN'T ANY SIGN saying this was it. ", "Just like there wasn't any sign saying it was Friday night and May, a nice balmy night that didn't need any overcoat to bother you when you prowled. ", "This was it all right. ", "New York. ", "The heart of New York. ", "Broadway.", "\n\nThree of them stood there, right in the middle of the sidewalk. ", "They didn't pay any attention to the people walking at them and around them and away from them. ", "They didn't even pay any attention to the babes digging them as they swished by. ", "They stood there, Bill and Hank and Johnnie.", "\n\n\"This is the Great White Way,\" Bill announced.", "\n\n\"Don't look white to me,\" Hank said. \"", "Kind of a dirty gray.\"", "\n\n\"It's the brownout,\" Bill told him. \"", "We're in a war, soldier. ", "Don't you know nothing, soldier?\"", "\n\nJohnnie said, \"I want to ride on the subway.\"", "\n\nThe other two looked at him. ", "Bill sighed. \"", "There he goes again.\"", "\n\nHank stood five feet eleven and one half inches in his G. I. shoes. ", "He had black hair and a big knuckly fist. ", "He said \"Pipe down, soldier.\"", "\n\nJohnnie stood six feet two inches in his G. I. shoes. ", "He didn't duck. ", "But he winced. \"", "I only said I wanted to ride on the subway.\"", "\n\nBill wasn't as tall as Hank but he was the one with the guide book to New York City in his head. ", "Besides he'd already been here on one pass. ", "He said, \"Listen, Johnnie, in the first place you don't ride on a subway like on a merry-go-round. ", "You ride in, like in a train.\"", "\n\n\"Choo-choo. ", "Get it, soldier?\" ", "Hank demanded. \"", "You rode in a train all the way from Texas to New Jersey, didn't you? ", "Didn't you? ", "Now can't you pipe down?\"", "\n\n\"I've never been on—in—a subway. ", "I always wanted to ride on—in—one.\"", "\n\n\"Listen, Johnnie.\" ", "Bill was patient. ", "He planted himself in front of Johnnie, blocking more sidewalk, and Hank planted himself beside him. ", "Johnnie looked down at both of them. ", "They looked tough and they looked exasperated. ", "All because he wanted to ride on a subway.", "\n\n\"Listen, we got to be back in camp by Sunday morning, don't we? ", "We got thirty-three hours.\" ", "Bill looked at his watch. \"", "Thirty-two hours and forty-seven minutes. ", "And time off that to get back to camp. ", "We got just that long to see New York. ", "And you want to ride in a subway!\"", "\n\nHank snorted.", "\n\n\"I still do,\" Johnnie allowed. \"", "Gee, I don't know what my dad and my mom and my kid sister and my kid brother would think of me if I came to New York and didn't ride on the subway. ", "We used to talk about it all the time back home in Texas.\"", "\n\nThe two tough faces weren't weakening. ", "No milk of human kindness dripping out. ", "Johnnie changed tactics. \"", "Listen, why can't I ride on the subway while you guys go to the broadcast and the Stage Door Canteen and all the places you want to go?\" ", "He warmed up to it. \"", "I'll just take me a little ride and then I'll meet you any place you say.\"", "\n\nBill looked at Hank. ", "Hank looked at Bill. ", "They looked at each other as if something smelled. ", "They looked at Johnnie.", "\n\n\"You'll get lost,\" Bill said sternly.", "\n\nJohnnie picked it up fast. \"", "How can I get lost?\" ", "He argued, \"You get on and you ride. ", "You stay on and you come back where you started. ", "All you got to do is get off where you got on. ", "You can't get lost.\"", "\n\n\"You would,\" Bill stated.", "\n\n\"I couldn't.\" ", "Johnnie had them wilting now. ", "He stuck to his guns. \"", "Even if I did, where do you think we are, Boona Boona? ", "New Yorkers speak English, don't they? ", "I could ask 'em, couldn't I?\"", "\n\nHank put in his oar. \"", "F'go'sakes, Johnnie, you don't mean you'd rather ride in a hole in the ground than go to the Stage Door Canteen? ", "Dorothy Lamour might even be there.\"", "\n\n\"She lives in Hollywood,\" Johnnie told him.", "\n\n\"I saw her picture at the Stage Door Canteen,\" Hank declared. \"", "Anyhow there's lot of girls there. ", "Chorus girls!\" ", "He whistled. \"", "Subway!\" ", "He snorted again.", "\n\n\"I still want to ride a subway. ", "Gee, I don't know what Jimmie, my kid brother, would say if I couldn't tell him about riding on a subway—\"\n\nBill interrupted. \"", "Listen. ", "Suppose we let you go. ", "We're just wasting our time standing here flapping, Hank. ", "Suppose we let you go and we mosey up to the broadcast. ", "Would you promise not to get lost? ", "Would you promise to meet us in an hour at the Stage Door Canteen?\"", "\n\n\"I promise,\" Johnnie grinned.", "\n\n\"And you won't buy the Brooklyn Bridge?\"", "\n\n\"Do you think I'm a hick?\" ", "Johnnie demanded. \"", "Don't answer that.\"", "\n\n\"Or the Empire State Building?\"", "\n\nHe didn't deign a reply to that one.", "\n\n\"Where you got your folding dough?\"", "\n\n\"In my shoe. ", "Where'd you think?\"", "\n\n\"How much in your pockets?\"", "\n\nJohnnie investigated. \"", "Two dollars.\" ", "He counted. \"", "And ninety-seven cents. ", "Four nickels, see?\"", "\n\n\"Don't spend it all,\" Bill advised. \"", "Now listen. ", "It's seven twenty-two. ", "You be at the Stage Door Canteen—no—\" He looked at Hank. \"", "He'll never find it.\" ", "He turned back to Johnnie. \"", "You meet us at the Astor, front door.\" ", "He jabbed a finger in the black topcoat unfortunately passing them. \"", "Scuse me. ", "There it is across the street. ", "See it. ", "Astor. ", "A-s-t-o-r. At nine o'clock. ", "Don't be any later than that.\"", "\n\nHank said, \"What a cluck. ", "Sweating out the subway.\"", "\n\n\"You won't get lost?\" ", "Bill insisted.", "\n\n\"Don't worry about me.\" ", "Johnnie grinned all over his face now.", "\n\n\"Nine o'clock, front door of the Astor.\"", "\n\nNine o'clock, the Astor, Johnnie repeated. ", "His eyes weren't paying any attention to old Bill now. ", "They were roving to the subway kiosk by the newspaper stand over there. ", "People diving into the door and other people popping out of it. ", "Like a magician putting rabbits in a hat and pulling out chickens. ", "He'd seen it happen once on the stage at the high school auditorium back home in Texas.", "\n\nHank had the last thing to say. ", "He said it ruefully.", "\n\n\"Tain't safe, Bill.\"", "\n\n## 2.", "\n\nJohnnie put his hands in his pockets, felt for a nickel, took a breath and dived into traffic. ", "He made it to the island where the subway opening stood. ", "He didn't bother to watch the departure of Bill and Hank. ", "Couple of old women. ", "Just because he'd got lost in Newark waiting for a train. ", "That had been purely accidental. ", "Just because Hank had been to school in Tulsa, he thought he was big time. ", "Just because Bill was from Omaha, he thought he knew his way around any place. ", "Well, he, Johnnie had been to Dallas a couple of times himself. ", "And anybody could have got lost in Newark on Decoration Day. ", "He wouldn't get lost tonight. ", "There wouldn't be any parades tonight. ", "If there were, he'd stand still and watch, not follow a baton twirler. ", "He was bait for baton twirlers. ", "Particularly blonde ones.", "\n\nJohnnie kept his nickel in his hand as he ducked into the doorway. ", "It wasn't so easy then. ", "The subway wasn't standing on a track, waiting. ", "He even had a sneaky feeling maybe Bill and Hank had been right after all. ", "Maybe he shouldn't have wandered off from them. ", "Maybe he was just a hick. ", "That feeling didn't last. ", "He found his way. ", "He started down the stairs. ", "He found where to drop a nickel. ", "He went around corners and followed arrows and climbed up and down more stairs. ", "He took his time, not like all these people darting around like polliwogs in a pool of water. ", "He had plenty of time. ", "A whole hour and a half before he had to meet the guys again. ", "A whole hour and half to take a subway ride.", "\n\nHe finally reached the place where the subway train ran. ", "Right under a big sign, black letters on white. ", "Johnnie craned his neck to read it. ", "Times Square. ", "He was starting out from Times Square. ", "All he had to do was come back to Times Square. ", "A pipe. ", "Johnnie was exceedingly content.", "\n\nHe stood there and observed a couple of trains. ", "He didn't pay any attention to the three girls digging him. ", "He wanted to get the full feel of a subway before he got on for a ride. ", "Besides there'd be better looking girls at the Stage Door Canteen. ", "He wanted to know what he'd look like when he was inside one of those trains. ", "He wanted to know how about getting inside. ", "He figured it out easy. ", "When the door slid open you pushed in, no ticket or nothing. ", "Then you grabbed a strap or sat on a wicker seat or leaned against the door after it slid closed. ", "The train rumbled away out of sight down a long tunnel. ", "He could go that far watching. ", "When he was well filled with it, he moved up nearer the edge of the platform. ", "He waited for the next train with the blissful anticipation of a small boy, and with only the slightest apprehension of something so radically new.", "\n\nIt was coming now. ", "First you heard the roar. ", "Then you saw the two green eyes, or the green and red eyes. ", "Then the train rushed up, quieted, finally stopped moving. ", "The magical doors opened. ", "And Private Johnnie Brown walked inside, just as if he were used to subways.", "\n\nThe car was fair to middling crowded, not any sardine in a can crowd, but enough so that Johnnie had to hold to a strap. ", "He didn't mind that. ", "It made it more fun than just sitting down. ", "And the strap was easy on his hand; he didn't have to strain his seams like the five by five beside him. ", "He got a kick out of watching the walls slide by, the lights blink, the jerk whenever the train stopped. ", "It was like being in a movie. ", "A movie of New York. ", "He got such a kick out of it that he didn't pay any attention to all the other folks riding, most of them reading papers anyhow. ", "He didn't even notice until past Columbus Circle that the pudgy guy beside him was talking German. ", "When he first noticed it, he didn't rightly notice. ", "It just seemed like part of being in a movie. ", "Then he woke up that it really was German. ", "Johnnie hadn't ever heard it spoken except in movies, movies about Nazis and spies, but he knew it was German all right. ", "It was like listening to someone talk and clear their throat all at once.", "\n\nHe took a good look at the five by five then. ", "A little fat fellow, about fifty maybe, with a moon face that should have had a handlebar mounted over the fat mouth. ", "Maybe he had had one once; under his button nose the skin wasn't as weathered as on the cheeks and forehead. ", "The man had on a dark suit and a pepper and salt topcoat. ", "His black derby was too big for him; it sat down on his ears. ", "Johnnie looked below to the fat man's shoes; you could usually tell whether a guy had folding money by his shoes. ", "This one didn't have much. ", "His feet were little and splayed out like a duck's. ", "The shoes were black with pointed toes and even a shine wouldn't have made them look too good.", "\n\nBy that time Johnnie was catching some words, and clear words like Munich, spitting out the ich, and Potsdam. ", "There were other words that sounded like nothing at all. ", "Totenkopfverbaede. ", "Sicherheitsdrentl. ", "Not Hitler. ", "Maybe the fat man wasn't a spy after all. ", "But he hadn't ought to be giving out with enemy flap. ", "It just didn't sound good. ", "Somebody ought to tell him it didn't sound good.", "\n\nJohnnie had about made up his mind that he might say something to Pudgey when he happened to remember that the guy wasn't talking to him. ", "And unless he was a nut, he wasn't talking to himself. ", "The woman holding the strap on the other side of the man had a newspaper covering her face. ", "She couldn't be it. ", "That left the man sitting down in front of Pudgey. ", "Johnnie took one look and knew that was the one. ", "His face looked like he had indigestion or was about to have it; long thin nose, long thin cheeks, long pointed chin. ", "His eye, the one Johnnie could see, was like a glass eye. ", "No more expression than that. ", "He was dressed better than the fat one. ", "His derby fit him. ", "His black overcoat had a velvet collar. ", "Everybody in New York seemed to wear overcoats even if they didn't need them. ", "This guy's feet belonged to him, the gray spats were clean and the black shoe tips had a high polish. ", "His gray gloves were clean. ", "He didn't look like the subway. ", "Pudgey did. ", "His fat hands had dirty fingernails.", "\n\nThe thin one wasn't doing any talking, just nodding every once in a while to show he wasn't a stiff, or maybe it was the subway that jerked his head. ", "But the thin one could be a Nazi. ", "If there'd been a monocle over that glass eye, Johnnie would have known he was one. ", "He couldn't make up his mind about these two; he only knew they hadn't ought to talk the enemy language with a war on. ", "The more hochs and achs and ichs he heard, the more it annoyed him. ", "He had really made up his mind to say something when the car pulled up into another station. ", "The fat man pushed to the door, the thin one stood up and followed him.", "\n\nJohnnie followed both of them. ", "He didn't think, at all then, just like when he followed the parade in Newark. ", "He simply walked on out the door after them.", "\n\nHe followed them up the soiled cement steps into the fresh air. ", "When he got up there he didn't know what to do next or why he'd done this much. ", "They'd crossed the street to the left, the near side, and were heading back downtown. ", "The fat one was still talking.", "\n\nJohnnie rubbed his ear. ", "He didn't know what to do. ", "He finally decided. ", "Being as he'd gone this far he might as well finish it up. ", "He'd tell that guy to stop talking German. ", "They were half way down the block before Johnnie started loping after them. ", "He could have caught up easy enough but his first spirit dwindled. ", "What could you say to two perfect strangers, that is, in a nice way. ", "Easy enough to tap old Pudge on his shoulder and say, \"Listen, Bub. ", "Speak United States. ", "Don't you know we're in a war?\" ", "But that might spell trouble. ", "And trouble was one thing Uncle Sam's uniforms were supposed to stay out of in the city. ", "Sure as there'd be trouble, two M. P.'s, clubs and all, would pop out of the manhole cover and little old Johnnie Brown wouldn't be at liberty to see Grant's Tomb and the Statue of Liberty and the Empire State Building tomorrow. ", "No, it had to be done in a polite way.", "\n\nBy now Johnnie knew it had to be done. ", "He wasn't taking this walk for the exercise. ", "He'd walked enough in the last few months to last him a lifetime. ", "Every time he thought about walking, his dogs started barking. ", "Yet here he was walking on his pass and it wasn't going to be for nothing. ", "Besides he'd have to have some excuse for being late at the Astor. ", "If he hurried it up, maybe he wouldn't be late.", "\n\nAt that moment the small fat and taller thin turned left at the corner. ", "Johnnie speeded up again. ", "They'd crossed to the right of this street and were trotting past a row of houses, long, tall houses, each one exactly alike and each one looking like something out of an old fairy tale book. ", "A whole street of fairy tale houses, with only little chinks of light showing under the window shades. ", "Not very friendly looking. ", "Johnnie slowed again. ", "He might scare these guys if he went up now and tapped their shoulders. ", "If someone pawed his back in the dark, he'd turn and slug. ", "He looked over his shoulder quick but nobody was behind him. ", "Quite a ways back was a guy cruising down the street minding his own business. ", "That was all.", "\n\nJohnnie faced front again. ", "This time he heard it distinct. ", "Hitler. ", "The thin one was saying it, \"Hitler,\" maybe even, \"Heil Hitler.\" ", "If so, Johnnie'd missed the Heil part of it. ", "Hitler was enough. ", "It made Johnnie mad. ", "He was sure now these goats were spies and he knew he was going to do something about it. ", "He was a soldier in the United States Army and if he was worth his salt he wasn't going to let a couple of Nazi spies walk around loose. ", "He'd knock their heads together and drag them to the nearest police station. ", "Two against one didn't bother him. ", "He'd had some Commando training back at the camp in Texas. ", "Besides he was bigger than both of them together.", "\n\nWhile he was seeing red, the two men were climbing up the stone steps of one of the houses in the middle of the block. ", "Pudgey was still talking while he pushed a doorbell. ", "Before Johnnie could make it to the steps, the door opened a yellow streak. ", "Pudgey said something. ", "Someone inside made a sound like, \"Errdorp.\" ", "The guys went inside. ", "The streak of yellow blacked out.", "\n\nJohnnie walked on by. ", "He marched past identical houses and then the street ended, like that. ", "He turned right about face and marched back six houses; he'd counted them. ", "There was only one thing to do. ", "See if he could get inside that house. ", "If he couldn't he'd at least get the street number. ", "You couldn't see a thing from here on account of the brownout.", "\n\nHis G. I. boots clapped up the steps. ", "He stuck his finger in the doorbell, left it there. ", "Finally the yellow streak showed up again. ", "Standing inside it was a pasty-faced young squirt with a red necktie on. ", "Johnnie coughed. \"", "Errdorp.\"", "\n\nFor a moment it didn't look as if it were going to work. ", "The kid looked hard at him but he couldn't see much, peering out into the dark. ", "Then he said, \"Come in.\" ", "He stepped aside.", "\n\nJohnnie walked in. ", "Just like that. ", "He stood in a small hallway. ", "There was one light in the ceiling, dark red carpeting on the floors, dark red paper on the walls. ", "The staircase went right up a few paces from the front door. ", "There was one straight chair in the hall, an old-fashioned hall tree against the staircase, and a green china umbrella stand at the foot of the stairs. ", "There were four umbrellas sticking out of the umbrella stand. ", "There wasn't a sign of a derby or a coat on the hall tree.", "\n\nThe squirt was giving Johnnie a good look now, a suspicious one. ", "Mostly he was eyeing Johnnie's uniform. ", "He didn't do so well on Johnnie's face. ", "He had to crane up to it. ", "He finally asked, part suspicion, part just plain wondering, \"You are to see Herr Dorp?\"", "\n\n\"Yeah,\" Johnnie said. ", "Errdorp was either the fat guy or he was somebody that Pudgey was calling on. ", "Either way it didn't matter.", "\n\n\"Wait here,\" Squirt said. ", "He pulled aside the brown chenille drapes at the left and Johnnie went on in the parlor. ", "He heard the squirt going up the stairs.", "\n\nJohnnie felt fine as soon as he looked around the room. ", "It reminded him of Aunt Clotilda's parlor up in Pampa. ", "There was even a green velvet cover on top of the upright piano with little green balls of fringe dangling down over the music stand. ", "There were old-fashioned plush-covered chairs, two of them rockers. ", "There was a black sofa that looked hard as a rock and he bet it was. ", "The chairs and sofa had crocheted doilies pinned on them. ", "There was a worn red carpet all over the floor, with some scatter rugs over the wornest parts. ", "He didn't kick them up to make sure but he knew he'd find loose threads if he did. ", "Aunt Clotilda's carpet was that way. ", "The chandelier hanging from the ceiling almost bopped him on the head when he walked under it. ", "Four lights in it, converted from gas when electricity came in. ", "And a gas fireplace under a golden oak mantel with a lozenge-shaped mirror set in it.", "\n\nJohnnie stood in front of the mirror and stretched his mouth right and left. ", "He smirked pretty and then he made his mouth an O. He jerked off his garrison cap. ", "Mind your manners, soldier! ", "He stuffed it in his pocket. ", "He slicked back his yellow cowlick and said out loud, \"Damn.\" ", "Even a G. I. haircut couldn't take out all the curl. ", "Didn't curl so bad down home except in summer when he got sweated. ", "Back East with the ocean only a spit and a holler away, he couldn't keep it plastered down.", "\n\nOne thing in this room wasn't like Aunt Clotilda's. ", "She had pictures of the family in big gold frames. ", "Here there was a flower garden, and a castle on a river, and a sailing ship. ", "All in nice bright colors. ", "Johnnie turned back to the mirror. ", "He wrinkled his nose. ", "Then he stuck his right forefinger over his upper lip, puffed up his cheeks and squeaked, \"Heil Hitler.\"", "\n\nThe folding doors at the back of the room took that particular moment to go click. ", "Johnnie swung around. ", "He was blushing like sixty. ", "He knew it because even his ears were hot. ", "A girl was digging him from the opening. ", "Evidently she hadn't seen his imitation because she didn't look poisonous. ", "And she certainly hadn't known he was in the room. ", "If she had she wouldn't have stood there stock still with her big blue eyes flabbergasted on him.", "\n\nShe was a cute little half-pint. ", "Her legs were covered up in gray slacks ending with saddle oxfords and butter yellow socks. ", "Above the belt was a butter yellow sweater and she was built for sweaters. ", "She had yellow curly hair and a face sort of like Sonja Henie. ", "Not that cute. ", "Not even Sonja Henie could be as cute as Sonja Henie looked. ", "But this girl would come close to it.", "\n\nShe finally managed to get her mouth open. ", "What came out wasn't promising. ", "She gaped, \"What do you want?\"", "\n\nJohnnie might be cowed by the superior experience of his friends, Hank and Bill, but not by a babe. ", "In fact he had a slogan, paraphrased, which he employed in dealing with all females who were not wives, mothers or grandmothers. ", "It was: Never give a babe an even break. ", "He smiled cheerfully at this member of the sex. ", "He spoke with appreciation, \"Hi ya, Babe.\"", "\n\nShe came into the room on that and she clicked the doors shut behind her. ", "She hadn't paid any attention at all to his friendly advance. ", "She was if anything more menacing than before. ", "She demanded, \"What are you doing here?\"", "\n\nHe said, \"I'm waiting to see Errdorp.\"", "\n\n\"Herr Dorp? ", "Is he expecting you?\"", "\n\n\"He ought to be. ", "The Squirt\"—he jerked his hand toward the hall—\"went up to tell him ten minutes ago.\"", "\n\nHe had a small wince at the time lapse. ", "Bill and Hank would get to the Astor first. ", "They wouldn't like wasting time waiting. ", "And Hank could be plenty tough. ", "Johnnie took another gander at the babe and dismissed his conscience. ", "They wouldn't wait long. ", "They'd lost him before. ", "He smiled his best at her.", "\n\nShe wasn't paying any heed. ", "She was gasping again. \"", "He couldn't. ", "Herr Dorp is in conference.\" ", "She put her eye on Johnnie. \"", "Did Herr Dorp send for you?\"", "\n\n\"Well, not exactly,\" Johnnie admitted.", "\n\n\"Who are you?\" ", "It wasn't any simple question. ", "She was trying to figure out where she'd seen him before or what he was doing here or something.", "\n\nHe drew himself up. \"", "I'm Johnnie Brown and no cracks about Harpers Ferry. ", "I'm from Texas.\"", "\n\nShe demanded, \"Why do you want to see Herr Dorp?\"", "\n\nFat chance I'd tell you, sister, said Johnnie silently to Johnnie. ", "This babe was just gunning for a chance to show him the door. ", "He began, \"We-l-l, there's something I want to talk to him about.\"", "\n\nThe girl pushed back her shoulders. ", "The sweater fit even better that way. \"", "Herr Dorp can't possibly see you tonight, Private Brown.\"", "\n\n\"Private First Class Brown,\" he interjected. \"", "But you can call me Johnnie.\"", "\n\nShe went right on without a flicker. \"", "He is very busy. ", "If you will come some other time he would be glad to talk to you.\"", "\n\n\"Haven't got no other time,\" Johnnie told her. \"", "My pass is only good until Sunday morning and I got a busy day lined up for tomorrow. ", "Besides I'm a stranger. ", "I'd never find my way back. ", "I guess I'll just have to see him now. ", "Won't take but a couple of minutes.\" ", "He sat down on the plushy arm of the green chair.", "\n\nShe almost stamped a foot. \"", "I tell you he can't see you. ", "He is in a most important conference. ", "He won't have time to see you.\"", "\n\nJohnnie grinned. \"", "Reckon I'll wait and see what Squirt has to say when he comes downstairs.\"", "\n\n\"Theo isn't coming downstairs,\" she stated firmly. \"", "There's more important things for him to do right now.\"", "\n\n\"Did he tell Herr Dorp I was here?\"", "\n\n\"He didn't get a chance to open his mouth. ", "As soon as he came in he was given instructions—\" She did stamp her foot this time. \"", "Why am I telling you all of this? ", "It's nothing to you. ", "Now will you please get out of here. ", "Right now!\"", "\n\nJohnnie set the chair to rocking. \"", "Who are you? ", "Herr Dorp's daughter?\"", "\n\n\"I am not.\"", "\n\n\"What's your name?\"", "\n\n\"Will you please get out?\" ", "She softened just a little. \"", "Believe me, I advise you to get out—now.\" ", "She didn't say, \"while you can,\" but it was almost on the tip of her tongue.", "\n\n\"Before you call the police?\" ", "he asked. ", "He knew right away then that he wasn't going to get out until he had a heart to heart talk with this Herr Dorp. ", "There was some hanky panky here. ", "Even a guy from Texas could see that. ", "The way her eyes jumped when he said, \"police,\" and the way they looked quick to the brown chenille drapes. ", "He looked too but nobody was peeking through them. ", "He talked easy now, \"Because if you want to, you just go right ahead and call them. ", "There's nothing they can do to me. ", "I didn't break in. ", "The squirt—Theo—let me in.\" ", "He looked under his eyes at her. \"", "I'll even be pleased to tell the police what I want to talk to Herr Dorp about.\"", "\n\nShe put the tip of her tongue between her lips. \"", "Why don't you tell me?\" ", "she coaxed. \"", "If it's important I can take the message to Herr Dorp—\" She broke off.", "\n\nHe'd heard the car too. ", "She started on a run to the front windows. ", "When she passed Johnnie she gave him a push back toward the sliding doors. \"", "Get in there and don't make a light.\"", "\n\nHe didn't understand but he was used to taking orders. ", "That was the Army for you. ", "Especially orders from that top sergeant tone of voice. ", "He backed to the doors, slid them, kept backing.", "\n\nShe was peeking between the window curtains. ", "Her voice came muted but insistent over her shoulder. \"", "Watch out for the—\"\n\nShe didn't have to finish the sentence. ", "She didn't have to tell him to watch out for the buckets. ", "He'd found them. ", "There was a noise like the house crashing down but it was only he and the buckets. ", "Here in the dark he didn't know what he'd fallen into; he only knew it felt cold and gooey. ", "He said all the swear words he knew.", "\n\nShe'd run back to him and she was adding her share. \"", "I said, 'Watch out!'\" ", "she told him in disgust.", "\n\n\"Not soon enough,\" he complained. ", "He picked himself up clammily.", "\n\nShe was gazing upward. \"", "I guess they're too busy to investigate.\"", "\n\nHe took one step toward the light.", "\n\n\"Don't you come in here!\" ", "she warned. \"", "Don't you track that stuff in the parlor!\"", "\n\n\"What is it?\"", "\n\n\"Paste,\" she said.", "\n\nHe recognized it now, smell and unpleasant texture. ", "He shifted his feet. ", "They felt as if he was standing in a mess of taffy.", "\n\n\"Thank heavens that car went by,\" she continued. \"", "The paper hangers left their stuff. ", "They didn't get finished this morning.\" ", "She eyed him wearily. \"", "Now what can I do with you?\"", "\n\n\"If you'll tell that Herr Dorp—\"\n\nOne ear cocked toward the window, she broke in. \"", "Take off that suit.\"", "\n\nHe was alarmed. \"", "I can't do that. ", "It's against regulations.\"", "\n\n\"It certainly can't be regulations to walk around the streets drooling paste. ", "Take it off.\"", "\n\nHe moved warily nearer the lighted room, gazed downward at the damage. ", "He could feel it thick on his seat but he hadn't known that it also lay in gobs all over the front of his uniform. ", "It had even splashed up on his tie. ", "He didn't have words for what he was thinking. ", "An M. P. would have them.", "\n\n\"Take it off,\" she commanded. \"", "Quick.\"", "\n\n\"Then what?\"", "\n\nShe shook her head dolefully. \"", "I'll send it around to the little cleaner's on Columbus. ", "He's open late. ", "He can do something with it, I guess.\" ", "She didn't sound too hopeful. \"", "The shoes, too. ", "He'll do them for me.\" ", "She bristled. \"", "Don't just stand there. ", "Rudolph's due any minute. ", "He has an awful temper when things go wrong.\" ", "She raised her voice. \"", "Take off that suit!\"", "\n\n\"What'll I put on?\" ", "He just didn't know what to do.", "\n\n\"You can wrap yourself in one of those aprons the paper hangers left.\"", "\n\nHe wiped his hands on his pants, began unknotting his tie. ", "This was against regulations. ", "Only regulations didn't cover something like this. ", "One thing, he wouldn't dare appear in public looking like a paste pot. ", "The M. P.'s would pick him up for sure.", "\n\n\"Hurry,\" she urged.", "\n\n\"You tell that cleaner to hurry,\" Johnnie countered. \"", "I can't stick around here all night. ", "I got big things to do.\"", "\n\n\"I'll get one of Dorp's men to take it around right away.\"", "\n\nHe had the shirt off, bent over to his shoes.", "\n\n\"Don't worry,\" she assured him, not a bit friendly, \"I don't want you here any longer than necessary. ", "In fact, I don't want you here at all.\"", "\n\nHe stepped out of the shoes into a dry place. ", "His folding money was still safe in his sock. ", "His fingers fumbled at his belt, hesitated. ", "He gave her a look. \"", "Aren't you going to turn around?\"", "\n\nShe glared before she turned, then she ran back to the front windows. ", "He heard the car as he stepped out of the gummy pants. ", "He removed the wallet containing his identification papers. ", "He removed his cigarettes, his matches, his Scout knife. ", "She came running back to him. ", "She caught his hand.", "\n\nHe pulled back. \"", "Wait a minute. ", "I don't have that apron—\"\n\n\"Too late now. ", "You're an idiot, but come on.\" ", "She was pulling him and he understood it was important for him to cooperate, but fast. ", "He wasn't dressed for company. ", "He grabbed his stuff. ", "She dragged him over to the chenille, stuck her head out, and hand-led him across to the staircase. ", "She whispered, \"Just don't talk, That's all.\"", "\n\nHe couldn't have talked if he'd wanted to at the moment. ", "He was too loopy. ", "He'd never run into anything like this before, not even in the movies. ", "She didn't hesitate on the second floor but kept right on leading him, retracing the corridor soundlessly, up another flight of stairs to third. ", "Her knuckles rapped on the door at the right, front.", "\n\n\"Who is it?\" ", "Another babe inside.", "\n\n\"It's Trudy. ", "Open the door.\"", "\n\nThere were footsteps and the door opened, just a little. ", "Trudy said, \"I've got to dress fast. ", "Rudolph's here.\" ", "She pushed Johnnie inside. \"", "For God's sake, do something with this!\"", "\n\nThe door closed behind her. ", "Johnnie was in a bedroom. ", "Garbed only in striped magenta shorts, G. I. socks and dog tags, he was standing in a lady's bedroom. ", "And before him was one of the most gorgeous queens he'd ever laid eyes on.", "\n\n# Two\n\nTHIS WAS MORE THAN a bedroom. ", "It should be called a boudoir. ", "It was all fluffy white and solid gold. ", "Even the rugs were white. ", "There was nothing in it that belonged to the shabby parlor below.", "\n\nTrudy, the blonde number, had vanished completely. ", "But this substitute was a honey. ", "She was taller, slimmer, and had dark hair flowing down her shoulders. ", "Her eyes were queer, narrow, and as green as grama grass. ", "Her eyelashes stuck out about two feet, and her mouth and nails, even her toenails, were the color of strawberry jam. ", "Johnnie started blushing when he took in the toenails. ", "Because she certainly couldn't be called dressed. ", "She had on a fluffy white thing that wasn't even fastened, and the white satin criss-crosses on her toes were what the kid sister called mules. ", "Maybe this was one of those skin games he'd read about. ", "Well, he wasn't going to give up his hard-earned pay for any racket. ", "He'd dish out some Commando stuff first.", "\n\nThe green eyes weren't looking at him with any embarrassment or any particular surprise. ", "She said, \"You're late.\"", "\n\nJohnnie blinked.", "\n\n\"Dorp's men were all supposed to be ready before seven. ", "I don't know why Trudy put you off on me. ", "I'm not dressed either. ", "Is Rudolph actually here?\" ", "Her voice was kind of like sorghum, dark and thick, just a little foreign.", "\n\nHe began, \"Well, a car stopped in front of the house and—\"\n\nShe brushed his words aside. \"", "Then I've a few moments. ", "Rudolph wouldn't be in the first car.\" ", "She studied him out of those slant green eyes. \"", "Where's your uniform?\"", "\n\n\"It had an accident,\" Johnnie admitted. ", "She must have taken in his G. I. haircut and his dog tags to know he was a soldier. ", "He wished she'd concentrate on the hair not the ensemble. ", "His wallet and stuff didn't make much of a screen. ", "He wished she'd offer him a bathrobe or a barrel.", "\n\n\"You look it.\" ", "She frowned. \"", "What are those strings around your neck?\"", "\n\n\"Identification—\"\n\n\"Dorp thinks of everything. ", "Sometimes—What's your name?\"", "\n\n\"Johnnie Brown.\" ", "His toes curled on the white velvet rug.", "\n\n\"Johnnie. ", "I'll slip up to the wardrobe and get you another suit. ", "How tall are you? ", "Come here.\"", "\n\nHe didn't want to but he moved toward her. ", "She leaned against him. ", "Her hair smelled like cape jasmine. ", "The top of it touched his chin.", "\n\n\"Shoe size?\"", "\n\n\"Nine and a half.\" ", "This wasn't Johnnie Brown. ", "He'd gone to sleep on the subway and he'd better wake up, but fast.", "\n\n\"Sit down. ", "I'll be back in a moment.\" ", "She trailed out, closed the door.", "\n\nHe didn't sit down. ", "No irate husband was going to come barging in and catch him off guard. ", "He kicked the gold leg of a chair and yelped, \"Ow!\" ", "He wasn't asleep. ", "He must be asleep. ", "He rubbed his ear. ", "He looked at his hands, went over to the gold and white dressing table mirror and squinted at the reflection. ", "It was the same old face. ", "Freckles on the long nose, red cheekbones, redder than usual, blue eyes, yellow cowlick that curled whether it was cut G. I. or Texas. ", "He turned quick when the door reopened.", "\n\nThe beauty was back with a suit over one arm, black boots in one hand. ", "She threw the clothes on the ruffled white bed, dropped the boots, closed the door and turned the key in it. \"", "Put these on. ", "There's no time to waste. ", "Hurry.\"", "\n\nHe stood still in the middle of the floor. \"", "You mean—I should get dressed here—in your room?\"", "\n\nHer strawberry red mouth curved in disdain. \"", "If you're squeamish, go on in the bath. ", "You need some soap and water anyway. ", "That door. ", "But hurry. ", "They are here.\"", "\n\nHe picked up the clothes and the boots and went into the bath she'd pointed. ", "It was all gold and white too. ", "He had a feeling he hadn't ought to be doing this, putting on somebody else's clothes. ", "There were Army rules about wearing uniform. ", "But he didn't have a uniform at the moment and he certainly didn't want to go around in his underwear any longer. ", "Not before strangers. ", "Somehow this was like being in a game or a show, if it wasn't a dream. ", "You did things you wouldn't think of doing in your right mind. ", "The gal out there had an idea about something and this seemed to be it.", "\n\nSans pants and shirt, he called through the door, \"Hey, what's your name?\"", "\n\nShe said, \"I am Magda. ", "Hurry, Johann.\"", "\n\n\"Just plain Johnnie suits me, Princess,\" he called back. ", "That was it; she spoke like a princess, gave orders like one. ", "There was something peculiar about the whole setup. ", "He could catch on that far. ", "Two men talking German hadn't led him into any ordinary house. ", "He might as well get dressed and find out some more. ", "He lathered with the white perfumed soap, hands and face, dived for a towel that felt like velvet. ", "Some dump this even if the girls were kind of screwy. ", "Black shirt, black britches, black coat with silver snakes embroidered on the collar, black leather Sam Browne belt.", "\n\nHe got into the britches. \"", "What am I supposed to be, your chauffeur?\"", "\n\n\"Never mind that. ", "Hurry.\" ", "She said something like: Damn my hair.", "\n\nHe got into the shirt, black tie, coat. ", "He felt for his folding money, still there safe in the right sock. ", "Boots a little big but better than too small. ", "His wallet he slid into an inner pocket. ", "Knife in his pants. ", "Cigarettes handy. ", "He started to open the door then remembered she was dressing. ", "He called, \"Can I come out now?\"", "\n\n\"I wish you would. ", "You'll have to hook my dress. ", "I can't imagine where Trudy's vanished to.\"", "\n\nHe blinked when he saw her. ", "She was something to pin up on the barracks wall. ", "She'd piled her hair on top of her head and she looked more like a princess than ever. ", "Her dress was all white skirts sprinkled with brilliants. ", "A little piece of white covered her breasts. ", "The white straps looked as if they wouldn't hold up a feather.", "\n\nShe pointed to the back end of the little piece of white. \"", "There.\"", "\n\nHe swallowed.", "\n\n\"Hook it.\"", "\n\nHis fingers were too big, besides they jittered.", "\n\n\"Hurry,\" she commanded.", "\n\n\"I am hurrying,\" Johnnie mumbled. \"", "These dang things are too small.\" ", "He got it done somehow and heaved a sigh of relief.", "\n\nHer green eyes examined him. \"", "You'll do. ", "Only stand up straight, like a soldier.\"", "\n\n\"I am a soldier.\"", "\n\n\"I know. ", "Stand like this. ", "Stiff. ", "That's better. ", "Where Dorp finds you young men, I don't know. ", "Just remember to keep quiet and do as you're told, then you'll be all right. ", "You carry my wrap, over your arm, like that, and my bag.\" ", "She laid the white velvet cape just so over his left arm, thrust the white velvet purse in his hand. \"", "You follow me. ", "One moment—\"\n\nShe went to her dressing table, opened a golden box, and pulled out a handful of stuff. ", "Johnnie didn't whistle. ", "His mouth merely pursed. ", "She hung four bracelets on one wrist and three bigger ones on the other. ", "The rocks in them would put out your eyes. ", "On her ring finger she slipped a ruby, big as a reflector.", "\n\n\"Now. ", "We won't wait for Trudy. ", "She's probably been called downstairs. ", "Come along and remember, don't speak unless you're spoken to. ", "Ottomkopf is a terrible stickler for discipline.\"", "\n\n\"Yes, Princess,\" he grinned.", "\n\n\"And don't do that,\" she said sharply.", "\n\n\"Do what?\"", "\n\n\"Don't smirk.\" ", "Her green eyes were harassed. \"", "Don't smile at all.\"", "\n\nHe grinned again. \"", "Not just a little one?\"", "\n\nHer face was suddenly angry. \"", "Do as you're told!\"", "\n\n\"Okay, Princess,\" he said.", "\n\nShe seemed about to explode but she didn't. ", "She only said, \"Don't call me that,\" and she muttered, \"Wait until I see Dorp. ", "And Trudy.\"", "\n\nHe followed her to the staircase. ", "She gathered her skirts and floated down with dignity, one hand just touching the balustrade. ", "He followed, not so lightly. ", "At the foot of the stairs she turned a warning glare. ", "Then she smoothed it off until her face was a beautiful picture. ", "She floated across to a double door. ", "There were two guys outside it, one on each knob. ", "One had yellow hair like Johnnie's, not curled, and one had brown hair. ", "Neither one was as big as Johnnie. ", "Their faces were screwed up tight, not a smile in a faceload. ", "When Magda floated between them, the two acted like jumping jacks. ", "They bowed to her and they bowed to each other and they swung open the door.", "\n\nNot until he was following Magda into the room did Johnnie notice. ", "Those guys had had on chauffeur suits just like his, even to the silver snakes on the collar. ", "The reason he took notice then was because there were so many suits just like that already in the room. ", "Otherwise he probably wouldn't have taken note; the room itself was knocking him loopy.", "\n\nThe first thing that hit him in the eyes were the three chandeliers. ", "They were probably made of cut glass but they looked like big hunks of diamonds. ", "The next thing he saw was Trudy and she was something to whistle at. ", "She had on white skirts like Magda's but instead of brilliants there were ermine tails spotting them. ", "The little white wisp above the waistline was even skimpier than Magda's. ", "The hardware on her wrists was brighter than the chandeliers.", "\n\nWhen he got his eyes off Trudy, Magda had already left him behind. ", "He stuck out his boot to follow per orders but Trudy's bracelets were wig-wagging him to stand still. ", "At least he gathered that was the signal. ", "Anyway he stood still and watched.", "\n\nMagda had floated up to a guy standing on a red velvet platform and she was curtseying to him just as if he were King of the May. He didn't look it. ", "He looked like the squirt, Theo. ", "Only he wasn't Theo. ", "Theo was wearing one of the chauffeur suits with his face screwed up like the jumping jacks outside. ", "As a matter of fact the King of the May had on one of the same kind of suits only his had a lot more silver embroidering it and there was a whole chestful of medals dangling on the front. ", "This guy was a little taller than Theo but he had the same pasty face, the same patent leather hair. ", "Johnnie figured it must be Rudolph, the one who had this house in such a tizzy.", "\n\nRudolph was smoking a cigarette in a three-inch long black holder with silver snakes on it. ", "He gave Magda a nod then turned up his nose as if she smelled bad instead of like cape jasmine. ", "Well, maybe he didn't like the smell of jasmine. ", "Johnnie did. ", "Reminded him of home, down around Corpus Christi way. ", "Every man to his own smells.", "\n\nBy that time Johnnie had located Dorp. ", "He was bursting the seams out of his white tie and tails. ", "Probably rented it. ", "His shoes still weren't good, the patent leather was wrinkled across the toes. ", "But Dorp—at least Pudgey was Dorp to Johnnie till he found out different—looked happy. ", "His fat face was bisected by a blissful smile. ", "He was the only one in the room wearing a smile. ", "The chauffeur squadron didn't even look human. ", "And Dorp's pal, the glass-eyed, hatchet-faced menace, looked more sour than ever. ", "He was standing beside Rudolph with a big ribbon across his middle, like pictures of the little New Year on magazine covers only the ribbon was red, and instead of a diaper he was wearing full dress like Dorp. ", "His gray head looked as if it needed a shave.", "\n\nThis room was really something. ", "The windows were covered with red velvet and all the chairs were red velvet. ", "The one on the platform had a canopy of red velvet with a golden crown and scepter embroidered on it. ", "Even the rug was red velvet. ", "If he hadn't just come down the stairs with Magda, Johnnie wouldn't have believed he was in the same house he'd entered half an hour ago. ", "This room and Magda's room certainly didn't fit with Aunt Clotilda's parlor downstairs.", "\n\nMagda came out of the curtsy just as if she were used to making one every hour on the hour. ", "She pulled out all the stops in her voice. ", "It throbbed. \"", "Rudolph, I cannot believe you are here at last. ", "You must tell me all of your travels, all the excitement. ", "But you are tired, my dear—\"\n\n\"I'm not tired,\" Rudolph put in. ", "He had an adenoidal tenor. \"", "And there wasn't any excitement.\"", "\n\n\"Ah, but your escape!\"", "\n\n\"It was dull.\" ", "Rudolph's lip pouted. \"", "I thought it would be exciting.\" ", "His beady black eyes glared at the man beside him. \"", "But it wasn't. ", "Herr Ottomkopf put me on the plane in Mexico City. ", "I flew to El Paso.\"", "\n\n\"You just come from El Paso?\" ", "Johnnie burst out happily. ", "He ceased. ", "The way everyone in the room turned on him he might have been announcing that he had a bad case of cholera. \"", "Well,\" he began in explanation.", "\n\nMagda was ice. \"", "Quiet,\" she commanded. \"", "I'm sorry, Rudolph.\"", "\n\nDorp's hands waggled. ", "He spoke English now but so thickly he reminded Johnnie of Captain Katzenjammer. \"", "I regret, Your Highness. ", "I regret much, but the draft it takes so many of our young men and we must train more, sometimes with such little time.\" ", "His voice oozed away under Rudolph's empty stare. ", "The silence was so rugged that Johnnie could feel his ears sizzling.", "\n\nRudolph's adenoids began again. \"", "From El Paso I had to come by train. ", "Unendurable!\" ", "He fanned his face with the cigarette holder. ", "He had a big ruby on his finger, too. ", "Johnnie never had liked guys who wore jewelry. ", "He knew for certain he wasn't going to like Rudolph. ", "Highness or no highness, let Rudy make one crack about Texas and he'd pop him one. ", "But Rudolph didn't. ", "He jabbed the cigarette at the glassy-eyed man beside him. \"", "If you could come by plane, Herr Ottomkopf, why must I endure days on the filthy train?\"", "\n\nOttomkopf bowed. \"", "For safety, Your Highness.\" ", "He had a worse accent than Herr Dorp. \"", "I have explain. ", "The incognito—\"\n\n\"I didn't like it,\" Rudolph said, and the steel spine of Ottomkopf wobbled just a trifle.", "\n\nMagda poured oil. \"", "It's all over now, Rudo. ", "From now on you travel by plane, the best planes. ", "Dinner is prepared. ", "Shall we—\"\n\n\"I'm not hungry,\" Rudolph said petulantly. ", "He popped his cigarette holder like a water pistol. ", "The stub fell to the carpet. ", "Herr Ottomkopf with no expression picked it up. ", "He passed it to the black suit next to him. ", "That guy passed it on. ", "Johnnie never did see who finally swallowed it. ", "He was looking at Trudy again. ", "Cute as a button, a Sonja Henie button, she was. ", "But she was on pins and needles about something. ", "It was making her blue eyes jump around. ", "It couldn't be that she was jealous of Magda taking over the great Rudo. ", "Nuts to that.", "\n\nHerr Ottomkopf fitted another long white cigarette into the long black holder. ", "He struck a match. ", "Nobody made a false move until the ritual of His Highness' cigarette was over and the first blast of smoke exhaled.", "\n\nMagda smiled. \"", "We have your favorite foods prepared, Rudolph. ", "I remembered each one.\" ", "Johnnie wasn't too dumb to catch that glint on Trudy's face. ", "She'd done the remembering, not the gorgeous Magda. \"", "Wienerwurst. ", "Head cheese and pickled walnuts. ", "And apple cake and champagne.\"", "\n\n\"I'm not hungry.\" ", "Rudolph repeated. \"", "I ate at the station.\"", "\n\nEveryone glared now at the Number One boy next to Ottomkopf. ", "He snapped his heels and, without relaxing his face, recited, \"It is true. ", "His Highness wishes to eat. ", "He eats. ", "I remain with him.\"", "\n\n\"I was hungry then,\" Rudolph explained loftily. \"", "I'm not hungry now. ", "I had a bowl of chile con came and a double chocolate malt.\"", "\n\nJohnnie winced. ", "The junk they called chile in any eating house east of Kansas City was slop for the pigs.", "\n\n\"Now I'm going to Ruprecht's party,\" Rudolph announced.", "\n\nThat one really threw them. ", "The big shots actually moved from their invisible chalk marks on the red rug. ", "Big stop signs were written all over their faces but nobody yelled, \"No.\"", "\n\nMagda finally cried, \"You can't do that!\"", "\n\nJohnnie found out then why everyone had kept quiet. ", "Rudolph's face turned to a regular neon sign, half green, half red. ", "Furthermore it took on the look of a particularly mean little oaf who had a mud ball in his fist and no one near enough to disarm him. ", "He closed his mouth tight and said nothing.", "\n\nDorp began dripping, \"What she means, Your Highness, is that with all the risks we have took, it is not wise you leave mine house until time we go to the Clipper.\"", "\n\n\"I'm going to Ruprecht's,\" Rudolph stated nastily.", "\n\n\"It's impossible.\" ", "Trudy was tiny but she stepped right up to him. \"", "Ruprecht himself agreed that it was wiser if he didn't try to see you. ", "We'd have had him here otherwise. ", "But the danger of him being followed—the F. B. I. follows him night and day.\"", "\n\n\"Ruprecht's at a party,\" Rudolph said. \"", "I'm going too. ", "I'm invited.\"", "\n\n\"He doesn't even know you're here!\" ", "Dorp's face was full of little rivulets running down into his fat neck.", "\n\n\"He does too,\" Rudolph countered. \"", "I telephoned him.\"", "\n\n\"You telephoned him!\" ", "This time they were kicked in the teeth. ", "They turned balefully as one man on the Number One boy.", "\n\nHe didn't flinch. ", "He clicked his heels and recited, \"It is true. ", "His Highness wishes to phone. ", "I remain outside. ", "He phones.\"", "\n\n\"And did you think of the F. B. I. waiting to apprehend His Highness?\" ", "Dorp shouted. \"", "Did you not know you were to come direct to headquarters from the train?\"", "\n\nRudolph mused, \"When I want to do something, I do it. ", "I want to go to Ruprecht's party. ", "And nobody's going to stop me.\" ", "He stuck out his chinless chin at the whole roomful.", "\n\nThat stymied them. ", "All but Trudy. ", "She said, \"Don't be an ass, Rudolph. ", "Ruprecht isn't alone. ", "He's a guest of Lessering.\"", "\n\n\"I know it. ", "Ferenz Lessering is my friend.\" ", "Rudolph blew smoke. \"", "I owe him one hundred fifty thousand rudls. ", "Or rather the kingdom does. ", "He'll be glad to see me.\" ", "His eyes popped. \"", "And I'm not an ass, Trudy.\"", "\n\n\"You are if you do anything so utterly, utterly—\"\n\n\"Icky,\" Johnnie supplied.", "\n\n\"Quiet!\" ", "Magda yelled. ", "She turned back to Rudolph. \"", "Don't you see it's a trap? ", "It must be a trap. ", "Ruprecht agreed—\"\n\n\"You're all being revoltingly stupid,\" Rudolph said. \"", "I am going to Ruprecht's party right now. ", "I like parties. ", "The Clipper doesn't leave until morning. ", "It is not yet eight o'clock. ", "What do you expect me to do until tomorrow? ", "Sit and eat wienerwursts!\" ", "He shuddered. \"", "Janssen!\"", "\n\nThe Number One jumping jack clicked again.", "\n\n\"My coat.\"", "\n\n\"If you insist on seeing your brother,\" Herr Ottomkopf gritted, \"I will attend you.\"", "\n\n\"And I,\" Herr Dorp sighed.", "\n\n\"Of course, I'll go with you, Rudo,\" Magda purred. \"", "If you really need to see Ruprecht so badly.\"", "\n\nJohnnie looked for Trudy to make it a quorum. ", "Somehow she'd slipped out of the room. ", "Probably while he was watching Janssen perform.", "\n\nRudolph drew himself up but he didn't protest. ", "Janssen helped him into a black coat that buttoned under his chin. ", "Janssen put on the patent leather hair a black dress cap, officers' cap. ", "Johnnie frowned. ", "He hadn't caught it before. ", "These weren't chauffeur suits; they were soldier suits. ", "But not of the U. S. Army. ", "His stomach teetered for the first time.", "\n\nDorp said, \"Wait. ", "Theo, you will come with me. ", "We must have coats for the men. ", "They cannot go into the street this way.\" ", "He paddled out. ", "Theo goose-stepped after him.", "\n\nMagda turned. \"", "My cape. ", "Johann! _", "Johnnie_!\"", "\n\n\"Who, me?\" ", "He'd been watching Rudolph pop another butt to the floor.", "\n\n\"Yes, you.\"", "\n\nHe brought it to her, laid it about her shoulders. ", "She looked daggers but she wouldn't stab him in front of the great Rudolph. ", "She pulled the hood over her head, took the velvet handbag, fumbled in it. \"", "My gloves. ", "One moment, Rudolph. ", "I forgot them.\" ", "Her smile would melt butter. ", "She swirled, made swiftly out the door.", "\n\nJohnnie turned, followed her. ", "She was almost at the head of the stairs before he started up. ", "But he had his orders. ", "Follow me. ", "He hesitated just a minute before he opened the door of her room. ", "Gloves might mean something like powder my nose. ", "Just the same he went in. ", "He wanted a word alone with her. ", "He couldn't go out on the street like this. ", "What if the M. P.'s spotted him?", "\n\nHe nearly backed out again fast. ", "She was standing in front of her fancy dressing table. ", "And she was just putting a little blunt-nosed shiny gun into the velvet purse.", "\n\n## 2.", "\n\nMagda saw his reflection in the dressing-table mirror. ", "She whirled her white skirts. ", "The velvet bag was closed now. \"", "What are you doing here?\" ", "she demanded.", "\n\nHe found his voice. \"", "You told me to trail you, Princess.\" ", "He burst out with it. \"", "What are you doing with that gun?\"", "\n\nShe held the velvet against her. ", "She spoke carefully. \"", "I think this is a trap. ", "There are certain people who do not want Rudolph to return to his country.\" ", "She flared, \"How dare you question me?\"", "\n\n\"Where is his country?\"", "\n\nShe had a pair of long white gloves and she began easing them over her wrist diamonds. \"", "Did you ever hear of Luxembourg?\"", "\n\n\"No'm.\"", "\n\nShe was impatient. \"", "Well, it isn't Luxembourg but it's near there. ", "If you've never heard of it, the name wouldn't mean anything.\"", "\n\nHe was suspicious. \"", "Not Germany?\"", "\n\n\"No, not Germany,\" she snapped. \"", "Come along. ", "I wouldn't trust that idiot not to go off and leave me here.\"", "\n\n\"Listen, Princess,\" he began.", "\n\n\"Come along,\" she commanded, shoving past him. \"", "And I told you to stop that Princess stuff.\"", "\n\nShe made time on the stairs but she didn't get away from him. ", "The others were gathered in the second floor corridor. ", "The soldiers had black coats covering up their uniforms. ", "Dorp was giving orders with his fat fingers. ", "The nails were still dirty. \"", "You will go in this car—you in that—\"\n\nMagda stated, \"I, of course, will go with Rudolph.\" ", "She gave him the big smile, put her hand under his arm.", "\n\nTrudy shoved a coat at Johnnie. \"", "Put this on. ", "Button it up.\" ", "She had a little short cape of ermine around her shoulders.", "\n\n\"I can't go with you,\" Johnnie told her under his breath. \"", "Not without my uniform. ", "Where's my uniform?\"", "\n\n\"It isn't back yet,\" Trudy muttered. \"", "You look all right. ", "You might as well come along. ", "I might need you. ", "And it'll be a good party.\"", "\n\nRudolph whined, \"What are we waiting for? ", "It's a supper party.\"", "\n\n\"You stick with Magda,\" Trudy ordered under her breath. \"", "You're her attendant.\" ", "Johnnie didn't get to say any more. ", "She slid back to Dorp and Theo, started with them down the stairs.", "\n\nThe squadron stood at attention on either side. ", "The two men who had been outside the throne room followed Dorp, Theo and Trudy. ", "After them went Ottomkopf and Janssen, Magda and Rudolph, with Johnnie bringing up the rear. ", "He didn't know what else to do. ", "If he lost sight of Trudy he might never get his uniform back. ", "He hoped the brownout was still working. ", "It'd be too bad if the M. P.'s spotted him now.", "\n\nThere were no strangers visible in the street. ", "Two cars stood at the curb. ", "The first was a Chevrolet sedan. ", "One jumping jack was at the wheel. ", "Theo climbed in beside him; Dorp and Trudy took the rear. ", "The big black limousine behind it had the other jumping jack in the driver's seat. ", "Ottomkopf took his place beside him. ", "Magda and Rudolph took up the back seat. ", "That left jump seats for Janssen and Johnnie.", "\n\nThe cars rolled away. ", "Johnnie took out his package of cigarettes. \"", "Smoke?\" ", "he offered Janssen.", "\n\nJanssen said sharply but softly, \"No!\"", "\n\nJohnnie lit his own. ", "Janssen looked horrified. ", "He was making gestures but Johnnie ignored them. ", "If they meant that Johnnie shouldn't have a cigarette that was too bad. ", "Rudolph was smelling up the car with his brand. ", "And Rudolph was complaining, \"I don't know that I like this plan at all, Magda.\"", "\n\n\"You want to reign, don't you?\"", "\n\n\"Yes, certainly I do. ", "That's the only reason I left Mexico. ", "I wasn't afraid of those men Otto was always burbling about. ", "I never laid eyes on them. ", "I liked Mexico. ", "I learned to eat chile. ", "I dearly love chile, Magda. ", "Who's going to make chile for me at home?\"", "\n\n\"Chile.\" ", "She almost snorted it. \"", "With a throne waiting.\"", "\n\n\"I came, didn't I? ", "But I don't like it. ", "How do we know it's safe?\"", "\n\n\"The enemy can't last another year, Rudolph. ", "You'll have to be on hand to take over, near, where you can fly over the border in a couple of hours.\"", "\n\n\"How do I know it isn't just a trick to get me back there? ", "Who is this dreadful little fat man, Herr Dorp, anyway? ", "Where did you find him? ", "How do we know he isn't working for Hitler, trying to get me to go back and be a puppet king? ", "I won't be a puppet king. ", "I'll run away again. ", "That's why I ran away before.\"", "\n\n\"And because you didn't like the bombs,\" she slurred.", "\n\n\"And no butter and no sugar and no coffee. ", "In Mexico—\"\n\nMagda's voice was sweet as molasses but underneath there was that glint she showed when she talked to Johnnie. \"", "You want to be king, don't you? ", "If you aren't there when the enemy is defeated, the people will elect a president. ", "How would you like to see your stableman, Kraken, president?\"", "\n\nJohnnie leaned around to put in his oar. \"", "Abraham Lincoln was born in a log cabin. ", "He made a good president.\"", "\n\n\"Who asked you?\" ", "Magda retorted. ", "Her green eyes widened in disgust. \"", "How did you get in this car?\"", "\n\n\"I'm following you,\" Johnnie said. \"", "Like you told me.\"", "\n\n\"I wanted you left behind. ", "You're stupid. ", "I meant to tell Dorp.\" ", "She shook her head. \"", "That's what comes of hurrying, upsetting everything.\"", "\n\n\"I didn't want to come. ", "That's what I wanted to tell you upstairs. ", "I have to—\"\n\n\"Keep quiet,\" she ordered.", "\n\n\"Okay, Princess.\" ", "He sighed back to the front.", "\n\n\"You are speaking to the Duchess Magda!\" ", "Rudolph thundered. ", "Only it came out a squeak not a thunder. \"", "Who is this oaf, Magda?\"", "\n\n\"I'm no oaf.\" ", "Johnnie swung back again with his fist doubled. \"", "I'm Johnnie Brown of Texas and if you know what's good for you, you'll button up your lip with that oaf stuff. ", "Before I paste you one—\"\n\nJanssen had swung to face him. ", "His hand might have been on a gun. ", "It was in his pocket.", "\n\nMagda spoke quietly. \"", "No violence, Janssen. ", "Remember, we're in New York.\"", "\n\nRudolph squeaked, \"This fellow—he is threatening me—me!\"", "\n\nMagda apologized. \"", "It is unfortunate. ", "I will tell Dorp. ", "So many new men, untrained. ", "He will be disciplined.\"", "\n\nJohnnie had a mouthful more to say but the car was turning in a gate now. ", "Two men on guard were talking to the chauffeur. ", "Johnnie looked out the window. ", "He could see the silver of a river below. ", "Must be Riverside Drive, he figured. ", "He'd seen pictures of it in the New York Sunday papers. ", "This big house set back from the street was evidently one of the few relics of days when New Yorkers lived in homes. ", "All around it were towering apartments.", "\n\nThe car passed inspection. ", "It followed the smaller lead sedan up to the porte-cochere. ", "Magda spoke to Johnnie as he waited to help her out of the car. ", "Her face was frozen. \"", "If you have any sense at all, you will keep quiet.\"", "\n\nJohnnie put out his chin which was far from chinless. \"", "I'll keep quiet so long as that false alarm doesn't start any more of that oaf business. ", "I'm an American and no tin horn prince is going to shove—\"\n\nShe didn't wait for him to finish. ", "Rudolph had been unpacked by then. ", "She left Johnnie with only a baleful green glare to remember her by. ", "He took a lungful of air and followed.", "\n\nA real butler opened the door, knee britches, silver tray on his hand, and all the fixings. ", "Dorp must have arranged things. ", "The butler didn't ask for tickets. ", "The entrance hall was massive with broad marble stairs leading to a marble balcony. ", "Johnnie goggled. ", "He'd never even imagined anything like this. ", "It was a regular palace. ", "From above there was music and chitter chatter. ", "The butler took all the wraps, handed them around to a flock of knee-britched assistants. ", "He led the way up the marble stairs.", "\n\nJohnnie was right on Magda's heels. ", "He hoped there would be a place to sit down upstairs. ", "He was getting tired of standing on his feet. ", "Enough of that at camp without wasting a free night that way. ", "The butler disappeared when they reached the balcony. ", "Some of the party milling about there looked pretty curious at them. ", "Johnnie didn't wonder. ", "It wasn't a fancy dress ball but this bunch looked it. ", "He eyed the marble benches along the wall but he couldn't make a break for it as yet. ", "The yellow velvet cushions were tempting.", "\n\nThe man who came out of the ballroom door weighed about two hundred and ninety pounds, but he stood six feet two in his stocking feet. ", "He was that much taller than Johnnie. ", "He had a face all pouches, a prissy mouth, thin brown hair and a voice like a high school girl's. \"", "My dear Rudolph,\" he burbled. \"", "This is an honor.\" ", "He fussed with his white tie while he talked. \"", "Magda, my love, how sweet of you to decide to come!\"", "\n\n\"Ruprecht invited me,\" Rudolph said nastily. \"", "The others insisted on coming too.\"", "\n\n\"But I wanted them. ", "I love them.\" ", "His great arm enveloped Rudolph's shoulders. \"", "Now where can Ruprecht be?\"", "\n\n\"He's over there, Ferenz,\" Trudy pointed.", "\n\nThe guy at the end of her finger was on a bench at the far corner of the balcony. ", "He was the one doing a little smooching with the platinum blonde babe.", "\n\n\"That's Ruprecht,\" Magda agreed with acidity.", "\n\n\"Let me fetch him.\" ", "Ferenz's tails switched half way to the bench before Ruprecht looked up. ", "When he looked up, he grinned. ", "He was one of the best-looking guys Johnnie had ever seen. ", "He looked like a movie actor, the kind the babes went all out for. ", "Maybe like Alan Ladd. ", "Tall, almost six foot, blond, blue-eyed, and poured into his full dress suit.", "\n\nHe left the babe flat and ambled past Ferenz to the group. \"", "Hiya, Rudo,\" he called. ", "He was a little popped, maybe more than a little. ", "He swayed when he clapped his brother's shoulder and he held on to it. \"", "See you brought the family.\" ", "He unloosed Rudy and beamed on Magda. \"", "Hiya, Beautiful.\" ", "He pinched Trudy somewhere for she jumped and said, \"Ow.\" \"", "Hiya, Toots. ", "Well, I didn't think old sourball Otto would let you come but here we all are together. ", "That calls for a drink.\" ", "He pulled Rudolph to the wide doors.", "\n\nFerenz lisped anxiously. \"", "Wait a minute, Rupe. ", "Just a minute, dear. ", "When Shanks informed me that Rudolph was here, I arranged a little—\" His face relaxed. ", "There was a roll of drums as he was speaking. ", "He nodded his head beatifically as the butler trumpeted, \"His Royal Highness, Prince Rudolph of Rudamia!\" ", "There were gasps, applause, and a lot of craning toward the balcony. \"", "Her Royal Highness, Princess Ermintrude of Trudamia. ", "Her Highness, Duchess Magda of Trudamia.\"", "\n\n\"And entourage!\" ", "Ruprecht murmured. ", "Entourage was a good fifty-buck word but it didn't throw Johnnie. ", "He was already thrown by Trudy stepping out on Ferenz's arm. ", "She should have looked like a midget hanging there but all of a sudden she really looked like a royal highness. ", "She must have done this kind of performance before. ", "The band struck up some kind of a march. ", "The party, led by Magda and Rudolph, set out. ", "Johnnie followed. ", "But as soon as the others were surrounded by simpering women and bowing men, Johnnie ditched the parade. ", "He'd seen the buffet over at the right. ", "He sashayed straightaway toward it. ", "He hadn't known for some little time what those funny feelings were in his stomach. ", "Now he knew. ", "Food. ", "The hamburgers he and Bill and Hank had put away at six o'clock weren't exactly a full meal. ", "This mess was a hungry guy's heaven. ", "Turkey and hams and a big pink rib roast, dishes full of everything.", "\n\nJohnnie heaved a plate at one of the gold buttons behind the table. \"", "Fill 'er up,\" he suggested. ", "From then on all he had to do was nod while Gold Buttons pointed to this and that and this. ", "When there were about three layers he said, \"Hold it.\" ", "He could come back for seconds, no rush for chow here. ", "Everybody was too busy babbling around the royal entourage. ", "Johnnie gathered up a napkin and a handful of silver. ", "Big white napkins, the kind Mom had for company dinners back home. ", "With a couple of fingers he managed to balance a cup of coffee. ", "Three lumps of sugar, and cream you could cut with a knife. ", "Ferenz must be (a) a farmer, (b) a hotel, (c) a hoarder in a big way.", "\n\nNobody paid any attention to Johnnie when he walked out of the room. ", "There wasn't anyone on the balcony now. ", "Johnnie picked the couch down below where Ruprecht had had the platinum babe cornered. ", "He sort of wished the babe had been left over. ", "But he didn't need her now. ", "He dived into supper. ", "When he'd worked his way through the first two layers he had time to think. ", "He wanted to think. ", "It was essential that he think. ", "Because he wasn't asleep. ", "He'd never fed this well in a dream.", "\n\nBeing awake the first question was, how had he come to get mixed up in this screwy business? ", "He was a little embarrassed by that one. ", "He was always getting mixed up in something. ", "Like the time in San Antonio when he—he blushed above his ears. ", "No sense getting sidetracked. ", "That babe had been a honey. ", "But there were no flies on Trudy. ", "On Magda neither, if she'd just stop pawing over Rudo, the goon, and be human. ", "Cut out the girl angle. ", "What was it all about?", "\n\nWell, they weren't Nazis. ", "Because they were waiting for Hitler to hit the banana peel and he for one hoped they were right about it going to be soon. ", "He'd like to finish up this war fast and get back home to Texas. ", "On the other hand why were they scared of the F. B. I. if they weren't Nazis? ", "And why did Dorp talk German to Ottomkopf in public? ", "And what about this royal highness stuff? ", "Who were they trying to kid?", "\n\nMaybe the big fat nancy who ran this swell dump. ", "Maybe they were putting on the dog to crash this party. ", "Maybe, Johnnie considered with blissful excitement, maybe they were society jewel thieves! ", "The bliss faded. ", "Couldn't be. ", "Because none of them wanted to come to the party except Rudolph.", "\n\nWait—a—minute! ", "He doubled back to his plate. ", "Would the dolls have dressed up like Christmas to sit home and eat wienies in Dorp's house? ", "Uh uh. ", "They _said_ they didn't want to come to the party. ", "Johnnie's head nodded sagely. ", "What quicker way could they get Rudolph to agree to coming than to balk him?", "\n\nThe guns Magda and Janssen carried. ", "The soldiers left behind, but each one hatted and coated for the street. ", "They were probably outside now surrounding the joint. ", "They would have had to come by subway because there were only two cars. ", "Couldn't be very big-time crooks with only two cars. ", "Well, if there was any trouble he'd stick to Ruprecht. ", "That Ruprecht looked like a good Joe. ", "Tight or not you could tell that. ", "The others—well, maybe Trudy was okay but the rest he wouldn't trust as far as he could heave a jeep. ", "As for pasty Theo and the goon, he definitely didn't like them at all.", "\n\nJohnnie rubbed the last hunk of roll over his plate, tucked it in his mouth and chewed. ", "The trouble was he couldn't afford to get mixed up in any trouble. ", "He was in the Army now. ", "The C. O. simply wouldn't understand that it was purely accidental. ", "He let out a well-filled sigh. ", "He'd better go in and corral a few chocolate éclairs, then get going. ", "He'd never be missed. ", "And a piece of that strawberry pie and another cup of coffee. ", "His uniform ought to be back from the cleaners by now.", "\n\nHe sat up suddenly. ", "He couldn't get going! ", "He didn't know where to go. ", "He didn't have any idea how to get from here to Dorp's house. ", "That's what he got for arguing with Rudolph in the car instead of watching the scenery. ", "There was one thing he could do. ", "Ask Trudy where the house was. ", "He anticipated a little trouble on that count. ", "Trudy wanted him here. ", "She'd said she might need him. ", "Well, he wasn't going to act as any stupe for jewel thieves.", "\n\nBetter ask Magda.", "\n\nBetter have the éclairs first. ", "There might be a rush on them before he pried Magda loose from Rudo and got through wrangling with her. ", "She reminded him of the kid sister. ", "She'd rather argue than eat. ", "Only Sis didn't tell him to keep quiet and her eyes weren't grama-grass green. ", "He sighed again. ", "He wished he were back home in Texas. ", "But he perked up. ", "Mom and Dad and the rest of the folks would get a big boot out of his being at a Lessering's party. ", "If that guy was one of the Lesserings.", "\n\nHe stacked his dishes and cased the inside of the ballroom before entering. ", "He didn't want to be bothered by any more orders until he had dessert. ", "He never really felt comfortable after a meal until he'd had dessert. ", "Preferably a chocolate dessert. ", "Or strawberry. ", "No one seemed to be looking for him. ", "He went back to the cafeteria. ", "A couple of others had found it by now but none of the royal highness bunch.", "\n\n\"More?\" ", "asked the gold buttons with the yon-Cassius look. ", "Johnnie had learned that flap from Bill. ", "It meant scrawny.", "\n\nJohnnie didn't like the way the guy said it but there wasn't any point in starting trouble with the boss of the supply train. \"", "I've had enough of that junk,\" he scowled. ", "Then he smiled. \"", "Now I want dessert. ", "That one.\" ", "He pointed to the biggest chocolate éclair. \"", "And some strawberry pie.\" ", "He'd missed the caramel éclairs on his first foray. \"", "And that one. ", "And another cup of coffee.\"", "\n\nHe made it out on the balcony without being spotted, headed back to his chosen spot. ", "He tried the pie first. ", "Real strawberries! ", "And whipped cream, an inch thick. ", "Curiosity was biting him worse than the need for food. ", "Where was this Luxembourg? ", "And where were Rudamia and Trudamia? ", "If Bill were here, he'd know. ", "Or he'd look it up in the Base library. ", "Trouble with Johnnie was he'd never taken much to schooling. ", "But he'd played right end two years with Texas A. and M. Bill hadn't done that even if he did know Shakespeare like it was a book.", "\n\nJohnnie sampled the chocolate éclair. ", "Look it up. ", "He could look it up himself. ", "A house this big and fancy would be sure to have a dictionary. ", "He took his plate and cup and made his way to the marble stairs. ", "Below there were several of the knee-britched fellows marking time. ", "The one Johnnie approached was bow-legged as a cowhand.", "\n\n\"Have you got a dictionary?\" ", "Johnnie asked.", "\n\n\"Yes, sir. ", "This way, sir.\"", "\n\nHe trailed along to a room at the left beyond the staircase. ", "The flunky opened the door. \"", "The library, sir. ", "You will find the reference works over there, sir.\" ", "Over there was just a couple of miles away down the room.", "\n\n\"Okay,\" said Johnnie. ", "This room had more books in it than the Carnegie library back home. ", "They were stacked on shelves from the floor to the high ceiling. ", "Bill would sure go for this library. ", "Even Johnnie did. ", "There was a real fire burning in the fireplace. ", "Soon as he took a look at the dictionary—it wouldn't be the dictionary, he knew better than that, it would be the encyclopedia—he'd stretch out on the couch by the fire for a smoke. ", "Meantime he'd better look up those places while he had a chance. ", "He didn't take to this flying blind.", "\n\nThere were plenty of high-backed velvet chairs pulled up in front of the shelves. ", "Each one had a reading stand beside it with a little pin-point light attached. ", "It didn't look as if you could read by such a little light but it worked fine. ", "Johnnie pulled out Lu, Ru, and Tr; stacked them beside him. ", "His plate and coffee he set on the reading stand. ", "That worked fine too. ", "He lifted Ru to his lap. ", "While he was thumbing for Rud, he finished the strawberry pie.", "\n\nThe door at the other end of the room was opening softly. ", "Johnnie froze. ", "When he had the nerve he peered around the back of his chair. ", "Magda was closing the door even more softly. ", "He ducked back again fast. ", "He didn't want her catching up to him, bossing him around, not until he'd finished eating. ", "Evidently she didn't see him because she didn't say anything. ", "The back of his chair was to the door and the coffee cup shaded the pin-point. ", "He took another cautious peek. ", "She was standing in front of the fire, her back to the reference corner, facing the door.", "\n\nCarefully Johnnie took up the chocolate éclair in his fingers, bit off a hunk. ", "He didn't have to chew; it melted in your mouth. ", "Magda was waiting for someone. ", "She didn't wait long. ", "The door opened again, not so carefully. ", "Johnnie didn't dare take a glimpse just yet. ", "Anyone coming in the door could see him if he stuck his neck out. ", "He didn't need a look. ", "He knew the voice. ", "It was the only male voice he'd heard tonight that he'd want to hear again. ", "It was Ruprecht.", "\n\nJohnnie heard him close the door and walk over toward the fireplace. ", "He was saying lazylike and still kind of tight, \"What's the game, Gorgeous? ", "Psst, meet me in the library at midnight.\"", "\n\nJohnnie took a quick one at his watch. ", "It wasn't midnight. ", "It wasn't even ten o'clock.", "\n\nMagda said, \"Oh, Ruprecht!\" ", "She sighed. ", "She was putting it on thick for him. \"", "I had to see you. ", "I had to explain to you.\"", "\n\n\"Explain what?\" ", "There was a click, click. ", "Johnnie peered fast. ", "Ruprecht had set two quart bottles of champagne on the table by the couch.", "\n\n\"Ruprecht, please.\"", "\n\n\"Don't be a ninny, Magda. ", "It's worked, hasn't it? ", "Dorp smoked out Ottomkopf. ", "Otto smoked out Rudolph. ", "You've the Rudamian ring right now on your stunning finger, sweetheart. ", "What is there to explain? ", "Nary a hitch. ", "How about a little toastie?\"", "\n\n\"Ruprecht!\"", "\n\nJohnnie ducked back fast. ", "He took a bite of éclair, a big one. ", "That was the glint in the voice. ", "But she didn't follow it up with a bawling out. ", "There was silence, so much silence he could hear himself swallowing chocolate custard. ", "Maybe they were sneaking up on him right now. ", "He crammed the last end of éclair in his mouth and, braving it, peeked. ", "He almost choked. ", "You couldn't have wedged a hair off Magda's head between those two!", "\n\nHe couldn't move. ", "That was a clinch that was a clinch. ", "And the kiss that went with it could have taught Gable and Turner plenty. ", "But Johnnie wasn't the only appreciative audience.", "\n\nIn the doorway stood Trudy.", "\n\n## 3.", "\n\nTrudy didn't look particularly surprised, nor particularly angry. ", "She was just plain disgusted. ", "She ought to have coughed or something to let on to the hot cargo that she was present. ", "Of course, so should he, Johnnie, but that was different. ", "He hadn't barged in on them; he was here first. ", "The strain was getting him. ", "Something had to break up that clutch. ", "If Magda didn't open her eyes pretty soon and see that look on Trudy's mouth, he'd drop the encyclopedia and take the consequences.", "\n\nHe relaxed when Trudy said one word. \"", "Cut.\"", "\n\nRuprecht beat Magda to it. ", "He swung around as if he'd been kicked in the pants. ", "Magda just tossed back her head and ran her hands down her hips. ", "Johnnie didn't whistle. ", "He chewed.", "\n\nRuprecht said, \"For God's sake, Trudy. ", "You should be belled.\"", "\n\nTrudy didn't pay him any heed. ", "She kept her eyes on Magda. ", "Her mouth was curled up. \"", "I thought I'd find you here. ", "And I thought you'd be at it.\"", "\n\nMagda said, \"Sneak.\"", "\n\n\"Rudolph is waiting for you. ", "He's going to make a speech.\" ", "Her little smile wasn't friendly. \"", "Hand in hand with his betrothed. ", "You'd better snap out of it. ", "Maybe Rudolph can't make with the pash like Rupe but he is the oldest. ", "And he doesn't like to be kept waiting.\"", "\n\nMagda begged eagerly, \"You mean he's going to announce—\"\n\n\"At Ferenz's special request. ", "And you'd better get that kissed look off your mouth. ", "Rudolph is dumb but not that dumb.\"", "\n\nMagda remarked while she did repair work, \"You're a nasty little twirp and you always were.\" ", "She replaced the mirror and lipstick in her purse. \"", "See you later, Rupe.\" ", "She sailed out of the room like a queen on a hurry call.", "\n\nTrudy stood aside for her to pass. ", "She made a good Bronx sound before Magda was out of the doorway. ", "The way she slammed the door after her nearly jiggled the book off Johnnie's lap.", "\n\n\"Now see here, baby mine,\" Ruprecht began.", "\n\nTrudy stomped. \"", "I'm not your baby. ", "Definitely not. ", "I knew you'd wolf after almost anything in skirts but I did think you'd draw the line at that one.\"", "\n\n\"Now, honey.\"", "\n\n\"And don't honey me!\" ", "Trudy shouted. \"", "Honey her. ", "I don't care. ", "You know she's a no-good slut but if that's what you want you can have it. ", "All I want is to know why you invited Rudo here tonight.\"", "\n\n\"I didn't.\"", "\n\n\"You did. ", "After you promised you'd stay out of the picture. ", "You swore to me you wouldn't try to see him.\"", "\n\n\"I swore I didn't want to see him. ", "I still don't. ", "He makes me sick to the entrails. ", "And you swore you'd keep him out of my sight. ", "Then the whole passel of you escort him here with a guard of honor.\"", "\n\n\"You invited him.\"", "\n\n\"I did not, baby mine.\"", "\n\n\"He phoned you. ", "You said come to the party. ", "You knew he wouldn't turn down a party. ", "Has he ever?\"", "\n\n\"Where do you get such silly ideas, Toots?\"", "\n\n\"From Rudo himself.\"", "\n\n\"He's a filthy liar. ", "He always was.\"", "\n\n\"Yes? ", "How would he know there was a party at Furry's house if he hadn't phoned you from the station? ", "He just got in tonight. ", "He's been on a train for days. ", "How could he know if you didn't invite him to come?\"", "\n\nJohnnie had forgotten caution. ", "He watched this openly, caramel éclair in hand and mouth. ", "It looked as if she'd pop Rupe any minute. ", "She was mad enough. ", "And she was closing in.", "\n\n\"I give you my word, Trudy. ", "He couldn't have called me. ", "I was with some friends at Twenty-One. ", "I didn't get back here until the party was started.\" ", "He decided, \"It must have been Furry who invited him. ", "I didn't have a chance to chat with him until you and yours barged in.\"", "\n\n\"Ferenz wouldn't. ", "He refused to put up the money to bring Rudolph to New York unless Dorp promised he shouldn't have to lay eyes on him. ", "He wouldn't invite him.\"", "\n\n\"He would if Rudo called up and announced himself. ", "You know Furry. ", "Etiquette. ", "Didn't you have anyone watching Rudolph?\"", "\n\n\"Janssen.\"", "\n\n\"That robot. ", "Where was Otto?\"", "\n\n\"He'd come up to the house earlier with Dorp to make last arrangements. ", "Rupe, we've got to get Rudo out of here.\"", "\n\nRuprecht was lighting a cigarette. \"", "Take him, my little love. ", "I don't want him.\"", "\n\n\"You'll have to help. ", "And I'm not your love. ", "What are _you_ doing here?\"", "\n\nThat last question wasn't to Ruprecht. ", "It was delivered with gusto and without pleasure. ", "Johnnie spoke through his éclair. \"", "Who me?\"", "\n\n\"Who else?\" ", "She came around, Ruprecht following, until she stood in front of Johnnie. ", "He couldn't get to his feet without dropping the encyclopedia on hers. ", "He just sat there.", "\n\n\"What are you doing here?\"", "\n\n\"I'm reading the encyclopedia.\" ", "Johnnie's dignity was marred by the mouthful of goo. \"", "At least I was,\" he swallowed. \"", "I was before the row started.\"", "\n\n\"Who's he?\" ", "Ruprecht pointed. \"", "One of Dorp's men?\"", "\n\n\"Yes,\" Trudy said.", "\n\n\"No,\" Johnnie said.", "\n\nA discreet knock on the door ended that one. ", "After the knock came Theo. ", "He made a jerky bow. \"", "His Royal Highness wishes you upstairs in the ballroom.\"", "\n\n\"Tell him to go boil his head,\" Ruprecht said pleasantly.", "\n\nTheo's pasty face grew paler at sacrilege.", "\n\n\"We'd better go up, Rupe.\" ", "Trudy shrugged. \"", "We can't afford scenes tonight.\"", "\n\n\"I'm not going,\" Ruprecht told her.", "\n\n\"But, Rupe—\"\n\n\"I'm not going,\" he repeated. \"", "I wouldn't listen to his crummy speech if he sent his whole bodyguard after me.\"", "\n\nShe flared up. \"", "So you can't face it. ", "Magda and Rudolph—\"\n\nRuprecht sounded tough now. \"", "If you don't stop that drivel, I'll break every bone in your—\"\n\n\"I'm going.\" ", "She turned on Johnnie. \"", "Come on, you. ", "You're supposed to be guarding Magda, not reading books.\"", "\n\n\"She didn't need me. ", "She had two other guys.\" ", "He licked his fingers, piled up his china and let the book thump to the floor.", "\n\n\"She'll need you now,\" Ruprecht supplied gently. \"", "Now that Trudy has her knife whetted.\"", "\n\nTrudy marched to the door, chin up. ", "She pushed Theo out ahead of her, snapped, \"Come on,\" to Johnnie and continued her march without looking back.", "\n\nJohnnie carried his dishes after her. ", "He didn't make the door. ", "Ruprecht asked persuasively, \"How about a little drink before you go?\"", "\n\nJohnnie turned around. ", "Ruprecht held out one of the bottles of champagne. \"", "I always carry a spare for emergencies like this. ", "You don't really want to hear that baby Führer make a pep talk, do you? ", "Kick that door shut and set down the crockery. ", "We'll have one little drink. ", "And if there's not enough here for one little drink, we'll buzz for more.\"", "\n\nJohnnie kicked the door shut. ", "He exchanged the dishes for the bottle. ", "Ruprecht said, \"The cork's been sprung. ", "Do you need a glass or are you a man?\"", "\n\nJohnnie tipped up the bottle. ", "He'd never tasted champagne before. ", "He smacked his lips.", "\n\n\"Have a seat,\" Ruprecht invited. ", "He lounged in one corner of the couch. ", "Johnnie took the other. \"", "How's about a little toast? ", "Damn all women. ", "I don't like women.\"", "\n\n\"I kinda do,\" Johnnie admitted.", "\n\n\"What for?\"", "\n\n\"We-l-l—\"\n\n\"But that's all,\" Rupe closed that avenue. \"", "I say damn their golden hides.\" ", "He drank. ", "Johnnie drank. ", "Ruprecht said, \"Particularly damn Trudy.\" ", "He raised the bottle.", "\n\n\"I don't know,\" Johnnie dissented. \"", "She's a pretty cute little mouse.\"", "\n\nRupe drank. \"", "She needs beating.\" ", "He held up the bottle again. \"", "With a club. ", "How do you stand on damning Magda?\"", "\n\n\"We-l-l—\" Johnnie thought seriously about that. \"", "She's—she's—\"\n\n\"She's a slut. ", "Trudy's right about that. ", "We'll damn Magda too.\"", "\n\nJohnnie drank. \"", "Is she really going to marry that lug?\"", "\n\n\"Sirrah, you speak of my brother! ", "She is if she can. ", "Wouldn't surprise me any if she had a J. P. in the crowd just to make it legal, but quick.\" ", "Ruprecht eyed him. \"", "Just what were you doing in here?\"", "\n\n\"Honestly, I was reading.\"", "\n\n\"Who sent you?\"", "\n\n\"Nobody sent me. ", "I came down here to find out about Rudamia and Trudamia and that Luxembourg. ", "I never heard of them before.\"", "\n\nRuprecht's eyes widened. \"", "For God's sake where did you come from?\"", "\n\n\"I'm from Texas,\" Johnnie bridled. \"", "And I still never heard of Rudamia and—\"\n\nRuprecht murmured, \"I should say in rebuttal that I have never heard of Texas. ", "Unfortunately that wouldn't be true. ", "For two years I have heard nothing else but.\" ", "He clapped his hands. \"'", "Deep in the Heart of Texas'.\" ", "He raised his voice in song. \"'", "Got too much of Texas in my ha-ir.'\" ", "He eyed Johnnie carefully. \"", "And how did you get mixed up with this den of thieves? ", "Who are you?\"", "\n\nJohnnie took another swig. ", "It was a relief to have someone to talk with at last, someone who wouldn't shut you up every time you opened your mouth. \"", "It just happened.\"", "\n\n\"Spill it.\"", "\n\n\"I was taking a subway ride. ", "And Pudgey—Herr Dorp—was on the same subway. ", "And I just happened to follow him.\" ", "He might as well give out with the whole works. \"", "See, he was talking German to old Gimlet-face, the one you call Ottomkopf, and I didn't think it was patriotic for him to be talking German, not in these times.\"", "\n\nRuprecht looked kind of funny. \"", "Otto doesn't speak English well. ", "It makes it difficult.\"", "\n\nJohnnie bristled, \"I'm in the Army, see? ", "I'm Private First Class John Brown from Texas stationed at Fort Dix in New Jersey. ", "I didn't like that guy talking German. ", "I was going to tell him.\" ", "He relaxed. \"", "Only he went in his house before I could, so I followed him.\"", "\n\n\"How did you get in?\"", "\n\n\"The squirt—that guy called Theo—he let me in.\"", "\n\nRupe's eyes squinted. \"", "Go on.\"", "\n\n\"Well, that's when it began to happen. ", "I was waiting to see Herr Dorp, and Trudy came in, and I fell in the paste, and she rushed me upstairs and put me in Magda's room.\"", "\n\n\"I trust you protected your honor,\" Ruprecht peered down the mouth of his bottle.", "\n\nJohnnie blushed a little. \"", "Magda didn't even see me. ", "You know. ", "She just bossed me around, made me put on this monkey suit—\" He broke off, demanded, \"Are these S's?\" ", "He jabbed the silver snakes on his collar. \"", "Because I've heard of the S. S.'s.\"", "\n\nRuprecht sighed. \"", "They're an imitation.\"", "\n\n\"What do you mean imitation?\"", "\n\n\"Skip it. ", "It's a uniform, sort of private army.\"", "\n\n\"That goon's?\"", "\n\n\"If by goon you are referring to my unadmired brother, Johnnie, you're in the groove. ", "Continue.\"", "\n\nHe wasn't sure yet. ", "Even imitations wouldn't be good. ", "But he continued, \"That's all there is to it. ", "Only I wanted to find out about those countries so I decided to look them up.\" ", "Intelligent, just like Bill.", "\n\n\"Save your eyes,\" Ruprecht admonished. \"", "I can tell you all there is to know about Rudamia and Trudamia. ", "Rudamia is coal and iron, Trudamia is oil and mica. ", "Divided we fall. ", "But if Rudo and Magda get together, we aren't divided any more.\"", "\n\n\"You mean,\" Johnnie began bug-eyed, \"like in history? ", "They get married for state reasons?\"", "\n\n\"You don't think she's marrying him for his manly virtues, do you?\"", "\n\nJohnnie took a long drink. \"", "What about Luxembourg?\"", "\n\n\"Well, most people have heard of Lux. ", "Even if they haven't heard of Rudamia and Trudamia. ", "They're all down in the same neighborhood. ", "Only Ru and Tru aren't as big as Lux. ", "When the Nazis rolled in—\"\n\n\"You mean—\"\n\n\"Don't you read the papers? ", "But then it wasn't in the headlines. ", "There weren't any battles. ", "The Nazis just took us over.\"", "\n\n\"How did you get away?\"", "\n\n\"I wasn't there.\" ", "Ruprecht held the bottle upside down. ", "Nothing came out. \"", "I've been at Yale the last five years. ", "Nice place, Yale. ", "Much nicer than Rudamia. ", "Before that, I was at Exeter.\"", "\n\n\"I'm Texas A. and M. Or I was before the war.\" ", "Johnnie got back on the beam. \"", "Did the Nazis take Magda's country too? ", "How did she escape?\"", "\n\n\"She wasn't there either. ", "She's been at Miss Featherley's for years. ", "That's where they send girls with figures instead of minds. ", "Trudy's been at Bennington. ", "That's for girls with figgers and minds both.\"", "\n\n\"And Rudolph?\"", "\n\n\"Rudo had no yen for higher learning. ", "He was at Biarritz when the shooting began. ", "He took straight off for Alex, just in case. ", "Smart lad, Rudo. ", "Only trouble with him, he waited too long to get to the States. ", "Only made it to Mexico.\"", "\n\n\"He likes Mexico,\" Johnnie supplied.", "\n\n\"Why didn't he stay there if he likes it so well? ", "The family has a big rancho in Mexico, belonged to an ancestor. ", "Why go back to Rudamia? ", "But he wants to play king.\"", "\n\n\"That goon is really a king?\"", "\n\nRuprecht took his tongue out of the bottle. \"", "Empty. ", "Absolutely empty. ", "Not even an aroma. ", "We'll have to go for reinforcements. ", "Unless you'd like to wait here while I get them.\"", "\n\nJohnnie consulted his watch. ", "It was ten o'clock now. \"", "I better not. ", "I got a date with a couple of soldiers downtown. ", "I can't be too late. ", "They want to go to the Stage Door Canteen. ", "I'd better go find Magda.\"", "\n\n\"Lay off Magda,\" Ruprecht warned. ", "He gathered up the empties; Johnnie took the crockery. \"", "Trudy's bad enough but Magda—she's poison. ", "If you really want a girl, I've got a list that will lay you against the ropes.\"", "\n\nJohnnie shook his head. \"", "I just want to ask her something. ", "After that I'll tell off Herr Dorp. ", "Then I'll be on my way.\" ", "He remembered his manners. \"", "I've enjoyed the party very much, Mr. Ruprecht. ", "Especially the éclairs and the champagne.\"", "\n\n\"Call me Rupe. ", "And don't thank me. ", "Thank Ferenz.\"", "\n\nThey weaved to the marble stairs, climbed fairly steadily. ", "The ballroom was noisier than ever, climaxed around Rudolph and Magda. ", "Rudolph was still talking. ", "His brother said, \"Sure you won't join me in another bottle? ", "We could split one.\"", "\n\n\"Haven't time. ", "Thanks just the same.\" ", "He'd had enough. ", "He wasn't tight, just pleasant, but he was warm. ", "He'd enjoy getting outdoors.", "\n\nRuprecht laid his hand on his shoulder. \"", "If I were you I wouldn't mention to anyone in these parts just who you really are. ", "They might not like it.\" ", "He wobbled pleasantly toward the bar.", "\n\nJohnnie sidled back to the supper table. ", "He ate a handful of salted nuts and a big ripe olive. ", "He wasn't going to get near Magda soon, not in this mob scene. ", "She was standing over near the music, on Rudolph's arm, bored stiff behind her painted smile. ", "Ottomkopf, Janssen, Dorp and Theo were grouped around. ", "Ferenz beamed like a goat-fed cobra. ", "Trudy was evidently too small to show. ", "Johnnie grabbed another handful of nuts and a couple of mints. ", "No use standing up for the rest of the oration. ", "He couldn't make out what the goon was saying as it was. ", "He retired gracefully to his favorite couch. ", "More than ever he regretted the absence of the platinum babe. ", "He was in the mood for a blonde about now. ", "He'd give Rudo ten more minutes. ", "If he didn't shut up by then, he, Johnnie, would make a dive through the crowd and interrupt. ", "He had to find out the address of his uniform.", "\n\nRudolph's voice squeaked on \"Rudamia!\" ", "A burst of applause drowned him out. ", "Must be about over. ", "Just then Trudy came out the door. ", "She was moving fast until she spied Johnnie. ", "She didn't slow down then but she changed her course. ", "She was in front of him before he could budge. \"", "Why are you out here?\"", "\n\n\"Just resting. ", "I got tired standing up.\"", "\n\nShe gazed at him with an eye like Aunt Clotilda in her bad moments. \"", "What did you do with Rupe?\"", "\n\n\"He's gone for more champagne.\"", "\n\n\"He's had enough champagne. ", "And so have you.\" ", "She darted a quick one over her shoulder. ", "No one was there. ", "Her voice dropped. \"", "Here. ", "Take this. ", "Don't give it to anyone but me and don't tell anyone you have it.\"", "\n\nShe'd pulled 'this' out of her gold evening bag. ", "It was an envelope, done up with blobs of red sealing wax. ", "It was too heavy for its size. ", "Something besides paper in it. ", "The jewels?", "\n\nShe pushed it into his hand. \"", "Take it. ", "Put it in your pocket, your inside pocket, stupid! ", "Quick.\"", "\n\nHe made it quick. ", "He was almost scared sober she was so jumpy. ", "If anyone had come out of the door they couldn't have seen what he was doing. ", "She was shielding him. ", "He got it tucked inside.", "\n\nShe fixed her eyes on him. \"", "Remember. ", "Don't tell anyone, not anyone, that I gave you anything.\"", "\n\n\"Sure nuff,\" he nodded.", "\n\n\"If you do—\" It was funny but he hadn't ever noticed before that her eyes weren't pure blue. ", "Around the pupils were flecks as green as Magda's. \"", "If you do,\" she repeated, and her voice was colder than the marble bench, \"I don't think you'll live very long.\"", "\n\n# Three\n\nFOR A MOMENT, BUT only for a moment, Johnnie observed Trudy through pinwheels. ", "He wasn't that drunk. ", "He had heard what she said. ", "She was still standing there making sure he took it in. ", "And he was right, her eyes weren't any softer than marble.", "\n\nHis voice gulped back into his throat. \"", "I won't forget,\" he assured her quickly. ", "All the pleasant glow had evaporated. ", "The only warm place about him was his inner coat pocket. ", "That was too hot.", "\n\nShe seemed satisfied. ", "She looked human when she asked sharply, \"Just what were you doing in the library?\"", "\n\n\"Reading. ", "Trying to read. ", "I wanted to find out about those countries. ", "Then I was interrupted. ", "But Rupe told me about them. ", "Magda's queen of this Trudamia—\"\n\n\"Indeed she is not!\" ", "Trudy flashed. \"", "My mother's queen of Trudamia. ", "And I'll be queen some day. ", "Trudamia is a matriarchy. ", "Magda comes from a very minor branch of the family, a sixth cousin. ", "Her father was a commoner.\"", "\n\nEven if she had just scared him out of a year's growth, she really was cute as a bug. ", "And she was a blonde. ", "Johnnie took her hand. \"", "Sit down and tell me about it,\" he urged. ", "He began to feel warm again. \"", "You don't want to hear any more of that guff, do you?\" ", "He sort of half-pulled her down beside him. ", "She wasn't exactly reluctant. ", "Maybe her feet hurt too. \"", "If Magda isn't queen why is she going to marry Rudolph?\"", "\n\n\"You don't think I want to marry him, do you?\" ", "She was indignant. \"", "It's a perfect solution. ", "Gets rid of Magda and Rudo both—if it comes off.\"", "\n\n\"He actually is a king?\"", "\n\n\"He will be. ", "If he gets back in time after the war. ", "Of course the people would rather have Ruprecht but Rudolph is nine months older so he gets to reign. ", "Uncle Ruffeni—their father—died this year.\"", "\n\n\"The Nazis?\" ", "he asked somberly.", "\n\n\"The Nazis had nothing to do with it,\" she retorted promptly. \"", "He had apoplexy because some fool in Nairobi watered his cognac. ", "That was Uncle Ruffeni. ", "Personally I think Rupe's a bastard.\"", "\n\n\"He is not,\" Johnnie contradicted. \"", "He's a good Joe.\"", "\n\n\"I don't mean a bastard that way. ", "I mean the other way. ", "He couldn't be Uncle Ruff's son.\"", "\n\nHe wished she'd stop talking so much. ", "He felt like working up to a little cuddling. ", "He moved a little closer. \"", "You know who you remind me of?\"", "\n\n\"Sonja Henie,\" she snapped. \"", "If all the men I've reminded of Sonja Henie were laid end to end I'd drive a tank over them with pleasure.\" ", "She sighed. \"", "But he is too.\"", "\n\nJohnnie sighed with her. \"", "Is what?\"", "\n\n\"A bastard that way too.\" ", "She gave him a gimlet glare. \"", "Who kissed whom?\"", "\n\n\"Who kissed whom?\"", "\n\n\"Rupe and Magda. ", "Who kissed whom?\"", "\n\n\"I wasn't watching them. ", "Maybe it was mutual.\" ", "Her mouth turned down at the corners. ", "He recollected. \"", "But she'd made the date and she was doing the preliminary footwork.\"", "\n\nThat was better. ", "Suddenly Trudy reared back against his arm. \"", "Just how did you get in on this anyway?\"", "\n\n\"Listen, babe,\" he took her hand firmly, \"I like that. ", "You're the one got me in on it. ", "You shoved me in her room and she made me put on this fancy costume. ", "And you ask me what I'm doing here!\" ", "He remembered again what he had to do. \"", "Listen, I got a date downtown. ", "I'm late now. ", "The guys aren't going to like it. ", "I don't want to break up the party but I've got to get back and change my clothes.\"", "\n\n\"What guys?\"", "\n\n\"Bill and Hank. ", "My sidekicks, compadres, see? ", "They're waiting for me at the Astor. ", "If you'll just give me that address—\"\n\n\"First you have to help me get Rudo away from here.\"", "\n\n\" _I_ do!\"", "\n\n\"Yes, you do. ", "We must get him back to Dorp's before it's too late.\"", "\n\n\"Too late for what?\"", "\n\nShe was holding his hand now. \"", "Don't you see it isn't safe for him to be running around this way. ", "It isn't even safe to be here at Lessering's. ", "Any minute—\"\n\nThey'd been talking so hard neither one had noticed the balcony filling up. ", "The speech was over. ", "Not until the shadow of Ferenz loomed above them did they look up. ", "The big guy was actually twittering. \"", "Trudy, isn't it divine? ", "I can't conceive of such good fortune. ", "The announcement of Rudolph's betrothal made here, in my home.\" ", "He squinted at Johnnie. \"", "And who is your handsome friend, dear?\"", "\n\n\"One of Dorp's men.\" ", "Trudy stood up. \"", "Come on, Johnnie. ", "Let's us be the last to congratulate the hapless bride. ", "See you later, Furry.\"", "\n\nShe dragged Johnnie by the hand. ", "He muttered, \"Why do you keep saying I'm one of Dorp's men?\"", "\n\nHer voice was clear if quiet. \"", "How long would you last if I told the truth?\"", "\n\nThat made a second warning. ", "He took it. \"", "Who is that Furry?\"", "\n\n\"Ferenz Lessering. ", "He's giving the party.\"", "\n\n\"He's really one of the Lesserings?\"", "\n\n\"Munition Lesserings? ", "Yes. ", "You get it?\"", "\n\nJohnnie shook his dumb head.", "\n\n\"That's why Rupe can live here. ", "Rupe's not a queer. ", "And that's why Ferenz has been putting up the money for Otto and Dorp. ", "The more little wars the merrier. ", "Keeps the wheels of industry rolling.\"", "\n\nHe still didn't get it.", "\n\n\"You don't think the Rudamians will put up with Rudolph long without having a revolution, do you? ", "But we must get him out of here. ", "It wouldn't be cricket to let him be assassinated before he was ever crowned.\"", "\n\n\"You think there's danger of that here?\" ", "His eyes popped.", "\n\n\"This house is full of Rudamians and anti-Rudamians. ", "The only place in New York where we know he'll be safe is at Dorp's. ", "We must take him back there.\"", "\n\n\"How?\"", "\n\nThe music was playing a fairly decent swing. \"", "Might as well dance across,\" Johnnie said. ", "He grabbed her before she could refuse. ", "She could trundle all right. \"", "How?\" ", "he repeated.", "\n\n\"I don't know,\" she confessed.", "\n\nHe didn't bother his head about it now. ", "Not dancing with this little honey. ", "He didn't even think of Bill and Hank waiting outside the Astor. ", "He didn't bother to think until somebody rammed a fist in his back.", "\n\n\"You cannot do that,\" Dorp stormed.", "\n\n\"Can't do what?\" ", "Johnnie had his own fist ready.", "\n\n\"You cannot dance with Her Highness.\"", "\n\n\"Who says I can't?\"", "\n\n\"Wait.\" ", "Trudy stopped dancing. \"", "I asked him to dance me over to Rudolph, Dorp. ", "We want to get Rudo out of here. ", "Johnnie's going to help.\"", "\n\n\"How?\" ", "Dorp shrugged.", "\n\n\"I could throw him over my shoulder.\" ", "Johnnie was practical. \"", "He couldn't weigh more than a Garand.\"", "\n\n\"He could bite,\" Trudy warned. \"", "Have you talked to him, Dorp?\"", "\n\n\"He would not even listen. ", "He is having a good time. ", "Cock of the walk. ", "Royal Highness this, Royal Highness that. ", "He must not miss the plane.\"", "\n\n\"That doesn't go till morning,\" Johnnie reminded.", "\n\n\"But there is much business to attend to.\"", "\n\n\"And if he gets on the Clipper drunk, he'll talk too much,\" Trudy said. \"", "We've simply got to think of something.\"", "\n\nThey all thought. ", "Johnnie suggested, \"Why couldn't I take him with me to the Astor?\"", "\n\n\"No,\" Trudy said.", "\n\n\"You aren't supposed to think,\" Dorp told him. \"", "We do the thinking.\"", "\n\n\"You better think fast if you want my help,\" Johnnie began.", "\n\n\"Quiet!\" ", "Trudy commanded. ", "She thought some more.", "\n\n\"I can think better when I'm dancing,\" Johnnie grinned. \"", "How's about it?\"", "\n\n\"Quiet!\" ", "Dorp commanded.", "\n\nJohnnie didn't wander away. ", "He walked off. ", "Now was the time for action. ", "He walked right across the ballroom to Magda. ", "She didn't appear to be having a very good time. ", "Everyone was crowding up to the goon. ", "No one even noticed she was a gorgeous number.", "\n\nJohnnie announced, \"I'm back.\"", "\n\nShe turned, startled. ", "When she saw who it was her eyes greened. \"", "Where have you been?\"", "\n\n\"Dancing. ", "You want to dance?\" ", "He held open his arms. ", "Either she'd been away from Trudamia too long to remember the rules or it was that commoner father. ", "Or maybe if a fellow opened his arms she knew only one way to move. ", "She closed in. ", "He danced her out on the floor. ", "The Highness didn't notice. ", "Trudy could dance but with Magda under your chin you didn't care what it was she called dancing.", "\n\nJohnnie said, \"I wish we were somewhere good. ", "This band stinks. ", "Why don't we get out of here?\"", "\n\nShe flung those long black lashes up at him. \"", "I wish we could. ", "But Rudolph—\"\n\n\"We could take him along.\"", "\n\nHer eyes narrowed and her mouth curved. \"", "Then what would we do with him?\"", "\n\nJohnnie swallowed hard. ", "He held on. ", "This wasn't what he'd bargained for. ", "This was worse than a bottle of champagne. \"", "Anything you say, honey,\" he murmured to her cape jasmine hair. \"", "But anything.\"", "\n\nShe pushed him away without any warning. \"", "Who are you?\"", "\n\nHe was getting tired of playing invisible man. ", "He didn't get a chance to answer.", "\n\nHer eyes burned. \"", "You can't dance with me.\"", "\n\n\"What's the matter, don't you like it?\"", "\n\nFor just a second she half-smiled. \"", "Some other time.\" ", "Then she was back to being queen again. \"", "Of all the impudence. ", "Royalty does not dance with commoners.\"", "\n\nHe said, \"Listen. ", "It's none of my business but I think you ought to gather up Rudo and get him out of here.\"", "\n\nHer \"Why?\" ", "was sharp. ", "Her eyes slitted around the room.", "\n\n\"Trudy didn't like that scene a bit she barged into. ", "You and Rupe on the griddle. ", "If you don't get Rudo away where you can have him alone, there might be some sabotage. ", "You aren't married to him yet.\"", "\n\nShe dug her fingers into his arm. \"", "What did she say?\"", "\n\n\"She doesn't think you're good enough for Rudolph. ", "Your old man—\"\n\nShe was furious. ", "He lifted her claws off his sleeve. \"", "That little—that little prig trying to wench my game. ", "Just because her father was a Dallas millionaire.\"", "\n\n\"Did you say Dallas?\" ", "Johnnie cried joyfully.", "\n\n\"I said Dallas.\"", "\n\n\"Then he was a commoner, too!\"", "\n\n\"No, he wasn't. ", "He was a prince. ", "But he went to work in Texas—oil. ", "No better than a commoner.\" ", "She set her teeth. \"", "Trudy wants Ruprecht but she won't get him. ", "He wouldn't give a phony nickel for her.\"", "\n\n\"You can't have both the boys,\" he told her.", "\n\nShe tossed her head. \"", "Tell Theo to get the cars ready. ", "We're leaving.\"", "\n\n\"Rudolph too?\"", "\n\n\"Rudolph too.\"", "\n\n\"How?\"", "\n\n\"Never mind how. ", "Do as you're told.\" ", "She didn't float; she plunged toward her fiancé.", "\n\nJohnnie returned to the thinkers, still thinking in the same old spot. \"", "Tell Theo to get the cars,\" he ordered. \"", "We're all leaving.\"", "\n\nThe two of them raised incredulous round eyes. \"", "How?\" ", "they Indianed.", "\n\nJohnnie spoke haughtily. \"", "Wouldn't you like to know?\" ", "He didn't remain with them. ", "He sidled back to the buffet, stuffed his pocket with salted nuts, lifted a last chocolate éclair and finished it in three bites. ", "He was well pleased with himself. ", "All this how business. ", "All you had to do was use your head. ", "Nothing to it.", "\n\nIt didn't do any good to try to get in the car with Trudy. ", "The setup was as it had been earlier. ", "Even to the cordon trudging off on foot. ", "Johnnie had the same uncomfortable jump seat.", "\n\nRudolph was doing the talking just as he had on the trip over but he was more jittery now. \"", "How do you know there were F. B. I. agents at Ferenz's party, Magda? ", "How do you know they were there? ", "How do you know they aren't following us?\"", "\n\nMagda had known how to use her head too. ", "Nothing to it. ", "Johnnie grinned and lit a smoke. ", "He blew it toward Janssen, sitting there stiff as a ramrod.", "\n\nMagda said, \"Never mind how I know it. ", "It's my business to know. ", "And they aren't following. ", "We didn't parade out of the house, did we? ", "We melted away quietly. ", "Even if they were following, the boys have orders to give them the slip.\"", "\n\n\"How do you know they won't come to Dorp's house when they see I'm missing? ", "How do you know they won't follow us there?\"", "\n\nShe didn't say, \"Stupid,\" but her voice implied it. \"", "Dorp is a respectable professor of languages at Columbia University. ", "No one is going to break into his house. ", "And if they did, what would they find? ", "A respectable house. ", "That downstairs would fool anyone. ", "It's hideous.\"", "\n\n\"Suppose they came upstairs? ", "Suppose they—\"\n\nJanssen snarled, \"Make him stop it, Magda. ", "He's getting me nervous. ", "I can't afford to be caught by the F. B. I. It's all right for the rest of you but I can't afford it. ", "You know I was enrolled in the party before I got away. ", "I couldn't help it but I was. ", "They'd find it out and shoot me. ", "How _do_ you know we're safe, Magda?\"", "\n\nMagda said wearily, \"For God's sake, Louie, don't I have enough on my hands without you going to pieces? ", "If you and Rudo can't take my word for it, I'll get out of this car right now and you can stew in your own juices. ", "Now shut up both of you. ", "You make me excruciatingly ill.\"", "\n\n\"But Magda,\" Rudolph whimpered.", "\n\n\"Light me one of your cigarettes, Johnnie,\" Magda interrupted. \"", "Or are your hands shaky?\"", "\n\n\"I'm not afraid of man nor beast,\" Johnnie drawled. \"", "Or the F. B. I.\" He almost swallowed that one with a gulp. ", "If the F. B. I. really were on the trail, how was Private Johnnie Brown going to explain wearing this monkey suit instead of his G. I. uniform? ", "He passed the cigarette to her. ", "There wasn't any F. B. I. That was her contribution to spiriting Rudolph back to Dorp's.", "\n\nRudolph stammered, \"I wish I were back in Mexico.\"", "\n\nMagda didn't say, \"So do I.\" She merely began to hum, \"Get Out of Town.\"", "\n\nThe car pulled up in the quiet side street, stopped short.", "\n\nRudolph quavered, \"Where are we? ", "What is it?\"", "\n\n\"Dorp's,\" Magda said.", "\n\n\"Where is Dorp? ", "Where's Trudy?\"", "\n\n\"They're already here. ", "We came roundabout purposely. ", "I told you that.\"", "\n\nRudolph backed into the corner. \"", "How do you know they're—\"\n\nShe drew a breath. \"", "I say they're here. ", "They're here. ", "Now get out.\"", "\n\n\"Before I beat your brain in,\" Johnnie murmured to himself. ", "He helped her to the street. ", "She rushed ahead up the stairs. ", "He stuck with her. ", "The rest pattered after them. ", "It wasn't Theo who opened the door; it was Trudy, sparkling white in the dim hallway.", "\n\n\"Hiya, Babe,\" Johnnie greeted her.", "\n\n\"Go right on up.\" ", "Her mouth was grim. \"", "I'm waiting for the squad to get here.\"", "\n\nJohnnie followed Magda. ", "Dorp was pacing up and down, his short arms behind his back, his fat face red as the velvet throne. ", "Theo was standing in the corner chewing his fingernails. ", "Dorp waited only until the five, trailed by a wheezing Ottomkopf, were inside. ", "Then he exploded. \"", "Theo has lost the papers!\"", "\n\nOttomkopf fell back. \"", "It cannot be!\" ", "He was hoarse. ", "His eyes were like broken glass now.", "\n\n\"Do any of you have them?\"", "\n\nJohnnie shook his head along with the rest of them.", "\n\nRudolph asked, \"What papers?\"", "\n\n\"Your passports. ", "Your identifications.\"", "\n\n\"But I have them,\" Rudolph began.", "\n\n\"Idiot!\" ", "Dorp raged. \"", "You have the ones to take you from this country to Europe. ", "You do not yet have the ones to take you from Switzerland to Rudamia. ", "The true ones.\" ", "His eyes opened hopefully. \"", "Or do you?\"", "\n\n\"I have never seen them and you know it.\" ", "He flounced to the throne chair and extracted from his pocket the long cigarette holder. \"", "You know very well I haven't seen them. ", "You told me you'd give them to me when I boarded the Clipper.\"", "\n\n\"Theo has lost them,\" Dorp repeated with menace. \"", "I keep them on me until we go to the party. ", "Then I think it is not wise I carry them there. ", "They do not look so well in the full dress suit. ", "Perhaps Ferenz will grow snoopy. ", "He is so afraid we do something outside the law, something at which we get caught. ", "He would not like doctored papers such as Rudolph must use to enter his country. ", "So the last thing in the car I pass them to Theo. ", "He has big military pockets to keep them safe. ", "And Ferenz does not like Theo.\" ", "His little eyes narrowed. \"", "Because Theo does not like Ferenz.\" ", "He shrugged. \"", "Does he put them into the inner pocket as anyone with the brains of a peahen would do?\"", "\n\nJohnnie had the papers! ", "He realized it suddenly. ", "This didn't seem exactly the time to disclose that fact. ", "Besides Trudy had been insistent he keep mum. ", "More than insistent. ", "She'd threatened him. ", "He kept his mouth shut. ", "Despite everything he liked Trudy a lot better than this passel of thieves. ", "He didn't like Dorp at all.", "\n\n\"No!\" ", "roared Dorp. ", "He slapped his fat thigh and winced. \"", "He puts them in his coat pocket where when he leans over to make the bow they fall out.\"", "\n\n\"They couldn't have fallen out,\" Theo blubbered. \"", "I told you, Herr Dorp. ", "The envelope went way deep.\"", "\n\n\"Someone picked his pocket,\" Magda said. \"", "That's obvious. ", "In the crush while Rudolph was speaking. ", "Who was near you?\"", "\n\n\"I don't know.\" ", "There were tears in Theo's eyes. ", "One hung from the tip of his nose. \"", "I didn't notice. ", "I was listening like Herr Dorp told me to.\" ", "He wailed, \"I didn't want to carry the papers. ", "I didn't want to be responsible.\"", "\n\n\"Enough,\" Ottomkopf commanded. \"", "You will turn in your uniform, be confined to quarters.\" ", "He looked about the room. ", "The rear guard hadn't caught up yet. ", "The only uniforms were Janssen attending Rudolph, and Johnnie following Magda. \"", "Who will escort him?\"", "\n\n\"I know the way,\" Theo sniffled. \"", "I'll go.\" ", "He turned at the door. \"", "If you'd only told me the inside pocket, Herr Dorp. ", "But you said pocket.\"", "\n\n\"Go. ", "Go on!\" ", "Dorp waggled five thick fingers. ", "Theo went.", "\n\n\"It's Ferenz.\" ", "Magda scowled. \"", "Of course it's Ferenz in back of it.\"", "\n\n\"But why?\" ", "Dorp shook his head. \"", "He is paying good money for Rudolph to go. ", "And he knows nothing of the false papers.\"", "\n\n\"When you've known Ferenz as long as we have, Herr Dorp, you won't ask why. ", "You'll know that everything he does is to make trouble and sell some more of his nasty bombs and stuff.\"", "\n\nRudolph almost fell off the throne. \"", "You think Ferenz doesn't want me to return to Rudamia? ", "Because I won't go if that's the way he feels. ", "After all I owe him a hundred and fifty thousand rudls. ", "Besides he might be planning another revolution.\"", "\n\n\"He might be,\" Magda admitted. ", "She sat on the throne steps and put her chin in her hand. ", "She surveyed the ruby lovingly. \"", "But in that case why wouldn't he let you go ahead? ", "A revolution's no good without a king to dethrone. ", "And he promised me I could be queen. ", "He even got the betrothal ring out of hock.\"", "\n\n\"There are no revolutions in the new Rudamia,\" Dorp swelled up.", "\n\n\"There can be,\" Ottomkopf countered.", "\n\nDorp stuck out his chin. \"", "Saupreussen!\"", "\n\nOttomkopf turned the colors of roquefort. ", "He couldn't get his tongue to work.", "\n\nMagda said, \"I wish you'd be quiet. ", "I'm trying to think how we can get Ferenz over here now.\" ", "She stood up. \"", "I can't think in these clothes. ", "I'm going to get comfortable. ", "Don't start any more name-calling until I return. ", "Save that for Furry.\"", "\n\nRudolph said, \"I want to take a bath.\"", "\n\n\"Now?\" ", "Magda turned on him violently.", "\n\n\"I don't know when I've had a bath,\" he said dreamily. \"", "I've heard so much about American hot water. ", "You and Trudy and Rupe were always bragging about it. ", "I want a bath now.\"", "\n\n\"Don't drown,\" Magda said with set teeth.", "\n\n\"Janssen will show you your room,\" Dorp said.", "\n\nMagda added, \"Get back before Ferenz arrives.\" ", "She sailed out. ", "Johnnie was in her wake. ", "She didn't turn around until she was on the floor above, outside her door. \"", "You can't come in. ", "I'm going to change.\"", "\n\n\"I want to change too,\" he said. \"", "I don't like these clothes.\"", "\n\n\"Why not? ", "On you it looks good.\"", "\n\n\"I want my own uniform.\"", "\n\n\"A uniform's a uniform.\" ", "She slammed the door behind them.", "\n\nIt was not. ", "This snake thing wasn't anywhere near as good as old G.I. He didn't mention that. ", "Not with two warnings not to talk too much. ", "He was looking around. ", "His suit wasn't here yet. ", "He said, \"I guess Trudy hasn't brought my things up yet.\"", "\n\n\"For heaven's sake why should she bring them to my room?\" ", "Magda demanded.", "\n\n\"Well, she put me in here to dress, didn't she?\"", "\n\n\"God knows why.\" ", "Magda had the white skirts half over her head before he could yell, \"Wait a minute!\"", "\n\n\"If you're still squeamish,\" she retorted, \"get out.\"", "\n\nHe started for the door.", "\n\n\"No, don't.\" ", "It was a command. \"", "I want to talk. ", "I've got to talk.\"", "\n\nHe did the next best thing. ", "He turned his back and sat down. ", "He said sadly, \"My uniform ought to be back by now.\"", "\n\n\"Keep quiet about your uniform,\" said Magda through a mouthful of dress. \"", "How can I go about getting Ferenz over here? ", "That's the trouble. ", "He's so full of good manners he won't walk out on his party. ", "And he didn't want to see Rudolph in the first place. ", "He made the best of it, that's Ferenz, but he didn't like it.\" ", "Her mouth was empty now. \"", "Well, why don't you say something.\"", "\n\n\"I want my suit,\" Johnnie said.", "\n\n\"Your suit! ", "You worry about a suit when I have this to contend with!\" ", "She was quiet for a spell and then she said, \"You can turn around now, Johnnie. ", "I'm decent. ", "But think, how can I make Ferenz come? ", "It's got to be good.\"", "\n\nShe was more than decent. ", "She was a thriller. ", "Yellow slacks, yellow sweater, black velvet coat and sandals. ", "She was rolling a yellow chiffon handkerchief to tie around her black hair.", "\n\nJohnnie had a brainstorm. \"", "Business,\" he stated.", "\n\n\"What business?\"", "\n\n\"Tell him it's business. ", "Tell him there's a new war started, lots of business for him.\"", "\n\nShe whirled from the dressing table. \"", "Darling!\" ", "She plastered a kiss on his yellow cowlick.", "\n\n\"Don't _do_ that!\" ", "Johnnie murmured, not loud.", "\n\nShe dipped some more magnolia perfume, touched her chin. \"", "But of course. ", "That will bring him. ", "Why didn't I think of it before? ", "I'll tell him there's a revolution broken out in Rudamia. ", "We just heard it over short wave. ", "We need his help. ", "He'll have to come then. ", "Rudamia's royal family owes him too much money to let the country go Bolshie.\"", "\n\nThere was a white phone by her bed. ", "She stretched herself full length on the fluffy white coverlet. ", "Johnnie gazed at the rug. ", "She was made for sweaters, or maybe she wasn't. ", "He lit a cigarette.", "\n\nShe said, \"It's most important that I speak to Mr. Lessering, Shanks. ", "Call him at once.\" ", "Her voice stroked the space between the bed and Johnnie. \"", "Whoever you are, you're a lamb and a love. ", "I don't know why Dorp didn't bring you around sooner. ", "Why don't you come over here?\" ", "She patted the edge of the bed. ", "There wasn't room for a toothpick on that side of it.", "\n\nJohnnie felt his ears turn scarlet. ", "He just shook his head.", "\n\n\"You're a darling. ", "Hello—hello—Ferenz, Magda.\" ", "Her voice became throaty, conspiratorial. \"", "We've just heard the most awful news. ", "Rudamia has revolted against the Nazis. ", "Bolshies. ", "You'll have to come over at once. ", "I know but this is important. ", "Don't you understand? ", "We must decide what to do about Rudolph. ", "We can't send him into that and we don't dare keep him here. ", "No! ", "Don't tell Ruprecht—he'd just upset Rudolph.\" ", "She nodded her gorgeous head, smiled at Johnnie. \"", "Yes, Furry. ", "You do understand? ", "You will come? ", "Angel! ", "Hurry!\" ", "She replaced the phone and stretched her arms above her head. ", "She laughed. ", "She reminded Johnnie of a leopard he'd seen once at the circus. ", "She looked at Johnnie between those foot long eyelashes. \"", "You don't want to come over here?\"", "\n\nJohnnie breathed deeply. \"", "Not now.\" ", "He breathed some more. \"", "I really haven't time. ", "I have a date downtown I'm late for.\" ", "He'd get back to Trudy, find out what she'd done with the uniform, and he'd skip out fast. ", "Before anything more happened. ", "He wasn't used to babes like this one.", "\n\n\"You'll have to break it.\" ", "She leaned on an elbow. \"", "But I had better get downstairs and tell them Ferenz is coming. ", "We'll have to plan an attack. ", "The dirty bum. ", "Snatching those papers.\" ", "She patted the yellow chiffon back in place. \"", "He isn't easy to work on. ", "Come along, Johnnie.\"", "\n\nHe waited until she had the door open before he moved. ", "He didn't want to get any nearer than that to her. ", "His neck was damp enough. ", "She didn't speak again until she reached the door of the throne room. \"", "Go down and tell Trudy he's coming so she'll wait for him.\" ", "She patted his cheek. \"", "You're sweet as well as smart, Johnnie.\"", "\n\nHe ducked down the flight to first but fast. ", "This was the break. ", "Tell Trudy. ", "Trade her the papers for his uniform and beat it.", "\n\nShe was sitting on the straight chair, a deserted white cherub. ", "He said, \"Everything's under control, baby. ", "Ferenz is coming.\"", "\n\nShe jumped up. \"", "What for?\"", "\n\n\"I forgot. ", "You don't know.\" ", "He glanced upstairs. ", "No one in sight. ", "He lowered his voice. \"", "Anyone hear us?\" ", "She motioned him down on the steps, sat beside him. \"", "They think Ferenz took the papers.\" ", "He patted his left upper pocket. \"", "So Magda's called him up and told him there's a revolution on in Rudamia and he'd better get over and decide what to do with Rudo. ", "Only there isn't any revolution. ", "We sort of thought it up together,\" he admitted modestly. ", "He talked fast under his breath. \"", "When he gets here they're going to try to get the papers. ", "Only he hasn't them.\" ", "He stuck his hand toward his pocket. \"", "Where's my uniform? ", "I got to be going now so you'd better take these and—\"\n\n\"Going?\" ", "Her blue eyes were rubber balls.", "\n\n\"Sure. ", "I told you. ", "Or I've told everybody else. ", "I got a date.\"", "\n\n\"You can't go now. ", "It's too late.\"", "\n\n\"It is late,\" he admitted. \"", "But Bill and Hank kind of expect me not to turn up on time. ", "They'll keep looking. ", "Where's my suit?\"", "\n\n\"I mean you don't dare go. ", "They'd nab you if you left now.\" ", "Her hand touched him. \"", "Listen, Johnnie, you don't think they're going to let anyone leave here, not until the papers turn up, do you?\"", "\n\nHe stuck out his chin. \"", "Then I'll give them the damn papers.\"", "\n\n\"You can't do that!\" ", "She put her face up to his. \"", "How are you going to explain where you got them?\"", "\n\n\"You gave them to me.\"", "\n\n\"Do you think they'd believe you? ", "A—a strange Soldier—? ", "When I said that it was all a big lie?\"", "\n\nHe leaned just a little bit closer and he kissed her. ", "Like that. ", "She jerked back. ", "He said, \"You're cute, baby. ", "Even if you are a stinker.\"", "\n\n\"I'm no baby. ", "I'm no stinker either. ", "Johnnie,\" she softened up again, \"the cleaner hasn't sent your suit yet so you'll have to stick around just a little longer. ", "It'll be here by the time we get Rudolph on his way, I'm sure. ", "You can stay that long.\"", "\n\n\"I cannot,\" he denied. \"", "Why can't I go around to the cleaner's myself?\"", "\n\nHer face fell. \"", "Johnnie!\" ", "She whispered it. \"", "With the F. B. I. watching the house?\"", "\n\n\"They're not,\" he moaned.", "\n\nShe nodded. \"", "Come here.\" ", "He followed her on tiptoe to the front door. ", "She pulled aside the shirred curtain covering the glass. ", "He peered over her head where she pointed. \"", "See that man across there in the shadows? ", "There—in the door of that house.\"", "\n\nHe squinted. ", "He could see flickering shadows. ", "It might be a man.", "\n\n\"He's been there all evening. ", "He's either F. B. I. or he's one of the Young Terrorists.\"", "\n\n\"What are they?\" ", "he asked hoarsely.", "\n\n\"They're an organization avowed to end the Ruffeni reign in Rudamia. ", "They'd as soon kill you as look at you.\" ", "Her eyes held fright. ", "She scuttled back to her chair. \"", "You don't dare appear out in that uniform.\"", "\n\n\"But—\" He followed her to the steps, sank down. \"", "But they let us go out earlier.\"", "\n\n\"Safety in numbers,\" she nodded sagely. \"", "Anyone who goes out alone is simply walking straight up the gallows.\" ", "She added more cheerfully, \"Whether that man's a Terroristi or an F. B. I.\"\n\nHe was stuck. ", "Plenty stuck. ", "He sighed down to his toes. ", "It was late. ", "Getting on to eleven. ", "Bill and Hank might not be looking for him. ", "They'd probably picked up a couple of cute chicks themselves by now. ", "He hadn't told Dorp off, either. ", "And he would like to know what it was all about. ", "Mom and Dad and the kids would pass right out from curiosity when he wrote them about tonight if he didn't know any more than he knew now. ", "He decided. \"", "I guess I'll stick around for a while.\"", "\n\n\"Good.\" ", "She brightened. \"", "I'll probably need your help to get Rudolph out of here.\"", "\n\n\"Just till my suit gets back,\" he warned her. ", "He tipped his head with curiosity. \"", "Tell me something. ", "Why did you snatch those papers?\"", "\n\n\"I want to examine them.\"", "\n\n\"Let's.\" ", "His hand dived but she pulled it away from his pocket fast.", "\n\n\"Not here!\" ", "She whispered, \"I'll arrange it so we can slip out after Ferenz gets here. ", "You keep them until then. ", "They're safer on you than me. ", "No one would suspect you of having them. ", "A Rudamian patriot.\"", "\n\n\"Is that what I'm supposed to be?\" ", "he asked.", "\n\n\"That's what you are tonight,\" she told him with emphasis. \"", "And don't forget it. ", "Not till I can take over the papers. ", "You'd better go back up now and see what's going on. ", "If there's any funny business, let me know.\"", "\n\nIt was all funny business as far as he was concerned. ", "He didn't say so; he just grinned, \"A'right, honey.\"", "\n\nShe ducked this time.", "\n\nHe drawled, \"I need target practice. ", "Be seeing you, sugar. ", "And don't forget, let me know as soon as my suit gets here.\" ", "He went on up the stairs. ", "He didn't knock at the throne room, just moseyed in. ", "Nobody paid any attention to him. ", "The S. S. boys were all back at attention, standing around. ", "Dorp and Ottomkopf and Magda were in a huddle by the throne. ", "She was sitting on it; Rudolph wasn't around. ", "Johnnie picked an inconspicuous far corner chair and sat down to rest. ", "The guard shielded him from the three big shots and he could hear plenty. ", "Dorp didn't know how to talk below a shout.", "\n\n\"I still cannot believe it was Ferenz,\" he was yelling. \"", "Think of the money he has put up! ", "Why would he steal the papers which cost so much to procure?\"", "\n\nMagda said, \"But Ruprecht wouldn't want them. ", "I tell you he doesn't want to be king. ", "All he wants is to stay in New York and drink and rhumba.\"", "\n\n\"In the German Army this could not have happened,\" Ottomkopf stated nastily. \"", "It is this untrained guard you have.\"", "\n\n\"You try to do better,\" Dorp shouted. \"", "In Germany I could do better but here—how can I train with what I have to train—\"\n\nJohnnie didn't like this talk of Germany. ", "He knew now he wasn't going to leave until he'd told off Dorp and Ottomkopf in full.", "\n\n\"If you two don't get together,\" Magda stated, \"at least until Rudolph's out of the way, I'm going to walk out right now. ", "You just try to manage him without me!\"", "\n\n\"Now, Magda,\" Dorp began.", "\n\nOttomkopf puffed, \"That is not fair, Magda. ", "You have give your word you would help us if we—\"\n\nThe door opened. ", "The guard stiffened. ", "Trudy announced sweetly, \"Here he is.\" ", "Ferenz bounded into the room.", "\n\nHe was wringing his plump pink hands. \"", "Magda, but this is unbearable, dear. ", "When everything was so perfect—\"\n\n\"Sit down, Ferenz.\" ", "She pointed to a chair ringed with the guards. \"", "I'll tell you all about it. ", "Get Rudolph, will you, Trudy?\"", "\n\n\"Where is he?\"", "\n\n\"He's taking a bath,\" Magda gritted.", "\n\nTrudy departed. ", "Unobtrusively a part of the guard reformed until they blocked the doorway.", "\n\n\"Now tell me, dear,\" Ferenz breathed. \"", "What did you hear? ", "It is execrable that right now—why, I had the word of every leader!\"", "\n\nMagda rested her head against the chair. \"", "I lied to you, Ferenz. ", "There's no revolution.\"", "\n\nThe big man jumped up. ", "He squealed, \"No revolution! ", "Why then—\"\n\n\"Sit down, dear,\" she repeated softly. \"", "We want to talk to you.\"", "\n\nShe wasn't depending on glamorous persuasion. ", "She held her gun pointed directly at Ferenz's stomach.", "\n\n## 2.", "\n\nMagda continued, \"Captain Janssen's men are here to see that you do sit down, Ferenz. ", "That's better.\"", "\n\nFerenz fell back in the chair. ", "He was shaking like a jitterbug. ", "He stuttered, \"Mmmmmmagda! ", "I don't understand this.\"", "\n\nShe tucked the gun back into her jacket pocket. \"", "You will. ", "Tonight at your house, someone stole the papers that Rudolph must have to cross the Rudamian border. ", "We want to know why.\"", "\n\n\"Mmmmmagda!\"", "\n\nHer eyes glittered. \"", "We want to know why.\"", "\n\n\"But Magda, I know nothing about any papers—\"\n\nRudolph came pushing through the crowd. ", "Trudy wasn't with him. ", "He had on a purple satin bathrobe with a gold crown on the pocket, purple velvet bedroom slippers with gold heels. ", "His legs were skinny. \"", "Ferenz, why did you take my papers?\" ", "he demanded.", "\n\n\"I don't know anything about it.\" ", "Ferenz rolled his eyes. \"", "Why should I take the papers? ", "I want Rudolph to be king. ", "I'm paying for it that he should be king. ", "Why should I take his papers?\"", "\n\n\"Stop beating around the bush,\" Magda said sweetly. \"", "They were stolen in your house.\"", "\n\n\"I know nothing of it,\" he swore. \"", "I can't believe it. ", "Have you looked?\"", "\n\n\"They are gone,\" Dorp scowled. \"", "Gone before we leave your home.\"", "\n\n\"It wasn't I,\" said Ferenz. ", "He raised a sudden forefinger. \"", "Ruprecht!\"", "\n\n\"That's who it was,\" Rudolph agreed. \"", "That's exactly who I thought it was. ", "He's jealous.\"", "\n\n\"Folderol!\" ", "Magda snapped. \"", "Rupe doesn't want to be king any more than Johnnie does.\" ", "She glanced around for him. ", "He slid down into the chair and hoped the guy six paces in front of him wouldn't budge. \"", "You'll have to come across better than that, Ferenz. ", "If you didn't do it, who did? ", "Who did you hire to do it? ", "Who was there?\"", "\n\n\"No one there would do it! ", "I tell you that. ", "We've been planning ever since you left. ", "After the war we'll charter two clippers and fly across for the coronation. ", "Oh, we had the sweetest plans, really we did. ", "Everyone wants you to be king, Rudolph.\"", "\n\n\"The servants?\" ", "Dorp piped hopefully.", "\n\n\"They are all utterly loyal,\" Ferenz declared with a noble leer. \"", "To me and to Rudamia,\" he added.", "\n\nMagda sighed. \"", "We've had enough of this runaround. ", "Either you turn over the papers, Ferenz, or—\" She eyed the guard meaningly. \"", "Or you go upstairs.\"", "\n\nFerenz turned green. \"", "Oh no, Magda. ", "You wouldn't dare do that. ", "Not to me.\"", "\n\n\"I'd dare anything,\" she told him, \"to be queen.\"", "\n\nDorp and Ottomkopf both nodded. ", "Some of the guards shifted uneasily.", "\n\n\"Magda, dear, I don't have them,\" he wept. \"", "You must believe me. ", "I'll do anything you can think of to get Rudo away in the morning. ", "Money is no object to me now. ", "All I have spent on Rudo means nothing. ", "Gladly will I spend more. ", "Anything. ", "But I can't give you the papers. ", "I've never even seen them.\"", "\n\nJohnnie was getting tired of this. ", "Obviously the big guy was telling the truth. ", "Sure he was. ", "The papers were in Johnnie's own pocket. ", "He wished Trudy would come back. ", "He wished she'd plan that sneak and turn over the damn papers. ", "He was getting sleepy. ", "And he wanted a drink of water.", "\n\nOttomkopf said, \"Have you any suggestions, Duchess Magda?\"", "\n\n\"Couldn't we buy another set?\" ", "Ferenz asked eagerly.", "\n\nDorp shook a sad head. \"", "We have worked for three whole weeks getting those papers made so they will pass any inspection.\" ", "He looked wary. \"", "I mean so they will not be discovered what they are before he reaches Switzerland. ", "Could I do that again before tomorrow morning? ", "The answer is no.\"", "\n\nRudolph dropped ash to the red velvet rug. \"", "Somebody must have them. ", "And I don't think it's Ferenz.\"", "\n\nFerenz smirked weakly.", "\n\n\"But this has gone far enough. ", "Whoever has them must give them up. ", "If they don't—\" He tapped his head. \"", "I shall now get dressed. ", "If they do not turn up before I come back I shall—\" He tapped harder. \"", "I know what I'll do. ", "I'll go straight to Washington to our own government-in-exile. ", "I shall tell them everything.\"", "\n\n\"Not everything!\" ", "cried Ferenz, Ottomkopf, Dorp and Magda.", "\n\n\"Everything!\" ", "Rudolph said snippily. \"", "I shall leave to them my safe return to Rudamia—or Mexico.\"", "\n\n\"We could send you back to Mexico tonight,\" Ferenz cried eagerly. \"", "That's safe enough.\"", "\n\nRudolph weakened but he pulled himself up again. \"", "Not until after I have talked with our government-in-exile. ", "Unless of course the papers are returned before I finish dressing.\" ", "The guard made a wary path for him. ", "He banged the door.", "\n\nDorp drooped. \"", "He cannot talk. ", "Not that he knows much.\"", "\n\n\"He knows too much,\" Ferenz squealed. \"", "Where will I be if he goes to Washington? ", "The F. B. I. will listen in on all he has to say. ", "Every one of us—\"\n\nJohnnie perked up again. ", "There was something more than squirrel stuff here. ", "They were all afraid of the F. B. I. They weren't on the up and up. ", "And it wasn't jewels.", "\n\n\"I will be ruined,\" Ferenz whispered starkly.", "\n\nOttomkopf spoke slowly. \"", "He must not talk.\"", "\n\nThe guards shifted weight again in the silence. ", "Johnnie could see even better now.", "\n\nDorp said, \"If only we can find these papers in time.\" ", "He turned purple. \"", "That dumkopf. ", "That Theo.\"", "\n\n\"You should not have trusted something that important out of your hands,\" Ottomkopf gloated. \"", "You Herrenvolk are all alike, afraid you will be caught at your dirty work. ", "A Prussian would—\"\n\n\"Seupreussen!\" ", "Dorp screamed again. \"", "Don't you tell me nothing. ", "How do I know you did not take them yourself just to get me in trouble?\"", "\n\nMagda ordered, \"Stop it. ", "Rudolph's upstairs now scurrying into his clothes and you—all you can do is call names.\" ", "She closed her eyes. \"", "I think I'd better go talk with Rudo.\"", "\n\n\"Yes,\" Ottomkopf nodded.", "\n\n\"That is good,\" Dorp beamed. \"", "A little more time we get.\"", "\n\nFerenz leaped to his feet. ", "His finger pointed dramatically. ", "His voice was hoarse. \"", "Who is that hiding in the corner?\"", "\n\nHe was pointing directly at Johnnie. ", "The guard had shifted once too often. ", "They widened out now.", "\n\n\"I'm not hiding,\" Johnnie said. \"", "I'm resting.\"", "\n\nMagda was impatient. \"", "That's one of Dorp's men. ", "The one who attended me tonight.\"", "\n\nDorp peered. \"", "He is not one of my men. ", "I do not know him. ", "I never have seen him until you bring him downstairs with you tonight. ", "I think that you—\"\n\nMagda turned on him fast. \"", "He is too one of yours. ", "Trudy brought him to my room tonight. ", "She told me—\"\n\nJohnnie stepped up to her. \"", "If you'd have listened to me at the beginning, Magda, I'd have told you I wasn't one of his men. ", "Instead you kept telling me to keep quiet every time I opened my mouth.\" ", "He glared at Dorp. \"", "But you're wrong on one thing, Pudgey. ", "You did too see me before I came here tonight. ", "I stood right beside you on the subway. ", "I came here purposely to see you. ", "I wanted to tell you we're in a war. ", "A war against Germany. ", "And when we—that's Hank and Bill and me and the rest of us—get through with those Nazis, there isn't going to be anybody talking German. ", "Not unless he wants a kick in the teeth. ", "I came here to tell you that it isn't patriotic for you to be riding around on the subway talking German like you were tonight. ", "But after some of the other things I've heard in your house I guess you don't care whether it's patriotic or not. ", "All I hope is that the goon does go to Washington. ", "I think the F. B. I. should know about you folks.\"", "\n\nHe turned on his heel, started to the door.", "\n\n\"Where are you going?\" ", "Ferenz howled.", "\n\n\"To the Astor. ", "That's where I'm going. ", "Not that it's any of your business, Bub.\" ", "He turned again. ", "G. I. suit or no G. I. suit, he was getting out of here. ", "He whirled back just in time. ", "Horse sense. ", "Two of the guards were almost on him.", "\n\nHe kicked one in the belly, wrenched the other's arm out of its socket. ", "This was what he'd been waiting for. ", "This was what he'd been learning in camp, to fight dirty against Nazis. ", "He threw the fellow across the room right into Dorp's fat face. ", "They crashed together.", "\n\nTwo more guards were at him. ", "He flailed, got one in the Adam's apple and one below the belt. ", "The other members of the unit held back. ", "He didn't blame them. ", "He swaggered, \"Come on. ", "I'll take you all together.\"", "\n\n\"You needn't,\" Magda said. ", "He looked at her quick. ", "She had the blunt-nosed automatic pointed right at him now. \"", "I won't shoot to kill if you make one move, Johnnie. ", "I'll shoot where it will hurt the most without hanging murder on me. ", "Maybe you learned about that in camp.\" ", "She ordered Janssen, \"Take him upstairs. ", "Tie him up. ", "Tight.\"", "\n\nJanssen started forward with soldierly stride. ", "Johnnie made a horrible face at him. ", "Janssen stood still. \"", "Do you think we should?\" ", "he asked. ", "He was listening to the groans of the men on the floor, watching others rubbing their anatomies.", "\n\nMagda's lip curled. \"", "What do you want to do? ", "Let him walk out and bring back the F. B. I.?\"", "\n\nIt had never occurred to Johnnie to do any such thing. ", "Even if he was in uniform it wouldn't appeal to him. ", "They'd just think he was a drunk soldier on a pass and he'd land in the brig. ", "They wouldn't believe what happened tonight. ", "Dorp and his buddies would all be safely on the Clipper or in Mexico or under Lessering's important name while he, Johnnie, languished in the clink.", "\n\nMagda continued with disgust, \"I'll go up with you, Louie. ", "I'm not afraid of him.\" ", "Her green eyes smiled unpleasantly across at Johnnie. \"", "He's afraid of me but I'm not afraid of him.\"", "\n\nJanssen barked an order and two untouched guardsmen came gingerly forward. ", "More gingerly they took Johnnie's arms. ", "He released his arms. \"", "I'm not aiming to get shot,\" he told Magda, \"but I don't want no panty-waists helping me to walk. ", "Which way?\"", "\n\n\"Upstairs,\" she said.", "\n\nThe two guards walked behind him. ", "Janssen was behind them. ", "Magda and the gun brought up the rear. ", "Johnnie might have made a run for it but he preferred to keep whole. ", "He was perfectly certain she'd be able to shoot crooked as well as straight, and the openwork banisters wouldn't be any protection. ", "On the third floor she marched him to the door at the back. ", "Janssen opened it. ", "The room was small, evidently Theo's from the large framed photograph of the squirt looking chinlessly soulful at his crossed knee and a cigarette. ", "Johnnie had always meant to have his picture taken that way for the kid sister but he'd never had the nerve. ", "He was glad of it now.", "\n\nJanssen stepped ahead to open the closet door. ", "At the back of the closet he slid away the wall. ", "Johnnie whistled. ", "He'd never actually believed that anyone had trick houses like that. ", "New York City was all that it was cracked up to be. ", "Beyond the opening was another staircase. ", "Janssen went ahead to the hidden fourth floor. ", "The corridor was dark until Janssen pulled on a small overhead light. ", "There were only closed doors visible and there wasn't any velvet carpeting on the floor.", "\n\nMagda waited while Janssen turned the knob on the door at the front. ", "He pulled another overhead light. ", "It was a little dinky room. ", "Four old kitchen chairs, a battered table with a burned-down candle in a broken candle holder, nothing else in it. ", "Johnnie's mouth set. ", "Must be the torture chamber. ", "Where nobody could possibly hear you, nobody could see you. ", "The only window was a small triangular attic one at the front. ", "It wasn't big enough to crawl out of even if you felt like gymnastics.", "\n\nMagda ordered, \"Tie him up.\"", "\n\nThe guards looked at Janssen. ", "Janssen looked at the guards. ", "All turned hesitantly to Magda.", "\n\nShe frowned. \"", "You're not still afraid, are you? ", "I have the gun. ", "Tie him up.\"", "\n\n\"What with?\" ", "Janssen asked.", "\n\nWhile Magda was gathering fury Johnnie plopped down on one of the chairs. ", "The guards jumped at the sound. ", "He explained, \"My feet hurt.\"", "\n\nMagda shouted, \"With what! ", "Idiots! ", "Cretins!\" ", "She gathered more breath. \"", "Nuts! ", "Go get a rope. ", "Get wire. ", "Get anything. ", "Go. ", "I'll watch him. ", "Go. ", "GO!\"", "\n\nThey went fast. ", "They clattered down the steps. ", "Magda sighed. \"", "Can you imagine such fools?\" ", "Without turning she pushed a chair far across the room from Johnnie, sat down, laid the gun on her crossed knee. \"", "If you move I'll shoot you.\"", "\n\n\"I won't move. ", "Can I smoke?\"", "\n\n\"If there's a trick to it, I'll shoot you.\"", "\n\n\"There's no trick.\" ", "He lit a cigarette. ", "There wasn't. ", "He just wanted a smoke, that was all.", "\n\n\"I suppose you think I should shoot you now?\"", "\n\n\"Oh no!\" ", "he reassured her.", "\n\n\"Dorp would. ", "Or Otto. ", "It would be safer. ", "But I've never killed anyone yet.\"", "\n\nJohnnie swallowed hard. ", "He hoped she wouldn't start tonight. ", "She seemed to be considering it.", "\n\n\"That's one reason. ", "More important, if anything should happen I don't want a murder pinned on me.\"", "\n\n\"I should hope not,\" Johnnie agreed weakly.", "\n\n\"There's always the problem of getting rid of the body and we haven't time for that now. ", "Although it isn't much of a problem.\"", "\n\nHe gulped. \"", "Maybe it wouldn't be if I were just John Brown back home in Texas but I'm not.\"", "\n\nHer gun jumped into her hand. \"", "Just who are you, Johnnie Brown from Texas? ", "Where did Trudy find you?\" ", "Her lip curled. \"", "And why?\"", "\n\nHe'd been warned to keep quiet but he was too mad now to worry about that. ", "And too scared. ", "Well, not exactly scared but he didn't feel very safe at the moment. \"", "She didn't find me. ", "I came here to see Herr Dorp. ", "For a good reason. ", "And I better get out of here safe too. ", "I'm important. ", "I'm Private John Brown. ", "I live in Uncle Sam's house. ", "If anything happens to me—\" He swallowed the lump. \"", "If anything should happen to me, he'd find me.\"", "\n\n\"Not if I got rid of you, Johnnie,\" she said with certainty.", "\n\n\"That's what you think. ", "He'd have a million M.P.'s out looking for me. ", "They'd find me. ", "Don't you think they wouldn't. ", "They'd find me whatever you did and they'd find you, too.\"", "\n\nShe laughed. \"", "You're really quite stuff, Johnnie. ", "I wouldn't want to shoot you. ", "It's too bad you don't like me better. ", "We might have had some fun. ", "Don't you like me at all?\"", "\n\nHis tongue was thick. \"", "You're mighty pretty.\"", "\n\nShe laughed lazily. \"", "Is that the best you can do?\" ", "Her eyes narrowed. \"", "I suppose you prefer blondes.\"", "\n\nHe knew better than to irritate her. ", "She was twirling the gun. \"", "Oh no, ma'am,\" he vowed. \"", "I like blondes and brunettes. ", "And redheads.\"", "\n\nHe remembered with a pang that redhead back on the campus. ", "He'd meant to write to her. ", "If he ever got out of this whole, he would write to her. ", "He'd ask her for a picture. ", "She was funny-looking with a turned up nose and freckles. ", "He never wanted another sultry beauty pinned above his bed.", "\n\n\"Perhaps we might get together if you're that versatile.\"", "\n\n\"I'd like to,\" he cried. ", "He lied in his teeth. ", "Well maybe not that bad but at the moment there was nothing he wanted less than playing games with any girl.", "\n\n\"Some other time,\" she smiled.", "\n\nJohnnie took the bull by the horns. \"", "Just what are you going to do with me? ", "You can't leave me tied up here forever.\"", "\n\n\"I could if I wished,\" she said coolly. \"", "But it might make the house smell.\" ", "She smiled wider. \"", "Only a few days, Johnnie.\"", "\n\n\"Few days!\" ", "He leaped up.", "\n\n\"Sit down,\" she suggested, with the gun pointing smack at his middle.", "\n\nHe flopped. ", "This was the worst news. \"", "I can't be gone that long. ", "My pass is only good till Sunday morning. ", "I have to be back in camp by four A.M.\"\n\n\"I'm afraid you'll be late, Johnnie.\"", "\n\n\"But I can't be late. ", "I have to be there. ", "Don't you understand? ", "I'm in the Army. ", "What will my top sergeant say?\" ", "What wouldn't he say.", "\n\n\"I'm so sorry,\" she said lightly.", "\n\nHe glowered at her. \"", "I'm sorry I didn't throw that guy at you instead of at Dorp.\"", "\n\n\"I thought you might be.\"", "\n\nHe had to do something about this and quick. ", "But that gun wasn't fooling. ", "Neither was Magda. ", "He tried to reason with her. \"", "Why do I have to stay here that long?\"", "\n\n\"We must get Rudolph away.\"", "\n\n\"But you're going to do that tonight.\"", "\n\n\"Not without the papers.\"", "\n\nWell, he could give her the papers. ", "He could hand her the damn papers right this minute. ", "The same two reasons held him back. ", "One was Trudy's nervousness about their contents. ", "And she had a gun too. ", "The other was what might happen to him if suddenly he did admit to having them. ", "That wasn't a pretty picture.", "\n\n\"You needn't worry, Johnnie,\" she said. \"", "Of course you will have to explain to your top sergeant why you're late for Sunday breakfast but nothing is going to happen to you.\"", "\n\n\"No, nothing,\" he groaned.", "\n\n\"You'll be perfectly safe. ", "It's necessary that we tie you up so that you won't gum the works but you won't be hurt. ", "Just as soon as possible you'll turn up safe somewhere. ", "By that time it won't do you any good to bring back the Marines. ", "We'll all be gone.\"", "\n\nAnd he'd be trying to explain what looked like A.W.O.L. He'd be better off if she did shoot him. ", "He stuck out his jaw. \"", "I'd bring the Army if I came back not any Marines. ", "But I wouldn't come back here for a million dollars. ", "Or for the biggest farm in Texas. ", "You couldn't pay me enough to come back here.\" ", "He shook his head. \"", "You couldn't let me go by tomorrow night if I promised to say nothing?\"", "\n\n\"I'm afraid not.\" ", "She turned on the reappearing guards. \"", "What did you do, knit it?\"", "\n\nThey held what looked like a clothesline. \"", "We had to wait for Trudy,\" Janssen explained.", "\n\n\"And where was Trudy?\" ", "Magda was suspicious.", "\n\n\"Nobody knew,\" Janssen said. \"", "But I found her.\"", "\n\nMagda clutched the gun more firmly. \"", "Where was she?\"", "\n\n\"With His Highness.\"", "\n\n\"Snip!\"", "\n\n\"Well, she saw you with Ruprecht,\" Johnnie reminded her.", "\n\nShe swung to the guards. \"", "What are you waiting for? ", "Tie him up!\"", "\n\nJohnnie didn't make any false moves, not with that steel eyeball poking at him. ", "He did offer one weak protest as his hands were lashed behind his back to the chair. \"", "How'm I going to smoke with my hands tied? ", "I won't be able to smoke.\"", "\n\n\"Won't that be too bad?\" ", "She inspected the job unsmiling, nodded her head. \"", "Janssen, we'll go back down now. ", "Post a man on this door.\" ", "She turned mocking eyes on Johnnie. \"", "Hawg-tied, as you say in Texas, don't you?\" ", "She bent down, kissed his mouth. \"", "You are cute, you know.\"", "\n\nShe didn't look back at the color of his ears. ", "Only four lonely walls knew they sizzled.", "\n\n## 3.", "\n\nHawg-tied. ", "That was Johnnie. ", "Those saps in the black suits didn't have any muscles but they knew how to lash a man fast. ", "If he were smart like Bill or tough like Hank he wouldn't be in this stew. ", "He'd be thinking right now of a way to get loose. ", "He was thinking only he couldn't think of a thing. ", "What could any guy do tied to a chair in an attic bedroom? ", "Yelling wouldn't do any good. ", "Or would it?", "\n\nHe opened his mouth and bellered, \"Help! ", "Murder! ", "Police!\"", "\n\nIt sounded pretty silly to be yelling all by yourself. ", "It didn't even sound loud. ", "All that happened was that skimpy guy outside the door stuck his head in, took a look, and yapped, \"You be quiet.\" ", "The guy had a rifle now. ", "He pointed it ahead of him awkwardly when he barged in. ", "He went right out again, banging the door after him.", "\n\nThat settled making a row. ", "No one could possibly hear, no one but that dumb rookie outside. ", "Even if sounds carried below, that bunch wouldn't investigate.", "\n\nDick Tracy would have a piece of glass or a nail file hidden between his fingers to saw the rope. ", "Johnnie didn't. ", "Superman would swell out his muscles and break the ropes. ", "Johnnie tried that one. ", "Well, he'd never claimed to be Superman. ", "Jungle Jim would have a faithful friend crawling through the window to release him. ", "Johnnie didn't have a friend within thousands of miles except Bill and Hank and they were too busy cutting a rug at the Canteen to worry about their poor partner.", "\n\nWhat would Bill do? ", "Bill would never have shoved into a mess like this in the first place. ", "He'd have reasoned that old Pudgey Dorp was a German professor not a Nazi. ", "Only Johnnie wasn't too sure yet about that. ", "Dorp could be both. ", "He acted like a Nazi. ", "Plenty of those downstairs acted like Nazis. ", "And those uniforms looked just like Nazi uniforms in the movies.", "\n\nWhat would Hank have done? ", "He'd have socked Dorp right there on the subway and he'd have told everybody in earshot why. ", "He'd have a medal on his chest by now, not yards of clothesline.", "\n\nThe door clicked. ", "Johnnie scowled at it. ", "His eyes opened. ", "Rudolph, the goon. ", "All dressed up in a pearl gray suit with pin stripes, a lavender spotted tie, lavender hanky sticking out of his pocket. ", "All sweet and perfumed. ", "Probably not perfume, just the grease oiling down his black hair.", "\n\nIf this panty-waist had come up to make with the Nazi tricks, he, Johnnie, would hit him with chair, rope and all. ", "But Rudolph hadn't. ", "His mouth was drooping open. \"", "What does this mean?\" ", "he was complaining. \"", "What are you doing?\" ", "He acted as if Johnnie had staged this only to annoy.", "\n\n\"I'm waiting for the expressman,\" Johnnie replied.", "\n\n\"I don't understand.\"", "\n\n\"Cut yourself a piece of brain. ", "You don't think I tied myself up in a package, do you?\"", "\n\n\"Who did?\"", "\n\n\"The Damnazis,\" Johnnie stated with emphasis.", "\n\nHe hadn't expected Rudolph to take it this way. ", "The goon's face went pearlier than his suit. ", "He cringed. \"", "Nazis! ", "Are they here?\"", "\n\n\"What do you think? ", "The place is full of those Nazi soldiers.\"", "\n\n\"Oh,\" cried Rudolph relieved. \"", "Those aren't Nazis. ", "They're the Rudamian guard. ", "Maybe some of them had to join the S.S. when the Nazis marched in but they got away. ", "They don't belong any more. ", "No one in Rudamia wants Hitler. ", "They don't like him. ", "They're going to throw him out.\"", "\n\n\"They and who else? ", "They couldn't even throw me out, and I don't live on top a mountain.\"", "\n\nRudolph said, \"At first you frightened me. ", "I thought perhaps I had been tricked by the Nazis. ", "I will not return and be one of their puppet rulers. ", "They approached me time and again in Egypt and I just told them I will not be a puppet ruler. ", "I shall return only as a rightful king of Rudamia to rule as I choose. ", "No other way.\" ", "He finished his speech and was curious again. \"", "But I still don't see why you're tied up here in this dreadful little room.\"", "\n\n\"I tell you it was the Nazis.\" ", "Johnnie was using the old bean now. \"", "You don't think they're here because they've fooled you. ", "What do you know about Dorp?\"", "\n\n\"Magda said—\"\n\n\"Magda wants you to be king so she can be queen. ", "She doesn't want to wait till the war is over. ", "She doesn't care who she plays with so long as she gets to be queen.\"", "\n\nThe prince was getting queasy again.", "\n\n\"Anyhow what does she know about Dorp? ", "She's a woman,\" Johnnie said smoothly. \"", "Maybe he's fooled her too. ", "But he doesn't fool me. ", "Talking German and Munich this, Munich that.\" ", "He demanded suddenly, \"Who comes from Munich?\"", "\n\n\"I won't be made a fool of.\" ", "Rudolph shuddered. \"", "But I'm afraid of Nazis. ", "They're brutes.\"", "\n\n\"Now you're jiving,\" Johnnie complimented. \"", "If you'll just untie me, we'll get out of here.\"", "\n\n\"Get out?\" ", "Rudolph piped.", "\n\n\"Yeah. ", "Get out. ", "But quick.\" ", "He coaxed, \"You want to get out, don't you? ", "You don't want to be a Nazi puppet, you said so.\"", "\n\n\"I want to be King of Rudamia,\" said Rudolph simply.", "\n\n\"You won't get to be King of Rudamia if the Nazis tie you up too and leave you here to starve to death.\"", "\n\n\"Starve?\" ", "Rudolph faltered in falsetto.", "\n\n\"Starve,\" said Johnnie grimly. \"", "Now will you untie me?\"", "\n\nThe goon still hesitated. \"", "I don't know whether I ought to. ", "Whoever tied you up might not like it.\"", "\n\n\"Well, you'd better,\" Johnnie menaced. \"", "You aren't going to like it a bit when the police come and find my body up here and arrest all of you for murder. ", "You'll never get to be King of Rudamia then.\"", "\n\n\"Police?\" ", "Rudolph's face was as spotted as his tie.", "\n\n\"Sure, the police. ", "Listen, I don't know how they do it in Rudamia but over here if somebody gets killed the police come and they haul everybody down to headquarters\"—he drew on his moving picture experience—\"and they keep giving them the third degree with rubber hoses until they get a confession and then—\" He decided he'd better cut before Rudolph fell flat on his face. ", "He concluded, \"So you'd better untie me so I can get both of us out of here before somebody gets killed.\"", "\n\nRudolph wiped his lavender face with his lavender handkerchief. \"", "How will you do it?\"", "\n\n\"Leave that to me.\" ", "Johnnie spoke with assurance. ", "Not one hundred percent but Rudolph couldn't know. \"", "It'll be a pipe to get the gun from that phony guard. ", "Why did you come up here anyway?\"", "\n\n\"I heard Magda's voice, in that back room downstairs. ", "By the time I finished dressing, she wasn't there. ", "I thought maybe she'd been coming up here. ", "There wouldn't be any other reason for her to be in that room.\"", "\n\n\"You discovered the secret door?\"", "\n\n\"I knew about it. ", "Ottomkopf told me before I left Mexico.\" ", "He tittered. \"", "How the guard comes up here without anyone knowing, to drill and hold meetings. ", "And how if anyone questions them on the street, they say they are actors, dressed for a performance.\"", "\n\n\"Drill in this cracker box?\" ", "Johnnie scorned. \"", "No wonder they are undersized. ", "Start with the hands, Rudolph. ", "Get them loose and I can do the ankles.\"", "\n\nRudolph began fumbling in back of the chair. \"", "There's a room beyond this, a big one. ", "This little one is for committee meetings.\" ", "He was panting like an Airedale pup. \"", "I can't budge these knots.\"", "\n\nJohnnie's heart zoomed down into his toes. ", "He wiggled them. ", "Then he perked. \"", "Listen, in my right hand pocket you'll find a knife. ", "Stick your hand in. ", "I'll try to lift up a bit. ", "My pants pocket. ", "And no hooking the folding dough there.\" ", "He strained at the ropes until Rudolph could edge in a hand. \"", "Any trouble getting past that guard?\"", "\n\n\"Certainly not. ", "He saluted and I came in.\"", "\n\n\"What did he say?\"", "\n\n\"Nothing. ", "I am his commander. ", "The Rudamian guard has never been loyal to that dreadful man. ", "They wish reinstatement of their rightful rulers.\" ", "He drew out the Scout knife. \"", "Is this it?\"", "\n\n\"Open the big blade and start sawing. ", "I'm pleased to hear you're the commandant, brother. ", "If Nosey peeks in tell him to mind his own business. ", "Saw away and mind the arteries.\"", "\n\n\"I still don't see what good this is going to do.\"", "\n\n\"You'll see,\" Johnnie told him. \"", "I'm tough. ", "I've been trained. ", "We'll get Stupid's gun—he doesn't even know how to handle it—then we'll march right out of here and if anyone gets in our way they better duck.\" ", "There was the rear to be considered on the march. \"", "You don't by any chance have a gun, do you?\"", "\n\n\"Oh my no!\" ", "Rudolph exclaimed. \"", "Otto made me carry one on the trip but I'm rid of it. ", "I loathe firearms of any sort.\"", "\n\n\"We'll risk it just the same.\" ", "Maybe he could back down the stairs with Rudo as a shield. ", "No one here would potshot the future King of Rudamia. \"", "Once we're out we'll grab a car and I'll drive you to the airport. ", "I'll see you get on the Clipper. ", "How did they get you into this mess in the first place?\"", "\n\n\"It wasn't a mess. ", "It was wonderful.\" ", "Rudolph stopped sawing for the moment to heave a sigh. \"", "Rudamia wanted me to return. ", "Most of Rudamia. ", "Only there's a man—he used to be in charge of the royal stables but he didn't like Father. ", "You see, Father used to sneak down to Kraken's house while he was currying the horses and steal his brandy. ", "That was when Grandmother put Father on brandy rations.\"", "\n\n\"Keep sawing. ", "Where's your Grandmother now?\"", "\n\n\"She's in Lisbon. ", "She's running a bar there. ", "Father died of apoplexy last year.\"", "\n\n\"So I heard.\" ", "Johnnie nodded. ", "His hands were free. \"", "Now give me the knife. ", "You got a mother?\"", "\n\n\"She divorced Father when I was quite young. ", "She lives in Hollywood. ", "She's married to a big producer there.\"", "\n\nJohnnie cut the chest and thigh bonds. \"", "Why don't you go home to Mother?\"", "\n\n\"I'd rather be king,\" Rudolph stated. ", "He was lighting one of his fancy cased cigarettes. ", "He dusted a chair with his lavender handkerchief, perched on the edge of it. \"", "That's what I was telling you. ", "The people want me, most of them, but Kraken wants to be president of Rudamia. ", "He tells them lies about me. ", "So unless I can get in fast after Hitler is run out, Kraken will force himself on the people.\"", "\n\n\"Tough,\" Johnnie murmured. ", "He stepped free. ", "Deliberately he took up the rope and began cutting it into tiny chunks.", "\n\n\"Why are you doing that?\"", "\n\n\"For fun,\" he retorted. ", "Nobody would tie him up again with this line. ", "Maybe they would have to knit the next.", "\n\n\"Colonel Ottomkopf—he prefers Herr Ottomkopf in these times—is a Prussian baron who has long been the military adviser of our kingdom. ", "He first got wind of Rudamia's planned revolt against Hitler and then he met Dorp who corroborated it. ", "Otto thought I should return, wait in Switzerland until the time was ripe. ", "I had to get out of Mexico anyway. ", "The Nazis had found out I was there. ", "They were watching me. ", "I never saw them but Otto did. ", "They wanted to take me back to be a puppet king, then you see they could hold on to the country for themselves even with Hitler gone. ", "I won't be a puppet king.\"", "\n\n\"Don't blame you,\" Johnnie grunted.", "\n\n\"Ferenz fixed it up that I could travel over the border. ", "He's very clever. ", "I pretended I worked for one of his companies in Mexico. ", "The Nazis were after me then, right on my trail. ", "But Otto put me safely on the plane. ", "The trouble is I have to be careful here too until I can get on the Clipper. ", "If the United States government knew that Rudolph of Rudamia was in town, they would intern me.\"", "\n\n\"Why?\"", "\n\n\"I don't know why.\" ", "He was petulant. \"", "I've written them about it time and again. ", "They let Ruprecht stay here but they refuse to let me come into the country.\"", "\n\n\"Rupe was in before Rudamia went Nazi, wasn't he?\"", "\n\n\"What difference does that make? ", "I'm more important than he is. ", "But no. ", "They refuse entrance to me—me! ", "Even my government-in-exile hasn't helped me. ", "Surely the American government cannot believe I am in sympathy with those loathsome Nazis. ", "Peasants! ", "Not a one of them has a pedigree.\"", "\n\n\"Bust mah britches,\" Johnnie murmured. \"", "And now if you'll light that candle for me.\"", "\n\n\"What for?\"", "\n\n\"I want to read a letter.\" ", "Johnnie moved to the table.", "\n\n\"Is there time? ", "Hadn't we better get away first?\"", "\n\n\"Won't take a minute,\" Johnnie said.", "\n\nRudolph's hand wobbled with the match. ", "Johnnie took the letter from his pocket. ", "He heated the pen knife and lifted seal upon seal. ", "There were a lot of papers. ", "He examined them.", "\n\n\"Who's it from?\" ", "Rudolph asked.", "\n\nJohnnie moved to the other side of the table. \"", "My girl.\" ", "There was nothing wrong with these as far as he could see. ", "Just Rudo's real passports and pedigrees. ", "But the weight of the letter had been too heavy. ", "He removed from one fold the thin brown cylinder. ", "And he stared at it.", "\n\n\"Why did she send you a cigar?\" ", "Rudolph wanted to know.", "\n\nHis voice was shaky. \"", "Cause I keep running out of cigarettes.\" ", "Here he'd been whamming around with the Rudamian boys and this in his pocket. ", "No wonder Dorp had passed it to Theo at the party. ", "He wouldn't have wanted to take any chance of trouble with this on him. ", "Theo didn't count. ", "Theo was expendable. ", "But what hit Johnnie right between the eyebrows was that neither did Rudolph count. ", "He wasn't supposed to reach Rudamia. ", "He was going to carry this thing with him on the Clipper. ", "It was the kind of thing that spies packed in boxes so ships would explode in mid-ocean. ", "Johnnie'd learned about them in bomb strategy.", "\n\nHe let out his breath. ", "It couldn't be harmful until morning. ", "It wasn't to be handed to Rudo until then. ", "Rudo might investigate the contents if he had it sooner. ", "Dorp certainly didn't intend to blow himself up. ", "Johnnie carefully put the cigar in his right hand coat pocket. ", "He heated the knife again, pressed down each seal until it stuck. \"", "We'd better get going, Rudo. ", "I mean going places. ", "You aren't safe here.\" ", "He blew out the candle, replaced the letter in his inner pocket.", "\n\nRudolph paled. \"", "You really mean you think—\"\n\n\"I know, son.\" ", "Johnnie nodded grimly. \"", "After this war you can throw a party for me in Rudamia. ", "The guy who saved you from sudden death. ", "Now you step out and speak to the guard and don't worry about what I do. ", "Don't mention my name.\" ", "He spat on his hands.", "\n\nRudolph went first. \"", "Good night,\" he quavered.", "\n\nJohnnie caught the guard on the first heel click. ", "A right behind the ear, swing him, a left to the jaw. ", "He grabbed the rifle as the fellow crumpled.", "\n\nRudolph squealed, \"Why did you do that?\"", "\n\n\"Remember, I'm saving you from sudden death,\" Johnnie vowed. ", "He grimaced at the prone guard. \"", "If we have any luck he won't wake up until we're safe outside. ", "Now listen, Rudo, we'll try strategy. ", "If that doesn't work we go into Commando stuff. ", "You walk ahead. ", "I follow with the shoulder arms—like this. ", "If anyone says, 'What cha doing?' ", "you say, 'One side, Joe.' ", "But if any of the big guys turn up we change around, me in front, fix bayonets, and then we rush the can. ", "Get it?\"", "\n\n\"Not very well,\" Rudolph admitted. \"", "Half of what you say has never been intelligible to me. ", "But I shall try to follow you.\"", "\n\nJohnnie patted his shoulder. \"", "That's the old one-two.\"", "\n\nThey met no one in the descent to Theo's room. ", "The corridor without was dim, silent. ", "Rudolph pulled Johnnie's sleeve. \"", "I'll have to stop in my room for a minute.\"", "\n\n\"What for?\"", "\n\n\"To get my suitcase.\"", "\n\nJohnnie was apprehensive. \"", "Do you have to?\"", "\n\n\"Oh, my yes!\" ", "Rudolph whispered. \"", "There's seven thousand dollars in it. ", "I can't leave that behind.\"", "\n\nJohnnie could understand that even if he didn't like the waiting, now they'd come this far. ", "Maybe that guard wasn't out as far as he'd looked. ", "He agreed reluctantly, \"All right, we'll stop.\"", "\n\n\"You wait outside,\" Rudolph warned. \"", "I won't be a minute. ", "Keep watch.\"", "\n\nHe opened a cautious door at the left, here at the back of the house. ", "Johnnie was glad of its location. ", "He didn't want to be near Magda's room, right front. ", "No telling what she might think up if she caught them sneaking out. ", "Rudolph had closed the door after him. ", "Johnnie stood in the semi-darkness listening to the thump of his heart. ", "It didn't sound good. ", "He hoped Rudo would step on it. ", "Thirty seconds seemed long. ", "And then, unmistakably, he heard footsteps below. ", "He ducked inside the room fast.", "\n\nRudolph jumped from the closet, holding a topcoat and a soft gray hat. ", "He shrilled softly, \"What is it?\"", "\n\n\"I don't know,\" Johnnie said. ", "He held the door, listened. \"", "Somebody's coming up or going down. ", "Either way it isn't good.\" ", "He pressed his ear to the crack. \"", "I don't think we'd better try it that way,\" he decided. ", "He had an idea.", "\n\nHe pushed past Rudolph toward the windows. ", "Before he got quite there, he stopped. ", "The way the bed stuck out had hidden this thing. ", "A guy lying flat on his face. ", "A big hole burned in the back of a pepper and salt topcoat.", "\n\nOnly a gun made a hole like that.", "\n\n# Four\n\nTHE MAN'S BLACK HOMBURG lay half under his head. ", "A suitcase was on its side resting under the pepper and salt arm. ", "The man didn't move. ", "Johnnie bent down, lifted the head by the black hair. ", "It was Theo. ", "Johnnie dropped the head and wiped his hand on his pants leg. ", "He kept wiping it. ", "He felt a little sick.", "\n\nHe'd never heard a throat rattling before. ", "Rudolph stood behind him. \"", "Dead?\" ", "he whispered.", "\n\nJohnnie nodded. ", "He was thinking about this. ", "It was all his fault the squirt was killed. ", "That made a fellow feel terrible. ", "If he hadn't held on to the papers, Theo wouldn't be lying here dead.", "\n\n\"Why is he in my room?\"", "\n\nJohnnie said heavily, \"I suppose he was coming in to tell you he was still loyal even if he had made a mess of things.\"", "\n\nRudolph said, \"No.\" ", "He said it one word at a time as if he couldn't make his tongue move. \"", "No. ", "He was running away. ", "My room's on the fire escape. ", "It isn't really my room. ", "It's Trudy's.\"", "\n\nThat was the first time Johnnie noticed the room. ", "It was a girl's room, all clean delft blue and white and a big framed photograph of Ruprecht on the dressing table. ", "It was signed: For Baby Mine from the Wolf.", "\n\nTheo had been running away. ", "There was his suitcase, a battered brown one, to prove it. ", "Rudolph's grip was a smart affair, striped, over by the bureau. ", "Theo was running away because everyone was down on him. ", "And it was Johnnie's fault that everyone was down on him. ", "Theo was scared of what Dorp would do. ", "Dorp had done it. ", "Johnnie's muscles knotted. ", "He'd beat the hell out of Dorp before he left here.", "\n\n\"Come on. ", "We must go quickly.\" ", "Rudolph put on his hat backward, struggled with his topcoat and grip. \"", "This is terrible, terrible.\"", "\n\n\"We're not going,\" Johnnie said.", "\n\n\"Not going!\"", "\n\n\"We've got to call the police.\"", "\n\n\"The police!\" ", "Rudolph screamed. \"", "We can't call the police.\"", "\n\n\"We got to,\" Johnnie repeated. \"", "When you find a body, you have to call the police.\"", "\n\n\"But if the police come they won't let me leave. ", "They won't let me be King of Rudamia. ", "You told me so.\" ", "Rudolph's chin wiggled. \"", "I don't want to stay here. ", "Not after this dreadful, terrible thing has happened. ", "In my room, too.\"", "\n\n\"That's another reason we can't go. ", "Suppose we skip out. ", "What happens? ", "Whoever rubbed out Theo gives the police our identification tags and we're picked up. ", "If we run away nobody's going to believe we didn't do it, or at least that you didn't. ", "The room is full of your fingerprints.\"", "\n\n\"Of course it is. ", "How silly. ", "But I didn't do anything wrong.\"", "\n\nJohnnie hadn't even considered that. ", "Rudolph could have before he came upstairs. ", "No. ", "He was too dumb.", "\n\n\"Why would I do it?\"", "\n\n\"Because he lost your passports.\"", "\n\n\"I didn't.\"", "\n\n\"No cop would believe that if we hightailed.\" ", "Johnnie looked hard at him. \"", "That's one reason why we're not skipping. ", "The other is that somebody's got to pay out for this. ", "We're going downstairs and tell that gang we found Theo. ", "And we'll see who isn't surprised. ", "Then we'll call the police. ", "We'll see who doesn't want us to call the police.\"", "\n\nRudolph took off his hat. \"", "I don't like this.\"", "\n\nJohnnie shouldered the rifle sadly. \"", "Who does? ", "Come on, Prince. ", "Nobody's going to hurt you. ", "Not now.\"", "\n\nRudolph followed timidly. ", "There weren't any guards at the throne-room door. ", "Johnnie opened it. \"", "You first,\" he told His Highness.", "\n\nRudolph walked in. ", "Johnnie followed with fixed bayonets.", "\n\nMagda cried, \"Rudo!\" ", "She wasn't expecting him, that was a cinch. ", "She had her yellow slacks hanging over the arm of the throne chair, her black velvet shoulders resting on the other arm. ", "She looked comfortable. ", "She looked alluring. ", "The allured was Janssen sitting at the foot of the throne. ", "He picked up the two highball glasses before he jumped to attention, before she rolled to her feet. \"", "Rudo, where have you been?\" ", "She looked beyond him and scowled. \"", "You're supposed to be tied up.\"", "\n\n\"I untied him.\" ", "Rudolph gazed balefully at Janssen.", "\n\n\"Why?\"", "\n\n\"Because I wanted to.\" ", "He kept his eye on Janssen. \"", "Where are the others?\"", "\n\n\"They're going over Ferenz's guest list name by name. ", "Trudy's phoning everyone to see if anyone picked up those papers by mistake.\"", "\n\n\"Ruprecht stole them,\" Rudolph said.", "\n\n\"She's trying to find Ruprecht too. ", "She's calling all the night spots but she hasn't caught up with him yet. ", "Where have you been, Rudo? ", "We've looked everywhere.\"", "\n\n\"You didn't look in my boudoir,\" Johnnie stated harshly. \"", "Have her go get the others in here, Rudolph.\"", "\n\n\"Janssen will get them,\" Rudolph ordered.", "\n\nJohnnie added, \"Ask them to come in here and don't tell them who or why. ", "Get it?\"", "\n\nMagda patted the throne. \"", "Come sit down, darling.\"", "\n\n\"I'll stay here,\" Rudolph told her frigidly. ", "He took a stance closer to Johnnie.", "\n\nJanssen had walked only to the end of the room. ", "He knocked on a door there. ", "Someone out of sight slid it open. ", "Janssen said, \"Will you come in please? ", "All of you. ", "By request.\"", "\n\nDorp emerged first, Ottomkopf, Ferenz, last Trudy. ", "She'd changed her white skirts too. ", "She had on pink slacks and a pink sweater and a pink ribbon around her yellow hair. ", "She looked about the age of the kid sister. ", "Only Sis hadn't filled out yet.", "\n\nFerenz burbled, \"Rudolph!\" ", "Dorp echoed it. ", "Trudy didn't say anything. ", "Ottomkopf said something in German. ", "Trudy was looking at Johnnie and his gun.", "\n\n\"Where have you been, dear?\" ", "Ferenz asked. \"", "We searched for you. ", "We thought maybe you'd left.\" ", "Dorp and Ottomkopf kept staring.", "\n\nJohnnie got it then. ", "Rudolph had threatened to go to Washington. ", "Theo and Rudolph looked pretty much alike. ", "In a dark room—Rudolph's room—a man with a suitcase was Rudolph. ", "Rudolph had been killed. ", "Only it turned out to be Theo. ", "Which one had fired the gun? ", "Everyone of them had been surprised when Rudolph showed up. ", "He wasn't expected to show up. ", "There was even a goat for the killer. ", "A dumb private from Texas, the stranger.", "\n\nJohnnie nudged the gray pinstripe ribs. \"", "Tell 'em.\"", "\n\n\"What?\" ", "Magda cried. \"", "Tell us what.\"", "\n\nRudolph shivered. \"", "We found Theo. ", "He's dead. ", "In my room.\"", "\n\nJohnnie watched faces. ", "They all managed to look amazed. ", "Ottomkopf demanded, \"Who is Theo?\"", "\n\n\"He was my lieutenant,\" Dorp said. \"", "The dumb one who lost the papers.\"", "\n\n\"Oh,\" said Otto, almost pleased.", "\n\nTrudy's little voice cut through. \"", "In your room, Rudo?\"", "\n\n\"Yes. ", "It's disgraceful. ", "Actually the room is yours but I was using it. ", "And I don't like such things.\"", "\n\nJohnnie said, \"Somebody shot him in the back. ", "Some dope. ", "Anybody with the sense of ducks would know he was the only one who might remember something about those papers.\"", "\n\n\"He should not have been killed,\" Dorp agreed.", "\n\n\"I'll say not.\" ", "Johnnie shifted the rifle. \"", "Well, where's the 'phone? ", "I'm going to call the police.\"", "\n\n\"The police?\" ", "They all said it and they all looked faintly surprised and more than faintly worried.", "\n\n\"Sure, the police. ", "You have to call the police when there's a murder.\"", "\n\n\"Maybe it was an accident,\" Ferenz began.", "\n\n\"You can't accidentally shoot yourself in the back. ", "Anyhow you have to call the police for an accidental death too. ", "I know. ", "My Uncle Tom was Sheriff of our county once.\"", "\n\nThat didn't go over at all. ", "Dorp eyed the others. \"", "It is true. ", "The police must be notified.\" ", "He didn't mean it.", "\n\n\"After Rudolph leaves,\" Ferenz smiled.", "\n\n\"Certainly. ", "After Rudolph leaves.\" ", "Dorp rubbed his fat head. \"", "We would not jeopardize the plans by calling now. ", "It is not long to wait.\"", "\n\nJohnnie shook his head. \"", "You can't do that. ", "You have to call the police right away.\"", "\n\n\"Young man, will you kindly mind your own business?\" ", "Ferenz sputtered. \"", "You've caused enough trouble tonight as it is. ", "Besides I thought you were tied up.\"", "\n\n\"I didn't like it,\" Johnnie swaggered. \"", "I don't wonder you're scared of the police. ", "You must be the worst hoarder in New York.\"", "\n\n\"I am not a hoarder.\" ", "Ferenz's face turned bright red. \"", "Every bit of food in my home tonight was produced on my own farm.\"", "\n\nOttomkopf accented, \"Why do you waste words with this specimen, Mr. Lessering?\"", "\n\nFerenz raised elephantine shoulders. \"", "He taunted me.\"", "\n\n\"And you're afraid of the police.\" ", "Johnnie jumped on Herr Ottomkopf with both feet. \"", "Because you're a German and they'd turn you over to the F. B. I.\"\n\nOttomkopf fixed him with two glazed eyes. \"", "I am a Rudamian.\"", "\n\n\"You're a Prussian!\" ", "Rudolph interjected. ", "He was ignored.", "\n\n\"I am here by permission thanks to Ferenz Lessering.\"", "\n\n\"I wouldn't want that to be investigated,\" Ferenz said.", "\n\n\"And you,\" Johnnie swung on Dorp. \"", "You're nothing but a scrub of a Nazi. ", "You killed Theo. ", "Rudo and I know why you killed him too. ", "You meant to kill Rudolph but you made a mistake in the dark. ", "You wanted to kill Rudolph so he couldn't go to Washington and tell about you.\"", "\n\nRudolph kept gulping.", "\n\nOttomkopf demanded coldly. \"", "Why did you dismiss the guard, Herr Dorp?\"", "\n\n\"A lot of good they'd do. ", "A lot of good they did before.\" ", "Johnnie swelled out his chest. \"", "Let's stop beating around the bush. ", "I'm going to call the police right now. ", "And soon as they get here Rudolph and I are heading for the airport. ", "I'm going to see he gets on the Clipper safe.\"", "\n\n\"Oh no you're not,\" Trudy said. ", "She said it from behind Johnnie and it wasn't her finger poked into his lower spine. \"", "You're going to drop that shotgun right now or you're going to get plugged in the back like Theo was. ", "One—two—\"\n\nJohnnie dropped it. ", "It made a bang big enough to cause all the audience to jump. ", "Ferenz put his hands over his ears. ", "Johnnie kicked himself. ", "Why hadn't he kept his eye on Trudy? ", "He ought to have known by now that the girls in this roost had more backbone than the men.", "\n\nRudolph was complaining. \"", "You can't do this, Trudy. ", "This man is helping me.\"", "\n\n\"Helping you?\" ", "She laughed out loud and pushed the hole deeper into Johnnie's spine. \"", "Sure, he's helping you. ", "Right into an internment camp. ", "He isn't one of your Rudamian patriots. ", "He's an American soldier. ", "He's even got dog tags. ", "Look under that shirt. ", "Private John Brown, United States Army.\"", "\n\nRudolph raised doubtful eyes at Johnnie.", "\n\n\"Sure, I'm in the Army,\" Johnnie admitted. \"", "But—\"\n\n\"He's a government spy,\" Trudy said. \"", "I've known it all evening but I didn't want to worry you. ", "I thought I could handle him until we got you away.\"", "\n\nJohnnie's mouth and eyes opened.", "\n\nRudolph scurried ever to Magda. \"", "And to think I almost let him take me away from here.\"", "\n\nJohnnie had found his voice. \"", "Rudolph, listen, of all the awful liars—\"\n\nTrudy jabbed the gun. \"", "You're going back upstairs, soldier. ", "Janssen, bring that rifle and come along. ", "This time you won't get untied. ", "Put your hands out in front of you, Johnnie. ", "Much safer than over the head.\"", "\n\n\"Rudolph, listen,\" Johnnie plead.", "\n\nRudolph was drinking Janssen's and Magda's drinks, one in each hand. ", "He shook his head.", "\n\nTrudy ordered, \"March.\"", "\n\nJohnnie marched. ", "Same old '76. ", "Let a girl pull a gun on him. ", "But these girls weren't fooling. ", "He was smart enough to know that. ", "The men might talk but the girls acted.", "\n\nHe hesitated on the third floor. \"", "Listen, Trudy—\"\n\n\"March,\" she commanded. \"", "Open the door, Janssen.\"", "\n\nThe fellow circled Johnnie to obey. ", "Even if Trudy were holding a gun, Janssen was still nervous about getting in front. ", "Johnnie waited until the man had the knob in his hand. ", "He couldn't resist. ", "He gave the chief guard a good hard boot in the behind.", "\n\nJanssen howled, \"Ow!\" ", "He jerked around.", "\n\nTrudy pushed with the gun. \"", "Stop that nonsense, Johnnie. ", "Go on, Janssen.\"", "\n\nJanssen, rubbing his rear, climbed on up. ", "He was out of sight before Johnnie and Trudy entered the closet. ", "When they reached the upper hallway, he was bending over the sniveling guard. ", "He ducked away from Johnnie. \"", "He hit Wallie!\"", "\n\n\"He hit me twice!\" ", "Wallie humped on the floor, rubbing his jaw.", "\n\n\"What did you do to him?\" ", "Trudy demanded.", "\n\nWallie whined, \"Nothing. ", "Not a single thing.\"", "\n\n\"Why not?\" ", "She jabbed at Johnnie. \"", "Go on in there. ", "Janssen, you and Wallie come too. ", "You'll have to tie him up.\"", "\n\nThe rope lay in jagged segments all over the floor. ", "Johnnie's boot pushed at one of them cheerfully. ", "Janssen and Wallie looked woebegone.", "\n\n\"What's the matter?\" ", "Trudy asked.", "\n\n\"He cut the clothesline!\" ", "Janssen informed her.", "\n\nJohnnie grinned. \"", "What you going to do? ", "Splice it?\"", "\n\n\"Sit down.\" ", "Trudy pushed. \"", "In that chair. ", "Take your belts, boys. ", "Strap him to it.\"", "\n\n\"My belt?\" ", "Janssen held on to its Sam Browne magnificence. ", "Wallie gazed at his, transferred his attention to the despoiled rope, and stepped backward.", "\n\n\"You heard me,\" Trudy said. \"", "Do as I say.\"", "\n\nSlowly, unhappily, the two guards removed the leather. ", "They weren't fooling when they approached Johnnie. ", "They hated his guts. ", "If Trudy hadn't been present they'd have jumped him and he knew it. ", "The straps bit into his ankles, crunched his wrists.", "\n\nTrudy rammed the gun into her waistline. \"", "That ought to do it. ", "You may rejoin His Highness.\"", "\n\n\"And you?\" ", "Janssen inquired.", "\n\nShe put both hands on her hips and lifted red hot and blue eyes to him. \"", "If you're not careful, Louie Janssen, you'll lose those bars on your shoulders. ", "Even if Magda is making a play for you. ", "Stop trying to think. ", "Obey orders. ", "Get out of here before I lose my temper. ", "I'm remaining to question the prisoner and I don't want your big ears in on it. ", "Is that clear? ", "Beat it. ", "Blitz. ", "Leave that door open and go.\"", "\n\nJanssen and Wallie clattered. ", "Trudy didn't move until she heard the sliding panel of the closet replaced. ", "Then she ambled over, slammed the door. ", "She returned to Johnnie. \"", "Where are the papers?\"", "\n\n\"What's the idea of tying me up?\" ", "he demanded.", "\n\n\"If you'd had any sense you wouldn't have tried to get loose in the first place. ", "You're safer up here. ", "If you can catch a little sense you'll stay tied up this time.\"", "\n\n\"You think this is fun?\"", "\n\n\"I think it's a lot safer here than below just as I told you. ", "If the F. B. I. agents decide to break in you'll have a much better explanation if you're tied up in the attic than if you're holding his princely hand downstairs.\"", "\n\nJohnnie hawed. \"", "You were seeing shadows. ", "That F. B. I. stuff is a lot of bunk. ", "Magda thought it up to get Rudo to leave. ", "After I told her you were trying to snake him.\"", "\n\n\"You told her that?\"", "\n\n\"Because you'd seen her smooching with Ruprecht.\"", "\n\n\"You told her that!\" ", "In another minute she'd pop him one.", "\n\n\"Well, you asked me to get Rudolph away.\"", "\n\n\"You didn't have to go that far. ", "Letting her think I cared what she and Rupe were doing. ", "I don't care that.\" ", "She spat. \"", "Now where are those papers?\"", "\n\n\"If you'll loose my hands—\"\n\n\"I won't and if you don't tell me where those papers are quick\"—she flipped up the gun again—\"you're going to have half an ear less in three seconds.\"", "\n\n\"They're where they've been. ", "Reach in my inside pocket.\" ", "He scowled. ", "If she'd release his hands alone he'd take a particular pleasure in holding her up by the heels until she hollered Uncle. ", "The brat.", "\n\nShe swished the envelope under his nose, turned it over and over. \"", "Did you open it?\"", "\n\n\"It's sealed, isn't it?\" ", "he glowered.", "\n\nShe seemed to be weighing it on her hand. ", "Finally she ripped the seals.", "\n\nHe warned her, \"You can't seal it up again if you do that.\"", "\n\n\"I don't intend to. ", "When it's found, no one is going to know who had it.\" ", "She sat down at the table, read carefully through the papers, read with a puzzled scowl. \"", "Is this all there was in it?\"", "\n\n\"'S all.\" ", "After he'd answered her, he realized she'd stuck him with that one. ", "But she didn't pay any attention. ", "She was rereading the documents. \"", "You're sure this is all? ", "Because there's nothing wrong with these, Johnnie, not a thing.\"", "\n\n\"That's what I figured.\"", "\n\n\"You said you didn't open it.\"", "\n\n\"I've got x-ray eyes,\" he grinned. \"", "How about letting loose my hands so I can smoke?\"", "\n\n\"Hold on.\" ", "She darted into the hall.", "\n\nWell, there'd been no harm in asking. ", "She had vanished. ", "He heard doors opening, closing. ", "And then suddenly she was there again. ", "She had a key in her hand. ", "She turned it in the door.", "\n\nHe tried not to duck when she walked over to him. ", "He kept telling himself she was only a blonde chick. ", "But he couldn't help the feathers blowing up and down his spine. ", "Not when she went behind him. ", "And then all at once his hands were free. ", "He couldn't believe it. ", "He looked at them, rubbed at his wrists. \"", "That bastard buckled too tight.\"", "\n\n\"What did you expect? ", "You kicked him. ", "Undo your own feet.\"", "\n\nHe was wary. ", "He didn't get this. ", "He asked, \"You won't shoot?\"", "\n\nShe looked like a kid but her eyes were wise as hell. \"", "Don't be an ass,\" she said. ", "Her eyes were looking not into his but down into his soul. \"", "I need your help.\"", "\n\n## 2.", "\n\nTrudy perched on the table and riffled the precious papers. ", "Johnnie walked around getting the blood to circulating in his ankles.", "\n\n\"I don't get it, Johnnie,\" she admitted.", "\n\n\"What did you expect to find?\" ", "He stood on his toes.", "\n\n\"Treachery. ", "I distinctly heard Dorp tell Theo to keep that envelope on him and tell no one. ", "Later I heard Theo tell someone over the phone that Rudolph would never reach Europe. ", "That's all I heard. ", "It wasn't in the car. ", "It was before we left the house. ", "I didn't get a chance to pick his pocket until we were at Ferenz's. ", "But there isn't anything here to stop Rudolph.\" ", "She tapped her knuckles against her teeth. \"", "I must reach Ruprecht.\"", "\n\n\"You haven't yet?\"", "\n\n\"He isn't in the bars. ", "That was a smoke screen to keep them quiet below. ", "I know where he is.\"", "\n\n\"Call him.\"", "\n\n\"No phones. ", "He's in one of two places. ", "One's a little beerstube up on Columbus. ", "Just a hole-in-the-wall. ", "He likes it there. ", "The other—\" She bit her lip. \"", "The other is a woman's apartment. ", "On West End. ", "That's where you come in.\"", "\n\n\"Me?\"", "\n\n\"You've got to go get him.\"", "\n\n\"I got to get the police.\"", "\n\n\"I'll call them. ", "You get Rupe.\"", "\n\n\"Listen, honey—\"\n\n\"I know. ", "But I'll take care of details. ", "I'd do it myself only I don't dare leave. ", "I don't know what they might think up while I was away. ", "You'll have to do it.\"", "\n\n\"But honest,\" Johnnie argued, \"I don't know a thing about where Columbus is or the West End or nothing. ", "I've never been in New York before tonight.\"", "\n\n\"It's easy. ", "Look. ", "You just walk down to the end of the block and that's Columbus. ", "Turn left. ", "Middle of the block, right hand side. ", "You can't miss it. ", "Go there first. ", "If Hans hasn't seen Rupe tonight then you walk over—\"\n\n\"Wait a minute.\"", "\n\n\"All right.\" ", "She repeated directions. \"", "You have it?\"", "\n\nHe nodded. ", "That much was clear.", "\n\n\"If he isn't there, walk back over to Broadway. ", "That's the other direction. ", "Go downtown to a Hundred and Third Street. ", "It isn't far. ", "Then turn right and walk the same direction you did to Broadway, west. ", "West End's the next street. ", "It's an apartment house. ", "The Dragham. ", "The name is\"—she raised her nose—\"Edna Riggens.\" ", "She went on very fast. \"", "She's a dreadful person but Rupe likes her. ", "He likes so many people. ", "Mostly women. ", "That's half his trouble. ", "You will go get him, won't you?\"", "\n\n\"Sure I'll go,\" Johnnie was hearty. \"", "There's nothing I'd like better than to go.\" ", "He eyed her. \"", "But not without my own clothes.\"", "\n\nShe eyed him right back again. ", "She was little and tough but she knew when she was beaten. ", "Right now. \"", "All right,\" she nodded. \"", "You sit tight. ", "I'll fetch them.\"", "\n\nShe unlocked the door, closed it after her. ", "But she wasn't taking any chances on him. ", "He heard the key turn in the lock. ", "He lit a cigarette. ", "At long last he could break out of here. ", "He'd deliver the message to Rupe and then make tracks for Times Square. ", "He'd probably never find Bill or Hank at this hour but that wasn't important. ", "The main thing was to get away.", "\n\nThe key rattled in the lock. ", "Trudy reentered bearing his uniform on a hanger. ", "She said, \"Pick up your shoes outside the door and lock it again.\"", "\n\nHe did. ", "She handed over the uniform. ", "For a hurry-up job and the shape it had been in, it looked pretty good. ", "It didn't even smell too much of cleaning fluid. ", "He sniffed, \"How long has this been back?\"", "\n\n\"For hours,\" she said airily.", "\n\n\"Then why in thunderation—\"\n\n\"I wanted you here.\" ", "Her cobra smile vanished quickly. \"", "I had a hunch I'd need help, playing a lone hand against this field.\" ", "She urged, \"Well, go on. ", "Get dressed.\"", "\n\n\"Where?\"", "\n\nScorn lifted her nose. \"", "Since when are you so particular? ", "Go on. ", "I've seen your underwear before tonight.\"", "\n\nHe pulled off a boot. \"", "There's no more privacy here than at a reception center.\"", "\n\nShe didn't pay any attention to him. ", "She was walking up and down, her hands behind her back. \"", "You will find Rupe for me and bring him back, won't you?\"", "\n\n\"I'll see he gets here. ", "But I don't see any reason why I should walk back into this bear trap. ", "I've been waiting for hours to get out of the dump.\"", "\n\n\"Because I need you.\" ", "She stopped in front of him. \"", "Don't you see it's Rupe and me against the field? ", "And if you two don't return—\"\n\nHe pushed her out of his way. \"", "Are they Nazis?\" ", "he demanded.", "\n\n\"I don't know. ", "I don't know what Dorp is. ", "Maybe he's a Nazi. ", "Maybe he's of the Terrorists. ", "He brought Rudolph here to kill him.\"", "\n\n\"I don't get it.\"", "\n\n\"If he's a Nazi and can get rid of Rudolph, they can put a puppet king on the throne. ", "The Terrorists want a president.\"", "\n\n\"What about Ruprecht?\" ", "Under cover of the shirt, he transferred the cigar.", "\n\n\"He doesn't want to be king. ", "He'll abdicate in favor of anyone. ", "He'll do anything to keep from being king.\"", "\n\nJohnnie took an inner squint at it. \"", "Why didn't some of you tell Rudolph what it was all about? ", "Why did you let him walk into this?\"", "\n\n\"I didn't know, stupid. ", "I didn't know until tonight that anything was wrong. ", "Of course I didn't believe all that stuff about Rudamia wanting him but I knew he wasn't safe in Mexico with the Nazis gunning for him, and he couldn't come here. ", "His government-in-exile told your state department they absolutely would not have Rudo in their hair. ", "So I thought it would be fine if he could be sent as far as Switzerland. ", "My mother's there and she would keep an eye on him. ", "The others still don't know there's anything wrong. ", "Magda wanted Rudo to come so she could get her claws on the crown. ", "Otto's a royalty boy. ", "He wants to play Metternich for twenty-five more years in Rudamia. ", "If he's the one who puts Rudo back on the throne, he's set, don't you see? ", "And Ferenz—well, I guess he has so much in the hole now that he has to keep the Ruffeni heirs in the saddle until they pay off. ", "He's the one that found Dorp and Dorp's running the show. ", "Rupe and me haven't had anything to say.\"", "\n\n\"You could tell them now,\" Johnnie suggested.", "\n\n\"Tell them anything!\" ", "she snorted. \"", "Don't you understand? ", "Dorp is Ferenz's pet They're all so used to doing what Furry says—because of the money of course—they'd never believe me.\"", "\n\nJohnnie turned his back to button his trousers. \"", "But how you going to keep Dorp from killing Rudolph? ", "If that's what he wants.\"", "\n\nShe frowned. \"", "I'm going to stick right with him. ", "He's waiting for Rupe to show up with the papers. ", "Something about those papers means death for Rudo. ", "I can't fathom it but I know it's true. ", "Dorp's not going to make a move until he knows for sure they won't turn up. ", "As long as he believes he can put Rudolph on the Clipper, he won't risk his fat neck.\"", "\n\n\"What do you mean he's not going to move? ", "Theo's dead, isn't he? ", "He wasn't killed because he was Theo. ", "You know that. ", "Dorp or whoever had the gun thought it was Rudo sneaking out. ", "Bang.\"", "\n\n\"That's true,\" she admitted. \"", "But that was different. ", "It was because of the F. B. I., not Rudamia. ", "You get Rupe for me and—\"\n\n\"And what?\"", "\n\n\"He'll snake Rudolph out of here. ", "Then—\"\n\n\"What?\"", "\n\n\"Leave it to me.\" ", "She was a chubby pink cherub but he didn't doubt her abilities.", "\n\n\"O. K. I'll get him.\" ", "He jerked his tie under the second button.", "\n\n\"And you'll come back with him?\"", "\n\n\"I don't know. ", "But I'll fetch Rupe for you. ", "And you'll call the police right away? ", "We don't want to get in any serious trouble.\"", "\n\n\"I'll call them. ", "Don't worry about that.\"", "\n\n\"How do I get out without being caught?\"", "\n\n\"That's easy.\" ", "She walked to the far wall, shoved it open. ", "There wasn't any door you could see, just wall, but it opened. ", "She reclosed it. \"", "The house next door is Dorp's too. ", "Just in case of emergencies. ", "He didn't tell me but I found out. ", "No one lives there but an old lady—a cousin of Dorp's. ", "She's in Brooklyn for the week end. ", "You just go on through and out the front door.\"", "\n\n\"How do I get back in?\"", "\n\n\"There's a key in the hall table drawer. ", "Take it with you. ", "Can you make it in the dark? ", "Better not turn on the lights.\"", "\n\n\"I can make it.\" ", "He started to the wall.", "\n\n\"Wait.\" ", "She caught his arm. \"", "Wait.\" ", "She took a packet of safety matches from her pants pocket, lit the candle. \"", "Turn out the light.\" ", "He obeyed. ", "She carried the candle to the front window. ", "She kept it in front of her while she signaled some message. ", "He couldn't get it. ", "She said casually, \"You wouldn't get out otherwise. ", "But don't mention it to Rupe. ", "He doesn't have to know everything.\"", "\n\nIt struck him then; he might be walking Ruprecht back into a trap. ", "Two princelings at one fell swoop. ", "Well—he still had a string to his bow. ", "Good thing he'd held it out. ", "That bomb might come in handy yet.", "\n\nShe pushed the wall again. \"", "Make it quick, Johnnie. ", "It may take you an hour but make it quick as you can. ", "They'll want to start to the airport in plenty of time. ", "I'm sorry I can't let you use one of the cars but I'm afraid to risk that. ", "You will hurry?\"", "\n\n\"I sure will.\"", "\n\nShe turned her face up to his. ", "Unaccountably she closed in. ", "He didn't question it. ", "Her arms went around his neck. ", "His arms went around her. ", "He kissed her. ", "It was a kiss. ", "And then he yelped.", "\n\n\"Now I know you'll come back.\" ", "His dog tags dangled from fingers. ", "The dirty little tramp, rubbing the back of his neck, cutting the plastic cord while he was otherwise engaged. ", "She must have cut it, nobody could break one of those things.", "\n\nHe lunged but she had a smile and the gun aimed at him. ", "The gun wasn't fooling any more than it had been earlier. \"", "Run along, Johnnie, and hurry back.\" ", "She closed him in behind the wall.", "\n\nIt would serve her right if he didn't go looking for Ruprecht. ", "It would serve her right if she never laid eyes on him again. ", "Only what was he going to tell the sergeant about losing the dog tags? ", "You couldn't lose them. ", "Not unless somebody sawed your neck in two jerking them off. ", "And there was still the problem of the dead body. ", "Somebody would have to call the police eventually. ", "With him missing, who would they claim did it? ", "Private First Class John Brown of the United States Army. ", "That's what he got for giving his right name.", "\n\nHe had to go back. ", "What's more he wanted to go back. ", "He wanted to get a crack at those Nazi-Rudamians. ", "Dressing him up in a Nazi uniform and parading him across town. ", "Making him think it was a chauffeur suit. ", "He wasn't so sure Magda wasn't in on the plan to knock off Rudolph. ", "Not the way she'd honeyed up to Ruprecht. ", "He wasn't so sure Dorp had killed Theo. ", "After all Dorp and Theo had been pretty chummy. ", "Magda, moreover, had a pretty curious glint in her green eye when she said she'd never killed a man. ", "Then there was Ottomkopf of the glassy glims. ", "And Ferenz Lessering of the Lesserings, making deals with Nazis even if he did make munitions to kill Nazis.", "\n\nHe wasn't so sure of Trudy's wanting Ruprecht merely to get Rudolph away. ", "If that was it, he, Johnnie, could do the job a lot quicker. ", "How was Ruprecht going to help? ", "He and Rudo were not aficionado. ", "Johnnie found the key in the hall drawer. ", "He stuck it in his pocket. ", "He opened the front door cautiously, slipped out, closed it without sound. ", "There were men walking down the street on this side, up the street on the other side even at this hour. ", "There was a fellow and his girl doing some smooching on the stoop of the house across the way. ", "No cops. ", "No guards. ", "No Terroristis that Trudy had dreamed up to keep him from skipping. ", "And nobody paid any attention to him. ", "He walked fast, his heels hitting hard on the pavement. ", "Wasn't far to Columbus Avenue. ", "He found Hans' place easy enough. ", "Late as it was, the door opened. ", "Hans was a long, tall drink of water with a scar taking up most of his right cheek. ", "The place smelled good, like beer. ", "It was a little joint, two booths, three red-checkered tables pushed together. ", "The only customer was a big black cat. ", "Johnnie clinked down a quarter. ", "He had time for a beer. ", "He'd take time for a beer. ", "He needed fortifying.", "\n\nHans asked, \"What kind you want?\"", "\n\n\"Anything wet.\" ", "Johnnie drank from the bottle. \"", "Rupe been in tonight?\"", "\n\n\"Who is that?\"", "\n\n\"Ruprecht of Rudamia.\"", "\n\n\"That is what I think you say.\" ", "Hans shook his long head. \"", "Who send you? ", "Kraken?\"", "\n\n\"Never heard of him.\" ", "He had but he couldn't remember who it was.", "\n\n\"I have not seen Ruprecht for one week,\" Hans said.", "\n\nThe cat had slant green eyes just like Magda's.", "\n\nJohnnie said, \"His cousin wants him to come home.\" ", "Trudy called Rupe's father Uncle Ruffeni; that should make them cousins.", "\n\n\"You know his cousin?\"", "\n\nHans might be too chatty; he might be one of Dorp's stool pigeons. ", "Johnnie said, \"Sure. ", "Just came from a date with her. ", "She asked me to drop by and see if he was here.\"", "\n\n\"He lives at Ferenz Lessering's,\" Hans stated with importance.", "\n\n\"He isn't home.\" ", "Johnnie finished the beer, took up his change. \"", "Thanks. ", "Which way to Broadway?\"", "\n\n\"Right across town.\" ", "Hans pointed.", "\n\nJohnnie didn't walk back to Dorp's street, not with Hans maybe watching him. ", "He went on up another block before turning crosstown. ", "He tried not to keep looking over his shoulder but somehow he couldn't help it. ", "The brownout was practically a blackout here uptown. ", "He felt better when he crossed Broadway and there still wasn't anybody following him. ", "Now down to 103d. ", "The blocks going this way were short. ", "He swung along getting back his confidence. ", "It was sure quiet though here uptown, quieter than Corpus Christi. ", "A trolley bumped up the tracks, the few passengers slumped down behind the lighted windows.", "\n\nAnd Johnnie smacked headlong into a guy as tall as himself. ", "He umphed, \"Excuse me, Mister.\" ", "Then he looked. ", "For a minute he thought it was one of the Nazi-Rudamian peasants. ", "It wasn't. ", "The guy was a cop. \"", "Excuse me,\" he repeated. \"", "Should have been looking where I was going, sir. ", "Guess I was too busy watching the street car.\" ", "He kept stammering because he sure didn't want to be kept by a policeman right now. ", "It was bad luck, that's what it was. ", "The black cat with Magda's eyes.", "\n\nThe cop said pleasantly, \"That's all right, soldier.\" ", "In the dim light he appeared a good-looking dark fellow, not much older than Johnnie himself. ", "His dark eyes were good-natured. ", "But he didn't move out of Johnnie's way. \"", "You on a furlough?\"", "\n\n\"Just a pass.\"", "\n\n\"Live up this way?\"", "\n\n\"No, sir. ", "I'm from Texas. ", "This is the first time I've ever been in New York.\"", "\n\nThe cop grinned. \"", "How do you like it?\"", "\n\n\"Well—I—\" How did he like it? ", "That hadn't occurred to him. ", "He hadn't had time to think about New York at all. ", "He hadn't even had time to see it. ", "All at once he got mad. ", "Not at the cop; he liked the guy's face. ", "He'd always wished instead of yellow curly cowlicks he had black hair, not skimpy patent leather hair like Rudolph's but thick, like this fellow's would be from the looks of what showed under his cap.", "\n\n\"You don't like it?\"", "\n\n\"Oh, I sure do!\" ", "Johnnie said quickly. \"", "I always like new places. ", "I'd never been out of Texas, only to Mexico, till I joined the Army. ", "I've sure been enjoying all the strange places I've been seeing.\"", "\n\nThe cop grinned some more. \"", "Glad you like it, soldier. ", "It's my home town. ", "Doesn't look the way it should because of the war. ", "Wish you could have seen her when she was lit up. ", "But then if it weren't for the war you wouldn't be here at all, would you?\"", "\n\n\"That's right,\" Johnnie grinned back. ", "He liked this young cop. ", "Only he ought to be getting on his way. ", "There wasn't much time left. \"", "I haven't seen much of it yet but tomorrow—I guess it's today—anyhow I'm going to see the town, the whole town. ", "The Empire State Building and Radio City and the Statue of Liberty and—\"\n\n\"You should see the Bronx Zoo and the Metropolitan Museum, too. ", "Sure most of the best pictures are sent away but there's the Roman Gardens—they're worth the price of admission. ", "And the Egyptian tombs—\" The cop broke off. ", "He looked a little anxious, like Bill. \"", "You'd better get going on your way now, soldier. ", "It's not safe wandering around at nights any more.\" ", "He shook his head sadly. \"", "It used to be safe any time of the day or night up in these parts but it just doesn't seem to be since the brownout. ", "You'd better get inside.\"", "\n\n\"Okay,\" Johnnie nodded.", "\n\n\"'Night.\"", "\n\n\"Good night.\"", "\n\nHe started out but the cop turned after him. \"", "Where are you stopping, soldier?\"", "\n\n\"I don't know yet,\" Johnnie admitted. \"", "My compadres are downtown waiting for me.\" ", "He hoped. \"", "Bill always takes care of things like that.\"", "\n\n\"How did you get so far uptown?\"", "\n\n\"I came for a subway ride,\" Johnnie explained.", "\n\nThe cop doubled up. \"", "That's a good one.\"", "\n\n\"Well, I wanted to,\" Johnnie defended. \"", "Hank and Bill thought I was crazy but that's what I wanted to do.\"", "\n\n\"Pardon me for laughing,\" the cop apologized. \"", "I couldn't help it. ", "I live in the Bronx. ", "Twice a day, every day, I'm a whole hour wasting time on the subway getting from and to home. ", "I couldn't imagine anyone riding the subway for fun.\" ", "He removed his cap now, brushed back the thick dark hair, just a little curly not like Johnnie's yellow bush. \"", "Come on and have a cup of coffee with me just to show there's no hard feelings. ", "Then I'll see you to your subway and you can go downtown to your friends.\"", "\n\n\"I'm not going downtown just yet,\" Johnnie said hesitantly. \"", "There's no hard feelings only I haven't got time for a coffee. ", "Wish I had but I'm late now.\"", "\n\n\"Where are you going?\" ", "A bit of suspicion went into that question.", "\n\nJohnnie recited glibly, \"The Dragham on West End Avenue.\"", "\n\n\"You know somebody there?\"", "\n\n\"Oh yes,\" Johnnie nodded rapidly. \"", "I don't know Edna Riggens—it's her apartment—but I know Rupe. ", "He's the one I'm looking for.\"", "\n\n\"No trouble?\" ", "The cop wasn't suspicious but he was anxious again.", "\n\nJohnnie laughed. \"", "No, sir. ", "I like Rupe.\" ", "He closed his mouth quick. ", "If he weren't careful he'd be talking too much. ", "He brought his hand up vaguely, \"Well, good night, sir. ", "I sure enjoyed talking to you.\"", "\n\nThe cop settled his cap. \"", "I might as well walk that far with you, soldier. ", "Seeing's you're a stranger, you might get lost.\"", "\n\n\"You needn't do that,\" Johnnie assured him. \"", "I never get lost. ", "Except once in Newark and that was the parade.\"", "\n\n\"No trouble at all, soldier. ", "I'm not looking forward to my subway ride.\" ", "He haw-hawed on that, started Johnnie down the street.", "\n\nYou just couldn't tell a cop, \"Run along, Bub,\" not even a cop off duty. ", "Besides this fellow was nice. ", "He talked kind of funny, sort of \"dese\" and \"dose\" and \"goil,\" but so did most the New Yorkers he'd met at camp. ", "Anyhow this cop was a regular Joe. ", "He was trying to be helpful. ", "He didn't know that Johnnie was mixed up with a mess of screwballs. ", "If he, Johnnie, had had a guy like this with him tonight, he would have cleaned out that place hours ago, not wasted a good evening. ", "For a moment Johnnie was inclined to tell all. ", "He buttoned up his lip tighter. ", "It wasn't going to do him any good in the Army if he got mixed up in a murder investigation. ", "He would let Trudy take care of the police angle. ", "She'd call them. ", "She said she would.", "\n\n\"What's your name, soldier?\" ", "the cop asked chattily.", "\n\n\"Private First Class Johnnie Brown.\"", "\n\n\"How is it down in Texas? ", "Lots of broncos and sagebrush and Indians?\"", "\n\n\"Sure,\" Johnnie grinned. \"", "What's your name?\"", "\n\n\"Mike Costello.\"", "\n\n\"Say!\" ", "Johnnie shouted. \"", "You played left end for Fordham two years ago. ", "Or are you that Michael Costello?\"", "\n\nThe cop looked modest. \"", "I'm the one.\"", "\n\n\"I was right end at Texas A. and M. last year. ", "Not that I was in your class, Officer Costello.\"", "\n\n\"Call me Mike, Johnnie. ", "We turn here.\"", "\n\nThey were on a long side street now. ", "Almost pitch dark. ", "Wasn't bad having someone beside you. ", "Not that Johnnie was scared of the dark. ", "But he liked company. \"", "Remember that game you played with N. Y. U.?\"", "\n\n\"De Vi'lets,\" Mike Costello growled. \"", "They spiked me in the first two minutes of play. ", "I'll tell you how it was.\"", "\n\nJohnnie hung on every word. ", "He didn't even realize they'd been standing under the canopy of a mid-street apartment house until Mike concluded, \"And that's why I scummed four of those gorillas—by accident, I mean. ", "We always play clean. ", "Well, here we are at the Dragham. ", "You don't want me to wait and show you to the subway?\"", "\n\n\"No, thanks,\" Johnnie said. \"", "I'll be walking back with Rupe to his cousin's. ", "I guess they'll see I find the right subway later.\" ", "He clasped Mike Costello's hand. \"", "I'm sure glad I bumped into you. ", "I really did, didn't I? ", "Anyhow it's something I'll always remember. ", "My kid brother's going to get a big boot out of it when I write him I met Mike Costello of Fordham. ", "Good night, Mike.\"", "\n\n\"Good night, Johnnie. ", "Happy landings.\" ", "He strode back into the gloom. ", "Johnnie peered into the dim foyer. ", "This wasn't any dump. ", "The lobby was full of over-stuffed furniture. ", "In one chair there was a plum uniform with brass braid. ", "The little guy in it nodded in snoring rhythm. ", "Johnnie put his hand on the door. ", "And suppose Rupe wasn't here? ", "Who was he, Johnnie, to barge in on some strange woman at two o'clock in the morning? ", "He took one long-legged stride back to the pavement. ", "He spread his mouth wide with his forefinger and his little finger and he whistled. ", "It sounded loud in the pitch quiet of West End Avenue. ", "The murky figure down near the corner turned. ", "Johnnie waved an arm wildly. ", "Mike Costello came pounding back.", "\n\n\"What is it?\" ", "He asked. ", "He wasn't a bit out of breath.", "\n\n\"Listen,\" Johnnie began. ", "He barged right in without thinking of any consequences. \"", "Listen, Mike, would you be interested in a murder?\"", "\n\n## 3.", "\n\nMike Costello leaned to him, smelled his breath. \"", "I thought it was beer. ", "It is beer.\"", "\n\n\"Only one beer,\" Johnnie said. \"", "And the champagne was hours ago. ", "I'm strictly sober.\"", "\n\n\"Didn't you say murder?\"", "\n\nJohnnie nodded.", "\n\n\"Here?\"", "\n\n\"Oh no, not here. ", "I haven't been here yet.\" ", "Johnnie was polite. \"", "I thought maybe if you aren't in too big a hurry to get home you might go in with me here to get Rupe, then we'll go back to where the murder is.\"", "\n\n\"And where is that?\"", "\n\nJohnnie's face fell. \"", "I didn't even think. ", "If Rupe isn't here I don't know how to get back.\" ", "He reared up. \"", "I've got to get back. ", "She snitched my dog tags.\"", "\n\n\"Who's she?\"", "\n\n\"Trudy. ", "She's the one sent me after Rupe. ", "And she took my dog tags so I'd come back.\"", "\n\nMike was patient. \"", "What about this murder?\"", "\n\n\"That's where it happened. ", "In that house we're going back to—if Rupe's here.\"", "\n\n\"There really was a murder?\"", "\n\n\"Yeah. ", "Rudo and me found the body.\"", "\n\n\"Who is it?\"", "\n\n\"A little guy named Theo. ", "I don't know his last name.\"", "\n\n\"Who killed him?\"", "\n\n\"I don't know,\" Johnnie said wide-eyed. \"", "You're a policeman. ", "I thought maybe you could find out. ", "Trudy said she was going to call the police but I've been thinking maybe she won't. ", "The whole bunch is pretty loopy. ", "I think they're—\"\n\nMike Costello sniffed again.", "\n\n\"I know it makes me sound loopy but I'm not,\" Johnnie defended. \"", "Strictly not. ", "You come along with me and I'll show you.\"", "\n\nThe cop said, \"I ought to turn in an alarm if this is straight. ", "Even if I am really off duty—I was just going to check out at my precinct when I met you. ", "You say you don't know where this house is. ", "How did you get there in the first place?\"", "\n\n\"I followed a fat old man I saw on the subway. ", "His name's Dorp. ", "He was talking German and I didn't like it. ", "It's his house. ", "Listen, Mike, I have to hurry and get Rupe back before they take Rudo to the Clipper. ", "I got to get my dog tags. ", "You don't know that top sergeant of mine. ", "I'll tell you all about it after we get Rupe.\"", "\n\nMike scratched his head. \"", "Either you're stir crazy or giving me a rib is what I think, soldier.\"", "\n\n\"I'll prove it,\" Johnnie coaxed. \"", "Will you come?\"", "\n\nMike hesitated. \"", "I might as well, Texas. ", "Any guy with an imagination like yours needs a caretaker.\"", "\n\nJohnnie sighed relief. \"", "I sure hoped you would. ", "And honestly every word is true.\"", "\n\nThey entered the foyer. ", "Costello tapped the sleeping plum uniform on the knee. ", "The little guy jumped up. ", "When he recognized a cop he jumped again.", "\n\nMike asked, \"What's that name, Johnnie?\"", "\n\n\"Edna Riggens.\"", "\n\nThe little guy talked foreign. \"", "What is it? ", "I will call the manager, yes?\"", "\n\n\"That you won't,\" Mike said. \"", "You'll take us up to Edna Riggens' apartment and you won't call her either.\" ", "He softened. \"", "It isn't a pinch. ", "We're pals.\"", "\n\nNormal pallor returned to the man's face. \"", "Yes. ", "Yes indeed.\"", "\n\n\"Get going,\" Mike ordered. \"", "Into the elevator with you. ", "What's her number?\"", "\n\n\"Ten B.\"\n\n\"That better be right.\"", "\n\n\"It is right.\"", "\n\n\"And we don't want any manager in this. ", "So be sure you don't talk until we leave.\"", "\n\n\"Yes, sir,\" the man said sullenly. ", "He stopped the cage at ten. \"", "It is front left.\"", "\n\nJohnnie stepped out first. ", "Mike Costello followed. ", "He said, \"I ought to run that guy in on suspicion.\"", "\n\n\"Not now. ", "We haven't time.\" ", "Johnnie stopped at B. \"Listen, Mike, don't tell Rupe anything about the murder yet or he might not come with us.\"", "\n\n\"I won't,\" Mike swore. \"", "I won't mention it to a soul.\" ", "It was obvious that he still didn't believe it.", "\n\nJohnnie pushed the button, kept his finger there. ", "They waited. ", "He didn't like this. ", "Trudy didn't know Rupe was here. ", "Edna wasn't going to appreciate getting out of bed at two in the morning for nothing.", "\n\nThe door opened with, \"Hold your horses.\" ", "The girl inside the darkened hall looked out at them and then she took another look, opening her brown eyes as big as plates. ", "She was a honey. ", "Upswept red hair, uplift black satin tight as a cinch. ", "She smelled like whisky. ", "Her voice wasn't pleasant when she said, \"You got the wrong number, soldier.\" ", "There was a Conga squawking away in the inner room. ", "She yelled back, \"Turn that damn thing off, Rupe.\"", "\n\n\"No, I haven't, babe,\" Johnnie grinned. ", "He moved his foot inside the door.", "\n\n\"You sure have. ", "I've never laid eyes on you before and you know it. ", "Honestly, copper\"—she dazzled a smile beyond Johnnie to Mike—\"I've never laid eyes on him.\"", "\n\nJohnnie heard Rupe's lazy voice coming behind her. \"", "What's going on, Edna?\" ", "He came in sight. \"", "It's Johnnie.\" ", "He smiled all over his face. \"", "It's my soldier boy, Edna.\" ", "He brushed her out of the way. \"", "Come on in, soldier. ", "Bring your friend. ", "Sure, come on. ", "I've got just what you're looking for. ", "Don't mind Edna, I pay the rent.\" ", "He reached out, put his arm around Johnnie's shoulder. ", "He spoke backward to Mike. \"", "You come right along. ", "Any friend of Johnnie's is my friend. ", "Right here, soldier.\"", "\n\nIt was a nice living room with flowered couches and easy chairs and a big radio-phonograph. ", "Edna followed reluctantly. ", "Her eyes were still stretched wide. ", "She picked up a half-filled highball glass and sat down plunk in the farthest away chair.", "\n\n\"Just what you're looking for, Johnnie. ", "Help yourself.\" ", "Rupe pointed to six bottles of champagne on the table. ", "One was empty, one was being emptied. \"", "Take one. ", "More than I need. ", "She doesn't like it.\"", "\n\n\"It makes me sick,\" Edna said through another gulp of whisky.", "\n\n\"You too,\" Rupe urged Mike. ", "His face dripped sudden surprise. \"", "It's a policeman!\"", "\n\n\"Sure, it's a copper, Bright-eyes,\" Edna muttered.", "\n\n\"He's off duty,\" Johnnie explained. \"", "He's Michael Costello—remember? ", "Left end at Fordham. ", "Officer Costello, Mr. Ruprecht.\"", "\n\n\"Pleased to meet you.\" ", "Ruprecht bowed low. ", "He teetered upward, urged, \"Have a bottle. ", "It's Ferenz's champagne, the best champagne.\" ", "He raised his half-used bottle.", "\n\n\"We haven't time,\" Johnnie said. \"", "We got to go.\"", "\n\n\"So sorry,\" Edna gritted. ", "She took a bigger drink.", "\n\n\"You just arrived,\" Ruprecht complained.", "\n\n\"I came to get you. ", "Trudy wants you.\"", "\n\nEdna jumped up. \"", "Who the hell is Trudy?\"", "\n\n\"Trudy's his cousin,\" Johnnie said. \"", "She needs him.\"", "\n\n\"Cousin, my eye-wash. ", "He never told me about her.\" ", "She went over to Rupe, put pointed black satin against him. \"", "Don't go, Rupe. ", "There's something damn funny about this. ", "It smells.\"", "\n\nRupe disregarded her. \"", "What does Trudy want?\" ", "He'd swung out of being tight fast enough, the way he had once before tonight.", "\n\n\"It's about Rudolph. ", "They can't find the papers, the ones he has to have to go on the Clipper.\"", "\n\n\"I haven't them.\" ", "Ruprecht felt in his pockets, shook his head. \"", "Probably has them himself. ", "One of his tricks.\"", "\n\n\"No, he hasn't,\" Johnnie stated out of knowledge. \"", "It's serious. ", "Mr. Lessering even left his party to come over.\"", "\n\n\"Not much of a party.\" ", "Rupe lifted his eyebrows. \"", "I left too.\"", "\n\n\"Trudy's been phoning all the night clubs for you.\"", "\n\n\"Dear Trudy.\" ", "The redhead choked.", "\n\n\"Finally she asked me to go to the two places she couldn't phone to Hans'—\"\n\n\"How is old Hans?\" ", "Ruprecht brightened. \"", "I've neglected him. ", "I'll have to go back to beer. ", "I'm getting tired of champagne anyway.\"", "\n\n\"—and here.\"", "\n\n\"I have a phone,\" Edna bristled. \"", "Why couldn't this dame phone?\"", "\n\n\"You don't know Trudy, my sweet,\" Rupe soothed. \"", "She'd never call me at a woman's. ", "I might get the erroneous idea she cared.\"", "\n\nEdna drew away. \"", "That isn't healthy. ", "If she's your cousin.\"", "\n\n\"Very distant. ", "Under the rose perhaps.\" ", "Rupe uptilted the bottle. \"", "I'm afraid we had better go, Johnnie. ", "If Trudy went to such lengths, even seeking a policeman—\"\n\n\"She didn't send Mike,\" Johnnie explained quickly. \"", "I found him myself.\"", "\n\n\"You're not taking him with us?\"", "\n\nJohnnie hesitated. \"", "Well, yes I am. ", "But it's for a different reason. ", "You don't need to worry about that, Rupe.\"", "\n\n\"I doubt he'll be welcome,\" said Rupe sagely. ", "His eyes narrowed slightly. \"", "I doubt very much if he'll get in.\"", "\n\n\"I'll get in,\" Mike Costello announced with simple and menacing faith. \"", "Don't worry about that, Bub. ", "I'll get in.\"", "\n\nRupe shrugged. \"", "If that is how you feel—\" He took up his tall hat, his topcoat.", "\n\n\"You're walking out on me for this Trudy?\" ", "Edna shrilled.", "\n\n\"Time you were in bed anyway,\" Mike told her.", "\n\n\"If you do you needn't ever come crawling back here!\"", "\n\nRupe spoke sweetly. \"", "I never crawl, my pet. ", "So undignified. ", "But I'll be back. ", "It may be years. ", "It may be forever. ", "But I shall return, my love.\"", "\n\n\"Get out!\" ", "She yelled. ", "Johnnie was ready to duck but she didn't throw the glass.", "\n\nRupe said, \"We mustn't forget the refreshments, Johnnie!\" ", "He returned to the table, held out two bottles to Johnnie, took the other two himself. \"", "Good-by, my little dove. ", "Until tomorrow. ", "Alas, tomorrow never comes.\"", "\n\nHer imprecations followed them to the elevator.", "\n\n# Five\n\nRUPRECHT PUT A FINGER on the buzzer. \"", "A sweet girl,\" he orated. \"", "She is teaching me to Conga and Rhumba. ", "Very good at it. ", "Only she doesn't like champagne. ", "Strange.\" ", "He thrust a bottle at Mike Costello. \"", "You wouldn't care to manage one for me? ", "I thought not.\"", "\n\n\"Sorry, Bub. ", "Not in uniform. ", "Afraid I might run into Lieutenant McGonigle. ", "Lefty, we call him.\"", "\n\nThe elevator took them down faster than it had brought them up. ", "The operator didn't look at them.", "\n\n\"We'll have to go up to Broadway to find my car,\" Ruprecht pushed open the door to the street. \"", "Or should I say Ferenz's car? ", "I prefer that the chauffeur does not know all of my places of dalliance. ", "Not that I enjoy walking. ", "A highly overestimated form of travel.\"", "\n\n\"How'd you like to be a cop?\" ", "Mike asked.", "\n\n\"Would I get a whistle?\" ", "Ruprecht shook his head. \"", "Not even for a whistle could I endure it. ", "That is the trouble with all manly occupations—hunting, fishing, policemaning. ", "Walk, walk, walk. ", "And for what?\"", "\n\nMike interrupted. \"", "Do you know where this house is we're going to?\"", "\n\n\"Dorp's, I presume.\"", "\n\n\"Texas here doesn't know the address.\"", "\n\n\"Hundred and Twelfth Street.\" ", "Ruprecht scowled at Johnnie. \"", "But you've been there. ", "You just came from there.\"", "\n\n\"He came from Texas,\" Mike gurgled. \"", "He didn't think to notice the address.\"", "\n\n\"I'd sure have been in a spot if you hadn't been at Edna's,\" Johnnie admitted. \"", "I have to get back there. ", "Trudy snitched my dog tags.\"", "\n\nRupe laughed admiringly. \"", "Little devil.\"", "\n\n\"She did it so I'd come back. ", "Though I don't know why she wanted me to come back particularly.\"", "\n\n\"You'll find women are like that,\" Rupe stated. \"", "Especially Trudy.\"", "\n\nThey came over the crest on to Broadway.", "\n\n\"Gurk is somewhere about,\" Rupe said. \"", "Perhaps a restaurant. ", "If I could whistle now—\"\n\nJohnnie said, \"I can.\" ", "He did.", "\n\n\"There—up the block.\" ", "Rupe took his hands away from his ears and pointed. ", "The others followed his lead to the long black car. ", "Gurk slept at the wheel.", "\n\n\"Don't the cops ever run him in for all-night parking?\" ", "Mike inquired.", "\n\n\"He has a host of good yarns. ", "Try him sometime.\" ", "Rupe rapped on the window. ", "Gurk blinked, scrambled out to open the rear door. ", "When he eyed Mike's uniform, his face retired.", "\n\n\"We are not arrested, my good man,\" Rupe said. ", "He gestured his guests ahead of him, followed. \"", "To Dorp's.\"", "\n\nThe car turned, cut across the tracks, headed uptown. ", "It slowed to the corner of 112th Street. ", "It stopped. ", "A red lantern and a saw horse barred entrance. ", "Two men held a drill. ", "When they pressed it into the pavement it made an awful racket.", "\n\n\"This isn't the street,\" Johnnie said.", "\n\n\"Yes, it is.\"", "\n\nMike volunteered, \"You don't know how fast the N.Y.C. street department can pop up, Johnnie. ", "No use trying the other end. ", "It's blocked too.\"", "\n\n\"Have to walk,\" Johnnie stated. ", "He opened the door on his side. \"", "It won't wear you down, Rupe. ", "It's only half way down the block. ", "You ought to be in the Army.\"", "\n\n\"That is a matter of opinion,\" Rupe said. \"", "The Army takes the negative. ", "I'm glad we brought refreshments. ", "Dorp never has anything fit to drink. ", "Stingy old coot.\" ", "He patted the top hat slant on his head. \"", "Lead on, my hearties.\"", "\n\nThey struck out for the house. ", "It showed no light save the dimmed bulb in the lower hall. ", "The throne room upstairs was completely blacked out. ", "Johnnie had one foot on the steps when the voice from the gloom hit him.", "\n\n\"I wouldn't go in there, soldier,\" it said.", "\n\n\"Why not?\" ", "he demanded.", "\n\n\"I'm telling you.\"", "\n\nMike put in from the darkness below, \"Are you the watchman?\"", "\n\n\"Yeah, I'm the watchman,\" the man answered truculently.", "\n\n\"Watchman, what of the night?\" ", "Ruprecht mused.", "\n\n\"And I got my orders no one's to go in.\"", "\n\n\"Listen, you,\" Mike began.", "\n\n\"Wait, Mike.\" ", "Ruprecht spoke up brightly. \"", "It's the wrong house.\" ", "He tittered. ", "He nudged Johnnie with a champagne bottle. ", "His voice was tighter than it had been. \"", "You picked the wrong house.\" ", "He nudged again. \"", "It's the one next door we want.\"", "\n\nJohnnie played up. \"", "That's right.\" ", "He'd forgotten. ", "They were supposed to go in next door. ", "He didn't know how Rupe knew it. \"", "Sorry, Bud. ", "We picked the wrong house. ", "They all look alike in the dark.\"", "\n\n\"You mean that one?\" ", "The man jerked a thumb down the street.", "\n\n\"You aren't going to tell me we can't go in there?\" ", "Johnnie blustered. \"", "I got a key. ", "I'm supposed to go there.\"", "\n\nRupe interrupted quickly. \"", "That's where I live. ", "With my Aunt Gretchen. ", "Good old girl, Gretchen. ", "She always puts up soldiers on leave. ", "She isn't home this evening. ", "Aunt Bertha—she lives in Brooklyn—poor Aunt Bertha had another attack. ", "But Aunt Gretchen told us to stay here just the same. ", "Even gave us her key.\" ", "He dangled the bottle. \"", "Come on, men.\"", "\n\nHe lurched forward. ", "Johnnie caught Mike's arm. \"", "Come on.\"", "\n\nMike hung back. \"", "What's up?\"", "\n\n\"We got the wrong house,\" Johnnie said loud. ", "He pushed Mike forward. \"", "Come on.\" ", "Into his ear he undertoned, \"We can get in this other way. ", "Don't say anything.\"", "\n\nRupe was climbing to the other door. \"", "Where's the key, Johnnie? ", "You didn't lose the key, did you?\" ", "He lowered his voice. \"", "You really have the key?\"", "\n\nJohnnie stuck it in the lock. \"", "Hurry up, Mike.\" ", "Rupe was already in the hall. ", "Johnnie pushed Mike, followed, closed the door tight. ", "The three stood together in the black darkness. \"", "We can't show a light,\" he warned.", "\n\n\"We'd better,\" Rupe said soberly. \"", "Whoever put that fellow out there, he wasn't fooling. ", "And he wasn't a watchman. ", "We want him to think we're legal.\"", "\n\n\"I don't get it,\" Mike complained.", "\n\nRupe turned on a lamp. \"", "Dorp uses both of these houses. ", "But he does keep an old woman here for a front. ", "Her name's Gretchen. ", "She isn't here tonight. ", "She's always sent to her sister's in Brooklyn when anything big is happening. ", "That varlet couldn't know that Gretchen hasn't a nephew who sleeps in occasionally. ", "Only we'd better get to Dorp's fast just in case he decides to report anything suspicious.\" ", "He took a blackout torch from his pocket, turned it on the stairs. \"", "Let's go up.\"", "\n\n\"What is happening here?\" ", "Mike demanded.", "\n\n\"Didn't Johnnie tell you?\"", "\n\n\"I still think he's ribbing,\" Mike said. \"", "All he told me was that a guy had been murdered.\"", "\n\n\"Murdered?\" ", "Rupe swirled too fast. ", "Johnnie grabbed the banisters as Mike pitched into his backlegs.", "\n\n\"I told you not to tell him,\" Johnnie complained to the policeman.", "\n\n\"I forgot.\"", "\n\nRupe demanded. \"", "Who is murdered?\"", "\n\nJohnnie spoke reluctantly. \"", "Theo. ", "The little punk who used to open the door.\"", "\n\nRuprecht scowled. \"", "Why Theo?\"", "\n\n\"It was supposed to be Rudolph.\"", "\n\n\"I knew it!\" ", "He started taking the steps, two at a time. ", "The others scrambled after him in the darkness. ", "There was no letup in pace until they reached the fourth floor attic room.", "\n\nMike panted, \"You mean there actually was a murder?\"", "\n\n\"Sure there was,\" Rupe retorted. \"", "I'm surprised there hasn't been a massacre.\" ", "He pulled on the overhead light here. ", "The windows were painted over black. ", "He replaced his torch in his pocket, set the bottles of champagne on a rickety table.", "\n\nThe wall was solidly papered. ", "It hadn't occurred to Johnnie before he departed; he didn't know the trick of getting back in. ", "He asked, \"Shall we pound on the wall for Trudy?\"", "\n\n\"Are you crazy?\" ", "Rupe demanded. \"", "Someone else might be in there. ", "No one must know I'm here.\"", "\n\n\"But they're waiting for you.\"", "\n\n\"In good time, soldier, all in good time. ", "I don't want to be in the jug for a murder.\"", "\n\n\"Did you do it?\" ", "Mike asked quick.", "\n\n\"He wasn't here.\" ", "Johnnie was disgusted. \"", "He was with that Conga mouse.\"", "\n\nRupe was counting off bow-knots of wall paper. \"", "But they'd like to pin it on me. ", "And who has a better motive?\" ", "The wall began its slow angled swing.", "\n\n\"Will you look at that?\" ", "Mike gazed in awed admiration.", "\n\nRupe stepped back. \"", "You take a squint, Johnnie?\"", "\n\nJohnnie advanced cautiously to the opening. ", "He stepped through. ", "The light had been left burning; the room was empty. ", "He advised over his shoulder. \"", "Coast's clear.\"", "\n\nRuprecht left the wall ajar as he followed. ", "The befuddled Mike sniffed at the room. \"", "Not very fancy,\" he commented.", "\n\n\"What do you expect in a guardhouse—pink ribbons?\" ", "Johnnie tried the door. ", "Locked. ", "He turned around. \"", "What do we do now? ", "Wait for Trudy?\"", "\n\nMike came to life. \"", "What's the matter with you dopes? ", "There's been a murder here.\" ", "He rattled the knob. \"", "It'll bust easy.\"", "\n\n\"There was a guard outside earlier,\" Johnnie warned.", "\n\n\"Listen. ", "I'm the law.\" ", "Mike stuck out his chest. \"", "New York's finest.\"", "\n\n\"Off duty.\"", "\n\n\"In emergencies, always on duty. ", "Murder's an emergency.\" ", "He put his shoulder to the door.", "\n\n\"Wait!\" ", "Rupe cried.", "\n\n\"What for?\"", "\n\n\"Why don't we take off the hinges? ", "Then we can sneak up on them. ", "No use bang-banging around. ", "They might scram.\"", "\n\nJohnnie examined the hinges. \"", "This looks like a pipe.\"", "\n\n\"It is,\" Rupe agreed. \"", "But it wasn't the first time I did it. ", "Trudy's oiled it since then.\"", "\n\nWhile Johnnie removed the pins, the others steadied the door.", "\n\n\"Now if you'll just smash the lock with your gun, copper, we can put it back together again and barge in and out easily.\"", "\n\n\"It's a pleasure,\" said Mike. ", "He unbuckled his holster.", "\n\n\"Don't shoot!\" ", "Rupe warned. \"", "Here.\" ", "He took the gun, bumped it against the catch.", "\n\n\"One shot would do it,\" Mike complained. \"", "And not so much noise either.\"", "\n\n\"You don't know how gun shy this house is,\" Rupe said solemnly. \"", "There. ", "That's enough.\"", "\n\nJohnnie hadn't thought about that one. ", "Somebody must have heard the shot that killed Theo. ", "He hadn't. ", "And he'd been practically overhead. ", "There were silencers. ", "He'd read about them. ", "But neither Magda's nor Trudy's gun was fitted. ", "That cut out two who might have bumped off the underling. ", "Not even those dames would be unsmart enough to walk up to someone in this house and say, \"Let me take your gun with the silencer on it. ", "I want to kill a guy.\"", "\n\nThe door was back on its hinges. \"", "Now where's the Stiff?\" ", "Mike wanted to know.", "\n\n\"Wait,\" Rupe called out again.", "\n\n\"What do you want us to do now?\" ", "Mike demanded. \"", "Take up the floor?\"", "\n\nRuprecht contemplated the rough boards. \"", "A wonderful idea. ", "Unfortunately it wouldn't let you down into the reception room.\" ", "He glowed. \"", "To be sure, if sweet Magda were in bed—\" He shook his head dolefully. \"", "She wouldn't be. ", "You'd better use the staircase. ", "You fellows are going downstairs.\"", "\n\n\"What about you?\" ", "Johnnie wanted to know.", "\n\n\"I'll make my entrance without fanfare. ", "Later. ", "You try to get word to Trudy, in private, that I'm here. ", "I want a confab with her before I walk into Dorp's parlor. ", "If you can't reach her, sneak back and let me know.\"", "\n\n\"And if I can't sneak back?\"", "\n\n\"I will wait a reasonable length of time, soldier. ", "After that I shall do it another way.\"", "\n\n\"You aren't going to run out?\"", "\n\nRuprecht smiled. \"", "I give you my word. ", "I shall see it through. ", "In fact it will give me great pleasure to see this through.\"", "\n\nJohnnie had to take his word for it. ", "He didn't exactly disbelieve Ruprecht's word. ", "But if there should be any more shooting, any loud shooting, Rupe would be a sucker if he didn't take a powder. ", "He and Mike were the only two who couldn't possibly have held the silent gun. ", "Johnnie said, \"Okay.\" ", "He led Mike down the stairs quietly, pushed aside the trick closet wall.", "\n\nMike gasped. \"", "Jeeze. ", "It's like a film scarer, isn't it?\"", "\n\n\"Wait'll you meet the folks,\" Johnnie whispered. ", "He wished that he had had the cop with him when those S.S. guards were jerking around. ", "Together they could have cleaned up the lot. ", "Until Magda pulled the gun on both of them. ", "He warned, \"Keep quiet as you can, Mike. ", "I want you to see the body before we walk in on them. ", "This is the room here.\" ", "Cautiously he made a light. \"", "The body's over here—\"\n\nMike asked, \"Where?\" ", "His voice was flat.", "\n\nJohnnie's eyes gazed hopelessly at the floor by the window. ", "He said weakly, \"It's gone.\"", "\n\nMike's face was hard-boiled. \"", "Gone where?\"", "\n\n\"It was here. ", "Rudolph was in the closet, he didn't see it. ", "I found it when I came over by the window. ", "It was lying right down there on its face and the suitcase leaning against it. ", "Like this—\" He flung down on the rug, sprawled out. \"", "With the hat like this—\" He wrinkled his nose, stood up. \"", "That floor smells funny.\"", "\n\n\"Blood?\" ", "Avid interest returned to the cop. ", "He knelt, sniffed the boards beyond the rug. ", "He stood up and brushed his knees. \"", "Floor polish.\" ", "His voice was flatter.", "\n\n\"Well, he was here,\" Johnnie insisted. \"", "He sure was here.\" ", "He didn't take to the I-was-right-about-this-all-the-time look on Mike's face. ", "He scowled. \"", "Those dirty Nazis have hidden him away. ", "So they wouldn't have to report to the police. ", "I knew they didn't mean to call the police.\" ", "He suddenly saw it plain. \"", "They didn't want Ruprecht here at all. ", "They just wanted to get me out of the house so they could get rid of the body. ", "Well, I'll show them.\"", "\n\nHe didn't wait for Mike; he pounded out of that room and down the stairs. ", "How much noise he was making didn't matter. ", "Not that it was much on the carpet. ", "When he reached the throne room he flung open the doors belligerently.", "\n\nThey were all there, all looking pleased as hell over their trick. ", "Rudolph was on the throne with the cigarette holder sticking out of his mouth. ", "Magda and Ferenz were rallying round. ", "Dorp and Ottomkopf sat on a squashy red velvet couch with Trudy between them. ", "Janssen alone wasn't amused. ", "He was gazing at Magda from afar and picking up the cigarette butts as they wafted down.", "\n\nJohnnie spoke up loud. \"", "Where's Theo?\"", "\n\n\"Are you loose again?\" ", "Magda sighed. ", "That was before her eyes popped like buttons. \"", "The police,\" she breathed.", "\n\nEach one of the others slowly, apprehensively turned eyes on Mike stepping up beside Johnnie. ", "Every mouth rounded. \"", "Police!\"", "\n\nMagda was the first to stop behaving like a spook. ", "She came off the throne smiling, her hand outstretched. \"", "How clever of you, Johnnie, to know just what we needed.\"", "\n\nHe didn't get it. ", "This was such a complete nip-up, it dashed the temper out of him. ", "It was pretty much of a surprise to most of the others too.", "\n\nMagda stuck her hand right out in front of Mike. ", "He had to take it. ", "He didn't seem to mind. ", "Well, in the yellow slacks and black coat she was something out of the glamour book. ", "And the size of that ruby on her finger didn't spoil the picture. ", "To think that he, Johnnie, had been dopey enough earlier to think that this bunch were merely jewel thieves. ", "Magda was cooing, \"Officer, it's so good of you to come. ", "Officer...?\"", "\n\n\"Mike Costello,\" the dumb cop smirked.", "\n\n\"Officer Costello, you don't know how we appreciate this, how relieved we are to have you here. ", "It was sweet of Johnnie to bring you back to us. ", "It is imperative that Rudolph reach the airport in time to take the Clipper.\"", "\n\nMike glinted real suspicion at Johnnie. ", "Johnnie opened his mouth but Magda lifted her voice. \"", "We didn't see how we could make it without an escort—\"\n\n\"You want a motorcycle cop, lady,\" Mike stated. ", "He glowered at Johnnie again before giving Magda the alert.", "\n\nJohnnie shouted before she could sabotage any longer, \"Where's Theo?\"", "\n\nDorp beamed, \"What do you want with Theo? ", "He has gone home.\"", "\n\n\"He couldn't go home.\"", "\n\n\"He has,\" Dorp nodded. \"", "He was tired. ", "He lives so far, all the way to Queens he has to go. ", "After I dismiss the attendants, I say Theo too may leave us early.\"", "\n\n\"Dead guys can't walk,\" Johnnie stated distinctly.", "\n\nMagda raised impatient eyebrows. \"", "What are you talking about?\"", "\n\n\"Theo was dead.\"", "\n\n\"Dead? ", "Was dead?\"", "\n\n\"He was dead. ", "Maybe he was going home but somebody killed him before he got out.\"", "\n\nThey were all closing in on him now, all but Rudolph who kept right on lounging on the throne, and Janssen who had to stand by to pick up the butts.", "\n\n\"When was this?\" ", "Dorp asked curiously.", "\n\n\"Before I left. ", "I found him. ", "I told you about it. ", "I—\"\n\n\"Where?\"", "\n\n\"You might as well stop this game,\" Johnnie began.", "\n\n\"Where?\" ", "Dorp repeated.", "\n\n\"Upstairs. ", "In Rudolph's room—Trudy's room—\"\n\nFerenz smiled magnificently. ", "Dorp began to laugh. ", "At least that was what it was supposed to be. ", "Johnnie figured that out because the mouth turned up. ", "Trudy just stood there upping big eyes at him.", "\n\nMagda cried, \"You must be crazy! ", "There's no one in Rudo's room.\"", "\n\n\"Not now there isn't,\" Johnnie interrupted loudly. \"", "But there was—\"\n\nHe saw Mike's grim mouth and he raised his voice louder. \"", "You're darn right there was. ", "He was lying on his face by the window and he was dead as a duck.\" ", "He broke through the circle toward the throne. \"", "You tell them, Rudo. ", "You saw him too.\"", "\n\n\"Saw whom?\" ", "Rudolph squeaked airily.", "\n\n\"Theo. ", "Up in your room. ", "Murdered.\"", "\n\nThe princeling drew himself up. \"", "I never saw anything of the sort,\" he denied flatly. ", "His black eyes looked smack into Johnnie's. \"", "How silly!\"", "\n\n## 2.", "\n\nJohnnie didn't say any more. ", "He just looked at Rudolph. ", "Looked at him and didn't believe his ears. ", "He turned around slowly. ", "They were all watching him. ", "But they weren't surprised or annoyed like they were pretending. ", "Underneath that they were all making mock of him. ", "All but the cop. ", "Mike was really mad.", "\n\nJohnnie came up for the third time spying the life-saver. \"", "Trudy,\" he began.", "\n\nShe shook her head. ", "She turned sweetly to Mike. \"", "I don't know why he's saying this, officer. ", "As a matter of fact, we don't even know who he is. ", "He walked in here tonight—\"\n\nFerenz broke in. \"", "He even crashed a party of mine tonight, officer.\" ", "He puffed up. \"", "I am Ferenz Lessering. ", "No one crashes my parties.\"", "\n\nMike was sure by now that Johnnie had hoaxed him. ", "He didn't like it. ", "But he didn't not like it as much as he would have if Magda's cheek hadn't been practically against his arm.", "\n\nJohnnie took a deep breath. \"", "All right,\" he announced. \"", "All right,\" he repeated. ", "He fixed reproachful eyes on Mike. \"", "You can believe these birds if you want to. ", "I've told you what they are. ", "Go ahead and believe them. ", "You're going to look pretty funny after you come to.\" ", "He butted through that circle as if it were not there.", "\n\nMagda carolled after him, \"Where are you going now, Johnnie?\"", "\n\n\"I'm going to find Theo!\" ", "he howled back.", "\n\nHe heard Mike as he started down the stairs. \"", "I better go along to see he doesn't hurt anything,\" and Magda's laughter, \"He can't hurt a thing.\"", "\n\nHe gritted his teeth. ", "He'd tear this house down wall by wall before he'd let them get by with this. ", "He'd start searching at the bottom. ", "Someone was following him down the stairs. ", "Johnnie swung around and doubled his fists.", "\n\nMike halted. \"", "Now listen, Johnnie—\"\n\n\"You listen,\" Johnnie said. \"", "I tell you somebody killed this guy Theo and now somebody's hidden the body so the police won't find it.\" ", "He scorned. \"", "Though why they think the police would be interested, I don't know.\"", "\n\n\"Listen, Johnnie—\"\n\n\"You listen.\" ", "He pounced again. \"", "Rudolph saw that body and he told them about it, not me. ", "And no one was surprised either.\" ", "He cocked his head. \"", "Get that. ", "They knew Theo was dead the minute Rudolph and me walked in. ", "Because Rudolph was the one supposed to be dead. ", "Theo was the only one who looked like Rudolph.\"", "\n\n\"Listen, Johnnie.\" ", "Mike raised his voice. \"", "Listen just for a minute, will you? ", "Why would a guy be killed just because he looked like another guy?\"", "\n\n\"Because somebody doesn't want Rudolph to go back and be king.\"", "\n\n\"King?\" ", "Mike backed up a few steps. ", "Johnnie guessed they'd told him that he, Johnnie, was kind of cuckoo.", "\n\n\"Yes, king!\" ", "he snapped. ", "If Mike couldn't tell who was crazy in this outfit and who wasn't there was no time now to go into it. \"", "That Rudolph's a prince. ", "A crown prince of Rudamia. ", "You never heard of it and neither did I but it's a place near Trudamia and Luxembourg only the Nazis own it now.\"", "\n\nMike came down to him. ", "He coaxed, \"Listen, Johnnie, let's—\"\n\n\"I'm giving it to you straight. ", "Ask Rudolph. ", "He won't lie about that. ", "He wants to be king.\" ", "He wondered. \"", "Magda wants him to be king because she's going to marry him. ", "That'll make her a queen. ", "Ottomkopf—that's old bristle-head—wants him to be king because he'll get to boss Rudamia.\" ", "He confided, \"Rudolph's kind of a goon.\" ", "He thought about it again. \"", "Ferenz wants him to be king because Rudolph owes Ferenz a lot of money and he could pay off then. ", "But if Rudolph was killed, Ruprecht would be king. ", "And Magda'd rather have Rupe. ", "Only she hasn't got him. ", "I wonder. ", "If Rupe wanted to be king, he might bump off Rudo, only Rupe doesn't want to be and he's the one guy couldn't have done it. ", "He wasn't here.\"", "\n\n\"Maybe he only just got to Edna's,\" Mike suggested. \"", "Maybe she's just his alibi.\"", "\n\n\"She was mad enough to spill if that was it,\" Johnnie stated. \"", "Trudy says she doesn't want Rupe to be king. ", "She goes for him though and she might be lying.\" ", "She'd lied in his face. ", "Saying she would call the police. ", "Good thing he had a hunch. \"", "She might think she could beat Magda out. ", "She could with me. ", "I don't know where Dorp comes in it. ", "He's trying to get Rudolph off on the plane. ", "Dorp's a Nasty. ", "He has his own S. S. troops.\"", "\n\nMike stopped believing again.", "\n\n\"Didn't you get that suit on Janssen? ", "There was a whole squad of them here earlier. ", "Bowing and scraping. ", "Your Highness this. ", "Your Highness that.\"", "\n\n\"Listen, Johnnie, there aren't any more kings,\" Mike reasoned \"Except in England and Abyssinia—\"\n\n\"That's what I thought, brother, until tonight. ", "But there is a Rudamia. ", "It's in the Encyclopaedia Britannica. ", "And that goop upstairs is going to be king of it. ", "If he lives so long.\" ", "He caught Mike's lapel. \"", "Don't you see we got to find out who did it before Rudolph does get killed? ", "And first we have to find Theo. ", "They can't lie out of a murder if we find Theo.\" ", "He put it down cold. \"", "Are you going to help me look for him or not?\"", "\n\nMike scratched his nose. \"", "If you're talking straight—I'm not saying I believe you, see?—but if it should be true all this stuff about kings and about you finding a stiff, you don't think they've got it hidden here, do you?\"", "\n\n\"Where else?\"", "\n\n\"If they thought you could find the body—I mean, supposing there really is one—you don't think they'd turn us loose to look for it, do you? ", "There's more of them than of us.\"", "\n\n\"But you're a cop—they couldn't stop you looking.\"", "\n\n\"Yes, they could,\" Mike said slowly. \"", "Murderers aren't particular about who they put the second bullet in. ", "You can't go to the chair more than once.\"", "\n\nJohnnie deflated. \"", "What do you think we ought to do?\"", "\n\n\"I think we ought to go report to Ruprecht.\"", "\n\n\"I think so too,\" Trudy's voice agreed. ", "She was sitting there above them on the stairs.", "\n\n\"How long have you been there?\" ", "Johnnie demanded.", "\n\n\"Long enough.\" ", "She stood up, shook out her pink slacks' creases. \"", "You did bring Ruprecht back?\"", "\n\n\"Yes, I brought him back.\"", "\n\n\"Then come on. ", "Take me to him.\"", "\n\nJohnnie didn't move. \"", "I'm looking for Theo.\"", "\n\n\"You won't find him here,\" she said. \"", "And I must see Ruprecht before the others do. ", "I told them I'd follow you and see you didn't get into any mischief. ", "And I told them they'd better stay put because you might get suspicious if all of them trailed you around. ", "Now take me to Rupe.\"", "\n\n\"Where's Theo?\" ", "Johnnie demanded stubbornly.", "\n\n\"Have you tried Queens?\" ", "she mocked.", "\n\n\"Kings—queens—\"\n\n\"Shshsh. ", "Do you want all of them down here? ", "Officer Costello, will you take me to wherever Rupe is holed? ", "Johnnie can stay here and play hide-and-seek all he wants. ", "I must see Rupe right away.\"", "\n\n\"You better come with us, Johnnie,\" Mike urged. \"", "I think we ought to talk this over with Rupe.\"", "\n\nHe gave in. \"", "All right. ", "He's up in the attic where you had me.\"", "\n\nTrudy nodded. \"", "Be quiet both of you. ", "We'll go up. ", "Wait—Officer Costello—\"\n\n\"Call him Mike,\" Johnnie said. \"", "No use being formal with a cop.\"", "\n\n\"Mike, why don't you go back in with the others? ", "Tell them I'm following Johnnie around. ", "That way if any of them do start looking for us you can give a warning. ", "I don't want them to see Rupe yet.\"", "\n\n\"Rupe didn't want to be seen yet,\" Mike admitted. ", "He was torn between a possible body and Magda's figure. \"", "I don't know—\"\n\nTrudy nodded her butter yellow head. \"", "It'll be safer.\"", "\n\n\"How can I signal you?\"", "\n\n\"Shoot your gun,\" Johnnie advised. \"", "Though I don't know if we'd hear it upstairs. ", "I didn't hear the shot that killed Theo.\"", "\n\n\"After you shoot it, be sure you're in the lead if anyone comes after us.\" ", "She gave Mike her Sonja smile. \"", "You go first now. ", "We'll wait until you're safe inside.\"", "\n\n\"Okay,\" Mike agreed. \"", "But come back and let me know what you decide, Johnnie.\"", "\n\n\"Don't worry.\" ", "He wasn't going to lose the cop after finding him. ", "He stood behind Trudy on the stairs until Mike had shut himself in the throne room.", "\n\nShe whispered, \"Come on now. ", "Don't talk until we get upstairs.\" ", "On third she turned again. \"", "You lamebrain. ", "Why did you bring that cop here?\"", "\n\n\"I thought he might come in handy,\" Johnnie told her. \"", "Why did you lie about Theo?\"", "\n\n\"What did you expect me to do, tell Mike all about it? ", "Don't you think I have enough on my mind without you bringing home a policeman?\"", "\n\n\"Mike's a good guy. ", "Besides you told me you'd call the police and you didn't. ", "You're not going to get away with murdering Theo by hiding him.\"", "\n\n\"I didn't murder Theo,\" she retorted. \"", "And I'm not trying to get away with anything.\" ", "She pushed open the secret closet door. \"", "I wish I knew who did it.\" ", "She smelled like lemon perfume here in the dark. ", "He caught hold of her hand, just for guidance.", "\n\n\"Listen, if you'd tell Mike there was a murder,\" he said, \"he could find out. ", "After all he is a cop.\"", "\n\n\"He can find out after I get Rudolph away from here.\"", "\n\n\"Suppose Rudolph did it?\"", "\n\nShe was disgusted. \"", "He didn't. ", "He's the one person didn't. ", "He could never have mistaken Theo for himself.\" ", "She opened the door of the attic. ", "Her mouth turned down at the corners. \"", "He's gone.\"", "\n\n\"He said he wouldn't run out,\" Johnnie frowned. \"", "Try tapping on that phony wall.\"", "\n\n\"You watch at the door.\" ", "She tapped, called softly, \"It's Trudy.\"", "\n\nThe wall swung a little, wider. ", "Ruprecht came in.", "\n\n\"I thought maybe you'd blown,\" Johnnie sighed.", "\n\n\"Such lack of confidence!\" ", "Ruprecht scoffed.", "\n\n\"Rupe!\" ", "Trudy cried. ", "That was the first time Johnnie realized that she wasn't as tough as she'd been acting. ", "She sort of caved in against Ruprecht's chest. ", "He kissed her, none of the lingering stuff he'd given Magda in the library, just a nice big brother kiss.", "\n\n\"What's the matter, sweet stuff?\"", "\n\n\"Oh, Rupe. ", "So much.\"", "\n\nJohnnie said, \"Pass me a chair, Rupe. ", "My feet hurt. ", "I'll guard sitting down.\" ", "He put it against the door, plopped on it.", "\n\nRuprecht and Trudy parked on the table. ", "She wailed, \"Somebody's trying to kill Rudolph.\"", "\n\nHe nodded. \"", "Johnnie told me. ", "About Theo.\"", "\n\n\"That wasn't all. ", "Before that Dorp gave Theo an envelope. ", "And he said Rudo wasn't to reach Rudamia. ", "I stole it. ", "But there's nothing wrong with it. ", "Just his real passports.\"", "\n\nFor the first time in hours, Johnnie remembered the bomb cigar in his pocket. ", "Remembered it none too comfortably. ", "Time was getting on. ", "It was set to go off on the Clipper. ", "He didn't know exactly what time the Clipper was leaving but it might be dangerously close.", "\n\n\"They think you have it, Rupe.\"", "\n\n\"Give it to me then. ", "I will have it.\" ", "He put his arm around her shoulder.", "\n\nShe leaned her head against him. \"", "I haven't it here. ", "It's in the little room, under the uniforms in the wardrobe.\"", "\n\n\"I'll get it. ", "You say there's nothing wrong with it?\"", "\n\n\"Not a damn thing, Rupe.\"", "\n\nThat envelope wouldn't have just killed Rudolph. ", "It would have killed all the passengers, everyone on board the Clipper. ", "Johnnie sat up. ", "Maybe it was meant to kill everyone. ", "Maybe even the president would be on board. \"", "Say,\" he began.", "\n\nThey didn't pay any attention to him. ", "They were pitching a little quiet woo during this conference. ", "Well, he, Johnnie, didn't blame Rupe for making time. ", "He merely envied him.", "\n\n\"Rupe, I don't think we ought to let Rudolph leave on the Clipper,\" Trudy said.", "\n\n\"I thought you wanted it, baby. ", "You even told me to stay out of the picture so that there wouldn't be any chance of me rubbing Rudo the wrong way and making him change his mind.\"", "\n\n\"I know. ", "It did seem like a good idea when Furry first told me of it. ", "Before someone tried to kill Rudolph.\"", "\n\n\"You know,\" Ruprecht smiled winningly, \"I can think of a lot of persons who would like to kill Rudolph for any number of reasons. ", "But there isn't a one of them in this house. ", "That's what I don't get. ", "On the face of it, everyone here should want Rudolph to be king. ", "It's the only way for Magda to get in the ranks. ", "If Furry was losing money on such a deal, he might do it, but in the long run he isn't. ", "Or if Otto were going to get kicked out on his pratt, but Rudo wouldn't dare.\"", "\n\n\"That's the way I figure,\" Johnnie interrupted. ", "They still weren't paying any attention to him. ", "Ruprecht was tugging her curly yellow hair and she was rubbing his knee.", "\n\n\"Someone doesn't,\" Trudy said. \"", "And that's why I don't think we ought to let him leave. ", "If he isn't even safe here with his friends, he certainly won't be in Europe.\"", "\n\n\"What'll we do with him?\" ", "Rupe brightened. \"", "Maybe Edna would like to hide him.\"", "\n\n\"Who's Edna?\"", "\n\n\"Madame La Riggens. ", "My Conga teacher.\"", "\n\n\"She stinks.\"", "\n\n\"But sweetly. ", "What do you think we ought to do with him?\"", "\n\n\"We could turn him over to the state department.\"", "\n\nRuprecht scowled. \"", "I don't think he'd want to be interned.\"", "\n\nTrudy shook her head. \"", "He'd love it, Rupe. ", "The best food and wine. ", "Nothing to do but play cards and gossip in a beautiful hotel. ", "I think it's a perfect solution.\"", "\n\nRuprecht bit her cheek absently. \"", "Maybe you're right. ", "But come the revolution, who gets to be king?\" ", "He kissed her just as absently. ", "Johnnie made a face. ", "If a guy was going to kiss a honey like Trudy, he ought to have his mind on his work.", "\n\n\"That's just it,\" she said briskly. \"", "I don't think there's going to be any revolution. ", "Not until after the war. ", "I think Dorp's lying about Rudamia turning on Hitler. ", "They wouldn't have the nerve. ", "I think that's all a part of the gag to get rid of Rudolph. ", "But if it should be true—\" She took his hand, patted it. ", "Her voice was sugary. \"", "Why not let Kraken be president?\"", "\n\n\"What!\"", "\n\n\"Why not, Rupe?\"", "\n\n\"What about me?\"", "\n\nShe stuck out her chin. \"", "You don't want to be king, do you?\"", "\n\n\"God, no! ", "You know I don't.\"", "\n\n\"You don't need to be king. ", "You have plenty of money without being king. ", "There's all that money your Uncle Isaiah from Chicago left you.\"", "\n\n\"It's in trust until I'm thirty. ", "I only get the income. ", "It's not enough to keep me in champagne.\"", "\n\n\"Too bad,\" she scowled. \"", "Well, if you had to, you could go to work at some more pleasant job than kinging, couldn't you?\"", "\n\n\"Ye-es.\"", "\n\n\"Then why not? ", "If Rudolph gets back on the throne before he's assassinated, you'll have to be king. ", "You're it.\" ", "She coaxed pretty again. \"", "But if neither of you go back then Kraken will take over as soon as Rudamia can run the Nazis out.\"", "\n\nRuprecht said, \"I don't like Kraken.\"", "\n\n\"How do you know you don't? ", "You never exchanged a word with him except, 'Saddle the black mare' or 'Curry the stallion.' ", "You might like him a lot if you ever stood him a beer at Hans!\" ", "She quirked a smile. \"", "I always thought he was sort of cute.\"", "\n\nRupe grabbed her shoulders. \"", "Trudy! ", "You didn't ever go out with him?\" ", "He shook her. \"", "That night I met you coming in about one o'clock—the night you went to bed early with a headache—\"\n\n\"Don't be silly,\" she said sweetly, and eagerly, \"How about it, Rupe?\"", "\n\nMaybe Ruprecht believed her; he gave her a cigarette. ", "Johnnie wasn't such a dope. ", "She hadn't denied it; she'd wiggled.", "\n\n\"What about you?\" ", "Rupe demanded.", "\n\n\"What about me?\"", "\n\n\"I always thought—I mean—I rather took it for granted you'd marry me some day.\"", "\n\nJohnnie's eyes blinked. ", "He'd never sat in on a proposal before. ", "It was kind of embarrassing. ", "Only the others seemed to have forgotten that he wasn't just a decoration on the door.", "\n\n\"How sudden,\" Trudy blew out smoke.", "\n\n\"Don't be an ass.\"", "\n\n\"I won't.\" ", "She sighed. \"", "But if you ever do want to propose, that won't make any difference. ", "Mum and I aren't going back to Trudamia.\"", "\n\n\"No?\"", "\n\n\"No. ", "Mum's bought an inn in Switzerland. ", "She's running it and making pots of money. ", "There's a dairy farm went with it and she's having the time of her life making butter and cheese. ", "You know she always liked to churn. ", "I sort of think she's going to marry the former innkeeper. ", "She says he has the sweetest whiskers. ", "Anyway she's not going back to Trudamia. ", "And neither am I.\"\n\n\"What are you going to do?\"", "\n\nShe said, \"I don't know,\" but he didn't take the hint. \"", "I know one thing though. ", "I'm going to be an American. ", "After all, my father was a naturalized one. ", "So you see you won't have to be a prince when you get around to marrying me. ", "And we can keep Rudolph from being king.\"", "\n\nRuprecht nodded somberly. \"", "Maybe,\" he said. \"", "Have you thought of consulting Rudolph on this?\"", "\n\nShe shook her head.", "\n\n\"You know of course that he may want to be king.\"", "\n\n\"He does, drat him. ", "That's why you had to come here. ", "You've got to change his mind.\"", "\n\n\"My God, Trudy,\" he groaned. \"", "Change Rudolph's mind?\"", "\n\n\"Well, maybe not that,\" she admitted. \"", "But you have to think of something to delay him, to keep him from going on this Clipper. ", "You do that much and leave the rest to me.\"", "\n\nHe rumpled her hair. \"", "That bodes no good, fair one. ", "The first time I left all to you I lost my eyebrows. ", "Remember that infernal chemical set you had when you were sweet seven? ", "And the last time as I recall, I was fired out of Yale for leaving all to you. ", "Why did you tell the Proctor you were a bubble dancer?\"", "\n\n\"He wouldn't believe I was Crown Princess of Trudamia.\"", "\n\nJohnnie was on his feet, his back against the door. \"", "I hate to interrupt but someone's just started up the stairs. ", "Two people.\"", "\n\nRuprecht kissed Trudy on the mouth. ", "There was nothing casual about that one. \"", "I'll get the papers and bust in. ", "Clean this room fast as you can.\" ", "He was behind the wall like magic.", "\n\nTrudy beckoned to Johnnie. \"", "Come over here and hold my hand.\"", "\n\nHe made it in two and a half strides. ", "He didn't waste time hand-holding though. ", "He went into a clinch. ", "He deserved a kiss himself. ", "He didn't break it until he heard the door open.", "\n\n## 3.", "\n\nTrudy said under her breath, \"Why, Johnnie Brown!\" ", "Her eyes were laughing.", "\n\nMagda and Mike stood on the threshold. ", "Magda's eyebrows were up like flags. \"", "Have you found the body?\" ", "She inquired with a leer in those green eyes.", "\n\n\"Not yet,\" Johnnie admitted.", "\n\nTrudy spoke pertly. \"", "We haven't looked in your room, darling.\"", "\n\n\"Why not,\" she countered.", "\n\n\"I'm always afraid of what I might find there.\" ", "Trudy cooed. ", "She slid from the table. \"", "Come on, Johnnie, let's go down and have a drink.\" ", "She said regally to Magda, \"You may have the sofa now.\"", "\n\nMagda disdained. \"", "I don't want it. ", "Mike and I were merely curious, you were gone so long. ", "He didn't know you'd—taken time off.\"", "\n\nMike was panting to ask questions. ", "It was all over his face. ", "Johnnie tried to give him the high sign. ", "He hoped it caught. ", "He urged, \"Come on, Mike. ", "Trudy's been telling me about Trudamia. ", "Sounds like a swell country. ", "You ought to tell Mike about that time you were caught sneaking in the palace after hours.\"", "\n\nMagda's mouth narrowed. \"", "Instead of such fantasies, Trudy, you might be trying to locate Ruprecht. ", "There isn't much time before we must leave for the Clipper.\"", "\n\n\"He'll be here.\" ", "Trudy managed to shoo everyone out ahead of her, close the door with a double bang. \"", "I told you—or were you and Rudolph too busy talking?—that woman said she'd send him right over.\"", "\n\n\"What woman?\" ", "Magda demanded.", "\n\nTrudy smiled. \"", "His dance teacher, darling. ", "She has the loveliest dyed red hair.\"", "\n\n\"You're making it up.\" ", "Magda banged through Theo's room, started down to second.", "\n\n\"Oh no, I'm not,\" Trudy yelled after her. \"", "I could do a lot better than that if I were making it up!\"", "\n\nFerenz met them at the throne-room door. \"", "I wish you girls would stop running all over the house with these strange young men. ", "Rudolph feels neglected.\"", "\n\nJohnnie and Mike swelled out their chests.", "\n\n\"Besides it's getting late and we still don't have those papers. ", "Where is Ruprecht?\"", "\n\n\"He'll be here any minute now,\" Trudy assured him.", "\n\nRudolph was off the throne. ", "He sulked at Magda. \"", "It took you long enough to find her.\"", "\n\nJohnnie looked quick at Mike. ", "Mike winked. ", "Johnnie grinned. ", "But it occurred to him he might have played the wrong number tonight in Trudy. ", "She was in love with Ruprecht. ", "Whereas Magda wasn't in love with Rudolph, and she wasn't that in love with Ruprecht. ", "Only trouble there was that Magda scared him off. ", "It took a real New Yorker like Mike to handle that babe, somebody used to swell dishes.", "\n\nDorp pattered through the inner doorway. \"", "I have made liverwurst sandwiches and some coffee as you suggest, Ferenz.\" ", "He spied Trudy. \"", "And where have you been, Miss? ", "It gets later and where is Ruprecht?\"", "\n\n\"He'll be here any minute,\" she likewise reassured him.", "\n\n\"What do you say we all eat?\"", "\n\nRudolph said, \"I want a bowl of chile.\"", "\n\n\"We'll get that for you at the airport.\" ", "Ferenz patted him. \"", "Let's have some nice sandwiches and coffee now.\"", "\n\n\"And cake,\" Dorp added.", "\n\nRudolph stuck out his lip. \"", "I don't want sandwiches and coffee. ", "I don't want cake. ", "I want chile.\"", "\n\nFerenz's eyes glittered. \"", "There is no chile.\"", "\n\n\"Some house with no chile,\" Johnnie put in. ", "Evidently he'd missed one of the prince's tantrums. ", "One good break. \"", "Back home in Texas you'd as lief run out of soap as chile. ", "Liefer.\"", "\n\n\"Texas,\" Rudolph breathed. \"", "Did you say Texas?\"", "\n\n\"Yeah,\" Johnnie defied him. \"", "I said Texas.\"", "\n\n\"I was in Texas,\" he sighed. \"", "Days and days—\"\n\n\"I said Texas.\" ", "Johnnie walked right up to him. \"", "I come from Texas. ", "You want to make something out of it?\"", "\n\n\"Not now!\" ", "Ferenz shrilled.", "\n\nOttomkopf glowered, \"Why is this man loose again?\"", "\n\n\"Ask Trudy,\" Magda smiled.", "\n\n\"Why shouldn't he be?\" ", "Mike joined Johnnie.", "\n\nJohnnie swung to him. \"", "I didn't tell you they tied me up twice tonight, did I? ", "That's the kind of a bunch this is, tying a soldier of Uncle Sam's. ", "Would you have believed that?\"", "\n\n\"Officer, can't you take this man into custody?\" ", "Ferenz begged. \"", "He is definitely insane. ", "A persecution complex.\"", "\n\n\"Why don't you throw me out?\" ", "Johnnie demanded.", "\n\n\"Why don't you?\" ", "Rudolph urged.", "\n\nFerenz didn't answer those.", "\n\n\"Why don't you, Rudolph?\" ", "Ruprecht drawled from the doorway. ", "He was tight again or acting tight. ", "He'd put on his top hat and he had one hand stuck behind his tails. ", "In his other hand he held out an envelope, a fat white envelope blobbed with red sealing wax.", "\n\n\"The papers!\" ", "Ferenz gurgled. \"", "Ruprecht, I could kiss you!\"", "\n\n\"Not without getting your teeth knocked out,\" Ruprecht grinned. \"", "You mean this?\" ", "He waggled the envelope out of reach.", "\n\n\"Yes, dear. ", "We've been waiting for that. ", "Where did you get it?\"", "\n\n\"Found it,\" Rupe teetered.", "\n\n\"Where?\" ", "Dorp demanded.", "\n\n\"Under Magda's pillow.\"", "\n\n\"That's a lie!\" ", "she cried.", "\n\n\"That's a lie,\" Rudolph echoed. \"", "You're just trying to make me jealous.\"", "\n\n\"I didn't say Magda was under the pillow,\" Rupe grinned. \"", "Just this.\"", "\n\n\"It isn't true!\" ", "she said. \"", "If it was there, someone put it there. ", "And what were you doing in my room?\"", "\n\nRudolph echoed again, \"What were you doing in her room?\"", "\n\n\"I always go first to Magda's room. ", "Just to see what's going on. ", "Dull tonight. ", "Who wants this moldy old envelope?\" ", "He held it out of reach from the advance.", "\n\n\"I will take it,\" Dorp decided firmly. ", "He did.", "\n\nRuprecht brushed off his hands, stuck them into his pockets. \"", "Hello, Gorgeous,\" he greeted Magda.", "\n\n\"It's been opened,\" Dorp said softly.", "\n\n\"Sure, it's been opened,\" Ruprecht admitted. \"", "Wanted to see what was inside.\"", "\n\nThe fat man's voice was dangerous. \"", "What did you do with the rest of it?\"", "\n\n\"What rest of it? ", "That's all there was, there wasn't any more.\" ", "He winked at Trudy. \"", "Hello, Snookums.\"", "\n\nFerenz began softly, \"Concentrate, Ruprecht. ", "Please, dear.\" ", "He put his hand on Rupe's arm. \"", "For old Furry. ", "Think hard. ", "What did you do with the rest of it?\"", "\n\n\"Nothing else.\"", "\n\n\"Let me see it.\" ", "Ferenz tore it away from Dorp, ruffed through the papers. \"", "What is it missing?\"", "\n\n\"Should I know?\" ", "Dorp shrugged. \"", "I saw only the outside of it. ", "But when I received it from Herr Ottomkopf, it was more thick, more heavy.\"", "\n\nOttomkopf didn't stir a bristle on his head.", "\n\nJanssen chimed in. \"", "Yes it was. ", "Herr Ottomkopf, you look. ", "What is it missing from the envelope?\"", "\n\nOttomkopf said, \"I did not prepare the envelope. ", "I received it. ", "I passed it on. ", "That is all.\"", "\n\n\"What's supposed to be in it?\" ", "Trudy asked.", "\n\nJohnnie spoke out of the corner of his mouth to Mike. \"", "There's coffee going to waste. ", "I could use a cup.\" ", "He edged away from the group. ", "Mike followed. ", "No one yapped at them.", "\n\nThey went down the room and into the next. ", "It was the swellest dining room Johnnie had ever seen. ", "The walls were all tapestry, guys in wigs and skirts hunting with spears. ", "The table and chairs must have been built right here. ", "They were too heavy to carry around. ", "The swellest part was the big coffee pot with steam and smell exuding from it, the platter of sandwiches, the dish of cakes. ", "Johnnie stuffed a pink one into his mouth while he poured two cups. ", "He said, \"I'm dead on my feet. ", "No sense of our listening to that ring around the rosy. ", "The guy who really knows what was in the envelope isn't going to talk.\"", "\n\nMike double-decked a sandwich. \"", "What do you suppose is missing?\"", "\n\n\"I know what's missing,\" Johnnie said. \"", "And I'm the only one knows except the guy who put it there.\"", "\n\n\"What is it?\"", "\n\n\"A bomb.\"", "\n\nMike swallowed half a sandwich without chewing. \"", "A bomb!\"", "\n\n\"Shshsh.\" ", "Johnnie went to the door, peeked out. ", "The whole bunch was arguing now. \"", "Don't let them hear you say that. ", "I might get in trouble.\"", "\n\n\"How do you know it's a—cupcake?\"", "\n\n\"Because I'm the guy who opened the envelope. ", "Trudy passed it to me after she lifted it. ", "I'm the guy who took out the—cupcake.\"", "\n\n\"What did you do with it?\"", "\n\n\"It's in my pocket.\"", "\n\nMike smiled and laid himself back in the chair. \"", "Who you kidding?\"", "\n\n\"All right, wise guy.\" ", "Johnnie wiped his fingers on the tablecloth. \"", "Look.\" ", "He edged it out of his pocket, one eye on the door. \"", "There she is. ", "There's the cupcake.\"", "\n\nMike was suspicious. \"", "Looks like a cigar to me.\"", "\n\n\"Sure it does. ", "But I've had a course on bombs. ", "This is the kind automatically ignites at a certain time. ", "Of course you can pull the pin and make it go off sooner.\"", "\n\n\"You hadn't ought to carry it around in your pocket like that.\"", "\n\nJohnnie manfully put it back in. \"", "I think it's safe. ", "You see, it couldn't be meant to go off here. ", "That would get the guy who made it. ", "It must have been safe in the envelope until Rudolph was on the Clipper.\" ", "He took another sandwich to keep his stomach from playing scales. \"", "Anyhow don't you say anything about it yet.\"", "\n\n\"I won't. ", "But I think I better call up the precinct and get some help over here. ", "Fast.\"", "\n\nJohnnie chewed gravely. \"", "I don't think they'll let you borrow the phone. ", "They killed Theo you know.\"", "\n\n\"You really did see him?\"", "\n\nJohnnie scowled. \"", "You mean you still don't believe it?\"", "\n\n\"By now I don't know what I believe.\" ", "Mike drank his coffee black. \"", "I should have gone to bed instead of trying to play Boy Scout to you.\"", "\n\nJohnnie jumped up suddenly. ", "He grabbed a nut-studded cupcake and began eating fast. \"", "I got it, Mike!\"", "\n\n\"Got what?\"", "\n\n\"I know where Theo is.\"", "\n\n\"Where?\"", "\n\n\"That's it.\" ", "Johnnie nodded his head wisely. \"", "That's just it.\"", "\n\n\"Well, tell it.\"", "\n\nHe lowered his voice. \"", "Those guys cutting up the street. ", "They're not from the Street Department. ", "They're Dorp's men. ", "They're digging up the street for Theo. ", "Put him in the hole. ", "Close it up. ", "Theo never shows again.\"", "\n\nMike shook his head. \"", "Where could they get a drill?\"", "\n\n\"Where did they get those Nazi uniforms? ", "And a bomb? ", "Getting it wouldn't bother them any. ", "Mike—\" He grabbed another cake quickly. \"", "We've got to stop them before it's too late.\"", "\n\n\"If they aren't going to let me phone, you think they'd let you go out and stop those men?\"", "\n\nJohnnie hadn't considered that. \"", "We aren't going to tell them,\" he figured. \"", "We'll say we're going to look for Theo. ", "They don't care how much we look for him in this house. ", "Then when we get downstairs we'll make a dash for the door. ", "Once outside if that watchman starts anything, I'll let him have it. ", "You have a gun and a police whistle, haven't you? ", "And I have a couple of fists.\"", "\n\n\"Okay, soldier. ", "Let's go.\"", "\n\nJohnnie took another cake with him for reinforcement. ", "They marched back into the throne room. ", "The bunch was still arguing. ", "Rudolph had collapsed on the throne. ", "Janssen was rallying on one side, Magda on the other. ", "They could dig each other without the goon catching on. ", "Ferenz and Ottomkopf, Dorp and Trudy were doing most of the talking. ", "But loud. ", "Ruprecht alone was out of it. ", "He was balancing his silk topper on his nose. ", "He inquired, \"Where did you go to, soldier?\"", "\n\n\"I was hungry. ", "There's a lot of good grub going to waste in there.\"", "\n\n\"Lead the way.\" ", "He clapped the hat over one ear and put his arm through Johnnie's.", "\n\nJohnnie pointed. \"", "Right down there at the end of the room to the right. ", "You can't miss it.\"", "\n\n\"I might,\" Ruprecht insisted. \"", "You show me.\"", "\n\n\"We can't show you now,\" Mike said. \"", "We got to—\"\n\n\"Aw, come on, show me first. ", "Won't take a minute. ", "What's so important?\"", "\n\n\"We have to find Theo,\" Mike said.", "\n\n\"He won't run away,\" Ruprecht argued.", "\n\nJohnnie began to catch on. ", "Rupe wasn't tight any more than he'd been earlier. ", "He had something he wanted to say. ", "Privately. \"", "All right, I'll show you. ", "Come on.\"", "\n\nMike started after them until Magda cooed, \"Officer Costello.\"", "\n\nMike looked at her then he looked at Johnnie.", "\n\n\"Go on,\" Johnnie said. \"", "See what she wants.\"", "\n\nShe didn't look as if she wanted anything more than a little variety. ", "But whatever she wanted would be worth investigating.", "\n\nRuprecht waited until they were in the dining room. \"", "Do you have a gun?\" ", "he demanded.", "\n\n\"No, I don't.\"", "\n\n\"Damn nonsense. ", "I left mine at home. ", "I didn't expect any trouble.\" ", "He poured a cup of coffee, swallowed it quickly.", "\n\n\"Mike's got one,\" Johnnie said. \"", "So has Magda and Trudy and—\"\n\n\"—everyone else that shouldn't have. ", "There's trouble ahead.\"", "\n\n\"What kind or trouble?\"", "\n\n\"Fighting trouble. ", "Dorp says Rudolph can't leave without the missing papers. ", "Ferenz says whatever is missing could be sent to him in Switzerland. ", "He also points out that he can't arrange a seat on the Clipper every day. ", "Magda agrees with Ferenz. ", "So does Rudolph.\"", "\n\n\"What does Old Bristle-Head say?\"", "\n\n\"Ottomkopf? ", "He's too mad to say anything. ", "First he sides with Dorp and then he sides with the others. ", "And he wants to know who let a soldier and a policeman in here. ", "What he wants most is to take a rubber truncheon to me. ", "I say that's all the thanks I get for finding their damn papers. ", "Trudy's trying to organize a search of the house. ", "Stalling for time. ", "I think she knows what's missing. ", "I think she hid it purposely.\"", "\n\nJohnnie didn't know whether to mention the bomb or not. ", "If he did, Ruprecht might take it away from him to use as his weapon. ", "Johnnie sort of liked having it in his pocket. ", "If he finally had to fight his way out of here, it would come in handy. ", "He didn't mention it. ", "Instead he asked, \"What do you want a gun for?\"", "\n\n\"Because I want to use it if the final decision is for Rudolph to leave. ", "He's an ass but after all he is my brother. ", "And I don't go for having him killed by the Nazis.\"", "\n\nJohnnie thoughtfully selected another cake. ", "He wasn't hungry but it was something to do and for free. \"", "I think we all need guns,\" he said. \"", "I mean you and me and Mike and Trudy. ", "I think Dorp's a Nazi and I think those soldiers of his are Nazis too. ", "I don't know why he wants to kill Rudolph only if he does, he's going to kill you too.\"", "\n\n\"Kill me?\" ", "Ruprecht echoed quietly.", "\n\n\"Figure it out for yourself. ", "Who takes over if anything happens to your brother?\"", "\n\nRupe figured it. \"", "Could be that the Nazis want that damn Kraken to take over. ", "I don't doubt a bit that he's gone whole hog for the New Order. ", "Ugly bastard. ", "But why would Trudy play Dorp's game?\"", "\n\n\"Maybe she doesn't know.\"", "\n\n\"Why do you think we've had her and Magda living here but to keep an eye on Dorp? ", "And who got me over here tonight? ", "I had no intention coming into it. ", "I'll talk to Trudy. ", "She has a gun?\"", "\n\n\"Yeah.\" ", "He looked at Rupe's face anxiously. \"", "You wouldn't hurt Trudy, would you?\"", "\n\n\"I'd beat her to a pulp if I thought she was selling me out.\" ", "He didn't look as if he were fooling. ", "Johnnie followed fast.", "\n\nMike and Magda alone occupied the throne room. ", "They were gazing into each other's eyes. ", "Magda was gold and black wickedness. ", "Mike was pleased.", "\n\n\"Where's Trudy?\" ", "Ruprecht demanded.", "\n\n\"They've all gone hunting, darling. ", "Want a drink?\"", "\n\n\"Where's Rudolph?\" ", "Johnnie shouted. \"", "Who let Rudolph go? ", "You know someone's trying to kill him.\"", "\n\n\"Don't be silly,\" Magda deprecated.", "\n\n\"Come on,\" Johnnie called. ", "He ran to the door. ", "Mike ran after him.", "\n\n\"He's safe,\" Mike said. \"", "They went in pairs. ", "He's with Trudy.\"", "\n\nJohnnie slowed down and breathed again. \"", "As long as we're started,\" he decided, \"we might as well get outside before they finish the search. ", "If you can tear yourself away from Yellow-britches.\"", "\n\nMike did look sheepish. \"", "On her they aren't repulsive,\" he said. \"", "We're going to look pretty silly if that's the N. Y. C. street department outside.\"", "\n\n\"You're going to look sillier if Theo has to be dug out of the street again.\"", "\n\nThey reached the foot of the stairs.", "\n\n\"After we're out, how we going to get back in?\" ", "Mike asked.", "\n\n\"We're coming back with the whole force,\" Johnnie boasted. \"", "And Theo. ", "Though personally I'd just as lief not see this place again. ", "If I only had my dog tags—\" He had his hand on the doorknob before he remembered to look toward the chenille curtains. ", "He wouldn't have been surprised if the whole outfit was lined up there poking guns on him. ", "He was exceedingly surprised that the curtains didn't even quiver. \"", "Outside, brother,\" he warned Mike.", "\n\nIt was that easy. ", "They descended the steps, headed toward the drill in the middle of the street. ", "Mike let him take the lead. ", "Either Mike was still afraid he'd look silly or his mind was on that green-eyed thing back in the house. ", "The drill made a worse noise than the Louisiana maneuvers. ", "Johnnie set his teeth.", "\n\nThe two workmen took a recess when he upped to them. ", "He demanded, \"What are you doing here?\"", "\n\nThe one with his hat pulled over one eye said nastily, \"Playing gin rummy. ", "Want to set in?\"", "\n\nThe one with his hat over both eyes said, \"What do you think we're doing, wise guy?\"", "\n\nYou couldn't distinguish faces, not on a black night in a brownout. ", "They didn't need the hats to hide them.", "\n\nJohnnie persisted, \"Why are you digging up this street?\"", "\n\n\"We like to dig up streets,\" the first guy said. \"", "Any objections?\"", "\n\n\"I want to know why you're digging it up now at this time of the morning.\"", "\n\nThey eyed each other.", "\n\n\"Drunk,\" the first worker said.", "\n\n\"Nuts.\" ", "The second waved a fist. \"", "Scram, soldier. ", "We got work to do.\" ", "He set his hand on the drill.", "\n\nThe noise ate away Johnnie's eardrums. ", "He couldn't hear what Mike was saying. ", "The cop was making gestures at the men. ", "They desisted.", "\n\n\"Now what?\" ", "the second guy demanded.", "\n\n\"Listen, Johnnie,\" Mike began. \"", "Look at that hole. ", "It isn't deep enough.\"", "\n\nJohnnie looked. ", "It wasn't a big hole; the surface wasn't cracked to a depth of more than a few inches. ", "He said, \"They can make it deeper.\"", "\n\n\"So you don't like our hole?\" ", "the first guy sighed. \"", "I wish I was back at excavating. ", "I'd show you a nice big hole. ", "Besides kibitzers can't talk to you when you're excavating. ", "If they do you can't hear them.\"", "\n\n\"Wait,\" Mike said to the hand on the drill. \"", "Look, Johnnie, it isn't an excavation. ", "The street department just breaks up the top layer. ", "You couldn't hide anything there.\"", "\n\n\"Did you gents lose something?\" ", "Number Two asked.", "\n\n\"Yes,\" Johnnie answered promptly, and not so promptly \"Well—no—yes—\"\n\n\"Make up your mind.\"", "\n\n\"We might as well go back in,\" Mike urged. \"", "Theo isn't here.\"", "\n\n\"I'm not so sure.\" ", "Johnnie was belligerent. \"", "They've been working a long time to make such a little hole.\"", "\n\n\"What do you want us to do, be unemployed by morning?\" ", "the first said. \"", "Better take your pal away—say, you're a cop!\"", "\n\n\"Off duty,\" Johnnie explained. ", "He didn't want Mike to get in any trouble.", "\n\n\"Mike Costello.\" ", "He introduced himself. \"", "Sorry we bothered you. ", "Come on, Johnnie.\"", "\n\n\"I'd like a better look at that hole,\" Johnnie persisted. ", "He didn't continue. ", "There was a little figure running toward them. ", "It was Trudy.", "\n\n\"What are you two doing out here?\" ", "She was breathless. \"", "Are you crazy?\"", "\n\n\"Sure,\" the second man called out, loud and true.", "\n\n\"We're looking for Theo,\" Johnnie said with dignity.", "\n\n\"That's what I came to tell you. ", "I've found him.\" ", "She grabbed his hand. \"", "Hurry!\"", "\n\nHe didn't have time to think. ", "He ran beside her back toward the house. ", "Mike caught up with them.", "\n\n\"Where is he?\"", "\n\n\"I'll show you.\"", "\n\nThey went inside again. ", "She turned and closed the door softly. \"", "Upstairs.\" ", "They started fast. ", "They were on the first step when she called, \"Wait!\" ", "Both of them turned back.", "\n\nShe was standing against the door, far enough away to make a plunge impossible. ", "There was a sweet smile on her face. ", "In her hand was her gun. ", "It pointed smack at them.", "\n\n# Six\n\n\"ROOKED AGAIN,\" JOHNNIE GROANED.", "\n\n\"What's the big idea?\" ", "Mike doubled his fists.", "\n\n\"The big idea is that you're to put your hands out in front of you and climb up those stairs.\" ", "She was little but there was nothing soft about her voice or the gun.", "\n\n\"You need some help, Trudy?\" ", "There was someone behind the chenille curtain now. ", "Someone with a thick accent. ", "It was Dorp.", "\n\n\"I found these two out in the street.\"", "\n\nAnxiety popped his eyes. \"", "They send no message?\"", "\n\n\"I don't know. ", "I don't think they had time.\"", "\n\n\"What were they doing?\"", "\n\n\"Talking to those men fixing the street.\"", "\n\nDorp scowled. \"", "Can you hold them here while I get together everyone? ", "We must decide what now to do.\"", "\n\n\"You're darn right I can hold them,\" she stated. \"", "One off beat and I'll get trigger finger.\"", "\n\nDorp waddled upstairs.", "\n\n\"Listen, Trudy.\" ", "Johnnie tried to reason with her. \"", "Mike's a cop. ", "You can't shoot him.\"", "\n\n\"Keep your hands up,\" she commanded. \"", "A dead cop's just as dead as a dead pigeon. ", "In there.\"", "\n\nThey walked into her parlor.", "\n\nMike complained. \"", "It's the last time I play Boy Scout to the Army. ", "I should have been home in bed hours ago. ", "With my shoes off.\"", "\n\nJohnnie had no answer. ", "He too could have had a good evening, chorus girls and fun. ", "He certainly hadn't intended to sweat out a pass this way. ", "He'd probably be too tired tomorrow for sight-seeing. ", "And Bill and Hank would doubtless never speak to him even if he found them again.", "\n\nTrudy eyed him reproachfully from the piano bench. \"", "You've certainly messed things up, Johnnie Brown.\"", "\n\n\"Me?\" ", "He was indignant. ", "He sputtered. \"", "Me? ", "Who was it dragged me upstairs tonight? ", "Who was it handed me—\"\n\nShe broke in loudly. \"", "Keep quiet. ", "I tried to get you to leave when you first barged in, remember? ", "But no. ", "You had to stick around. ", "You deserve just what you get.\"", "\n\n\"Give me back my dog tags and I'll go right now.\"", "\n\n\"No, you won't,\" she slurred. \"", "You haven't a chance of getting out until it's all over. ", "And you'd better stop trying.\" ", "She circled past them, the gun steady as a Texas Sheriff's. \"", "You might tell me one thing. ", "Did you send a message?\"", "\n\n\"I wouldn't tell you the right time.\" ", "Johnnie was glum. ", "He and Mike should have called the police before looking at that hole in the street. ", "He and Mike should never have followed Trudy back in here. ", "He and Mike should have their respective heads examined.", "\n\n\"If you did,\" her smile was too sweet, \"I'd advise you to lie about it when the others came down. ", "They wouldn't like it.\"", "\n\n\"Wouldn't like what?\" ", "That was Rupe's voice behind them. \"", "What gives now, Trudy? ", "Why the ack-ack?\"", "\n\n\"These two were trying to skip,\" she stated.", "\n\n\"How stupid. ", "Hold it steady, baby mine.\"", "\n\nJohnnie couldn't see what was happening. ", "He heard Mike's shout, \"Hey, you can't do that!\" ", "and Trudy's warning, \"Keep those hands up, copper.\"", "\n\nRuprecht pranced over to her. ", "He was fondling Mike's revolver with admiration.", "\n\n\"He took it right out of my holster,\" Mike complained. \"", "Unbuttoned my holster and took it right out.\"", "\n\n\"You know my motto about dead cops,\" Trudy warned.", "\n\n\"At ease.\" ", "Rupe put his arm around Trudy. ", "His free hand held Mike's gun. \"", "I'll keep them covered for you.\"", "\n\n\"Judas,\" said Mike sadly.", "\n\n\"You boys can sit down,\" Rupe said. \"", "Right there on the floor. ", "It's safe, Trudy. ", "Johnnie doesn't have a gun. ", "I tried to borrow one from him earlier. ", "I have Mike's. ", "Go on, sit down, fellows.\"", "\n\nIt wasn't very comfortable but they sat down on the worn red carpet. ", "Mike said to Johnnie's ear, \"Who's on who's side here?\"", "\n\n\"Don't mutter,\" Rupe warned.", "\n\nHe repeated aloud, \"Who's on who's side here?\"", "\n\n\"I wish I knew,\" Trudy breathed.", "\n\nMagda and Janssen came down together. ", "Janssen's mouth was too red. ", "That indelible stuff was hard to rub off quick. ", "Mike glared at him. ", "Magda's green eyes opened wide. \"", "Why are they sitting there?\"", "\n\n\"We're having a picnic, darling,\" Rupe drawled. \"", "Johnnie and Mike arrived early.\"", "\n\n\"I'm not,\" Mike glowered.", "\n\nFerenz called out, \"What does Dorp want now? ", "He told us to come here.\" ", "He stopped when he saw the picnickers, walked all around them cautiously. ", "His mouth pursed out superciliously as he moved away.", "\n\nOttomkopf was next. ", "He glared at the two prisoners. \"", "What now have these spies did?\"", "\n\n\"Who's a spy?\" ", "Johnnie demanded. \"", "Don't answer, let me. ", "You're a spy.\"", "\n\n\"Oh hush!\" ", "Ferenz was petulant.", "\n\nDorp dived through the curtains at last. \"", "Are we all here? ", "We must leave at once. ", "These men—\"\n\n\"Where's Rudolph?\" ", "Johnnie shouted suddenly. ", "He scrambled up then gun or no gun.", "\n\nEveryone looked at everyone else. ", "All anyone saw was a frightened face. ", "Ruprecht's voice threatened, \"Where is Rudolph?\"", "\n\nOttomkopf turned on Janssen. ", "He thundered, \"Where is Rudolph?\"", "\n\nMike said with evident pleasure, \"He started with Trudy.\"", "\n\n\"I turned him over to Janssen,\" she said quickly.", "\n\nJanssen quavered, \"I don't know. ", "He told me he wanted to take a bath.\"", "\n\n\"He took one bath!\" ", "Dorp roared.", "\n\n\"He told me he didn't want to look for papers. ", "He wanted a bath. ", "I was outside his door. ", "Then Magda came along and asked me to hunt with her. ", "I—I—\"\n\n\"Good hunting?\" ", "Mike asked with malice.", "\n\nJanssen turned bricky.", "\n\n\"Mike,\" Ruprecht ordered, \"You go stand guard at the front door. ", "Don't let anyone in or out.\"", "\n\nMike lolled on the floor. \"", "So you want to play with me now?\"", "\n\n\"Don't be difficult,\" Rupe said. \"", "Johnnie and I have to search the house. ", "We don't want the murderer escaping while we search.\"", "\n\nMike clambered up reluctantly. \"", "I'm not doing any guarding in this house without my gun.\"", "\n\n\"Sorry.\" ", "Rupe handed it back to him just like that. ", "Mike looked amazed. ", "He took it as if there were a trick. \"", "I'll use Trudy's.\"", "\n\nMike stuck the gun away. \"", "How about the back door?\"", "\n\n\"There's only the front staircase. ", "Guard it.\"", "\n\n\"O.K.\" Mike turned to glare at the room. \"", "Don't anybody be coming around with excuses. ", "It won't do you no good.\"", "\n\n\"Come on, Johnnie,\" Rupe said. \"", "Give me your gun, Trudy.\"", "\n\n\"I'm going with you, Rupe.\" ", "She moved to his side.", "\n\n\"Give me your gun anyway.\"", "\n\n\"What about us?\" ", "Dorp ventured. \"", "What do we do?\"", "\n\n\"I don't care what you vultures do. ", "Only I advise you to keep your eyes on each other.\" ", "He eyed them singly. \"", "I don't know who got rid of Rudolph. ", "I only know who didn't. ", "Johnnie and Mike didn't because they were outdoors. ", "Trudy didn't. ", "She was following them. ", "And I know I didn't. ", "That leaves the rest of you.\"", "\n\n\"Dear, what are you saying?\" ", "Ferenz's little eyes were pained.", "\n\n\"He's nuts,\" Magda shrugged. \"", "He always was.\" ", "She dug her hands into the pockets of her black velvet jacket. \"", "I know what I'm going to do. ", "Stay right here. ", "I'm tired of searching this damn house. ", "And if anyone has any ideas of making me disappear, I warn them to watch out.\" ", "She flipped out her gun. \"", "I know how to shoot.\"", "\n\n\"I'll be with you, Magda.\" ", "Janssen licked his lips.", "\n\n\"Let's get going, Rupe,\" Johnnie said disgusted. ", "Some girl friend. ", "Didn't matter to her that Rudolph had probably been killed. ", "Just as long as there was another guy handy.", "\n\nTrudy trailed Johnnie and Rupe. ", "Johnnie didn't like her behind him. ", "Not with that habit she had of sticking a gun in a guy's backside.", "\n\nHe scowled his face at her. \"", "What was the idea of holding me and Mike up with your gun? ", "Like we were the enemy.\"", "\n\n\"Didn't you see Dorp watching us? ", "Besides—\" She shoved past him to Rupe's side. \"", "Besides no matter how much I love you, Johnnie, I can't have you and your copper monkey-wrenching my plans. ", "Not this late in the day. ", "Guardroom, Rupe?\"", "\n\n\"Yes.\" ", "He headed toward Theo's room.", "\n\n\"Hadn't we ought to just look in his bathroom first?\" ", "Johnnie suggested.", "\n\n\"You don't think he's there, do you?\" ", "Rupe's face was grim. \"", "Well, go on and look. ", "I'm betting on the attic. ", "If you find him, yell.\"", "\n\nTrudy hesitated. \"", "You don't expect to find him, do you?\"", "\n\n\"Not alive.\" ", "Rupe's mouth was a bitter line. \"", "But I'll find him. ", "And I'll find who did it.\" ", "He halted. \"", "You still don't have a gun, do you, Johnnie?\"", "\n\nJohnnie showed his muscle. \"", "I don't need one.\" ", "He didn't. ", "He still had the bomb. ", "He watched the two go into Theo's room, close the door. ", "He himself headed for Rudolph's. ", "He wasn't afraid to go in, but he was almost afraid to turn on the light. ", "He'd seen one dead man in here tonight. ", "It wasn't that ha'nts scared him but he didn't like the idea of finding corpses.", "\n\nHe closed his eyes before he switched the light. ", "He opened them slowly as possible. ", "The room was empty. ", "He stood for a moment breathing again. ", "No one on the floor. ", "No one under the bed. ", "No one in the closet. ", "He went over to the bathroom door. ", "He knocked. ", "He knocked three times, each time louder. ", "Finally he opened the door a teensy crack. ", "He closed his eyes before he did it. ", "Drowning in a bath tub wouldn't be something he wanted to remember. ", "The bathroom was empty. ", "There was one dampish towel hung over the tub. ", "That would be the first bath. ", "Rudolph hadn't taken a second. ", "Not even a yardbird from Arkansas would use the same bath towel twice, not with a pole full of big clean ones at hand. ", "Rudolph had not taken a second bath. ", "That was an excuse to give Janssen the slip. ", "It hit Johnnie like a ton of bricks. ", "That closet wasn't just empty of dead bodies: it was empty. ", "No coat and hat. ", "The suitcase gone. ", "The brief case gone. ", "Rudolph had got away!", "\n\nJohnnie ran to the window on the fire escape. ", "He pushed it up, leaned out. ", "That was dopey. ", "Rudolph would have left a long time ago whether he went by window or door. ", "He wouldn't be hanging around waiting to be discovered. ", "There wasn't any doubt in Johnnie's mind that Rudolph had skipped. ", "Not when it was this easy. ", "Rudolph didn't have the chin of a thinker but it wouldn't take much brain power for him to figure he was safer out of this house than in it. ", "He, Johnnie, didn't claim to be any Eisenhower but he knew he'd be safer out of here. ", "And, this was his chance.", "\n\nHe leaned out the window. ", "Somewhere below that watchman might be prowling but he wouldn't be hard to handle. ", "Johnnie hesitated. ", "He didn't hesitate long. ", "He drew back, closed the window. ", "He couldn't skip without Mike. ", "He'd brought the copper into this: he couldn't rat out. ", "Not and leave Mike to fight off this bunch singlehanded. ", "Besides if he walked out now he never would know how it turned out. ", "And he couldn't leave without his dog tags. ", "He was in to the finish. ", "The finish was going to be soon. ", "As soon as he reported that Rudolph had flown the coop.", "\n\nHe wasn't going to hurry with that information. ", "Give a guy an outside chance to get clear. ", "He, Johnnie, might as well put up his feet and have a smoke until Rupe and Trudy came back downstairs. ", "He plumped the pillows behind his head on the old-fashioned mahogany four poster, stretched his feet out on the blue and white tufted spread. ", "He lit a cigarette. ", "This was solid comfort. ", "This was what he'd been waiting for. ", "He took a quick one at his watch. ", "No wonder bed felt good. ", "Four-thirty A.M.! ", "He'd have to remember to keep his eyes open in this rest period. ", "A catnap might turn into a real pounding of the ear and he'd miss what was going to happen. ", "He wished he had a bottle of Rupe's champagne. ", "That would wake him up. ", "Or he wished he had Trudy around. ", "He wouldn't feel like sleeping if she were here. ", "He blew a whole chain of rings—pretty good ones, too—and thought about Trudy. ", "Bill and Hank wouldn't believe he'd spent the evening with a blonde babe, cute as Sonja Henie, even if he could describe her to them. ", "Nobody would.", "\n\nHe turned over and buried his ear in the pillow. ", "He'd like to stay right here. ", "Only you'd think they would furnish a mattress without lumps for Crown Princess Ermintrude of Rudamia. ", "Maybe she knew how to avoid the bumps. ", "Maybe...\n\nJohnnie slid off the bed but fast. ", "He shoved his hand under the blankets about where that hump had been. ", "He drew out what his hand closed on.", "\n\nNow he had a gun too. ", "A gun with a silencer. ", "The murderer hadn't taken much pains to hide it. ", "Maybe he'd hoped Rudolph would find it, put his fingerprints on it. ", "Johnnie's mouth turned wry. ", "Big stupe, Johnnie. ", "He'd done it all right. ", "Now when he turned it over to the police, they'd have their murderer easy. ", "One Pfc. ", "John Brown. ", "He shoved it in his pocket and he flopped down again on the bed. ", "Hank had been right. ", "It wasn't safe for him and Bill to let Johnnie go off alone.", "\n\nHe leaned up on his elbow suddenly. ", "Somebody outside was turning the knob of the door. ", "Johnnie lay still. ", "He wasn't relaxed; he could have jumped and hit that door before it opened. ", "But he wanted to see who it was. ", "Maybe the murderer was coming back for his gun. ", "Neither Trudy nor Rupe would be pussy-footing.", "\n\nThe door opened one small crack and then it started closing again. ", "Johnnie sang out quick, \"Come on in.\" ", "He didn't want to have to get up and chase the intruder. ", "His invitation worked. ", "The door opened and Ferenz bounced through.", "\n\nThe big man closed the door behind him, looked around and pursed up his lips. \"", "What are you doing?\" ", "he asked petulantly.", "\n\n\"Just resting,\" Johnnie said.", "\n\n\"You've found Rudolph?\"", "\n\n\"Uh uh.\" ", "He blew out a real thick ring. \"", "He's gone.\"", "\n\n\"Gone?\" ", "Ferenz nearly screamed it. ", "But softly. \"", "Gone?\"", "\n\n\"Uh huh.\" ", "He didn't like fat pants with the squeaky voice.", "\n\n\"Where?\"", "\n\n\"I don't know.\"", "\n\n\"Have you looked?\"", "\n\n\"I don't have to look any more. ", "His coat's gone. ", "His hat's gone. ", "Also his bags. ", "He's gone all right.\"", "\n\nFerenz's face drooped down over his chins.", "\n\n\"There's a fire escape outside the window.\"", "\n\n\"You don't have to tell me! ", "I own this house.\" ", "But he billowed over, opened the window and peered out. \"", "He took everything?\"", "\n\n\"Yeah.\"", "\n\n\"The traitor. ", "All that money. ", "Sixty-five thousand dollars I put up to send him back to Rudamia.\"", "\n\n\"It wasn't sixty-five thousand. ", "It was seven thousand.\"", "\n\n\"Sixty-five thousand, I tell you.\" ", "Ferenz turned a face like a tomato. ", "An over-ripe one. \"", "I know how much money I have spent on him, don't I? ", "And how does he repay? ", "By running to Washington to get me in bad with the government!\" ", "He stuck out his head again, withdrew it, banged down the window and swirled on Johnnie. \"", "You knew he'd gone! ", "And you lay here resting!\"", "\n\nJohnnie rolled off the bed, keeping it between them and the big fellow. ", "Ferenz looked mad enough to froth. \"", "I was waiting for Trudy and Rupe to come back.\" ", "Johnnie opened his eyes full after he'd said that. ", "It hadn't occurred to him before. ", "Maybe he'd been snipe-hunting, he and Mike. ", "Maybe those two weren't coming back. ", "He made for the door.", "\n\nFerenz screamed, \"Where are you going?\"", "\n\nHe didn't bother to answer. ", "Ferenz was puffing on his heels. ", "Johnnie whirred into Theo's room, pushed aside the secret closet and bellowed up into the dimness, \"Rupe, Trudy, get down here. ", "Double time.\" ", "Silence alone answered him. ", "He called again, \"Trudy, Rupe!\" ", "There was no answer.", "\n\nHe plunged past Ferenz, almost knocking him down as he tore by him and down the stairs to the parlor. ", "He swooped open the chenille curtains.", "\n\nNo one was in the room. ", "No one at all.", "\n\n## 2.", "\n\nFerenz came to a halt behind him. ", "He was winded. ", "He gasped, \"Are you crazy?\"", "\n\n\"Look.\" ", "Johnnie pointed to the obvious. \"", "They've all skipped. ", "Not just Rupe and Trudy. ", "All of them.\" ", "He swung suddenly. \"", "Mike!\"", "\n\nCrash-bang answered him. ", "He shoved Ferenz, stepped out into the hall. ", "Mike was on the floor. ", "So was the chair. \"", "I wasn't asleep,\" Mike denied. \"", "I was sabotaged.\"", "\n\n\"They're gone!\" ", "Johnnie shouted.", "\n\nFerenz spoke wearily. \"", "Don't be an ass. ", "They're upstairs for a bite to eat. ", "Loathsome food. ", "Cold sandwiches.\"", "\n\nJohnnie didn't look at Mike. ", "He stubbed up the stairs after Ferenz. ", "He'd forgotten the lure of food.", "\n\nThey were stuffing placidly, Magda, Janssen, Ottomkopf, Dorp. ", "They weren't in the least interested in Johnnie's appearance in the doorway. ", "Magda spoke through a sandwich. \"", "Where was he?\"", "\n\n\"He wasn't.\" ", "Ruprecht and Trudy couldn't have helped but heard his roar. ", "No matter how much wooing was going on. ", "If they'd been up there.", "\n\nFerenz sat down at the head of the table. \"", "A cup of coffee, please dear. ", "Rudolph has left us.\"", "\n\nJanssen's mouth alone dropped open. \"", "You mean—like Theo?\"", "\n\n\"I don't mean anything of the sort,\" Ferenz snapped. \"", "I mean bag and baggage.\" ", "He pushed the cup away. \"", "With what do you adulterate your coffee, Herr Dorp, soybeans? ", "I cannot endure bad coffee. ", "Mine I fly in once a week from South America. ", "Doubtless Rudolph is even now en route to Washington, to the government-in-exile. ", "There is no possible way to stop him.\"", "\n\n\"And why not?\" ", "Ottomkopf demanded.", "\n\n\"My dear, do you suggest that one of us attempt abducting him from the Pennsylvania Station or from the airport? ", "There are laws in this country.\" ", "He flung down the cake he was absent-mindedly nibbling. \"", "I abhor pink icing!\" ", "He brushed off his fingers. \"", "I too am leaving. ", "I told you I did not wish to appear in this. ", "You have involved me against my will. ", "Pray do not bother me again—any of you.\"", "\n\nMagda choked on crumbs. \"", "What about the missing papers?\"", "\n\n\"I know nothing of them. ", "Doubtless one of you do. ", "If they are ever found, I suggest sending them to Rudolph, in internment. ", "With my compliments.\" ", "He pushed up. \"", "Good night.\"", "\n\nDorp jumped to face him. \"", "I do not think you should leave us like this.\"", "\n\n\"Do I care what you think?\" ", "He drew himself up to six foot two inches of floppy dignity. \"", "I am Ferenz Lessering.\"", "\n\n\"What's up now?\" ", "Ruprecht asked mildly.", "\n\nJohnnie could have cheered. ", "Good old Rupe! ", "He hadn't ratted. ", "Neither had Trudy. ", "She was right behind him, pink and pretty and curious.", "\n\n\"Rudolph's skipped,\" Johnnie explained.", "\n\n\"Skipped? ", "What do you mean?\"", "\n\nFerenz said, \"Just what he says. ", "Rudolph has gone. ", "Coat, hat, luggage—gone.\" ", "His chest began to heave. \"", "All my money gone. ", "Gone with one who sneaks away to tell the F.B.I, what I have done for him.\"", "\n\nRuprecht began to laugh. ", "Trudy looked at him and she began to laugh too.", "\n\n\"I wouldn't have thought he had enough guts,\" Rupe chortled. \"", "Good old Rudo. ", "I'll buy him a drink when he gets out of internment.\" ", "He became straight-faced. \"", "Maybe he didn't like your plans.\" ", "He looked at each one of them in turn.", "\n\n\"What do you mean?\" ", "Ferenz asked haughtily.", "\n\n\"Maybe he figured he'd rather be a live duck under suspicion than a dead one under the plans.\"", "\n\nFerenz shook his head. \"", "There was the risk, Ruprecht, always the risk in king-making. ", "But a throne is worth the gamble. ", "And Dorp had it directly from Europe—\"\n\n\"How do you know?\" ", "Ruprecht demanded. \"", "Anybody could tell you anything so long as you agreed with it. ", "How do you know what Dorp dreamed up?\"", "\n\n\"You are speaking of me?\" ", "Dorp squawked.", "\n\nJohnnie liked this.", "\n\n\"Yeah, you. ", "Why wouldn't you dream them pretty when you'd found a sucker who didn't care what he put out for as long as he could play Metternich. ", "But murder's a different story.\"", "\n\n\"So are Nazis,\" Johnnie allowed.", "\n\nMagda commanded, \"Quiet!\"", "\n\nIt was the first time she'd pulled that in hours. ", "Johnnie was so surprised he turned and looked at her. ", "She wasn't paying any attention to him though. ", "She'd said it automatically. ", "She was watching Ferenz. ", "Johnnie was thankful he wasn't Ferenz. ", "Those green eyes were more like the eyes of a rattler than of a glamour girl. ", "If he hadn't been on the wrong side of the table, Johnnie would have made a dive for her gun pocket. ", "He didn't think she was safe having it at the moment.", "\n\nFerenz didn't seem worried though. ", "He was merely tired of it all. ", "He droned, \"I am leaving here, Ruprecht. ", "Find out what you can, dear, and let me know. ", "I am writing this project off as a bad debt. ", "Perhaps the Rudamian _Republic_ will some day reimburse me.\"", "\n\n\"What makes you think you're leaving?\" ", "Magda asked softly. \"", "You're in this too, Furry. ", "Don't think you're not. ", "If the rest of us are investigated, we're not going to pretend we dug up the money out of Fort Knox to send Rudolph back to Rudamia.\"", "\n\n\"I do not intend to figure in this, Magda.\" ", "Ferenz's voice rose. \"", "Whatever lies you choose to tell about me, my lawyers and I shall refute with ease.\"", "\n\nHe walked to the door. ", "Ruprecht still blocked it. ", "Magda's hand was in her pocket. ", "Dorp spoke. \"", "Let him go.\" ", "It was an order.", "\n\nRuprecht stepped aside. ", "Now Trudy barred the way. ", "Ferenz could squash Trudy like she was a crocus. ", "He didn't. ", "She raised her big blue eyes to him. \"", "Don't you want to help us find Theo? ", "And whoever murdered him?\"", "\n\n\"Theo is of no possible interest to me,\" Ferenz answered loftily. \"", "I am leaving here at once. ", "I would advise the rest of you to do the same as quickly as possible. ", "Once Rudolph reaches the government-in-exile, I fear the F.B.I. will be headed this way. ", "Even if they do not come, I am supporting this house no longer. ", "You have bungled. ", "All of you. ", "Good night.\" ", "He pushed her aside.", "\n\nDorp repeated, \"Let him go.\"", "\n\nTrudy grinned. \"", "He won't get far. ", "Mike's got integrity.\"", "\n\nDorp's fat face split. \"", "I too remembered Mike.\"", "\n\nEven Ottomkopf simulated their giggles.", "\n\nDorp brushed the crumbs off his vest and belched. \"", "I do not believe Mr. Lessering should be allowed to leave without us.\" ", "He trotted into the throne room. ", "The others followed. \"", "Phew,\" he said. \"", "Phew.\" ", "His nose wrinkled. \"", "This room. ", "It smells.\" ", "He pulled the red curtains away from the front windows, flung the windows wide.", "\n\n\"Is this wise?\" ", "Ottomkopf asked dubiously.", "\n\n\"Why not? ", "It is almost daylight. ", "The prize has vanished. ", "The rest of us too must vanish.\"", "\n\nFrom below there were voices. ", "The injured bleat was Ferenz. ", "The bluster was Mike.", "\n\nMagda smiled. \"", "You think we should prepare to leave with Ferenz?\"", "\n\n\"I believe this would be the wise move,\" Dorp stated.", "\n\nFrom below there rose the plaint, \"Ruprecht, this fellow refuses to allow me to depart.\"", "\n\nMike's voice climbed over it. \"", "I got my orders, Bub.\"", "\n\nJohnnie slid along to the banisters, leaned over. ", "It was just like it sounded. ", "The big Lessering stood at bay at the foot of the stairs, trembling with rage. ", "Mike was on both feet by the door, twirling his service revolver and looking pleased as Punch. ", "Johnnie cheered, \"At-a-boy!\"", "\n\n\"Ruprecht!\" ", "Ferenz wailed.", "\n\nRuprecht hadn't come out of the throne room yet. ", "The others had, all but Trudy. ", "They were bustling around, upstairs, in rooms, out of rooms. ", "All the while Ferenz kept howling for Ruprecht. ", "Johnnie felt a nudge on his arm. ", "It was Trudy squeezing up beside him. ", "That felt good. ", "It would have felt better if Rupe hadn't come along pushing on the other side of her. ", "She didn't honey up to him though. ", "She urged, \"Go on, Rupe.\"", "\n\n\"And miss the fun? ", "Not yet. ", "Don't worry about me.\"", "\n\nMike was finally making himself heard above the din. ", "He spoke to the point. \"", "Aw, shut up before I let you have it.\"", "\n\nBy that time Dorp and Ottomkopf were hurrying down the stairs, bowlered and coated. ", "After them came Janssen, his uniform enveloped by the dark coat again, and Magda, a polo coat over her yellow slacks. ", "At the same moment the pounding at the front door broke through the racket.", "\n\nJohnnie felt relieved. ", "Some way Mike had got word through to headquarters. ", "If it weren't the police, it must be the Marines. ", "This was the spot for them.", "\n\nMike pointed a steady gun to the crowd on the staircase. \"", "Stay right where you are,\" he said.", "\n\nJohnnie whispered to Trudy. \"", "Might as well see the show in comfort.\" ", "He took her by the hand and hurried her to the top step. \"", "Box seats,\" he offered. ", "They sat down. ", "The only trouble was that Rupe followed, sitting down on the other side of Trudy.", "\n\n\"You are no longer to guard,\" Dorp was announcing to Mike but he didn't attempt to move from the lower step.", "\n\n\"The hell I'm not,\" Mike told him. ", "The door pounding wasn't quieting down any. ", "Mike shouted to it, \"Keep your shirt on.\" ", "He backed nearer to the noise while warning the tableau, \"One of you make a false move and you'll see if I'm still on guard.\" ", "He put his hand on the knob, opened the door without turning. \"", "Come in and join the party. ", "Keep quiet and watch this gun.\" ", "He kept the shooting iron and eyes pointed steady forward.", "\n\nJohnnie lifted up from the step but Trudy pulled him down. \"", "Wait,\" she ordered. ", "She was watching the door.", "\n\nThe new entrants weren't policeman. ", "They were the two street department men with the hats pulled over their eyes. ", "Johnnie had known they were phonies. ", "Real street department workers wouldn't be coming in here. ", "He would have warned Mike but it happened too fast. ", "Before he could yell, one of them had lunged, quietly knocked the revolver out of Mike's hand. ", "The gun bumped across the floor. ", "Dorp picked it up, scurried to a stand in front of the chenille curtains where he covered not only the bunch on the stairs but the three by the door. ", "The only ones he didn't cover were Johnnie and Trudy and Rupe on the top step. ", "He didn't know they were there.", "\n\nMike's fist had shot out the minute he was attacked. ", "The workman's chum had closed in. ", "You couldn't see what was what by now.", "\n\n\"Stop that horseplay,\" Dorp commanded once he was set. \"", "Stand where you are.\"", "\n\nMike and the wrestling team moved apart. ", "One workman had an incipient shiner. ", "The other was wiping his nose. ", "Mike brushed at his sleeves.", "\n\n\"Now I have something to say,\" Dorp announced. \"", "Thank you, Joe.\"", "\n\n\"Wasn't nothing,\" Joe said. ", "He picked up his hat, pulled it over one eye like before.", "\n\nJohnnie whispered, \"Why can't I go down the back way and sneak up on Dorp from behind?\"", "\n\n\"No back stairs,\" Trudy whispered. \"", "Wait.\" ", "She had her eyes fixed on the door again.", "\n\n\"May we leave now?\" ", "Ferenz was haughty.", "\n\n\"Not yet,\" said Dorp. \"", "Not until I know who killed Theo.\"", "\n\n\"Does it matter?\" ", "Ferenz wearily examined his nails.", "\n\n\"He was a traitor,\" Ottomkopf growled. \"", "He deserved to die. ", "Let us go.\"", "\n\n\"He did not deserve to die,\" Dorp said slowly. \"", "He was a poor weak fool, yes. ", "A tool, yes. ", "But I did not intend he should die. ", "I should myself have protected him had I known he was to die. ", "I did not know. ", "Now I shall find out who it was killed him.\"", "\n\n\"You're being frightfully silly, Dorp.\" ", "Ferenz was impatient. \"", "We can confer at a safer place than this. ", "Even now Rudolph may be in Washington, may have set on us the F. B. I.\"\n\nDorp laughed, a noisy jiggling laugh. \"", "The F. B. I. is not coming up from Washington to investigate us. ", "This need not worry your head.\"", "\n\nRupe's jaw was set. ", "He leaned forward. ", "Trudy's hand went swiftly to his arm. ", "She still watched the door with puzzled anxiety.", "\n\n\"What do you mean?\" ", "Ferenz's whisper was shrill.", "\n\nMagda cried, \"What do you mean? ", "You didn't—Rudolph isn't—dead?\"", "\n\nDorp laughed louder. ", "When he stopped the silence was thick as his accent. ", "He spoke into it. \"", "I hope he is not dead. ", "If he is someone will be sorry, very sorry.\"", "\n\nThe silence was awkward. ", "Ferenz began, not so sure of himself now, \"I cannot remain here longer.\"", "\n\nDorp moved the gun forward. \"", "But you will,\" he said softly. \"", "Or I shall be forced to shoot this gun at you.\"", "\n\n\"I scarcely knew this Theo.\"", "\n\n\"I didn't know him at all,\" Ottomkopf spoke up.", "\n\n\"No. ", "But it was not Theo who was meant to die. ", "It was Theo who died but it was meant to be Rudolph. ", "And there were many who wish Rudolph to die.\"", "\n\n\"You can't include me!\" ", "Magda exclaimed.", "\n\n\"Indeed yes, Magda. ", "If Rudolph dies, who is king? ", "Ruprecht, yes. ", "And much better you should be his queen, no?\"", "\n\nTrudy made an ugly face.", "\n\n\"I wasn't betrothed to Ruprecht.\"", "\n\n\"It is the royal custom,\" Dorp smiled, \"that if a betrothal is made publicly—as it was tonight—the lady must be taken over by the new king. ", "Ruprecht could do nothing but marry you.\"", "\n\n\"I could abdicate,\" Ruprecht muttered.", "\n\nOttomkopf said, \"That is quite true, Herr Dorp. ", "She killed Theo.\"", "\n\n\"I did not!\" ", "Magda shouted. \"", "What about you? ", "You never could get along with Rudolph.\"", "\n\n\"It appears to me,\" Ferenz stated, \"that Ruprecht had the most to gain by Rudolph's death.\"", "\n\nRuprecht spoke again under his breath. \"", "My pal.\"", "\n\n\"I certainly have nothing to gain,\" Ferenz continued. \"", "If Rudolph had been killed tonight, I should have lost a goodly sum of money, the cost of bringing him from Mexico, the ticket on the Clipper, the expenses involved—\"\n\n\"Maybe,\" Dorp agreed. \"", "Maybe not. ", "There is a good price on Rudolph's head. ", "Put there by the Nazis who now hold Rudamia. ", "The same price is on Ruprecht's head. ", "That is why the F. B. I. watch so closely on him, I believe. ", "The Nazis would eliminate the heirs to the Rudamian throne. ", "Believing this would save them a revolution.\"", "\n\n\"For someone who poses as a Rudamian patriot,\" Ferenz said meanly, \"It seems to me you know a lot about Nazi affairs.\"", "\n\n\"Of certainty I do. ", "It is because these things I know that I am able to help you plan Rudolph's return. ", "I am an honest man. ", "I do not like it that one of you is not honest. ", "That one of you pretends only that he wishes Rudolph to return. ", "I do not like it that he is brought here only to be killed. ", "I particularly do not like it that one of you kills poor Theo by mistake.\"", "\n\nJanssen spoke up suddenly. \"", "Herr Dorp, there is one question you must answer. ", "Why did you give that envelope to Theo? ", "Everything starts from that point.\"", "\n\n\"I am asking the questions,\" Dorp reminded him coldly. \"", "Remember that. ", "Which of you killed Theo?\"", "\n\nSilence alone answered him.", "\n\n\"I could tell him,\" Johnnie muttered.", "\n\nTrudy put her finger to her lips.", "\n\n\"If that is not to be answered by you, I do not anticipate the consequences. ", "Not pleasurably for you. ", "I and my men will—\"\n\nTrudy let out her breath. ", "Someone had knocked on the front door. ", "The knock was repeated.", "\n\n\"See who this is, Joe,\" Dorp frowned.", "\n\nJoe opened the door. ", "Whoever Trudy had been expecting, this wasn't it. ", "Nor was it the Marines.", "\n\nIt was Rudolph.", "\n\n## 3.", "\n\nIt was Rudolph, a Rudolph with a satisfied canary-filled expression on his vacant face and his long cigarette holder angled in his mouth. ", "No one expected him. ", "The lower stair delegation reared forward as one man. ", "Ruprecht and Johnnie grabbed Trudy's arm just in time to keep her from tumbling on her head. ", "Disappointment was fluctuating with amazement on her face. ", "Dorp's mouth was wondrous. ", "But he didn't forget to keep the gun pointed at his prisoners.", "\n\nMagda recovered first. \"", "Rudolph! ", "Where have you been?\"", "\n\n\"I was hungry,\" he said blandly.", "\n\n\"We had supper prepared.\"", "\n\nHe lifted supercilious eyebrows. \"", "There was no chile. ", "I told you I wanted some chile.\"", "\n\n\"But how did you get out?\"", "\n\nHe frowned at her stupidity. \"", "How do you think? ", "On wings? ", "I walked out the front door, of course. ", "And I found a nice little restaurant, open all night, on the next street. ", "Strange. ", "The man who runs it is from Rudamia. ", "Hans—\"\n\n\"Your bags?\" ", "Dorp demanded. \"", "What did you do with your bags?\"", "\n\n\"Aren't they here? ", "I told that guard to watch them.\" ", "He was annoyed. \"", "What are you doing with that gun, Dorp? ", "I brought them down myself. ", "It was almost time to go to the airport. ", "I left them by the halltree there.\"", "\n\nJohnnie peered through the banisters. ", "They were there all right. ", "Only everyone here, inspired by a dumb private from Texas, was so certain that Rudolph had flown the roost they hadn't bothered to look in the dark passageway.", "\n\nDorp too had glanced. \"", "They are there. ", "Please to join the others on the stairs, Rudolph.\"", "\n\n\"What for? ", "Aren't we going to La Guardia field? ", "Do you mean no one yet gave up the papers you were stewing about?\"", "\n\n\"You haven't been to Washington?\" ", "Ferenz asked anxiously.", "\n\n\"How silly.\" ", "Rudolph dropped ashes. \"", "How could I get to Washington and back in less than an hour, Furry? ", "I went to eat some chile. ", "Hans didn't have chile but he had sauerbraten and some good beer. ", "What about those papers?\"", "\n\n\"They have not been recovered,\" Dorp said. \"", "The important part of them is still missing. ", "If you will now obey please and take your place on the stairs.\"", "\n\n\"I don't know why anyone would want to sit on the stairs. ", "And I don't know why you're wasting time this way.\"", "\n\n\"I am not wasting time.\" ", "Dorp's lip protruded. \"", "I am finding the murderer of Theo.\"", "\n\n\"He probably killed himself,\" Rudolph offered. \"", "From chagrin.\"", "\n\n\"With what? ", "His fingernails?\"", "\n\n\"All right, he didn't.\" ", "Rudolph elbowed past Ferenz on the lower step, shook off Magda's fingers and continued climbing.", "\n\nDorp roared, \"You are not to go upstairs.\"", "\n\nRudolph turned in annoyance. \"", "I don't know why not. ", "If Rupe can sit upstairs, why can't I?\"", "\n\nTrudy groaned.", "\n\nDorp lifted his eyes. \"", "Sooo? ", "So you are here. ", "Even our soldier friend is yet with us. ", "You will join the others down here if you please.\"", "\n\n\"The hell we will,\" Johnnie said pleasantly. ", "He shook off Trudy's fingers and rose up. ", "His hand went into his pocket, came out with the cigar. ", "He put it to his mouth. \"", "See this? ", "Know what it is? ", "It's what you've been calling papers all night. ", "It isn't papers.\"", "\n\n\"It's a cigar,\" Rudolph said.", "\n\n\"It isn't a cigar. ", "It's a neat job. ", "I'm in the Army. ", "I know about these things.\" ", "He put it closer to his teeth. \"", "And I'm the guy who knows how to pull the pin. ", "And if you don't drop that gun, I'll pull it.\"", "\n\n\"Blow us all up?\" ", "Mike shouted.", "\n\nJohnnie felt very brave and patriotic at the moment. \"", "Rather than let these Nazis loose, yes!\" ", "He apologized quickly, \"Sorry, Mike. ", "Okay, Dorp. ", "One—two—\"\n\nDorp let the gun fall. ", "He didn't like doing it.", "\n\n\"Get it, Mike,\" Johnnie called. \"", "And the rest of you hold still. ", "One wiggle and—\"\n\nMike had recovered the gun. ", "With it in hand he waved the two workman into the lower stair group. ", "He growled, \"All right, Dorp. ", "Get over.\"", "\n\nDorp said, \"You are making a mistake. ", "I work for the F. B. I.\"\n\n\"Oh yeah?\" ", "Johnnie could think of nothing more devastating to say at the moment.", "\n\n\"That is true, Private Johnnie Brown. ", "Joe and Jorge here are members of the F. B. I. I help them. ", "They help me. ", "They have been waiting all evening outside to apprehend some of these people. ", "Even now while I have talked, it was just that we must wait until the cars arrive to convey these enemy aliens to headquarters where questioning will be more successful.\"", "\n\nJohnnie held the bomb handy. \"", "Watch that door, Mike,\" he warned. \"", "If any more of Dorp's F. B. I. gets here, let them have it. ", "I guess you think I'd fall for anything, Pudgey, just because I'm from Texas. ", "If those guys were really F. B. I. they wouldn't have jumped Mike.\"", "\n\n\"They don't know he's a cop. ", "I don't know myself what he is. ", "Anyone can borrow a uniform. ", "He has behaved rather exceptional since he has arrived.\" ", "He looked from Magda to Mike. ", "Mike scuffed a toe. ", "Dorp turned again to Johnnie. \"", "Your motives are admirable, Private Brown, but you make a mistake. ", "If I were not what I say I could have shot you when first you showed the bomb to me.\"", "\n\n\"And risk it exploding?\" ", "Ferenz squealed.", "\n\n\"That would not happen until the pin is pulled, or in due time is dissolved.\"", "\n\nJohnnie sent it solid. \"", "You know all about it, Herr Dorp.\"", "\n\n\"Yes, indeed,\" he said proudly. \"", "I examined the envelope when first it came to me. ", "I prised away the seals, saw what it contained.\"", "\n\n\"And didn't call the cops,\" Johnnie snapped.", "\n\n\"No. ", "I have the evidence. ", "That will not run away.\" ", "He scowled. \"", "So I think.\" ", "His head nodded. \"", "I do not wish the cops; the F. B. I. and myself will take care of matters when all the elements have come together. ", "But I do not risk being asked to hand over the envelope prematurely. ", "It is possible someone suspect I am not what I seem. ", "It is possible that the envelope is taken from me, the envelope which will blow him up, and given to Rudolph; then him secreted away while I am at Mr. Lessering's. ", "I do not wish Rudolph to be hurt. ", "He is what you call the innocent bystander.\" ", "He scowled ferociously. \"", "It is others whom I and the Department of Justice wish to apprehend.\"", "\n\nHis shoulders shrugged. \"", "I give the envelope to Theo—the misguided youth who plays with fire, an enemy patriot—no one will suspect he has it. ", "He is too unimportant for that. ", "If I am asked for it I will say it is not with me. ", "We will all return to my house where my men watch outside. ", "I will keep Rudolph safe while I bag the traitors.\"", "\n\n\"If you were going to bag them, why didn't you?\" ", "Johnnie demanded. \"", "What have you been waiting for all night—Christmas?\"", "\n\n\"Interruptions!\" ", "Dorp exploded. \"", "Interruptions! ", "First Rudolph must go to the party. ", "Before my men arrive he must leave. ", "When finally we manage to bring him back, the evidence is missing. ", "Then Theo is killed. ", "Comings and goings, comings and goings, but no evidence.\" ", "He demanded, \"And how did you get it?\"", "\n\n\"Trudy hooked it out of Theo's pocket,\" Johnnie grinned. \"", "She gave it to me for the same reason you gave it to Theo, no one would suspect me of having it.\"", "\n\nShe glared at him. \"", "You told me there was nothing in it but the papers.\"", "\n\n\"There was, though.\" ", "He grinned to his ears now. \"", "I unsealed the seals just like Dorp and then I sealed it up again. ", "Rudolph watched me.\" ", "He scowled. \"", "Only I kept the evidence on me. ", "Wanted to make sure nobody got hurt. ", "It didn't make any difference to me what happened to the goon but I didn't want the Clipper blown up. ", "Nobody but a Nazi would think of anything as awful as blowing up a Clipper just to get rid of one guy. ", "Only maybe the guy wasn't the important thing. ", "Maybe the whole deal was just to blow up the Clipper and whoever was on it this morning.\"", "\n\n\"That's smart figuring,\" Joe of the pulled down hat admitted. \"", "Imagine the stink if an American Clipper exploded with important politicians aboard.\"", "\n\nHe talked as if he knew something. ", "He didn't talk like a street worker at all. ", "Johnnie squinted at what was visible of the face.", "\n\nTrudy pulled his sleeve. \"", "Johnnie.\"", "\n\nOut of the side of his mouth, like a gangster, he shot, \"Don't bother me. ", "Can't you see I'm busy?\"", "\n\n\"Johnnie,\" she clarioned. \"", "Tell Mike to open that door and start blowing his police whistle. ", "Tell him to keep blowing it until help comes.\" ", "She called down, \"Can you hold the gun and blow at the same time, Mike?\"", "\n\n\"Watch me.\" ", "He flung the door wide. ", "Daylight was gray outside. ", "Mike stepped into the opening, stood facing the staircase as he began to shrill.", "\n\nRuprecht sighed. \"", "This calls for refreshments, Johnnie. ", "We still have our bottles upstairs. ", "I'll get them.\"", "\n\n\"Wait,\" Dorp cried. \"", "Do not let him escape.\"", "\n\n\"He's going for our champagne.\" ", "Johnnie shouted with what he hoped was sufficient frigidity above the din.", "\n\n\"You're in the groove.\" ", "Rupe pounded his shoulder.", "\n\nTrudy said \"Eeow,\" and rubbed where he had passed her.", "\n\n\"Don't squeal. ", "See you soon, baby mine. ", "Here's your popgun. ", "Be good or you won't share the rations.\"", "\n\nA man had appeared in the doorway behind Mike. ", "He was just an ordinary homely guy in a dark suit with sleepy eyes. \"", "What the hell are you doing here, Mike?\" ", "he demanded.", "\n\nMike said, \"Didn't expect to draw you, Lefty.\"", "\n\nLefty came on into the room, looked tentatively at the haul. ", "He didn't glance up the stairs until Trudy called, \"Lefty, where have you been?\"", "\n\nHis face was sour. \"", "Where have I been? ", "I been in that damn doorway across the street ever since seven o'clock last night. ", "Ever since I talked to you in the basement.\"", "\n\nThe faces below weren't faces. ", "They were big blanks.", "\n\n\"All ready to close in and what happens? ", "You signal me, don't come.\"", "\n\n\"That was because Rudolph insisted on going out.\"", "\n\n\"Back you come. ", "Signal stand by. ", "I stand by. ", "What happens? ", "No signal.\"", "\n\n\"Ferenz was coming. ", "I knew it wouldn't do any good to signal while he was here. ", "He'd just get all his Washington bigwig friends to get the Nazis off.\"", "\n\n\"Why, Trudy.\" ", "Ferenz was hurt.", "\n\n\"I wanted to get rid of him first. ", "But then things got too bad. ", "Rudolph disappeared. ", "And I signaled you and you didn't come and didn't come—\"\n\n\"I fell asleep,\" Lefty admitted glumly. \"", "Even a police lieutenant gets sleepy after a fifty-two hour shift.\" ", "He took a more thorough dig at the assemblage. \"", "Okay. ", "Do we run them all in?\" ", "His face brightened. \"", "Hi there, Joe. ", "Jorge. ", "You guys on business?\"", "\n\nDorp was giggling. \"", "It is very funny. ", "I have my men waiting. ", "And you too, Trudy. ", "A double guard.\" ", "He shook his finger. \"", "I always knew you were a good girl in the heart.\"", "\n\nJohnnie said, \"They say they're F. B. I.'s.\"", "\n\n\"Who are you?\" ", "Lefty demanded. \"", "Sure they're F. B. I.'s.\"", "\n\nJohnnie's grip on the bomb weakened. \"", "Dorp too?\" ", "Lefty couldn't be a phony; Mike knew him.", "\n\nLefty said, \"How do, Professor Dorp. ", "Didn't see you at first in the crowd.\"", "\n\nJohnnie repeated wanly, \"Is Dorp F. B. I. too?\" ", "He hoped Ruprecht would get back fast with the champagne. ", "He needed it.", "\n\n\"I am a military secret,\" Dorp stated proudly.", "\n\n\"That's about right,\" Lefty agreed. \"", "Well, I guess we aren't needed here, Mike. ", "Not with the Feds on the job.\"", "\n\nJohnnie still couldn't trust. ", "He didn't want Mike to leave. ", "He shouted quick, \"Tell him about the murder.\"", "\n\n\"Yeah, murder,\" Mike remembered. \"", "Only no body.\" ", "He scratched his head. \"", "We never got to finish looking, Johnnie. ", "Say, there's some cars stopping out front.\"", "\n\n\"Our fellows,\" Joe nodded.", "\n\n\"How about asking them to wait,\" Lefty requested. \"", "Murder. ", "I'd like a crack at this bunch before you take them in. ", "Maybe if I solve a murder I'll get boosted to Inspector.\"", "\n\n\"Mike's done all the work,\" Johnnie yelled. \"", "You got to make him a lieutenant or I won't tell you who did it.\"", "\n\nMike spoke placatingly. \"", "He's my friend, Lefty. ", "You know who did it, Johnnie?\"", "\n\n\"I know how to find out,\" he said. \"", "Only first I want to know who put the bomb in that letter.\"", "\n\n\"Bomb!\" ", "Lefty popped. \"", "Mike, call the bomb squad quick.\"", "\n\nDorp bowed. \"", "If you will give it to me, Private Brown. ", "Any minute now it might explode. ", "The Clipper left one hour ago, you know.\"", "\n\nRudolph sprang to life. \"", "Why am I not on it?\"", "\n\nMagda sighed from her toes. \"", "For God's sake.\"", "\n\n\"We got a better idea for you,\" Joe told him.", "\n\nDorp said, \"If you will but carefully pass to me the bomb, Private Brown.\"", "\n\n\"I don't know.\" ", "Johnnie examined it cautiously. ", "He still wasn't certain about Dorp.", "\n\n\"You'd better give it to him, Johnnie,\" Trudy urged.", "\n\n\"Give it to him,\" Janssen insisted.", "\n\nFerenz pouted. \"", "Make him give it to you, Dorp.\"", "\n\n\"We will all be blown up,\" Ottomkopf said hoarsely.", "\n\nJorge bounded up the steps. \"", "I'll take care of it, soldier.\" ", "He grabbed it, bounded down again and out the door.", "\n\nEveryone but Johnnie sighed relief. ", "He said. \"", "Now I got nothing to protect myself with.\" ", "He did have. ", "The murderer's gun.", "\n\n\"I'll protect you,\" Mike promised. \"", "Now, who killed Theo?\"", "\n\nJohnnie sat down on the top step. ", "Rupe was sure taking his time. \"", "First let's find out who fixed the bomb.\" ", "The sea of faces was annoyed with him. \"", "Well, why not? ", "I got to be back in camp in the morning. ", "I want to know what this is all about. ", "You know it'll be censored out of the newspapers. ", "How can I fight a war if I got to be worrying about this thing for the duration? ", "Besides the same person did both. ", "Both were jobs to kill Rudolph.\"", "\n\nRudolph said simply, \"I wish I'd stayed in Mexico.\"", "\n\n\"So do I,\" Magda sighed.", "\n\nTrudy said, \"If I'd learned sooner what was up, I'd have seen that you stayed there, Rudolph.\"", "\n\n\"Traitor,\" said Magda.", "\n\n\"Are you admitting you knew it was a Nazi plot?\" ", "Trudy demanded.", "\n\nThe F. B. I. and New York's finest both moved in closer.", "\n\n\"Don't talk that way to her.\" ", "Janssen's arm went around Magda's shoulders.", "\n\nRudolph squealed, \"Take your hands off my betrothed.\"", "\n\nJanssen ignored him.", "\n\nDorp spoke calmly. \"", "It was Magda gave me that envelope.\"", "\n\nHer voice rose swiftly. \"", "Ottomkopf gave it to me.\"", "\n\nOttomkopf was apoplectic. \"", "You cannot accuse me. ", "I did not open the envelope. ", "I did not know what I carried when I came to this house. ", "Ferenz Lessering asked me to bring it to Dorp. ", "Magda took it from me here.\"", "\n\n\"Yes,\" Ferenz nodded. \"", "Yes, I gave it to Ottomkopf to carry. ", "Janssen had brought it to me. ", "He had an important guard meeting. ", "He could not convey it to Herr Dorp.\"", "\n\nJanssen said quickly, \"I picked it up for Herr Dorp at our Brooklyn headquarters.\"", "\n\n\"Ring around the rosy,\" Trudy sang.", "\n\nMagda spoke up nastily. \"", "Don't forget Trudy handled it.\"", "\n\n\"That does not work.\" ", "Dorp shook his head. \"", "I had opened it before she took it.\"", "\n\n\"Perhaps,\" Magda agreed. \"", "But you did not open it at once. ", "You put it on the desk in your room while you conferred with Ottomkopf.\"", "\n\n\"How do you know?\" ", "Trudy asked. \"", "You can't black-wash me, wench. ", "If I'd filched it then I wouldn't have had to pick Theo's pocket tonight.\"", "\n\n\"Last night,\" Johnnie yawned.", "\n\n\"And I wouldn't have had Lefty in a drafty areaway all night if I was in on it.\"", "\n\nDorp said briskly, \"This is no good. ", "We take them to headquarters. ", "It is too bad for Private Brown's curiosity\"—he shrugged—\"but we can waste no more time.\"", "\n\n\"Wait a minute,\" Lefty demanded. \"", "What about that murder?\" ", "He squinted up at Johnnie. \"", "If you want Mike to solve it, you'd better spill.\"", "\n\n\"Oh that,\" Johnnie said. \"", "First get their guns.\" ", "He didn't want the murderer taking a pot shot at him before he named names.", "\n\n\"Pass 'em out,\" Lefty barked. \"", "Anybody got identifying tags to mark them with?\"", "\n\nJorge announced, \"Always prepared.\" ", "He fished in his pocket.", "\n\n\"The Marines!\" ", "Johnnie cried joyously.", "\n\nMagda's was first. ", "Janssen had his in the pocket where his hand had rested in the car. ", "Hours ago. ", "Yesterday. ", "From Ottomkopf, Mike produced a nasty Luger.", "\n\n\"I have none,\" Rudolph said sweetly.", "\n\n\"Nor have I,\" Ferenz growled. \"", "I am not in the habit of carrying a gun.\"", "\n\n\"You too, Trudy,\" Johnnie urged.", "\n\n\"All right, Benedict Arnold.\" ", "She handed it down to the F. B. I. man.", "\n\n\"Now listen,\" Johnnie began. ", "This was the difficult part. \"", "I have the murderer's gun.\" ", "He pulled it from his pocket. \"", "I found it where he'd hidden it. ", "In Rudolph's bed.\"", "\n\n\"Trudy's bed,\" Rudolph prompted.", "\n\n\"It's got my fingerprints all over it. ", "So I found it.\" ", "He defied them. \"", "Even if you can't find the murderer's fingerprints underneath you can prove I didn't do it.\"", "\n\nFerenz spoke up. \"", "I knew all along this man was dangerous. ", "Arrest him, officer.\"", "\n\n\"You can prove it easy,\" Johnnie persisted. \"", "You know how?\"", "\n\n\"Yeah,\" Lefty nodded. \"", "The paraffin test for hands.\"", "\n\nEveryone turned the palms of his hands up. ", "Everyone automatically examined those of his neighbor.", "\n\n\"I shall protest to my government-in-exile,\" Rudolph proclaimed.", "\n\nJohnnie cleared his throat preparatory to an important speech. \"", "The murderer,\" he said solemnly, \"is Ferenz Lessering.\"", "\n\n# Seven\n\n\"WHAT!\" ", "FERENZ ROCKED TO his toes. ", "He was wrapped in disdain. \"", "You are being absolutely absurd. ", "I shall speak to my friend J. Edgar Hoover about this. ", "I shall speak to Attorney-General Biddle. ", "I shall speak—\"\n\n\"Speak to everybody,\" Johnnie cried blissfully. \"", "Speak to Mayor La Guardia and Mr. Hopkins and Eleanor Roosevelt and Senator Knox and General MacArthur and my top sergeant—\" He grinned. \"", "They won't speak to you.\"", "\n\n\"Ferenz Lessering.\" ", "Lefty was dubious.", "\n\n\"I suspected him all along,\" Johnnie said sagely. \"", "Any guy that has as much food stored away as Mr. Lessering couldn't be any good. ", "He smuggles coffee too. ", "He said so tonight.\"", "\n\n\"I said no such thing!\" ", "Ferenz denied. \"", "I am a coffee importer.\"", "\n\n\"Tell that to the Marines,\" Johnnie advised. \"", "But tonight when he came sneaking up to Rudolph's room to get the gun he'd hidden in the bed, then I knew.\"", "\n\n\"This man is insane!\" ", "Ferenz quivered. \"", "I don't believe he's a soldier at all.\"", "\n\n\"I am too!\" ", "Johnnie retorted. \"", "I'll show you my dog tags.\" ", "He turned to Trudy. \"", "Give me my dog tags.\"", "\n\nWordless she dug them out of her pocket.", "\n\nHe dangled them aloft. \"", "See?\" ", "Everyone saw. \"", "He thought he was killing Rudolph but he killed Theo by mistake—\"\n\n\"Why would I kill Rudolph?\" ", "Ferenz wept. \"", "Already he has cost me a small fortune.\"", "\n\nDorp patted his fat vest. \"", "I believe Johnnie is right. ", "I eliminate. ", "Who will gain by Rudolph's death? ", "Not I. Not even in my role as the loyal German-Rudamian who trains the young patriots. ", "If Rudolph dies there are no patriots to train. ", "Herr Ottomkopf? ", "If he wishes Rudolph to die it is very simple to kill him in Mexico. ", "A bit of poison in the chile. ", "Who could taste it?\" ", "He sputtered. \"", "Who could taste anything in that. ", "Ruprecht? ", "Where is Ruprecht?\"", "\n\n\"He's icing the champagne,\" Trudy said.", "\n\n\"Very well. ", "He does not wish to be king.\"", "\n\n\"So he says,\" Ferenz put in.", "\n\n\"He does not. ", "I know. ", "Did not Herr Ottomkopf and myself try to persuade him to be king when first you broached the idea of kingmaking? ", "Rudolph would be persuaded to abdicate.\"", "\n\n\"I would not!\" ", "Rudolph squealed.", "\n\n\"For good pay, yes, you would. ", "Ruprecht would make the better king, says Herr Ottomkopf. ", "But Ruprecht refuses. ", "Hence he would not kill his brother to receive what he could have without the trouble. ", "Magda wishes to be queen. ", "She prefers Ruprecht but a bird in the hand is better eating.\" ", "Dorp's voice perked up. \"", "Who is it insists Rudolph come here to fly to South America? ", "Who? ", "It is Ferenz Lessering. ", "It is his price for redeeming the Rudamian ruby for Magda. ", "The ruby which Herr Ottomkopf has pawned. ", "Only if she insists that Rudolph come here to sign the marriage papers. ", "Why would Ferenz Lessering wish Rudolph here but to send him to his death? ", "Are there not good airports in Mexico City?\"", "\n\n\"I'll sue you for every cent you own!\" ", "Lessering screamed.", "\n\n\"You deny it? ", "Ah, but there is a reason behind it. ", "You are a man of high finance, Mr. Lessering. ", "You will spend money to make money, yes? ", "But you will not throw it away. ", "Already you have spent more than you can afford on Rudolph. ", "And Rudolph is such poor pay, always. ", "But if Rudolph is dead, Ruprecht will be king. ", "You and Ruprecht are such good friends, no? ", "For months you have been together making these plans—\"\n\n\"I demand the best lawyers,\" Lessering bellowed. \"", "Let me out of here. ", "My lawyers will answer you.\"", "\n\n\"You're going out, Bub. ", "Don't worry about that.\" ", "Joe stepped up to him.", "\n\n\"Feet first if you don't pipe down,\" Jorge added.", "\n\nHe took one look at them, huffed, \"If you refuse to allow me to pass, I shall go telephone my lawyers. ", "At once.\" ", "He started up the stairs two at a time. ", "Johnnie didn't hesitate. ", "He ducked the outswung arm, caught Ferenz by a thumb and swung him up over his shoulder.", "\n\n\"Look!\" ", "he crowed. \"", "Commando stuff.\"", "\n\nHe started with him back down the stairs. ", "Ferenz was a cream puff. ", "But two hundred ninety pounds of cream puff was just that. ", "And Ferenz wasn't cooperating. ", "He wiggled. ", "Johnnie lost his footing halfway down. ", "He fell against the banisters. ", "They couldn't take it. ", "He released Ferenz as they hurtled through space. ", "From all the screaming and shouting, he thought he must have broken his head right open. ", "He hadn't. ", "Ferenz had cushioned his fall. ", "It was like landing on a sofa. \"", "Give a guy air,\" he complained to the crowd.", "\n\nFerenz wasn't hurt much either. ", "He wouldn't have been yowling so loud if he had been. ", "Yowling, \"Get off of me, you lout. ", "I'll see my lawyers.\"", "\n\nJohnnie crawled off. ", "And his eyes opened wide. \"", "Theo!\" ", "he breathed. ", "That was Theo propped in the corner, in the darkest far corner.", "\n\nRudolph whispered, \"I thought it was a guard. ", "I told him to watch my bags.\"", "\n\n\"It is Theo Kraken. ", "Dead,\" said a hoarse voice.", "\n\nEveryone looked up and around at the tall man with the scar splitting his face. ", "Hans was peering over the huddle of heads.", "\n\n\"Did you say Kraken?\" ", "Rudolph shivered.", "\n\nHe nodded solemnly. \"", "Yes. ", "The young brother of Ipomio Kraken. ", "I did not know he was in New York. ", "It was he who drew the short straw—my cousin told me this—at the last meeting of the Terrorists before the war. ", "It was he who was to kill His Highness, Prince Rudolph.\"", "\n\nJanssen's voice shook. \"", "And it was Theo who gave me the bomb.\"", "\n\nRudolph spoke up brightly. \"", "Then I had a right to kill him. ", "It was in self-defense.\"", "\n\nJohnnie got to his feet. \"", "Say that slow, brother.\"", "\n\n\"You killed him?\" ", "Lefty yelled.", "\n\n\"In self-defense,\" said Rudolph proudly. \"", "I came out of my bath as he was trying to escape through the window. ", "I thought it was my suitcase he carried. ", "With all that money in it.\" ", "He beamed. \"", "Instead he was trying to escape before he was arrested for killing me. ", "I killed him in self-defense.\"", "\n\n\"I shall get you the best lawyers, dear,\" Ferenz spat.", "\n\nRudolph turned in accusation on Dorp. \"", "You told me you'd get rid of the body.\"", "\n\nDorp sighed. \"", "The boys promised they would. ", "They must have been afraid they'd miss the last train home. ", "They are not well disciplined, I fear.\" ", "He winked at Joe and Jorge. \"", "I thought it best we hide the body for a little until more important things were taken care of.\"", "\n\n\"More important things?\" ", "Lefty scratched his head hard.", "\n\n\"Yes.\" ", "Dorp's mouth set. \"", "Yes. ", "More important that we apprehend Herr Ottomkopf. ", "The villain!\"", "\n\n\"You speak of me?\" ", "Ottomkopf spluttered.", "\n\n\"Yes,\" said Dorp. \"", "There he is, Joe, Jorge. ", "The man who smuggled the Rudamian jewels into this country. ", "Smuggled them encased in particularly evil-smelling cheese. ", "You remember the cheese? ", "This is the slippery customer whom I could catch only by engaging in this plan to make Rudolph king. ", "Only for that would Herr Ottomkopf return to pay for his misdemeanor.\" ", "He pointed a pudgy finger at Ottomkopf. \"", "Do not deny it. ", "The jewels smell even yet of cheese.\"", "\n\nOttomkopf's eyes were hollow. \"", "You do this to me, Herr Dorp? ", "You who were of my own regiment thirty years ago. ", "You betray me now—\"\n\nDorp struck his chest. \"", "A Rudamian never forgets!\" ", "His little eyes narrowed. \"", "A fine career I might have had in the Rudamian army. ", "Already a young man, I was a lieutenant. ", "What did you do?\"", "\n\nOttomkopf groaned.", "\n\n\"For a paltry one hundred and fifty rudls—which I won honestly from you in playing poker—for a miserable one hundred and fifty rudls which you did not wish to pay me, you had me cashiered. ", "In disgrace I come to America. ", "But I vow, 'Some day he will pay the one hundred and fifty rudls. ", "Through the nose!'\" ", "He pointed. \"", "Take him, Joe, Jorge. ", "I, Professor Dorp, have captured for you a criminal.\"", "\n\nLefty sighed. \"", "Well, we've bagged a smuggler and a murderer—\"\n\n\"Self-defense,\" repeated Rudolph.", "\n\n\"—and an O. P. A. violator.\"", "\n\nFerenz groaned into his hands.", "\n\n\"Think we can call it a day?\"", "\n\n\"One moment, if you please.\" ", "Hans bowed. \"", "Before you leave for the police station, Your Highness, you will please to pay me for the sauerbraten you ate and the beer you drank.\" ", "He drew himself high and thundered, \"And which you sneaked out without paying for while I was answering the telephone.\"", "\n\n\"Pay him, Ferenz.\" ", "Rudolph waved a languid hand.", "\n\nFerenz raised his head from his hands. \"", "Pay him yourself,\" he said crossly. \"", "For you,\" his lip drooped, \"I will have to starve myself. ", "The Board of Rations does not understand my needs.\" ", "His voice zoomed, \"Pay him yourself with my sixty-five thousand dollars.\"", "\n\n\"You didn't give me sixty-five thousand dollars,\" Rudolph retorted. \"", "It was only seven thousand.\"", "\n\n\"Dorp!\" ", "Ferenz bellowed.", "\n\nDorp said, \"It wasn't sixty-five thousand, Mr. Lessering. ", "It was only ten thousand. ", "Don't you remember that? ", "Three thousand of it Herr Ottomkopf and I needed for expenses. ", "Rudolph's bills in Mexico. ", "The escape. ", "Seven thousand we have given to Rudoph.\"", "\n\n\"It was sixty-five thousand,\" Ferenz insisted. \"", "First twenty-five thousand. ", "Then twenty-five more. ", "And another fifteen. ", "Add it up. ", "Sixty-five thousand I turned over to Ruprecht to finance this flight—\" He broke off. ", "Silence was utter. ", "His voice bubbled through. \"", "Where is Ruprecht?\" ", "His voice filled the house. _\"", "Where is Ruprecht?\"_", "\n\nTrudy's smile was apologetic. \"", "I think by now he's on his way to Mexico.\"", "\n\n\"Mexico!\" ", "Ferenz faltered.", "\n\n\"I'm sorry. ", "I didn't know until tonight, Furry, or I wouldn't have let him. ", "He's wanted Rudolph's Mexican place for a long time. ", "To make sort of a rich man's dude ranch out of it. ", "That's why he thought up the idea of getting you to make Rudolph king. ", "It was the only way he could borrow enough money from you—it's only a loan, really—and oust Rudolph at the same time. ", "You'll get your money all paid back. ", "He's going to make pots of it.\" ", "Her voice was smaller. \"", "And even if he doesn't it's only three years till he's thirty and he'll have Uncle Isaiah's estate. ", "You don't have to worry one bit, Ferenz. ", "He'll pay you back.\"", "\n\n\"Oh God,\" Ferenz groaned.", "\n\nJohnnie'd had a funny feeling for some time that Rupe wasn't coming back with that champagne. ", "He'd been right. ", "He only hoped the bottles were left behind. ", "He was pretty sure they weren't.", "\n\nThe law was forming ranks now. ", "Johnnie said, \"Before we go I'd like to ask Herr Dorp one thing. ", "Why was he talking German on the subway?\"", "\n\n\"I don't talk German,\" Dorp said. \"", "That was Rudamian.\"", "\n\n## 2.", "\n\nBroadway looked about the same as it had twenty-four hours ago. ", "Saturday night didn't seem to make much difference to New Yorkers. ", "Every night was Saturday here. ", "He, Johnnie, didn't think he'd care much about that kind of a town. ", "You wouldn't know when it was time to celebrate.", "\n\nHe stood on the steps outside the front door of the Astor, right where Bill and Hank had told him to meet them. ", "They ought to be turning up pretty soon now.", "\n\nHe hadn't had a lick of sleep but he didn't feel very tired. ", "He'd seen New York and how. ", "From the Battery to the Bronx. ", "He hadn't missed a trick. ", "Including the inside of Centre Street. ", "He'd sure have a letter to write home to the folks this week. ", "Take him a week to write it. ", "They'd get a big kick out of all the sights he'd seen today. ", "He'd been lucky that Trudy wasn't tied up. ", "It was more fun sightseeing with a cute little blonde babe under your arm. ", "Lucky too, that she'd wanted to make up to him for missing everything last night. ", "She knew the town. ", "Without her he'd never have thought of half the places to go.", "\n\nHe did feel kind of funny having her pay everything. ", "But it was Ruprecht's party, she said. ", "Ruprecht had given Trudy the folding dough to show Johnnie everything, including the best food he'd ever put down. ", "Without Johnnie helping out last night, Ruprecht might not have got away in time. ", "He might have been in the soup with the rest of them. ", "Not that Rupe had done anything wrong. ", "He'd simply made a suggestion and Ferenz had taken care of the rest. ", "Ferenz would get his money back.", "\n\nThere was only one big disappointment left in Johnnie. ", "None of them turned out to be Nazis. ", "He would have liked to have captured a band of Nazis. ", "Well, he'd have to take care of that when he got over seas. ", "If they'd only hurry and ship him before the big push was over.", "\n\nHe looked up and down the street. ", "No sign of Hank and Bill. ", "He hoped they hadn't forgotten him. ", "Then he turned his nose up to the sky. ", "Stars up there. ", "Not great big shiny ones like in Texas but stars just the same. ", "Somewhere up above there was a plane. ", "Trudy would be on her way to Mexico by now. ", "She wasn't letting Rupe escape her. ", "The first thing she was going to do there was send a bottle of champagne to Johnnie.", "\n\nCouple of soldiers crossing Broadway now that might be Bill and Hank. ", "They were Bill and Hank. ", "Johnnie hunched back his shoulders. ", "They'd be difficult at first but he could out-talk them. ", "He had before. ", "He came down the steps to meet them.", "\n\n\"Hi ya, fellows,\" he greeted.", "\n\nThey were relieved to see him. ", "After that they were mad.", "\n\n\"Well,\" said Bill. \"", "The missing link, I presume?\"", "\n\n\"When did you think you were supposed to meet us?\" ", "Hank demanded. \"", "Any night at nine? ", "You think the Army gave us a pass to hang out in front of the Astor for the duration?\"", "\n\n\"Cut the two-bit flap,\" Johnnie advised happily. \"", "I'm here, ain't I?\"", "\n\nBill's chin went up. \"", "So you got lost again, did you?\"", "\n\n\"I did not,\" Johnnie denied hotly. \"", "I knew where I was all the time.\"", "\n\n\"Where were you?\" ", "Hank wanted to know. \"", "Where have you been?\"", "\n\nJohnnie took a deep breath. \"", "I've been everywhere. ", "To the Bronx zoo and the Aquarium and Grant's Tomb, that isn't much; and a conducted tour of Radio City and rowing on the lake in Central Park; and Park Avenue, that's nothing but apartments, and Harlem—\" He stopped for another breath.", "\n\n\"Alone?\" ", "Bill's face was unbelieving.", "\n\nIt would be nice to say, \"Yes, alone,\" and get Bill over the idea that he, Johnnie, was a hick. ", "But that wouldn't be fair to Trudy. ", "He shook his head. \"", "No, not alone.\"", "\n\n\"Who went with you?\"", "\n\n\"A girl.\"", "\n\nBill and Hank gave him the wolf gleam. \"", "Where is she?\"", "\n\nHe said happily, \"She left for Mexico. ", "So sorry, chums.\"", "\n\nIt was all going well. ", "But disappointment couldn't silence these lugs long enough. ", "Bill was too smart. ", "Bill asked carefully now, \"Where were you last night?\"", "\n\nJohnnie said with vagueness, \"I went for a ride on the subway.\" ", "He wouldn't ever tell them about last night. ", "They would never trust him out of their sight again. ", "They would think he was crazy. ", "They wouldn't understand it had all been strictly accidental.", "\n\n\"In the subway,\" said Bill. \"", "And then?\"", "\n\nJohnnie talked fast. \"", "I had some champagne, real champagne.\" ", "He'd better get these guys started before they got too nosey. ", "The money he hadn't touched was burning a hole in his sock. \"", "I'll tell you what, let's go buy a bottle of champagne right now. ", "My treat.\" ", "He grabbed an arm on either side of him. \"", "And then let's go to the Stage Door Canteen. ", "Maybe we'll see Sonja Henie.\"", "\n\nHe didn't want to waste tonight too. ", "When a guy had a weekend pass, he expected a little fun.", "\nAll rights reserved under International and Pan-American Copyright Conventions. ", "By payment of the required fees, you have been granted the non-exclusive, non-transferable right to access and read the text of this ebook onscreen. ", "No part of this text may be reproduced, transmitted, downloaded, decompiled, reverse engineered, or stored in or introduced into any information storage and retrieval system, in any form or by any means, whether electronic or mechanical, now known or hereinafter invented, without the express written permission of the publisher.", "\n\nThis is a work of fiction. ", "Names, characters, places, and incidents either are the product of the author's imagination or are used fictitiously. ", "Any resemblance to actual persons, living or dead, businesses, companies, events, or locales is entirely coincidental.", "\n\nCopyright © 1944 by Dorothy B. Hughes\n\nCover design by Erin Fitzsimmons\n\n978-1-4804-2697-9\n\nThis 2013 edition distributed by MysteriousPress.com/Open Road Integrated Media\n\n345 Hudson Street\n\nNew York, NY 10014\n\nwww.mysteriouspress.com\n\nwww.openroadmedia.com\n\n# EBOOKS BY \nDOROTHY B. HUGHES\n\n**FROM MYSTERIOUSPRESS.COM**\n\n**FROM OPEN ROAD MEDIA**\n\nAvailable wherever ebooks are sold\n\nOtto Penzler, owner of the Mysterious Bookshop in Manhattan, founded the Mysterious Press in 1975. ", "Penzler quickly became known for his outstanding selection of mystery, crime, and suspense books, both from his imprint and in his store. ", "The imprint was devoted to printing the best books in these genres, using fine paper and top dust-jacket artists, as well as offering many limited, signed editions.", "\n\nNow the Mysterious Press has gone digital, publishing ebooks through MysteriousPress.com.", "\n\nMysteriousPress.com offers readers essential noir and suspense fiction, hard-boiled crime novels, and the latest thrillers from both debut authors and mystery masters. ", "Discover classics and new voices, all from one legendary source.", "\n\nFIND OUT MORE AT\n\nWWW.MYSTERIOUSPRESS.COM\n\nFOLLOW US:\n\n**@emysteries** **and** **Facebook.com/MysteriousPressCom**\n\nMysteriousPress.com is one of a select group of publishing partners of Open Road Integrated Media, Inc.\n\n**Open Road Integrated Media** is a digital publisher and multimedia content company. ", "Open Road creates connections between authors and their audiences by marketing its ebooks through a new proprietary online platform, which uses premium video content and social media.", "\n\n**Videos, Archival Documents, and New Releases**\n\nSign up for the Open Road Media newsletter and get news delivered straight to your inbox.", "\n\nSign up now at\n\nwww.openroadmedia.com/newsletters\n\n**FIND OUT MORE AT**\n\n**WWW.OPENROADMEDIA.COM**\n\n**FOLLOW US:**\n\n**@openroadmedia and**\n\n**Facebook.com/OpenRoadMedia**\n" ]

{ "pile_set_name": "Books3" }

[ 0.0007328485953621566, 0.0008857432403601706, 0.00117425003554672, 0.0009111123508773744, 0.00117425003554672, 0.0010069404961541295, 0.00117425003554672, 0.000949640991166234, 0.00117425003554672, 0.0009349029278382659, 0.00117425003554672, 0.0009671702864579856, 0.0007665404118597507, 0.0006796268280595541, 0.0007408246747218072, 0.0009935257257893682, 0.0007149400771595538, 0.0008806830155663192, 0.0010516684269532561, 0.0012138450983911753, 0.008451159112155437, 0.0009137043380178511, 0.0010288330959156156, 0.08299603313207626, 0.06830993294715881, 0.001275555812753737, 0.11895997077226639, 0.0560111366212368, 0.0037941765040159225, 0.0009017032571136951, 0.0007940229843370616, 0.0008059983956627548, 0.004302867688238621, 0.6841385960578918, 0.018208542838692665, 0.0028561223298311234, 0.005355375353246927, 0.000790335820056498, 0.0014139027334749699, 0.0014793024165555835, 0.0007090430590324104, 0.0020423943642526865, 0.007735489867627621, 0.012734961695969105, 0.011378040537238121, 0.00220117368735373, 0.0017408295534551144, 0.001867396174930036, 0.0018567214719951153, 0.0018568991217762232, 0.005095022730529308, 0.0006557138403877616, 0.0014694822020828724, 0.003965843468904495, 0.0008701493497937918, 0.0008198308642022312, 0.015056927688419819, 0.0008173068636097014, 0.0007217312813736498, 0.0007692427607253194, 0.0009373489883728325, 0.004364605061709881, 0.0006093380507081747, 0.07984089106321335, 0.001173135475255549, 0.0006814567605033517, 0.00646044360473752, 0.0005539152771234512, 0.0010846086079254746, 0.0015331344911828637, 0.0006681946106255054, 0.001387225929647684, 0.0006232121959328651, 0.0020186209585517645, 0.0022346365731209517, 0.002079753903672099, 0.002086172578856349, 0.0007223808206617832, 0.18706730008125305, 0.0006226745899766684, 0.003167565446346998, 0.01486047264188528, 0.026763102039694786, 0.11157333105802536, 0.052061598747968674, 0.0008200797601602972, 0.0009228446870110929, 0.01415298506617546, 0.00411579804494977, 0.0011551551287993789, 0.0016479399055242538, 0.0010999322403222322, 0.0029385024681687355, 0.012891503050923347, 0.0006777449161745608, 0.0007952080341055989, 0.0006100560422055423, 0.007951391860842705, 0.0011744715739041567, 0.0007143645780161023, 0.0017878779908642173, 0.003313562599942088, 0.011951055377721786, 0.0027478362899273634, 0.0011003644904121757, 0.012143663130700588, 0.01051067654043436, 0.0009297396172769368, 0.0035529632586985826, 0.0006789761828258634, 0.0006110633257776499, 0.0013495885068550706, 0.007121837232261896, 0.0014156238175928593, 0.005687543656677008, 0.0007563967374153435, 0.0008340135682374239, 0.002518904395401478, 0.004344515968114138, 0.0007787662325426936, 0.0009141506161540747, 0.0006207750993780792, 0.0007115073385648429, 0.0008295643492601812, 0.0006910816882736981, 0.0033049718476831913, 0.0014293886488303542, 0.0013848966918885708, 0.00124238186981529, 0.0010871223639696836, 0.0010164598934352398, 0.0007724995375610888, 0.0010867748642340302, 0.020574375987052917, 0.005910096690058708, 0.0008433226612396538, 0.0008296690066345036, 0.0007944998797029257, 0.15532459318637848, 0.003377714892849326, 0.43984612822532654, 0.005042719654738903, 0.003368340665474534, 0.0015029242495074868, 0.0023956478107720613, 0.0025111157447099686, 0.0007987911812961102, 0.0008541620336472988, 0.0033143656328320503, 0.0049224309623241425, 0.00922247115522623, 0.148918017745018, 0.0005979528650641441, 0.0013791194651275873, 0.0009619440534152091, 0.0065090227872133255, 0.002535546664148569, 0.006523389369249344, 0.0009155379375442863, 0.0008662330801598728, 0.031436748802661896, 0.0013209915487095714, 0.0010976775083690882, 0.000623191415797919, 0.0006969429668970406, 0.0005822964012622833, 0.0006619488121941686, 0.004953252151608467, 0.0008824062533676624, 0.0031818407587707043, 0.07676266133785248, 0.06455578655004501, 0.001298973336815834, 0.0009406395838595927, 0.0013434322318062186, 0.0007961948285810649, 0.002246703254058957, 0.17664968967437744, 0.0008650894742459059, 0.0013061210047453642, 0.01826024428009987, 0.013478993438184261, 0.001016780617646873, 0.15800176560878754, 0.0006474574911408126, 0.0011553927324712276, 0.0024328664876520634, 0.0012264648685231805, 0.00196422659792006, 0.0018557044677436352, 0.000745499215554446, 0.0007500808569602668, 0.00405676057562232, 0.007035893853753805, 0.000730405212379992, 0.0005461249384097755, 0.01237381063401699, 0.002015886129811406, 0.0006134146242402494, 0.0010350790107622743, 0.0013456688029691577, 0.0005965812597423792, 0.003085196716710925, 0.015690108761191368, 0.0016660643741488457, 0.0007499750936403871, 0.0006757488590665162, 0.0015131221152842045, 0.0010385577334091067, 0.0011225518537685275, 0.0008033836493268609, 0.0010048260446637869, 0.0008059196406975389, 0.0011657924624159932, 0.0007957022753544152, 0.0009464947506785393, 0.0007794307311996818, 0.0011262026382610202, 0.5458988547325134, 0.001574796624481678, 0.0006975136930122972, 0.00147629517596215, 0.1602351814508438, 0.0006456055562011898, 0.0010801665484905243, 0.0007046150858514011, 0.001102410489693284, 0.001125980052165687, 0.0006358756800182164, 0.6795521974563599, 0.0014352533034980297, 0.0009380815899930894, 0.03482075408101082, 0.03145790845155716, 0.0009846433531492949, 0.2140030562877655, 0.005436758045107126, 0.0007024401566013694, 0.0016893792198970914, 0.00558421341702342, 0.13990062475204468, 0.022138668224215508, 0.4165075123310089, 0.0021424456499516964, 0.0007525316323153675, 0.001128127332776785, 0.0031655156053602695, 0.1590738147497177, 0.007864843122661114, 0.0018913329113274813, 0.048926014453172684, 0.0006915866397321224, 0.041822489351034164, 0.0012534793931990862, 0.0009470955119468272, 0.34157782793045044, 0.0008587671909481287, 0.008481725119054317, 0.000722460332326591, 0.003096706932410598, 0.0009128398378379643, 0.007191502954810858, 0.05708315968513489, 0.9637683629989624, 0.0060666268691420555, 0.2871900796890259, 0.0007933585438877344, 0.001995930913835764, 0.019917285069823265, 0.0007599251111969352, 0.34371450543403625, 0.0010471311397850513, 0.0006735835340805352, 0.0023139214608818293, 0.0009398427209816873, 0.0008963882573880255, 0.0013481753412634134, 0.5553814172744751, 0.02726409211754799, 0.001778817386366427, 0.0007064189994707704, 0.0014259937452152371, 0.001493811490945518, 0.010802075266838074, 0.0007375589339062572, 0.0006286778952926397, 0.4596758484840393, 0.000820326735265553, 0.01870008185505867, 0.0011116056703031063, 0.0019071064889431, 0.04135594516992569, 0.0006967663066461682, 0.0009763215784914792, 0.0012102305190637708, 0.001078460249118507, 0.009637920185923576, 0.0012340665562078357, 0.0009688395075500011, 0.000800239504314959, 0.04033859819173813, 0.0008116021635942161, 0.0016172450268641114, 0.0018259091302752495, 0.0008565659518353641, 0.0007395655266009271, 0.01667347364127636, 0.3819078803062439, 0.0030127987265586853, 0.001526715699583292, 0.00139261141885072, 0.004413359798491001, 0.000644112762529403, 0.3892495334148407, 0.005848041735589504, 0.002039549872279167, 0.18456093966960907, 0.026951409876346588, 0.04431662708520889, 0.08164037019014359, 0.6162386536598206, 0.0010626039002090693, 0.0005716931773349643, 0.0018450982170179486, 0.0011381410295143723, 0.01301138661801815, 0.0028511090204119682, 0.0222826786339283, 0.0012207889230921865, 0.0019487026147544384, 0.0032939498778432608, 0.001104080001823604, 0.0016207557637244463, 0.0043372041545808315, 0.0008716920856386423, 0.008263715542852879, 0.0010435843141749501, 0.0008249461534433067, 0.01189970038831234, 0.006568495184183121, 0.0009277424542233348, 0.18327566981315613, 0.0007362635806202888, 0.0008406397537328303, 0.000785217562224716, 0.0015246020630002022, 0.0013604285195469856, 0.002302192384377122, 0.0011213126126676798, 0.001449668314307928, 0.0007830476970411837, 0.0008739979239180684, 0.0007338966242969036, 0.0007961830706335604, 0.0007522899541072547, 0.0007995706982910633, 0.004052578471601009, 0.001209063222631812, 0.0065226261503994465, 0.00074604811379686, 0.0008454447379335761, 0.0008476630900986493, 0.5222178101539612, 0.0015606284141540527, 0.0025646027643233538, 0.000700507836882025, 0.014921157620847225, 0.0006117384182289243, 0.000995907699689269, 0.0007317885174416006, 0.0015779434470459819, 0.011505127884447575, 0.0034722215496003628, 0.0009192273719236255, 0.0008020461536943913, 0.001163458451628685, 0.01879592053592205, 0.000688742904458195, 0.0008668795926496387, 0.1415417492389679, 0.40513473749160767, 0.3709578812122345, 0.0019399186130613089, 0.781033456325531, 0.0020949975587427616, 0.004797957371920347, 0.005217345431447029, 0.0016751334769651294, 0.0005954527878202498, 0.0007565575651824474, 0.0006161189521662891, 0.0022805507760494947, 0.24272269010543823, 0.13702788949012756, 0.000898623198736459, 0.0007837180164642632, 0.001775825279764831, 0.03962377458810806, 0.011672439984977245, 0.008095154538750648, 0.0013560490915551782, 0.027656693011522293, 0.704894483089447, 0.028491832315921783, 0.0016611432656645775, 0.0040252795442938805, 0.002633729949593544, 0.006729309447109699, 0.0011387976119294763, 0.3618367612361908, 0.0007981235394254327, 0.0010430187685415149, 0.0036509286146610975, 0.021459758281707764, 0.28893259167671204, 0.21176031231880188, 0.0005794750177301466, 0.005815146956592798, 0.0007307794294320047, 0.004762295633554459, 0.007640217896550894, 0.0007339759031310678, 0.0013026754604652524, 0.0009693916072137654, 0.027433188632130623, 0.01722322590649128, 0.0007258200785145164, 0.0009477237472310662, 0.006452444940805435, 0.0006422222941182554, 0.014701602049171925, 0.0009510774398222566, 0.004099670331925154, 0.0005620870506390929, 0.0030491072684526443, 0.0007858688477426767, 0.0021908350754529238, 0.00069305335637182, 0.0007954884204082191, 0.0016354628605768085, 0.0006722701946273446, 0.004491779953241348, 0.0009278802899643779, 0.0006709046429023147, 0.0024613847490400076, 0.0006486013298854232, 0.0007592783076688647, 0.001904406351968646, 0.026127424091100693, 0.03645789623260498, 0.0005929498584009707, 0.03632277995347977, 0.000628482666797936, 0.0012642544461414218, 0.0007094696047715843, 0.0006951810792088509, 0.000720781332347542, 0.0017722625052556396, 0.0005634865374304354, 0.0007861006888560951, 0.0006256081396713853, 0.0007516465266235173, 0.0037288120947778225, 0.000584693974815309, 0.0006294127088040113, 0.0018978329608216882, 0.0015281811356544495, 0.014059125445783138, 0.0005955520318821073, 0.0018973778933286667, 0.000740791845601052, 0.001536909956485033, 0.0008940182160586119, 0.0005607823841273785, 0.0010555454064160585, 0.12574748694896698, 0.0018913551466539502, 0.0008585683535784483, 0.017994053661823273, 0.4840613603591919, 0.0010807937942445278, 0.000777397130150348, 0.011473430320620537, 0.0011714486172422767, 0.0009599737240932882, 0.0009143200004473329, 0.014278705231845379, 0.0007926833932287991, 0.16156864166259766, 0.0008328512776643038, 0.004227303899824619, 0.0015600193291902542, 0.0008918317616917193, 0.0012038276763632894, 0.0006139216711744666, 0.0008437659707851708, 0.0007486141403205693, 0.0006200569914653897, 0.007808618247509003, 0.0017467420548200607, 0.04321856424212456, 0.00073499750578776, 0.000666778942104429, 0.05193880572915077, 0.0014141586143523455, 0.0006736959330737591, 0.0013433158164843917, 0.0009188066469505429, 0.008138350211083889, 0.0009009143686853349, 0.043673377484083176, 0.0020681126043200493, 0.001545349252410233, 0.0007948379497975111, 0.002075818832963705, 0.001495617558248341, 0.0007599930977448821, 0.0219119880348444, 0.0034218484070152044, 0.0015858057886362076, 0.020038366317749023, 0.0017995316302403808, 0.06451775878667831, 0.0008633264224044979, 0.0868411734700203, 0.16370132565498352, 0.0013432134874165058, 0.008193669840693474, 0.0007948493002913892, 0.000649178575258702, 0.002494080923497677, 0.150163933634758, 0.0025394363328814507, 0.0014532178174704313, 0.0009214477031491697, 0.001731785130687058, 0.0007172764744609594, 0.005615013185888529, 0.004155938047915697, 0.0007028616964817047, 0.003031216561794281, 0.0006566765950992703, 0.0052969809621572495, 0.002197525929659605, 0.0025578532367944717, 0.061718568205833435, 0.0007782416651025414, 0.0010267416946589947, 0.0007956544868648052, 0.013188744895160198, 0.002341714920476079, 0.0006729778833687305, 0.005530588794499636, 0.0008043625857681036, 0.0007429569377563894, 0.0011890120804309845, 0.0024829604662954807, 0.0010183510603383183, 0.000875856087077409, 0.02930128388106823, 0.0006054521654732525, 0.005429198499768972, 0.00061885203467682, 0.0007031604764051735, 0.0009986463701352477, 0.0010220493422821164, 0.013367355801165104, 0.03365510329604149, 0.0008102923748083413, 0.08922627568244934, 0.0007994155748747289, 0.18213719129562378, 0.0009576615993864834, 0.0014406231930479407, 0.01228075660765171, 0.12838420271873474, 0.0009608095861040056, 0.000671780260745436, 0.02964443527162075, 0.00785150472074747, 0.0007146147545427084, 0.0007123862160369754, 0.022153927013278008, 0.0006127444212324917, 0.0009687601123005152, 0.0323604941368103, 0.0017254698323085904, 0.010329210199415684, 0.0021268303971737623, 0.0016304136952385306, 0.003998813685029745, 0.0017576180398464203, 0.001759253558702767, 0.006542691495269537, 0.03914407640695572, 0.0011598808923736215, 0.019157549366354942, 0.011335242539644241, 0.007581162266433239, 0.0029277116991579533, 0.0009042390738613904, 0.0013667073799297214, 0.9841304421424866, 0.0010300958529114723, 0.0013309301575645804, 0.005968269892036915, 0.004043221939355135, 0.001460880390368402, 0.0006102665211074054, 0.02907640114426613, 0.0009792288765311241, 0.0010815452551469207, 0.013850890100002289, 0.0012573765125125647, 0.1056949570775032, 0.0007073328597471118, 0.014955708757042885, 0.002321109874173999, 0.0019374035764485598, 0.0008461031829938293, 0.016174187883734703, 0.021980978548526764, 0.012798336334526539, 0.01734992489218712, 0.04919317737221718, 0.0018501414451748133, 0.0022064174991101027, 0.0013705466408282518, 0.0006469646468758583, 0.0008759959018789232, 0.000967044907156378, 0.001121334033086896, 0.0016985281836241484, 0.00521208206191659, 0.19714170694351196, 0.03203285485506058, 0.0006068089278414845, 0.0014183672610670328, 0.0026298947632312775, 0.000681556120980531, 0.0074432771652936935, 0.0006785783916711807, 0.001974815269932151, 0.004729493521153927, 0.0008072609198279679, 0.0009390294435434043, 0.017240911722183228, 0.0010556249180808663, 0.000755548884626478, 0.1643386036157608, 0.0007761454326100647, 0.0006243596435524523, 0.0009076461428776383, 0.0012514579575508833, 0.002919053891673684, 0.0007112856255844235, 0.00581569317728281, 0.0007425298099406064, 0.008885234594345093, 0.4030129313468933, 0.05986563116312027, 0.0008322512148879468, 0.05518525838851929, 0.0006972316186875105, 0.0008330445270985365, 0.0006981990882195532, 0.0007442317437380552, 0.0007579824305139482, 0.0015363817801699042, 0.046383656561374664, 0.003990526776760817, 0.0017024388071149588, 0.012066039256751537, 0.08359074592590332, 0.0018380859401077032, 0.000903428765013814, 0.0007660178816877306, 0.000984188518486917, 0.009382936172187328, 0.0029274052940309048, 0.0007531127193942666, 0.006517959292978048, 0.0013501214561983943, 0.24960502982139587, 0.24199049174785614, 0.0011188137577846646, 0.004036758095026016, 0.10014722496271133, 0.0007268323097378016, 0.010563737712800503, 0.006906963884830475, 0.0009708025609143078, 0.0021881151478737593, 0.004524475894868374, 0.005861236248165369, 0.021839341148734093, 0.0008460467797704041, 0.0013534589670598507, 0.018430165946483612, 0.07280084490776062, 0.7088822722434998, 0.004439154174178839, 0.014495164155960083, 0.0008957739919424057, 0.0012314034393057227, 0.0039023070130497217, 0.0006260972004383802, 0.004886991810053587, 0.0008265698561444879, 0.07546192407608032, 0.0008408516878262162, 0.0008043062407523394, 0.013694480992853642, 0.0007908089319244027, 0.0029591205529868603, 0.0011537617538124323, 0.000752314692363143, 0.0007399807800538838, 0.001827996107749641, 0.0005802219384349883, 0.0006685242406092584, 0.0007368226652033627, 0.0023259525187313557, 0.003036034759134054, 0.38147181272506714, 0.0029401052743196487, 0.004794420208781958, 0.00515002990141511, 0.0033468748442828655, 0.0008460467797704041, 0.8999053239822388, 0.002731368178501725, 0.0009236306650564075, 0.0015713336179032922, 0.020767711102962494, 0.5958709716796875, 0.009542695246636868, 0.002147322054952383, 0.0013343398459255695, 0.0007680173730477691, 0.2430621087551117, 0.0006441462319344282, 0.0007990261074155569, 0.04554875195026398, 0.02204933576285839, 0.01849844492971897, 0.33988654613494873, 0.0009192510042339563, 0.0014201643643900752, 0.0006965319626033306, 0.0012175795855000615, 0.007158811669796705, 0.006702364422380924, 0.0009140788461081684, 0.0006739483214914799, 0.0038491073064506054, 0.0006495248526334763, 0.0006488183280453086, 0.0009407597244717181, 0.002346075838431716, 0.0008613305981270969, 0.0008199464646168053, 0.04219682514667511, 0.009353441186249256, 0.0007133978069759905, 0.0012453325325623155, 0.001532984897494316, 0.011139779351651669, 0.0008961661369539797, 0.032031070441007614, 0.0009556887089274824, 0.0021870213095098734, 0.017650224268436432, 0.0010683011496439576, 0.023439932614564896, 0.014095497317612171, 0.0009432646911591291, 0.0007126849959604442, 0.0007502975058741868, 0.001345645054243505, 0.21422812342643738, 0.000736954330932349, 0.0008980436250567436, 0.0010826947400346398, 0.0013776682317256927, 0.003417730564251542, 0.017108667641878128, 0.000795608211774379, 0.001228036475367844, 0.04101822152733803, 0.009488258510828018, 0.0008341497741639614, 0.0013297157129272819, 0.002230137586593628, 0.0006518895388580859, 0.0008110300987027586, 0.012445497326552868, 0.0008264320204034448, 0.04966467618942261, 0.0027368285227566957, 0.0020062814000993967, 0.0008656906429678202, 0.001258974545635283, 0.0030877143144607544, 0.1556219905614853, 0.021191684529185295, 0.000845565227791667, 0.001505050458945334, 0.0022540574427694082, 0.0007537046913057566, 0.002346085850149393, 0.001603726646862924, 0.008387300185859203, 0.0009560224134474993, 0.026623902842402458, 0.0013442084891721606, 0.0012350643519312143, 0.003726644441485405, 0.05030117183923721, 0.0006749799940735102, 0.0007978741778060794, 0.0023898533545434475, 0.20470023155212402, 0.0012666875263676047, 0.2222813367843628, 0.0006950615206733346, 0.0029588364996016026, 0.0007112401654012501, 0.013909782283008099, 0.09446520358324051, 0.0017235925188288093, 0.0009194507729262114, 0.0007999554509297013, 0.014778289012610912, 0.0008175474940799177, 0.003369661746546626, 0.0007400318863801658, 0.0011057567317038774, 0.009498050436377525, 0.6190029978752136, 0.004563186317682266, 0.005689223762601614, 0.3819611966609955, 0.004839416593313217, 0.013814905658364296, 0.0008855652413330972, 0.0015002277214080095, 0.0007006159285083413, 0.0008027423173189163, 0.0014325781958177686, 0.002304133027791977, 0.003684478346258402, 0.0015106593491509557, 0.0006976852891966701, 0.0011036773212254047, 0.0006478753639385104, 0.00404650904238224, 0.001396563253365457, 0.0006775376386940479, 0.007754132151603699, 0.004528756253421307, 0.01697702519595623, 0.0005552830407395959, 0.18139827251434326, 0.0008266064687632024, 0.0010527495760470629, 0.0006476185517385602, 0.0006972887786105275, 0.0011478235246613622, 0.0019781477749347687, 0.005391589365899563, 0.0006362005951814353, 0.016760915517807007, 0.0016904507065191865, 0.0006697323988191783, 0.0018032349180430174, 0.0010020813206210732, 0.0024170647375285625, 0.0006037047714926302, 0.013410375453531742, 0.00115496467333287, 0.0006496610585600138, 0.0008283233037218451, 0.002376530086621642, 0.20993570983409882, 0.03705362603068352, 0.0017478199442848563, 0.0033884060103446245, 0.02601887285709381, 0.0008607497438788414, 0.01173117570579052, 0.07446036487817764, 0.0007305555627681315, 0.0010299241403117776, 0.0059176599606871605, 0.0006626661634072661, 0.001356096239760518, 0.0008149585337378085, 0.3990127146244049, 0.0007822533953003585, 0.0007074005552567542, 0.0015182305360212922, 0.016245979815721512, 0.006192734465003014, 0.0007908691768534482, 0.002148885978385806, 0.0006613809382542968, 0.0007317979470826685, 0.0007106672856025398, 0.011781750246882439, 0.0014755704905837774, 0.004218415357172489, 0.021292835474014282, 0.21964973211288452, 0.012000643648207188, 0.0038520796224474907, 0.002097723539918661, 0.0007248395122587681, 0.0005946031888015568, 0.0005629145307466388, 0.11212294548749924, 0.0011364585952833295, 0.007879478856921196, 0.005379595328122377, 0.0006684302934445441, 0.001170461531728506, 0.0007218086393550038, 0.0006306598661467433, 0.0022741733118891716, 0.0028613610193133354, 0.0020960853435099125, 0.014196762815117836, 0.0007510232389904559, 0.0006547868251800537, 0.00135858915746212, 0.0012758292723447084, 0.0007780174491927028, 0.38102173805236816, 0.0009003716404549778, 0.001799175632186234, 0.0007091329316608608, 0.001716461032629013, 0.01145419292151928, 0.0007062460645101964, 0.02169317938387394, 0.2939961850643158, 0.0794425904750824, 0.0023583960719406605, 0.0013164260890334845, 0.000817084510345012, 0.0015784334391355515, 0.000675556599162519, 0.0007212100899778306, 0.02501806430518627, 0.0009662781376391649, 0.0007270949427038431, 0.0006051547825336456, 0.002767974743619561, 0.8186252117156982, 0.0007191795739345253, 0.0006158333271741867, 0.0007732308586128056, 0.23434096574783325, 0.019940366968512535, 0.0011094840010628104, 0.00069003168027848, 0.0013655018992722034, 0.0027400723192840815, 0.0007057111943140626, 0.0031024888157844543, 0.0012721585808321834, 0.0007205996662378311, 0.0006324324640445411, 0.002882579807192087, 0.003953917883336544, 0.20892487466335297, 0.008557727560400963, 0.0011312615824863315, 0.9402431845664978, 0.0009537766454741359, 0.0017498726956546307, 0.0008345131645910442, 0.0007776615675538778, 0.09820466488599777, 0.08850173652172089, 0.0006728297448717058, 0.000623150379396975, 0.0006243944517336786, 0.8060826063156128, 0.012314071878790855, 0.0035824652295559645, 0.009608803316950798, 0.0008002932881936431, 0.005822837818413973, 0.016860874369740486, 0.8643348813056946, 0.0015526836505159736, 0.0009896042756736279, 0.0008069209870882332, 0.0010764069156721234, 0.0011865794658660889, 0.10863372683525085, 0.0008158544078469276, 0.0009511009557172656, 0.003962616436183453, 0.0009137901943176985, 0.0012972159311175346, 0.0007834977586753666, 0.06449304521083832, 0.00081386708188802, 0.0007176600047387183, 0.003369682701304555, 0.0007747052586637437, 0.003171182470396161, 0.004489957354962826, 0.012135319411754608, 0.0007801054161973298, 0.0007004991639405489, 0.0049146502278745174, 0.0006920560845173895, 0.026908863335847855, 0.0011293563293293118, 0.008951620198786259, 0.000881386105902493, 0.0009633894660510123, 0.0008526722667738795, 0.02100641466677189, 0.0024535974953323603, 0.001152018434368074, 0.0013069615233689547, 0.0010751334484666586, 0.0015363114653155208, 0.6121440529823303, 0.0032270224764943123, 0.0015979321906343102, 0.06656185537576675, 0.0047964914701879025, 0.0007360444287769496, 0.0006449930369853973, 0.0008243634947575629, 0.007424080744385719, 0.0015836390666663647, 0.001719447667710483, 0.0064797913655638695, 0.0024127960205078125, 0.008739524520933628, 0.0021206752862781286, 0.002348371548578143, 0.0010427674278616905, 0.0012485214974731207, 0.0350131019949913, 0.008391432464122772, 0.016872212290763855, 0.0025090696290135384, 0.029759487137198448, 0.002535546664148569, 0.0010362382745370269, 0.24050763249397278, 0.0009539260063320398, 0.0010483409278094769, 0.03589504957199097, 0.0008236682624556124, 0.0027494230307638645, 0.0008876036154106259, 0.03472953662276268, 0.0023059509694576263, 0.0005823555402457714, 0.013682841323316097, 0.0007662566495127976, 0.11336920410394669, 0.0009387929458171129, 0.0006570068071596324, 0.0007350010564550757, 0.001439696759916842, 0.0007989457808434963, 0.0006183918449096382, 0.0006264834082685411, 0.0006753557827323675, 0.0008913186611607671, 0.001025799079798162, 0.0009280205122195184, 0.9535808563232422, 0.0007032167632132769, 0.016545549035072327, 0.0009889478096738458, 0.005640816874802113, 0.0007369217346422374, 0.10273142158985138, 0.49715518951416016, 0.03909829631447792, 0.0015029488131403923, 0.006515380926430225, 0.0029223295859992504, 0.006201047915965319, 0.005397781264036894, 0.014417980797588825, 0.009177479892969131, 0.0028204729314893484, 0.0018043554155156016, 0.0006688085268251598, 0.0008405324770137668, 0.0006503003532998264, 0.000942101061809808, 0.0005860485835000873, 0.00150722183752805, 0.0007784668123349547, 0.03783819079399109, 0.33518606424331665, 0.0007604684215039015, 0.0039852578192949295, 0.000981036340817809, 0.0011449280427768826, 0.0013816916616633534, 0.0018782403785735369, 0.013613495044410229, 0.0007662030402570963, 0.02253066562116146, 0.0010441690683364868, 0.0009031855151988566, 0.0006281721289269626, 0.0058052255772054195, 0.003390856087207794, 0.02216116338968277, 0.0010364712215960026, 0.0013723111478611827, 0.0007645662408322096, 0.0046898238360881805, 0.010240658186376095, 0.11278600245714188, 0.0007162463152781129, 0.0008864292758516967, 0.0029147283639758825, 0.0007907139952294528, 0.0009106095531024039, 0.023273292928934097, 0.002079735044389963, 0.002189485589042306, 0.3867643177509308, 0.0006856079562567174, 0.002685505198314786, 0.0011800240026786923, 0.0007556558703072369, 0.0013247283641248941, 0.001411565812304616, 0.0007341382442973554, 0.0008090540650300682, 0.0007131660240702331, 0.0007303209858946502, 0.0011361278593540192, 0.0008149908389896154, 0.001295736525207758, 0.0006615290767513216, 0.00347932823933661, 0.0006528623052872717, 0.0008456759969703853, 0.7259536385536194, 0.0011413857573643327, 0.029575789347290993, 0.00949154794216156, 0.013998018577694893, 0.0007869119290262461, 0.03388422727584839, 0.0012396802194416523, 0.0008631044183857739, 0.08139989525079727, 0.006098097190260887, 0.0006575039005838335, 0.0017637257697060704, 0.0012846378376707435, 0.0005555532989092171, 0.0008580960566177964, 0.0010789009975269437, 0.1953917294740677, 0.0022155451588332653, 0.0025976940523833036, 0.0009075488778762519, 0.07126766443252563, 0.9870408177375793, 0.0009699695510789752, 0.03645726665854454, 0.0008539980044588447, 0.0012990371324121952, 0.00057451450265944, 0.017592888325452805, 0.0008253522682935, 0.007870854809880257, 0.0018091559177264571, 0.024765001609921455, 0.000898882222827524, 0.047095976769924164, 0.05083547905087471, 0.0017083771526813507, 0.3008508086204529, 0.06658985465765, 0.009234617464244366, 0.0011376315960660577, 0.0006379550322890282, 0.0008539431146346033, 0.0006134037976153195, 0.04835890978574753, 0.0007963648531585932, 0.0010918410262092948, 0.0026164499577134848, 0.0009917524876073003, 0.0012214519083499908, 0.0009501350577920675, 0.0018912075320258737, 0.0014364004600793123, 0.0008735682931728661, 0.000671020126901567, 0.0006294088088907301, 0.0013421624898910522, 0.0006856442196294665, 0.0010635295184329152, 0.0008065765723586082, 0.0008310901466757059, 0.002515470841899514, 0.0008297513122670352, 0.019360750913619995, 0.009337231516838074, 0.00867153238505125, 0.0006020145956426859, 0.0011110203340649605, 0.0009929342195391655, 0.009439174085855484, 0.0007848054519854486, 0.0007999257650226355, 0.0008764718077145517, 0.0064139598980546, 0.0010986573761329055, 0.001704922877252102, 0.0008786316029727459, 0.003668018849566579, 0.00160772236995399, 0.0013252028729766607, 0.0006278968648985028, 0.006481080781668425, 0.022474054247140884, 0.0009857133263722062, 0.000536750943865627, 0.0008392471936531365, 0.001048669102601707, 0.0006437666015699506, 0.0007665776065550745, 0.004668651148676872, 0.0007600394892506301, 0.1586933732032776, 0.0019210678292438388, 0.0005677554872818291, 0.000809381774161011, 0.000990567379631102, 0.0009856809629127383, 0.0006114746211096644, 0.0009520017774775624, 0.0006204258534125984, 0.0016129030846059322, 0.0019397138385102153, 0.0009670365834608674, 0.00845966674387455, 0.045724350959062576, 0.0032126293517649174, 0.0071214353665709496, 0.00110852369107306, 0.0006858713459223509, 0.0007274099043570459, 0.0025146380066871643, 0.0010811486281454563, 0.004981737583875656, 0.000978308031335473, 0.0015469135250896215, 0.0009093222906813025, 0.0009094579727388918, 0.0006481304299086332, 0.0010477763134986162, 0.0006437908159568906, 0.0020159194245934486, 0.04865150526165962, 0.001452820491977036, 0.001332679996266961, 0.0017174974782392383, 0.0008793234010227025, 0.0031105470843613148, 0.0006941672181710601, 0.0018172900890931487, 0.0007600819226354361, 0.008586414158344269, 0.000863781024236232, 0.0010163190308958292, 0.0007656756788492203, 0.0007862051716074347, 0.0008581107831560075, 0.001237922115251422, 0.012923453003168106, 0.27745500206947327, 0.0006887891795486212, 0.0011295219883322716, 0.0009559309110045433, 0.0010532030137255788, 0.0032490829471498728, 0.0006548110977746546, 0.0006422382430173457, 0.0012615318410098553, 0.0012595730368047953, 0.0012433313531801105, 0.003594555426388979, 0.019058702513575554, 0.004202582873404026, 0.0006095370044931769, 0.0010445909574627876, 0.0008264229982160032, 0.0006936318823136389, 0.0010567191056907177, 0.0012058555148541927, 0.0007722806185483932, 0.004272047895938158, 0.0005849202279932797, 0.035627610981464386, 0.016405610367655754, 0.002054499229416251, 0.0010518943890929222, 0.0015160426264628768, 0.0015984069323167205, 0.001264739315956831, 0.0008013021433725953, 0.0005867673899047077, 0.0008003939292393625, 0.0005950544727966189, 0.0010109595023095608, 0.003721598768606782, 0.024722516536712646, 0.0007509991992264986, 0.0006163010257296264, 0.003758892649784684, 0.001544916070997715, 0.010573122650384903, 0.0008986578905023634, 0.07448870688676834, 0.0075922696851193905, 0.0007724767201580107, 0.09719812870025635, 0.0531243197619915, 0.1472112238407135, 0.2602071762084961, 0.0007807465153746307, 0.0010601984104141593, 0.002778995083644986, 0.832827627658844, 0.036258161067962646, 0.000839906744658947, 0.0007492536678910255, 0.0011026248103007674, 0.0013697147369384766, 0.0017654862022027373, 0.002737739821895957, 0.0031422236934304237, 0.0011382175143808126, 0.0008923120331019163, 0.0009238281636498868, 0.02130868099629879, 0.001335129956714809, 0.0018413354409858584, 0.0008947448222897947, 0.0012567646335810423, 0.034054454416036606, 0.0010288007324561477, 0.0009780885884538293, 0.0020551474299281836, 0.0009702274692244828, 0.0067029292695224285, 0.01107554417103529, 0.0024293754249811172, 0.0008599353022873402, 0.00152469496242702, 0.0015885548200458288, 0.001481183571740985, 0.0021096868440508842, 0.0017834422178566456, 0.037383053451776505, 0.001981063513085246, 0.002882838947698474, 0.0012026969343423843, 0.0019441646290943027, 0.0007375160348601639, 0.0007583180558867753, 0.0010888931574299932, 0.0007725131581537426, 0.0009899046272039413, 0.0007703236769884825, 0.04141928628087044, 0.001613877946510911, 0.0020436388440430164, 0.02738674357533455, 0.004581223241984844, 0.002063950290903449, 0.0017918532248586416, 0.0010593876941129565, 0.001351601560600102, 0.026095157489180565, 0.07656010240316391, 0.00886474922299385, 0.0010265191085636616, 0.0029911589808762074, 0.0010199565440416336, 0.0009676863555796444, 0.0007209269679151475, 0.0021136044524610043, 0.0008957120589911938, 0.000974985770881176, 0.0010844293283298612, 0.0014647996285930276, 0.0008730245172046125, 0.001654854859225452, 0.0008027557050809264, 0.1207004114985466, 0.0006361560663208365, 0.010364547371864319, 0.0008195317350327969, 0.0011136905523017049, 0.001629076199606061, 0.0011774577433243394, 0.0009554392308928072, 0.0007005218649283051, 0.0014836997725069523, 0.0011248071677982807, 0.0014549028128385544, 0.01617022044956684, 0.0102513637393713, 0.0008921994012780488, 0.0012173871509730816, 0.002910146489739418, 0.0006004390888847411, 0.0012803850695490837, 0.0017441705567762256, 0.0008094719960354269, 0.0007997974171303213, 0.000636078417301178, 0.0015401410637423396, 0.002220280934125185, 0.006744740065187216, 0.10431332141160965, 0.0012888549827039242, 0.001032040803693235, 0.0006946585490368307, 0.0006690650479868054, 0.000618131656665355, 0.018242252990603447, 0.0008741773781366646, 0.0005431390018202364, 0.0006822199793532491, 0.0006838630069978535, 0.0008025347488000989, 0.000978027586825192, 0.0017221359303221107, 0.0011099000694230199, 0.00338188954629004, 0.008508141152560711, 0.0006264529656618834, 0.005759566556662321, 0.0007338545983657241, 0.0006515687564387918, 0.0006459219148382545, 0.0009404208976775408, 0.0009667709236964583, 0.0006801795097999275, 0.003963313065469265, 0.0014923689886927605, 0.0009572164271958172, 0.0007821072940714657, 0.03570271655917168, 0.0017151461215689778, 0.012112247757613659, 0.00467676343396306, 0.0009179766639135778, 0.004817994777113199, 0.0007342425524257123, 0.005177128594368696, 0.06690330803394318, 0.05305802449584007, 0.001477627083659172, 0.0008514008368365467, 0.0012606123927980661, 0.0007741673034615815, 0.2565041780471802, 0.0010270472848787904, 0.0010955348843708634, 0.004411570727825165, 0.0014121702406555414, 0.0012210308341309428, 0.004192348103970289, 0.0026230623479932547, 0.0006278836517594755, 0.0013672320637851954, 0.0019486071541905403, 0.0024678923655301332, 0.0010086812544614077, 0.0040430668741464615, 0.0027475710958242416, 0.0006858680280856788, 0.0007700113928876817, 0.0020665486808866262, 0.001163986511528492, 0.0010709897615015507, 0.0006750353495590389, 0.8596541285514832, 0.0006920052692294121, 0.031125003471970558, 0.003408882301300764, 0.06895939260721207, 0.0009004375897347927, 0.007202054373919964, 0.001197723438963294, 0.003494442207738757, 0.005365400109440088, 0.010996801778674126, 0.0016215197974815965, 0.02783389203250408, 0.16484583914279938, 0.005542783997952938, 0.04091477021574974, 0.0008799817296676338, 0.053754597902297974, 0.0036822594702243805, 0.000895581441000104, 0.0012574429856613278, 0.0007208548486232758, 0.0006916354177519679, 0.0024626520462334156, 0.0011313423747196794, 0.02937779203057289, 0.002183659467846155, 0.0007312370580621064, 0.0010403691558167338, 0.0029549666214734316, 0.0007055088062770665, 0.020397016778588295, 0.0006255994667299092, 0.012225309386849403, 0.0015882962616160512, 0.1684218943119049, 0.05779639258980751, 0.0021870213095098734, 0.001076199347153306, 0.003015617374330759, 0.0006882069283165038, 0.0018955266568809748, 0.0030768525321036577, 0.11839259415864944, 0.008983436971902847, 0.000663876358885318, 0.0038600268308073282, 0.0014963754219934344, 0.0011692250845953822, 0.0009456586558371782, 0.017313199117779732, 0.004712322726845741, 0.13967424631118774, 0.002610228257253766, 0.0007218815153464675, 0.8646515607833862, 0.6524525284767151, 0.826632022857666, 0.0008021837566047907, 0.0010329161304980516, 0.01465103030204773, 0.0008279469329863787, 0.0007752210949547589, 0.026410745456814766, 0.0008042192202992737, 0.0020385996904224157, 0.10796467959880829, 0.0010005630319938064, 0.042363449931144714, 0.000958197342697531, 0.026305921375751495, 0.0008986933971755207, 0.005491279065608978, 0.08299930393695831, 0.9552432298660278, 0.007914633490145206, 0.0008752129506319761, 0.0013126088306307793, 0.017389127984642982, 0.006621302105486393, 0.0010581632377579808, 0.0008930808980949223, 0.10995876044034958, 0.03021339327096939, 0.0011091066990047693, 0.0006682917010039091, 0.003108665579929948, 0.0009380109841004014, 0.0013362501049414277, 0.0014514661161229014, 0.0009848756017163396, 0.6216199398040771, 0.004082052037119865, 0.9802402853965759, 0.000876334379427135, 0.0007241949788294733, 0.0009849308989942074, 0.0009869838831946254, 0.0012566939694806933, 0.0008037055376917124, 0.0008595564286224544, 0.0013725522439926863, 0.012618637643754482, 0.12486868351697922, 0.0024832026101648808, 0.0007912758737802505, 0.0010677934624254704, 0.000741169264074415, 0.0007743723690509796, 0.0008084309520199895, 0.0037478161975741386, 0.0016017936868593097, 0.002163453958928585, 0.0008520716219209135, 0.0014787375694140792, 0.025840576738119125, 0.0007980706868693233, 0.0007073985761962831, 0.0006917672581039369, 0.013057013042271137, 0.0009619115153327584, 0.0007344076875597239, 0.41627317667007446, 0.001981079578399658, 0.007500936742872, 0.014648009091615677, 0.0006553902057930827, 0.0546448789536953, 0.0010972463060170412, 0.0009013660019263625, 0.0012504131300374866, 0.0006959089078009129, 0.0021115760318934917, 0.0011506840819492936, 0.001045883516781032, 0.014107405208051205, 0.0010162614053115249, 0.0010217441013082862, 0.0006675616023130715, 0.0019650692120194435, 0.0007522957748733461, 0.0008538369438610971, 0.00150195078458637, 0.0007893769652582705, 0.001154259778559208, 0.0007049378473311663, 0.0008754635928198695, 0.002597705228254199, 0.0037511256523430347, 0.19469979405403137, 0.0006521203904412687, 0.03628121316432953, 0.03786422312259674, 0.0018438085680827498, 0.0006766648730263114, 0.0008397639030590653, 0.0011979361297562718, 0.0010828586528077722, 0.28584596514701843, 0.0007397212903015316, 0.02445695549249649, 0.0006807895260863006, 0.4487750828266144, 0.009440341964364052, 0.19366727769374847, 0.0033948146738111973, 0.0011229336960241199, 0.0006746008293703198, 0.037148285657167435, 0.0007555211195722222, 0.08590374886989594, 0.0019320374121889472, 0.001615895889699459, 0.0015280203660950065, 0.002600792096927762, 0.0017297931481152773, 0.0017421277007088065, 0.0006573544233106077, 0.0007408775854855776, 0.020950578153133392, 0.7829957008361816, 0.0020297919400036335, 0.001272045192308724, 0.2539806365966797, 0.0011768663534894586, 0.0007064061937853694, 0.004389822483062744, 0.001433826400898397, 0.0008982131839729846, 0.08324316143989563, 0.0007649547187611461, 0.012817365117371082, 0.0006896033301018178, 0.0007686767494305968, 0.9748558402061462, 0.6256316900253296, 0.0007387069053947926, 0.0008596854167990386, 0.002519800793379545, 0.7513965964317322, 0.012172904796898365, 0.001586511149071157, 0.3504446744918823, 0.0022067008540034294, 0.0006608539260923862, 0.004782781004905701, 0.0014522140845656395, 0.8999408483505249, 0.0012678613420575857, 0.0012543811462819576, 0.6899721622467041, 0.0006605343660339713, 0.9874672293663025, 0.0006716892821714282, 0.7814685106277466, 0.0009818465914577246, 0.46038496494293213, 0.0007869206019677222, 0.0023237140849232674, 0.0006761118420399725, 0.0011065771104767919, 0.0009807588066905737, 0.0006853260565549135, 0.0012981940526515245, 0.0012666700640693307, 0.0007569264271296561, 0.0006447038031183183, 0.0008012998150661588, 0.00910848006606102, 0.0007556698401458561, 0.0007387874647974968, 0.0008734154980629683, 0.0006191676948219538, 0.0016847307560965419, 0.000655040261335671, 0.000613981916103512, 0.005521278362721205, 0.0006415897514671087, 0.09571818262338638, 0.005159437190741301, 0.04890792816877365, 0.5305573344230652, 0.0007077485788613558, 0.0010088147828355432, 0.0018240180797874928, 0.05988755449652672, 0.000666503794491291, 0.0006543612689711154, 0.03554316982626915, 0.0006570985424332321, 0.001311377971433103, 0.0006538950256071985, 0.0013619874371215701, 0.0007321278681047261, 0.002013977849856019, 0.0008228315855376422, 0.0007914539310149848, 0.0008566622855141759, 0.0010344593320041895, 0.0170914139598608, 0.0007557036587968469, 0.0014040772803127766, 0.0007054113084450364, 0.0022870099637657404, 0.006733080837875605, 0.0007149543380364776, 0.0018870123894885182, 0.0012008596677333117, 0.14792786538600922, 0.0022316041868180037, 0.0006058112485334277, 0.000738036644179374, 0.024961575865745544, 0.0009179547778330743, 0.0013905724044889212, 0.0008422613609582186, 0.03532884642481804, 0.00543047022074461, 0.0006953026168048382, 0.0007129485602490604, 0.0009995740838348866, 0.0008198902942240238, 0.0005166284390725195, 0.010104456916451454, 0.03112291730940342, 0.0007577801588922739, 0.01150533463805914, 0.024107741191983223, 0.0011408432619646192, 0.0011416134657338262, 0.0010024809744209051, 0.0012278927024453878, 0.0009697483037598431, 0.0007738213171251118, 0.0006952708354219794, 0.0007521577645093203, 0.001003372366540134, 0.005099634639918804, 0.02482728287577629, 0.0007496053585782647, 0.0007493882440030575, 0.15056392550468445, 0.001156982034444809, 0.0007884702645242214, 0.0012044647010043263, 0.0011101982090622187, 0.0006145717925392091, 0.0006647927802987397, 0.000833783473353833, 0.000612083647865802, 0.0010134415933862329, 0.000952347822021693, 0.028613872826099396, 0.0008713183342479169, 0.0007353797554969788, 0.0007763558533042669, 0.08787873387336731, 0.0007576339994557202, 0.5875232219696045, 0.0007157744839787483, 0.009171927347779274, 0.0006530915852636099, 0.000642918050289154, 0.015201808884739876, 0.00151945766992867, 0.0007339713629335165, 0.0008393123862333596, 0.0007087920093908906, 0.000548293930478394, 0.0036953401286154985, 0.0013834269484505057, 0.02593865431845188, 0.013788515701889992, 0.09127793461084366, 0.03112226165831089, 0.0009056096314452589, 0.0006078386213630438, 0.0018576671136543155, 0.000713803106918931, 0.001065553748048842, 0.0015850057825446129, 0.006245368625968695, 0.001713012345135212, 0.0009723554248921573, 0.013185463845729828, 0.20363785326480865, 0.020868347957730293, 0.5257710814476013, 0.07024417072534561, 0.008932722732424736, 0.0006213366286829114, 0.001627070363610983, 0.0012578652240335941, 0.0007251144852489233, 0.0006146187079139054, 0.0006432480295188725, 0.008824844844639301, 0.0017265338683500886, 0.000624476873781532, 0.0007000716868788004, 0.0010469801491126418, 0.0006910336087457836, 0.0015496277483180165, 0.0007046500686556101, 0.0009863286977633834, 0.0005769979325123131, 0.03023984283208847, 0.0009442632435820997, 0.0006622658693231642, 0.005400936119258404, 0.0019352048402652144, 0.0011614785762503743, 0.0011650105006992817, 0.0012456077383831143, 0.04049983248114586, 0.0041401875205338, 0.0013282170984894037, 0.0007520735380239785, 0.04365234076976776, 0.0019016378792002797, 0.0159494336694479, 0.006759821902960539, 0.0019236350199207664, 0.0010862356284633279, 0.001470615272410214, 0.0022909706458449364, 0.027262084186077118, 0.10753443092107773, 0.001357921166345477, 0.002939213765785098, 0.0016262525459751487, 0.0022662836126983166, 0.002689261455088854, 0.0010733779054135084, 0.0008581844158470631, 0.0067656030878424644, 0.004177004564553499, 0.0007049475098028779, 0.0010262682335451245, 0.004580223001539707, 0.0012416258687153459, 0.0006556803709827363, 0.0008703258936293423, 0.001999537693336606, 0.003699007211253047, 0.0013896505115553737, 0.0010513177840039134, 0.0011636168928816915, 0.0011696267174556851, 0.004107262473553419, 0.0010613256599754095, 0.0007498075137846172, 0.0012688367860391736, 0.0006503778276965022, 0.0008382597006857395, 0.0014118999242782593, 0.0016245216829702258, 0.9847257733345032, 0.0010183510603383183, 0.0006399886915460229, 0.12247656285762787, 0.002290567383170128, 0.008622262626886368, 0.000698798568919301, 0.0008153233211487532, 0.0007708677439950407, 0.015073916874825954, 0.015344462357461452, 0.0008595485705882311, 0.003186190268024802, 0.16066668927669525, 0.0006762957782484591, 0.029362743720412254, 0.0006446673651225865, 0.0007054949528537691, 0.0007840837351977825, 0.003167911898344755, 0.0006886008777655661, 0.0011333838338032365, 0.0011778135085478425, 0.05608990415930748, 0.0006141774356365204, 0.0007596767391078174, 0.0007653232896700501, 0.0008270638645626605, 0.0005595748662017286, 0.0008218450238928199, 0.0008194642723537982, 0.004200454335659742, 0.0006718769436702132, 0.0027225371450185776, 0.0018657783512026072, 0.009941039606928825, 0.0008485548314638436, 0.023773474618792534, 0.011862222105264664, 0.02916707657277584, 0.0009076729766093194, 0.0008608158095739782, 0.0006941899773664773, 0.05559508502483368, 0.005248402711004019, 0.0009115543798543513, 0.012818076647818089, 0.0011666212230920792, 0.0058373697102069855, 0.0012689860304817557, 0.0007062881486490369, 0.01809353195130825, 0.0011508025927469134, 0.002201611641794443, 0.0008897107327356935, 0.0037627245765179396, 0.004838243126869202, 0.14199385046958923, 0.0011250446550548077, 0.029159637168049812, 0.6698718070983887, 0.0012067455099895597, 0.9410893321037292, 0.0008733344147913158, 0.0007956563495099545, 0.6897950172424316, 0.000847791088744998, 0.006479328032582998, 0.0010515081230551004, 0.010343375615775585, 0.0007198238163255155, 0.001146350521594286, 0.0011005343403667212, 0.023370668292045593, 0.0008256657747551799, 0.0009660476353019476, 0.00129734689835459, 0.0008661039173603058, 0.9111775159835815, 0.10857754200696945, 0.005148202646523714, 0.0046458616852760315, 0.000890190654899925, 0.005148202646523714, 0.0008858965011313558, 0.0006620405474677682, 0.01631004922091961, 0.0005982572329230607, 0.0006525312783196568, 0.0007251097122207284, 0.01884242333471775, 0.000782377552241087, 0.0010999753139913082, 0.003943207208067179, 0.21816807985305786, 0.0010417968733236194, 0.0007121927919797599, 0.0009327799780294299, 0.0013898052275180817, 0.003896349109709263, 0.0019838863518089056, 0.0008013883489184082, 0.000725511577911675, 0.001167655223980546, 0.0008519482216797769, 0.020926447585225105, 0.0017499268287792802, 0.0009450138313695788, 0.03284056857228279, 0.0014374664751812816, 0.0010626530274748802, 0.0018941062735393643, 0.0008073420613072813, 0.0006684634136036038, 0.002049087081104517, 0.0021780095994472504, 0.0007242456777021289, 0.0006934553966857493, 0.0006238989299163222, 0.0007011563866399229, 0.0006938807782717049, 0.0007298566051758826, 0.0011865156702697277, 0.0008488867315463722, 0.0026673818938434124, 0.01807679794728756, 0.005112886894494295, 0.0011862139217555523, 0.0008736468735150993, 0.000660315970890224, 0.002501055132597685, 0.0023692664690315723, 0.0007149625453166664, 0.016796471551060677, 0.0008566557080484927, 0.0007623407291248441, 0.0028278063982725143, 0.0010531945154070854, 0.0008940021507441998, 0.0012628710828721523, 0.9245875477790833, 0.0021215444430708885, 0.14072275161743164, 0.0008002124959602952, 0.04136544466018677, 0.0006404335144907236, 0.0011140926508232951, 0.008218605071306229, 0.44745245575904846, 0.0008073251228779554, 0.0007937820628285408, 0.000771417107898742, 0.8625559210777283, 0.0012595856096595526, 0.0018222383223474026, 0.0009189492557197809, 0.0005865615676157176, 0.0007863917271606624, 0.02800644189119339, 0.0018024893943220377, 0.0009468140779063106, 0.002249154495075345, 0.0007942855590954423, 0.0012464498868212104, 0.0014296453446149826, 0.0007469042902812362, 0.19882197678089142, 0.001244206097908318, 0.0008685373468324542, 0.018334126099944115, 0.01349340658634901, 0.001455825287848711, 0.0008268715464510024, 0.0009005942847579718, 0.0016565811820328236, 0.6155133247375488, 0.0006382688879966736, 0.0009189492557197809, 0.001035492168739438, 0.1846158802509308, 0.0006271838792599738, 0.0012416655663400888, 0.026310227811336517, 0.0012344397837296128, 0.012108447961509228, 0.0006082437466830015, 0.8486267328262329, 0.001727424212731421, 0.0010765453334897757, 0.000809305056463927, 0.0005863704136572778, 0.025148512795567513, 0.000604294880758971, 0.0007008623797446489, 0.0006326513248495758, 0.0008150090579874814, 0.0010894896695390344, 0.000582236738409847, 0.0005896781804040074, 0.0035824652295559645, 0.0009639551280997694, 0.0007120309164747596, 0.0005836569471284747, 0.0007428556564264, 0.0035824652295559645, 0.0020503357518464327, 0.0009110646788030863, 0.03098168596625328, 0.0009062177268788218, 0.0009232465527020395, 0.0008337188046425581, 0.006124801002442837, 0.002033247845247388, 0.0007561816601082683, 0.0019954161252826452, 0.000754284206777811, 0.0011560373241081834, 0.0008541428833268583, 0.0027444842271506786, 0.0023297586012631655, 0.002190719358623028, 0.0009012921364046633, 0.0025107695255428553, 0.0582411102950573, 0.001488765818066895, 0.01965540274977684, 0.0005600244621746242, 0.9617758393287659, 0.29155233502388, 0.023706743493676186, 0.0006241076625883579, 0.00060020707314834, 0.0034589599817991257, 0.0010808005463331938, 0.0022698650136590004, 0.0009099264862015843, 0.0008394487667828798, 0.0019900526385754347, 0.0024788915179669857, 0.0007925452082417905, 0.004679305478930473, 0.005159437190741301, 0.0034378538839519024, 0.0016352619277313352, 0.2130834460258484, 0.047320395708084106, 0.0014745431253686547, 0.0009510520612820983, 0.0007256011595018208, 0.002418211428448558, 0.003253210335969925, 0.002174431225284934, 0.0007611259934492409, 0.3133710026741028, 0.0008591510122641921, 0.0008649868541397154, 0.021905692294239998, 0.0010317395208403468, 0.00265712384134531, 0.03499336540699005, 0.020861772820353508, 0.2529924809932709, 0.0007163013215176761, 0.0007965238182805479, 0.2600928246974945, 0.18224962055683136, 0.30607879161834717, 0.0008455426432192326, 0.0007784226909279823, 0.0007109037251211703, 0.000637196411844343, 0.007228451315313578, 0.0012240991927683353, 0.020850656554102898, 0.0008525487501174212, 0.030859705060720444, 0.07397522032260895, 0.003131276462227106, 0.4193043112754822, 0.0025082617066800594, 0.21064434945583344, 0.0025385634507983923, 0.0025556168984621763, 0.0007739669526927173, 0.0006807476165704429, 0.0009189492557197809, 0.001904066652059555, 0.002231709659099579, 0.0013415764551609755, 0.0006039617583155632, 0.006491968408226967, 0.001731675467453897, 0.0017421443480998278, 0.0009468140779063106, 0.03013366274535656, 0.0007839290774427354, 0.0010353836696594954, 0.0012281296076253057, 0.009803608059883118, 0.0005911968182772398, 0.0011978893307968974, 0.7040179967880249, 0.0011170214274898171, 0.0015611463459208608, 0.0007423193310387433, 0.0019888642709702253, 0.0012411228381097317, 0.000836131745018065, 0.003619889495894313, 0.0008406029082834721, 0.0011626363266259432, 0.035820990800857544, 0.0011170214274898171, 0.002985418075695634, 0.05215677618980408, 0.0013961158692836761, 0.0009362832643091679, 0.0014198822900652885, 0.0011816489277407527, 0.0009508029324933887, 0.001459285500459373, 0.0020067014265805483, 0.0011820417130365968, 0.378527969121933, 0.000770356971770525, 0.12106682360172272, 0.0010993179166689515, 0.0023463882971554995, 0.05486317723989487, 0.037895940244197845, 0.0007987105054780841, 0.0028425571508705616, 0.0013106282567605376, 0.2742981016635895, 0.0008529273909516633, 0.004858539905399084, 0.3619878590106964, 0.0019516309257596731, 0.6848307251930237, 0.10511995851993561, 0.942391037940979, 0.27241092920303345, 0.0007795183919370174, 0.06988032162189484, 0.0012622332433238626, 0.0012122852494940162, 0.006765593774616718, 0.010665740817785263, 0.003937190864235163, 0.00711127370595932, 0.0006712896283715963, 0.04272749274969101, 0.0019428159575909376, 0.0011720312759280205, 0.0009131169063039124, 0.0014523406280204654, 0.0013427766971290112, 0.0007266436005011201, 0.001228255219757557, 0.0006351309712044895, 0.0007796899881213903, 0.008327028714120388, 0.001951318932697177, 0.0013233342906460166, 0.005174336954951286, 0.5847502946853638, 0.6033796072006226, 0.002099498175084591, 0.0019435449503362179, 0.01081257127225399, 0.03981604799628258, 0.0011229374213144183, 0.0008958785329014063, 0.0007485848618671298, 0.042286984622478485, 0.0034021162427961826, 0.0020469187293201685, 0.3951251208782196, 0.08428942412137985, 0.016327425837516785, 0.1726638376712799, 0.009654807858169079, 0.002276418497785926, 0.0017636568518355489, 0.006843080744147301, 0.007541721686720848, 0.0009353175992146134, 0.006636550184339285, 0.0007403799681924284, 0.0007878760807216167, 0.0006689350702799857, 0.0006599035114049911, 0.984654426574707, 0.0008556254324503243, 0.009323774836957455, 0.007582496386021376, 0.0032654714304953814, 0.0006443073507398367, 0.002097273711115122, 0.0008092086063697934, 0.011913142167031765, 0.0006828704499639571, 0.0007651300984434783, 0.029273629188537598, 0.002143009565770626, 0.0006726223509758711, 0.002119091572239995, 0.009793715551495552, 0.013673679903149605, 0.0010437533492222428, 0.0010540842777118087, 0.0024434286169707775, 0.015972577035427094, 0.0018857617396861315, 0.009381682612001896, 0.0007976438500918448, 0.10249729454517365, 0.0012800965923815966, 0.0007083422970026731, 0.000646498054265976, 0.0013865437358617783, 0.0007858171593397856, 0.013250899501144886, 0.40501126646995544, 0.06627526879310608, 0.010644000954926014, 0.0019296088721603155, 0.001138003310188651, 0.891376256942749, 0.0011769611155614257, 0.00742980744689703, 0.0013879217440262437, 0.0006188033730722964, 0.0028489395044744015, 0.0010935475584119558, 0.000689364445861429, 0.0020732819102704525, 0.0007851701229810715, 0.004750729072839022, 0.0023564142175018787, 0.0008707796805538237, 0.000888122187461704, 0.00813152827322483, 0.00107036461122334, 0.022126734256744385, 0.0009922434110194445, 0.0010669722687453032, 0.0018886198522523046, 0.0006772852502763271, 0.003734838217496872, 0.01551027875393629, 0.0008823053212836385, 0.001356357242912054, 0.0009713178733363748, 0.0009952896507456899, 0.019261552020907402, 0.004059279337525368, 0.06964196264743805, 0.0016636495711281896, 0.0008812718442641199, 0.0007759779691696167, 0.0007671042112633586, 0.0008291024132631719, 0.008750064298510551, 0.0009712216560728848, 0.0021125851199030876, 0.0008399175712838769, 0.025056064128875732, 0.02061171643435955, 0.00172985321842134, 0.001340758870355785, 0.06747537106275558, 0.0008275380241684616, 0.0009575716685503721, 0.016637040302157402, 0.0006066703936085105, 0.0006944119813852012, 0.009850847534835339, 0.0015017655678093433, 0.0187813900411129, 0.001162883942015469, 0.0008039529784582555, 0.022865982726216316, 0.0033903049770742655, 0.001168937305919826, 0.013367600739002228, 0.002212070394307375, 0.0010749148204922676, 0.0009534903219901025, 0.001387705677188933, 0.0006322070839814842, 0.0030268863774836063, 0.004427243024110794, 0.009448759257793427, 0.0009834043448790908, 0.1144687756896019, 0.0010503262747079134, 0.0006062123575247824, 0.0007752676028758287, 0.018390974029898643, 0.36009612679481506, 0.001385943149216473, 0.006278621964156628, 0.0014155956450849771, 0.003195072989910841, 0.002047000452876091, 0.010855634696781635, 0.001449008472263813, 0.001100838417187333, 0.012021631002426147, 0.0009239862556569278, 0.0005431573954410851, 0.016442475840449333, 0.00241908454336226, 0.17559510469436646, 0.0008267462835647166, 0.001284743077121675, 0.0010185756254941225, 0.0008247673395089805, 0.0009613897418603301, 0.0006182516226544976, 0.005097375251352787, 0.017105573788285255, 0.0015973701374605298, 0.0009244683897122741, 0.04483827203512192, 0.6839888095855713, 0.014113028533756733, 0.0015359920216724277, 0.0009527629590593278, 0.0006545874057337642, 0.0006371134659275413, 0.0006256182095967233, 0.0684456005692482, 0.007267644628882408, 0.005151242017745972, 0.002943870611488819, 0.005523784551769495, 0.004263442009687424, 0.0007001871126703918, 0.0008262178744189441, 0.23088398575782776, 0.0007121995440684259, 0.0009906126651912928, 0.016912177205085754, 0.006233172956854105, 0.0008704602951183915, 0.0007476734463125467, 0.0010362777393311262, 0.0005597189301624894, 0.004467745311558247, 0.021125443279743195, 0.0006267139688134193, 0.17455989122390747, 0.0006617384497076273, 0.0006396527169272304, 0.0008413060568273067, 0.0008438958320766687, 0.0034154641907662153, 0.0011196138802915812, 0.0013629754539579153, 0.5328050255775452, 0.009361036121845245, 0.0008671249379403889, 0.0006738153751939535, 0.0006897808634676039, 0.0015078282449394464, 0.000641409948002547, 0.0014107327442616224, 0.0006196759641170502, 0.0006837176624685526, 0.001148275681771338, 0.00492115831002593, 0.0029516094364225864, 0.11406198143959045, 0.0008202677709050477, 0.001975805964320898, 0.011186551302671432, 0.0010226391023024917, 0.0016729390481486917, 0.0007734998944215477, 0.4941776394844055, 0.0009671416482888162, 0.005181529093533754, 0.025648171082139015, 0.002746660728007555, 0.0013052598806098104, 0.017966344952583313, 0.0018532542744651437, 0.0007792398100718856, 0.0008430072921328247, 0.0010127226123586297, 0.0918252170085907, 0.002635635668411851, 0.0010527776321396232, 0.0006109570385888219, 0.004281443078070879, 0.0006341245607472956, 0.010778388008475304, 0.007728151511400938, 0.0014779627090319991, 0.0027989940717816353, 0.006526501849293709, 0.0010800821473821998, 0.0034493005368858576, 0.004785475786775351, 0.0016447956440970302, 0.01798192225396633, 0.0028298492543399334, 0.0009188118856400251, 0.0008777509210631251, 0.003191526047885418, 0.0006517823785543442, 0.001028170227073133, 0.0007435221341438591, 0.0009453470120206475, 0.0007303296588361263, 0.005717294290661812, 0.0009092604159377515, 0.10018805414438248, 0.0009014463284984231, 0.0009523786138743162, 0.00489733275026083, 0.008203420788049698, 0.8478719592094421, 0.02031203918159008, 0.0031189010478556156, 0.0010149335721507668, 0.0006857739645056427, 0.005276856478303671, 0.0012344862334430218, 0.0068433950655162334, 0.0010415547294542193, 0.005166566465049982, 0.006715303752571344, 0.0008652130491100252, 0.0009401190327480435, 0.0018795576179400086, 0.0010502742370590568, 0.024602536112070084, 0.00910593569278717, 0.0009602683130651712, 0.0016925459494814277, 0.0018766697030514479, 0.0008589443750679493, 0.001164546119980514, 0.000988392042927444, 0.0007642217096872628, 0.0031983184162527323, 0.0014323885552585125, 0.001263655605725944, 0.0023591117933392525, 0.0006752959452569485, 0.001194796641357243, 0.004479608498513699, 0.0007227202877402306, 0.0005683412891812623, 0.0007010678527876735, 0.010516643524169922, 0.0007525786641053855, 0.003102704184129834, 0.001966774696484208, 0.000897164863999933, 0.7214379906654358, 0.000711070082616061, 0.0013133242027834058, 0.0007116083870641887, 0.0012754957424476743, 0.006964043248444796, 0.0018888365011662245, 0.0007494453457184136, 0.0007994616753421724, 0.0008178985444828868, 0.0009899361757561564, 0.020145878195762634, 0.027086254209280014, 0.0017097211675718427, 0.0009991127299144864, 0.040761034935712814, 0.6973077654838562, 0.005453824996948242, 0.1479734480381012, 0.0007104313117451966, 0.0011329849949106574, 0.004600208718329668, 0.0027265914250165224, 0.002833674428984523, 0.012361940927803516, 0.0013680498814210296, 0.04538697376847267, 0.0006856945110484958, 0.9061799049377441, 0.0023251117672771215, 0.4949955344200134, 0.0007238461985252798, 0.0006856808322481811, 0.0007783225155435503, 0.0011127324542030692, 0.0007990112062543631, 0.046949613839387894, 0.0010122295934706926, 0.0008020006935112178, 0.030502665787935257, 0.000992684974335134, 0.0008640733431093395, 0.003990526776760817, 0.016729895025491714, 0.001341762370429933, 0.0027557138819247484, 0.0008058732491917908, 0.001408598618581891, 0.0010589155135676265, 0.0008288685930892825, 0.0008364723762497306, 0.0006413821829482913, 0.39972984790802, 0.0010311695514246821, 0.0011345293605700135, 0.005621003452688456, 0.8529261350631714, 0.042752355337142944, 0.07150851935148239, 0.04490426182746887, 0.0009929485386237502, 0.0007672818028368056, 0.0006398209952749312, 0.02902553416788578, 0.04179005324840546, 0.0014119166880846024, 0.001419676118530333, 0.0019611387979239225, 0.0011279737809672952, 0.004038892686367035, 0.0006463906029239297, 0.0011371223954483867, 0.0006844595773145556, 0.0008108956390060484, 0.0006325382855720818, 0.0006561439367942512, 0.0006291901809163392, 0.000840600929223001, 0.009287148714065552, 0.0154677489772439, 0.0009772209450602531, 0.0008063056156970561, 0.002005711430683732, 0.0005955472588539124, 0.0007519424543716013, 0.006933495402336121, 0.0018972648540511727, 0.0010826404904946685, 0.0008750136476010084, 0.004586301278322935, 0.0013242242857813835, 0.02093244157731533, 0.0010046700481325388, 0.0015600193291902542, 0.0017627119086682796, 0.0012041693553328514, 0.0008151577785611153, 0.0009925308404490352, 0.0006110842805355787, 0.0006898902938701212, 0.0006675985059700906, 0.0007149635930545628, 0.0008551717619411647, 0.010985507629811764, 0.0011782078072428703, 0.00687978882342577, 0.0018373802304267883, 0.005675674881786108, 0.005623370874673128, 0.002456463174894452, 0.0009537816513329744, 0.0026536916848272085, 0.0009198367479257286, 0.0027581271715462208, 0.002113019349053502, 0.00233255117200315, 0.0015171392587944865, 0.001319678034633398, 0.03360109403729439, 0.020270362496376038, 0.0007372890831902623, 0.0035590864717960358, 0.005958786234259605, 0.0006749976892024279, 0.001996336504817009, 0.0019821038004010916, 0.00539973471313715, 0.0012747608125209808, 0.0027777121867984533, 0.0018483961466699839, 0.0007737066480331123, 0.0007876224117353559, 0.005747145041823387, 0.7202256321907043, 0.0012791843619197607, 0.0010779333533719182, 0.0010665708687156439, 0.000622228195425123, 0.0015135318972170353, 0.0016272313660010695, 0.018504440784454346, 0.0008215305861085653, 0.003968249540776014, 0.0007986477576196194, 0.000909067690372467, 0.00070794956991449, 0.099418506026268, 0.01163468323647976, 0.0008720447076484561, 0.00944640301167965, 0.0012664245441555977, 0.0009047863422892988, 0.0006400534184649587, 0.0007480283384211361, 0.1553211510181427, 0.002535546664148569, 0.0009551338735036552, 0.0006565933581441641, 0.02617313712835312, 0.37669938802719116, 0.10878737270832062, 0.0008455728529952466, 0.005736860446631908, 0.00196722405962646, 0.00796165969222784, 0.0006519492017105222, 0.0026378578040748835, 0.0017613070085644722, 0.0006519492017105222, 0.0010305866599082947, 0.0016165038105100393, 0.026865752413868904, 0.21153201162815094, 0.0008744076476432383, 0.03194989636540413, 0.0006536305299960077, 0.001951909507624805, 0.0008175786351785064, 0.007366519887000322, 0.027380894869565964, 0.0009342416888102889, 0.07669641077518463, 0.03882380947470665, 0.0016377478605136275, 0.002133417408913374, 0.0008291205740533769, 0.0017323787324130535, 0.0070829750038683414, 0.0010986118577420712, 0.0006429406930692494, 0.0034175633918493986, 0.0006197766633704305, 0.000683356134686619, 0.016412783414125443, 0.0017157340189442039, 0.0008525954908691347, 0.0021489555947482586, 0.000909813737962395, 0.0042593590915203094, 0.0008092167554423213, 0.0008535993983969092, 0.0014042978873476386, 0.0008912472985684872, 0.0026228525675833225, 0.0009399089612998068, 0.0006542446790263057, 0.0008041016408242285, 0.000632304756436497, 0.003613739274442196, 0.0008021356188692153, 0.0008208439685404301, 0.0009002102888189256, 0.0009113011765293777, 0.0007672185893170536, 0.000987375620752573, 0.0013800576562061906, 0.0014424537075683475, 0.0009504568297415972, 0.006855634041130543, 0.009595707058906555, 0.0011054192436859012, 0.018723642453551292, 0.0009514694684185088, 0.0008315372979268432, 0.0023483927361667156, 0.0015021474100649357, 0.01298692636191845, 0.006100987084209919, 0.01758582703769207, 0.0007368862861767411, 0.0013938540359959006, 0.0008292709826491773, 0.0007369774975813925, 0.0010603979462757707, 0.001426966511644423, 0.0011093281209468842, 0.0009224165696650743, 0.002922121435403824, 0.5549242496490479, 0.006559863220900297, 0.0015062597813084722, 0.0009805032750591636, 0.0009440041612833738, 0.0007791767129674554, 0.009423541836440563, 0.0005479501560330391, 0.0006311553297564387, 0.000836215796880424, 0.0008366361726075411, 0.0008825449040159583, 0.0036936248652637005, 0.0010546513367444277, 0.000777081586420536, 0.0008721892372705042, 0.0007296646945178509, 0.0013203815324231982, 0.011206818744540215, 0.00489676371216774, 0.015261013060808182, 0.001213827752508223, 0.001091238809749484, 0.0006168248946778476, 0.001023720484226942, 0.000984752201475203, 0.001125813229009509, 0.000820273591671139, 0.0024811741895973682, 0.0010255484376102686, 0.0006481925374828279, 0.0014012167230248451, 0.0005532195791602135, 0.00065575260668993, 0.001030612736940384, 0.08444011956453323, 0.0008205929771065712, 0.004106331616640091, 0.0010935007594525814, 0.0017291920958086848, 0.0014090555487200618, 0.030391540378332138, 0.006509831175208092, 0.0006943378248251975, 0.0511716790497303, 0.0010111902374774218, 0.132165789604187, 0.0006899445434100926, 0.0009818999096751213, 0.0008754381560720503, 0.0006273043691180646, 0.0006329405005089939, 0.012459230609238148, 0.020016735419631004, 0.0016381425084546208, 0.004175642039626837, 0.640809178352356, 0.015604676678776741, 0.009801214560866356, 0.03326399624347687, 0.0014826672850176692, 0.0015328419394791126, 0.03687861189246178, 0.002698807278648019, 0.02356850914657116, 0.0007032764260657132, 0.0007407137891277671, 0.0006862322334200144, 0.016572222113609314, 0.004127490799874067, 0.0007570617599412799, 0.003072161227464676, 0.0007403225172311068, 0.0007026526727713645, 0.0008080713450908661, 0.0008550120983272791, 0.0006842834991402924, 0.0009646082180552185, 0.0023562898859381676, 0.0006523382617160678, 0.0008299205219373107, 0.006843340117484331, 0.0007954335305839777, 0.0009216231992468238, 0.05295523256063461, 0.15076513588428497, 0.000953405920881778, 0.0006666925037279725, 0.0008602007874287665, 0.065042644739151, 0.0016267744358628988, 0.30194443464279175, 0.0009804533328860998, 0.0007639494142495096, 0.0007060007774271071, 0.13554997742176056, 0.03614966198801994, 0.0837116688489914, 0.25019246339797974, 0.00723134633153677, 0.009711580350995064, 0.01069746632128954, 0.00228053773753345, 0.04233533889055252, 0.001043981988914311, 0.014671538025140762, 0.0008462225086987019, 0.0008463087724521756, 0.015159456990659237, 0.006741849239915609, 0.12002912908792496, 0.0007529677241109312, 0.0015092546818777919, 0.016224397346377373, 0.08102867007255554, 0.0008026103605516255, 0.11991803348064423, 0.6061437726020813, 0.0023712203837931156, 0.009208238683640957, 0.0012111213291063905, 0.0018143790075555444, 0.0017714772839099169, 0.010088509880006313, 0.0006922655156813562, 0.0015549525851383805, 0.0007076662732288241, 0.013746115379035473, 0.37804344296455383, 0.6868948936462402, 0.0005995483952574432, 0.0008844597032293677, 0.4119490087032318, 0.011956371366977692, 0.0008782838121987879, 0.36385175585746765, 0.0008219440351240337, 0.0010565288830548525, 0.0015600193291902542, 0.0016618343070149422, 0.0009249882423318923, 0.0011313821887597442, 0.1219344437122345, 0.0006744813290424645, 0.0011498273815959692, 0.1057083010673523, 0.00127314159180969, 0.0007540071383118629, 0.10833665728569031, 0.0008467867155559361, 0.000647318665869534, 0.006190918851643801, 0.0009716664208099246, 0.0010252509964630008, 0.0017173878150060773, 0.05397631227970123, 0.0008556462707929313, 0.0007340679294429719, 0.0016250490443781018, 0.0014772491995245218, 0.0110612902790308, 0.0008047497249208391, 0.003488933900371194, 0.0017514134524390101, 0.0007534012547694147, 0.009470523335039616, 0.0017673596739768982, 0.0006619084160774946, 0.008751636371016502, 0.03243190050125122, 0.0007713726372458041, 0.0011416178895160556, 0.0007387065561488271, 0.0007291422807611525, 0.0010525711113587022, 0.000701586774084717, 0.0007941516814753413, 0.0015119516756385565, 0.000826130504719913, 0.00102232547942549, 0.0010957812191918492, 0.010628210380673409, 0.04916761443018913, 0.04914429038763046, 0.0007610080647282302, 0.0013238058891147375, 0.1724034994840622, 0.0007630061008967459, 0.0008472895715385675, 0.0010168638546019793, 0.0008322512148879468, 0.0018776996294036508, 0.03387727588415146, 0.2608228325843811, 0.0010893500875681639, 0.000949622830376029, 0.0011665602214634418, 0.0033728801645338535, 0.005380108021199703, 0.0017277232836931944, 0.9881991147994995, 0.6074560284614563, 0.0016254978254437447, 0.8004082441329956, 0.09377545863389969, 0.008098217658698559, 0.024660401046276093, 0.07057108730077744, 0.0041487268172204494, 0.07057108730077744, 0.035476457327604294, 0.0007261019782163203, 0.013369650579988956, 0.0007672185893170536, 0.7269237041473389, 0.015231653116643429, 0.8213046193122864, 0.000983404810540378, 0.2625158727169037, 0.6830960512161255, 0.0009765704162418842, 0.011186551302671432, 0.0008572074002586305, 0.018242890015244484, 0.804298460483551, 0.0015143536729738116, 0.011792374774813652, 0.0015962038887664676, 0.0007256589597091079, 0.000608049042057246, 0.028584163635969162, 0.0022698650136590004, 0.0010451643029227853, 0.0006515488494187593, 0.000913421914447099, 0.017134923487901688, 0.0006092454423196614, 0.0008115015807561576, 0.0006619904306717217, 0.0008094411459751427, 0.0006598406471312046, 0.08124860376119614, 0.0013662128476426005, 0.001179143670015037, 0.0008823334937915206, 0.000910112401470542, 0.02144702896475792, 0.006502636708319187, 0.0006143890786916018, 0.0023095773067325354, 0.0007965865079313517, 0.0007052398868836462, 0.02570958621799946, 0.0006849006749689579, 0.000816703075543046, 0.0019651157781481743, 0.013451489619910717, 0.04504406452178955, 0.013188800774514675, 0.0008416612399742007, 0.04141400381922722, 0.06211017444729805, 0.001343489857390523, 0.09891553968191147, 0.0009300603996962309, 0.0013624640414491296, 0.737467348575592, 0.041487738490104675, 0.0005546091706492007, 0.009188635274767876, 0.10080505162477493, 0.05376552417874336, 0.0007875447045080364, 0.0006986450753174722, 0.0007939575589261949, 0.004256431479007006, 0.01032494567334652, 0.008738145232200623, 0.0009255889453925192, 0.013326401822268963, 0.0006764662684872746, 0.0006179914344102144, 0.0006843663286417723, 0.0014257602160796523, 0.001043334836140275, 0.21943292021751404, 0.05351242795586586, 0.0006626794347539544, 0.0011862589744850993, 0.008065999485552311, 0.013095899485051632, 0.000616787001490593, 0.21912509202957153, 0.002229779027402401, 0.0010672722710296512, 0.0005981244030408561, 0.018694337457418442, 0.0007097758934833109, 0.0006249505095183849, 0.0007818547310307622, 0.000906275468878448, 0.1444321721792221, 0.004434038419276476, 0.15882867574691772, 0.0010970346629619598, 0.0006895747501403093, 0.006317438557744026, 0.0009043188183568418, 0.0017086586449295282, 0.004281443078070879, 0.0007259507547132671, 0.001072694081813097, 0.0008731608977541327, 0.0006586805102415383, 0.008524221368134022, 0.004079399164766073, 0.0007220707484520972, 0.0011170358629897237, 0.03926102817058563, 0.0020642646122723818, 0.0007700165151618421, 0.000928097462747246, 0.0031880277674645185, 0.0007706140168011189, 0.0007063847151584923, 0.0006584071670658886, 0.7157537937164307, 0.0010186794679611921, 0.0008335356251336634, 0.021000022068619728, 0.0028547076508402824, 0.0014746342785656452, 0.0008169478387571871, 0.250193327665329, 0.0009612345020286739, 0.0009156159940175712, 0.102229543030262, 0.0007132000173442066, 0.004327844828367233, 0.0072700874879956245, 0.15088465809822083, 0.24295848608016968, 0.0008920608670450747, 0.0012921872548758984, 0.0006583927315659821, 0.020073814317584038, 0.017735691741108894, 0.0012621779460459948, 0.0007470829878002405, 0.005189311224967241, 0.0009165991796180606, 0.0006686427514068782, 0.0006661313236691058, 0.0007142137619666755, 0.0012033162638545036, 0.0007424119394272566, 0.0013134392211213708, 0.00641467422246933, 0.0013720400165766478, 0.0007052258006297052, 0.002856791950762272, 0.0008762747747823596, 0.0010507185943424702, 0.001302829827181995, 0.508478581905365, 0.008580806665122509, 0.0148081099614501, 0.48884040117263794, 0.09781106561422348, 0.000859249266795814, 0.09601762145757675, 0.0015514910919591784, 0.02384246699512005, 0.025398803874850273, 0.011592431925237179, 0.02667873725295067, 0.0007307567866519094, 0.0015692905290052295, 0.0011796565959230065, 0.0024626520462334156, 0.01309928297996521, 0.0008709804969839752, 0.012019853107631207, 0.007913077250123024, 0.020733807235956192, 0.0006797673995606601, 0.0016582552343606949, 0.016102291643619537, 0.0009305589483119547, 0.024270936846733093, 0.8354611396789551, 0.0021984074264764786, 0.08549489080905914, 0.0010374364210292697, 0.05406680330634117, 0.00545728113502264, 0.0006421665893867612, 0.186497300863266, 0.001170444767922163, 0.8606775403022766, 0.0007885825471021235, 0.5967576503753662, 0.0010248003527522087, 0.0007989575387910008, 0.0007336476701311767, 0.002033491851761937, 0.009516842663288116, 0.0013664743164554238, 0.0017427505226805806, 0.0020636790432035923, 0.20773111283779144, 0.0007296875701285899, 0.0009449889766983688, 0.6950405240058899, 0.4558058977127075, 0.09504206478595734, 0.0010542887030169368, 0.016650527715682983, 0.0014575356617569923, 0.0017217942513525486, 0.0006620800122618675, 0.0021788678131997585, 0.006017069797962904, 0.0010253936052322388, 0.0010239327093586326, 0.014183609746396542, 0.441749632358551, 0.0008293160935863853, 0.04215336963534355, 0.0007220050320029259, 0.0018148187082260847, 0.0010897698812186718, 0.002327947411686182, 0.0006553037092089653, 0.0009359657415188849, 0.9796961545944214, 0.00265528098680079, 0.0010851745028048754, 0.1821862906217575, 0.000686447776388377, 0.02169947326183319, 0.0007996689528226852, 0.9037695527076721, 0.0011117157991975546, 0.0007745808688923717, 0.8007287383079529, 0.0006298468797467649, 0.08339153975248337, 0.033768199384212494, 0.02159617654979229, 0.009769422002136707, 0.16231970489025116, 0.08517088741064072, 0.10580460727214813, 0.0009448986384086311, 0.01453239656984806, 0.0007621758850291371, 0.0325741283595562, 0.05043446645140648, 0.0006386999739333987, 0.007831849157810211, 0.0010001922491937876, 0.0005864036502316594, 0.002374927746132016, 0.05721431225538254, 0.001202927902340889, 0.06507117301225662, 0.0010465646628290415, 0.006080803461372852, 0.037386104464530945, 0.03487144038081169, 0.013135697692632675, 0.0008665857021696866, 0.002346655121073127, 0.002127793151885271, 0.010362893342971802, 0.0006294264458119869, 0.0009216197649948299, 0.025334523990750313, 0.0007065240642987192, 0.2930718660354614, 0.5541135668754578, 0.0015004591550678015, 0.22138163447380066, 0.1112632229924202, 0.0007136143976822495, 0.0007945260149426758, 0.7553250193595886, 0.0008921219850890338, 0.026136713102459908, 0.3072914779186249, 0.003138294443488121, 0.9193166494369507, 0.17429672181606293, 0.0007954835309647024, 0.09827420115470886, 0.028317784890532494, 0.0022393290419131517, 0.002145058009773493, 0.0037799912970513105, 0.0010439587058499455, 0.6075042486190796, 0.03473547101020813, 0.0008854520856402814, 0.0059648845344781876, 0.0008043464622460306, 0.07707209885120392, 0.601322591304779, 0.03539387509226799, 0.0009734862833283842, 0.000964135630056262, 0.000626535911578685, 0.0006864693714305758, 0.38257545232772827, 0.0009626445244066417, 0.0009221440996043384, 0.0010123868705704808, 0.000672255118843168, 0.000992182525806129, 0.0009334756177850068, 0.0006242608069442213, 0.0007231016061268747, 0.0013787945499643683, 0.0010228670435026288, 0.0007468273979611695, 0.010310494340956211, 0.0007560671074315906, 0.002073338022455573, 0.001243363949470222, 0.07062092423439026, 0.03231579437851906, 0.0009276827331632376, 0.0005496601806953549, 0.024922948330640793, 0.0007479488267563283, 0.00088052439969033, 0.21712251007556915, 0.101750947535038, 0.047024909406900406, 0.34068793058395386, 0.0009013171074911952, 0.1584884524345398, 0.002125256462022662, 0.0006541436887346208, 0.001228122040629387, 0.0009099399321712554, 0.0005895051290281117, 0.0007280511199496686, 0.0021197169553488493, 0.0009303538245148957, 0.004680780228227377, 0.0015266233822330832, 0.0028937177266925573, 0.0009691990562714636, 0.034020598977804184, 0.002011008094996214, 0.07720988243818283, 0.0014320374466478825, 0.0007154021295718849, 0.0007205025176517665, 0.0007207284797914326, 0.0006154346046969295, 0.858291506767273, 0.000616668548900634, 0.034328557550907135, 0.0016127779381349683, 0.0007334138499572873, 0.0007220958941616118, 0.04067187011241913, 0.0006738625816069543, 0.03011961653828621, 0.004002279601991177, 0.006692271213978529, 0.0009031360968947411, 0.0008918219245970249, 0.000794057035818696, 0.0005768429255113006, 0.0021089641377329826, 0.002932084258645773, 0.0032091846223920584, 0.0019255218794569373, 0.0036215921863913536, 0.0021384870633482933, 0.044899433851242065, 0.2189515382051468, 0.0007732710801064968, 0.002084330189973116, 0.06303519755601883, 0.0006897643906995654, 0.0007757742423564196, 0.0006089549278840423, 0.2895500659942627, 0.1933421790599823, 0.002311207354068756, 0.0008343235240317881, 0.0005601912853308022, 0.01985517330467701, 0.43956810235977173, 0.000798060791566968, 0.02590985596179962, 0.0007753341342322528, 0.0010321317240595818, 0.0017367812106385827, 0.01547972857952118, 0.21388956904411316, 0.0006603410583920777, 0.0025856909342110157, 0.01174536906182766, 0.0008646654896438122, 0.0008358266786672175, 0.0048047020100057125, 0.0008057642262428999, 0.0007374408887699246, 0.0009896679548546672, 0.0010144984116777778, 0.024838395416736603, 0.11645451188087463, 0.003040373558178544, 0.0008140307618305087, 0.019324244931340218, 0.0030178544111549854, 0.005310288164764643, 0.000615795433986932, 0.0009176788735203445, 0.0006872231024317443, 0.2833782136440277, 0.0008596502593718469, 0.0012907744385302067, 0.0009421024587936699, 0.0009405674645677209, 0.0007776678539812565, 0.01156330481171608, 0.0005640816525556147, 0.003397475928068161, 0.08050783723592758, 0.0010906689567491412, 0.0009323600679636002, 0.0008719911566004157, 0.08181688189506531, 0.0007753444951958954, 0.5161641836166382, 0.07812770456075668, 0.011169933713972569, 0.0092400461435318, 0.0016421134350821376, 0.0008596854167990386, 0.0006100827595219016, 0.0010095398174598813, 0.0007460701745003462, 0.0009342595003545284, 0.0006573108839802444, 0.0008874201448634267, 0.0009329412132501602, 0.0028439522720873356, 0.0006525387871079147, 0.0006949121598154306, 0.0008538247202523053, 0.0010245366720482707, 0.0008076790836639702, 0.0016829289961606264, 0.0006772480555810034, 0.04738966375589371, 0.0006676875636912882, 0.0006091153481975198, 0.0007070787250995636, 0.002180979587137699, 0.0007112351013347507, 0.0008533225045539439, 0.09230133891105652, 0.01760409027338028, 0.0008863380644470453, 0.0011594510870054364, 0.0015553189441561699, 0.011194354854524136, 0.0007890519918873906, 0.0017517254455015063, 0.0006814700900577009, 0.0014049486489966512, 0.0006639563944190741, 0.024114955216646194, 0.0007267080945894122, 0.0013711400097236037, 0.0009136547450907528, 0.3036133944988251, 0.0011468421434983611, 0.0026046293787658215, 0.3186180889606476, 0.0008807073463685811, 0.019451066851615906, 0.0031652720645070076, 0.00206961901858449, 0.0007455439190380275, 0.0006534393178299069, 0.007881988771259785, 0.2662077844142914, 0.008785771206021309, 0.0018281735247001052, 0.2901316285133362, 0.0006082121981307864, 0.001366166747175157, 0.0024420341942459345, 0.14390011131763458, 0.0009488915675319731, 0.0007288643391802907, 0.11231493949890137, 0.0009792583296075463, 0.006121136248111725, 0.013737842440605164, 0.0006471410160884261, 0.0011108873877674341, 0.0045625390484929085, 0.0010810389649122953, 0.0014664751943200827, 0.02207096479833126, 0.0016408212250098586, 0.0006917158025316894, 0.0007841804763302207, 0.0015953774563968182, 0.0040336367674171925, 0.0007658084505237639, 0.001772918738424778, 0.0017219178844243288, 0.0007653389475308359, 0.0012117911828681827, 0.0008596854167990386, 0.01682371459901333, 0.0007056392496451735, 0.001835702802054584, 0.0007743340102024376, 0.0007076015463098884, 0.0007539517828263342, 0.0007794161792844534, 0.0007941183866932988, 0.001087802927941084, 0.0005949322367087007, 0.004417011048644781, 0.0011605378240346909, 0.007819505408406258, 0.0009384775767102838, 0.0006400563870556653, 0.01119586918503046, 0.001330772996880114, 0.004236967768520117, 0.0011468507582321763, 0.0007499068742617965, 0.007198332343250513, 0.0008538662805221975, 0.0014409476425498724, 0.007191670127213001, 0.0023093027994036674, 0.0007711807265877724, 0.0008010681485757232, 0.0007732445374131203, 0.00958180520683527, 0.0007293667295016348, 0.04887991026043892, 0.0006485265330411494, 0.0008395502809435129, 0.0027020121924579144, 0.0009793213102966547, 0.001329803722910583, 0.11193571984767914, 0.01507001742720604, 0.006145776715129614, 0.14108063280582428, 0.0008239825838245451, 0.0018979927990585566, 0.018317805603146553, 0.0017435579793527722, 0.2043372094631195, 0.0041726031340658665, 0.04246504604816437, 0.002528953831642866, 0.000947285967413336, 0.006457579787820578, 0.001096448046155274, 0.0007757742423564196, 0.0005873520276509225, 0.09574946761131287, 0.001367627875879407, 0.028021447360515594, 0.0032384605146944523, 0.0006967418012209237, 0.0007809403468854725, 0.0007253080257214606, 0.0013785817427560687, 0.008359943516552448, 0.007454057689756155, 0.001104724477045238, 0.0008343549561686814, 0.0006739377859048545, 0.0013298981357365847, 0.0016343325842171907, 0.002903939224779606, 0.0006636236212216318, 0.0007434342987835407, 0.027172651141881943, 0.02232123725116253, 0.012153700925409794, 0.0023396227043122053, 0.0021745399571955204, 0.37452828884124756, 0.006881697103381157, 0.0006222002557478845, 0.0028034306596964598, 0.02665390446782112, 0.0008669931557960808, 0.0033894756343215704, 0.014961139298975468, 0.002995459595695138, 0.015790540724992752, 0.0013809831580147147, 0.0007590522291138768, 0.016480213031172752, 0.003918532747775316, 0.042356736958026886, 0.0008017653017304838, 0.025079600512981415, 0.009392625652253628, 0.0010230385232716799, 0.0009680861257947981, 0.0010928050614893436, 0.0014670919626951218, 0.0025053024291992188, 0.0014344642404466867, 0.024955902248620987, 0.020552370697259903, 0.0007752410601824522, 0.7494683861732483, 0.0007021604105830193, 0.0006518535083159804, 0.0006512567633762956, 0.0013785817427560687, 0.9534522294998169, 0.0008979979902505875, 0.004399830941110849, 0.0008752129506319761, 0.0009344148566015065, 0.0006447407649829984, 0.0009066586499102414, 0.003871823428198695, 0.007201737724244595, 0.0006615908350795507, 0.03649120777845383, 0.0013622026890516281, 0.009122662246227264, 0.0065277572721242905, 0.0007362007745541632, 0.0014904766576364636, 0.018747758120298386, 0.14812466502189636, 0.001028170227073133, 0.0006869304343126714, 0.001406257157213986, 0.0006890797521919012, 0.0010431037517264485, 0.001146484981290996, 0.037666890770196915, 0.043537382036447525, 0.01809106580913067, 0.0019579262007027864, 0.0005983177106827497, 0.0019570505246520042, 0.001125775626860559, 0.0011459034867584705, 0.007159757427871227, 0.0006314844940789044, 0.0014524450525641441, 0.003091653576120734, 0.0007315176189877093, 0.0009405674645677209, 0.0009607698302716017, 0.0007071384461596608, 0.001191464951261878, 0.000646545784547925, 0.0006781455012969673, 0.001529628993012011, 0.0008882309775799513, 0.0008616753621026874, 0.12109453976154327, 0.0005705049261450768, 0.0024483848828822374, 0.003392202081158757, 0.0013452568091452122, 0.0011371808359399438, 0.0016408212250098586, 0.0016608736477792263, 0.0012845240999013186, 0.006515417713671923, 0.0027927071787416935, 0.0010662026470527053, 0.006746701430529356, 0.0008892047917470336, 0.0006750517059117556, 0.09202302247285843, 0.000604555185418576, 0.0007327899220399559, 0.022226054221391678, 0.007193025667220354, 0.006761704105883837, 0.001668458105996251, 0.0016434547724202275, 0.000769514765124768, 0.0008328405674546957, 0.0007369269733317196, 0.001338417176157236, 0.0009546434739604592, 0.0008731576381251216, 0.0017760482151061296, 0.0010238556424155831, 0.0008677163859829307, 0.000665512285195291, 0.0014286619843915105, 0.0006745578139089048, 0.0011071923654526472, 0.029539192095398903, 0.001644277130253613, 0.0021275512408465147, 0.0006995751755312085, 0.0009355988586321473, 0.009968829341232777, 0.7077327966690063, 0.0006367420428432524, 0.0018050925573334098, 0.001019132323563099, 0.0012614073930308223, 0.0006621415377594531, 0.0007048498373478651, 0.0011222055181860924, 0.037418775260448456, 0.002026981906965375, 0.0007229716866277158, 0.0006423410959541798, 0.0014047400327399373, 0.0014554871013388038, 0.8324800729751587, 0.0007376193534582853, 0.0008623345638625324, 0.0959537997841835, 0.0007737232372164726, 0.03779255226254463, 0.001404688460752368, 0.0019027221715077758, 0.05545622110366821, 0.38994503021240234, 0.0007479944615624845, 0.018060289323329926, 0.0007565456908196211, 0.0007084959652274847, 0.0009976617293432355, 0.04060048609972, 0.0008681030012667179, 0.0006371299386955798, 0.0008043464622460306, 0.009855299256742, 0.0008224608027376235, 0.6891387701034546, 0.04978553578257561, 0.0009301326354034245, 0.0006732848123647273, 0.0008561293943785131, 0.0010716067627072334, 0.0007548076682724059, 0.0007193560595624149, 0.0011962661519646645, 0.0006612196448259056, 0.0007018539472483099, 0.0006222047377377748, 0.7363489866256714, 0.0009085880010388792, 0.0006779400282539427, 0.008932722732424736, 0.0031151489820331335, 0.003635915694758296, 0.017238762229681015, 0.0017842621309682727, 0.0054133194498717785, 0.000639245321508497, 0.0013585510896518826, 0.04766027256846428, 0.9142556190490723, 0.01680232398211956, 0.07305072247982025, 0.0006899695144966245, 0.0011026274878531694, 0.0009701460949145257, 0.07563086599111557, 0.02150047942996025, 0.006681021302938461, 0.3938635289669037, 0.002714968752115965, 0.6954798102378845, 0.0006805855082347989, 0.0019516448955982924, 0.0005985948955640197, 0.0008299315231852233, 0.0010444988729432225, 0.9835980534553528, 0.5217687487602234, 0.2437359094619751, 0.11193574219942093, 0.3406166434288025, 0.001042415271513164, 0.0008181433076970279, 0.0011123227886855602, 0.0005775501485913992, 0.0005859904922544956, 0.16892759501934052, 0.08184952288866043, 0.04820144921541214, 0.0017449287697672844, 0.0008103128056973219, 0.0037297068629413843, 0.043816469609737396, 0.8191416263580322, 0.0008987619075924158, 0.03418450430035591, 0.15257370471954346, 0.26506373286247253, 0.0008701638435013592, 0.010042095556855202, 0.0011422623647376895, 0.005749030504375696, 0.0008798958151601255, 0.0009725498966872692, 0.053852830082178116, 0.000941554200835526, 0.0009233037708327174, 0.1011199951171875, 0.04742593690752983, 0.011519388295710087, 0.20183981955051422, 0.0007074973545968533, 0.0006807703175581992, 0.000602996617089957, 0.020803241059184074, 0.0009764485293999314, 0.001897498033940792, 0.004884573630988598, 0.0009843872394412756, 0.0022032263223081827, 0.0008006334537640214, 0.37409910559654236, 0.016325971111655235, 0.0015070796944200993, 0.0015715857734903693, 0.1363787204027176, 0.0009129463578574359, 0.0006408325862139463, 0.0013534564059227705, 0.032365910708904266, 0.0009809999028220773, 0.0007772426470182836, 0.0011307746171951294, 0.651529848575592, 0.11319408565759659, 0.0006690099253319204, 0.004786883946508169, 0.0010935439495369792, 0.0009064650512300432, 0.0014766305685043335, 0.0006877220585010946, 0.006082576233893633, 0.0009996425360441208, 0.001181033905595541, 0.1730021834373474, 0.007694714702665806, 0.020318791270256042, 0.007178591098636389, 0.22856256365776062, 0.0008602511952631176, 0.6370448470115662, 0.009026875719428062, 0.0021119830198585987, 0.0008492626366205513, 0.061432767659425735, 0.03118150867521763, 0.303363561630249, 0.001573074609041214, 0.002254546619951725, 0.005708223674446344, 0.0008253392879851162, 0.0009654546156525612, 0.00073616998270154, 0.008887709118425846, 0.0011572003131732345, 0.21954311430454254, 0.0007980482769198716, 0.01306590810418129, 0.003384323325008154, 0.0009809397161006927, 0.001008749008178711, 0.005754685960710049, 0.0007148137665353715, 0.000740791845601052, 0.0015106451464816928, 0.0009244041284546256, 0.001853706780821085, 0.0007557832868769765, 0.0023700869642198086, 0.019411295652389526, 0.0309483390301466, 0.020056117326021194, 0.0008772521396167576, 0.0012625566450878978, 0.0007960454095155001, 0.0043058088049292564, 0.0007997759967111051, 0.0024734593462198973, 0.9621859192848206, 0.0015832764329388738, 0.014954270794987679, 0.020456578582525253, 0.0015320538077503443, 0.0007620970718562603, 0.0010576174827292562, 0.0007579788216389716, 0.0011579307029023767, 0.020510738715529442, 0.06044080853462219, 0.013761994428932667, 0.004068462178111076, 0.8399302959442139, 0.11282077431678772, 0.0006928364746272564, 0.0059314570389688015, 0.0014822016237303615, 0.018842017278075218, 0.0020442798268049955, 0.001156510435976088, 0.11172179877758026, 0.0006370233022607863, 0.0008638756698928773, 0.000854873622301966, 0.03194989636540413, 0.0013587853172793984, 0.0009863399900496006, 0.0005765760433860123, 0.0007537420024164021, 0.0005619501462206244, 0.022960832342505455, 0.0014035304775461555, 0.001902912394143641, 0.13316497206687927, 0.00832642987370491, 0.002069139387458563, 0.0008463889826089144, 0.007327053230255842, 0.0011688609374687076, 0.06866692006587982, 0.000751925224903971, 0.0007808636291883886, 0.00440298393368721, 0.08451253920793533, 0.09522192925214767, 0.0008276539156213403, 0.20445334911346436, 0.0010205659782513976, 0.005257596727460623, 0.0010975097538903356, 0.02146683633327484, 0.05925421044230461, 0.0011954597430303693, 0.000956991221755743, 0.0006666937260888517, 0.033536940813064575, 0.000588863855227828, 0.03888475522398949, 0.003424749244004488, 0.0016823866171762347, 0.000801092479377985, 0.0005957652465440333, 0.0008465927094221115, 0.0007459173211827874, 0.0008432928589172661, 0.0010599751258268952, 0.000626410823315382, 0.0008817763300612569, 0.0007762585883028805, 0.000645358522888273, 0.000784886593464762, 0.0008396675111725926, 0.5068894028663635, 0.001084115356206894, 0.018096623942255974, 0.0007511588046327233, 0.0015566961374133825, 0.002970656845718622, 0.0009426542674191296, 0.0012373562203720212, 0.0023818055633455515, 0.003303352976217866, 0.06700216233730316, 0.005469111260026693, 0.0017418150091543794, 0.0008635938283987343, 0.002553296508267522, 0.0024671813007444143, 0.9882504940032959, 0.0009057156858034432, 0.36713477969169617, 0.10526908934116364, 0.000859905791003257, 0.0011535435914993286, 0.010362502187490463, 0.2005295604467392, 0.9540594816207886, 0.005592621397227049, 0.0007187331793829799, 0.002535546664148569, 0.0007201973930932581, 0.007829801179468632, 0.0007345210178755224, 0.0007960275397635996, 0.002639932092279196, 0.013149636797606945, 0.0012879708083346486, 0.0006789444596506655, 0.0009344624704681337, 0.0010173434857279062, 0.0008636823040433228, 0.0015563967172056437, 0.000664025719743222, 0.08947944641113281, 0.0012261646334081888, 0.0009235611069016159, 0.0015950258821249008, 0.010833078064024448, 0.0009085334604606032, 0.0016486808890476823, 0.0008161771111190319, 0.0009485363261774182, 0.0035694390535354614, 0.015788355842232704, 0.0007437567110173404, 0.020180076360702515, 0.004380940925329924, 0.0011621940648183227, 0.0008106190362013876, 0.0012182246427983046, 0.022809667512774467, 0.011443588882684708, 0.001922168186865747, 0.03318674489855766, 0.0009718529181554914, 0.0005558832781389356, 0.0029055217746645212, 0.0006365799927152693, 0.0008118241676129401, 0.000784178962931037, 0.0008048000163398683, 0.000660428951960057, 0.0023738567251712084, 0.006321366876363754, 0.0026144760195165873, 0.00624022725969553, 0.0014238097937777638, 0.0011710000690072775, 0.001200323924422264, 0.000651445472612977, 0.0006308011361397803, 0.000869854586198926, 0.0010885944357141852, 0.0006736545474268496, 0.0008790386491455138, 0.000932335271500051, 0.0028465345967561007, 0.0008054590434767306, 0.001080415560863912, 0.0024399999529123306, 0.0009914700640365481, 0.0031532342545688152, 0.0011701448820531368, 0.000800973444711417, 0.0027720832731574774, 0.0010600166860967875, 0.24956415593624115, 0.00804703775793314, 0.03341791406273842, 0.0006471691303886473, 0.0011179172433912754, 0.0023633858654648066, 0.0012348454911261797, 0.003854612587019801, 0.003012959146872163, 0.0006932333344593644, 0.0006963112391531467, 0.00891252513974905, 0.0020715934224426746, 0.006207987200468779, 0.0007096450426615775, 0.00157749664504081, 0.011186551302671432, 0.06274999678134918, 0.0006549363024532795, 0.0008939880062825978, 0.005698613356798887, 0.00103919324465096, 0.0029198992997407913, 0.06188253313302994, 0.0014451424358412623, 0.0007629297906532884, 0.0005502155399881303, 0.003752809716388583, 0.0007826209766790271, 0.0006789693725295365, 0.0013420236064121127, 0.0006231061997823417, 0.0007857505115680397, 0.0011217785067856312, 0.02337099425494671, 0.0009737960644997656, 0.04595812410116196, 0.0011246063513681293, 0.008160674013197422, 0.05114418640732765, 0.06166765093803406, 0.0006561564514413476, 0.0015758188674226403, 0.005748760886490345, 0.045820970088243484, 0.005949210375547409, 0.020612500607967377, 0.11011025309562683, 0.004370458424091339, 0.002027166076004505, 0.0012006692122668028, 0.022230543196201324, 0.23209857940673828, 0.03194989636540413, 0.0008785428362898529, 0.0011559486156329513, 0.7825872898101807, 0.47370976209640503, 0.36329492926597595, 0.000894049764610827, 0.5375058650970459, 0.33088645339012146, 0.0010087840491905808, 0.0014732180861756206, 0.025753356516361237, 0.018226424232125282, 0.007689185906201601, 0.0008482556440867484, 0.0007367489743046463, 0.0012847797479480505, 0.962502658367157, 0.0008165474282577634, 0.021347030997276306, 0.01988711766898632, 0.0005917769158259034, 0.001892496831715107, 0.0007452814024873078, 0.08406545221805573, 0.009763584472239017, 0.0017077275551855564, 0.0849706381559372, 0.0026710352394729853, 0.001201945124194026, 0.0007657748647034168, 0.0006576057057827711, 0.0009807368041947484, 0.0014083444839343429, 0.004281443078070879, 0.01327022910118103, 0.10287977010011673, 0.0902986153960228, 0.0006811658968217671, 0.0008322512148879468, 0.001261306693777442, 0.0012695457553490996, 0.2847820818424225, 0.0008257896406576037, 0.0021804464049637318, 0.1673305779695511, 0.0008142813458107412, 0.011106123216450214, 0.006204037927091122, 0.0011775043094530702, 0.02035421133041382, 0.03879811614751816, 0.0007063624798320234, 0.0007515082834288478, 0.011619733646512032, 0.0372476689517498, 0.038063690066337585, 0.0009787853341549635, 0.0008479824755340815, 0.19449500739574432, 0.02666221372783184, 0.037468019872903824, 0.014307210221886635, 0.0008785428362898529, 0.006903069093823433, 0.007815367542207241, 0.002264147624373436, 0.001922168186865747, 0.0008968870970420539, 0.002535637002438307, 0.0006839281995780766, 0.013459977693855762, 0.001599398092366755, 0.000587984686717391, 0.0012033783132210374, 0.0006333435885608196, 0.0008128974586725235, 0.0020709410309791565, 0.000686389219481498, 0.04192374274134636, 0.0012878034031018615, 0.0006557807209901512, 0.0014542117714881897, 0.0014529036125168204, 0.0016417368315160275, 0.0006485555786639452, 0.10474669188261032, 0.0008268715464510024, 0.03004934825003147, 0.0008478767122142017, 0.002872932469472289, 0.002344288630411029, 0.0010386889334768057, 0.0017120862612500787, 0.0006915147532708943, 0.0012017596745863557, 0.0009854071540758014, 0.0009227202390320599, 0.000928990077227354, 0.010629283264279366, 0.00964435376226902, 0.0039491113275289536, 0.0006789335166104138, 0.039469651877880096, 0.06164167821407318, 0.0008714893483556807, 0.0005804442916996777, 0.0007892904104664922, 0.0016179181402549148, 0.0009525669156573713, 0.000726010650396347, 0.06482164561748505, 0.0008455112110823393, 0.0006852688966318965, 0.0427919402718544, 0.006352773401886225, 0.0565260574221611, 0.0018164253560826182, 0.037244003266096115, 0.10372169315814972, 0.027590559795498848, 0.39640340209007263, 0.0011443377006798983, 0.0776035264134407, 0.0037229324225336313, 0.0012269375147297978, 0.12007927894592285, 0.0007994734914973378, 0.0009741241228766739, 0.001441237167455256, 0.004509184509515762, 0.8849372863769531, 0.0012596611632034183, 0.0015328542795032263, 0.00107623974326998, 0.0009242763626389205, 0.0007348630460910499, 0.020017627626657486, 0.0010383535409346223, 0.7478600144386292, 0.2698597013950348, 0.0020244054030627012, 0.002863416215404868, 0.0009167118114419281, 0.03948451578617096, 0.0033684910740703344, 0.01741626486182213, 0.007028764113783836, 0.28254446387290955, 0.0009455208200961351, 0.0006504209595732391, 0.0010124341351911426, 0.0033066230826079845, 0.000759016431402415, 0.0017952797934412956, 0.0018147183582186699, 0.001040101982653141, 0.007961121387779713, 0.010578570887446404, 0.001106570241972804, 0.0019484634976834059, 0.0063267662189900875, 0.0022591345477849245, 0.0008468161104246974, 0.0006975040887482464, 0.0027196696028113365, 0.020705590024590492, 0.006073736120015383, 0.0008169953362084925, 0.06074703112244606, 0.0009217018377967179, 0.0011746824020519853, 0.000817027292214334, 0.0009128855308517814, 0.0008959518745541573, 0.010176158510148525, 0.0009255343466065824, 0.0013147915014997125, 0.0012960031162947416, 0.0009481243323534727, 0.0006372112547978759, 0.012401357293128967, 0.0054677315056324005, 0.0011833327589556575, 0.0006758808740414679, 0.0007077596383169293, 0.0007914237212389708, 0.006993691436946392, 0.0021472321823239326, 0.0008065745932981372, 0.0007427895325236022, 0.005031635519117117, 0.0006655250326730311, 0.0020409293938428164, 0.0006877341074869037, 0.0006368266767822206, 0.002261544344946742, 0.0008164349710568786, 0.0006072827382013202, 0.0008234374690800905, 0.0007389244274236262, 0.0010608162265270948, 0.001117828767746687, 0.00519863236695528, 0.0020082099363207817, 0.002132020192220807, 0.0007010711124166846, 0.0010492642177268863, 0.0011119651608169079, 0.0006085809436626732, 0.0005983128794468939, 0.0006743388948962092, 0.003704008413478732, 0.0027879357803612947, 0.001512691262178123, 0.017738783732056618, 0.0009584000217728317, 0.005063554737716913, 0.0013032089918851852, 0.000707235827576369, 0.0006867334013804793, 0.0031087810639292, 0.0008631775272078812, 0.01985759660601616, 0.0010155424242839217, 0.0009987620869651437, 0.0017829820280894637, 0.0008084340952336788, 0.025233041495084763, 0.0010795986745506525, 0.0009144837968051434, 0.0009488287032581866, 0.0009322655387222767, 0.0007814494892954826, 0.0007774082478135824, 0.0009093864937312901, 0.0007935528410598636, 0.0009078436996787786, 0.0006969047826714814, 0.0007315183756873012, 0.12804540991783142, 0.002300145337358117, 0.006062732078135014, 0.0026751665864139795, 0.0007752673118375242, 0.0006092360708862543, 0.000859115447383374, 0.000937017728574574, 0.0005536262760870159, 0.00074228853918612, 0.0013696313835680485, 0.0007602025289088488, 0.0009495124104432762, 0.0006272122845984995, 0.0009198919287882745, 0.0008429246372543275, 0.0007439675973728299, 0.011685192584991455, 0.0007288462948054075, 0.0006007012561894953, 0.0005459464155137539, 0.0007776875863783062, 0.0015508433571085334, 0.0012698329519480467, 0.05927763134241104, 0.0008656125864945352, 0.0012781273107975721, 0.0006263347459025681, 0.016048472374677658, 0.00066206487827003, 0.0019770872313529253, 0.000654218252748251, 0.004325468093156815, 0.004108569119125605, 0.000654671632219106, 0.000903654785361141, 0.0006338840466924012, 0.0008315329905599356, 0.0007263594307005405, 0.0008092668722383678, 0.0008957841782830656, 0.0005881579127162695, 0.0006514193955808878, 0.002134587150067091, 0.006398292258381844, 0.002835166407749057, 0.0011033492628484964, 0.005510449875146151, 0.000979598960839212, 0.002517951186746359, 0.001293982146307826, 0.0016774723771959543, 0.0006086238427087665, 0.0007215648074634373, 0.0007468669209629297, 0.001043981988914311, 0.0006675982149317861, 0.0009183467482216656, 0.0007159959059208632, 0.0006385198794305325, 0.0007493621669709682, 0.0008535270462743938, 0.0008391812443733215, 0.0010652625933289528, 0.0007387748337350786, 0.0011874863412231207, 0.0011049207532778382, 0.05707882344722748, 0.000698000134434551, 0.0007095301407389343, 0.0005310620181262493, 0.0009394165826961398, 0.009359470568597317, 0.177541121840477, 0.0007533420575782657, 0.005193907301872969, 0.0005883756675757468, 0.0018961646128445864, 0.0018372839549556375, 0.004290936980396509, 0.0038963824044913054, 0.0005661526811309159, 0.0011096193920820951, 0.020652849227190018, 0.0007603996200487018, 0.06184934452176094, 0.001109655830077827, 0.000590204494073987, 0.034332167357206345, 0.0013193280901759863, 0.0006734523340128362, 0.002111860318109393, 0.0008377865306101739, 0.0014179135905578732, 0.001259160926565528, 0.0007121242815628648, 0.0006540380418300629, 0.0007724745664745569, 0.0006365011213347316, 0.0010668991599231958, 0.0006695942138321698, 0.0011441621463745832, 0.0009283083491027355, 0.0016386205097660422, 0.0011180297005921602, 0.0006211681175045669, 0.0010901604546234012, 0.0006736571085639298, 0.00099524378310889, 0.0009521922329440713, 0.000895205361302942, 0.0033654735889285803, 0.007077695801854134, 0.0015707279089838266, 0.002452219370752573, 0.0006529988604597747, 0.0008729941910132766, 0.0006633447483181953, 0.00216489564627409, 0.000688094412907958, 0.001313385320827365, 0.04695281386375427, 0.0024108903016895056, 0.0010720478603616357, 0.006502865348011255, 0.0006090913084335625, 0.005985395051538944, 0.0008998372941277921, 0.001038089394569397, 0.0009559709578752518, 0.0008079512044787407, 0.0006503787590190768, 0.004155886359512806, 0.0006992155686020851, 0.0007053178269416094, 0.0006583381909877062, 0.0010159933008253574, 0.0018982782494276762, 0.061357349157333374, 0.0018039578571915627, 0.0006490310770459473, 0.00119969982188195, 0.020350292325019836, 0.0010448368266224861, 0.0049715046770870686, 0.0015970759559422731, 0.6064018607139587, 0.0009871008805930614, 0.0044597359374165535, 0.001100902445614338, 0.009747747331857681, 0.0009214477031491697, 0.0015600193291902542, 0.024622717872262, 0.0006405232707038522, 0.0026043145917356014, 0.010654943063855171, 0.0024626520462334156, 0.0032561663538217545, 0.0013274431694298983, 0.0011817315826192498, 0.0008895890787243843, 0.0007155027706176043, 0.000878545397426933, 0.019596539437770844, 0.0007757742423564196, 0.0009029890061356127, 0.001302384422160685, 0.000822730828076601, 0.0006393181974999607, 0.020510097965598106, 0.0009038398275151849, 0.019165104255080223, 0.000726433820091188, 0.0016036503948271275, 0.0007533940952271223, 0.01157835591584444, 0.005899463314563036, 0.0017739292234182358, 0.000740080198738724, 0.014431505464017391, 0.01817566342651844, 0.0006642035441473126, 0.0028316923417150974, 0.0007140589877963066, 0.002140928292647004, 0.0013340013101696968, 0.0007945260149426758, 0.002655189950019121, 0.0012573765125125647, 0.0014145363820716739, 0.0006408205954357982, 0.09302875399589539, 0.0009645573445595801, 0.20523667335510254, 0.000579176819883287, 0.0011373682646080852, 0.0008048268500715494, 0.0009296603966504335, 0.0006939016166143119, 0.001172390184365213, 0.0011497067753225565, 0.00461998488754034, 0.0010860891779884696, 0.001235963311046362, 0.0006930242525413632, 0.19363482296466827, 0.004087586421519518, 0.0016417993465438485, 0.0031391570810228586, 0.0042468830943107605, 0.023944521322846413, 0.0007471726858057082, 0.000925453205127269, 0.005688476376235485, 0.32789525389671326, 0.0006913579418323934, 0.0028538010083138943, 0.0007891794666647911, 0.0008058079401962459, 0.0029238888528198004, 0.0006419753772206604, 0.0006556941661983728, 0.000734169443603605, 0.0011861438397318125, 0.0010980545775964856, 0.025328703224658966, 0.008846831507980824, 0.0007038141484372318, 0.0006531370454467833, 0.0006190354470163584, 0.0009175826562568545, 0.0006475531263276935, 0.0010150863090530038, 0.00081687665078789, 0.0007454956066794693, 0.0010507471160963178, 0.0007725562318228185, 0.0017516652587801218, 0.0008940021507441998, 0.0006395573727786541, 0.00402451865375042, 0.0019019426545128226, 0.0007991878665052354, 0.0007344555924646556, 0.0006424880120903254, 0.0009264752734452486, 0.0010091392323374748, 0.0029141423292458057, 0.0008791930740699172, 0.0007957211928442121, 0.0009089715895242989, 0.0010358424624428153, 0.012863215990364552, 0.0010511199943721294, 0.0008478779345750809, 0.006078340113162994, 0.0014277398586273193, 0.001304570003412664, 0.0013434489956125617, 0.008033107966184616, 0.0007471602293662727, 0.006040879059582949, 0.000998395262286067, 0.0050130062736570835, 0.01838238164782524, 0.0036484249867498875, 0.06353097409009933, 0.08906947821378708, 0.06710458546876907, 0.0016069011762738228, 0.002983912592753768, 0.8916255831718445, 0.0008303239592351019, 0.013030948117375374, 0.0006663570529781282, 0.009963291697204113, 0.0006878799758851528, 0.021773669868707657, 0.0006817728281021118, 0.0007943507516756654, 0.0007071030559018254, 0.003185507608577609, 0.0006309724994935095, 0.014708920381963253, 0.036785997450351715, 0.0010402292245998979, 0.0014999140985310078, 0.0006568068056367338, 0.0018815885996446013, 0.004965565633028746, 0.0006232724990695715, 0.0006361588020808995, 0.0006983821513131261, 0.001413798308931291, 0.0013291649520397186, 0.0007551615708507597, 0.0020478658843785524, 0.010142985731363297, 0.0006703776307404041, 0.0006565733347088099, 0.0006833070074208081, 0.0011048669693991542, 0.0009147439850494266, 0.000953716691583395, 0.002431082772091031, 0.0014924505958333611, 0.0008087153546512127, 0.0009816300589591265, 0.0016821944154798985, 0.0005843616090714931, 0.001138614839874208, 0.0009111128747463226, 0.0007028121035546064, 0.0007245622691698372, 0.0005729759577661753, 0.001502343569882214, 0.0036845537833869457, 0.000590290583204478, 0.008836885914206505, 0.0007424158393405378, 0.001024941448122263, 0.0006670226575806737, 0.00670938054099679, 0.001441739033907652, 0.22244314849376678, 0.0010206024162471294, 0.0008610459044575691, 0.6423356533050537, 0.0008909458993002772, 0.00672150868922472, 0.011724504642188549, 0.0007280337158590555, 0.014428026974201202, 0.08751796185970306, 0.04273739084601402, 0.04209509864449501, 0.0008803565870039165, 0.0007378812879323959, 0.002246046904474497, 0.000707089900970459, 0.0007333471439778805, 0.0008642009343020618, 0.0015113954432308674, 0.0007873732829466462, 0.0013411331456154585, 0.0006565884104929864, 0.0008649712544865906, 0.0006899202126078308, 0.0008406497654505074, 0.0008633116958662868, 0.0007191066397354007, 0.003951699007302523, 0.000654247181955725, 0.0007166549912653863, 0.0014844671823084354, 0.0007408857345581055, 0.0011856462806463242, 0.019207417964935303, 0.0006114941206760705, 0.0007381741888821125, 0.0012315917992964387, 0.0017470804741606116, 0.0013856197474524379, 0.01581624709069729, 0.0007257481920532882, 0.0009610237320885062, 0.0009889269713312387, 0.004769060295075178, 0.0009090214152820408, 0.000706243677996099, 0.0011753332801163197, 0.0008937781094573438, 0.0006814165390096605, 0.0008523806463927031, 0.0022930577397346497, 0.0007369645754806697, 0.0008018799708224833, 0.0006910990341566503, 0.0018833131762221456, 0.0006701138918288052, 0.0006622318178415298, 0.0010191653855144978, 0.0008541331044398248, 0.009397018700838089, 0.0010878480970859528, 0.0007930093561299145, 0.0009664559038355947, 0.009856481105089188, 0.000732805987354368, 0.0033852336928248405, 0.15323714911937714, 0.0006597884348593652, 0.014927082695066929, 0.0017528078751638532, 0.002459327457472682, 0.0006460557924583554, 0.0006129406974650919, 0.0010208941530436277, 0.7406563758850098, 0.008086149580776691, 0.006937324069440365, 0.0007533610914833844, 0.0006942416075617075, 0.0011938579846173525, 0.0009562119957990944, 0.0012654189486056566, 0.0007482218788936734, 0.013639786280691624, 0.0012254554312676191, 0.0010762945748865604, 0.0006206813850440085, 0.0028509192634373903, 0.0009482729365117848, 0.0011203351896256208, 0.002222765004262328, 0.0006987355882301927, 0.001431083190254867, 0.0010031114798039198, 0.03903607279062271, 0.0015621485654264688, 0.0010923175141215324, 0.0010781479068100452, 0.001618782407604158, 0.0011085586156696081, 0.001710168900899589, 0.0020589600317180157, 0.0006531410617753863, 0.001691112294793129, 0.001736267120577395, 0.0026153067592531443, 0.0015686549013480544, 0.0011760768247768283, 0.0022473155986517668, 0.010385289788246155, 0.0007966149132698774, 0.0007391198887489736, 0.00172246468719095, 0.0008961986750364304, 0.0006663240492343903, 0.0007609163876622915, 0.0006649154238402843, 0.0007891576387919486, 0.0007381249452009797, 0.022659296169877052, 0.0006164181977510452, 0.000638491241261363, 0.008832047693431377, 0.0023736930452287197, 0.0008036293438635767, 0.5297693014144897, 0.0014425581321120262, 0.0006411679787561297, 0.25761619210243225, 0.0006299542728811502, 0.00083570322021842, 0.0011783413356170058, 0.0007588096195831895, 0.0007968104328028858, 0.0014451424358412623, 0.00197928911074996, 0.009804246947169304, 0.01017087697982788, 0.0025488687679171562, 0.009351846762001514, 0.001084682997316122, 0.0005674065323546529, 0.001146351103670895, 0.018688993528485298, 0.003604609752073884, 0.002778676338493824, 0.0008040645043365657, 0.0007004928193055093, 0.0011310945264995098, 0.0012354578357189894, 0.0009425145690329373, 0.00090127281146124, 0.0011284680804237723, 0.0007667106110602617, 0.03168753907084465, 0.0008258384768851101, 0.0006726976134814322, 0.002043864456936717, 0.001836255774833262, 0.0007540772203356028, 0.0008821930969133973, 0.0020580824930220842, 0.014249525964260101, 0.0027080276049673557, 0.025589611381292343, 0.0007102004601620138, 0.0006985721411183476, 0.0005779496277682483, 0.005472649820148945, 0.38641130924224854, 0.0022352279629558325, 0.001237379852682352, 0.002896806923672557, 0.0010620160028338432, 0.0010397210717201233, 0.001296044560149312, 0.004452826920896769, 0.0009654546156525612, 0.03194989636540413, 0.0010649007745087147, 0.0024918161798268557, 0.0006712442846037447, 0.0008090370101854205, 0.000852815224789083, 0.0012033776147291064, 0.0008286154479719698, 0.0008829369326122105, 0.000662997190374881, 0.0012043098686262965, 0.004092787858098745, 0.0008218137081712484, 0.0007278145058080554, 0.0017685663187876344, 0.0008001266396604478, 0.0007639151299372315, 0.0006806415040045977, 0.0007470032433047891, 0.001072149956598878, 0.0015763764968141913, 0.0007534816977567971, 0.0011722669005393982, 0.001152894925326109, 0.0008365452522411942, 0.0008235556306317449, 0.02775326557457447, 0.000959782162681222, 0.002732599852606654, 0.0013018021127209067, 0.0006775847868993878, 0.0007174391648732126, 0.0011109043844044209, 0.0008024116395972669, 0.0007822854095138609, 0.014515449292957783, 0.001591651001945138, 0.013528075069189072, 0.0009581566555425525, 0.0008924361900426447, 0.002832378726452589, 0.0014923056587576866, 0.0010757456766441464, 0.008059242740273476, 0.0030580232851207256, 0.0018464080058038235, 0.0007565474370494485, 0.001370245823636651, 0.0008908063173294067, 0.0030580232851207256, 0.0008826677803881466, 0.0017652518581598997, 0.0013075791066512465, 0.0010183121776208282, 0.0014642076566815376, 0.0014323885552585125, 0.0012474058894440532, 0.0012848887126892805, 0.0008405308471992612, 0.005778851918876171, 0.0028989564161747694, 0.007748798932880163, 0.0017145127058029175, 0.0007827690569683909, 0.025468774139881134, 0.0021110514644533396, 0.0008272249833680689, 0.0011060712859034538, 0.002778001595288515, 0.0008409914444200695, 0.03899593651294708, 0.0011156629770994186, 0.0018967331852763891, 0.0006254212348721921, 0.0012764947023242712, 0.0007447333773598075, 0.008782096207141876, 0.0007732718368060887, 0.0007119098445400596, 0.0284137986600399, 0.0007873905124142766, 0.000963100406806916, 0.004164782352745533, 0.018505148589611053, 0.020888812839984894, 0.043180596083402634, 0.0013737718109041452, 0.0009779977845028043, 0.0013694108929485083, 0.02345087192952633, 0.0005953724030405283, 0.001519208773970604, 0.1102316603064537, 0.0007464076625183225, 0.0014020550297573209, 0.0006418903358280659, 0.000830664939712733, 0.0009565700893290341, 0.004372346680611372, 0.0007382410112768412, 0.0010425752261653543, 0.0006676713819615543, 0.0007379343151114881, 0.0006881344015710056, 0.03397631645202637, 0.0093455221503973, 0.0009240901563316584, 0.0008047205628827214, 0.11906462907791138, 0.8193272948265076, 0.0013694108929485083, 0.0020657051354646683, 0.0012734223855659366, 0.002728414488956332, 0.0006335190264508128, 0.049971435219049454, 0.0009369271574541926, 0.0013451382983475924, 0.0010921915527433157, 0.0028009340167045593, 0.16875387728214264, 0.0008393263560719788, 0.01978360116481781, 0.00112774851731956, 0.0014473680639639497, 0.0008371633593924344, 0.0006571142585016787, 0.0016822682227939367, 0.0035474759060889482, 0.0005819338839501143, 0.0010332803940400481, 0.0027663602959364653, 0.0006141985068097711, 0.0006573155988007784, 0.0018591133411973715, 0.0034530097618699074, 0.000710330787114799, 0.006740374490618706, 0.0024126949720084667, 0.003582994919270277, 0.0011765608796849847, 0.0008989553898572922, 0.0007859597681090236, 0.013208848424255848, 0.83805251121521, 0.0016044314252212644, 0.00230816169641912, 0.0007699885754846036, 0.0009378666873089969, 0.0007635734509676695, 0.0011850360315293074, 0.4348942041397095, 0.0006763573619537055, 0.0016370418015867472, 0.0006545886863023043, 0.18912629783153534, 0.1081351637840271, 0.0015639376360923052, 0.001482341205701232, 0.0008596854167990386, 0.0013706276658922434, 0.01279321126639843, 0.10016026347875595, 0.04317905008792877, 0.0006354383076541126, 0.0047302814200520515, 0.00069935352075845, 0.0007681751158088446, 0.0006150212720967829, 0.000664008257444948, 0.27319324016571045, 0.000621636922005564, 0.0013078469783067703, 0.3226717710494995, 0.0016199032543227077, 0.0008351149735972285, 0.0038955681957304478, 0.0009118149755522609, 0.001007450046017766, 0.006015356630086899, 0.0008522075950168073, 0.015222208574414253, 0.0006602954817935824, 0.022293034940958023, 0.001044618315063417, 0.0015271359588950872, 0.004103569779545069, 0.0005834589246660471, 0.0011194241233170033, 0.03892005234956741, 0.23318374156951904, 0.8910244703292847, 0.0012842427240684628, 0.0019136144546791911, 0.0009080319432541728, 0.0015470682410523295, 0.0008068582974374294, 0.006026411894708872, 0.0015433126827701926, 0.0006687167333438993, 0.0005929487524554133, 0.0009790610056370497, 0.0008130818023346364, 0.03560745343565941, 0.0032335540745407343, 0.0010078493505716324, 0.0013951793080195785, 0.0010446666274219751, 0.0007176411454565823, 0.0017831603763625026, 0.0008223542245104909, 0.0010052304714918137, 0.008433643728494644, 0.006419158540666103, 0.0014808571431785822, 0.0007778794970363379, 0.0006546913064084947, 0.0018965337658300996, 0.0007338931318372488, 0.0017807547701522708, 0.000559941167011857, 0.0005306473467499018, 0.000731361098587513, 0.000993593828752637, 0.3497658371925354, 0.006376343313604593, 0.0006862999289296567, 0.012155636213719845, 0.0007912216242402792, 0.001188834896311164, 0.0012270211009308696, 0.0006503118202090263, 0.07519442588090897, 0.0006205385434441268, 0.08205126971006393, 0.02414144016802311, 0.022635426372289658, 0.0008779796771705151, 0.0006892412784509361, 0.0019233202328905463, 0.002453731605783105, 0.000992120592854917, 0.0008845047559589148, 0.0016158251091837883, 0.0012861350551247597, 0.0007800938910804689, 0.009302837774157524, 0.0007738095591776073, 0.001399749657139182, 0.0011480696266517043, 0.02802746556699276, 0.020347103476524353, 0.17805048823356628, 0.000777644629124552, 0.0008151344954967499, 0.026694584637880325, 0.0011681313626468182, 0.0012151673436164856, 0.0007072149310261011, 0.0007453347207047045, 0.006191050633788109, 0.000815822568256408, 0.9024844169616699, 0.0008186400518752635, 0.0008991456707008183, 0.0006601293571293354, 0.002126409439370036, 0.024933721870183945, 0.0006818355177529156, 0.006785216275602579, 0.005093461833894253, 0.001046329503878951, 0.0013158890651538968, 0.08386131376028061, 0.22269457578659058, 0.0010480053024366498, 0.0026936247013509274, 0.002084474079310894, 0.01192016527056694, 0.000634308613371104, 0.0014942986890673637, 0.10498738288879395, 0.0010501526994630694, 0.004396024625748396, 0.0008571558864787221, 0.0007175122736953199, 0.013375218026340008, 0.0021984074264764786, 0.06421399861574173, 0.0008507618331350386, 0.0006854090606793761, 0.00125913938973099, 0.044893763959407806, 0.000637871737126261, 0.018854988738894463, 0.0012044899631291628, 0.0011949536856263876, 0.0007919061463326216, 0.0008807833073660731, 0.013566226698458195, 0.0018205062951892614, 0.001066328608430922, 0.4898599088191986, 0.0005707344389520586, 0.0007114869658835232, 0.0005415548221208155, 0.0008046270813792944, 0.01041387114673853, 0.0013815100537613034, 0.0026777656748890877, 0.0023018254432827234, 0.0016001451294869184, 0.0012941634049639106, 0.0015304784756153822, 0.0007621492841280997, 0.004141560290008783, 0.007628816179931164, 0.0007078369380906224, 0.010062461718916893, 0.0008187652565538883, 0.0008411745657213032, 0.00663399463519454, 0.007881962694227695, 0.0015040196012705564, 0.005975181702524424, 0.13170874118804932, 0.047241900116205215, 0.0008665182976983488, 0.0010192124173045158, 0.0008003692491911352, 0.0034161570947617292, 0.0006390141788870096, 0.0010963906534016132, 0.000970314780715853, 0.0009737960644997656, 0.0014202941674739122, 0.00078516302164644, 0.0006969748646952212, 0.010453685186803341, 0.0007310563232749701, 0.007564361207187176, 0.0007463180227205157, 0.9148178696632385, 0.009229074232280254, 0.0006998516037128866, 0.006313913036137819, 0.24651721119880676, 0.0967799574136734, 0.000836930877994746, 0.17998060584068298, 0.0007604648126289248, 0.0008225144702009857, 0.0012908574426546693, 0.0013606195570901036, 0.060049861669540405, 0.048977140337228775, 0.0030154569540172815, 0.0008463039994239807, 0.029660703614354134, 0.750423789024353, 0.002535546664148569, 0.0007644413271918893, 0.0006448614876717329, 0.001847152365371585, 0.001414489233866334, 0.0014534370275214314, 0.0015022697625681758, 0.03125108405947685, 0.009413318708539009, 0.15165182948112488, 0.0007223223219625652, 0.0006756123038940132, 0.057372383773326874, 0.0006635455647483468, 0.0010104451794177294, 0.0006689857109449804, 0.0010396403959020972, 0.0008955951780080795, 0.027910519391298294, 0.0012333561899140477, 0.0008758936310186982, 0.001236389041878283, 0.0039036644157022238, 0.011424927972257137, 0.0008769296109676361, 0.0006530025275424123, 0.0007326928316615522, 0.0011676179710775614, 0.0007776479469612241, 0.0006445079343393445, 0.0032594134099781513, 0.0006323107518255711, 0.0007231188355945051, 0.0014446924906224012, 0.02850131317973137, 0.11388104408979416, 0.0016877474263310432, 0.002820136258378625, 0.15859805047512054, 0.26982468366622925, 0.0008807098492980003, 0.0082389609888196, 0.13702861964702606, 0.0007741476874798536, 0.0007973485626280308, 0.01433346513658762, 0.0008506487356498837, 0.0005810551228933036, 0.0008671657997183502, 0.0008752129506319761, 0.0008851033635437489, 0.0006879619904793799, 0.07107530534267426, 0.015133059583604336, 0.0014410190051421523, 0.017185717821121216, 0.0018805582076311111, 0.0006557138403877616, 0.0008066414739005268, 0.0007440350018441677, 0.0289576668292284, 0.0023472770117223263, 0.0013164323754608631, 0.01591329090297222, 0.0006773752393200994, 0.0012589877005666494, 0.0010817385045811534, 0.0071361130103468895, 0.004544664174318314, 0.0010918659390881658, 0.006008902098983526, 0.0030843429267406464, 0.000581038766540587, 0.0009347866289317608, 0.0008566202595829964, 0.009566864930093288, 0.0006819046684540808, 0.019896509125828743, 0.005687071476131678, 0.4358421266078949, 0.0190654918551445, 0.0006098431767895818, 0.0029277547728270292, 0.12211925536394119, 0.008246059529483318, 0.0013307210756465793, 0.0009462779271416366, 0.05763743817806244, 0.0011884220875799656, 0.000654035247862339, 0.002239455934613943, 0.0016405265778303146, 0.002061522798612714, 0.002877427265048027, 0.13987217843532562, 0.004028741270303726, 0.0010534869506955147, 0.04461628198623657, 0.0013232884230092168, 0.0009911243105307221, 0.0012584686046466231, 0.7500816583633423, 0.012787563726305962, 0.0023133479990065098, 0.0008008487056940794, 0.0008849338628351688, 0.0006798532558605075, 0.0013114335015416145, 0.0009084801422432065, 0.0006482604658231139, 0.002327070338651538, 0.0006853038212284446, 0.011060377582907677, 0.006538434885442257, 0.001907114521600306, 0.07887620478868484, 0.008703901432454586, 0.013026539236307144, 0.0011495162034407258, 0.0014731986448168755, 0.04021686315536499, 0.0008138725534081459, 0.0009483036701567471, 0.0011889481684193015, 0.0011084482539445162, 0.03986001014709473, 0.0006385925807990134, 0.026972876861691475, 0.011121074669063091, 0.0007536170887760818, 0.0009915842674672604, 0.0007859721663407981, 0.0006150912959128618, 0.0015845131129026413, 0.0008168825297616422, 0.004088318441063166, 0.000854803598485887, 0.018329979851841927, 0.0016525553073734045, 0.000854695332236588, 0.0018729779403656721, 0.001359222107566893, 0.0007602528785355389, 0.000844560272525996, 0.003416988532990217, 0.0011636745184659958, 0.0014857463538646698, 0.0023685821797698736, 0.0012738724472001195, 0.0014479373348876834, 0.0321391224861145, 0.00227944552898407, 0.34583333134651184, 0.14976273477077484, 0.04608526453375816, 0.0026332626584917307, 0.009733396582305431, 0.0006487657665275037, 0.0007174086640588939, 0.000749458558857441, 0.001695494051091373, 0.0007854687282815576, 0.0010151761816814542, 0.0006716887000948191, 0.0017500618705525994, 0.0007218089886009693, 0.000760229304432869, 0.005650738254189491, 0.0029428238049149513, 0.0008338005864061415, 0.008806096389889717, 0.0016785869374871254, 0.0009622349753044546, 0.0008813042077235878, 0.06992428749799728, 0.0006175905000418425, 0.001217636396177113, 0.4358309805393219, 0.0005895461072213948, 0.01452326774597168, 0.010209791362285614, 0.0011146425968036056, 0.0008806557743810117, 0.0016402417095378041, 0.0006271369638852775, 0.0009152975399047136, 0.0010005754884332418, 0.010267715901136398, 0.06200966611504555, 0.0015264221001416445, 0.0007603467092849314, 0.0009071195963770151, 0.7650257349014282, 0.0020694781560450792, 0.0006291188183240592, 0.001169321476481855, 0.0008292616112157702, 0.007925746962428093, 0.0006335899233818054, 0.00547241885215044, 0.24933847784996033, 0.002437534974887967, 0.001195948338136077, 0.01447268296033144, 0.000644545943941921, 0.011157377623021603, 0.0007446737727150321, 0.0012914736289530993, 0.004682255443185568, 0.001183793880045414, 0.000942048616707325, 0.010699460282921791, 0.0012007259065285325, 0.0025640372186899185, 0.0009743287228047848, 0.0017425473779439926, 0.006798101123422384, 0.0027885427698493004, 0.0007069715647958219, 0.45151570439338684, 0.007215090095996857, 0.0006564585492014885, 0.0008903408306650817, 0.0015702187083661556, 0.001113705919124186, 0.0020782926585525274, 0.0008715250296518207, 0.009612017311155796, 0.0008527051541022956, 0.0015877510886639357, 0.005149463191628456, 0.008045234717428684, 0.0008002917747944593, 0.007060354109853506, 0.0018581447657197714, 0.003339750226587057, 0.07410681247711182, 0.0013178499648347497, 0.018760526552796364, 0.0008381993975490332, 0.28748226165771484, 0.0008145447354763746, 0.0007770549273118377, 0.000821452762465924, 0.0009546012151986361, 0.001158106722868979, 0.0023825783282518387, 0.0057376897893846035, 0.000732630433049053, 0.0006374636432155967, 0.001299452967941761, 0.0007628363673575222, 0.0009766881121322513, 0.0007101348601281643, 0.0006581207853741944, 0.0012597691966220737, 0.0008143402519635856, 0.0006850073696114123, 0.03263126313686371, 0.06689420342445374, 0.0007752982783131301, 0.000703432597219944, 0.0007341169402934611, 0.0007661686395294964, 0.6956706643104553, 0.018145523965358734, 0.14889325201511383, 0.00277737807482481, 0.3816339373588562, 0.0005792591255158186, 0.0006784888100810349, 0.0014316930901259184, 0.0005798308411613107, 0.0009359777322970331, 0.0008127359906211495, 0.0010285739554092288, 0.0009749583550728858, 0.09860511869192123, 0.0008199464646168053, 0.0006759620155207813, 0.06880438327789307, 0.09394127130508423, 0.0011806744150817394, 0.0011023391271010041, 0.002354181371629238, 0.006521758157759905, 0.0018235467141494155, 0.02483431249856949, 0.0006362591520883143, 0.0015524878399446607, 0.06857908517122269, 0.000758149370085448, 0.009846006520092487, 0.00081133923958987, 0.0013748443452641368, 0.000824367452878505, 0.000955902214627713, 0.000909358321223408, 0.0007184818387031555, 0.0009730726596899331, 0.9788908362388611, 0.0009293659240938723, 0.0016102989902719855, 0.0006903608446009457, 0.0007464076625183225, 0.0009171784040518105, 0.003935530316084623, 0.0011017470387741923, 0.0005453351186588407, 0.0014673992991447449, 0.0005918110255151987, 0.0029977532103657722, 0.0006783908465877175, 0.0017680536257103086, 0.0046736993826925755, 0.12317397445440292, 0.06455737352371216, 0.0006854341481812298, 0.0012118350714445114, 0.0007176152430474758, 0.12146005034446716, 0.015304917469620705, 0.008307555690407753, 0.0012027793563902378, 0.000771266408264637, 0.001236919080838561, 0.0011751423589885235, 0.0012388993054628372, 0.0010376627324149013, 0.05092112720012665, 0.08221852779388428, 0.012388830073177814, 0.0016455998411402106, 0.0395919606089592, 0.01664072461426258, 0.001126479939557612, 0.0006083318730816245, 0.00131699547637254, 0.0006787788588553667, 0.0035628746263682842, 0.0008844971307553351, 0.0017647225176915526, 0.0008754497393965721, 0.10339900106191635, 0.05562834069132805, 0.0013458706671372056, 0.29952722787857056, 0.008056292310357094, 0.001490033115260303, 0.0012396335368975997, 0.0011790409917011857, 0.0008843180839903653, 0.0005788948619738221, 0.007579615339636803, 0.0014208285138010979, 0.004475187510251999, 0.005078805144876242, 0.12556225061416626, 0.0026104592252522707, 0.31117790937423706, 0.01292815525084734, 0.0010446666274219751, 0.0030460215639322996, 0.0010376627324149013, 0.001101903966628015, 0.0008433865732513368, 0.0007985849515534937, 0.0017512417398393154, 0.000981779769062996, 0.08129377663135529, 0.9681918621063232, 0.0009939768351614475, 0.0008256657747551799, 0.0007681004353798926, 0.008398700505495071, 0.000908565882127732, 0.0011013724142685533, 0.0035788756795227528, 0.0008736652671359479, 0.0008213028777390718, 0.0028488512616604567, 0.001131837721914053, 0.6415897011756897, 0.0019794097170233727, 0.001377516775391996, 0.0008379885694012046, 0.0006041914457455277, 0.002301204716786742, 0.0019817037973552942, 0.00510795135051012, 0.0017338646575808525, 0.0007718399283476174, 0.0006808559992350638, 0.0006686609704047441, 0.057372383773326874, 0.001106458599679172, 0.03260764107108116, 0.001520269550383091, 0.0021482021547853947, 0.0007202591514214873, 0.0009771176846697927, 0.0006836297106929123, 0.0007660865085199475, 0.0008486259612254798, 0.05083277449011803, 0.0006921737804077566, 0.0017607671907171607, 0.008507500402629375, 0.0012788049643859267, 0.0013318430865183473, 0.0009818030521273613, 0.029240688309073448, 0.002509081270545721, 0.0006384288426488638, 0.007583081256598234, 0.0006236551562324166, 0.05963783338665962, 0.03863881900906563, 0.009318170137703419, 0.0006414338131435215, 0.006803283002227545, 0.0006625161622650921, 0.0030354647897183895, 0.0018978167790919542, 0.10105136036872864, 0.003973782993853092, 0.0024626520462334156, 0.00107972149271518, 0.002377179218456149, 0.002244078554213047, 0.00833792332559824, 0.0011534375371411443, 0.0018504082690924406, 0.0006805646698921919, 0.0006601862842217088, 0.0013469804544001818, 0.0009638962219469249, 0.0006782185519114137, 0.0010635360376909375, 0.0018858433468267322, 0.008568220771849155, 0.0010195422219112515, 0.0011189805809408426, 0.002237255685031414, 0.0015960513846948743, 0.0007261386490426958, 0.0008450419991277158, 0.01161240879446268, 0.0007826440851204097, 0.0006754069472663105, 0.0014106640592217445, 0.0006687867571599782, 0.0006479735602624714, 0.0015144965145736933, 0.005201949737966061, 0.0009730925667099655, 0.0006591728306375444, 0.0027857478708028793, 0.03771613910794258, 0.0044553535990417, 0.0028302662540227175, 0.017105573788285255, 0.0006530865794047713, 0.0009385424200445414, 0.0010697504039853811, 0.0006968025118112564, 0.004206832032650709, 0.0022326631005853415, 0.0005894938949495554, 0.0012292835162952542, 0.014574564062058926, 0.0009374190121889114, 0.0010333871468901634, 0.000783787458203733, 0.0014186117332428694, 0.000816029089037329, 0.02733493037521839, 0.044980380684137344, 0.0015044579049572349, 0.0007548029534518719, 0.0009163577342405915, 0.000776428438257426, 0.0006963873165659606, 0.005547249224036932, 0.0019904617220163345, 0.0135424192994833, 0.003106048097833991, 0.004448713269084692, 0.0008627664064988494, 0.0008363795932382345, 0.003480131970718503, 0.0012108439113944769, 0.0009312876500189304, 0.0007437234744429588, 0.0008709605899639428, 0.0005616738926619291, 0.002049199305474758, 0.000606903457082808, 0.0010184834245592356, 0.022678488865494728, 0.001077826484106481, 0.004833821207284927, 0.0012515062699094415, 0.002718763193115592, 0.0007532767485827208, 0.000872873526532203, 0.002653825329616666, 0.0006292603211477399, 0.00693090446293354, 0.0008635757840238512, 0.0006136291776783764, 0.000870768039021641, 0.004569550044834614, 0.0007544563268311322, 0.0006775589426979423, 0.0007502813823521137, 0.0007092329324223101, 0.0009677056805230677, 0.0010107523994520307, 0.0017234317492693663, 0.0007952137384563684, 0.021020397543907166, 0.0007010297267697752, 0.0012336381478235126, 0.0007919072522781789, 0.0007412811974063516, 0.000834629638120532, 0.0010724840685725212, 0.0009634785237722099, 0.0035733026452362537, 0.001272637746296823, 0.806420624256134, 0.0008721302729099989, 0.04795486107468605, 0.004088318441063166, 0.002973945112898946, 0.0007373539847321808, 0.0011075541842728853, 0.0013130102306604385, 0.0014738580211997032, 0.007765267509967089, 0.013323492370545864, 0.003898399882018566, 0.0009702302049845457, 0.06876512616872787, 0.3527442216873169, 0.40048959851264954, 0.0010040246415883303, 0.0007719355635344982, 0.0007882132777012885, 0.0005697498563677073, 0.0007769886869937181, 0.009102065116167068, 0.0009737960644997656, 0.004022178240120411, 0.028198309242725372, 0.03194383531808853, 0.0027689121197909117, 0.0017842664383351803, 0.00850003957748413, 0.0019242027774453163, 0.0007771156379021704, 0.0011920848628506064, 0.0007765208720229566, 0.0006361896521411836, 0.001832784153521061, 0.0009571822010912001, 0.0024150926619768143, 0.0006292957114055753, 0.04417360574007034, 0.01584848389029503, 0.0007131460006348789, 0.0007881644414737821, 0.0014451424358412623, 0.0019655246287584305, 0.000882468419149518, 0.0008121201535686851, 0.0006438850541599095, 0.0006573080900125206, 0.33992335200309753, 0.000821043795440346, 0.0008504890720359981, 0.0008403798565268517, 0.0006848285556770861, 0.0015751199098303914, 0.0007624021382071078, 0.0006282999529503286, 0.014350897632539272, 0.01657906174659729, 0.0080238226801157, 0.000821043795440346, 0.0009062923491001129, 0.0006301581743173301, 0.0007422304479405284, 0.0008553645457141101, 0.000971701112575829, 0.0008167034829966724, 0.0007313876412808895, 0.0006539963069371879, 0.017787069082260132, 0.000742102216463536, 0.0007375848945230246, 0.03751383721828461, 0.0007511270814575255, 0.00067382917040959, 0.0005912489141337574, 0.0005950709455646574, 0.0009320105309598148, 0.0007411834085360169, 0.001008749008178711, 0.001954119885340333, 0.03546078875660896, 0.0006974522839300334, 0.0016221451805904508, 0.001524677500128746, 0.008068197406828403, 0.0019808721262961626, 0.0009462720481678843, 0.09862974286079407, 0.0006869998178444803, 0.0024688353296369314, 0.0019005880458280444, 0.11815343052148819, 0.002894928678870201, 0.0006615804741159081, 0.0006243537063710392, 0.0007175212376751006, 0.0008429595618508756, 0.000753610918764025, 0.0007199945976026356, 0.0009214477031491697, 0.10319788753986359, 0.0014500466641038656, 0.36464598774909973, 0.20020540058612823, 0.0023528095334768295, 0.0007765966583974659, 0.009017790667712688, 0.0558653399348259, 0.01052164752036333, 0.0007830610848031938, 0.0005757668404839933, 0.0343472845852375, 0.0007742875022813678, 0.0008756077731959522, 0.008255247958004475, 0.002427411498501897, 0.0005826833657920361, 0.0010357886785641313, 0.0009090313105843961, 0.0011887250002473593, 0.0014239413430914283, 0.002017450286075473, 0.0006425143219530582, 0.0008101849816739559, 0.0007217329111881554, 0.0008199649164453149, 0.008585980162024498, 0.007258626166731119, 0.0013073132140561938, 0.0008393799653276801, 0.0005948469624854624, 0.0007714255480095744, 0.0011244580382481217, 0.0005754236481152475, 0.005349293351173401, 0.0007474389858543873, 0.0012369797332212329, 0.0011571390787139535, 0.002686650026589632, 0.0006487821228802204, 0.0016935071907937527, 0.13189265131950378, 0.0007556017371825874, 0.0007412624545395374, 0.00120865972712636, 0.0007327906205318868, 0.006850110366940498, 0.0038277101702988148, 0.0009079047595150769, 0.01641921140253544, 0.0014203976606950164, 0.0009488522191531956, 0.0013061707140877843, 0.0009737960644997656, 0.0009352150955237448, 0.0012603356735780835, 0.0008897649240680039, 0.000753285363316536, 0.0014323885552585125, 0.025041237473487854, 0.00120966334361583, 0.017686201259493828, 0.001393915736116469, 0.4823453724384308, 0.0010521755320951343, 0.0018041097791865468, 0.017005082219839096, 0.0008893857011571527, 0.16224893927574158, 0.03293614834547043, 0.0008314430015161633, 0.0008747706888243556, 0.004628041759133339, 0.004855670500546694, 0.0006256194319576025, 0.0006978917517699301, 0.0015618777833878994, 0.04380226880311966, 0.015158836729824543, 0.0010864549549296498, 0.18817317485809326, 0.019461560994386673, 0.0031725591979920864, 0.0009546962101012468, 0.0008977336692623794, 0.0047442070208489895, 0.0010505215032026172, 0.012612858787178993, 0.001374930958263576, 0.0166618749499321, 0.0007425099611282349, 0.0054695080034434795, 0.0016984480898827314, 0.002974201226606965, 0.0010582605609670281, 0.0008729196269996464, 0.07136621326208115, 0.0007110100705176592, 0.008778391405940056, 0.0007101091323420405, 0.0007493668235838413, 0.0010264599695801735, 0.0008785746758803725, 0.0014197092968970537, 0.0008922733250074089, 0.0022432447876781225, 0.0006843076553195715, 0.0007253792136907578, 0.0039550671353936195, 0.001022850046865642, 0.0007940312498249114, 0.001690235105343163, 0.0006616126047447324, 0.0006737469811923802, 0.0007206934387795627, 0.0030580232851207256, 0.0011827590642496943, 0.0008491072803735733, 0.0008756825118325651, 0.0007078541093505919, 0.0007603104459121823, 0.0005390504375100136, 0.0007753551471978426, 0.045468684285879135, 0.03194989636540413, 0.0009575024014338851, 0.8429604768753052, 0.0007682182476855814, 0.0007309274515137076, 0.0006458027637563646, 0.0006849323399364948, 0.0011771410936489701, 0.000760347000323236, 0.001005322439596057, 0.001152330543845892, 0.0010042708599939942, 0.0006555728614330292, 0.0006161635392345488, 0.0008790980209596455, 0.0007988281431607902, 0.10329166054725647, 0.001107245683670044, 0.2693156599998474, 0.0030063919257372618, 0.016431130468845367, 0.01632724329829216, 0.4172663688659668, 0.0007613544003106654, 0.0010301120346412063, 0.0007596014183945954, 0.000651748850941658, 0.0011693944688886404, 0.0012287941062822938, 0.0008063502609729767, 0.013856465928256512, 0.0006891056546010077, 0.009438201785087585, 0.00060819968348369, 0.9783490300178528, 0.37021565437316895, 0.000809300399851054, 0.000644489424303174, 0.13680455088615417, 0.0009398660040460527, 0.47583889961242676, 0.6989519000053406, 0.44439697265625, 0.0008057292434386909, 0.0011063768761232495, 0.021335750818252563, 0.0007196022197604179, 0.9039580821990967, 0.005507588852196932, 0.9959825277328491, 0.0009330248576588929, 0.0008386971894651651, 0.0010360359447076917, 0.0011856089113280177, 0.0007331894594244659, 0.0006982037448324263, 0.017412060871720314, 0.0007124544936232269, 0.0007682190043851733, 0.0013716357061639428, 0.034909944981336594, 0.06070690229535103, 0.0008967709727585316, 0.0032222482841461897, 0.0009964937344193459, 0.5591524839401245, 0.0006333269993774593, 0.0007117344066500664, 0.0016621493268758059, 0.0013862730702385306, 0.003084882628172636, 0.0007244155858643353, 0.0009283083491027355, 0.0017059206729754806, 0.4070475399494171, 0.45224541425704956, 0.0010842253686860204, 0.023385576903820038, 0.022285111248493195, 0.0008053070632740855, 0.0007827835506759584, 0.0008268360979855061, 0.0007535790209658444, 0.0009301960235461593, 0.06324467062950134, 0.010546652600169182, 0.0015045932959765196, 0.03462369740009308, 0.04240838810801506, 0.004727700259536505, 0.0013682902790606022, 0.001736267120577395, 0.0007846021326258779, 0.0008892547921277583, 0.0007512995507568121, 0.003984739072620869, 0.010011802427470684, 0.0006760708638466895, 0.004385585431009531, 0.000762938114348799, 0.0010893625440075994, 0.0010712045477703214, 0.07597645372152328, 0.0013537246268242598, 0.04966459795832634, 0.0007594653870910406, 0.006971277762204409, 0.04155672341585159, 0.0014568716287612915, 0.0010964004322886467, 0.007475725375115871, 0.0016158412909135222, 0.0007330263615585864, 0.011605722829699516, 0.0007422018679790199, 0.0005866955034434795, 0.0022495160810649395, 0.05134708806872368, 0.504662811756134, 0.0031124271918088198, 0.002691656583920121, 0.0006861917208880186, 0.0013960773358121514, 0.00514069851487875, 0.0010800337186083198, 0.0009880271973088384, 0.0006190207204781473, 0.0010065046371892095, 0.002927904948592186, 0.0006248629651963711, 0.123296357691288, 0.0008471111068502069, 0.0009542310144752264, 0.0010964678367599845, 0.00065863091731444, 0.24475720524787903, 0.0006397960241883993, 0.0007350273081101477, 0.15709565579891205, 0.12503720819950104, 0.002238054061308503, 0.0008385605178773403, 0.000893628632184118, 0.0006648590788245201, 0.0008419552468694746, 0.061213430017232895, 0.0013136795023456216, 0.0007231736090034246, 0.0009655530448071659, 0.002074326854199171, 0.0006899064173921943, 0.0014329917030408978, 0.000873848854098469, 0.01175872702151537, 0.0006590870907530189, 0.04588063433766365, 0.0007723865564912558, 0.006709190085530281, 0.0006695942138321698, 0.0005854055052623153, 0.0011756971944123507, 0.0011386290425434709, 0.0007047383114695549, 0.0009265940170735121, 0.0014964004512876272, 0.0009532891563139856, 0.0008690746035426855, 0.0014059338718652725, 0.8056964874267578, 0.0007676898967474699, 0.0006971014081500471, 0.0006727786967530847, 0.0010131032904610038, 0.0027507843915373087, 0.0016447956440970302, 0.000966402527410537, 0.006082011386752129, 0.0013210808392614126, 0.0016272313660010695, 0.000749149767216295, 0.001390949240885675, 0.0014784397790208459, 0.0007625747239217162, 0.0008491032058373094, 0.0012432034127414227, 0.002768617356196046, 0.003217426361516118, 0.0007774874684400856, 0.024034984409809113, 0.009815942496061325, 0.0006877518608234823, 0.000712338020093739, 0.1689351201057434, 0.14693596959114075, 0.024323906749486923, 0.000693905574735254, 0.0008327747345902026, 0.0008180860313586891, 0.0024831800255924463, 0.0007370976381935179, 0.0007323225145228207, 0.000985794118605554, 0.0008785428362898529, 0.0006959437159821391, 0.0008627565111964941, 0.0006307557341642678, 0.0008315397426486015, 0.0007955828332342207, 0.0006617362378165126, 0.033185236155986786, 0.34830302000045776, 0.0012894897954538465, 0.0006746992585249245, 0.0007527905399911106, 0.03760337829589844, 0.23626330494880676, 0.1073833778500557, 0.2588733732700348, 0.0007673754007555544, 0.0014301559422165155, 0.0009710337617434561, 0.0017094077775254846, 0.0012301421957090497, 0.029358137398958206, 0.0012636869214475155, 0.0005656424327753484, 0.001356728607788682, 0.000803539005573839, 0.004603841342031956, 0.0023740308824926615, 0.0012847376056015491, 0.0012182246427983046, 0.0022013664711266756, 0.0030588810332119465, 0.0014290109975263476, 0.0008361652144230902, 0.0013589593581855297, 0.024374384433031082, 0.005924328695982695, 0.0008719911566004157, 0.01072792336344719, 0.38308098912239075, 0.016560444608330727, 0.025471480563282967, 0.01670197769999504, 0.0013289009220898151, 0.01002577319741249, 0.0005745837697759271, 0.0009563745115883648, 0.0007371696992777288, 0.0025830359663814306, 0.019861262291669846, 0.004509918857365847, 0.07838399708271027, 0.000988231971859932, 0.0018517562421038747, 0.001244760351255536, 0.0010203541023656726, 0.0010118130594491959, 0.0070063224993646145, 0.000693727342877537, 0.9754905700683594, 0.0009396797395311296, 0.000880466541275382, 0.0061906748451292515, 0.021155256778001785, 0.002038877224549651, 0.0008983975858427584, 0.0007633523200638592, 0.06670307368040085, 0.013432007282972336, 0.0006743694539181888, 0.003338815411552787, 0.011889019049704075, 0.0009347671293653548, 0.0010197466472163796, 0.001274955808185041, 0.0017581324791535735, 0.0007413769490085542, 0.008131202310323715, 0.0005502564599737525, 0.0009165424853563309, 0.002447867766022682, 0.0009103314368985593, 0.0022142576053738594, 0.018621912226080894, 0.0015052970265969634, 0.000637771503534168, 0.0009417735273018479, 0.11544563621282578, 0.002020888263359666, 0.0016969797434285283, 0.0013039017794653773, 0.0007909709820523858, 0.0011812858283519745, 0.000620385049842298, 0.003224915824830532, 0.0012561859330162406, 0.0008089962648227811, 0.001101357163861394, 0.040210407227277756, 0.0021910748910158873, 0.001767710316926241, 0.0009725851123221219, 0.003715894650667906, 0.0014156238175928593, 0.04516725242137909, 0.5895780324935913, 0.001435914309695363, 0.02348155900835991, 0.0008523022988811135, 0.000831924844533205, 0.001539934310130775, 0.0008550606435164809, 0.0009356457157991827, 0.015603096224367619, 0.0007483263616450131, 0.0017499452224001288, 0.0025439357850700617, 0.012880682945251465, 0.00512341083958745, 0.0006119754980318248, 0.0007170796161517501, 0.0008633223478682339, 0.009421111084520817, 0.02016300894320011, 0.001022192882373929, 0.0007377750589512289, 0.01986003667116165, 0.013918894343078136, 0.007680760696530342, 0.0007520513026975095, 0.017294567078351974, 0.040653884410858154, 0.00868216808885336, 0.02693050354719162, 0.04360120743513107, 0.027515307068824768, 0.0009535113349556923, 0.00403605867177248, 0.019403522834181786, 0.0007655281806364655, 0.009515746496617794, 0.0007166547002270818, 0.0010251898784190416, 0.0006573600694537163, 0.0012056322302669287, 0.0007127557182684541, 0.021859019994735718, 0.001402052934281528, 0.0006879298598505557, 0.002518606139346957, 0.0013544332468882203, 0.013650709763169289, 0.0057493820786476135, 0.0011675490532070398, 0.11700398474931717, 0.001912019564770162, 0.014105461537837982, 0.21456174552440643, 0.0008243799675256014, 0.0007065917598083615, 0.0009330443572252989, 0.28875598311424255, 0.0007773608085699379, 0.0011086176382377744, 0.0012511380482465029, 0.0008848760044202209, 0.0008414142648689449, 0.0009591070702299476, 0.002379239536821842, 0.0009449183708056808, 0.027207085862755775, 0.0007291940273717046, 0.002197016729041934, 0.6210269927978516, 0.000876334379427135, 0.002634096657857299, 0.0012725632404908538, 0.013840335421264172, 0.8342185616493225, 0.011314302682876587, 0.054074838757514954, 0.1471497118473053, 0.00653796037659049, 0.014849076978862286, 0.016609089449048042, 0.0015600876649841666, 0.023394374176859856, 0.0006446402985602617, 0.0007210719049908221, 0.01697416789829731, 0.5648742318153381, 0.29693910479545593, 0.05807648226618767, 0.009622326120734215, 0.0008521914132870734, 0.004527505021542311, 0.07641308009624481, 0.00092050910461694, 0.0010939111234620214, 0.0006918697617948055, 0.005401586182415485, 0.0029972742777317762, 0.0007083872915245593, 0.0014749517431482673, 0.006619859486818314, 0.0020140488632023335, 0.0006722621619701385, 0.09052620083093643, 0.0006710143061354756, 0.002505830256268382, 0.0014578368281945586, 0.015766089782118797, 0.05249226838350296, 0.0009670053259469569, 0.0007966039120219648, 0.044809214770793915, 0.012940014712512493, 0.0007361689349636436, 0.0012007259065285325, 0.075513556599617, 0.004425387363880873, 0.0026833286974579096, 0.0014121163403615355, 0.00118266511708498, 0.020750954747200012, 0.0017922266852110624, 0.0010059409542009234, 0.00653479341417551, 0.000981299439445138, 0.0037824774626642466, 0.010290137492120266, 0.06344012916088104, 0.006423335522413254, 0.05027415230870247, 0.0014774398878216743, 0.015164332464337349, 0.002282034372910857, 0.016498330980539322, 0.01494783814996481, 0.001259061973541975, 0.032250791788101196, 0.0007812566473148763, 0.0013701864518225193, 0.008733640424907207, 0.0012534608831629157, 0.0016187932342290878, 0.03464601933956146, 0.0014289653627201915, 0.001685629365965724, 0.000787685508839786, 0.00553571293130517, 0.002739142393693328, 0.0008824541582725942, 0.026221241801977158, 0.0006525397184304893, 0.008579829707741737, 0.0007135280757211149, 0.00105889025144279, 0.012848183512687683, 0.0015783410053700209, 0.000874165678396821, 0.007337718736380339, 0.0019916819874197245, 0.000773350300733, 0.0007001848425716162, 0.01014090795069933, 0.0014205870684236288, 0.0019984666723757982, 0.0068640378303825855, 0.001749419723637402, 0.049404874444007874, 0.0015917395940050483, 0.0011352294823154807, 0.0005931340856477618, 0.0006602804060094059, 0.0008844613912515342, 0.022474326193332672, 0.004106384702026844, 0.011186551302671432, 0.0005913568893447518, 0.0008026103605516255, 0.0006455591064877808, 0.0010817230213433504, 0.0016557271592319012, 0.0012019685236737132, 0.01943790167570114, 0.000914932694286108, 0.009671295061707497, 0.0008825684781186283, 0.002414126880466938, 0.00262441742233932, 0.0029492597095668316, 0.0035170356277376413, 0.09099886566400528, 0.0010096547193825245, 0.0010104125831276178, 0.0007006473606452346, 0.014219711534678936, 0.5887281894683838, 0.0008149127243086696, 0.02322956547141075, 0.02121441625058651, 0.00430937297642231, 0.0010867934906855226, 0.002354204887524247, 0.0028033931739628315, 0.0007636163500137627, 0.010409695096313953, 0.0021292262244969606, 0.0008528408943675458, 0.043489959090948105, 0.0008536278619430959, 0.00276602222584188, 0.0006387325702235103, 0.0020447594579309225, 0.0042719971388578415, 0.01254824548959732, 0.0006805738084949553, 0.08959456533193588, 0.8418397307395935, 0.007593839894980192, 0.0012785710860043764, 0.009694930166006088, 0.0007365503115579486, 0.0011545483721420169, 0.004595872480422258, 0.0010897698812186718, 0.004381011240184307, 0.000665284984279424, 0.0008620120934210718, 0.0007201640983112156, 0.0677516981959343, 0.0027885427698493004, 0.0017415496986359358, 0.0025346686597913504, 0.0007714935345575213, 0.0015399826224893332, 0.0007967420970089734, 0.30305731296539307, 0.0009737960644997656, 0.0007851701229810715, 0.0008189135696738958, 0.0010901556815952063, 0.002895515412092209, 0.004081043880432844, 0.0035963761620223522, 0.000990788685157895, 0.05291514843702316, 0.0023701502941548824, 0.0034563387744128704, 0.002593382028862834, 0.005281160585582256, 0.0014176799450069666, 0.0007124544936232269, 0.15355883538722992, 0.00581884803250432, 0.0016764354659244418, 0.0007766825146973133, 0.0008925220463424921, 0.0007953103049658239, 0.15535281598567963, 0.024709554389119148, 0.001281355507671833, 0.0008228343212977052, 0.013597873970866203, 0.0031162139493972063, 0.008946968242526054, 0.027059903368353844, 0.016652315855026245, 0.114731065928936, 0.0009822199353948236, 0.0008609548676759005, 0.0007457801839336753, 0.001522745587863028, 0.0010652239434421062, 0.016101989895105362, 0.05419323965907097, 0.0014396089827641845, 0.005838446784764528, 0.04855796694755554, 0.0007455264567397535, 0.0013497646432369947, 0.001274662557989359, 0.0014249716186895967, 0.04754037782549858, 0.000890758354216814, 0.004537688568234444, 0.001969595905393362, 0.002535546664148569, 0.015471604652702808, 0.001749209826812148, 0.6428102254867554, 0.0007955862092785537, 0.0006931303068995476, 0.0010148552246391773, 0.0008745497325435281, 0.0011196304112672806, 0.0007045448874123394, 0.002888540970161557, 0.00818609818816185, 0.027946004644036293, 0.02083204686641693, 0.0012639800552278757, 0.0008987361798062921, 0.0007689126068726182, 0.011244586668908596, 0.0024242601357400417, 0.001545599545352161, 0.9785690307617188, 0.0010605539428070188, 0.06626161932945251, 0.0007842002669349313, 0.0014421502128243446, 0.021924585103988647, 0.0008520724368281662, 0.007149267476052046, 0.0006267933640629053, 0.0006099356687627733, 0.0012187823886051774, 0.0009711842285469174, 0.0007984183612279594, 0.0038288787472993135, 0.0007301786681637168, 0.0008029500604607165, 0.0006013316451571882, 0.0007438790053129196, 0.03530758246779442, 0.005632737651467323, 0.000792117090895772, 0.0011394541943445802, 0.001676343847066164, 0.01565922424197197, 0.0020568175241351128, 0.0006655006436631083, 0.0006101644248701632, 0.0008778825867921114, 0.0008268558303825557, 0.0016567615093663335, 0.017314929515123367, 0.0006162181380204856, 0.002117195865139365, 0.1218964159488678, 0.05845196545124054, 0.0020779764745384455, 0.0009308361331932247, 0.0037367672193795443, 0.018657401204109192, 0.0509195551276207, 0.0007094838074408472, 0.0012190337292850018, 0.001949987723492086, 0.0006725200801156461, 0.0005883675767108798, 0.006821521557867527, 0.0007144180126488209, 0.0049962857738137245, 0.0018374613719061017, 0.1232994943857193, 0.0020464726258069277, 0.0008471330511383712, 0.0007282384322024882, 0.0010018126340582967, 0.0008610233198851347, 0.013759063556790352, 0.001432061311788857, 0.0009721043170429766, 0.004150201100856066, 0.0006768535822629929, 0.0008276874432340264, 0.0008229840896092355, 0.0007396694854833186, 0.0018486459739506245, 0.0016230650944635272, 0.10233495384454727, 0.01194872334599495, 0.21022623777389526, 0.006303089205175638, 0.0009030603687278926, 0.3098418116569519, 0.264400839805603, 0.004198161419481039, 0.000729788385797292, 0.0014783658552914858, 0.0006404680316336453, 0.0007740898290649056, 0.0016914054285734892, 0.028673453256487846, 0.0021067806519567966, 0.0009969581151381135, 0.0048833126202225685, 0.0007114838808774948, 0.0011095295194536448, 0.0005553857190534472, 0.0007214389625005424, 0.0008260671165771782, 0.019424760714173317, 0.0007765634218230844, 0.018556421622633934, 0.5256894826889038, 0.0314025916159153, 0.15621154010295868, 0.009177006781101227, 0.001165134715847671, 0.0008981481078080833, 0.0009662386146374047, 0.0006881606532260776, 0.001258807722479105, 0.001204164233058691, 0.03372771665453911, 0.016415569931268692, 0.0006307136500254273, 0.00075356854358688, 0.0013477189932018518, 0.0009450142970308661, 0.0011291868286207318, 0.002385109430179, 0.001290605403482914, 0.0014624031027778983, 0.0009048355277627707, 0.07296890020370483, 0.005845305975526571, 0.0016441644402220845, 0.001161200925707817, 0.0010043034562841058, 0.008150742389261723, 0.003185692010447383, 0.0019274168880656362, 0.002455206122249365, 0.0007323016179725528, 0.03242303803563118, 0.0023777876049280167, 0.0013226463925093412, 0.004069789778441191, 0.4702553153038025, 0.0012007259065285325, 0.000925239350181073, 0.0018515720730647445, 0.01518433541059494, 0.0009357432718388736, 0.0023245089687407017, 0.0007685298332944512, 0.006280809175223112, 0.000896525802090764, 0.16154764592647552, 0.09202302247285843, 0.0007144180126488209, 0.011747566983103752, 0.01111222617328167, 0.0006721901590935886, 0.00862062443047762, 0.0006725265411660075, 0.7358386516571045, 0.0005932417698204517, 0.0019098405027762055, 0.06705358624458313, 0.0009805986192077398, 0.004893456120043993, 0.0007632235647179186, 0.0014623863389715552, 0.0017656259005889297, 0.03696043789386749, 0.002038184553384781, 0.04209509864449501, 0.003504728665575385, 0.000677538278978318, 0.0009118900634348392, 0.0009239862556569278, 0.000695318914949894, 0.0008850953308865428, 0.008317154832184315, 0.0012089353986084461, 0.0013847931986674666, 0.02488817647099495, 0.0007248395122587681, 0.0015680358046665788, 0.0005688791861757636, 0.0012878805864602327, 0.0006329896859824657, 0.0013319123536348343, 0.0008018295629881322, 0.0007602546247653663, 0.12635140120983124, 0.04789742827415466, 0.0009563558851368725, 0.003494442207738757, 0.07517959922552109, 0.0025847097858786583, 0.0007971217855811119, 0.00129245116841048, 0.0012341458350419998, 0.00633256696164608, 0.0007430285331793129, 0.0005945218726992607, 0.0009076508576981723, 0.0010092714801430702, 0.0028598159551620483, 0.0012542359763756394, 0.0008503926801495254, 0.003929775673896074, 0.003573460504412651, 0.0005957848043181002, 0.8456553220748901, 0.007903738878667355, 0.0008014441700652242, 0.006480776704847813, 0.0006144014187157154, 0.0007077350746840239, 0.0008241149480454624, 0.0021488440688699484, 0.005309847183525562, 0.0020785003434866667, 0.0006787859601899981, 0.0005492715863510966, 0.0018006439786404371, 0.0006122689228504896, 0.000966205436270684, 0.002222623210400343, 0.0034189356956630945, 0.2454981803894043, 0.0015123354969546199, 0.21852576732635498, 0.016218408942222595, 0.0029688060749322176, 0.0015572217525914311, 0.12137158960103989, 0.0015743423718959093, 0.0015499901492148638, 0.0015600139740854502, 0.0017656291602179408, 0.0025365345645695925, 0.003704083850607276, 0.019290270283818245, 0.00312374671921134, 0.0012084805639460683, 0.01420409232378006, 0.01156135369092226, 0.0014221030287444592, 0.001271704793907702, 0.0008119039121083915, 0.017820490524172783, 0.008737574331462383, 0.000777735433075577, 0.0018057464621961117, 0.04283493012189865, 0.0009730142774060369, 0.0007848379900678992, 0.07186788320541382, 0.0007793386466801167, 0.0007818163721822202, 0.0005782005609944463, 0.0009724859846755862, 0.014171958900988102, 0.010814633220434189, 0.000783258059527725, 0.0008478767122142017, 0.001387011376209557, 0.0016336473636329174, 0.006142223719507456, 0.0012164830695837736, 0.06562517583370209, 0.0021071394439786673, 0.0019827017094939947, 0.19123180210590363, 0.916232705116272, 0.0017222523456439376, 0.3578675091266632, 0.8775147199630737, 0.0007506232941523194, 0.49327901005744934, 0.36329275369644165, 0.0008565712487325072, 0.23039069771766663, 0.8776670098304749, 0.0007557036587968469, 0.0005536359967663884, 0.02572632022202015, 0.00223932066000998, 0.03913204371929169, 0.002233233768492937, 0.000997641822323203, 0.004556779749691486, 0.0006715529598295689, 0.0007740898290649056, 0.0009764269925653934, 0.0011489158496260643, 0.0009549540700390935, 0.0010101179359480739, 0.0015159371541813016, 0.0005858612130396068, 0.00968091282993555, 0.0007101318333297968, 0.0009710597805678844, 0.0007708328776061535, 0.0017300613690167665, 0.0007476933533325791, 0.8194428086280823, 0.0006964781787246466, 0.0006937399739399552, 0.0011013724142685533, 0.13643382489681244, 0.001903487485833466, 0.4581138491630554, 0.005333773326128721, 0.001292277593165636, 0.001060090260580182, 0.13711224496364594, 0.0009964685887098312, 0.0043679880909621716, 0.772471010684967, 0.0009620773489587009, 0.0010276174871250987, 0.015668649226427078, 0.0016907195094972849, 0.0009597383323125541, 0.22368867695331573, 0.0013217133237048984, 0.002357805846258998, 0.0011349563719704747, 0.001171015202999115, 0.001088227261789143, 0.0008796259062364697, 0.000704804842825979, 0.0009079938172362745, 0.0028753113001585007, 0.0008881801622919738, 0.03646114468574524, 0.13359881937503815, 0.010759877040982246, 0.00852294359356165, 0.27496978640556335, 0.0007889298140071332, 0.004246314521878958, 0.0005997695843689144, 0.0005813700845465064, 0.0006699676741845906, 0.011503977701067924, 0.001507394015789032, 0.4524272382259369, 0.6215024590492249, 0.0006652777083218098, 0.0008610810618847609, 0.0008606111514382064, 0.0005752245779149234, 0.0007086529512889683, 0.0007346530328504741, 0.09506700187921524, 0.0013497646432369947, 0.0006321640103124082, 0.2372479885816574, 0.0007473222212865949, 0.0010473212460055947, 0.019321024417877197, 0.022179847583174706, 0.001798994024284184, 0.0009837928228080273, 0.0040965876542031765, 0.0008726684609428048, 0.0009279838413931429, 0.0008210109663195908, 0.0024626520462334156, 0.002115563489496708, 0.0013244925066828728, 0.000628962938208133, 0.018057432025671005, 0.00120207155123353, 0.016927557066082954, 0.03543832525610924, 0.0006836788961663842, 0.0017943264683708549, 0.0011560373241081834, 0.0008055361686274409, 0.0006634424789808691, 0.001782808220013976, 0.0008914039935916662, 0.0008610282093286514, 0.0011002827668562531, 0.9138368964195251, 0.000838861393276602, 0.0007168985903263092, 0.0019474622095003724, 0.0008672716794535518, 0.0013382203178480268, 0.00101998180616647, 0.0030482637230306864, 0.0015209211269393563, 0.003280336270108819, 0.0010596339125186205, 0.0020923593547195196, 0.0032517448998987675, 0.0280828345566988, 0.002993800910189748, 0.0011651769746094942, 0.0006336354999803007, 0.001659492147155106, 0.0006165518425405025, 0.026239097118377686, 0.0007357937283813953, 0.0008729238179512322, 0.0006271300371736288, 0.0008585773757658899, 0.0007747812196612358, 0.0011375020258128643, 0.0008088625036180019, 0.0008931983611546457, 0.6394815444946289, 0.03889181837439537, 0.016609836369752884, 0.0011896080104634166, 0.0010522933444008231, 0.0006903726607561111, 0.0008194295223802328, 0.0007184017449617386, 0.0009669233695603907, 0.0023612831719219685, 0.002371183130890131, 0.0015263691311702132, 0.002631859155371785, 0.0059435563161969185, 0.03680473938584328, 0.0006870141951367259, 0.000835143553558737, 0.0031474989373236895, 0.0008793007582426071, 0.0012675733305513859, 0.0009109882521443069, 0.03643066808581352, 0.0009229958523064852, 0.0008376460755243897, 0.0007717210683040321, 0.0008945355657488108, 0.002848833566531539, 0.0029351485427469015, 0.0011411139275878668, 0.0007438463508151472, 0.16230608522891998, 0.0019030048279091716, 0.002677900716662407, 0.01962956041097641, 0.0007631595362909138, 0.0007640483672730625, 0.0008157918928191066, 0.0007569267181679606, 0.0007953406311571598, 0.0010165388230234385, 0.0008160578436218202, 0.0007259507547132671, 0.0005906803417019546, 0.010490254499018192, 0.03453832492232323, 0.33282360434532166, 0.6099414229393005, 0.005482716020196676, 0.000527828698977828, 0.3993348181247711, 0.0006556857260875404, 0.0037665211129933596, 0.01145345438271761, 0.0030665304511785507, 0.0010810272069647908, 0.02248215861618519, 0.034009192138910294, 0.0006105731590650976, 0.001654433668591082, 0.024570109322667122, 0.0012527412036433816, 0.044270265847444534, 0.0006104681524448097, 0.0007223205757327378, 0.013349676504731178, 0.0007479242631234229, 0.0005712340353056788, 0.0006420123972930014, 0.004252981394529343, 0.024368302896618843, 0.093612439930439, 0.021179696545004845, 0.06347421556711197, 0.0016640598187223077, 0.0011373704764991999, 0.0007734000100754201, 0.0005980873247608542, 0.0019770420622080564, 0.05311460420489311, 0.0008318309555761516, 0.0009100838797166944, 0.5226540565490723, 0.0032676372211426497, 0.000904471380636096, 0.0014480015961453319, 0.0005766408867202699, 0.0010381952160969377, 0.000624495034571737, 0.0005427529686130583, 0.0005717237363569438, 0.0012105359928682446, 0.0011013724142685533, 0.000799037516117096, 0.000859763182234019, 0.000815822568256408, 0.0006596476305276155, 0.0010831712279468775, 0.01838028058409691, 0.0006374696968123317, 0.001147042028605938, 0.019741110503673553, 0.01574462279677391, 0.18368859589099884, 0.0007705182069912553, 0.0005776621401309967, 0.0007516418118029833, 0.014733693562448025, 0.01955639012157917, 0.0006099001620896161, 0.027843382209539413, 0.19203457236289978, 0.06492966413497925, 0.0014156238175928593, 0.0011070542968809605, 0.0016150429146364331, 0.05454827472567558, 0.006800728850066662, 0.0009187028626911342, 0.01840260811150074, 0.0013575267512351274, 0.48991718888282776, 0.0008281441987492144, 0.003299013478681445, 0.0006656430196017027, 0.0009071826352737844, 0.006741045042872429, 0.0008066425798460841, 0.0006339593091979623, 0.0025361289735883474, 0.0007474069716408849, 0.0007696772227063775, 0.000815822568256408, 0.0011203564936295152, 0.026688985526561737, 0.004300222732126713, 0.698541522026062, 0.0007964259712025523, 0.021837083622813225, 0.0008607866475358605, 0.30266717076301575, 0.0006253463798202574, 0.0016317041590809822, 0.0007000876939855516, 0.0010876795276999474, 0.0007668918697163463, 0.6137967705726624, 0.0014224984915927052, 0.0009157254244200885, 0.07171693444252014, 0.0023284535855054855, 0.17427760362625122, 0.03562774509191513, 0.010376007296144962, 0.0009848633781075478, 0.000719080213457346, 0.000738036644179374, 0.0005787050467915833, 0.0006105952779762447, 0.0011753506259992719, 0.0010568685829639435, 0.006124264094978571, 0.0006335802609100938, 0.002419480588287115, 0.0018523239996284246, 0.027304334565997124, 0.0010502827353775501, 0.11600229889154434, 0.002528108423575759, 0.14759500324726105, 0.0006214517634361982, 0.0013583519030362368, 0.0010921104112640023, 0.7673253417015076, 0.03194989636540413, 0.02293243817985058, 0.000867524475324899, 0.0017562898574396968, 0.18336240947246552, 0.0011792357545346022, 0.649469256401062, 0.005049523431807756, 0.0012724681291729212, 0.02224397473037243, 0.005314367823302746, 0.022125203162431717, 0.0007972418097779155, 0.019825171679258347, 0.0008899574168026447, 0.0008854580228216946, 0.0025053024291992188, 0.0007340067531913519, 0.0013726928737014532, 0.000807353644631803, 0.17044566571712494, 0.0007279196288436651, 0.0635838583111763, 0.008619719184935093, 0.001117352512665093, 0.0016604845877736807, 0.004093250725418329, 0.002532794838771224, 0.0009748975862748921, 0.0008891352917999029, 0.008518001064658165, 0.0022246078588068485, 0.0007730894722044468, 0.0008365684188902378, 0.0009142421185970306, 0.001087850658223033, 0.0006351839401759207, 0.006202638149261475, 0.0008530505001544952, 0.0027095822151750326, 0.38347581028938293, 0.0006219479837454855, 0.12798379361629486, 0.004491779953241348, 0.002058424288406968, 0.22381985187530518, 0.0029807009268552065, 0.0010770941153168678, 0.024877896532416344, 0.0012191816931590438, 0.0006674340693280101, 0.011880232952535152, 0.000951622670982033, 0.0011009108275175095, 0.000767354154959321, 0.0007475201855413616, 0.0007948860293254256, 0.0014716029400005937, 0.0008957082754932344, 0.0047597517259418964, 0.001895996741950512, 0.014829767867922783, 0.001211025519296527, 0.02979106828570366, 0.0007613369962200522, 0.0008610142976976931, 0.0006948084919713438, 0.0008325247326865792, 0.5885162949562073, 0.0007557818898931146, 0.003559684846550226, 0.0009427497861906886, 0.01237562857568264, 0.0006231953157112002, 0.004073587246239185, 0.0010681088315322995, 0.0007393304840661585, 0.009904005564749241, 0.6537926197052002, 0.0007850840338505805, 0.015474147163331509, 0.0008181421435438097, 0.0009652154985815287, 0.07057404518127441, 0.0006736426730640233, 0.0006998965982347727, 0.000803532951977104, 0.0015808067983016372, 0.00429290346801281, 0.0007903731311671436, 0.0027488074265420437, 0.0007851701229810715, 0.0006199012859724462, 0.0008723243954591453, 0.0006982936174608767, 0.0007322332239709795, 0.016476154327392578, 0.00471294391900301, 0.41560912132263184, 0.0008401332888752222, 0.0013442770577967167, 0.009317153133451939, 0.0008641568711027503, 0.0007645516889169812, 0.0022701467387378216, 0.0007896843017078936, 0.055372800678014755, 0.007734842598438263, 0.10129950195550919, 0.0030237827450037003, 0.000723961740732193, 0.0014727069064974785, 0.003633508924394846, 0.0008581671281717718, 0.0011006502900272608, 0.000683777267113328, 0.002708782209083438, 0.0022030179388821125, 0.0006180871860124171, 0.2144651561975479, 0.0006935456185601652, 0.000920996128115803, 0.0006249973084777594, 0.19903501868247986, 0.011517205275595188, 0.002254546619951725, 0.0009679201757535338, 0.0017495729262009263, 0.0055643124505877495, 0.5066136717796326, 0.001637367531657219, 0.0006526961806230247, 0.000721139251254499, 0.0006565993535332382, 0.0007151158642955124, 0.006832326762378216, 0.0057359738275408745, 0.0007714710664004087, 0.0007793463882990181, 0.0009171001729555428, 0.0009770604083314538, 0.0006965369102545083, 0.0007836052682250738, 0.0006892449455335736, 0.0007441664929501712, 0.0006414830568246543, 0.0005713364225812256, 0.0008244345663115382, 0.0014089300530031323, 0.0006545409560203552, 0.0013756747357547283, 0.008750064298510551, 0.0006936104036867619, 0.0006809445330873132, 0.0008918257663026452, 0.0010268252808600664, 0.0009083831682801247, 0.0007508686976507306, 0.8918837308883667, 0.001220444100908935, 0.0006591659039258957, 0.0012198763433843851, 0.0010697406250983477, 0.0006464903126470745, 0.002510532969608903, 0.0013495363527908921, 0.00393215985968709, 0.0006360423867590725, 0.000720897747669369, 0.0007547454442828894, 0.34053051471710205, 0.06200439855456352, 0.005843303166329861, 0.0007761410088278353, 0.0006202038493938744, 0.002437832998111844, 0.0013021959457546473, 0.0007490990101359785, 0.0012583252973854542, 0.0008319621556438506, 0.0009099558810703456, 0.0007921740179881454, 0.3605296015739441, 0.0007624177378602326, 0.0008303780341520905, 0.006361708045005798, 0.0006635126774199307, 0.0007150869350880384, 0.04061935096979141, 0.0006412636139430106, 0.0007300516590476036, 0.08931536227464676, 0.0008030403405427933, 0.0006862845038995147, 0.004929891787469387, 0.0007423069328069687, 0.00214734161272645, 0.0006500082090497017, 0.0019799843430519104, 0.0027729084249585867, 0.0007033699075691402, 0.002281132386997342, 0.0068869758397340775, 0.0006049630464985967, 0.000924271997064352, 0.0008703093626536429, 0.0013032678980380297, 0.0009731167228892446, 0.000589250645134598, 0.0009635129244998097, 0.0005978898843750358, 0.0027822712436318398, 0.0014649794902652502, 0.003388927783817053, 0.004628191236406565, 0.3538183867931366, 0.0005934937507845461, 0.0007397223962470889, 0.0006037162966094911, 0.000613728363532573, 0.0036503721494227648, 0.0007602619007229805, 0.0016550542786717415, 0.0006015736144036055, 0.0011234654812142253, 0.00787664670497179, 0.0006376763340085745, 0.000798147520981729, 0.0007328974897973239, 0.0010559472721070051, 0.0006478979485109448, 0.0019036015728488564, 0.9289519786834717, 0.0007511127623729408, 0.0011929050087928772, 0.0008769057458266616, 0.0007419500616379082, 0.021548571065068245, 0.0007985145784914494, 0.022243158891797066, 0.0034568398259580135, 0.0013317962875589728, 0.0008384917746298015, 0.0007208092138171196, 0.08235005289316177, 0.0007561715901829302, 0.0014380072243511677, 0.39296725392341614, 0.0006395701202563941, 0.001178559148684144, 0.0656929761171341, 0.0012865908211097121, 0.44159066677093506, 0.0013812411343678832, 0.5930116772651672, 0.005172996781766415, 0.0014364408561959863, 0.0030588810332119465, 0.003598121227696538, 0.0014673405094072223, 0.0014186117332428694, 0.0012000106507912278, 0.0006337209488265216, 0.004834860563278198, 0.0011600808938965201, 0.0009516426944173872, 0.0009301326354034245, 0.0009656138136051595, 0.00099150778260082, 0.0018366683507338166, 0.0007671337225474417, 0.00073907122714445, 0.0013314790558069944, 0.0013744798488914967, 0.10089495033025742, 0.003462824271991849, 0.0008452727925032377, 0.002018467290326953, 0.0014418535865843296, 0.0013557089259847999, 0.0013572151074185967, 0.004276941064745188, 0.0007459709886461496, 0.0007017219322733581, 0.39588379859924316, 0.0006699609220959246, 0.8257981538772583, 0.1058213859796524, 0.0015762352850288153, 0.0007476452738046646, 0.001024921308271587, 0.0008109879563562572, 0.0008975955424830317, 0.003010034328326583, 0.022966934368014336, 0.048818860203027725, 0.0006700854282826185, 0.0006429917993955314, 0.5421214699745178, 0.003062536008656025, 0.023875761777162552, 0.0008968870970420539, 0.0011857039062306285, 0.0007618857780471444, 0.0042228722013533115, 0.0006994534633122385, 0.002558158477768302, 0.0006905562477186322, 0.11741948872804642, 0.0013501233188435435, 0.0007360258605331182, 0.0006725515122525394, 0.007365905214101076, 0.20671510696411133, 0.0017952312482520938, 0.0014814987080171704, 0.21214905381202698, 0.0019465689547359943, 0.011237607337534428, 0.001236729440279305, 0.0021780573297291994, 0.04099203646183014, 0.001044618315063417, 0.003937908913940191, 0.0016756337136030197, 0.0015902126906439662, 0.0012322200927883387, 0.022259483113884926, 0.9673475623130798, 0.0009647177066653967, 0.007028008811175823, 0.0016303517622873187, 0.004629531409591436, 0.0011075353249907494, 0.001040009898133576, 0.0006786045269109309, 0.002317088656127453, 0.0010733227245509624, 0.0012755637289956212, 0.007808799855411053, 0.001711564720608294, 0.0009150220430456102, 0.0007701650611124933, 0.0007029021508060396, 0.0008940021507441998, 0.0009000238496810198, 0.0007564317202195525, 0.003455197671428323, 0.3446126878261566, 0.000746925245039165, 0.03532544896006584, 0.0006005186587572098, 0.6035122871398926, 0.000819746928755194, 0.002214258536696434, 0.020537374541163445, 0.1732238084077835, 0.004889842588454485, 0.0007274844101630151, 0.005836415570229292, 0.0006460949662141502, 0.0009547853260301054, 0.0007981992093846202, 0.05510234460234642, 0.3008390963077545, 0.05072407424449921, 0.003993021324276924, 0.006377376616001129, 0.0008115333039313555, 0.0010255617089569569, 0.0018115900456905365, 0.0007244559237733483, 0.0006391829228959978, 0.0007466331589967012, 0.0006491850945167243, 0.03085707500576973, 0.0006918697617948055, 0.0027948403730988503, 0.0008940021507441998, 0.0007617779192514718, 0.02852931059896946, 0.0008267328375950456, 0.022581178694963455, 0.0011256138095632195, 0.0009478804422542453, 0.02383320964872837, 0.10716183483600616, 0.000762539857532829, 0.0006743533886037767, 0.0013062951620668173, 0.45673227310180664, 0.0031399745494127274, 0.005535608157515526, 0.0037037937436252832, 0.00729840574786067, 0.0640995055437088, 0.39031296968460083, 0.05255398899316788, 0.0018857617396861315, 0.000861704524140805, 0.00088016118388623, 0.001059223199263215, 0.0008098867838270962, 0.04438270628452301, 0.07745011895895004, 0.037113696336746216, 0.011143309995532036, 0.0007553397445008159, 0.0006616703467443585, 0.08068764954805374, 0.0008188650826923549, 0.06763359904289246, 0.010483683086931705, 0.0012174015864729881, 0.0011506719747558236, 0.0005720139597542584, 0.0007916910108178854, 0.001451930613256991, 0.007418419234454632, 0.022764399647712708, 0.0007243195432238281, 0.0029711821116507053, 0.035787101835012436, 0.7323508858680725, 0.0008427398279309273, 0.0131096001714468, 0.000660052290186286, 0.0008333009318448603, 0.004137695766985416, 0.0008833572501316667, 0.0009490051306784153, 0.001068726647645235, 0.0011178826680406928, 0.0006864837487228215, 0.0006857377011328936, 0.0008161892183125019, 0.0015355254290625453, 0.0007470911368727684, 0.0008615464903414249, 0.0011817151680588722, 0.0010646304581314325, 0.0008771781576797366, 0.0009135067812167108, 0.07282787561416626, 0.0006420072168111801, 0.0014186117332428694, 0.0012233380693942308, 0.0012754148337990046, 0.0006786055164411664, 0.0017074252245947719, 0.0017520097317174077, 0.0008818019414320588, 0.0007107706042006612, 0.0033621452748775482, 0.0006729172309860587, 0.0009705876000225544, 0.000644095242023468, 0.0009443838498555124, 0.04475751519203186, 0.0006521847099065781, 0.0006670362781733274, 0.005040069110691547, 0.005577914882451296, 0.15362054109573364, 0.0015213165897876024, 0.0006539043388329446, 0.000874767720233649, 0.0008975774399004877, 0.0008455482311546803, 0.0008128521149046719, 0.0006639190251007676, 0.0007137263310141861, 0.0011239605955779552, 0.0010532872984185815, 0.002535546664148569, 0.0007560782833024859, 0.0020161536522209644, 0.0014339041663333774, 0.001684612943790853, 0.0006790917250327766, 0.0013054823502898216, 0.002371161710470915, 0.016525309532880783, 0.0006985511281527579, 0.0006802213029004633, 0.001678043627180159, 0.0006916400161571801, 0.000613710843026638, 0.0006767548620700836, 0.000850483775138855, 0.0007202475098893046, 0.006913335528224707, 0.0008263591444119811, 0.0009139969479292631, 0.0011006990680471063, 0.0008043568814173341, 0.0009481582674197853, 0.0007431778940372169, 0.00093814916908741, 0.005643152631819248, 0.0011841480154544115, 0.0007024672231636941, 0.03652017563581467, 0.0006832324434071779, 0.404963880777359, 0.46887752413749695, 0.0005894756177440286, 0.0011412715539336205, 0.0033424159046262503, 0.0013219208922237158, 0.0008230452658608556, 0.02182895876467228, 0.0007166737341322005, 0.0006069974624551833, 0.0007618642994202673, 0.005268745590001345, 0.0015385843580588698, 0.0006432312075048685, 0.0010641706176102161, 0.002305231522768736, 0.012269026599824429, 0.0008465108112432063, 0.0008276539156213403, 0.0018931592348963022, 0.0008678941521793604, 0.0005749949486926198, 0.11846324801445007, 0.0012449714122340083, 0.0007072448497638106, 0.0007532645831815898, 0.00220117368735373, 0.0011680434690788388, 0.0008600856526754797, 0.0007302621961571276, 0.0023358094040304422, 0.005606795195490122, 0.13843533396720886, 0.002665981650352478, 0.000676079245749861, 0.0015034362440928817, 0.0006601872737519443, 0.0011560373241081834, 0.0008769296109676361, 0.0007445180090144277, 0.000788636680226773, 0.0011729421094059944, 0.019227851182222366, 0.01958475261926651, 0.0007629345054738224, 0.017735691741108894, 0.00082130212103948, 0.001368041499517858, 0.001345955184660852, 0.001426424947567284, 0.0020710090175271034, 0.0007232039351947606, 0.001615332905203104, 0.0006049835355952382, 0.025531712919473648, 0.025354301556944847, 0.0010559794027358294, 0.000730286817997694, 0.0009352493798360229, 0.007885118015110493, 0.23457933962345123, 0.0010672665666788816, 0.0015729832230135798, 0.0008024608832783997, 0.0005838599754497409, 0.0005643118056468666, 0.016687488183379173, 0.032459259033203125, 0.0007248157053254545, 0.0008926644804887474, 0.007208460476249456, 0.0006908255163580179, 0.0007044862140901387, 0.023433061316609383, 0.0006834499072283506, 0.0005889494204893708, 0.0005135131068527699, 0.0006347875460051, 0.0007763477624394, 0.0007939485367387533, 0.0006968217785470188, 0.0006666584522463381, 0.0006890048971399665, 0.0005845769192092121, 0.0005968775367364287, 0.0006151862908154726, 0.0005888303858228028, 0.0006152434507384896, 0.000566808448638767, 0.0005801500519737601, 0.0007013160502538085 ]

[ "What is the closest to -1 in -276, -3, -1/8, 3.6?", "\n-1/8\nWhat is the closest to -0.1 in -4, -0.06, -1/5, -0.259?", "\n-0.06\nWhat is the nearest to 0.5 in 0.149, -1/2, -2?", "\n0.149\nWhich is the nearest to -0.15? ", " (a) -1 (b) 2/3 (c) -1/16 (d) -32 (e) 0.5\nc\nWhat is the closest to -1/8 in 5, 4, -340431?", "\n4\nWhat is the closest to -47 in 1, -2, -1/3, -9, 4?", "\n-9\nWhich is the closest to 2? ", " (a) 0.02 (b) 7 (c) 179 (d) -0.2\na\nWhich is the closest to 1? ", " (a) 6/13 (b) -0.3 (c) -1 (d) -1/4 (e) 1/4\na\nWhat is the nearest to -0.7 in 0, -4, 2.4?", "\n0\nWhat is the closest to 18 in -1276, 2/7, 4/5?", "\n4/5\nWhich is the closest to -40? ", " (a) -3 (b) -47 (c) 0.15 (d) -2/9\nb\nWhich is the closest to 0.2? ", " (a) -1 (b) -55 (c) 804/19 (d) -3\na\nWhat is the nearest to 2 in -2/3, -0.1, 1.73, 0.2?", "\n1.73\nWhat is the nearest to -2/7 in -53, 54, -0.04?", "\n-0.04\nWhat is the closest to -1 in -8/21, -0.02, 52?", "\n-8/21\nWhat is the nearest to -8 in 10, 31, -1/2, -31?", "\n-1/2\nWhich is the closest to -1? ", " (a) 1 (b) 5/3 (c) 1/6 (d) 60 (e) -147\nc\nWhat is the closest to 0.032 in 0.05, 2, 5, -2?", "\n0.05\nWhat is the closest to -0.3 in -0.5, -423, 2/75?", "\n-0.5\nWhich is the closest to 0? ", " (a) 4 (b) -8 (c) 9.5 (d) -0.5\nd\nWhich is the nearest to -4? ", " (a) -0.3 (b) 3/7 (c) -25/18 (d) -2/3\nc\nWhat is the closest to -1/51 in -2/15, 8, -5?", "\n-2/15\nWhat is the closest to -0.01 in -5, -4/19, -4?", "\n-4/19\nWhich is the nearest to -4/5? ", " (a) 1/17 (b) -2/13 (c) -69\nb\nWhat is the closest to 2 in -14, 3, -24, 21?", "\n3\nWhich is the closest to 4? ", " (a) -1 (b) 8 (c) -40\nb\nWhat is the closest to 560/13 in 0.2, 1/4, 2/7, 0.5, -0.1?", "\n0.5\nWhich is the closest to 1/5? ", " (a) -0.3 (b) 4 (c) 2/11 (d) -15 (e) 0.422\nc\nWhat is the closest to 5 in 0, -3, -0.1, 64, -7?", "\n0\nWhich is the nearest to -0.1? ", " (a) 1/12 (b) 0.13 (c) 0.01 (d) 1\nc\nWhat is the closest to 1 in -5, -6, 1, -0.08?", "\n1\nWhich is the closest to 2? ", " (a) 2/5 (b) 1/10 (c) -10/11 (d) -83\na\nWhat is the nearest to 0.1 in 0.4, 19, 1.6, -4?", "\n0.4\nWhich is the nearest to 0.2? ", " (a) 0 (b) 5 (c) 0.988 (d) 2\na\nWhich is the nearest to -0.9? ", " (a) 2/9 (b) -9 (c) -50/9 (d) 5\na\nWhich is the nearest to 1? ", " (a) -2/7 (b) -70183 (c) -4 (d) 5\na\nWhat is the closest to 0.161 in -1, 0.05, -0.3?", "\n0.05\nWhat is the nearest to -10 in -2, 1/3, -19, -1.4?", "\n-2\nWhich is the nearest to -1? ", " (a) 1/3 (b) -4 (c) -6368 (d) 1\na\nWhich is the nearest to 1/2? ", " (a) -8 (b) 2/3 (c) -1889 (d) -2/5 (e) 0.2\nb\nWhat is the nearest to 3/7 in -869, -3, 0, 5?", "\n0\nWhat is the closest to -6/11 in 2, -481, 3/5, 1/5?", "\n1/5\nWhat is the nearest to -1 in 1/7, 2, 0.64?", "\n1/7\nWhich is the nearest to 435? ", " (a) -4 (b) -3 (c) 1.7\nc\nWhat is the closest to -0.63 in -8, 4/25, -1, -5?", "\n-1\nWhich is the nearest to 1? ", " (a) -41/4 (b) -0.11 (c) 2/5 (d) -3/2 (e) 5\nc\nWhich is the nearest to 1? ", " (a) -1.708 (b) 4/5 (c) -1\nb\nWhat is the nearest to -0.1 in -0.4, 0.5, -14, 0.7, 2?", "\n-0.4\nWhich is the closest to -19/27? ", " (a) 3 (b) 3/23 (c) 0\nc\nWhich is the closest to 2054? ", " (a) 2/7 (b) 3 (c) 0 (d) -3\nb\nWhich is the closest to 1/14? ", " (a) 2859 (b) -0.5 (c) 8\nb\nWhich is the closest to 1? ", " (a) 4/7 (b) -4 (c) -5 (d) -8/125\na\nWhich is the closest to -0.034? ", " (a) 2/29 (b) -5 (c) -1\na\nWhat is the closest to 1 in 5, -5, -4, -359?", "\n5\nWhich is the nearest to -2/111? ", " (a) 0.2 (b) -1/5 (c) 0 (d) -1\nc\nWhat is the closest to 3 in 0.02, -0.3, 0.4, -1, -5/2?", "\n0.4\nWhat is the nearest to 936/7 in 0, 6, 3/2, -4?", "\n6\nWhat is the closest to 0.8 in 2, 3.3, 7?", "\n2\nWhat is the closest to -137 in -3, -2/9, 0.1, 1/2?", "\n-3\nWhat is the closest to 2/3 in -0.3, 70.77, 0.11?", "\n0.11\nWhich is the nearest to 2? ", " (a) 1 (b) -2/113 (c) 0.495\na\nWhich is the nearest to -1/2? ", " (a) 292 (b) -18 (c) -5 (d) 0.4\nd\nWhich is the closest to 1? ", " (a) 61 (b) 0.1 (c) 7 (d) 5/4 (e) 5\nd\nWhich is the nearest to 2? ", " (a) -28 (b) -0.2 (c) -6 (d) 3/7\nd\nWhich is the nearest to 2.5? ", " (a) -1/7 (b) -0.19 (c) -22\na\nWhat is the nearest to -7 in 0, 750, -3?", "\n-3\nWhat is the closest to -0.1 in -0.1, -0.044, -2/9, 13, 2?", "\n-0.1\nWhat is the closest to 0 in -1/6, 1502/9, 0.2?", "\n-1/6\nWhich is the nearest to -2/7? ", " (a) 0.5 (b) -2 (c) -40.5 (d) -1 (e) -3\nd\nWhat is the closest to 0.1 in -11, -4.5, 0.2, 4?", "\n0.2\nWhich is the closest to 0? ", " (a) -0.5 (b) -2/25 (c) -2164\nb\nWhich is the closest to 1.2? ", " (a) -5/2 (b) 0.1 (c) -8759 (d) -1/2 (e) -1/3\nb\nWhich is the closest to 0.8? ", " (a) 0.3 (b) -3 (c) 6 (d) -0.08\na\nWhat is the closest to 7.3 in -269, 0.2, 2/7?", "\n2/7\nWhat is the nearest to -1/4 in -1/7, -1641, 0.2, -1/8?", "\n-1/7\nWhich is the closest to 11.7? ", " (a) 0 (b) 44 (c) 4\nc\nWhat is the nearest to 2.3 in -37, 19, -0.05, -5/3, -2?", "\n-0.05\nWhat is the nearest to -2 in 155, 2, 4, -4?", "\n-4\nWhich is the nearest to -5? ", " (a) 8 (b) -1.9 (c) -0.4 (d) 0.3\nb\nWhat is the nearest to 1 in 3, 11, -1/6, 0.034?", "\n0.034\nWhich is the nearest to 0? ", " (a) -518 (b) 16 (c) 0.4 (d) -3/7\nc\nWhich is the closest to -52? ", " (a) 7 (b) 0 (c) 37 (d) 3/2\nb\nWhich is the closest to 16? ", " (a) 5.3 (b) 0.09 (c) -2 (d) 3\na\nWhich is the closest to 1/3? ", " (a) 9 (b) -18 (c) 1/11\nc\nWhich is the nearest to 1? ", " (a) 336.07 (b) -1/10 (c) -2/3\nb\nWhat is the closest to 77 in -2, -0.5, 27, 0.6?", "\n27\nWhich is the closest to -0.2? ", " (a) 2 (b) -1/4 (c) 0\nb\nWhich is the nearest to 4? ", " (a) -3 (b) 9 (c) 1\nc\nWhat is the closest to -0.033 in -6/29, 2, 3, -1?", "\n-6/29\nWhich is the closest to 2/3? ", " (a) 4 (b) 1/4 (c) 1/6 (d) 1883 (e) -5\nb\nWhat is the closest to 0 in 0.1, 3/73, 1/2, 1861?", "\n3/73\nWhich is the nearest to 12? ", " (a) 14 (b) 2 (c) -209\na\nWhat is the nearest to 2 in 7, 0.0165, -1?", "\n0.0165\nWhich is the nearest to 4? ", " (a) -4 (b) -17 (c) 13 (d) -0.4 (e) -2\nd\nWhich is the closest to 0.3? ", " (a) -2/7 (b) -3 (c) 15 (d) 0.3 (e) 1/7\nd\nWhat is the nearest to 2/7 in -0.13, 70, -1, 0.014?", "\n0.014\nWhat is the closest to 1/67 in -9, 0.05, 0.2, -1/15?", "\n0.05\nWhich is the closest to 0.2? ", " (a) -34 (b) -607/9 (c) -0.5\nc\nWhich is the closest to 0.04? ", " (a) 4 (b) -16 (c) -5/8 (d) 1/7 (e) 3\nd\nWhat is the closest to 0 in -6.224, 4, 2/3?", "\n2/3\nWhat is the nearest to -0.1 in -1.221, 0.01, 2/5, 3?", "\n0.01\nWhat is the nearest to -0.1 in -21700, 0.1, -3/2?", "\n0.1\nWhat is the closest to 38 in -2/119, -0.4, -11?", "\n-2/119\nWhat is the closest to -3533 in -2/3, 3, -7, 0.5?", "\n-7\nWhich is the closest to -54? ", " (a) -1 (b) 5 (c) 291\na\nWhich is the nearest to 3? ", " (a) -5 (b) -205/6 (c) -2/7 (d) -1\nc\nWhat is the nearest to 0.124 in 1/8, 3, 2?", "\n1/8\nWhat is the closest to -112 in -41, 0.4, -2, -2/7, -1/4?", "\n-41\nWhich is the nearest to 0.07? ", " (a) 0.023 (b) 1/2 (c) 2 (d) -0.1166\na\nWhat is the nearest to 13 in 2, 6, 0.1, 42.7, 4?", "\n6\nWhat is the nearest to -1 in 589, 2/5, -76/7?", "\n2/5\nWhich is the nearest to 2.15? ", " (a) 0 (b) 1/3 (c) -34\nb\nWhat is the closest to -2/11 in 1, -639, -10, -2/11, 3?", "\n-2/11\nWhich is the nearest to 0.9? ", " (a) 1 (b) 3 (c) 0.1 (d) -1/26\na\nWhat is the closest to 1 in 1/3, -0.0028, 0.3?", "\n1/3\nWhat is the nearest to -39 in 1/10, -1.1, 203?", "\n-1.1\nWhich is the nearest to 1? ", " (a) -4 (b) 333 (c) 2/7 (d) -1 (e) 0.88\ne\nWhich is the closest to 0? ", " (a) 5 (b) -4 (c) 1110\nb\nWhat is the nearest to -8/3 in 2, 0.1, -4/3, 3, 6671?", "\n-4/3\nWhich is the nearest to 1? ", " (a) -4 (b) 1 (c) -11/2 (d) -5 (e) -0.04\nb\nWhich is the closest to -1? ", " (a) 2 (b) -3 (c) 0 (d) 0.3\nc\nWhat is the nearest to -1/2 in -1/8, -13/16, -2, -21?", "\n-13/16\nWhat is the nearest to 2/7 in 12213, 2/29, 0?", "\n2/29\nWhich is the closest to -10.8? ", " (a) -6 (b) -7/4 (c) 3 (d) 4 (e) -4\na\nWhat is the nearest to 0.393 in 1.6, -5, -43?", "\n1.6\nWhich is the closest to -185? ", " (a) -0.4 (b) -0.1 (c) -1/117\na\nWhat is the closest to 0 in -0.1245, 3, 0?", "\n0\nWhich is the nearest to 4? ", " (a) -2 (b) 4 (c) 0.5 (d) -0.01\nb\nWhich is the nearest to 0? ", " (a) -2.6 (b) -2/2609 (c) -4\nb\nWhat is the closest to -33.7 in -3/5, -1.6, 5?", "\n-1.6\nWhich is the nearest to 0.01? ", " (a) -2/3 (b) 37218 (c) 4\na\nWhich is the closest to 3? ", " (a) 0.1 (b) 6 (c) 13\na\nWhat is the nearest to -1 in 64/7, 2/13, 3/2, 0.1?", "\n0.1\nWhich is the nearest to -2/7? ", " (a) -5.4 (b) -3 (c) 3 (d) 5\nb\nWhat is the nearest to -0.05 in -4, -0.5, -1, 0.6?", "\n-0.5\nWhich is the nearest to 2? ", " (a) 5 (b) 0.31 (c) 23\nb\nWhich is the closest to 1? ", " (a) -0.0154 (b) 0 (c) 1 (d) 10 (e) -2/5\nc\nWhat is the closest to -0.7 in -3695, 0.5, -2/5?", "\n-2/5\nWhat is the nearest to 129 in " ]

{ "pile_set_name": "DM Mathematics" }

[ 0.0007530715083703399, 0.0008905118447728455, 0.0012943119509145617, 0.0010926328832283616, 0.0007975867483764887, 0.0008186552440747619, 0.0007723947055637836, 0.0009408753248862922, 0.0008862806134857237, 0.0008028899901546538, 0.000863290682900697, 0.0007698650006204844, 0.0009129768004640937, 0.0009861655998975039, 0.0008169583743438125, 0.0009278127108700573, 0.0007204572320915759, 0.0009502264438197017, 0.0010302710579708219, 0.0008761920034885406, 0.0008763428195379674, 0.0007830759859643877, 0.0007700843852944672, 0.0008150028879754245, 0.0007799712475389242, 0.0008350437274202704, 0.0007522014784626663, 0.0008886322029866278, 0.0010710469214245677, 0.0011301656486466527, 0.0009277839562855661, 0.000809326593298465, 0.0009699497022666037, 0.0010771254310384393, 0.001530007692053914, 0.0008431618916802108, 0.0008917786763049662, 0.0010891788406297565, 0.0007801143219694495, 0.0007912336732260883, 0.0008980946731753647, 0.0008412018651142716, 0.0010472319554537535, 0.0009068815852515399, 0.0007897192263044417, 0.0008435320341959596, 0.0009040003642439842, 0.0010911360150203109, 0.0007328545907512307, 0.0007359293522313237, 0.0008829958387650549, 0.0007652835338376462, 0.0007558541838079691, 0.00076590187381953, 0.0008119335980154574, 0.0009975909488275647, 0.0008253853302448988, 0.0009448854252696037, 0.0008302107453346252, 0.000851598393637687, 0.0010056463070213795, 0.0007320574368350208, 0.0007513686432503164, 0.001753852004185319, 0.0008221782627515495, 0.0007636931841261685, 0.0009917208226397634, 0.0009744110284373164, 0.0007714244420640171, 0.0010806028731167316, 0.001041045761667192, 0.000729758816305548, 0.0008802056545391679, 0.0008774878224357963, 0.0009971029357984662, 0.000723216391634196, 0.001623315503820777, 0.0009138475288636982, 0.0008166287443600595, 0.0011372474255040288, 0.0014234342379495502, 0.0007053379667922854, 0.001187512301839888, 0.0008255591965280473, 0.0008911009063012898, 0.0008309202967211604, 0.0008277801098302007, 0.0010302637238055468, 0.000823543465230614, 0.0007222490385174751, 0.0009415277163498104, 0.0008829575963318348, 0.0009111891849897802, 0.0009556909208185971, 0.0008683279738761485, 0.0011110715568065643, 0.0008222213946282864, 0.000993336783722043, 0.0007593712653033435, 0.0011644373880699277, 0.0011412438470870256, 0.000972783425822854, 0.0008676546858623624, 0.0008137914701364934, 0.0007473634905181825, 0.0007914173183962703, 0.0008076817030087113, 0.0007654958171769977, 0.0009012178634293377, 0.0009406068711541593, 0.00085946184117347, 0.0009558753808960319, 0.0008301091147586703, 0.0008546545868739486, 0.001017660484649241, 0.0008091569761745632, 0.0008628876530565321, 0.0009558234014548361, 0.0008692746632732451, 0.0008183518657460809, 0.0007989240111783147, 0.0010939649073407054, 0.0007831805269233882, 0.0007797315483912826, 0.0008808181737549603, 0.0008221226744353771, 0.0011064880527555943, 0.001165223540738225, 0.0011911103501915932, 0.0007798103615641594, 0.0008776220493018627, 0.0007068985141813755, 0.001046259654685855, 0.0008805324323475361, 0.0015311409952118993, 0.0008547526667825878, 0.0011087533785030246, 0.0009526213980279863, 0.0007408496458083391 ]

[ "Passerivirus\n\nPasserivirus is a genus of viruses in the order Picornavirales, in the family Picornaviridae. ", "Birds serve as natural hosts. ", "There is currently only one species in this genus: the type species Passerivirus A.\n\nTaxonomy\nGroup: ssRNA(+)\n\nStructure\nViruses in Passerivirus are non-enveloped, with icosahedral and Spherical geometries, and T=pseudo3 symmetry. ", "The diameter is around 30 nm. ", "Genomes are linear and non-segmented, around 8kb in length.", "\n\nLife cycle\nViral replication is cytoplasmic. ", "Entry into the host cell is achieved by attachment of the virus to host receptors, which mediates endocytosis. ", "Replication follows the positive stranded RNA virus replication model. ", "Positive stranded RNA virus transcription is the method of transcription. ", "The virus exits the host cell by lysis, and viroporins.", "\nBirds serve as the natural host.", "\n\nReferences\n\nExternal links\n Viralzone: Passerivirus\n ICTV\n\nCategory:Picornaviridae\nCategory:Bird diseases" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.003258688608184457, 0.0007529979338869452, 0.0006438279524445534, 0.0005796614568680525, 0.0006222820957191288, 0.0009413590305484831, 0.0007800254970788956, 0.0005756845348514616, 0.0007018502801656723, 0.0009296161006204784, 0.0007969873258844018, 0.0006851197103969753 ]

[ "\"No, you've already had some.\" \"", "Go away!\" \"", "AFTER THE WEDDING\" \"Are there only rich people where you are going?\" \"", "If I was rich, I'd be happy.\" \"", "You hate all the rich, Mr. Jacob.\" \"", "Is it because the houses are far apart that people are far apart?\" \"", "You're not coming back.\" \"", "I know it.\" \"", "Why do you have to go?\" \"", "Do you promise to come to my birthday?\" \"", "Okay?\" \"\"", "In the yard, a flock of sparrows saw him and began to shout:\"\" \"\"Tit tit!\" \"", "Tit tit!\" \"", "Oh, look at Nils Goosey-boy.\"\" \"\"", "Look at Thumbietot!\" \"", "Look at Nils Holgersen Thumbietot!\"\" \"\"", "Cock-a-doodle-do, cried the cock.\"\" \"\"", "Cock-a-doodle-do!\"\" \"\"", "Then the hens came.\" \"", "Peck, peck, peck...\"\" \"We'll stop here for tonight.\" \"", "You have to sleep.\" \"", "Into bed with you.\" \"", "Sleep tight.\" \"", "Good night.\" \"", "Good night, Morten.\" \"", "Good night, Martin.\" \"", "It'll be fun to see what important thing I forgot.\" \"", "Yes, it will be lovely.\" \"", "As long as there's food and wine...\" \" You're not nervous at all?\" \" ", "No, I'm looking at it as a test.\" \" ", "Of what?\" \" ", "Anna will marry many times.\" \"", "The first wedding is always hard.\" \"", "With a little luck, it will be okay.\" \"", "Jorgen...\" \"Jorgen?\" \"", "Yes?\" \"", "Mother, aren't you in bed?\" \"", "I can't get online.\" \"", "Don't speak to me like I'm senile.\" \"", "Why can't I get online?\" \"", "There's poker in three minutes.\" \"", "Why did we have to get that damn wireless network?\" \"", "But it's working now...\" \"Thank you.\" \" ", "Sleep tight.\" \" ", "Don't stay up all night.\" \"", "Sorry.\" \"", "Could we teach her to knock first?\" \"", "I've tried, but she's senile.\" \"", "Only when she wants to be.\" \" ", "I'll send her to a home tomorrow.\" \" ", "Promise?\" \"", "That's me.\" \" ", "May I take your bag?\" \" ", "No, thanks.\" \"", "Please step inside.\" \"", "Main switch.\" \"", "The bedroom.\" \"", "BO television.\" \"", "The first of the suite's two bathrooms.\" \"", "There are also three toilets.\" \"", "Mini bar.\" \"", "Safe.\" \"", "Larger bottles here.\" \"", "If there's anything else you'd like just say so.\" \"", "Flat screen.\" \"", "Air-conditioning.\" \"", "BO stereo in the corner.\" \"", "Sauna.\" \"", "Adjustable temperature.\" \"", "Timer.\" \"", "On/off button.\" \"", "The same goes for the Jacuzzi.\" \"", "On and off.\" \"", "Private rooftop terrace.\" \"", "The old university.\" \"", "The cathedral where the Crown Prince got married.\" \"", "The Round Tower.\" \"", "If you need anything else, press three.\" \"", "Excuse me.\" \"", "Excuse me, sir.\" \" ", "Jacob Pedersen?\" \" ", "That's me.\" \"", "Christian Refner, I'm here to pick you up.\" \"", "Do you have a coat?\" \"", "No?\" \"", "Then let's go.\" \" ", "The room's okay?\" \" ", "It's fine.\" \"", "It used to be a department store.\" \"", "Funny isn't it?\" \" ", "So, Jacob with a C or a K?\" \" ", "It's with a C.\" \"I'm Christian with a C too.\" \" ", "So you're meeting Jorgen?\" \" ", "Yes.\" \" ", "Do you know him well?\" \" ", "He's my father-in-law.\" \" ", "Or will be on Saturday.\" \" ", "Congratulations.\" \"", "Jorgen's fantastic.\" \"", "He's brilliant, really brilliant.\" \" ", "People often fear him, but don't.\" \" ", "Good.\" \"", "He's worth over a billion and started out flat broke, but you can't tell.\" \"", "That he started flat broke?\" \"", "No, no...\" \" Jacob Pedersen is here.\" \" ", "Have a seat.\" \"", "Just for a moment.\" \" ", "It was nice to meet you, Jacob.\" \" ", "Same here.\" \"", "Good luck.\" \"", "Give my regards to Jorgen.\" \" ", "Hi.\" \" ", "Hi.\" \" ", "Busy?\" \" ", "A little.\" \" ", "That looks nice on you.\" \" ", "Thanks.\" \" ", "Have a nice day, okay?\" \"", "Bye\" \" Bye\" \"Jacob.\" \"", "Welcome.\" \"", "My name is Jorgen Hansson.\" \" ", "Jacob.\" \" ", "This way.\" \"", "Was the flight okay?\" \"", "Good.\" \"", "This is where we live.\" \"", "You can see Sweden on a clear day.\" \"", "If you feel like it, that is.\" \"", "A drink?\" \"", "No, thanks.\" \"", "Cheers.\" \"", "Cheers.\" \"", "You have a video that can give me a sense of what goes on there.\" \"", "It will take more than a video to show you that.\" \"", "Meaning?\" \"", "Bombay has over a million child prostitutes.\" \"", "Four or five times that suffer from malnutrition.\" \"", "They're not on the video.\" \"", "Then there are those who die every day of...\" \"Well, what...\" \"Minor illnesses, minor infections...\" \"Completely minor things- that could be cured for tiny sums if one only had the will.\" \"", "We've developed a sort of priority list...\" \"You're an angry man.\" \"", "That's good.\" \"", "It gives you a lot of drive.\" \"", "The educational supplies we need include books, tables, chairs, beds... but what we need most urgently is medicine.\" \"", "Eventually we'd like to...\" \"Yes...\" \"We'd like to take twice as many off the streets.\" \" ", "Would you like one?\" \" ", "No, thanks.\" \"", "We'd like to take in twice as many and vaccinate them- which could be done all for less than five kroner a day.\" \"", "And we'd like to change our food program...\" \" Do they all sleep in the same room?\" \" ", "We have 45 at the moment.\" \"", "We go to an area, and in two minutes, 40-50 kids gather, who we then feed.\" \"", "But after five minutes, there are 500 kids.\" \" ", "I don't need to see more.\" \" ", "The new kids...\" \"It's an extremely impressive project you have established.\" \"", "Very impressive.\" \"", "I've looked at different ways I might be able to help.\" \"", "Thank you very much.\" \"", "In all, I found five different projects.\" \"", "Yours is one of the most interesting.\" \"", "Thank you.\" \"", "We're glad to hear it.\" \"", "But may I ask you why?\" \"", "Like I said...\" \"It's a good project.\" \"", "I was thinking of an annual donation of one million dollars for four years.\" \"", "But I need more time to think through which projects I want to get involved with.\" \"", "So don't get your hopes up too high.\" \"", "Okay...\" \"I was given a different impression.\" \"", "Then let's look at the papers again, because...\" \"No, no.\" \"", "Let's forget the boring paperwork until Monday.\" \"", "We'll have lunch and I'll let you know what I've decided.\" \" ", "I've got a busy weekend coming up.\" \" ", "So I've heard.\" \"", "I spoke to the guy that drove me here.\" \"", "He's marrying your daughter?\" \" ", "Yes, Christian.\" \"", "You're not married?\" \" ", "No.\" \" ", "Got any family here?\" \" ", "No, I don't.\" \"", "Then come to the wedding tomorrow.\" \"", "It's a huge wedding.\" \"", "I don't know half of the guests myself.\" \" ", "lt would be nice.\" \" ", "I need to...\" \"You don't have any other plans.\" \"", "We're through.\" \"", "See you tomorrow?\" \"", "We're looking forward to it.\" \" ", "Then I can get to know you.\" \" ", "Thanks for your time.\" \" ", "Hey, Dad!\" \" ", "How are you?\" \"", "Were you jumping on the trampoline?\" \"", "Can I see?\" \"", "Everything okay?\" \"", "Except that Annette can't cope with the stress.\" \"", "Then now's not the time to say another guest is coming.\" \"", "A business contact from India.\" \"", "You better do it gently... in stages.\" \"", "Have you changed your mind?\" \"", "There's still time.\" \" ", "Yes, come on...\" \"You've got time.\" \" ", "You're just jealous.\" \"", "Yes, of course.\" \"", "You're much too beautiful for him.\" \"", "Will you love and honor her, for better or for worse, in good times and bad, as husband and wife till death do you part?\" \"", "Yes.\" \"", "And now I ask you, Anna Louise Hansson:\" \"do you take Christian Refner as your lawfully wedded husband?\" \" ", "Yes.\" \" ", "Will you love and honor...\" \" I'm very sorry.\" \" ", "That's okay.\" \"", "Those who before us have pledged to live as man and wife,\" \"confirming before God and those assembled here their solemn vows, I therefore pronounce you man and wife.\" \"", "Don't throw them yet.\" \"", "Come here.\" \"", "I'll show you...\" \" Hi.\" \" ", "Hi, Jacob.\" \" ", "Doing well?\" \" ", "Yes.\" \" ", "Hi.\" \"", "Welcome.\" \" ", "Thank you.\" \" ", "This is my wife.\" \" ", "I see.\" \"", "Have you met Anna?\" \"", "You must.\" \" ", "This is Jacob, who I told you about.\" \" ", "Congratulations.\" \" ", "Christian.\" \" ", "Hi, Jacob.\" \"", "This is Christian's mother.\" \"", "There you are.\" \"", "Care for a drink?\" \"", "Yes, please.\" \" ", "Cheers.\" \"", "Welcome.\" \" ", "Thanks.\" \" ", "Can I play?\" \" ", "Yes!\" \"", "Are you any good?\" \"", "Good?\" \"!\" \"", "I'm the best\" \"Aren't you playing together?\" \"", "I stand not just before you, Anna- but also my boss and father-in-law, Jorgen\" \"and Helene and, of course, the rest of you.\" \"", "Anna, we met at Jorgen's firm when it was in the suburbs.\" \"", "I didn't dare speak to you because you were the boss's daughter.\" \"", "Then one day you needed to borrow 1000 kroner.\" \"", "Jorgen wasn't there and so I had to lend it to you.\" \"", "You'd think he was marrying Jorgen.\" \"", "But Jorgen and Helene, I would like... to thank you for the way you've welcomed me into the family.\" \"", "I know you think it's early for Anna to marry but please know that it feels very right to me.\" \"", "Anna, I love you more than all the world.\" \"", "I'm thrilled you'll have me.\" \"", "Please toast to my beautiful bride and her fantastic family who have welcomed me so kindly\" \"Jorgen, Helene, the twins...\" \"Cheers.\" \"", "Christian's lovely, don't you think?\" \"", "He's nice.\" \" ", "He's so cute.\" \" ", "Cute?\" \"", "Maybe.\" \" ", "I dated him before Anna.\" \" ", "Was he your boyfriend?\" \"", "But Anna gets whatever she wants.\" \"", "It's not traditional for the bride to give a speech but everything's gone so well so far.\" \"", "I know Mom's waiting for something to go horribly wrong.\" \"", "I'll do it now so that you can relax.\" \"", "My speech isn't for you, Christian.\" \"", "I love you and you know it.\" \"", "I couldn't be happier than I am today.\" \"", "And don't worry, I'll pay back the 1000 kroner.\" \"", "But I'd like to thank Mom and Dad.\" \"", "Mom, I know we argue now and then but you are the best, the most loving\" \"and the most loyal person I have ever met.\" \"", "And Dad...\" \"When I turned 18 a few years ago, you had to tell me that you weren't my real father... genetically.\" \"", "You told me how Mom had known another man\" \"and we didn't talk for almost six months.\" \"", "It wasn't until I met Christian that I began to understand why you did what you did.\" \"", "You did it to protect me, so I'd have a mother and father like everyone else.\" \"", "I've had a dad.\" \"", "You've been the best father anyone could ever wish for.\" \"", "And if I could have chosen, I would have chosen you, Dad, whether you're my father or not.\" \"", "So I'd like to say thank you.\" \"", "Thank you for today and for everything.\" \"", "And thanks for being the way you are for as long as I can remember.\" \"", "So I'd like to propose a toast for Mom and Dad- the loveliest couple here tonight.\" \" ", "Cheers.\" \" ", "Cheers.\" \"", "Why are you sitting here all by yourself?\" \"", "Because I want to.\" \"", "Weren't you ever taught not to abandon a lady with 7 old maids?\" \"", "Listen, I've got a plan.\" \"", "If you wait a little and I wait a little- we could go into town after they dance.\" \"", "You and me.\" \"", "I know a place where they make fruit with drinks in them.\" \" ", "You could come along.\" \" ", "I don't think so.\" \"", "I'd like to be alone for a while, okay?\" \" ", "I mean it.\" \" ", "Yes.\" \"", "I won't tell anyone if you come along.\" \"", "I won't tell Anna.\" \" ", "I don't want to talk to you.\" \" ", "No.\" \" ", "Are you angry?\" \" ", "Are you stupid?\" \"", "Go away!\" \"", "I don't know what the hell to think, Helene.\" \" ", "About what?\" \" ", "Too much fits together too well.\" \"", "But then I think, you wouldn't have done that to me.\" \"", "I'd like to talk, but not right now.\" \"", "I simply can't believe you've done this to me.\" \"", "I haven't done anything.\" \"", "What have I done?\" \"", "ls she my daughter?\" \"", "Of course not.\" \"", "She is mine and Jorgen's.\" \"", "What were you thinking?\" \" ", "ls she my daughter?\" \" ", "I'll call tomorrow.\" \" ", "I asked you a question!\" \" ", "I'll call you tomorrow!\" \"", "Won't you come to bed?\" \" ", "Why did you do it, Jorgen?\" \" ", "Do what?\" \"", "I didn't know it was him, Helene.\" \"", "It's just too much of a coincidence.\" \" ", "He shouldn't have come.\" \" ", "No.\" \"", "But we can't control everything in the world.\" \"", "Hi, it's 602 again.\" \"", "Do I have any messages now?\" \"", "Thanks.\" \" ", "That's nice.\" \" ", "Let me have a look?\" \" ", "It's got small swastikas on it.\" \" ", "They're not swastikas.\" \"", "It's wonderful.\" \"", "It's from...\" \" It's from Allan and Kristina.\" \" ", "One of our really good lawyers.\" \"", "He'll be fired for giving such an ugly vase, right?\" \" ", "Put it over there.\" \" ", "It goes in the basement.\" \"", "I have to talk to Helene.\" \"", "Listen, I don't like this either, but I need to talk to her now.\" \" ", "Come in.\" \" ", "Thank you.\" \"", "Wait here.\" \"", "Helene, we have a guest.\" \" ", "Wanna play football?\" \" ", "Hi.\" \" ", "Thanks for coming yesterday.\" \" ", "My pleasure.\" \" ", "Can we offer you something?\" \" ", "No.\" \"", "Helene, can we talk?\" \" ", "I was going to call.\" \" ", "But you didn't.\" \"", "Do you have a minute?\" \"", "Of course.\" \"", "Yes.\" \" ", "Let's go out to the kitchen.\" \" ", "Good idea.\" \" ", "Or would you rather be alone?\" \" ", "No, I'd like you to come.\" \"", "Boys, stay with Anna and grandmother.\" \" ", "Jorgen, is everything okay?\" \" ", "Yes, unpack your presents.\" \"", "All this running to and fro.\" \"", "You old grump...\" \" Did you lose again?\" \" ", "Yes.\" \"", "Don't come here like this.\" \"", "You should have waited for me to call you.\" \" ", "You didn't call!\" \" ", "Don't come here and intimidate me!\" \"", "I waited all day.\" \"", "Who are you?\" \"", "How can you stand yourself?\" \"", "Jacob, we tried to contact you several times, but we couldn't find you.\" \"", "Come on.\" \"", "You're filthy rich.\" \"", "You could have hired an army.\" \"", "It obviously took more than an army to find you.\" \"", "To find a junkie drinking in India with hookers.\" \"", "You hid my daughter for 20 years because I cheated once?\" \"", "Do you really think that's why, Jacob?\" \"", "Because you cheated once?\" \"", "You're a very small person.\" \" ", "What are you telling me?\" \" ", "You're not listening.\" \" ", "Then tell me.\" \"", "Tell me!\" \" ", "Let's all calm down a little.\" \"", "Why didn't you tell me you were pregnant?\" \" ", "We'd have figured something out.\" \" ", "I didn't know until I got back.\" \"", "I met Jorgen and...\" \"No, Jacob, I don't owe you anything.\" \"", "You don't owe...\" \"Aren't we talking about your daughter?\" \" ", "Shouldn't she know her father?\" \" ", "She has a father, a good father.\" \"", "I don't know what the hell to say.\" \"", "What you did is so wrong.\" \"", "You know that, right?\" \"", "But you have to tell her.\" \"", "You owe her and you owe me.\" \"", "She doesn't give a shit.\" \"", "You are so infuriating.\" \"", "ls that the language you use in this house?\" \"", "I just think that it would be good if you told her.\" \"", "If you don't, I will.\" \"", "I'm going to see what's going on.\" \"", "We thought he was dead.\" \" ", "We didn't think he existed.\" \" ", "You're still lying.\" \"", "I'm not lying.\" \"", "Jorgen tried to find him in India lots of times.\" \"", "He never reacted so we assumed that he wasn't...\" \" I don't have time for this, Mom.\" \" ", "Jacob was a big, immature child!\" \"", "He fucked everything with a pulse.\" \"", "He was drinking himself to death.\" \"", "He did drugs.\" \"", "He had grand ideas, but did nothing.\" \"", "He probably means well, but you can't trust him.\" \" ", "He wants to save everyone, but...\" \" I don't care if he's fucked a goat.\" \"", "I have a right to know who my father is.\" \" ", "You can't manipulate people like that.\" \" ", "We're not.\" \"", "Fuck off and leave us alone!\" \"", "Not right now.\" \"", "You're far out.\" \"", "What's Jorgen's reaction?\" \"", "Anna...?\" \" ", "Should I come along?\" \" ", "No.\" \"", "I'll wait here, okay?\" \"", "Would you like to come in?\" \"", "I mean, please come in.\" \"", "Thanks.\" \"", "I don't know what to say.\" \"", "It's a little new to me.\" \"", "For me too.\" \"", "Didn't you know I existed?\" \"", "I'm sorry.\" \"", "You shouldn't say sorry.\" \"", "You're the only one who can't be blamed.\" \" ", "Would you like a Coke?\" \" ", "Yes, please.\" \"", "I think we've got one here.\" \" ", "There aren't any more.\" \"", "Some water?\" \" ", "That's fine.\" \" ", "He's nice...\" \"Christian.\" \" ", "Yes, Christian.\" \"", "He's waiting in the car.\" \" ", "Mom said you were dead.\" \" ", "Well, okay.\" \"", "But apparently I'm not.\" \"", "Would you like a glass?\" \"", "It's a little tight. ", "lt needs a...\" \"How long are you staying?\" \"", "Do you have time to meet?\" \"", "Yes.\" \"", "I'd like that very much.\" \" ", "I'm here all the time.\" \" ", "I could call.\" \"", "Yes.\" \" ", "Or I could give you my number.\" \" ", "If you've got one, I'd like that.\" \" ", "Now you know I exist.\" \" ", "Yes.\" \"", "I've got a pencil and some paper.\" \" ", "Here you go.\" \" ", "Thanks.\" \"", "I better go now.\" \"", "Bye.\" \"", "I'll be home very soon.\" \"", "Do I have any brothers or sisters?\" \" ", "No, not really.\" \" ", "What do you mean?\" \"", "There's a little boy at the orphanage called Pramod.\" \" ", "Pramod?\" \" ", "Pramod, yes.\" \"", "I've taken care of him since he was a baby.\" \" ", "How old is he now?\" \" ", "He'll turn eight in precisely a week.\" \"", "He's this big.\" \"", "He's tiny, but he wants to be a footballer.\" \"", "Maybe it's stupid, but I brought some pictures, if you'd like to see them.\" \"", "Yes, please.\" \"", "Here I'm taking a bath.\" \"", "That's Lennart, my first boyfriend.\" \"", "He had a moped.\" \" ", "But he didn't want me.\" \" ", "Why not?\" \"", "Because I beat him at table tennis.\" \"", "It destroyed him.\" \"", "You can't do that!\" \"", "That was in Italy.\" \"", "That's Da...\" \"Jorgen.\" \"", "Was I silly to bring them?\" \"", "No, I'd like to see them all.\" \"", "What happened back then?\" \"", "Why didn't you come home?\" \"", "I just didn't.\" \"", "We had broken up.\" \"", "And you were drunk all the time, right?\" \"", "Yeah.\" \"", "And you did her friend?\" \"", "Yep, I think I actually did that.\" \" ", "Would you like dessert?\" \" ", "Yes, please.\" \"", "Jacob, I am glad you came anyway.\" \"", "I thought it all through yesterday and I became convinced we must continue.\" \"", "You would like to continue?\" \"", "As though nothing's happened?\" \"", "Yes, it fits even better now.\" \" ", "Well, let's try then.\" \" ", "Are you hungry?\" \"", "We need some lunch.\" \"", "We're going to lunch.\" \"", "Wasn't it strange meeting her again...\" \"Helene?\" \"", "Yes.\" \"", "Don't you think she's ageing well?\" \"", "She's still extremely beautiful.\" \"", "Cheers!\" \"", "Cheers.\" \"", "Why was I at that wedding, Jorgen?\" \"", "You knew.\" \"", "I didn't know.\" \"", "I didn't know you were that Jacob.\" \" ", "I don't believe that.\" \" ", "Well, I can't change anything now.\" \"", "What do you want?\" \" ", "The honest or the official answer?\" \" ", "I'd like the honest answer.\" \"", "I'm just a good person.\" \"", "There's not much in this.\" \"", "We better complain.\" \" ", "I don't need any more.\" \" ", "We need another bottle.\" \"", "It's the best way to get to know people.\" \"", "Another bottle.\" \" ", "I don't think that would be wise.\" \" ", "You're not paid to think.\" \"", "Either bring another bottle or bring your boss.\" \"", "Understand?\" \"", "Or should I ask him to translate?\" \" ", "I need to go.\" \" ", "Why?\" \"", "We'd like another drink.\" \" ", "What's the problem?\" \" ", "We need a bottle of schnapps.\" \"", "We can't serve you when you're so drunk.\" \"", "So drunk?\" \"", "I've only just gotten started.\" \" ", "It's a policy we have.\" \" ", "A policy?\" \"", "A policy?\" \"", "That's a damned bad argument.\" \"", "If you want to get on in the world, you need to make decisions.\" \"", "When you break policies, you show decisiveness.\" \"", "Yes, and I think you should go home.\" \"", "You stupid little asshole.\" \"", "Who do you think you're talking to?\" \" ", "Run off and get another bottle.\" \" ", "Jorgen, we'll go somewhere else.\" \"", "I'm not the only one that's drunk.\" \"", "Coming?\" \"", "Empty already?\" \"", "Those silly little bottles.\" \" ", "Mother helped too.\" \" ", "That's good.\" \"", "Helene, I would like to have a party on my birthday.\" \"", "It would be nice.\" \"", "Sure, but is one bottle of whiskey each enough?\" \"", "Jorgen, would you please tell me what this is all about?\" \"", "I couldn't be bothered.\" \"", "We're getting up early tomorrow and driving far.\" \"", "Why won't you let Jacob go home?\" \"", "You can't just run our lives in your sick head.\" \"", "Do you know what really doesn't suit you?\" \" ", "When you feel sorry for yourself.\" \" ", "Don't talk to me like that.\" \"", "But I don't understand what you're talking about!\" \"", "What have I done wrong, Helene?\" \"", "Can't you tell me what I've done wrong?\" \"", "I've made a deal with Jacob.\" \"", "You should be happy.\" \"", "If you're so bored, get another job or a hobby.\" \"", "Instead of going around making my life hell.\" \"", "Fine, as long as I get peace.\" \"", "Helene!\" \"", "I must admit it got a little wet.\" \" ", "I hope I didn't scare you.\" \" ", "lt takes more than that.\" \" ", "How about a drink?\" \" ", "It's a little early.\" \"", "I've changed the plans a little, so it will take a few more days.\" \"", "Why?\" \"", "I can't do that.\" \"", "I need to be back in two days.\" \"", "Listen.\" \"", "Instead of an annual donation...\" \"I've talked to my advisors about establishing a fund.\" \"", "It means something to all of us that you're Anna's biological father.\" \"", "So I'm establishing the fund in Anna's and your name.\" \"", "You two will decide how the money is spent.\" \"", "So you've chosen my project?\" \" ", "I just said that.\" \" ", "And you want me to do it with Anna?\" \"", "Yes, why not?\" \"", "She has shown a great interest in aid work.\" \"", "My advisors have gone through everything and agree that a sum of 12 million dollars is realistic.\" \" ", "12 million dollars?\" \" ", "I know the dollar is low.\" \"", "All kidding aside.\" \"", "You can quickly see that it will cover a whole year for 65,000 children.\" \"", "Including room, board, school and administration.\" \"", "65,000 children.\" \"", "That's more than are born in Denmark in a year.\" \"", "Think of what that money could do.\" \"", "You could really do something.\" \" ", "What do you get out of this?\" \" ", "Nothing.\" \"", "I keep my good life.\" \"", "I buy remission for my sins.\" \"", "And we're almost family.\" \" ", "Why are you doing this?\" \" ", "I'm assuming you're interested.\" \"", "Yes, damn it.\" \"", "Of course I'm interested.\" \"", "Jacob, stay here.\" \"", "You'll get to know Anna better.\" \"", "You could take out Helene for dinner.\" \"", "I'm going to to Sweden with the twins.\" \"", "We're going fishing.\" \"", "You're a strange man, Jorgen.\" \"", "She has to eat.\" \"", "She's a terrible cook.\" \" ", "Take care of yourselves, okay?\" \" ", "We will, Mother.\" \" ", "Don't lose too much online.\" \" ", "I won 235 dollars last night.\" \"", "Congratulations.\" \"", "Try and hang on to them.\" \" ", "Mom did it up wrong.\" \" ", "We can't have that.\" \"", "There.\" \"", "Hop inside.\" \"", "Thanks.\" \"", "I want to come with you.\" \"", "No, out of the question.\" \"", "You don't want to, Helene.\" \"", "It's sons and their father in the woods.\" \"", "Or else they'll turn out gay.\" \"", "Promise to use a life vest and water wings.\" \"", "And the boys too.\" \" ", "Bye bye!\" \" ", "Bye.\" \" ", "Can we talk?\" \" ", "What do you want to talk about?\" \" ", "We could start with Jorgen?\" \" ", "Stop already.\" \"", "Listen.\" \"", "Can I come in?\" \"", "Thanks.\" \" ", "So talk about Jorgen.\" \" ", "Can we sit down?\" \"", "We could find a chair.\" \"", "This is fine.\" \"", "May I sit here?\" \"", "Okay...\" \"Did you know Jorgen asked me to administer a fund?\" \" ", "No.\" \"", "What fund?\" \" ", "It's aid work.\" \"", "With Anna.\" \" ", "You'll run it with Anna?\" \" ", "With Anna.\" \"", "It's a very generous offer, but he's dragging things out.\" \"", "I want to know what's going on.\" \"", "If it's one of your games, I want it to stop.\" \"", "Stop being paranoid.\" \"", "You don't have to be poor to have good intentions.\" \"", "There are people with money and ideals.\" \" ", "Really?\" \"", "I'd like to meet one.\" \" ", "Hello, Jacob.\" \"", "Give me a break.\" \"", "You never had any ideals.\" \"", "I could be rude about your ideals and we could go on and on.\" \" ", "We could go on being rude...\" \" Then tell me what he wants.\" \"", "He doesn't care about the orphanage or humanitarian work.\" \"", "It's bad business.\" \"", "What does he want?\" \"", "I don't know what he wants to do with the orphanage and Anna.\" \"", "I don't understand it, Jacob.\" \"", "Then let me ask you a different way:\" \"Do you know something I don't?\" \"", "No, Jacob, I know nothing.\" \"", "That's all I wanted to know.\" \" ", "May I offer you a cup of coffee?\" \" ", "No, thanks.\" \" ", "Dare I offer you a glass of wine?\" \" ", "Only if you've got enough.\" \"", "Right.\" \"", "Dare I ask how you've been?\" \"", "The last twenty years?\" \"", "They've been a bit up and down.\" \"", "And you?\" \"", "I've been fine.\" \"", "Also a bit hectic.\" \" ", "I just got a daughter.\" \" ", "Congratulations.\" \" ", "Do you have a wife?\" \" ", "No.\" \" ", "You haven't married?\" \" ", "No.\" \"", "A girlfriend?\" \"", "No.\" \" ", "ls it rude of me to ask?\" \" ", "No, no.\" \" ", "Why don't I get that wine?\" \" ", "Good idea.\" \"", "When I went home, I thought you would follow me.\" \"", "I thought so too.\" \"", "I thought you would come back.\" \"", "You did?\" \"", "But we didn't.\" \"", "We should go to India.\" \" ", "Why?\" \" ", "It's warm.\" \"", "They've got good hotels.\" \"", "Stop it.\" \"", "Why?\" \"", "Look at this apartment.\" \"", "We're lying on a mattress.\" \"", "There's lots to do.\" \" ", "It doesn't matter.\" \" ", "It does.\" \" ", "And we're going to Val d'Isere.\" \" ", "We can go there, but not India?\" \"", "Give me a break.\" \"", "Ever since you met your real, holy father you've been really irritating to be with.\" \"", "What about us?\" \"", "It's always Jacob, Jacob, Jacob, all the time.\" \"", "You can't change things now, Anna.\" \"", "Hello.\" \"", "Why are you sitting here?\" \"", "Sweetheart!\" \"", "It's lovely to see you.\" \" ", "I can't stand it when we fight.\" \" ", "Me neither.\" \"", "But we need to talk about this properly.\" \" ", "Yes.\" \" ", "Like grown-ups.\" \" ", "Of course, sweetie.\" \" ", "So stop calling me sweetie.\" \" ", "What can I call you then?\" \" ", "You could call me Anna.\" \"", "Okay.\" \"", "Did you marry Jorgen for my sake?\" \"", "So that I had a father?\" \"", "No.\" \"", "I love Jorgen.\" \"", "Do you?\" \"", "A lot.\" \"", "So everything with Jacob was a mistake?\" \" ", "No.\" \" ", "What was it then?\" \"", "I was very in love with Jacob, but I was also very unhappy.\" \"", "About what?\" \"", "About being in love with him.\" \"", "We just hurt each other all the time.\" \"", "When you told me Jorgen wasn't my father- why didn't you say Jacob was?\" \"", "Maybe because...\" \"because I wanted to forget him.\" \"", "Did you?\" \"", "Well...\" \"I thought so.\" \" ", "Who drove off last night?\" \" ", "It was Jacob.\" \"", "I thought Johannes drove him, but he couldn't have.\" \" ", "Jorgen lent him to Jacob.\" \" ", "He never lends out Johannes.\" \"", "He did to Jacob.\" \"", "It seems he is giving it all to that Jacob.\" \"", "Helene Hansson.\" \"", "I'd like to speak to Doctor Phillipsen.\" \"", "Remember to lie.\" \"", "How big was it?\" \"", "You have to agree or she won't believe it...\" \"Good, off you go.\" \" ", "We caught one that was this big.\" \" ", "No way!\" \"", "It's true, but it got away.\" \"", "I have to go to town.\" \"", "Jorgen?\" \"", "Won't you stay for lunch?\" \"", "We ate on the way.\" \"", "I'll be home in a few hours.\" \" ", "Jorgen?\" \"", "I spoke to Doctor Phillipsen.\" \" ", "Yes.\" \"", "Phillipsen's under confidentiality.\" \"", "That's totally unacceptable.\" \"", "He promised me.\" \"", "He's betrayed my trust.\" \"", "You had promised him to tell me after the wedding, right?\" \"", "You've known for five months.\" \"", "I want to let it be for now, Helene.\" \"", "You don't have the time.\" \"", "What will you do?\" \"", "Anna and the boys must not know before it's absolutely necessary.\" \"", "Are you listening?\" \"", "Not before it's absolutely necessary.\" \" ", "Do you understand?\" \" ", "Yes.\" \"", "We'll figure something out.\" \"", "There's always a solution.\" \"", "There's always something in America...\" \" There's nothing to do.\" \" ", "Yes, there is.\" \"", "There's nothing to do!\" \" ", "There's...\" \" No!\" \" ", "There's nothing to do, understand?\" \" ", "You can't die!\" \"", "We don't get to decide, damn it.\" \"", "Let go.\" \"", "Get out.\" \"", "Get out of the damn car before I throw you out!\" \"", "Shut the door!\" \"", "How long will you stay there?\" \"", "So, here you are.\" \"", "Please excuse the formalities.\" \"", "You only need to read the last three pages.\" \"", "Did Helene invite you to my birthday?\" \" ", "No.\" \" ", "You can't rely on her.\" \" ", "Then I better do it.\" \" ", "Thanks.\" \"", "There are a few things I don't understand.\" \"", "Can we look at it?\" \"", "What does that mean?\" \"", "It means that you and Anna have 100% control of the fund.\" \"", "No, not that.\" \"", "Here it is.\" \"", "The part where it says I have to live in Denmark.\" \"", "Yes, we haven't talked about that yet.\" \"", "To build an organization like that you have to live in Denmark.\" \"", "Can't I just come to board meetings?\" \"", "No, it's a demand on my behalf.\" \"", "Why should I do that?\" \"", "Because I said it's a demand on my behalf.\" \"", "You mean that?\" \"", "I can't spend half a year here and half a year there?\" \"", "Have I said anything I don't mean?\" \"", "Maybe everyone else kisses your ass, but I won't.\" \" ", "What do you mean?\" \" ", "You've lost your mind.\" \"", "What is that?\" \"", "ls that why I came?\" \"", "To meet Anna and see Helene?\" \"", "You want to buy me?\" \" ", "I don't want to buy you.\" \" ", "That's what it says here.\" \"", "Fine, then let's say that.\" \"", "Think of what you could do with the money.\" \"", "How many you could help.\" \"", "Wouldn't you sell yourself for that?\" \" ", "Come on.\" \"", "I know you would.\" \" ", "You don't know shit about me.\" \"", "I know all about you.\" \"", "You're a good person.\" \"", "Naive, but well-intentioned.\" \"", "Except for some water projects and some schools in Bangalore not one of your projects has succeeded in the last 15 years.\" \"", "You're good at finding people to help, but not at financing it.\" \" ", "You've been checking me out?\" \" ", "Your orphanage has to close.\" \"", "All your sweet little kids will be on the street again.\" \"", "You fat pig.\" \"", "ls it fun playing God, you big, fat pig?\" \"", "It's not true.\" \"", "I'm just saying that you're lying to yourself.\" \"", "You're an idiot if you don't take this chance.\" \"", "You can kiss my ass, Jorgen.\" \" ", "Jacob, wait.\" \" ", "I don't want to talk to you.\" \"", "You're right, Jacob.\" \"", "Don't touch me!\" \"", "I don't have time for this.\" \"", "I am sick, damn it!\" \"", "I'm the one that is out of time.\" \"", "Jacob, I am dying.\" \"", "You have to stay and do what we have decided.\" \" ", "Nothing has been decided.\" \" ", "Anna will need you.\" \"", "And Helene...\" \"And the boys...\" \"They're so young, Jacob.\" \"", "Look at me, Jacob!\" \"", "Don't you see that there is a point to all of this?\" \"", "You have a responsibility here, Jacob.\" \"", "Do I have to live on the other side of the world to get your help?\" \"", "Hi, Anna.\" \"", "It's Jacob.\" \"", "Would you please call me?\" \"", "I need to speak to you.\" \"", "Call as soon as you can.\" \"", "I'm leaving now.\" \"", "I have to go take care of my hubby.\" \"", "ls something wrong?\" \" ", "Can I sleep here?\" \" ", "Yes, of course.\" \"", "Anna, what happened?\" \"", "There.\" \"", "Hi, sweetheart.\" \" ", "Are you managing?\" \" ", "I'm okay.\" \"", "He's been calling all morning.\" \" ", "I don't ever want to talk to him.\" \" ", "No.\" \" ", "Would you like some breakfast?\" \" ", "No, thanks.\" \" ", "I need some breakfast.\" \" ", "Yes, you do.\" \" ", "Want anything?\" \" ", "A glass of juice maybe.\" \"", "What a little asshole.\" \"", "What a stupid little boy.\" \" ", "Thank you for coming.\" \" ", "Of course I came.\" \"", "I'll get a room though, so I don't have to commute.\" \"", "I brought my teddy bear pajamas, some cookies and a glass of water- sloshing about in my bag.\" \"", "I haven't been in Copenhagen this often since university.\" \"", "I delivered papers.\" \" ", "You did?\" \" ", "I sold flowers pretending to be blind.\" \"", "Helene, you have to tell her.\" \"", "Jorgen doesn't want us to.\" \"", "What are you going to do?\" \"", "I don't know.\" \"", "Here comes breakfast.\" \"", "It turns out I was hungry after all.\" \"", "May I see?\" \"", "You look so beautiful.\" \"", "You're so lovely.\" \"", "Yes, you are.\" \"", "And you're so soft.\" \"", "And you smell so nice.\" \"", "I forgot your juice.\" \"", "That's all we needed.\" \"", "That dumb juice.\" \"", "I'm sorry...\" \"There.\" \"", "Jacob.\" \"", "Right there.\" \" ", "There.\" \" ", "Thank you.\" \"", "Jorgen, here you go.\" \"", "Thanks.\" \"", "Does anyone have a pen?\" \"", "Thanks.\" \"", "Anna signed yesterday, so now I'm a poor man.\" \"", "Almost.\" \" ", "Your daughter is here.\" \" ", "Anna?\" \"", "Then show her in.\" \" ", "Well, thank you for your time.\" \" ", "You're leaving and she's coming?\" \"", "I don't think she came to talk to me.\" \" ", "I didn't expect her to come today.\" \" ", "Me neither.\" \" ", "Are you okay?\" \" ", "Yes.\" \"", "He had to hurry to the bank.\" \" ", "Hi.\" \"", "Good to see you.\" \" ", "Hi, Anna.\" \"", "I didn't think you were coming today.\" \"", "Why didn't you tell me?\" \"", "Why haven't you told me yourself?\" \"", "Why do you keep lying to me?\" \"", "Sorry, Anna...\" \"I didn't want to make you sad.\" \"", "Did you think I wouldn't be sad if you just died one day?\" \" ", "No...\" \" What?\" \"", "I didn't want you to see me... as a dead man before I was.\" \"", "I wanted us to be together as much as possible before anyone knew.\" \"", "If I knew you were dying, I wouldn't spend my time doing other stuff.\" \"", "And I want you to tell me these things.\" \"", "I want you to tell me.\" \"", "Anna, you mustn't cry now.\" \"", "It will hurt... but it will pass, just like everything else.\" \"", "And now Jacob will be with you.\" \"", "I don't care about Jacob.\" \"", "You're my father and you didn't tell me you're dying.\" \"", "I don't want anyone but you.\" \"", "If you don't tell me you're dying, I can't say the things I want to say.\" \"", "To say that...\" \"I love you... and that I don't want you to die... and lots of other things...\" \"Come over here.\" \"", "I love you.\" \"", "Shouldn't you hurry up?\" \"", "They'll be here soon.\" \"", "You look great.\" \"", "Thank you.\" \"", "There, come on.\" \" ", "Are you still up?\" \" ", "It's skateboarding.\" \"", "ls it skateboarding?\" \"", "ls it exciting?\" \" ", "Move!\" \" ", "It's really exciting.\" \"", "Move!\" \"", "Then you have to go to bed in half an hour.\" \"", "Sleep tight.\" \"", "Jorgen was a diplomat, so he was sent down there.\" \"", "He sat down in the chair and he didn't say a word.\" \"", "Finally Baunsgaard asks, will they do it by 3 or will we have to pay overtime?\" \"", "Jorgen said, you won't have to pay overtime at least.\" \"", "I just fired all 42 of them.\" \"", "This story gets better and better.\" \"", "Last time it was 32.\" \"", "I don't know the cost in dollars and cents, but we almost went bankrupt.\" \"", "But we had integrity.\" \"", "Integrity, Jorgen.\" \" ", "And cheers to that, Jorgen.\" \" ", "Thanks.\" \"", "Cheers.\" \" ", "You're not drinking much tonight.\" \" ", "I probably shouldn't get drunk.\" \"", "I'll just start crying.\" \"", "I feel obliged to say thank you for all the kind words.\" \"", "Now I'm not the type that likes to hear my own voice in such a well filled room.\" \"", "But I am turning 48 after all.\" \"", "And there was so much I didn't manage to say when I turned 40... and much has happened since, so I think it's reasonable\" \"that I be allowed to steal ten minutes of your precious time.\" \"", "Because it is.\" \"", "Time is precious.\" \"", "The years have taught me that.\" \"", "Helene...\" \"I could stand here and brag about you for hours.\" \"", "But don't worry.\" \"", "I know you don't want me to.\" \"", "But I will say, that even though you can't always feel it\" \"I am extremely happy that you're with me.\" \"", "You are night and day, the heaven and the seas for me.\" \"", "The time I'm with you and our wonderful children confirms exactly what I would have said.\" \"", "Every acquaintance, every friend, every person who has a place in your heart... lt is the time with them that really means something.\" \"", "Nothing else matters.\" \"", "Apart from the firm, of course.\" \"", "We've expanded a lot recently.\" \"", "We will continue to, far into the future, I hope.\" \"", "Already today, cranes stand in London, New York and Singapore.\" \"", "It shouldn't be long before we can sleep in our own buildings when we visit Houston and Manila...\" \"I'll anticipate things a little and invite you all to the opening of our new headquarters in Singapore on January 5th next year.\" \"", "I'm sure my ten minutes are up, but I am very grateful to you for wanting to spend the day with me.\" \"", "And I would like to propose a toast to the future.\" \"", "Cheers!\" \"", "Jorgen?\" \"", "I talked to the boys' teacher about separating them after the holidays and moving Morten into a different class.\" \"", "It sounded quite reasonable.\" \"", "Because they're more...\" \"There are not so many cliques and...\" \" Why are you telling me?\" \" ", "Would you like a glass of water?\" \"", "Helene, come here.\" \"", "Why are you telling me this?\" \"", "Because we have to decide.\" \"", "You don't need me anymore, Helene.\" \"", "Everything is taken care of now, right?\" \"", "Anna and the boys...\" \"I'll just slow you all down.\" \" ", "Stop.\" \" ", "No.\" \"", "I'm the only one stopping for now.\" \"", "I just mean...\" \"Do you think you and Jacob will get together?\" \"", "Do you?\" \"", "Stop it.\" \"", "I would like to know.\" \"", "I just didn't want... you to see me...\" \"like this.\" \"", "This is only the beginning, Helene.\" \"", "It will get worse from now on.\" \" ", "Can you manage?\" \" ", "Yes.\" \"", "I'm so damned pathetic...\" \"I don't want to...\" \"I don't want to die!\" \"", "I don't, Helene.\" \"", "I don't want to, damn it!\" \"", "I don't want to die!\" \"", "I don't!\" \"", "Damn it!\" \"", "God damn it!\" \"", "I don't want to!\" \"", "I don't want to die, Helene.\" \"", "Why...?\" \"", "Praise be to God, our Lord Jesus Christ who by his great mercy has granted us hope\" \"in the resurrection of Jesus Christ from the dead.\" \"", "Jorgen Lennart Hansson... we commit your body to the ground.\" \"", "Ashes to ashes, dust to dust.\" \"", "And to dust thou shalt return.\" \"", "Goodbye, Dad.\"" ]

{ "pile_set_name": "OpenSubtitles" }

[ 0.0007862616912461817, 0.29093512892723083, 0.0006551938131451607, 0.0005835787742398679, 0.6473923325538635, 0.0008704764768481255, 0.04329269379377365, 0.0007933555752970278, 0.0011017265496775508, 0.0025962144136428833, 0.0008074736106209457, 0.06012173742055893, 0.13128815591335297, 0.001440329011529684, 0.010973970405757427, 0.001936023822054267, 0.9887446165084839, 0.9533095359802246, 0.059177350252866745, 0.005502751562744379, 0.016559891402721405, 0.10086739808320999, 0.001459849183447659, 0.0006833281368017197, 0.000918051868211478, 0.0007676876848563552, 0.0005960307898931205, 0.0005538144032470882, 0.0007603626581840217, 0.0006784363649785519, 0.0007761361775919795, 0.0010349118383601308, 0.0008136774995364249, 0.0005503592547029257, 0.0014348445693030953, 0.0007158492226153612, 0.03968525305390358, 0.0008263182244263589, 0.10311141610145569, 0.0011414776090532541, 0.0009188380790874362, 0.7012592554092407, 0.0006200454663485289, 0.001459849183447659, 0.032410990446805954, 0.0007211306947283447, 0.05038611218333244, 0.07696515321731567, 0.0009484771289862692, 0.01774059422314167, 0.0007737257983535528, 0.0009919079020619392, 0.08756302297115326, 0.0005983319133520126, 0.0010922237997874618, 0.0006598472245968878, 0.005361286923289299, 0.0007975897751748562, 0.000660965743009001, 0.0011730499099940062, 0.0026349739637225866, 0.0007144220871850848, 0.0006096537690609694, 0.0006059983279556036, 0.0007975760963745415, 0.0006448292406275868, 0.0009115469874814153, 0.001150555326603353, 0.0006720059318467975, 0.0007235599914565682, 0.002609207760542631, 0.0006796945235691965, 0.0009882828453555703, 0.0006848738994449377, 0.0008326945826411247, 0.0005592834786511958, 0.0006867186748422682, 0.0006652186857536435, 0.0014722882770001888, 0.000937728735152632, 0.0007592385518364608, 0.0009919079020619392, 0.01751825399696827, 0.0014689188683405519, 0.000862345565110445, 0.0008241137838922441, 0.0006184569792822003, 0.0006170438718982041, 0.0007579495431855321, 0.0007303923484869301, 0.005170144140720367, 0.0008952824282459915, 0.0007860916084609926, 0.0006974356365390122, 0.0006729582673870027, 0.001061717513948679, 0.0007850848487578332, 0.0005873014451935887, 0.0006575083243660629, 0.0006597315659746528, 0.0008253412670455873, 0.0006345449946820736, 0.02767832949757576, 0.005013449117541313, 0.0008250412647612393, 0.0009324325365014374, 0.0006101792678236961, 0.0005577896954491735, 0.0006706470157951117, 0.000572575256228447, 0.0007140218513086438, 0.000731741776689887, 0.000731741776689887, 0.0014563875738531351, 0.000784645788371563, 0.0005538109689950943, 0.0005748633993789554, 0.0007024699589237571, 0.001003521610982716, 0.0006425060564652085, 0.0007400897447951138, 0.0009599823970347643, 0.0006939598242752254, 0.0006583045469596982, 0.0006345449946820736, 0.0011058099335059524, 0.0006097453297115862, 0.0007718991255387664, 0.0011417348869144917, 0.0005983319133520126, 0.000544087786693126, 0.000544087786693126, 0.0006581502384506166, 0.0006603700458072126, 0.0006953563424758613, 0.8106548190116882, 0.0071258568204939365, 0.0008621196611784399, 0.06872740387916565, 0.04752437397837639, 0.0006200126954354346, 0.002469046972692013, 0.000575839017983526, 0.017841918393969536, 0.0008593495585955679, 0.0005983319133520126, 0.042623717337846756, 0.0011158653069287539, 0.0006331972545012832, 0.0027302876114845276, 0.0009202194050885737, 0.0006827780744060874, 0.0006510473322123289, 0.0005895677604712546, 0.0005273869028314948, 0.0005376014159992337, 0.0005729377153329551, 0.0006028730422258377, 0.0005571157089434564, 0.0005648192600347102, 0.0006586472154594958, 0.0006204991368576884, 0.0005642453907057643, 0.0005532950162887573, 0.002063555410131812, 0.0006300104432739317, 0.0007092938176356256, 0.0022179645020514727, 0.0006245587137527764, 0.0006556326407007873, 0.0006595388986170292, 0.0006777291418984532, 0.0070501891896128654, 0.0009474343969486654, 0.00606644619256258, 0.0008441177778877318, 0.0011448615696281195, 0.0008951327763497829, 0.0018349180463701487, 0.0011293502757325768, 0.0006431018700823188, 0.0005767634138464928, 0.0017044401029124856, 0.0008925793808884919, 0.0008158758864738047, 0.0005749760312028229, 0.0006414081435650587, 0.0005712520214729011, 0.0037193435709923506, 0.001141029759310186, 0.033270444720983505, 0.0008147531771101058, 0.0006762652192264795, 0.0007670182967558503, 0.0009122164337895811, 0.0005817164783366024, 0.0006101941107772291, 0.0009834839729592204, 0.0006586365634575486, 0.0009338052477687597, 0.053071338683366776, 0.0006266897544264793, 0.011684521101415157, 0.07639589160680771, 0.0006974356365390122, 0.004074189346283674, 0.0006974356365390122, 0.0005892273620702326, 0.0006403496372513473, 0.00247659208253026, 0.008110077120363712, 0.0033055974636226892, 0.0006795807857997715, 0.0006877033738419414, 0.0007058624760247767, 0.0006974356365390122, 0.000731741776689887, 0.0006425060564652085, 0.0005571157089434564, 0.0008627815986983478, 0.0006783197168260813, 0.0008561608265154064, 0.0013628775486722589, 0.0006025022594258189, 0.0005873014451935887, 0.0015400853008031845, 0.0006877033738419414, 0.0032861018553376198, 0.000931608839891851, 0.0016546383267268538, 0.0005888803279958665, 0.000544087786693126, 0.0006425060564652085, 0.0005748633993789554, 0.0012608226388692856, 0.0008441459503956139, 0.0008489454630762339, 0.0007455251179635525, 0.0006872555240988731, 0.004024073481559753, 0.0005737815517932177, 0.2638707160949707, 0.001756031415425241, 0.0007498946506530046, 0.000853302248287946, 0.0005528342444449663, 0.0006079475861042738, 0.0008473791531287134, 0.0006178389303386211, 0.0005106323515065014, 0.0006614559679292142, 0.0005984503077343106, 0.0007158321677707136, 0.000693963491357863, 0.0006905648042447865, 0.0011414579348638654, 0.054887909442186356, 0.001043367083184421, 0.0005885237478651106, 0.025517888367176056, 0.0006496007554233074, 0.010046287439763546, 0.0006988245295360684, 0.0006861508009023964, 0.0432608500123024, 0.0006392014329321682, 0.0013464611256495118, 0.009507376700639725, 0.0012872073566541076, 0.0007242588326334953, 0.008258574642241001, 0.0008882859838195145, 0.0010100515792146325, 0.001760943210683763, 0.000548197771422565, 0.0005284526851028204, 0.0008231385727412999, 0.000722838391084224, 0.000544087786693126, 0.000544087786693126, 0.011310580186545849, 0.0014277315931394696, 0.022372659295797348, 0.0007288337801583111, 0.0010647380258888006, 0.0013894042931497097, 0.0006359726539812982, 0.0005924157449044287, 0.0007113930187188089, 0.0007257768302224576, 0.0007930362480692565, 0.0006974356365390122, 0.0007084591197781265, 0.0007432926213368773, 0.0029349576216191053, 0.0008441177778877318, 0.05459638684988022, 0.9715738892555237, 0.29093512892723083, 0.3262767493724823, 0.0007684174343012273, 0.0006534013082273304, 0.0007821908220648766, 0.0006149151595309377, 0.002432378241792321, 0.0008117901161313057, 0.0011752392165362835, 0.013669026084244251, 0.0009168765973299742, 0.0033130464144051075, 0.0007868665270507336, 0.013669026084244251, 0.0008091669878922403, 0.00071415223646909, 0.0015659126220270991, 0.01947754994034767, 0.0011135149979963899, 0.0009598744800314307, 0.0006868302589282393, 0.0009087762446142733, 0.001376149128191173, 0.0008441177778877318, 0.0010336348786950111, 0.0007596383802592754, 0.0011259784223511815, 0.0005748633993789554, 0.0006120821926742792, 0.0008378719794563949, 0.02515394799411297, 0.062141548842191696, 0.0005778006161563098, 0.0006518010050058365, 0.0005924197030253708, 0.2936761677265167, 0.0009932555258274078, 0.005729833617806435, 0.000616439909208566, 0.000664873921778053, 0.001992456614971161, 0.0005571157089434564, 0.00128931796643883, 0.0005936888628639281, 0.002302359091117978, 0.000731741776689887, 0.0005509610055014491, 0.0006425771280191839, 0.0007699841517023742, 0.0008441177778877318, 0.0006682716775685549, 0.0009534562705084682, 0.0011134655214846134, 0.0008279173634946346, 0.0006442738813348114, 0.0006974356365390122, 0.001724004396237433, 0.000582425738684833, 0.0011828560382127762, 0.0009765112772583961, 0.028037501499056816, 0.0008072535274550319, 0.000587351736612618, 0.0015255298931151628, 0.5911009311676025, 0.0006974356365390122, 0.057856183499097824, 0.0011335453018546104, 0.001191094983369112, 0.16996625065803528, 0.0006458341958932579, 0.003712827805429697, 0.12698660790920258, 0.0007506647380068898, 0.0028070947155356407, 0.9677019715309143, 0.00111318938434124, 0.02510916441679001, 0.7761238217353821, 0.0031977545004338026, 0.0008040200336836278, 0.0011116316309198737, 0.4669169783592224, 0.0008872704929672182, 0.03784884139895439, 0.0008562494185753167, 0.0018331619212403893, 0.0006479309522546828, 0.0278550386428833, 0.0005719711189158261, 0.0007032938301563263, 0.0012643244117498398, 0.01852584443986416, 0.0009410317870788276, 0.0009742513066157699, 0.5059354901313782, 0.001658621709793806, 0.0006866097683086991, 0.0011353790760040283, 0.08503339439630508, 0.9842137098312378, 0.2812555730342865, 0.0010929908603429794, 0.0005408906727097929, 0.003726049792021513, 0.00060509133618325, 0.0015562783228233457, 0.0009105039644055068, 0.09764134883880615, 0.0010821435134857893, 0.0005960120470263064, 0.010605980642139912, 0.6758467555046082, 0.9941344857215881, 0.7282555103302002, 0.10057459026575089, 0.0008849195437505841, 0.0006564998184330761, 0.9891561269760132, 0.0007260763668455184, 0.008721420541405678, 0.0008781771757639945, 0.9948838353157043, 0.0007591549656353891, 0.26731598377227783, 0.0007820831378921866, 0.0010681668063625693, 0.0008518090471625328, 0.0008441177778877318, 0.0007109734578989446, 0.0011228229850530624, 0.0006160131888464093, 0.0005748633993789554, 0.0007723192684352398, 0.0006467612111009657, 0.0006503871409222484, 0.0021170165855437517, 0.0006722756079398096, 0.0006876129191368818, 0.08658219873905182, 0.01814797706902027, 0.0005888803279958665, 0.0006124816136434674, 0.0008079534745775163, 0.0009467464406043291, 0.0006590321427211165, 0.00079328753054142, 0.0009474343969486654, 0.0011162119917571545, 0.562215268611908, 0.0006729146698489785, 0.0008140489226207137, 0.0010157779324799776, 0.0007827835506759584, 0.0009570900583639741, 0.0007722324226051569, 0.0006974356365390122, 0.0005905274883843958, 0.0007384112104773521, 0.0006699982914142311, 0.0006974356365390122, 0.0021212787833064795, 0.0005846585263498127, 0.006793183274567127, 0.0006974356365390122, 0.0006761327385902405, 0.0008036802755668759, 0.0005748633993789554, 0.000966895604506135, 0.0010483075166121125, 0.0007707869517616928, 0.0010131283197551966, 0.000730224244762212, 0.0007883428479544818, 0.0010794146219268441, 0.0012686960399150848, 0.000730594911146909, 0.002508264034986496, 0.08972620964050293, 0.0014413236640393734, 0.11790639162063599, 0.04537442699074745, 0.046566735953092575, 0.0005888803279958665, 0.015118036419153214, 0.0015680536162108183, 0.011990652419626713, 0.0012948766816407442, 0.0009556325967423618, 0.000887096393853426, 0.002177505986765027, 0.004963389597833157, 0.0006184174562804401, 0.0015229848213493824, 0.01456911489367485, 0.0006453066016547382, 0.0007446474628522992, 0.0017283355118706822, 0.0008565920288674533, 0.0007579196244478226, 0.22010548412799835, 0.0007149261073209345, 0.0009935053531080484, 0.0008220745366998017, 0.0014334794832393527, 0.0005888803279958665, 0.0006720494711771607, 0.0005488275201059878, 0.0007543715182691813, 0.0007908488623797894, 0.0005802271771244705, 0.000652872200589627, 0.001962473848834634, 0.0010982381645590067, 0.001003655488602817, 0.0006717053474858403, 0.0006974356365390122, 0.0010740325087681413, 0.0009600820485502481, 0.0006001241272315383, 0.000544087786693126, 0.0008759770425967872, 0.0008847058052197099, 0.0007058699266053736, 0.0014964696019887924, 0.0008907621377147734, 0.0007867245003581047, 0.0009955210844054818, 0.0007718822453171015, 0.0005987809272482991, 0.0006015566177666187, 0.0006617371691390872, 0.0018067901255562901, 0.0008243564516305923, 0.0015895693795755506, 0.0005601076991297305, 0.001514919800683856, 0.0006523109041154385, 0.0265198927372694, 0.00341060315258801, 0.0007846330408938229, 0.0008433290640823543, 0.0014314231229946017, 0.0009252536110579967, 0.0012714783661067486, 0.001307181315496564, 0.004645184613764286, 0.7287887930870056, 0.17670989036560059, 0.000676303228829056, 0.000660071789752692, 0.0007347961654886603, 0.0007347961654886603, 0.17751477658748627, 0.0011078898096457124, 0.0006542656337842345, 0.008024608716368675, 0.9966762065887451, 0.0011562621220946312, 0.034155383706092834, 0.00082542619202286, 0.05649453029036522, 0.0009017332922667265, 0.0076514482498168945, 0.6470811367034912, 0.0013834935380145907, 0.0006200126954354346, 0.000946367159485817, 0.0005627469508908689, 0.0006547640077769756, 0.0007156248320825398, 0.000676885130815208, 0.0006773200584575534, 0.0025089073460549116, 0.8947410583496094, 0.0009558157180435956, 0.0007165140123106539, 0.055779047310352325, 0.0007203459972515702, 0.0011087819002568722, 0.0010950007708743215, 0.0006042277091182768, 0.0005687135853804648, 0.08648066222667694, 0.06094484403729439, 0.0006044201436452568, 0.0010417565936222672, 0.0020636438857764006, 0.001180700957775116, 0.0008982645231299102, 0.0013224926078692079, 0.0006856844411231577, 0.000579783518332988, 0.0009252536110579967, 0.0008359031053259969, 0.0010839026654139161, 0.000690011540427804, 0.0006314146448858082, 0.0033907063771039248, 0.0007517528720200062, 0.0006091968971304595, 0.0007874208968132734, 0.0006787494057789445, 0.0013783540343865752, 0.0007128996658138931, 0.0005522038554772735, 0.0005433026235550642, 0.0007932988810352981, 0.00109975622035563, 0.0010170256718993187, 0.0021298970095813274, 0.000594017212279141, 0.010955613106489182, 0.0007323619211092591, 0.001024194760248065, 0.0006672005984000862, 0.0021257298067212105, 0.0018709636060521007, 0.001752485171891749, 0.009944874793291092, 0.0008210822707042098, 0.0009005873580463231, 0.0005914377397857606, 0.8411468863487244, 0.0005840141675435007, 0.013192406855523586, 0.0006524402415379882, 0.0006565083167515695, 0.002494226908311248, 0.0007040016353130341, 0.07616817206144333, 0.010521701537072659, 0.17951317131519318, 0.020492952316999435, 0.019251352176070213, 0.014876375906169415, 0.0006923829787410796, 0.0005873014451935887, 0.017305681481957436, 0.013423833064734936, 0.0006923628388904035, 0.0006926552159711719, 0.0016122544184327126, 0.0005748633993789554, 0.005009145475924015, 0.0007143840193748474, 0.00440772483125329, 0.0008066845475696027, 0.925645649433136, 0.0006093534757383168, 0.0008510614279657602, 0.0025938088074326515, 0.0010483075166121125, 0.0006865907344035804, 0.0006218143389560282, 0.0007616759394295514, 0.013384749181568623, 0.000690011540427804, 0.0008908118470571935, 0.0005748633993789554, 0.0006303515983745456, 0.0008793234010227025, 0.0008522738353349268, 0.0006496638525277376, 0.000770210986956954, 0.0008380975923500955, 0.0008441177778877318, 0.0008121263235807419, 0.0006511264364235103, 0.0006651527946814895, 0.0009198200423270464, 0.0006651527946814895, 0.0005764391971752048, 0.0006535293068736792, 0.0010105256224051118, 0.2585424780845642, 0.03368205949664116, 0.0006018855492584407, 0.0008307232055813074, 0.0006297556101344526, 0.0006823000148870051, 0.001042091054841876, 0.003128253621980548, 0.0018191324779763818, 0.009463525377213955, 0.003461712272837758, 0.001225767657160759, 0.0009909840300679207, 0.0006228220881894231, 0.0007899928605183959, 0.0006304939743131399, 0.0009952461114153266, 0.00070903729647398, 0.0007989998557604849, 0.0005983319133520126, 0.0233134925365448, 0.002238110639154911, 0.0006859576678834856, 0.010218334384262562, 0.0007378095178864896, 0.001000313786789775, 0.0011312421411275864, 0.0006162528297863901, 0.0008235446293838322, 0.002399103483185172, 0.0005873014451935887, 0.011944715864956379, 0.0008441177778877318, 0.0019431470427662134, 0.0008441177778877318, 0.002699483884498477, 0.0008441177778877318, 0.001747550442814827, 0.0008099214755930007, 0.001167658600024879, 0.000582425738684833, 0.0008304291404783726, 0.0006368873873725533, 0.004655302502214909, 0.0010225382866337895, 0.000699881580658257, 0.012740365229547024, 0.0009252536110579967, 0.0006434262031689286, 0.000555644859559834, 0.0008813814492896199, 0.0009252536110579967, 0.0006704836850985885, 0.0020740751642733812, 0.0006204096716828644, 0.0013735657557845116, 0.0007425835938192904, 0.0020635996479541063, 0.0005987132899463177, 0.001042091054841876, 0.014737320132553577, 0.0007579890079796314, 0.0006324595888145268, 0.0009010487701743841, 0.0006684535183012486, 0.0008763828664086759, 0.00209070835262537, 0.0005709403776563704, 0.024684518575668335, 0.0009587703971192241, 0.00055577332386747, 0.0006974356365390122, 0.06753553450107574, 0.0006945437053218484, 0.011736744083464146, 0.0007984217954799533, 0.001061938120983541, 0.0006919825682416558, 0.004569875542074442, 0.0012576273875311017, 0.0008441177778877318, 0.0006525362841784954, 0.0026654177345335484, 0.0007825822103768587, 0.0012112390249967575, 0.0008441177778877318, 0.0007606408908031881, 0.0006991995614953339, 0.0007684174343012273, 0.0039968849159777164, 0.05605287104845047, 0.0009347518789581954, 0.0018808936001732945, 0.0016317834379151464, 0.0007069554412737489, 0.005959845148026943, 0.0008002017857506871, 0.0006851530051790178, 0.0006422363803721964, 0.0007880203193053603, 0.0012046305928379297, 0.0008091939962469041, 0.0007511105504818261, 0.0006312531186267734, 0.013998163864016533, 0.001376714208163321, 0.0014441113453358412, 0.0006851726211607456, 0.002519777975976467, 0.0007022566860541701, 0.0011827100533992052, 0.00110748247243464, 0.0011457065120339394, 0.0006332645425572991, 0.0007145303534343839, 0.00110748247243464, 0.0006162722129374743, 0.0006974356365390122, 0.0006790406187064946, 0.0007171383476816118, 0.0008129687048494816, 0.0006406737957149744, 0.0007207130547612906, 0.0006275336490944028, 0.0007519237697124481, 0.00138674711342901, 0.0011927083833143115, 0.0006824430311098695, 0.0011142821749672294, 0.0006417359109036624, 0.0010872952407225966, 0.0006974356365390122, 0.0005941618583165109, 0.000663610699120909, 0.000715336762368679, 0.0006373688811436296, 0.0024089987855404615, 0.0012745162239298224, 0.0010539722861722112, 0.8560914397239685, 0.7406917214393616, 0.03254680708050728, 0.5681120753288269, 0.9900980591773987, 0.8186428546905518, 0.0010737716220319271, 0.0014547837199643254, 0.0005835528718307614, 0.0006218872149474919, 0.001330031780526042, 0.0008441177778877318, 0.002474982524290681, 0.0007350196246989071, 0.0005748633993789554, 0.0006248963181860745, 0.0006548885139636695, 0.0007240059785544872, 0.0007774485857225955, 0.0007715920801274478, 0.0007063560769893229, 0.0007376273861154914, 0.0005867640138603747, 0.00397882703691721, 0.000731789565179497, 0.0011745871743187308, 0.0009049928630702198, 0.0008448677835986018, 0.0009052373934537172, 0.0009383001015521586, 0.0007831876282580197, 0.9851810932159424, 0.0007883428479544818, 0.35075148940086365, 0.0008723227074369788, 0.0008119073463603854, 0.000693964771926403, 0.003583791432902217, 0.03381938487291336, 0.0007118660723790526, 0.0006294984486885369, 0.0008918598177842796, 0.0005970633355900645, 0.03884236142039299, 0.0028070947155356407, 0.0008739224867895246, 0.9173941612243652, 0.0007345774210989475, 0.0006155557930469513, 0.0006274176994338632, 0.0006122219492681324, 0.000597817765083164, 0.0007562313112430274, 0.003329080529510975, 0.12595413625240326, 0.9892151951789856, 0.939106285572052, 0.0008096039528027177, 0.2744881212711334, 0.9760007262229919, 0.9896831512451172, 0.0008007059223018587, 0.0029349576216191053, 0.0007465428207069635, 0.4988805055618286, 0.0008233829285018146, 0.8970962762832642, 0.001169328112155199, 0.017498839646577835, 0.0011583075392991304, 0.0006536143482662737, 0.0010343341855332255, 0.0013900408521294594, 0.006553356070071459, 0.0008308184915222228, 0.0007748861098662019, 0.005838972050696611, 0.0006656798068434, 0.000709394458681345, 0.0007924797828309238, 0.0007798890583217144, 0.0011460192035883665, 0.0017003209795802832, 0.002983505604788661, 0.0009716529166325927, 0.0016281052958220243, 0.0006266897544264793, 0.0007811248651705682, 0.0006926552159711719, 0.0007064497331157327, 0.0007684877491556108, 0.0006295242346823215, 0.0007577271899208426, 0.0009958487935364246, 0.0008441177778877318, 0.0015605994267389178, 0.0005983319133520126, 0.0012586310040205717, 0.0007630061008967459, 0.0010057712206616998, 0.0006182421348057687, 0.9926804900169373, 0.9853501319885254, 0.0005225084023550153, 0.0006991226109676063, 0.000701266573742032, 0.001360416761599481, 0.0006135882576927543, 0.0005965838208794594, 0.0010225382866337895, 0.004801392555236816, 0.0008952931384555995, 0.001238146098330617, 0.0010162711841985583, 0.0007662306888960302, 0.0010103220120072365, 0.0007255887030623853, 0.0007276702672243118, 0.0017758370377123356, 0.0006636467296630144, 0.0019096650648862123, 0.025491632521152496, 0.31543225049972534, 0.0013121444499120116, 0.000686220417264849, 0.8273522257804871, 0.000698281277436763, 0.0009599823970347643, 0.0006798059330321848, 0.0006926552159711719, 0.0005571157089434564, 0.0009938792791217566, 0.0005748633993789554, 0.0008037753286771476, 0.0005748633993789554, 0.0008851960301399231, 0.0007859879406169057, 0.0737091600894928, 0.0009098683949559927, 0.0007913127774372697, 0.0005381848313845694, 0.016649169847369194, 0.000702377874404192, 0.000691347464453429, 0.0009587703971192241, 0.0008375945617444813, 0.0006974356365390122, 0.0009622616344131529, 0.000731741776689887, 0.000580639869440347, 0.0006656798068434, 0.0007160433451645076, 0.0009839090052992105, 0.0011111091589555144, 0.00656796945258975, 0.001525837928056717, 0.45925888419151306, 0.0011378395138308406, 0.0053503490053117275, 0.0006869244971312582, 0.47281983494758606, 0.0005993578815832734, 0.0009183287038467824, 0.07112781703472137, 0.015688510611653328, 0.01620008982717991, 0.015573189593851566, 0.8854326009750366, 0.1601056605577469, 0.5574260950088501, 0.5647608041763306, 0.0006640740903094411, 0.0008194376132450998, 0.0011588510824367404, 0.0007008660468272865, 0.0005571157089434564, 0.0010700114071369171, 0.0013390412786975503, 0.0007860137848183513, 0.0013687433674931526, 0.0008034069323912263, 0.026197761297225952, 0.0005909173632971942, 0.026197761297225952, 0.020264964550733566, 0.001459849183447659, 0.0007143945549614727, 0.0011312044225633144, 0.0013297131517902017, 0.0009175048908218741, 0.010832255706191063, 0.0006620661588385701, 0.0006801357958465815, 0.0048210956156253815, 0.0006440114229917526, 0.0007116483757272363, 0.0005613120156340301, 0.0005748633993789554, 0.000544087786693126, 0.03607138991355896, 0.015453392639756203, 0.026139825582504272, 0.0004997115465812385, 0.0011781578650698066, 0.000824720598757267, 0.0014185747131705284, 0.0008134603849612176, 0.0006207579863257706, 0.000796895066741854, 0.22986188530921936, 0.0008344249217770994, 0.002314105397090316, 0.0006703936378471553, 0.014772236347198486, 0.000600421626586467, 0.0007518517668358982, 0.0012049565557390451, 0.000597622653003782, 0.0005810639704577625, 0.0006025430629961193, 0.0005348975537344813, 0.0005800107028335333, 0.0005677819717675447, 0.0005641082534566522, 0.0006001241272315383, 0.00110748247243464, 0.0006706122076138854, 0.0005682800547219813, 0.0009487618808634579, 0.0009039979195222259, 0.0010877071181312203, 0.0008122941944748163, 0.0006373837240971625, 0.003072571475058794, 0.0006111768889240921, 0.02773796021938324, 0.004655381664633751, 0.0008441177778877318, 0.0009313072077929974, 0.0007743672467768192, 0.0026654177345335484, 0.0008813814492896199, 0.0006330346222966909, 0.002780422568321228, 0.0007534612668678164, 0.0016351279336959124, 0.0007922952645458281, 0.0006974356365390122, 0.8352557420730591, 0.0008640922605991364, 0.8548865914344788, 0.20803461968898773, 0.0025927196256816387, 0.9410704374313354, 0.9441856741905212, 0.007678286172449589, 0.059157438576221466, 0.0011472349287942052, 0.0011372285662218928, 0.6942428946495056, 0.29085636138916016, 0.053340353071689606, 0.0012698735808953643 ]

[ "Rhopalomyia californica\n\nRhopalomyia californica, the coyote brush bud gall midge, is a species of gall midges, insects in the family Cecidomyiidae.", "\n\nReferences\n\nFurther reading\n\n \n \n\nCategory:Cecidomyiinae\nCategory:Articles created by Qbugbot\nCategory:Insects described in 1908" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.04636397212743759, 0.005334671586751938 ]

[ "Swans Gmunden\n\nBasket Swans Gmunden is an Austrian professional basketball club that is based in Gmunden. ", "Their home arena is Volksbank-Arena Gmunden. ", "The club has won the Austrian Bundesliga four times; the last championship was in 2010. ", "To add to that, the Swans have won six national Cups as well. ", "The main sponsor of the team used to be Allianz for a long time.", "\n\nHistory\n\nThe team was founded in 1965, as the basketball section of \"Union Gmunden\". ", "The first match of Union was played in 1966, it was lost 11–35. ", "After six years, the team eventually promoted all the way to the 2. ", "Bundesliga. ", "Gmunden played seven years in the league, than promoted to the 1. ", "Bundesliga.", "\n\nThe club had its golden years starting from 2003, since then the team started winning trophies in Austria. ", "In 2005, 2006 and 2007 the Swans took the national title. ", "In the 2007–08 season, the first European game of the Swans was played. ", "The team competed in the ULEB Cup, the second tier of European basketball. ", "Swans won the first game on the road against Hapoel Galil Elyon with 74:79. ", "After it sensationally survived the regular season, the team lost in the Eight-finals against Joventut Badalona, the eventual ULEB Cup champions.", "\n\nIn 2014, the sponsorship deal with Allianz ended and the team was named just Swans Gmunden.", "\n\nTrophies\nÖsterreichische Bundesliga: 4 \n2005, 2006, 2007, 2010\nAustrian Cup: 6 \n 2003, 2004, 2008, 2010, 2011, 2012\nAustrian Supercup: 7\n2004, 2005, 2006, 2007, 2008, 2010, 2011\n\nSeason by season\n\nCurrent roster\n\nNotable players\n\n De'Teri Mayes (12 seasons: 1999–2011)\n Kęstutis Kemzūra (1 season: 2000–01)\n Darius Dimavičius (2 seasons: 2000–02)\n Ian Boylan (4 seasons: 2006–08, 2009–11)\n Robert Arnold (2 seasons: 2011–13)\n Sharaud Curry (1 season: 2011–12)\n\nReferences\n\nExternal links\n Official website \n Eurobasket.com Swans Gmunden Page\n\nCategory:Gmunden\nCategory:Basketball teams in Austria\nCategory:Basketball teams established in 1966\n \nCategory:1965 establishments in Austria" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0009561021579429507, 0.0011694361455738544, 0.0007521818042732775, 0.0007192834164015949, 0.0006192912696860731, 0.0006575067527592182, 0.0006908794166520238, 0.0006130764959380031, 0.0008272943086922169, 0.0008732932037673891, 0.0008272943086922169, 0.0005890193278901279, 0.0006899794097989798, 0.0006188455154187977, 0.0007872678688727319, 0.0007713053491897881, 0.001092886202968657, 0.0006642693188041449, 0.0006167337414808571 ]

[ "History\n\nMexican Routes | Free Mexico Travel Guide and Travel Information\n\nSorry, your browser does not support this audio tag.", "\n\nThe history of Mexico covers a period of more than three millennia. ", "First populated more than 13,000 years ago, the territory had complex indigenous civilizations before being conquered and colonized by the Spanish in the 16th century. ", "One of the important aspects of Mesoamerican civilizations was their development of a form of writing, so that Mexico’s written history stretches back hundreds of years before the arrival of the Spaniards in 1519. ", "This era before the arrival of Europeans is called variously the prehispanic era or the precolumbian era.", "\n\nThe Aztec capital of Tenochtitlan became the Spanish capital Mexico City, which was and remains the most populous city in Mexico.", "\n\nFrom 1521, the Spanish conquest of the Aztec empire incorporated the region into the Spanish Empire, with New Spain its colonial era name and Mexico City the center of colonial rule. ", "It was built on the ruins of the Aztec capital of Tenochtitlan and became the capital of New Spain. ", "During the colonial era, Mexico’s long-established Mesoamerican civilizations mixed with European culture. ", "Perhaps nothing better represents this hybrid background than Mexico’s languages: the country is both the most populous Spanish-speaking country in the world and home to the largest number of Native American language speakers in North America. ", "For three centuries Mexico was part of the Spanish Empire, whose legacy is a country with a Spanish-speaking, Catholic and largely Western culture.", "\n\nAfter a protracted struggle (1810–21) for independence, New Spain became the sovereign nation of Mexico, with the signing of the Treaty of Córdoba. ", "A brief period of monarchy (1821–23), called the First Mexican Empire, was followed by the founding of the Republic of Mexico, established under a federal constitution in 1824. ", "Legal racial categories were eliminated, abolishing the system of castas. ", "Slavery was not abolished at independence in 1821 or with the constitution in 1824, but was eliminated in 1829. ", "Mexico continues to be constituted as a federated republic, under the Mexican Constitution of 1917.", "\n\nThe Age of Santa Anna is the period of the late 1820s to the early 1850s that was dominated by criollo military-man-turned-president Antonio López de Santa Anna. ", "In 1846, the Mexican–American War was provoked by the United States, ending two years later with Mexico ceding almost half of its territory via the Treaty of Guadalupe Hidalgo to the United States. ", "Even though Santa Anna bore significant responsibility for the disastrous defeat, he returned to office.", "\n\nThe Liberal Reform began with the overthrow of Santa Anna by Mexican liberals, ushering in La Reforma beginning in 1854. ", "The Mexican Constitution of 1857 codified the principles of liberalism in law, especially separation of church and state, equality before the law, that included stripping corporate entities (the Catholic Church and indigenous communities) of special status. ", "The Reform sparked a civil war between liberals defending the constitution and conservatives, who opposed it. ", "The War of the Reform saw the defeat of the conservatives on the battlefield, but conservatives remained strong and took the opportunity to invite foreign intervention against the liberals in order to forward their own cause.", "\n\nThe French Intervention is the period when France invaded Mexico (1861), nominally to collect on defaulted loans to the liberal government of Benito Juárez, but it went further and at the invitation of Mexican conservatives seeking to restore monarchy in Mexico set Maximilian I on the Mexican throne. ", "The US was engaged in its own Civil War (1861–65), so did not attempt to block the foreign intervention. ", "Abraham Lincoln consistently supported the Mexican liberals. ", "At the end of the civil war in the US and the triumph of the Union forces, the US actively aided Mexican liberals against Maximilian’s regime. ", "France withdrew its support of Maximilian in 1867 and his monarchist rule collapsed in 1867 and Maximilian was executed.", "\n\nWith the end of the Second Mexican Empire, the period often called the Restored Republic (1867–76) brought back Benito Juárez as president. ", "Following his death from a heart attack, Sebastian Lerdo de Tejada succeed him. ", "He was overthrown by liberal military man Porfirio Diaz, who after consolidating power ushered in a period of stability and economic growth. ", "The half-century of economic stagnation and political chaos following independence ended.", "\n\nThe Porfiriate is the era when army hero Porfirio Díaz held power as president of Mexico almost continuously from 1876-1911. ", "He promoted “order and progress” that saw the modernization of the economy and the flow of foreign investment to the country. ", "The period is generally called the Porfiriato, which ended with the outbreak of the Mexican Revolution in 1910. ", "Under Díaz, Mexico’s industry and infrastructure were modernized by a strong, stable but autocratic central government. ", "Increased tax revenues and better administration brought dramatic improvements in public safety, public health, railways, mining, industry, foreign trade, and national finances.", "\n\nThe Mexican Revolution is the chaotic period between 1910 and 1920 when Mexicans fought to determine future after the end of the Díaz era. ", "Although little had been done for the nation’s poor, the sparking forces of the Mexican Revolution were elites outside Díaz’s inner circle, such as Francisco Madero, a member of one of the richest land-owning families in Mexico, plus liberal intellectuals, and industrial labor activists. ", "The fraudulent election of 1910 keeping 80-year-old Díaz in power brought opposition elements together, unleashing a 10-year civil war known as the Mexican Revolution (1910–20). ", "The conflict was not a unified one, but took place mainly in Mexico’s north with organized armies of movement under leaders such as Pancho Villa and Alvaro Obregón and in the center of Mexico, particularly the state of Morelos with guerrilla peasants fighting under the leadership of Emiliano Zapata. ", "The war killed a tenth of the nation’s population and drove many northern Mexicans across the U.S. border to escape the fighting. ", "The Revolution ended the system of large landed estates, or haciendas, that had originated with the Spanish Conquest.", "\n\nA new legal framework was established in the Constitution of 1917, which reversed the principle established under Porfirio Díaz that gave absolute property rights to individuals. ", "Article 27 of the Constitution, empowered the State to expropriate owners and gave the State subsoil rights, which had been the principle during the colonial era. ", "Organized labor’s contribution to the revolution was recognized in Article 123, guaranteeing labor unions’ rights. ", "In Article 3, the State strengthened its anticlerical measures to control the power of the Roman Catholic Church. ", "Northern revolutionary generals Alvaro Obregón and Plutarco Elías Calles each served a four-year presidential term following the end of the military conflict in 1920. ", "The assassination of president-elect Obregón in 1928 led to a crisis on succession, solved by the creation of a party structure in 1929.", "\n\nThe post-revolutionary era is generally marked by political peace whereby conflicts are not resolved by violence. ", "This new period has been marked by changes in policy and amendments to the 1917 Mexican Constitution to allow for neoliberal economic policies. ", "Following the formation in 1929 of the precursor to the Partido Revolucionario Institucional (PRI), this single party controlled national and state politics after 1929, and nationalized the oil industry in the 1930s. ", "Following World War II, where Mexico had been a strong ally of the United States and had benefited significantly by supplying metals to build war materiel as well as guest farm workers, who freed U.S. American men to fight in the two front war. ", "Mexico emerged from World War II with wealth and political stability and unleashed a major period of economic growth, often called the Mexican Miracle. ", "It was organized around the principles of import substitution industrialization, with the creation of many state-owned industrial enterprises. ", "The population grew rapidly and became more urbanized while many others moved to the United States.", "\n\nA new era began in Mexico following the fraudulent 1988 presidential elections. ", "The Institutional Revolutionary Party barely won the presidential election, and President Carlos Salinas de Gortari began implementing sweeping neoliberal reforms in Mexico. ", "These reforms required the amendment of the Constitution, especially curtailing the power of the Mexican state to regulate foreign business enterprises, but also lifted the suppression of the Roman Catholic Church in Mexico. ", "Mexico’s economy was further integrated with that of U.S. and also Canada after the North American Free Trade Agreement or NAFTA agreement began lowering trade barriers in 1994. ", "Seven decades of PRI rule ended in the year 2000 with the election of Vicente Fox of the Partido Acción Nacional (PAN). ", "His successor, Felipe Calderón, also of the PAN, embarked on a war against drug mafias in Mexico, one which has resulted in tens of thousands of deaths. ", "In the face of extremely violent drug wars, the PRI returned to power in 2012, promising that it had reformed itself.", "\n\nThe dense and socially filled and politically complex civilizations of Mexico developed in the center and southern regions (with the southern region extending into what is now Central America) in what has come to be known as Mesoamerica. ", "The civilizations that rose and declined over millennia were characterized by:\n\nsignificant urban settlements\n\nmonumental architecture such as temples, palaces, and other monumental architecture, such as the ball court\n\nthe division of society into religious, political, and political elites (such as warriors and merchants) and commoners who pursued subsistence agriculture\n\ntransfer of tribute and rending of labor from commoners to elites\n\nreliance on agriculture often supplemented by hunting and fishing and the complete absence of a pastoral (herding) economy, since there were no domesticated herd animals prior to the arrival of the Europeans\n\ntrade networks and markets\n\nIt is remarkable that so many civilizations arose in a region with no major navigable rivers, no beasts of burden, and difficult terrain that impeded the movement of people and goods. ", "Indigenous civilizations developed complex ritual and solar calendars, a significant understanding of astronomy and developed forms of written communication in the form of glyphs, clear testimony to their advanced level of sophistication.", "\n\nThe history of Mexico prior to the Spanish conquest is known through the work of archaeologists, epigraphers, and ethnohistorians (scholars who study indigenous history, usually from the indigenous point of view), who analyze Mesoamerican indigenous manuscripts, particularly Aztec codices, Mayan codices, and Mixtec codices.", "\n\nAccounts written by the Spanish at the time of their conquest (the conquistadores) and by indigenous chroniclers of the post-conquest period constitute the principal source of information regarding Mexico at the time of the Spanish Conquest.", "\n\nWhile relatively few pictorial manuscripts (or codices) of the Mixtec and Aztec cultures of the Post-Classic period survive, progress has been made in the area of Maya archaeology and epigraphy.", "\n\nThe presence of people in Mesoamerica was once thought to date back 40,000 years, an estimate based on what were believed to be ancient footprints discovered in the Valley of Mexico; but after further investigation using radiocarbon dating, it appears this date may not be accurate. ", "It is currently unclear whether 23,000-year-old campfire remains found in the Valley of Mexico are the earliest human remains uncovered so far in Mexico.", "\n\nThe first people to settle in Mexico encountered a climate far milder than the current one. ", "In particular, the Valley of Mexico contained several large paleo-lakes (known collectively as Lake Texcoco) surrounded by dense forest. ", "Deer were found in this central area, but most fauna were small land animals and fish and other lacustrine animals were found in the lake region. ", "Such conditions encouraged the initial pursuit of a hunter-gatherer existence.", "\n\nCorn, squash, and beans\n\nThe diet of ancient central and southern Mexico was varied, including domesticated corn (or maize), squashes such as pumpkin and butternut squash, common or pinto beans, tomatoes, peppers, cassavas, pineapples, chocolate, and tobacco. ", "The Three Sisters (corn, squash, and beans) constituted the principal diet.", "\n\nIndigenous peoples in western Mexico began to selectively breed maize (Zea mays) plants from precursor grasses (e.g., teosinte) between 5,000 and 10,000 years ago.", "\n\nReligion\n\nThe Mesoamerican had the concept of god and religion, but were very different from Abrahamic concepts. ", "The Mesoamericans had a belief where everything, every element of the cosmos, the earth, the sun, the moon, the stars, which mankind inhabits, everything that forms part of nature such as animals, plants, water and mountains all represented a manifestation of the supernatural. ", "In most cases gods and goddesses are often depicted in stone reliefs, pottery decoration, wall paintings and in the various Maya, and pictorial manuscripts such as Maya codices, Aztec codices, and Mixtec codices.", "\n\nThe spiritual pantheon was vast and extremely complex. ", "However, many of the deities depicted are common to the various civilizations and their worship survived over long periods of time. ", "They frequently took on different characteristics and even names in different areas, but in effect they transcended cultures and time. ", "Great masks with gaping jaws and monstrous features in stone or stucco were often located at the entrance to temples, symbolizing a cavern or cave on the flanks of the mountains that allowed access to the depths of Mother Earth and the shadowy roads that lead to the underworld.", "\n\nCults connected with the jaguar and jade especially permeated religion throughout Mesoamerica. ", "Jade, with its translucent green color was revered along with water as a symbol of life and fertility. ", "The jaguar, agile, powerful and fast, was especially connected with warriors and as spirit guides of shamans. ", "Despite differences of chronology or geography, the crucial aspects of this religious pantheon were shared amongst the people of ancient Mesoamerica.", "\n\nThus, this quality of acceptance of new gods to the collection of existing gods may have been one of the shaping characteristics for the success during the Christianization of Mesoamerica. ", "New gods did not at once replace the old; they initially joined the ever-growing family of deities or were merged with existing ones that seemed to share similar characteristics or responsibilities. ", "The Christianization of Europe also followed similar patterns of appropriation and transformation of existing deities.", "\n\nA great deal is known about Aztec religion due to the work of the early mendicant friars in their work to convert the indigenous to Christianity. ", "The writings of Franciscans Fray Toribio de Benavente Motolinia and Fray Bernardino de Sahagún and Dominican Fray Diego Durán recorded a great deal about Nahua religion, since they viewed understanding the ancient practices as essential for successfully converting the indigenous to Christianity.", "\n\nWriting\n\nMesoamerica is the only place in the Americas where indigenous writing systems were invented and used before European colonization. ", "While the types of writing systems in Mesoamerica range from minimalist “picture-writing” to complex logophonetic systems capable of recording speech and literature, they all share some core features that make them visually and functionally distinct from other writing systems of the world.", "\n\nAlthough many indigenous manuscripts have been lost or destroyed, texts known Aztec codices, Mayan codices, and Mixtec codices still survive and are of intense interest to scholars of the prehispanic era.", "\n\nThe fact that there was an existing prehispanic tradition of writing meant that when the Spanish friars taught Mexican Indians to write their own languages, particularly Nahuatl, an alphabetic tradition took hold. ", "It was used in official documents for legal cases and other legal instruments. ", "The formal use of native language documentation lasted until Mexican independence in 1821. ", "Beginning in the late twentieth century, scholars have mined these native language documents for information about colonial-era economics, culture, and language. ", "The New Philology is the current name for this particular branch of colonial-era Mesoamerican ethnohistory.", "\n\nDuring the pre-Columbian period, many city-states, kingdoms, and empires competed with one another for power and prestige. ", "Ancient Mexico can be said to have produced five major civilizations: the Olmec, Maya, Teotihuacan, Toltec, and Aztec. ", "Unlike other indigenous Mexican societies, these civilizations (with the exception of the politically fragmented Maya) extended their political and cultural reach across Mexico and beyond.", "\n\nThey consolidated power and exercised influence in matters of trade, art, politics, technology, and religion. ", "Over a span of 3,000 years, other regional powers made economic and political alliances with them; many made war on them. ", "But almost all found themselves within their spheres of influence.", "\n\nOlmecs (1400–400 BC)\n\nThe Olmec first appeared along the Atlantic coast (in what is now the state of Tabasco) in the period 1500–900 BC. ", "The Olmecs were the first Mesoamerican culture to produce an identifiable artistic and cultural style, and may also have been the society that invented writing in Mesoamerica. ", "By the Middle Preclassic Period (900–300 BC), Olmec artistic styles had been adopted as far away as the Valley of Mexico and Costa Rica.", "\n\nMaya\n\nMayan cultural characteristics, such as the rise of the ahau, or king, can be traced from 300 BC onwards. ", "During the centuries preceding the classical period, Mayan kingdoms sprang up in an area stretching from the Pacific coasts of southern Mexico and Guatemala to the northern Yucatán Peninsula. ", "The egalitarian Mayan society of pre-royal centuries gradually gave way to a society controlled by a wealthy elite that began building large ceremonial temples and complexes.", "\n\nThe earliest known long-count date, 199 AD, heralds the classic period, during which the Mayan kingdoms supported a population numbering in the millions. ", "Tikal, the largest of the kingdoms, alone had 500,000 inhabitants, though the average population of a kingdom was much smaller—somewhere under 50,000 people.", "\n\nTeotihuacan\n\nTeotihuacan is an enormous archaeological site in the Basin of Mexico, containing some of the largest pyramidal structures built in the pre-Columbian Americas. ", "Apart from the pyramidal structures, Teotihuacan is also known for its large residential complexes, the Avenue of the Dead, and numerous colorful, well-preserved murals. ", "Additionally, Teotihuacan produced a thin orange pottery style that spread through Mesoamerica.", "\nTeotihuacan view of the Avenue of the Dead and the Pyramid of the Sun, from the Pyramid of the Moon. ", "At its peak around 600 CE, Teotihuacan was the sixth-largest city in the world. ", "It featured a rational grid plan and a two-mile-long main avenue. ", "Its monumental pyramids echo the shapes of surrounding mountains.", "\n\nThe city is thought to have been established around 100 BCE and continued to be built until about 250 CE. ", "The city may have lasted until sometime between the 7th and 8th centuries CE. ", "At its zenith, perhaps in the first half of the 1st millennium CE, Teotihuacan was the largest city in the pre-Columbian Americas. ", "At this time it may have had more than 200,000 inhabitants, placing it among the largest cities of the world in this period. ", "Teotihuacan was even home to multi-floor apartment compounds built to accommodate this large population.", "\n\nThe civilization and cultural complex associated with the site is also referred to as Teotihuacan or Teotihuacano. ", "Although it is a subject of debate whether Teotihuacan was the center of a state empire, its influence throughout Mesoamerica is well documented; evidence of Teotihuacano presence can be seen at numerous sites in Veracruz and the Maya region. ", "The Aztecs may have been influenced by this city. ", "The ethnicity of the inhabitants of Teotihuacan is also a subject of debate. ", "Possible candidates are the Nahua, Otomi or Totonac ethnic groups. ", "Scholars have also suggested that Teotihuacan was a multiethnic state.", "\n\nToltec\n\nThe Toltec culture is an archaeological Mesoamerican culture that dominated a state centered in Tula, Hidalgo, in the early post-classic period of Mesoamerican chronology (ca 800–1000 CE). ", "The later Aztec culture saw the Toltecs as their intellectual and cultural predecessors and described Toltec culture emanating from Tollan (Nahuatl for Tula) as the epitome of civilization; indeed, in the Nahuatl language the word “Toltec” came to take on the meaning “artisan”.", "\n\nThe Aztec oral and pictographic tradition also described the history of the Toltec empire giving lists of rulers and their exploits. ", "Among modern scholars it is a matter of debate whether the Aztec narratives of Toltec history should be given credence as descriptions of actual historical events. ", "While all scholars acknowledge that there is a large mythological part of the narrative some maintain that by using a critical comparative method some level of historicity can be salvaged from the sources, whereas others maintain that continued analysis of the narratives as sources of actual history is futile and hinders access to actual knowledge of the culture of Tula, Hidalgo.", "\n\nOther controversy relating to the Toltecs include how best to understand reasons behind the perceived similarities in architecture and iconography between the archaeological site of Tula and the Maya site of Chichén Itzá – no consensus has emerged yet about the degree or direction of influence between the two sites.", "\n\nAztec Empire (1325–1521 AD)\n\nThe Nahua peoples began to enter central Mexico in the 6th century AD. ", "By the 12th century, they had established their center at Azcapotzalco, the city of the Tepanecs.", "\n\nThe Mexica people arrived in the Valley of Mexico in 1248 AD. ", "They had migrated from the deserts north of the Rio Grande over a period traditionally said to have been 100 years. ", "They may have thought of themselves as the heirs to the prestigious civilizations that had preceded them. ", "What the Aztec initially lacked in political power, they made up for them with ambition and military skill. ", "In 1325, they established the biggest city in the world at that time, Tenochtitlan.", "\n\nAztec religion was based on the belief in the continual need for regular offering of human blood to keep their deities beneficent; to meet this need, the Aztec sacrificed thousands of people. ", "This belief is thought to have been common throughout Nahuatl people. ", "To acquire captives in times of peace, the Aztec resorted to a form of ritual warfare called flower war. ", "The Tlaxcalteca, among other Nahuatl nations, were forced into such wars.", "\n\nIn 1428, the Aztec led a war against their rulers from the city of Azcapotzalco, which had subjugated most of the Valley of Mexico’s peoples. ", "The revolt was successful, and the Aztecs became the rulers of central Mexico as the leaders of the Triple Alliance. ", "The alliance was composed of the city-states of Tenochtitlan, Texcoco, and Tlacopan.", "\n\nAt their peak, 350,000 Aztec presided over a wealthy tribute-empire comprising 10 million people, almost half of Mexico’s estimated population of 24 million. ", "Their empire stretched from ocean to ocean, and extended into Central America. ", "The westward expansion of the empire was halted by a devastating military defeat at the hands of the Purepecha (who possessed weapons made of copper). ", "The empire relied upon a system of taxation (of goods and services), which were collected through an elaborate bureaucracy of tax collectors, courts, civil servants, and local officials who were installed as loyalists to the Triple Alliance.", "\n\nBy 1519, the Aztec capital, Mexico-Tenochtitlan, the site of modern-day Mexico City, was one of the largest cities in the world, with an estimated population between 200,000 and 300,000.", "\n\nThe first mainland explorations were followed by a phase of inland expeditions and conquest. ", "The Spanish crown extended the Reconquista effort, completed in Spain in 1492, to non-Catholic people in new territories. ", "In 1502 on the coast of present-day Colombia, near the Gulf of Urabá, Spanish explorers led by Vasco Núñez de Balboa explored and conquered the area near the Atrato River.", "\n\nThe conquest was of the Chibcha-speaking nations, mainly the Muisca and Tairona indigenous people that lived here. ", "The Spanish founded San Sebastian de Uraba in 1509—abandoned within the year, and in 1510 the first permanent Spanish mainland settlement in America, Santa María la Antigua del Darién.", "\n\nThe first Europeans to arrive in what is modern day Mexico were the survivors of a Spanish shipwreck in 1511. ", "Only two managed to survive Gerónimo de Aguilar and Gonzalo Guerrero until further contact was made with Spanish explorers years later. ", "On 8 February 1517 an expedition led by Francisco Hernández de Córdoba left the harbor of Santiago de Cuba to explore the shores of southern Mexico.", "\n\nDuring the course of this expedition many of Hernández’ men were killed, most during a battle near the town of Champotón against a Maya army. ", "He himself was injured, and died a few days shortly after his return to Cuba. ", "This was the Europeans’ first encounter with an advanced civilization in the Americas, with solidly built buildings and a complex social organization which they recognized as being comparable to those of the Old World. ", "Hernán Cortés led a new expedition to Mexico landing ashore at present day Veracruz on 22 April 1519, a date which marks the beginning of 300 years of Spanish hegemony over the region.", "\n\nIn general the ‘Spanish conquest of Mexico’ denotes the conquest of the central region of Mesoamerica where the Aztec Empire was based. ", "The fall of the Aztec capital of Tenochtitlan in 1521 was a decisive event, but Spaniards conquered other regions of Mexico, such as Yucatán, extended long after Spaniards consolidated control of central Mexico. ", "The Spanish conquest of Yucatán is the much longer campaign, from 1551 to 1697, against the Maya peoples of the Maya civilization in the Yucatán Peninsula of present-day Mexico and northern Central America.", "\n\nAnalysis of defeat\n\nThe Alliance ambushed indigenous ceremonies, such as during The Feast of Huitzilopochtli, which allowed the superior Spanish conquerors to avoid fighting the best Aztec warriors in direct armed battle.", "\n\nSmallpox (Variola major and Variola minor) began to spread in Mesoamerica immediately after the arrival of Europeans. ", "The indigenous peoples, who had no immunity to it, eventually died in the millions. ", "A third of all the natives of the Valley of Mexico succumbed to it within six months of Spaniards arrival.", "\n\nTenochtitlan was almost completely destroyed by fire and cannon shots. ", "Those Aztecs who survived were forbidden to live in the city and the surrounding isles, and they went to live in Tlatelolco.", "\n\nCortés imprisoned the royal families of the valley. ", "To prevent another revolt, he personally tortured and killed Cuauhtémoc, the last Aztec Emperor; Coanacoch, the King of Texcoco, and Tetlepanquetzal, King of Tlacopan.", "\n\nThe Spanish had no intention to turn over Tenochtitlan to the Tlaxcalteca. ", "While Tlaxcalteca troops continued to help the Spaniards, and Tlaxcala received better treatment than other indigenous nations, the Spanish eventually disowned the treaty. ", "Forty years after the conquest, the Tlaxcalteca had to pay the same tribute as any other indigenous community.", "\n\nPolitical: Apparently, Cortes favored maintaining the political structure of the Aztecs, with minor changes.", "\n\nReligious: Cortés immediately banned human sacrifice throughout the conquered empire. ", "In 1524, he requested the Spanish king to send friars from the mendicant orders, particularly the Franciscan, Dominican, and Augustinian, to convert the indigenous to Christianity. ", "This has often been called the “spiritual conquest of Mexico”. ", "Christian evangelization began in the early-1520s and continued into the 1560s. ", "Many of the mendicant friars, especially the Franciscans and Dominicans, learned the native languages and recorded aspects of native culture, providing a principal source for our knowledge about them. ", "One of the first 12 Franciscans to come to Mexico, Fray Toribio de Benavente Motolinia recorded in Spanish observations of the indigenous. ", "Important Franciscans engaged in collecting and preparing native language materials, especially in Nahuatl are fray Alonso de Molina and fray Bernardino de Sahagún. ", "By 1560, more than 800 clergy were working to convert Indians in New Spain. ", "By 1580, the number grew to 1,500 and by 1650, to 3,000.", "\n\nEconomics: The Spanish colonizers introduced the encomienda system of forced labor, which in central Mexico built on indigenous traditions of rendering tribute and labor to rulers in their own communities and local rulers rendering tribute to higher authorities. ", "Individual Spaniards were awarded the tribute and labor or particular indigenous communities, with that population paying tribute and performing labor locally. ", "Indigenous communities were pressed for labor services and tribute, but were not enslaved. ", "Their rulers remained indigenous elites, who retained their status under colonial rule and were useful intermediaries. ", "The Spanish also used forced labor, often outright slavery, in mining.", "\n\nThe capture of Tenochtitlan marked the beginning of a 300-year colonial period, during which Mexico was known as “New Spain” ruled by a viceroy in the name of the Spanish monarch. ", "Colonial Mexico had key elements to attract Spanish immigrants: (1) dense and politically complex indigenous populations (especially in the central part) that could be compelled to work, and (2) huge mineral wealth, especially major silver deposits in the northern regions Zacatecas and Guanajuato. ", "The Viceroyalty of Peru also had those two important elements, so that New Spain and Peru were the seats of Spanish power and the source of its wealth, until other viceroyalties were created in Spanish South America in the late 18th century.", "\n\nThis wealth made Spain the dominant power in Europe and the envy of England, France, and (after its independence from Spain) the Netherlands. ", "Spain’s silver mining and crown mints created high quality coins, the currency of Spanish America, the silver peso or Spanish dollar that became a global currency.", "\n\nContinued conquest (1521–50)\n\nSpanish conquerors did not bring all areas of Aztec Empire under its control. ", "After the fall of Tenochtitlan in 1521, it took decades of sporadic warfare to subdue the rest of Mesoamerica, particularly the Maya regions of southern New Spain and into what is now Central America.", "\n\nOutside the zone of settled Mesoamerican civilizations were nomadic northern indios bárbaros (“wild Indians”) who fought fiercely against the Spaniards and their indigenous allies, such as the Tlaxcalans, in the Chichimeca War (1576–1606). ", "The northern indigenous populations had gained mobility via the horses that Spaniards had imported to the New World. ", "The desert in the north was only interesting to Spanish because of its rich silver deposits. ", "The Spanish mining settlements and trunk lines to Mexico City needed to be made safe for supplies to move north and silver to move to south, to central Mexico.", "\n\nEconomics of the early colonial period\n\nThe most important source of wealth in the first years after the conquest of central Mexico was the encomienda, a grant of the labor of a particular indigenous settlement to an individual Spanish and his heirs. ", "Conquerors expected to receive these awards and conqueror Hernán Cortés in his letter to the Spanish king justified his own allocation of these grants. ", "Spaniards were the recipients of traditional indigenous products that had been rendered in tribute to their local lords and to the Aztec empire. ", "The first Spanish viceroy, Don Antonio de Mendoza has his name given to the title of an Aztec manuscript Codex Mendoza, that enumerates in glyphic form the types of tribute goods and amounts rendered from particular indigenous towns under Aztec rule. ", "The earliest holders of encomiendas, the encomenderos were the conquerors involved in the campaign leading to the fall of Tenochtitlan, and later their heirs and people with influence but not conquerors. ", "Forced labor could be directed toward developing land and industry in the area the Spanish encomenderos’ Indians lived. ", "Land was a secondary source of wealth during this immediate conquest period. ", "Where indigenous labor was absent or needed supplementing, the Spanish brought African slaves, often as skilled laborers or artisans, or as labor bosses of encomienda Indians.", "\n\nEvolution of the race\n\nDuring the three centuries of colonial rule, less than 700,000 Spaniards, most of them men, settled in Mexico. ", "The settlers interbred with indigenous women, creating the mixed race (mestizo) descendents who today constitute the majority of Mexico’s population.", "\n\nColonial period (1550–1810)\n\nAs a colony, Mexico was part of the much larger Viceroyalty of New Spain, which included Cuba, Puerto Rico, Central America as far south as Costa Rica, the southwestern United States as well as Florida, and the Philippines. ", "Hernán Cortés had conquered the great empire of the Aztecs and established New Spain as the largest and most important Spanish colony. ", "During the 16th century, Spain focused on conquering areas with dense populations that had produced Pre-Columbian civilizations, because such populations were a disciplined labor force and a population to catechize.", "\n\nTerritories populated by nomadic peoples were harder to conquer, and although the Spanish explored much of North America, seeking the fabled “El Dorado”, they made no concerted effort to settle the northern desert regions in what is now the United States until the end of 16th century (Santa Fe, 1598).", "\n\nColonial law with native origins but with Spanish historical precedents was introduced, creating a balance between local jurisdiction (the Cabildos) and the Crown’s, whereby upper administrative offices were closed to natives, even those of pure Spanish blood. ", "Administration was based on a racial separation of the population among the Republics of Spaniards, Indians and Mestizos, autonomous and directly dependent on the king. ", "The population of New Spain was divided into four main groups, or classes. ", "The group a person belonged to was determined by racial background and birthplace. ", "The most powerful group was the Spaniards, people born in Spain and sent across the Atlantic to rule the colony. ", "Only Spaniards could hold high-level jobs in the colonial government.", "\n\nThe second group, called creoles, were people of Spanish background but born in Mexico. ", "Many creoles were prosperous landowners and merchants. ", "But even the wealthiest creoles had little say in government.", "\n\nThe third group, the mestizos, were people who had some Spanish ancestors and some Indian ancestors. ", "The word mestizo means “mixed”. ", "Mestizos had a much lower position and were looked down upon by both the Spaniards and the creoles, who held the racist belief that people of pure European background were superior to everyone else.", "\n\nThe poorest, most marginalised group in New Spain was the Indians, descendants of pre-Columbian peoples. ", "They had less power and endured harsher conditions than other groups. ", "Indians were forced to work as laborers on the ranches and farms (called haciendas) of the Spaniards and creoles.", "\n\nIn addition to the four main groups, there were also some black Africans in colonial Mexico. ", "These black African were imported as laborers and shared the low status of the Indians. ", "They made up about 4% to 5% of the population, and their mixed-race descendants, called mulattoes, eventually grew to represent about 9%.", "\n\nFrom an economic point of view, New Spain was administered principally for the benefit of the Empire and its military and defensive efforts. ", "Mexico provided more than half of the Empire taxes and supported the administration of all North and Central America. ", "Competition with the metropolis was discouraged; for example cultivation of grapes and olives, introduced by Cortez himself, was banned out of fear that these crops would compete with Spain’s.", "\n\nTo protect the country from the attacks by English, French and Dutch pirates, as well as the Crown’s revenue, only two ports were open to foreign trade—Veracruz on the Atlantic and Acapulco on the Pacific. ", "Pirates attacked, plundered and ravaged several cities like Campeche (1557), Veracruz (1568) and Alvarado (1667).", "\n\nEducation was encouraged by the Crown from the very beginning, and Mexico boasts the first primary school (Texcoco, 1523), first university, the University of Mexico(1551) and the first printing press (1524) of the Americas. ", "Indigenous languages were studied mainly by the religious orders during the first centuries, and became official languages in the so-called Republic of Indians, only to be outlawed and ignored after independence by the prevailing Spanish-speaking creoles.", "\n\nMexico produced important cultural achievements during the colonial period, like the literature of Sor Juana Inés de la Cruz and Ruiz de Alarcón, as well as cathedrals, civil monuments, forts and colonial cities such as Puebla, Mexico City, Querétaro, Zacatecas and others, today part of Unesco’s World Heritage.", "\n\nThe syncretism between indigenous and Spanish cultures gave rise to many of nowadays Mexican staple and world-famous cultural traits like tequila (since the 16th century), mariachi (18th), jarabe (17th), charros (17th) and the highly prized Mexican cuisine, fruit of the mixture of European and indigenous ingredients and techniques.", "\n\nThe creoles, mestizos, and Indians often disagreed, but all resented the small minority of Spaniards who had all the political power. ", "By the early 1800s, many native-born Mexicans believed that Mexico should become independent of Spain, following the example of the United States. ", "The man who finally touched off the revolt against Spain was the Catholic priest Father Miguel Hidalgo Y Costilla. ", "He is remembered today as the Father of Mexican Independence.", "\n\nInspired by the American and French Revolutions, Mexican insurgents saw an opportunity in 1808 as the king abdicated in Madrid and Spain was overwhelmed by war and occupation. ", "The rebellion began as an idealistic peasants’ and miners’ movement led by a local priest Miguel Hidalgo y Costilla who issued “The Cry of Dolores” on 16 September 1810; the day is celebrated as Independence Day. ", "Shouting “Independence and death to the Spaniards!” ", "they marched on the capital with a very large, poorly organized army. ", "It was routed by the Spanish and Hidalgo was executed.", "\nEntry into Mexico city by the Mexican army.", "\n\nAnother priest, Jose Maria Morelos took over and was more successful in his quest for republicanism and independence. ", "Spain’s monarchy was restored in 1814 after Napoleon’s defeat, and it fought back and executed Morelos in 1815. ", "The scattered insurgents formed guerrilla bands. ", "In 1820, creoles, led by Agustín de Iturbide, joined the rebellion. ", "The rebels formulated the “Plan of Iguala”, demanding an independent constitutional monarchy, a religious monopoly for the Catholic Church, and equality for Spaniards and creoles. ", "On September 27, 1821, Iturbide and the viceroy signed the Treaty of Cordoba whereby Spain granted the demands and withdrew.", "\n\nAfter independence (1821–1829)\n\nAfter independence, Mexican politics was chaotic. ", "The presidency changed hands 75 times in the next 55 years (1821–76).", "\n\nThe Spanish attempts to reconquer Mexico comprised episodes of war between Spain and the newly born Mexican nation. ", "The designation mainly covers two periods: from 1821 to 1825 in Mexico’s waters, and a second period of two stages, including a Mexican plan to take the Spanish-held island of Cuba between 1826 and 1828, and the 1829 landing of Spanish General Isidro Barradas in Mexico to reconquer the territory. ", "Although Spain never regained control of the country, it damaged the fledgling economy.", "\n\nThe newly independent nation was in dire straits after 11 years of war. ", "No plans or guidelines were established by the revolutionaries, so internal struggles for control of the government ensued. ", "Mexico suffered a complete lack of funds to administer a country of over 4.5 million km², and faced the threats of emerging internal rebellions and of invasion by Spanish forces from their base in nearby Cuba.", "\n\nMexican Empire\n\nMexico now had its own government, but Iturbide quickly became a dictator. ", "He even had himself proclaimed emperor of Mexico, copying the ceremony used by Napoleon when he proclaimed himself emperor of France. ", "No one was allowed to speak against Iturbide. ", "He filled his government with corrupt officials, who became rich by taking bribes and making dishonest business deals.", "\n\nIn 1822, Mexico annexed the Federal Republic of Central America, which includes present-day Costa Rica, El Salvador, Guatemala, Honduras, Nicaragua, and part of Chiapas.", "\n\nRepublic\n\nBy 1823, Mexicans of all classes were fed up with emperor Agustin de Iturbide’s corrupt and oppressive rule. ", "They overthrew him and 4 October 1824, the United Mexican States (Spanish: Estados Unidos Mexicanos) was established. ", "The new constitution was partly modeled on the constitution of the United States. ", "It guaranteed basic human rights and defined Mexico as a representative federal republic, in which responsibilities of government were divided between a central government and a number of smaller units called states. ", "It also defined Catholicism as the official and unique religion. ", "The Federal Republic of Central America was allowed to re-establish its independence, which it had declared on 1 July 1823.", "\n\nHowever, most of the population largely ignored the new constitution. ", "When Guadalupe Victoria was followed in office by Vicente Guerrero, gaining the position through a coup after losing the 1828 elections, the Conservative Party saw an opportunity to seize control and led a counter-coup under Anastasio Bustamante, who served as president from 1830 to 1832, and again from 1837 to 1841.", "\n\nIn much of Spanish America soon after its independence, military strongmen or caudillos dominated politics, and this period is often called “The Age of Caudillismo”. ", "In Mexico, from the late 1820s to the mid-1850s the period is often called the “Age of Santa Anna”, named for the general turned politician, Antonio López de Santa Anna. ", "The federalists asked Santa Anna to overthrow conservative President Anastasio Bustamante. ", "After he did, he declared General Manuel Gómez Pedraza (who won the election of 1828) president. ", "Elections were held thereafter, and Santa Anna took office in 1832. ", "He served as president 11 times. ", "Constantly changing his political beliefs, in 1834 Santa Anna abrogated the federal constitution, causing insurgencies in the southeastern state of Yucatán and the northernmost portion of the northern state of Coahuila y Tejas. ", "Both areas sought independence from the central government. ", "Negotiations and the presence of Santa Anna’s army caused Yucatán to recognize Mexican sovereignty. ", "Then Santa Anna’s army turned to the northern rebellion.", "\n\nThe inhabitants of Tejas declared the Republic of Texas independent from Mexico on 2 March 1836 at Washington-on-the-Brazos. ", "They called themselves Texans and were led mainly by recent English-speaking settlers. ", "At the Battle of San Jacinto on April 21, 1836, Texan militias defeated the Mexican army and captured General Santa Anna. ", "The Mexican government refused to recognize the independence of Texas.", "\n\nComanche raids\n\nThe northern states grew increasingly isolated, economically and politically, due to prolonged Comanche raids and attacks. ", "New Mexico in particular had been gravitating toward Comancheria. ", "In the 1820s, when the United States began to exert influence over the region, New Mexico had already begun to question its loyalty to Mexico. ", "By the time of the Mexican–American War, the Comanches had raided and pillaged large portions of northern Mexico, resulting in sustained impoverishment, political fragmentation, and general frustration at the inability—or unwillingness—of the Mexican government to discipline the Comanches.", "\n\nIn addition to Comanche raids, the First Republic’s northern border was plagued with attacks on its northern border from the Apache people, who were supplied with guns by American merchants. ", "Goods including guns and shoes were sold to the Apache, the latter being discovered by Mexican forces when they found traditional Apache trails with American shoe prints instead of moccasin prints.", "\n\nTexas\n\nSoon after achieving independence from Spain, the Mexican government, in an effort to populate its northern territories, awarded extensive land grants in Coahuila y Tejas to thousands of families from the United States, on condition that the settlers convert to Catholicism and become Mexican citizens. ", "The Mexican government also forbade the importation of slaves. ", "These conditions were largely ignored.", "\n\nA key factor in the government decision to allow those settlers was the belief that they would (a) protect northern Mexico from Comanche attacks and (b) buffer the northern states against US westward expansion. ", "The policy failed on both counts: the Americans tended to settle far from the Comanche raiding zones and used the Mexican government’s failure to suppress the raids as a pretext for declaring independence.", "\n\nThe Texas Revolution or Texas War of Independence was a military conflict between Mexico and settlers in the Texas portion of the Mexican state Coahuila y Tejas.", "\n\nThe war lasted from October 2, 1835 to April 21, 1836. ", "However, a war at sea between Mexico and Texas continued into the 1840s. ", "Animosity between the Mexican government and the American settlers in Texas, as well as many Texas residents of Mexican ancestry, began with the Siete Leyes of 1835, when Mexican President and General Antonio López de Santa Anna abolished the federal Constitution of 1824 and proclaimed the more centralizing 1835 constitution in its place.", "\n\nWar began in Texas on October 2, 1835, with the Battle of Gonzales. ", "Early Texian Army successes at La Bahia and San Antonio were soon met with crushing defeat at the same locations a few months later. ", "The war ended at the Battle of San Jacinto where General Sam Houston led the Texian Army to victory over a portion of the Mexican Army under Santa Anna, who was captured soon after the battle. ", "The end of the war resulted in the creation of the Republic of Texas in 1836. ", "In 1845, the U.S. Congress ratified Texas’s petition for statehood.", "\n\nMexican-American War (1846–1848)\n\nIn response to a Mexican massacre of a U.S. army detachment in disputed territory, the U.S. Congress declared war on May 13, 1846; Mexico followed suit on 23 May. The Mexican–American War took place in two theaters: the western (aimed at California) and Central Mexico (aimed at capturing Mexico City) campaigns.", "\n\nIn March 1847, U.S. President James K. Polk sent an army of 12,000 volunteer and regular U.S. Army soldiers under General Winfield Scott to the port of Veracruz. ", "The 70 ships of the invading forces arrived at the city on 7 March and began a naval bombardment. ", "After landing his men, horses, and supplies, Scott began the Siege of Veracruz.", "\n\nThe city (at that time still walled) was defended by Mexican General Juan Morales with 3,400 men. ", "Veracruz replied as best it could with artillery to the bombardment from land and sea, but the city walls were reduced. ", "After 12 days, the Mexicans surrendered. ", "Scott marched west with 8,500 men, while Santa Anna entrenched with artillery and 12,000 troops on the main road halfway to Mexico City. ", "At the Battle of Cerro Gordo, Santa Anna was outflanked and routed.", "\n\nScott pushed on to Puebla, Mexico’s second largest city, which capitulated without resistance on 1 May—the citizens were hostile to Santa Anna. ", "After the Battle of Chapultepec (13 September 1847), Mexico City was occupied; Scott became its military governor. ", "Many other parts of Mexico were also occupied. ", "Some Mexican units fought with distinction. ", "One of the justly commemorated units was a group of six young Military College cadets (now considered Mexican national heroes), who fought to the death defending their college during the Battle of Chapultepec.", "\n\nThe war ended with the Treaty of Guadalupe Hidalgo, which stipulated that (1) Mexico must sell its northern territories to the US for US $15 million; (2) the US would give full citizenship and voting rights, and protect the property rights of Mexicans living in the ceded territories; and (3) the US would assume $3.25 million in debt owed by Mexico to Americans. ", "The war was Mexico’s first encounter with a modern, well-organized, and well-equipped army. ", "Mexico’s defeat has been attributed to its problematic internal situation, one of disunity and disorganization.", "\n\nAfter the war, Washington discovered that a much easier railroad route to California lay slightly south of the Gila River, in Mexico. ", "In 1853, President Santa Anna sold off the Gadsden Strip to the US for $10 million in the Gadsden Purchase. ", "This loss of still more territory provoked considerable outrage among Mexicans, but Santa Anna claimed that he needed money to rebuild the army from the war. ", "In the end, he kept or squandered most of it.", "\n\nLa Reforma was a period during the mid-19th century characterized by liberal reforms and the transformation of Mexico into a nation-state. ", "The reformers, based in the cities, reached out to educate the largely rural population of eight million, half of them poorly educated Indians. ", "The younger generation of political leaders were shocked at Mexico’s poor fight against the United States in 1848, and saw modernization as a way to strengthen the nation.", "\n\nNotable liberal politicians in the reform period include Benito Juárez, Juan Álvarez, Ignacio Comonfort, Miguel Lerdo de Tejada, Sebastián Lerdo de Tejada, Melchor Ocampo, José María Iglesias and Santos Degollado. ", "Their strategy was to sharply limit the traditional privileges and land holdings of the Catholic Church and thereby revitalize the market in land. ", "However, no class of small peasants who identified with the Liberal program emerged. ", "Many merchants acquired land (and control over the associated tenant farmers). ", "Many existing landowners expanded their holdings at peasant expense, and some upwardly mobile ranch owners, often mestizos, acquired land.", "\n\nThe Reforma began with the final overthrow of Santa Anna in the Revolution of Ayutla in 1855. ", "The moderate Liberal Ignacio Comonfort became president. ", "The Moderados tried to find a middle ground between the nation’s liberals and conservatives. ", "There is less consensus about the ending point of the Reforma.", "\n\nCommon dates are 1861, after the liberal victory in the Reform War; 1867, after the republican victory over the French intervention in Mexico; and 1876 when Porfirio Díaz overthrew president Sebastián Lerdo de Tejada. ", "Liberalism dominated Mexico as an intellectual force into the 20th century. ", "Liberals championed reform and supported republicanism, capitalism, and individualism; they fought to reduce the Church’s conservative roles in education, land ownership and politics. ", "Also importantly, liberals sought to end the special status of indigenous communities by ending their corporate ownership of land.", "\n\nConstitution of 1857\n\nColonel Ignacio Comonfort became president in 1855 after a revolt based in Ayutla overthrew Santa Anna. ", "Comonfort was a moderate liberal who tried to maintain an uncertain coalition, but the moderate liberals and the radical liberals were unable to resolve their sharp differences. ", "During his presidency, the Constitution of 1857 was drafted creating the Second Federal Republic of Mexico. ", "The new constitution restricted some of the Catholic Church’s traditional privileges, land holdings, revenues and control over education.", "\n\nIt granted religious freedom, stating only that the Catholic Church was the favored faith. ", "The anti-clerical radicals scored a major victory with the ratification of the constitution, because it weakened the Church and enfranchised illiterate commoners. ", "The constitution was unacceptable to the clergy and the conservatives, and they plotted a revolt. ", "With the “Plan of Tacubaya” in December 1857, Comonfort tried to regain the popular support from the growing conservative pro-clerical movement. ", "The liberals failed, however, as conservative General Félix Zuloaga succeeded in a coup in the capital in January, 1858.", "\n\nWar of Reform (1857-1861)\n\nThe revolt led to the War of Reform (December 1857 to January 1861), which grew increasingly bloody as it progressed and polarized the nation’s politics. ", "Many Moderates, convinced that the Church’s political power had to be curbed, came over to the side of the Liberals.", "\n\nFor some time, the Liberals and Conservatives simultaneously administered separate governments, the Conservatives from Mexico City and the Liberals from Veracruz. ", "The war ended with a Liberal victory, and liberal President Benito Juárez moved his administration to Mexico City.", "\n\nFrench intervention and Second Mexican Empire (1861–1867)\n\nIn 1862, the country was invaded by France which sought to collect debts that the Juárez government had defaulted on, but the larger purpose was to install a ruler under French control. ", "They chose a member of the Habsburg dynasty, which had ruled Spain and its overseas possessions until 1700. ", "Archduke Ferdinand Maximilian of Austria was installed as Emperor Maximilian I of Mexico, with support from the Catholic Church, conservative elements of the upper class, and some indigenous communities. ", "Although the French suffered an initial defeat (the Battle of Puebla on May 5, 1862, now commemorated as the Cinco de Mayo holiday), the French eventually defeated the Mexican army and set Maximilian on the throne. ", "The Mexican-French monarchy set up administration in Mexico City, governing from the National Palace.", "\n\nMaximilian’s consort was Empress Carlota of Mexico and they chose Chapultepec Castle as their home. ", "The Imperial couple noticed the mistreatment of Mexicans, especially Indians, and wanted to ensure their human rights. ", "By contrast, Napoleon III wanted to exploit the mines in the northwest of the country and to grow cotton.", "\n\nMaximilian was a liberal, a fact that Mexican conservatives seemingly did not know when he was chosen to head the government. ", "He favored the establishment of a limited monarchy that would share power with a democratically elected congress. ", "This was too liberal for conservatives, while liberals refused to accept any monarch, considering the republican government of Benito Juárez as legitimate. ", "This left Maximilian with few enthusiastic allies within Mexico. ", "Meanwhile, Juárez remained head of the republican government. ", "He continued to be recognized by the United States, which was engaged in its Civil War (1861–65) and at that juncture was in no position to aid Juárez directly against the French intervention until 1865.", "\n\nFrance never made a profit in Mexico and its Mexican expedition grew increasingly unpopular. ", "Finally in the spring of 1865, after the US Civil War was over, the US demanded the withdrawal of French troops from Mexico. ", "Napoleon III quietly complied. ", "In mid-1867, despite repeated Imperial losses in battle to the Republican Army and ever decreasing support from Napoleon III, Maximilian chose to remain in Mexico rather than return to Europe. ", "He was captured and executed along with two Mexican supporters, immortalized in a famous painting by Eduard Manet. ", "Juárez remained in office until his death in 1872.", "\n\nJuarez and restoration of the republic (1867–1872)\n\nIn 1867, the republic was restored and Juárez reelected; he continued to implement his reforms. ", "In 1871, he was elected a second time, much to the dismay of his opponents within the Liberal party, who considered reelection to be somewhat undemocratic. ", "Juárez died one year later and was succeeded by Sebastián Lerdo de Tejada.", "\n\nPart of Juarez’s reforms included fully secularizing the country. ", "The Catholic Church was barred from owning property aside from houses of worship and monasteries, and education and marriage were put in the hands of the state.", "\n\nThe rule of Porfirio Díaz (1876–1911) was dedicated to the rule by law, suppression of violence, and modernization of all aspects of the society and economy. ", "Diaz was an astute military leader and liberal politician who built a national base of supporters. ", "To avoid antagonizing Catholics, he avoided enforcement of anticlerical laws. ", "The country’s infrastructure was greatly improved, thanks to increased foreign investment from Britain and the US, and a strong, stable central government.", "\n\nIncreased tax revenue and better administration dramatically improved public safety, public health, railways, mining, industry, foreign trade, and national finances. ", "Díaz modernized the army and suppressed some banditry. ", "After a half-century of stagnation, where per capita income was merely a tenth of the developed nations such as Britain and the US, the Mexican economy took off and grew at an annual rate of 2.3% (1877 to 1910), which was high by world standards.", "\n\nMexico moved from being a target of ridicule to international pride. ", "As traditional ways were under challenge, urban Mexicans debated national identity, the rejection of indigenous cultures, the new passion for French culture once the French were ousted from Mexico, and the challenge of creating a modern nation by means of industrialization and scientific modernization.", "\n\nPoverty\n\nMexico was poorer per capita in 1876 than in 1821. ", "Some commentators attribute the slow economic growth to the negative impact of Spanish rule, the concentration of landholding by few families, and the reactionary role of the Catholic Church. ", "Coatsworth rejects those reasons and says the chief obstacles were poor transportation and inefficient economic organization. ", "Under the Porfiriato regime (1876–1910), economic growth was much faster.", "\n\nOrder, progress, and dictatorship\n\nIn 1876, Lerdo was reelected, defeating Porfirio Díaz. ", "Díaz rebelled against the government with the proclamation of the Plan de Tuxtepec, in which he opposed reelection, in 1876. ", "Díaz overthrew Lerdo, who fled the country, and Díaz was named president. ", "Thus began a period of more than 30 years (1876–1911) during which Díaz was Mexico’s strong man. ", "He was elected president eight times, turning over power once, from 1880 to 1884, to a trusted ally, General Manuel Gonzailez.", "\n\nThis period of relative prosperity is known as the Porfiriate. ", "Diaz remained in power by rigging elections and censoring the press. ", "Possible rivals were destroyed, and popular generals were moved to new areas so they could not build a permanent base of support. ", "Banditry on roads leading to major cities was largely suppressed by the “Rurales”, a new police force controlled by Diaz. ", "Banditry remained a major threat in more remote areas, because the Rurales comprised fewer than 1000 men.", "\n\nThe Army was reduced in size from 30,000 to under 20,000 men, which resulted in a smaller percentage of the national budget being committed to the military. ", "Nevertheless, the army was modernized, well-trained, and equipped with the latest technology. ", "The Army was top-heavy with 5,000 officers, many of them elderly, but politically well-connected veterans of the wars of the 1860s.", "\n\nThe political skills that Díaz used so effectively before 1900 faded, as he and his closest advisers were less open to negotiations with younger leaders. ", "His announcement in 1908 that he would retire in 1911 unleashed a widespread feeling that Díaz was on the way out, and that new coalitions had to be built. ", "He nevertheless ran for reelection and in a show of U.S. support, Díaz and Taft planned a summit in El Paso, Texas, and Ciudad Juárez, Mexico, for October 16, 1909, an historic first meeting between a Mexican and a U.S. president and also the first time an American president would cross the border into Mexico. ", "Both sides agreed that the disputed Chamizal strip connecting El Paso to Ciudad Juárez would be considered neutral territory with no flags present during the summit, but the meeting focused attention on this territory and resulted in assassination threats and other serious security concerns. ", "On the day of the summit, Frederick Russell Burnham, the celebrated scout, and Private C. R. Moore, a Texas Ranger, discovered a man holding a concealed palm pistol standing at the El Paso Chamber of Commerce building along the procession route. ", "Burnham and Moore captured and disarmed the assassin within only a few feet of Díaz and Taft. ", "Both presidents were unharmed and the summit was held. ", "At the meeting, Diaz told John Hays Hammond, “Since I am responsible for bringing several billion dollars in foreign investments into my country, I think I should continue in my position until a competent successor is found.” ", "Díaz was re-elected after a highly controversial election, but he was overthrown in 1911 and forced into exile in France after Army units rebelled.", "\n\nPopulation and public health\n\nUnder Díaz, the population grew steadily from 11 million in 1877 to 15 million in 1910. ", "Because of very high infant mortality (22% of new babies died) the life expectancy at birth was only 25.0 years in 1900. ", "Few immigrants arrived. ", "Diaz gave enormous power and prestige to the Superior Health Council, which developed a consistent and assertive strategy using up-to-date international scientific standards. ", "It took control of disease certification; required prompt reporting of disease; and launched campaigns against tropical disease such as yellow fever.", "\n\nEconomy\n\nFiscal stability was achieved by José Yves Limantour (1854–1935), Secretary of Finance of Mexico from 1893 until 1910. ", "He was the leader of the well-educated technocrats known as Científicos, who were committed to modernity and sound finance. ", "Limantour expanded foreign investment, supported free trade, and balanced the budget for the first time and generated a budget surplus by 1894. ", "However, he was unable to halt the rising cost of food, which alienated the poor.", "\n\nThe American Panic of 1907 was an economic downturn that caused a sudden drop in demand for Mexican copper, silver, gold, zinc, and other metals. ", "Mexico in turn cut its imports of horses and mules, mining machinery, and railroad supplies. ", "The result was an economic depression in Mexico in 1908–1909 that soured optimism and raised discontent with the Díaz regime, thus helping to set the stage for revolution in 1910.", "\n\nMexico was vulnerable to external shocks because of its weak banking system. ", "The banking system was controlled by a small oligarchy, which typically made long-term loans to their own directors. ", "The banks were the financial arms of extended kinship-based business coalitions that used banks to raise additional capital to expand enterprises. ", "Economic growth was largely based on trade with the United States.", "\n\nMexico had few factories by 1880, but then industrialization took hold in the Northeast, especially in Monterrey. ", "Factories produced machinery, textiles and beer, while smelters processed ores. ", "Convenient rail links with the nearby US gave local entrepreneurs from seven wealthy merchant families a competitive advantage over more distant cities. ", "New federal laws in 1884 and 1887 allowed corporations to be more flexible. ", "By the 1920s, American Smelting and Refining Company (ASARCO), an American firm controlled by the Guggenheim family, had invested over 20 million pesos and employed nearly 2,000 workers smelting copper and making wire to meet the demand for electrical wiring in the US and Mexico.", "\n\nModernity\n\nThe modernizers insisted that schools lead the way, and that science replace superstition. ", "They reformed elementary schools by mandating uniformity, secularization, and rationality. ", "These reforms were consistent with international trends in teaching methods. ", "In order to break the traditional peasant habits that hindered industrialization and rationalization, reforms emphasized the children’s punctuality, assiduity, and health. ", "In 1910, the National University was opened as an elite school for the next generation of leaders.", "\n\nCities were rebuilt with modernizing architects favoring the latest European styles, especially the Beaux-Arts style, to symbolize the break with the past. ", "A highly visible exemplar was the Federal Legislative Palace, built 1897–1910.", "\n\nRural unrest\n\nTutino examines the impact of the Porfiriato in the highland basins south of Mexico City, which became the Zapatista heartland during the Revolution. ", "Population growth, railways and concentration of land in a few families generated a commercial expansion that undercut the traditional powers of the villagers. ", "Young men felt insecure about the patriarchal roles they had expected to fill. ", "Initially, this anxiety manifested as violence within families and communities. ", "But, after the defeat of Díaz in 1910, villagers expressed their rage in revolutionary assaults on local elites who had profited most from the Porfiriato. ", "The young men were radicalized, as they fought for their traditional roles regarding land, community, and patriarchy.", "\n\nThe Mexican Revolution is a broad term to describe political and social changes in the early 20th century. ", "Most scholars consider it to span the years 1910-1920, from the fraudulent election of Porfirio Díaz in 1910 until the December 1920 election of northern general Alvaro Obregón. ", "Foreign powers important economic and strategic interests in the outcome of power struggles in Mexico, with United States involvement in the Mexican Revolution playing an especially significant role.", "\n\nThe Revolution grew increasingly broad-based, radical and violent. ", "Revolutionaries sought far-reaching social and economic reforms by strengthening the state and weakening the conservative forces represented by the Church, the rich landowners, and foreign capitalists.", "\n\nSome scholars consider the promulgation of the Mexican Constitution of 1917 as its end point. “", "Economic and social conditions improved in accordance with revolutionary policies, so that the new society took shape within a framework of official revolutionary institutions,” with the constitution providing that framework. ", "Organized labor gained significant power, as seen in Article 123 of the Constitution of 1917. ", "Land reform in Mexico was enabled by Article 27. ", "Economic nationalism was also enabled by Article 27, restricting ownership of enterprises by foreigners. ", "The Constitution also further restricted the Roman Catholic Church in Mexico; implementing the restrictions in the late 1920s resulted in major violence in the Cristero War. ", "A ban on re-election of the president was enshrined in the Constitution and in practice. ", "Political succession was achieved in 1929 with the creation of the Partido Nacional Revolucionario (PNR), the political party that has dominated Mexico since its creation, now called the Institutional Revolutionary Party.", "\n\nOne major effect of the revolution was the disappearance of the Federal Army in 1914, defeated by revolutionary forces of the various factions in the Mexican Revolution.", "\n\nThe Mexican Revolution was based on popular participation. ", "At first, it was based on the peasantry who demanded land, water, and a more sympathetic national government. ", "Wasserman finds that:\n\n“Popular participation in the revolution and its aftermath took three forms. ", "First, everyday people, though often in conjunction with elite neighbors, generated local issues such as access to land, taxes, and village autonomy. ", "Second, the popular classes provided soldiers to fight in the revolution. ", "Third, local issues advocated by campesinos and workers framed national discourses on land reform, the role of religion, and many other questions.”", "\n\nElection of 1910 and popular rebellion\n\nPorfirio Díaz announced in an interview to a US journalist James Creelman that he would not run for president in 1910, at which point he would be 80 years old. ", "This set off a spate of political activity by potential candidates, including Francisco I. Madero, a member of one of Mexico’s richest families. ", "Madero was part of the Anti-Re-electionist Party, whose main platform was the end of the Díaz regime. ", "But Díaz reversed his decision to retire and ran again. ", "He created the office of vice president, which could have been a mechanism to ease transition in the presidency. ", "But Díaz chose a politically unpalatable running mate, Ramón Corral, over a popular military man, Bernardo Reyes and popular civilian Francisco I. Madero. ", "He sent Reyes on a “study mission” to Europe and jailed Madero. ", "Official election results declared that Díaz had won almost unanimously and Madero received only a few hundred votes. ", "This fraud was too blatant, and riots broke out. ", "Uprisings against Díaz occurred in the fall of 1910, particularly in Mexico’s north and the southern state of Morelos. ", "Helping unite opposition forces was a political plan drafted by Madero, the Plan of San Luis Potosí, in which he called on the Mexican people to take up arms and fight against the Díaz government. ", "The rising was set for November 20, 1910. ", "Madero escaped from prison to San Antonio, Texas, where he began preparing to overthrow Díaz—an action today considered the start of the Mexican Revolution. ", "Diaz tried to use the army to suppress the revolts, but most of the ranking generals were old men close to his own age and they did not act swiftly or with sufficient energy to stem the violence. ", "Revolutionary force—led by, among others, Emiliano Zapata in the South, Pancho Villa and Pascual Orozco in the North, and Venustiano Carranza—defeated the Federal Army.", "\n\nDíaz resigned in May 1911 for the “sake of the peace of the nation”. ", "The terms of his resignation were spelled out in the Treaty of Ciudad Juárez, but it also called for an interim presidency and new elections were to be held. ", "Francisco León de la Barra served as interim president. ", "The Federal Army, although defeated by the northern revolutionaries, was kept intact. ", "Francisco I. Madero, whose 1910 Plan of San Luis Potosí had helped mobilize forces opposed to Díaz, accepted the political settlement. ", "He campaigned in the presidential elections of October 1911, won decisively, and was inaugurated in November 1911.", "\n\nMadero presidency and its opposition, 1911-1913\n\nFollowing the resignation of Díaz and a brief interim presidency of a high-level government official from the Díaz era, Madero was elected president in 1911.", "\n\nThe revolutionary leaders had many different objectives; revolutionary figures varied from liberals such as Madero to radicals such as Emiliano Zapata and Pancho Villa. ", "As a consequence, it proved impossible to agree about how to organize the government that emerged from the triumphant first phase of the revolution. ", "This standoff over political principles led quickly to a struggle for control of the government, a violent conflict that lasted more than 20 years.", "\n\nCounter-revolution and civil war, 1913-1915\n\nMadero was ousted and killed in February 1913 during the Ten Tragic Days. ", "General Victoriano Huerta, one of Díaz’s former generals, and a nephew of Díaz, Félix Díaz, plotted with the US ambassador to Mexico, Henry Lane Wilson, to topple Madero and reassert the policies of Díaz.", "\n\nWithin a month of the coup, rebellion started spreading in Mexico, most prominently by the governor of the state of Coahuila, Venustiano Carranza along with old revolutionaries demobilized by Madero, such as Pancho Villa. ", "The northern revolutionaries fought under the name of the Constitutionalist Army, with Carranza as the “First Chief” (primer jefe).", "\n\nIn the south, Emiliano Zapata continued his rebellion in Morelos under the Plan of Ayala, calling for the expropriation of land and redistribution to peasants. ", "Huerta offered peace to Zapata, who rejected it.", "\n\nHuerta convinced Pascual Orozco, whom he fought while serving the Madero government, to join Huerta’s forces. ", "Supporting the Huerta regime were business interests in Mexico, both foreign and domestic; landed elites; the Roman Catholic Church; as well as the German and British governments. ", "The Federal Army became an arm of the Huerta regime, swelling to some 200,000 men, many pressed into service and most ill-trained.", "\n\nThe US did not recognize the Huerta government, but from February to August 1913 it imposed an arms embargo on exports to Mexico, exempting the Huerta government and thereby favoring the regime against emerging revolutionary forces. ", "However, President Woodrow Wilson sent a special envoy to Mexico to assess the situation, and reports on the many rebellions in Mexico convinced Wilson that Huerta was unable to maintain order. ", "Arms ceased to flow to Huerta’s government, which benefited the revolutionary cause.", "\n\nThe US Navy made an incursion on the Gulf Coast, occupying Veracruz in April 1914. ", "Although Mexico was engaged in a civil war at the time, the US intervention united Mexican forces in their opposition to the US. ", "Foreign powers helped broker US withdrawal in the Niagara Falls peace conference. ", "The US timed its pullout to throw its support to the Constitutionalist faction under Carranza.", "\n\nInitially, the forces in northern Mexico were united under the Constitutionalist banner, with able revolutionary generals serving the civilian First Chief Carranza. ", "Pancho Villa began to split from supporting Carranza as Huerta was on his way out. ", "The break was not simply on personalist grounds, but primarily because Carranza was politically too conservative for Villa. ", "Carranza was not only a political holdover from the Díaz era, but was also a rich hacienda owner whose interests were threatened by the more radical ideas of Villa, especially on land reform. ", "Zapata in the south was also hostile to Carranza due to his stance on land reform.", "\n\nIn July 1914, Huerta resigned under pressure and went into exile. ", "His resignation marked the end of an era since the Federal Army, a spectacularly ineffective fighting force against the revolutionaries, ceased to exist.", "\n\nWith the exit of Huerta, the revolutionary factions decided to meet and make “a last ditch effort to avert more intense warfare than that which unseated Huerta.” ", "Called to meet in Mexico City in October 1914, revolutionaries opposed to Carranza’s influence successfully moved the venue to Aguascalientes. ", "The Convention of Aguascalientes did not reconcile the various victorious factions in the Mexican Revolution, but was a brief pause in revolutionary violence. ", "The break between Carranza and Villa became definitive during the Convention. ", "Rather than First Chief Carranza being named president of Mexico, General Eulalio Gutiérrez was chosen. ", "Carranza and Obregón left Aguascalientes, with far smaller forces than Villa’s. ", "The convention declared Carranza in rebellion against it and civil war resumed, this time between revolutionary armies that had fought in a united cause to oust Huerta.", "\n\nVilla went into alliance with Zapata to form the Army of the Convention. ", "Their forces separately moved on the capital and captured Mexico City in 1914, which Carranza’s forces had abandoned. ", "The famous picture of Villa, sitting in the presidential chair in the National Palace, and Zapata is a classic image of the Revolution. ", "Villa is reported to have said to Zapata that the presidential “chair is too big for us.” ", "The alliance between Villa and Zapata did not function in practice beyond this initial victory against the Constitutionalists. ", "Zapata returned to his southern stronghold in Morelos, where he continued to engage in guerrilla warfare under the Plan of Ayala. ", "Villa prepared to win a decisive victory against the Constitutionalist Army under Obregón.", "\n\nThe two rival armies of Villa and Obregón met in April 6–15, 1915 in the Battle of Celaya. ", "The frontal cavalry charges of Villa’s forces were met by the shrewd, modern military tactics of Obregón. ", "Constitutionalist victory was complete. ", "Carranza emerged in 1915 as the political leader of Mexico with a victorious army to keep him in that position. ", "Villa retreated north, seemingly into political oblivion. ", "Carranza and the Constitutionalists consolidated their position as the winning faction, with Zapata remaining a threat until his assassination in 1919.", "\n\nConstitutionalists in power, 1915-1920\n\nVenustiano Carranza promulgated a new constitution on February 5, 1917. ", "The Mexican Constitution of 1917, with significant amendments in the 1990s, still governs Mexico.", "\n\nOn 19 January 1917, a secret message (the Zimmermann Telegram) was sent from the German foreign minister to Mexico proposing joint military action against the United States if war broke out. ", "The offer included material aid to Mexico to reclaim the territory lost during the Mexican–American War, specifically the American states of Texas, New Mexico and Arizona. ", "Carranza’s generals told him that Mexico would lose to its much more powerful neighbor. ", "However, Zimmermann’s message was intercepted and published, and outraged American opinion, leading to a declaration of war in early April. ", "Carranza then formally rejected the offer, and the threat of war with the US eased.", "\n\nCarranza was assassinated in 1920 during an internal feud among his former supporters over who would replace him as president.", "\n\nIn December 1920, Álvaro Obregón, one of Carranza’s former allies who had joined with Plutarco Elías Calles and Adolfo de la Huerta in the Plan of Agua Prieta, overthrew Carranza and became president. ", "His government managed to accommodate many elements of Mexican society except the most conservative clergy and big land owners. ", "As a result, he was able to successfully implement policies emerging from the revolutionary struggle; in particular, the successful policies were: the integration of urban, organized labor into political life via CROM, the improvement of education and Mexican cultural production under José Vasconcelos, the movement of land reform, and the steps taken toward instituting women’s civil rights. ", "He faced several main tasks in the presidency, mainly political in nature. ", "First was consolidating state power in the central government and curbing regional strongmen (caudillos); second was obtaining diplomatic recognition from the United States; and third was managing the presidential succession in 1924 when his term of office ended. ", "His administration began constructing what one scholar called “an enlightened despotism, a ruling conviction that the state knew what ought to be done and needed plenary powers to fulfill its mission.” ", "After the nearly decade-long violence of the Mexican Revolution, reconstruction in the hands of a strong central government offered stability and a path of renewed modernization.", "\n\nObregón knew it was necessary for his regime to secure the recognition of the United States. ", "He had come to power by joining with Sonoran allies and eliminating Carranza. ", "With the promulgation of the Mexican Constitution of 1917, the Mexican government was empowered to expropriate natural resources. ", "The U.S. had considerable business interests in Mexico, especially oil, and the threat of Mexican economic nationalism to big oil companies meant that diplomatic recognition could hinge on Mexican compromise in implementing the constitution. ", "In 1923 when the Mexican presidential elections were on the horizon, Obregón began negotiating with the U.S. government in earnest, with the two governments signing the Bucareli Treaty. ", "The treaty resolved questions about foreign oil interests in Mexico, largely in favor of U.S. interests, but Obregón’s government gained U.S. diplomatic recognition. ", "With that arms and ammunition began flowing to revolutionary armies loyal to Obregón.", "\n\nSince Obregón had named his fellow Sonoran general, Plutarco Elías Calles, as his successor, Obregón was imposing a “little known nationally and unpopular with many generals,” thereby foreclosing the ambitions of fellow revolutionaries, particularly his old comrade Adolfo de la Huerta. ", "De la Huerta staged a serious rebellion against Obregón. ", "But Obregón once again demonstrated his brilliance as a military tactician who now had arms and even air support from the United States to suppress it brutally. ", "Fifty-four former Obregonistas were shot in the event. ", "Vasconcelos resigned from Obregón’s cabinet as minister of education.", "\n\nAlthough the Constitution of 1917 had even stronger anticlerical articles than the liberal constitution of 1857, Obregón largely sidestepped confrontation with the Roman Catholic Church in Mexico. ", "Since political opposition parties were essentially banned, the Catholic Church “filled the political void and play the part of a substitute opposition.”", "\n\nThe 1924 presidential election was not a demonstration of free and fair elections, but the incumbent Obregón did not stand for re-election, thereby acknowledging that revolutionary principle, and he completed his presidential term still alive, the first since Porfirio Díaz. ", "Candidate Calles embarked on the first populist presidential campaign in the nation’s history, as he called for land redistribution and promised equal justice, more education, additional labor rights, and democratic governance. ", "Calles indeed tried to fulfill his promises during his populist phase (1924–26), and then began a repressive anti-Catholic phase (1926–28). ", "Obregón’s stance toward the church appears pragmatic, since there were many other issues for him to deal with, but his successor Calles, a vehement anticlerical, took on the church as an institution and religious Catholics when he succeeded to the presidency, bringing about violent and bloody conflict known as the Cristero War.", "\n\nCristero War\n\nThe Cristero War of 1926 to 1929 was a counter-revolution against the Calles regime set off by his persecution of the Catholic Church in Mexico and specifically the strict enforcement of the anti-clerical provisions of the Mexican Constitution of 1917 and the expansion of further anti-clerical laws.", "\n\nA number of articles of the 1917 Constitution were at issue: a) Article 5 (outlawing monastic religious orders); b) Article 24 (forbidding public worship outside of church buildings); and c) Article 27 (restricting religious organizations’ rights to own property). ", "Finally, Article 130 took away basic civil rights of the clergy: priests and religious leaders were prevented from wearing their habits, were denied the right to vote, and were not permitted to comment on public affairs in the press.", "\nThe formal rebellions began early in 1927, with the rebels calling themselves Cristeros because they felt they were fighting for Jesus Christ himself. ", "The laity stepped into the vacuum created by the removal of priests, and in the long run the Church was strengthened. ", "The Cristero War was resolved diplomatically, largely with the help of the U.S. Ambassador, Dwight Whitney Morrow.", "\n\nThe conflict claimed about 90,000 lives: 57,000 on the federal side, 30,000 Cristeros, and civilians and Cristeros killed in anticlerical raids after the war’s end. ", "As promised in the diplomatic resolution, the laws considered offensive by the Cristeros remained on the books, but the federal government made no organized attempt to enforce them. ", "Nonetheless, persecution of Catholic priests continued in several localities, fueled by local officials’ interpretation of the law.", "\n\nFormation of the ruling party\n\nIn 1929, the National Revolutionary Party (PNR) was formed by the former president, General Plutarco Elías Calles. ", "Calles was to be succeeded by General Alvaro Obregón, who had served as president from 1920-24. ", "Obregón was assassinated by a Catholic in July 1928 before he could take office. ", "There were no viable presidential candidates acceptable to Calles, who was excluded from taking formal power again. ", "A solution to the problem was the formation of the PNR, which brought together regional caudillos and integrated labor and the peasantry in a party that was better able to manage the political process. ", "General Lázaro Cárdenas, who was a revolutionary general and had a political power based in the state of Michoacan, became part of the PNR. ", "In 1934, after a series of “puppet presidents” while Calles remained the effective power, Cárdenas out-maneuvered his former patron and sent him into exile. ", "Cárdenas reformed the PRN structure, resulting in the creation of the PRM (Partido Revolucionario Mexicano), the Mexican Revolutionary Party, which included the army as a party sector. ", "He had convinced most of the remaining revolutionary generals to hand over their personal armies to the Mexican Army; the date of the PRM party’s foundation is thus considered by some to be the end of the Revolution. ", "In 1946, at the six-year transition of the Mexican presidency, the party was reformed again, with the army no longer included as a party sector. ", "The Institutional Revolutionary Party (Partido Revolucionario Institucional) or PRI is the latest form of the party that evolved from the PRN and PRM. ", "The name “institutional” in its title reflects its supporters’ notion that the Mexican Revolution has been preserved in its structure.", "\n\nThe party is typically referred to as the three-legged stool, in reference to its sectors of Mexican workers, peasants, and bureaucrats.", "\n\nAfter its establishment as the ruling party, the PRI monopolized all the political branches: it did not lose a senate seat until 1988 or a gubernatorial race until 1989. ", "It was not until July 2, 2000, that Vicente Fox of the opposition “Alliance for Change” coalition, headed by the National Action Party (PAN), was elected president. ", "His victory ended the PRI’s 71-year hold on the presidency. ", "Fox was succeeded by the PAN candidate, Felipe Calderón. ", "In the 2012 elections, the PRI regained the presidency with its candidate Enrique Peña Nieto.", "\n\nRevitalization of the revolution under Cárdenas\n\nLázaro Cárdenas was hand-picked by Calles as the successor to the presidency in 1934. ", "Cárdenas managed to unite the different forces in the PRI and set the rules that allowed his party to rule unchallenged for decades to come without internal fights. ", "He nationalized the oil industry (on 18 March 1938), the electricity industry, created the National Polytechnic Institute, and started land reform and the distribution of free textbooks to children. ", "In 1936 he exiled Calles, the last general with dictatorial ambitions, thereby removing the army from power.", "\n\nOn the eve of World War II, the Cárdenas administration (1934–1940) was just stabilizing, and consolidating control over, a Mexican nation that, for decades, had been in revolutionary flux, and Mexicans were beginning to interpret the European battle between the communists and fascists, especially the Spanish Civil War, through their unique revolutionary lens. ", "Whether Mexico would side with the United States was unclear during Lázaro Cárdenas’ rule, as he remained neutral. “", "Capitalists, businessmen, Catholics, and middle-class Mexicans who opposed many of the reforms implemented by the revolutionary government sided with the Spanish Falange” i.e., the fascist movement.", "\n\nNazi propagandist Arthur Dietrich and his team of agents in Mexico successfully manipulated editorials and coverage of Europe by paying hefty subsidies to Mexican newspapers, including the widely read dailies Excélsior and El Universal. ", "The situation became even more worrisome for the Allies when major oil companies boycotted Mexican oil following Lázaro Cárdenas’ nationalization of the oil industry and expropriation of all corporate oil properties in 1938, which severed Mexico’s access to its traditional markets and led Mexico to sell its oil to Germany and Italy.", "\n\nManuel Ávila Camacho, Cárdenas’s successor, presided over a “bridge” between the revolutionary era and the era of machine politics under PRI that lasted until 2000. ", "Ávila, moving away from nationalistic autarchy, proposed to create a favorable climate for international investment, which had been a policy favored nearly two generations earlier by Madero. ", "Ávila’s regime froze wages, repressed strikes, and persecuted dissidents with a law prohibiting the “crime of social dissolution.” ", "During this period, the PRI shifted to the right and abandoned much of the radical nationalism of the early Cárdenas era. ", "Miguel Alemán Valdés, Ávila’s successor, even had Article 27 amended to protect elite landowners.", "\n\nMexico played a relatively minor role militarily in World War Two in terms of sending troops, but there were other opportunities for Mexico to contribute significantly. ", "Relations between Mexico and the U.S. had been warming in the 1930s, particularly after U.S. President Franklin Delano Roosevelt implemented the Good Neighbor Policy toward Latin American countries. ", "Even before the outbreak of hostilities between the Axis and Allied powers, Mexico aligned itself firmly with the United States, initially as a proponent of “belligerent neutrality” which the U.S. followed prior to the Pearl Harbor attack in December 1941. ", "Mexico sanctioned businesses and individuals identified by the U.S. government as being supporters of the Axis powers; in August 1941, Mexico broke off economic ties with Germany, then recalled its diplomats from Germany, and closed the German consulates in Mexico. ", "The Confederation of Mexican Workers (CTM) and the Confederation of Mexican Peasants (CNC) staged massive rallies in support of the government. ", "Immediately following the Japanese attack on Pearl Harbor on December 7, 1941, Mexico went on a war footing.", "\n\nMexico’s biggest contributions to the war effort were in vital war materiel and labor, particularly the Bracero Program, a guest-worker program in the U.S. freeing men there to fight in the European and Pacific theaters of War. ", "There was heavy demand for its exports, which created a degree of prosperity. ", "A Mexican atomic scientist, José Rafael Bejarano, worked on the secret Manhattan Project that developed the atomic bomb.", "\n\nIn Mexico and throughout Latin America, Franklin Roosevelt’s “Good Neighbor Policy” was necessary at such a delicate time. ", "Much work had already been accomplished between the U.S. and Mexico to create more harmonious relations between the two countries, including the settlement of U.S. citizen claims against the Mexican government, initially and ineffectively negotiated by the binational American-Mexican Claims Commission, but then in direct bilateral negotiations between the two governments. ", "The U.S. had not intervened on behalf of U.S. oil companies when the Mexican government expropriated foreign oil in 1938, allowing Mexico to assert its economic sovereignty but also benefiting the U.S. by easing antagonism in Mexico. ", "The Good Neighbor Policy led to the Douglas-Weichers Agreement in June 1941 that secured Mexican oil only for the United States, and the Global Settlement in November 1941 that ended oil company demands on generous terms for the Mexicans, an example of the U.S. putting national security concerns over the interests of U.S. oil companies. ", "When it became clear in other parts of Latin America that the U.S. and Mexico had substantially resolved their differences, the other Latin American countries were more amenable to support the U.S. and Allied effort against the Axis.", "\n\nFollowing losses of oil ships in the Gulf (the Potrero del Llano and Faja de Oro) to German submarines (U-564 and U-106 respectively) the Mexican government declared war on the Axis powers on May 30, 1942.", "\n\nPerhaps the most famous fighting unit in the Mexican military was the Escuadrón 201, also known as the Aztec Eagles.", "\n\nThis group consisted of more than 300 volunteers, who had trained in the United States to fight against Japan. ", "The Escuadrón 201 was the first Mexican military unit trained for overseas combat, and fought during the liberation of the Philippines, working with the U.S. Fifth Air Force in the last year of the war.", "\n\nAlthough most Latin American countries eventually entered the war on the Allies’ side, Mexico and Brazil were the only Latin American nations that sent troops to fight overseas during World War II.", "\n\nWith so many draftees, the U.S. needed farm workers. ", "The Bracero Program gave the opportunity for 290,000 Mexicans to work temporarily on American farms, especially in Texas.", "\n\nEconomic “miracle” (1930–1970)\n\nDuring the next four decades, Mexico experienced impressive economic growth (albeit from a low baseline), an achievement historians call “El Milagro Mexicano”, the Mexican Economic Miracle. ", "Annual economic growth during this period averaged 3–4 percent, with a modest 3-percent annual rate of inflation.", "\n\nThe miracle, moreover, was solidly rooted in government policy: 1) an emphasis on primary education that tripled the enrollment rate between 1929 and 1949; 2) high tariffs on imported domestic goods; and 3) public investment in agriculture, energy, and transportation infrastructure. ", "Starting in the 1940s, immigration into the cities swelled the country’s urban population.", "\n\nThe economic growth occurred in spite of falling foreign investment during the Great Depression. ", "The application of Article 27 of the Constitution of 1917 that gave subsoil rights to the Mexican government were implemented with the nationalization of foreign oil companies in 1938 by President Lázaro Cárdenas was a popular move. ", "But the real roots of Mexico’s sustained period of prosperity can be found in the period 1940-46, when Mexico allied with the United States against the Fascist Axis powers. ", "By supplying raw and finished war materials to the Allies, Mexico built up significant assets that in the post-war period could be translated into sustained growth and industrialization.", "\n\nGuatemala conflict\n\nThe Mexico–Guatemala conflict was an armed conflict between the Latin American countries of Mexico and Guatemala, in which civilian fishing boats were fired upon by the Guatemalan Air Force. ", "Hostilities were set in motion by the installation of Miguel Ydígoras as President of Guatemala on March 2, 1958.", "\n\nAlthough PRI administrations achieved economic growth and relative prosperity for almost three decades after World War II, the party’s management of the economy led to several crises. ", "Political unrest grew in the late 1960s, culminating in the Tlatelolco massacre in 1968. ", "Economic crises swept the country in 1976 and 1982, leading to the nationalization of Mexico’s banks, which were blamed for the economic problems (La Década Perdida).", "\n\nOn both occasions, the Mexican peso was devalued, and, until 2000, it was normal to expect a big devaluation and recession at the end of each presidential term. ", "The “December Mistake” crisis threw Mexico into economic turmoil—the worst recession in over half a century.", "\n\nEarthquake of 1985\n\nOn 19 September 1985, an earthquake (8.1 on the Richter scale) struck Michoacán, inflicting severe damage on Mexico City. ", "Estimates of the number of dead range from 6,500 to 30,000. ", "Public anger at the PRI’s mishandling of relief efforts combined with the ongoing economic crisis led to a substantial weakening of the PRI. ", "As a result, for the first time since the 1930s, the PRI began to face serious electoral challenges.", "\n\nChanging political landscape 1970-1990\n\nA phenomenon of the 1980s was the growth of organized political opposition to de facto one-party rule by the PRI. ", "The National Action Party (Mexico), founded in 1939 and until the 1980s a marginal political party and not a serious contender for power, began to gain voters, particularly in Mexico’s north. ", "They made gains in local elections initially, but in 1986 the PAN candidate for the governorship of Chihuahua had a good chance of winning. ", "The Catholic Church was constitutionally forbidden from participating in electoral politics, but the archbishop urged voters not to abstain from the elections. ", "The PRI intervened and upended what would likely have been a victory for the PRI. ", "Although the PRI’s candidate became governor, the widespread perception of electoral fraud, criticism by the archbishop of Chihuahua, and a more mobilized electorate made the victory costly to the PRI.", "\n\n1988 Presidential election The Mexican general election, 1988 was extremely important in Mexican history. ", "The PRI’s candidate, Carlos Salinas de Gortari, an economist who was educated at Harvard, had never held an elected office, and who was a technocrat with no direct link to the legacy of the Mexican Revolution even through his family. ", "Rather than toe the party line, which would have been for the other disappointed PRI candidates to support the official PRI choice, Cuauhtemoc Cárdenas, the son of former President Lázaro Cárdenas, broke with the PRI and ran as a candidate of the Democratic Current, later forming into the Party of Democratic Revolution (PRD). ", "The PAN candidate Manuel Clouthier ran a clean campaign in long-standing pattern of the party.", "\n\nThe election was marked by irregularities on a massive scale. ", "The Ministry of the Interior (Gobernación) controlled the electoral process, which meant in practice that the PRI controlled it. ", "During the vote count, the government computers were said to have crashed, something the government called “a breakdown of the system”. ", "One observer said, “For the ordinary citizen, it was not the computer network but the Mexican political system that had crashed.” ", "When the computers were said to be running again after a considerable delay, the election results they recorded were an extremely narrow victory for Salinas (50.7%), Cárdenas (31.1%), and Clouthier (16.8%). ", "Cárdenas was widely seen to have won the election, but Salinas was declared the winner. ", "There might have been violence in the wake of such fraudulent results, but Cárdenas did not call for it, “sparing the country a possible civil war.” ", "Years later, former Mexican President Miguel de la Madrid (1982–88) was quoted in the New York Times that the results were indeed fraudulent.", "\n\nOn 1 January 1994, Mexico became a full member of the North American Free Trade Agreement (NAFTA), joining the United States and Canada.", "\n\nMexico has a free market economy that recently entered the trillion-dollar class. ", "It contains a mixture of modern and outmoded industry and agriculture, increasingly dominated by the private sector. ", "Recent administrations have expanded competition in sea ports, railroads, telecommunications, electricity generation, natural gas distribution, and airports.", "\n\nPer capita income is one-quarter that of the United States; income distribution remains highly unequal. ", "Trade with the United States and Canada has tripled since the implementation of NAFTA. ", "Mexico has free-trade agreements with more than 40 countries, governing 90% of its foreign commerce.", "\n\nPresident Ernesto Zedillo (1994–2000)\n\nIn 1995, President Ernesto Zedillo faced the “December Mistake” crisis, triggered by a sudden devaluation of the peso. ", "There were public demonstrations in Mexico City and a constant military presence after the 1994 rising of the Zapatista Army of National Liberation in Chiapas.", "\n\nThe United States intervened rapidly to stem the economic crisis, first by buying pesos in the open market, and then by granting assistance in the form of $50 billion in loan guarantees. ", "The peso stabilized at 6 pesos per dollar. ", "By 1996, the economy was growing, and in 1997, Mexico repaid, ahead of schedule, all U.S. Treasury loans.", "\n\nZedillo oversaw political and electoral reforms that reduced the PRI’s hold on power. ", "After the 1988 election, which was strongly disputed and arguably lost by the government, the IFE (Instituto Federal Electoral – Federal Electoral Institute) was created in the early 1990s. ", "Run by ordinary citizens, the IFE oversees elections with the aim of ensuring that they are conducted legally and impartially.", "\n\nEnd of PRI rule in 2000\n\nAccused many times of blatant fraud, the PRI held almost all public offices until the end of the 20th century. ", "Not until the 1980s did the PRI lose its first state governorship, an event that marked the beginning of the party’s loss of hegemony.", "\n\nPresident Vicente Fox Quesada (2000–2006)\n\nEmphasizing the need to upgrade infrastructure, modernize the tax system and labor laws, integrate with the U.S. economy, and allow private investment in the energy sector, Vicente Fox Quesada, the candidate of the National Action Party (PAN), was elected the 69th president of Mexico on 2 July 2000, ending PRI’s 71-year-long control of the office. ", "Though Fox’s victory was due in part to popular discontent with decades of unchallenged PRI hegemony, also, Fox’s opponent, president Zedillo, conceded defeat on the night of the election—a first in Mexican history. ", "A further sign of the quickening of Mexican democracy was the fact that PAN failed to win a majority in both chambers of Congress—a situation that prevented Fox from implementing his reform pledges. ", "Nonetheless, the transfer of power in 2000 was quick and peaceful.", "\n\nFox was a very strong candidate, but an ineffective president who was weakened by PAN’s minority status in Congress. ", "Historian Philip Russell summarizes the strengths and weaknesses of Fox as president:\n\nMarketed on television, Fox made a far better candidate than he did president. ", "He failed to take charge and provide cabinet leadership, failed to set priorities, and turned a blind eye to alliance building….By 2006, as political scientist Soledad Loaeza noted, “the eager candidate became a reluctant president who avoided tough choices and appeared hesitant and unable to hide the weariness caused by the responsibilities and constraints of the office.” …", "He had little success in fighting crime. ", "Even though he maintained the macroeconomic stability inherited from his predecessor, economic growth barely exceeded the rate of population increase. ", "Similarly, the lack of fiscal reform left tax collection at a rate similar to that of Haiti….Finally, during Fox’s administration, only 1.4 million formal-sector jobs were created, leading to massive immigration to the United States and an explosive increase in informal employment.", "\n\nPresident Felipe Calderón Hinojosa (2006–2012)\n\nPresident Felipe Calderón Hinojosa (PAN) took office after one of the most hotly contested elections in recent Mexican history; Calderón won by such a small margin (.56% or 233,831 votes.) ", "that the runner-up, Andrés Manuel López Obrador of the leftist Party of the Democratic Revolution (PRD) contested the results.", "\n\nDespite imposing a cap on salaries of high-ranking public servants, Calderón ordered a raise on the salaries of the Federal Police and the Mexican armed forces on his first day as president.", "\n\nCalderón’s government also ordered massive raids on drug cartels upon assuming office in December 2006 in response to an increasingly deadly spate of violence in his home state of Michoacán. ", "The decision to intensify drug enforcement operations has led to an ongoing conflict between the federal government and the Mexican drug cartels.", "\n\nPresident Enrique Peña Nieto (incumbent)\n\nOn July 1, 2012, Enrique Peña Nieto was elected president of Mexico with 38% of the vote. ", "He is a former governor of the state of Mexico and a member of the PRI. ", "His election returned the PRI to power after 12 years of PAN rule. ", "He was officially sworn into office on December 1, 2012.", "\n\nThe Pacto por México was a cross party alliance that called for the accomplishment of 95 goals. ", "It was signed on 2 December 2012 by the leaders of the three main political parties in Chapultepec Castle. ", "The Pact has been lauded by international pundits as an example for solving political gridlock and for effectively passing institutional reforms. ", "Among other legislation, it called for education reform, banking reform, fiscal reform and telecommunications reform, all of which were eventually passed. ", "Most importantly the Pact wanted a revaluation of PEMEX. ", "This ultimately resulted in the dissolution of the agreement when in December 2013 the center-left PRD refused to collaborate with the legislation penned by the center-right PAN and PRI that ended PEMEX’s monopoly and allowed for foreign investment in Mexico’s oil industry.", "\n\nDrug war\n\nMexico is a major transit and drug-producing nation: an estimated 90% of the cocaine smuggled into the United States every year moves through Mexico. ", "Fueled by the increasing demand for drugs in the United States, the country has become a major supplier of heroin, producer and distributor of MDMA, and the largest foreign supplier of cannabis and methamphetamine to the U.S.’s market. ", "Major drug syndicates control the majority of drug trafficking in the country, and Mexico is a significant money-laundering center.", "\n\nAfter the Federal Assault Weapons Ban expired on September 13, 2004 in the United States, the Mexican President Calderon Hinojosa decided to use brute force to combat some drug lords and in 2007 started a major escalation on the Mexican Drug War. ", "Mexican drug lords found it easy to buy assault weapons in the United States. ", "The result is that drug cartels have now both more gun power, and more manpower due to the high unemployment in Mexico.", "\n\nDrug cultivation has increased too: Cultivation of opium poppy in 2007 rose to 17,050 acres (69.0 km2), yielding a potential production of 19.84 tons of pure heroin or 55.12 tons of “black tar” heroin. ", "Black tar is the dominant form of Mexican heroin consumed in the western United States. ", "Marijuana cultivation increased to 21,992 acres (89.00 km2) in 2007, yielding a potential production of 17,416.52 tons.", "\n\nThe Mexican government conducts the largest independent illicit-crop eradication program in the world, but Mexico continues to be the primary transshipment point for U.S.-bound cocaine from South America." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006356611847877502, 0.0006226077675819397, 0.0007894825539551675, 0.0005796796758659184, 0.000869107258040458, 0.0007864505751058459, 0.000724530837032944, 0.00081630825297907, 0.0006636628531850874, 0.0006438899436034262, 0.0008228291990235448, 0.0005804863758385181, 0.0005581172881647944, 0.004858311731368303, 0.0006867547053843737, 0.0006969283567741513, 0.0008101174607872963, 0.0009962834883481264, 0.0009240364888682961, 0.0008146418258547783, 0.0005962347495369613, 0.0013839607127010822, 0.0025845759082585573, 0.0007997496868483722, 0.0014871788443997502, 0.004322949331253767, 0.0010079421335831285, 0.002968030981719494, 0.0009093323023989797, 0.0034599131904542446, 0.001071637379936874, 0.00558313587680459, 0.0006810136837884784, 0.0006275791092775762, 0.0007240790291689336, 0.0006882174056954682, 0.0006782020791433752, 0.000691821682266891, 0.001910607679747045, 0.004169392865151167, 0.0007095719920471311, 0.11618012189865112, 0.0010289649944752455, 0.0006007433403283358, 0.0008168030763044953, 0.0006372638163156807, 0.0012574609136208892, 0.0006922113825567067, 0.000611793773714453, 0.0006033357931300998, 0.0006300378008745611, 0.0007142451358959079, 0.0009009942295961082, 0.0007148879813030362, 0.0005792235024273396, 0.0007427598466165364, 0.0010206695878878236, 0.0013625847641378641, 0.0009079133160412312, 0.0005401068483479321, 0.0006896900595165789, 0.0008699582540430129, 0.002715284936130047, 0.000686969025991857, 0.0005918749957345426, 0.0006440578144975007, 0.0005551147041842341, 0.0006193792214617133, 0.0005545140011236072, 0.0005676242872141302, 0.0007052953005768359, 0.0005981791182421148, 0.000697340932674706, 0.000816171697806567, 0.0007494803285226226, 0.0008201126474887133, 0.0008506977465003729, 0.0006203537341207266, 0.0007192083867266774, 0.00077059306204319, 0.0006109934183768928, 0.000696057453751564, 0.0005489476025104523, 0.0005831864546053112, 0.0006451217923313379, 0.0006302605615928769, 0.0005748765543103218, 0.0005616393173113465, 0.0005544736050069332, 0.0006276736385188997, 0.000700538803357631, 0.0005939303082413971, 0.000638214114587754, 0.0006374891963787377, 0.0007642343989573419, 0.0006674439646303654, 0.0006012092926539481, 0.0006506153149530292, 0.0005999371642246842, 0.0005805250839330256, 0.0005333971348591149, 0.0006942310137674212, 0.000549978285562247, 0.000685597478877753, 0.0006366497254930437, 0.0007509487913921475, 0.0008249139063991606, 0.0005814595497213304, 0.0006407690234482288, 0.0007978391367942095, 0.0006610614946112037, 0.0006143077043816447, 0.000620148261077702, 0.0011014831252396107, 0.0005866189021617174, 0.000645297986920923, 0.0008351010037586093, 0.0006579182227142155, 0.0007635382353328168, 0.000717789982445538, 0.0008070517214946449, 0.0006800745613873005, 0.0006319510866887867, 0.0006048529176041484, 0.0006634955643676221, 0.0006437834817916155, 0.0005688396049663424, 0.0007764753536321223, 0.0007231329218484461, 0.0005913906497880816, 0.0005737981991842389, 0.0006793163483962417, 0.0008678284357301891, 0.0009072872344404459, 0.0007183025008998811, 0.0007369283703155816, 0.000567121896892786, 0.0005930294864811003, 0.000585293339099735, 0.0006129306857474148, 0.0006992461858317256, 0.0008789238636381924, 0.0007623505080118775, 0.0007677915855310857, 0.0005534379160962999, 0.0006165888626128435, 0.000718462688382715, 0.007454862352460623, 0.0006966388900764287, 0.000827830983325839, 0.004293535370379686, 0.0017822132213041186, 0.0015847190516069531, 0.0006915569538250566, 0.0006518361042253673, 0.000752384657971561, 0.0007561531383544207, 0.000701482524164021, 0.0007522014784626663, 0.0006411144859157503, 0.0006805231678299606, 0.0009154655272141099, 0.0010201586410403252, 0.0008471334003843367, 0.0009392168722115457, 0.0008152234368026257, 0.0007231777417473495, 0.0013781171292066574, 0.004007604904472828, 0.0007315904949791729, 0.0008475217036902905, 0.0006175613380037248, 0.0007575866766273975, 0.0008200824959203601, 0.000690856424625963, 0.0005916316877119243, 0.0031848216895014048, 0.0006705683772452176, 0.009066999889910221, 0.0043431613594293594, 0.0006083211046643555, 0.0811857208609581, 0.0013340222649276257, 0.0010088490089401603, 0.0009709422593005002, 0.0005769135314039886, 0.0009327034931629896, 0.0022212236654013395, 0.0015993629349395633, 0.0006133979186415672, 0.0006442159065045416, 0.0006508161895908415, 0.0005815706681460142, 0.0011111234780400991, 0.0006111258990131319, 0.0007078274502418935, 0.0006394988158717752, 0.00056006497470662, 0.0006719249067828059, 0.0018769596936181188, 0.0008029236923903227, 0.0006522396579384804, 0.0006293313927017152, 0.0009285507840104401, 0.0007268247427418828, 0.0007777279824949801, 0.0010851967381313443, 0.0012549716047942638, 0.0009180360357277095, 0.0005795606411993504, 0.0007954736356623471, 0.0006077830330468714, 0.0006383655709214509, 0.0008470284519717097, 0.0005794087192043662, 0.0006382153369486332, 0.001960974419489503, 0.0007511495496146381, 0.004300455562770367, 0.0007285282481461763, 0.0016373011749237776, 0.000563100737053901, 0.0007352907559834421, 0.0008777776383794844, 0.0007196934311650693, 0.0007660029223188758, 0.0012301531387493014, 0.0006556610460393131, 0.0006303437985479832, 0.0007192902849055827, 0.01386912539601326, 0.0008150614448823035, 0.0005727553507313132, 0.0006895363330841064, 0.0015334944473579526, 0.0010203876299783587, 0.0363321378827095, 0.020063187927007675, 0.0027969025541096926, 0.02907571569085121, 0.022006716579198837, 0.11297421157360077, 0.0022878553718328476, 0.0005775715690106153, 0.0008904541609808803, 0.0008422922692261636, 0.0010846597142517567, 0.013660792261362076, 0.000577737286221236, 0.0007460954948328435, 0.0005496952217072248, 0.000584539317060262, 0.0015829304466024041, 0.0008295319275930524, 0.0009624280501157045, 0.0010865357471629977, 0.0007713281083852053, 0.0007093792664818466, 0.8656297326087952, 0.0013126732083037496, 0.003927003126591444, 0.0009275285410694778, 0.0013126275734975934, 0.0009744481067173183, 0.0006923328037373722, 0.0006319748936221004, 0.0015567280352115631, 0.000711594766471535, 0.0006607528775930405, 0.0006068349466659129, 0.0018328852020204067, 0.0005530002526938915, 0.001126231043599546, 0.001232923474162817, 0.0006802923162467778, 0.002076617907732725, 0.01992800645530224, 0.0008897242369130254, 0.0009317856165580451, 0.070610910654068, 0.0006375797092914581, 0.038055241107940674, 0.00674772122874856, 0.0005856502102687955, 0.0007029453990980983, 0.0008833513711579144, 0.0006482166354544461, 0.0006617091130465269, 0.0007083687232807279, 0.000905306835193187, 0.0006266977870836854, 0.002034431556239724, 0.0007561668171547353, 0.0006619134219363332, 0.0006931883981451392, 0.000785117328632623, 0.0008142956648953259, 0.0010548769496381283, 0.0019206638680770993, 0.0008350206189788878, 0.0009769091848284006, 0.0024539183359593153, 0.0012996775330975652, 0.0006976400618441403, 0.0007565489504486322, 0.000599063525442034, 0.0034465279895812273, 0.000986530794762075, 0.0013896827585995197, 0.0011615930125117302, 0.10657389461994171, 0.0006709701265208423, 0.0007758980500511825, 0.0010719819692894816, 0.0013608114095404744, 0.0009079826413653791, 0.0007950682193040848, 0.0006403056904673576, 0.0009803303983062506, 0.0008913080673664808, 0.0014730155235156417, 0.0009524562628939748, 0.0007800362654961646, 0.0009355640504509211, 0.0008188924402929842, 0.000808470300398767, 0.000842724577523768, 0.0008445180719718337, 0.0006749401218257844, 0.003526324173435569, 0.001384021365083754, 0.002921878360211849, 0.0013314137468114495, 0.0008646411006338894, 0.0008605147595517337, 0.001098521752282977, 0.0011684162309393287, 0.0009926954517140985, 0.0012624814407899976, 0.0011006408603861928, 0.0007879455806687474, 0.0010261817369610071, 0.0018568160012364388, 0.0008977956604212523, 0.0008670237148180604, 0.0011542652500793338, 0.0007256893441081047, 0.0008089037728495896, 0.001056330045685172, 0.001588011858984828, 0.0006322800181806087, 0.0008342976798303425, 0.0006527916411869228, 0.001135552767664194, 0.006214550696313381, 0.0005923428689129651, 0.0007093235617503524, 0.0008298354805447161, 0.004319082014262676, 0.002617582678794861, 0.0007622804259881377, 0.0018565614009276032, 0.0006920788437128067, 0.000782861141487956, 0.0007385073695331812, 0.06652820855379105, 0.0013089117128401995, 0.000708244158886373, 0.0012629637494683266, 0.0012498254654929042, 0.008071701973676682, 0.0007103649550117552, 0.0019146621925756335, 0.0005954155931249261, 0.0006535087595693767, 0.0006525667267851532, 0.0014408695278689265, 0.0006780598778277636, 0.0007574142655357718, 0.0019188894657418132, 0.0009084823541343212, 0.001620552851818502, 0.0009815744124352932, 0.0028108011465519667, 0.0012502475874498487, 0.0016769072972238064, 0.000759695190936327, 0.00296228495426476, 0.0010940029751509428, 0.0006414549425244331, 0.0011293848510831594, 0.002556416904553771, 0.001118648098781705, 0.0005947003955952823, 0.0010042674839496613, 0.002957874909043312, 0.0026255694683641195, 0.0024495674297213554, 0.0006110164104029536, 0.0013212066842243075, 0.026999540627002716, 0.0005757813923992217, 0.0007180643151514232, 0.001604916644282639, 0.001864281832240522, 0.006956795696169138, 0.0007533708121627569, 0.0009992950363084674, 0.0006540006725117564, 0.0012908568605780602, 0.0006040362641215324, 0.0008032607147470117, 0.0006761550321243703, 0.0015341625548899174, 0.000581738946493715, 0.0006680577644146979, 0.0006863895687274635, 0.0037954924628138542, 0.001193750649690628, 0.002499402267858386, 0.0051017808727920055, 0.0007465662783943117, 0.0005822093226015568, 0.0006954869022592902, 0.0005785942194052041, 0.0006087778601795435, 0.0008556997054256499, 0.0006475849659182131, 0.0006222868687473238, 0.002117674332112074, 0.0005518408142961562, 0.000571728334762156, 0.000654806790407747, 0.0005917819798924029, 0.0008527266327291727, 0.0036527193151414394, 0.0005550155183300376, 0.0007683676667511463, 0.0005725848022848368, 0.0009388354374095798, 0.0006121110636740923, 0.02650591731071472, 0.0011413509491831064, 0.0016023238422349095, 0.0006067146314308047, 0.0010776869021356106, 0.0007833641720935702, 0.0006379489786922932, 0.0005956815439276397, 0.0005938394460827112, 0.0006894890684634447, 0.0005589797510765493, 0.000545509799849242, 0.0006528233643621206, 0.0017773066647350788, 0.000768035592045635, 0.0006044276524335146, 0.0017677709693089128, 0.0006176981842145324, 0.0006598730687983334, 0.0006184363155625761, 0.0005893775960430503, 0.0006218262715265155, 0.00077292590867728, 0.0006853672675788403, 0.0009305151179432869, 0.0006946129142306745, 0.0007147128344513476, 0.0006289329612627625, 0.0005507643800228834, 0.019013408571481705, 0.000722372904419899, 0.0006107206572778523, 0.0005472726770676672, 0.0006365681765601039, 0.0005941842100583017, 0.0006911616655997932, 0.001249448279850185, 0.0007231994532048702, 0.0006148925749585032, 0.0006299570086412132, 0.0006546420627273619, 0.0010401955805718899, 0.000621513114310801, 0.0005720543558709323, 0.0008536290843039751, 0.0006372310454025865, 0.0007970902952365577, 0.0007957799825817347, 0.002043532906100154, 0.0011132986983284354, 0.0005650300299748778, 0.000727687613107264, 0.0007113275933079422, 0.0007003289647400379, 0.23993471264839172, 0.0009504419867880642, 0.0008928061579354107, 0.0006484795594587922, 0.0018451297655701637, 0.0014928807504475117, 0.0013383221812546253, 0.000814496714156121, 0.0006129278335720301, 0.0007510017603635788, 0.0008838357753120363, 0.0007597458316013217, 0.0005967466859146953, 0.000539777975063771, 0.0006697505014017224, 0.0005841208039782941, 0.0009720266098156571, 0.0009978751186281443, 0.001298950519412756, 0.0007652437780052423, 0.0011519481195136905, 0.0010945929680019617, 0.0007206055452115834, 0.001111048273742199, 0.0007003045175224543, 0.0035478819627314806, 0.0007160064997151494, 0.0006454210379160941, 0.0007826105575077236, 0.0008780984790064394, 0.0009157948079518974, 0.0005912401829846203, 0.0007479930063709617, 0.0007302068406715989, 0.001271178130991757, 0.0008422934915870428, 0.001163015142083168, 0.0018566773505881429, 0.0007595837814733386, 0.0018901277799159288, 0.0009874188108369708, 0.0007130688172765076, 0.0007058479823172092, 0.0006033550598658621, 0.0006811989587731659, 0.00151511887088418, 0.0009109856327995658, 0.0009461110457777977, 0.0011859580408781767, 0.0006014190730638802, 0.0007763374014757574, 0.0008802543743513525, 0.0010854463325813413, 0.0021057012490928173, 0.0008263816707767546, 0.0013571344316005707, 0.0009841228602454066, 0.0007242594729177654, 0.000625031825620681, 0.0022245782893151045, 0.0006837316905148327, 0.0005797026096843183, 0.0008690721588209271, 0.0007172409095801413, 0.003777706064283848, 0.0025237412191927433, 0.0012045869370922446, 0.0008313697762787342, 0.001588274259120226, 0.0009735271451063454, 0.000784816627856344, 0.0007083194213919342, 0.0006894496036693454, 0.0011264875065535307, 0.00063746003434062, 0.0007364527555182576, 0.0016854200512170792, 0.0007378049194812775, 0.0007870349218137562, 0.0005862871767021716, 0.0006584877846762538, 0.0006252716411836445, 0.0023780863266438246, 0.0019151825690642, 0.00110939412843436, 0.03247067704796791, 0.0013513865415006876, 0.0007687342003919184, 0.0009335388313047588, 0.0007203356944955885, 0.0007169402088038623, 0.0011784289963543415, 0.007231527473777533, 0.004418499767780304, 0.0007544728578068316, 0.0007818129961378872, 0.0008920289110392332, 0.0008527835598215461, 0.0006853460217826068, 0.010076255537569523, 0.0007631515618413687, 0.001611198647879064, 0.0006269699078984559, 0.0007937276386655867, 0.002301630564033985, 0.0008268770761787891, 0.0009952811524271965, 0.001183195854537189, 0.0009016520343720913, 0.0008532057981938124, 0.0010772967943921685, 0.0005557078984566033, 0.0008610967197455466, 0.0006139252218417823, 0.000976988230831921, 0.0006912769749760628, 0.0007144520641304553, 0.0013080693315714598, 0.0007437716703861952, 0.0007610192988067865, 0.0006096090655773878, 0.00079669727711007, 0.0018342764815315604, 0.001393135986290872, 0.0008471308974549174, 0.0007682066061533988, 0.053174566477537155, 0.012141644023358822, 0.0011372165754437447, 0.0007181796245276928, 0.0008278999594040215, 0.001604421529918909, 0.0007997702923603356, 0.0006463877507485449, 0.0006672915769740939, 0.0006038644933141768, 0.0007052512955851853, 0.0008108280599117279, 0.0009133027051575482, 0.0023896349593997, 0.000730185944121331, 0.0005789358983747661, 0.000718911993317306, 0.0005843382095918059, 0.0005769082927145064, 0.0008254561107605696, 0.000588134047575295, 0.0006623302469961345, 0.0029332961421459913, 0.0008611040539108217, 0.0007610614411532879, 0.0008197184070013463, 0.0013866527006030083, 0.0019313644152134657, 0.0008842156967148185, 0.0006215891917236149, 0.0005698541062884033, 0.0005710214609280229, 0.0005512029165402055, 0.0006539046880789101, 0.0005936886882409453, 0.0007730497163720429, 0.0006709074950776994, 0.0007826325600035489, 0.0005627074860967696, 0.0005575350951403379, 0.0008487257873639464, 0.0006276260828599334, 0.0015581606421619654, 0.012879403308033943, 0.0007147942669689655, 0.002739103278145194, 0.002759851049631834, 0.0009234537719748914, 0.0006122289341874421, 0.0007587550207972527, 0.0006515025743283331, 0.0011227438226342201, 0.0006769377505406737, 0.0010886525269597769, 0.0005856284406036139, 0.0006914156256243587, 0.001068170415237546, 0.0006558141903951764, 0.0007428592653013766, 0.0006168198888190091, 0.0009131982224062085, 0.0007293883245438337, 0.0006680519436486065, 0.00089132075663656, 0.003006884828209877, 0.0006992329144850373, 0.0006048477371223271, 0.0007410456310026348, 0.001051648403517902, 0.0005797568010166287, 0.0007116143824532628, 0.0005939818220213056, 0.0006048039649613202, 0.0008945648442022502, 0.00060162169393152, 0.0005739009939134121, 0.0016793588874861598, 0.0006312537007033825, 0.0007365089259110391, 0.0005743097281083465, 0.0006128395907580853, 0.0014537899987772107, 0.0011035799980163574, 0.0006170888664200902, 0.0012848934857174754, 0.0008498462266288698, 0.0005192395765334368, 0.0022581222001463175, 0.0008275415166281164, 0.0009281358798034489, 0.0012769214808940887, 0.0006194557063281536, 0.0007315636612474918, 0.0006270736339502037, 0.000815624778624624, 0.0006409314810298383, 0.0011315569281578064, 0.0006838968838565052, 0.0007194527424871922, 0.000799022673163563, 0.0011341316858306527, 0.0006965950015000999, 0.0007522850064560771, 0.000586049456615001, 0.0005648434744216502, 0.0007161163375712931, 0.0007969908183440566, 0.0006845708121545613, 0.03134457767009735, 0.001326572964899242, 0.0012714741751551628, 0.0007491022115573287, 0.0018422524444758892, 0.00789865106344223, 0.0024037333205342293, 0.08314184099435806, 0.0006423250888474286, 0.0023425437975674868 ]

[ "Editors' Notes Houston's status as a fertile and influential rap mecca is still thriving as the rest of the world continues to catch up with the city's historically insular greatness. ", "So consider Megan Thee Stallion an ambassador of what’s happening there now. ", "From the blaxploitation vibes of its cover art to its loaded contents, her proper debut album builds upon the filthy flows that made her preceding Tina Snow project and its breakout single “Big Ole Freak” such an essential listen.", "\n\n\n\nOver live-wire beats informed less by purple drank and slab cars than by Cash Money and Hypnotize Minds, she doles out sex positivity and hustles wisdom about female empowerment in anthems like \"Dance\" and \"Money Good.\" ", "Boasting a rare and deadly approach both lyrical and diabolical, she clowns hopeless imitators on “Realer” and provides ample ratchet motivation on the bassbin ruiner “Shake That.” ", "Academy Award winner Juicy J, who produced three of Fever's cuts, doles out his legendary co-sign with Southern pride, dropping a few raw bars himself on “Simon Says” alongside Megan’s characteristically raw ones." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.000705032201949507, 0.0009009911445900798, 0.003162106266245246, 0.03540225327014923, 0.016687849536538124, 0.0012054936960339546 ]

[ "One of our favorite acronyms is ditching another one: Hewlett-Packard wants to spin off its personal computers division in a dramatic move. ", "Whatever the means—spin-off, direct sale, or \"other transaction\"—HP is done with this low-profit market. ", "Yes, that announcement comes from the current leader in worldwide PC sales. ", "Speaking of the commodity PC business during today's earnings call, HP CEO Leo Apotheker said \"continuing to execute in this market is no longer in the interest of HP and its shareholders.\"", "\n\nAnd that's not all. ", "The company is also buying British data analysis company Autonomy in a $10.2 billion blockbuster deal and effectively shutting down what's left of Palm. ", "You'd think that the third-quarter report that's due after the closing bell would be enough excitement for one day, but HP didn't think so.", "\n\nThere's a common thread running through all of these changes, and it all starts at the top.", "\n\nTrickle-down economics\n\nApotheker is very much a software man. ", "Coming in from decades of enterprise software experience at German powerhouse SAP, Leo was thrown into a world full of hardware at HP. ", "From PCs and printers to UNIX servers—and even a finger in Intel's Itanium design—the Palo Alto giant must have looked alien to a man of Apotheker's pedigree.", "\n\nHP's board of directors knew this when they hired him. ", "If the steering committee wasn't okay with a radical shift into software and services, they would have hired somebody else.", "\n\nSo it was always obvious that the new boss would run HP very differently from predecessor Mark Hurd's relentless cost-cutting focus. ", "Less low-margin hardware and more super-profitable software is the motto here. ", "Every single one of Thursday's announced and rumored moves echoes that very refrain.", "\n\nA dash of history\n\nWhen HP joined forces with Compaq ten years ago, the mega-merger created a computing colossus to rival Dell, which ran the roost in those days. ", "Even in the aftermath of the dot-com implosion, the PC market was vibrant and full of growth. ", "It was something worth fighting for.", "\n\nThen IBM dropped out of the race, selling its PC operations to Chinese counterpart Lenovo. ", "Meanwhile, Microsoft coasted on Windows XP for half a decade, exchanging OS innovation for service packs. ", "And when Windows Vista finally showed up, it was a dud. ", "Meanwhile, Palm and the BlackBerry platform had sown the seeds for meaningful mobile computing, and Apple seized that market with both hands in 2007. ", "Hello, iPhone!", "\n\nAnd now, HP gives up on the PC market even as Dell focuses on servers and services over its old consumer-grade warhorses. ", "Consumer-grade systems are not very profitable unless you're Apple, because the market has become saturated. ", "If you want or need a PC, you probably already have one (or two, or five). ", "Like the family car, you'll buy a new one only if the old mainstay breaks down. ", "Gigahertz races are a thing of the past, and nearly every system is interchangeable with a dozen alternatives from competitors.", "\n\nRise of the non-machines\n\nPreannouncing that standalone webOS devices like the TouchPad and Pre-successor smartphones are joining the Dodo bird and dinosaurs only underscores HP's lack of hardware commitment. ", "If it's not software or services, it's probably not worth spending resources on. ", "In the case of the Palm-derived gadgets, it's more of a failed experiment than the end of an era. ", "Indeed, Apotheker said on the call that the TouchPad and other consumer devices \"didn't perform to expectations.\" ", "And it's all right—webOS lives on as a feature of HP's printers anyway. ", "The company is getting a little something for its $1.2 billion investment.", "\n\nI wouldn't be surprised to see webOS finding new uses, too. ", "It's software, after all, and Apotheker understands how to wring value out of that asset class.", "\n\nReforming in the name of...\n\nThat brings us back to Autonomy. ", "As of the last financial report, software sales represented just 2.9 percent of HP's annual sales. ", "The Autonomy deal will give the software segment an instant 20 percent revenue jolt. ", "When you remove the PC division from the equation, software sales then become about 5.5 percent of the company's total sales—more than twice as important to HP's health as the segment is today.", "\n\nPurchasing Autonomy will drain HP's cash reserves, probably even forcing the company to dip into fresh debt to finance it all. ", "Don't forget that taxes take a real toll when moving cash across national borders, and that Autonomy is a British company.", "\n\nEven so, I expect plenty more software deals out of HP in the coming quarters and years. ", "Apotheker has tipped his hand, and his version of Hewlett-Packard looks even more IBM-like than the Mark Hurd incarnation. ", "Server systems can stay because they are wildly profitable and also tied into the vestige of a software ecosystem that HP has. ", "Printers? ", "Apotheker can get used to them, being the primary driver of HP's cash machine today. ", "But if he ever finds the ink drying up, that division is going to someone like Toshiba, stat. ", "Leo just needs an excuse.", "\n\nTrading even more hardware products in for software will transform HP in Apotheker's own image. ", "Three or four years from now, the new HP will butt heads with Oracle and Microsoft more than Canon, Epson, and Lenovo. ", "The one constant in HP's environment is IBM, which remains a big, blue role model for both Apotheker and Larry Ellison.", "\n\nBy hook, crook, or stock swaps, Apotheker will find a way to move his company in that direction. ", "And it doesn't hurt his ambitions at all that interest rates are at historical lows across the globe. ", "The economic crisis creates a flood of cheap and easy debt-based financing.", "\n\nDoes Apotheker need an apothecary?", "\n\nAll of this drastic change begs the question whether Leo Apotheker is a genius or a madman. ", "HP is already a very successful and profitable business, and a worldwide leader in the soon-to-be-forgotten PC market. ", "You don't mess with success, right? ", "Apotheker knows that HP's shareholders are watching very closely: \"I know our investors don't like being in this position, and neither do I,\" he said during the earnings call. \"", "I'm taking ownership for these decisions and investments.\"", "\n\nBut I think the man is on an inspired mission. ", "The Personal Systems Group, which sells business and consumer PCs as well as mobile computing devices, is by far the least profitable of HP's many divisions. ", "It's also stagnant in a fully mature market. ", "Getting rid of that is a logical first step, and why wouldn't a software guru get back to what he knows best? ", "The dominoes fall from that premise and leave us with a reformed, very different, and more profitable company when all is said and done.", "\n\nAnd that's what it's all about in the name of the patriarch, his favorite business, and the holy shareholder." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0007091474835760891, 0.0006795708322897553, 0.0005944475997239351, 0.0005978485569357872, 0.001172364572994411, 0.0008015442290343344, 0.0006123060011304915, 0.0005699333851225674, 0.0021995301358401775, 0.0006546211079694331, 0.0035743843764066696, 0.0006303909467533231, 0.0005925614386796951, 0.0007744266767986119, 0.0007280860445462167, 0.0008976685348898172, 0.0009726958815008402, 0.0007028824184089899, 0.000987173756584525, 0.0009091213578358293, 0.0006223747041076422, 0.03389294818043709, 0.0006174195441417396, 0.0010546684497967362, 0.000922403356526047, 0.0007166601135395467, 0.0007236162200570107, 0.0016643361886963248, 0.0008604192407801747, 0.0007888614200055599, 0.0007666342426091433, 0.0007269085617735982, 0.0007693541701883078, 0.0009261813829652965, 0.0005871818866580725, 0.0007509323768317699, 0.0013368355575948954, 0.0005831014714203775, 0.0006191575666889548, 0.0005556284449994564, 0.0006902184686623514, 0.0009875628165900707, 0.0008389552822336555, 0.000599161721765995, 0.006362801883369684, 0.000655987358186394, 0.0008490659529343247, 0.0010509719140827656, 0.0006798882386647165, 0.003588726045563817, 0.0007808536174707115, 0.00087317219004035, 0.0007039439515210688, 0.003305366262793541, 0.000796632724814117, 0.0006423606537282467, 0.003314135828986764, 0.005491294898092747, 0.000757046916987747, 0.0066301277838647366, 0.0006294361082836986, 0.0005403339164331555, 0.0005577048868872225, 0.0006996265146881342, 0.0007765337941236794, 0.0008993803639896214, 0.0007767665665596724, 0.0006664948887191713 ]

[ "If there is an upside to the amount of persecution young conservatives suffer at the hands of puerile progressive thugs today, it is in the knowledge that they are in the long run being refined like silver. ", "When they emerge from the fire of harassment and persecution they will be among the world’s best prepared leaders — hardened against criticism, and ready to make tough calls when needed.", "\n\nOf course in the meantime, as ugly harassment, violence, and threats of violence are endured by the most intelligent and principled of our young people for their support of President Trump, the trouble takes a real toll.", "\n\nJayne Zirkle, a high school senior, is a vocal supporter of the president. ", "She told One America News that her political views have made it impossible for her to continue to attend her exclusive public high school in Washington, D.C.\n\n“I go to School Without Walls High School and I’m being bullied for being a Trump supporter. ", "The bullying and harassment has gotten so bad,” she said.", "\n\nShe indicated that she and her family met with top leaders of the District Of Columbia public school system.", "\n\n“When we met with the superintendent, we showed him all the harassment that I received online. ", "We filled him in on the history of harassment at the school, most of which was reported, especially when teachers were lowering my grades due to my political beliefs,” she said.", "\n\nZirkle said the superintendent was not sympathetic.", "\n\n“He responded with, ‘Well, this type of thing will blow over in a week or two.’ ", "And he just wasn’t very helpful because I mean obviously there is a very big safety threat. ", "But he just tried to act like it would be fine,” she said.", "\n\nBut as the result of the meeting, things went from bad to worse.", "\n\n“And while I was in this meeting,” said Zirkle, “actually, there were students who happened to be at the school who began taking my photo meeting with the principal and posting on social media saying that ‘she’s back in the school.'”", "\n\nShe said she pointed out in real time that those students were doxxing her for being there, taking her photo though the window.", "\n\nThe high school senior provided school officials with a 200-page packet of screen shots of hostile online comments she had received on account of her conservative views.", "\n\nAs it stands now, Zirkle is being permitted to finish her senior year by taking her classes online.", "\n\n“The school told us that some of the things these kids were saying were ‘arrestable’ but not actually ‘suspendable’,” she said. “", "D.C. is very, very lenient on these types of things. ", "It’s almost impossible to suspend a student.", "\n\nOAN reporter Neil McCabe said: “One America spoke to the top official at Zirkle’s high school, and we were told that officials at the school are not authorized to speak to the media about her situation. ", "Our inquiries were referred to Shane Wells who is the spokesman for the D.C. public schools, and Wells has not responded to OAN before deadline.”", "\n\nWatch the One America News segment below:\n\nVideo by OAN" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.04924381896853447, 0.000790960737504065, 0.004897862672805786, 0.0007444038055837154, 0.005457115359604359, 0.001958159962669015, 0.000541543762665242, 0.0032989538740366697, 0.0006739550735801458, 0.0006932723335921764, 0.0919034406542778, 0.0014153550146147609, 0.000648503890261054, 0.0009214494493789971, 0.0006709375884383917, 0.0009575092699378729, 0.0008867308497428894, 0.0010015926091000438, 0.0006651173462159932, 0.0005697588203474879, 0.01758778840303421, 0.0006320420070551336, 0.000568130926694721, 0.0006790700135752559 ]

[ "Declan Long\n\nDeclan Long is an Irish art critic and lecturer specialising in contemporary art made in ‘Post-Troubles’ Northern Ireland.", "\n\nCareer\n\nDeclan Long is programme director of the MA course 'Art in the Contemporary World' at the National College of Art & Design, Dublin, Ireland.", "\n\nHe frequently appears on Arena on RTÉ Radio 1, discussing and reviewing contemporary art. ", "His criticism is regularly published in Artforum, Frieze, and Source Photographic Review. ", "In 2013 Long was a member of the judging panel for the Turner Prize. ", "He is also a board member of the Douglas Hyde Gallery, Dublin.", "\n\nHe has written gallery texts for numerous exhibitions including: Willie Doherty (for Alexander & Bonin, New York and Matt’s Gallery, London, 2012), Isabel Nolan (The Model, Sligo, and Le Musée d'art Moderne de Saint-Etienne, 2011), Jesse Jones (Project Arts Centre, 2011), Mamma Andersson (Douglas Hyde Gallery, 2009), Ulla Von Brandenburg (Irish Museum of Modern Art, 2009), Lothar Hempel (Douglas Hyde Gallery, 2008), William McKeown (Irish Museum of Modern Art, 2008), Fergus Feehily (Neuer Aachener Kunstverein, 2008), Clodagh Emoe, Nina Canell, and Linda Quinlan (for the exhibition 'Come Together' at the Douglas Hyde Gallery, 2007). ", "\n\nHis recent book, Ghost-haunted Land: Contemporary Art and Post-troubles Northern Ireland, was described in The Irish Times as \"a foundational work of art criticism that will stand alongside Colin Graham’s study of photography and the North as a first point of reference for anyone interested in the Troubles and their cultural legacies.\"", "\n\nBibliography\nLong, Declan. ", "Anois. ", "Dublin: Temple Bar Gallery & Studios (2001). ", "\nLong, Declan. ", "Didymosphenia Geminata: Barrie Cooke. ", "Dublin: Kerlin Gallery (2007). ", "\nLong, Declan. ", "Passage. ", "Belfast: Golden Thread Gallery (2007). ", "\nLong, Declan, and Beatrix Ruf. ", "Ulla Von Brandenburg: Whose Beginning is Not, Nor End Cannot be. ", "Dublin: Irish Museum of Modern Art (2008). ", "\nJuncosa, Enrique; Lotz, Corinna; Long, Declan. ", "William McKeown. ", "Milan & Dublin: Charta/Irish Museum of Modern Art (2009). ", "\nLong, Declan. ", "Willie Doherty Photo/text/85/92. ", "London & New York: Matt's Gallery & Alexander and Bonin (2012). ", "\nMurray, Peter; Long, Declan. ", "Mark Clare, I Believe in You. ", "Cork: Crawford Art Gallery (2014). ", "\nPacker, Matt; Long, Declan; Ricks, Jim. ", "Here Comes The Summer. ", "Derry: Centre for Contemporary Art Derry~Londonderry (2017).", "\n Long, Declan. ", "Ghost-haunted Land: Contemporary Art and Post-troubles Northern Ireland. ", "Manchester: Manchester University (2017). ", "\n Long, Declan, Kelly Grovier, Rudi Fuchs, and Sean Scully. ", "Sean Scully: Landlines and Other Recent Works. ", "London: Cultureshock Media (2019).", "\n\nReferences\n\nCategory:Irish art critics\nCategory:Living people\nCategory:Academics of the National College of Art and Design\nCategory:Year of birth missing (living people)" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0009228077833540738, 0.000626358378212899, 0.0006409003399312496, 0.0006843865267001092, 0.0006656778859905899, 0.000678944808896631, 0.0006312669720500708, 0.0006032245000824332, 0.0008216358837671578, 0.0011584487510845065, 0.000632232113275677, 0.001011059619486332, 0.0008664006600156426, 0.0006500791059806943, 0.001011059619486332, 0.001076861284673214, 0.0006081509636715055, 0.001000541145913303, 0.0007981102680787444, 0.0006648777634836733, 0.0007058409391902387, 0.001654412946663797, 0.0006366233574226499, 0.001011059619486332, 0.0006557457381859422, 0.0006209742859937251, 0.0007617358933202922, 0.0007447816315107048, 0.0006394583033397794, 0.0010127611458301544, 0.001898225978948176, 0.0006774733774363995, 0.001011059619486332, 0.0008078484097495675, 0.0006566268857568502, 0.0007621641852892935, 0.0006238793139345944, 0.0006199878407642245, 0.0006109975511208177 ]

[ "Q:\n\nReact Native Multiline ReturnKeyType Bug\n\nI've made a TextInput where multiline={true} . ", "I wanted to stop the user from being able to enter a newline themselves, so I set returnKeyType={'done'}. ", "However, the returnKeyType prop seems to be nonfunctional when the multiline prop is true. ", "Is there a work around for this, or will I just have to wait until they patch this? ", "I'm using an android phone and am on react-native version 0.44.0.", "\n\nA:\n\ntry to set blurOnSubmit aside from returnKeyType={'done'} and multiline\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.001290791667997837, 0.0007644963334314525, 0.0007819388993084431, 0.0006655145552940667, 0.0006729435990564525, 0.0010582332033663988 ]

[ "Everything was a bit last minute when Dennis Praet completed his £18m transfer from Sampdoria to Leicester City last month. ", "The Belgium international did his homework on his new club on the Sampdoria team bus and when he turned up at Leicester to sign a week or so later it was without the tools of his trade.", "\n\n“It was a really close call because it was deadline day,” Praet says. “", "I arrived at the training ground but there were some small issues with the contract and I think it was only one hour before the deadline that everything was figured out, so I signed just in time. ", "But I arrived here with the thought that if I sign, I could go back to get my stuff I needed. ", "But the gaffer really wanted me to stay for the first game. ", "I had no boots, so I did two training sessions and the first game with somebody else’s. ", "I don’t even know whose they were.”", "\n\nPremier League: 10 things to look out for this weekend Read more\n\nPraet smiles as he looks back on that rather chaotic start. ", "At one stage Brendan Rodgers, Leicester’s manager, thought Praet was ignoring him. “", "He sent me a text message the day before I came but it was on my Belgium number that I didn’t have with me, so I saw it three days after I signed,” says Praet, shaking his head. “", "He thought I didn’t reply to him. ", "He said: ‘I sent you messages!’”", "\n\nOther lines of communication were already open at Leicester. ", "Youri Tielemans, who had joined from Monaco earlier in the summer, was a former teammate at Anderlecht as well as being part of the Belgium squad, and Praet was soon on the phone to his countryman once he had satisfied himself that Leicester’s style of play complemented his own.", "\n\n“When I heard about the interest from Leicester in me, it was important for me to see how they played because I didn’t know exactly. ", "At that moment I was on the coach with Sampdoria, we were driving to a friendly game and I watched the second half of Leicester v Atalanta,” says Praet, smiling at the thought.", "\n\n“I know Atalanta from Italy – they’re a really good team. ", "But I was really surprised by the way Leicester were playing – with a really high press, really nice football, a lot of chances. ", "At that moment I was sold. ", "Of course after that, when it was really getting serious, I spoke with Youri about: ‘How is the gaffer? ", "How is the training centre? ", "How are the players?’ ", "And he was so positive.”", "\n\nAlthough the intensity of the Premier League has taken Praet a little by surprise – his debut at Chelsea was more like a basketball match when he came off the bench – he has no doubt he has made the right move and also believes Leicester can achieve something special this season. “", "We must be a team that tries to get into that top six,” he says before Saturday’s fixture at Tottenham, “and I think we have the players to do it.”", "\n\nFacebook Twitter Pinterest Dennis Praet went to school 70km from home to be part of Genk’s academy. ", "Photograph: Plumb Images/Leicester City FC via Getty Images\n\nPart of a golden generation of Belgium players and gifted with a racket too (he was ranked the seventh-best tennis player in the country in his age-group at the age of nine), Praet has been linked with Premier League clubs since he was a schoolboy. ", "He was shown around Arsenal’s training ground as a 15-year-old by Liam Brady, when Praet was coming off the same conveyer belt in Genk that produced Kevin De Bruyne, Divock Origi and Thibaut Courtois.", "\n\n“I had three or four really good options,” Praet says. “", "We went to visit Arsenal, Lille, Ajax and Anderlecht. ", "Arsenal would have been a really nice step and I could earn a lot more money there than in Anderlecht, but at that moment my education was not finished and that was really important for me – there was no insurance that I would become a good football player.”", "\n\nPraet gave himself every chance of succeeding, though. ", "As a child, he would be picked up from his home in Leuven just after 7am, attend a secondary school in Genk, which was 70km away, and then train with the club’s academy across the afternoon and evening. “", "I would came back to Leuven at 10pm,” Praet says. “", "They were 14/15-hour days. ", "But I never thought: ‘This is heavy.’ ", "It was my goal to become a football player. ", "Of course, in Genk they always said: ‘Come to this guest family, it’s much easier.’ ", "But I’m also a family man and I like being at home.”", "\n\nGenk’s loss was always going to be Anderlecht’s gain. ", "Praet broke into the first-team as a 17-year-old and racked up more than 100 appearances by the time he made his Belgium debut at the age of 20. ", "Scoring and creating goals freely, he was named Belgium’s player of the year in 2014 and it was inevitable he would move on sooner or later.", "\n\nFacebook Twitter Pinterest Dennis Praet was in Genoa when the Morandi Bridge collapsed. ‘", "I was just watching it with a dry throat,’ he says. ", "Photograph: Fabio De Paola/The Guardian\n\nIn the end he joined Sampdoria and it is clear that the club, the city of Genoa and Italian football in general left a big impression on him during his three years there. ", "Praet talks about being “a more complete player than I was before” and explains how he has evolved from a No 10 into “a modern No 8 that can be creative in attack but also do the dirty work in defensive ways”.", "\n\nIt was, Praet says, a totally different way of training as well as playing. “", "In Italy, the tactics is what it’s all about. ", "To give an example – and I really thought this was funny – we came into the TV room to watch videos almost every day, and when we played in training against the under-20 team [as preparation for an upcoming match], they also had to come into the video room to show them how the opposition team was pressing; that’s how far it goes. ", "They were in there for half an hour: ‘This guy presses like this, now this guy presses like this,’ and then they did it on the training ground too.”", "\n\nWhile Praet, 25, has many happy memories from his spell with Sampdoria, his time in Genoa was marked by tragedy too. ", "On 14 August last year, a 200-metre section of the landmark Morandi Bridge collapsed, killing 43 people. ", "Praet and his Sampdoria teammates, together with the Genoa players, attended a state funeral for the victims as the city’s football teams united.", "\n\nThe Fiver: sign up and get our daily football email.", "\n\n“It was a really, really sad day,” Praet says. “", "I remember our team manager saying in the WhatsApp group for the team: ‘The Morandi Bridge collapsed. ", "Is everybody OK?’ ", "I was thinking: ‘Hell, what is he saying?’ ", "Then I put on the TV – I was at home at the time – and then you see all those images. ", "I was just watching it with a dry throat. ", "It was unbelievable.”", "\n\nIt is another reason why Sampdoria and the city of Genoa will always have a “special place” in Praet’s heart. ", "Returning to say farewell to his former teammates after signing for Leicester was something that Praet, who comes across as such a likable character, simply had to do. ", "And, of course, he needed to pick up those boots." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006326995207928121, 0.0006195560563355684, 0.0007114554173313081, 0.0005218717851676047, 0.0013887678505852818, 0.0007809633971191943, 0.0007388159865513444, 0.0010621970286592841, 0.0005773167358711362, 0.0007905933889560401, 0.005665396340191364, 0.0011554055381566286, 0.0014751849230378866, 0.0005731316632591188, 0.0007609413587488234, 0.0005507845780812204, 0.0006116786389611661, 0.0006138500175438821, 0.0005761727807112038, 0.0007079701172187924, 0.0006578573957085609, 0.0006294762715697289, 0.0008541441638953984, 0.0006462421151809394, 0.0006281805108301342, 0.0007177906227298081, 0.009673742577433586, 0.0007621968979947269, 0.0010002932976931334, 0.0006844204617664218, 0.0005903969286009669, 0.0006480226875282824, 0.0011479973327368498, 0.001023954595439136, 0.0009090594248846173, 0.0013498758198693395, 0.0006972209666855633, 0.00111209019087255, 0.0006928340881131589, 0.0008956255041994154, 0.0034417735878378153, 0.0011849439470097423, 0.0006309376331046224, 0.002506824443116784, 0.0006491563399322331, 0.0005705744842998683, 0.001296540256589651, 0.0006952761905267835, 0.0006502167088910937, 0.0006016131374053657, 0.0006882176385261118, 0.0007040338241495192, 0.00152286805678159, 0.0009039397118613124, 0.0008642186294309795, 0.0008920374675653875, 0.0007057572365738451, 0.0008124649175442755, 0.1886775642633438, 0.001050990424118936, 0.0006481860182248056, 0.0006836261600255966, 0.0007184712449088693, 0.0005962827708572149, 0.0025896169245243073 ]

[ "Hispanic Magazine takes on teen pregnancy, plays the blame game\n\nIn the latest issue of Hispanic Magazine, journalist Betty Cortina dedicates an article to the “disturbing” rates of Latina teen pregnancy in the US entitled “A Growing Problem.” ", "Although I applaud her for bringing this issue to the forefront of Hispanic Magazine’s readers, I can’t help but think her information was a little one-sided.", "\n\nAt the beginning of the article, Cortina ridicules her own family for being happy for her pregnant 15 year old cousin. ", "She blames our culture for looking at an unwanted pregnancy as a blessing. ", "Next, she goes on to cite a Texas school district as having one of the “most successful teen pregnancy programs” in the country. ", "She believes that letting the young mothers stay in their original schools serves two purposes; one being that it allows them to finish school and graduate, and two it acts as a deterrent for the rest of the girls in the school.", "\n\nAlthough I believe in programs that offer services like child care and transportation to help teen moms finish school, I don’t believe that the “scare tactic” is the best approach to reducing teen pregnancy. ", "I was very disappointed to see that Cortina did not choose to highlight a school with a sexual and reproductive health education program instead.", "\n\nThe author continues by highlighting the Mary’s Center executive director, Maria Gomez. ", "The Mary’s Center is known for providing essential reproductive health services to teen parents, but also many social services to thousands of undocumented immigrants in the Maryland area. ", "Agreeing with Gomez, Cortina concludes by saying that the best solution to reducing teen pregnancy in our communities is to have more role models. ", "She says that as successful Latinas, we “forget” that we have a responsibility to mentor those left behind.", "\n\nOf course she doesn’t mention social conditions, the impact of economics, or even our political conditions. ", "Once again, it’s our own fault. ", "I’ve seen the work that organizations such as NLIRH and other reproductive justice organizations do on a day-to-day basis. ", "To say that we have forgotten about our communities is completely false and misses the broader point: changing our community isn’t just about individual responsibility, it’s also about the broader society and how it impacts us." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0008943987195380032, 0.000623708066996187, 0.0026328079402446747, 0.0018435189267620444, 0.0006287213764153421, 0.004099399782717228, 0.0011411112500354648, 0.0029877081979066133, 0.0005692490958608687, 0.0011449716985225677, 0.0005597827257588506, 0.0008460507960990071, 0.0006265932461246848, 0.011152218095958233, 0.0007642111741006374, 0.0006205615936778486 ]

[ "1. ", "Field of the Invention\nThis invention relates to a process for preparing ammonium tungstate. ", "More particularly, the invention concerns a process for preparing ammonium tungstate from calcium tungstate ores or concentrates that have been subjected to a reduction step.", "\n2. ", "Prior Art\nVarious tungsten compositions are known in the art. ", "Calcium forms a tungstate mineral known as scheelite (CaWO.sub.4). ", "Calcium also forms a tricalcium tungstate of the formula Ca.sub.3 WO.sub.6. ", "Iron and manganese form a range of tungstate minerals varying in composition between FeWO.sub.4 and MnWO.sub.4. ", "These minerals are generally referred to as ferberite, wolframite and huebnerite, depending on the composition of the mineral. ", "Generally, ferberite is used to describe such a mineral containing more than 20% by weight of FeO and huebnerite, when the mineral contains more than 20% by weight of MnO. The intermediate compositions are referred to as wolframite, although this term is often used for the whole range of compositions; such use may be made hereinafter. ", "These various minerals and tungsten compositions are important sources of tungsten trioxide and metallic tungsten.", "\nIn conventional processes for recovering tungsten values from scheelite or from wolframite ores, the ores are usually concentrated by gravity, magnetic and/or flotation techniques. ", "The concentrates, so formed, are then processed further. ", "For example, water soluble sodium tungstate can be obtained by fusing a concentrate with sodium carbonate or by contacting a concentrate with hot sodium hydroxide solution. ", "Acidification of the aqueous sodium tungstate solution yields insoluble tungstic acid. ", "Alternatively, tungstic acid can be obtained from the concentrate by leaching the concentrate with a strong acid, such as concentrated hydrochloric acid. ", "The tungstic acid can then be dissolved in a base and processed further to recover other tungsten values.", "\nFrequently ammonium tungstate is formed in known processes as an intermediate, which is then isolated, dried and heated to form tungsten trioxide. ", "The ammonium tungstate is believed to be the paratungstate salt, which may be defined as having the formula x(NH.sub.4).sub.2 O.yWO.sub.3.zH.sub.2 O with, for example, x=3 and y=7 or x=5 and y=12, the value of z depending on the conditions of crystallization of the salt. ", "This intermediate can be formed by dissolving tungstic acid in ammonium hydroxide, and subsequently can be converted to tungsten trioxide, tungsten and other useful tungsten compounds by techniques such as those described in K. C. Li and C. Y. Wang, \"Tungsten,\" American Chemical Society Monograph 130, Reinhold Publishing Corporation, New York (1955), especially Chapter IV.", "\nEach of the above-described processes is useful for extracting tungsten values from various tungsten compositions. ", "However, lower levels of impurities in products produced with good yields are technically and economically desirable. ", "For example, ammonium tungstate manufactured by known processes is susceptible to contamination by impurities. ", "The concentration of such impurities depends at least in part on the actual process conditions employed in the manufacture of the ammonium tungstate and on the composition of the tungsten ore." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0009391900966875255, 0.0005628479993902147, 0.0005717939930036664, 0.001185585861094296, 0.0005953469080850482, 0.0008095541852526367, 0.0016802792670205235, 0.0006788839818909764, 0.0006025321781635284, 0.0006458883290179074, 0.0006266183918341994, 0.0005712250131182373, 0.0005952504579909146, 0.0006244941032491624, 0.001835127710364759, 0.0010405706707388163, 0.000730375584680587, 0.0006079762242734432, 0.0007588663138449192, 0.0006974757998250425, 0.0005650589009746909, 0.0006220695213414729, 0.0006562165217474103, 0.0006443969905376434 ]

[ "Apple Sues Clone-Maker Psystar\n\n0\n\nZDNet broke the story this morning that Apple has filed suit against Mac clone maker Psystar. ", "The Florida-based manufacturer of PC’s is famous for its ‘OpenMac’ line of Mac clones, which were released earlier this year. ", "The devices are standard PC hardware running a hacked copy of Mac OS X – so the legality of their sale was always questionable. ", "Regardless, Psystar have been selling the machines at a fraction of the price of Apple branded hardware.", "\n\nPsystar were earlier forced to change the name of the OpenMac product to “Open Computer” – which is available in two models. ", "Apple filed a suit this morning in the federal district court for Northern California, in San Francisco. ", "The suit claims that Apple is a big great company with a big brand to protect and lots of IP (not to mention lots of money), while Psystar is a shitty little hardware manufacturer from Florida, therefor Apple win by default. ", "The result will likely be that Apple will win, because they have already proven to the court on numerous ocassions in the past the value of their brand and IP.", "\n\nThe core of what Psystar is doing ‘wrong’ is that they have detached Apple software from Apple hardware, thus the experience is no longer ‘uniform’. ", "The claims for the case can also fall under the anti-circumvention clauses of the DMCA – the same draconian laws used to prosecute mod-chip enthusiasts and those who dare to watch a DVD on Linux or BSD. ", "Apple can claim that by running OS X on non-Apple hardware, that the manufacturer circumvented their protection controls.", "\n\nApple will crush Psystar – no doubt about it, their intentions are clear now. ", "The question is wether what Psystar are doing should be considered right or wrong – considering that they aren’t stealing Apple software and are probably reaping a new market of OS X users who would otherwise have not purchased Apple hardware. ", "Outside the business decision – the fact is that the laws in the USA (especially since the DMCA) are firmly on the side of the larger party." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0031675701029598713, 0.0007785914931446314, 0.0007148838485591114, 0.0006424917373806238, 0.0007165662245824933, 0.0007151070167310536, 0.08131929486989975, 0.000677337811794132, 0.0006877508712932467, 0.001701276982203126, 0.0007433004793711007, 0.042213693261146545, 0.0018911391962319613, 0.0006224624812602997 ]

[ "Dan Horrigan\n\nDan Horrigan (born 1963) is an American politician and educator, currently serving as the 62nd mayor of Akron, Ohio, having been elected on November 3, 2015, following eight years as the Clerk of Summit County's Common Pleas Courts.", "\n\nEarly life and education\nShortly after earning his Bachelor of Arts in Economics from Kent State University, Horrigan returned to school to earn an additional degree in Education from the University of Akron. ", "Horrigan then taught social studies at St. Vincent–St. Mary High School from 1996 to 1998. ", "\n\nIn 1999, Horrigan left his position with the school to successfully run for Akron City Council. ", "Horrigan represented Akron's Ward 1, including Highland Square and North Hill, from 1999 to 2007. ", "In his time as Ward 1 Council representative, he chaired the Public Utilities Committee and was a senior member of the Planning Budget & Finance and Parks & Recreation Committees. ", " In 2001, Horrigan brought together business leaders and residents to develop a comprehensive plan for the Highland Square neighborhood. ", "The plan's vision led to a new library, new school, and new grocery store.", "\n\nSummit County Clerk of Courts\nIn 2007, the Democratic Party of Summit County selected Horrigan as the Clerk of Summit County's Common Pleas Courts, where he oversaw an office of 87 public employees.", "\n\nAkron Mayoral Election\nHorrigan announced his candidacy for Mayor on June 9, 2015. ", "In addition to economic revival, his campaign focused on a number of local issues such as finding affordable solutions to the city's sewage system issues, union contracts, downtown development, and increased citizen engagement. ", "Following his victory on November 3, 2015, Horrigan became Akron's first newly-elected Mayor in 28 years.", "\n\nPrimary Election Results\n\nGeneral Election Results\n\nFirst Mayoral Term\n\nBlue Ribbon Task Force \nFollowing his election, Horrigan appointed a \"Blue Ribbon Task Force\" composed of local business and community leaders, to \"look under the hood\" of City government and make recommendations for its management.", "\n\nEarly Initiatives & Policies \nDuring Mayor Horrigan's first year in office, he led a variety of successful initiatives including: rebuilding relationships with the United States EPA; and working closely with Huntington Bank as it acquired FirstMerit Corporation. ", "Mayor Horrigan also followed through on a recommendation to appoint the City of Akron's first ever Human Resources Director, which required an amendment to the City's charter.", "\n\nOther successes for Mayor Horrigan during his first year in office included: hosting six town hall meetings within the community and meeting with every high school senior class within the Akron Public Schools, implementing cost-saving reform of retiree supplemental health benefits, securing approval of First Consent Decree Amendment resulting in $56.7 million in CSO savings; securing nationally competitive $5 million TIGER grant to redevelop Main Street and leading successful effort to bring Stark State Community College campus to Akron.", "\n\nAdditionally, Horrigan was recognized by Cleveland Magazine's Community Leader Power 100 – List of most influential leaders in Northeast Ohio. ", "He joined the coalition of Mayors across the U.S. in the Mayors Against Illegal Guns. ", " In order to further his goal of improving the health of the community, Mayor Horrigan he partnered with Akron Children's Hospital-Akron Marathon Race Series, County of Summit and Summit County Public Health to launch a citywide 100 Million Steps Walking Challenge.", "\n\nAkron Mayoral Re-election 2019\n\nPrimary Results\n\nThis was the first May primary in Akron in 70 years due to a voter-approved change in primary dates. ", "The leadership of Akron City Council and Mayor Horrigan touted this change as a way to save money and increase voter turnout. ", "No money was saved and 5000 less voters turned out compared to the 2015 primary results.", "\n\nReferences\n\nCategory:Living people\nCategory:Mayors of Akron, Ohio\nCategory:Ohio Democrats\nCategory:1963 births\nCategory:21st-century American politicians\nCategory:Kent State University alumni\nCategory:University of Akron alumni" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0009917349088937044, 0.0007095811306498945, 0.0007975529879331589, 0.000916612334549427, 0.0006758263916708529, 0.0005895958747714758, 0.0005769655108451843, 0.0006702380487695336, 0.0006848595221526921, 0.000644950894638896, 0.0005416991771198809, 0.0007962514064274728, 0.0005576658295467496, 0.0005794893368147314, 0.0005999842542223632, 0.0006491242093034089, 0.0006371323252096772, 0.0010879619512706995, 0.0006349313189275563, 0.0006168419495224953, 0.0005920270923525095, 0.0009613650036044419, 0.0006358380778692663 ]

[ "My site on philosophy, theology, apologetics, and whatever else I feel like writing about.", "\n\nbible\n\nYouTube atheist JaclynGlenn has just recently released a video of her commenting on the recent shooting of a gay club in Orlando by Omar Mateen, as well as the responses given by a couple of pastors who were actually praising such an event.1 Now, in this video it’s clear that she’s really down and upset about everything that’s happened, and it’s also clear that she’s not trying to spread any more hate. ", "Because of that, I’m going to give her a bit of a break. ", "However, there are two points that JaclynGlenn makes that I would like to comment on.2\n\nI know this is my first post in about a month. ", "The reasons why are mainly because of both the holidays and that I received a lot of Christian apologetics for Christmas that I’m still trying to read. ", "And because I have so much to read (not to mention a number of questions that I need answers to), don’t be surprised if I publish my posts non-consistently.", "\n\nAnyway, I came across this blog called “Why there is no god,” and it featured an article that really caught my attention. ", "The article was called “Responses to common theist arguments.”" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005968487821519375, 0.012045832350850105, 0.0013501915382221341, 0.0006021061562933028, 0.0005925879813730717, 0.00060333835426718, 0.0007515254546888173, 0.0006675087497569621 ]

[ "Multiple myeloma in Mexico: a 20-year experience at a single institution.", "\nIn a 20-year period at a single institution, 66 cases of multiple myeloma (MM) were identified. ", "The disease was less frequent in Mexico because in a multicenter study it represented 4.2% of all hematologic malignancies, whereas during this experience it was found to represent 7.7%. ", "These figures contrast with those reported in Caucasians-10-15%. ", "There were two patients <40 years of age; median age was 66 years. ", "Bone pain was present in 54%, fatigue in 66%, and weight loss in 47%. ", "Anemia was present in 75% of females and in 96% of males at diagnosis; median hemoglobin was 10.2 g/dL; abnormal monoclonal spike had a median of 2.87 g/dL (range 0-9.9). ", "Four cases (6%) of nonsecretory myelomas were identified. ", "Bence Jones proteinuria was present in 51 cases (77%). ", "Forty six individuals were followed for >3 months (97-7,054 days, median 2,371 days). ", "Their survival (SV) was 51% at 540 days. ", "Patients treated with melphalan/prednisone had a median SV of 33 months with a 72-month SV of 30%. ", "Patients treated with vincristine/adriamycin/dexamethasone had an SV of 40% at 42 months, whereas those given high-dose chemotherapy and autologous stem cell rescue had an SV of 80% at 22 months. ", "Clinical features of Mexican patients with MM were not significantly different from those reported for other populations; best results from treatment were observed in patients administered autologous stem cell transplantation." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006836232496425509, 0.0007272983202710748, 0.0006780253606848419, 0.000667679647449404, 0.000615208235103637, 0.0017492856131866574, 0.000883274304214865, 0.006681524682790041, 0.0006173953879624605, 0.0005911204498261213, 0.0006494756671600044, 0.0007548460271209478, 0.000732289394363761, 0.0005855460767634213 ]

[ "1. ", "Field of the Invention\nThe present invention relates to a photomask used in a photolithography process which is one of the manufacturing processes of a semiconductor device.", "\n2. ", "Description of the Background Art\nA lithography technique is usually used for forming a circuit pattern to be provided on a semiconductor device. ", "This technique fundamentally consists of a coating step for coating a substrate such as wafer with photoresist to form a photoresist layer, an exposure step for impinging light (for example, light in an ultraviolet region) from a suitable light source upon a photomask having a predetermined pattern to transfer the pattern to the photoresist layer and a development step for developing the photoresist layer to obtain a photoresist layer having the predetermined pattern.", "\nFIG. ", "1 is a perspective view of a conventional photomask 70 used in the exposure step. ", "In FIG. ", "1, numeral 71 represents a glass substrate, on which a shield layer 72 of chromium is formed. ", "The shield layer 72 is provided with two adjacent rectagular light-transmission patterns 73 and 74 formed by rectangular openings in parallel. ", "In addition, the term \"rectangular\" means a shape including a square and a oblong.", "\nFIG. ", "2 is a schematic structural view of an exposure device. ", "As shown in FIG. ", "2, the exposure device is provided with a light source 81 for emitting light in an ultraviolet region downwardly. ", "The light from the light source 81 is directed through a lens 82 to the photomask 70. ", "Some of the incident light passes through the rectangular light-transmission patterns 73 and 74, further to be introduced through a lens 83 onto a photoresist surface 84. ", "On the other hand, the light impinging upon the shield layer 72 is shielded by the shield layer 72. ", "Thus, exposure patterns corresponding to the rectangular light-transmission patterns 73 and 74 are transferred to the photoresist surface 84.", "\nAs in FIG. ", "1, the rectangular light-transmission patterns 73 and 74 are adjacent to each other; More particularly, one rectangular light-transmission pattern 74 (or 73) is disposed on the normal lines N.sub.3 (or N.sub.4) of the other rectangular light-transmission pattern 73 (or 74). ", "When the exposure process is carried out with the photomask 70, diffraction light from the rectangular light-transmission pattern 73 (or 74) exerts adverse effect on the form of the transferred pattern which is formed by focusing diffraction light from the rectangular light-transmission pattern 74 (or 73) on the photoresist surface 84; in brief, the patterns transferred on the photoresist surface 84 are deformed by the diffraction light. ", "The closer the rectangular light-transmission patterns 73 and 74 are in proximity to each other, the larger the deformation grows. ", "The deformation causes the deterioration of transfer accuracy of the pattern to the photoresist surface 84. ", "In particular, in these days of advancing high integration, the rectangular light-transmission patterns 73 and 74 are disposed in further closer proximity to each other. ", "Accordingly, the influence of the diffraction light is a serious problem." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0009391900966875255, 0.000591883494053036, 0.001185585861094296, 0.0005871152970939875, 0.0006069688242860138, 0.0008292015991173685, 0.0005870168679393828, 0.0006813188083469868, 0.0006478296709246933, 0.000577156082727015, 0.0006283727707341313, 0.0008292015991173685, 0.00065807462669909, 0.0006297628278844059, 0.0006231317529454827, 0.0005707037053070962, 0.0005674263229593635, 0.000645362539216876, 0.0006038491846993566, 0.0007343979086726904, 0.0006135555449873209, 0.0006253583123907447, 0.0005552523070946336, 0.0005890835891477764, 0.0005696282023563981, 0.0007213128847070038 ]

[ "his two buddies , sean and tim never have trouble in that department , and they set out to help in their own way . ", "\n" ]

{ "pile_set_name": "Github" }

[ 0.0008036826038733125, 0.001995444530621171 ]

[ "BERLIN. ", "Die Grünen haben ihren Untersuchungsbericht zu den Pädophilie-Verstrickungen in den achtziger Jahren veröffentlicht. „", "Zu den bittersten Erkenntnissen der Aufarbeitung gehört, daß es unter den pädophilen Aktivisten auch Täter mit grünem Parteibuch gab“, zitiert der Berliner Tagesspiegel aus dem nun fertiggestellten Bericht einer Arbeitsgruppe.", "\n\nDiese hatte unter der Leitung von Parteichefin Simone Peter mehr als zwei Jahre lang untersucht, wie es während der Anfangsjahre der Grünen dazu kommen konnte, daß sich die Partei für Pädophilie eingesetzt hatte. ", "Es handele sich um „ein bedrückendes Kapitel“ der Parteigeschichte und sei „viel zu lange ausgeblendet worden“.", "\n\nZwölf Mißbrauchsopfer\n\nDie Pädophilie-Debatte samt Verstrickung der Grünen hatte wenige Monate vor der Bundestagswahl 2013 begonnen. ", "Nach der Wahl setzte die Partei eine Arbeitsgruppe ein. ", "Der Bundesvorstand richtete für Betroffene eine telefonische Anlaufstelle, einen E-Mail-Kontakt und einen Anhörungsbeirat ein. ", "Zusätzlich untersuchte der Göttinger Forscher Franz Walter die Fälle.", "\n\nBislang hätten sich zwölf Mißbrauchsopfer gemeldet. ", "In drei der Fälle hätten die Betroffenen laut Tagesspiegel in Anerkennung des erfahrenen Leids eine Zahlung erhalten, da eine „institutionelle Mitverantwortung“ der Grünen nicht auszuschließen sei. ", "Ein weiterer Fall werde derzeit vom Anhörungsbeirat beraten. ", "In zwei weiteren Fällen habe der Sachverhalt nicht weiter geprüft werden können, in sechs Fällen sei kein direkter Zusammenhang zur Partei ersichtlich gewesen. (", "ls)" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0007819973398000002, 0.05869841203093529, 0.02740822546184063, 0.28515273332595825, 0.09805696457624435, 0.15797752141952515, 0.033433157950639725, 0.003782337298616767, 0.03150423243641853, 0.35793715715408325, 0.03742191195487976, 0.1569131761789322, 0.012858552858233452, 0.0007901946664787829 ]

[ "This item has been removed from the community because it violates Steam Community & Content Guidelines. ", "It is only visible to you. ", "If you believe your item has been removed by mistake, please contact Steam Support\n\nThis item is incompatible with Z1 Battle Royale. ", "Please see the instructions page for reasons why this item might not work within Z1 Battle Royale.", "\n\nCurrent visibility: Hidden This item will only be visible to you, admins, and anyone marked as a creator.", "\n\nCurrent visibility: Friends-only This item will only be visible in searches to you, your friends, and admins.", "\n\nCaption is it a bird? ", "is it a plane? ", "Save Cancel\n\nCreated by BeanerBoy\n\nOnline File Size Posted Size 0.316 MB 18 Nov, 2017 @ 10:23am 1600 x 1080 193 Unique Visitors 0 Current Favorites" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006463230820372701, 0.0006940560415387154, 0.0007166174473240972, 0.0005831450689584017, 0.0007358539733104408, 0.0007080359500832856, 0.0008848065626807511, 0.0008774360176175833, 0.0012340135872364044 ]

[ "Q:\n\nIs Macro Better Than UIColor for Setting RGB Color?", "\n\nI have this macro in my header file:\n#define UIColorFromRGB(rgbValue) \\\n [UIColor colorWithRed:((float)((rgbValue & 0xFF0000) >> 16))/255.0 \\\n green:((float)((rgbValue & 0xFF00) >> 8))/255.0 \\\n blue:((float)(rgbValue & 0xFF))/255.0 \\\n alpha:1.0]\nAnd I am using this as something like this in my .m file:\ncell.textColor = UIColorFromRGB(0x663333);\nSo I want to ask everyone is this better or should I use this approach:\ncell.textColor = [UIColor colorWithRed:66/255.0\n green:33/255.0\n blue:33/255.0\n alpha:1.0];\nWhich one is the better approach?", "\n\nA:\n\nor create a separate category, so you only need to import one .h file:\n@interface UIColor (util)\n+ (UIColor *) colorWithHexString:(NSString *)hex;\n+ (UIColor *) colorWithHexValue: (NSInteger) hex;\n@end\n\nand\n#import \"UIColor-util.h\"\n\n@implementation UIColor (util)\n\n// Create a color using a string with a webcolor\n// ex. [", "UIColor colorWithHexString:@\"#03047F\"]\n+ (UIColor *) colorWithHexString:(NSString *)hexstr {\n NSScanner *scanner;\n unsigned int rgbval;\n\n scanner = [NSScanner scannerWithString: hexstr];\n [scanner setCharactersToBeSkipped:[NSCharacterSet characterSetWithCharactersInString:@\"#\"]];\n [scanner scanHexInt: &rgbval];\n\n return [UIColor colorWithHexValue: rgbval];\n}\n\n// Create a color using a hex RGB value\n// ex. [", "UIColor colorWithHexValue: 0x03047F]\n+ (UIColor *) colorWithHexValue: (NSInteger) rgbValue {\n return [UIColor colorWithRed:((float)((rgbValue & 0xFF0000) >> 16))/255.0\n green:((float)((rgbValue & 0xFF00) >> 8))/255.0\n blue:((float)(rgbValue & 0xFF))/255.0\n alpha:1.0];\n\n}\n\n@end\n\nA:\n\nHow about creating your own:\n#define RGB(r, g, b) \\\n [UIColor colorWithRed:(r)/255.0 green:(g)/255.0 blue:(b)/255.0 alpha:1]\n#define RGBA(r, g, b, a) \\\n [UIColor colorWithRed:(r)/255.0 green:(g)/255.0 blue:(b)/255.0 alpha:(a)]\n\nThen use it:\ncell.textColor = RGB(0x66, 0x33, 0x33);\n\nSeems simple enough to use, uses hex values for colors and without needing additional calculation overhead.", "\n\nA:\n\nA middle ground might be your best option. ", "You could define either a regular C or objective-C function to do what your macro is doing now:\n// As a C function:\nUIColor* UIColorFromRGB(NSInteger rgbValue) {\n return [UIColor colorWithRed:((float)((rgbValue & 0xFF0000) >> 16))/255.0\n green:((float)((rgbValue & 0xFF00) >> 8))/255.0\n blue:((float)(rgbValue & 0xFF))/255.0\n alpha:1.0];\n}\n\n// As an Objective-C function:\n- (UIColor *)UIColorFromRGB:(NSInteger)rgbValue {\nreturn [UIColor colorWithRed:((float)((rgbValue & 0xFF0000) >> 16))/255.0\n green:((float)((rgbValue & 0xFF00) >> 8))/255.0\n blue:((float)(rgbValue & 0xFF))/255.0\n alpha:1.0];\n}\nIf you decide to stick with the macro, though, you should put parentheses around rgbValue wherever it appears. ", "If I decide to call your macro with:\nUIColorFromRGB(0xFF0000 + 0x00CC00 + 0x000099);\nyou may run into trouble.", "\nThe last bit of code is certainly the most readable, but probably the least portable - you can't call it simply from anywhere in your program.", "\nAll in all, I'd suggest refactoring your macro into a function and leaving it at that.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.000816255749668926, 0.0006747475126758218, 0.0006894728867337108, 0.0008619578438811004, 0.0008182052406482399, 0.0005987041513435543, 0.0009081712923943996, 0.03360816836357117, 0.0006358908140100539, 0.0012539057061076164, 0.001995444530621171 ]

[ "Q:\n\ntinyMCE SetContent() causes undo step\n\nAfter I SetContent() on the tinyMCE plugin (Version 3), in the event that a user changes something small like the formatting of a piece of that text block for example, the next undo step will clear the entire text block instead of just clearing the formatting change.", "\nHas anyone experienced this before?", "\nIs there a call I can make after the SetContent() to make sure the next undo step only includes the formatting change and not the entire block of text?", "\nI've attempted calling UndoManager.clear() after the set but that didn't seem to change the behavior.", "\nAny help is greatly appreciated.", "\n\nA:\n\nI use \ntinyMCE.getInstanceById(\"editorTexto\").setContent(obj.texto);\n tinyMCE.getInstanceById(\"editorTexto\").undoManager.clear();\nIt works in version 3.5.4\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0009292330942116678, 0.0007117005297914147, 0.0007517944322898984, 0.0008562089642509818, 0.0005347580881789327, 0.0009912928799167275 ]

[ "WESTMINSTER – A 33-year-old man is in critical condition Monday after being shot in the head by a jewelry store owner during a robbery attempt at the Asian Garden Mall, officials said.", "\n\nA second man was arrested and police are seeking a third man who escaped in a late-model Honda Accord, said Sgt. ", "Cameron Knauerhaze of the Westminster Police Department. ", "The wounded suspect, whom police have identified as Harold Eugene Walker of Gardena, was taken to UC Irvine Medical Center in Orange.", "\n\nThe second suspect, identified as Earnie Jerome Robinson, 57, of Gardena, was taken to Fountain Valley Regional Hospital because of a pre-existing medical condition, officials said.", "\n\nThe shooting was reported about 1:15 p.m. in the 9200 block of Bolsa Avenue near Moran Street, police said.", "\n\nTwo suspects entered Tick Tock Watches jewelry store, one using a wheelchair that later turned out to be a ruse, Knauerhaze said. ", "The pair ordered the customers onto the ground, as one wielded a gun and the other a sledgehammer, he said.", "\n\nHearing the noise from the back of the store, a shop owner armed himself with his own gun and confronted the man with the gun, warning him to drop the weapon, Knauerhaze said.", "\n\nWhen the man did not comply, the shop owner fired once, striking him in the head, Knauerhaze said. ", "The two men fled on foot. ", "Officers apprehended Walker as he tried to climb a wall in the parking lot, while a witness and a security guard apprehended Robinson, police said.", "\n\n“This is an isolated incident that occurred in just one of the jewelry stores,” Knauerhaze said, who added that nothing was stolen from the store.", "\n\nAnyone with information should call the Westminster Police Department at 714-898-3315.", "\n\nContact the writers\n\nContact the writer: desalazar@ocregister.com or ljow.ocr@gmail.com" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.004380088299512863, 0.0008747785468585789, 0.0006991559057496488, 0.0006956178112886846, 0.0007033776491880417, 0.0009621726931072772, 0.0014567530015483499, 0.0032593451905995607, 0.002886286936700344, 0.031742386519908905, 0.004224751610308886, 0.0008624647743999958, 0.000658650416880846, 0.0006009609787724912, 0.0008474179776385427 ]

[ "INTRODUCTION\n============\n\nOsteoporosis is an aging-related major health problem in the United States. ", "There are two major known causes of osteoporosis: low peak bone mineral density (BMD), typically achieved around the age of 30, and a high rate of bone loss that occurs particularly after menopause and during the natural process of aging. ", "Bone loss occurs with age in part because the rate of bone resorption surpasses the rate of bone formation. ", "Effective inhibitors of bone resorption such as bisphosphonates have widely been used in the clinic to treat high-turnover bone diseases. ", "However, treatment with bisphosphonates results in suppression of both bone resorption and bone formation and blunts the anabolic actions of PTH \\[[@r1]\\]. ", "Because bisphosphonates are incorporated within the bone matrix with high affinity, long term treatment with these drugs may impair fracture healing, cause jaw osteonecrosis, and increase the risk for atypical fractures of the femur \\[[@r2]--[@r7]\\]. ", "Although a cathepsin K inhibitor had shown promise in large animal and human clinical studies, treatment with the cathepsin K inhibitor caused off-target effects and increased the risk of stroke \\[[@r8]\\]. ", "Treatment of postmenopausal women with an anti-RANKL (receptor activator of nuclear factor-κB ligand) monoclonal antibody (denosumab) was effective, however the bone turnover rebounds after 2 years' discontinuation of denosumab \\[[@r9]\\]. ", "Therefore, novel anti-resorptive molecules that avoid anti-anabolic actions are needed as therapeutics to increase bone mass and reduce fracture risk.", "\n\nLeucine rich repeat kinase 1 (LRRK1) belongs to the ROCO protein family and contains four ankyrin repeats (ANK), seven leucine-rich repeats, a GTPase-like domain of ras of complex proteins (Roc), a C-terminal of Roc domain (COR), and a serine/threonine kinase domain that is regulated by GTP binding to the Roc domain \\[[@r10]\\]. ", "A point mutation within the Roc domain that abolishes GTP/GDP binding resulted in inaction of LRRK1 kinase *in vitro* \\[[@r11], [@r12]\\]. ", "In our previous studies, we have demonstrated that mice with disruption of the *Lrrk1* gene displayed severe vertebral and long bone osteopetrosis resulting from the dysfunction of mature osteoclasts (OCs). ", "OCs lacking LRRK1 failed to form peripheral sealing zones on bone slices due to defects in RANKL-induced cytoskeletal rearrangement. ", "In contrast to bisphosphonate-treated monocytes, precursors derived from *Lrrk1* KO mice differentiate normally into mature OCs, and these OCs fail to resorb bone because of reduced OC activity. ", "While bone resorption in KO mice is reduced dramatically, bone formation is not significantly affected \\[[@r1]\\]. *", "Lrrk1* KO mice have normal teeth, are healthy through one year of age, and respond to anabolic PTH treatment, but they are resistant to ovariectomy-induced bone loss \\[[@r1]\\]. ", "More recently, an autosomal recessive mutation of *Lrrk1* has been identified in a human patient \\[[@r13]\\]. ", "A partial DNA deletion in the *Lrrk1* gene caused a frame-shift mutation, resulting in the disruption of the 7^th^ WD-40 repeats and addition of a 66 amino acid sequence to the C-terminus of the LRRK1 protein. ", "The mutation caused loss of LRRK1 function in OCs. ", "The clinical features of the patient were very similar to the skeletal phenotypes observed in the *Lrrk1* KO mice. ", "The patient with a loss of function mutation had an osteosclerotic metaphyseal dysplasia, a distinctive form of osteopetrosis characterized by severe osteosclerosis confined to the metaphysis of the long and short tubular bones due to OC dysfunction \\[[@r1], [@r13]\\]. ", "These studies strongly suggest that LRRK1 plays a critical role in regulating OC function and peak bone mass. ", "Therefore, LRRK1 is a novel drug target for alternative anti-resorptive drugs to treat osteoporosis and osteoporotic fractures.", "\n\nThe 3D structures of the ROCO4 superfamily including LRRK1 and LRRK2 can be used as a receptor for structure-based drug screening \\[[@r14]\\]. ", "In previous studies, the 3D structure of the ROC domain dimer from LRRK2 was resolved and was used for a combination of computer-aided drug design for screening small molecule competitors against the GTP pocket for treatment of Parkinson disease \\[[@r15], [@r16]\\]. ", "Little is known about the structure of the LRRK1 KD. ", "In this study, we performed structure homology modeling and virtual screening \\[[@r17]\\], and we tested the anti-resorptive function of a candidate LRRK1 inhibitor *in vitro*.", "\n\nRESULTS\n=======\n\nIN04 docks to the active pocket of the LRRK1 KD and inhibits ATP binding to the LRRK1 KD\n----------------------------------------------------------------------------------------\n\nHomology-based protein modeling of the hLRRK1 KD indicated that the LRRK1 KD contains an extra loop in the activation site compared with the hLRRK2 KD \\[[@r18]\\], and it has a narrower active pocket for ligand binding ([Figure 1A](#f1){ref-type=\"fig\"}). ", "A total of approximately 5,000 KINACore and 11,000 KINASet compounds were screened. ", "By using a computer program, four promising inhibitors (Cambridge, \\#20040537, \\#3148851, \\#21337060, and \\#7989904) were identified with high scores (data not shown). ", "Among them, IN04 (\\#7989904) not only docked to the active pocket of the hLRRK1 KD but also inhibited OC function without suppressing OC formation in OC differentiation and pit assays ([Figure 1B](#f1){ref-type=\"fig\"}, [1C](#f1){ref-type=\"fig\"}). ", "Two of these compounds inhibited OC formation (\\#3148851 and \\#21337060) in the OC differentiation assay, and one of these compounds (\\#20040537) did not suppress OC function either in pit formation assays, although it did not inhibit OC formation (data not shown). ", "To test if IN04 docking to the active pocket inhibits ATP binding to the LRRK1 KD, we first purified recombinant protein from *E. coli* and used the protein for an *in vitro* pulldown assay. ", "We found that INO4 at 16 nM completely blocked ATP binding to the LRRK1 KD ([Figure 1D](#f1){ref-type=\"fig\"}, [1E](#f1){ref-type=\"fig\"}).", "\n\n{#f1}\n\nIN04 treatment inhibits OC bone resorption function with no effect on OC formation\n----------------------------------------------------------------------------------\n\nTo test the effect of IN04, we performed OC formation and bone resorption pit assays *in vitro*. ", "CD11b-positive monocytes isolated from the mouse spleen were seeded on bone slices and treated with 20 ng/ml M-CSF and 30 ng/ml RANKL in the presence of candidate inhibitor or vehicle DMSO to form multinuclear cells. ", "The mature OCs on the bone surface were counted. ", "Bone resorptive pits were stained with hematoxylin after removing the cells from the bone surface. ", "We observed that INO4 treatment had no effect on OC formation but significantly inhibited bone resorption in a dose-dependent manner ([Figure 2A](#f2){ref-type=\"fig\"}). ", "While the number of mature TRAP-positive OCs on bone slices were comparable for the IN04 and DMSO treatments, IN04 treatment of OCs increased OC fusion, and significantly impaired their ability to resorb bone without causing toxicity or cell death. ", "Dysfunctional OCs treated with IN04 kept fusing and became larger than the DMSO-treated control cells ([Figure 2C](#f2){ref-type=\"fig\"}). ", "The average area of IN04 treated OCs on bone slices at 5 μM and 10 μM was 6 and 3 times bigger than the DMSO treated cells, respectively. ", "The area of resorption pits was reduced by 43% in the cultures at 5 μM IN04 and 83% at 10 μM IN04 as compared to DMSO vehicle-treated control cells ([Figure 2B](#f2){ref-type=\"fig\"}, [2D](#f2){ref-type=\"fig\"}). ", "In addition, individual resorption pits appeared smaller and shallower in IN04 treated cultures as measured by nano-CT ([Figure 3A](#f3){ref-type=\"fig\"}, [3C](#f3){ref-type=\"fig\"}). ", "Pit size on bone slices was reduced by 54%, and pit depth was decreased by 42% ([Figure 3B](#f3){ref-type=\"fig\"}, [3D](#f3){ref-type=\"fig\"}). ", "The average pit size was 2.4 x10^-3^ mm^2^ in the IN04-treated cultures vs. 5.2 x10^-3^ mm^2^ in the vehicle controls. ", "Pit depth on bone slices was 15 μM in the IN04-treated vs. 26 μM in the controls. ", "By resorptive pit formation assays, we have estimated a 50% inhibition of resorptive function (IC50) at an IN04 concentration of 5.72 ± 0.86 μM *in vitro* as shown in [Figure 4](#f4){ref-type=\"fig\"}. ", "In addition, we tested 3D analogs that are structurally like IN04 from the Chembridge small molecular libraries (\\#7929558, \\#7976361, \\#7386352, \\#7966678, \\#7962797, and \\#7927030), and none of them could inhibit bone resorption *in vitro* assessed by pit formation assays (data not shown).", "\n\n![**", "IN04 treatment inhibits osteoclast bone resorption function with no effect on osteoclast formation.** ", "Osteoclast precursors derived from C57BL/6J mice were seeded on bone slices (0.4 x 0.8 cm) and differentiated in the presence of DMSO or INO4 for 6--9 days. ", "Cells were stained for TRAP (Tartrate-resistant acid phosphatase), and bone slices were stained with hematoxylin for bone resorption pits. (**", "A**) Representative images of TRAP-positive osteoclasts (upper panel) and resorption pits (lower panel) on bone slices. (**", "B**) Quantitative data of osteoclast numbers on bone slices. (**", "C**) Quantitative data of osteoclast size on bone slices. ", "\\[[@r29]\\]. ", "Quantitative data of pit formation on bone slices. ", "The results are presented as percentage of pit area relative to the bone slice area. ", "Data are presented as mean ± SEM. *", "P* \\< 0.05 or *P* \\< 0.01 indicates statistical significance (N=4).](aging-11-101977-g002){#f2}\n\n{#f3}\n\n{#f4}\n\nIN04 treatment of OCs impairs peripheral sealing zone on bone slices\n--------------------------------------------------------------------\n\nAs shown in [Figure 5](#f5){ref-type=\"fig\"}, almost all vehicle-treated mature OCs displayed a typical rounded appearance with clear actin ring formation ([Figure 5A](#f5){ref-type=\"fig\"}, left panel). ", "Horizontal cross-section images of multinucleated cells revealed clustered F-actin formed a peripheral sealing zone (SZ) in DMSO-treated OCs from both views when cultured on bone slices (fluorescent dots indicated by arrows in [Figure 5B](#f5){ref-type=\"fig\"}, left panel). ", "These mature OCs were associated with resorptive pits as shown in [Figure 5C](#f5){ref-type=\"fig\"}, left panel. ", "By contrast, more than 90% of IN04-treated multinucleated cells showed disarranged F-actin in the cytoplasm with weak peripheral F-actin rings. ", "Despite contact with the bone surface, IN04-treated OCs failed to form a typical sealing zone, and the cells were not associated with resorptive pits ([Figure 5B](#f5){ref-type=\"fig\"}, [5C](#f5){ref-type=\"fig\"}, right panel).", "\n\n{#f5}\n\nIN04 treatment does not influence OC differentiation and coupling factor expression\n-----------------------------------------------------------------------------------\n\nTo test if IN04 treatment of mature OCs alters expression of OC differentiation marker genes and OC-derived coupling factors, including bone morphometric protein 6 (BMP6), collagen triple helix repeat containing 1 (CTHRC1), and wingless-type MMTV integration site family member 10B (Wnt10b), we cultured CD11b-positive precursors derived from mouse spleens and differentiated the cells on bone slices in the presence of M-CSF and RANKL together with DMSO or IN04 (5 μM) for 6 days. ", "The mature multinuclear cells were harvested for RNA extraction and real-time RT-PCR. ", "We found that IN04 inhibition mature OC function did not compromise the expression of endogenous Lrrk1 or the OC differentiation marker genes: nuclear factor of activated T cells cytoplasmic, calcineurin dependent 1 (NFATc1), TRAP, and cathepsin K in mature OCs ([Figure 6A](#f6){ref-type=\"fig\"}--[6D](#f6){ref-type=\"fig\"}). ", "The expression levels of known OC coupling factors such as BMP6, CTHTC1, and Wnt10b were unchanged in IN04-treated OCs as compared to vehicle-treated cells ([Figure 6E](#f6){ref-type=\"fig\"}--[6G](#f6){ref-type=\"fig\"}).", "\n\n{#f6}\n\nIN04 treatment has no effect on bone marrow stromal cell-derived nodule formation *in vitro*\n--------------------------------------------------------------------------------------------\n\nTo evaluate whether IN04 has effects on osteoblast differentiation, we cultured bone marrow stromal cells and differentiated them to form nodules *in vitro*. ", "We found that the amount of mineralized nodule formation was comparable in IN04-treated bone marrow stromal cells as compared to DMSO-treated cells after 24 days of culture in a mineralization medium ([Figure 7A](#f7){ref-type=\"fig\"}, [7B](#f7){ref-type=\"fig\"}).", "\n\n{#f7}\n\nDISCUSSION\n==========\n\nThe ideal agents for management and treatment of osteoporosis should have both OC inhibitory and osteoblast stimulatory functions. ", "However, such drugs are currently not available. ", "At present, most available drugs function to limit bone resorption, either directly or indirectly targeting OCs. ", "These antiresorptive agents include bisphosphonate family members (e.g., alendronate, Fosamax, Reclast, or Bovina), the selective estrogen receptor modulator raloxifene, and a fully humanized monoclonal antibody specific to RANKL. ", "Contrasting with the anti-resorptive drugs are the anabolic drug agents that stimulate skeletal bone formation. ", "These drugs consist of full-length parathyroid hormone (PTH) 1--84, PTH (1--34), and the PTH related peptide analog abaloparatide. ", "Given the current limited options for regulation of bone anabolism and the side effects of current anti-resorptive drugs due to suppression of OC differentiation and OC--osteoblast coupling, it is important to develop additional alternatives that can trigger bone formation or novel anti-resorptive agents that suppress bone resorption without inhibiting mature OC-coupled bone formation. ", "In this study, we chose LRRK1 as a drug target for anti-resorptive drug screening because our previous studies have demonstrated that a lack of LRRK1 in mice resulted in increased bone mass and prevented OVX-induced bone loss in aging mice. *", "Lrrk1* KO mice were healthy and responded normally to anabolic PTH treatment. ", "In contrast to bisphosphonate-treated monocytes, precursors derived from *Lrrk1* KO mice differentiated normally into mature multinuclear cells that failed to resorb bone \\[[@r1]\\]. ", "Our previous studies suggest different mechanisms for bisphosphonate and LRRK1 actions on bone cells. ", "We predicted that inhibition of LRRK1 action by small molecular weight inhibitors in OCs would inhibit OC function with no effects on OC--osteoblast coupling. ", "As expected, we found that IN04 treatment of OCs significantly impaired their ability to resorb bone by blocking ATP binding to the active pocket of LRRK1 KD. ", "Individual pits appeared smaller and shallower while OC formation on the bone slices was normal. ", "IN04-treated OCs exhibited disorganized F-actin in the cytoplasm, and F-actin failed to assemble a sealing ring on bone slices. ", "The phenotypic features of mature OCs treated with IN04 were very similar to the dysfunctional OCs derived from *Lrrk1* KO mice that were reported previously \\[[@r1]\\]. ", "Our results indicate that the inhibitor IN04 may suppress OC activity via inactivation of LRRK1 function in mature OCs.", "\n\nMature OCs are known to send OC-derived signals to promote osteoblast precursor recruitment and differentiation and as such stimulate bone formation \\[[@r19], [@r20]\\]. ", "There are 3 main classes of OC-derived coupling factors: (1) OC-mediated release of stored growth factors from bone matrix during bone resorption, (2) mature OC-synthesized and secreted factors, and (3) OC membrane proteins. ", "Among them, OC-secreted Wnt10b and CTHRC1, a glycoprotein associated with Wnt family signaling, are two important enhancers of bone formation \\[[@r21]--[@r23]\\]. ", "Interestingly, expression of OC-derived Wnt10b is induced by TGFβ, and the ability of OCs to stimulate bone formation in response to TGFβ could be blocked by the Wnt10b inhibitor DKK-1 \\[[@r20]\\]. ", "Mice with disruption of Wnt10b exhibited aging-dependent loss of bone mass and progressive reduction of mesenchymal progenitor cells \\[[@r24]\\]. ", "CTHRC1 is also secreted by mature OCs in the active resorbing bone, and its expression is highly induced by BMP2, hydroxyapatite, and RANKL but blunted by aging and alendronate treatment \\[[@r23], [@r25]\\]. *", "Cthrc1*-null mice displayed low bone mass because of decreased bone formation and osteoblast number, whereas *Cthrc1* transgenic mice showed high bone mass due to increased osteoblast number. ", "Both *Cthrc1*-null and transgenic mice have normal OC number \\[[@r23], [@r25]\\]. ", "Taken together, these studies indicate that CTHRC1, Wnt10b, and BMP6 could be involved in the cross-talk between OCs and osteoblasts during bone remodeling. ", "Thus, if our hypothesis that IN04 inhibits OC function without influencing bone formation is correct, we should observe no changes in the expression of OC-derived coupling factors. ", "As predicted, we found that IN04 treatment had no effect on expression of CTHRC1, BMP6, and Wnt10b in mature OCs *in vitro*. ", "Additionally, IN04 treatment did not affect osteoblast functions since the amount of mineralized bone formed by bone marrow stromal cells *in vitro* was not affected by IN04 treatment. ", "Our data indicate IN04 is a potent inhibitor of LRRK1 that suppress OC function with no effect on OC formation or osteoblast functions *in vitro*. ", "However, whether IN04 has the same inhibitory effect on OC function and OC-osteoblast coupling *in vivo* needs to be examined in future studies. ", "Based on the *in vitro* studies, we cannot exclude the possibility that IN04 decreases release of bone-matrix derived growth factors and, thereby, bone formation *in vivo* due to impaired bone resorption.", "\n\nDirect high throughput screening of small molecular libraries for LRRK1 inhibitors by testing inhibitory phosphorylation or autophosphorylation via a LRRK1 kinase assay is not feasible because the key direct biological substance(s) and autophosphorylation site(s) have not been identified yet. ", "In this study, we first screened the compounds designed to target the ATP-binding site against LRRK1 kinase by computer program-based virtual screening, and we subsequently confirmed the efficacy by using an *in vitro* ATP-site competition binding assay and cell-based functional testing. ", "The screening strategy enabled rapid identification of candidate compounds that selectively inhibited OC function but not OC differentiation. ", "The identified candidate inhibitor of LRRK1, IN04, was not able to dock into the active pocket of LRRK2 KD and was structurally distinct from LRRK2-IN01 inhibitor that suppresses LRRK2 but not LRRK1 kinase activity by blocking ATP binding to the LRRK2 kinase domain \\[[@r26]\\]. ", "The PubChem (CID 1259183) database showed that it was inactive to MITF (melanogenesis associated transcription factor) and STK33 (serine/threonine kinase 33). ", "The 3D analogs of IN04 failed to inhibit OC function. ", "Our studies indicate that IN04 is relatively selective inhibitor of LRRK1 kinase.", "\n\nSince the 3D structure of Lrrk1 is not available, we used TAK1 as a template to build 3D structures of hLRRK1 KD for drug screening. ", "Thus, it is possible that IN04 may inhibit enzymatic activity of TAK1 or other MAPKKK family members. ", "Although we minimized off-target effects by eliminating the compounds that also interact with other known kinases (e.g., p38 MAP kinase, PKC, GSK, c-Src, and B-RAF kinase) and focused on compounds that suppress OC activity by disrupting cytoskeleton rearrangement, but not through affecting OC differentiation, further characterization of the kinase selectivity of IN04 are still needed with experimental high-throughput approaches such as kinase binding assays by the KINOMEscan^TM^ methodology and activity-based enzymatic assays by the KiNativ^TM^ technology \\[[@r27], [@r28]\\]. *", "In vivo* testing in ovariectomized osteoporotic mice or inflammatory bone mouse models with high bone turnover is also needed to confirm that IN04 inhibits bone resorption with no effect on bone formation and to determine whether IN04 has better pharmacologic efficacy than bisphosphonates in treating osteoporosis. ", "It will be our future direction to conjugate IN04 inhibitor with penetrating oligopeptide (DSS)~6~ to target active OCs on bone surface. ", "Lastly, a crystallographic structure of LRRK1 needs to be resolved for refinement of potential LRRK1 inhibitors and for high throughput screening of more specific and selective inhibitors.", "\n\nMATERIALS AND METHODS\n=====================\n\nMice\n----\n\nFive-week-old C57BL/6J mice were purchased from the Jackson Laboratory (Bar Harbor, ME). ", "Mice were housed at the VA Loma Linda Healthcare System (VALLHCS) under standard approved laboratory conditions. ", "All procedures were performed with approval of the Institutional Animal Care and Use Committee of VALLHCS.", "\n\nRecombinant proteins, antibodies, and plasmids\n----------------------------------------------\n\nRecombinant macrophage colony stimulating factor (M-CSF) and receptor activator of nuclear factor-κB ligand (RANKL) and anti-6xHis antibody were from R&D Systems (Minneapolis, MN). ", "Ni resin-based columns were obtained from Bio-Rad (Hercules, CA). ", "Plasmid of pUC57-hLrrk1 KD encoding human LRRK1 kinase domain (hLRRK1 KD) from amino acids 1240--1530 was synthesized by GenScript (Piscataway, NJ) and sub-cloned into the pET28a plasmid with 6xHis tag at the N-terminus for recombinant protein expression in *E. coli*. ", "ATP Affpur kit III was purchased from Jena Bioscience (Jena, Germany). ", "The chemical inhibitor methyl 3-\\[({\\[5-(3,5-dimethoxyphenyl)-1,3,4-oxadiazol-2-yl\\] thio} acetyl) amino\\] benzoate (IN04) was from Cambridge (San Diego, CA).", "\n\nhLRRK1 KD expression and purification\n-------------------------------------\n\nThe recombinant hLRRK1 KD protein was expressed in Rosetta competent cells in LB broth containing 2 mM MgSO~4~ and induced by a 12-hour treatment of 4 mM *IPTG* at 25°C. ", "The cells were lysed in a lysis buffer containing 25 mM Tris-HCl (pH 8.0), 300 mM NaCl, and 10% N-Lauroylsarcosine sodium (Sarkosyl) by sonication. ", "The lysate was diluted 10 times with a buffer containing 25 mM Tris-HCl (pH 8.0) and 300 mM NaCl, and then Triton X-100 was added to the diluted lysate to make the final concentration of 0.2%. ", "The recombinant poly-histidine-tagged protein was purified in a working solution containing 25 mM Tris-HCl (pH 8.0), 300 mM NaCl, 1% Sarkosyl, and 0.2% Triton X-100 with the Ni resin-based columns (Bio-Rad) by HPFC (Next Generation Chromatography, Bio-Rad) and concentrated with 10k Vivaspin columns after a series of dialyses in 25 mM Tris-HCl buffer (pH 8.0).", "\n\nhLRRK1 KD modeling and docking\n------------------------------\n\nBecause crystallographic data of the LRRK1 KD has not yet been resolved, we performed protein structure homology modeling with SWISS-MODEL \\[[@r17]\\]. ", "BLAST searches to identify suitable templates for modeling of the hLRRK1 KD led to three highly significant matches. ", "The detected templates of TGFβ activated kinase 1 (TAK1), constitutive triple response 1 kinase (CTR1), and mixed-lineage kinase 1 (MLK1) all belong to the PKC-like superfamily of serine/threonine protein kinases and have been co-crystallized with small inhibitors \\[[@r30]--[@r33]\\]. ", "While CTR1 is expressed in *Arabidopsis thaliana* and plants, its mammalian homolog MAPKKK Raf plays a significant role in regulating cell growth and differentiation. ", "TAK1 and MLK proteins expressed in mice and humans are also members of the MAPKKK family, and they play a critical role in regulating OC differentiation and bone formation \\[[@r33], [@r34]\\]. ", "We chose TAK1 as a template to build a 3D structure of hLRRK1 KD using the ESyPred3D automated homology modeling program (Swiss Institute of Bioinformatics, Switzerland) because mice with disruption of TAK1 also show an osteopetrosis phenotype \\[[@r33], [@r35]\\]. ", "The PDB file of the hLRRK1 KD was loaded as a receptor into Molsoft 3.7 (Molsoft, San Diego, CA), and the potential ligand binding pocket was identified. ", "KINACore and KINASet compounds synthesized based on matches to 3D pharmacophore fingerprints generated from either published kinase active sites or from the adenosine portion of ATP from Cambridge was screened via \"table docking.\" ", "Four chemicals that dock into the pocket with high scores were chosen for further *in vitro* testing.", "\n\n*In vitro* inhibition of ATP binding assay\n------------------------------------------\n\nIN04 inhibition of ATP binding to hLRRK1 KD was assessed by a pulldown assay with ATP-agarose according to the manufacturer\\'s instructions (ATP Affpur kit III, Jena Bioscience, Jena, Germany). ", "Briefly, 50 ng recombinant hLRRK1 KD was first incubated with various concentrations of IN04 inhibitor (3.2 nM, 16, nM, 80 nM, 0.4 μM, and 5.0 μM) or the same volume of DMSO in 500 μl of 1x binding buffer on ice for 15 minutes. ", "After the incubation, 50 μl of the equilibrated ATP-agarose was added into the reaction and the reactions were incubated by end-over-end mixing for 1 hour at 4°C after which beads were washed 4 times in 1x washing buffer. ", "Proteins were eluted using 2x LDS sample buffer (Invitrogen, CA), heated at 90°C for 5 minutes and analyzed with 10% NuPage Bis-tris gel by western blot with anti-6xHis antibody as described previously \\[[@r1]\\].", "\n\n*In vitro* OC formation\n-----------------------\n\nPrimary CD11b^+^ monocytes derived from the spleen of 5-week old C57BL/6J mice were positively isolated with magnetic CD11b microbeads according to the manufacturer's instructions (Miltenyi Biotec, Bergisch Gladbach, Germany). ", "Briefly, 10^8^ splenocytes in 1 ml MACS buffer were incubated with 150 μl of CD11b microbeads at 4°C for 15 minutes after removing red blood cells with RBC lysis buffer. ", "The cells were then washed with 15 ml PBS washing buffer containing 0.5% BSA and 2 mM EDTA, spun down, and re-suspended in 500 μl of washing buffer. ", "The cell suspension was then loaded onto a MACS® Column placed in the magnetic field of a MACS Separator. ", "The magnetically labeled CD11b^+^ monocytes were eluted and flushed out with the plunger after 3 times washing and removing from the separator. ", "The isolated CD11b^+^ monocytes were maintained in α-MEM supplemented with 10% fetal bovine serum (FBS), penicillin (100 units/ml), streptomycin (100 μg/ml), and M-CSF (20 ng/ml) at 37°C in 5% CO~2~ for 3 days to stimulate monocyte proliferation. ", "The cells were then induced to differentiate in a medium containing the LRRK1 inhibitor IN04. ", "The medium was changed every 2 days. ", "Osteoclastogenesis was evaluated by counting TRAP staining positive, multinucleated cells having at least three nuclei. ", "Mature OC size was measured by the Lieca Application Suite X software equipped with Lieca STP6000 microscope and Image J (National Institutes of Health).", "\n\nRNA extraction and real-time PCR\n--------------------------------\n\nRNA was extracted from primary cultures as described previously \\[[@r36]\\]. ", "An aliquot of RNA (1 μg) was reverse-transcribed with an oligo(dT)~12--18~ primer into cDNA in a 20 μl reaction volume. ", "The real-time PCR reaction contained 0.5 μl of template cDNA, 1x SYBR GREEN master mix (ABI), and 100 nM of specific forward and reverse primers in a 12 μl reaction volume. ", "Primers for peptidyl prolyl isomerase A (PPIA) were used to normalize the expression data for the genes of interest. ", "The primer sequences used for real-time PCR are listed in [Table 1](#t1){ref-type=\"table\"}.", "\n\n###### Primer sequences used for real time PCR.", "\n\n --------------- ---------------------------- -----------------------------\n **Gene** **Forward primer** **Reverse primer**\n *Ppia* 5'-CCATGGCAAATGCTGGACCA 5'-TCCTGGACCCAAAACGCTCC\n *Lrrk1* 5'-GCTCAACATTGAGGCCAAGG 5'-GCCGATAGTGCTACCCACAT\n *Nfatc1* 5'-ATACTTCCTGTCCTCTGGCAACA 5'-GCTTGCAGCTAGGAAGTACGTCTT\n *Trap* 5'-CACTCAGCTGTCCTGGCTCAA 5'-CTGCAGGTTGTGGTCATGTCC\n *Cathepsin K* 5'-GAACGAGAAAGCCCTGAAGAGA 5'-TATCGAGTGCTTGCTTCCCTTC\n *Bmp6* 5'-GGAGCATCAGCACAGAGACT 5'- AAGAAGGCCACCATGAAGGG\n *Cthrc1* 5\\'-CTACAGTTGTCCGCACCGAT 5\\'-TTGAATCCATCCCGACCTGG\n *Wnt10b* 5\\'-CTGAGTAAGCGACAGCTGGG 5\\'-GGAGAAAGCACTCTCACGGA\n --------------- ---------------------------- -----------------------------\n\nBone resorption pit and actin ring formation assays\n---------------------------------------------------\n\nSlices from bovine cortical bone were placed in 48-well plates and cells were differentiated on top of the bone slices as described previously \\[[@r1]\\]. ", "Cells on bone slices were digested with trypsin at 37°C overnight. ", "Multinucleated cells were further removed by 5-minute sonication in 1M ammonia. ", "Air-dried bone slices were stained with hematoxylin. ", "The entire surface of each bone slice was examined and the total resorbed area per bone slice was quantified using ImageJ software. ", "Resorption pits were also visualized by nano-CT at a 0.66 μM voxel dimension (VersaXRM-500, Xradia, Pleasanton, CA, USA). ", "The pit area and pit depth on bone slices were quantified with ImageJ software and TXM Reconstructor, respectively. ", "Cells on bone slices were also stained with Alexa Fluor 488-conjugated phalloidin for F-actin and DAPI for nuclei staining. ", "Actin ring formation, sealing zone, and 3D OC images were visualized by Olympus Fluoview 3000 confocal microscopy.", "\n\nNodule assay\n------------\n\nBone marrow stromal cells isolated from the femurs and the tibias of the mice were grown to 80% confluence. ", "The cells were then treated with a mineralization medium containing 10 mM β-glycerophosphate, 50 μg/ml ascorbic acid, and 10% FBS for 24 days. ", "The cells were washed, fixed, and stained with 40 mM alizarin red (pH 4.2). ", "The mineralized area was measured as described previously \\[[@r37]\\].", "\n\nStatistical analysis\n--------------------\n\nData are presented as mean ± SEM and analyzed by Student's t-test or two-way ANOVA as appropriate.", "\n\n**AUTHOR CONTRIBUTIONS:** Study design: WX and SM. ", "Acquisition of data: WX, MS, CZ, SS, and HG. ", "Analysis and interpretation of data: MS, WX, and SM. ", "Drafting manuscript: MS, WX, and SM. ", "Revising manuscript: WX and SM. ", "Approved final version of manuscript: WX and SM. ", "WX accepts responsibility for integrity of data analysis.", "\n\n**CONFLICTS OF INTEREST:** Authors have no conflicts of interests to declare.", "\n\n**FUNDING:** This work was supported by National Institutes of Health grants 1R21 AR066831-01 (to WX) and 1R21AR072831-01 (to WX*).* ", "The funder had no role in study design, data collection and analysis, decision to publish, or manuscript preparation. ", "SM's salary was supported by a senior research career scientist award from the Department of Veteran's Affairs. ", "MS was supported by a research fellowship from the Shanghai Ninth People's Hospital, Affiliated to Shanghai Jiaotong University School of Medicine, Shanghai, China. ", "SS was supported by a research fellowship from the Sixth Affiliated Hospital Guangzhou Medical University, Qingyuan City, Guangdong Province, China. ", "The research work was performed at facilities provided by the Department of Veterans Affairs.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.004714188165962696, 0.0014981391141191125, 0.0010354359401389956, 0.0012957013677805662, 0.0023735486902296543, 0.002035672077909112, 0.0008870679885149002, 0.009047227911651134, 0.000688095751684159, 0.0008853327599354088, 0.0007329917862080038, 0.004666008520871401, 0.0007866398082114756, 0.0017755412263795733, 0.00090789858950302, 0.005457928404211998, 0.0007282759179361165, 0.0008576076361350715, 0.0009520841995254159, 0.0008160002762451768, 0.00537081016227603, 0.0007026741513982415, 0.006258910521864891, 0.0006068780203349888, 0.0005725350929424167, 0.0007488809642381966, 0.0005743258516304195, 0.00141952745616436, 0.0006280945963226259, 0.0006387928151525557, 0.0008321352652274072, 0.0007343139150179923, 0.009430879727005959, 0.0007394006242975593, 0.008222682401537895, 0.00078310735989362, 0.0006230390863493085, 0.0006424711318686604, 0.0012661912478506565, 0.019045045599341393, 0.010285932570695877, 0.000806337920948863, 0.0011930634500458837, 0.007814198732376099, 0.0006317463121376932, 0.0008867278811521828, 0.0012553212000057101, 0.0007221519481390715, 0.0006398185505531728, 0.0006118736928328872, 0.0007067415863275528, 0.000612483941949904, 0.00066339410841465, 0.0006167458486743271, 0.0007532078307121992, 0.008222682401537895, 0.0164913609623909, 0.000731386651750654, 0.0017340643098577857, 0.0011241837637498975, 0.0011873535113409162, 0.007689495105296373, 0.0016384546179324389, 0.0006201480282470584, 0.0006508457008749247, 0.0005860041710548103, 0.0012107533402740955, 0.03367745131254196, 0.0007497778278775513, 0.0005747601389884949, 0.0008526653982698917, 0.0007096687331795692, 0.0006703258841298521, 0.0005860041710548103, 0.0013221525587141514, 0.0014084806898608804, 0.0008386583649553359, 0.0006237217457965016, 0.000589630741160363, 0.0006396472454071045, 0.0005986645119264722, 0.0006757417577318847, 0.0011512214550748467, 0.0008146670297719538, 0.008222682401537895, 0.04829597845673561, 0.0007365899509750307, 0.0018237039912492037, 0.00860380195081234, 0.0024178281892091036, 0.0006185167585499585, 0.0006408529588952661, 0.0005870590684935451, 0.0008910158649086952, 0.0022392759565263987, 0.0005941109266132116, 0.000683323887642473, 0.0006207452970556915, 0.008222682401537895, 0.0012509783264249563, 0.0005891860346309841, 0.0009280365193262696, 0.0008051436161622405, 0.0005860041710548103, 0.0017957660602405667, 0.00063091836636886, 0.008222682401537895, 0.0009197731269523501, 0.0009524793713353574, 0.0007454725564457476, 0.0027267844416201115, 0.00137202104087919, 0.0006971007096581161, 0.003887431463226676, 0.0010178699158132076, 0.0011698841117322445, 0.0010724018793553114, 0.000847996270749718, 0.0006729798042215407, 0.0010525118559598923, 0.0017050340538844466, 0.0010592080652713776, 0.0007233855430968106, 0.0010153822368010879, 0.0007333417888730764, 0.0010396685684099793, 0.0016666401643306017, 0.0009389601182192564, 0.0014592563966289163, 0.0006350853363983333, 0.0010297264670953155, 0.0006876270053908229, 0.0017313663847744465, 0.0014648763462901115, 0.003229554509744048, 0.0013175010681152344, 0.0008909318712539971, 0.0006033573299646378, 0.0006845551542937756, 0.0013940278440713882, 0.001693452475592494, 0.0006410481873899698, 0.0006217763875611126, 0.0007003639475442469, 0.0005637833382934332, 0.0005605013575404882, 0.0008125660242512822, 0.0006597346509806812, 0.000768345664255321, 0.0006341369589790702, 0.000590245530474931, 0.0010820702882483602, 0.0006729073938913643, 0.002148117171600461, 0.0011257623555138707, 0.0005790192517451942, 0.0007273004157468677, 0.0005647045909427106, 0.0006000692374072969, 0.0007573456387035549, 0.0005498097743839025, 0.0007074720342643559, 0.0005748949479311705, 0.0009134210413321853, 0.0010106685804203153, 0.0006438871496357024, 0.0008553335792385042, 0.0007137231878004968, 0.0006458936259150505, 0.0005902683478780091, 0.0006427121697925031, 0.0010528743732720613, 0.0010359218576923013, 0.0007732750964350998, 0.0005917529342696071, 0.0006103942287154496, 0.0006106904475018382, 0.0007062608492560685, 0.0007327962084673345, 0.0006619513151235878, 0.0008271383121609688, 0.0006620181375183165, 0.0009339813841506839, 0.0008649842930026352, 0.0006472248933278024, 0.001263827783986926, 0.0006519084563478827, 0.0006809793412685394, 0.0005785547546111047, 0.0007857164600864053, 0.000579357089009136, 0.0006300944951362908, 0.0006066039204597473, 0.0005876524955965579, 0.0006400341517291963, 0.0005835000774823129, 0.0006967211375012994, 0.32501232624053955, 0.0008045384893193841, 0.0007405571523122489, 0.010272310115396976, 0.0006285569397732615, 0.0005865353159606457, 0.0006715270574204624, 0.0008323177462443709, 0.0006030397489666939, 0.0013255822705104947, 0.0007632424822077155, 0.0007433046703226864, 0.0006083005573600531, 0.0005916641093790531, 0.0006157546886242926, 0.000571574957575649, 0.0005709539982490242, 0.0006157755269668996, 0.0007041428470984101, 0.0005844173138029873, 0.0005706933443434536, 0.0007660361588932574, 0.0005938479444012046, 0.0006412339280359447, 0.0005953508662059903, 0.0005768324481323361, 0.0005671510589309037, 0.0005566608160734177, 0.001995444530621171 ]

[ "Q:\n\nextract images from clusters separately in kmeans python\n\ni have done K-means clustering over a dataset of images after which i have 5 clusters. ", "Now i want to extract the images from each clusters and save them separately. ", "i have no idea how to do that. ", "i have tried doing this but i am not able to access the images. ", "\nhere is my code\nimport matplotlib.pyplot\nimport matplotlib.pyplot as plt\nimport pandas as pd\nfrom sklearn.externals import joblib\nimport numpy as np\nimport cv2 \nimport sys\nimport pickle\nfrom sklearn.manifold import TSNE\nfrom sklearn.decomposition import PCA\nimport os \nfrom skimage.feature import local_binary_pattern \n# To calculate a normalized histogram\nfrom scipy.stats import itemfreq \nfrom sklearn.preprocessing import normalize \nimport cvutils \nimport csv \nimport numpy \nfrom matplotlib.pyplot import imshow\nfrom PIL import Image\nimport time\nfrom sklearn.cluster import KMeans\n\nstart_time=time.time()\n ############################################################################################\ndir_unknown = 'UntitledFolder'\ntrainingSet='/home/irum/Desktop/Face-Recognition/thakarrecog /UntitledFolder/UntitledFolder1'\nimageLabels='/home/irum/Desktop/Face-Recognition/thakarrecog/class_train'\npath='/home/irum/Desktop/Face-Recognition/thakarrecog/Clusters'\n#Create CSV File\nimages_names = []\nSEPARATOR=\" \"\nprint\"start\"\n'''\nfor (dirname, dirnames, filenames) in os.walk(dir_unknown):\n for subdirname in dirnames:\n subject_path = os.path.join(dirname, subdirname)\n for filename in os.listdir(subject_path):\n abs_path = \"%s/%s\" % (subject_path, filename)\n\n #csv_path = \"%s%s%d\" % (abs_path, SEPARATOR, label)\n #print \"%s%s%d\" % (abs_path, SEPARATOR, label)\n images_names.append(\"%s%s%d\" % (abs_path, SEPARATOR, label))\n #print images_names \n with open('class_train1', 'w') as myfile:\n wr = csv.writer(myfile,delimiter=' ', doublequote=False , quotechar=None, lineterminator='\\r\\n', skipinitialspace=True)\n wr.writerow(imageLabels)\n label = label + 1\n'''\n# Store the path of training images in train_images\ntrain_images = cvutils.imlist(trainingSet)\nprint \"Total Images\",len(train_images)\n\n# Dictionary containing image paths as keys and corresponding label as value\ntrain_dic = {}\nwith open('/home/irum/Desktop/Face-Recognition/thakarrecog/class_train', 'rb') as csvfile:\n reader = csv.reader(csvfile, delimiter=' ')\n for row in reader:\n train_dic[row[0]] = row[1]\n\n# List for storing the LBP Histograms, address of images and the corresponding label \nX_test = []\nX_name = []\ny_test = []\n\nprint\"Calculating LBP Histograms\"\nh1 = time.time()\n# For each image in the training set calculate the LBP histogram\n# and update X_test, X_name and y_test\nfor train_image in train_images:\n # Read the image\n im = cv2.imread(train_image)\n\n # Convert to grayscale as LBP works on grayscale image\n im_gray = cv2.cvtColor(im, cv2.COLOR_BGR2GRAY)\n\n radius = 3\n # Number of points to be considered as neighbourers \n no_points = 8 * radius\n\n # Uniform LBP is used\n lbp = local_binary_pattern(im_gray, no_points, radius, method='uniform')\n\n # Calculate the histogram\n x = itemfreq(lbp.ravel())\n\n # Normalize the histogram\n hist = x[:, 1]/sum(x[:, 1])\n\n # Append image path in X_name\n X_name.append(os.path.join(train_image))\n\n # Append histogram to X_name\n X_test.append(os.path.join(hist))\n\n # Append class label in y_test\n #y_test.append(train_dic[os.path.split(images_names)[1]])\n\nh2 = time.time()\nt = (h2 - h1)\nprint\"Time taken by LBPH\",t\n\n# Dump the data\njoblib.dump((X_name, X_test), \"lbp.pkl\", compress=3)\n\np1 = time.time()\nprint\"Applying PCA on LBP Histograms\"\nX_test = np.array(X_test)\npca = PCA(n_components=26)\npca.fit(X_test)\npca_activations = pca.transform(X_test)\np2 = time.time()\nt = (p2 - p1)\nprint\"Time taken by PCA\",t\n\nt1 = time.time()\nprint\"Applying t-SNE on PCA\"\n# then run the PCA-projected activations through t-SNE to get our final embedding\nX = np.array(pca_activations)\ntsne = TSNE(n_components=2, learning_rate=500, perplexity=50, verbose=2, angle=0.2, early_exaggeration=7.0).fit_transform(X)\nprint \"t-SNE Type\", type(tsne)\nprint\"tsne\",tsne\nt2 = time.time()\nt = (t2 - t1)\nprint\"Time taken by t-SNE\",t\n\nn1 = time.time()\nprint\"normalize t-sne points to {0,1}\"\ntx, ty = tsne[:,0], tsne[:,1]\ntx = (tx-np.min(tx)) / (np.max(tx) - np.min(tx))\nty = (ty-np.min(ty)) / (np.max(ty) - np.min(ty))\n\nn2 = time.time()\nt = (n2 - n1)\nprint \"Normalization completed in time\",t\n\nwidth = 5000\nheight = 5000\nmax_dim = 100\n\nprint \"displaying\"\nfull_image = Image.new('RGB', (width, height))\nfor img, x, y in zip(X_name, tx, ty):\n #print \"for loop\"\n tile = Image.open(img)\n rs = max(1, tile.width/max_dim, tile.height/max_dim)\n tile = tile.resize((tile.width/rs, tile.height/rs), Image.", "ANTIALIAS)\n full_image.paste(tile, (int((width-max_dim)*x), int((height-max_dim)*y)))\nfull_image.save(\"myTSNE.png\")\n\n#matplotlib.pyplot.figure(figsize = (12,12))\n#plt.imshow(full_image)\n\nprint \"K-Means clustering\"\n#Convert Images to Float32 \nimages = np.asarray(tsne, np.float32)\nN = len(images)\nimages = images.reshape(N,-1)\n\n#using kmeans clustring having 5 clusters\nkmeans = KMeans(n_clusters=5)\n\n#passing images to kmeans \nkmeans.fit(images)\n\ncentroids = kmeans.cluster_centers_\nlabels = kmeans.labels_\n\ncolors = 10*['r.", "','g.", "','b.", "','c.", "','k.", "','y.", "','m.']", "\n\n#I want to Move each cluster to seperate folder (5 clusters means 5 folders)\n\nfor i in range(len(images)):\n print(\"coordinate:\",images[i], \"label:\", labels[i])\n plt.plot(images[i][0], images[i][1], colors[labels[i]], markersize = 10)\n\n img = cv2.convertScaleAbs(images[i])\n print \"Images Type\", img.dtype\n\n pin=sorted([int(n[:n.find('.')]) ", "for n in os.listdir(path)\n if n[0]!='.' ]", "+[0])[-1] + 1\n cv2.imwrite('%s/%s.png' % (path, pin), img)\n\nplt.scatter(centroids[:, 0],centroids[:, 1], marker = \"x\", s=150, linewidths = 5, zorder = 10)\n\nplt.show()\n\nend_time=time.time()\ntotal_time=t = (end_time - start_time)\nprint\"Total execution time in seconds\",total_time\n\ni am trying to extract clusters here, but failing. ", "I need images I clusters separately as an output so that I can manipulate them further.", "\n`#I want to Move each cluster to seperate folder (5 clusters means 5 folders)\nFor i in range(len(images)):\n print(\"coordinate:\",images[i], \"label:\", labels[i])\n plt.plot(images[i][0], images[i][1], colors[labels[i]], markersize = 10)\n\n img = cv2.convertScaleAbs(images[i])\n print \"Images Type\", img.dtype\n\n`\n\nI want images in red cluster separate, in blue cluster separate and so on, in separate folders actually. ", "5 clusters 5 folders.", "\nI have accessed images like this:\nfor i,j in zip(images, labels):\n if labels[j] == 1:\n #print \"Images Type\", images.dtype\n img = images[i]\n pin=sorted([int(n[:n.find('.')]) ", "for n in os.listdir(path)\n if n[0]!='.' ]", "+[0])[-1] + 1\n cv2.imwrite('%s/%s.png' % (path, pin), img)\n\nbut i am getting deformed images and in a very small size.", "\ni get output like this\n\nfor an image like this\n\nA:\n\nFrom your code, it seems that you have your images here images and that the variable labels is an array with the same dimension, containing the class labels. ", "\nIf you want to get all the images for a class called myclass, then simply do:\nimages_in_myclass = [i for i,j in zip(images, labels) where j=='myclass']\n\nzip allows you to iterate over the two arrays element-wise, and you are only returning the images for which the label condition is satisfied.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0005733154248446226, 0.0005764281959272921, 0.000725299003534019, 0.000576192804146558, 0.0054803998209536076, 0.0009353701607324183, 0.0010354635305702686, 0.0009736342472024262, 0.0010727721964940429, 0.001727986615151167, 0.0014338005566969514, 0.0007829141104593873, 0.0006556922453455627, 0.0011675305431708694, 0.0008037427323870361, 0.0006098824087530375, 0.0006758975796401501, 0.000731388689018786, 0.0006520191091112792, 0.0011675305431708694, 0.0008728631073608994, 0.0006395744276233017, 0.000677789852488786, 0.001995444530621171 ]

[ "Binding of an acceptor substrate analog enhances the enzymatic activity of human blood group B galactosyltransferase.", "\nThe hydrolysis of the donor substrate uridine diphosphate galactose (UDP-Gal) by human blood group B galactosyltransferase (GTB) has been followed by nuclear magnetic resonance in the presence and in the absence of an acceptor substrate analog. ", "It is observed that the presence of the acceptor substrate analog promotes hydrolysis of UDP-Gal. ", "Subsequent analysis of the kinetics of the enzymatic hydrolysis suggests that this effect is due to an increased affinity of GTB for UDP-Gal in the presence of the acceptor analog. ", "Isothermal titration calorimetry experiments substantiate this conclusion. ", "As hydrolysis may be understood as a glycosyl transfer reaction where water serves as universal acceptor, we suggest that in general the binding of acceptor substrates to retaining glycosyltransferases modulates the rate of glycosyl transfer. ", "In fact, this may point to a general mechanism used by retaining glycosyltransferases to discriminate acceptor substrates under physiological conditions." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0010078479535877705, 0.0007199589163064957, 0.0006082616746425629, 0.0005990280769765377, 0.0006186355603858829, 0.0007111202576197684, 0.0006888765492476523 ]

[ "Total management of the open abdomen.", "\nThe management of complex abdominal problems with the 'open abdomen' (OA) technique has become a routine procedure in surgery. ", "The number of cases treated with an OA has increased dramatically because of the popularisation of damage control for life-threatening conditions, recognition and treatment of intra-abdominal hypertension and abdominal compartment syndrome and new evidence regarding the management of severe intra-abdominal sepsis. ", "Although OA has saved numerous lives and has addressed many problems related to the primary pathology, this technique is also associated with serious complications. ", "New knowledge about the pathophysiology of the OA and the development of new technologies for temporary abdominal wall closure (e.g. ABThera™ Open Abdomen Negative Pressure Therapy; KCI USA Inc., San Antonio, TX) has helped improve the management and outcomes of these patients. ", "This review will merge expert physician opinion with scientific evidence regarding the total management of the OA." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006348163005895913, 0.0006056455313228071, 0.0007086499244906008, 0.0006930632516741753, 0.0005483655259013176, 0.0005804100073873997 ]

[ "Switching the conformation of a DNA molecule with a chemical oscillator.", "\npH oscillations generated by a nonequilibrium chemical reaction are used to switch a pH-sensitive DNA structure between two distinct conformations. ", "The utilization of a chemical oscillator represents a novel method for achieving autonomous motion in molecular devices. ", "The oscillatory reaction is a variant of the Landolt reaction and produces pH variations in the range between pH 5 and 7. ", "In this range, a cytosine-rich DNA strand can be switched between a random coil conformation and the folded i-motif structure. ", "The conformational changes are monitored simultaneously with the pH value in fluorescence-resonance energy-transfer experiments." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.001071546575985849, 0.0007110473234206438, 0.0006384096923284233, 0.0007359802257269621, 0.0006159612676128745, 0.0005683505441993475 ]

[ "Based off of the immensely popular Diku MUD The Forest's Edge which went offline in 1998, the game which everyone loved to play has expanded! ", "A vast amount of new objects, mobs, areas, quests, and coding modifications are being implemented over the next 30 days.", "\n\nThe Eternal Forest is a text-based MUD which is very user friendly. ", "Characters can be created on the fly from a relatively simple race/class/alignment list, then begin exploring a humongous map which has grown and evolved for nearly eight years! ", "There is no cost to play, and characters do not have to pay rent for upkeep. ", "Roleplaying is encouraged, but not required. ", "Players can choose to grow and explore the lands on their own, or band together with other online players to battle a series of increasingly challenging areas. ", "Characters progress with improved skills, spells, and equipment. ", "Players who love quests or attention to detail will enjoy the new zones being added, being some of the most detail-rich unique areas ever seen before. ", "PK is available though restricted to particular zones.", "\n\nUnlike most overpopulated graphical MUDs, interaction with the same players is frequent, yet without the loneliness present on many upstart text-based MUDs with small playerbases.", "\n\nLong described as one of the most fun MUDs to play, TFE and its subsequent clones have maintained a steady playerbase and progression that stretches nearly eight years. ", "Come join the fun at eternalforest.net port 9000!" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0008048766758292913, 0.0006045664777047932, 0.0008630804950371385, 0.0007421014597639441, 0.0008396762423217297, 0.0006185524398460984, 0.0011248559458181262, 0.0007153486949391663, 0.0006506837671622634, 0.0005438087973743677, 0.013452762737870216, 0.0008707854431122541, 0.0014314381405711174 ]

[ "Start-up Overview and Submission Requirements\n\nTeams incorporate their start-up; apply for the NIH start-up license or a license from the Clemson University Research Foundation (for their invention) and apply for seed funding. ", "In order to complete these three activities, it will also be necessary for the team to refine their commercialization plan, development plan, regulatory strategy and provide a comprehensive view of their management team and board of advisors\n\nSubmission Requirements:\n\nrevised commercialization plan\n\nrevised development plan\n\nrevised regulatory strategy\n\nrevised comprehensive view of their management team and board of advisors\n\nAs an alternative to creating your own start-up, you may want to find a start-up that has interest in licensing the invention. ", "In this case, you will be required to perform the above steps together with the licensing start-up\n\nAN ONLINE FORM WILL BE PROVIDED FOR YOU TO ATTACH THESE SUBMISSIONS; PLEASE ADHERE TO THE GUIDANCE ON ATTACHMENT NAMING CONVENTION PROVIDED IN THE ONLINE FORM\n\nStart-up Timeline\n\nStart-up phase: The start-up phase will begin with the start-up launch on February 20th, 2014, the start-up deadline will be September 23rd, 2014. ", "The end date of the Challenge may be extended if Start-ups have not received feedback from seed funders to whom they applied\n\nStart date: February 20th, 2014\n\nEnd date: September 23rd, 2014\n\nPlease note: the end date may shift out if the teams have not received word back on seed funding and their NIH licensing application\n\nStart-up Phase Steps for Challenge Teams\n\nReview the Start-up template and guidance. ", "More information can be found here\n\nReview potential seed funders that have agreed to participate in this Challenge; they will be posted on October 1st, 2013 and will continue to be updated throughout the Challenge\n\nAs soon as you enter this portion of the Challenge we recommend that you identify which seed funding you will apply for and look at the seed funding application requirements. ", "In addition, we recommend that you identify NIH information requirements in their start-up license. ", "Finally we suggest incorporating your company. ", "It would be wise to do these three activities in parallel\n\nComplete and submit all applications as soon as possible in this stage upon revising business plan components\n\nIdentify your availability for a meeting with the inventor between 1 and 5pm ET, March 3-7th or March 31st-April 4th, 2014\n\nSubmit all deliverables outlined under \"submission requirements\" above on September 23rd, 2014\n\nEvaluation Process, Criteria and Guidelines\n\nIn this phase, the Office of Technology Transfer (OTT) at the National Institutes of Health (NIH) and the Clemson University Research Foundation will evaluate start-up licensing applications independently of seed funders as well as the core team and judges. ", "Seed funders will evaluate applications to receive dilutive/non-dilutive capital. ", "Below we've provided links to typical dilutive and non-dilutive capital criteria from specific organizations as well as the licensing requirements from the NIH\n\nPlease see \"Deliverable Guidance\" tab of this site for additional guidance regarding the other deliverables required in this phase, including: the commercialization plan/strategy, development plan, regulatory strategy and management team/board of advisors/board of directors" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005368750425986946, 0.000523241760674864, 0.0005163037567399442, 0.0005333663430064917, 0.0005219414015300572, 0.000526414078194648, 0.0006500952877104282, 0.0005123973242007196, 0.0005979687557555735, 0.000521529174875468 ]

[ "This product cannot be shipped to Switzerland …?", "\nYes, we can!", "\nSimply order with EUROGOODS. ", "We deliver every online-product to Switzerland.", "\nAnd that all at very attractive EURO-prices\n\nSHOPPING IN THE EU\nKNOW BEFOREHAND WHAT YOU HAVE TO PAY\nYOU DO NOT NEED A CROSS BOARDER PARCEL SHOP OR A DELIVERY ADDRESS ABROAD ANY LONGER\n\nYOUR ADVANTAGES:\n\nSHOPPING IN THE EU.", "\nThere is no reason for you to be held back from the advantages of the EU markets, only because you live in Switzerland. ", "Now you can easily buy everything online in EU countries and have it sent to your home address.", "\nYOU DON’T NEED A CROSS BOARDER PARCEL SHOP OR A DELIVERY ADDRESS ABROAD.", "\nEUROGOODS will send your order by parcel service to your home address, duty and tax paid, so you don’t need to worry about anything at all.", "KNOW BEFOREHAND WHAT YOU HAVE TO PAY.", "\nYou will always receive a confirmation from EUROGOODS stating the final price including all cost before you buy.", "\n\nThere are even more advantages here:\nCLICK HERE\nRegister and benefit immediately from wide choice and cheap prices:\nCLICK HERE You can’t wait to start shopping? ", "Here is how it works:\nCLICK HERE" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0007516039186157286, 0.0008098878897726536, 0.0007022467325441539, 0.0006085922359488904, 0.0006845035823062062, 0.0011599708814173937, 0.0007457922911271453, 0.0009819065453484654, 0.0009165197261609137, 0.025149540975689888, 0.0006264980183914304, 0.0007511846488341689, 0.0008769601117819548 ]

[ "Long-term evaluation of implantation of fresh and cryopreserved human embryos following ovarian stimulation with buserelin acetate-human menopausal gonadotrophin (HMG) or clomiphene citrate-HMG.", "\nThis study is a long-term evaluation of the total pregnancy potential of cohorts of fresh and cryopreserved sibling embryos from in-vitro fertilization (IVF) cycles stimulated with either the gonadotrophin-releasing hormone analogue buserelin (BUS) (long protocol) or clomiphene citrate (CC) both in combination with human menopausal gonadotrophin (HMG). ", "Therefore a retrospective analysis was performed on patients who entered the IVF programme between January 1986 and July 1987 and who had triple embryo transfer in the collection cycle. ", "Significantly more fertilized oocytes developed to good-quality embryos in the CC-HMG group (86.1%) than in the BUS-HMG group (80.8%). ", "Transfer of the three morphologically best-looking embryos was performed in day 2 post-insemination in 106 CC-HMG and 80 BUS-HMG cycles. ", "Supernumerary embryos were cultured for a further 24 h and multicellular embryos with up to 20% of fragments were frozen slowly with 1.5 M dimethylsulphoxide on day 3 post-insemination (162 embryos in CC-HMG cycles, 102 embryos in BUS- HMG cycles). ", "Outcome was measured by embryo survival rate, embryo implantation rate and delivery rate in fresh and frozen embryo transfers. ", "Delivery rates were 31.3 and 21.7% per fresh embryo transfer in BUS-HMG and CC- HMG cycles respectively. ", "Fresh embryo implantation rates were significantly higher in collection cycles stimulated with BUS-HMG (17.9%) than in cycles stimulated with CC-HMG (11.3%). ", "Implantation rates were significantly enhanced in embryos transferred in excess of one in cycles leading to pregnancy, perhaps indicative of higher embryo quality in BUS-HMG cycles. ", "Almost all cryopreserved embryos have by now been thawed, so the contribution of frozen embryos to overall pregnancy rates can be evaluated. ", "Overall morphological survival rates of frozen-thawed embryos have by now been thawed, so the contribution of frozen embryos to overall pregnancy rates can be evaluated Overall morphological survival rates of frozen-thawed embryos were similar for 140 embryos from CC-HMG cycles (50%) and 100 embryos from BUS-HMG cycles (46%). ", "The percentage of fully intact embryos was, however, significantly lower in the BUS-HMG group (19%) than in the CC-HMG group (39.5%). ", "Delivery rates were significantly lower following 30 transfers of frozen-thawed embryos from BUS-HMG-stimulated cycles (3.3%) than following 42 transfers of frozen-thawed embryos from CC-HMG cycles (19.1%). ", "Embryo implantation rates were lower for frozen-thawed embryos from BUS-HMG cycles (2.3%) than from CC-HMG cycles (12.7%). ", "Here we demonstrate that ovarian stimulation with the long protocol BUS-HMG instead of the CC-HMG protocol led to higher embryo implantation rates in collection cycles but to lower intact embryo survival rates and to lower embryo implantation rates for frozen sibling embryos. ", "Despite the lower implantation rates with frozen embryos originating from the BUS-HMG protocol, there was no significant difference between total delivery rate per transfer from cycles stimulated with CC-HMG (30.2%) compared with BUS-HMG (33.8%)." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0014778762124478817, 0.0007196485530585051, 0.0005722727510146797, 0.0006030035438016057, 0.000587525952141732, 0.000638791942037642, 0.0005449867458082736, 0.000580847728997469, 0.0006327698356471956, 0.0005767043912783265, 0.000669833563733846, 0.0006442306330427527, 0.0005994081730023026, 0.0006430678186006844, 0.0006726342253386974, 0.0009862756123766303, 0.0006169609841890633 ]

[ "Krishika Lulla\n\nKrishika Lulla is an Indian film producer. ", "She made her foray into producing films with 2010s romantic film Anjaana Anjaani, a co-production with Sajid Nadiadwala, starring Ranbir Kapoor and Priyanka Chopra. ", "In December 2010, India's first live action animation film Toonpur Ka Superrhero was released, with Krishika at the helm as producer.", "\n\nPersonal life\nKrishika married Sunil Lulla, managing director and executive vice-chair of Eros International.", "\n\nCareer\n2011 was a successful year for the Lulla with two more movies to her credit – the much acclaimed Chalo Dilli by Shashant Shah, a fun slice of life film starring Lara Dutta and Vinay Pathak and Desi Boyz starring Akshay Kumar, John Abraham, Deepika Padukone and Chitrangada Singh. ", "Desi Boyz had Krishika launching the talented Rohit Dhawan, son of David Dhawan in his directorial debut.", "\n\nIn 2013, Krishika produced the hit romantic saga Raanjhanaa, directed by Anand L. Rai, starring Sonam Kapoor, south sensation Dhanush and Abhay Deol which went on to wow critics and audiences alike. ", "Bajatey Raho was hex production featuring an ensemble cast of Vinay Pathak, Ranvir Shorey, Tusshar Kapoor, Ravi Kishan and Dolly Ahluwalia.", "\n\nIn 2015, Krishika teamed up with notable director Anand L. Rai to present what would be one of the biggest hits of that year, Tanu Weds Manu Returns. ", " Their association further continued with Happy Bhag Jayegi, directed by Mudassar Aziz, a family entertainer starring Diana Penty, Abhay Deol, Ali Fazal and Momal Sheikh that released on 19 August 2016.", "\n\nIn 2016, Krishika produced the entertainment thriller Banjo, which was a musical drama which marking multiple national award winning Marathi Director Ravi Jadhav’s debut in Hindi starring Riteish Deshmukh and Nargis Fakhri. ", "Banjo made its worldwide release on 23 September.", "\n\nWith a diverse range of Bollywood films to her credit already, Krishika has also forayed into regional cinema and backed two Marathi projects -, Phuntroo, a sci-fi romantic love story, a first for Marathi cinema, directed by National Award Winning Sujay Dahake and & Jara Hatke, starring Mrinal Kulkarni, Indraneil Sengupta, Siddharth Menon and Shivani Rangole, a beautiful story of human relationships, which she co-produced with Ravi Jadhav, both of which released earlier this year (2016).", "\n\nWhile producing movies takes up a chunk of her time, Krishika extends her entrepreneurial skills beyond films. ", "Krishika is an active member of the Women's Wing of the IMC. ", "She was also recently unveiled as the face of leading jewelry brand Jet Gems. ", "Describing her as the epitome of what a woman achiever should aspire to be today, Jet Gems owner Pradeep Jethani unveiled the campaign at a glittering event at the JW Marriott recently.", "\n\nKrishika also recently lent her support as the brand ambassadress to the grand opening of the famous Mumbai hot spot Enigma at the JW Marriott Mumbai which is back with a bang in its new avatar.", "\n\nAs brand ambassador, Krishika recently hosted the launch of the new Asian restaurant Dashanzi at JW Marriott, Juhu, Mumbai.", "\n\nFilmography\n\nReferences\n\nExternal links\n\n \n\nCategory:Living people\nCategory:Hindi film producers\nCategory:Indian women film producers\nCategory:Film producers from Mumbai\nCategory:1980 births" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0011960058473050594, 0.0007915322785265744, 0.0006915481062605977, 0.0007222465355880558, 0.0008481377153657377, 0.0009060355369001627, 0.0008171499357558787, 0.0009487727656960487, 0.0006862545269541442, 0.0009011338115669787, 0.0006954405107535422, 0.000617701152805239, 0.0006590732955373824, 0.0006372288917191327, 0.002998344600200653, 0.0006326540606096387, 0.0006625127280130982, 0.0009221661021001637, 0.0005514671793207526, 0.0006282945978455245 ]

[ "(Touhou GIF) Yuyuko Saigyouji By ConcealedBoundary Watch\n\n9 Favourites 0 Comments 2K Views\n\nRemembering the melancholy of human existence\n\nEven ghosts stray from the path of righteousness.", "\n\n\n\nFrom Touhou 7: Perfect Cherry Blossom.", "\n\n(Actually, her design is from Touhou 13: Ten Desires, 'cause I like it more).", "\n\nIMAGE DETAILS Image size 900x720px 34.56 MB Show More\n\nPublished : Feb 27, 2017" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0011254411656409502, 0.0006044935435056686, 0.0005799466161988676, 0.0006478482391685247 ]

[ "package geometry;\n\npublic class Line {\n\n\tstatic final double INF = 1e9, EPS = 1e-9;\n\t\n\tdouble a, b, c;\n\t\n\tLine(Point p, Point q)\n\t{\n\t\tif(Math.abs(p.x - q.x) < EPS) {\ta = 1; b = 0; c = -p.x;\t}\n\t\telse\n\t\t{\n\t\t\ta = (p.y - q.y) / (q.x - p.x);\n\t\t\tb = 1.0;\n\t\t\tc = -(a * p.x + p.y);\n\t\t}\n\t\t\t\t\t\n\t}\n\t\n\tLine(Point p, double m) { a = -m; b = 1; c = -(a * p.x + p.y); } \n\t\n\tboolean parallel(Line l) { return Math.abs(a - l.a) < EPS && Math.abs(b - l.b) < EPS; }\n\t\n\tboolean same(Line l) { return parallel(l) && Math.abs(c - l.c) < EPS; }\n\t\n\tPoint intersect(Line l)\n\t{\n\t\tif(parallel(l))\n\t\t\treturn null;\n\t\tdouble x = (b * l.c - c * l.b) / (a * l.b - b * l.a);\n\t\tdouble y;\n\t\tif(Math.abs(b) < EPS)\n\t\t\t y = -l.a * x - l.c;\n\t\telse\n\t\t\ty = -a * x - c;\n\t\t\n\t\treturn new Point(x, y);\n\t}\n\t\n\tPoint closestPoint(Point p)\n\t{\n\t\tif(Math.abs(b) < EPS) return new Point(-c, p.y);\n\t\tif(Math.abs(a) < EPS) return new Point(p.x, -c);\n\t\treturn intersect(new Line(p, 1 / a));\n\t}\n\t\t\t\n}\n\n\n\n\n\n\n\n\n\n\n\n\n" ]

{ "pile_set_name": "Github" }

[ 0.005510810296982527 ]

[ "Background {#s1}\n==========\n\nCancer related issues \\[[@R01]-[@R06]\\] are linked to the BCL-2 family of proteins \\[[@R07]- [@R12]\\]. ", "BCL-2 is a known cancer target with several potential inhibitors under validation. ", "Therefore, it is of interest to design and develop new compounds from plant source with improved binding features with the BCL-2 protein. ", "Hence, we report the molecular docking analysis of Bcl-2 with phyto-compounds.", "\n\nMaterials and Methods: {#s2}\n======================\n\nBCL-2 structure: {#s2a}\n----------------\n\nThe structure data of Bcl-2 protein (PDB ID: 2W3L) was downloaded from the protein databank (PDB) \\[[@R13]\\] and processed for further analysis.", "\n\nLigand data: {#s2b}\n------------\n\nThe structures of phytocompounds such as artesunate, bruceantin, maytansin, Salvicine, indicine N-oxide, kamebanin, and oxyacanthine were downloaded from the pubchem database in SDF format and converted to PDB format using the Online Smiles Translator.", "\n\nActive site prediction: {#s2c}\n-----------------------\n\nBinding site prediction of Bcl-2 was completed using MetaPocket 2.0 server \\[[@R14]\\].", "\n\nMolecular docking: {#s2d}\n------------------\n\nPatchDock \\[[@R15],[@R16]\\] was used for the molecular docking analysis of BCL-2 with phytocompounds such as artesunate, bruceantin, maytansin, Salvicine, indicine N-oxide, kamebanin and oxyacanthine.", "\n\nResults and discussion: {#s3}\n=======================\n\nBCL2 is a known cancer target. ", "Therefore, it is of interest to design new Bcl2 inhibitors from phyto compounds such as artesunate, bruceantin, maytansin, Salvicine, indicine N-oxide, kamebanin and oxyacanthine. ", "The predicted active site residues in BCL-2 are LYS 22, GLN 25, ARG 26, THR 55, ASP 62, SER 64, ARG 66, TYR 67, ARG 68, PHE 71, LEU 80, ARG 86, ASN 102, GLY 104, VAL 107 and GLU 111. ", "The molecular docking analysis data of Bcl-2 with the phyto-compounds are given in Table 1. ", "Detailed interaction between BCL-2 and the compounds are shown in [Figure 1](#F1){ref-type=\"fig\"}. ", "The residues ARG 26, ARG 68, ARG 66, SER 64, ARG 86, ARG 68, GLY 104, LYS 22, SER 20, ASN 34, LYS 22, LYS 270, SER 351, ARG 469, and LYS 345 are found to be interacting with the phyto compounds ([Figure 1](#F1){ref-type=\"fig\"}). ", "Thus, we report the optimal binding features of these compounds with Bcl-2 for further consideration towards in vitro and in vivo validation.", "\n\nConclusions: {#s4}\n============\n\nWe report compounds with improved binding features with Bcl-2 for further consideration towards in vitro and in vivo analysis.", "\n\n**Edited by P Kangueane**\n\n**Citation:**Kirubhaanad *et al.* ", "Bioinformation 16(6):468-473 (2020)\n\n###### Molecular docking analysis of Bcl-2 with phyto-compounds\n\n S. No Compound Name Score (kcal/mol) ACE Hydrogen bonds Bond length No of non-bonded interaction\n ------- ------------------ ------------------ --------- ---------------- ------------- ------------------------------\n 1 Artesunate 4814 -211.33 ARG 26- NH-O 2.46 148\n ARG 68- NE-O 3.24 \n ARG 66- NH2-O 3.3 \n 2 Bruceantin 5714 -104.71 SER 64 OG-O 3.34 67\n 3 Maytansin 773.1 -110.4 ARG 86 NE-O 2.04 102\n 4 Salvicine 4946 -126.9 ARG 68 NE-O 2.17 131\n GLY 104 N-O 2.47 \n 5 Indicine N-oxide 4226 -130.62 LYS 22 NZ-O 1.75 37\n ARG 26 NH2-O 1.95 \n 6 Kamebanin 4002 -140.03 SER 64 OG-O 3.08 40\n 7 Oxyacanthine. ", " 6368 -102 ARG 66 NE-O 2.79 31\n\n{#F1}\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.0008865120471455157, 0.0006787559250369668, 0.0005304885562509298, 0.0005436220089904964, 0.0006217951304279268, 0.0006135204457677901, 0.0006544598727487028, 0.0008340851054526865, 0.0077351173385977745, 0.0007496857433579862, 0.0008140861755236983, 0.0005686379736289382, 0.0005430562305264175, 0.0006747407605871558, 0.0005144674214534461, 0.0005625839112326503, 0.0006918609142303467, 0.003988451790064573, 0.017920389771461487, 0.0010105472756549716 ]

[ "\n239 N.J. Super. ", "139 (1990)\n570 A.2d 1250\nFRANK BURBRIDGE AND ANGELA BURBRIDGE, HIS WIFE; JOHN E. BURBRIDGE AND MARY BURBRIDGE, HIS WIFE, JOSEPH P. BURBRIDGE AND ELAINE BURBRIDGE, HIS WIFE, PLAINTIFFS-RESPONDENTS, CROSS-APPELLANTS,\nv.\nJOHN PASCHAL AND THOMAS PASCHAL, DEFENDANTS-APPELLANTS, CROSS-RESPONDENTS.", "\nSuperior Court of New Jersey, Appellate Division.", "\nArgued October 18, 1989.", "\nDecided February 21, 1990.", "\n*142 Before Judges KING, SHEBELL and BAIME.", "\nHerbert M. Korn argued the cause for appellant (William J. DeMarco, on the brief).", "\nRichard T. Sweeney argued the cause for respondents (Sears, Sweeney & Marcickiewicz, attorneys).", "\nThe opinion of the court was delivered by KING, P.J.A.D.\nThe principal point on this appeal concerns the implication of the failure to cross-appeal from a dismissal on the merits of a count of the complaint. ", "We conclude that this failure to cross-appeal on the dismissed count was fatal to an attempt to retry that count after reversal on the direct appeal.", "\n*143 This appeal is taken from a judgment in April 1988 in which the jury awarded plaintiffs an aggregate $20,000 in compensatory and $2,000 in punitive damages for nuisance claims (Count Five) and $30,000 in compensatory and $45,000 in punitive damages for defamation claims (Count Six). ", "Defendants appeal from these verdicts, totalling $97,000. ", "The jury decided the claims on Counts One and Two (malicious prosecution) in defendants' favor. ", "The claims under the Third and Fourth Counts of the complaint, for malicious abuse of process and the Seventh Count for intentional infliction of emotional distress, were dismissed by the trial judge and not submitted to the jury. ", "Plaintiffs cross-appeal from these rulings.", "\nPlaintiffs Frank and Angela Burbridge, John and Mary Burbridge, and Joseph and Elaine Burbridge live on Thomastown Road in Mine Hill. ", "Defendants John Paschal and Thomas Paschal live across the road from plaintiffs, where they also operate a junkyard. ", "In 1977 John Paschal was cited and convicted in the Municipal Court for maintaining a nonconforming commercial use of his property, which had been zoned residential. ", "His municipal court conviction was set aside on appeal de novo to the Law Division. ", "In 1980 he applied for a license to operate the junkyard. ", "The Township Committee granted the license for an expanded nonconforming use on the condition that he erect a ten-foot fence around the site. ", "Defendant completed the fence later that year.", "\nIn February 1982 John Paschal began leasing a small, wooded area of land owned by Ann Fran Realty, located immediately adjacent to the houses of plaintiffs Joe and John Burbridge. ", "The leased property contained mine holes about 30 feet deep and 30 feet in diameter. ", "John Paschal alleges that before the lease began, the plaintiffs had illegally dumped refuse and chemicals into these mine holes. ", "In what he claims was an effort to persuade plaintiff to remove the dumped material from the Ann Fran property, Paschal posted \"no trespassing\" and \"no dumping\" signs on trees between the two lots. ", "He claims that plaintiffs responded by defacing or removing the *144 signs. ", "Paschal then erected several more signs along this property line which read, \"Joe Burbitch Landfill,\" \"Joe Burbitch Dump,\" \"24 Hr. ", "Dumping for Family Members Only\" and \"Joe Burbitch Shit.\" ", "These signs were visible from the plaintiffs' homes and from Thomastown Road. ", "Plaintiffs also allege that defendants used various forms of harassment including \"banging, laughing and jeering\" at various times, all of which plaintiffs claim constituted a common-law nuisance interfering with the use of their property.", "\nOn September 1, 1982 plaintiffs started an action in lieu of a prerogative writ against the Township of Mine Hill, its officials and defendant John Paschal to stop Paschal from expanding the scope and use of his junkyard, a nonconforming use in this residential zone. ", "Plaintiffs prevailed in that case in the Law Division and on appeal to this court but Paschal sought further relief by variance. ", "The litigation over Paschal's variance application culminated recently in his favor. ", "See Burbridge v. Mine Hill, 117 N.J. 376, 568 A.2d 527 (1990). ", "That opinion contains a detailed history of both the use of the Paschal property and of the litigation between the parties.", "\nOn October 26, 1982 defendant John Paschal filed a municipal complaint charging plaintiffs with illegal dumping on the wooded property leased to him. ", "On March 8, 1983 the municipal court found plaintiffs not guilty. ", "That complaint was the subject of plaintiffs' claims for wrongful abuse of process and malicious prosecution, asserted in the Law Division in the present case.", "\nOn April 25, 1983 plaintiffs filed this civil complaint for damages which resulted in the aggregate $97,000 judgment of April 1988 and which is the subject of this appeal. ", "Plaintiffs Frank Burbridge and Angela Burbridge, John E. Burbridge and Mary Burbridge, and Joseph Burbridge and Elaine Burbridge (collectively, plaintiffs) filed the seven-count complaint against John Thomas Paschal (Thomas) and John George Paschal (John) *145 (collectively, defendant or defendants).[1] The first and second counts of the complaint alleged that defendants instituted, with malice and without probable cause, a municipal court action resulting in a not-guilty verdict against plaintiffs Joseph and John Burbridge. ", "The third and fourth counts alleged that John Paschal utilized that legal process to intimidate and harass plaintiffs, Joseph and John Burbridge. ", "The fifth count alleged that both defendants created a common-law nuisance with regard to the property they leased near the homes of the three plaintiff couples which interfered with the use and enjoyment of plaintiffs' homes. ", "The fifth, or nuisance count stated:\n6. ", "During the term of such lease, Defendant John Paschal has utilized this property in a manner which has caused noise, dust and fumes to emanate from such property. ", "In addition, Defendant John Paschal has caused such property to be strewn with trash, litter, scrap materials and other debris. ", "Defendant John Paschal has also caused to be erected on such property certain signs and placards which are derogatory in nature and which are located so as to be constantly visible from Plaintiffs' properties and Thomastown Road.", "\n7. ", "As a result of Defendant John Paschal's use of the above described property as set forth herein, Plaintiffs have suffered serious and unreasonable interference with the use and enjoyment of their respective properties and have suffered a diminution of the residential property value of their respective properties.", "\nWHEREFORE, Plaintiffs demand judgment against the Defendant John Paschal:\nA. Directing John Paschal to cease and desist in the utilization of such property in such a manner as constitutes a nuisance;\nB. Awarding to Plaintiffs damages, reasonable attorney's fees and costs of suit.", "\nThe sixth, or defamation count alleged that defendants had erected scandalous and derogatory signs which were visible from plaintiffs' homes as well as to the public, and that plaintiffs were thereby defamed in reputation and character. ", "The sixth count stated:\n2. ", "Defendant John Paschal has erected, or caused to be erected, certain signs which present Plaintiffs in a false and derogatory light as aforesaid.", "\n\n*146 3. ", "Defendant Thomas Paschal has knowingly and willingly taken part in the construction and design of these scandalous and derogatory signs.", "\n4. ", "The aforesaid signs are visible from Plaintiffs' respective properties as well as from Thomastown Road.", "\n5. ", "These aforesaid signs, aside from being an eyesore and blight upon the neighborhood in themselves, convey the false message that the condition of John Paschal's leasehold property as set forth previously, that is that it is strewn with litter, scrap and debris, is the result of actions by Plaintiffs.", "\n6. ", "These signs were constructed by Defendants John Paschal and Thomas Paschal with reckless disregard for the truth, and with the intent to injure the name and reputation of Plaintiffs to subject them to public scorn, and by portraying them in this false light, to embarrass and humiliate Plaintiffs in the eyes of the community.", "\n7. ", "These signs have been seen and read by a large number of people.", "\n8. ", "As a result of these aforesaid actions by Defendants the Plaintiffs have sustained injury to their reputation, fame or character, have suffered personal humiliation, embarrassment and mental anguish, suffering and distress.", "\nWHEREFORE, Plaintiffs demand judgment against Defendants John Paschal and Thomas Paschal for compensatory damages, punitive damages, interest and costs of suit.", "\nThe seventh count alleged that defendants had intentionally inflicted severe emotional distress upon plaintiffs. ", "Plaintiffs asserted that the Paschals had used the leasehold property \"consistently and systematically [to] harass, impede and prevent plaintiffs from all reasonable use and enjoyment of [their] properties.\" ", "Plaintiffs alleged that defendants knew that their actions would \"inflict severe emotional shock and trauma upon plaintiffs\" and that as a result \"of the extreme and outrageous actions of defendant ... plaintiffs have suffered severe and debilitating emotional shock and trauma.\"", "\nThese events took place as the trial date approached. ", "On February 14, 1985 a notice of trial was issued assigning a trial date of March 25, 1985. ", "On February 9, 1985 plaintiffs had obtained orders compelling defendant John Paschal to respond to certain interrogatories and compelling defendant Thomas Paschal to appear for depositions. ", "On March 7, 1985 plaintiffs obtained an order compelling both defendants to disclose their financial status.", "\nJohn Paschal failed to make discovery in accordance with the March 7, 1985 order. ", "Further, he failed to appear for court-ordered *147 depositions which had been scheduled for March 25 or April 1, 1985; defendant's counsel explained that defendant was \"outside the State.\"", "\nOn April 9, 1985 the court again ordered John Paschal to appear for depositions and to provide discovery as he had previously been ordered. ", "The court also instructed that in the event Paschal failed to appear, an order would be entered suppressing his answer and defenses and entering default on plaintiffs' complaint. ", "The trial date was rescheduled for April 30.", "\nOn April 30 defendant John Paschal made an application to Judge Gascoyne for a two-week adjournment of this matter. ", "Paschal argued that an adjournment was necessary because of a controversy which allegedly had developed between him and his attorney and which prompted him to seek substitute counsel. ", "That motion was denied. ", "The court advised defendant that he would have to proceed pro se if his counsel would not proceed on the trial date set by the court.", "\nOn May 2, 1985, after the case had been assigned to a trial judge, defendant John Paschal unsuccessfully made another application for a four-day adjournment of the trial to allow his newly-retained attorney to prepare for trial. ", "During the preliminaries before selecting a jury, defendant indicated that he was not feeling well. ", "The trial judge referred him to the presiding judge, civil part, to request an adjournment on the basis of illness. ", "Defendant made this request to the presiding judge, but the application was again denied.", "\nDefendant collapsed during the luncheon recess on May 2 and was transported to the local hospital by ambulance. ", "The trial judge was informed of the reason for defendant's failure to return to court after recess but nevertheless entered a default judgment against him on May 6. ", "The default order provided that the default would be vacated on or before May 17 upon a showing that defendant's absence from the courtroom was justified. ", "Defendant then submitted a certification in support *148 of his motion to vacate the default, which described the symptoms he had experienced during his absence from the courtroom on May 2. ", "His examining physician's report indicated that although defendant's electrocardiogram, pulse and blood pressure were normal, defendant had suffered from a vasovagal stress reaction associated with hyperventilation, bringing on the manifested physical reactions. ", "Despite these contentions, the trial judge concluded that defendant had feigned illness as a means of obtaining a continuance and refused to vacate the default.", "\nPursuant to the default order entered on May 6, a proof hearing was conducted on May 20 and 21, during which proofs were submitted on behalf of plaintiffs. ", "Counsel for defendants was present and participated. ", "On May 30, 1985 Judge D'Ambrosio entered judgments in favor of the various plaintiffs in the total amount of $180,000 for compensatory and punitive damages. ", "These judgments were as follows: Frank and Angela Burbridge, $25,000 compensatory and $5,250 punitive damages; John E. and Mary Burbridge, $50,000 compensatory and $8,250 punitive damages; Joseph P. and Elaine Burbridge, $90,000 compensatory and $11,500 punitive damages. ", "The judgment awarded these damages on Counts One, Two, Five and Seven — the counts for malicious prosecution (One and Two), nuisance (Five), and intentional infliction of emotional harm (Seven), respectively. ", "The judge dismissed Counts 3 and 4 (malicious abuse of process) and 6 (defamation). ", "R. 4:43-2(b). ", "The order of dismissal specifically stated: \"Further Ordered that Counts 3, 4 and 6 be and are hereby dismissed.\"", "\nJudge D'Ambrosio said in his oral decision at the proof hearing: \"It is conceded by both sides that the complaint although in seven counts falls into four basic causes of action being asserted.\" ", "These were nuisance, defamation, infliction of severe emotional distress, and malicious prosecution. ", "On the dismissal of the defamation Count Six, Judge D'Ambrosio specifically stated:\n\n*149 I will take the defamation allegations first because it seems to this Court that the proof of special damages is a requirement of a cause of action for defamation unless the defamation is one of these special categories which our Courts refer to as the per se defamations.", "\nI don't know why this isn't a per se type of event, but the Courts have said it isn't. ", "And there was no proof of special damages. ", "So there can be no recovery on the defamation counts.", "\nI suppose there's a tenuous, or comes close with regard to Joseph Burbridge and Elaine Burbridge. ", "Joseph, according to the evidence, was once a mayor of the town, and mayor was referred to. ", "However, it didn't allege that he did anything wrong as mayor. ", "It wasn't a defamation with regard to his occupation or profession, because he wasn't mayor at the time.", "\nAnd Elaine, for some reason, was singled out for an effigy.", "\nIt would be a stretch of the imagination to suggest that some profession was being suggested by the placing of a thin lath stick between the legs of the effigy. ", "It would be too tenuous and, as a matter of fact, thinking about it, perhaps defiling the people more than is warranted.", "\nAnd so, I cannot come to any conclusion, I cannot make any finding of a per se defamation under the law.", "\nI did some research. ", "I thought there should be. ", "I just couldn't find out that indicated that this is a per se. ", "And there being no special damages, I find that I can't award damage on the defamation allegations.", "\nSee Heimbach v. Mueller, 229 N.J. Super. ", "17, 23-24, 550 A.2d 993 (App.", "Div. ", "1988); Morales v. Santiago, 217 N.J. Super. ", "496, 505, 526 A.2d 266 (App.", "Div. ", "1987) (on failure to prove a prima facie case of damages after default).", "\nDefendants then appealed to this court. ", "On June 16, 1987 we reversed the judgment of May 30, 1985 and remanded the case to the Law Division \"for further proceedings.\" ", "There was no cross-appeal taken from the dismissal of Counts Three and Four (malicious abuse of process) and Count Six (defamation). ", "R. 2:3-4.", "\nFollowing our reversal, this case proceeded to trial on March 8, 1988. ", "Before the trial began, counsel and the court discussed the issues to be tried. ", "The primary dispute was whether the malicious abuse of process counts (Three and Four) and the defamation count (Six), dismissed after the proof hearing, were still viable. ", "The newly-assigned trial judge, who was not the original trial judge, concluded that these counts were still in the case and could be tried. ", "The defense then requested a continuance *150 on the grounds that it was unfairly surprised by this development. ", "The request was denied.", "\nAs described, the jury returned the aggregate verdict on the defamation count in the sum of $30,000 compensatory damages and $45,000 in punitive damages and the aggregate verdict on the nuisance count in the sum of $20,000 in compensatory damages and $2,000 in punitive damages. ", "The jury found in favor of defendants on the malicious prosecution counts. ", "As noted, the judge refused to permit Counts Three and Four, malicious abuse of process, and Count Seven, malicious infliction of emotional harm, to go to the jury. ", "Defendants then appealed the judgment on Counts 5 and 6; plaintiffs cross-appealed the judge's dismissal of Counts 3, 4 and 7.", "\n\nI\nDefendant-appellant John Paschal urges that the trial judge erred in relitigating Count Six, the defamation count, and in submitting that claim to the jury after it had been dismissed. ", "Plaintiffs urge that defendant's contention places an overly technical emphasis on the procedural rather than the substantive aspects of this appeal. ", "We disagree with plaintiffs and must reverse the verdict on the defamation count.", "\nThe trial judge thought that the \"equitable thing to do\" was to set aside the dismissals against plaintiffs previously entered as a result of the proof hearing and \"to permit the plaintiff to go to trial on them.\" ", "He said that he chose not to \"rely on form over substance.\"", "\nThe problem is that the judge simply had no jurisdiction to rehear the defamation claims asserted in Count Six. ", "These claims had been heard on the merits and dismissed for failure to establish a compensable claim at the time of the proof hearing. ", "Judge D'Ambrosio specifically found that \"there can be no recovery on the defamation count\" and ordered that count dismissed in the May 30, 1985 order for judgment. ", "This dismissal operated as an adjudication on the merits and was *151 with prejudice. ", "R. 4:37-2(d). ", "It was never the subject of a cross-appeal, R. 2:3-4, or a motion for relief from judgment, R. 4:50-1.", "\nNor can we take the view that our previous decision simply sent the entire matter back to start the case over afresh and from the beginning, procedurally. ", "True, the 1985 notice of appeal recited that defendant John Paschal appealed \"from the entire decision\" of the Law Division. ", "That notice of appeal referred both to the orders of May 21 and May 30, 1985 and to the failure of Judge D'Ambrosio to \"recuse himself\" from the two-day proof hearing as grounds for appeal.", "\nOur 1987 opinion reversed the aggregate judgments for the plaintiffs of $180,000 on Counts One, Two, Five and Seven because \"the refusal to grant the adjournment or to vacate the default requires a reversal of the judgment.\" ", "There was nothing in our 1987 opinion to suggest that the reversal was in any way intended to deprive defendant of the favorable results obtained in the Law Division on Counts Three, Four and Six at the conclusion of the proof hearing. ", "If plaintiffs did not like the dismissals on those counts, they should have cross-appealed. ", "Since they did not, this court had no jurisdiction, under settled principles of law, to disturb these dismissals, even at the time of the first appeal to us back in 1987.", "\nThis principle is established by an unbroken line of cases in our modern era. ", "A party may not attack the judgment under review without having appealed. \"", "This is the procedure contemplated and provided for by the rules and it has been recognized as a matter of practice.\" ", "Liberty Title & Trust Co. v. Plews, 6 N.J. 28, 45, 77 A.2d 219 (1950) (Vanderbilt, C.J.). ", "In Franklin Discount Co. v. Ford, 27 N.J. 473, 491, 143 A.2d 161 (1958), the Supreme Court found itself \"without jurisdiction to decide the question\" raised by plaintiff-respondent as to whether \"the trial court erroneously denied its motion for a non-jury trial.\" ", "The Supreme Court rather conclusively stated: \"The plaintiff has not cross-appealed from the judgment below and *152 we have held that a party, in order to attack the actions below which were adverse to him, must pursue a cross-appeal.\" ", "Ibid.", "\nThis principle appears to command universal application. ", "In Mondelli v. State Farm Mut. ", "Auto. ", "Ins. ", "Co., 102 N.J. 167, 174, 506 A.2d 728 (1986), the plaintiff alone sought relief in the Supreme Court. ", "In the absence of a cross-appeal by either insurance carrier defendant, the Court noted that it \"left in place\" that portion of the trial judgment not subject of the appeal. ", "The Court said: \"In so doing we do not at all suggest a definite ruling on the point, or even imply that the result is correct. ", "The question is just not before us.\" ", "Ibid. ", "Accord, State v. Ogar, 229 N.J. Super. ", "459, 472, 551 A.2d 1037 (App.", "Div. ", "1989) (defendants who failed to file cross-appeal from trial judge's decision upholding constitutionality of criminal statute are \"precluded from raising this point as an issue\" on appeal); State v. Pescatore, 213 N.J. Super. ", "22, 30, 516 A.2d 261 (App. ", "Div. ", "1986), aff'd o.b. ", "105 N.J. 441, 522 A.2d 440 (1987) (\"Failure to cross-appeal effectively precludes [defendants] from raising that argument.\"); ", "State v. Sanchez, 183 N.J. Super. ", "391, 396, 444 A.2d 52 (App.", "Div. ", "1972) (Because the State failed to cross-appeal, \"it is foreclosed from questioning that determination at this late date.\"); ", "Areba School Corp. v. Mayor & Council of Tp. ", "of Randolph, 151 N.J. Super. ", "336, 342, 376 A.2d 1273 (App.", "Div.), ", "certif. ", "den. ", "75 N.J. 586, 384 A.2d 816 (1977) (\"In the absence of a cross-appeal this issue is not before us\"); Lyons v. Hartford Ins. ", "Group, 125 N.J. Super. ", "239, 248, 310 A.2d 485 (App.", "Div. ", "1973) (\"We cannot consider the point, for it can only be brought here by cross-appeal and none has been filed,\" citing Franklin Discount). ", "The only slight amelioration of the principle we can find is Matter of Estate of Karas, 197 N.J. Super. ", "642, 645, 485 A.2d 1083 (App.", "Div. ", "1984), where a modification in the judgment, not subject of the appeal, made \"no substantive change in the result [that trial] Judge McGann intended.\" ", "We stated, \"[i]n reality we have simply used a different theory than that relied upon by the trial judge to reach the same end.\" ", "Ibid. ", "An affirmance by us on Count Six here would hardly reach the \"same end\" in this case but would *153 be a reversal, in effect, of the original final order of dismissal of that count.", "\nWe conclude that the judgment on appeal representing damages for defamation as claimed in Count Six must be reversed. ", "This claim was dismissed by Judge D'Ambrosio, rightly or wrongly, in the May 30, 1985 order after the two-day proof hearing. ", "No appeal or cross-appeal was taken from that final order. ", "R. 2:2-3; R. 2:3-4. ", "We could not have altered that portion of the judgment in defendant's favor, which had dismissed the three counts of the complaint, (Counts Three, Four and Six), at the time of the 1987 appeal absent a cross-appeal properly taken and before us at that time. ", "We cannot allow a judgment contrary to and inconsistent with that 1985 order of dismissal to stand at this time, no matter what the \"equities\" may have seemed to the trial judge upon our initial remand in 1987.", "\n\nII\nWe next consider the claim that a photograph of plaintiffs' lawn in the Spring of 1982, P-38, was improperly admitted into evidence and was unduly prejudicial to the plaintiff. ", "On the second day of trial, plaintiff successfully offered into evidence a photograph (P-38) showing the view of plaintiff Joseph Burbridge's lawn from the roof of his house. ", "The photograph clearly shows that a portion of the grass on his lawn, about 300 square feet, had turned brown.", "\nJust before P-38 was introduced into evidence, plaintiff Joseph Burbridge had testified on direct examination that in 1982 his front yard and the bushes around his home had been vandalized for \"a total damage of approximately $2,000.\" ", "Joseph Burbridge testified that he later mentioned the vandalism to defendant John Paschal during a telephone conversation. ", "When asked to recount defendant's reply, plaintiff testified:\n\n*154 A. Yes. ", "I said to Mr. Paschal, I can't say you did, but I said it's awful funny that all of a sudden I live here for so many years and all of a sudden this would happen. ", "I said I can't say you did it. ", "I didn't see you do it, but I know you either did it or had it done.", "\nQ. Did he reply?", "\nA. I said now what will you do about the front and he said I don't want to talk about it. ", "I don't want to talk about it, I don't want to talk about it and that was the end of our conversation.", "\nNo evidence was offered to show that defendant caused the damage to plaintiff's property as shown in P-38.", "\nDefendant objected to the offer of the photograph in evidence because no allegation had been made regarding the damage to plaintiff's lawn. ", "Plaintiff's counsel agreed, saying \"there is no claim being made for the damage, that is liquidated claim for the damage done to the front lawn.\" ", "The judge then interjected the comment: \"It goes to the state of mind, is that what you're saying?\" ", "Plaintiff's counsel responded: \"It goes to the state of mind, to the intentions of this defendant from the beginning.\"", "\nThe judge then allowed P-38 into evidence with this comment:\nLadies and gentlemen, just so that you know what we're talking about, this photograph and the testimony about the damage to the front yard is not being offered so that you would award any damages for for injury to the front yard. ", "It is offered only to show the state of mind of the defendant during the time.", "\nPlaintiff now asserts on appeal that the colloquy between the principals justified allowing P-38 into evidence as a species of adoptive admission. ", "Evid.", "R. 63(8)(b). ", "That rule provides that \"a statement is admissible against a party, ... (b) if the party with knowledge of the content of the statement has, by words, or other conduct, manifested his adoption of it or his belief in its truth.\" ", "Ibid. ", "Defendant's alleged refusal to discuss the alleged vandalism on the telephone was not an admission of its truth, as plaintiff himself did not actually directly accuse defendant of the vandalism during the conversation, and defendant himself had no duty to respond in the circumstances.", "\nOur Supreme Court has noted that the \"adoptive admission\" exception \"must be used with caution and only when the trial *155 judge is satisfied preliminarily that all conditions for its application have been established by the proponent.\" ", "Greenberg v. Stanley, 30 N.J. 485, 498-499, 153 A.2d 833 (1959); cf. ", "State v. Thompson, 59 N.J. 396, 408-410, 283 A.2d 513 (1971) (inculpatory nature of conversation between defendant and another was \"inescapable\"). ", "In these circumstances, we conclude that a reply in the form of an outright denial was not called for from the defendant, the failure of which would subject him to the type of damaging evidentiary admission contemplated by the exception.", "\nPresumably, the trial judge admitted P-38 as evidence of another \"civil wrong\" to show defendant's state of mind. ", "He did this supposedly to show defendant's propensity or disposition to commit such wrongs against plaintiffs; however, in so doing he failed to consider the safeguards of Evid.", "R. 55. ", "See also Evid.", "R. 8. ", "Since there was no evidence that defendant committed the civil wrong, Evid.", "R. 55 itself could not justify admissibility. ", "When an offer of this type of evidence is made, the judge should conduct an Evid.", "R. 8 hearing, out of the presence of the jury, on threshold admissibility. ", "In criminal cases, the standard of proof in determining whether these prior events did in fact occur is \"by the clear and convincing evidence doctrine.\" ", "State v. Wilson, 158 N.J. Super. ", "1, 5-6, 385 A.2d 304 (App.", "Div. ", "1978), certif. ", "den. ", "79 N.J. 473, 401 A.2d 229 (1978); McCormick, Evidence § 190 at 564 (3rd 1984); Buinno, Current N.J. Rules of Evidence, Comment 3 to Evid.", "R. 55 at 473 (1989). ", "We think that a preponderance of evidence burden, the routine civil burden, is sufficient in a civil case.", "\nEven though we disapprove the admission of P-38, we conclude that the error was harmless with regard to the remaining question before us, whether the plaintiff's verdict on the nuisance count, $20,000 compensatory and $2,000 punitive, should be reversed. ", "As we construe the record, defendant did while testifying deny participating in the alleged vandalism of plaintiffs' lawn and property and effectively denied having *156 made any admissions by silence or evasion. ", "Moreover, the jury had the opportunity to hear not only the very tenuous, if not nonexistent, nature of the alleged adoptive admission as alleged by plaintiff but also defendant's own version of the telephone conversation, during which he also made references to vandalism on his own property by unknown persons. ", "With these considerations in mind, we are satisfied that the error did not taint the jury's verdict on nuisance. ", "R. 2:10-2.", "\nThe verdict was based on clearly established acts of defendant which fully support the nuisance theory. ", "See Sans v. Ramsey Golf & Country Club, Inc., 29 N.J. 438, 448-449, 149 A.2d 599 (1959); Rose v. Chatkin, 187 N.J. Super. ", "210, 216-217, 453 A.2d 1378 (Ch.", "Div. ", "1982). ", "Plaintiff did not exploit the improperly admitted P-38 on summation to stir the jury's emotions. ", "The verdict on the nuisance count, particularly as to punitive damages, was moderate in amount and reflected no likelihood of distortion from the evidentiary error. ", "Alone, this erroneous ruling on admissibility is not sufficient to command a new trial where we are otherwise convinced that substantial justice has been done by the verdict. ", "See Gaido v. Weiser, 115 N.J. 310, 311, 558 A.2d 845 (1989).", "\n\nIII\nWe are satisfied that the remaining relevant points raised by defendants on this appeal are clearly without merit and require no discussion. ", "They are: (1) that the voir dire of the jury was inadequate, (2) that use of the matrimonial affidavits and cross-examination of Officer Spetz was error and (3) that the nuisance count was unproved as matter of law. ", "R. 2:11-3(e)(1)(E).", "\n\nIV\nThe next point requiring discussion on this appeal and cross-appeal is the propriety of the trial judge's dismissal of the Seventh Count of plaintiffs' complaint, the Count for \"intentional infliction of emotional distress.\" ", "The complaint specifically *157 alleged that plaintiffs \"suffered severe and debilitating emotional shock and trauma.\" ", "We conclude that the trial judge properly removed this count from the jury.", "\nWe are guided by the standards in Buckley v. Trenton Saving Fund Soc., ", "111 N.J. 355, 544 A.2d 857 (1988), decided five months after the trial of this case. ", "In Buckley, Justice Pollock described the requisites for such a claim:\nGenerally speaking, to establish a claim for intentional infliction of emotional distress, the plaintiff must establish intentional and outrageous conduct by the defendant, proximate cause, and distress that is severe. ", "Initially, the plaintiff must prove that the defendant acted intentionally or recklessly. ", "For an intentional act to result in liability, the defendant must intend both to do the act and to produce emotional distress. ", "Liability will also attach when the defendant acts recklessly in deliberate disregard of a high degree of probability that emotional distress will follow.", "\nSecond, the defendant's conduct must be extreme and outrageous. ", "The conduct must be \"so outrageous in character, and so extreme in degree, as to go beyond all possible bounds of decency, and to be regarded as atrocious, and utterly intolerable in a civilized community.\" ", "Third, the defendant's actions must have been the proximate cause of the plaintiff's emotional distress. ", "Fourth, the emotional distress suffered by the plaintiff must be \"so severe that no reasonable man could be expected to endure it.\" ", "By circumscribing the cause of action with an elevated threshold for liability and damages, courts have authorized legitimate claims while eliminating those that should not be compensable.", "\nThe severity of the emotional distress raises questions of both law and fact. ", "Thus, the court decides whether as a matter of law such emotional distress can be found, and the jury decides whether it has in fact been proved. ", "When conduct is directed at a third party, proof of bodily harm is required, but when the intentional conduct is directed at the plaintiff, he or she need not prove any physical injury. ", "It suffices that the conduct produce emotional distress that is severe. [", "Buckley, 111 N.J. at 366-367, 544 A.2d 857 (citations omitted).]", "\nThe judge concluded that a jury could find that defendants' conduct was \"extreme and outrageous.\" ", "However, after considering the testimony and all reasonable inferences, he decided that there was not enough evidence of severe emotional distress to create a case for the jury. ", "He said:\nI tend to agree that there has been less than enough on — in this case on that second aspect of the intentional infliction count. ", "I don't think we have any real evidence of severe emotional distress. ", "We have certainly some emotional distress. ", "I don't doubt that. ", "But we don't really have any, as far as I recall, anything severe in the sense that people were — even the fear seemed to be *158 downplayed considerably. ", "We do have a situation where it seemed that the Plaintiffs were able to live with the problem fairly well. ", "Although there's no question that it was an annoyance and bothersome and caused them upset, that type of thing. ", "I think the evidence is not sufficient on the severe emotional aspect to send this cause of action to the Jury. ", "So I'm going to take this one away from the Jury.", "\nWe agree and affirm. ", "We do not think that a cause of action was proved under the Buckley test.", "\nFinally, the plaintiffs' claim of error in not submitting to the jury the claims on Count Three and Four (malicious abuse of process) is clearly without merit, R. 2:11-3(e)(1)(E), both substantively and for the reasons given in I. In view of our dispositive rulings in I and II, we need not consider any other points raised on this appeal.", "\nOn appeal, reversed in part and affirmed in part; remanded for entry of judgment of dismissal on Count Six (defamation); the judgment on Count Five (nuisance) is affirmed. ", "On the cross-appeal, affirmed.", "\nNOTES\n[1] Although John and Thomas Paschal were both named as defendants, Thomas was reportedly in military service at the time of these proceedings and his status as a participating defendant is thus unclear.", "\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0.0009976413566619158, 0.0007548349676653743, 0.0007389427628368139, 0.0006503955228254199, 0.0006547999219037592, 0.0007721315487287939, 0.0006763199926353991, 0.0005836402415297925, 0.0006265687989071012, 0.000797751359641552, 0.0008499077521264553, 0.0006588720134459436, 0.0007849999237805605, 0.000953132112044841, 0.0006054374389350414, 0.001238481723703444, 0.0010526592377573252, 0.0007640968542546034, 0.0005998516571708024, 0.0009069411316886544, 0.0006895491969771683, 0.0005813509342260659, 0.0006837424589321017, 0.0009725908166728914, 0.0029658672865480185, 0.0009037114796228707, 0.0008478007512167096, 0.0010099081555381417, 0.8509330153465271, 0.0007130488520488143, 0.004884119611233473, 0.0007893415167927742, 0.0006175957969389856, 0.0006175177986733615, 0.0007130379090085626, 0.0006090289098210633, 0.0006958446465432644, 0.0008794247405603528, 0.0007392113911919296, 0.0007163743721321225, 0.0008599000866524875, 0.001215646043419838, 0.0008127285400405526, 0.000739456620067358, 0.0012485464103519917, 0.03647230193018913, 0.0007469815318472683, 0.0013101339573040605, 0.0007493472076021135, 0.0008962691063061357, 0.0006990466499701142, 0.0007596565410494804, 0.0006613529403693974, 0.0011206691851839423, 0.0007507001864723861, 0.0012900278670713305, 0.0007230161572806537, 0.0013671480119228363, 0.0007647043676115572, 0.001202064217068255, 0.0010542781092226505, 0.0013101339573040605, 0.000559671432711184, 0.0014581186696887016, 0.0031446563079953194, 0.0009799042018130422, 0.0012959593441337347, 0.0008536855457350612, 0.0014199791476130486, 0.0005528511246666312, 0.0005873112240806222, 0.0006748689920641482, 0.000590766139794141, 0.0006782175623811781, 0.0006566422525793314, 0.0006845336174592376, 0.0007724645547568798, 0.0006996991578489542, 0.0006750330794602633, 0.0006438439013436437, 0.000772763101849705, 0.000581661588512361, 0.0006336017395369709, 0.000588333117775619, 0.0008176051778718829, 0.0006087676738388836, 0.0007594002527184784, 0.0007489159470424056, 0.0006810373743064702, 0.0005769534036517143, 0.0006830344791524112, 0.0008181487792171538, 0.0005881018005311489, 0.0005462996196001768, 0.0008416460477747023, 0.0013455329462885857, 0.0013274798402562737, 0.00112964678555727, 0.0007158662774600089, 0.0006569407414644957, 0.0005897004157304764, 0.010229118168354034, 0.000773677951656282, 0.0006673717289231718, 0.0008063713321462274, 0.000770299113355577, 0.0005882991827093065, 0.0005899126408621669, 0.000753119878936559, 0.0007491675787605345, 0.008340391330420971, 0.0018319380469620228, 0.0006300524692051113, 0.0009669979917816818, 0.0005985538591630757, 0.0006247507408261299, 0.0011341436766088009, 0.0008545152959413826, 0.0007454828009940684, 0.0006865759496577084, 0.0008487396407872438, 0.0007578321965411305, 0.00069098686799407, 0.0008487396407872438, 0.0007300680154003203, 0.0006047598435543478, 0.0005965536693111062, 0.0008515489171259105, 0.000791593047324568, 0.0006019208231009543, 0.000545859569683671, 0.000742752687074244, 0.0006349152536131442, 0.0006438703276216984, 0.0006488999933935702, 0.001263958984054625, 0.0008151259389705956, 0.001222417806275189, 0.0006680192309431732, 0.0007664603763259947, 0.0006314772181212902, 0.0007039224146865308, 0.0006321040564216673, 0.0007072131847962737, 0.0009930047672241926, 0.0006789981853216887, 0.0006894696271046996, 0.0008170708897523582, 0.0007383577758446336, 0.0007334197289310396, 0.0005794796743430197, 0.0005800204235129058, 0.0006727412110194564, 0.0007148814620450139, 0.0006583895883522928, 0.0007722640293650329, 0.0006061112508177757, 0.0005981549620628357, 0.0005862793186679482, 0.0005602184683084488, 0.0007160900277085602, 0.0008074462530203164, 0.000646271975710988, 0.000775543216150254, 0.0006382229039445519, 0.0009309416636824608, 0.0021504724863916636, 0.0008361894288100302, 0.0008508575265295804, 0.0006192685104906559, 0.0006215720204636455, 0.0006222682422958314, 0.000775543216150254, 0.0007905274978838861, 0.0008026505238376558, 0.0008487396407872438, 0.0006932957912795246, 0.0007007475360296667, 0.0008487396407872438, 0.007560013793408871, 0.0006832223734818399, 0.0009802118875086308, 0.0008619053405709565, 0.0008487396407872438, 0.0006257974309846759, 0.0006474581314250827, 0.0008188370848074555, 0.000730172439943999, 0.0007249037735164165, 0.0008762722136452794, 0.0062388344667851925, 0.0007222341955639422, 0.0008596248226240277, 0.0006984573556110263, 0.0008487396407872438, 0.0005873714108020067, 0.0006535043939948082, 0.0008196606650017202, 0.0008487396407872438, 0.0006809737533330917, 0.000904713524505496, 0.000775543216150254, 0.0006653661257587373, 0.000759462418500334, 0.0006797133246436715, 0.0007271136273629963, 0.0008906165603548288, 0.0006122493068687618, 0.000656462914776057, 0.0006272071623243392, 0.0006822394789196551, 0.0006560106994584203, 0.0007511506555601954, 0.0006931068492121994, 0.0006708419532515109, 0.0008134072995744646, 0.0009535467252135277, 0.0007467152900062501, 0.001125496462918818, 0.0007163846166804433, 0.000941403501201421, 0.0007124025141820312, 0.0007380728493444622, 0.0006597202154807746, 0.0007060189382173121, 0.0005718476604670286, 0.0008920947439037263, 0.0005464449641294777, 0.0007516078185290098, 0.0008518025861121714, 0.0007760426378808916, 0.0006495474954135716, 0.000775543216150254, 0.0008341994835063815, 0.0005700975307263434, 0.0008219840819947422, 0.0006751678301952779, 0.0006190452259033918, 0.0007715769461356103, 0.0008633133256807923, 0.0009071437525562942, 0.0006751167238689959, 0.0009663048549555242, 0.0007837024168111384, 0.0007119474466890097, 0.000785798067227006, 0.0006276027415879071, 0.0006554033025167882, 0.0010599192464724183, 0.0006731090252287686, 0.0008487396407872438, 0.0007677616667933762, 0.0062388344667851925, 0.0006866414332762361, 0.000645751366391778, 0.0006123091443441808, 0.0008099519764073193, 0.0008580825524404645, 0.0007399099413305521, 0.0007309229113161564, 0.0008376787882298231, 0.0007639926625415683, 0.0007817068253643811, 0.0007424951181747019, 0.0008487396407872438, 0.0007633646600879729, 0.0007937691989354789, 0.0008371290168724954, 0.000736225105356425, 0.0006436319672502577, 0.0005447738221846521, 0.0014454348711296916, 0.0009642090299166739, 0.0007318289717659354, 0.0013329795328900218, 0.0006652041920460761, 0.0005861949757672846, 0.0006675737095065415, 0.0007584672421216965, 0.000871487776748836, 0.0006499527371488512, 0.0007244587177410722, 0.0017386467661708593, 0.001018620328977704, 0.0007314260001294315, 0.0007037524483166635, 0.0007505413959734142, 0.0005835509509779513, 0.0006140106706880033, 0.002506847260519862, 0.0007480283384211361, 0.000701762328390032, 0.0008687906665727496, 0.0006502107717096806, 0.000637022138107568, 0.000908315647393465, 0.0006288879667408764, 0.0006744032143615186, 0.0006608409457840025, 0.0006206668331287801, 0.000882999156601727, 0.000699653523042798, 0.0007132615428417921, 0.0005303081125020981, 0.0007301038131117821, 0.0006224102689884603, 0.0007829529349692166, 0.0006600950728170574, 0.0005788230919279158, 0.001995444530621171 ]

[ "Review\n\nWe use the word beautiful everyday but probably could not come up with a clear definition of what it really means. ", "We cannot come up with a clear definition of what is beautiful because beauty is somewhat conditional. ", "What is beautiful to me might be ugly to another person, and what is beautiful to that person might be something that I think is totally disgusting. ", "It is why we have people who hang crosses in their living room and other people that want to hang them from those crosses, it is why we have people who are addicted to porn and why we have people who get their porn from a PBS special on \"The Lost Dinosaurs,\" and, it is why a snobby white basketball player looks beautiful to Duke fans but looks like a jackass to the rest of America. ", "It is tough to define beauty as anything but conditional.", "\n\nBeauty is just as conditional in music but it can be broken up into genres and subjects. ", "What a metal fan finds \"beautiful\" is going to be different from what a hip hop fan finds beautiful (unless this is a Jay Z and Linkin Park CD,) and what an indie fan finds \"beautiful\" is also going to be different from what a hip hop finds \"beautiful\" (unless this is a Jaydiohead CD.) ", "Also what an indie fan finds \"beautiful\" when he or she is depressed is going to be different from what a metal fan finds \"beautiful\" when he or she is depressed, what a hip hop fan finds \"beautiful\" when he or she is working out is going to be different from what an emo fan finds \"beautiful\" when he or she is working, and what a electronica fan finds \"beautiful\" when he or she is in love is going to be different from what a post-hardcore fan finds \"beautiful\" when he or she is in love. ", "Beauty is not only conditional in music but it also depends on the genre and the subject manner the music falls under. ", "It almost seems like it would be impossible to find an album that everyone found beautiful.", "\n\nSo, trying to find an album that any music fan finds beautiful is going to be twice as difficult as finding a man that every woman finds attractive (Ryan Gosling?). ", "It is going to be twice as difficult finding that one show that everyone describes as beautiful, the one movie that every critic thinks is beautiful, and the one team that every sports fan finds beautiful. ", "It seems like finding an album that fans of any genre and in any mood could find \"beautiful\" would be as impossible as finding one person who didn't link KONY video today.", "\n\nIt seems like it would be impossible to find an album that transcends beauty, but Sigur Ros have always been a band that have made the impossible possible. ", "They are an Icelandic band that is so good that they have made it in the United States, they are a band that can make 10 minute songs that never seem to drag on or become repetitive, they are a band that has released over three quality albums in an era where bands cannot put out one good single, and they are a band that trascends the normal definition of beauty on their 2008 album Med Sud I Eyrum Spilum Endalust by making songs for fans of any genre and making songs for any occasion.", "\n\nThe first thing that makes this album a beautiful album for every music fan is that it sounds like just about any type of music. ", "The song \"Festival\" is a great example of this. ", "The first half of the song sound likes an brilliant combination of Radiohead's \"Give Up The Ghost,\" U2's \"Where The Streets Have No Name,\" the opening parts of Arcade Fire's \"Haiti,\" and any hard rock bands attempt at a power ballad. ", "The second half of the song (the fast paced half) sounds like a combination of one of U2's faster songs, the end of Arcade Fire's \"Rebellion,\" the dramatic ending to Radiohead's \"Separator,\" and the chorus to one of the hit hair metal songs of the 1980's. ", "On just about every song Sigur Ros are able to present just about one genre beautifully: the opening song gives us an alternative folk song, the second song gives a Beirut/Fleet Foxes song with a little added soul, the third track sounds like the acoustic ballad any popular artist dreams of putting out, the fourth track combines the Beirut and Fleet Foxes feel of the second track with a more hard rock feel, the sixth track (\"Festival\" is the fifth track) is the perfect piano song, the seventh track is another perfect soft song, and the last song is just a combination of just about every genre possible. ", "It is safe to say Sigur Ros offer something beautiful for fans of just about any type of music on this album.", "\n\nAnother thing that makes this album the \"ultimate beautiful album\" is that it not only has songs that beautifully define one of your moods but it has multiple songs that can define just about any of your moods. ", "None of the songs on the album are happy or sad, hard or soft, punk or emo, bad or good, they all just have a beautiful indifference about them that allows you to connect to them in your own unique way. ", "Every song on this album is so beautiful that anyone in any mood can connect to them instantly. ", "That is a beauty that is almost impossible to have in a music industry defined by \"happy songs,\" \"sad songs,\" \"war songs,\" \"breakup songs,\" and \"sex songs.\" ", "But Sigur Ros make an album of 11 songs that are so beautiful and free that anyone can connect to them almost instantly.", "\n\nIt is tough to describe Sigur Ros music as anything less than breathtaking or beautiful. ", "It is a beauty for post rock fans, a beauty for rock fans, a beauty for electronica fans, a beauty for indie fans, a beauty for hip hop fans and a beauty for fans of whatever you call the music Insane Clown Posse makes. ", "It is a beauty that says whatever you are doing is okay, it is a beauty that wants you to run away yet wants you to lay down and cry, it is a beauty that wants you to love yet wants you to move on, it is a beauty that tells you to believe in God yet is a beauty so powerful that it makes you believe that you are already in heaven. ", "Sigur Ros' Med Sud I Eyrum Spilum Endalust is more than just an album, it is a beautiful Icelandic utopia that makes the impossible possible and brings an instant beauty into your life." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005666161887347698, 0.00063920026877895, 0.18079988658428192, 0.528569757938385, 0.0006906422204338014, 0.0005714374710805714, 0.0010026375530287623, 0.0037414904218167067, 0.0006277107167989016, 0.000616588571574539, 0.0010514400200918317, 0.0006293458282016218, 0.0005991959478706121, 0.0007197308004833758, 0.0007956253248266876, 0.0006056461133994162, 0.0005886693834327161, 0.0006451996159739792, 0.0006892643286846578, 0.0005950411432422698, 0.0005501916748471558, 0.0006871602381579578, 0.002136946888640523, 0.0005668033263646066, 0.004561958368867636, 0.0006358996615745127, 0.0008217212744057178, 0.000902624218724668, 0.07009454071521759, 0.001553298789076507 ]

[ "To Build a Home\n\n\"To Build a Home\" is a song by English electronic music group The Cinematic Orchestra, with vocals and piano performed by Canadian singer-songwriter Patrick Watson. ", "It was released as the second single from the group's third studio album, Ma Fleur (2007), on 29 October 2007. ", "In 2015, the song peaked at number 96 on the French Singles Chart.", "\n\nComposition\n\"To Build a Home\" is a piano ballad that serves as the opening track to its companion album, Ma Fleur, though it serves as the closing track on the Domino-released versions of the album. ", "It features vocals from Canadian singer-songwriter Patrick Watson, who also has writing credits on the song alongside Phil France and Jason Swinscoe of the Cinematic Orchestra. ", "Watson also performed piano for the song. ", "The instrumental begins with about three to four piano chords looped, building up to a more loud and grand point, introducing strings. ", "During this portion of the instrumental, Watson sings over both the piano and strings, eventually climaxing with falsetto vocals. ", "Lyrically, the song deals with Watson wanting to create a house for him and his lover. ", "What happens with the house is unknown, resulting it to be merely metaphorical in place of a resting place for the two.", "\n\nRelease and reception\nThe song was first released on 29 October 2007 as a 7\" vinyl single by Ninja Tune in the United Kingdom. ", "It was backed with a cover version of the song performed by Grey Reverend. ", "A 7\" single was also released in the U.S. by the Domino Recording Company's U.S. division, which was backed with \"Child Song\".", "\n\n\"To Build a Home\" had a positive reception from music critics. ", "Critics often saw Watson's vocal performance as a highlight on the song. ", "For The Observer, Stuart Nicholson wrote that \"Swinscoe transforms three- and four-chord vamps into something special.\" ", "Drowned in Sound's Shain Shapiro regarded the vocals as \"bellowing [and] haunting\", while Tyler Fisher of Sputnikmusic noted that Watson \"nearly steals the show\". ", "Maggie Fremont of Vulture called it \"one of the most emotional songs ever performed.\"", "\n\n\"To Build a Home\" has been used in several different TV shows, movies, and adverts, including Tinker, Tailor, Soldier, Spy, One Tree Hill, Grey's Anatomy, Criminal Minds, Suits (Season 2, Episode 5), Friday Night Lights, Orange Is the New Black, This Is Us and The Gifted. ", "At the 2018 Winter Olympics, figure skaters Julian Yee and Dmitri Aliev used the song in their respective performances. ", "In December 2017 the song was used in a Christmas-themed TV advert for the Dutch supermarket chain PLUS. ", "It was reported in November 2016 that the song had been streamed over 60 million times, and by 2019 had over 200 million streams on Spotify alone.", "\n\nTrack listing\n Ninja Tune (ZEN7 200; UK 7\" vinyl single)\n\n Domino (DNO 148; U.S. 7\" vinyl single)\n\nCharts\n\nReferences\n\nExternal links\n \n \n\nCategory:2007 singles\nCategory:2007 songs\nCategory:Ninja Tune singles" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0007127427379600704, 0.0008176862029358745, 0.0006134134600870311, 0.000622690306045115, 0.0005931982304900885, 0.0005722620990127325, 0.0005942791467532516, 0.0006800525588914752, 0.0006585662486031651, 0.0005800300859846175, 0.0005550409550778568, 0.0008182629244402051, 0.000603652442805469, 0.000682102341670543, 0.0006185624515637755, 0.0006396131357178092, 0.0006947839865460992, 0.0009224630775861442, 0.0008238075533881783, 0.0005927497986704111, 0.0007530172588303685, 0.0006056071724742651, 0.0005920158000662923 ]

[ "The present invention relates to a mechanism for collecting objects laying down at the bottom level of different water basin, and more particularly, to a device for sea urchins or sea hedgehogs picking or the like and collecting the same.", "\nFor ages, seawater-filled areas and streams, rivers and waterways have been a source of food for humans. ", "Regularly, new species of edible fish or seafood start to be commercially exploited. ", "Consequently, an important new market of sea urchins and other animals living at the bottom of seas, oceans and rivers, and the like started to develop.", "\nTraditionally sea urchin picking is a generally manual work performed by a diver at the bottom of reefs and collecting them in a basket or the like. ", "This relative archaic method is slow, tedious and also not economical. ", "There also exists a relatively high potential for accidents since the diver must resurface to empty his basket(s) a large number of times during a working day.", "\nU.S. Pat. ", "No. ", "4,193,737 granted on Sep. 22, 1977 to Lemmon and U.S. Pat. ", "No. ", "4,756,671 granted on Feb. 28, 1983 to Grimes disclose fish pumping systems, which pump fish and water passing nearby their location using submersible rotary impeller means; non-submersible impellers could also be used.", "\nThe limitation of the prior art is that it is impossible picking sea urchins or non-living objects weighting approximately up to two pounds (2 lbs) from a water-filed area and automatically collecting them into collecting areas without potentially high damages of the sea urchins.", "\nIt is therefore a general object of the present invention to provide a device for sea urchins picking that obviates the above-mentioned disadvantages.", "\nAnother object of the present invention is to provide a device for sea urchins picking that allows for gathering the sea urchins without any damage/hurt to the same, thereby allowing for collected young small sea urchins to be returned into the sea.", "\nA further object of the present invention is to provide a device for sea urchins picking that allows for continuous and economical gathering process.", "\nStill another object of the present invention is to provide a device for sea urchins picking that is simple, adaptable, and easy to build.", "\nStill a further object of the present invention is to provide a device for sea urchins picking that is adaptable for operating by a person or by a different operating system (for example optical or acoustical).", "\nYet another object of the present invention is to provide a device for sea urchins picking that is efficient and requires a relatively low power pumping system.", "\nAn advantage of the present invention is that the device for sea urchins picking is also capable of picking other living and non-living objects from the waterbed with a weight up to two pounds (2 lbs) or even more.", "\nOther objects and advantages of the present invention will become apparent from a careful reading of the detailed description provided herein, with appropriate reference to the accompanying drawings.", "\nAccording to the present invention, there is provided a sea urchin collecting device for allowing an intended user to individually harvest sea urchins located within a body of liquid, said device allowing for the individual and sequential collecting of sea urchins having an urchin outer diameter below a predetermined threshold outer diameter, said device comprises:\na collecting tube for individually collecting at least one of said sea urchins, said collecting tube defining a tube first end, a tube second end and a tube intermediate segment extending therebetween, said tube defining a tube inner diameter for allowing sequential movement within said tube of individual sea urchins having an urchin outer diameter below said predetermined threshold urchin outer diameter while preventing adjacent sea urchins from being in a side by side relationship within said tube, said tube being manually maneuverable for allowing said intended user to manually position said tube first end adjacent a targeted sea urchin located within said body of liquid;\na pump hydraulically coupled to said tube second end for pumping an urchin-liquid mixture including targeted sea urchins and adjacent portions of said body of liquid into a collecting means, said collecting means being coupled to said pump.", "\nPreferably, the device further comprises a separating means in communication with said collecting means for separating said targeted sea urchins from said portions of said body of liquid.", "\nPreferably, the pump and said separating means are positioned on a buoyant body for maintaining said pump and said separating means above the surface of said body of water when said tube first end is positioned below said surface of said body of water in an operational configuration; whereby said tube first end is at least partially decoupled from said pump and said separating means by said collecting tube and said buoyant so as to facilitate manual maneuvering of said tube adjacent said tube first end.", "\nTypically, the separating means is located downstream relative to said pump, said separating means being located between said collecting means and said pump.", "\nTypically, the separating means includes a container, said container being provided with at least one drainage aperture extending therethrough, said drainage aperture allowing said pump to drain liquid out of said container while said container retains said sea urchins therein.", "\nPreferably, the separating means includes:\na first container and a second container, each of said first and second containers being provided with at least one corresponding drainage aperture extending therethrough, each of said drainage aperture allowing the drainage of liquid from a corresponding one of said first or second containers and the retention of sea urchins within a corresponding one of said first or second containers;\nan hydraulic circuitry including valve means for selectively allowing either one of said first or second containers to be individually filled with said liquid-urchin mixture, whereby said hydraulic circuitry allows said first or second containers to be individually filled with said liquid urchin mixture while the other one of said first or second containers is being individually drained from said liquid.", "\nPreferably, the device further comprises a pre-filling means hydraulically coupled to either one of said first or second containers for ensuring that a corresponding either one of said first or second containers maintains a predetermined minimal amount of liquid therein.", "\nPreferably, the pre-filling means includes a pre-filling hydraulic circuitry hydraulically coupled to said corresponding either one of said first or second containers for redirecting a portion of said liquid having been drained from said corresponding either one of said first or second containers into said corresponding either one of said first or second containers.", "\nPreferably, the hydraulic circuitry includes:\na first and a second inlet duct hydraulically coupling said tube second end respectively to said first and second containers;\na first and a second inlet duct valve for selectively allowing and preventing the flow of said liquid-urchin mixture respectively in said first and second inlet ducts.", "\nPreferably, the hydraulic circuitry further includes:\na first and a second outlet duct respectively hydraulically coupling said first and second containers to said pump;\na pump valve means for selectively allowing and preventing the flow of liquid from said first and a second outlet ducts to said pump.", "\nTypically, at least one of said first or second containers includes a container door, said container door being movable between a door closed configuration and a door open configuration, wherein when said door is in said door closed configuration said container door retains said urchins within a corresponding one of either said first or second containers and wherein when said container door is in said door open configuration said container door allows said urchins to be retracted from a corresponding one of either said first or second containers.", "\nAlternatively, the container door is positioned so as to be pivotable towards said door open configuration under the action of gravity and wherein said door is provided with a releasable door locking component for releasably locking said container door in said door closed configuration.", "\nPreferably, either one of said first or second containers further includes a container basket, said container basket being movable between an extended and a retracted configuration wherein when said container basket is in said retracted configuration said container basket is confined to a corresponding either one of said first or second containers and wherein when said container basket is in said extended configuration at least a portion of said container basket protrudes from said urchin removing aperture for facilitating the retrieval of sea urchins therefrom.", "\nPreferably, the pump is a rotary pump, said rotary pump being positioned downstream relative to said separating means.", "\nAlternatively, the pump includes;\na pump housing defining a first and a second housing aperture;\na first and a second pump inlet ducts, said first and second pump inlet ducts being in fluid communication with said tube second end and respectively with said first and second housing apertures;\na first and a second pump outlet ducts, said first and second pump outlet ducts being in fluid communication with said separating means and respectively with said first and second housing apertures;\na first and a second pump inlet duct valve for selectively allowing and preventing the flow of said liquid-urchin mixture respectively in said first and second pump inlet ducts;\na first and a second pump outlet duct valve for selectively allowing and preventing the flow of said liquid-urchin mixture respectively in said first and second pump outlet ducts;\na reciprocating piston slidably mounted within said pump housing for alternatively increasing. ", "and decreasing the hydraulic pressure of said liquid-urchin mixture adjacent said first and second housing apertures,\nwhereby when said hydraulic pressure is increased by said piston adjacent either one of said first or second housing apertures a corresponding one of said first or second pump inlet duct valve is closed and a corresponding one of said first or second pump outlet duct valve is opened for allowing a fraction of said liquid-urchin mixture within said pump housing to be discharged towards said separating means and the hydraulic pressure is decreased by said piston adjacent the opposed first or second housing apertures with a corresponding one of said first or second pump outlet duct valve closed and a corresponding one of said first or second pump inlet duct valve opened for allowing a fraction of said liquid-urchin mixture emanating from said tube second end to fill at least a portion of said pump housing.", "\nAlternatively, the pump includes:\na pump housing defining a first and a second housing aperture;\na first and a second pump inlet ducts, said first and second pump inlet ducts being in fluid communication with said tube second end and respectively with said first and second housing apertures;\na first and a second pump outlet ducts, said first and second pump outlet ducts being in fluid communication with said separating means and respectively with said first and second housing apertures;\na first and a second pump inlet duct valve for selectively allowing and preventing the flow of said liquid-urchin mixture respectively in said first and second pump inlet ducts;\na first and a second pump outlet duct valve for selectively allowing and preventing the flow of said liquid-urchin mixture respectively in said first and second pump outlet ducts;\na pressure creating means for increasing the hydraulic pressure of said liquid-urchin mixture within said pump housing;\na reciprocating pump valve slidably mounted within said pump housing for alternatively allowing the flow of said liquid-urchin mixture into or out of said first and second housing apertures." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0015527596697211266, 0.0006513759144581854, 0.0007461637142114341, 0.005034295376390219, 0.00538629898801446, 0.0007202705019153655, 0.0008523029973730445, 0.0010884626535698771, 0.0013785817427560687, 0.0006582919741049409, 0.0013785817427560687, 0.0006379458936862648, 0.00201359367929399, 0.04075421765446663, 0.010769656859338284, 0.004129786975681782, 0.018449993804097176, 0.004391079302877188, 0.020818397402763367, 0.00460838433355093, 0.0005154605023562908, 0.0009992540581151843, 0.0011823372915387154, 0.0006785253644920886, 0.0005551867070607841, 0.0009631476132199168, 0.0006064062472432852, 0.0006010064389556646, 0.0005784924724139273, 0.0007152828620746732, 0.0006244851974770427, 0.003407316282391548, 0.0006694516050629318, 0.0010977952042594552, 0.0005828491994179785, 0.0007333617541007698, 0.0007447539246641099, 0.0007787517388351262 ]

[ "Graphene-supported ultrafine metal nanoparticles encapsulated by mesoporous silica: robust catalysts for oxidation and reduction reactions.", "\nGraphene nanosheet-supported ultrafine metal nanoparticles encapsulated by thin mesoporous SiO2 layers were prepared and used as robust catalysts with high catalytic activity and excellent high-temperature stability. ", "The catalysts can be recycled and reused in many gas- and solution-phase reactions, and their high catalytic activity can be fully recovered by high-temperature regeneration, should they be deactivated by feedstock poisoning. ", "In addition to the large surface area provided by the graphene support, the enhanced catalytic performance is also attributed to the mesoporous SiO2 layers, which not only stabilize the ultrafine metal nanoparticles, but also prevent the aggregation of the graphene nanosheets. ", "The synthetic strategy can be extended to other metals, such as Pd and Ru, for preparing robust catalysts for various reactions." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006331909098662436, 0.000618118152488023, 0.0005769850686192513, 0.0005965172313153744, 0.0005405736737884581 ]

[ "Ready for the ballroom? ", "Paul Gascoigne is rumoured to be planning an appearance on Italy's version of Strictly Come Dancing\n\nTroubled: Former Spurs and England player Gascoigne has been battling alcohol problems\n\nPast and present: Gascoigne in his prime at Spurs, left, and how he appears today\n\nBusting some moves: Gascoigne (right) uses his skills to get past a Cameroon player in the 1990 World Cup quarter-final\n\nGascoigne is reportedly hoping the hard work and physicality of the dancing regime will aid his continued battle to recover from alcoholism.", "\n\n'He plans to take some time away from the UK to help his battle to stay sober after coming close to death recently,' a friend said.", "\n\nAnother friend added: 'Paul believes the show will give him a focus. ", "He is determined to stay on the straight and narrow and to show off nifty footwork.'", "\n\nOn the ball: Gascoigne was excellent for England at the 1990 World Cup, left, and also played for Lazio\n\nMoment of brilliance: Gascoigne scores England's second goal against Scotland in Euro 96\n\nGazza has struggled with alcohol problems for years and has made a number of rehab attempts. ", "However, he was arrested following a drunken fracas in July this year and was fined £1000 after an assault in a train station in Stevenage, Hertfordshire.", "\n\nThe former White Hart Lane legend has long been linked with appearing on reality TV series in recent years and snubbed the offer of a stint in the I’m A Celebrity jungle.", "\n\nGazza spoke earlier this year about finally being ready for reality TV and the reported deal with the Italian Strictly Come Dancing would make him one of the best paid dancers on any version of the seroes.", "\n\nHe would not be the first famous footballer to appear on the show - Argentinian soccer legend Diego Maradona took to the dancefloor in 2005." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0009726745192892849, 0.0009704544208943844, 0.0017362796934321523, 0.0005742579814977944, 0.0008991456707008183, 0.0011004044208675623, 0.0027838568203151226, 0.0006329971947707236, 0.0006391445058397949, 0.0008808982674963772 ]

[ " \n# Chasing Justice\n\n## Danielle Stewart\n\n## Random Acts Publishing\nCopyright © 2013 by Danielle Stewart\n\nAll rights reserved.", "\n\nNo part of this book may be reproduced in any form or by any electronic or mechanical means, including information storage and retrieval systems, without written permission from the author, except for the use of brief quotations in a book review.", "\n\n* * *\n\nCover Design by Gin's Book Designs (http://ginsbookdesigns.com/)\n\nImage used under license from Shutterstock.com / ver0nicka\n\n Created with Vellum\n\n# Dedication\n\nTo my husband who frequently reminds me to breathe, and my son who always takes my breath away.", "\n\n* * *\n\nThank you to my sisters, Jennipher and Nichole, for all they've added to this book and my life. ", "Gratitude to Emily and Karen for your honest and invaluable feedback. ", "And a special thank you to Becky, for her incredible support, and her vast knowledge of proper comma placement. ", "I'd be nothing without your red pen.", "\n\n# Contents\n\nPrologue\n\nChapter 1\n\nChapter 2\n\nChapter 3\n\nChapter 4\n\nChapter 5\n\nChapter 6\n\nChapter 7\n\nChapter 8\n\nChapter 9\n\nChapter 10\n\nChapter 11\n\nChapter 12\n\nChapter 13\n\nChapter 14\n\nChapter 15\n\nChapter 16\n\nChapter 17\n\nChapter 18\n\nChapter 19\n\nChapter 20\n\nChapter 21\n\nChapter 22\n\nChapter 23\n\nChapter 24\n\nChapter 25\n\nChapter 26\n\nExcerpt from Book 2, Cutting Ties\n\nExcerpt from Book 2, Cutting Ties - Chapter One\n\nAlso by Danielle Stewart\n\nBooks in the Barrington Billionaire Synchronized World\n\nForeign Editions\n\nNewsletter Sign-up\n\nAuthor Contact Information\n\n# Chasing Justice\n\nPiper Anderson has been given a fresh start in the picturesque town of Edenville, North Carolina. ", "But her plans of settling into a normal life are derailed when she witnesses a prominent judge in her community committing a violent assault. ", "Running from her own past and fueled by a passion to make the judge answer for his crimes, Piper is forced to decide if she'll play by the rules or achieve justice in her own way.", "\n\n* * *\n\nComplicating things further, Piper finds herself fighting a powerful attraction to rookie cop, Bobby Wright. ", "Although she's increasingly enamored with Bobby, his staunch belief in the justice system is in stark contrast to her own. ", "She may not share his opinions about the effectiveness of the law, but she certainly can't deny how safe she feels when she's in his arms or how every kiss leaves her desperate for more.", "\n\n* * *\n\nFor Piper, the idea of finally living an ordinary life with a man to love is tempting. ", "However, fate keeps placing the judge, quite literally, in her path. ", "Will she decide the only way to win is to be as wicked as the judge, but with righteous intentions? ", "And more importantly, will Bobby choose to let her go, or follow her as she crosses the line and takes justice into her own hands?", "\n\n# Prologue\n\n**The world is full of terrible people.** ", "I'm sure you've heard that before, maybe even said it yourself. ", "But when you say the \"world\" you don't mean _your_ world. ", "You're not thinking about your supermarket, your children's school, the place you work. ", "You're thinking about those big cities with those big problems, not your neighborhood.", "\n\nThis kind of talk makes me sound paranoid, and maybe I am. ", "But I'm also right. ", "I know the pedophile blurs into the role of coach. ", "The violent sex offenders deliver your mail or bag your groceries. ", "So often we find out too late the laws that are meant to protect the innocent instead shield the offenders. ", "There was a small window of time in my life when I thought I could be one of the \"good guys,\" and I use the term lightly as I happen to be a woman. ", "I believed I could follow the letter of the law and still take part in cleaning this world up a little. ", "But I was wrong. ", "You can't do things the right way and still win when the villains have no code. ", "The only way to get anything done is to be just as wicked, but with righteous intentions.", "\n\nMy ideals aren't something I've formed half-heartedly. ", "They've been forged like steel, burned in a fiery pit and then hammered relentlessly. ", "I've been hurt. ", "I've faced death. ", "I've made many mistakes. ", "My spirit was broken and I believed the only way I could repair myself was to knock a little piece of evil off this planet.", "\n\nOne afternoon, as I stared outside, I came face to face with my opportunity. ", "I had left my window slightly open so the breeze could balance the stale, recycled feeling of the air conditioner. ", "Late summer in North Carolina was usually humid and stagnant, but I remember on that day the wind was moving nicely through the trees. ", "I had hoped it would blow new life into me.", "\n\nThe rear of my townhouse faced an alley where an Italian restaurant backed up to the bank. ", "Out the back door of the restaurant stepped a man familiar enough for me to take notice, but not so much that I could place him. ", "From behind him came a girl, who even from that distance, I could see was half woman and half child. ", "She was dressed in mismatched clothing not suited for her age.", "\n\nThe two looked like a peculiar pair. ", "They were clearly not father and daughter, not student and teacher. ", "There was something about their demeanor, the way the man was moving with force and the girl creeping behind him timidly, that made my skin break out in goose bumps. ", "Something was not right.", "\n\nSuddenly the man turned on his heels to face the girl. ", "He cocked back his fist and before she could even raise her hands to protect herself he struck her hard across the face. ", "The girl stifled a yelp as her hands rushed to her nose which had instantly begun bleeding. ", "She slouched forward, and the man straightened her by grabbing the loose ponytail on the back of her head. ", "He leaned in close and hissed into her face. \"", "You don't get to talk to me here. ", "You don't get to _know_ me here. ", "This is my real life and you are a whore who I screw when I feel like it. ", "If you ever approach me in public again I will end you, and there isn't a soul in this world who would even know you were gone. ", "No one misses a fourteen-year-old hooker.\" ", "He tugged again at her hair to make sure she understood, and she nodded through the pain. ", "In a moment of clarity I suppose, the man looked over his shoulder to see if anyone had been within earshot. ", "I ducked back behind my curtains. ", "As he turned again toward her I realized where I had seen the salt and pepper in his hair, the lines on his red doughy face, the roundness of his bulbous nose.", "\n\nHe looked different without his black robe but there was no doubt—he was a judge whose courtroom I had sat in while shadowing a lawyer a few weeks earlier. ", "There he was standing in an alley beating an underage prostitute who had the unfortunate judgment of addressing him outside the confines of whatever seedy motel they usually frequented. ", "This man of stature and prominence in our community was a sex offender.", "\n\nAny reasonable person would stop what she was doing and immediately call the police. ", "But I believed I could do something about this on my own. ", "To understand why, you would need to know what makes me different from the general population. ", "You would have to understand what brought me to North Carolina in the first place. ", "No, I'm not an assassin who spent her childhood being groomed by monks in the art of ancient jiu jitsu.", "\n\nAs a matter of fact, even if my life depended on it, I'd be hard pressed to do a chin-up. ", "I'm about as graceful as a seasick flamingo. ", "My overall endurance makes me pretty sure I'm one of those people who is thin on the outside and fat on the inside. ", "I don't have a weapon, I don't have any allies, and I don't really have a plan.", "\n\nI have no particularly impressive skills besides perhaps valuing my own life so little that I'm willing to risk it even when the odds are stacked against me. ", "I'm delusional and I'm damaged, but I'm brave. ", "That's really all I have right now.", "\n\nSo how did I get here, how did I get to a point where I thought I could take justice into my own hands? ", "I arrived in North Carolina two years before I had witnessed the judge's assault. ", "The life that lay before me was blank. ", "I was given a clean slate; clean to a degree that many people would envy considering the circumstances that led me there. ", "Yet to me, the void stretching before me was suffocating rather than liberating. ", "I was adrift in a new town, a new world. ", "I was twenty-three years old and essentially born again, burdened with the ignorance of a child and the expectations of an adult.", "\n\nMy \"relocation,\" as I have come to internally label it, had afforded me a small place to live. ", "It was paid outright, and it was mine. ", "I had a sum of money that, in my naïve, unworldly experience, seemed like a small fortune. ", "In truth, it was just enough to be swallowed up by the reality of existing on my own. ", "As it turns out, barricading myself in my townhouse and ordering delivery pizza couldn't be a long-term solution. ", "It was as bad for my mental health as it was for my desire to fit into my skinny jeans.", "\n\nI was the warden in my own prison. ", "That realization hit me on a Tuesday and by the following Monday, I had enrolled in college. ", "It was something I had never allowed myself to consider in the past. ", "I was breaking free of the chains, and embracing my new life.", "\n\nIt made perfect sense to me that I should major in criminal justice. ", "I had the unfortunate experience of seeing the system up close and personal from a very young age. ", "The first year was thrilling in its fairy-tale-like explanation of our justice system. ", "I was slightly older than many of the other students who were fresh out of high school, but no one seemed to notice. ", "The excitement of the large lecture halls with stadium seating like I had seen on television made muddling through my general requirement courses a little more bearable. ", "It was text books and study groups. ", "It was me practicing my new life, my new name.", "\n\nBecause I had more time than the average student I enrolled in a few classes that would have normally been reserved for the following year. ", "I was completely captivated by the curriculum in my criminal profiling and theories of crime classes.", "\n\nThe philosophies I learned were idealistic and stirred something within me. ", "I had a newfound feeling of empowerment and pride. ", "My entire life had been so turbulent, such a mess, but now here I was in college dreaming of something better. ", "It seems ridiculous looking back on it now, but I believed I could change the world. ", "Maybe I couldn't do anything about my own past, but someone else's future could be shaped by my actions, my hardline belief in the system.", "\n\nDuring my second year it was time to plot out the direction of my career. ", "How would I apply this degree? ", "So I went out into the world. ", "I ventured into the streets of this new town I had been dropped in—Edenville, North Carolina. ", "Its population was just over fifteen thousand, but it had pockets of small town charm, and I lived right in the middle of one of those communities. ", "This place was so different than the world in which I had grown up. ", "There were times I felt like I had been transported to Mayberry.", "\n\nTo get started, I set up appointments at the courthouse to shadow criminal attorneys and police officers. ", "I toured the prison two towns over and visited the child protection agency. ", "I was enamored with the thought of making a difference. ", "Then, slowly, reality began to set in. ", "People, bad people, were let back into society because of clerical errors or loopholes.", "\n\nI observed eight cases, and as far as I was concerned, six of them were completely disheartening. ", "I saw children torn away from caring and loving foster homes and placed back with drug-addicted parents, all in the name of \"keeping a family together.\" ", "I saw a rape victim being persecuted for the low-rise cut of her jeans and the long line of boyfriends she had leading up to the attack. ", "There were drug dealers who walked free because the police made several errors bringing the case to trial.", "\n\nThe picture slowly became very clear to me. ", "A trial is a game where the truth is of secondary importance and each side aims to win regardless of the collateral damage.", "\n\nMy naïve exuberance turned quickly to disdain. ", "These were the people who failed me; they were no different.", "\n\nSo the moment I saw the judge punching the young girl behind my house I found my purpose. ", "It made me realize that just because I could not arrest or prosecute someone for a crime didn't mean I couldn't punish him. ", "And just like that, I dropped out of school. ", "I tossed my books in the trash and ignored emails from my professors.", "\n\nI, Piper Anderson, was unwilling to accept the world through the eyes of a defeatist. ", "My life up until that point had been wasted. ", "I wasn't going to spend another minute watching the system fail people. ", "The time I had spent in school showed me that a man like that judge would never be held accountable for his crimes. ", "I'd need to find a way to do it myself. ", "There had to be a place in this world for my idea of justice, and if there wasn't I was damn sure going to do everything I could to make room for it.", "\n\n# Chapter 1\n\nShort of grabbing tights and a cape, Piper had to think long and hard about what channels she would follow in order to right the wrong she had witnessed that day. ", "She was a _no one_ in this town and the judge was certainly a _someone_. ", "He made decisions and had important friends, many of whom would probably defend his character out of obligation. ", "Would she depend on finding some diligent assistant district attorney who would believe her? ", "Perhaps she'd contact the FBI, though they didn't seem to have a toll-free number floating around.", "\n\nPiper knew Edenville's size would make it all the more challenging to poke around and go unnoticed. ", "It was an insulated suburb on the fringe of Durham, North Carolina.", "\n\nThis place was so different than the world in which she had grown up. ", "Brooklyn, her hometown, was a place where anonymity was as easy as losing yourself in the crowd of morning commuters. ", "That wouldn't be an option here in sleepy Edenville where everyone was a familiar face.", "\n\nThere seemed to be no limit to the number of times you might run into the same person day after day. ", "The courthouse, the bank, the post office, and town hall were all housed in drafty old brick buildings with Main Street addresses. ", "The mainstays of downtown dining included the diner, the deli, and the general store. ", "At lunchtime you'd find the same people ordering the same meal at the same time every day, and folks seemed quite content to be known as regulars in any of the establishments. ", "The rest of Main Street was made up of florists, hobby stores, and consignment shops. ", "There were banners advertising an upcoming festival celebrating Edenville's textile mill heritage. **** ", "It had the quintessential small town façade, but now Piper knew it hid big city secrets.", "\n\nThe one thing that worked to Piper's advantage was her ability to be insignificant and overlooked. ", "She found this to be ironic since she had spent the majority of her life attempting to draw the attention of men, regardless of whether that attention was good or bad. ", "Before she moved to Edenville, getting a man to look her way, to engage her in some flirty banter, was a hobby of hers.", "\n\nBefore she came here Piper had kept her hair long, well past her shoulders. ", "She would highlight it with blonde streaks that would catch any man's eye. ", "Now it was shorter and she kept it her natural dark chocolate color. ", "It was average and forgettable.", "\n\nTo further her attempt to go unnoticed, her covered skin to exposed skin ratio had dramatically swung the other way. ", "Now even on warm days she found herself in long pants instead of the minuscule shorts of her past.", "\n\nHowever, even with the changes to her hair and clothing, Piper hadn't quite perfected the technique of ambiguity yet. ", "There were still a few distinct features she hadn't been able to camouflage. ", "Her brown eyes had the depth of an old soul and frequently drew compliments from people. ", "When the light caught them, they had a sparkle that no amount of work on her part could extinguish. ", "They were framed by long lashes and, although she had stopped covering them with mascara, they still seemed glamorously exotic. ", "Her skin was a glowing caramel that needed next to no maintenance in order to remain flawless. ", "And her smile, though it rarely made an appearance, had frequently been called stunning. ", "She had perfectly honed the use of her impish innocent face to appeal to men. ", "Now, as she tried to fade into the walls of Edenville, she realized getting people to remember you was a lot easier than getting them to forget you.", "\n\nIn spite of the added challenge of a small town, Piper took to following the _Honorable_ Judge Randall A. Lions. ", "He ate regularly in the diner, and this became the best way to learn more about him. ", "The wait staff was straight out of a movie, with their pale blue polyester uniforms and frilly white aprons. ", "One waitress in particular always captivated Piper. ", "Her name tag read \"Betty\" and Piper overheard her say that she had worked there for over ten years. ", "Doing a job like that for so long had given Betty a very acute sense of people.", "\n\nAfter two weeks of what Piper was calling surveillance, she felt as though she had learned a lot. ", "The judge seemed to be well-liked by those who frequented the diner, but he only noticed the people who came right up to greet him. ", "If you stayed in his peripheral and acted as though he was not there then he would ignore you. ", "To Piper it seemed like your run-of-the-mill above-the-law narcissism. ", "Another nausea inducing quality of the judge was the way he ate eggs sloppily; it never failed to turn Piper's stomach. ", "On occasion she would catch Betty's eye and they would both realize they were wearing the same expression of disgust. ", "They'd smirk and turn their gazes quickly in opposite directions.", "\n\nThe judge was regimented about his time which, thankfully, made following him relatively easy. ", "He frequented the diner, the bank, the Italian restaurant, the back door of the Blue Fox Motel on Tuesdays, and, of course, the courthouse. ", "The rest of his time was spent at home. ", "His house was beautifully landscaped, and about seven blocks from Piper's. ", "This was where she was most apprehensive about watching him because she struggled to blend into the scenery of his quiet neighborhood. ", "She had taken to posing as a jogger, which, even though she was thin, was clearly a stretch. ", "Her stamina left a lot to be desired. ", "But the exhaustion proved worth it when she caught a glimpse of the judge's wife one morning. ", "She was a stunning woman with dark black hair, exotic features, and an amazing figure. ", "Piper assumed she was somewhere around fifty, but could easily pass for thirty-five. ", "The judge, she had learned from public records, was sixty-six. ", "Seeing Mrs. Lions infuriated Piper. ", "She could never understand why men cheat, but especially why they cheat on beautiful women.", "\n\nWhile jotting some notes about the judge's schedule in her tattered black notebook, Piper heard the bell over the door of the diner jingle as a man entered. ", "He was someone she hadn't seen during her weeks at the diner, and she found herself intrigued. ", "After a couple days perched in one seat you tended to see the same people, so a stranger was interesting.", "\n\nThe man was tall and too thin for Piper's taste, though, to be honest, she didn't think she had a taste in men. ", "Her past had made men as a whole seem rather repulsive. ", "He looked like someone recovering from the flu in need of rest and food. ", "Outside of that, he was beguiling enough in his own way to pique her curiosity, and she continued to watch him. ", "His hair was dark, almost black, and cut short in a military style. ", "He had great posture, and Piper thought perhaps he was a soldier who had mastered standing at attention. ", "There didn't seem to be anything extraordinary about this man, but for some reason Piper was captivated by him. ", "She watched him the way you might watch a child who's been accidently separated from his parents in a crowd—watching to make sure he found his way. ", "This man seemed lost in some way, and Piper stared, waiting to see if he'd find what he was looking for.", "\n\nBetty jumped up from the stool where she sat counting her tips when she saw him enter. \"", "Bobby you look like you've been running all over hell's half acre.\" ", "For a moment Betty looked like she might throw her arms around him, but instead she slapped him across the shoulder.", "\n\n\"Oh come on Betty, don't give me any shit. ", "I've been laying low for a while, waiting for this whole thing to blow over. ", "Can I get something to eat or what?\" ", "Bobby scanned the diner as if to make sure whoever he was avoiding while laying low wasn't present.", "\n\n\"You have nothing to feel bad about. ", "It could have happened to any cop on the force. ", "Two week suspension is malarkey. ", "I'd've gone right in there and given that captain a piece of my mind if I didn't think those crooked bastards would be in here shutting the diner down the very next day. ", "You keep your chin up, and I'll get you the usual.\" ", "Betty was halfway in the kitchen as she finished her sentence and Bobby had no time to retort. ", "His face was flush with embarrassment, and he sulked over to the corner booth where Piper was sitting.", "\n\nHe didn't notice Piper until he was almost ready to sit across from her. ", "There were plenty of other empty booths, so she looked annoyed as she said, \"Excuse me.\" ", "The man seemed to wake from a dream and shot back an equally irritated and confused look.", "\n\n\"This is my booth. ", "You're in my booth.\" ", "He stood waiting for the girl to gather her things and move. ", "When no attempt was made, he backed away more aggravated.", "\n\n\"I've been sitting here for the last couple weeks,\" she croaked at him. ", "Piper thought to herself, _what kind of weirdo has his own booth and expects people to get up when he comes in_?", "\n\n\"That's because I haven't been here for the last couple weeks, but for five years I've been sitting here every morning for breakfast. ", "So yeah, it's my booth. ", "But whatever, I don't need this today.\" ", "He slinked into the adjacent booth as Betty re-emerged from the kitchen and immediately read the scene.", "\n\n\"Oh Bobby, get over it. ", "It's just a seat and this young lady has been a loyal customer, as loyal as you or Judge Lions. ", "Like clockwork.\" ", "At the sound of these words Piper's cheeks pinked. ", "Had she been so obvious with her attempts at surveillance that a waitress could spot her motives?", "\n\n\"Fine,\" Bobby mumbled. \"", "I just want to get my life back to normal as soon as possible. ", "My suspension is over, and I'm back on duty this morning. ", "I was hoping that two weeks of being gone wouldn't mean my whole life would be upside down.\" ", "He peppered the eggs Betty had brought him and moved them around his plate like a pouting child.", "\n\nBetty smiled at him and squeezed his shoulder. \"", "Well you weren't suspended from the diner, and in the words of a wise man 'move your feet, lose your seat.'\" ", "She leaned in and whispered loud enough for Piper to hear. \"", "It's going to be all right Bobby, and if it means that much to you, go sit with her.\" ", "He rolled his eyes up at Betty and put his hand over hers that rested now on his shoulder. ", "He let the firmness in his jaw relax slightly but stopped short of smiling.", "\n\nFor no apparent reason, and without much thought, Piper was intrigued enough to chat with this man. \"", "So what did you do? ", "You know, what got you suspended?\" ", "Initiating a conversation with a stranger was completely out of character for Piper. ", "She hated small talk. ", "Why, she wondered, was she even bothering to talk to this guy?", "\n\n\"Who the hell are you?\" ", "he barked, and Piper shrank back, not expecting that degree of harshness from a man with such warm brown eyes. ", "If this had been two years ago, if she had been back home still living her own life, then this man would have been in for the tongue-lashing of the century. ", "She would have gone up one side of him and down the other, spouting expletives he probably had never heard before. ", "But things were different now. ", "Just like she had worked hard to lose her accent, she had worked hard to control her temper. ", "Where she was from it was a weapon that proved necessary, but here all it would do was turn heads her way.", "\n\n\"Nobody,\" she whispered. \"", "You can have your seat back.\" ", "She was painfully aware of how drawing attention would undermine what she was doing here in the first place. ", "She grabbed her things, left money on the table for Betty and hustled past him. ", "He called something out, but Piper was already under the jingling bell of the door.", "\n\nBobby reluctantly peeled himself from the booth and jogged out to catch her.", "\n\n\"Wait,\" he called out to the girl as she crossed the street. ", "He saw her turn and look back toward him and then increase her pace slightly. ", "He was a high school track star and one of the fastest men in his class at the police academy. ", "There was no way she was going to out run him. ", "He hadn't been a perfect gentleman, but he wasn't so rude that she needed to run away. ", "This all seemed a little extreme to him.", "\n\nAs he jogged up behind her she stopped abruptly, looking completely frazzled by his presence.", "\n\n\"What?\" ", "she asked, clutching her notebook tightly to her chest. ", "She worried that perhaps he had glimpsed her notes or maybe Betty had tipped him off to her peculiar behavior.", "\n\nBobby ran his hands over the bristly stubble that covered his cheek and sighed loudly, looking utterly overwhelmed. \"", "I'm sorry I was short with you. ", "I'm not having a great couple of weeks.\" ", "Piper caught a glimpse of his flexed bicep and felt herself drawn to it, staring for a moment. ", "He stood nearly a foot taller than she was but, unlike some men of that size, he was warm not intimidating. ", "He was the kind of man that made you feel safer when he was around. ", "It was clear the blustery rudeness he had just exhibited was not his normal temperament. ", "His face was tired but too gentle for that to be true. ", "Still, Piper wasn't interested in his apology.", "\n\n\"All right,\" she snapped curtly, and began to turn away from him.", "\n\n\"That's it? ", "That's all you have to say? ", "I'm trying to apologize here.\" ", "He may have chased after her partially out of guilt but also because she was captivating. ", "Not gorgeous, not exotic, but there was something fascinating about her. ", "His curiosity, however, was waning as her rudeness seemed to grow. ", "He had thought that he might be able to redeem himself by the over-the-top gesture of running after her and apologizing. ", "He was wrong. ", "Much like the rest of his life right now, things weren't going as he had imagined.", "\n\nHe watched her impatiently tuck her silky brown hair behind her ear and he realized that maybe he had misread her. ", "Back in the diner he thought her murky dark-brown eyes had been calling out to him in a haunting way. ", "She seemed to have a depth that he had struggled to find in anyone lately. ", "Maybe at first she seemed like something beautiful that had been knocked down and was waiting to be picked up and dusted off. ", "Now standing on the sidewalk, with no words passing between them, he felt silly.", "\n\n\"Well, I guess that's it then,\" he said awkwardly, turning on his heels. ", "It wasn't usually hard for Piper to watch anyone walk away from her. ", "She normally found herself relieved to be alone. ", "This felt different. ", "She had to stifle a little tug at her heart as she watched this man leave, and all that did was annoy her. ", "She didn't need butterflies in her stomach; she needed ice in her veins.", "\n\nPiper didn't like the way he looked at her penetratingly, like he could see something that others couldn't—the heaviness she carried. ", "Starting right now he would be someone she'd need to avoid.", "\n\n# Chapter 2\n\n\"Betty.\" ", "Bobby waved her over before she could head back to the kitchen. \"", "What's that girl's name, and, for that matter, what's her story?\" ", "At that question Betty lit up like a Christmas tree and plopped herself down in his booth, his real booth, the booth he moved to the moment he came back to the diner.", "\n\n\"I have no idea. ", "The girl doesn't say a peep. ", "Polite as pie, easily pleased, but she is closed up tight as a clam. ", "I haven't pried much, but you know how most people love to come in here and gush about themselves? ", "Well she sits, reads, writes, and watches.\" ", "Betty's hands were moving frantically, as they usually did when she gossiped. ", "Bobby often wondered if she would know what to say if she couldn't flail her hands around when she spoke.", "\n\n\"Watches what?\" ", "Bobby asked, losing more interest in the story by the minute. ", "After Betty's animated response he was more convinced than ever that the girl was probably only taking in the sights of a lackluster town and dreaming up some soap opera to write an English paper about. ", "That was the problem with living so close to a college. ", "You often found yourself dealing with entitled students.", "\n\n\"Everything. ", "The girl seems like a private eye. ", "She watches everything, and everybody. ", "To tell you the truth, she's got my antennas up. ", "You know how I have that sixth sense about people? ", "Well my radar is going off like crazy with her. ", "She's got something going on. ", "I just haven't asked the right questions.\" ", "Betty's excitement over the whole thing had sealed the deal for Bobby. ", "A nosy waitress hoping a boring customer will turn out to be something more than she is.", "\n\n\"I've got to get to work.\" ", "Bobby laid his money on the table for Betty and kissed her lightly on the cheek. ", "The woman was a bit cracked but she'd been better to him than his own family at times, and something about her always made him feel good.", "\n\nGod knows he needed a reason to feel better. ", "There were moments in everyone's life that could be considered tipping points—events that became large black lines forever separating the before from the after. ", "Bobby's came two weeks ago, and it certainly changed his life, career, and plans.", "\n\nSam Manton. ", "Just thinking his name put a brick in Bobby's stomach. ", "He'd spent four months of this year, his rookie year, building a case against this creep. ", "Manton was pretty widely known for importing dope of all kinds into Edenville and the surrounding areas. ", "No one in the department showed much interest, which still puzzled him.", "\n\nTaking Manton down seemed like a no-brainer. ", "Sure, maybe it was only water cooler chatter but the rumors of Manton's deals had become enough to convince Bobby it was worth the department's effort. ", "It was at least worth investing some time into checking him out a little more.", "\n\nBobby remembered thinking that he signed on to this job to make a difference. ", "He wasn't interested in sitting around the donut shop on lazy afternoons with the rest of the beat cops comparing stories about the couple of times in their years of service they actually saw some action. ", "He had heard the story of Donny Lee foiling a bank robbery so many times that he felt like he'd been there making a deposit himself that day. ", "In reality, it was a transient guy passing through town who handed a note to the teller. ", "She pressed the silent alarm, and Donny peeled himself off his diner stool, crossed the street, and strolled down to the bank when he heard it go over the radio. ", "The guy was walking out with the money when Donny was walking in. ", "He drew his gun, said, \"Freeze,\" and that was that. ", "But now whenever the opportunity arose he told the story like a scene out of Point Break.", "\n\nSo one day Bobby decided he would spend his free time watching Sam Manton. ", "He would do a little freelance P.I. work and see if the story would start to come together. ", "The problem was it didn't take much work on his end to see what was happening. ", "Manton had been running guns into town and then selling them to drug dealers in nearby cities. ", "His drug trades were fairly easy to spot as well but didn't seem to be his main focus. ", "The guns must have been where the money was because that's what he was moving and moving them fast. ", "It took some snooping, some eavesdropping, and some patience, but nailing him was not quite the insurmountable task Bobby feared it would be. ", "There were moments Manton seemed to parade his deals down Main Street.", "\n\nBobby considered himself lucky. ", "He would be the rookie who would make a name for himself through the takedown of a sloppy arms and drug dealer who had become too cocky. ", "Bobby detailed reports and had documented everything he gathered in hopes of bringing the information to his captain. ", "He assumed Captain Baines would congratulate him and form a task force to take down Manton with the information Bobby collected.", "\n\nBaines was a brash, overweight, stocky man with a short temper. ", "He didn't tolerate anything that resulted in having to listen to static from the mayor. ", "If a cop in his department did something to draw negative attention or acted a fool, he'd be in for a quick and fierce punishment from the captain. ", "Bobby had tried to stay out of his way until this point. ", "He had ignored the smell of whiskey on Baines's breath as well as the bags under his tired eyes. ", "There was a chain of command for a reason. ", "It was Bobby's job to take orders, not ask questions.", "\n\nMuch to Bobby's surprise, Baines assigned Officer Rylie to assist him on the bust. ", "He was told that the fewer people who knew about something this important, the better. ", "Aaron Rylie was an old school cop who had been on the job for over twenty years. ", "He kept himself fit, unlike many of the other cops his age, and Bobby appreciated that about him. ", "He seemed to take his job seriously and didn't let his many years of service become an excuse for taking a more lax approach to his duties. ", "Bobby knew Officer Rylie was from the Irish crew of cops that had been part of some really impressive busts over the years. ", "His reddish-brown hair had started to grey, and his skin was leathery from so many days out walking the beat. ", "He was a man of few words but seemed very interested in what Bobby had been able to find out about Manton.", "\n\nBobby's information suggested that the guns would be following the delivery schedule of a fake transport business Manton had created. ", "This deal was especially important because it involved Manton being present to receive the shipment and meet a person who Bobby deduced was the supplier. ", "He hadn't managed to pinpoint who that was exactly.", "\n\nThe morning came and Bobby readied himself for what he assumed would be a career-changing moment. ", "Little did he know how right he was. ", "It certainly changed the trajectory of his life, but not for the better. ", "Going in with only two cops seemed light when dealing with a serious case like this, but he ignored his gut and trusted his superiors as he had been taught to do in the academy. ", "After all, they knew best.", "\n\nBobby and Officer Rylie arrived on the scene and the rest was a blur. ", "The delivery had already been made. ", "The new supplier, who Bobby assumed would be collateral damage and turn into another historical collar for him, had left. ", "Perhaps they had been tipped off, or maybe Bobby had gotten his information wrong.", "\n\nOfficer Rylie nodded for Bobby to climb the chain link fence that separated them from Manton and two of his cronies who were hastily moving the crates into a truck for transport. ", "Bobby landed and steadied himself after hopping the fence. ", "He drew his weapon, announced himself and told them to put their hands up where he could see them. ", "One man reached for what Bobby's training had taught him to assume was a weapon tucked into the back of the man's belt. ", "When the perp saw Officer Rylie, he relaxed and moved his hands back to his sides. ", "Bobby assumed the presence of another officer led the man to believe he was surrounded or outnumbered and it would be unwise to pull a weapon.", "\n\nManton gave a curious look over Bobby's shoulder to Officer Rylie. ", "He seemed puzzled rather than scared. ", "It wasn't the reaction Bobby anticipated, but hell, it was his first real action as a cop. ", "Who was he to assume how anyone would act in this type of situation?", "\n\nBobby approached the man who had reached for a weapon first and pulled the gun from behind his back, tucking it into his own belt and reaching for his cuffs. ", "Officer Rylie was cuffing Manton and seemed to be speaking to him more than one would think necessary for a collar like this. ", "Manton never spoke. ", "Bobby was out of earshot, but whatever Rylie said had Manton nodding his head in agreement.", "\n\nThe process was going smoothly and Bobby's confidence was growing with each passing minute. ", "Bobby approached the third man, his service weapon now holstered, and read the scene as contained. ", "He reached for his zip ties since his other cuffs were being used, and in that moment felt a wall of pain hit his face. ", "He fell backward to the ground, stunned and unaware of what exactly had happened. ", "There was a kick to his stomach and chest, then a stomp on his back as he attempted to roll away. ", "He reached for his weapon and wondered for a brief second what Officer Rylie was doing. ", "Finally Rylie was there, gun drawn and pointed directly at the man, telling him to back the hell up before he blew his head off.", "\n\nBobby lay there, gathering himself while Rylie cuffed the third man and called for backup.", "\n\nWhen other squad cars began to arrive Bobby managed to stand and knock most of the dust off his uniform. ", "But the skin over his cheekbone had split where the man's gaudy gold ring had made contact. ", "An ambulance pulled up and, as much as he had attempted to wave them off, Rylie had insisted Bobby go in and get checked out.", "\n\nTen hours later, when he had expected to be collecting the accolades for a job well done, Bobby was being suspended and gun dealers were being released back onto the street. ", "The explanation he was given was that since this was Bobby's bust he was the point person, even though Rylie had tenure. ", "Rylie had mentioned this to him that morning, but Bobby was too insecure to ask him to elaborate on exactly what their roles would be. ", "He didn't want to sound green, so he clammed up and nodded his head in agreement. ", "Because he was distracted by the boxing match he was having with assailant number three, none of the men had been read their rights. ", "The officers who came to the scene to transport had assumed Bobby had done so, and proceeded to book them. ", "Their lawyers, who were obviously the kings of technicalities, had been made aware of the minor detail and had their clients walking free in no time.", "\n\nBobby shook off the memory as he pulled up at the station. ", "He wasn't sure what his first day back would involve. ", "Would his fellow officers slap him on the back and tell him not to sweat it, or would his locker be plastered with printed copies of the Miranda rights? ", "He pulled his duffle bag from the trunk of his car and drew in a deep breath. ", "No matter what was in store for him, the first day back would be a long one.", "\n\n# Chapter 3\n\nThe following day Piper walked hesitantly into the diner. ", "Yesterday's commotion had done more than just piss her off; it reminded her that she wasn't invisible. ", "A scene like that could be enough to draw the attention of the judge, attention she was trying to avoid.", "\n\nSitting on the opposite side of the diner wasn't an option considering she needed to be outside the direct view of the judge in order to watch and listen to him. ", "During the last couple weeks she had managed to overhear a few interesting conversations that the arrogant judge assumed were spoken in a code that no common person could decipher. ", "She didn't want her run-in with this guy Bobby to undermine her real goal. ", "With that in mind she chose the booth adjacent to the one in which she had previously perched.", "\n\nBetty sauntered up with her pad in hand and a smile across her wrinkled face. ", "Something about her expression gave Piper a glimmer of joy. ", "Betty's bliss was as contagious as the flu. ", "It was impossible to keep from smiling when she was shining her bright eyes at you.", "\n\n\"I'm so glad Bobby didn't run you out of here. ", "I was afraid he scared you off before I had a chance to find out more about you.\" ", "Betty's heavy southern drawl was sweet delight, and the tone of her voice was as warm and welcoming as fresh-baked cookies. ", "Piper had grown fond of her unique turn of phrase over the last couple of weeks.", "\n\n\"It takes more than a little fuss to keep me away,\" Piper smirked wryly. ", "She glanced over the menu, though she and Betty both knew that she'd be ordering the same thing she had for the last two weeks—a bowl of oatmeal with strawberries and syrup. ", "It was the closest thing on the menu to the pouches of instant oatmeal she had grown accustomed to making herself as a child. ", "Piper's eating habits were so full of prepackaged food that she now found it hard to eat meals that didn't come from a box.", "\n\n\"He isn't a bad guy really. ", "He's a nice guy having some bad luck and taking it out on anyone who has the misfortune to get in his path.\" ", "Betty, to Piper's surprise, sat down across from her in the booth. ", "Apparently, the occasional unannounced break wasn't frowned upon in this particular diner.", "\n\n\"In my experience when someone says, 'I'm not a jerk once you get to know me' what he really means is, 'I'm a real ass but you'll get used to it after a while,'\" Piper said, thinking back to all the people she knew who fell into this category.", "\n\nBetty let out a howl of a laugh and slapped her knee. \"", "Isn't that the truth? ", "Well usually, but I can tell you that don't apply to Bobby. ", "You got my word.\" ", "Betty drew a cross over her heart with her finger as she continued, \"So, I've been dying to know more about you. ", "What's your name? ", "I've been meaning to ask you for some time but you always seem so focused.\" ", "Betty tucked her pencil behind her ear in true diner-waitress fashion. ", "She dropped her pad on the table as if to indicate she had no plans for writing down any orders until she heard some answers.", "\n\nPiper hesitated, separating in her head her old life from this new one. ", "Remember the right name, remember the right details, she told herself before speaking. ", "No matter how much time passed, when you were told never to speak your real name again, it always felt like it was dancing at the back of your throat, about to jump out.", "\n\n\"Piper Anderson,\" she said, stumbling a little. ", "She was convinced it didn't sound natural, and she felt her face flush slightly.", "\n\n\"Oh my word, what a sweet name that is,\" Betty said in her singsong voice and Piper felt her shoulders relax. \"", "Are you a student? ", "You look like a student.\"", "\n\n\"I was in school, but I quit. ", "And I know how dumb that sounds, but I can assure you it wasn't because I drank too much or slept through my classes or anything.\" ", "Piper had begun anticipating people's disappointment upon hearing her status as a college dropout, and she felt it easier to head-off that conversation early.", "\n\n\"Oh you won't get any lecture out of me, that's for sure. ", "If I had a nickel for everything I've ever quit I wouldn't be serving eggs to assholes every morning at five a.m.\" Piper appreciated the way Betty didn't clean up her language for her sake. ", "A few good curse words were pretty refreshing. \"", "What were you going to school for anyway?\" ", "She tucked her hand inquisitively under her chin and glanced at Piper over the rim of her eyeglasses sitting low on her nose.", "\n\n\"I was going to school for criminal justice,\" Piper said, waiting for her to respond. ", "But Betty's strategically placed silence worked perfectly, making Piper feel obligated to continue. \"", "The first year was all about the idea of justice and how lucky we were to live in a society like ours. ", "The second year was reality, which is how lucky _criminals_ are to live in a society like ours. ", "Once I saw a handful of really repulsive people rejoin the general population because of one loophole or another, I realized I'd better save my time and money.\" ", "Piper let the words flow from her mouth easily rather than catching them at the back of her throat and scanning them for any slip-up or misstep as she usually did when speaking to people. ", "Betty seemed to put her at ease. ", "She made her want to talk, which was not an easy task.", "\n\n\"Well that's not something you need to explain to me, especially not in this shady town. ", "My husband was a cop for sixteen years, the entire length of our marriage. ", "He started two weeks after our wedding day.\" ", "She pursed her lips in what Piper read as anger.", "\n\n\"Are you divorced?\" ", "The question was forward but Betty didn't seem to mind a direct question. ", "She certainly didn't mind asking them.", "\n\n\"Widowed, he died on the job.\" ", "Betty swallowed hard. \"", "That's why I started working here. ", "I couldn't stay in the house anymore and carry all that grief. ", "All my mind did was work through the conspiracy theories.\"", "\n\n\"Conspiracy theories? ", "What do you mean?\" ", "Piper thought Betty to be eccentric but not an alien-chasing kind of crazy.", "\n\n\"Nothing they ever told me about his death made any sense. ", "He was meticulous about how he did his job, how he took care of his weapons. ", "It'll be eleven years this fall and I swear there isn't a day that goes by that I don't wonder what really happened to my husband. ", "My Stan was a good cop and a smart man. ", "He wouldn't have walked into a situation without proper backup or with a dirty weapon that would jam. ", "I should have known by the way he had been acting the few months leading up to it that something wasn't right, but I tried to mind my own business. ", "I don't trust a single cop in this town besides Bobby, and especially the ones Stan thought were his friends. ", "Not one of them came by the house to see how Julie and I were doing. ", "I mean, she was only fifteen years old and burying her father. ", "If it weren't for Bobby I'm not sure how she would have made it through.\" ", "Betty seemed lost in thought as she trailed off.", "\n\n\"Are you and Bobby related?\" ", "Piper asked, genuinely interested in the answer. ", "Piper had overheard enough of Betty's conversations to realize there was always something worth hearing.", "\n\n\"He grew up next door to us, which in these parts practically makes you kin. ", "His father is a businessman and wasn't around too much, a cat's-in-the-cradle type thing. ", "So Stan took to spending time with him. ", "He coached his baseball team and such. ", "Bobby took it real hard when Stan died, but even at fifteen he was a great support to my Julie. ", "They were thick as thieves since they were about ten years old. ", "They rode out all their growing pains together, and if you'd have asked me a couple years ago I'd've told you they'd be married by now.\" ", "Betty was lost in a sweet memory for a moment.", "\n\n\"But as Bobby got older it became clear he was determined to join the force. ", "It was all he talked about. ", "Julie couldn't deal with it. ", "She wasn't willing to put herself through the risk of losing someone she loved again, and they've never been the same since. ", "She went off and married this moron. ", "I don't use the term moron lightly either. ", "The boy doesn't know whether to check his ass or scratch his watch. ", "She and Scott met one week after Bobby left for the academy. ", "For the life of me, I could not see what she found appealing in this lump of a man. ", "They dated for about six weeks and Jules was acting like a lovestruck puppy. ", "I finally called her out on it and she told me that Scott was all she ever wanted. ", "He was simple, which I thought to be the understatement of the century. ", "He had a good safe job and wanted a normal life. ", "What I started to realize was that my daughter was trying to be with someone she didn't love who had a very low-risk job. ", "She was looking for the complete opposite of Bobby, and I give her credit. ", "If nothing else Scott was certainly that. ", "I told myself I'd let her get this out of her system and when Bobby came back from the academy, he'd help me set all this right. ", "But then that spiteful little hothead went and eloped the night before Bobby was set to come home. ", "It was a nightmare. ", "I didn't like Bobby joining the force either, but I never expected Jules to go out and do something so impulsive and frankly dumb. ", "To be honest, I couldn't forgive Bobby myself for a while until I realized how proud Stan would've been of him for becoming a cop. ", "That made it all a little easier. ", "But listen to me ramble on about my old, dusty history. ", "I just wanted you to know that I got it when you said the system wasn't all it's cracked up to be. ", "I think I'll go to my grave not knowing what happened to Stan.\" ", "Betty's voice was barely above a whisper and she frequently looked over her shoulder, checking to see who might be listening.", "\n\n\"I'm sorry to hear all that, Betty, and I hope you do find out someday.\" ", "Empathy didn't come easily to Piper, but she had watched enough television in her day to be able to fake it.", "\n\n\"And now?\" ", "Betty let the words drag out, saying them slowly and inquisitively. ", "The question seemed to strike Piper unexpectedly, as though the air leaving her lungs was being pulled by a vacuum. ", "Filling the void in conversation, Betty thought she should frame up that vague question a little. \"", "Do you have a job or are you independently wealthy or something?\" ", "She leaned in closely and whispered slyly, \"Old family money?\" ", "She winked as if to say, your secret is safe with me. ", "Which Piper doubted it would be.", "\n\n\"No, don't I wish. ", "I'm looking for a job. ", "I haven't found anything that suits me quite yet.\" ", "Piper tucked the loose hair that had fallen toward her face behind her ears. ", "She always thought it made her look mousy and studious with it pulled back but she couldn't stand to have it in her eyes.", "\n\n\"We're always looking for some help on the graveyard shift here. ", "It pays crap and is boring as hell but you can't screw it up.\" ", "Betty leaned back and raised an eyebrow at Piper, goading her to take her up on the offer.", "\n\n\"That sounds like a challenge, because, trust me, I could certainly screw it up. ", "I'd be a terrible waitress. ", "Frankly, I don't like people all that much, and I have the patience of a two year old. ", "I appreciate the offer, but it's not something I would be any good at.\" ", "The thought of working in a diner, wearing that hideous getup and pulling her hair into a bun was enough to make Piper queasy. ", "She'd rather rob a bank and live on the run than come home with a pocket full of loose change and smelling like bacon.", "\n\n\"Is there anything you're good at?\" ", "Betty asked, seemingly disappointed to not have Piper signed on as the newest addition at the diner.", "\n\n\"Not particularly. ", "I've always liked computers. ", "I'm pretty savvy with technology I guess. ", "But without a degree I'm sure there isn't much work out there for me,\" Piper said, shrugging it off.", "\n\n\"Well, not so fast. ", "My moron of a son-in-law happens to work for the cable company. ", "Since no one seems to be able to live without cable now I know his place is always hiring. ", "That's all that computer and technology junk right? ", "You could get a job there.\" ", "Betty's face was lit again with the spark of excitement. ", "It was clear the thought of being a part of something, being a help to someone made joy rise within her.", "\n\nAs Piper began to decline, Betty cut in with something interesting. ", "This could be something that would again open a door, quite literally, for Piper and her greater plan. \"", "You know everyone lets the cable company in their house. ", "Think of how many dirty little secrets you'll be finding out, and you can come back here and gossip until we're blue in the face about it. ", "Who's ordering dirty movies, whose house is a disaster? ", "You know, all that good stuff.\"", "\n\n_Dirty little secrets?_ ", "Piper thought. ", "Betty was right; everyone lets the cable company in. ", "It would be easy access to someone's home. ", "She might be on to something.", "\n\n\"Betty, that sounds like a really nice offer, but I couldn't put you out like that.\" ", "Betty cut into Piper's words with the waving of her hands.", "\n\n\"That boy owes me so many favors I can't even dream up enough ways to collect on them. ", "The biggest of all is the fact that I let the idiot live after he married my daughter. ", "I'm telling you, he's usually as useful as a screen door on a submarine so trust me, if there is something he can actually do to help, then he should.\"", "\n\n\"But you don't owe me anything, so why would you help me?\" ", "Piper furrowed her brow, for the first time letting her skeptical nature shine through.", "\n\n\"I consider myself a pretty sharp judge of character, and you, my girl, seem like a good kid. ", "I haven't quite gotten you all figured out, but I've seen enough to know I like what I see. ", "Now come on over to my house tomorrow for dinner, and I'll have my daughter and my son-in-law over. ", "We can talk details. ", "I have to get back to work, so I'll just see you tomorrow.\" ", "Betty patted Piper's hand and stood. ", "She pulled her pencil from behind her ear and jotted an address on her order pad, ripped it skillfully, and handed it to Piper.", "\n\n\"That sounds good but...\" Piper said sheepishly.", "\n\n\"Oh Piper, it's no trouble. ", "I guess you're one of those people who don't like to take help from anyone... but, it's nothing.\" ", "Her hands were perched on her hips and had a \"not taking no for an answer\" kind of look.", "\n\n\"I was just going to say I was hungry. ", "I haven't eaten yet.\" ", "The two broke out into a laugh as Betty slapped her hand across her forehead. \"", "Coming right up,\" she called as she hustled into the kitchen.", "\n\n# Chapter 4\n\nThe average person might take for granted how much an upbringing prepares one for adulthood. ", "By the time most people hit their mid-twenties they are, at a bare minimum, equipped to attend a casual dinner at the home of an acquaintance. ", "But, of course, most folks don't have the paralyzing social ineptitude that comes from being raised by criminals.", "\n\nPiper sat in front of her computer staring at the void line of a ready and waiting search engine. ", "She wasn't quite sure how to word her inquiry, and it had her eyes practically crossing as she tried to focus on the screen.", "\n\nFinally she typed in \"How to act at a dinner party\" and hit enter. ", "Much to her surprise she was met with over seven hundred thousand results. ", "Perhaps she wasn't the only person in the world not given the tools to succeed. ", "And, like so many times before, the vast information floating around the Internet had saved the day.", "\n\nShe browsed over each link and settled for the blog including five easy steps of dinner party etiquette. ", "She figured she couldn't possibly go wrong with five easy steps. ", "She pulled out her notebook and proceeded to jot them down. ", "She always seemed to retain more information when she was writing it for herself.", "\n\nStep 1: Always bring a gift or dish for the host and hostess.", "\n\nStep 2: Unfold your napkin and place it across your lap. ", "When your meal is finished place the napkin neatly back on the table.", "\n\nStep 3: Wait your turn for food. ", "It is traditional to serve the most senior lady at the table, then the other ladies in descending order of rank (usually equating to age unless you have royalty staying), and lastly the gentlemen. _", "Never_ start eating until the hostess begins to eat.", "\n\nStep 4: With many different sets of cutlery beside the plate, start at the outside and work in. ", "If in doubt, look at what the other guests are using.", "\n\nStep 5: Make polite conversation with those guests around you. ", "Dinner parties are not just about the food; they are intended to be a sociable occasion.", "\n\nPiper closed her notebook feeling like those were pretty manageable rules to follow. ", "Now she just had to pick something to wear and which dish she would bring for Betty, considering her plates were all pretty plain.", "\n\nAs Piper approached the house at the address Betty had given her, she felt tightness in her chest. ", "Social endeavors of any kind were something she avoided. ", "She continued to remind herself this would all be worth it when she was working at the cable company and coming and going out of people's houses without having to put breaking and entering onto her record.", "\n\nBetty's home was fairly unassuming and old-fashioned. ", "Parts of it teetered on being in disrepair in Piper's opinion. ", "The clapboard siding was faded with the paint chipping and peeling. ", "The bones of the house seemed tired but the attempts at keeping it fresh were easy to see. ", "The garden was full of fresh blossoms and the hedges that hugged the outside of the house were well-kept and blooming beautifully. ", "The windows were sparkling, and white cotton sheer curtains were blowing in and out of them with the breeze. ", "The front porch had an old style hanging swing with floral cushions that Piper immediately found inviting. ", "She imagined how relaxing it would be to waste away an afternoon there.", "\n\nIt was farther outside of town than Piper expected. ", "She didn't realize Betty had a twenty-minute drive to work each day and that the house would be tucked so far from the road. ", "The long dirt driveway was lined with trees and an old stone wall that had seen better days. ", "It was quieter here than any place Piper had ever been. ", "The only real noises she heard were the idling of her own car engine and the birds chirping in the trees.", "\n\nAs Piper parked her car she saw Betty's rusted blue sedan and a shiny, red antique pick-up truck parked ahead of her. ", "She reached into the back to get her purse and the plain blue empty plate she had brought. ", "And finally it hit her. ", "The article she read didn't mean to bring your hostess an empty plate; it meant a _dish,_ like peas or salad! \"", "What an idiot,\" she thought to herself, feeling grateful that she hadn't brought the stupid plate in with her. ", "She rummaged through her glove box to see if she had something that would qualify as a gift for her hostess. ", "Nothing. ", "Well, rule number one had been broken.", "\n\nPiper walked toward the house and heard the swinging of a screen door as Betty stepped out onto the porch to greet her. ", "Betty's smile wasn't a cosmetically pretty one, but the way it spread across her whole face made it striking.", "\n\n\"I'm so glad you found the house. ", "We're so excited to have you, and I hope you're hungry. ", "I know you're not from down South, so I made you some good ol' fashioned country food for you to try out.\" ", "Betty hardly took a breath as she spoke, and Piper only had time to nod and follow her obediently into the house.", "\n\n\"I've got some more work to do in the kitchen so you go on into the sitting room, it's two doors down that hall. ", "I'll get the rest of the meal all finished up.\" ", "She pulled her apron back up over her head and around her neck. ", "Before Piper could ask if there was anything she could help with, Betty was gone.", "\n\nPiper intended to make some polite conversation with Julie and Scott and do her best to not sound like a fool until Betty came back. ", "As she entered the sitting room she was surprised to see Bobby lounging comfortably on the couch reading a car magazine.", "\n\n\"What are you doing here?\" ", "Piper asked without the slightest attempt to cover her disappointment at his presence.", "\n\nBobby did a slightly better job at hiding his surprise. ", "He had years of experience at dealing with Betty's meddling ways. ", "He kept his face unaffected as she spoke. \"", "I come here every Wednesday night for dinner, but I would have made the exception and skipped tonight had I known I'd be in mixed company.\" ", "He barely spared her a glance over the top of his magazine before nonchalantly returning to his reading.", "\n\nAt the sight of this man lounging confidently and flinging insults her way, Piper felt her fight or flight mechanism kick in. ", "Running out of the room seemed slightly ruder than engaging him in some hostile banter, so fight would have to do right now. \"", "Do you have some sort of mental disorder or something? ", "Because it seems like you do a lot of the same things at the same time in the same place every week. ", "You might want to have that checked out. ", "I'm going to give Betty a hand in the kitchen.\" ", "Piper turned to leave as Bobby stood up. ", "She was still taken aback by his height and the width of his shoulders, but more so by the way he carried his size. ", "He was so much larger than her but not the least bit intimidating.", "\n\n\"No, don't go into the kitchen. ", "Then Betty will think I was rude to you, and I'll catch hell for it. ", "Sit down and I promise not to bother you.\" ", "He caught her elbow gently and she felt a shock go through her body. ", "Its intensity was unfamiliar and scary. ", "She didn't think she liked the way Bobby's touch rocked her. ", "He pointed to the wingback chair across from the couch.", "\n\nPiper looked closely at the chair, peeking on either side of it and behind it.", "\n\n\"What are you looking for?\" ", "Bobby asked, thinking this girl might be crazy.", "\n\n\"I'm trying to make sure your name isn't on this chair anywhere. ", "I'd hate to take a seat that belongs to you again. ", "I've learned my lesson.\" ", "Piper kept her face intentionally serious even though she felt like a wry smirk would fit the moment better. ", "Bobby rolled his eyes and flopped back to his seat heavily. ", "He pulled the magazine up in front of his face and she felt slightly victorious as she caught a glimpse of the corners of his mouth rising in a reluctant smile.", "\n\nThe screen door squeaked open and slammed shut as someone else entered the house. ", "A younger version of Betty stood in the doorway of the sitting room. ", "She had all of Betty's features: the small pointed nose, almond shaped eyes, and feminine jaw line. ", "But they were all in a form that had not been weathered by half a lifetime of worry. ", "Her hair, however, was crimson red—not at all like Betty's dark caramel tresses that were now streaked with gray. ", "Everything about this girl seemed perfectly proportioned and delicate. ", "Her nails were artfully polished, her hair bright and voluminous. ", "Her lips were a soft pink and freshly glossed contrasting her pale complexion which was dotted with endearing little freckles. ", "It would have been easy to tell which attributes came from her mother and which from her father, even without ever meeting him.", "\n\n\"Hi, you must be Piper. ", "I'm Jules.\" ", "She reached her hand out and Piper shook it firmly. ", "Piper meant to say that it was nice to meet her as well, that she was grateful to Betty for having her over for dinner and helping her to get a job. ", "Instead all that came out was a timid \"hello\" and then it was too late, the conversation moved on without her. ", "Piper hated how the events in her life over the past few years had changed her so greatly and how weak she must look to people. ", "She missed being labeled as a firecracker and partaking in clever banter. ", "She felt constantly confined by her new identity and her responsibility to maintain its credibility.", "\n\n\"So you don't even say hello anymore, Bobby? ", "Have you been as rude to poor Piper here as you've been to the rest of us lately?\" ", "Jules's hand rested on her hip, and she stood on tippy-toes to catch Bobby's eye over the top of his magazine.", "\n\n\"Hello Jules. ", "Where's Scott, or have you wised up and left him?\" ", "He raised his magazine higher as a shield from her frosty stare.", "\n\n\"You're such an ass. ", "Actually he's stuck on a job. ", "He'll be here when he's finished.\" ", "She crossed the small room and sat beside him on the couch. ", "She was just about to turn the conversation back to Piper when Bobby spoke.", "\n\n\"Some big cable company emergency? ", "Boy they sure are lucky to have a dedicated guy like Scott there when HBO is on the fritz. ", "I'm sure he's up for a medal or something by now.\" ", "He threw his magazine to the coffee table and readied himself for Jules to fire back. ", "Piper was having a hard time telling if they were both enjoying themselves or genuinely couldn't stand each other. ", "Regardless, she was slightly envious of the chemistry between them. ", "This was the dynamic she had missed since moving here.", "\n\n\"You know what Bobby? ", "His job is important, and he's good at it. ", "What's the point of having some big job like yours if you're just going to screw it up in the first place?\" ", "Piper cringed with the direct hit that Bobby had just taken to his ego.", "\n\n\"Whatever, I'm going in the kitchen to see if Betty needs any more help with dinner. ", "The sooner it's ready the sooner I can get out of here.\" ", "He went to stand and Jules grabbed his sleeve and pulled him back to the couch.", "\n\n\"No way, if you go in there she'll know I am giving you a hard time and she'll give me hell for it,\" Jules stammered.", "\n\nWith that, Bobby's eyes met Piper's and they both did their best to stifle a laugh.", "\n\n\"Supper's ready,\" Betty called from the kitchen. ", "It was still strange to Piper to hear the last meal of the day referred to as supper, rather than dinner. ", "There were certainly things down South she felt she'd never get accustomed to.", "\n\nPiper felt her palms begin to sweat as she ran through the rules of etiquette once more in her mind. ", "She waited for everyone to take what she assumed were customary seats. ", "Betty pointed to the open chair by Bobby, and Piper cringed inside at the thought of having to apply rule number five regarding polite conversation to him. ", "She was still beating herself up about blowing it on rule number one, but was relieved to see a paper towel in place of a napkin sitting across her plate. ", "She still laid it over her lap, but at least it wasn't a beautifully folded cloth napkin to contend with. ", "She also noticed that there was no endless line of different shaped cutlery at either side of her plate, just a fork and knife.", "\n\n\"So Piper, this meal is about as country as it gets, and I won't be offended if you don't like it. ", "I know we all tend to like what we grew up on. ", "You eat what you like; no feelings will be hurt here. ", "What was your favorite dish growing up, dear?\" ", "Betty asked as she served herself a heaping spoon of mashed potatoes and passed the bowl over to Bobby. ", "Piper noticed no one at the table seemed to have read the same article she had regarding etiquette.", "\n\n\"Um... we ate a lot of takeout when I was growing up. ", "Pizza, fast food, not a lot of home cooking, but this all looks amazing, I'm sure I'll love it. ", "Are these your own recipes or something from a cookbook?\" ", "Piper had become incredibly astute at redirecting a conversation away from her. ", "She had found people generally enjoyed talking about themselves more than listening anyway.", "\n\nBetty proceeded to go into elaborate detail about how the fried chicken recipe had been handed down through many generations of her family. ", "She talked at length of how it was her mother who had started adding sour cream to the mashed potatoes, her great-grandmother who had first fried the okra, and how the biscuits were a family secret.", "\n\nPiper, who had no appreciation for cooking, or food for that matter, was astonished by the pride Betty associated with the simple act of mixing up some ingredients. ", "It was another reminder there was no shortage of things that separated Piper from the rest of the world.", "\n\nThe screen door swung open and slammed shut again, and in walked a stocky bald man wearing the navy button-down shirt of the cable company. ", "This must be Scott, thought Piper. ", "He was as dull looking as Betty had implied. ", "Piper thought she recalled Jules mentioning that Scott was twenty-eight, but he could easily pass for forty. ", "His eyes were slightly vacant and droopy like those of a basset hound. ", "His round face was flush and sweaty from working outdoors. ", "Piper thought if you put a hard hat and tool belt on this guy he could be the poster child for blue-collar work in the South.", "\n\n\"Hi Scott,\" Jules squeaked. \"", "This is Piper; remember Mom was telling you about her? ", "She's interested in a job at ComCable with you. ", "Remember?\" ", "It was as if Jules was willing him to not say something dumb or to admit that he didn't remember who the hell Piper was or why she was there.", "\n\n\"Oh, yeah we'll get you a job.\" ", "He smiled, flashing the small gap between his front teeth. \"", "I mean, a hot chick like you they'll hire in a minute. ", "I was afraid you were going to be some cow with a unibrow, and I'd have to find some nice way to tell you no dice on the job. ", "But any of the guys would be all right with you on the crew.\" ", "Scott clearly couldn't see the icy stare of his wife or the enormous, gloating grin plastered across Bobby's face. ", "Scott just continued to check out Piper's goods and assess her _qualifications_ for the job.", "\n\nPiper coughed as the water she was drinking lodged slightly in her throat. ", "There was really nothing left to the imagination when it came to why Bobby had been so snarky about the love of his young life marrying a dumbass. ", "No wonder Betty was disappointed in her daughter's choice for a husband, especially when there was a man like Bobby in the running. ", "Scott was exactly as Piper had imagined him, maybe slightly worse, but he was going to get her a job and access to what she needed. ", "That was really all that should matter to her. ", "For some reason however, a small part of her ached for everyone in that room, excluding Scott.", "\n\n\"Thanks Scott. ", "For the job and the self-esteem boost. ", "I was feeling a little bovine-esque lately.\" ", "Piper knew she was speaking to only one person in the room. ", "That was Bobby. ", "She knew her comment would fly over Scott's head, sting Jules and maybe even Betty, but Bobby would appreciate it, and she found herself wanting to put a point in his column for some reason. ", "It worked, because as she glanced over at Bobby she saw him smiling. ", "Her remark may have been funny, but her timing was terrible, as he too coughed back a sip of his drink.", "\n\nBobby shot Piper a grateful look and she felt herself blush slightly.", "\n\n\"Oh good,\" Scott said obliviously. \"", "Can we get to eating now? ", "I'm so hungry my belly thinks my throat's been cut.\" ", "He reached his large arm across Jules's plate and began to serve himself.", "\n\nGetting the dinner back on track quickly became Betty's number one objective. ", "They all ate sheepishly. ", "They knew any amount of fooling around would result in some form of scolding from Betty.", "\n\nThe remainder of the meal was uneventful but delicious. ", "They kept the conversation limited to the unusually warm weather they were having. ", "Normally by September in North Carolina you could count on a break in the humidity and the evenings would be cool enough for a sweater at times. ", "Each of them took turns commenting on how the extended heat had them all anxious for winter. ", "It seemed to be the only common ground they could find.", "\n\nPiper had barely left room for dessert but decided it would be rude not to partake in Betty's peach cobbler. ", "She looked around the table, and, although the tension was still palpable, she found herself envious that all these people would be back here next week. ", "The bickering and jabbing that might have seemed annoying to all of them was charming to Piper. ", "No one here was throwing things; no one was threatening anyone's life or slamming a door. ", "They were simply disagreeing without being overly disagreeable. ", "It was such a stark contrast to all Piper had ever known, and she wished it didn't have to end after just one night.", "\n\nJules rose abruptly from the table after Scott had taken the final bite of his second helping of cobbler.", "\n\n\"Ma, I'll help you clear the table, but I've got a big day at work tomorrow and we'd better get going.\" ", "Jules physically lifted Scott upward by hooking him under his arm. ", "He clearly had not gotten the message that she was anxious to go. ", "As far as Piper could tell, he was completely oblivious to any tension circling the table. ", "As a matter of fact, it seemed like there was no shortage of things to which he was oblivious.", "\n\n\"Don't you touch a dish. ", "I know there's a lot going on in your office. ", "It seems like every time I drive by, there is a line practically out the door. ", "That's what happens in a growing town like ours. ", "I guess everyone needs something from town hall. ", "Permits, licenses, records. ", "In a small place like Edenville they expect you guys to do it all.\"", "\n\nBetty turned toward Piper and said with pride lighting her face, \"My Julie is in charge of the whole town hall. ", "Well pretty much.\" ", "Piper loved how Betty seemed to be the only one who called her daughter by her full name. ", "She wondered when it had morphed into Jules for everyone else and why Betty had decided that just wouldn't do for her.", "\n\n\"Not quite, Ma. ", "It's too bad you quit school Piper. ", "If you ever go back we'd be seeing a lot of each other. ", "All the courthouse documents are housed in my archives. ", "The lawyers, detectives, and such are always pawing through and leaving it a mess.\" ", "Jules was still trying to shuffle Scott away from the table as she spoke. \"", "It was really nice to meet you Piper, I'm glad Ma had you over and that Scott will be able to help you get a job.\" ", "She leaned in and whispered to Piper. \"", "He means well, you just have to get to know him better.\" ", "She smiled through the embarrassment of having to plead her case for compassion for her husband. ", "She pulled Piper in for a hug and continued their private conversation. \"", "And keep your eye on Bobby for me. ", "He's on a slippery slope. ", "He could use a friend right now.\"", "\n\n\"We're not really friends. ", "He's been kind of rude actually. ", "All we've done is argue with each other,\" Piper whispered, with a confused look on her face as they broke their embrace.", "\n\n\"Well that's how most epic love stories begin,\" Jules insisted, as she turned away from Piper and toward her husband who had his fork back in the serving dish of peach cobbler. \"", "Are you kidding? ", "Let's go already Scott.\" ", "She yanked on his arm and he finally moved in the direction of the door.", "\n\n\"Come down to the office tomorrow, Pepper. ", "I'll have everything set up for you,\" Scott mumbled, his mouth full of cobbler.", "\n\n\"It's Piper, Scott. ", "I swear you have the memory of a gold fish.\" ", "Jules physically shoved him the rest of the way through the door and toward the porch. \"", "Bye Ma,\" she called out behind her.", "\n\nBetty walked out behind them and waved from the porch until they were out of sight. ", "Bobby and Piper had begun clearing the table, and she quickly hustled back into the dining room to stop them.", "\n\n\"You put those dishes down and get on out of here. ", "Go sit out on the porch, and I'll bring out some tea. ", "Dishes keep, good company doesn't.\" ", "She shooed them out the screen door, and they found themselves standing there awkwardly, not sure exactly what had just happened or how they ended up alone again, something neither of them wanted.", "\n\n\"I should actually get going,\" Piper said just louder than a whisper. \"", "It's getting dark and I don't know these roads very well. ", "It's taking me a while to get accustomed to things down South, especially no street lights on these country roads.\" ", "She fished in her pocket for her car key and looked through the screen door, hoping to see Betty on her way back out.", "\n\n\"I know, moving down South takes a little while to get used to. ", "I was young when we moved here from New Jersey, but it took me years to get accustomed to things like chicken fried steak and grits. ", "Listen, you might as well have a seat. ", "Dark or not, Betty won't let you go without a little time on the porch, it's what we do on Wednesday nights. ", "She's been letting Jules off the hook, but I think that's only so she doesn't have to listen to Scott snoring after he falls asleep on the swing. ", "If you want I'll follow you home, make sure you get there safely.\" ", "Bobby flopped down on the squeaky swing whose chains groaned under his weight.", "\n\nPiper forced herself to brush past his offer. ", "She pushed out of her mind the thoughts of him getting her home safely, and the even more dangerous thought of him getting her to her bed safely. ", "She did not like how she felt in Bobby's presence, how caught up in him she was getting. ", "He was taking up far too much space in her head. ", "Instead she went right for the other interesting part of his statement. \"", "You're from New Jersey?\" ", "Piper asked, intrigued enough to sit down next to him without thinking of how boorish he had been toward her.", "\n\n\"I knew you weren't charming enough to have been born here. ", "You lack the innate warmth of a southerner. ", "I mean you have that endearing little drawl and the _yes ma'am_ thing going on, but I knew you were too brash to be a good ol' boy. ", "Northerners are a different breed. ", "We're skeptical and hotheaded. ", "I could tell you had a little of that in you. ", "I blame it on the cold winters. ", "There is something about dredging through icy puddles before the sun comes up that makes it impossible to love thy neighbor the way people do down here.\" ", "She poked his chest accusingly with her finger. ", "It was firm and muscular and bent her finger back slightly.", "\n\n\"I guess that's one way to look at it. ", "I like to think I have more than a yes ma'am and a drawl. ", "I learned the exaggerated wink, and I'm practically a professional chitchatter in the supermarket. ", "You've got the wrong idea about me. ", "If you had met me a month ago, you'd think I was the poster child for southern gentlemen. ", "You, on the other hand, are clearly from the north. ", "Which frosty New England town do you hail from?\" ", "Bobby asked, starting to realize Piper hadn't said much at all about herself in their few encounters. ", "She had clearly tried to drop her accent but it still lingered enough for him to hear it occasionally.", "\n\nPiper wasn't sure how she had let this conversation get away from her. ", "This is what happened when she let little pieces of her former self show through, people always wanted to dig deeper. ", "If she hadn't been lost for a minute in the majesty of the setting sun falling behind the tree line, then she would have been more effective in guiding the conversation.", "\n\n\"We moved around a lot. ", "But this is as far south as I've ever been, and sometimes I feel like I'm on a different planet. ", "What's this whole sweet tea thing about? ", "They know it tastes terrible, right? ", "I can't tell you how many glasses I've had to choke down since I moved here just to be nice.\" ", "Piper hoped a little commiserating about the _swill of the south_ , as she liked to call it, would have them focusing on something other than her mysterious past.", "\n\nBetty pushed the screen door open with her elbow while balancing a tray of empty glasses, a bowl of ice, and pitcher on her forearm. \"", "Who's ready for some sweet tea?\" ", "Betty sang with an enormous grin. ", "Piper had made the idiotic assumption that Betty was inside brewing some hot tea and coffee for an after-dinner treat. ", "But obviously she was inside mixing up the simple syrup and black tea bags to pour over large glasses of ice.", "\n\nBobby's face was bright red as he tried half-heartedly to stifle his laughter. ", "Piper plastered a gigantic smile across her face and said with as much conviction as she could muster, \"Yum.\" ", "At that, Bobby let loose his poorly contained amusement. ", "His body shook as tears began to roll down his cheeks, and soon Piper followed suit. ", "The two couldn't catch their breath long enough to give some explanation to Betty, not that they would have told her the truth anyway.", "\n\n\"Are you two on drugs? ", "I mean it's nice to see you getting on so well but someone's going to pull a muscle.\" ", "The two had begun to gather their composure, sit upright again, and wipe the wetness from their eyes. \"", "Well that's better,\" Betty sang, grabbing the handle of the pitcher she had placed on the small outdoor table. \"", "Now we can have our tea.\" ", "Piper and Bobby erupted once more in irrepressible laughter.", "\n\n# Chapter 5\n\nPiper found the cable company to be a relatively good fit in her life. ", "She had made it easily through her training as well as her thirty day probation period. ", "She was ready to get started on her unaccompanied installations and repairs. ", "The work was repetitive but gave her time to think, and she appreciated that.", "\n\nFor the last month she had continued to join Bobby, Scott, and Jules for dinner at Betty's every Wednesday night. ", "Because of her rotating schedule she didn't have the ability to tail the judge as well as she had before. ", "It also meant fewer breakfasts at the diner with Betty, which was disappointing.", "\n\nThese new friends and a new job were beginning to lull her into complacency. ", "The world was looking a little shinier and brighter these days, and the memory of the judge's assault was becoming fuzzy. ", "Her nights were spent dealing with long, internal battles between what she thought was right and what she currently _felt_ was right in her life. ", "She had spent so much of her adolescence immersed in turmoil that for the first time she was feeling a sense of normalcy. ", "Who in their right mind, she wondered, would give that up for the sake of traveling the moral high ground? ", "There were days when she was convinced she had the righteous fortitude to continue chasing down information. ", "Then there were other days she could easily picture herself being quite content swinging on the front porch and counting the lightning bugs after a home-cooked meal at Betty's house.", "\n\nPiper wasn't inclined to believe much in fate, but it seemed hard to deny as she pulled her white cable van into the driveway two doors down from the judge's house. ", "She sat for a moment staring over at his door. ", "She told herself if a sign of some sort presented itself then she'd let it reignite the spark that had seemed to be burning so brightly a month ago.", "\n\nPiper's attention was drawn from the judge's door to the entry of the house she was parked in front of. ", "A tall, voluptuous blonde woman stood waving and practically bouncing out of her much-too-tight clothes. ", "This woman looked as though she was greeting a ship coming home on military leave rather than a stranger from the cable company. ", "Piper liked playing a new game she called \"What would Betty say?\" ", "Betty would probably describe this woman's clothes as being tight enough to see her religion. ", "She loved Betty's unique colloquialisms and found many of them stuck in her head.", "\n\n\"I'm so glad you're here,\" she called to Piper as she stepped out of her van. \"", "Oh, you're a woman? ", "Well I wish I had known that, I wouldn't have gotten all gussied up for nothing.\" ", "The overwhelming excitement that had seemed to fill the woman left her body all at once.", "\n\n\"Sorry, Mrs. Jenkins, right? ", "I got a call that you're having problems with your cable connection.\" ", "Piper looked down at her clipboard and read through the brief notes left by the dispatcher.", "\n\n\"Yes, I'm Mrs. Jenkins. ", "The box thingy won't come on. ", "I didn't realize they let women do this kind of work now. ", "I was hoping I'd get one of those tall, handsome men with a baseball hat. ", "Are you one of those lesbians or something? ", "It's okay if you are. ", "I'm no bigot or anything, not like Mr. Avery down the block. ", "If you tried to fix his cable he'd be standing behind you quoting the Bible to you like he was performing an exorcism or something. ", "But I applaud you people really, bless your heart.\" ", "The woman clasped her hands together and tilted her head in a look made up of pity and encouragement.", "\n\n\"I'm not a lesbian,\" Piper said flatly, completely puzzled by how the conversation had turned from a faulty cable connection to her sexual orientation.", "\n\n\"Oh, thank Jesus. ", "I didn't think so because you're so pretty, it really would be a shame,\" the woman said as she showed Piper into the house.", "\n\nPiper considered starting a long conversation about how assuming that the outward appearance of someone somehow contributed to her sexual orientation did, in fact, make this woman a bigot. ", "But she had to remember that this was a customer, and pissing her off certainly wouldn't help her in the long run.", "\n\nThe entryway and formal living room were massive. ", "Piper had never been in such a stunningly decorated home in her life. ", "There were multiple bouquets of fresh flowers adorning every available nook and mantle. ", "Beautiful artwork was hung thoughtfully around every corner. ", "Either Mrs. Jenkins was a designing genius or she had an amazing interior decorator. ", "Considering how hideously and inappropriately Mrs. Jenkins was dressed, Piper assumed it was the latter.", "\n\n\"You have a beautiful home, Mrs. Jenkins. ", "Now which television is giving you the problem?\" ", "With her frighteningly long candy apple red fingernails, Mrs. Jenkins pointed to the spacious media room that had more audio equipment than the local cinema. ", "Piper said a silent prayer that the problem would be something minor and she wouldn't need to call for any assistance. ", "She wasn't sure she could stomach one of her coworkers pawing at Mrs. Jenkins and belittling Piper for not being able to do the job.", "\n\nIn the center of the room, sitting crossed-legged on the floor in front of the coffee table was a girl. ", "She had dark brown hair cut in a short pixie style that suited her sharp-edged features. ", "She had three large textbooks open in front of her as she tapped her pencil to the beat of whatever pop song was playing through her iPod. ", "She looked up at Piper and Mrs. Jenkins and rolled her green eyes that were covered in far too much pink eye shadow and black eyeliner.", "\n\n\"Are they finally here to fix the cable? ", "It's about time. ", "I told you to tell them to hurry up, Mom,\" she huffed loudly in the way only a teenager could.", "\n\n\"Nikki, what are you still doing here? ", "You're supposed to be over at Judge Lion's house already. ", "Get your things and go,\" Mrs. Jenkins spoke in a hardline voice significantly different than the bubbly exuberance she had shown Piper—well, prior to insulting a whole subset of the population by announcing that Piper was too pretty to be a lesbian.", "\n\nUpon hearing the judge's name Piper stumbled and knocked over the tool bag she had just placed on the side of the cable box. ", "Had she really just heard Mrs. Jenkins tell her daughter to go to Judge Lion's house?", "\n\nShe quickly tried to gather up her loose tools from the hardwood, praying one of them hadn't scratched it and the commotion wouldn't push the conversation into another room.", "\n\n\"Mom, I told you I didn't want to go there anymore. ", "It's boring. ", "All we ever do is talk about old court cases and look through stupid photo albums of people I've never heard of. ", "I wrote one paper on the guy because I figured it would get me a good grade, and now he thinks he's my mentor. ", "I'm over it.\" ", "Nikki's argument didn't seem to faze her mother, who had begun closing her books and shoving them into her backpack.", "\n\n\"You are going. ", "Having a man like Judge Lions take an interest in you is an honor, and you aren't going to blow it because you think it's boring. ", "The man is very important in this community, and if he sees potential in you then you should take it seriously. ", "Do you want to end up working at the cable company like this poor girl? ", "She has people thinking she's a lesbian all day, and do you know what? ", "She isn't. ", "Do you want that to be you? ", "Do you want to wear that unflattering shirt and khakis, crouching down behind people's televisions all day?\" ", "Mrs. Jenkins continued to gesture over at Piper as though she were an exhibit at a museum rather than a person with feelings who might take exception to the insults being hurled in her direction.", "\n\n\"No, I don't want that. ", "Fine, I'll go.\" ", "Nikki snatched her backpack from her mother's hands and stomped heavily out the door.", "\n\n\"Kids—they think by thirteen they have it all figured out,\" Mrs. Jenkins sang to Piper, seemingly unaware of how wounding her little speech may have been. \"", "Just let me know when you have it fixed,\" she said, sauntering out of the room.", "\n\nPiper went from her crouched position behind the television to sitting with her back up against the wall. ", "She thought if she didn't lean on something she might just fall over. ", "Her mind swirled with thoughts.", "\n\nWas Judge Lions so brazen that he would groom his neighbor's daughter for some kind of sick purpose under the guise of mentorship? ", "Was that the real reason Nikki didn't want to go there? ", "It was infuriating to think that he had this community so blinded by his prominence that people were begging to send their daughters to him.", "\n\nMaybe it wasn't like that with Nikki. ", "She seemed very strong-minded and self-confident. ", "She didn't seem like someone who would carry that weight around with her, even under the pressure of her mother. ", "Either way, regardless of Nikki's situation, the thought of Judge Lions being allowed in the presence of a young girl was sickening to Piper. ", "Here was her sign; the flame inside her that had dimmed over the last few weeks was officially reignited.", "\n\nThe image of the powerless girl in the alley, bleeding and petrified, was once again as clear as it had been the day she had witnessed it. ", "The nights she spent parked outside the motel watching the judge exit the back door and arrogantly pull away in his black Mercedes were now all she could think of. ", "She had assumed her sign would come in the way of seeing the judge. ", "Instead, the possibility of another victim was enough to remind Piper why she started this endeavor in the first place.", "\n\n# Chapter 6\n\nHer time at the Jenkins home had Piper's mind wandering through the different possibilities of proceeding with her plan. ", "She knew the judge was a lofty target, she knew following the regular law enforcement channels wouldn't work, but she also knew he needed to be stopped. ", "She had thought about going to Bobby and telling him what she had seen that day. ", "But after he had shared with her what had gotten him suspended, she realized he didn't need any more attention. ", "She put herself back in a dark place, one she worked hard to stay out of. ", "She asked herself a question she hated, _How would my father have handled this?_", "\n\nThe question may have terrified her, but it did offer a solution. ", "Her father wouldn't have turned the judge in, because he knew that wouldn't result in the outcome he needed. ", "The judge was well-connected and would likely be protected. ", "Her father would realize when a man is well-insulated by people, then the only way to make him vulnerable is to turn his protection against him. ", "So the key for Piper would be to learn about the people with whom the judge had frequent dealings. ", "Who was making it possible for him to regularly meet with prostitutes, yet never get caught? ", "Would people protect him in return for judicial rulings in their favor or some sort of \"you scratch my back and I'll scratch yours?\" ", "There was very little Piper would admit she had learned from her father, but in this case she knew it was advantageous to have had such a dysfunctional family. ", "Her father had taught her that no man attempting to live two separate lives could maintain such a lifestyle autonomously. ", "Someone, maybe multiple people, must be helping him to continue his charade. ", "Finding out who would be the key. ", "That led her to an old acquaintance she actually found herself happy to see again. ", "He had been one of the first people she connected with when exploring her criminal justice career in Edenville.", "\n\n\"Piper Anderson, I thought you had fallen off the face of the earth. ", "I haven't heard from you in over two months,\" said the absolutely statuesque Michael Cooper. ", "He stood in the waiting room of his upscale office, ready to escort Piper in. ", "Michael's hair was sandy blond and a little longer than Piper usually liked on a man, but he kept it styled perfectly with a litany of salon products. \"", "I was so happy to hear you had made an appointment with my office. ", "I hope you weren't waiting long.\"", "\n\n\"Good to see you as well, Michael. ", "No, I wasn't waiting long at all, thank you.\" ", "Piper took a seat in the large leather chair that Michael had gestured toward. ", "She loved being in his presence. ", "She felt like a different person when she was with him, very much her old self.", "\n\nHe brought back the unshakable confidence she thought she had lost. ", "When they had spent time together in the past Piper found herself becoming bolder with each encounter. ", "Being with Michael was easy. ", "He was self-absorbed enough not to really notice that Piper never mentioned her past. ", "He never asked her deep questions, and never seemed to need an explanation for anything. ", "When they were together, they lived in the here and now, and something about that made Piper feel completely at ease. ", "In her entire time in Edenville, he had been the only person to have that effect. ", "When she was with Michael, she almost felt like she had an alter ego. ", "Or maybe she simply allowed herself to fall back into being the dynamic, vibrant person she used to be. ", "Everything that had been taken from her seemed to come back when she was with him.", "\n\n\"I was secretly hoping you had reconsidered my invitation to dinner. ", "I know I'm at least ten years older than you, but I really felt a connection. ", "You are one of the most passionate students I've had shadow me in all the years I've been doing this. ", "You're really something special. ", "So it had me thinking we should get to know each other a little better.\" ", "Michael lounged back in his plush leather office chair and laced his fingers behind his head. ", "If Piper hadn't had the pleasure of seeing his bleeding heart in action on three pro bono cases she might find him to be another slimy prosecutor. ", "She had watched him work tirelessly for people and things he believed in only to be let down by the very rules he was fighting to uphold. ", "He may have wanted to seem arrogant, but he couldn't convince her.", "\n\nPiper fought a smile as she spoke. \"", "It's awkward for me to have to be the one to break this to you, but you know you're gorgeous right?\" ", "She leaned in toward him and waited for his response. ", "They'd had their share of playful spats over the course of their brief time together, so she knew he would be game.", "\n\n\"I'm not really sure how to answer that without sounding completely self-absorbed. ", "Thank goodness I'm not under oath.\" ", "He sat up from his lounging position, readying for her quips.", "\n\nPiper continued in a mock serious manner. \"", "You're gorgeous. ", "You have blond hair and those mesmerizing emerald green eyes. ", "Chiseled movie star features. ", "You're over six feet tall right? ", "You've got to be in the gym at least five times a week to have a body like that.\" ", "She gestured at his chest. \"", "You wear perfectly tailored thousand dollar suits. ", "I'm sure you have a really expensive car and only eat at the finest restaurants. ", "Let's face it, you smell amazing. ", "I have a hard time sitting next to you without becoming completely intoxicated by that cologne. ", "And Michael,\" she continued coyly, \"that smile... you could be in a toothbrush commercial with that smile. ", "You pretty much have what every woman wants.\"", "\n\n\"I thought you were making a case for why you didn't want to have dinner with me,\" he said, raising his eyebrow skeptically, unwilling to accept the compliments until he knew her angle.", "\n\n\"Well, you see, you're single. ", "Any man with all those qualities who's still single has one of two problems. ", "Maybe his standards are far too high, and if I don't meet them my self-esteem will be shattered, and I'll develop an eating disorder or get addicted to plastic surgery.\" ", "She smiled wryly at him and shrugged her shoulders.", "\n\nMichael loved every second of this banter. ", "Too often women tried hard to be accommodating to his ego, so it was nice to have a woman willing to shut him down. \"", "Well, I think we both know there isn't a man in this world who could put a dent in your self-esteem,\" he countered.", "\n\nPiper found this hilarious. ", "If Michael could only see how fragile she really was he'd be stunned.", "\n\n\"You have no shortage of confidence. ", "And you said two problems. ", "That was only one problem.\"", "\n\n\"Maybe you have some fundamental personality flaw that has women running from your house screaming once they discover it. ", "You speak in the third person during sex, or you have an inappropriate bond with your mom or something,\" Piper said, fighting hard to keep her face serious.", "\n\n\"Wait, women don't like those things?\" ", "Michael asked with a look of shock as he pretended to write down what she was saying. \"", "Hold on let me take notes since you seem to have this all figured out.\"", "\n\n\"Seriously, Michael, there would be absolutely no hope of anything ever panning out with us, and I happen to like what we have right now,\" she said with a more serious tone in her voice.", "\n\n\"What exactly do we have right now? ", "You stopped calling months ago. ", "Then I hear from you out of the blue and still don't know why. ", "Did you kill someone?\" ", "Michael tried to let the blow to his pride from her rejection go, and turn the mood back to a light one.", "\n\n\"No, I didn't kill anyone. ", "You'll be glad to know I do need your help though. ", "I know men like you really enjoy chivalry. ", "So, no, I won't have dinner with you, but I do _need_ you.\" ", "She pulled a notebook and pen from her bag and placed it on her lap.", "\n\nMichael was intrigued now. ", "He was born with that unfortunate gene that made it impossible not to help a beautiful woman. \"", "I guess I can settle for being your hero and buying you a drink. ", "What exactly do you need?\"", "\n\n\"I'll definitely take a raincheck on the drink, maybe next week? ", "Today I need some information. ", "I'm writing a paper for school on judicial ethics,\" Piper lied. \"", "I need some real world examples to be able to get my head in the right place for this assignment. ", "Since I sat in on some of your cases I thought we could use things that I can relate to. ", "Do you think you can help?\" ", "She did her best to look pathetically desperate, and it seemed to be working.", "\n\n\"I guess so. ", "But it's important you know, I barely even talk to my mom, and I only refer to myself in third person when I'm getting ready in the morning. ", "It helps me get pumped up for the day.\" ", "Joking with Piper was like being on vacation, and he would help her write ten papers if it meant she'd stay in his office a little longer. ", "Being a lawyer wasn't nearly as exciting as he thought it would be. ", "So when a woman like Piper walked in, with a jagged sense of humor and the ability to keep up intellectually, he took notice.", "\n\n\"Great! ", "Now what was that judge's name for that drug case you lost? ", "The older guy with the big nose?\" ", "Piper put her pen to her lips and pretended to rack her brain.", "\n\n\"Judge Lions? ", "I've tried a bunch of cases in front of him. ", "We can use him as an example, but you can't cite any names in this paper. ", "Not mine and not his, understood?\" ", "The joking had clearly ceased for a minute while Michael made his point.", "\n\n\"No, of course not, I'm trying to get a few real life scenarios so I can make this paper feel authentic. ", "Now let me ask you, have you ever felt like Judge Lions was being biased or unethical?\" ", "She put her pen to the paper, ready to write.", "\n\n\"I can't answer that question. ", "You're asking me to say if I think a judge who I stand before regularly is doing his job appropriately. ", "I'm sorry, kiddo, that's not going to happen,\" Michael insisted, shaking his head.", "\n\n\"No, that's not at all what I'm asking you to do. ", "I'm wondering if there have been cases where you feel like the judge is leaning in favor of the defendant for personal reasons. ", "Come on Michael, I promise I won't bring you into this—or the judge for that matter. ", "I want to be able to look through the eyes of your years of experience. ", "Please, I need your help.\" ", "She hated to play that card, but with a man like Michael, who always wanted to lend a hand, she knew he would cave.", "\n\nMichael gritted his teeth and his nostrils flared. ", "This damn girl was driving him crazy. \"", "Fine, here's what I'll tell you. ", "Every judge has a life outside of the courtroom. ", "Each grew up a certain way, had a whole existence before becoming a judge, and there are times when I think that can make a difference in how they rule, even though it's not supposed to. ", "I don't really care for Judge Lions myself. ", "I have tried about nine cases in front of him and seven were lost because he either suppressed evidence or ruled some testimony to be stricken for one reason or another. ", "He never did anything illegal in my eyes, but I've felt sour about those cases. ", "That comes with the territory. ", "Do I think there are crooked judges out there? ", "Yes. ", "Do I know if Judge Lions is one? ", "No. ", "Writing a paper about judicial ethics is a slippery slope, Piper. ", "You can't go calling people out and trying to break the next big story. ", "If I were ever to accuse a judge because I thought he was ruling on something based on personal bias and I was wrong, my career would be over. ", "That means all the people I plan to help for the rest of my career are out of luck. ", "In this business you help who you can, and you play by the rules. ", "I know it doesn't sound like we're all following our moral compass here, and maybe it's disheartening for someone starting out, but it's the truth. ", "I can win a lot of small battles but the odds are I can't win the war. ", "If you want to continue down this path then you're going to have to come to terms with that.\"", "\n\nMichael never liked to be the one to break it to people that sometimes there was a whole lot of grey in this profession, not nearly as much black and white as they led you to believe in school.", "\n\nPiper was unimpressed and annoyed. \"", "That's kind of bullshit. ", "You're telling me that if you thought the judge was, let's say taking money from someone and then making decisions in their favor, you wouldn't do anything?\" ", "Her voice was a few octaves higher than she meant it to be, but it was becoming clear Michael wasn't going to give up much helpful information without perhaps being argued into doing so.", "\n\n\"That isn't what I said. ", "If that were the case I would bring any information I had to my superiors and push to have him removed if there was enough evidence.\" ", "Defensive tones didn't sound as good as playful banter.", "\n\n\"Oh sure, and when your boss is on the take too, you find yourself careening off the side of a mountain because someone cut your brake line in an effort to keep you quiet,\" she said with true conviction on her face.", "\n\n\"You've been watching way too many movies. ", "Are there some rumors and grumbling from prosecutors who feel Judge Lions might be more lenient to the defendants in some cases? ", "Sure. ", "But mostly that's because, as you never fail to point out, prosecutors have giant egos, and when we are bruised we go looking for a reason for why we lost.\" ", "Michael hoped this explanation would be enough to redirect Piper's focus away from a conspiracy within the judicial system.", "\n\n\"Which group do you think he is more lenient toward? ", "Is there a specific subset of people that he tends to favor?\" ", "Piper was not stupid. ", "She saw her window of opportunity closing quickly, and dancing around her questions wouldn't serve her very well with Michael.", "\n\n\"That's all you took away from that?\" ", "Michael asked, clearly exasperated. \"", "Listen Piper, I don't know what this is all about, but you are heading down a path with far greater repercussions than you can imagine. ", "I know what it's like to be starting out and to feel like there has to be more you can do to take the bad guys off the street, but trust me, being a good prosecutor is the best thing I can do. ", "Whether this is a paper or an investigation, leave it alone.\" ", "Michael paused and ran his fingers through his hair trying not to get too wound up. \"", "Even as I say it, I know you aren't listening, so rather than have you go poking around and asking someone else, I'll tell you that all cases are public records. ", "You can see the players, the verdicts, and the evidence all down at town hall in the records department. ", "Go do the math and draw your own conclusions. ", "But I need you to promise me two things.\" ", "Michael leaned forward across his desk and put his hand on Piper's. ", "There was electricity when he touched her. ", "It was enough to get her attention, but it paled in comparison to the feeling that shot through her when Bobby sat close enough to her for their arms to touch.", "\n\nShe looked directly into his green eyes and nodded her head as he continued.", "\n\n\"Promise me that I'm your only contact for this. ", "You don't go running around asking any lawyer who will listen what he thinks of a sitting judge. ", "You can trust me, but you got lucky. ", "Next time you might be asking the wrong person.\" ", "He released her hand and sat back in his chair.", "\n\n\"I promise, I won't go asking these kinds of questions anywhere else. ", "You said to promise you two things. ", "What was the other?\" ", "Piper had hoped it was something lighthearted and back to being about dinner plans.", "\n\n\"Promise me that if you get in over your head, with anything, you'll call me. ", "I'd like to hope that after leaving this conversation you'll go home and run a search on your computer for judicial ethics, piece together some fluff paper, and put all this behind you. ", "But I'm not getting that impression. ", "So in light of that, if you get yourself in a tough spot, promise you'll give me a call.\" ", "Michael had no idea what was so magnetic about Piper. ", "She was beautiful and came across as incredibly confident, but at the same time she seemed very broken. ", "Maybe it was those big brown doe eyes with lashes that seemed to go on forever. ", "Something about her made him think she was a walking contradiction. ", "She managed to be both a headstrong woman and damsel in distress. ", "It was hard to put his finger on but something about her always left Michael wanting more.", "\n\nHe was physically attracted to her, but if he was honest with himself, at the end of the day it was more that he wanted to know her, and to know she was all right. ", "She had never volunteered much information about herself and it wasn't in Michael's personality to go digging for it. ", "At work that was all he seemed to do, search for the truth. ", "In his personal life he preferred to leave his connections with people fun and light. ", "That's why things worked so well with Piper. ", "She didn't spend all her time gushing over her last terrible boyfriend or her daddy issues. ", "There were times, however, when he considered using his prosecuting skills to find out more about her, but he always reconsidered. ", "Some territories are better left unexplored.", "\n\n\"I will, and thank you, Michael.\" ", "She tucked her pen and notebook back into her bag and stood up.", "\n\n\"Don't thank me for that information. ", "I'm sure I've done you more harm than good.\" ", "Michael stood as well, although he was sorry to see her going.", "\n\n\"I'm not thanking you for that. ", "I'm thanking you for being exactly the guy I hoped you were. ", "I'm not sure why I knew I could come to you, but I did, and you proved me right. ", "There are a lot of disappointing people in the world, and today you weren't one of them.\" ", "She smiled at him gratefully.", "\n\n\"Should we hug? ", "I feel like we should hug.\" ", "Michael walked around his desk with his arms stretched out, ready to embrace her.", "\n\n\"Why on earth would we hug?\" ", "Piper asked, stepping back from him and laughing.", "\n\n\"I was hoping if I could press you up against me, get you close enough to smell my cologne and touch my rock hard muscles, then you'd be so overcome with my charm that you would reconsider my dinner offer.\" ", "He stepped in closer to her.", "\n\n\"Then we should definitely hug, because there is no chance of that happening,\" she replied, with a deadpan look on her face as she let him wrap his arms around her.", "\n\nHe put his lips to her ear and whispered through her hair, \"Is it working?\"", "\n\n\"Not even a little bit,\" she said, and he let her go as they laughed. ", "She threw her bag over her shoulder, and he opened his office door for her.", "\n\n\"Be smart, Piper,\" Michael called out, as he watched her walk back through the waiting area. ", "She turned and smiled, mouthing the words \"thank you\" as she passed through the glass doors and back toward the elevator.", "\n\n# Chapter 7\n\nAs Piper walked the eight blocks from her apartment to town hall she tried to internalize the warning Michael had given her. ", "She wasn't entirely sure this endeavor was something that could exist in reality. ", "She reminded herself that there would be a point in time when it would be too late to turn back. ", "She still had time to change course and mind her own business, get on with the new uncomplicated life that lay in front of her. ", "She ran Michael's words through her head over and over, but it didn't seem to matter. ", "She was committed to this now, and no amount of admonition would be enough to deter her.", "\n\nShe was lost in her own thoughts when she suddenly found herself knocked backward. ", "She had run right into someone and she, being the smaller of the two, had toppled back onto the sidewalk. ", "She felt a cold liquid spread across her chest and stomach. ", "As she regained her bearings she heard a familiar voice over her.", "\n\n\"Oh my,\" shouted Judge Lions. \"", "My dear I am so sorry. ", "Are you hurt?\" ", "He reached his hand down to lift Piper back to her feet, but shock kept her from taking his assistance. \"", "I spilled my sweet tea all over you. ", "You poor girl.\" ", "He crouched down next to her and with his large hands and sausage-like fingers began trying to wipe at Piper's shirt.", "\n\n\"I'm fine,\" Piper grunted, brushing his hand away. ", "She wanted to shove his hand back and ask what kind of man uses the guise of a spilled drink to fondle a stranger, but she held her composure. ", "This needed to be a relatively quick event with no lasting memory for the judge. ", "She didn't want to be on his radar in any way, especially as the woman shouting at him for groping her.", "\n\nAs hard as it was at that moment, Piper smiled at him. \"", "I'm so sorry, I wasn't looking where I was going, and I'm not hurt. ", "Thank you for trying to help, but I'm on my way to an appointment and have to run.\" ", "Now standing, she was close enough to smell his dated musky cologne and to see the large black hairs in his nose and ears. ", "She couldn't be sure if it was her knowledge of his deviant ways that made him so repulsive or if he truly was a disgusting looking man. ", "Either way, from this close proximity, her stomach turned at the sight of him.", "\n\n\"Are you sure? ", "I've ruined your shirt.\" ", "He reached out and touched Piper's shirt just over her belly button and it took an enormous amount of self-control for her to not physically strike him.", "\n\n\"I can pay you for dry cleaning costs if you like. ", "Or we can go right into that shop there and I'll get you a new one, whatever one you'd like. ", "We'd probably get it for free. ", "I'm a judge, you see, and I've helped Martha with a few speeding tickets, she drives like a lunatic. ", "I'm sure she'd be delighted to return the favor.\" ", "He pointed to the shop across the street that read \"Martha's Boutique and Fine Jewelry.\"", "\n\nPiper winced as the judge's breath, tainted heavily with the smell of onions, blew across her face. ", "She supposed when you paid people to like you, or even to have sex with you, there was very little grooming required.", "\n\nShe took a few steps back then pointed over her shoulder. \"", "That is such a nice offer, but I really have to get going. ", "I appreciate it.\" ", "She let her words trail off as she turned and quickly walked away from him.", "\n\nShe climbed the large cement stairs outside of town hall practically in a run, skipping two at a time. ", "She stepped into the revolving door and pushed it quickly around, pressing herself against the glass and willing it to move faster.", "\n\nOnce inside the lobby, she braced herself with her hands on her knees, trying to catch her breath. ", "Her hair had become wild, knocked out of its barrette when she fell. ", "She felt jittery and blood was pumping quickly through her veins, but she didn't realize how tousled she really looked.", "\n\n\"Piper?\" ", "She heard someone calling her name, but couldn't register it without more oxygen making its way to her brain. \"", "What happened to you?\" ", "Piper squinted and looked hard, trying to make out the blurry figure standing in front of her. ", "It was Jules, and she was staring at Piper as if she had seen a ghost, a very out of breath ghost covered in sweet tea. ", "She took Piper by the arm and led her into an office, shut the door and offered her a chair.", "\n\n\"I'm fine. ", "I bumped into someone on my way here and took a little fall. ", "He accidently spilled his drink on me. ", "It's nothing really.\" ", "Piper wiped at the front of her shirt, not realizing until right then how much of the drink had actually landed on her, and how transparent her white T-shirt had become.", "\n\n\"Well here, you can wear my sweater.\" ", "Jules pulled her red sweater off and handed it to Piper. \"", "I always wear layers when I'm here. ", "You never know if the old air conditioner in this building will be blowing hot or cold air. ", "It has a mind of its own.\" ", "Jules look suspiciously at Piper. \"", "Are you sure you're okay?\"", "\n\n\"I'm positive. ", "It was my fault really. ", "I was distracted and I slammed right into the guy. ", "I landed on my butt, and I was a little embarrassed I guess. ", "I wanted to get out of there as quickly as possible.\" ", "Piper smiled as convincingly as she could, and Jules's worry seemed to diminish.", "\n\n\"Give me that shirt and I'll go wash it out in the bathroom and run it under the hand dryer. ", "I spill so much coffee on myself here I'm like an expert with that thing.\" ", "Sitting in wet clothes in the drafty building had given her a chill and she was grateful for the sweater.", "\n\nPiper slipped her wet shirt over her head. ", "She hadn't heard another soul around the office since she had sat down. ", "But of course that changed the moment she tossed her shirt over to Jules.", "\n\nA quick knock before the door swung open sent Piper nearly jumping out of her skin and standing up abruptly. ", "The sweater fell between the wall and the chair, out of her reach.", "\n\n\"Hey Jules, your mom asked me to stop by and see if you...\" Bobby was halfway in the door before seeing Piper, standing shirtless, with a deer-in-the-headlights expression. ", "The moment seemed to last forever. ", "It was long enough for him to catch a glimpse of the subtle lace of her bra contrasting against the crimson red of her skin, flush with embarrassment.", "\n\n\"Bobby, get out,\" Jules shouted, shoving him backward and slamming the door nearly on his head. \"", "I'm so sorry, Piper. ", "I didn't know he was coming. ", "He always just comes right in like that. ", "I should have locked the door.\" ", "Jules hustled over to her and reached down under the chair for the sweater. ", "Piper was still standing motionless. ", "Then a small smile broke across her face. ", "Jules wasn't sure exactly what to make of it. \"", "Why are you smiling?\"", "\n\n\"I'm trying to imagine what he's thinking in the hallway. ", "Like what kind of scenario is he's envisioning that would have me in your office half dressed in the middle of the day? ", "This is pretty embarrassing for me, but I'm betting he is dying out there.\" ", "Piper slipped the sweater on and sat back in the chair.", "\n\n\"Should we let him sweat it out a little, wondering what the hell we're doing in here?\" ", "Jules was so grateful that Piper had taken a lighthearted approach to this uncomfortable situation. ", "Having Piper around had helped alleviate some of the tension that had grown between her and Bobby since Scott came along.", "\n\n\"No, let's let him off the hook. ", "It's not like he came running into the ladies' room or anything. ", "This is an office, I should have known better. ", "I guess we're lucky it was him and not some stranger looking for directions to the bathrooms,\" Piper said, gesturing toward the door.", "\n\n\"All right, Bobby, it's safe to come in now,\" Jules said as she opened the office door and waved him into the room. ", "He slinked back through the door, trying hard to avoid eye contact with Piper.", "\n\n\"I'm sorry about that Piper, I really didn't see anything. ", "I've come in this office a thousand times and there have never been any half dressed women before. ", "I can assure you if there were I'd be by more often.\" ", "He regretted his joke the moment he said it. ", "He fixed his gaze on a colorful framed picture on the wall.", "\n\n\"It's not your fault. ", "I had a little accident on my way here, and someone spilled his drink all over me and knocked me on my butt. ", "Jules was nice enough to offer me her sweater, and I wasn't thinking when I started to change. ", "Let's forget it ever happened. ", "And like you said, you didn't really see anything anyway. ", "Now someone change the subject please,\" Piper said, looking expectantly at Jules.", "\n\n\"Oh, all right, well why are you here, Piper? ", "Did you need something or was it a friendly visit? ", "I've got to get back up front to help out, so I can't stay back here too long,\" Jules said, amused by Bobby's red face.", "\n\n\"Actually, I need some time down in the courthouse archives. ", "An attorney friend of mine needs a hand with some research, and I told him I'd help out. ", "I need you to point me in the right direction.\" ", "Piper stood, and was ready to get back on course, the one she had been on before Judge Lions physically knocked her off it.", "\n\nA page rang out over the old intercom system calling Jules to the front to assist. ", "She rolled her eyes and headed for the door. \"", "I swear they can't last five minutes without me up there. ", "If you want to hang on for a bit, I can come back and help you out. ", "It's a little confusing down there. ", "It takes a while to find what you're looking for unless you've already used our system.\" ", "The static and cracking of the intercom rang out again, calling for Jules to come to the front.", "\n\nBobby, looking for a way to make this situation right, cut in with an offer.", "\"I can give you a hand. ", "I know my way around the system pretty well, and we can probably figure out the rest together until Jules gets a free couple of minutes.\" ", "Bobby was still not looking directly at Piper for fear his eyes would be drawn back to her chest out of some uncontrollable magnetic curiosity.", "\n\n\"Great,\" Jules called as she headed out of the office. \"", "When I get a few minutes I'll join you guys.\" ", "She walked swiftly toward the front of the building as the intercom rang out a third time.", "\n\n\"Bobby, I know you're busy. ", "I appreciate the offer, but I don't want to put you out.\" ", "Piper was confident that she could have researched the cases she needed with the help of Jules without raising any suspicion, but Bobby was a different story. ", "In the last few weeks that they had spent time together she had found him to be very perceptive. ", "He, in true police officer fashion, asked piercing questions and seemed to retain information exceptionally well.", "\n\nThat troubled Piper. ", "Most people preferred to talk about themselves and rarely remembered details she shared with them about her past. ", "This was helpful as the particulars were all fabricated and, at times, difficult for her to keep straight. ", "It was why, whenever possible, she redirected the conversation away from herself. ", "But this had stopped working with Bobby.", "\n\n\"I know that was kind of awkward, me walking in and seeing you without a shirt, but I don't want it to make things weird for us. ", "I've really enjoyed hanging out over the last few weeks, and I hope this doesn't mess that up. ", "Before you came along, Jules and I were on a pretty destructive path. ", "You've helped offset that dynamic a little, and I don't want what happened today to wreck things.\" ", "Bobby finally found the courage to look back in Piper's direction as he spoke.", "\n\nIt amazed Piper how much he had changed in the last month compared to the first day she saw him in the diner. ", "It wasn't limited to the fact that he was much more considerate and soft-spoken than he had been during their first few meetings, but he actually looked different now, too. ", "In the diner he was pale, unshaven, and thin. ", "During the past month he seemed to have gained a much-needed ten pounds, and the color had returned to his cheeks. ", "With his shy smile and his face clean-shaven, Piper found him almost unrecognizable from her first impression.", "\n\nHe was not the same kind of handsome as Michael. ", "He and Michael were polar opposites in many ways. ", "Michael kept his fingernails perfectly groomed and shining, whereas Bobby tended to have painfully short nails often imbedded with grease from the work he had been doing on his truck. ", "Michael had piercing green eyes and Bobby's were a swirling espresso flecked with gold. ", "Michael was like a performer; he walked with an air of confidence, almost a stage presence. ", "Bobby stood like a soldier, back straight and arms by his side. ", "They were both tall, but Michael had maybe an inch or two over Bobby.", "\n\nIt struck Piper as odd how she could find two men with completely contrasting features and builds both incredibly attractive. ", "And yet she didn't consider dating either one of them. ", "Any other woman in her place would be pouring her time and energy into gaining the affection of one or the other, or maybe both. ", "The fact that she wasn't doing this only reminded her of how damaged she truly was.", "\n\n\"I guess you can get me started, but I don't want to keep you here all afternoon. ", "I know you'll be having dinner at Betty's tonight, and you need lots of time to prepare funny digs about Scott to drive Jules crazy,\" Piper teased, poking an elbow into Bobby's ribs as she passed him. ", "She might not be actively pursuing his affection, but it sure was nice to find reasons to touch him every now and then.", "\n\n\"Do you think I do too much of that? ", "Maybe it's to the point where I need to be supportive of her. ", "She's married now and I'm her best friend. ", "Best friends don't act the way I've been acting.\" ", "A look of worry filled Bobby's face as he thought about how terrible he had been lately. ", "He gestured down the dark hall where the court records were kept, and she joined him in that direction.", "\n\n\"Jules is lucky to have you as a friend. ", "You love her, and sometimes it's hard to watch people we love do things that aren't in their best interest. ", "It's a lot like how she probably felt when you became a cop. ", "You're both watching each other make these choices, and then acting like idiots because you're worried. ", "You had your reasons for becoming a cop, and Jules had her reasons for marrying Scott. ", "But what you need to decide is if you'd both be willing to give up those things to be together.\" ", "Every now and again Piper surprised herself with how insightful she could be. ", "Maybe she didn't know the proper etiquette for everyday social settings, but she understood the idea of love.", "\n\nThey entered the small windowless room that housed the court documents, and Bobby flipped on a switch that brought the humming florescent overhead lights to life.", "\n\n\"I've certainly considered it. ", "It's not like I'm doing a bang-up job at work or anything. ", "What would I really be walking away from? ", "But when I think about what our lives would be like with everything that's happened I feel we're better off as friends. ", "I don't know if I could be with someone who asked me to give up everything I believe in. ", "I don't think that's the right foundation for a relationship. ", "All I want is Jules and I to be happy for each other, even if we can't be happy together. ", "I'm not making any sense,\" Bobby stuttered, heading toward the computer and turning it on.", "\n\n\"It makes perfect sense to me. ", "I completely understand why she doesn't want you to be a police officer, but I also understand why you feel like you have to be. ", "It's amazing how one event can impact people so differently.\" ", "Piper and Bobby hadn't ever talked about Stan's death, but he assumed Betty had shared it with her. ", "If Piper was coming over for Wednesday dinners that meant Betty trusted her. ", "Bobby was inclined to agree, but was taking a bit longer to form his full opinion.", "\n\n\"That's exactly it. ", "Stan being murdered made me want to chase down criminals, and it made Jules want to protect everyone she loves and her own heart. ", "When we were younger it didn't matter as much because doing either of those things was outside our control. ", "Eventually, though, we grew up and had to decide if we were going to stay on our paths or make a new path together. ", "I'm hoping there is some middle ground somewhere. ", "I feel like we're finally on our way to finding it.\" ", "Bobby pulled two chairs up to the computer and sat down. ", "Piper joined him, her leg brushing his thigh as she sat. ", "This man was solid muscle. ", "She let her thoughts move from the melancholy of Bobby's heartache, to the idea of what he might look like under that uniform, then finally to the anxiety of what she was about to do. ", "She wished now she had been firmer in her objections to his help, but she had to admit being here next to him had its perks, too.", "\n\n\"So,\" Bobby continued, \"you tell me what you're looking for, and I'll use this program to drill down to the specific cases. ", "The drill downs are almost endless. ", "Just give me the criteria you need and I'll enter it. ", "Then it will tell where in these filing cabinets we can find the public information linked to them. ", "Also, by searching here in this field, you can pull up any news stories that may have been printed about it.\" ", "Bobby sat with his fingertips over the keyboard waiting for Piper to direct him. ", "She bit her lip and let her mind run through the possible repercussions of over-sharing here. ", "As long as Bobby was under the impression that she was gathering the work for a friend then it seemed fairly safe. ", "She decided that sitting quietly while he waited looked far more suspicious than having him dig up some old files in the name of research.", "\n\n\"I need to find case files from the last eighteen months where the sitting judge was Judge Lions. ", "Then I need only the cases that were found in favor of the defendant. ", "I'd like to drill down into cases that included special judicial rulings like the suppression of evidence for any reason, technicalities resulting in an acquittal, or petitions by either the defense or prosecution that were ruled in favor of the defense.\" ", "Piper pulled her notebook onto her lap and waited as Bobby typed the information into the system.", "\n\n\"Okay, that gave us thirty-nine results. ", "Now we just need to write down the reference numbers and then go dig them out.\" ", "Bobby called the numbers off to Piper as she jotted them down.", "\n\nIt took them over an hour to gather all thirty-nine case files and, by the end of it, Piper's arms were tired and her eyes were strained. ", "Every time they crossed paths Piper felt her body tingle and her face become warm.", "\n\n\"Why exactly do you need all this stuff anyway? ", "Are you trying to site precedence in a case or something?\" ", "Bobby asked as he handed Piper another stack of documents.", "\n\n\"It's not for a case per se. ", "It's more along the lines of a thesis, something for my friend Michael to publish eventually. ", "He's a lawyer and you know how gigantic their egos are. ", "Well apparently they like having their names in writing too. ", "He's trying to show how strict adherence to the letter of the law in our society has prevented the spirit of the law from being enforced.\" ", "Piper had spent the last twenty minutes getting that story straight in her head.", "\n\n\"I know all about that. ", "Catching a guy with a box of illegal guns and getting your ass kicked means nothing unless you Mirandize him. ", "If that isn't bullshit I don't know what is.\" ", "Bobby sat down at the computer again and grimaced. \"", "Let's not get into that though, what other information do you need about these cases?\"", "\n\n\"Well I'll need a list of the defendants and the charges against them.\" ", "Piper rolled her chair back over to his side. ", "She quickly realized another absolute difference between Bobby and Michael—the way they smelled. ", "Michael wore expensive cologne that always made Piper imagine him dressed in a sweater vest, holding a polo mallet and posing for a clothing store ad. ", "Bobby, on the other hand, just smelled clean, like soap and maybe some shaving cream.", "\n\n\"Here's the list, alphabetized.\" ", "He scanned it as Piper read over his shoulder. ", "She noticed a trend immediately.", "\n\n\"That's odd. ", "Of all these cases, fourteen of them have the same last name—Donavan. ", "And here, five of them have the last name Cheval. ", "That doesn't seem normal, does it?\" ", "If Bobby hadn't been with her, she'd be running those names through every search engine she could find, frantically looking for more information on them.", "\n\n\"It's not that odd, really. ", "Donavans are a pretty notorious family in this part of the state. ", "It doesn't surprise me they've had a lot of cases. ", "Duke Cheval is a known associate of theirs. ", "There aren't too many really bad guys in this area luckily, but they are certainly on the short list. ", "I would have expected to see their names on here.\" ", "Bobby passed the list over to Piper.", "\n\n\"What makes them so bad?\" ", "asked Piper as she rolled her chair over to the piles of folders on the table. ", "She tried to look as though she were only half listening to what Bobby was saying, when in reality she was hanging on every word.", "\n\n\"Christian Donavan, Jr. is said to have followed pretty closely in his father's footsteps. ", "Christian Sr. ", "was a notorious gambler who ran an enormous bookie business. ", "When things were going his way he was living the high life, but when times got tough he started to invest in some shady deals. ", "He was around in Stan's heyday. ", "I remember hearing stories of how Christian Sr. ", "was the number one source for illegal guns at the time. ", "The homicide rate had almost doubled in the underprivileged sections of the state where he had been running prostitution rings and gun sales. ", "A lot of people actually looked at him pretty favorably since he had an unwritten code about not selling the guns in Edenville. ", "Who says there's no honor among thieves?\" ", "Bobby rolled his chair over to sit next to Piper, hoping he'd be able to help her sort through the documents in front of her.", "\n\n\"I love the irony in that name. ", "Christian, it's so fitting. ", "So all these Donavans on here are related to him?\" ", "Piper passed the list back to Bobby and continued to pretend to be otherwise occupied.", "\n\n\"It looks like it. ", "Christian, Jr. is the brains of the operation as far as rumor has it. ", "He picked up pretty much where his dad left off. ", "These two cases here are his cousin Tommy's. ", "I know of his brother, Sean. ", "He has three cases on this list. ", "He's not so bright. ", "He's known for being a bigmouth skirt-chaser, and that's not conducive to a successful life of crime. ", "If I were going to take these guys down, I'd start with him. ", "Not that it matters—I'll be working traffic for the next ten years.\" ", "Bobby took his hands and rubbed at his temples as though the thought of directing traffic gave him an instant headache.", "\n\n\"I'm sure you'll be back taking down huge crime rings before you know it. ", "One mistake doesn't ruin your entire career.\" ", "She put her hand on his shoulder and was instantly impressed by how muscular it was. ", "There didn't seem to be an ounce of fat on him anywhere.", "\n\n\"I think I'll be asking to stay on traffic actually. ", "The mistake I made had nothing to do with forgetting to read the Miranda rights. ", "It was being overconfident enough to think I could manage that type of investigation and take down those guys my rookie year. ", "I was trying to prove something, to Jules or myself or maybe to Stan. ", "I don't want to be just an average cop, because if I am then I gave up someone I loved in order to do a mediocre job. ", "I guess I was trying to overcome that. ", "Realistically, I had no business getting involved. ", "I could have blown more than an opportunity, I could have gotten myself and Rylie killed. ", "Those two weeks of suspension were some of the darkest of my life.\"", "\n\nPiper's hand lingered on his shoulder, and he felt it burning through his shirt. ", "He wanted to believe that it was all the time they had been spending together lately that made the thought of her touching him intoxicating, and hoped it wasn't the fact that all he could picture was that lace bra of hers. ", "He didn't want to be that kind of guy.", "\n\n\"I wish I had known you then, because I would have told you I was proud of you. ", "It took someone with an enormous amount of courage to do what you did. ", "You should have no regrets. ", "I wouldn't have let you stay in that dark place for too long.\" ", "She saw a look of gratitude fill Bobby's face as she spoke.", "\n\nWith a swift movement toward her, Bobby leaned in and pressed his lips against hers. ", "It wasn't a kiss full of passion and hunger. ", "It was a kiss that two old friends might share. ", "To Piper, even though it was brief, it felt powerful.", "\n\n\"I'm sorry,\" Bobby whispered. \"", "No one else has said that to me since this whole thing started, and I needed to hear it more than I thought. ", "I didn't mean to ambush you like that.\" ", "For the second time today Bobby couldn't look at Piper directly.", "\n\n\"That's all right, I completely understand. ", "It was nothing.\" ", "Piper smiled and waved her hands, indicating it was no big deal, though inside, her mind was reeling. ", "She thought the only thing worse than the awkwardness of a kiss would be a lingering silence to follow it, so she kept speaking. \"", "You found a box of guns and three pretty terrible guys and none of it mattered because you didn't follow every single step in the process. ", "The justice system is completely flawed and set you up to fail. ", "Those guys should be in jail right now, and you should be a hero.\"", "\n\nBobby followed Piper's lead and kept the chatter going. \"", "The system is there for a reason. ", "I'm supposed to execute it exactly how it's been laid out so that everyone gets treated fairly. ", "I made a mistake. ", "It's taken me a little while to own up to that, but I know now that, ultimately, I might have had the right motivations, but those guys deserve the same opportunities you or I would have.\" ", "Bobby tried to nonchalantly lean back in his chair to create some distance between them. ", "Kissing Piper felt right in the moment, but sliding the piles of folders off the table and slowly peeling off her clothes didn't seem as appropriate.", "\n\n\"You've got to be kidding me.\" ", "Piper was completely annoyed now and it was obvious all over her face. \"", "I'd imagine you know where all those guns go. ", "They're involved in robberies, homicides, and drive-by shootings every day. ", "Those guns kill children. ", "The drugs they push ruin people's lives. ", "If I had my way, those guys would have been begging to go to jail when I was done with them. ", "Look at this case.\" ", "Piper pulled open a folder she had been browsing earlier. \"", "Duke Cheval was arrested for holding the lease to an apartment where seven women were being kept as sex slaves. ", "The notes in the prosecutor's file say that the women were too afraid to testify against him and, therefore, he was found not guilty. ", "He claimed that the people were squatters, and he had no knowledge they were using his apartment as a brothel. ", "There were pictures of Duke entering and leaving the building on at least two occasions, but Judge Lions suppressed the evidence due to a mishandling in the storage process. ", "Apparently the pictures were coded incorrectly by the person cataloging them and they were filed with another case. ", "By the time they were found the judge felt there was too much opportunity for them to have been tampered with. ", "The youngest victim was sixteen years old and had restraint marks on her ankles and wrists, as well as cigarette burns all over her body. ", "Can you honestly tell me that you think he had no idea what was going on in that place? ", "Are you telling me that he doesn't deserve a fate worse than prison?\" ", "Piper didn't need the extra space Bobby had given her by leaning back in his chair in order to keep them from kissing again. ", "His ridiculous idealism about the justice system was enough of a deterrent.", "\n\n\"So what exactly is your solution, vigilantism? ", "We all go get our pitchforks and torches and hand out punishment as we see fit? ", "How can someone with any interest in criminal justice have that opinion?\" ", "Bobby loved a good debate as much as anyone but he was desperately hoping that Piper would break into a laugh any minute and admit she was joking.", "\n\n\"Why do you think I'm not in school anymore? ", "The entire thing is a joke, and I don't want to be a part of it. ", "Maybe retribution outside the system is exactly what they need.\" ", "Piper closed the file in front of her with a huff, exasperated by Bobby's stubbornness. ", "They both sat for a minute in silence, their faces twisted in frustration at the other's view. ", "Just as Bobby began to defend his point further, a voice broke in.", "\n\n\"I am so sorry guys. ", "I swear they can't do anything up there without me. ", "Bobby, were you able to help Piper?\" ", "Bobby stood, and Jules, knowing him well, recognized the annoyance on his face.", "\n\n\"I think she needs more help than I can give.\" ", "Immediately regretting the dig he tried to change the subject quickly. \"", "I completely forgot, Jules, I came here to ask you what kind of cake you want for tonight. ", "I'm going to pick it up on my way.\"", "\n\n\"I think I'd like a strawberry cake with white frosting,\" Jules said as she looked back and forth between Piper and Bobby, trying to make sense of the tension in the room.", "\n\nBobby nodded and headed for the door. \"", "I'll see you guys tonight then.\" ", "He leaned in and kissed Jules on the cheek as he hurried away.", "\n\n\"What was that about?\" ", "Jules asked with her hands on her hips looking suspiciously at Piper. \"", "Did I walk in on you two about to make out or about to fistfight?\"", "\n\n\"We were definitely not about to make out. ", "We were having a fiery debate about my feelings that legal mechanisms for criminal punishment are either nonexistent or insufficient, and maybe a little justice outside the law is occasionally in order. ", "He, however, feels that the rules are there for a reason and the law is completely black and white.\" ", "Piper started to stack the files up and found herself doing it with a little more annoyance than she intended.", "\n\n\"In other words you want to go kick some ass and he wants to let the law do its job. ", "That sounds a lot like Bobby. ", "He plays by the rules, almost to a fault. ", "That's how my dad was, and he feels like anything else would be doing a disservice to his memory. ", "He might be a little sensitive today. ", "The cake he's going to get is for my dad's birthday. ", "Every year my dad used to let me pick whatever cake I wanted and every year I picked something different. ", "We've tried to keep that tradition alive. ", "We'll have it after dinner tonight.\" ", "Jules swallowed hard as she smiled through the pain she still carried with her about losing her father. ", "It didn't matter how many years went by, how many cakes she picked, it always felt like she had just lost him.", "\n\nPiper stopped forcefully stacking folders and turned herself toward Jules. ", "She felt like a bratty little child now and wanted to slink away and die of embarrassment. \"", "I feel like such an idiot now. ", "I didn't know. ", "I get so caught up in my own convictions sometimes that I lose sight of the fact that people have reasons for believing what they do. ", "I don't want to intrude on your celebration tonight or upset Bobby any more than I have. ", "I should skip dinner this time.\"", "\n\n\"I want you to come,\" Jules whispered, with a disarming smile. \"", "My father would have liked you. ", "He always appreciated a good discussion of opposing views. ", "Plus, I know Bobby wants you there. ", "When you know someone as long as I've known Bobby you can read 'em like a book. ", "I've actually been fixing to tell you that if something should happen between you and Bobby, I'd be all right with it. ", "I'm always going to love him, but I don't ever see us being together again. ", "I want him to be happy, and if that comes from being with you then I'm all for it,\" Jules said, flashing her magnificent smile at Piper. ", "It was hard to even listen to Jules speak sometimes without getting caught up in how stunning she was.", "\n\n\"You don't have to worry about that at all, Jules. ", "Bobby is a really nice guy, and getting to know him better has been great, but nothing is going to happen between us. ", "I know it's kind of a cliché, but I have an enormous amount of baggage. ", "I'm hardly in a position to be anyone's friend right now let alone anything more than that. ", "I don't have any room in my life for it.\" ", "Piper hoped this brief moment of honesty on her part wouldn't lead to a barrage of questions from Jules.", "\n\n\"Oh darling, Bobby is the kind of guy you make room for. ", "He'll open your car door, drive twenty minutes to kill a spider you've trapped under a jar, and he'll forgive you before you even realize you're sorry. ", "That boy has been by my side for every hard moment of my life. ", "Whatever woman makes room for Bobby will be eternally blessed,\" Jules said with a knowing look on her face. ", "Letting Bobby's love slip through her fingers was a regret she'd have to live with, but if she could stop someone else from making the same mistake maybe she'd find some peace with it.", "\n\n# Chapter 8\n\nPiper kept thinking to herself, this isn't at all like the movies. ", "She was an average person with no notable skills trying to do something most people wouldn't be delusional enough to attempt. ", "It had been two weeks since digging through court records had helped her make the connection between the Donavan family and the judge, yet she still found herself buried in more research. ", "She couldn't decide if she was stalling or being thorough.", "\n\nTwo more trips to the town hall had proven helpful. ", "She was able to read an abundance of articles that had been printed about the Donavan family along with personal notes by various attorneys. ", "This gave her insight into people's perceptions of them. ", "None of the material offered cold hard facts, but there was something to be said for rumors; they almost always held some truth. ", "Two prosecutors had actually made notes in the margins of their pads that made vague references to judicial bias.", "\n\nPiper was also very grateful for the job with the cable company. ", "Not only did the staggered shifts give her ample time to piece the puzzle together, but the company's data base was a gold mine of information. ", "It was amazing what you could learn about someone from television and Internet choices. ", "She compiled a spreadsheet of addresses for each member of the Donavan family she could find. ", "Something Bobby had said kept running through her head. _", "If I was going to take them down, I'd start with Sean._ ", "And everything Piper found was pointing in that same direction.", "\n\nSean didn't seem to be employed as he spent most of his time during the day utilizing the gaming system and chat function that ran through the cable company. ", "At night he rented an ungodly number of porn movies. ", "His overall Internet and television usage was astronomical. ", "He seemed to be a deadbeat, just as Bobby had described him.", "\n\nAll of this was helpful information, but Piper still had no idea how to use it. ", "She knew that the quickest and most effective way to remove the judge was to turn his allies against him. ", "She was now fairly certain that the Donavans were the cohorts in question, but what was her next move?", "\n\nShe did have a slight advantage over the average person. ", "Her childhood provided an inside track to the unwritten code of criminals. ", "Most people would incorrectly assume that a family of crime would be far too indebted to a judge who consistently acted in their interest. ", "But Piper knew there were at least three things the judge could do to undermine his relationship with the Donavans.", "\n\nFirst, you never mess with an associate's children or sleep with his wife. ", "Even if they are divorced, she is still off limits. ", "Second, you don't double dip, meaning if you are currently taking bribes from the Donavans you don't go getting greedy and start looking to expand your dealings with other groups. ", "And third, you are perfectly allowed to sleep with women of any age. ", "You can frequent strip clubs, pay for sex, and even rough the girls up if that's your thing. ", "Regardless of how young they are, in the eyes of these men, you are not a pedophile. ", "But if you make the same habit with young men and boys, then you are a monster and considered the lowest of low on the criminal food chain. ", "If the judge were to cross any of those lines it would be a fast track to dissolving their alliance.", "\n\nSo Piper would follow Bobby's unwitting advice and start with Sean. ", "She wasn't sure where he would lead her, but she felt if anyone was going to further her plan it would be him.", "\n\nNow all she needed to do was set the trap. ", "Finding a way into his house wouldn't be all that difficult. ", "Sean certainly couldn't live long without his cable and Internet, so disrupting those would result in an urgent call for a technician in that area. ", "The hard part would be what she would do once she was there. ", "No one really opens up much to some stranger from the cable company. ", "She would need this encounter to be a bridge to a more intimate rendezvous between them. ", "She decided that she would need Sean to ask her out on a date. ", "Judging by his inability to put down the remote control, this might not be an easy task. ", "Somehow she would have to come across as someone worth leaving the house for.", "\n\nThat meant more research. ", "She studied the video games he played in great detail and watched many of the movies he ordered through pay-per-view, but she stopped short of diving into the ones that fell under the adult subscription. ", "She hoped that sharing his interest in _Smoking Hot Moms_ wouldn't be necessary to win him over.", "\n\nBefore she knew it, Piper was standing outside the door of Sean Donavan's third-floor apartment choking back the urge to vomit. ", "She blamed the feeling on the repulsive smell of marijuana and garbage that seemed to fill the hallway, but realistically, her nerves had begun to catch up with her.", "\n\nShe knocked hesitantly and clutched her toolbag tightly with her sweaty hand. ", "She heard a muffled grumbling noise and then the shuffling of feet coming toward her. ", "The door swung open and a disheveled man who had clearly just woken up stood before her. ", "His eyes were puffy and red, which Piper assumed was from doing drugs of some sort. ", "His hair, which was somewhere between blond and brown, was matted in some areas and then looked as though it was attempting to escape from his head in other areas.", "\n\nHe wore baggy gray sweatpants and a green buttoned-down shirt that was wide open, exposing his chest and stomach. ", "Piper noticed he was fit and had a thick, raised scar running from his chest down to his belly button. ", "Even with the repulsive lack of grooming he had a gorgeous face. ", "The structure of his lips and cheeks were rigid and incredibly masculine. ", "He reminded Piper of a young James Dean, weathered but smolderingly handsome.", "\n\n\"They send a freaking skirt to fix my cable? ", "What the hell is this world coming to?\" ", "Sean asked as he squinted to look Piper over. ", "The bright lights of the hallway were too much for his cloudy and watery eyes. ", "Piper was beginning to wonder what kind of backward town Edenville must be. ", "Its occupants had such a hard time wrapping their mind around a woman being able to run some wires and drill some holes. ", "She wasn't sure if they thought work at the cable company was so complicated or that girls weren't capable of manual labor. \"", "At least you're hot. ", "Let's get this over with already. ", "I've got shit, like work, to do on my computer.\"", "\n\nPiper wanted to interject that chatting with other unmotivated strangers while blowing things up in the latest video game didn't count as work. ", "Instead, she smiled and followed Sean into his apartment. ", "Not surprisingly, it was a mess. ", "The apartment itself was quite nice, with a brick fireplace and granite countertops in the kitchen, but it was overrun with beer bottles, ashtrays, and piles of clothes.", "\n\n\"Sorry you're having trouble with your cable. ", "I'm sure I can get it fixed so you can get back to work,\" Piper spoke in a coy, quiet voice and smiled warmly at Sean. ", "She made her way to the first television in the room. ", "She knew full well that the problem with his cable didn't lie in the house. ", "She had disconnected his service from outside.", "\n\nSean plopped down on the couch, and she could feel his eyes on her. ", "Piper had on a lace tank top beneath her uniform and had left most of the buttons on her shirt undone. ", "In a very degrading move she had searched through her old clothes to find a pair of thong underwear that she hiked up above the line of her khaki pants. ", "It was all incredibly demeaning to her, but she had known guys like Sean her whole life. ", "She knew what he'd be thinking as she bent down to get access behind the television.", "\n\n\"Oh wow,\" Piper sang, feigning surprise. \"", "You have the Demons from the Depths Five? ", "I've been on the waiting list to get a copy of that for weeks. ", "You're so lucky.\" ", "Piper felt her face warm a little as she tried to sound like an envious fellow gamer.", "\n\n\"It's not luck. ", "You have to be someone in this town to get access to shit like that so early. ", "You play?\" ", "She assumed that was some kind of gamer slang and that he was asking her if she liked video games.", "\n\n\"A little,\" she answered. \"", "I can hold my own. ", "But I guess it doesn't matter, since I'm not _someone in this town_ I won't get a chance to play it for a while,\" Piper used her fingers to make air quotes and show a sassy side.", "\n\n\"If you ever get my shit fixed here, then maybe I'll let you lose to me for a while.\" ", "Sean had clearly spotted the lacey clues Piper had left for him to find all over her body. ", "She could feel his interest in her growing. ", "He had a devilish smile creeping across his face.", "\n\n\"I'll have it fixed in just a few minutes, but I have other jobs to get to so I can't stay, even though I'd really like to hang for a while.\" ", "Piper wasn't sure if people still said things like hang, and she could feel her nerves raging. ", "She winked at him and gave her best attempt at a naughty crooked grin.", "\n\n\"I think if you stayed we'd find other things to play.\" ", "Sean rose from the couch and Piper felt her heart skip a beat. ", "She wanted to be flirty and mysterious, but she knew she might claw his eyes out if he actually tried to touch her right now.", "\n\n\"I don't play anything without dinner, or at least drinks.\" ", "Piper slowly started putting her tools back in her bag and stood.", "\n\n\"You might be worth a drink or two. ", "How about you meet me at Lorenzo's Bar on Thursday night at nine?\" ", "Sean moved closer to her and she could feel her skin begin to crawl. ", "She sidestepped him as he approached and headed for the door.", "\n\n\"That sounds great. ", "I'll see you there. ", "Your cable should be all set in about ten minutes. ", "I'll just show myself out,\" she spoke fast and moved even faster toward the door. ", "Mission accomplished, she thought, no need to stick around and give Sean a chance to get any ideas.", "\n\nAs Piper reconnected Sean's cable from the box outside his place, she could feel her heart pounding against her chest. ", "Every time she took one step further down this path she felt herself falling slightly more out of control.", "\n\n# Chapter 9\n\n\"Are you ready to go?\" ", "Bobby asked Piper as they sat on Betty's porch swing watching the night unfold before them. ", "Lightning bugs were beginning to sparkle across the open field of the front yard, and the crickets were chirping loudly. ", "Piper looked forward to Wednesday nights week after week. ", "They were brief moments in time filled with calmness and tranquility mixed with laughter. ", "For the last two weeks Bobby had given her a ride there. ", "Betty had insisted that it didn't make sense for two people coming from the same direction to drive in different cars. ", "Whether she was playing matchmaker or mother hen, it didn't seem up for debate.", "\n\n\"I'm never ready to leave here,\" Piper answered, with a little pout. \"", "Don't you wish you could stay forever? ", "This creaky old swing, the sounds of the night and all these stars? ", "I'm not sure there is anywhere on earth more peaceful than this.\" ", "Bobby watched the wonder dance on Piper's face and realized how different her life must have been from his growing up. ", "He appreciated a little front porch sitting as much as the next southerner, but Piper seemed completely in love with the concept of quietly watching the world around her, as if she had never really done it before. ", "Until his parents moved back up north two years ago, Bobby had lived at home, just next door, with them. ", "Most of his nights ended exactly this way. ", "Now, since moving into downtown Edenville, Wednesday night was the only way he could enjoy the outdoors this way. ", "But if he had to, he'd sit on a pile of rotting trash at the landfill to be next to Piper.", "\n\n\"Come on,\" he said, standing and pulling her up by her outstretched hands. \"", "It'll be next Wednesday night before you know it. ", "I'll be honking the horn outside your house and we'll be on our way back here.\" ", "Bobby poked his head back through the screen door and called a goodbye to Betty who was drying the dishes and humming a song.", "\n\n\"Bye kids, drive safe.\" ", "Betty walked out on the porch as they got into Bobby's big red truck and waved at them as she always did. ", "Piper loved that about Betty. ", "She loved that she stood on the threshold of her house and waved all of them off every time they left.", "\n\nThere was something so comforting about knowing no matter how many times you looked back she'd still be there. ", "She'd stand with her dishrag draped over her shoulder waving her hand and smiling until you were out of sight. ", "Piper felt like she had waited her whole life for gestures like that.", "\n\nBeing a passenger in Bobby's truck was oddly exciting. ", "It was an antique but so comfortable and well-kept that you'd never know how old it really was. ", "It was nice not to have to navigate the dark country roads, and to simply sit back and watch the world go by. ", "They usually talked about how work was going for both of them, how much of an idiot Scott was that night, and occasionally about Betty and Stan. ", "Piper had learned their love story was one you might see in a movie. ", "Bobby painted them as the perfect parents and fiercely loyal to each other. ", "He had mentioned on more than one occasion that he would never settle for a relationship that was less than what Betty and Stan had.", "\n\n\"So I've been meaning to ask you something,\" Bobby started timidly, and Piper could tell he was feeling a little awkward about his question. \"", "Did Jules give you the same speech about how we have her blessing if anything should happen between us?\" ", "Bobby looked straight ahead, focusing on the road.", "\n\n\"She did. ", "It was strange and uncomfortable but very sweet. ", "Don't worry though, I told her nothing was going to happen.\" ", "Piper was desperate to move on from this conversation. ", "She hated any deep discussion that didn't come with an exit strategy, unless she considered diving out of a moving truck an acceptable form of ending a chat. ", "She knew everything she had been doing over the past weeks was playing with fire. ", "She couldn't go around blending herself into this peculiar but delightful group without them wanting more from her. ", "And she couldn't go around swinging on a porch swing week after week with a gorgeous cop and not think he'd expect something to come of it.", "\n\n\"Well that's not completely true. ", "We kissed.\" ", "Bobby felt a small pang of disappointment at Piper's reaction. ", "He had hoped this conversation might be a jumping off point for something more.", "\n\n\"That wasn't really a kiss. ", "It was a thank you between friends. ", "It didn't mean anything. ", "It was how you would kiss your grandmother for goodness sake.\"", "\n\n\"I guess the next time I kiss you I better not leave any doubt about my intentions then,\" he smiled unapologetically at her.", "\n\n\"There isn't going to be a next time. ", "I'm not sure how to put this so bear with me while I think of the right way to say it.\" ", "She bit her lip and searched out her window, hoping maybe the right words would be painted on the passing trees.", "\n\nWhen Piper remained silent for several moments, Bobby spoke up. \"", "You're very beautiful when you're speechless. ", "Let me see if I can help you. ", "Are you dating that lawyer guy you're doing all that research for? ", "Because that won't stop me from pursuing you. ", "I'm not above stealing another guy's girl,\" Bobby said with a forced seriousness that broke into a smile.", "\n\n\"No, Michael and I are barely even friends. ", "We're more like acquaintances. ", "That isn't it at all.\" ", "She looked down at her lap still searching for the right words to say. ", "She fiddled nervously with her hands until Bobby reached over to hold one.", "\n\nHe intertwined his fingers with hers, and she was taken aback by how warm and large his hand felt. ", "Her hands were always cold regardless of the outside temperature. ", "It seemed to be ages since she had felt the warmth of another person in this intimate way. ", "She let the comfort and connection of his hand take over for a moment before realizing what she had to do. ", "She pulled her hand away and began to speak.", "\n\n\"I'm not even a whole person, Bobby. ", "I'm no Betty to your Stan. ", "There are some girls out there who are worth the fight and the hard work, but you're going to have to trust me when I tell you that I'm not one of them.\" ", "She had her hands back in her lap now and stared down at them. ", "It had only been a minute and she already missed the feeling of his hand enveloping hers.", "\n\n\"I'm a pretty insightful guy, Piper. ", "By now I've realized that you don't talk about your past. ", "If you haven't noticed, I've stopped asking. ", "I can see that you've got some history that maybe you're still dealing with. ", "That doesn't make you some damaged girl unworthy of a relationship.\" ", "Bobby pulled the truck up to the front of Piper's house. ", "The thought of the conversation ending was relieving to Piper and disappointing to Bobby. ", "She pushed open her truck door instead of waiting for Bobby to come around and do it for her as he usually did, another gesture she had always imagined but never expected. ", "Before she could hit the first step of her apartment she heard Bobby following behind.", "\n\n\"Bobby, I know you have this whole hero complex thing, and you probably see me as this great cause you can work on. ", "I don't need that right now. ", "I need a friend, and you, Jules, and Betty have been wonderful. ", "That's all I have room for at the moment.\" ", "She fumbled for her front door key as she climbed the stairs, not looking over her shoulder to see his reaction or if he was following her. ", "He certainly was.", "\n\nThey were both at the top of the stairs now, her keys in hand and her forehead pressed against the door in frustration. ", "He turned her around to face him and pulled her chin up so he could look into her eyes.", "\n\n\"I'm going to kiss you right now unless you explicitly tell me not to.\" ", "He paused, and Piper was frantically searching for the words to tell him to stop, but none came.", "\n\nBobby leaned in and kissed her, hesitating slightly as if he were afraid to scare her off. ", "After a moment of passively fighting it, Piper parted her lips, inviting him to kiss her passionately. ", "Bobby's warm hand was resting softly on her cheek. ", "His tongue danced lightly across her lips. ", "He used his free hand to pull her body up against his and she felt herself shake with passion. ", "It didn't matter how many times she had touched him over the last few weeks she was always surprised by the tightness of his muscles and the width of his shoulders.", "\n\nTime seemed to cease, until the sound of a honking car somewhere in the distance freed them both from the trance. ", "As their lips moved away from each other's, their foreheads came together, and Bobby looked into Piper's eyes, searching for a reaction.", "\n\nHer face read only stunned. ", "She was surprised at how magical the moment felt, how she had made it all the way into her twenties without ever feeling anything like that before. ", "She was even more surprised that she had let it happen. ", "Bobby kissed her cheek, tucked her frazzled brown hair behind her ear and leaned in to whisper to her, \"That was no Grandma kiss.\" ", "He took the keys from her hand, unlocked her door, and swung it open. ", "Piper, who was still reeling from the kiss, felt his hand on the small of her back as he nudged her in. ", "For a moment she thought he'd be joining her and the kiss would be only a gateway to a night of passion. ", "But in true gentlemanly fashion, he nodded and winked as he turned back toward the street, pulling the door closed between them.", "\n\nIt took another long minute before she could will herself to move toward the window to watch his taillights as he pulled away. ", "She had kissed and been kissed by men in the past, but none had ever felt so breathtaking. ", "She could still taste the mint of his gum on her lips and smell his fresh, soapy skin. ", "She knew now that she felt something for Bobby that she had never experienced before, and it meant one of two things. ", "Either she'd have to let him in or push him away. ", "Both options seemed suffocating.", "\n\n# Chapter 10\n\nPiper opened her eyes wide as she brushed mascara across her lashes. ", "It had been so long since she had gone through the entire process of getting herself made-up. ", "She had to dig deep into her closet to find something edgy enough to wear on a date with Sean. ", "This method of preparation even required a trip to the store for additional makeup supplies and perfume, two things she had almost completely stopped buying years ago. ", "As the picture of her primped self started to come together in the mirror, Piper began feeling warm with excitement. ", "The thought of a date with Sean was repulsive, but the act of getting ready for an evening that didn't include sweatpants or flip-flops was a little enticing.", "\n\nThe problem was, as hard as she tried to force the memory of her kiss with Bobby out of her head, it continued to creep its way back in again and again. ", "She spread her ruby red gloss across her lips and all she could think about was how nice it would have been for this date to be with Bobby tonight. ", "How he would come to her door with flowers and be floored by how beautiful she looked. ", "She wouldn't need to wear this black cocktail dress, just something simple. ", "She would feel his eyes on the curve of her hips and his hand on the small of her back as he walked her to his truck and opened the door. ", "They'd have a romantic picnic under the stars somewhere so quiet it teetered on spooky, because Bobby knew her well enough to know that was what would make her happiest, not drinks in some overcrowded noisy bar.", "\n\nWhen she was finally done getting ready, Piper stood in front of her full-length mirror and reviewed her handiwork. ", "Her thick hair, which she usually let air dry, was silky and full of volume thanks to forty-five minutes of blow drying with a giant round brush. ", "Her dress was cut low, and it hugged tight to her waist. ", "Piper's modesty would never allow her to admit it, but she did have the figure for perfectly showcasing a snug fitting dress.", "\n\nAs she walked the ten blocks to the restaurant in heels, she realized this would be daunting to most people in Edenville. ", "People hardly walked anywhere in this town if they didn't have to. ", "For Piper, however, her whole life had been spent walking the streets of Brooklyn. ", "Her parents never owned a car, and Piper avoided public transportation as often as possible. ", "As a result, she frequently found herself walking miles to her destination. ", "She thought it very funny that she had a car and a driver's license now. ", "It had all been included in her relocation. ", "The fact that she never took a driving class, passed the necessary test, or had even been behind the wheel, didn't seem to matter to anyone. ", "Those types of details fall through the cracks when you're handed a prefabricated new life. ", "She had taught herself to drive in the parking lot of a closed supermarket. ", "It took three weeks before she was willing to venture out onto the streets, but, even now, she walked whenever possible.", "\n\nWalking in Edenville was so different than walking in Brooklyn. ", "In Edenville, there were no herds of people moving like cattle. ", "You didn't have to jump to avoid oily puddles loaded with floating cigarette butts. ", "There were no homeless people to step over and passively ignore. ", "Edenville had charm, but Brooklyn had character, and Piper knew there was a big distinction. ", "You could search all of Edenville and still probably not be able to find a group of people to represent every race, creed, and religion whereas in Brooklyn you could find it all walking down the street. ", "No matter what time of night, you could get any type of food you wanted in Brooklyn. ", "A Viennese deli, a food truck, an upscale restaurant—they were all just steps away from each other. ", "For Piper, Brooklyn was full of toxic memories, but they were the only ones she had.", "\n\nThe contrast between New York and Edenville was most glaring in some of the simplest scenarios. ", "Piper would watch a school bus stop every hundred feet in Edenville to gather up children of all ages. ", "Back in Brooklyn once you reached middle school, there were no school buses to transport you. ", "Students ventured out onto the subway, walked, or hopped three or four different bus routes to bravely make their way to school, unaccompanied and trying hard to appear unafraid.", "\n\nThe tallest building in Edenville was the bank, standing three stories high. ", "In Manhattan, where Piper would escape to as often as possible, she'd get vertigo just by staring up at the enormous structures that towered over the busy streets. ", "As a child, Piper's favorite thing to do was ride the elevators up the highest buildings and stare out the large glass windows at the skyline of New York. ", "There was no shortage of differences between the two places she had lived, but Edenville had one thing New York didn't—Bobby. ", "She let herself smile slightly at the thought of him, and replayed in her mind for the hundredth time, the kiss they had shared.", "\n\nPulling the door to the restaurant open Piper pushed out the thoughts of her past and Bobby. ", "She took a seat at the bar and started to refocus on what her goal was tonight. ", "She was going to attempt to determine through which avenue it would be best to annihilate the judge's relationship with the Donavans. ", "Would it be Christian's wife? ", "Would it be his family? ", "She might not get everything she needed from Sean tonight, but even the most general conversation could open up a new door for her to explore.", "\n\nIt was now a full thirty minutes past the time Sean was supposed to arrive and Piper was getting annoyed as she sat looking quite pathetic at the bar. ", "Finally, after telling herself she'd give him five more minutes, the door swung open and in walked Sean. ", "He was wearing dark denim jeans that were a few sizes too big and hung low around his waist, not so low that he could be an extra in a rap video, but low enough to look ridiculous as far as Piper was concerned.", "\n\nHe had on the same green button-up shirt she had seen him in just days before, but now, thankfully, it was buttoned. ", "His hair was combed back and greased in true mafia fashion. ", "She hated that he was good-looking; that she had even the slightest attraction to him infuriated her. ", "The muddled chatter around the bar subsided for a moment as patrons watched Sean approach. ", "When he sidled up next to Piper, conversations quickly resumed, though Piper could now feel a dozen pair of eyes on her.", "\n\nSean leaned in toward her and kissed her cheek, lingering for a moment to smell her hair. ", "He pulled out his stool and sat down beside her, looking her over from top to bottom. \"", "Damn girl, you clean up nice.\" ", "As a true New Yorker herself, Piper was annoyed by Sean's attempts to sound like anyone other than the Southern-born kid he was. ", "He tried hard to hide his drawl and speak like one of the Italian tough guys you'd see outside of the bakeries in Brooklyn. ", "He did a terrible job at it, and every word grated on her nerves.", "\n\nHe flagged the bartender down, which wasn't hard as he seemed eager to serve in a moment's notice. \"", "Hey Chuck,\" he said as the two shook hands across the bar. ", "Piper could read an air of anxiety on the bartender's face.", "\n\n\"Hey Sean, how's things going?\" ", "Chuck asked, stumbling slightly on his words. \"", "What can I get you two to drink tonight? ", "On the house, of course.\" ", "He stood wringing his towel in his hands nervously.", "\n\n\"I'll have the usual, and she'll have a Seven and ginger,\" Sean said, not even looking at the bartender. ", "His eyes were locked on Piper's body, and he grinned like a child who had found an extra toy in his happy meal. ", "Piper ignored the fact that he hadn't actually asked her what she'd like to drink. ", "That didn't really matter, because if she'd had her choice it would have been a root beer. ", "She hated the taste of alcohol and usually struggled to pick a drink for herself.", "\n\n\"Great guess. ", "That's one of my favorite drinks,\" Piper giggled, batting her mascara-laden eyelashes.", "\n\n\"So since I guessed right, does that mean I get a prize? ", "Maybe we should drink these fast and get out of here.\" ", "Sean put his cold, clammy hand on her thigh just under the hem line of her dress. ", "It was incredible to her how two hands could feel so different. ", "The night before, Bobby's hands were warm and comforting, and tonight Sean's hands felt intrusive and dirty.", "\n\n\"Maybe I gave you the wrong impression over at your house,\" Piper explained, trying to slow the night down a bit. \"", "I think you're a cool guy, and I'm glad we're out having drinks, but I don't even really know you. ", "Let's at least talk a bit before we take this any further.\"", "\n\nSean rolled his eyes and grabbed for his beer the bartender had just put down in front of him. \"", "I knew you weren't going to be as easy as I hoped.\" ", "He rolled his eyes and took a swig of his beer with his free hand, the other still planted on her leg. \"", "Fine, what do you want to know about me? ", "Bring on the stupid chitchat.\"", "\n\n\"I guess my questions changed the minute you walked in here tonight, because originally I did want to ask you some dreary questions about your favorite movies, but not anymore.\" ", "Piper leaned in and looked into his eyes, talking barely above a whisper in an effort to seem more seductive. \"", "Now what I really want to know is why the whole bar got quiet when you walked in, why everyone seems a little nervous you're here, and why you drink for free in one of the only decent bars in this town. ", "I could give a shit what your favorite movie is now; all I want to know is who the hell I'm sitting with here.\" ", "She knew what this would do to a man like Sean. ", "She knew making him feel important and bolstering his ego would put him in the mood to talk.", "\n\n\"You're a very observant girl, aren't you? ", "I'm guessing you're not from Edenville because you'd already know plenty about me. ", "If you were smart you'd've asked around before coming out tonight.\" ", "His finger danced in a circled on the top of her thigh and under her dress as he flashed a devilish grin.", "\n\n\"And what would I have heard, exactly? ", "I don't tend to listen to rumors much. ", "I like to get my information right from the source.\" ", "She slowly reached across and fixed the corner of his collar that was sticking up slightly. ", "She did this partially because she thought it would be a sexy gesture and partially because it was annoying the hell out of her.", "\n\n\"I come from a very important family in this town. ", "We have a lot of history, here. ", "My dad was a businessman until he died five years ago. ", "My older brother and I, we've picked up where he left off. ", "Don't bother asking me what kind of business, you don't want to know.\" ", "He threw his beer back, took another mouthful, and it reminded Piper she hadn't even sipped her drink yet. ", "She reached for it, pulled some up through the tiny straw and used all of her willpower not to wince.", "\n\n\"Very mysterious, I like that. ", "So if you're such an important businessman, what were you doing home in the middle of the day waiting to play video games?\" ", "She placed her drink back on the bar and tried to ignore the vibrating of her phone in her bag. ", "The noise was loud enough to distract them and it was the third time it had gone off.", "\n\n\"I handle the family side of the business. ", "Up until school started I watched my nephew every day. ", "Now I have him every afternoon. ", "My brother is very protective, and he doesn't trust him with anyone but family. ", "It sounds like a lame gig, but it pays well, that's for sure.\" ", "Somehow Sean had already managed to finish his beer and before even thinking of waving down the bartender another had appeared before him.", "\n\n\"That sounds like a nice setup. ", "How old is he? ", "Doesn't he have a mom who can watch him?\" ", "Piper didn't want the questions to come too fast and sound like she was gathering information.", "\n\n\"Chris is eight. ", "His mom didn't exactly like the lifestyle that came along with the family business, so she took off a few years ago. ", "She's a real bitch.\" ", "Piper assumed Chris was short for Christian III. ", "What a lucky kid, part of such a wonderful legacy.", "\n\n\"That is really cute. ", "I think guys who get along well with kids are so hot.\" ", "She reached into her bag trying to get a glimpse of who was calling her while grabbing her lip gloss. ", "No luck, she couldn't see the caller ID without being more conspicuous, but luckily it had stopped vibrating. ", "She smeared the lip gloss across her lips and puckered them together.", "\n\n\"So is that enough to get you to finish that drink and get out of here?\" ", "His hand moved another inch up her leg as he leaned in toward her ear whispering, \"My car is right out front.\"", "\n\n\"How do I know you're telling the truth? ", "You prove it to me.\" ", "Her phone began vibrating again, and she could see Sean becoming irritated, either with the phone or her protests about leaving. \"", "A good uncle would have picture of his nephew in his wallet.\"", "\n\nHe huffed and finally released her leg, leaned over and pulled his wallet from his back pocket. ", "He flipped it open and there was a school picture of a little boy. ", "He was perched in front of a fake autumn scene wearing the uniform of a private school. ", "Piper leaned in to get a good look at the crest on his shirt and cooed over how adorable he was.", "\n\nShe slid off her stool and whispered in his ear, \"Let me go find out who is calling me and run to the ladies' room. ", "Then I'll be right back, and we'll talk about getting out of here.\"", "\n\n\"I'm done talking,\" he hissed back, half angrily half playfully as he grabbed a handful of her ass on her way by.", "\n\nShe looked over her shoulder at him and winked, \"We'll see.\" ", "As she rounded the corner of the restaurant and was out of sight she wrestled her stupid oversized bag for her phone. ", "It rang again and the screen read _Michael_.", "\n\n\"Hello?\" ", "she said in an exasperated tone. ", "There was no answer, she heard the phone click and disconnect.", "\n\n\"What the hell are you doing?\" ", "Michael's voice called from behind her, sending her jumping. \"", "Are you seriously on a date with Sean Donavan, or am I having some sort of stroke?\"", "\n\n\"Michael, you scared the hell out of me. ", "What are you doing here, and why are you calling me every five seconds?\" ", "She knew the answer to the latter question, but faking ignorance seemed like her only card to play.", "\n\n\"Look at you,\" he said, pointing to her dress and hair. \"", "I barely recognized you. ", "I tried for fifteen minutes to convince myself it wasn't you sitting at the bar with that complete degenerate. ", "So tell me, do you have the nastiest taste in men or the faultiest judgment on earth? ", "Because you are either out on a date with him or poking your nose where it doesn't belong, either of which would be a terrible choice.\" ", "Michael's face turned from hard-lined disappointment to genuine concern. \"", "What have you gotten yourself into, Piper? ", "When I told you to go check out those court records I had hoped you would either be too dumb to figure it out, or too smart to do anything more with them.\"", "\n\n\"Seriously?\" ", "Piper couldn't believe what she was hearing. \"", "So you knew all along what I would find? ", "You had the answer and wouldn't give it to me? ", "More importantly, you're too much a coward to do anything about it yourself. ", "I'm writing a paper Michael, stop being so dramatic.\" ", "Piper tried to storm past him but he used his body to block her. ", "He put his hands on her shoulders, not with force but enough for her to stay put.", "\n\n\"What I believe and what I know are two different things. ", "In this case I believe there may be more than meets the eye when it comes to a judge and a crime family. ", "I'm certain you are in absolutely no position to go trying to find out on your own. ", "I have tried two cases against Sean, and both were sexual assaults. ", "He is a dangerous guy and as tough and smart as you are, you can't outrun wickedness, it will catch up to you. ", "Please, make an excuse to leave and meet me at my office. ", "We'll talk this out.\" ", "Michael brought himself down to her level and looked her in the eye. \"", "Please.\"", "\n\n\"Fine.\" ", "Piper had gotten all she could out of Sean without actually having to sleep with him which she never intended to do anyway. ", "Michael's incessant phone calls had actually acted as a decent exit strategy, but she wouldn't give him the satisfaction of meeting him after. \"", "I don't need the lecture though, so I'll skip the little meeting at your office. ", "Thanks anyway.\" ", "She shook his hands off her shoulders and stormed past him.", "\n\nAs Piper approached the bar she worked fast to concoct a decent story. \"", "The pipes in my place burst,\" she huffed, sounding flustered and put out. \"", "I've got to get back there and deal with the damage. ", "My landlord is having a meltdown. ", "I'll have to take a rain check on tonight.\" ", "She had prepared herself for some pouting, whining, and overall childish behavior on his part and was surprised at how calm he was.", "\n\n\"Oh, that sucks. ", "Why don't you just finish your drink, that's what we came here for, right?\" ", "He pointed to her bar stool and smiled crookedly at her. \"", "The pipes won't be any less broken in ten minutes.\"", "\n\nShe didn't have time to dispute, her story was not thought out well enough to ad lib reasons she must leave right this second. ", "When nothing came to her, she acquiesced and sat back down. ", "She knew Michael's eyes would have been on her. ", "She knew he must be steaming mad, but she thought finishing her drink was a small price to pay for exiting this horrible date unscathed and with a little more information than she had when she arrived.", "\n\nThe drink only tasted worse the longer it sat, and Piper decided to drink it quickly and make short work of it. ", "With five or six large swigs that she tried to work in between more idle conversation, the drink was finished. ", "Why she was worried about being rude was beyond her, but she thought she should wait at least another five minutes or so before taking off.", "\n\nIt was in the middle of a discussion about video games that Piper realized something was amiss. ", "She had been half-listening to Sean speak and half-organizing the thoughts of her plan in her head as she processed the information he had given her and considered ways to use it. ", "Then she was doing neither; her thoughts seemed to be sloshing around in her head like a boat at sea. ", "She felt dizzy and confused, her vision failing her slightly.", "\n\nWhen she grimaced and brought her hand to her forehead to try to steady the spinning room she heard Sean's voice, now seeming far away. \"", "You don't look so good. ", "We better get you out of here.\" ", "He lifted her arm, the one closest to him, and swung it up over his neck. ", "In an instant she realized what was happening. ", "He had put something in her drink and now was trying to take her out of the bar.", "\n\nEven though her limbs were heavy and she couldn't find her voice, she used her free arm to swat at Sean's beer bottle and knocked it to the floor where it smashed loudly. ", "All she needed to do was draw some attention to herself and then someone, hopefully Michael, would intervene.", "\n\n\"Hey.\" ", "She heard Michael's voice swimming around in her head. ", "She could barely keep her eyes open now and her legs were shaking, hardly able to support her weight. ", "She didn't want to keep holding on to Sean, but if he were to let go she knew she would fall to the floor.", "\n\n\"What the hell do you think you're doing?\" ", "Michael stood between Sean and the door. \"", "Did you drug her? ", "You honestly think you're walking out of here with some girl who can't even see straight. ", "That doesn't sound like a good idea with a record like yours.\" ", "Michael was ready to fight, either with his professional skills or his fists, it didn't matter. ", "There was no way Piper was leaving with Sean while he was standing there.", "\n\n\"I don't have a record. ", "I've never been convicted of anything. ", "You're the lawyer, you should know that. ", "Just because you can't win a case doesn't mean you have to go around making shit up. ", "She had a few too many drinks, I'm taking her home.\" ", "Michael was a full five inches taller than Sean and significantly stronger. ", "As long as Sean didn't have a weapon on him, or was stupid enough to show it in a busy restaurant, then Michael felt confident. ", "Sean tried to push past him and in one fell swoop Michael pulled Piper to his side and shoved Sean in the other direction.", "\n\nChuck the bartender, still meek in his approach, came out from behind the bar and talked quietly to Sean. \"", "Sean, buddy, if you catch another case your brother is going to kill you, especially if you draw any more attention to this place. ", "Just get out of here and I'll cover for you.\" ", "He ushered Sean toward the door.", "\n\n\"Wait,\" Michael shouted, having a last minute epiphany. \"", "What the hell did you give her and how much?\" ", "He knew this information would be vital to figuring out what to do next with the lifeless girl pressed to his side.", "\n\n\"Right, like I'm going to tell a lawyer. ", "That tease wasn't worth it anyway.\" ", "Sean pushed open the door and proceeded to flash his middle finger back at Michael. ", "If there had been a safe place to lay Piper down he would have followed Sean into the parking lot and beat him senseless.", "\n\nThe bartender waved back at Michael signaling that he would try to find out and to stay right where he was. ", "Michael looked down at Piper who was now limp and seemed as though she were sleeping. ", "He watched her chest rise and fall and was relieved to see she was still breathing. ", "A few moments later Chuck reemerged from the doors and tossed a pill bottle over to Michael.", "\n\n\"There's an ambulance on the way, but you've got to meet them at the corner,\" Chuck said, motioning toward the street. \"", "Sean said he only put one in her drink, and all she'll need to do is sleep it off.\" ", "Chuck was shaking his head as he crossed back behind the bar and went right back to work. \"", "I can't have this shit here,\" he mumbled.", "\n\nMichael adjusted his grip on Piper's upper half and scooped her up from behind her legs, cradling her in his arms. ", "He had stood next to Piper, leaned in close to her over some documents a few times, but it wasn't until this very moment he realized how tiny she was. ", "He pushed his way through the entrance and was stunned by the lack of offers to help. ", "People didn't want anything to do with this and certainly would have let Sean walk right out with Piper regardless of what state she was in.", "\n\nOutside the restaurant, Michael sat down on a bench under a flickering street lamp, his arms starting to ache from holding Piper for so long. ", "He was still supporting her under the legs, and her face was now pressed against his neck. ", "He took comfort in the repetition of her breath and was whispering encouraging words in her ear.", "\n\nThe ambulance pulled up one block over from the restaurant, and Michael was relieved to recognize the EMT. ", "It was an old acquaintance of his, Johnny Thompson. ", "He saw him occasionally testifying in court and they still had some friends in common. ", "They had partied together in Michael's early days in Edenville. ", "The move to a small town where he hadn't known anyone had seemed like such a good idea until the loneliness had started to set in. ", "Johnny had been a dependable drinking buddy for a while.", "\n\n\"Hey Mikey, what's going on?\" ", "Johnny asked, as he and his partner, a young stout woman, hustled over toward them.", "\n\n\"Hey Johnny, it's been a crazy night.\" ", "There was a good chance that Johnny Thompson no longer preferred to be called Johnny. ", "He was probably just John now, much like Michael had converted from Mikey years ago. ", "But the relationships you form in your youth, as casual as they might be, always seem to transport you back in time.", "\n\nMichael relayed the story to Johnny and handed over the bottle of pills. ", "They loaded Piper into the ambulance and took her vitals.", "\n\n\"So what's the plan here, Mikey? ", "If I bring her into the hospital this turns into a police report, and it won't be something we can forget about tomorrow. ", "Her vitals are stable. ", "There's been no impact to her blood pressure or blood oxygen levels. ", "Most likely she needs to sleep this off, so if you want to leave the cops out of this...\" Johnny's voice trailed off as a police car pulled up to the scene. \"", "Never mind, looks like this will be a police matter after all.\" ", "Johnny walked over to the police car and Michael watched a young, dark-haired cop exit his car. ", "He could tell by his military posture and unsmiling face that this cop wasn't one of the good ol' boys.", "\n\nGreat, Michael thought, at least one of the older cops would be willing to let this go to avoid the paperwork. ", "But an eager young rookie would be a thorough bastard tonight. ", "Michael was confident whatever Piper was doing here tonight, she wouldn't want it to be the start of a long-drawn-out court case. ", "She'd want it to go away.", "\n\n\"Hey Bobby,\" Johnny said, pulling his rubber glove off and extending a hand out to greet the officer. ", "Michael felt slightly relieved that at least they knew each other.", "\n\n\"Did this get called in? ", "I didn't hear anything about it over the radio. ", "I was passing by and thought maybe you could use a hand. ", "What's going on?\" ", "Bobby approached the open doors of the ambulance and glanced inside. ", "Immediately recognizing Piper, his heart popped in his chest, and he felt panic briefly overtake him. \"", "Piper?\" ", "he quaked, pulling himself into the back of the ambulance to be by her side. \"", "What the hell happened, is she all right?\"", "\n\n\"You know her?\" ", "Michael asked, feeling like this night was one of the strangest of his life. ", "Living in Edenville you grew accustomed to knowing someone almost everywhere you went, but Piper wasn't from here, and from what Michael knew she was somewhat of a loner. ", "She never talked about having friends or family in the area. ", "Now suddenly she was associating with cops and criminals.", "\n\n\"She's my friend,\" Bobby said, hesitating a little on the words. ", "Piper certainly had become a friend over the past months, but after the kiss they shared last night Bobby had been wondering if they were becoming more. ", "He reached for her hand and pulled it up to his chest and over his heart.", "\n\n\"She was out tonight with Sean Donavan. ", "Apparently the date wasn't moving fast enough for him and he put something in her drink. ", "I saw him trying to get her out of the bar, clearly not of her own volition, and I stepped in. ", "This being one of the Donavan-owned establishments we didn't get much support from the staff, which is why we are sitting here, a block away from the place, and no one else seems to be worried about how she's doing.\" ", "Michael found himself still itching to fight, his nerves still on edge, and the thought of all those complacent people enjoying their meals was making him crazy.", "\n\n\"Is she going to be okay? ", "Are you taking her to the hospital?\" ", "Bobby had urgency in his voice that spoke volumes about his feelings for Piper.", "\n\n\"We were talking that over,\" Johnny cut in. \"", "Her vitals are stable. ", "We know what kind of pill he gave her. ", "It was rohypnol, or ruffies. ", "She isn't showing any signs of an allergic reaction, most likely she needs to sleep it off as long as someone can stay and watch her. ", "We've got to get back to the station, so I don't want to rush you but we need to make a decision.\"", "\n\n\"I don't think she'd want this to turn into a big thing,\" Michael said, forgetting for a minute that he hadn't really introduced himself as more than a stranger in the right place at the right time. \"", "Dealing with the Donavans, especially in court, is no easy process. ", "There is a restaurant full of people ready to cover for Sean. ", "Unfortunately I've been through this process with him before. ", "They'll drag her through the mud in any kind of case we try to make. ", "Piper got lucky tonight; maybe we should just cut our losses and move on. ", "I think that's what she would want.\"", "\n\n\"You know Piper?\" ", "Bobby asked with a skeptical glare. ", "He let his mind run through the scenarios of how this man might somehow be involved.", "\n\n\"I'm sorry, I haven't introduced myself.\" ", "Michael leaned into the ambulance and shook Bobby's free hand. \"", "I'm Michael Cooper. ", "I'm a lawyer and a friend of Piper. ", "I was out tonight having drinks with some people from work and saw her up at the bar.\"", "\n\n\"I'm Bobby Wright,\" he answered, skeptical of this entire situation. \"", "So you're _the_ Michael? ", "You're the one Piper has been doing all this research for? ", "I find it odd that one day she's digging up cases on these guys for you and the next she's risking her life at the bar with them. ", "It sounds like maybe you were looking for a little more information and decided to use her as bait?\" ", "Bobby put Piper's hand back down gently and exited the ambulance to get a better view of Michael. ", "Bobby was excellent at reading body language, facial cues, and tone of voice. ", "If he was going to get an accurate read on this guy he'd need to get closer.", "\n\n\"She isn't doing any research on my behalf,\" Michael barked defensively. \"", "She's writing some paper for school, and I've been giving her pointers. ", "I have no idea what she was thinking being out with Sean tonight, but you can be damn sure I didn't put her up to it. ", "If you guys are such good friends why didn't you know where she was?\" ", "Michael was dumbfounded at the attack. ", "All he had tried to do up until this point was steer Piper away from danger. ", "He certainly wasn't putting her in harm's way.", "\n\n\"She dropped out of school months ago. ", "She isn't writing any paper. ", "What the hell is going on?\" ", "Bobby replied, looking back over his shoulder at Piper.", "\n\n\"Guys,\" Johnny said. \"", "I'm sorry but I need to either get her to the hospital or not. ", "Can someone keep an eye on her tonight?\"", "\n\n\"Bobby, I don't have all the answers, but I think you should get her home. ", "Getting any deeper into this isn't going to help her.\" ", "Michael wasn't naive enough to think his knowledge of Piper or their friendship was that deep. ", "He did, however, know the Donavans and the lengths they would go, to avoid prosecution.", "\n\nBobby climbed back into the ambulance and lifted Piper, holding her close to his body. ", "Michael shook hands with Johnny, nodded a thank you to his partner and opened the rear door of Bobby's cruiser.", "\n\nOnce Bobby had placed Piper in the back of his car and positioned her in a way he thought she'd be safe, he turned back to Michael. ", "The ambulance had driven off and now it was only the two men standing uneasily on the quiet corner.", "\n\n\"Thanks for keeping her safe tonight. ", "I'm glad you were there. ", "I don't want to think about what might have happened if Sean left with her.\" ", "Bobby's mind was churning with questions and worry. ", "He wasn't completely sure what he thought of Michael yet, but, at a minimum, he seemed to have stepped in when Piper needed him.", "\n\n\"Cindy Martin,\" Michael whispered, shaking his head. \"", "I know you don't want to think about what might have happened, and tomorrow neither will she, but you both should. ", "She's mixed up in something, Bobby, and tonight could have ended much differently. ", "Sean has been charged twice with some pretty serious crimes, one of which was drug facilitated sexual assault. ", "The details of that crime will be seared into my mind forever. ", "Cindy Martin, the girl he drugged and assaulted had three broken ribs, a fractured cheek bone, and was covered in scrapes and bruises. ", "He rolled her out of his moving car and left her on the side of the road in the middle of December. ", "She was on the verge of hypothermia when she was discovered by a woman driving home that night. ", "Yet, there was a parade of people willing to corroborate his alibi. ", "Once they had destroyed Cindy's credibility on the stand because she had a history of recreational drug use in her past, the case started to fall apart.\" ", "Michael was speaking mostly through his teeth with an angry hiss. ", "He was motioning his hands animatedly as if he were giving an impassioned closing argument.", "\n\n\"I almost didn't come out tonight. ", "I was tired and had more work to do, and if it weren't for my buddies convincing me I needed a break, I'd be at home trying to find a way to prosecute a crime while Sean was out committing another one. ", "Tomorrow when she wakes up and doesn't want to tell you what the hell she was doing here tonight, when she tells you she's fine and that she had it all under control, you tell her about Cindy Martin. ", "You tell her about the beautiful twenty-two-year-old girl who can't eat out at a restaurant anymore without having a panic attack, has three locks on her door, and hasn't been on a date in a year and a half. ", "Here's my card,\" Michael said, pulling a business card out from his pocket. \"", "If you're really her friend you'll get her to tell you what she was doing with Sean tonight, and you'll convince her to stop before it's too late. ", "Give me a call in the morning to let me know she's all right.\"", "\n\nBobby tucked the card into the breast pocket of his uniform shirt. \"", "I hear you,\" he said, shaking Michael's hand. \"", "I'll see what I can find out tomorrow. ", "Hopefully a scare like this will be enough to get her out of whatever stuff she's mixed up in.\"", "\n\nMichael nodded a goodbye. ", "As he turned back toward his car he spoke over his shoulder. \"", "I don't know what it is about this girl that makes me give a damn. ", "It's impossible to cut my losses and mind my business. ", "The easiest thing in the world for me to do would be to get in my car and forget this night ever happened, forget about Piper all together. ", "She shoots down every date I ask her on, she plays me like a fool, and I know almost nothing about her. ", "She's like fireworks, captivating and gorgeous, you can't help but watch and be amazed, but you better keep your distance or you'll get burned.\"", "\n\n# Chapter 11\n\nPiper refused to open her eyes. ", "She had woken up a few moments earlier and realized something terrible had happened. ", "She thought if she could only keep her eyes closed and attempt to piece the previous night's events together she could make sense of it all. ", "She knew once she let herself come fully awake, she may not like what she faced. ", "She remembered talking to Michael in the back of the bar, she remembered finishing her awful drink and making idle conversation with Sean, and she remembered rapidly losing control of her faculties. ", "Had Michael come over and intervened, and now she was safely sleeping in his bed? ", "Had Sean been able to slip her out of the restaurant unnoticed and now she was who-knows-where and in further danger? ", "As fear began to overcome her she took mental stock of what she could with her other senses, still unwilling to open her eyes.", "\n\nShe was dressed, still in the uncomfortable black cocktail dress, though her shoes were off. ", "These sheets felt like her own, the flannel set she had just put on the previous day. ", "Her body was sore and her head ached, but she didn't feel violated or injured in anyway. ", "All these things brought her anxiety level to a manageable place, and she dared to let the light pour in as she cracked her eyes open.", "\n\nThere was her dresser, her nightstand, and her curtains. ", "She was in her own room, in her own bed, seemingly safe. ", "But who had brought her here? ", "Michael didn't know where she lived; perhaps he had looked at her driver's license and used her key to put her to bed?", "\n\n\"Piper?\" ", "a man's voice called from behind her. ", "She was still cloudy and her reflexes sluggish, but she was fairly certain it was Bobby. ", "She rolled over toward him and groaned. ", "She didn't think of the repercussions or the questions he may have for her, all she could think was how glad she was that he was there.", "\n\n\"You were given a dose of Royhpnol last night, it's a powerful sedative that causes a person to blackout and usually have memory loss and some fatigue the following day.\" ", "Bobby had pulled the chair from Piper's desk over to the side of her bed. ", "He had spent the night perched there, as she slept.", "\n\n\"The date rape drug?\" ", "Piper whispered. ", "Her voice was hoarse and her throat dry. ", "She closed her eyes again. ", "It was hard to focus on anything and the light was making her head pound.", "\n\nBobby reached for her hand and laced his fingers in between hers. \"", "Nothing happened. ", "Your friend Michael got you out of there before Sean could do anything. ", "I was driving by when I saw the ambulance and stopped to see if they needed help.\"", "\n\nAs wonderful as Bobby's hand felt in hers, as sweet as his voice was, thick with concern—all those words brought reality back into focus. ", "Bobby met Michael, he knew she was out with Sean, and there was an ambulance involved, probably a police report. ", "Bobby was too insightful, too good of a friend to not pry into this situation. ", "However happy she had been to wake up and see him sitting vigil by her, she knew everything was about to change the moment he wanted to know more.", "\n\n\"Piper, I'm going to ask you some questions, but first there is something I want to say. ", "We haven't known each other very long, but I care about you. ", "The kiss we shared, the time we've been spending together, for me it isn't some flirty game I'm trying to play. ", "I can see myself with you. ", "I can see this working between us. ", "I think it's important that you know that so when I'm asking you these questions you understand my motivation. ", "Does that make sense to you?\" ", "Bobby had ample time that night to think about how he would approach this precarious conversation. ", "He waited for Piper to nod that she understood and then he pulled her hand, still linked with his own, up to his lips and kissed it gently.", "\n\n\"When you first started coming around Betty's house I wanted to know more about you, but you weren't very forthcoming with information. ", "No one else seemed to notice, but I kept leaving every Wednesday night with more questions about you than answers. ", "Jules and Betty mean the world to me, and I was concerned that you had some ulterior motive. ", "I called in a few favors and did a background check on you. ", "The preliminary one came back as though you didn't exist prior to two years ago. ", "I thought maybe it was a glitch in the system so I pushed for more information. ", "I went up as high as I could and even indebted myself to some guys with pretty high clearance, and still there was nothing. ", "It really freaked me out at first, but the more I got to know you, the more I started to care about you, and the less I let it bother me. ", "I convinced myself that you had your reasons for not sharing your past with me and that when you were ready, I'd be here to listen. ", "I decided that you were not a threat to Jules and Betty and that I would give you time to open up to me. ", "I committed myself to trusting you even though it wasn't in my nature.\" ", "Bobby could feel Piper's grip on his hand loosening, and he knew it was her recoiling from his harsh honesty, but she didn't speak, so he continued.", "\n\n\"That was, until last night when I found out you've been untruthful about why you're so interested in the Donavans' criminal history. ", "I couldn't understand, and still can't really, why you'd be out with Sean. ", "I don't know why just weeks after you and I are rummaging through their court cases, discussing how unworthy they are of the benefits of our justice system, you're sitting across from one of them having drinks. ", "So what I'm asking is: who are you? ", "Who were you two years ago? ", "And what were you doing last night? ", "If you can tell me that, I promise you I'll help you in any way I can. ", "You need to trust me.\" ", "With that last sentence, Piper pulled her hand away from his, and he felt a piece of his heart go with it.", "\n\n\"Sure I'll trust you, let me run a background check on you first.\" ", "She pulled herself up to a sitting position knowing she looked too weak crumpled under her blankets to be taken seriously. \"", "I think you're being a little dramatic, and I'm guessing so was Michael. ", "The two of you together probably blew this whole thing out of proportion. ", "I'm sorry that I'm not turning out to be who you hoped I was, but I'm not going to sit here and be accused of having questionable motives. ", "I think you should go.\" ", "Piper pointed at the door, and she wondered how her mouth and her mind could betray her heart so deeply. ", "Would there ever be a time in her life that they pulled in the same direction?", "\n\n\"I don't want to go, Piper. ", "I'm not looking for an easy out.\" ", "Bobby stood and raised his voice slightly. ", "He felt this conversation, this woman, getting away from him and it wasn't how he wanted it.", "\n\n\"What do you want?\" ", "She threw her arms up in exasperation and immediately regretted the sudden movement. ", "She had momentarily forgotten how much her body was hurting and how fast her head was spinning. ", "She didn't want him to leave, but she wanted him to take back everything he had just said.", "\n\n\"What do I want? ", "I want to take off this uniform and crawl into bed with you. ", "I want to spend the entire day under these covers. ", "I'd tell you how terrified I was when I saw you lying in the back of that ambulance. ", "I'd tell you how I've never been so full of rage or had such a desire to track a man down and kill him for what he had done, what he could have done to you.\" ", "Bobby's hands clenched into fists as he thought of Sean. \"", "I want you to feel like you can tell me everything about yourself, the hard stuff, the scary stuff. ", "I want you to talk until you lose your voice, and I want to hold you until I can't figure out where I end and you begin. ", "I want today to be the first day of something incredible for us. ", "There is nothing that you can tell me that would scare me away, nothing that could change how I feel about you.\"", "\n\nHe was practically yelling now, his face red with frustration. ", "He realized how worked up he had become, and he softened his voice. \"", "I want to stay here and find out who you are.\"", "\n\nPiper forced the tears forming at the corners of her eyes to stay right where they were. ", "She swallowed back the lump in her throat and dug her fingernails into the palm of her hand to help redirect the pain away from her heart. ", "She let the thought flash through her mind for a moment. ", "What if she did tell Bobby who she was and what she had planned? ", "Would he do as he said and stay?", "\n\n\"I don't think there is anything more real to you than your convictions, Bobby, and I can assure you there isn't anything more important to me than mine. ", "The problem is that ours happen to sit at opposite sides of the moral spectrum. ", "I won't ask you to stand by me when I know it would mean you'd have to set aside things that make you who you are. ", "I'm also not naïve enough to believe you're even capable of that. ", "Who I was two years ago isn't something I'll share with you. ", "What I was doing last night isn't something you'll approve of. ", "So the only thing I can do, because I do care about you, is not lie. ", "I'm asking you to go, so that I don't have to.\" ", "Piper knew it would be more convincing, more final if she could be staring into Bobby's eyes as she spoke, but she couldn't bring herself to do it. ", "She thought if she raised her eyes and looked at him, she'd see his heart being pulled from his chest, and she couldn't stand to think of him hurting.", "\n\nHe didn't dissect her words about morals and convictions or try to argue his way to the truth. ", "He grabbed his things from her desk and quietly made his way to the door of her bedroom. ", "He dropped his head, and rubbed at his eyes, clearly feeling like he was out of options. \"", "When I go, you need to understand that's it for us. ", "I won't stand by and watch you put yourself in danger. ", "If I walk out this door right now, you're on your own. ", "That goes for Betty and Jules, too.\" ", "He was facing away from her as he spoke.", "\n\n\"You really think they'll just stop talking to me because you tell them to?\" ", "Piper, for the first time in this conversation, felt a righteous indignation about Bobby's decree and ultimatum.", "\n\n\"No, I won't tell them they can't talk to you. ", "I'm hoping that the person I started to care about is as principled as I thought. ", "If you're putting yourself in a compromising position I hope you won't be selfish enough to subject anyone else to it. ", "Especially people who have suffered enough already. ", "If you truly can't let anyone in, at least you can minimize the collateral damage. ", "I might not know who you were, but I'd like to think I was starting to know who you are.\" ", "He didn't wait for her response, he didn't look back to see if his words had impacted her. ", "There was nothing left to do but leave.", "\n\nWhen she heard the thud of his truck door slam and the rumbling of his engine starting up she knew she was in the clear. ", "She let a few warm tears roll down her cheeks, thinking they'd be enough to release the pressure of emotion that had built up inside her. ", "Instead they were the beginning of a flood. ", "She lay back down and pulled the blankets up over her face and sobbed. ", "She cried at the thought of losing Jules and Betty's friendship. ", "She cried for what could have happened last night, where she could be waking up this morning if it weren't for Michael. ", "And she cried at the thought of living the rest of her life without ever being kissed by Bobby again.", "\n\nAs she lay in bed aching mentally and physically she realized stories like these, the ones filled with revenge and vigilantism, all had one thing hers did not. ", "A capable, trained person with a litany of abilities. ", "She was not an assassin skilled in martial arts and able to physically protect herself. ", "She wasn't a robotic, cold-hearted black widow void of all emotion. ", "She didn't carry a gun. ", "She didn't even have mace for that matter. ", "She was like someone who'd never played football joining the NFL and playing without pads. ", "Yet, even all that wasn't enough to stop her. ", "She might be the underdog here, but it wasn't impossible, and that's all she needed to know to keep driving forward. ", "There was a chance that this journey was a self-inflicted masochistic punishment for the failures of her past. ", "Happiness seemed at her fingertips, but she wasn't ready to indulge in it, and there were miles to go before she'd feel worthy of it.", "\n\nHer eyes were puffy and burning from the salt of her tears. ", "She had managed to stop blubbering and wailing long enough to reach for her phone. ", "She squinted and queued up a familiar number. ", "It rang three times and finally an answer.", "\n\n\"Michael,\" she mumbled, trying to mask the devastation in her voice. ", "She may not have been able to give Bobby what he needed to keep him around, but Michael needed much less from her, and she wasn't ready to go back to being completely alone in this world.", "\n\n# Chapter 12\n\nSeventy-one days. ", "That's how long it had been since Piper had spoken to Bobby. ", "She had seen him and Betty, twice through the window of the diner, but she stealthily avoided being seen by them. ", "She had almost called him a handful of times, but managed to fight off the moments of weakness with the reminder of what that phone call would entail.", "\n\nOnce, in the middle of another sleepless night, she came to the depressing realization that she might love Bobby. ", "It was baffling to her how she could meet someone and be so annoyed by him and then just as quickly become so caught up in him. ", "The first couple of Wednesday nights since arguing with Bobby were like torture for Piper. ", "She'd spend hours looking out her window up at the stars and cursing the noise that came from the street and the stores below. ", "Nothing would ever be as tranquil and serene as her time spent with Bobby swinging on Betty's porch, watching the night unfold before them.", "\n\nShe occasionally saw Scott at work. ", "Whatever story Bobby had told them about Piper's absence had been enough to have him walking the other way when he saw her coming. ", "Her emotions ran the gamut. ", "There were days she was saddened by the barrenness of her life. ", "Other days she was angry that she didn't mean enough to any of these people for them to track her down and find out how she was. ", "Did she mean that little to them? ", "Had she misread their friendship?", "\n\nMichael had been a steady presence in her life since the night after her date with Sean. ", "She had asked him for coffee and told him that she was sorry for putting him in that position. ", "She had genuinely thanked him for his help that night and even let a few tears fall when relaying her gratitude. ", "She admitted she had been stupid, overzealous, and caught up in the idea of what she thought was wrong with the justice system. ", "She told Michael she wasn't putting this all behind her quite yet but she wouldn't put herself back in a position like that ever again. ", "She knew that was probably a lie, but it was one he needed to hear in order to forgive her.", "\n\nThey shared long nights together talking only about topics that pertained to Michael, never what was going on with Piper. ", "They discussed his dysfunctional family, his cases, and his future. ", "He picked her brain and loved to bounce new ideas off her. ", "It was nice to see the spark slowly come back into her eyes after her brush with danger.", "\n\nMany nights he felt himself on the verge of kissing her, staring at her lips as she spoke. ", "She had told him time and again there would never be anything more than a friendship between them. ", "Yet, somehow he kept finding himself caught up in the idea of running his tongue along her neck and making love to her on his desk. ", "It was an internal conflict he fought hard to keep at bay.", "\n\nHe had spoken with Bobby the morning after Piper's date with Sean. ", "Bobby had told him he wasn't able to get through to her. ", "It was a large part of Michael's job to read between the lines and it was clear that Bobby cared deeply for Piper. ", "But Bobby explained he had other people in his life to worry about, and Piper was too much of a liability to them right now. ", "He asked Michael to keep an eye on her, and to do his best to keep her safe just as he had that night with Sean.", "\n\nAt first Michael wasn't sure how he felt about being someone's keeper. ", "He was a successful, handsome, and wealthy man with his pick of woman and an abundant social network. ", "Babysitting wasn't in his job description, and he assumed it would put a cramp in his social life. ", "However, the more time he spent with Piper the more he realized how alone she was in this world. ", "She had told him that first day over coffee she needed him to refrain from asking her questions about her family or her past. ", "She wanted to spend time with Michael but it couldn't be an interrogation, she wasn't a puzzle needing to be pieced together. \"", "Let's go back to being funny, laid-back people who have a good time together,\" she begged, and, begrudgingly, he agreed. ", "However, even through casual conversation, he found Piper to be more damaged and lonely than anyone he had ever met before. ", "So why commit to keeping watch over her. ", "Frankly, he was lonely too.", "\n\nWhen he felt himself wanting to scoop her up into his arms and make love to her until she felt whole, he reminded himself that even though he wanted her he didn't love her. ", "And even if Bobby couldn't be around her right now, Bobby did love her. ", "If Piper was going to be happy someday it wouldn't be because of a passionate night in a dark office. ", "He wasn't going to be the guy sleeping with her when Bobby returned on his white horse.", "\n\n\"So have you thought about what you're going to get your mom for her birthday?\" ", "asked Piper as she curled a ring of hair around her finger and read a file Michael had given her. ", "She loved being in his office. ", "She loved being in his presence. ", "He had done exactly what she needed, been there for her without needing to be everything to her.", "\n\n\"I think I'm going to send her one of those fruit things that look like flowers. ", "I'm pretty sure she likes fruit and flowers. ", "So what do you think of that opening argument?\" ", "he gestured to the file in her hands.", "\n\n\"It's all right. ", "It seems a little weak though. ", "Have you thought about talking more about the children? ", "You said there are seven women on the jury, four with kids. ", "I would talk more about the impact the crime had on the kids. ", "Their mother was beat up by their father right in front of them while he was in a meth-induced rage. ", "Sure she was sleeping with another man, that might bias a few people on the jury, but she wasn't sleeping with the man in front of her kids. ", "The defendant is the only one who crossed that line. ", "That's not something they can get over. ", "How are their grades? ", "How are they sleeping? ", "Have they had any therapy? ", "I would tell the whole story from the perspective of the youngest... what was he, nine? ", "My opening statement would read like a journal entry from that little boy on the scariest day of his life. ", "That'll make an impact for sure.\" ", "She closed the folder and slid it across the desk to Michael.", "\n\n\"What a horrible misuse of talent, Miss Anderson. ", "That is simply genius, and I fully intend to steal the idea from you and pass it off as my own. ", "You should really consider going back to school. ", "Maybe even law school down the road.\" ", "Michael knew he was on thin ice. ", "Bringing up school with her was something they had put on the taboo list early on. ", "But he was tired of her skills being wasted, though he was certainly benefiting from them.", "\n\n\"Nope, I'm perfectly happy being your muse here and tinkering around at the cable company. ", "Besides, I'd probably end up taking your job someday if I did that.\" ", "She stood up and took his school conversation as a great cue to leave. ", "Things between them had been working so well, and some of it simply came down to a well-timed exit on her part. \"", "Give me a call once you have that drafted if you want to talk it through.\" ", "She pulled her bag over her shoulder and saw herself out.", "\n\nMichael swiveled his chair so he could look out his window and watch her get into her car and drive off. ", "He thought it was finally time to do something he had been thinking about for weeks. ", "He picked up his phone and dialed.", "\n\n\"Hey Bobby, it's Michael Cooper, do you think we could get together sometime this week? ", "I have a few things I'd like to chat about.\" ", "Going behind Piper's back wasn't ideal but she hadn't left him with much choice.", "\n\nPiper had planned on being at Michael's office for at least another hour before he had brought up school. ", "It was only six o'clock on Wednesday night which meant she'd have too much time to sit alone and think of Bobby if she went home now. ", "She normally would have had dinner with Michael, or they would have had takeout delivered to the office. ", "The only upside of knowing that everyone would be at Betty's house was it meant no one she knew would be at the diner. ", "At least she could get a bite to eat and even sit in the seat she knew Bobby had sat in earlier that day.", "\n\nAs she pushed her mashed potatoes around on her plate she realized how quiet the diner was this time of night. ", "She was ready to pay her bill and slink back to her lonely apartment when the booming voice of a man broke the silence as he pushed his way through the front door. ", "It was Judge Lions, and his face was flustered and dotted with beads of sweat.", "\n\n\"You better believe I'm pissed,\" he thundered as he hastily settled himself down into his booth. \"", "I can't talk about this right now, but I want to get it resolved as soon as possible. ", "Meet me at nine tomorrow morning at the mill.\" ", "He punched a button on his cell phone and slammed it down on the table. ", "He pulled a handkerchief from his breast pocket and wiped the sweat off his brow. ", "Something had flustered the normally even-keeled judge, and Piper was determined to find out what.", "\n\nOver the last few weeks, she had been able to identify which school young Chris Donavan attended by researching the crest she had seen on the picture Sean had shown her. ", "She had finally settled on Chris being the linchpin, that, if pulled, would collapse the relationship between the judge and the Donavans. ", "Her best bet was to combine two cardinal sins, \"don't mess with the kids and don't have an unhealthy interest in young boys.\"", "\n\nDetermining how that would play out had slowed Piper down a bit. ", "She was certain that she never actually wanted Chris to be in any danger, it would only need to look as though the judge was targeting him. ", "She had begun spending time watching Chris's comings and goings. ", "He was a simple boy who didn't seem as though he had been tainted yet by the power of his family. ", "He played fairly on the playground and took time to stop and watch the bugs crawling across the sidewalk on his way home from school. ", "He was always accompanied by someone.", "\n\nShe thought that she may, at some point, have to lay eyes on Sean again if he was ever appointed to walking-home-from-school duty, and she had decided it didn't matter. ", "She intended to seek retribution at some point, but she could be patient. ", "She wouldn't let her personal vendetta overshadow her main objective.", "\n\nThe judge's presence at the diner tonight and his cryptic conversation had Piper's senses tingling with excitement. ", "She didn't know what had upset him or who was on the other end of the line, but she was pretty certain she knew which mill he was talking about. ", "Back when she was tailing him more closely he had pulled into the old complex of mills that had once housed a textile company years ago. ", "She wasn't able to follow him into the long empty parking lot, but from the street she had seen him pull up to a loading dock and climb the stairs to a side door.", "\n\nShe had become savvier at using the database at the cable company to find the information she was looking for. ", "Both Christian and the judge had a GPS system on their cell phones that was tied to their data plans. ", "The information ran through a sister company of ComCable. ", "She had access to their information and could track their past locations as well as anytime they had been in close proximity to each other. ", "After seeing the judge enter the old mill she had cross-referenced their two phones to see if Christian had ever been in that area at the same time. ", "With this information she was able to determine that the mill was a preferred meeting place for the judge and Christian.", "\n\nShe paid her bill and hustled out the diner while the judge was chatting with the waitress. ", "Piper slipped out the door and quickly crossed the street. ", "If she was going to be ready to do surveillance on that meeting tomorrow she'd need all night to prepare.", "\n\n# Chapter 13\n\nGod bless search engines, she thought to herself. ", "Over the last few weeks the Internet had provided her with ample sites that sold interesting spy gear. ", "She had invested in a small hearing enhancement system that would help amplify any conversations she was trying to overhear. ", "She decided she needed some form of protection so a stun gun had been her weapon of choice since she assumed her background, or lack thereof, may keep her from being able to secure a gun permit. ", "She had two micro cameras that she still couldn't figure out how to work. ", "Hollywood had certainly made all this espionage stuff look much easier than it was.", "\n\nShe pulled a dark pair of jeans, a black sweatshirt, and a baseball hat from her closet. ", "The key to all of this would be to continue to maintain anonymity. ", "The advantage of not being a professional was she didn't have to pretend to be a nobody in their world because she genuinely was.", "\n\nPiper knew it was important to sleep. ", "She had triple-checked her alarm clock to ensure it was set for four a.m., but she still couldn't manage to quiet her mind long enough for sleep to come. ", "She watched the minutes tick by and thought of the different things tomorrow's meeting could be about, or who it could be with. ", "She was hoping it would be Christian Donavan. ", "She was dying to see the dynamics between the two men. ", "It was important for her to know if they had a reluctant or tenuous business relationship or if they were as close as family. ", "Knowing this would help her determine how irrefutable her intended evidence against the judge would need to be in order to sever their ties.", "\n\nArriving under the cover of early morning darkness to set up her hearing enhancement equipment was important. ", "She wanted to be settled in hours before their arrival and have an opportunity to find a sufficient hiding spot. ", "The mill was at least a thirty minute walk from her house, but she didn't want to have the hindrance of finding a covert place to park her car. ", "It was a cool morning, and she wasn't looking forward to the long trek, but her adrenaline had her body moving without much thought at all.", "\n\nAs she finally approached the mill she waited until there was no sign of a car coming down the quiet street. ", "She looked around for any sign of life, and when she felt sure the whole world was still asleep she made her move through the parking lot and toward the stairs. ", "Her heart jumped in her chest as she reached the door and pulled at the knob.", "\n\nWhy had she not assumed that the door would be locked? ", "Of course an old abandoned mill wouldn't simply be left wide open for anyone to come and go as they please. ", "She berated herself for such an oversight. ", "She remembered the lock-picking set she nearly bought the week before and realized it wouldn't have done her any good. ", "She'd probably be as hopeless at that skill as she had been at working the micro cameras.", "\n\nShe climbed back down the stairs and started looking for an alternative entrance. ", "There were multiple windows she could shimmy through but they were out of her reach. ", "She could touch the bottom of the sills with her fingertips but her embarrassing lack of upper body strength would keep her from being able to pull herself up. ", "She searched around for something to stand on. ", "She found a rusty barrel around the back of the mill that seemed like it would do. ", "She climbed onto it awkwardly, steadied herself, and peered in. ", "She'd need to break this window. ", "She pulled her sweatshirt over her head and wrapped it around her arm like she had seen this in a movie. ", "She cocked her arm back and punched at the glass. ", "It made a thud and she squeaked at the pain vibrating its way up her arm. ", "Perhaps there was some movie magic involved in the window breaking she had seen. ", "She unwrapped her hand and put the sweatshirt over her elbow instead. ", "She was losing the advantage of her early start and felt panic set in. ", "With all her might she slammed her elbow into the glass, and it shattered. ", "She broke away the remaining shards and while pulling at a few stubborn pieces she felt the window tilt out toward her. ", "It had been unlocked the entire time. ", "She cursed herself for not simply trying to open it first. ", "These were the moments she was glad she didn't have a partner.", "\n\nPiper lowered herself through the window and into the large open space of the mill. ", "She pulled a flashlight from her pocket and put her sweatshirt back on. ", "Using her foot she swept the glass from the unnecessarily broken window under a nearby shelf. ", "The floor was loaded with dust and she realized too much moving would leave foot prints and possibly draw attention to her presence if someone was astute enough to notice. ", "She could see a large area of the floor with most of the dust already disturbed. ", "It was under one of the only hanging lights that still had a bulb in it and she deduced this was probably where the judge held his surreptitious business meetings. ", "With that in mind she began searching for the right spot to settle in and wait.", "\n\nA few steps to her left were some stacked crates pushed catty-cornered against the wall. ", "There was enough space for her if she curled up the right way. ", "The small spaces between the crates would give her a possible line of sight and at least a place to point her microphone for the hearing enhancer.", "\n\nTime seemed to be moving at warp speed as she set up her equipment and wedged herself behind the crates, trying multiple positions in an attempt to give herself the best chance to have a view of the meeting. ", "She knew full well this was all a gamble. ", "Maybe the meeting would be held at the complete opposite end of the mill. ", "Maybe they'd sit outside in a car and never even come in. ", "She knew she needed a lot of stars to align in order for this to work, but she was willing to have some faith. ", "Something out there kept sending her signs to will her forward. ", "She knew she wasn't very skilled and maybe she made some rookie mistakes, but so far when it counted she'd been successful.", "\n\nShe had done one final run-through of everything and decided she wouldn't emerge from her hiding spot again until either the meeting had taken place or it had gotten late enough that she was sure it wasn't going to happen.", "\n\nHer watch read seven-forty-five and she knew this last stretch of waiting would be the hardest. ", "She refused to let her mind fall into thoughts of Bobby or what would happen if she was caught here. ", "She decided, instead, to think only of old songs she loved and her favorite books. ", "She would fill this time with quiet reflection on things she enjoyed rather than regret and fear.", "\n\nNot sleeping the night before was proving to be more detrimental to her mission than she had anticipated. ", "The dark, quiet mill was lulling her into an overdue sleep. ", "Time and again she felt her head slipping downward and repeatedly she jolted back up.", "\n\nWhen the sound of a key in the door came into Piper's ear through the headphones of her hearing device she instantly felt the exhaustion fall away. ", "She had never been more awake in her life. ", "She realized she would need to move her head backward in order to get a better view and see who had come in, but she was frozen with fear. ", "She heard the large, metal door slam shut and the amplified noise shocked her ears.", "\n\nHer fear hadn't just limited her ability to move, she also found herself unable to breathe, blink, or swallow. ", "It took a full minute for her to realize if she didn't do these things she might pass out.", "\n\nThe door once again squeaked open and slammed shut, and Piper heard a conversation start up and two hands slap together for a handshake.", "\n\n\"Sorry to take you away from a busy day in court, but you know I wouldn't have done so if it weren't critical. ", "The good news is, I think the situation is pretty well contained at the moment.\" ", "The voice sounded like that of an older man, not Christian's, which Piper had heard on two occasions when watching him walk his son home from school.", "\n\n\"I certainly hope so. ", "If not what the hell am I paying you for? ", "Tell me everything.\" ", "The judge seemed as aggravated as he had the previous night on the phone. ", "Piper was relieved to know her equipment was working properly. ", "She'd be able to hear the conversation clearly as long as they kept talking at this volume.", "\n\n\"There's this rookie cop who's got a little too much free time on his hands and apparently some lofty goals for his first year. ", "Remember the kid who dug up that stuff on Manton and tried to take him down? ", "Well he damn near would have done it if you and I hadn't intervened. ", "It's not like we give a damn about Manton, but he was set to have a meeting with our guy that day for some guns. ", "If we hadn't gotten Manton's guys off, they would have flipped on Christian. ", "That was a complete nightmare, but I thought we put the kid through the ringer enough to knock him down a few pegs. ", "I guess he's back at it and interested in your extracurricular activities. ", "He came to me yesterday with a couple of photos of you leaving the motel. ", "He said he hadn't dug into it enough to give any details yet, but he thought he spotted two of Christian's guys out front and that you might be involved in something worth checking out. ", "I told him to hit the brakes and let me look into it a bit, that those kinds of accusations against someone like you were nothing to mess around with. ", "Now I've got to figure out what to do.\" ", "The man's voice was quiet as he broke the bad news.", "\n\n\"Are you sure he hasn't been flashing the pictures around anywhere else? ", "Why would he bring them to you? ", "We can't be that lucky.\" ", "The judge's tone changed from frustration to alarm.", "\n\n\"I know the kid. ", "You're going to be pissed to hear this, but he was Grafton's neighbor. ", "He practically idolized the guy. ", "Grafton's the reason he became a cop in the first place. ", "He thinks I'm one of the old timer good guys like Grafton was. ", "He thinks he can trust me,\" the man said and Piper could hear his growing irritation with the situation.", "\n\n\"So let's take care of him the same way we did Grafton, and let's do it quickly before he realizes you're not quite as good a guy as he thinks,\" the judge retorted sarcastically.", "\n\n\"Things are different now. ", "We can't go around taking guys out anymore, Randy. ", "Luring a cop into a building, shooting him, and pinning it on some mystery criminal won't fly anymore. ", "There's too much technology, too many people with damn camera phones everywhere. ", "Not to mention, Internal Investigations isn't on our side. ", "We don't have as many of the guys as we used to in there. ", "They've all retired. ", "We've got to be smart about this.\" ", "The man's voice was forceful as he tried to deter the judge from making a rash decision.", "\n\n\"Come on, Red. ", "Buy him off, everyone has a price. ", "If he's such a determined kid I'm sure we can find a place for him in our organization,\" the judge snapped, clearly underestimating the situation.", "\n\n\"You don't get it,\" the other man roared, pounding his fist against a desk or a wall that Piper couldn't see. \"", "He's like Grafton reincarnated, it's actually scary sometimes. ", "I can tell you right now a payoff wouldn't have worked on Stan and it won't work on this kid either.\"", "\n\n\"So what exactly are you proposing? ", "I'm hearing a lot of objections and not too many solutions. ", "You know this kid, what's it going to take to get him off this?\" ", "The Judge was now pacing the room and Piper could hear his voice growing louder as he came closer to her, then fading as he headed back in the other direction.", "\n\n\"I've been wracking my brain and the only thing I can come up with is we hit him where it hurts. ", "He's got a thing for Grafton's daughter I think, and I know he's real close with Grafton's old lady too. ", "Maybe we let him know if he doesn't drop this then they're not safe.\" ", "The man cleared his throat frequently as he spoke and Piper tried to make a mental note of this habit. ", "If she couldn't turn and get a good look at him, then she'd need to try to piece together his identity any way possible.", "\n\n\"If we can't kill him, and we can't buy him off then let's scare the hell out of him and see if that works,\" the judge said arrogantly.", "\n\n\"I'm going to try one more time to get him off this whole kick first. ", "Maybe I can get through to him. ", "I really don't want to start messing with anyone's damn family, especially a dead cop's wife and kid. ", "I'm getting too old for this shit.\" ", "The man's voice trailed off as he turned in the other direction away from where Piper was hiding.", "\n\n\"Well if you find yourself getting cold feet about this then I'll have Christian take care of it for me. ", "He's got no problem doing what needs to be done. ", "Maybe that's why he's stepping on your toes so much lately. ", "Maybe it's time you retire.\" ", "The judge knew this was a hot button and he enjoyed exploiting it.", "\n\n\"Christian might have the stomach for all this, but he'll never be able to give you what I do as a cop on the force. ", "We haven't found one decent officer to recruit, and I'm one of your last guys left on the inside. ", "You might want to drop the retirement bullshit. ", "If anyone should be bowing out of this game, it's you. ", "You're getting sloppy. ", "We wouldn't be in this position right now if you could keep away from teenage girls.\" ", "The tension in the room was palpable. ", "Piper could sense it even from behind the crates.", "\n\n\"You take care of this kid before I decide your pussy diplomatic approach is a sign of weakness. ", "Get your hands on those pictures, and put this to bed. ", "Now get the hell out of here. ", "I'm supposed to be in court in fifteen minutes.\" ", "As the first man, the one the judge called Red, left he mumbled something under his breath that Piper couldn't make out.", "\n\nA few minutes later the door pulled open and slammed shut again. ", "Piper heard the key turning in the door again. ", "She sat motionless. ", "The amount of information buzzing in her mind was almost too much to process. ", "The meeting wasn't between the judge and Christian, it was much bigger than that. ", "The meeting was between the judge and a corrupt police officer, and more than that the rookie cop causing trouble was Bobby. ", "As all the pieces came together, her head spun with the reality of it all. ", "The person they were talking about murdering ten years ago was Betty's husband.", "\n\n# Chapter 14\n\n\"Bobby, I know I'm the last person in the world you want to talk to right now, but I need you to come to my house. ", "It's important.\" ", "Piper skipped the niceties; she needed to get to Bobby before that cop did.", "\n\n\"Piper, I think we were both pretty clear that day. ", "If you didn't want my help I wasn't going to let you put people I care about in danger.\" ", "Bobby's voice was quiet and she heard the noise of the diner crowd in the background.", "\n\n\"I'm not the one putting Jules and Betty in danger, you are. ", "I know you're across the street at the diner eating that same old breakfast. ", "Pay your bill and get over here.\" ", "Piper hung up the phone and tossed it onto the kitchen counter. ", "It was so nice to hear Bobby's voice again even though the circumstances were tense.", "\n\nFifteen minutes passed before she heard a knock on her door. ", "She looked through the peephole and saw Bobby standing there, looking annoyed and impatient. ", "She knew that nothing about this conversation was going to be easy, but what choice did she have?", "\n\nShe opened the door and waved Bobby in, then headed for the living room without speaking. ", "She hadn't had time to change her clothes, put on any makeup or even tidy up her house. ", "This wasn't how she had wanted her reunion with Bobby to go. ", "When she dreamed about it at night it always involved him having some kind of injury leading to memory loss that allowed them to start fresh and move on from all the friction that had grown between them.", "\n\n\"I've only got a half hour. ", "I have to get to work. ", "So in the interest of time, let's cut through all the bullshit and figure out if this conversation is going to go anywhere.\" ", "Bobby only took two steps inside the house and folded his arms across his chest in childish resistance.", "\n\n\"Fine, I won't mince words. ", "Have you been digging around for information on Judge Lions since the last time we spoke?\" ", "Piper didn't care if he didn't want to come in. ", "She wasn't going to stand in the entryway and have this conversation. ", "If he wanted to know more he'd have to at least stand in the living room with her.", "\n\n\"I don't really see how that's any of your business. ", "I don't know anything about you, remember? ", "For all I know you're in on whatever scheme he's running and you're pumping me for information. ", "If you can't prove to me that you're worthy of my trust then nothing you say is going to mean anything. ", "Even if you pull that crap about Jules and Betty being in danger, I'll chalk it up to one of your lies.\" ", "Bobby had indeed followed her to the living room but stopped in the doorway. ", "His stubbornness was so frustrating. ", "She had hoped enough time had passed to soften him. ", "Instead it seemed to have made him more scornful toward her.", "\n\n\"So even though Betty and Jules are in danger, and I have important information about that, you don't want to hear it unless I'm willing to dredge up everything I really am. ", "I have to prove to you that I'm not some drifter con artist who changes her identity to uphold her charade?\" ", "The question was full of sarcasm and petulance. ", "The idea of having to bare herself to him, to dig up parts of her past that she had intentionally buried to keep herself sane and safe, made her so angry. ", "She was only trying to help him. ", "Why couldn't he accept that and let her keep her secrets hidden where they belonged?", "\n\n\"Yes, that's it exactly,\" he replied curtly. ", "He wanted to know that she was capable of telling the truth, of letting him in. ", "If she could do that, then he'd be willing to hear her out.", "\n\n\"You have no idea what you're asking of me, and you're completely minimizing the impact it will have, but I don't care because Betty and Jules are in danger, and that's all that matters. ", "If you're juvenile enough to think knowing the _real me_ makes a difference then I'll appease you, even if it crushes me to talk about it. ", "But if I'm doing this it's not going to be while you have one hand on the door ready to leave. ", "If you want my story, you're going to get all of it, and you're going to sit here with me and listen. ", "Also, this never leaves this room. ", "What I tell you about me is my story to tell, not yours.\" ", "Piper sat down on the couch and Bobby came and joined her. ", "He had a look on his face like he had won something, something he wasn't really sure he wanted anymore.", "\n\n\"I'm not trying to minimize this, I'm sorry. ", "I don't want you to have to dredge up everything about your past just for my entertainment. ", "I want to believe that I can trust you, but you need to show me I'm not making a mistake by doing so. ", "I swear, I won't tell anyone what you tell me here today.\" ", "Bobby wanted to hold her hand, to brush the loose strands of hair out of her face. ", "She looked so tired, so alone. ", "He wanted to hold her and forget all of this, but it was too late now. ", "He needed her to come through for him.", "\n\n\"Promise me that you'll take what I say about the judge seriously and that you'll heed my advice. ", "If you guarantee me that then I'll tell you everything you want to know about me. ", "But remember, Bobby, this is a bell you can't unring. ", "Once you know where I come from and what I've done chances are everything between us will change.\" ", "She swallowed hard and could barely believe she was about to share the dysfunctional narrative of her upbringing with Bobby. ", "He nodded in agreement, and she took in a deep breath and tried to start from the beginning.", "\n\n\"My name, my real name, is Isabella Lawson. ", "I haven't said that name out loud in two years. ", "Can you imagine what it's like to not be able to say your own name, like it's a curse word? ", "My father was Roberto Lee Lawson, my mother, Carolina Murphy. ", "They never married. ", "I was what you would call an accident, but that would be a nice way of saying it. ", "I found out as I grew up I was a _mistake_ , a pregnancy that went undetected too long to be erased by an abortion. ", "My parents were neglectful, sadistic drug addicts who spent their entire lives dabbling in one crime or another. ", "My mother would sell her body in order to bankroll her next fix. ", "My father would find out, and after partaking in half of her score, would violently beat her. ", "I was in school only frequently enough to pass my classes and fly under the radar. ", "Half the kids there should have been taken from their parents. ", "The system wasn't equipped to deal with every bruised child who looked a little hungry. ", "I spent days locked in my room as my parents binged on drugs and threw rowdy parties. ", "I went without eating, without having a bathroom to use. ", "My childhood was one horrific moment after another. ", "The ironic thing is, that's not even why I'm here. ", "That's not why I changed my name. ", "It isn't even the darkest part of my life, and I can already feel you looking at me differently.\" ", "Piper stared straight ahead as she spoke. ", "Bobby wanted to put his arm around her and pull her up against him but he hesitated.", "\n\n\"When I was twenty years old, and on the verge of getting the hell out of that place, my mother got arrested again for prostitution. ", "Living in the projects was miserably oppressive at times, but I saw plenty of people succeed. ", "My parents just weren't those people. ", "They were swallowed up by it. ", "After that last arrest my mom was locked up for ninety days. ", "She came out completely sober, and you know the old cliché—she had _found God_. ", "She told me we were leaving, to pack up whatever I could before my father got home because we were getting out of there. ", "The clergyman in the prison had found us a shelter sixty miles away and had arranged a ride for us. ", "She told me she was tired of protecting my father. ", "At the time I had no idea what she meant. ", "It seemed like my father was doing just fine taking care of himself. ", "It was the two of us that needed protection. ", "I was so happy to be leaving that place, and my mother was like a new person. ", "She got a job at the mall next to the shelter. ", "A few months later we transitioned from the shelter to a place of our own,\" Piper gulped back the lump in her throat.", "\n\n\"That was the closest to normalcy and contentment I had ever experienced. ", "We didn't have to worry about my father's beatings or ripped-off drug dealers coming to our house on a vendetta. ", "I thought I finally had a chance at a real life. ", "We lived that way for twenty-one months and twelve days.\" ", "Piper wanted to look over and see what type of expression Bobby had on his face. ", "Was he horrified? ", "Sad? ", "Maybe he didn't believe her at all. ", "Either way she couldn't bring herself to turn toward him. ", "She carried on with her story.", "\n\n\"Then my mother came home one night from work high out of her mind. ", "She had fallen off the wagon. ", "I had suspected it for a while, but I couldn't bring myself to believe it. ", "She told me she had made a mistake, that in a moment of weakness she had called my father and told him where we were. ", "She said he was furious and that we'd need to leave as soon as possible before he came to get us. ", "I couldn't believe after all this time, after all the hard work, my mother would be so stupid and selfish. ", "We packed our duffle bags and gathered up every dollar we had in the apartment, pulling even the loose change from the couch cushions. ", "It didn't matter though, we weren't fast enough. ", "There was a loud thumping on our door, and I heard my father's voice booming in the hallway. ", "I thought we'd get the beating of a lifetime and have no choice but to return back home with him. ", "Unfortunately, it was worse than that.\"", "\n\nThere were warm tears rolling down Piper's cheeks now. ", "She could feel them forging itchy paths on her face, but she didn't wipe them away. ", "If Bobby was going to insist on hearing this then he could deal with the consequences of what it did to her.", "\n\n\"My mother finally opened the door and without a word my father cocked his fist back and punched her across the face. ", "She fell backward onto the floor and was disorientated. ", "I pressed myself up against the living room wall, feeling like a helpless child again. ", "I thought about grabbing a knife from the kitchen or the baseball bat from under my mother's bed, but my father was too strong and too fast for me to take such a chance. ", "I had resolved to endure the thrashing and beg for mercy as my mother was doing on the floor. ", "But my father changed the game, he pulled a large metal spike from his jacket, and my mom shrieked in a way I had never heard before. ", "She begged him not to do it, she begged him to let her live. ", "I didn't know it then, but my mother knew exactly what my father was about to do. ", "He struck her again in the face with his fist and then pinned her down by sitting on her stomach, his back to her face so that he could hold down her legs. ", "He raised the spike over his head and plunged it into her thigh. ", "He yanked it back out and blood, an ungodly amount of blood, poured out of her. ", "I did nothing. ", "I didn't scream or run over to her or try to stop him.\" ", "Piper choked back her quivering voice.", "\n\n\"I stood, still pressed against the wall, praying he would forget I was there. ", "When my mother stopped moving and the blood had stopped spurting from her wound, my father pulled out a switchblade that was clipped to his belt. ", "I couldn't see what he was doing from where I stood, but whatever it was took precision. ", "When he stood up, I begged him to let me go. ", "I promised that I wouldn't tell anyone. ", "He didn't blink, he didn't speak. ", "He walked slowly up to me, hit me in the face, and shoved me to the ground. ", "He was about to pin me down when we both heard the sound of sirens approaching. ", "I thought, he'd stop and run. ", "But he didn't. ", "The sirens had distracted him but not stopped him. ", "I decided in that moment, that I didn't want to die that way. ", "I didn't want to be someone who didn't fight back. ", "As he tried to pin me down the sirens grew closer, and he finally just raised his arm up, spike in hand, and plunged it into my leg as I tried to twist away from him. ", "I was pulling at his hair and clawing at his back. ", "Finally, he spun around, grabbed my hair, and slammed my head into the floor, knocking me out.\" ", "Piper might have been furious at Bobby for forcing her to tell this story, but there was something cathartic in saying the words out loud, about admitting what had happened to her.", "\n\n\"There is a lot more to this story, Bobby, but I know you need to get to work and it's important that I tell you the information I have.\"", "\n\n\"I don't need to go to work. ", "I have the afternoon shift today. ", "I was being a jerk. ", "I've got time and I want to listen. ", "I'm sorry this is so painful for you, but I promise none of this changes how I feel about you,\" Bobby said, wiping a tear from Piper's warm red cheek. ", "It felt so good to touch her again.", "\n\n\"That's easy to say, Bobby, but there are things I still can't forgive myself for. ", "Don't assume you'll be able to look past it,\" she said, pulling away from him slightly. \"", "I don't want to stay here anymore. ", "Can we please get in your truck and go for a ride? ", "I don't want to talk about it here.\" ", "Piper stood up and ran her fingers through her hair pulling the loose pieces away from her face and tying them back into a messy bun. ", "She knew her lack of sleep, lack of makeup, and overall ragged appearance should have kept her from leaving the apartment, but all she wanted was to be riding in the passenger seat of Bobby's truck watching the world zip by. ", "Most people would assume that the memory of nearly being killed and watching your mother take her last breath, would be the hardest thing to reminisce about, but really it's what happened next that Piper struggled with the most.", "\n\nBobby and Piper climbed into his truck, and he started to drive with no real direction in mind. ", "Piper waited until they were out of town and heading down a long stretch of open road before she started to speak again.", "\n\n\"The police came and stopped my bleeding just in time. ", "My father had fled, and, because I wasn't conscious, they had no leads to start hunting him down. ", "When I woke up in the hospital there was a woman sitting next to me.\" ", "Piper conjured up the memory of that haunting and familiar face she had awoken to. ", "She remembered she had short jet-black hair and the darkest eyes she'd ever seen. ", "Her skin was a rich dark espresso.", "\n\n\"I remember thinking how beautiful and strong she looked. ", "She was dressed in a perfectly tailored gray suit, and she smelled like peppermint. ", "I thought for a minute that maybe I was dead and she was some kind of spirit. ", "But I realized quickly I was alive and that life was about to get much harder for me. ", "The woman told me her name was Special Agent Lydia Carlson of the FBI. ", "She was sorry to inform me that my mother had not survived the brutal attack in our apartment but that, miraculously, I had. ", "She told me she knew I was tired, and this was not an ideal time to have to rehash the horrific details, but time was of the essence.", "\n\n\"I wanted to speak but my mouth and throat were so dry, and Special Agent Carlson kept talking and talking, hardly allowing an opportunity for me to speak even if I could. ", "Finally she asked me a question that made no sense to me. ", "She inquired if I had ever heard of the Railway Killer. ", "I hadn't, so I shook my head no. ", "She continued on, telling me that over the last nineteen years the Railway Killer had murdered twenty-two women with the same MO each time. ", "Agent Carlson had been part of the task force assigned to catch him for over ten of those years. ", "They had been waiting for a break in the case, and now they finally had one, she said.", "\n\n\"I couldn't understand what she was talking about, what this had to do with my mother and me. ", "As she continued to speak the fog lifted and everything became painfully clear. ", "She told me the Railway Killer targeted young women. ", "He utilized brute force and the element of surprise. ", "He would pin them down and drive a railroad spike into their femoral artery, severing it, causing massive blood loss and eventual death. ", "Then he would carve a number into their leg that corresponded to how many women he had killed before them. '", "Your mother had the number twenty-two carved into her leg, and you have the number twenty-three. ", "You are the only surviving victim of a man I have spent a decade hunting. ", "Anything you can tell me will help bring him to justice,' Agent Carlson said.", "\n\n\"You would think I would have sat up in bed and cried out that not only did I have details that would help the case, but I knew the name of the man they were searching for.\" ", "This was the hardest part for Piper, reliving this dark moment of her past was like slicing open an old wound. ", "But she had gone too far to stop now.", "\n\n\"That's what any rational person would have done in that situation, but instead I lay there, silent. ", "After nearly an hour had passed and she had made her case in every way possible, she left and told me she'd be back the following day and we could talk then. ", "She did come back, every day for five weeks, and I never spoke a word to her. ", "She would tell me how they could keep me safe, how they had reported in the news that I was dead in order to protect me from any more harm. ", "She'd fluctuate between empathy and frustration, but nothing would make me speak. ", "I didn't want to be the daughter of a serial killer, or the victim of one. ", "I wanted to rewind my life to when things had started to feel right, to when my mom was alive and sober. ", "I knew the moment I told Agent Carlson that my father was the Railway Killer, I could never take it back.\"", "\n\nPiper sobbed with her hands covering her face and her head pressed against the passenger window. ", "She had never admitted her horrible mistake to anyone, let alone someone whose opinion she valued so much. ", "Even if Bobby could overlook the dysfunction of her roots, she found it hard to believe he could move past her not coming clean to Agent Carlson. ", "She assumed he would see it the way she did, as a selfish attempt at self-preservation.", "\n\n\"Piper, you were in shock. ", "You had gone through a horrible event, had nearly been killed, and had watched your mother die. ", "Any officer knows that victims need time. ", "Even when you're anxious to solve a case, you can't do it at the expense of the victim.\" ", "Bobby reached across the truck and tried to calm Piper by rubbing her shoulder. ", "It killed him to see her fall apart like this.", "\n\n\"You don't understand. ", "I wasn't traumatized over the death of my mother. ", "I was sorry she was dead, but she was equally as sadistic and violent toward me as my father had been. ", "She wasn't my advocate or my protector. ", "Even when we moved on and tried to piece our lives together, we barely spoke. ", "We mostly just coexisted. ", "I think, to her, I was a reminder of a past she wanted to forget. ", "To me she was an enemy I couldn't forgive. ", "She called my father that day, she did drugs, and she told him where we were. ", "I believe my mother covered up his crimes for years. ", "I don't think anyone deserves to die that way, but that wasn't what was keeping me quiet. ", "I didn't want to deal with the spectacle that would come from telling the truth. ", "I didn't want my parents stealing any more life from me than they already had, and in that self-absorbed decision I was a part of something that I will carry around with me for the rest of my life.", "\n\nAfter my recovery, when on the verge of being released from the hospital, Agent Carlson came storming into my hospital room and threw a handful of pictures onto my bed. ", "They were crime scene photos, and I remember turning away at the sight of a dead girl sprawled out in a puddle of blood. ", "Agent Carlson put her face close to my ear and hissed, 'Delanie Morrison, a twenty-one-year-old waitress, was murdered last night on her way home from work.' ", "She pointed to a picture of the girl's thigh, which had the number twenty-four carved into it. '", "Every number after twenty-three is more blood on your hands,' she told me.\" ", "Piper's eyes were spilling over with guilt and tears.", "\n\n\"She was right, I could have prevented that murder and because I didn't, it made me just as guilty as my father. ", "That idea destroyed me.\" ", "Remembering the day she had found out about Delanie was harder for Piper than the day she had almost died. ", "She had never felt more alone, more immoral and guilty in her entire life. ", "She felt the air in her lungs turning to gravel. ", "She wanted to pull open the door of the truck and jump out. ", "She begged Bobby to pull over.", "\n\nWhen the truck came to a stop in a small clearing on the side of a quiet stretch of road, Piper pushed the door open and jumped out, gasping for air. ", "Bobby ran around the truck to try to calm her in any way he could. ", "What she did next took him completely by surprise.", "\n\nPiper unbuttoned her jeans and pulled them down slightly on one side, exposing her upper thigh. ", "Bobby's heart broke at the sight of a large, circular raised scar from the number twenty-three carved in her leg. ", "He had asked for the truth and assumed it would be murky and tainted in some way. ", "But he never imagined anything like this.", "\n\n\"I could have stopped him, but instead I kept my mouth shut. ", "After I saw those pictures of Delanie I told Agent Carlson everything. ", "I promised to testify against my father and do anything I could to make sure he was brought to justice. ", "It didn't matter though, nothing would bring back Delanie, give her parents back their child.\" ", "Piper was frantic and her words were hardly coherent.", "\n\nBobby came to her slowly. ", "He took her hand from the top of her jeans brought it to his mouth and kissed it. ", "He touched the raised skin of her scar and stared into her eyes. \"", "That was not your fault. ", "What Carlson did was a technique to get you to give her what she needed. ", "They literally train you on this stuff, on getting victims to talk. ", "Your father was the murderer. ", "The blood is on his hands, not yours. ", "The important thing is that you told her everything you knew and they were able to catch him. ", "You did the right thing, and it's understandable that it took you a little time to process it all.\"", "\n\n\"You don't get it! ", "I'm here in North Carolina because they haven't caught him. ", "I waited too long, and he had time to run. ", "Someone leaked to the press there was a break in the case and they were pursuing a person of interest due to an eyewitness ready to testify. ", "He is one of the most wanted men in America and no one can seem to find him. ", "I was put in witness protection until he's apprehended, and I can be called to testify against him. _", "He's still out there_.\"", "\n\nPiper wrapped her arms around Bobby's waist and rested her head on his chest. ", "Carrying this burden alone for the last two years had been suffocating. ", "Knowing she could say this all aloud and someone would still be there to hold her was liberating, even if the rehashing of her mistake was painful.", "\n\n\"Piper, I'm so sorry that you had to go through all that, and you've spent all this time blaming yourself. ", "You're not alone in this. ", "I'm still here, and I'm not going anywhere. ", "I'm sorry I doubted you, but I'm glad you told me. ", "Living with that burden by yourself is too much. ", "I'm here to listen to whatever you want to tell me.\" ", "Bobby squeezed her tighter and then crouched to lower himself to her eye level. ", "She was still breathing erratically through her tears, and as much as he wanted to kiss her, he didn't think this was appropriate. ", "Piper needed his support, and he didn't want any of it to be clouded by passion.", "\n\nPiper let herself melt into him for a moment before she spoke. \"", "I need you to hear what I have to say about Judge Lions. ", "It's important, and I'm not sure I can talk much more about my past right now.\" ", "Piper wiped at her cheeks and drew a deep, composing breath.", "\n\n\"All right, if you're sure you're up to talking about it then go ahead. ", "But can we get back in the truck? ", "It's getting cold out here and I don't want you getting sick.\" ", "Bobby walked over and opened her door. ", "As she walked by him to hop in, he grabbed her elbow and spun her gently back around toward him, hugging her one more time before the seats in his truck would force space between them.", "\n\nPiper wasn't sure exactly how to start this difficult conversation, but she dove in. \"", "I saw something in the alley behind my house one day. ", "I was feeling so lost, school hadn't panned out, and this seemed like a sign. ", "Judge Lions was assaulting a young girl. ", "I overheard enough of what he was saying to learn he was paying her to have sex with him. ", "At first I didn't know what to do or who to tell. ", "I felt like the whole system had failed me, and everything I had learned in school led me to believe there was no way a man like Judge Lions would be held accountable for his actions. ", "I started to concoct a plan to take down the judge without having to go through the normal channels I knew wouldn't work. ", "I saw that girl bleeding in the alley, and all I could think was that I wasn't going to let someone else get hurt or killed when there might be something I could do about it. ", "I've spent the last couple of months slowly gathering information. ", "Well, that search led me to a mill this morning where I was listening in on a meeting between the judge and who I thought would be Christian Donavan.\" ", "Piper hadn't fully recovered from telling her own story. ", "She felt like there was no way she had the emotional energy to tell Bobby what she knew about Stan's death, but she had no choice.", "\n\nBobby cut in, shocked by the thought of her solo surveillance. \"", "Wait, what do you mean you were listening in on a meeting? ", "Like you were hiding in this mill while the judge and Christian Donavan were there? ", "Please tell me sometime in your life you've had some training or experience to prepare you for this. ", "Maybe that's part of the story you haven't shared with me yet?\"", "\n\n\"No,\" Piper continued. \"", "And I know that sounds crazy. ", "I've mostly been taking it all really slow, thinking through my next move. ", "The meeting this morning was a little impromptu, and I had to make a decision whether or not to go. ", "I'm glad I did though. ", "The person meeting with the judge wasn't Christian, he was a cop. ", "I need to know, Bobby, if and why you've been digging into Judge Lions's business, because this cop was on to you.\"", "\n\n\"I have been,\" Bobby answered shocked at her knowledge of his recent activities. \"", "I started a few weeks ago. ", "I thought if you were involved in something this is how I would find out, and if you were in trouble, this is how I'd protect you. ", "I thought if I could figure out what was going on I'd be able to get ahead of this, ahead of you.\" ", "He wanted her to know that even though they hadn't been speaking he was still thinking of her every moment they'd been apart the last couple of months.", "\n\n\"Well whoever you showed the pictures of the judge to is the cop who was at that meeting today. ", "They were talking about how they were going to deal with the situation, deal with you. ", "They decided that hitting you where it hurts would be their best bet to get you to back off. ", "That meant making you realize Betty and Jules were in danger.\" ", "Piper was half hoping that Bobby would say he hadn't shown the pictures to anyone. ", "She was holding out hope that maybe the judge and the cop were talking about someone else, although her logic told her that was highly unlikely.", "\n\n\"That's not possible. ", "I only showed the pictures to Rylie. ", "There's no way he's on the take. ", "He's one of the most respected guys on the force, and he was a good friend of Stan's. ", "He wouldn't get involved with anything that put them in danger. ", "Are you sure you heard all this right?\" ", "Bobby asked in disbelief.", "\n\nThe next piece of information would be more of a blow than finding out someone respected was not worthy of it, and Piper was not looking forward to delivering the news. \"", "The judge called the man Red. ", "I don't know if that means anything to you, but I can assure you, it was clear to me that this man knew you. ", "It was also clear he knew Stan very well too.\"", "\n\n\"Yes, that's Rylie's nickname. ", "I can't believe he'd be mixed up in all this. ", "Maybe it's because he's so close to retirement. ", "They're messing with pensions so much, maybe he needed the money.\" ", "Bobby shook his head as he searched for any plausible reason why a cop like Rylie would go against the badge like this.", "\n\n\"Bobby, Rylie is going to come to you and try to convince you to back off this. ", "It's going to be your last out before they take more drastic measures. ", "You need to go along with that. ", "Tell him you've been thinking about it, and you don't need another mark against you like Manton. ", "Give him the pictures and tell him you trust him to do whatever he thinks is best with them. ", "That's the only way to keep everyone safe.\" ", "She was praying he'd agree and make this easy.", "\n\n\"I will, because there's no way I'm putting the girls at risk over this. ", "He was there for Manton so he'll understand why I wouldn't want any more attention on me right now,\" Bobby said, trying to convince himself this was the right thing to do.", "\n\n\"There's more to the story here, Bobby. ", "Rylie was there for the takedown on Manton because he was part of it. ", "The Donavans were supposed to be there that day. ", "Rylie set you up to protect them. ", "He made sure Manton got off the hook so he wouldn't flip on them. ", "I hate to say this and I haven't really thought of the right way yet, but there is something else I need to tell you. ", "Something worse.\" ", "Piper bit at her fingernail as she tried to find the right words. ", "She was about to stomp on Bobby's chest, crushing him in a way he probably didn't believe possible. ", "As much as she wanted him to know the truth, she wished she could protect him from it.", "\n\n\"Tell me,\" he said, reaching across and taking her hand, stopping her from ravaging her fingernails. \"", "I don't see how it can get much worse.\"", "\n\n\"I need to know that you'll handle this right. ", "This corruption is not limited to the judge and Rylie, it runs deep, and we have no idea who we can trust. ", "So when I tell you this I need you to think through all the consequences of any action you take and realize at the end of the day you need to protect the people you care about first and foremost.\" ", "Piper paused waiting for him to agree to her terms. ", "He nodded his head impatiently. \"", "The reason they want to target Jules and Betty rather than just take you out is because killing a police officer isn't as easy as it was ten years ago. ", "Ten years ago the judge and Rylie had more people on the inside willing to help in the cover-up. ", "There wasn't as much technology, times have changed. ", "So ten years ago they were able to lure a police officer into an abandoned building and shoot him, passing it off as a random robbery gone wrong. ", "They got away with it ten years ago when they killed Stan for digging around in their business and getting too close to the truth. ", "Bobby, Rylie and Judge Lions killed Stan. ", "I don't know which one of them pulled the trigger, but I know they orchestrated it and covered it up.\"", "\n\nPiper was crying again though she wasn't sure why. ", "She had never met Stan, but she felt like she had gotten to know him through his family, and the thought of him being betrayed by people he trusted sickened her.", "\n\nBobby tightened his hands over the steering wheel until his knuckles were white. ", "Piper could see him grinding his teeth as he processed the new information.", "\n\nHe sat silently for several minutes. ", "Piper kept wondering if she should say something, anything— but nothing she came up with sounded right in her head. ", "She opened her mouth to speak, but Bobby had beaten her to it. \"", "Betty was right all these years,\" he whispered. \"", "I've been telling her over and over again that she was crazy, that if there were some kind of conspiracy it would have been uncovered by now. ", "Everything I've ever believed about the sanctity of the shield and due process means nothing. ", "If the system can't flush out the men who killed a cop—a great cop—in ten years, then what the hell are we all doing every day? ", "I need to do something about this. ", "They can't continue to live above the law.\" ", "He punched his fist into the steering wheel and the horn blasted, sending Piper jumping in her seat.", "\n\n\"I have a plan,\" Piper said, hoping Bobby's resentment against Rylie would be enough to sway him. ", "She needed him to ignore his normal instinct to obey the law and let her continue with her explanation without argument. \"", "Originally I was only going to target the judge, but after I heard about Stan this morning I came up with a way to include Rylie and even Christian Donavan in all of it. ", "I want you to know that I have this all under control. ", "As long as you do your part with Rylie and convince him you're not interested in the judge anymore, then I'll take care of the rest. ", "The less you know the better.\"", "\n\n\"Piper, do you have a gun or another way to protect yourself when you get caught doing surveillance on these guys? ", "Have you ever even fired a weapon? ", "Your intentions are great, Piper, but you aren't qualified to do any more of this on your own. ", "Tell me what you're planning, and I can help.\" ", "Bobby's brain had kicked into high gear as he processed all Piper was telling him. ", "Maybe Stan's way of handling things was admirable, but it also got him killed. ", "If Piper hadn't come to him this morning with this information he unknowingly would have put Betty and Jules in danger. ", "He might not think Piper was qualified, but she was certainly doing everything right so far.", "\n\nPiper continued, \"Your instincts are going to tell you to shoot this plan down, so try to fight that. ", "Remember your other options. ", "You can drive your truck to Rylie's house right now and kill him in cold blood, spending the rest of your life in jail. ", "Or you can take the information you do have, most of which is hearsay, and report it, crossing your fingers and hoping whoever you confide in doesn't have a hidden alliance of some sort. ", "You'd spend the rest of your life looking over your shoulder and worrying that you've endangered people you love.\"", "\n\nPiper thought a preemptive strike against Bobby's possible points of contention would be her best approach. \"", "Knowing all that, my plan shouldn't sound so bad. ", "I haven't worked out all the details yet but I'll give you the basic outline. ", "The judge is a pedophile. ", "He engages in sexual activity with underage girls. ", "That doesn't matter to the men he's aligned with. ", "If the judge was more inclined to engage in this type of behavior with underage boys, this may change some minds. ", "But I'm not willing to take a chance on _maybe_ swaying someone against an association with the judge, so I plan to up the ante. ", "Christian Donavan has a young son who attends Millersville West Academy. ", "I intend to plant evidence that convinces Christian the judge is targeting his son as his next victim. ", "There is no way Christian will continue any type of affiliation with the judge under those circumstances, leaving him vulnerable and with limited protection.\"", "\n\nBobby shook his head. ", "His mouth was agape as he searched for the right words. ", "Piper had hoped he was on the verge of calling her a genius, or that his next question would be about how he could help, but as he started to speak she knew she had further persuading to do. \"", "You think he's going to simply discontinue his affiliation with the judge? ", "Christian isn't an 'I'm taking my ball and going home' kind of guy. ", "We'll be pulling the judge's bloated body out of the river within twenty-four hours of finding that evidence. ", "Do you really think you're prepared to cope with what part you're going to play in that? ", "I know it's not going to sit right with me, not to mention the legal implications if it comes back on us. ", "And how does this tie in Rylie with Christian?\"", "\n\nWell, he didn't say _no_ outright, so Piper felt like that was a start. ", "She had been pretty sure what she was doing could very well result in the judge's death at the hands of Christian, but she didn't think that was a good starting point for attempting to win Bobby over.", "\n\n\"It's chess, Bobby. ", "All I'm doing is setting up the pieces. ", "They're the ones playing the game. ", "If Christian wants to kill the judge, then that's on him, not me. ", "As far as taking the other two down, think of how advantageous it will be to know a murder will be committed before it happens. ", "Think of how easy it will be to gather crucial evidence when you know ahead of time both the victim and the murderer. ", "Once Christian believes his son is in danger, I'm confident he'll seek some form of revenge. ", "If we keep eyes and ears on him we'll be there to either catch him in the act or collect everything we need for an irrefutable slam-dunk case. ", "I overheard in today's meeting there was bad blood between Christian and Rylie. ", "We give Christian the opportunity to flip on Rylie. ", "Christian is a smart guy. ", "He'd be covering his bases and have some type of blackmail or evidence against Rylie in his back pocket in case he ever needs it.\" ", "This was the first time Piper had talked out loud about anything regarding the judge. ", "It was exhilarating, yet still strange, to think how far she had come all on her own.", "\n\n\"You'd be comfortable with giving a plea deal to a guy like Christian?\" ", "Bobby had to admit Piper had some solid ideas and, implemented correctly, there was a chance all of it could work. ", "Whether or not they could live with themselves when all this was over was a different story.", "\n\n\"A plea deal for killing a man I already want dead? ", "Yes, I think I can live with that,\" Piper said, immediately regretting the admission, knowing it made her sound cold. \"", "As much as I think Christian probably deserves to spend the rest of his life in jail, he didn't conspire to kill Stan. ", "Christian would have barely been out of high school back then. ", "I thought I was doing this because I wanted a man like the judge to be held accountable for his crimes against that young girl. ", "I thought it was shameful to live above the law and that his abuse of power needed to end. ", "Now, it's also about what they did to Stan, what they took from Jules and Betty all because of money and influence. ", "Christian is good collateral damage, but I want to see the judge and Rylie pay for what they've done.\"", "\n\nPiper knew this wasn't how Bobby would want to handle any of this. ", "Vengeance wasn't as appealing to him as straightforward legal justice, but she took his allowing her the opportunity to speak as a good sign.", "\n\nBobby looked hesitant. \"", "There has to be a way we can do this without risking the judge's life. ", "I want him held accountable, but I'm not sure how I'll sleep at night if I know we put into motion actions that led to his death. ", "I need time to think about it. ", "For now, I'll do my part with Rylie today and let him know I'm not moving forward with the pursuit of the judge.\"", "\n\nBobby tapped his fingers on the steering wheel and bit his lip. ", "This was a position he thought he'd never find himself in. ", "When faced with moral dilemmas there always seemed to be a clear right and wrong, but Piper was making him think maybe there had to be more options than that. ", "Maybe rules are important, but when they stop working you have to create your own in order to stay one step ahead of dangerous people.", "\n\n# Chapter 15\n\n\"Where the hell is he?\" ", "Bobby grumbled to himself as he drove his squad car up and down the streets of Edenville. ", "It was nearly dark and Bobby felt the last fifteen minutes of his shift melting away. ", "It seemed as though Rylie was being incredibly elusive today, which was frustrating the hell out of Bobby. ", "He didn't want to be transparent and call Rylie. ", "He needed their conversation to seem unprompted, and chasing Rylie down ran the risk of seeming desperate. ", "He crisscrossed side streets of Rylie's normal routes and continued to curse under his breath. ", "Finally, he suspended his search and decided to check in on Jules on his way home. ", "He was sure to see Rylie tomorrow as Friday mornings always included a little gathering of the first shift for coffee at the precinct.", "\n\nHe pulled his squad car up to the front of town hall. ", "He only planned to make a quick stop and no one tended to complain about a cop's car out front. ", "Every Thursday was Jules's day to work the late shift. ", "The only part of the building that was left open this late was the records department so that officers and court personnel could gather what they needed. ", "It tended to be pretty quiet, and Jules always appreciated company on these long days.", "\n\nBobby pushed open the large revolving door and, after seeing that Jules wasn't in her office, headed down the hall to the records room. ", "He felt a flash of heat flow through his body as he remembered this was the first place he had kissed Piper, the first time he had realized how much he cared for her.", "\n\n\"Hey Jules, just stopping in to say hello,\" Bobby called as he peeked his head into the large room lined with filing cabinets and storage boxes. ", "There was no one there, no sign of Jules. ", "This room and her office were the only two places she'd normally be once the front desk was closed for the day. ", "She'd never leave the front door unlocked and not be around to meet anyone coming in for the records room. ", "Bobby felt his chest tighten at the thought of Piper's warning about Rylie. ", "Maybe he should have tried harder to track him down and convince him that he wasn't interested in pursuing the judge any longer. ", "Perhaps Rylie had already acted on his plan to hit Bobby where it hurt.", "\n\nThe silence in the old, drafty building was broken by a loud deep voice coming from the front desk. ", "Bobby darted in that direction not sure what he might find.", "\n\nThere, at her usual post for the daytime hours, stood Jules with an enormous grin on her face. \"", "Oh Bobby, I was wondering if you were going to stop by tonight. ", "You know Officer Rylie.\" ", "Standing across from Jules with the cap of his uniform tucked dutifully under his arm was the redheaded backstabber who had killed Stan. ", "Bobby worked quickly to assess the situation and determine if Jules was under any type of distress. ", "She seemed to be oblivious to any danger.", "\n\n\"Why aren't you in your office or the records room? ", "It's late. ", "Isn't the front desk usually closed this time of night?\" ", "asked Bobby, pulling the small swinging half-door that led to the large desk Jules was standing behind. ", "He wanted to be closer to her than Rylie was and being next to her behind the high oak counter was the best he could do right now.", "\n\n\"Office Rylie came in looking for a burning permit, and I said I would help him out. ", "I know you guys work odd shifts, and it's not always easy to get in here during the day.\" ", "Jules turned toward the filing cabinet and thumbed through the folders, searching for the necessary paperwork.", "\n\n\"A burning permit?\" ", "Bobby raised an eyebrow skeptically at Rylie.", "\n\n\"Hey there, kid. ", "Yeah I've got some stuff I need to get rid of, and I figured the best way to do it would be to burn it. ", "Sometimes you need to reduce things down to ashes in order to be done with them. ", "You know how it goes.\" ", "Rylie winked at Bobby and flashed him a crooked grin.", "\n\n\"Yeah, I know how it goes. ", "Hey listen, Jules, can you finish up the paperwork? ", "I've got to talk to Officer Rylie out front. ", "Work stuff.\" ", "Bobby crossed back through the swinging half-door and waved for Rylie to follow him out.", "\n\n\"No problem. ", "Officer Rylie, it was good seeing you. ", "I'll put this in the mail tomorrow and you'll have it in time for the weekend,\" Jules said, waving to them.", "\n\nAs the two men pushed out the front door Bobby reached into his coat and pulled out an envelope containing all the pictures he had taken of the judge.", "\n\n\"Rylie, I've been doing a lot of thinking and I'm really not in a position to do anything with these pictures. ", "I'm practically the laughing stock of the department right now, and I don't think I'll survive another mess. ", "I'm in over my head, and I'm not really sure what to do. ", "It's none of my business if a judge wants to screw around on his wife. ", "Here are all the pictures I took. ", "I want to put this behind me. ", "Can you help me out?\" ", "Bobby handed the envelope over to Rylie who struggled to mask his delight. ", "He had a \"this is easier than I thought it would be\" look on his face.", "\n\n\"I hear you, kid. ", "I was going to warn you if you want a career in this town this isn't the way to go about it. ", "I've got some guys I can trust, and I'll pass these pictures along to them. ", "They'll look into it, and if there is anything, and I mean _anything_ , going on here they'll handle it. ", "You don't need to be a superhero. ", "Keep your head down and do your job. ", "Messing around with stuff like this will get you or someone you love hurt. ", "A pretty girl like that in there, it would be a shame to see anything happen to her.\" ", "Rylie tucked the envelope into his jacket pocket and put his cap back on his head. ", "Rain started to sprinkle down and a rumble of thunder sounded in the distance. \"", "I'm out of here, kid, before this storm starts. ", "It's supposed to be a bad one. ", "You made the right call though. ", "See you in the morning at the precinct.\"", "\n\nIt took an enormous amount of self-control for Bobby to not get in his car and run the man down. ", "He was a slimy, arrogant, corrupt bastard who didn't deserve to wear that uniform. ", "He stood outside for a few minutes after Rylie pulled away and tried to calm himself down.", "\n\nEven with the extra time outside Bobby couldn't help but storm down the hallway boiling with rage as he made his way back to Jules. \"", "I've told you so many times it's not safe to be here by yourself with the door unlocked. ", "You need to change your schedule so that you're not a sitting duck in this big building. ", "Someone could come in here, murder you, and no one would even hear you scream. ", "This is the last time I'm going to warn you about it. ", "You're smarter than this, Jules.\" ", "Bobby's face was red and his voice was a booming echo in the large empty building.", "\n\nJules had initially jumped at the sound of Bobby's voice but her fear turned quickly to annoyance. ", "They'd had this argument many times before, but it was the first time Bobby had been so resolute about it. ", "She rolled her eyes and returned back to her work as she spoke, \"The only people who come in here at night are cops and lawyers. ", "You're acting like we live in a crime-ridden metropolis and I'm some kind of target.\" ", "Jules tucked the paperwork into a file and came out from behind the counter. ", "She brushed past Bobby dismissively and headed for her office.", "\n\n\"Well maybe you should take your mom's advice and stop trusting everyone wearing a uniform. ", "All I'm saying is there has to be a better way to run this late shift on Thursdays.\" ", "Bobby was marching right behind Jules not letting her brush the situation off so easily.", "\n\n\"You're the one always talking Ma out of that asinine conspiracy theory crap. ", "You're not my keeper, Bobby. ", "I hear what you're saying but I think you're being a little over-protective. ", "It's sweet and all, but it's getting old.\" ", "Before Bobby could retort, his phone rang and Piper's name lit up his screen. ", "Jules spun around and grabbed his wrist to see who was calling. \"", "Wait, you still get to talk to Piper, but we have to give her space? ", "I really like her, and I don't understand why we haven't seen or heard from her in two months. ", "I already told you that if there is something going on between you guys I'm fine with it. ", "You don't need to keep her from me because you think it's going to hurt my feelings or something twisted like that.\"", "\n\n\"That's not it Jules, give me a second.\" ", "Bobby shook Jules's hand from his wrist and walked back out the front doors. ", "He felt a nervous shiver run up his spine as he stood in the misting rain. \"", "Hello?\"", "\n\n\"Bobby, I've got some bad news. ", "I was at the diner, and the judge was there. ", "I guess his wife is traveling or something so he's eating there all week. ", "I heard him take a call, and it didn't go well. ", "He said he didn't care if the situation sounded under control- it was too risky for them to sit back and do nothing. ", "He told the person on the other end of the phone that he thought they should stick with the plan. ", "I'm guessing it was Rylie he was talking to, and he didn't like what he was hearing. ", "The judge said if he wasn't interested in the job then Christian would be. ", "They talked for a bit more, and it sounded like the judge might have been coming around to Rylie's side on the whole thing, but all he said was they would talk more about it later. ", "I don't know if Jules and Betty are safe at this point, it's all going to come down to how convincing Rylie can be. ", "Until we know more, you have to be hyper-vigilant.\" ", "Piper was short of breath from the sprint she made back to her apartment after hearing the judge's phone conversation.", "\n\n\"I'm with Jules now. ", "Betty would have gotten home an hour and a half ago. ", "I'm not sure exactly how we should handle this. ", "Neither of them will be willing to blindly trust any warning I give them right now. ", "Jules is already pushing back. ", "I think we should talk to them tonight. ", "We don't have to tell them everything but we should let them know they may be in danger. ", "Can you get to Betty's house in about an hour? ", "I'll stay with Jules while she locks up and we'll head over there, too.\" ", "Bobby felt another chill run down his spine. ", "He wasn't sure if it was from the cold rain or the thought of an impending threat on the dearest people in his life.", "\n\nPiper hesitated on the other end of the phone, not sure how to ask a question weighing heavily on her. \"", "What did you tell them about me? ", "About why I wasn't around? ", "The way Scott was avoiding me at work I figured it had to be something pretty substantial. ", "I want to know what I'm walking into.\" ", "Piper went from being winded to feeling sheepish. ", "Somehow the thought of Jules or Betty thinking negatively about her was more intimidating than anything she was doing with the judge.", "\n\n\"I told them you were going through some stuff, and that you needed some space. ", "I said that you'd come around when you were ready and as hard as it was to stay out of it, we needed to. ", "The reason Scott was avoiding you is because he and Jules separated last month. ", "They filed for an annulment.\" ", "Now that Bobby had learned more about Piper he found himself looking for little moments of vulnerability. ", "Moments like this reminded him she wasn't quite as damaged as she liked to think she was. ", "She cared so much about the girls and about what they might think of her.", "\n\n\"Thank you. ", "I know you were only watching out for them and that you weren't intentionally trying to hurt me by keeping me away. ", "They are lucky to have you. ", "I'll get over there soon. ", "We'll figure this all out.\" ", "Piper waited for Bobby to say goodbye and then hung up the phone from her end. ", "She wasn't sure sharing anything with Jules and Betty would be in their best interest, but Bobby knew them better than anyone. ", "If he thought it was the only way to keep them safe then it was the right thing to do.", "\n\n# Chapter 16\n\nPulling into Betty's long dirt driveway felt incredibly right to Piper, even if her stomach was fluttering from nerves. ", "She had missed this place. ", "If she had to sum up the feeling of Betty's home in one word it would be _unconditional_. ", "That seemed like the perfect way to describe the love Betty showered on everyone, and the friendship around her table.", "\n\nBobby's truck was already in the driveway, and the light on the porch was shining brightly, cutting into the dark night. ", "Piper tapped on the screen door, no longer feeling that her old blank check about \"come right in, no need to knock\" still applied. ", "Betty came barreling around the corner with her arms stretched wide.", "\n\n\"Child you better not be knocking on that door. ", "You come right in, I don't care how long it's been between your visits—this house is always open to you.\" ", "Betty beamed animatedly, scurrying across her kitchen toward the screen door where Piper stood. \"", "I've been as nervous as a long-tailed cat in a room full of rocking chairs about you. ", "The only reason I knew you were still alive was because I had some spies at the diner. ", "They served you dinner a few nights and reported back to me that you seemed all right.\" ", "Piper pulled the door open and let Betty fold her arms around her in a warm embrace. ", "Piper had survived a lifetime without being embraced by a mother, and until this moment she hadn't realized what she had been missing. ", "She had never been held so tightly and so gently all at once. ", "In subtle ways, through small gestures, it felt like Betty was handing Piper little pieces of love. ", "Like she was giving her something to keep and string together. ", "Maybe one day it would be a road map to a place where Piper could feel whole.", "\n\nThere was a chance the hug went on too long- Piper wasn't sure when she was supposed to let go. ", "She knew she never wanted to. ", "She took in a deep breath, and realized Betty smelled like she had imagined every mother should. ", "It was a combination of a flowery perfume and some kind of sweet pastry.", "\n\n\"Thank you, Betty. ", "I'm sorry I haven't been around. ", "It's been a bumpy couple of months, but I'm happy to be turning a corner. ", "I can't tell you how much it means to me that you are welcoming me back like this.\" ", "Piper spoke into Betty's shoulder and she could feel warm tears gathering at the corners of her eyes. ", "She had expected to be excited to see Betty but her tender welcome had moved Piper deeply.", "\n\n\"Sweetheart,\" Betty said, pulling away and maternally stroking Piper's hair, \"we don't just want you here, we need you here.\"", "\n\n\"Come on in and sit down, Piper,\" Bobby called from the doorway of the sitting room. ", "Piper had hoped she and Bobby would have had a chance to calibrate their talking points before sitting with Betty and Jules, but she decided to follow his lead.", "\n\n\"You're really starting to spook me with all this, Bobby. ", "You're being very odd about this big important meeting, even though I was already in my housecoat and curlers. ", "You're lucky you gave me a few minutes' notice so I could get myself decent,\" Betty said, as she and Piper took a seat on the couch.", "\n\n\"I know. ", "I'm sorry to have to spring this on you. ", "I've gone back and forth with myself about whether or not sharing this is the right thing to do. ", "My gut tells me the more you know the more of a liability it is for you, but at the end of the day you are two capable, strong women who deserve the most information possible. ", "I'm not even really sure where to start.\" ", "Bobby looked over at Piper for some assistance. ", "She didn't know exactly what or how much he was planning on sharing, so a starting point would be up to him.", "\n\nBefore Piper could even nod some encouragement in Bobby's direction Jules chimed in, \"Bobby, spit it out. ", "If I thought what you were doing at the town hall was irritating I should have prepared myself for how annoying all this talking in code would be. ", "You have our attention; just say what you need to say. ", "Oh my word, did you get Piper pregnant? ", "Well that happened faster than a knife fight in a phone booth.\" ", "Jules's expression changed quickly from exasperation to glee. ", "She covered her mouth with her hands and shrieked with joy.", "\n\n\"No!\" ", "shouted Piper and Bobby in unison. ", "Bobby felt his face redden at the thought of getting Piper pregnant. ", "He certainly wasn't in the market to be a dad, but the idea of sex with Piper was something he had a hard time not thinking about. ", "From the moment he had walked in to Jules's office and caught a glimpse of Piper without her shirt, he found it hard not to undress her with his eyes. ", "He pictured them at her place, at his, and sprawled out on blankets in the bed of his pickup parked down by the lake. ", "Even now, with more than enough distraction and stress, he was picturing himself peeling away layers of Piper's clothes.", "\n\n\"This is about work,\" Bobby continued, refocusing himself. \"", "I know that neither of you are very keen on the job I've chosen, but you both know it's important to me. ", "You also know at times it can be complicated. ", "I'm currently working on something, and it's come to my attention that I may be a target for some less than reputable people. ", "In turn, that puts anyone I care about at risk as well. ", "That's why I was jumping down your throat today at work, Jules. ", "I need you both to bear with me over the next couple weeks while I work on eliminating the threat. ", "In the meantime you have to stay very alert and be aware of your surroundings constantly. ", "We need to come up with a plan to ensure you're safe. ", "I've started thinking of some simple schedule changes that will help, but I thought we could all brainstorm together on what would work best.\" ", "Jules stood up before Bobby could finish speaking.", "\n\n\"How dare you,\" she said, glaring at him with fire in her eyes. \"", "You know what we went through with Daddy. ", "You saw what it did to us. ", "This is exactly why I didn't want you to become a cop. ", "It wasn't me throwing some temper tantrum about not getting what I wanted. ", "It was about not ever wanting to go through all that pain again. ", "I can't believe you're sitting here asking us to uproot parts of our lives for the choices you've made at work. ", "That's so selfish of you.\" ", "Jules's voice was climbing and becoming shakier with every word.", "\n\n\"Sit down young lady,\" Betty thundered in a stern voice Piper hadn't heard from her before. ", "As quickly as Jules had stood up, the sound of her mother's voice had her seated again. \"", "That's what people do, they ask their loved ones to make sacrifices to support what they believe. ", "We don't have to understand it, but we sure as hell have the responsibility to be there for him when he needs us. ", "I don't like the risk that comes with Bobby's job either, but there isn't a single day that goes by I am not filled to the brim with pride.\" ", "She turned her stare from Jules over to Bobby. \"", "If you're telling us to be on guard for a couple weeks then that's what we'll do. ", "One of the hardest things I've ever been through with Stan was being in the dark. ", "It would have been much easier for you to keep this to yourself and hope nothing happened. ", "In my humble opinion, doing it by himself is what got my Stan killed. ", "You tell us what to do, and we'll do it. ", "You have our support like you've always supported us.\"", "\n\n\"Thanks, Betty,\" Bobby said, hanging his head. \"", "I'm so sorry Jules. ", "I never wanted to put you in any danger, but the only thing worse than that would be leaving you in the dark about it. ", "I promise it will be over soon and we'll all be better for it.\" ", "Bobby needed Jules's forgiveness to make all this work. ", "More than that, he needed her support, not because Betty was telling her to, but because she believed in him.", "\n\nJules lowered her voice but it was still filled with anger. \"", "Screw you. ", "I'll do whatever you want for the next couple weeks, but after that you either quit your job or you quit this friendship. ", "As far as I'm concerned if you really cared about us, you'd never put us in this position. ", "No case should ever be important enough to take these kinds of risks.\" ", "Jules's cheeks were flush with anger and she could feel blood rushing around her body.", "\n\nBetty shook her head in disappointment at her daughter's reaction. \"", "Don't waste your breath, Bobby. ", "Trying to get her to understand is like trying to nail jelly to a tree. ", "I swear she's as thickheaded as her daddy and as stubborn as her mama. ", "You don't stand a chance.\"", "\n\n\"I get it,\" Bobby murmured looking defeated. \"", "Let's discuss how to get through the next couple weeks. ", "I get why you're upset, Jules. ", "I don't blame you, and if it means we can't keep going this way then I'll understand that too.\" ", "Bobby tried to focus on the issue at hand and ignore how much this was killing him. ", "It became clear to Piper he didn't intend to share with them anything about the connection to Stan's death. ", "Maybe she was out of line, maybe she was about to ruin everything, but she couldn't keep quiet any longer.", "\n\n\"Bobby,\" Piper cut in, \"this is crazy. ", "You need to tell them the truth.\" ", "Piper gestured at Betty and Jules and stared hard into Bobby's eyes. ", "She turned her attention back to the two now-bewildered women, each holding her breath. \"", "You guys know Bobby is an intelligent, quick-thinking man with the best intentions and a fierce loyalty to you both. ", "The question is, do you trust him?\" ", "Betty nodded her head with unwavering support.", "\n\n\"Yes,\" Jules said quietly, \"I do think that he's loyal to us and would lay down his life to keep us safe. ", "I only wish he wouldn't put himself in the position to have to do that. ", "I wish he wouldn't make work more important than his life, or ours.\"", "\n\nPiper locked eyes with Jules as she spoke. \"", "Then you can rest easy, Jules, because this has nothing to do with work. ", "Not one word of this leaves this room. ", "I need you to give me your word on that.\" ", "Piper pointed her finger directly at Betty and then at Jules as they both agreed. \"", "I think the truth is the only thing that is going to get you to a place where you'll understand how serious this is.\" ", "She took a long breath, giving Bobby a chance to cut in. ", "When he remained silent she took it as her sign to continue. \"", "My interest in criminal justice led me down some unique paths here in Edenville, and along one of them I came across information about Stan's death.\" ", "Piper paused, half expecting Bobby to shout at her.", "\n\n\"What?\" ", "Betty exclaimed, covering her heart with her hands. \"", "What kind of information are you talking about?\" ", "Her voice was octaves higher than normal as she searched Bobby's face for answers.", "\n\n\"Bobby and I are looking into it. ", "There isn't much we can share with you right now. ", "It seems we've brought a little unwanted attention to both of you. ", "It isn't some imminent threat, and it actually may already be behind us, but he thought you had the right to know there may be some risk to you. ", "There will come a time when we can and will tell you everything. ", "Right now Bobby needs your trust and support so he can continue chasing down this lead. ", "We can't do anything if we think it will put you at further risk. ", "Helping to minimize that by being vigilant and careful will help move us forward.\" ", "Piper spoke in a steady, unemotional tone. ", "She may have shed tears when she learned of Stan's betrayal, but in this moment she would need to be the strong person in the room.", "\n\nJules crumpled forward and covered her face with her hands as she sobbed. \"", "I'm sorry,\" she said through her tears, \"I didn't know it was about Daddy, I didn't know.\" ", "Piper felt herself beginning to sweat. ", "She could handle a lot of things but when people got emotional she immediately felt unprepared to help them. ", "Luckily Bobby seemed more than equipped. ", "He crossed the room and crouched in front of Jules, trying to convince her to stop crying.", "\n\nBetty sat silently for a few minutes, stoic in expression and posture. ", "Finally, she said in her no-nonsense, straightforward manner, \"Bobby, you cannot trust anyone. ", "There is no one on that force, young or old, who I would reach out to. ", "I know someone there betrayed Stan, and I've carried that with me all these years. ", "Don't go on this quest for me, or for Jules. ", "I don't think there is a soul in this town who you could talk to who wouldn't double-cross you.\" ", "Betty's bravado faltered as she practically whispered, \"You'll end up like Stan.\" ", "She stifled a small sob as she said her husband's name. \"", "I know that I've been hoping for answers for years, but I don't want them at your expense. ", "You believe there is good in everyone. ", "You believe the system works the way it should, but it doesn't. ", "If you're planning on turning over whatever you've found and betting on the fact that you can rely on one of the good guys, then please don't do it. ", "Please let it go.\" ", "Betty clasped her hands together as she begged Bobby.", "\n\nPiper was quick to reassure her. \"", "We already have that covered Betty. ", "We have no intention of using the customary channels. ", "You said that you trust Bobby, so you should know he's thought through every angle of this. ", "We need to know you both will keep this to yourselves as it all unfolds. ", "Know that as soon as we can share more with you, we will.\"", "\n\nPiper leaned over on the couch and put her hand on Betty's shoulder. ", "She couldn't imagine how overwhelming this would be for them to hear after such a long time.", "\n\n\"We won't say anything,\" Jules trembled, trying to gather herself. \"", "You figure out who the hell killed my father, and make sure they pay for it. ", "I don't care how, as long as you guys stay safe doing it.\"", "\n\nBobby turned back to Piper with grateful eyes. ", "She had revealed enough to gain their buy-in but not so much that they might compromise their effort. ", "It was exactly what he had hoped to do. ", "He was glad Piper was there to pick up where he had faltered.", "\n\nBobby brushed Jules's wispy red hair away from her wet eyes and kissed her forehead before moving back to his chair. \"", "I know you've been talking about staying here for a bit while Scott looks for a new place. ", "I think you should start tonight. ", "Having you both in one spot will be better. ", "Betty, do you still have Stan's old pistol and hunting rifle?\"", "\n\n\"You bet your ass I do. ", "And I certainly haven't forgotten how to use them either.\" ", "Betty folded her arms across her chest in defiance. \"", "Part of me actually hopes someone comes around causing trouble, because I'd be as happy as a dead pig in the sunshine to shoot down the people who killed my husband.\"", "\n\nPiper smirked as she tried to wrap her mind around that odd statement. ", "Were dead pigs happiest when sitting in the sun, she wondered?", "\n\n\"Betty, I can't have you smacking a diner patron over the head with a frying pan because you think he's involved in this,\" Bobby said, raising an eyebrow at her. \"", "I know it's frustrating that I'm not sharing more of the details with you, but I promise the people involved in Stan's death will pay for it.\" ", "Bobby stood up and headed for the door of the sitting room. \"", "Betty, why don't you take Jules upstairs and relax for a while? ", "The best thing you can do is lay low, be alert, and try to keep your emotions in check.\"", "\n\nBobby nodded toward Piper, indicating she should follow him out. ", "They headed for the porch, one of her favorite places to be with Bobby. ", "Tonight, however, it felt different. \"", "That didn't go like I planned,\" he said, rubbing at the stress that had gathered in his temples. ", "He flopped down onto the swing, and Piper took her seat beside him. ", "In spite of all of this, there was still something comforting about swinging with Bobby.", "\n\n\"I know. ", "I was probably out of line back there. ", "Maybe I over shared, but it felt like the right thing to do. ", "Without her buy-in, Jules never would have taken the conversation seriously. ", "I thought that was most important.\" ", "Piper had hoped Bobby would agree. ", "She knew she had taken a big risk.", "\n\n\"You're right, we were losing her, and she needs to understand how serious this is. ", "I wanted to keep them clear of everything until the wheels were in motion, but I think you made the right choice. ", "I'm glad you were here. ", "We make a great team.\" ", "He sent Piper a half-hearted smile, he wanted to be happy but what lay before them seemed too daunting. \"", "I do, however, think that we need some more help. ", "We can't possibly focus our efforts on your plan and protect Jules and Betty at the same time. ", "We'd be stretched too thin, and both of those tasks are going to require an enormous amount of coordination and time. ", "We need a third person.\" ", "Bobby crossed his legs and lounged back on the swing. ", "Being back in this peaceful moment with Piper wasn't enough to remove the stress of the things to come, but it certainly took the rough edges off it. ", "He figured if he had to be knee-deep in a shitty situation at least he was there with a beautiful woman.", "\n\n\"I'm not sure that's a good idea. ", "We have no clue who we can trust on the force, and the more people we involve the more likely we are to expose ourselves. ", "The whole key to this is complete anonymity. ", "I'm just a girl working for the cable company with no ties to any of these players. ", "When all this goes down and people start digging, they won't even know I exist, let alone that I'd have a motive or means by which to play a part. ", "That means I should be doing all the leg work, and you should be focused on Jules and Betty.\" ", "Piper knew she was overestimating her abilities and oversimplifying the risk, but if she didn't believe she could do it, then who would?", "\n\n\"What about Michael? ", "Is he someone you think we can trust?\" ", "Bobby left the question hanging there between them. ", "He didn't try to argue why he thought Michael could be trusted; he wanted to hear Piper's opinion.", "\n\n\"I trust Michael. ", "He's a good friend and through his work I've come to believe he's a principled and reliable man. ", "The problem is he thinks this type of thing is a disservice to the greater good. ", "He's had ample opportunity to take on situations like this in his career, and I think he's turned a blind eye because he believes doing his job is his best bet for holding people accountable. ", "I don't think he'd be interested even if we talked to him, but I don't doubt he could be trusted,\" Piper said, pulling her sweater closed as a small chill overtook her body. ", "The nights had finally started to cool. ", "That didn't matter though, because even if it were snowing, which it rarely did in North Carolina, she'd still stay out as long as she could, swinging with Bobby.", "\n\nThere was something sexy in the rhythm of his legs while rocking them both along. ", "She rarely let her own feet hit the ground while they sat. ", "She would kick off her shoes and curl her legs up close to her body. ", "She liked that he did all the work, that he didn't mind keeping them both moving. ", "It reminded her that Bobby was the kind of man who would gladly carry the heavier load when you needed him. ", "You could fall—eyes closed, arms open—and know he'd be there every time to catch you. ", "He'd keep the swing moving, he'd drive the truck, and he'd agree to help you carry out the most outrageous plan even though it went against his instincts. ", "Piper recalled Jules's wise words from months earlier. ", "Bobby was the kind of man you make room for in your life.", "\n\n\"Here,\" Bobby said, standing up and shaking himself out of his uniform jacket. \"", "My adrenaline is pumping so much I don't need it.\" ", "Piper leaned forward and Bobby wrapped his coat around her shoulders. ", "The way the jacket completely enveloped her made her feel instantly warm and comfortable and seemed like the perfect metaphor for how this house and everyone in it was making her feel. ", "She had no idea how this would play out, but she knew for certain when it was all over she wanted to be sitting right here with all of them.", "\n\nBobby smiled at the sight of Piper cuddled under his coat. ", "He let his mind wander for a moment to the idea of her wearing only his coat, or maybe one of his shirts, waking up at his place. ", "But he cleared his mind and throat as he continued on. \"", "I think Michael would help if we asked him. ", "I had a good read on him that night outside the bar, and I know you're not going to like this, but I've had a few conversations with him since. ", "He actually called me on Wednesday. ", "I was pulling in here for dinner, and he caught me off guard. ", "I thought something may have happened to you. ", "He wanted to let me know you seemed to be cooling off a little bit and you hadn't been on a date with a single Donavan since I had seen you last. ", "He told me that if I really cared about you it was time to get over myself and call you. ", "He warned me if I didn't make my move he couldn't continue to keep you from falling in love with him. ", "He said it was a lot of work and he was getting tired of your constant advances.\" ", "Bobby couldn't hold back his laugh as he recounted the conversation with Michael. \"", "I think if we ask him, he'll help. ", "I think it's the kind of guy he is. ", "I also may have done a background check on him after I met him that first time.\" ", "Bobby saw Piper's eyes narrow. \"", "Don't give me that look. ", "If you had access, you'd be running checks on everyone.\"", "\n\nBobby knew Piper didn't particularly like the idea of vetting everyone he met to ensure untainted reputations, but it was one of the very few perks of his job, and he found it necessary at times.", "\n\n\"He spent four years in the Marines. ", "He was a sniper and had some time deployed. ", "That's how he paid for law school, the G.I. Bill. ", "He was honorably discharged and has a spotless record. ", "His parents live back in Ohio, and his sister attends college at Ohio State. ", "He doesn't have any extended family that he talks with regularly. ", "It seems like all he does is work and go to the gym. ", "We should reach out to him and give him a chance to meet Jules and Betty. ", "I think we should have him over for dinner tomorrow night.\"", "\n\nPiper laughed and rolled her eyes. \"", "You mean you think he should have a chance to see Jules prior to asking him to play hero because he'll be blinded by her charm and beauty. ", "He'll have no choice but to agree once he knows there is an actual damsel in distress. ", "You are a wise but manipulative man, Bobby. ", "I find your conniving side very attractive.\" ", "Piper winked at him playfully and dug her elbow into his side.", "\n\n\"I only use my powers for good. ", "I think this is the right move, but even if we get Michael on-board we still have a lot to work on. ", "Our framework is solid, but there is going to be no shortage of details to be figured out. ", "First, we need to make sure Jules and Betty are safe.\" ", "Bobby put his arm around Piper and pulled her close to him. ", "She felt so good under his arm, up against his body. ", "He wanted her badly, but it wasn't blind lust pulsing between them. ", "Piper already felt like a part of him, as vital as his lungs, as familiar as his own hands. ", "It scared him to realize how deeply connected to her he felt. ", "He rested his chin on the top of her head and spoke quietly, \"This isn't at all what I pictured making up with you would be like. ", "I hoped we'd be sitting here, and I hoped you'd be pressed up against me wearing my coat, but...\" Bobby stopped and Piper worried that he was overwhelmed by what lay before them.", "\n\n\"But what?\" ", "she asked, afraid to hear the answer. ", "She thought maybe Bobby was feeling that reuniting with her was more trouble than it was worth.", "\n\n\"I guess when I pictured this I didn't expect it to be so...\" he paused again, and Piper tried to prepare herself for his words, mentally filling in the blank. ", "Convoluted? ", "Problematic? ", "She held her breath bracing herself. ", "Then finally he spoke. \"", "Cold,\" he said, squeezing her tightly. \"", "Shit it's freezing out here, give me back my coat.\" ", "The two wrestled for a moment as Bobby pretended to struggle for his coat and instead tickled her relentlessly.", "\n\nShe quietly squealed and pleaded for him to stop, not wanting to disturb the others. ", "When he finally let up, Piper was out of breath and her hair was tousled and unruly. ", "Bobby effortlessly pulled her onto his lap as she tried to get her wild hair away from her face. ", "He had never had to work so hard to not kiss someone before. \"", "We're going to get through this, and when we do I intend to ask you some serious questions about us.\"", "\n\n\"Let's get through the next couple weeks alive, and then we'll see.\" ", "Piper rested her head against Bobby's shoulder, letting her face come dangerously close to his neck. ", "He felt her breath dancing on his skin and although his body was screaming to kiss her, his mind quieted the desires. ", "There would be a moment, not long in the future, when becoming clouded and completely overtaken with passion would be the most important thing on his to-do list. ", "Right now he knew it would have to wait.", "\n\n# Chapter 17\n\n\"Let me get this right,\" Jules said, standing in front of the mirror in Betty's upstairs bathroom and adjusting the curlers in her hair. ", "To Piper, she looked a little like a space alien, but Jules assured her the time she spent putting the curlers in would amount to loads of extra volume in her hair, which was apparently a big deal. \"", "I'm supposed to hit on this guy so he decides he wants to help our cause here. ", "We're whoring me out?\"", "\n\n\"No, don't think of it like that,\" Bobby said, as he sat on the edge of the tub, flashing his most charming smile. \"", "I'm saying that it would help tremendously if you and Michael hit it off. ", "If he decides to help, then you'll be spending a bit of time together, so making a good impression tonight would be to your advantage. ", "I would hardly call that whoring you out. ", "But out of curiosity, how far are you willing to go? ", "You know, for the good of our cause. ", "A little late night make-out session? ", "Third base?\" ", "Piper leaned over from her seat on a small bench by the sink and smacked Bobby's arm.", "\n\n\"Very funny. ", "Fine, I'll be nice, but I'm not making any promises. ", "For goodness sake the ink on my annulment papers is barely dry.\" ", "Jules applied her ruby red lipstick and pressed her silky lips together. ", "Piper was still adjusting to the fact Jules and Bobby had the type of relationship that would have them all sitting around the bathroom, Jules fresh from the shower and wrapped only in a towel.", "\n\n\"Hurry up then. ", "He'll be here any minute. ", "We're going downstairs to make sure Betty doesn't scare him off before we have a chance to get him in the door,\" Bobby said, grabbing Piper's hand and pulling her off the bench and out of the bathroom. \"", "So what did you say to Michael when you invited him over?\" ", "he asked Piper.", "\n\n\"I said that I was having dinner with some friends of mine, and I'd like it if he could come. ", "I told him you'd be here, and that it would be nice if the two of you to got to know each other better. ", "I also told him there was this incredibly beautiful redhead I wanted him to meet. ", "I think he might be under the impression we're going to a restaurant, or out for drinks. ", "It might be a bit of a shock to know we're having pot roast and then plan on hanging out on a porch. ", "The good news, however, is there was a motion for an extension by the defense in the case he was working on. ", "He's got at least two weeks with very little to do now. ", "This case is a big one, so he's been focusing on it almost exclusively. ", "He has all his legwork for the trial finished. ", "He'll just be in a holding pattern until the defense is ready or the judge gets tired of their stalling. ", "He's going to have some time on his hands.\"", "\n\nPiper watched as Bobby hopped down the stairs and tapped the wooden beam above his head with his hand. ", "It was something he seemed to do without any thought, a comforting habit formed out of hundreds of times up and down those stairs.", "\n\n\"That's good news as long as the idea of an 'at home country dinner' doesn't send him running for the hills. ", "I hope we can pull this off. ", "Without him I'm not sure how we move forward.\" ", "Bobby headed for the porch as Michael's sleek black car pulled into the dirt driveway. \"", "He's here,\" he called into the house, letting Jules know to hurry up.", "\n\nAs Michael stepped out of his car, Piper cringed at the sight of his tailored dress shirt and black slacks. ", "His shoes, probably worth hundreds of dollars, were instantly covered with dust as he walked up the dry, overgrown walkway to the porch. ", "Perhaps dinner out, in the environment to which Michael was more accustomed, would have been a better choice.", "\n\nJules came thudding with heavy feet down the stairs and pressed herself against the screen door speaking only loud enough for Piper and Bobby to hear.", "\n\n\"I changed my mind. ", "Put me down for at least third base. ", "How exactly did you fail to mention he could pass for a Swedish model and had buckets of money? ", "Don't those seem like things I would have wanted to know? ", "I can't wear this stupid sweater. ", "I'm going to go change.\" ", "Jules jumped back from the door and ran to her room for a more presentable outfit.", "\n\n\"Hey Michael,\" Piper said, waving guiltily at him. \"", "Thanks for making the drive out. ", "I know this is a little off the beaten path.\"", "\n\n\"That's no problem. ", "It's beautiful out here,\" said Michael, stepping onto the porch and extending a hand to Bobby.", "\n\nJust then, Betty burst from the screen door in her apron, a whisk still in one of her flour-covered hands. \"", "Welcome to my home. ", "I'm Betty, and you must be Michael. ", "I'm so happy to have you over for dinner tonight.\" ", "Piper winced. ", "The plan they had arranged was already going off course. ", "Piper and Bobby had hoped to meet Michael on the porch and apologetically ask him if he minded having dinner here at Betty's house. ", "Then they would tell him briefly about Betty and Jules, and ease him into the introduction. ", "Instead, Betty was in her normal position on the porch to greet any guest.", "\n\n\"It's a pleasure to meet you, Betty, and thank you for having me. ", "Is that pot roast I smell?\" ", "Michael was one of the smoothest people Piper had ever met, able to morph himself into any crowd and act perfectly comfortable.", "\n\n\"You have a keen nose, my boy. ", "Actually, by the looks of you, your nose probably isn't the only impressive thing you've got.\" ", "Betty eyed Michael and shook her head approvingly. \"", "It is pot roast with all the fixins and it's almost done. ", "Why don't you come on in and you kids relax in the sitting room while I finish up.\" ", "She shooed them all through the screen door, and Piper could feel sweat beginning to gather on the back of her neck.", "\n\nAs the three took a seat, Piper hoped someone would break the awkward silence that was beginning to choke her.", "\n\n\"Well, she's not a redhead and a bit older than I usually like my dates but she seems lovely. ", "This should shape up to be an interesting night,\" Michael said, forcing Bobby to laugh, even though he knew it would anger Piper, who was obviously tense. \"", "It might be a nice change actually. ", "The girl I just broke it off with was a little intense. ", "She didn't agree with my theory that when two people go for a long romantic walk together but only one of them knows about it, it's actually called stalking. ", "I guess my point is, beggars can't be choosers. ", "At least Betty doesn't seem the clingy type.\"", "\n\n\"No, Jules is upstairs still getting ready. ", "That's her mom. ", "Bobby grew up next door and they're all practically family. ", "We were thinking of going out to dinner but decided a nice meal here would be better. ", "If you're not comfortable though, I completely understand, and maybe the four of us can go for drinks somewhere instead.\" ", "Piper could feel her face glowing with hot embarrassment. ", "If Bobby didn't stop laughing he wouldn't have to worry about anyone else killing him because she'd do it right now.", "\n\n\"Are you nuts? ", "Do you know how long it's been since I've had a home-cooked meal? ", "I hate eating out, sitting at the bar with a bunch of morons from work. ", "This is going to be perfect. ", "I figure if Jules isn't my type, at least I know I've got Betty to fall back on.\" ", "Michael shrugged his shoulders and grinned at the sight of Bobby once again losing his composure and infuriating Piper.", "\n\n\"Hi,\" squeaked Jules as she entered the sitting room. \"", "I'm Jules, you must be Michael.\" ", "She extended her hand and Michael stood up to take it. \"", "We're sure glad you could join us tonight.\" ", "Piper took note of the softer southern drawl Jules had seemed to switch on. ", "The girl certainly knew how to be sexy, from her low-cut plum sweater to the soft flutter of her perfectly shadowed eyelids.", "\n\n\"I was just telling Piper and Bobby how happy I am to be here. ", "It's been far too long since I've had a home-cooked meal around a real table with such beautiful women.\" ", "Michael indicated for Jules to join him on the loveseat and waited, in true gentleman fashion, for her to sit first.", "\n\n\"So Michael, you're a lawyer. ", "Are you a bleeding heart or an ambulance chaser?\" ", "Jules asked matter-of-factly, shocking everyone in the room. \"", "What?\" ", "she asked, responding to the stunned looks she was receiving. \"", "I see lawyers every day and to me, they all fall into one of those two categories. ", "They're either out for money at any cost, or they're in it because they think they can change the world.\"", "\n\n\"I guess that's actually pretty right on,\" responded Michael. \"", "I'd prefer to think I'm in the bleeding-heart category. ", "I take some pro bono cases. ", "Can I ask where you get this large sampling of lawyers?\"", "\n\n\"I work at the town hall, and I set them all up in the records department. ", "Mostly I point them in the right direction and then cleanup after them,\" she said, rolling her eyes at the thought of the inconsiderateness of most people she dealt with on a day-to-day basis.", "\n\n\"Oh, you're the town hall girl?\" ", "Michael asked slapping his knee and lighting up with recognition. \"", "My clerks literally arm wrestle to see which of them will be going to the records department just so they can drool over you. ", "I have to admit I can see why.\"", "\n\n\"They call me the town hall girl? ", "That's pretty condescending don't you think?\" ", "Jules let her southern self-righteousness start to flare, and Piper cleared her throat in an effort to remind Jules of the purpose of this meeting.", "\n\n\"You've been called much worse,\" Bobby chimed in with a victorious smile. \"", "Remember what they used to call you in middle school?\"", "\n\n\"Shut your ugly mouth, Bobby Wright, or I'll tell Piper some of the most embarrassing things I know about you. ", "Don't think I'm above it, you know I'm not.\" ", "Jules pointed her finger at Bobby threateningly.", "\n\n\"Truce,\" Bobby shouted, not quite ready for Piper to hear about how he got stuck in a compromising position while trying to climb the Larson's chain-link fence, or how he burped accidently while playing spin the bottle with Stacy Parmer from down the road.", "\n\n\"It's ready,\" called Betty in her singsong voice as she carried a large tray of food past them and into the dining room.", "\n\nAs they all took their seats, Betty smiled with delight at the group gathered around her table. \"", "Thank you, Jesus, for this wonderful company. ", "Thank you for bringing Piper back to our table and for Michael joining us tonight.\"", "\n\n\"Amen to that,\" Bobby said, squeezing Piper's leg below the table. \"", "Now pass the potatoes, I'm starving.\" ", "By the look on Michael's face, if he wasn't completely won over by Jules's beauty then he might agree to help in order to get more of Betty's food.", "\n\nThe dinner was full of cordial conversation. ", "Jules seemed to refocus her energy back on wooing Michael, and by all accounts, it seemed to be working. ", "It was all going smoothly until, once again, Betty went off-script after dessert.", "\n\n\"Michael, I can't thank you enough for agreeing to be a part of all this. ", "When I lost my husband, Stan, I thought I'd never be able to go on with my life. ", "It devastated Jules and me beyond belief. ", "These last ten years have been brimming over with regret and questions. ", "When Piper and Bobby told me what they were going to do, it renewed my soul. ", "I feel like Stan is sitting right here with us. ", "I'd have to make you a thousand meals to ever come close to thanking you for your part in it.\" ", "Betty folded her hands together and put them over her heart, looking sincerely around the table.", "\n\n\"It's my pleasure, Betty. ", "I can't imagine what you've been through, and I'm so glad to hear that you're in the process of finding some peace,\" Michael said, smiling back at Betty and, much to Piper's amazement, not skipping a beat.", "\n\n\"Well I'm going to clear these dishes. ", "Why don't y'all go sit on the porch and enjoy this beautiful night. ", "Bobby, put some logs on the firepit out there so y'all don't freeze.\" ", "Betty stood and filled her hands with dishes before disappearing into the next room.", "\n\n\"Jules, will you do me a favor and help your mom clear? ", "I'm going to chat with Piper and Michael outside for a bit.\" ", "Bobby spoke through his teeth and glared at Jules indicating she had better do what he asked.", "\n\n\"It does sound like we have a bit to chat about, now doesn't it?\" ", "Michael quipped, standing up with an awkward smile on his face.", "\n\nThe three moved onto the porch, all searching for an appropriate starting point for the conversation. ", "Since Piper felt the most amount of responsibility for the three of them being there, she worked up the courage to speak first. \"", "That wasn't exactly how we planned to ask you for your help. ", "I'm sure you have a lot of questions, and I appreciate your not venting any frustration in front of Betty. ", "She means well.\"", "\n\n\"I guess I'm wondering what all that was about. ", "I think both Betty and Jules are lovely, and being here tonight was great. ", "Right up until the speech about the endless gratitude, I thought things were going pretty well.\" ", "Michael scratched at his head and looked perplexed.", "\n\nBobby thought he'd take a crack at an explanation. \"", "I think you had a good idea of what Piper was doing when she was digging for information on Judge Lions and the Donavans. ", "I know that when you and I spoke we decided that the best thing to do was try to talk her out of pushing it any further. ", "Unfortunately, we didn't do a great job, and at some point information came to light that made all of this very personal for me, for everyone in this house actually. ", "The judge is far more corrupt than we could have imagined, and Piper discovered that he and a cop currently on the force were responsible for Stan's death. ", "Stan was like a father to me, and I watched his death destroy Betty and Jules. ", "We have an opportunity to step in and seek some justice. ", "The problem is, while Piper and I are out doing that, we have an enormous amount of liability here, and we need another person ensuring Jules and Betty are safe.\" ", "Bobby had his back to Michael as he stuffed two more logs into the clay firepit that sat on the corner of the porch. ", "It seemed easier than looking him in the eye and explaining their plan.", "\n\nMichael looked back and forth between Piper and Bobby. ", "He half expected them both to start laughing and reveal this all to be an after-dinner joke they had orchestrated for the newest guest at the table.", "\n\n\"Guys, I'm really hoping this is some kind of a prank you're playing on me. ", "I'm hoping if you had evidence that the judge and a cop were involved in a murder, you wouldn't take it upon yourselves to seek retribution. ", "You'd turn whatever you had over to the authorities and let the cards fall where they may.\" ", "Michael was stern in his tone and now boring holes through Piper with his icy stare.", "\n\n\"They _are_ the authorities, Michael,\" Piper said firmly. \"", "We have no idea who we can trust anymore. ", "Bobby almost got himself in too deep by going to a cop he thought was one of the most reputable and honorable guys he knew, and it turns out his hands are as dirty as they get. ", "I trust you, and I know you wouldn't want anything to happen to these women. ", "It's impossible to not adore them once you spend a little time in their company. ", "I know with your case being continued you have some time on your hands. ", "Couldn't you just spend it here? ", "Maybe give them a ride to work every now and then, hang out in the records department while Jules is there?\"", "\n\nMichael was quiet as he stood up and leaned against the porch railing looking out into the night. ", "He had to admit, Piper was right about one thing. ", "Sitting around a table with kind, down-to-earth people had certainly felt nice. ", "But so did minding your own damn business and protecting your job and your life.", "\n\n\"It's fine, Michael, if you don't want to get involved. ", "I completely understand. ", "This was a long shot, a lot to ask. ", "Let's just call this a nice evening with great people and nothing more,\" Piper spoke quietly, afraid Michael might be on the verge of an emotional explosion. ", "Luckily she didn't need to be loud out here where the whole world was placid. ", "There were no car horns or bustling streets to contend with.", "\n\nMichael couldn't believe what he was about to say, damn his chivalry. \"", "I think you know me well enough to realize I'm not one to walk away from a lost cause, and, as far as I can tell, that's what the two of you are. ", "I won't sit here and play babysitter while you go off trying to right some old wrongs and get yourselves killed. ", "If you want my help, then I want the details. ", "I want to know who the players are and what you plan to do. ", "I have a skill set that can benefit you both greatly, but I'm not going to give my blind support. ", "Either fill me in, or count me out.\"", "\n\nHe turned back toward the two and realized how far over their heads they were. ", "If he did walk away now and something happened to any of them, he'd never forgive himself.", "\n\nPiper and Bobby looked at each other and seemed to share a telepathic conversation about the pros and cons of fully informing Michael. ", "There were certainly things he may be able to help with outside of what they originally considered, and if they were willing to trust him with Jules and Betty there shouldn't be anything holding them back.", "\n\n\"Fine,\" Piper said begrudgingly. \"", "But Jules and Betty don't know the details yet. ", "No one outside the three of us can know. ", "We're still at the beginning stages of planning, so don't jump down my throat if you don't like something you hear.\" ", "She raised an eyebrow at Michael and continued without his even agreeing to her terms.", "\n\n\"The judge is—and has been—corrupt for some time. ", "We know at least one police officer works closely with him to ensure the necessary outcomes on cases that provide them both with a large payoff. ", "His name is Officer Rylie. ", "I overheard a meeting between the two of them when they admitted to murdering Betty's husband, Stan. ", "Also, they planned to threaten or harm Jules and Betty if they couldn't get Bobby to back off about some photos he had taken of the judge. ", "You see, the judge has an affinity for underage prostitutes and uses his alliance with Christian Donavan to feed his addiction. ", "The only reason the judge is so well protected and why going to the authorities isn't an option is because Christian and his people need the judge right where he is in order to continue their illegal ventures and avoid prosecution.\" ", "She was leaving next to no room for him to interject as she spoke.", "\n\n\"Anyone bringing forth evidence on the judge or Rylie would be silenced in one way or another in order to keep the judge in his position. ", "So my idea was to sever the ties between Christian and the judge, rendering him unprotected and vulnerable.\" ", "Piper pulled a notebook from her purse, looking over her notes.", "\n\n\"How exactly do you plan to eliminate a mutually beneficial alliance that is held together by unlimited knowledge of the others' criminal exploits? ", "Christian is not going to flip on the judge. ", "In these circles, you're better off being anything besides a rat.\" ", "Michael's demeanor was still blustery with doubt.", "\n\n\"Unfortunately, I have my share of knowledge about criminals and their inner workings. ", "There is one thing worse than being a rat, and that's being a pedophile. ", "You see, Christian has a young son who he fiercely protects. ", "If evidence was brought to Christian's attention that suggested the judge has an unhealthy attraction to young boys, and then he's led to believe that his son is on the judge's radar, he would certainly take exception to that.\" ", "Piper could feel her confidence grow as she spoke of this plan out loud for the second time.", "\n\nMichael unfolded his arms from his chest and looked as though he had just taken a blow to the gut. \"", "He'll kill him; Christian will kill the judge.\"", "\n\nBobby stood up and threw his hands in the air. \"", "That's what I said. ", "She seems perfectly fine with that and all the possible repercussions that could come from it. ", "I, however, am racking my brain looking for some alternative solution. ", "She thinks we set up the evidence and then track Christian until he makes his move to kill the judge. ", "We let him and ensure there's enough evidence to charge Christian for the murder. ", "We use our evidence as leverage to get him to turn on Rylie in exchange for a reduced sentence. ", "This, in theory, eliminates all three men and serves as some kind of justice. ", "I, for one, am not ready to have that blood on my hands. ", "There has to be another way.\"", "\n\nMichael shook his head, still in awe of what had been laid out in front of him. \"", "You came up with this entire thing, Piper? ", "I have to say, it's kind of genius and, frankly, very scary. ", "I don't know your history, but it's got to be pretty twisted if you can work up a plan like that. ", "It can't go down like that though. ", "Planting evidence is one thing, but if it results in a murder we could all become accessories. ", "There has to be a way we can accomplish the same thing and keep our hands cleaner. ", "I need some time to think about it, but I'll admit you have the start of a plan here. ", "I'll look at this from a legal perspective and try to limit all of our liability, but, first and foremost, no one can be murdered.\"", "\n\nPiper had assumed this would be Michael's position on this point, but she was still holding firm. \"", "Come up with something equally effective, and I'll go along with it, but if no one can offer any alternatives then the plan is going to move forward as is, and I'll understand if you guys don't want to be a part of it. ", "I started this for my own reasons, and I'm prepared to follow through, even if that means I have to do it alone. ", "Now, our next step is to come up with a schedule that has someone with Jules and Betty at all times. ", "I've written down Bobby's and my schedule and where the biggest gaps are. ", "Since you are going to have free time, take a look at it and let me know where you can help. ", "Now, obviously, Bobby, you are armed. ", "Michael, Betty has a handgun and a rifle here at the house. ", "There is a chance we've completely minimized the threat because Bobby let Rylie know he doesn't have any interest in the judge anymore. ", "We're just not sure the judge buys it, so we need to take precautions.\" ", "Piper handed the notebook over to Michael, and he sighed as he looked at all the time he'd be spending watching after the women.", "\n\n\"How do you know I'm even capable of handling a weapon?\" ", "Michael furrowed his brow and started making note of what days and time he could be available.", "\n\n\"Colombo over here did a background check on you and saw you were in the Marines. ", "Don't feel too violated or special, though, he does checks on everyone.\" ", "Piper smirked up at Bobby who didn't seem to find his nickname all that funny.", "\n\n\"And how about you, do you have a weapon or any idea how to fire one? ", "I get that you're the mastermind of all this, but you still need to protect yourself.\" ", "Michael tossed the notebook back at Piper, and it bounced off her knees and hit the floor. ", "She winced and rubbed the pain away. ", "Michael rolled his eyes. \"", "We can cross off high threshold for pain and cat-like reflexes from your list of talents.\"", "\n\n\"I'm going to take her out in the woods behind here tomorrow and give her a crash course. ", "I have a small personal handgun I'm going to let her use,\" Bobby said, lowering his voice as he heard Betty and Jules approaching. \"", "So we're good here, you're on board?\"", "\n\n\"Reluctantly, yes. ", "I'm in,\" Michael sighed. \"", "But no one gets killed, and I get dibs on the redhead.\"", "\n\n# Chapter 18\n\nIn only three days Betty's sitting room had been converted to a war room. ", "Michael had brought in a large whiteboard to map out their strategy. ", "With many apologies to Betty he removed all the small porcelain clown figurines from the corner of the room in order to hang the board. ", "In reality he could have worked around them, but they were by far the creepiest little things he had ever seen. ", "He felt like their eyes were constantly on him. ", "The couch and love seat had become makeshift beds for whoever was tasked with keeping Betty and Jules company for the evening.", "\n\nPiper had done surprisingly well at target practice with Bobby out in the woods and she found herself feeling quite emboldened by the presence of the .22 magnum mini revolver in her purse. ", "It had also been nice to feel Bobby pressed up against her back as he steadied her hands and showed her the correct stance for firing a weapon. ", "She could have stayed like that all day, with his chin just above her ear, his arms wrapped around her, and his hands covering hers.", "\n\nBecause it had been decided that keeping the names of the judge and Rylie from Betty and Jules would be important, in order to prevent them from prematurely lashing out at the men, code names were created. ", "The judge would be called Porky, for his uncanny resemblance to the cartoon character. ", "Christian would be called Rico due to his constant violation of the Racketeering Influenced and Corrupt Organizations Act. ", "Piper named Rylie \"Eppolito.\" ", "She realized it didn't exactly roll off the tongue, but it was fitting. ", "Louis Eppolito was one of the most notoriously corrupt police officers in history. ", "He had worked for the NYPD on paper, but in reality, took his orders from a prominent crime family. ", "He was eventually convicted of racketeering, obstruction of justice, extortion and eight counts of murder and conspiracy. ", "Piper liked that outcome and thought the name could be a good omen.", "\n\nFor some reason, Michael insisted they all needed aliases as well. ", "Much to Bobby's disappointment, the name Colombo, which Piper had used to mock him, had stuck. ", "Michael decided he'd like to be called Finch, for Atticus Finch. ", "That character had been the reason he had become a lawyer in the first place. ", "Betty was dubbed The Queen, which seemed to suit her. ", "Michael decided Jules should be Princess since it seemed to infuriate her and flatter her all at once. ", "He adored the way her eyes narrowed into a glare failing in her attempt to fight off a smile.", "\n\nPiper shot down every nickname they had pitched so they had just begun calling her Captain. ", "It was all a bit too hokey for Piper, and, frankly, hard to keep up with. ", "She decided that placating Michael's desire to make this endeavor more like an espionage movie was a small price to pay for his help.", "\n\n\"So here are the pictures of Chris at school,\" Piper said, handing an envelope over to Bobby. \"", "I also took a tour of the school and his classroom, telling them I had a younger sister who was considering attending. ", "I managed to collect a lot of additional information, but I'm not sure how we can integrate it with the pictures. ", "I know his favorite television show is something called The Idiot Squad, which sounds like good quality programming. ", "His two best friends are Tristan and Corwin, which I didn't realize were even names. ", "He listens to a band called The Stabbing Mothers and seems to enjoy trading these weird cards with monsters on them. ", "So to sum up my findings, if the fate of humanity rests on the shoulders of this generation then we're all screwed.\"", "\n\n\"I love The Idiot Squad. ", "You sound like an old lady, shaking her fists at the kids walking on her lawn,\" Bobby said, pulling the pictures out of the envelope and looking them over.", "\n\n\"You belong in The Idiot Squad,\" Piper said, throwing a nearby magazine in his direction, intentionally missing. \"", "I still think it should be incorporated into the evidence we plant if possible. ", "It makes it more authentic and personal. ", "Maybe we can write some notes on the back of some of the pictures,\" Piper said, ripping out the page of her notebook and handing it over to Bobby, who flinched as though she was on the verge of slapping him.", "\n\n\"There's a chance that Rico would recognize Porky's handwriting. ", "We'd need to be able to match it close enough to be convincing. ", "I can get a sample from some court records and documents while I'm at town hall with Princess,\" Michael said making a note on the whiteboard.", "\n\n\"Do we really need to keep using these nicknames? ", "I keep forgetting who is who,\" Piper said, scratching her head with the back of her pen.", "\n\n\"Well if we want to be able to walk down the street and have a conversation about it, or we truly want to keep Jules and Betty from knowing the players then yes, Captain, we do need the nicknames. ", "I'm pretty sure if Betty knew that she was serving eggs to the man who killed her husband every morning she'd be plunging a butter knife into his temple tomorrow.\" ", "Michael was right, but Piper had a feeling deep down there was an element to these codenames that was more about how cool they were than how necessary.", "\n\n\"All right Finch,\" Piper said, throwing her arms up in surrender. \"", "I can forge Porky's handwriting on the back of the pictures. ", "I made a decent profit writing excuse notes in high school for anyone willing to pay. ", "Get me a sample, and I'll get this packet all ready to plant in Porky's house.\"", "\n\n\"Have we figured out how and when that's going to go down yet?\" ", "asked Bobby, sitting up in his seat ready to get down to business.", "\n\n\"The judge is a big fan of boxing. ", "There is a boxing thing on Saturday. ", "I'm thinking if I cut the cable Friday afternoon they'll be anxious to have it fixed in time and call in for an urgent repair.\" ", "Piper assumed her forethought regarding the timing would earn her some accolades, but she was finding this was a cynical group of relentless clowns who were always looking for the next punch line. ", "Jules was very similar, and when the four of them were together it was a parade of one-liners and zings.", "\n\n\"A boxing thing?\" ", "Bobby exclaimed incredulously with one eyebrow raised. \"", "Saturday is one of the biggest boxing matches of the _decade_. ", "Oliver Johnson and London Travis are two of the greatest fighters we've seen in years, and this is the first time they meet in the ring. ", "I swear if you weren't pretty you'd be tough to like.\"", "\n\n\"Shut up Bobby. ", "I don't think two guys beating each other senseless and suffering lifelong repercussions should be considered a sport. ", "The fact that you enjoy it is very telling. ", "You're such a caveman.\" ", "Piper rolled her eyes and decided to turn her back to Bobby and speak only to Michael. \"", "I'm going to bring this envelope in the house and plant it somewhere it wouldn't be stumbled upon accidently before Christian is made aware of it. ", "I'm thinking we need to get the wife out of the house for a bit, and I have an idea I know neither of you will like. ", "I'm very aware of why we want to keep Jules at a distance from this. ", "However, I think this is the only viable option. ", "The judge and his wife head a non-profit organization called Legal Buddies. ", "It's a program that pairs children who have been exposed to the system—either through their own crimes or their parents'—with a mentor. ", "They learn to have a positive appreciation for the legal system rather than distrust.\"", "\n\nMichael cut in, unable to contain his clever snipe. \"", "Sounds like a program that would have benefited you, my contemptuous little vigilante.\"", "\n\nPiper tossed her head back in exasperation. \"", "I honestly have no idea what to do with you two. ", "You're both so hilarious I'm not sure how we'll get through all this before your comedy careers take off. ", "As I was saying, the program is a non-profit that would have filed all its paperwork down at town hall. ", "We can get Jules to contact the wife and say they're expecting an audit and some paperwork is missing that has to be corrected immediately. ", "If not, the status of the charity would be at risk. ", "Hopefully she'll find it urgent enough, and my presence innocent enough, to consider leaving me there to work. ", "I know this exposes us slightly with Jules, but I can't think of another way.\" ", "The joking nature of the room seemed to subside as both Michael and Bobby began to consider the details Piper had laid out.", "\n\n\"It certainly makes sense,\" said Michael. \"", "I think if Jules was able to create a sense of urgency and you were to tell Mrs. Porky that you weren't able to come back for the rest of the repair until Monday she'd most likely leave you there. ", "You'll need to be personable right out of the gate; she'll have to like you.\"", "\n\n\"Believe it or not, I'm very capable of being likable.\" ", "Piper turned back toward Bobby. \"", "What do you think? ", "I know you don't want them involved, but I can't think of any other way.\"", "\n\n\"I think you're right. ", "This would give you much needed time in the house alone and not raise suspicion down the road. ", "If Michael or I were to try to create a diversion, it would likely blow back on us. ", "I want to be the one to talk to Jules about it though.\" ", "Bobby's mischievous grin had faded and the seriousness of all they were trying to do had seemed to suck the air out of the room.", "\n\n\"I understand,\" Piper said, as she tried to fight off the very foreign feeling of jealousy that had begun to creep its way in over the last few days of watching Bobby and Jules. ", "Their connection was deeper than any Piper had witnessed in her life. ", "They had endless stories of their past and would tell them, barely coherent, through breathless laughter. ", "Piper tried to remind herself of the budding romance between Michael and Jules.", "\n\nIt was clear that Michael had caught Jules's eye and that she was vying for his attention, finding reasons to be next to him. ", "It was also clear that Michael was reciprocating the feeling. ", "Piper had seen them engaged in a late night kissing session out on the porch just yesterday. ", "They seemed to be getting along quite well.", "\n\nGiven the choice, which he frequently was, Bobby always tried to find ways to be with Piper. ", "But for them there had been no stolen kisses or holding of hands, as both had agreed that it would draw focus away from their mission. ", "It wasn't easy for Piper to keep her hands and her lips to herself. ", "When there was time to think about something other than the judge, her mind would drift to that night on her doorstep before everything got so convoluted, and the only thing that seemed to matter was Bobby kissing her goodnight.", "\n\nShe frequently caught Bobby looking her way, smiling, presumably lost in the same memory. ", "The knowledge of these things should have been enough to calm Piper's anxiety and jealousy. ", "Still, there were times she thought infringing on the bond that Jules and Bobby shared was a futile task.", "\n\nPiper continued letting the business at hand trump her feelings. \"", "Along with the pictures I'll also be planting some micro cameras to ensure that we can keep tabs on the evidence and who is aware of it and when. ", "I'll use this burn phone to contact Christian.\" ", "She saw the look of frustration on Michael's face as he huffed with annoyance. \"", "Sorry, I mean Rico,\" Piper corrected. \"", "Then once we know he's in possession of the photos we'll tail him until he makes his move. ", "I'm guessing it'll be pretty quick, since there will most likely be an enormous amount of emotion involved in all this. ", "I doubt he'll be doing anything but seeking some revenge.\"", "\n\n\"You're oversimplifying this a bit. ", "How exactly do you plan to tell him about the photos? ", "Don't you think he's going to have some questions? ", "It's not going to be quite as easy as making a quick phone call,\" Bobby chimed in. ", "He was concerned that on paper, they were heading in the right direction, but in reality things wouldn't go as smoothly.", "\n\n\"I've got that conversation under control. ", "I'm prepared for it. ", "What we're not prepared for is what happens when these two men are face to face. ", "I know you're both against any bloodshed here, but I haven't heard any other solutions. ", "We can't let that piece of the puzzle put the brakes on everything else. ", "We move forward on Friday.\" ", "Piper heard loud footsteps move above her and then down the stairs toward them. ", "She had learned to tell the difference between Betty's slow and quiet steps and Jules's quick and heavy gait. ", "For a small person the girl could certainly stomp around the house.", "\n\nLike every night before this, she was bored and frustrated to be cut out of the details like a child. ", "She came sulking into the sitting room and planted herself down next to Michael.", "\n\n\"Are you guys finished yet? ", "I'm tired of being grounded,\" Jules said, folding her arms obstinately across her chest.", "\n\nMichael wrapped his arm around her and pulled her into his side. \"", "Yes, we're done for tonight. ", "Sorry you have to wait around so much. ", "I know this isn't easy on you. ", "We're in the homestretch now. ", "There won't be many more nights like this.\"", "\n\nIt was so odd to see Michael comforting Jules. ", "Piper had grown so accustomed to his silly side that she hadn't realized how good he was at being serious, at being someone's rock. ", "He was a good man in a storm, and this was certainly turning out to be turbulent weather. ", "They had only come together a few days ago, yet they seemed to balance each other perfectly. ", "Jules was a bit dramatic and emotional while Michael was steady and logical. ", "Certainly, under different circumstances, they'd never grow so close so quickly, but something about this ordeal seemed to make it right to seek comfort in each other.", "\n\nJules had spent hours telling Michael about her father and what his death had done to her as well as how grateful she was for Michael's role in all of this. ", "It had made Michael's resolve and commitment to see the endeavor through even stronger.", "\n\nPiper turned toward Bobby, expecting to find him watching begrudgingly as his childhood companion sought solace in the arms of another man. ", "Instead, his eyes were fixed on Piper, and his look was one of deep longing. ", "He knew he didn't need the distraction, he didn't need to be clouded by his emotions for her, but it didn't mean he wasn't finding it near impossible not to hold her.", "\n\n# Chapter 19\n\nPiper took in a deep breath as she rang the doorbell outside the judge's house. ", "She could feel sweat gathering all over her body, and she reminded herself that everything hinged on the proper execution of the task at hand. ", "There were so many moving parts, so many things that had to fall into place. ", "She didn't pray often and didn't even believe that God would be supportive of what she was about to do, but she sent up a small silent prayer all the same.", "\n\nThe door pulled open and Mrs. Lions stood there smiling warmly. ", "Piper was slightly shocked by her beauty. ", "She assumed perhaps the exotic features she had seen from a distance would look more weathered up close and her age would show. ", "It was quite the opposite. ", "The judge's wife was stunningly pretty. ", "Her hair was silky black, and perfectly styled. ", "She wore a tracksuit made of luscious pink suede that hugged her fit body. ", "Her jewelry was simple and elegant, but her most attractive accessory seemed to be her confidence.", "\n\nThe smell of cinnamon poured from the house and filled Piper with a sense of temporary calm as the woman began to speak. \"", "I'm so glad you were able to come out so quickly,\" she gestured for Piper to come in. ", "The house was so warm, not in temperature, but in its welcoming feel. ", "Flickering candles filled the house with the scent of fall. ", "There was a plate of baked goods laid out on the kitchen counter next to a small plate, cloth napkin, and an empty glass. \"", "Please have a seat and enjoy a little refreshment first. ", "I know how hard you work all day, you deserve a little break.\" ", "She waved Piper over to the bar stool in the kitchen.", "\n\n\"Ma'am that is so kind of you. ", "Unfortunately my schedule today is really full, and I have some appointments I've already had to push back. ", "I should get right to work. ", "I want to make sure we get you up and running before the end of the day. ", "If not, you'll probably have to wait until Monday, and I don't want that to happen.\" ", "Piper kept running the word personable through her mind. ", "Michael had been successful in slightly psyching her out about her likability.", "\n\n\"I completely understand. ", "My husband will just die if I don't have this all sorted out tonight. ", "There is a boxing match this weekend, and we are expecting company. ", "I can't stand it, such unnecessary violence, but you know how it is, we do anything for our husbands.\" ", "She smiled big enough to show her perfect white teeth and, again, Piper couldn't understand how anyone could turn outside his marriage to such a beautiful woman.", "\n\nRight on cue, the chimes of Mrs. Lion's phone began to ring. \"", "The television is right through those doors. ", "I'll take this call and be right back with you.\" ", "She brought the phone to her ear and gave a cheerful greeting. ", "Piper wanted to listen in on the call to ensure it was going as planned but knew she should set up her tools and look thoroughly busy by the time the judge's wife rejoined her.", "\n\n\"Oh, you've already started?\" ", "she said as she came fluttering into the room where Piper had laid out numerous tools and rolls of unnecessary cable. \"", "I've got to run out for a few minutes and take care of some paperwork down at town hall, is it possible you can come back later on today?\"", "\n\n\"I'm sorry, we've got so many people anxious to get their cable working before the boxing match that we're a little flooded. ", "I think I have the problem figured out here. ", "I'll need about an hour to get it all squared away. ", "I guess if I hurry I could be out of here in forty-five minutes.\" ", "Piper knew if Jules had done her job then she had created an urgency Mrs. Lions would not be able to ignore. ", "If Jules had told the story properly then she would have relayed how an auditor was making his way through their files and it was imperative she arrive quickly to correct some missing paperwork.", "\n\n\"I really must go get this paperwork fixed. ", "I know I'm not supposed to, but can I leave you here for just a few minutes? ", "I won't be long at all.\" ", "Mrs. Lions was already pulling on her coat and searching for her keys.", "\n\n\"It is against the rules, but as long as you won't be too long I won't tell anyone. ", "I might need to access other televisions in the house; can you point them out quickly before you go?\" ", "Piper could feel the corners of her mouth tugging into a smile and she fought the urge to prematurely celebrate.", "\n\n\"Sure, there is another television here in the kitchen that folds down from under the cabinet, and one in the spare bedroom at the top of the stairs. ", "Around the corner here in my husband's office, but you can't go in there. ", "All the other rooms are fine but that room is off limits, I'm barely allowed in there,\" she laughed awkwardly. \"", "My husband is a judge and has a lot of privileged information. ", "If that television isn't working he'll have one of his guys come by and look at it another time.\" ", "Mrs. Lions already had her hand on the door as she threw her purse over her shoulder.", "\n\n\"I understand. ", "I'll probably still be working on this one by the time you get back. ", "Drive safely.\" ", "Piper flashed the southern charm smile she had been practicing and waved warmly.", "\n\n\"Bless your heart. ", "I'll pack up some scones for you to take with you when I return.\" ", "She pulled the door closed behind her, and Piper waited until the car pulled away before fishing her phone out of her pocket and dialing Bobby's number.", "\n\n\"She's on her way to town hall now. ", "It sounds like Jules did great. ", "I'm going to be heading into his office and looking for the right spot for the cameras and the pictures.\" ", "Piper could feel her heart thumping against her ribs as she pulled everything she needed from her toolbag and moved toward his office.", "\n\nBobby sounded all together different to Piper as he began to speak. ", "She assumed this was the serious tone he used at work. \"", "Great job. ", "Michael is at town hall now and he'll give us a heads-up when she's leaving. ", "I'm on duty, so I'll take a couple of swings by the judge's house and make sure everything still looks clear for you. ", "How are you doing?\" ", "Even with the firmer tone, Bobby's voice was the comforting beacon of a lighthouse that kept Piper from losing herself in the intensity of the moment.", "\n\n\"I'm fine. ", "I want to get this done and get out of here,\" she stuttered nervously, hearing her words catch.", "\n\n\"Piper, stop for a second and breathe. ", "I know this is overwhelming but you have this under control. ", "Take it one step at a time. ", "I'll stay on the phone with you,\" Bobby said, with a calm he must have learned in some hostage negotiation class.", "\n\nPiper drew a long calming breath as she stepped through the threshold of the judge's home office. ", "The massive furniture was made of rich, dark wood. ", "The walls were a textured espresso color. ", "There was a wall of shelves covered in books and another wall covered in pictures of the judge with various celebrities and noteworthy people.", "\n\n\"What do you see?\" ", "Bobby asked, breaking Piper's momentary frozen state while she assessed the room. ", "He may have wanted her to be calm, but that didn't include being slow. ", "They were still up against the clock.", "\n\n\"There are a few filing cabinets, a huge bookshelf that's the size of the whole wall, and his desk.\" ", "She pulled the handles of the filing cabinet and they were locked. ", "She ran her hands over the tops of the books that were within reach looking for any gaps or hiding places.", "\n\n\"Take a good look around. ", "If you were going to hide something in there, something you didn't want to be found, where would you put it?\" ", "Bobby felt helpless, like his part in all of this was small and it wasn't fair to Piper to be in there alone.", "\n\nPiper closed her eyes and imagined she lived here. ", "She imagined this was her office and she was the judge, trying to live a double life. ", "She opened her eyes and scanned the room until her gaze was pulled upward. \"", "There's a gap between the top of the bookshelf and the ceiling. ", "I think I could pull a chair over to it and get the pictures up there. ", "I'm going to put the phone down for a minute. ", "Don't hang up.\" ", "She may have been alone in the house, but Bobby was her lifeline and she needed him to keep talking to her.", "\n\n\"I'm not going anywhere,\" he said reassuringly. ", "He turned onto the judge's street and drove by the house wishing he could pull over and help Piper.", "\n\nShe wheeled the desk chair over and lifted herself up so she could see the top of the bookshelf. ", "There was a good six inches from ceiling to shelf and it ran the length of the room. ", "It would be a great spot to plant the pictures. ", "The judge wouldn't be likely to accidently find them before Christian could.", "\n\nAs she tried to position herself better on the bulky office chair she felt the top of the bookshelf give way slightly under the weight of her arm. ", "She noticed a piece of it didn't match the rest and seemed to be loose. ", "She pulled her keys from her pocket and used one to pry up the wood. ", "It came loose and exposed a small cubby filled with notes and photographs. ", "Piper reached her hand in to pull some out.", "\n\nShe covered her mouth in shock as the reality of what she had found began to solidify in her brain. ", "There were pictures of various boys in compromising positions at the hands of the judge. ", "The boys seemed to range in age from ten to early teens and all had the same empty-eyed look of fear and pain in their eyes. ", "The papers Piper was trying to gather up were all written on the letterhead of the charity, Legal Buddies. ", "They seemed to be files of the young boys and in the margins were handwritten notes in the judge's familiar scrawl. ", "Piper could hear Bobby's faint voice from her phone on the desk and knew if she didn't come down and let him know she was all right he'd be busting down the door any minute. ", "She took a handful of the pictures and paperwork down with her as she dismounted the chair.", "\n\n\"Bobby, I found something. ", "I don't know if it changes things,\" she stammered. \"", "I don't know what to do here, I don't know what I'm supposed to do.\" ", "Piper's voice was high and Bobby could tell she was beginning to panic.", "\n\n\"What is it? ", "What did you find?\" ", "He didn't want to fluster her further but they needed to be finishing up soon, and the alarm in her voice was scaring the hell out of him.", "\n\n\"I was going to put the pictures on top of the bookshelf and there was this piece of the shelf that seemed like it was loose. ", "I pulled it up and I found all these pictures.\" ", "Piper looked down at her hands and felt tears filling her eyes. \"", "Bobby these boys, these poor little boys.\" ", "She let the tears fall as she flipped the photographs over, unable to look at the tormented faces of the judge's victims.", "\n\n\"There are all these papers here, too, from Legal Buddies. ", "It's like profiles on all these little kids, and the judge has notes written all over them about how to get them to keep quiet. ", "Here's one that says he'll rule to reduce the sentence of this little boy's father if he complies and doesn't tell anyone about their secrets. ", "This man is a monster.\" ", "She felt her hands shaking and her knees starting to buckle. ", "She wanted to grab the pictures and run from the house directly to the police department and scream until someone would help her.", "\n\n\"Piper, I need you to listen to me. ", "Put everything back where you found it and slip the photos of Chris in there with them. ", "Set up the cameras then pack up your tools. ", "We keep with the plan exactly how it is.\" ", "Bobby kept his voice steady but rigid. ", "There was no room for emotion right now, not with so much on the line and so little time. \"", "Do you hear me? ", "I just got a text from Michael that the judge's wife is leaving now.\"", "\n\n\"I hear you,\" Piper whispered. \"", "I'm okay, I'm putting everything back.\" ", "Piper flipped one photograph over and stared at it for a long moment. ", "There was no place on this earth for someone so evil, and she'd never believed that more than this moment.", "\n\nPiper mounted the micro cameras pointing to the bookshelf, replaced everything, and backed slowly out of the office, trying to confirm that it looked exactly as it had before she entered. ", "She dried all the tears from her eyes and tried to cool the redness in her cheeks with the back of her hands. ", "She hurried back to her toolbag and began collecting all her things. ", "As she zipped it up she heard the car pull into the driveway and readied herself to cheerfully greet Mrs. Lions.", "\n\n\"Are you all done?\" ", "she chirped, as she entered the house with a wide grin, surprised to see Piper all packed up and looking ready to leave.", "\n\n\"I am,\" Piper responded unreservedly, returning a warm smile. \"", "Your cable will be all set in about ten minutes. ", "I need to work on the box outside for a minute and then you'll be good to go.\" ", "Piper wondered what the judge's wife really knew about her husband's crimes, reminding her of her own mother's willingness to harbor a monster.", "\n\n\"Let me pack some scones for you, dear. ", "You sound like you have a long day ahead of you. ", "We're so grateful you were able to fit us in, it's the least we can do.\" ", "The judge's wife tucked four scones into a beautifully decorated paper bag.", "\n\n\"You are so kind. ", "I wish all my customers were as wonderful as you. ", "I'm not sure I'll have time to stop for lunch today, so these will be a nice treat.\" ", "Piper hardly recognized her own voice. ", "Perhaps Michael was right and being nice was indeed in stark contrast to her normal personality.", "\n\nPiper waved goodbye as she shut the door behind her, toolbag and scones in hand. ", "As she made her way to the van she saw Bobby's squad car approaching. ", "She knew he wouldn't stop. ", "They couldn't chat here, but as he passed, their eyes met, bringing a sense of relief that filled her entire body. ", "There was something magic about that man, even a glance from him could calm her when it seemed like nothing could.", "\n\nUnfortunately, as his car drove out of sight the magic wore off. ", "Piper backed out the driveway and, after driving a safe distance from the judge's house, pulled the van over. ", "She swung her door open and vomited onto a pile of freshly fallen leaves. ", "The vileness of the world and the lack of protection for children were too much for her stomach to handle. ", "As she pulled herself back into the van she felt the tears begin again, and she ached for this day to be over, to be safe at Betty's house.", "\n\n# Chapter 20\n\n\"Are you going to tell us what this is all about?\" ", "Michael asked in a demanding tone. \"", "Tell me exactly what you saw.\" ", "His patience with Piper was wearing thin. ", "She had been sitting in her car crying for twenty minutes, begging to be left alone before finally joining Michael and Bobby in the sitting room at Betty's house.", "\n\n\"Michael, back off her for a minute. ", "This hasn't been a very easy day,\" Bobby barked at Michael, as he rubbed Piper's back, supportively encouraging her to take her time.", "\n\nMichael ignored Bobby's demand and pushed on. \"", "No one said any of this was going to be easy. ", "We can't all curl up in a ball and cry when we realize how damn hard this is going to be. ", "You planted the pictures, got the cameras up, all without getting caught. ", "That seems like a victory to me.\" ", "Michael knew Bobby was going to be the compassionate shoulder for Piper to cry on, and someone had to be the voice of reality.", "\n\nPiper winced at the sharp edge of Michael's voice. ", "She wasn't a crier—this wasn't at all like her—but as hard as she had tried she couldn't contain her sadness. ", "She cleared her throat and stared away from both of them as she spoke. \"", "The judge is using his charity to blackmail boys into keeping quiet about sexual abuse. ", "When I went to put the pictures in his office I found a bunch of sick photographs and documents. ", "They were from Legal Buddies, all with notes from the judge detailing his disgusting manipulation.\" ", "Piper choked back tears, and her voice shook with emotion. \"", "Michael, there were dozens of pictures of different boys in that box. ", "I saw dates going back over ten years. ", "If you had seen the pictures, the look in their eyes, you'd be feeling the same way.\"", "\n\n\"I see that stuff every day, Piper. ", "It's hard, but you need to pull yourself together and we need to decide if this changes anything.\" ", "Michael was unwavering in his lack of empathy. ", "There was no time for that, no time for tears. ", "If Piper wanted to play in the real world she'd need to act accordingly.", "\n\n\"Why are you being such an ass, Michael? ", "If this was Jules you'd be bending over backward making sure she was all right.\" ", "Bobby stood, feeling the only way to get Michael to listen would be to stare him straight in the eye.", "\n\nMichael countered quickly. \"", "Jules isn't trying to be some superhero. ", "All I'm saying is, if this is what Piper wants, then she needs to shake it off. ", "If something like this is going to rattle her, do you really think she's going to be fine when the judge turns up with a bullet in his brain? ", "I know she's a tough kid, but we can't have any of this right now.\" ", "Michael gestured at Piper's frazzled hair and puffy eyes.", "\n\n\"You're a real jerk sometimes, Michael. ", "You think you know what's best for everyone.\" ", "Bobby's voice grew from a frustrated tone to an aggressive shout.", "\n\n\"He's right,\" Piper cut in, standing to join the two men before a fight started. ", "They towered over her, but she was certain she could break them apart if need be. ", "She put her hand delicately on his chest, encouraging him to back down. \"", "All this does is reaffirm what we're doing. ", "The judge is worse than we thought he was. ", "We keep going as planned and we make sure he can't hurt anyone else.\" ", "She wanted to tuck herself under Bobby's warm arm and bury her face in his chest, but she knew Michael needed to see her stand there, cheeks dry, lip not quivering, and continue with what needed to be done. \"", "We watch the cameras this weekend and make sure the judge doesn't realize anything's going on. ", "Then I call Christian on Monday morning when the judge's wife is out and get him over there.\" ", "Piper cleared her throat and stood a little taller. \"", "I'll take the first shift watching the cameras. ", "You guys go kiss and make up.\"", "\n\n# Chapter 21\n\nMonday had finally arrived. ", "The weekend was uneventful, and the pictures had remained right where she had planted them. ", "Piper sat in her car in Betty's driveway. ", "She slouched down to avoid the penetrating stares from Bobby and Michael who were camped out on the porch. ", "They had badgered her for hours about what the call to Christian should or shouldn't involve. ", "When she'd finally had enough, she took the burn phone and retreated to her car, locking the doors.", "\n\nShe hadn't mapped out the entire conversation with Christian, but she knew what had to be said. ", "More importantly, she knew how she needed to say it. ", "Yes, she was nervous and rather than masking it, she planned to utilize it. ", "Anyone calling Christian and expecting blind trust had better sound authentic. ", "Coming across as calculated and unemotional would give him the idea this was all a setup.", "\n\nShe dialed the number she had scrawled into her notebook and drew in a deep, shaky breath. ", "The phone rang twice, and then a man's voice came on the line.", "\n\n\"Hello,\" he answered, with an air of annoyance, probably at the fact that the number was coming across as anonymous on his caller ID.", "\n\n\"Is this Christian Donavan?\" ", "Piper asked, starting off almost imperceptibly quiet and then letting her voice grow.", "\n\n\"Yes it is, but listen, I already know who I'm voting for, I've found Jesus, and my kid is probably already selling whatever your kid is. ", "I'm a busy guy, and I'm not interested.\" ", "The man paused waiting for the textbook _overcoming objections_ rebuttal every new sales person was taught.", "\n\n\"I'm not a solicitor, Mr. Donavan. ", "I'm very sorry to bother you, but I can assure you that this is important. ", "It's about your son, Chris. ", "I have some information that I think you need to know.\" ", "Piper let her voice crack; she let the quietness of her tone reflect how terrified she was.", "\n\n\"What the hell is this, some kind of prank? ", "If it is I'll tell you right now it isn't funny, and you'll regret this phone call. ", "Tell me who this is.\" ", "Christian's tone immediately grew fierce as he spoke through pursed lips.", "\n\n\"I'm sorry, I can't tell you who I am. ", "I know who you are and what you do for a living, and I don't want to get mixed up in any of that. ", "I'm an ordinary person who stumbled upon something about your son being in danger. ", "I thought about minding my own business, but I don't want any more children to be hurt.\" ", "She jumped at the shock of Christian's voice cutting in.", "\n\n\"You don't know shit about what I do for a living, and you certainly don't have any business talking about my son. ", "This better not be bullshit. ", "You've got thirty seconds to spit it out or I'm hanging up the phone, and if you think a blocked phone number can protect you, you're wrong.\" ", "Christian's voice was now raised to a shout, and Piper could feel the phone shaking in her hand. ", "This reaction had validated Christian's love for his son and his response to protect him.", "\n\n\"Please don't be upset with me. ", "I'm trying to do the right thing here. ", "You do business with a judge. ", "If you go to his house, in his office above his bookshelf there is a loose board hiding some terrible secrets, secrets that pertain to your son. ", "Please take this seriously. ", "I know I've given you no reason to trust me, but for your son's sake, please go see for yourself.\" ", "Piper pulled the phone from her ear, and disconnected, feeling a wave of nausea come over her. ", "She had considered staying on the line long enough to get some kind of confirmation from Christian, but she didn't want to open herself up to any further questioning by him. ", "The dramatic end to the conversation would have perhaps created an even greater sense of urgency.", "\n\nShe tucked the phone back into her bag and was climbing out of the car as Bobby and Michael approached. ", "She knew there would be a barrage of questions, and she didn't want to participate.", "\n\n\"It's done,\" she said in a matter-of-fact way. \"", "I'm sure he's heading over there now. ", "Have we confirmed the judge's wife is gone for the morning?\" ", "She brushed past both of them and headed back toward the house. ", "Betty and Jules had called in sick today at Michael's urging, wanting to keep them close.", "\n\n\"Yes,\" Michael said, jogging behind her trying to catch up. \"", "She had a call with her girlfriend this morning about getting coffee and going jewelry shopping. ", "We heard her leave twenty minutes ago.\"", "\n\n\"What a charmed life. ", "Jewelry shopping, it only costs a few thousand dollars and your soul,\" Piper said as she turned the monitor of the laptop toward her and stared at the screen. ", "She was convinced Christian would be there soon.", "\n\n\"We don't know that the judge's wife knows any of this. ", "She could be as in the dark as the rest of the community,\" Bobby said, taking a seat next to Piper.", "\n\n\"You're not married to a man for that long without knowing what horrible things he's capable of. ", "She's probably as sick and twisted as he is. ", "I'm sure she covers for him all the time, hides his secrets.\" ", "Piper knew Bobby could see she was drawing the connection between her mother and the judge's wife. ", "Their eyes met and she shook her head. \"", "Never mind, it doesn't matter anyway.\"", "\n\nThirty minutes passed and there was no sign of Christian at the judge's house. ", "Doubt began to creep into Piper's mind about the effectiveness of her call. ", "It didn't help that Bobby and Michael seemed to be thinking the same thing.", "\n\n\"Did you tell him to get over there this morning?\" ", "Michael asked. \"", "Did he say where he was coming from? ", "For all we know he could be out of town.\"", "\n\n\"Shut up, Michael, he's coming. ", "I could hear it in his voice, he took it seriously and he's going to show up.\" ", "Piper stood up and walked away from the laptop, hoping the old adage, a watched pot never boils, might be true.", "\n\n\"He may have been completely worried, but if he's not in town then he couldn't get to the judge's house even if he wanted to. ", "You should have asked.\" ", "Michael stopped talking at the sight of Bobby waving his hands for them to be quiet. ", "Michael assumed it was another attempt to shield Piper from the harsh reality he was doling out.", "\n\n\"Someone's there,\" Bobby said, turning up the volume on the computer. \"", "I heard the door open.\" ", "Piper sat back down and crossed her fingers in a childish attempt at bringing them all some luck.", "\n\n\"It's Christian,\" Michael said as a man walked into the frame. ", "Piper was surprised by Christian's appearance. ", "He wasn't at all how she had pictured him. ", "She had imagined he'd have a round beer belly crammed into a running suit, slicked back hair, and maybe even a thick cigar hanging from his lips. ", "When she conjured up images of the head of a crime family she hadn't pictured a fit, shaggy haired, normally dressed man. ", "His dark denim jeans, comfortably fitting cotton shirt, and tennis shoes were incredibly misleading. ", "The picture coming through on her computer was grainy, but Piper could tell Christian shared the subtle yet dangerously handsome attributes of his brother Sean. ", "They both had those rebellious eyes and an intentionally unkempt air about them that tended to drive women wild.", "\n\nChristian crept skeptically around the office, still not certain if this was a trap. ", "He looked up at the bookshelf and whispered, \"Son of a bitch, this better be a joke.\"", "\n\nThe room was still as Piper, Bobby, and Michael all sat in anxious silence waiting for Christian to do something. ", "Finally, he wheeled the office chair over to the bookshelf, as Piper had done a few days earlier. ", "Bobby reached for Piper's hand. ", "It felt so comforting to have him here with her as a moment she had long anticipated had finally arrived.", "\n\nChristian's phone began ringing in his pocket before he could pull himself up onto the chair. ", "He fished it out and read the caller ID. \"", "Judge,\" he said with a devilish smile as he answered the phone, \"you have incredible timing. ", "I was just thinking about you.\"", "\n\n\"Holy shit, it's the judge,\" Michael said, slapping his hand to his forehead. \"", "What if he tells him about the call? ", "He could blow this whole thing up right now.\"", "\n\n\"He's not that stupid,\" said Piper. \"", "If he genuinely thinks his son is in danger he's not going to show his hand to the judge. ", "Sit down.\" ", "She pointed to the couch and Michael obeyed.", "\n\nChristian stood listening to the judge talk for a minute then finally cut in. \"", "I'm not sure how many times I have to tell you, Judge. ", "I'm not my father. ", "I'm a businessman, not some hired gun to go cleaning up your messes. ", "I've made you a lot of money, and you've gotten me and my crew out of countless jams, but I'm not your hitman. ", "I don't go after innocent women because you're catching some heat from some rookie cop. ", "Isn't this what your little puppy dog, Rylie, does for you?\"", "\n\nChristian used his shoulder to hold his phone pressed against his ear and hoisted himself up onto the chair. ", "He felt around at the top of the bookshelf and finally found the loose board and lifted it free. \"", "Holy shit,\" he said, pulling the photographs out of the hidden space and flipping through them, finally recognizing one as his son standing outside of his school.", "\n\n\"You know what, maybe you're right,\" Christian said, clearly trying to compose himself in the face of massive rage. \"", "Maybe I am being shortsighted. ", "Why don't we meet tonight at the mill and we can talk about some options. ", "Say... seven o'clock?\" ", "Christian waited for the judge to reply then abruptly hung up the phone. ", "He dismounted the chair and left the office.", "\n\n\"Where is he going?\" ", "asked Bobby, still in shock over what had just transpired. \"", "He's not going to leave everything all messed up is he?\"", "\n\nBefore full out panic could overtake the room, Christian reappeared holding a shoebox he had presumably gotten from the judge's closet. ", "He climbed back onto the chair and filled the shoebox with the contents of the hidden space. ", "When he was done he returned the loose board and the chair to their original positions. ", "He reached in his pocket once more for his phone and dialed a number.", "\n\n\"Sean,\" he said his voice shaking with anger, \"go pick up Chris at school, and take him back to your place. ", "Don't stop anywhere, and don't screw around. ", "Have a couple of the guys come by and watch the door. ", "I don't want anyone coming or going besides me. ", "Do you understand?\" ", "He waited as Sean replied and then punched his fist into the wall. \"", "Sean, do what I tell you. ", "Call me when you're back at your place. ", "I'm going to be late tonight.\" ", "He hung up his phone and returned it angrily to his pocket. ", "He let out a long line of expletives that made even Michael blush slightly. ", "He left the office and a minute later they heard the front door shut.", "\n\n\"I'm going to head over that way,\" said Bobby. \"", "I think it's safe to say nothing is going to go down until the meeting tonight, but I'd like to have eyes on Christian until then. ", "Can you track his cell phone and send me the information?\" ", "he asked, grabbing his coat and keys and heading for the door.", "\n\n\"Wait,\" Piper shouted. \"", "I want to come with you.\" ", "She had started this entire thing. ", "She certainly wasn't ready to take a back seat now that it was getting serious.", "\n\n\"You'll meet me later. ", "I'm going to hang back and watch to make sure nothing unexpected happens. ", "Get in touch with me if anything comes up.\" ", "Bobby hopped down the front steps and jogged to his truck, leaving no time for her to argue. ", "In reality, he had some ideas rolling around in his mind about how to keep Christian from killing the judge while still being able to execute the important parts of the plan. ", "Listening to Christian shirk the judge's requests to harm Betty and Jules had struck something inside of him. ", "Christian was no saint, certainly a criminal, but he, unlike the judge and Rylie, had drawn a line in the sand when it came to harming innocent people. ", "That meant something.", "\n\n# Chapter 22\n\nThe rest of the afternoon seemed to drag for everyone. ", "Piper and Michael paced around Betty's house waiting for a call from Bobby. ", "Betty and Jules felt the tension flood the house, so they decided to seek higher ground, retreating to their respective rooms upstairs. ", "Bobby, at least, was keeping busy. ", "He spent the afternoon hours tailing Christian who made multiple stops to different properties he owned. ", "He was moving with purpose and incredible focus, not stopping to make small talk or exchange niceties with anyone.", "\n\nWhen Christian finally seemed to settle into his house around four o'clock, Bobby picked up his phone to call Piper.", "\n\n\"It seems like he might be staying put for a little bit. ", "This would be a good time to go set up the cameras at the mill and park somewhere to test all the equipment. ", "I'll give you a heads-up once he's on the move again.\" ", "He hated the idea of Piper going to the mill on her own in the middle of the afternoon when she could easily be spotted. ", "He had, however, realized that there was little she thought she couldn't do, and trying to be the voice of reason or the knight in shining armor wouldn't get him anywhere.", "\n\n\"I'll head over there now.\" ", "Piper grabbed the bag full of supplies that she had packed, double checked, and then repacked while waiting for the go ahead from Bobby. ", "As she made her way to the door she heard footsteps tapping down the stairs behind her. ", "Piper turned to see Jules standing there with a look of sadness on her face, her eyes red-rimmed and wet from tears.", "\n\n\"This is it, isn't it?\" ", "Jules mumbled in a quiet and concerned voice. \"", "I could tell when Bobby ran out this morning, and now the look on your face says it all. ", "I know you guys don't want me to be involved in this, and I can respect that. ", "I want you to know that whoever killed my father robbed me and my mother of so many things, and in my eyes they deserve all the pain and punishment in the world. ", "They don't deserve to live. ", "I'm afraid if it comes down to it Bobby won't be able to face that, and might end up getting himself killed instead.\"", "\n\nThe tears started to roll again down Jules's cheeks, and Piper found herself, as usual, completely unprepared to cater to someone else's emotional needs. ", "She assumed a hug was required, some kind of reassuring gesture that would stop the tears and ease her mind, but as she wracked her brain to find one she felt the pressure of wasted time bearing down on her. ", "Piper had grown so much since meeting these wonderful people, but she still wasn't confident in her ability to comfort someone.", "\n\nShe looked past Jules with a flicker of panic in her eye. \"", "Um, Michael... Jules needs you,\" she called out, and she turned away, heading again for the door. ", "She knew that in the eyes of normal people she seemed cold-hearted and vacant. ", "If they only understood that empathy and social skills were taught, not innately known, then perhaps they could forgive her ignorance.", "\n\nAs she tossed the bag into her car and put the key in the ignition she felt a slight weight lift from her chest at the sight of Jules wrapped safely in Michael's arms in the doorway of the house. ", "At least if she couldn't give Jules what she needed she could get out of the way and let someone else do it.", "\n\nThe ride to the mill seemed to take an eternity. ", "She knew she had a lot to do, all while trying not to be noticed. ", "She pulled her car up two blocks from the entrance to the mill and walked casually toward the building, checking frequently to make sure no one was coming or going from its entrance. ", "She quickly made her way to the back of the building where the barrel she had used to force her way in last time stood. ", "She sighed with relief at the sight of the barrel, exactly as she had left it, below the window that she had needlessly broken. ", "She pulled herself up and through the window and dropped, catlike, onto the ground below. ", "Something about this felt easier than last time. ", "Perhaps it was that she knew the layout of the mill or the players involved, or maybe it was that for the first time in her life she didn't feel alone.", "\n\nIt took nearly an hour to get everything set perfectly. ", "As she walked back to her car she felt her phone vibrating in her pocket. ", "She pulled it out and was relieved to see it was Bobby.", "\n\n\"He's heading that way now. ", "Do you have everything set up?\" ", "There was no time for cordial greetings or casual chitchat. ", "This was crunch time, and only vital communication of facts would work.", "\n\n\"Everything's set up. ", "I'm heading back to my car now to make sure the cameras are working. ", "I should know in a few minutes,\" she said, happy to hear Bobby's voice.", "\n\n\"I'll meet you at your car. ", "I'm assuming Christian is trying to get there before the judge. ", "He has a duffle bag with him, but I'm not sure what's in it or what he has planned.\" ", "Bobby spoke quickly, and Piper could tell his anxiety was significantly higher than hers. ", "She felt she had come to terms with the fact that Christian would kill the judge. ", "But she knew Bobby was still searching for a solution, still holding out for an alternative. \"", "I have an idea,\" Bobby added, stopping Piper in her tracks. ", "She was afraid this would happen. \"", "I need to run it by Michael. ", "I'm going to give him a call and then fill you in as soon as I can. ", "Send me a message when you know the cameras are operational.\" ", "She heard the line disconnect and felt a knot in her stomach. ", "She reconsidered the last thing Jules had said to her. ", "Would Bobby really jeopardize his own life to avoid the bloodshed of criminals tonight? ", "Were his ideals more of a liability than she had considered?", "\n\nPiper sat tapping the steering wheel of her car, looking restlessly in her rearview mirror hoping to see Bobby either pulling up behind her or walking her way. ", "In the fifteen minutes since they had spoken on the phone she had determined the cameras and microphones were working properly. ", "She had watched Christian enter the side door of the mill and come into view of the cameras. ", "He was moving some boxes and an old office chair around. ", "She had tried twice to call Bobby, but she assumed he was still on the other line with Michael because he was not answering his phone.", "\n\nFinally, she saw Bobby hustling up the street toward her car, his phone still to his ear. ", "He pulled open her car door and flopped down into the passenger seat, bringing with him a gust of cold air. ", "She wanted to interrogate him, scold him, and hold him all at once. ", "Instead, she listened to the phone conversation as it continued.", "\n\n\"Yes, Michael, I think this could work.\" ", "Bobby grabbed Piper's hand and squeezed it as a sign of excitement over the newly hashed plan.", "\n\n\"Bobby, wait,\" Piper heard Michael say on the other end of the line. \"", "There's something I need to tell you first.\"", "\n\n\"Holy Shit,\" Bobby said, pointing at the screen televising the scene unfolding in the mill. \"", "The judge is here. ", "Whatever you have to tell me can wait. ", "I've got to get in there.\" ", "He hung up the phone and reached for the car door to leave.", "\n\n\"What are you doing? ", "You can't go in there yet. ", "That's not what we discussed!\" ", "Piper grabbed the sleeve of Bobby's jacket trying to pull him toward her.", "\n\n\"Michael and I think we've worked something out, but I have to get in there before Christian does anything, otherwise it's too late. ", "I need you to trust me.\" ", "He pulled her hand from his sleeve and held it, begging her with his eyes.", "\n\n\"No. ", "I mean, I do trust you, but I think your judgment is clouded.\" ", "The judge and Christian had begun talking, and the sound drew Piper's attention to the screen long enough for Bobby to hop out of the car.", "\n\n\"If anything happens to me, call the police. ", "No matter what, stay in the car. ", "Please trust me.\" ", "He half closed the door and then pulled it back open and stuck his head in. \"", "I think I might love you, Piper.\" ", "He pulled his head back, closed the door, and ran toward the mill.", "\n\nShe held her breath, unable for a moment to process anything. ", "Not the sudden changes to the plan, not the proclamation of maybe love, or the thought of something happening to Bobby that would warrant a call to the police. ", "She turned her attention to the scene unfolding on the screen in front of her. ", "She saw Christian sidle up to the judge and plunge something into his unsuspecting fat neck. ", "The judge put his hand to his neck and looked puzzled before falling limp into Christian's waiting arms. ", "Christian dragged his portly body toward a chair in the corner of the room and dropped him down onto it. ", "She saw him pull a gun from his waistband and hold the barrel to the judge's forehead. ", "Then she saw light from an opening door stream in and heard Bobby's familiar voice call out.", "\n\n\"Christian, stop.\" ", "He put his hands up showing he had no weapon and moved farther into the room but not any closer to Christian.", "\n\nChristian swung around and aimed the gun at Bobby who instinctively went to reach for his weapon. ", "At the last second, Bobby seemed to remember he wasn't here for a shoot-out, but for a negotiation, and purposefully lifted his empty hands again. ", "Piper felt her heart momentarily stop as she saw the large black gun pointing at the man who might love her.", "\n\n\"I'm here to save your life. ", "I need you to hear me out. ", "Can you put the gun down for a minute and let me talk to you?\" ", "Bobby kept his hands raised and voice steady. ", "He hadn't had enough time to think through all his talking points, and now staring down the barrel of a gun, it seemed as though a little more preparation would have been beneficial.", "\n\n\"I'm not sure who you are, but there are only two people in this room whose lives are in danger, and I'm not one of them,\" Christian barked, clearly rattled by Bobby's sudden appearance.", "\n\n\"My name is Bobby, and I'm a cop. ", "I'm not here to arrest you though. ", "I'm here to help you. ", "Lower your gun and give me a chance to explain. ", "Please.\" ", "Christian lowered his gun slightly, but gave no indication he'd be holstering it or handing it over. ", "Bobby continued, \"I know what this man has done, who he is, and I don't blame you for wanting to kill him. ", "I have a plan that ensures he pays for his crimes and keeps you from spending the rest of your life in jail.\" ", "Piper was as anxious to be let in on this plan as Christian was to, perhaps quite literally, shoot it down.", "\n\n\"There's no justice for a man like this other than a bullet in his brain, and even that doesn't seem like enough,\" Christian shouted, raising his gun, pointing it in the direction of the judge again.", "\n\n\"I know you think that, but there are dozens of other people—children—involved here and they deserve to see him pay for his crimes. ", "They don't want him to just disappear, his body never to be seen again. ", "If you pull that trigger now you'll be doing him a favor. ", "When all of this comes out he's going to pray for death. ", "I have a way to make sure he's held accountable and get you and your family a fresh start.\" ", "Bobby signaled for Christian to lower his weapon again and tried to draw his attention away from the judge.", "\n\n\"I'm no rat. ", "If that's what you're about to propose you can stop right there. ", "I come from a long line of people who pride themselves on loyalty.\" ", "Christian's eyes and gun were still fixed on the judge and Bobby knew he was running out of time. ", "The judge was still motionless, but Bobby could see he was breathing. ", "Whatever sedative Christian had injected into the judge's neck was certainly doing its job.", "\n\n\"You know when everything comes out about this guy, you won't be called a rat, you'll be a hero. ", "There are certain lines you don't cross and even your crew would agree he's a monster. ", "The people he's hurt deserve to see him pay, in the public eye. ", "All I'm asking is you hear me out.\" ", "Bobby felt the tightness in his chest fade slightly as Christian once again lowered his gun and turned toward him.", "\n\nBobby continued, \"You know if I was to bring any evidence in against him, either me or the people I love would be dead before it ever came to light, and the evidence would be destroyed. ", "You know exactly who is involved with the judge and you can give the evidence to people who you know don't have a relationship with him. ", "I know you took a box from the judge's house, and I know it holds more than enough to ruin him, but you're the only one who can navigate the corruption and ensure it gets to the right people.\"", "\n\nChristian's mind was spinning. ", "This was supposed to be a quick and clean kill and now it was falling apart. ", "This kid just didn't understand how things worked, so he'd thought he better set him straight. \"", "They'll retry cases, and most of my guys won't stand a chance without having a judge in their corner. ", "You might be right, they wouldn't stand for what this guy does to kids, but they wouldn't be willing to go to jail over it. ", "They'd kill me.\" ", "Christian's voice wasn't as harsh anymore. ", "He wasn't barking and shouting, he seemed to be hoping for another solution.", "\n\n\"I know. ", "That's why I've had a prosecutor friend of mine write up terms that would get you full immunity as well as relocation. ", "You could take your money and your son and start a new life somewhere. ", "I know you think this town is your legacy, the life your father led is all you're meant for, but this is the opportunity to give your son a whole new legacy.\" ", "Bobby knew if this argument didn't sway him, if starting over wasn't appealing, then he was completely out of options and had no idea where to go from here.", "\n\nChristian's eyes danced around the room as he thought over the proposal. ", "He bit his lip and furrowed his brow, and Bobby took the hesitation as a positive sign—at least he wasn't immediately opposed to the idea.", "\n\nHe was so tired of this life, this chaos he was living. ", "What this kid was proposing was something he had thought about every day since his son was born. ", "This was the first time it lay before him, his for the taking. \"", "I want my brother to come, too. ", "If he's not included in the deal, then I'm not interested.\" ", "Christian's stare was intensely boring holes through Bobby.", "\n\n\"Your brother has some serious problems. ", "He tried to hurt someone I care about very much. ", "You can't expect, with good conscience, we introduce him to a new community with no criminal record. ", "He's a danger to women.\" ", "Bobby wanted to tell Christian what his wonderful brother Sean had done to Piper but he didn't imagine it would do much to change his mind.", "\n\n\"It's the three of us or no dice. ", "If I leave and give you the evidence you need about the judge, then dozens of cases will be retried. ", "My friends _and_ my enemies will all be facing possible jail time, and they'll no longer be able to buy their way out of it. ", "If I leave my brother behind he'll be dead within a week. ", "I know he's got some issues, and I'll get him some help. ", "He needs to get out of here, get away from all this bullshit he thinks is our destiny.\" ", "Christian's face suddenly softened, the sternness melting away and replaced with weariness. ", "His eyes begged for compassion as he quietly uttered, \"He's my little brother.\"", "\n\nAll of this was so counterintuitive to Bobby. ", "There were good guys and bad guys, but now, standing here in front of someone he didn't think was capable of sincerity, he realized he might be wrong about the world. ", "Maybe being a criminal didn't mean you didn't love your family. ", "He'd never understood how someone could wake up every morning and break the law, but he knew what it meant to love someone enough to want to protect him. ", "He never wanted to find common ground with a man like Christian, but that's what seemed to be happening. ", "He cleared his throat and gritted his teeth and spoke in a tone, letting Christian know he was serious.", "\n\n\"If he goes with you, he registers as a sex offender under his new identity. ", "He gets counseling, and I will personally come out there and hunt him down if he so much as grabs a woman's ass without her permission. ", "He doesn't deserve a free pass as far as I'm concerned, but we've got the potential here to make a much larger impact.\" ", "Bobby shook his head, disappointed with himself and the situation. ", "Why did it always have to come down to compromising yourself to get things done?", "\n\nChristian let out an audible sigh of relief. ", "He wasn't ignorant to what a low-life moron his brother was, but he had an obligation to him. ", "He was blood, and their father had completely failed Sean. ", "It was a miracle he'd survived this long. ", "Christian had personally beaten his brother senseless when he had found out about the horrific crime he had committed and the way he had tossed that girl out of his car like she was trash. ", "He had saved his brother from prison by paying a hefty fee, but he had found other ways to punish him. ", "Christian honestly believed he could save him, if he could only get him out of this town.", "\n\nChristian couldn't believe what he was about to say. ", "He couldn't believe he was about to sell out everything his father had taught him. ", "When the doubt rose up in his stomach all he had to do was picture his son. ", "There was no denying a new life, somewhere far from all this, would be the best gift he could ever give Chris. ", "He closed his eyes and spoke quietly. \"", "Judge Rosenthal. ", "I won't meet with anyone else. ", "If you can get her out tonight and get my family and me out of here by morning I'll give you whatever you want. ", "I've got voicemails, loads of communications, and of course that box of filth I took from the judge's house sitting in my truck. ", "You get Judge Rosenthal, and you've got a deal.\" ", "Christian approached Bobby resignedly with his hand extended, ready to make a gentleman's agreement. ", "As Christian and his loaded weapon came closer, it suddenly dawned on Bobby how dangerous this had all been, how close to death he'd been, and how furious Piper would be. ", "At any point Christian could have, and maybe still would, lift his weapon and kill him.", "\n\nBobby took Christian's hand firmly and shook it. \"", "I need your gun, Christian. ", "You know we're not going to go sit with a judge while you have a weapon. ", "We've both taken some risks here tonight. ", "I need you to take one more.\" ", "Bobby extended his hand and gestured toward Christian's weapon. ", "Christian hesitated and looked over at the judge one last time.", "\n\n\"I want my kid to have a better life. ", "I don't want him constantly in the crosshairs. ", "I don't want him to be afraid of me the way I was of my father. ", "I've tried to do things right by him, but at every turn I keep getting myself in deeper. ", "This might be the first risk I take that actually makes him safer.\" ", "Christian handed over his gun and wiped away the sweat that had gathered on his forehead. ", "Christian asked, pointing over to the judge, \"So what are we going to do with him? ", "The stuff I gave him will keep him out for another eight hours or so.\"", "\n\n\"Do you have anything we can use to tie him up?\" ", "Bobby asked, deciding it was better to keep the judge in one spot to limit their liability of him either taking off or seeking retribution.", "\n\n\"I'm the head of the largest crime family in this state. ", "I carry around rope like normal people carry a pack of gum. ", "I never leave home without it,\" Christian said with a wry smile. ", "Bobby wasn't quite ready to start cracking jokes with Christian, but he had to admit it was a pretty witty response. ", "He bit his lip to hold back a smirk, and Christian patted him on the shoulder. \"", "I get it _Officer_ ; I'm still the enemy here. ", "I'm not trying to be best friends, but I have a feeling we're in for a long night so you might as well warm up to me now.\" ", "Bobby and Christian headed outside as Bobby pulled out his cell phone.", "\n\n\"You can put comedian on your list of career options, since you'll be in the market for one. ", "With any luck you'll get relocated somewhere real remote, maybe the Midwest. ", "Can you milk a cow?\" ", "Bobby pushed open the door as he heard Christian mumble an expletive or two under his breath. ", "It was clearly just dawning on Christian that he may not be picking his destination the way you would a vacation spot.", "\n\nBobby knew Piper would be bubbling over with questions and probably frustration. ", "But she'd have to wait a little longer to scold him because Michael needed an update first.", "\n\n# Chapter 23\n\nAs Bobby drove down the quiet streets of Edenville, he tried to wrap his mind around the evening's events. ", "He never would have imagined his passenger tonight would be Christian Donavan. ", "He assumed, instead, the man would be handcuffed and riding in the back of his cruiser. ", "He was equally surprised how well Piper had taken the direction he'd given regarding her heading back to Betty's and waiting for him to call. ", "He had thought, for sure, she'd be furious for the sudden change of plans and her lack of involvement in the next few steps.", "\n\nThe quick conversation he'd had with her was still spinning around in his head. ", "He had turned the words over and over in his mind trying to make sense of it. ", "When he had sidled up to her car window and waited for her to roll it down, he was shocked by her smile. ", "He'd immediately apologized but she barely let him finish his sentence. ", "She had beamed gratefully up at him. \"", "Don't apologize, Bobby. ", "You didn't just save the judge's life tonight; you saved mine. ", "I thought I wanted him dead. ", "At first I was so angry that you put yourself in that situation, but when Christian finally lowered his gun and agreed to the terms you'd given him, I felt relieved. ", "I've seen so much in my life I thought Christian killing the judge would somehow fix everything, but now I think it would have destroyed me. ", "There you were again, rescuing me from something I didn't even realize was about to hurt me.\" ", "She had leaned out of the car and kissed him, a short peck on the lips, and then she sped off to Betty's house. ", "As usual, she had completely surprised him.", "\n\nChristian's hands were shaking as he bit his already short fingernails. ", "He wasn't sure why he felt compelled to speak, but he wanted someone to know this wasn't the life he had imagined for himself. \"", "I don't think my son knows who I am yet. ", "I think if we leave tonight and start somewhere fresh, some suburb with a gate and pool, he may actually never have to feel the way I did when I realized the kind of man my father was.\" ", "He stared out the window, speaking more to the stars than to Bobby.", "\n\n\"How old were you when you figured it out?\" ", "Bobby asked, genuinely curious about what it must have been like to realize your father was a criminal. ", "He now knew two people who had lived through that. ", "Bobby thought maybe Christian could give him some perspective that would help him understand Piper better.", "\n\n\"I was twelve. ", "I always thought my father was a foreman at a construction company even though, looking back, I realized he was never actually on a jobsite. ", "He never had any tools, and he never came home dirty or anything. ", "This particular Sunday, we were driving in his brand new red Cadillac Deville. ", "I loved that car, and my father was so proud of it. ", "He kept it immaculately clean. ", "Suddenly, this old shit-box pickup truck with two guys in the cab pulled up ahead of us, and the driver started slamming on his brakes. ", "I thought they were real jerks, maybe some kids messing around. ", "My father was furious, and I remember him saying he couldn't believe they would do this with his kid in the car. ", "Then they tossed their soda bottles out of their windows, and one made contact with the windshield and a crack spread across it. ", "I could tell my father wanted to speed up and take care of this right then, but he looked over at me, patted my leg and said we'd head home. ", "I remember memorizing the license plate in case my father wanted me to go with him to the police department to report the damage to his car. ", "I thought I'd be such a hero when the detective would come over and I would say TS-1874. ", "But I never had that chance. ", "My father drove straight home, bypassing the ice cream shop, and told me to head into the house and tell my mother he'd be late.\" ", "Christian cleared his throat, and Bobby could tell the story wasn't coming to a happy ending.", "\n\n\"The next morning I sat eating my cereal and watching the news with my mother. ", "I heard a story come on that immediately got my attention. ", "The reporter was standing in front of a burned out pickup truck surrounded by yellow police tape. ", "Over his shoulder I could make out most of the license plate, and I felt myself getting lightheaded as I realized it was the truck that had harassed us the day before. ", "The report stated that the two men in the truck had been shot in the head before someone torched the vehicle with a Molotov cocktail. ", "I didn't want to believe that my father had anything to do with it. ", "I convinced myself whoever was in the truck must have continued vandalizing vehicles and had crossed paths with the wrong person. ", "It wasn't until I was on my way down our driveway to catch the bus and saw my father pulling in that I realized he was the wrong person they had crossed. ", "He rolled down his window, and with a big smile on his face, told me how sorry he was we missed our ice cream cone the day before.", "\n\nWhen I leaned in his window for a hug goodbye I saw his hand wrapped in white bandages, and the smell of gasoline stung my nose. ", "When he saw me staring at his bandage he said not to worry he had burned his hand on the exhaust pipe of an excavator at work. ", "That was the last time I hugged my father. ", "For the next couple of years I watched everything he did. ", "I had my antenna up and put together the puzzle that was my father, each piece revealing a more complex and immoral man. ", "Then, as I got older, he pulled me into his life and made me a part of his world. ", "After years of feeling so distant from him, I'd do almost anything to be close to him again. ", "I know most of what I do looks like a choice, but you'd be amazed how quickly you can fall down the rabbit's hole and not know how to get yourself back out. ", "I've tried everything to legitimize my family's business, but every time I get us out of one deal we get pulled into something else. ", "I know it doesn't mean much to you, but I don't mess with the sex trafficking and prostitutes, I've stayed out of all the drug deals inside Edenville, and I was on the verge of ending our gunrunning. ", "We dropped a shipment a few months ago, and it was the last one. ", "We're still pretty deep in the gambling ring, and I know that's no more legal than anything else I mentioned, but I'd like to think it's a victimless crime.\" ", "Christian wasn't sure why he was pouring his heart out to this kid. ", "He had said more in the last five minutes to this practical stranger than he had said in the last year to people in his immediate circle.", "\n\n\"You aren't your father—you've got a great shot of putting all this behind you and sparing your son the things you went through. ", "You're doing the right thing tonight.\" ", "If there were any doubts swimming around in Christian's mind, Bobby was trying to proactively squash them. \"", "This is the place. ", "Michael asked me to come to his office first so he could talk with me privately about something, and then have you join us, but I'm thinking we should stick together,\" Bobby said, putting his truck in park outside Michael's office building.", "\n\n\"Let's get this over with.\" ", "Christian swung open his door and huffed loudly, obviously dreading this moment even as he knew it was his best shot at a new life.", "\n\nThey entered through the back door of the office building Michael had suggested and boarded the staff elevator. ", "It was a quick but quiet ride up to the ninth floor and as the elevator door split open Michael came into view.", "\n\n\"Are you kidding me!\" ", "Christian exclaimed, his eyes large and his face immediately turning red. ", "He knew this was all too good to be true, deals like this never worked out. ", "He reached his hand to his side where he would normally keep his gun and clenched his fist when he realized he no longer had his weapon. ", "His only hope was there wasn't an army of the judge's men waiting just around the corner to torture or kill him. \"", "This is the lawyer we're meeting with? ", "You're dumber than I thought kid. ", "He's on the judge's payroll, and I'm getting the hell out of here. ", "The deal's off.\"", "\n\nBobby heard the words, but they didn't compute in his head quickly enough for him to even make an attempt at correcting Christian or to stop him from repeatedly hitting the close-door button on the elevator. ", "Luckily, Michael had his wits about him and put his arm across the closing door, and it popped back open.", "\n\n\"Give me a chance to explain,\" Michael said hurriedly, imploring Bobby to step off the elevator and into his office so they could talk. ", "If Michael was trying to calm Bobby with his demeanor he was doing a terrible job considering his forehead was covered with sweat and he was almost breathless. \"", "This is why I wanted to meet with you first. ", "This is what I wanted to tell you on the phone earlier.\"", "\n\n\"You wanted to tell me that you're on the judge's payroll?\" ", "Bobby asked incredulously, his brow furrowed and his stomach turning in knots. ", "He had prepared himself to be surprised by how deep this conspiracy would run, but he never assumed how close to home it would hit.", "\n\n\"No. ", "Well, not exactly, it's a long story, but if you don't get off the elevator I'm not going to be able to tell you any of it.\" ", "Michael said, gesturing for him to step through the doors and give him the opportunity to explain.", "\n\nChristian crossed his arms over his chest and glared at Bobby, refusing to address Michael. \"", "I'm not getting off this elevator. ", "If you want to chitchat with your buddy here, you can get off and let me go or he can get on and start talking.\" ", "With that, Michael acquiesced and joined them on the elevator. \"", "Listen Bobby, it's not what you think. ", "Not everything is black and white, good guys and bad guys. ", "If you hear my side of the story I know you'll understand.\"", "\n\n\"I can't believe I let you get close to Jules,\" Bobby yelled, his fists clenched and ready to strike his betrayer. \"", "How could you screw all of us like this? ", "What exactly have you been doing, losing cases on purpose or something?\"", "\n\n\"Yes,\" chimed in Christian, \"that's exactly what he did. ", "It was with one of Duke Cheval's guys who caught a case for possession with the intent to distribute. ", "Your buddy here sandbagged the case on purpose.\" ", "Christian's voice was angry, and his finger was pointing accusingly at Michael.", "\n\n\"That isn't true, how about you tell the whole story, Christian?\" ", "Michael sighed somewhat dejectedly, and launched into his explanation. \"", "Some people approached me about making some evidence in the case disappear, and I told them to go to hell. ", "They came back and threatened me, so I threatened them right back, letting them know they didn't scare me. ", "I told them I intended to have them charged with tampering and intimidation. ", "A week later I got a package in the mail loaded with pictures of my baby sister who was away at college. ", "There were photos of her in class, out in the campus courtyard, and sitting in the local coffee house. ", "Then finally there was a picture of one of Cheval's guys talking to her in front of her dorm. ", "A note read, 'You might not be afraid but you can bet she will be.' ", "I had my sister leave school immediately and sent her to stay with our uncle. ", "I tried the case and brought forth all evidence I had available. ", "I still lost, but it wasn't for a lack of trying, I can promise you that.\" ", "Michael choked out, his voice catching as he stared hard at Bobby. \"", "I could have brought the evidence to the judge but, just like you, I had no idea who I could trust. ", "I did my job without hesitation, and my conscience is clean. ", "I'm sorry that I didn't tell you that I'd been approached by these idiots. ", "I was trying to put it all behind me. ", "The moment I heard you and Piper had a plausible plan to do something about it, I got on board.\"", "\n\nBobby turned from Michael to Christian who was now noticeably silent and staring at the floor of the stopped elevator. \"", "I don't know the details,\" he mumbled, sounding much less confident than he had moments earlier. \"", "I remember hearing chatter that he wasn't really playing ball and that they were going to pay a visit to someone in his family. ", "When I heard the guy got off, I just assumed their threats had worked and Michael had thrown the case.\"", "\n\n\"You know what they say about assuming,\" Michael barked. \"", "Only assholes do it.\"", "\n\n\"I'm pretty sure that isn't the saying,\" Christian replied, shooting a dirty look back at Michael.", "\n\nBobby waved his hands, cutting through their childish attacks. \"", "You should have told me,\" he said, his mind bouncing between anger and pity. ", "Michael was right, he'd have certainly done the same thing if he thought Jules, Betty, or Piper was in imminent danger. ", "Look at how many concessions he had already made since starting out on this. ", "It wasn't like Michael had lost the case intentionally or destroyed important evidence. ", "Should he have blown the whistle? ", "Maybe, but as Bobby was starting to find out not everything was quite so cut and dry.", "\n\n\"Judge Rosenthal is going to be here any minute.\" ", "Michael said impatiently. \"", "She's probably down there right now wondering what the hell is wrong with the elevator. ", "We've got one shot at this, and if she thinks for a minute we aren't all calibrated then she'll pull the plug. ", "You won't get your protection and relocation,\" Michael said pointing at Christian, \"and you, Bobby, won't get your justice.\"", "\n\nBobby turned to Christian and tried to put this whole thing in perspective. \"", "You remember earlier tonight when you told me you wanted your brother to be included in your relocation? ", "It goes against everything I believe, but I am going out on a limb, because I trust you'll get him help. ", "You know him better than I do, and if you really believe you can help him then I have to default to you in order to make the rest of this work. ", "I'm asking you to do the same. ", "I know Michael, and I believe him. ", "Without him we can't pull this off.\"", "\n\nChristian didn't speak. ", "He only nodded and rolled his eyes. ", "Michael released the stop button on the elevator and they all stepped out as the door opened back up.", "\n\n# Chapter 24\n\n\"Judge Rosenthal, I can't thank you enough for coming out this time of night. ", "I know it's a little unorthodox, but I can assure you it will be worth your while,\" Michael said in his work voice, which was a bit softer and more polished.", "\n\n\"Mr. Cooper, until I came in and saw Mr. Donavan sitting there I was prepared to give you quite the tongue-lashing regarding after hours calls to a judge. ", "Now I must admit I am a little intrigued,\" Judge Rosenthal said. ", "She was a tiny woman with frail hands and wispy brittle hair. ", "Her pointed nose nearly took up half her face and her thin lips seemed to be permanently pursed. ", "She appeared meek, but as Michael had seen firsthand in the courtroom, one should never mistake her stature as a weakness. ", "There was nothing weak about Judge Rosenthal.", "\n\n\"I've always known you to be a highly ethical and unbiased judicator. ", "I've enjoyed every opportunity I've had to try a case in your court.\" ", "As Michael attempted to continue, the tiny judge cut in.", "\n\n\"Don't let me give you the wrong idea, Mr. Cooper, just because I am intrigued doesn't mean I want to sit here all night while you blow smoke up my ass. ", "I still have hopes of getting to bed at a decent hour, so get to it.\"", "\n\n\"Mr. Donavan has long been aware of judicial misconduct by Judge Lions.\" ", "Michael cleared his throat and continued, \"He has been privy to and part of multiple counts of bribery, extortion, and intimidation all spearheaded or supported by Judge Lions. ", "He has ample evidence of this and is here tonight to give a sworn statement regarding his information,\" Michael explained curtly, knowing that Judge Rosenthal was not in the mood for fluff.", "\n\nJudge Rosenthal looked wary. \"", "And I suppose he's doing this because of a sudden spell of conscience? ", "Or should I assume that he is looking for full immunity and most likely some kind of witness protection?\" ", "The judge pushed her glasses up tighter to her face from the bridge of her nose. ", "She had done her job long enough to realize nothing this size came without costs.", "\n\nMichael knew this was a game of chess and he was playing against an expert. \"", "Mr. Donavan feels when he provides this information he will be at great risk as will his brother and son. ", "In return for his testimony he would like—\" The judge huffed loudly and cut in.", "\n\n\"Michael, for goodness sake, it's late and this isn't court, can we please cut the bull? ", "How serious is this? ", "I've had my concerns about Judge Lions for a long time, and I've been waiting for the right opportunity to end the ridiculous circus he considers a courtroom. ", "Are you telling me this is it? ", "Is this credible?\" ", "Judge Rosenthal pursed her lips together. ", "She would have gladly driven Christian to the airport herself if it meant removing a corrupt judge from his seat.", "\n\n\"Judge Rosenthal,\" Christian said quietly, \"it's more than all the legal stuff that brings me here today. ", "I've known about his deals for years. ", "I've given him buckets of money in return for favors.\" ", "Christian reached into his breast pocket and pulled out an envelope. \"", "I found these in his home,\" he said, sliding the pictures across the table to her. \"", "I've been a part of some pretty heinous things in my life, but I won't spend another minute dealing with a man capable of that.\"", "\n\nJudge Rosenthal pulled open the envelope and, in her composed fashion, thumbed through the pictures of Judge Lions and his victims. ", "She didn't gasp, or even wince, because, unfortunately, she had seen her share of these kinds of things.", "\n\n\"Mr. Donavan, I despised your father. ", "He was a brutal man with no moral compass. ", "I've had numerous people cross my path who were damaged by him in so many ways.\" ", "The three men all sat stone-faced, unsure what correlation she was trying to draw. \"", "But I adored you. ", "I saw you often around town, and you have the sweetest spirit and kindest eyes. ", "I would often pray for you, that you might have a chance to forge your own path and not fall prey to the legacy of your father. ", "As time went on I saw you being sucked into his world. ", "I thought perhaps when your own son was born or when your father died you would take those as opportunities to change your ways. ", "I want you to know that what you are doing here tonight separates you from your father. ", "There would have been no pictures awful enough, no crime vile enough, for your father to put aside a mutually beneficial relationship and do the right thing.\" ", "Judge Rosenthal reached her hand across the table and patted Christian's arm. \"", "Michael,\" she asked, getting back to business, \"what are you proposing we do next?\"", "\n\n\"I'd like for Christian to document everything he can and compile the evidence against Judge Lions. ", "Then he writes up his statement and coordinates with a witness protection team to get him out of here first thing in the morning. ", "Judge Lions is currently indisposed at a designated location where he can be picked up anytime a warrant is issued.\" ", "Michael could feel the wheels spinning in his mind. ", "There would be so many steps once this was put into motion.", "\n\n\"Your Honor,\" Bobby said quietly, \"there is a police officer who has been a right-hand man to Judge Lions for years. ", "He conspired to, or possibly did, kill an Edenville police officer ten years ago.\"", "\n\n\"Stan?\" ", "Judge Rosenthal questioned. ", "This time, there was unmistakable emotion in the judge's voice. ", "Bobby nodded his head, and she continued, \"I knew Stan well, we went to school together. ", "Do you have any proof that they were involved in his murder?\" ", "The Judge sat up a little straighter in her chair.", "\n\n\"I don't, and I'm not sure we ever will. ", "I thought it was important for you to know when we go through this process. ", "Christian can give you enough evidence and important information to implicate Officer Rylie in plenty and ensure he spends the rest of his life in jail. ", "I just wanted someone else to know, even if we couldn't do anything about it now.", "\n\nBobby knew it wasn't of any legal significance to a judge to know about crimes someone may have committed if there was no proof, but he came here to say his piece, and he wasn't going to let this opportunity pass by.", "\n\n\"I'm glad you told me. ", "If we can't find the evidence to incriminate them for the murder, we'll make sure they never see the light of day again. ", "It might not be exactly what you were hoping for, but it's certainly better than what they have right now.\" ", "Judge Rosenthal's smile was warm. ", "It was amazing how quickly she could transition from the stern, disciplined judge to a warm and comforting maternal figure.", "\n\n\"There is one more thing, Your Honor,\" Michael said clearing his throat nervously. \"", "Bobby was an essential part of bringing all this together. ", "Without him we never would have been able to pull it off.\" ", "Michael paused, surprised by the look of annoyance spreading across the judge's face.", "\n\n\"I can assure you, Michael, you'll all get your time in the spotlight. ", "I'm sure they can get someone very famous to play you in the movie version of this epic adventure you've been on.\" ", "The judge rolled her eyes, never surprised by the size of men's egos.", "\n\n\"You're misunderstanding me. ", "No matter how many of the people we put in jail, there'll always be someone seeking retribution for what we are about to do. ", "Bobby has lived here his whole life. ", "He has people he loves dearly who would be in jeopardy if his name was in any way associated with this. ", "He's not looking for notoriety. ", "On the contrary, I'm asking for anonymity for him. ", "I know we're not in the business of removing people's names completely from something like this, but I was hoping, considering the circumstances, you would make an exception. ", "Allow Christian to write his statement without mentioning his interactions with Bobby.\" ", "Michael wasn't speaking now as a lawyer, his shoulders weren't back, his chin wasn't up and his eyes were notably avoiding everyone in the room. ", "Michael had turned off his confident boisterous persona and was now only asking a favor for his friend.", "\n\n\"I genuinely hate putting my foot in my mouth, it really annoys me. ", "I'm sorry I misread your request for confidentiality. ", "Under these very unique circumstances I think we can find a way to leave Bobby out of the written statement. ", "I would imagine, Michael, that you, too, have people you would like to protect. ", "Is your desire for fame outweighing your concern?\" ", "She raised an eyebrow at him and smirked. ", "She assumed there was another reason for him not including himself in his request and she wanted to hear it.", "\n\n\"I don't intend to leave you standing alone in this,\" Michael responded. \"", "Christian is going to be getting relocation and protection, Bobby has more people here in town who deserve to be protected. ", "I know there will be some blowback, and I know what I signed up for.\" ", "Michael had returned to his courtroom posture and tone.", "\n\n\"That's all quite laughable, Michael. ", "I appreciate your concern, but I can assure you these men don't frighten me. ", "I never married. ", "I have no children, no family, and ample protection for myself. ", "What you have both done is extraordinary, and while you deserve the accolades of your community you are far more likely to get the retaliation of the many scorned people who will be losing either their freedom or their paycheck. ", "I suggest that before Mr. Donavan takes pen to paper and starts telling this story you make your decision. ", "You have an opportunity to wake up tomorrow morning and act as surprised as everyone else when you hear the news.\" ", "Judge Rosenthal pulled her phone from her purse and began typing a message on it. ", "She was trying to minimize this moment by not giving it her full attention. ", "She appreciated the gesture on Michael's part, but the fewer people involved the less likely the collateral damage.", "\n\n\"As long as you're sure, your honor, I would greatly appreciate it.\" ", "Michael felt a weight lift off his shoulders as the thought of his sister flashed through his mind.", "\n\n\"Yes, hurry up then. ", "I'm already out much later than I had hoped to be. ", "Mr. Donavan, let's get this straight then, you found these pictures while you were a welcomed guest in the Lion's home. ", "You felt it was your duty to ensure the judge is held accountable for his deplorable actions, and you therefore contacted me directly. ", "We met, drafted a plan for the relocation of yourself, your brother, and your son with the conditions that you turn over any and all evidence you have that pertains to Judge Lions and any of his associates. ", "Are we all clear on that?\" ", "Judge Rosenthal barely looked up from her phone as she spoke. ", "There was an opportunity here for anyone in this room to recant, to get cold feet, and she wouldn't be a part of making this moment feel profound, even though it was.", "\n\nThe three men shook their heads in agreement as they looked at each other. ", "The room was quiet now, and they fixed their eyes on the judge, waiting for their next direction, and she was happy to oblige.", "\n\n\"Mr. Cooper, I've just sent a message and there are two men on their way up. ", "They escorted me here tonight and will now be in charge of getting Mr. Donavan and his family on a chartered plane tonight.\" ", "She turned her attention over to Christian.", "\n\n\"Mr. Donavan, please draft your written statement and then contact your brother to ensure everyone is ready to leave within the hour.\" ", "The Judge stood, and, out of sheer habit, all three men stood as well. \"", "There is one last thing I'd like to say to the three of you. ", "This is a clean slate, Mr. Donavan, not a free pass. ", "There is a difference. ", "I will not be privy to where you have settled. ", "This is both for your protection and my own, but these two men,\" she said pointing to Bobby and Michael, \"will be informed. ", "If you or your brother step one toe out of line I will personally have you dragged back here and deliver you to whoever is offering the highest bounty for your head. ", "You haven't made good choices up until this point, but that doesn't mean you aren't capable. ", "I won't be around to give your brother the same warning, so I hope you will convey this to him. ", "When people are seeking revenge for this, I'm sure your brother will make a suitable substitute for you. ", "You don't want him shipped back here because he can't keep his hands to himself.\" ", "The judge moved toward the conference room door and flagged down two large men and waved them over. \"", "Michael and Bobby, it was a pleasure meeting with you this evening. ", "We have it all under control from here. ", "I'd tune in to the morning news tomorrow, I plan to send them one hell of a story to run.\" ", "She shook both of their hands and smiled widely at them.", "\n\n\"Bobby,\" Christian said, reaching his hand out. \"", "Thank you for stopping me tonight. ", "If you ever need anything don't hesitate to ask.\" ", "Bobby nodded his head and shook Christian's hand, amazed how this night had turned out.", "\n\nThe elevator ride was silent as Michael and Bobby attempted to process what had happened—what they had just accomplished. ", "As the elevator doors opened and they stepped out, Michael finally found his voice through the thoughts swimming in his head.", "\n\n\"We've got quite the story to go tell the girls, don't we?\" ", "Even though everything had come together, there was still one thing that terrified Michael. \"", "Bobby, I'm really sorry for not telling you about that case. ", "I should have trusted you enough to tell you, I should have believed you'd understand. ", "If you want me to head home and not come back to Betty's with you, let me know.\"", "\n\nMichael held his breath, not wanting to hop in his car and drive to his cold loft apartment and sit alone on a night like tonight, but he would if it was what Bobby wanted.", "\n\n\"I wish you had told me, but there's no rulebook for things like this. ", "Even if I was still mad at you I wouldn't be crazy enough to keep you from Jules tonight. ", "I had one near-death experience already, I don't need another.\" ", "Bobby slapped Michael on the shoulder. ", "It wouldn't have been so long ago that an infraction like Michael's would have been enough for Bobby to lose all respect and cut all ties with him. ", "The last few months had taught him the only thing that mattered was surrounding himself with people who cared—friends who cared about each other, about the world around them, and doing the right thing. ", "No one was perfect, but people can be perfect for each other.", "\n\n\"You think she'd miss me if I wasn't there tonight? ", "I thought maybe it was all this commotion and when this settled down she'd toss me aside,\" Michael said, relieved at the forgiveness and the invitation.", "\n\n\"She still might, but I doubt it. ", "She really seems to like you. ", "I know your reputation though. ", "Don't confuse my ability to get over the withholding of a part of your past with how I might act if you hurt her. ", "You won't survive that.\" ", "Bobby raised his eyebrows and wiped any sign of humor away from his face, he was serious.", "\n\n\"I like her Bobby, she's special. ", "I don't know where it's going to lead but I can assure you my reputation is grossly exaggerated, and I won't hurt her. ", "I guess I should give you the same speech about Piper. ", "I'm the closest thing she has to family as far as I can tell, and I don't want to see her hurt either.\" ", "Michael pushed through the front door and stepped out onto the sidewalk pressing the button to unlock his car.", "\n\n\"I don't intend to hurt her. ", "You might not be sure where things with you and Jules are going, but I have no doubts where Piper and I are headed. ", "I love her,\" Bobby laughed, not able to contain his happiness. ", "He had thought for years that he was in love with Jules, but now, in contrast to how he felt about Piper, he realized his affection for Jules was one of family.", "\n\n\"What? ", "Man, that's fantastic,\" Michael shouted. \"", "Just be careful, Piper is like a bird, you don't want to spook her. ", "She's always ready to fly away. ", "I think if anyone can figure out how to love her, it's you.\" ", "Bobby put his hand out expecting Michael's firm grip but instead Michael pulled him in for a hug. \"", "I'll meet you at Betty's.\"", "\n\n# Chapter 25\n\nAs Bobby drove his truck up Betty's long dirt driveway he tried to make this night about the victory they had all achieved. ", "He tried to direct his mind to the joy and relief Jules would feel or the vindication Betty would experience. ", "Instead all he could think about was Piper. ", "She brought him to this place in his life, this crazy moment he never imagined he'd experience. ", "He tried to force himself to think of Stan tonight, but instead the thought of holding Piper superseded everything.", "\n\nEvery lamp in the house was on, like a lighthouse calling the men home. ", "Bobby waited a moment while Michael pulled in, and they exchanged a knowing look as they stepped onto the driveway. ", "They knew they were about to be greeted with a whirlwind of questions and commotion. ", "They both took a deep breath as the porch door swung open and Jules came sprinting out.", "\n\nBobby felt a pang of sadness when he saw only Jules running toward them. ", "For the first time, she wasn't the person he was hoping to hold. ", "Judging by the familiar but quick hug he shared with her, it was clear she was thinking the same thing. ", "He had hoped to be embracing Piper by now, and she couldn't get to Michael fast enough.", "\n\nJules moved past Bobby and, staring up into Michaels green eyes, she asked, \"It's good news, isn't it?\" ", "She held her hands over her heart, protecting it.", "\n\n\"It's great news,\" Michael said, laughing as Jules jumped up toward him, throwing her arms around his neck and her legs around his waist. ", "Bobby was relieved to see Betty coming toward him, a good distraction from the passionate kissing he could see out of his peripheral vision.", "\n\nBetty put her warm hands on Bobby's cold cheeks and smiled. \"", "Well done, son. ", "He'd be so very proud of you.\" ", "She patted his cheeks and looked away before the tears gathering in her eyes spilled over. \"", "For the love of Pete, Julie Marie, dismount that man before you hurt him. ", "Act like you got raised right.\" ", "Jules rolled her eyes and slid her way down Michael. \"", "Plus I want to hug him,\" Betty said opening her arms wide to Michael.", "\n\nBobby could do nothing but stare at the screen door as Piper's shadow appeared behind it. ", "He wondered why she wasn't racing down to him. ", "Was she angry? ", "Hurt?", "\n\n\"That girl is crazy about you, Bobby,\" Jules whispered from behind him. \"", "She's a hard nut to crack, but she's got eyes for you something fierce. ", "Whatever you do, don't blow it.\"", "\n\n\"I'm wondering if I already have,\" he said quietly, his heart aching for her to join them. ", "Feeling out of options, he waved at her awkwardly, and could see the brightness of her smile against the darkness of the night. ", "The weight on his chest finally floated away.", "\n\n\"Let's all get up in the house and have something warm to drink. ", "I'm sure you've got lots to tell us, and it's colder than a cast iron commode out here.\" ", "Betty shooed them all toward the porch as Piper opened the door. ", "She patted Michael on the shoulder as he passed by and attempted to do the same to Bobby. ", "He caught her hand before she could, and pulled her out onto the porch, letting the door shut noisily behind her. ", "He didn't care if that drew the attention of everyone who was now inside—he wanted this moment.", "\n\n\"I've got a lot to say to you, Piper.\" ", "He pushed the loose hair off her face, tucking it behind her ear, and lowered himself slightly to meet her eyes.", "\n\nPiper was trying desperately to play it cool. \"", "You've got an anxious crowd in there waiting for details. ", "I'll be here when it's all over. ", "We'll get a chance to talk.\" ", "She hadn't expected how overwhelmed she'd be at the sight of Bobby, safe and standing in the doorway. ", "If life up to this point had taught her anything it was that loving something too much was dangerous. ", "Her feelings for Bobby scared her. ", "The amount of willpower it took to suppress her innermost thoughts of what she wanted for her life was stifling.", "\n\n\"I think I can deal with that. ", "We'll talk later. ", "But we'll kiss right now.\" ", "Bobby leaned in and kissed Piper with such urgency that she almost stepped backward. ", "It only took a second for the sweet taste of his lips and the smell of his clean skin to make her fall toward him. ", "His cold hand running over her cheek and through her hair sent chills through her whole body.", "\n\nAs he let her go he knew it may not be easy to love Piper, or to help her to let go of her past and believe in him, but it would be worth it.", "\n\nBobby heard Betty clearing her throat, and though his eyes were locked on Piper's he knew they had an audience.", "\n\n\"I'm happier than a puppy with two tails that y'all are getting on so well, but I've been wearing a hole in the floor pacing and waiting. ", "There'll be plenty of time for pawing at each other later.\" ", "Betty took the liberty of opening the screen door and waving them both in.", "\n\nThe group gathered in the familiar sitting room, and Bobby began to tell Betty and Jules the details of what had transpired. ", "Both sat with eyes wide and occasionally cursing at the realization of who was involved. ", "Piper was pleased as she heard him recount the details of the events between Judge Rosenthal and Christian Donavan. ", "She was so relieved to hear that not only would they see justice served, but they would be safe from any retaliation as well. ", "When Bobby finally finished, he asked if they had any questions for him.", "\n\n\"So they won't actually get charged with Daddy's murder? ", "They're going to jail and getting punished, but no one will ever know they killed him?\" ", "Jules didn't want to sound ungrateful for all that had happened, for the risks that everyone had taken, but she wanted her father's story told.", "\n\nMichael felt the need to step in and answer. \"", "No, I don't think they'll be able to charge them with it, but we won't know until more of this gets sorted out. ", "I know it's disappointing, but I can assure you that I'll follow it closely, and if there is any opportunity to do so, we'll pursue it.\"", "\n\n\"I'll tell you what,\" Betty said, sitting up straighter in her chair, \"the best thing you've ever done is not tell me about any of this until it was over. ", "I'd've cut that judge's throat and let him bleed all over his runny eggs without a second thought about spending my life in jail. ", "I know y'all took some big risks, and I want you to know I'm eternally grateful. ", "I can't tell you what knowing the truth has done for me. ", "It's a debt I'll never be able to repay.\" ", "Betty wiped tears from her cheeks.", "\n\n\"Well, I'll take my payment in pot roast,\" said Michael, trying to lighten the mood. \"", "Or fried chicken. ", "Really, I'm pretty flexible.\"", "\n\n\"I'll put a big meal out for breakfast tomorrow. ", "You kids are all staying over, aren't you?\" ", "Betty asked, looking hopeful for the company.", "\n\n\"Of course,\" said Bobby, ignoring the urge to grab Piper by the hand and drive her somewhere, anywhere they could be alone. \"", "Judge Rosenthal assured us all this would be the headline story tomorrow, so we should all be together to watch it.\"", "\n\nBetty nodded, looking exhausted. \"", "I'm turning in. ", "My heart is tired. ", "You kids stay up and help yourselves to anything in the kitchen. ", "I'll see y'all in the morning.\" ", "Betty went around and kissed each of them on the forehead then slowly dragged her tired body upstairs.", "\n\n\"We've got to go celebrate,\" Jules said in an excited whisper. \"", "Let's go out for a drink and dancing. ", "I can't sit in this house all night, I'll go mad.\" ", "She was standing now and practically jumping out of her skin.", "\n\n\"I think I'll hang back here. ", "My adrenaline has been on overdrive, and I need to unwind for a little bit. ", "You and Michael should go,\" Bobby said, stretching as if he were completely exhausted, even though he had never felt so awake.", "\n\n\"Come on, Michael, let's go out. ", "I'm so excited. ", "I want to have some drinks and laugh and have a good time,\" Jules said, pulling Michael up by his arms.", "\n\nThey all moved to the porch as Michael and Jules pulled on their coats to leave. ", "They couldn't keep their hands off each other, and every other sentence was punctuated by a kiss and a smile. ", "As they stepped off the porch, Michael turned back toward Piper who hadn't said more than a handful of words since they had returned. \"", "You good?\" ", "he asked, winking at her, knowing that maybe he should stay, but he really didn't want to.", "\n\nShe nodded yes and waved them off. ", "She couldn't fight the feelings that had followed her throughout her life, the melancholy in the face of everyone else's joy. ", "She didn't know why she felt worse in this moment than she had through all the turmoil of the last few months.", "\n\nAs Michael's headlights disappeared from view, darkness fell back over the front yard. ", "Bobby had begun loading wood into the firepit and searching around for the matches.", "\n\nPiper sat on the familiar porch swing and pulled a blanket over her legs. ", "She watched Bobby building a fire to keep her warm and realized that really was who he'd be to her. ", "Maybe she didn't know how to keep herself cozy and balanced on the inside, but he would keep lighting her fires to make up for it.", "\n\nHe sat down beside her, reminding Piper of the first time they had sat there together. ", "It was funny how wrong their perceptions of each other were then—how far from the truth. ", "Now it was like they were sitting down together for the first time as they really were.", "\n\n\"I know that I might have spooked you earlier when I said I thought I love you. ", "We haven't known each other long, and there has been so much going on you probably think I'm crazy. ", "That's why I want to take it back,\" Bobby said, pulling the blanket up.", "\n\nPiper didn't think she was ready to be loved, but that wasn't at all where she thought the conversation was going. \"", "I understand,\" she said, trying to mask her shock.", "\n\n\"I was wrong when I said I think I love you. ", "What I meant to say... what I _should_ have said... is I _do_ love you. ", "There's no hesitation here. ", "I know how I feel about you. ", "I won't rush you or pressure you to be something you aren't or to feel something you don't, but I'm not foolish enough to lie to myself or to you. ", "I didn't want to make some big proclamation tonight, but sitting out here with you right now, I'm having a hard time not blurting out some very corny stuff.\" ", "Bobby reached over and laced his fingers with hers. \"", "Will you sit and listen to me professing my love?\"", "\n\n\"We've been through a lot, Bobby, and I'm sure emotions are running high for everyone. ", "Part of me wants to get lost in your eyes and let you say sweet things to me all night, but a bigger part of me has no idea how to deal with all of that.\" ", "Piper felt her anxiety rising. ", "She'd prepared herself for all kinds of heartbreak in her life, all forms of disappointment, but falling in love was not something she'd readied herself for. \"", "I have some fundamental flaws, Bobby. ", "Like tonight when everyone was smiling and celebrating, that's not at all how I felt. ", "These moments when most people are overjoyed, I'm completely out of sorts. ", "I'm anxious and sick to my stomach, because for me these happy moments are fleeting. ", "When I let myself indulge in the idea of something even remotely positive, reality comes flooding back in to knock me down. ", "I'm not built to enjoy life; I'm built to endure it. ", "I don't understand why you would love someone like that.\" ", "Piper felt the tears as they moved down her cheeks, but she didn't care. ", "She wasn't self-conscious or afraid to look weak. ", "Bobby had seen more of her than anyone, and somehow he was still sitting here begging for the chance to love her.", "\n\n\"Piper there are so many things in this world to be afraid of. ", "Don't let happiness be one of them. ", "You don't understand why I would love you? ", "I love you because you are tenacious in the face of reality. ", "I love that you have no idea how incredible you are, because that means I get to be here when you finally figure it out. ", "There's a good chance that one of these days you're going to wake up and see yourself the way I see you, and I can't wait to be a part of that. ", "Whatever loving you brings my way, I'm ready for it.\" ", "Bobby brushed the tears from her cheeks and pulled her into a powerful hug. ", "She felt a little afraid of how tight it was, but when she let herself melt into him she realized this is what loving him would be like. ", "Maybe she'd feel squeezed, maybe she'd worry about not getting enough air, but it was the warmest, safest place she'd ever been and she didn't want him to ever let go.", "\n\n\"You must be pretty jealous of Michael and Jules then, aren't you?\" ", "Piper settled herself onto his chest and he rested his chin gently on the top of her head. ", "She hadn't really cuddled much before, but now she sure understood why people did it.", "\n\n\"Why in the world would I be jealous of the two of them? ", "I'm glad they are hitting it off, but I don't feel the least bit of envy.\" ", "Bobby gazed off into the fire. ", "He knew Piper didn't profess her love in deep terms of endearment, but she had let him hold her, and he took that as a small pledge of love for now.", "\n\n\"Hitting it off? ", "Where do you think they're going? ", "I imagine they went to have a few drinks, and soon they'll be having shameless passionate sex back at his place. ", "And you are sitting on a porch, watching a fire, holding my hand. ", "It doesn't seem like you planned this out quite right.\" ", "Piper smiled up at him and waited for another kiss, which he gladly gave.", "\n\n\"I wouldn't want to be anywhere else right now. ", "When I make love to you, I don't want to think about this day and everything that happened. ", "I don't want to share the day we make love with anything else. ", "I don't want to be clouded by adrenaline or cramped up in the cab of my truck like a couple of high school kids. ", "Tonight is about holding you and kissing you and showing you that it's safe to celebrate. ", "I've got the rest of my life to love you. ", "We'll have our moment, and it will be incredible.\" ", "Bobby squeezed Piper tighter, and while he really did mean what he was saying, there was part of him that wanted to ignore his own advice and find a quiet place to show her how he felt.", "\n\n\"Doesn't Betty have a bottle of strawberry moonshine up in her pantry?\" ", "Piper asked, sitting up and smiling mischievously. \"", "She did say we could help ourselves to whatever we wanted, right?\" ", "She hopped up and tiptoed her way into the kitchen, lifting herself onto the counter and pulling down the mason jar of moonshine Betty had shown her months earlier. ", "She decided to forgo the glasses and take turns with Bobby, sipping the sweet and potent concoction until she had no choice but to be content.", "\n\n# Chapter 26\n\nSometime during the night the fire burned down, but the moonshine had kept them warm. ", "Bobby and Piper had fallen asleep, awkwardly curled up on the porch swing, completely tangled in each other.", "\n\nBobby was startled awake by the sound of an approaching car, and he rubbed the sleep from his eyes. ", "The engine sounded rougher than Michael's car, and the shape of the headlights cutting through the night were unfamiliar. ", "His job required him to take notice of these types of things. ", "The lights were square, the car boxy, and there was a dim light on top of it. ", "In his sleepy stupor, it didn't make any sense.", "\n\n\"Wake up, Piper,\" he said, shaking her gently. ", "She heard the concern in his voice and immediately shot up, regretting the combination of the moonshine and the sudden movement. \"", "There's a strange car pulling in. ", "I think you should head in the house.\" ", "Bobby remembered his service weapon was hanging by his coat just inside the door.", "\n\n\"It's a cab,\" Piper said, squinting to see who its passenger might be. \"", "I can see the light on top of it.\" ", "Piper had seen more cabs in her lifetime than the average person. ", "She recognized it in an instant.", "\n\nAs Bobby stood, he pulled Piper up and behind him and inched slowly for the door. ", "He planned to quickly push Piper into the house and grab his gun. ", "But before he could pull the screen door open he heard the familiar bubbly laugh of Jules as she spilled out of the cab, losing her balance and rolling into the dirt. ", "Michael was a step behind, laughing too hard to help her up. ", "He handed the fare to the driver who abruptly backed out of the long driveway. ", "As the headlights disappeared, Bobby headed down the porch steps to retrieve the two drunken idiots before they hurt themselves.", "\n\n\"Really?\" ", "Bobby asked, looking down at Jules, who still couldn't contain her laughter or regain her footing. \"", "I guess I should be glad you guys took a cab.\"", "\n\n\"Well we know the cops around here are real tight-asses. ", "We didn't want to take any chances,\" Michael said as he pulled Jules up to a standing position. \"", "Help me get her in the house,\" he muttered, half stumbling over his own feet. ", "Bobby took notice of the buttons on Michael's shirt that were misaligned, clearly fastened hastily. ", "He turned to look back at Piper who was probably right about how Michael and Jules had spent their night of celebration, but Bobby still had no regrets.", "\n\n\"You're on your own buddy. ", "I've done my share of holding that big mop of red hair while she hugs the toilet. ", "The only help I'll give you is a little advice. ", "When she says she's feeling better and she's ready to go to bed, she's wrong. ", "Toss a pillow in the bathroom for her or you'll be changing sheets and scrubbing carpets the rest of the night.\" ", "Bobby turned on his heels and headed back to the porch and rejoined Piper who had settled back on the swing. ", "She smirked at him and found her warm, comfortable spot and pressed up against him.", "\n\nThey slept on and off for the next couple of hours until they heard the recognizable sounds of Betty preparing a meal in the kitchen. ", "Her steady humming and the clanking of dishes were soon followed by the most comforting smells of cinnamon and bacon.", "\n\nBobby stood and stretched. ", "His arm that had been propping up Piper's head for hours was completely numb, but it was absolutely worth it. ", "He pulled the reluctant Piper to her feet and kissed her face gently. \"", "Let's go watch the news,\" he said with a smile.", "\n\nBetty greeted them in the kitchen and said, \"Good Morning. ", "I'm sure hoping you are in better shape than the two lushes asleep on my bathroom floor. ", "I've got breakfast almost ready. ", "Bobby, go wake them for me, and Piper, turn on the television there.\" ", "Betty looked noticeably relieved this morning. ", "Piper knew it wasn't actually possible for her to have slept off a few worry lines, but Betty certainly looked more at peace.", "\n\nAs the whole group settled into the kitchen around the table, Betty spun the small television to face them. \"", "Don't be making a mess, either. ", "My broom has never been as busy as it has since you kids moved in,\" she said, handing them each a napkin.", "\n\n\"Don't look at me,\" Michael said defensively. \"", "I'm not a slob, it's these guys.\" ", "He pointed to each of them, placing the blame.", "\n\nBetty wasn't buying it. ", "She raised a skeptical brow and shook her head. \"", "I suppose it's someone else dropping the food you eat, under the chair you sit in. ", "I was born at night, but not last night, my boy.\"", "\n\nHe waved his hand at her playfully. ", "It certainly wouldn't be an issue today. ", "Jules and Michael could hardly glance over at the large stack of pancakes and bacon, as they recovered from their celebration last night.", "\n\nBetty hushed them all, quieting their complaining and jokes. ", "She loved the noise that surrounded her table this morning, but the news was about to start, and she didn't want to miss a moment of it.", "\n\n\"It's a new day here in Edenville and we're happy to have you with us this morning,\" the white-haired anchorman said. ", "Bobby had never been so happy to see his silly combed-over hair and busy, colorful tie. ", "The man was goofy, but he had been the anchor on the local news program since Bobby had moved here. ", "It was easy to take him for granted, but today, on a day when they anxiously awaited the news, it felt comforting that it would be coming from a familiar face. \"", "We've got a breaking story that you'll hear exclusively here at WNC4. ", "Late last night Judge Randall Lions was arrested on charges of sexual crimes against children, judicial misconduct, and a host of other crimes that we're told are still being assessed. ", "Judge Lions has been presiding over cases in Edenville for over twenty years. ", "He is the head of a popular non-profit organization that helps children of currently incarcerated parents gain an appreciation for the justice system. ", "Our sources tell us that this charity, Legal Buddies, was in some way associated with the charges brought forth this morning. ", "Judge Lions and his office could not be reached for comment, but we did hear from Judge Samantha Rosenthal who is helping spearhead the investigation. ", "Here is a clip from our interview with her.\" ", "The screen switched over to Judge Rosenthal sitting in front of a large microphone.", "\n\n\"Lord Acton, a historian and moralist, said, 'Power tends to corrupt, and absolute power corrupts absolutely.' ", "There are checks and balances in our society for a reason. ", "This corruption has gone on far too long, and I will personally work to ensure that everyone involved is held accountable. ", "The positive news is this case has an unprecedented amount of evidence and a strong corroborating witness. ", "This will be tried in a court of law, but I am incredibly confident that we have taken a very corrupt and perfidious man off the bench, and, more importantly, off the streets of Edenville.\" ", "At the end of her statement she looked directly into the camera and nodded her head, almost like a thank you. ", "Michael smiled, feeling like in part it was meant for him.", "\n\nThe show cut back to the quirky anchor. \"", "We thank Judge Rosenthal for making time to talk to us. ", "In other news, a longtime police officer of Edenville, Officer Aaron Rylie, was found dead in his home this morning of an apparent self-inflicted gunshot wound. ", "We have not been able to confirm yet if the events surrounding the arrest of Judge Lions and the alleged suicide of Officer Rylie are in any way linked. ", "We'll continue to investigate this rapidly unfolding story, and, as always, keep you informed.\" ", "The show broke to commercial, and Bobby leaned across and turned the television off as an uncomfortable silence filled the room.", "\n\nThey had expected to be whooping and hollering at the headline story this morning, but the news about Rylie had thrown them all into a tailspin. ", "Bobby thought perhaps he should speak, but couldn't find any words. ", "Luckily Michael was able to weigh in.", "\n\n\"He had the same opportunity as anyone to be tried and plead his case in court. ", "He made the choice to kill himself. ", "That isn't on any of us.\" ", "He looked around the room trying to read everyone's expression, but just found darting eyes and uncomfortable fidgeting, until he glanced at Betty.", "\n\nShe had her chin up and a look of defiance on her face. \"", "That's no skin off my back, I say let God sort it all out.\" ", "She stood up and dropped her napkin onto her plate. \"", "The sun is just starting to come up; we should all go out and enjoy it. ", "It's going to be a beautiful day.\"", "\n\nNo one had finished eating, nor did they really feel like filing outside to watch the sun come up, but there were so few things they wouldn't do for Betty.", "\n\nAnd as usual, Betty's idea was right on. ", "The sunrise was the perfect way to start this day fresh. ", "Watching the streams of light cut through the trees that lined the front yard was therapeutic. ", "The clouds were bright red—it looked as though someone had set fire to them.", "\n\nJules sidled up to Michael who was standing against the porch railing, and he wrapped his arm around her. ", "Betty hummed quietly on the squeaky wooden rocker. ", "Bobby and Piper were right back where they had just left, cuddled comfortably on the porch swing.", "\n\nJules rested her tired head on Michael's chest and took in the beauty of the morning sky. \"", "It's so colorful, but you know what they say, red sky at morning, sailor take warning. ", "I bet there will be a fierce storm tonight.\"", "\n\n\"Not always,\" Bobby said, looking down into Piper's sweet face, \"sometimes a magnificent sunrise is just that. ", "You don't always have to be waiting for the storm; you can just enjoy the colors.\"", "\n\nPiper got the message, and she didn't think she'd ever grow tired of hearing it. ", "If Bobby wanted to be the man who reminded her it was safe to enjoy the moment, then she'd let him. ", "She smiled up at him seductively as he slipped his hand under the back of her shirt and let his fingers dip slightly under the top of her jeans. ", "Everyone else seemed to be so mesmerized by the beautiful morning sky that Bobby felt perfectly comfortable leaning in toward Piper and nibbling her ear. ", "They had both been patient and responsible. ", "They had committed themselves to following through on what they had started, and now it was done. ", "The only thing left to do was give in to their desires.", "\n\nPiper's body was craving more of him. ", "If the fire she felt when they kissed was any indication of what making love to him would be like, she wasn't sure she'd survive. ", "Then again, it wouldn't be a bad way to go. ", "She pulled away from him as she saw Jules turning back toward them, grinning like a school girl with a secret.", "\n\n\"I'm exhausted,\" Bobby said, hopping out of the chair like he'd just been stuck with a needle in the backside. \"", "I think I'm going to head home. ", "Piper, I'll give you a ride.\"", "\n\nIt didn't seem possible, but Jules's grin grew even larger. \"", "Yes Piper, enjoy the ride Bobby is about to give you. ", "Don't forget to buckle up.\" ", "She and Michael leaned into each other, giggling.", "\n\nPiper's face was crimson with embarrassment as Bobby pulled her from the swing to her feet. ", "He wrapped his arms around her for a hug and whispered through her hair, \"I might even let you drive.\"", "\n\nShe shook him off and dug her elbow into his side, pretending to be annoyed. ", "In reality she was desperate to get somewhere alone with Bobby. ", "She wanted to be on him, under him, she wanted him in a way she had never imagined possible.", "\n\nBobby put his arm over her shoulder, and they were about to head into the house to get their things when Bobby's ringing cell phone drew everyone's attention. ", "It was early for a phone call, especially since everyone he normally talked to was standing there with him.", "\n\n\"Good morning Captain Baines,\" Bobby said, trying to keep his cool even though his instincts were telling him something might be wrong. ", "At first Piper thought little of the call until she saw the blood drain from Bobby's face as he dropped his voice lower and stepped into the house and out of earshot.", "\n\nA knot formed in Piper's stomach, and judging by the worried looks passing between all of them, she wasn't alone. ", "Perhaps something had already gone wrong with the judge's case. ", "What if Christian and his family hadn't made it safely out of town yet? ", "Maybe Judge Rosenthal's promise of anonymity for the group hadn't panned out.", "\n\nBobby was pulling on his duty belt as he stepped back onto the porch. ", "He could feel the pressure of nervous stares weighing down on him. ", "They all had reason to worry, but only one of them, beside himself, would know why.", "\n\n\"A girl was attacked on campus early this morning. ", "Due to everything going on with the judge and the scene at Rylie's house, they need all available hands on deck to secure the evidence at the college.\" ", "Bobby pulled on his coat and tried to think quickly about how to proceed. ", "How, he wondered, could he tell them all the truth yet not break the trust Piper had placed in him?", "\n\n\"Is the girl going to be all right?\" ", "Jules asked, leaning into Michael. ", "All this drama was making her weary. ", "Hopefully this story would have a happy ending.", "\n\n\"She was beaten badly and is in critical condition. ", "Betty, it's going to be a long day, do you have anything I can take with me to eat?\" ", "Betty shot up and hustled into the house, happy to oblige. \"", "And Jules, I left my shaving kit up in the bathroom – can you grab it for me and bring it down? ", "I can't go to work looking like this. ", "I'll have to hit the precinct first.\" ", "Jules hurried into the house to gather Bobby's forgotten things. ", "She hadn't always been so accommodating, but Bobby could feel the direction of their relationship finally changing for the better. ", "He owed it all to Piper.", "\n\nThe moment they were gone, Bobby spun toward Piper and crouched down in front of her. \"", "The girl who was attacked this morning,\" he started in a no-nonsense tone, \"had the number twenty-three carved into her thigh. ", "I'm going down there to get more information, but this can't be a coincidence.\"", "\n\nPiper brought her hands up, covering her mouth as she gasped. ", "Her eyes immediately filled with tears and her body started to tremble. ", "Her worst nightmare was becoming a reality – her father was back for her. ", "Bobby leaned in and squeezed her tightly. ", "As he pulled away, he whispered to her, \"you're not alone anymore, Piper. ", "We're in this together.\"", "\n\n\"Why the number twenty-three?\" ", "Piper asked, clinging to Bobby's arm, not ready for him to let go. \"", "It doesn't make sense. ", "Delanie was his twenty-fourth victim. ", "If it really is him, why use the number twenty-three again? ", "It has to be a copy-cat. ", "It can't be him.\" ", "Piper knew she sounded manic, she could hear her voice rattling with fear. ", "She needed Bobby to look her in the eye and tell her it wasn't her father. ", "She needed him to tell her she was right, that it didn't make sense and there had to be some other explanation.", "\n\nInstead, he was already connecting the dots in his mind. \"", "It could be, but if he knows you're alive now, if he's found you, then he's likely sending you a message. ", "When he killed Delanie, he thought you were dead. ", "I'd imagine he'll want to try to draw you out and finish what he started. ", "I don't have all the answers yet, but that's what my gut is telling me.\"", "\n\nHe hated to loosen his grip on her while she was still shaking, but time was of the essence. \"", "Michael, we have a little trouble.\" ", "Bobby couldn't find the right words, and he knew he didn't have the time to explain, but luckily he didn't need to. ", "He and Michael had learned to trust each other over the last few weeks and along with that came the ability to read between the lines. \"", "The attack at the school hits close to home for Piper. ", "It might be nothing, but we can't take that chance. ", "I need the girls to go to your house. ", "I know I've already asked so much of you, but I swear, once my shift ends at nine, you're off the hook.\"", "\n\n\"I'm not looking to get off the hook here,\" Michael said in a low voice, glancing over Bobby's shoulder at Piper who was clearly shaken. \"", "I've got your back, man, we'll talk more tonight. ", "Until then I won't let any of them out of my sight.\"", "\n\nJules and Betty rejoined them on the porch, both obediently holding the items Bobby had requested. ", "Piper had managed to compose herself and stood to wave Bobby off. ", "Michael read this as a sign that Piper was not about to make her concerns about the attack public knowledge.", "\n\nAs Bobby hopped down the porch stairs, he looked back over his shoulder at Piper. ", "He was fairly certain the brief moment of calm they had all just experienced was about to be snuffed out. ", "Odds were that Piper's father had found her, and everything they had hoped to start would once again have to wait. ", "They were about to come face to face with the darkest parts of Piper's past, but they were going to do it together.", "\n\nThe End\n\nIncluding Chasing Justice (Book 1 in the Piper Anderson series), Danielle Stewart has 5 free books to kick off a new series. ", "Start one for free today with any of these books below:\n\n* * *\n\nChasing Justice\n\nFlowers in the Snow\n\nThree Seconds To Rush\n\nThe Bend in Redwood Road\n\nThe Way Down\n\n# Excerpt from Book 2, Cutting Ties\n\nBobby:\n\n* * *\n\n**When I became a police officer I swore an oath.** \"", "On my honor, I, Robert Murphy Wright, will never betray my badge, my integrity, my character, or the public trust. ", "I will always have the courage to hold myself and others accountable for our actions. ", "I will uphold the constitution, my community, and the agency I serve. ", "So help me God.\" ", "As I run that last phrase through my mind, I realize it has morphed from an affirmation to a plea. _", "Help me, God_.", "\n\nI pledged to tell the truth, to execute the law, because the law is the only thing that separates us from living in a state of anarchy. ", "We are not meant to be judge, jury, and executioner. ", "Falling in love was not supposed to challenge that. ", "They were mutually exclusive ideas. ", "You should be able to love someone and honor your responsibilities at the same time. ", "That is, unless the person you love has been failed by the system so many times she can't trust it. ", "If I'm constantly searching for ways to stand behind the words I swore that day, and she is forever looking for channels that undermine them—can we truly find happiness together?", "\n\nMeeting Piper, the daughter of a serial murderer, was like winning the worst kind of lottery. ", "No matter how much I try to rationalize it, try to convince myself loving her is dangerous, I can't stop. ", "I watch her battle herself, wondering if the wickedest parts of him are somehow a part of her. ", "She rubs her hand over that scar he left on her leg, the number twenty-three carved so precisely, and I know she fractures a little more. ", "Something broke me the same way it broke her, we just pieced ourselves back together differently.", "\n\nWitness protection was supposed to be the answer for her. ", "Edenville was supposed to be her fresh start. ", "Watching her accept the unreserved affection of my friends, Betty and Jules, gave me a hope that maybe she could find peace. ", "Maybe we could find a way to love each other.", "\n\nBut I didn't plan for the fact that her past wasn't quite as buried as she hoped. ", "When I got the call that a girl on campus had been attacked, the number twenty-three carved into her leg, I knew the trajectory of our lives was about to shift. ", "But something doesn't fit. ", "Too many facts don't align with the normal methods of her father, the Railway Killer. ", "Has he found her or is someone emulating his evil? ", "Why use the same number again? ", "Especially considering Piper was not his last victim. ", "Her mother was number twenty-two, and the unfortunate girl killed after Piper's attack was twenty-four. ", "This discrepancy is the small glimmer of hope I'm clinging to.", "\n\nYes, I fell in love with a fragmented and damaged girl, but she isn't the only one with a dark past. ", "I have my own secrets, my own history. ", "I begged and fought to know hers with no intention of ever revealing my own. ", "Not to her, not to anyone. ", "With every second that ticks by, every inch closer we get to her past, I'm afraid we'll end up unearthing my own. ", "Life isn't supposed to be this hard, love isn't meant to be this complicated. ", "So why don't I walk away? ", "Those eyes. ", "Those big, brown, old-soul eyes of hers just keep calling out to me. ", "One run of my fingers through her silky, dark hair, one brush of my lips on her skin, and I get dangerously distracted from what I believe.", "\n\n# Excerpt from Book 2, Cutting Ties - Chapter One\n\n\"I heard it was a crazy scene over at the university. ", "Did you get a peek at that girl's leg? ", "Creepy,\" Officer Lindsey LaVoie said as she squatted down next to Bobby and laced her boots. ", "He still hadn't gotten used to seeing her in the precinct locker room. ", "It was pretty clear none of the male officers had. ", "Prior to her being allowed in there, many of them had often strutted around naked with their chests puffed out proudly. ", "Now they scurried from the shower to the stalls wrapped in robes or towels. ", "Bobby actually appreciated the change. ", "As far as he was concerned no one should have to look at that many hairy asses before breakfast.", "\n\nIt had been a long battle, Lindsey against the whole department, but she'd finally won. ", "All it took was threats of legal action. ", "Bobby could understand. ", "She just wanted to be treated as an equal, like anyone else on the force. ", "But that was still a far cry from reality. ", "She'd been granted the right to ready herself in the locker room, but her peers found other ways of punishing her for not being a man. ", "They responded just a little slower than normal when she radioed for back up. ", "Partner assignments were like a revolving door after each officer inevitably complained to the captain. ", "Bobby knew when it was his turn to partner with her he'd make it work. ", "Lindsey was as effective as any of the officers he'd worked with, and he trusted she always had his back. ", "They'd formed a casual friendship primarily built on the fact that he didn't treat her like garbage—a low standard but a welcomed change for her.", "\n\nHe watched as she pulled her blond hair into a tight bun with quick precision. ", "It was a good representation of her overall performance on the force. ", "She was incredibly efficient, quick, and reliable. ", "Bobby thought she had a nice face, but her body was built stronger than he preferred. ", "She had a sturdy frame that she worked tirelessly to keep solid and competitive. ", "He had made a point to refrain from deciding if she was attractive or not. ", "To him she was a colleague, and just like Bill Thomly with the buckteeth or Micah Chilling with the handlebar mustache, the way she looked didn't determine how she did her job. ", "The problem was part of him kept wishing he were attracted to her. ", "Wouldn't it be easier to love someone like Lindsey? ", "Knowing that you both believed in doing things the right way, knowing you'd both sworn the same oath. ", "He didn't want to stop loving Piper, his feelings for her were stronger than anything he'd ever felt. ", "The spark when he touched her and the chemistry and bond between them was something he'd waited for his whole life. ", "But as he watched Lindsey he let the stray corners of his mind admit that loving her would be easier, and probably much smarter.", "\n\n\"I didn't see the cut on her leg, but I heard the girl was a wreck,\" Bobby replied, fighting off his inner voice and reminding himself it was Piper he'd been thinking about all day. ", "She was the one he was counting the minutes until he could hold.", "\n\n\"What do you think? ", "An angry ex-boyfriend or something? ", "It seems kind of sadistic.\" ", "It wasn't uncommon for Lindsey and Bobby to chat about a crime that had occurred, to brainstorm, but this was different. ", "He did have an idea who it was and why it happened, but he couldn't bring himself to say it.", "\n\nIt had been a long shift, and as late afternoon set in he was ready to get out of there. \"", "I've got to head out. ", "If you hear anything will you give my cell a call? ", "I'd like to stay up to date on it.\" ", "Bobby slapped her on the shoulder like he would any other officer, but he awkwardly pulled his hand away slowly. ", "Nope, that didn't feel right. ", "Was that too hard, he wondered? ", "Did I make her feel uncomfortable? ", "She read his face and laughed.", "\n\n\"Come on, Bobby, I'm not made of porcelain. ", "Get over yourself.\" ", "She punched his shoulder and he stumbled back with the force. ", "No, he thought, she was certainly not fragile. \"", "I'll call you if I hear anything,\" she chuckled. \"", "Have a good one.\"", "\n\nPiper hadn't slept in far too long. ", "After hearing about the campus attack that was eerily similar to the attacks her father had committed, Bobby had insisted Piper, Betty, and Jules spend the day at Michael's house. ", "She wanted to say they didn't need a babysitter, but having Michael around did put her mind at ease. ", "They'd be safer there, and though she had faced plenty of danger in her life, this felt different. ", "Piper kept fighting the gnawing feeling that once again she'd roped innocent people into her mess of a life. ", "Betty and Jules had welcomed Piper into their lives so willingly, and all she'd done so far was muddy it up. ", "Michael, the lawyer she suckered into helping take down Judge Lions, kept getting pulled further into her wake of troubles. ", "At some point she expected them all to realize loving her was more trouble than it was worth, and that scared her.", "\n\nPiper spent the day counting the minutes until Bobby's shift would be over and he could tell her what he'd found out about the campus assault. ", "Did they know who did it? ", "Was it her father? ", "She had wanted to fight sleep and stare out the window until she saw him pulling up, but her eyes grew heavy as lead, her head too weary to hold up. ", "She finally took Michael up on his offer to crash in his bed. ", "It took only a minute before she fell into a fitful sleep.", "\n\nShe'd been haunted by nightmares most of her life, but since she'd moved to Edenville, they'd subsided. ", "With the possibility of her father finding her, that dry spell seemed to be over. ", "Her mind clouded over with a familiar scene. ", "This was a nightmare she'd had before. ", "It wasn't soft around the edges like a dream sequence in a movie. ", "It was sharp, and the way it took her senses hostage made her feel like the prisoner. ", "She couldn't just see the scene, she could smell her father's musk, feel the wobble in her chair. ", "Her sleeping body was helpless now as it overtook her mind.", "\n\n_\"This tastes like shit! ", "I swear to God, Coco, you can't cook a meal to save your life. ", "This isn't what I wanted!\" ", "her father shouted across their lopsided thrift store kitchen table._", "\n\n_Piper, a smaller version of herself in this dream world, shrank down into her seat. ", "Her father's raised, sharp voice had that effect on her. ", "She was twelve years old. ", "Her father had insisted they sit down for Christmas dinner, something they had never done before. ", "The entire holiday season really meant nothing to her family. ", "There were never presents, special traditions, or family gatherings. ", "The only thing Christmas brought was a more glaring contrast between them and happy families. ", "It was the perfect time of year to realize how little you had._", "\n\n_Her father spoke again, and now he was manic, desperately trying to recreate a scene he'd seen on television. ", "He'd wanted them all to play a part, and so far it wasn't going according to plan. ", "He was spiraling out of control. ", "He'd wanted the house decorated, but her mother couldn't come down from her high long enough to hang the stockings properly. ", "He'd wanted a nice meal, a true holiday dinner, but cooking was something her mother was not capable of. ", "Everything was burnt, or soggy, or cold._", "\n\n_\"I told you I wanted this to be like the movie,\" he hissed, beating his hand on the table. ", "Piper knew what came next. ", "Her father's emotional escalation was the same almost every time he beat them. ", "First he'd bang his fist on a table, a wall, a car. ", "Then he'd throw something. ", "This particular time it was a plateful of freezing-cold instant mashed potatoes. ", "The way they landed with a squishy thud on the floor almost caused Piper to laugh, but she knew it would enrage her father more. ", "Finally, he would toss a few more inanimate objects before moving on to her mother._", "\n\n_It was by no means a one-sided fight. ", "Her mother would defend herself, sometimes even initiate the violence. ", "It was a relationship Piper never understood. ", "They were two toxic people who brought out the worst in each other, but just couldn't bear to be apart. ", "When one escalated, or spun out of control it seemed to fan the fire in the other._", "\n\n_There were days Piper could slip away, be forgotten, and escape the wrath. ", "This was not one of those days. ", "Her father's rage was bubbling over as the Christmas scene he had tried to orchestrate fell miles short of his expectation. ", "Now they would pay the price._", "\n\nPiper shot up in bed, sweating and panting. ", "She heard her own voice whimpering just as she had that day, the Christmas that never was. ", "She looked around the room, trying to get her bearings. ", "Michael's bedroom, she reminded herself. ", "Safe.", "\n\nShe thought back through the dream for a moment, reliving it through the eyes of her younger self, but now processing it as an adult. ", "Piper hadn't known her mother's real name wasn't Coco until she was nineteen years old. ", "She watched her mother fill out a job application and scribble down the name, Caroline Murphy. ", "She often wanted to ask her mother where the nickname came from, how long she had been called Coco, but she never found the right moment. ", "That could sum up much of her relationship with her mother, never quite the right moment to talk, to understand each other, to say the words that sat heavily on their minds.", "\n\n\"You good?\" ", "she heard Michael ask, his large frame leaning in the doorway. ", "He had heard her struggling and saw her awaken startled and upset. ", "She drew in a deep, centering breath and nodded her head. ", "Michael was a very calming presence in her life now, and she felt better just seeing him. ", "His sandy blond hair had gotten long in the last few weeks, and he was in need of some gel and a comb. ", "But Michael was one of those men who would have to try really hard not to be attractive. ", "Even as he lost focus on his grooming during this chaotic time, he still looked better than most men who'd put hours of work into their appearance. ", "You couldn't do much to dim the brightness of his emerald eyes or take away from the strength of his boxy, distinguished jaw. ", "He belonged on the cover of a romance novel, his muscular arms lifting the luscious blonde woman with a heaving bosom. ", "His shirt torn open, the skin of his perfectly smooth chest would be a glowing bronze. ", "Yes, Piper thought to herself, if Michael's career as a lawyer was ever to fall apart, he could certainly make some money in other ways.", "\n\nIt took another few minutes after Michael returned to his living room for Piper to gather herself. ", "She smoothed her wild dark hair down and rubbed the rest of the sleep out of her eyes. ", "She glanced over at Michael's sleek alarm clock and realized time had gotten away from her. ", "She leaped from the bed and headed through the apartment toward the window. ", "Without a word, she skipped right by Betty and Jules who were sipping tea around Michael's glass dining room table. ", "Bobby should be here, she thought. ", "He should know what's going on by now. ", "As she peeked out the window, she saw his red pickup pulling in. ", "She ran down the old industrial stairs of Michael's apartment building and burst through the heavy rusted door to greet him.", "\n\nShe felt the knot in her stomach tighten as she read Bobby's grim expression. ", "He stepped out of his truck with heavy shoulders. ", "His dark brown eyes were filled with worry and his jaw was clenched. ", "She couldn't imagine the news would be good, not with that look on his face.", "\n\n\"What did you find out?\" ", "she asked, her voice shaking with emotion. ", "The cold air sent a shiver through her. ", "Her thin cotton shirt was no match for the late fall air.", "\n\nHe walked hesitantly toward her, hating to see her sad, wanting to save and warm her all at once. \"", "It's still early in the investigation. ", "The girl is in stable condition. ", "She told detectives she was attacked from behind, and no other witnesses have come forward. ", "It's too soon to know, really. ", "The forensics team is just starting to go over the evidence now. ", "I don't know much more than I did when I left this morning.\" ", "Bobby opened his arms and she fell wearily into them, letting the muscles of his biceps tighten and curl around her. ", "They were both so tired, physically and emotionally.", "\n\nShe reached up and ran her hand through his short dark hair, and down his neck. ", "It was funny to her that even though they hadn't loved each other long, she seemed to have figured out small yet important things about him. ", "When he was stressed out he stopped shaving, as if the energy to slide the razor down his cheek was too much for him. ", "Or maybe the time spent looking in the mirror made his mind turn over and twist in ways he didn't like. ", "It seemed to change the whole dynamic of his face, but the beginnings of a beard looked good on him. ", "She loved the scratchy sensation it gave against the softness of her palm.", "\n\nEven in the midst of all this chaos she had to fight the urge to get lost in a passionate moment with him. ", "His touch made this entire thing feel like a distant worry rather than the looming danger it truly was.", "\n\n\"I guess we wait and see what they come up with,\" Piper murmured, talking into his shoulder as she squeezed him tighter, feeling safe in his arms.", "\n\n\"I think we need to go down to the precinct and tell them what we know. ", "They haven't tied this back to your father at all. ", "No one is even considering the fact that it might be bigger than just some campus crime. ", "It's important they know you're here.\" ", "Bobby rested his chin on Piper's head and closed his eyes. ", "He knew she wouldn't want to rehash her history, but in his heart he assumed she'd do what was right, even if she did it reluctantly.", "\n\n\"No,\" she said sharply as she pulled away from him. ", "His chin fell suddenly, sending his teeth into his tongue. ", "It was equally as jarring to Piper. ", "Leaving his arms felt like the shock of a windy day—your hat blowing off your head before you could even raise your arms to try to stop it. ", "She was the one backing up, but it still felt like he was the one being pulled away.", "\n\n\"We have no idea if this is my father or not. ", "Someone could have easily searched the Internet for serial killers and decided they wanted to play lunatic for the day. ", "I'm not going to go shout from the rooftops that I'm here in Edenville only to find out this had nothing to do with me.\"", "\n\nBobby was stunned by her steely tone and met her frustration with his own. \"", "I'm not asking you to go on the ten o'clock news. ", "I'm asking you to come down and talk to the captain. ", "Tell him what you know, who you are. ", "You have a responsibility here.\"", "\n\n\"Do you think I went on the ten o'clock news back in New York? ", "No. ", "But somehow information was leaked. ", "My father found out I survived and now here I am. ", "If this attack wasn't my father, if it was someone else, I can kiss Edenville goodbye. ", "You can kiss me goodbye. ", "All I have is this new identity. ", "Please don't take it from me. ", "I can't start over again.\" ", "She stared up at him, letting her eyes speak.", "\n\nShe had powerful eyes that seemed to have the ability to express things that words couldn't. ", "They were the eyes of a broken-hearted person, and anyone with an ounce of empathy couldn't resist their pull. ", "She didn't flash them often, she never wanted them to become too familiar or to lose their effect, but right now they were necessary. ", "She could tell her stare was creating small fractures in the shield Bobby had placed between them, but it had yet to shatter.", "\n\n\"I'm a police officer, Piper. ", "You can't ask me to withhold information about an active case. ", "There's a massive internal investigation going on right now. ", "People are being linked to Judge Lions, and everyone is on edge. ", "Edenville has been completely turned on its head, and we need to be as forthcoming as possible with any information we have. ", "Heads are rolling, jobs are being lost, and people are going to jail. ", "We need to stay on the right side of this. ", "I know when you sat in your living room and told me who you really were you didn't imagine it would ever come to this. ", "You told me because you love me, and now I'm asking you to trust me.\"", "\n\n\"Bobby, honestly, what's your hang up? ", "You love me. ", "That should come first. ", "I get the good guy thing. ", "I even understand the sense of duty, but does that really trump how you feel about me?\" ", "Piper didn't want to appear hurt, but she couldn't understand why he towed this line with so much damn conviction. ", "What was really keeping him from putting her first?", "\n\nHe wanted to shout that she _didn't_ understand, that maybe she never would. ", "His own history had created that black and white definition of the world. ", "Just as hers had made her jaded and skeptical, his past had made him this way. ", "All he had to do was keep walking the straight and narrow to keep his demons stuffed away. ", "The rules were the rules for a reason, and as long as he followed them he'd never find himself back in that terrible place he'd escaped. ", "He was convinced Piper didn't need to know why he was so inflexible and law-abiding. ", "She just needed to know and accept that he was.", "\n\nWhen he didn't answer she continued her plea. \"", "All I'm asking is for you to let the investigation play out for a couple of days. ", "Let the forensic team do its job.\" ", "She moved back toward him and wrapped her arms around his waist, begging him again with her eyes. \"", "Please, promise me you'll give it a couple of days.\"", "\n\nBobby couldn't do that. ", "The conflict raging inside his body kept his mouth from agreeing to her terms. ", "He wouldn't make that promise. ", "It was far too similar to one he'd made before, one that ended so badly he still couldn't forgive himself. \"", "And what about everyone upstairs?\" ", "he asked as he deflected her request. \"", "Do you plan to keep them cut out of all this? ", "Do you want to go back to hiding everything about yourself from people who care about you?\"", "\n\nPiper assumed she'd need to make some kind of concession. ", "She was asking a lot of Bobby, likely too much. ", "It was only fair to expect she would have to give something in return. \"", "I'm going to tell them the truth. ", "I trust them, and I know they care about me. ", "They deserve to know who I am.\" ", "She stood on her tiptoes and held Bobby's face in her hands. \"", "I'm sorry I'm not normal. ", "I hate that I come with all this baggage. ", "Please, stand by me on this.\"", "\n\nHe leaned down and kissed her, instantly calming every jagged nerve and untying all the knots in her stomach. ", "The effect on Bobby was slightly different. ", "The kiss didn't calm him, it scared him. ", "Loving her scared him. ", "She made him walk a fine line he'd always avoided. ", "He was afraid loving her would be his undoing.", "\n\nTheir bodies however didn't seemed to be as conflicted as their minds. ", "They leaned into each other, Bobby's hand grasping firmly to Piper's lower back and pulling her in tighter. ", "There were some things that weren't impacted by the reality of a situation, and their physical attraction hadn't tapered off at all. ", "On the contrary, the tension between their bodies, the desperate hunger to finally come together, had grown to an almost unmanageable level. ", "She let her body grind slightly into his and a low moan passed from his mouth to hers. ", "The passing of a rumbling motorcycle broke them from each other, reminding them that no matter how badly they wanted to give in to their desires, once again they would have to wait. ", "Understanding the attack today would need to come first. ", "Just like they had put the task of taking down the judge before their passion. ", "It felt like the right thing to do at the time, but now as their bodies ached for each other and more problems stood in their way, they were both wondering if waiting had been the right choice.", "\n\n* * *\n\nContinue reading Book 2: Cutting Ties\n\n# Also by Danielle Stewart\n\n**Missing Pieces Series:**\n\nBook 1: The Bend in Redwood Road\n\nBook 2: The Pier at Jasmine Lake\n\nBook 3: The Bridge in Sunset Park\n\nBook 4: The Stairs to Chapel Creek\n\n* * *\n\n**Broken Mirror Series:**\n\nBook 1: The Way Down\n\nBook 2: The Way Home\n\nBook 3: The Way Back\n\n* * *\n\n**Piper Anderson Series:**\n\nBook 1: Chasing Justice\n\nBook 2: Cutting Ties\n\nBook 3: Changing Fate\n\nBook 4: Finding Freedom\n\nBook 5: Settling Scores\n\nBook 6: Battling Destiny\n\nBook 7: Unearthing Truth\n\nBook 8: Defending Innocence\n\nBook 9: Saving Love(includes excerpts from Betty's Journal)\n\n* * *\n\n**Edenville Series – A Piper Anderson Spin Off:**\n\nBook 1: Flowers in the Snow\n\nBook 2: Kiss in the Wind\n\nBook 3: Stars in a Bottle\n\nBook 4: Fire in the Heart\n\n* * *\n\n**Piper Anderson Legacy Mystery Series:**\n\nBook 1: Three Seconds To Rush\n\nBook 2: Just for a Heartbeat\n\nBook 3: Not Just an Echo\n\n* * *\n\n**The Clover Series:**\n\nHearts of Clover \\- Novella & Book 2: (Half My Heart & Change My Heart)\n\nBook 3: All My Heart\n\n* * *\n\n**Over the Edge Series:**\n\nBook 1: Facing Home\n\nBook 2: Crashing Down\n\n* * *\n\n**Midnight Magic Series:**\n\nAmelia\n\n* * *\n\n**Rough Waters Series:**\n\nBook 1: The Goodbye Storm\n\nBook 2: The Runaway Storm\n\nBook 3: The Rising Storm\n\n* * *\n\n**Stand Alones:**\n\nYours for the Taking\n\nLove in a Paper Garden\n\n* * *\n\n********************************************************\n\n**Multi-Author Series including books by Danielle Stewart**\n\n* * *\n\n**_All are stand alone reads and can be enjoyed in any order._**", "\n\n* * *\n\nIndigo Bay Series:\n\n_A multi-author sweet romance series_\n\nSweet Dreams \\- Stacy Claflin\n\nSweet Matchmaker \\- Jean Oram\n\nSweet Sunrise \\- Kay Correll\n\nSweet Illusions \\- Jeanette Lewis\n\nSweet Regrets \\- Jennifer Peel\n\nSweet Rendezvous \\- Danielle Stewart\n\n* * *\n\nShort Holiday Stories in Indigo Bay:\n\n_A multi-author sweet romance series_\n\nSweet Holiday Wishes \\- Melissa McClone\n\nSweet Holiday Surprise \\- Jean Oram\n\nSweet Holiday Memories \\- Kay Correll\n\nSweet Holiday Traditions \\- Danielle Stewart\n\n# Books in the Barrington Billionaire Synchronized World\n\nBy Danielle Stewart:\n\nFierce Love\n\nWild Eyes\n\nCrazy Nights\n\nLoyal Hearts\n\nUntamed Devotion\n\nStormy Attraction\n\nFoolish Temptations\n\nSurprising Destiny\n\nLovely Dreams\n\nPerfect Homecoming\n\n* * *\n\nYou can now download all the Barrington Billionaire books by Danielle Stewart in a \"Sweet\" version. ", "Enjoy the clean and wholesome version, same story without the spice. ", "If you prefer the hotter version be sure to download the original.", "\n\nThe Sweet version still contains adult situations and relationships.", "\n\n* * *\n\nFierce Love - Sweet Version\n\nWild Eyes - Sweet Version\n\nCrazy Nights - Sweet Version\n\nLoyal Hearts - Sweet Version\n\nUntamed Devotion - Sweet Version\n\nStormy Attraction - Sweet Version\n\nFoolish Temptations - Sweet Version - Coming Soon\n\n# Foreign Editions\n\nThe following books are currently available in foreign translations\n\n* * *\n\n**German Translation:**\n\n* * *\n\nFierce Love\n\nUngezügelte Leidenschaft\n\n* * *\n\nWild Eyes\n\nGlühend heiße Blicke\n\n* * *\n\nCrazy Nights\n\nNächte, wild und unvergessen\n\n* * *\n\nLoyal Hearts\n\nHerzen, treu und ehrlich: Die Welt der Barrington-Milliardäre\n\n* * *\n\n***\n\n* * *\n\n**French Translation:**\n\n* * *\n\nFlowers in the Snow\n\nFleurs Des Neiges\n\n# Newsletter Sign-up\n\nIf you'd like to stay up to date on the latest Danielle Stewart news and be the first to hear about sales and giveaways Click Here.", "\n\n# Author Contact Information\n\nWebsite: AuthorDanielleStewart.com\n\nEmail: AuthorDanielleStewart@Gmail.com\n\nBookbub: https://www.bookbub.com/authors/danielle-stewart\n\nAmazon: https://www.amazon.com/Danielle-Stewart/e/B00CCOYB3O\n\nTwitter: @DStewartAuthor\n\n* * *\n\n Facebook\n\n Twitter\n\n BookBub\n" ]

{ "pile_set_name": "BookCorpus2" }

[ 0.0006324155838228762, 0.0005737790488637984, 0.002098805969581008, 0.0007054798188619316, 0.0005270964466035366, 0.0005162149318493903, 0.04453174024820328, 0.0007355910493060946, 0.006357179023325443, 0.004782987758517265, 0.0013776026898995042, 0.0007669766200706363, 0.0012917601270601153, 0.0010807341895997524, 0.0007992495084181428, 0.02714003250002861, 0.0013203149428591132, 0.439728707075119, 0.0006871690857224166, 0.001024361583404243, 0.005999178159981966, 0.0008847280987538397, 0.001471258932724595, 0.0007106416160240769, 0.21412988007068634, 0.9874333739280701, 0.0010348629439249635, 0.0006316452054306865, 0.0009151742560788989, 0.0009322042460553348, 0.00204546214081347, 0.05868994817137718, 0.0007657595560885966, 0.011264379136264324, 0.004007776267826557, 0.0658409371972084, 0.0006406048196367919, 0.34295111894607544, 0.0007232687203213573, 0.0007755628321319818, 0.0006290873279795051, 0.08911070972681046, 0.0021370782051235437, 0.0009331955225206912, 0.01960066705942154, 0.0023818088229745626, 0.0006147542735561728, 0.0015441718278452754, 0.0014246933860704303, 0.0010008452227339149, 0.040323324501514435, 0.37304824590682983, 0.12076544016599655, 0.012736346572637558, 0.13153982162475586, 0.002495183376595378, 0.0015724838012829423, 0.9923326969146729, 0.6581681370735168, 0.7581831216812134, 0.0061859567649662495, 0.0005586396437138319, 0.011139207519590855, 0.03756076097488403, 0.00331802386790514, 0.758004903793335, 0.6560340523719788, 0.0015874381642788649, 0.0006493451073765755, 0.0006326446891762316, 0.0006195683963596821, 0.001055785221979022, 0.0007900109048932791, 0.046104397624731064, 0.11043685674667358, 0.0021199570037424564, 0.0012155718868598342, 0.034205298870801926, 0.0007976889610290527, 0.0011134115047752857, 0.0007644449942745268, 0.003508558264002204, 0.0005951329949311912, 0.0009403631556779146, 0.002464656950905919, 0.029784267768263817, 0.0007804396445862949, 0.001217603450641036, 0.0008619081345386803, 0.000741205585654825, 0.012834987603127956, 0.13821375370025635, 0.011959965340793133, 0.0007367988582700491, 0.0006903648027218878, 0.0038749321829527617, 0.0012411257484927773, 0.0005497070378623903, 0.0006659082137048244, 0.0007569112931378186, 0.0007781449239701033, 0.0006928651710040867, 0.001437405589967966, 0.000665685860440135, 0.0006929843220859766, 0.0006547599332407117, 0.0005563515587709844, 0.0011050443863496184, 0.0016423864290118217, 0.0007588287116959691, 0.0006734908674843609, 0.0006954189739190042, 0.0015278566861525178, 0.0006984470528550446, 0.0006654498283751309, 0.0009590631816536188, 0.0005871363100595772, 0.0005913362838327885, 0.0006821604911237955, 0.0006084234337322414, 0.0010208947351202369, 0.011631299741566181, 0.0006337970844469965, 0.008729075081646442, 0.08347471803426743, 0.0014287810772657394, 0.0005878583760932088, 0.0011499997926875949, 0.0028236545622348785, 0.007086574099957943, 0.010964497923851013, 0.001329189632087946, 0.018651308491826057, 0.3831329941749573, 0.017351720482110977, 0.003050317754969001, 0.013122332282364368, 0.0019427661318331957, 0.0008769596461206675, 0.0637536495923996, 0.0014703290071338415, 0.0029163863509893417, 0.0005735819577239454, 0.001557679963298142, 0.0006271477323025465, 0.0007132887258194387, 0.000834507227409631, 0.0012536944122985005, 0.0017286974471062422, 0.0009414706728421152, 0.0008107959292829037, 0.0009557040757499635, 0.0006675890181213617, 0.0005526164313778281, 0.00227616960182786, 0.000626914668828249, 0.0010172238107770681, 0.0022015811409801245, 0.0010297971311956644, 0.0038951258175075054, 0.0024484675377607346, 0.0007320378790609539, 0.0006605437956750393, 0.0011717237066477537, 0.0008443671395070851, 0.05281953141093254, 0.0007999677327461541, 0.0006117707234807312, 0.0012070529628545046, 0.0008755102753639221, 0.0009095983114093542, 0.001995012629777193, 0.0006838581175543368, 0.040619369596242905, 0.01000287476927042, 0.0007251165807247162, 0.0005936247180216014, 0.0009100204915739596, 0.0009074641275219619, 0.0006041350425221026, 0.0007116222404874861, 0.0006945066270418465, 0.0005468570743687451, 0.004650295712053776, 0.08540390431880951, 0.019039424136281013, 0.016924621537327766, 0.0007357561262324452, 0.0005823952378705144, 0.0007001611520536244, 0.0011459247907623649, 0.0009515357087366283, 0.0006960999453440309, 0.035678159445524216, 0.0006055589183233678, 0.0006303137633949518, 0.0009189011179842055, 0.0007540872320532799, 0.000816088926512748, 0.00428464449942112, 0.46908286213874817, 0.0008388861315324903, 0.0006254375912249088, 0.0005325771635398269, 0.0012383490102365613, 0.007848842069506645, 0.002561317989602685, 0.001142400549724698, 0.005735274404287338, 0.0006309509044513106, 0.0006548048695549369, 0.004632832482457161, 0.0008183023310266435, 0.001051183557137847, 0.5180414915084839, 0.09662514179944992, 0.9731940627098083, 0.08081758767366409, 0.001384875038638711, 0.0009892917005345225, 0.026119306683540344, 0.001565320068039, 0.0011593224480748177, 0.7176903486251831, 0.020389048382639885, 0.0026019783690571785, 0.06906836479902267, 0.0009461187873966992, 0.0008703051717020571, 0.0036305112298578024, 0.001979442546144128, 0.00548071414232254, 0.0009550091926939785, 0.0007163225091062486, 0.00222075660713017, 0.02776823565363884, 0.0006304089911282063, 0.0011759514454752207, 0.0006111745024099946, 0.0008881142130121589, 0.0012721045641228557, 0.0013395637506619096, 0.002353728748857975, 0.02144947275519371, 0.0009917359566316009, 0.0006399783305823803, 0.007283772807568312, 0.0013376213610172272, 0.0010974276810884476, 0.09054422378540039, 0.0019829452503472567, 0.028332779183983803, 0.0009659983334131539, 0.0007948311395011842, 0.008208893239498138, 0.0007740104920230806, 0.0005588540225289762, 0.001115084858611226, 0.0008216179558075964, 0.0006944199558347464, 0.05705394223332405, 0.0007127013523131609, 0.9655632376670837, 0.001683027483522892, 0.012514584697782993, 0.13388970494270325, 0.0006482215831056237, 0.01121768169105053, 0.0013873454881832004, 0.0011122077703475952, 0.0060194917023181915, 0.0008004706469364464, 0.002099500270560384, 0.002556408289819956, 0.018500840291380882, 0.0022346365731209517, 0.0013500397326424718, 0.0008656810969114304, 0.027348728850483894, 0.012015261687338352, 0.0006859552813693881, 0.0013600010424852371, 0.001019132323563099, 0.0038025337271392345, 0.000685965467710048, 0.005128879565745592, 0.0012663707602769136, 0.0007357880240306258, 0.06333745270967484, 0.0010156870121136308, 0.0008673617267049849, 0.039373185485601425, 0.0010915881721302867, 0.0012319231173023582, 0.0012416880344972014, 0.0009096187422983348, 0.0010304413735866547, 0.0005984794115647674, 0.0011575812241062522, 0.0006618913030251861, 0.04632464796304703, 0.002042213687673211, 0.0014370825374498963, 0.0015642540529370308, 0.0028231656178832054, 0.0009573021088726819, 0.0006337659433484077, 0.0030526795890182257, 0.06562914699316025, 0.0007442895439453423, 0.0016033571446314454, 0.0007285747560672462, 0.0006516366847790778, 0.001812501810491085, 0.0009982921183109283, 0.0050477031618356705, 0.0010438283206894994, 0.0013680036645382643, 0.003493949305266142, 0.0006573841674253345, 0.005264926236122847, 0.000773891806602478, 0.0014223535545170307, 0.16962005198001862, 0.0006408526678569615, 0.0010889319237321615, 0.0008276290609501302, 0.0006993681890890002, 0.0009365928126499057, 0.0007086421246640384, 0.0009681701194494963, 0.005950327031314373, 0.0006624938105233014, 0.0008761929348111153, 0.00215296633541584, 0.0019552900921553373, 0.0009758166270330548, 0.0007780641317367554, 0.008197348564863205, 0.0007294522365555167, 0.0006636783946305513, 0.0006115477881394327, 0.13249823451042175, 0.0019057781901210546, 0.001938983565196395, 0.0006613906589336693, 0.0007221392006613314, 0.0008309040567837656, 0.0006144031649455428, 0.0011323493672534823, 0.031218113377690315, 0.0325431227684021, 0.011188682168722153, 0.00068755290703848, 0.03677160292863846, 0.0006281784735620022, 0.0006022123270668089, 0.0006124168867245317, 0.005777295678853989, 0.0006700448575429618, 0.0006178548792377114, 0.0016424444038420916, 0.0010756943374872208, 0.15012608468532562, 0.0006042821914888918, 0.0006878734566271305, 0.0006380733102560043, 0.0009464401518926024, 0.004096574150025845, 0.000582057808060199, 0.0013177319196984172, 0.0020065305288881063, 0.000713649089448154, 0.0006978558376431465, 0.11874458938837051, 0.0005649818340316415, 0.0006794827058911324, 0.4313003122806549, 0.0007300092256627977, 0.03977667912840843, 0.0012512588873505592, 0.011260837316513062, 0.0007032128050923347, 0.0013864032225683331, 0.0007319388096220791, 0.0005582478479482234, 0.0033946388866752386, 0.004352635703980923, 0.0010237254900857806, 0.000882495369296521, 0.00744083896279335, 0.0005762469372712076, 0.0009299952653236687, 0.0005811279406771064, 0.0007442040950991213, 0.0006372738280333579, 0.0011766107054427266, 0.0007657723035663366, 0.0027113042306154966, 0.0006648491835221648, 0.0009533637203276157, 0.0006733749760314822, 0.001109838718548417, 0.0009823261061683297, 0.00103782641235739, 0.0018209379632025957, 0.01584651507437229, 0.0008251336985267699, 0.005813437979668379, 0.0013865469954907894, 0.001320176525041461, 0.0007807791698724031, 0.021732280030846596, 0.0008476492948830128, 0.0031995803583413363, 0.001856200280599296, 0.0009565905202180147, 0.0011171044316142797, 0.0005634416593238711, 0.0007658047834411263, 0.020438024774193764, 0.010514624416828156, 0.09673545509576797, 0.0008198777795769274, 0.7267659902572632, 0.0037666806019842625, 0.008842196315526962, 0.0024928406346589327, 0.001904795179143548, 0.0008296816959045827, 0.0008047937881201506, 0.0011762588983401656, 0.000816938525531441, 0.004622490145266056, 0.0006596975727006793, 0.0011371818836778402, 0.0007111876620911062, 0.0008729230030439794, 0.10344848781824112, 0.014665687456727028, 0.003905121935531497, 0.0007483861991204321, 0.37794771790504456, 0.0010456428863108158, 0.0011173306265845895, 0.0036003924906253815, 0.002850752556696534, 0.0005745043745264411, 0.09926263242959976, 0.0008917204104363918, 0.011866425164043903, 0.0013799590524286032, 0.03620133548974991, 0.002339507918804884, 0.0009451754158362746, 0.0005830667214468122, 0.0007001110352575779, 0.0007808294030837715, 0.006159623619168997, 0.0016421893378719687, 0.0011544835288077593, 0.002883792854845524, 0.001344770658761263, 0.0007530812290497124, 0.21321049332618713, 0.5250914096832275, 0.0010242888238281012, 0.0006837518885731697, 0.0009638948831707239, 0.001972966594621539, 0.0013291074428707361, 0.0005469162715598941, 0.0026971290353685617, 0.0009636511094868183, 0.0009668362908996642, 0.0006406362517736852, 0.0133541040122509, 0.0007134077022783458, 0.001274607959203422, 0.0010765971383079886, 0.001722640241496265, 0.04327893257141113, 0.0009450443903915584, 0.07945378869771957, 0.0006632781005464494, 0.009188261814415455, 0.2981857359409332, 0.0058849891647696495, 0.0009229950373992324, 0.008186295628547668, 0.001337680732831359, 0.0006876086117699742, 0.0006536971777677536, 0.0013559593353420496, 0.0010432121343910694, 0.0010186833096668124, 0.0007682834984734654, 0.0009378675604239106, 0.0006513920961879194, 0.001743367058224976, 0.0007624373538419604, 0.075687937438488, 0.015272704884409904, 0.0007364895427599549, 0.0007195923244580626, 0.004028607159852982, 0.0010670359479263425, 0.0006530352402478456, 0.008623350411653519, 0.0006816636305302382, 0.0008188749197870493, 0.0008229840896092355, 0.0019141256343573332, 0.0010854293359443545, 0.0007218667306005955, 0.0058196778409183025, 0.0008845797274261713, 0.038437385112047195, 0.0009577263263054192, 0.0009207551483996212, 0.0012323715491220355, 0.0060204449109733105, 0.0006471591768786311, 0.0012982262996956706, 0.0007481523789465427, 0.000654453004244715, 0.0006758145173080266, 0.0015660529024899006, 0.002196600893512368, 0.001410868251696229, 0.0011893489863723516, 0.0008999628480523825, 0.35233354568481445, 0.0008033763151615858, 0.00069336814340204, 0.0006151804118417203, 0.0007246765308082104, 0.0013052442809566855, 0.002266863826662302, 0.933638870716095, 0.3369961678981781, 0.9565896391868591, 0.0005826014676131308, 0.014650116674602032, 0.2526421546936035, 0.0009886515326797962, 0.0011170294601470232, 0.00360710802488029, 0.0014986934838816524, 0.0010600428795441985, 0.0007897997857071459, 0.0010824636556208134, 0.0948193147778511, 0.014692363329231739, 0.31647393107414246, 0.0007128476863726974, 0.0006488814251497388, 0.0008282136404886842, 0.0005859151133336127, 0.1072796881198883, 0.0010940899373963475, 0.0007936391048133373, 0.0010814354754984379, 0.000813836813904345, 0.0014554758090525866, 0.001045225071720779, 0.0005961679853498936, 0.005570587702095509, 0.0008935345686040819, 0.0009297232609242201, 0.0007953429012559354, 0.0009298721561208367, 0.002522509777918458, 0.0006338399834930897, 0.0075073582120239735, 0.002414348302409053, 0.0005481638363562524, 0.9254409670829773, 0.0010843347990885377, 0.0029385245870798826, 0.013528509065508842, 0.10098408907651901, 0.0005540293059311807, 0.10682184249162674, 0.6992491483688354, 0.0008640065789222717, 0.0007498368504457176, 0.00076995266135782, 0.0007100871298462152, 0.0005603984463959932, 0.0007114367908798158, 0.0013769067591056228, 0.44005945324897766, 0.0006354337092489004, 0.1818048059940338, 0.001472631236538291, 0.0008114572265185416, 0.0007070400170050561, 0.0007337546558119357, 0.0006125251529738307, 0.0007304800092242658, 0.14375673234462738, 0.20325197279453278, 0.0006482710014097393, 0.1425916850566864, 0.0008516917005181313, 0.0006678508361801505, 0.0006689907750114799, 0.002036487916484475, 0.0006321630789898336, 0.0011700367322191596, 0.0006534943822771311, 0.9495418667793274, 0.0007479662890546024, 0.003819567384198308, 0.0006802728748880327, 0.0006869539502076805, 0.0006092593539506197, 0.006956202909350395, 0.0005345048266462982, 0.0010224272264167666, 0.0016767659690231085, 0.002530910074710846, 0.0010558204958215356, 0.0010523058008402586, 0.004770948085933924, 0.0014927128795534372, 0.0007420848705805838, 0.0009323889389634132, 0.037572018802165985, 0.001261306693777442, 0.000615286233369261, 0.0006595149752683938, 0.055100683122873306, 0.0008132914663292468, 0.0007515580509789288, 0.000670048117171973, 0.0007905681268312037, 0.0019452187698334455, 0.000836733088362962, 0.0005448448937386274, 0.0007484639645554125, 0.0013537760823965073, 0.0005475074285641313, 0.0005979491397738457, 0.0016098300693556666, 0.0007215390214696527, 0.006991767790168524, 0.0005968419718556106, 0.0015813426580280066, 0.0006214002496562898, 0.000636342796497047, 0.0007226007874123752, 0.0007354543195106089, 0.0009259824291802943, 0.0019518890185281634, 0.0017836382612586021, 0.0008292887941934168, 0.0006175905000418425, 0.0009447469492442906, 0.0012005160097032785, 0.0011346688261255622, 0.0006390324560925364, 0.0006118655437603593, 0.0009181148489005864, 0.0007342142052948475, 0.002611627569422126, 0.0008140629506669939, 0.000878418970387429, 0.002113540191203356, 0.0009183571091853082, 0.003590839449316263, 0.001251702313311398, 0.0029037720523774624, 0.0011185596231371164, 0.001019880292005837, 0.9416690468788147, 0.0007458825130015612, 0.008502587676048279, 0.0007620473043061793, 0.0014945141738280654, 0.0013812482357025146, 0.004932241048663855, 0.0013358708238229156, 0.0019791864324361086, 0.003192987060174346, 0.0016131795709952712, 0.0013005982618778944, 0.04134455695748329, 0.0015820052940398455, 0.011629726737737656, 0.0013954597525298595, 0.0010217441013082862, 0.0011075928341597319, 0.0009789798641577363, 0.0010415591532364488, 0.00079298485070467, 0.0006020803120918572, 0.003492877120152116, 0.01539534516632557, 0.01253262348473072, 0.7489622235298157, 0.0007101866067387164, 0.0005468753515742719, 0.0011901265243068337, 0.0013385292841121554, 0.001026267884299159, 0.0013695639790967107, 0.011432184837758541, 0.6359110474586487, 0.004642923828214407, 0.0037346479948610067, 0.0007462483481504023, 0.0010091791627928615, 0.005775545723736286, 0.000755205808673054, 0.0008024980197660625, 0.2489483654499054, 0.014733131974935532, 0.045560359954833984, 0.0008232613909058273, 0.0018490479560568929, 0.0151091692969203, 0.0012207678519189358, 0.05583366006612778, 0.0008334951708093286, 0.0012090374948456883, 0.0014141525607556105, 0.011339528486132622, 0.0006782505661249161, 0.0011596947442740202, 0.028358712792396545, 0.0006610869313590229, 0.0011303562205284834, 0.0008142099250108004, 0.0008030177559703588, 0.0006393117364495993, 0.0012086584465578198, 0.07043498754501343, 0.0687064677476883, 0.0005544917657971382, 0.0011079146061092615, 0.014829196035861969, 0.008631295524537563, 0.0007378868758678436, 0.0006490647792816162, 0.013640972785651684, 0.9898629188537598, 0.0034221524838358164, 0.0009365477599203587, 0.003653719089925289, 0.000789170095231384, 0.0006153100403025746, 0.0008969705086201429, 0.0009060968877747655, 0.03169217333197594, 0.004406837746500969, 0.0007228525937534869, 0.0007012261776253581, 0.0010983768152073026, 0.0006548735545948148, 0.08888933062553406, 0.015870530158281326, 0.000676034833304584, 0.014984243549406528, 0.03268804773688316, 0.34052684903144836, 0.00306823942810297, 0.0014026573626324534, 0.0006415502866730094, 0.0006293205660767853, 0.0011480154935270548, 0.0005881483084522188, 0.0007286282489076257, 0.005272023379802704, 0.0006622661603614688, 0.0006823077565059066, 0.0015752825420349836, 0.000627088185865432, 0.059596724808216095, 0.0019337364938110113, 0.0013567461865022779, 0.0006640775827690959, 0.0031718204263597727, 0.0005866105202585459, 0.0032660504803061485, 0.0009737047366797924, 0.0005681347101926804, 0.0006030669901520014, 0.0006384465377777815, 0.0006652929587289691, 0.0012146946974098682, 0.021865379065275192, 0.0010457609314471483, 0.249184712767601, 0.0008865479612722993, 0.03837158903479576, 0.02145078405737877, 0.0024020234122872353, 0.0008332077413797379, 0.001483603031374514, 0.0005870705936104059, 0.000781505717895925, 0.09711064398288727, 0.009388087317347527, 0.04521050676703453, 0.041028667241334915, 0.8102225661277771, 0.0005862259422428906, 0.006696170661598444, 0.0005644236807711422, 0.0008029580931179225, 0.2789873480796814, 0.000858399027492851, 0.0022628563456237316, 0.0014381655491888523, 0.000790638558100909, 0.0005825928528793156, 0.0006542777991853654, 0.0006092619732953608, 0.0008787307306192815, 0.0011749425902962685, 0.0007135674823075533, 0.0005813916213810444, 0.0020204526372253895, 0.0008706179214641452, 0.0006228585843928158, 0.0012246035039424896, 0.06213262304663658, 0.0017798327608034015, 0.000869536423124373, 0.03891010209918022, 0.009548483416438103, 0.0007361457683146, 0.0006354028009809554, 0.000553770107217133, 0.0006292794714681804, 0.0006366379093378782, 0.0014256725553423166, 0.0007584745762869716, 0.017017528414726257, 0.02338756062090397, 0.0006294348859228194, 0.001184509601444006, 0.0018364042043685913, 0.0007857434102334082, 0.029328186064958572, 0.0009546006331220269, 0.000854961690492928, 0.0007484440575353801, 0.09176469594240189, 0.000772404542658478, 0.001027111429721117, 0.0007885672384873033, 0.0006791839259676635, 0.0005992173682898283, 0.000803764967713505, 0.0011662673205137253, 0.0006352784694172442, 0.001162351225502789, 0.0008260367903858423, 0.0016204941784963012, 0.11270453780889511, 0.0008653825498186052, 0.0005986459436826408, 0.0007614291971549392, 0.0006737151998095214, 0.0007787662325426936, 0.0008571787620894611, 0.0005548507906496525, 0.0015017398400232196, 0.0008680082974024117, 0.005063090939074755, 0.0014117418322712183, 0.0005696007865481079, 0.0008737767930142581, 0.0029775851871818304, 0.000980396755039692, 0.0008412271272391081, 0.0034129894338548183, 0.0007734733517281711, 0.00224817986600101, 0.0010141500970348716, 0.06791792809963226, 0.0007818230660632253, 0.0010535060428082943, 0.0144402626901865, 0.0033162927720695734, 0.0021593617275357246, 0.0009630811400711536, 0.486250102519989, 0.0020517949014902115, 0.0007260815473273396, 0.004387151449918747, 0.0008732000133022666, 0.0010051510762423277, 0.0005955534870736301, 0.0024455285165458918, 0.0007011296111159027, 0.0006497669382952154, 0.0006923476466909051, 0.0039419434033334255, 0.002510226331651211, 0.009828338399529457, 0.0019866053480654955, 0.002169547136873007, 0.001947239856235683, 0.0020351316779851913, 0.001422222936525941, 0.0006003060261718929, 0.0013608114095404744, 0.0018663244554772973, 0.01342519000172615, 0.24043279886245728, 0.11188297718763351, 0.00225520646199584, 0.0008040499524213374, 0.002855990780517459, 0.0014386915136128664, 0.0005943626747466624, 0.6859710216522217, 0.005601376760751009, 0.0005781093495897949, 0.0007664414006285369, 0.0019064685329794884, 0.0011026967549696565, 0.0009097552392631769, 0.033630065619945526, 0.0014007438439875841, 0.0007223621942102909, 0.0006014760583639145, 0.0017596461111679673, 0.0006497855647467077, 0.0005958206602372229, 0.0006149663822725415, 0.0011091568740084767, 0.0006614868761971593, 0.006422924343496561, 0.0009580992045812309, 0.0006061583408154547, 0.0008028738666325808, 0.0007970347651280463, 0.001583563513122499, 0.6438935399055481, 0.000775313819758594, 0.0382709838449955, 0.0009822166757658124, 0.0034325863234698772, 0.007555041927844286, 0.002618394559249282, 0.05949390307068825, 0.0007970313890837133, 0.003081854432821274, 0.0006094005075283349, 0.0008750894921831787, 0.0015310044400393963, 0.0007436706800945103, 0.00067374506033957, 0.0005691457772627473, 0.0005387219716794789, 0.0006562892813235521, 0.0008006261778064072, 0.0008093130891211331, 0.0027439675759524107, 0.0006618913030251861, 0.00426948256790638, 0.0007328720530495048, 0.0008371549774892628, 0.0008100406848825514, 0.0008927141898311675, 0.001044572563841939, 0.0007878491305746138, 0.0008090097107924521, 0.0010135661577805877, 0.01672656275331974, 0.0009531429968774319, 0.0009916267590597272, 0.00350209535099566, 0.0007749397191219032, 0.0031665542628616095, 0.3405618667602539, 0.0013801496243104339, 0.0018694655736908317, 0.0006870649522170424, 0.0008006326970644295, 0.0006435509421862662, 0.0007641780539415777, 0.0007924292585812509, 0.11617743968963623, 0.0014067186275497079, 0.7698847055435181, 0.0006282167159952223, 0.01730911247432232, 0.07002037018537521, 0.0005373905878514051, 0.005317935720086098, 0.02505718171596527, 0.0009347559534944594, 0.05930398777127266, 0.13552917540073395, 0.1834484189748764, 0.001323347445577383, 0.0015973320696502924, 0.0006668220739811659, 0.0006470496882684529, 0.0006706808926537633, 0.003815173637121916, 0.0009067233768291771, 0.006216135807335377, 0.0011015764903277159, 0.000758456764742732, 0.03394313529133797, 0.0018003277946263552, 0.0020042916294187307, 0.000788060890045017, 0.013156481087207794, 0.0007955206674523652, 0.0007914266898296773, 0.027639873325824738, 0.00075998913962394, 0.0016141491942107677, 0.1607683151960373, 0.0031100164633244276, 0.001265437575057149, 0.0008726822561584413, 0.013990846462547779, 0.017731131985783577, 0.316251665353775, 0.0005937194800935686, 0.0007458146428689361, 0.016094686463475227, 0.0011937266681343317, 0.039379511028528214, 0.0005117940017953515, 0.12426723539829254, 0.17377342283725739, 0.0015090060187503695, 0.007993501611053944, 0.11369742453098297, 0.0007916408940218389, 0.001220455626025796, 0.000786197604611516, 0.059000320732593536, 0.0007552432944066823, 0.004650858696550131, 0.09096796065568924, 0.006499950774013996, 0.0007708538323640823, 0.005106366705149412, 0.0008570689242333174, 0.008766110055148602, 0.000723246717825532, 0.0006232659216038883, 0.004149290733039379, 0.009054895490407944, 0.0037366023752838373, 0.006610020995140076, 0.010159550234675407, 0.0006662363884970546, 0.0008238476002588868, 0.0006285221897996962, 0.0009431204525753856, 0.0007861669291742146, 0.0007409114623442292, 0.011061097495257854, 0.0045608896762132645, 0.000889881222974509, 0.001374949119053781, 0.0005604348261840641, 0.000911022478248924, 0.0006197893526405096, 0.5271160006523132, 0.5164370536804199, 0.00144557049497962, 0.0012769288150593638, 0.005467355716973543, 0.0024302119854837656, 0.0006244054529815912, 0.000633436837233603, 0.2934619188308716, 0.000722345313988626, 0.000805042393039912, 0.0006680176593363285, 0.0005573778180405498, 0.0007558127981610596, 0.0006219334900379181, 0.000568930699955672, 0.0011391042498871684, 0.001429339754395187, 0.0008687818772159517, 0.0008112658397294581, 0.0006714128539897501, 0.001819032826460898, 0.0009256904013454914, 0.0007634901558049023, 0.0006962701445445418, 0.0009103917400352657, 0.0009489593794569373, 0.0010564246913418174, 0.001706835231743753, 0.0005968818441033363, 0.000573542551137507, 0.0007731930236332119, 0.0009748426964506507, 0.0005512791103683412, 0.023258304223418236, 0.03140926733613014, 0.0009255401091650128, 0.0028524636290967464, 0.0011449127923697233, 0.0009379832772538066, 0.0012808400206267834, 0.0009975130669772625, 0.0006851742509752512, 0.0006385094602592289, 0.001981559442356229, 0.0008607616182416677, 0.008928695693612099, 0.06776108592748642, 0.0008174765971489251, 0.007140090689063072, 0.024732960388064384, 0.11359047144651413, 0.005445699207484722, 0.0015606804518029094, 0.0894809439778328, 0.0030292272567749023, 0.0014086270239204168, 0.06565539538860321, 0.0006699487566947937, 0.08505000174045563, 0.0018575487192720175, 0.11630348861217499, 0.001072256825864315, 0.003969814162701368, 0.2538697421550751, 0.003673683386296034, 0.004873118828982115, 0.0016457324381917715, 0.0006585082737728953, 0.0007581305108033121, 0.0008078499231487513, 0.8657243847846985, 0.38178595900535583, 0.2654382586479187, 0.0008161771111190319, 0.0005715629667975008, 0.0008008246077224612, 0.0006591140991076827, 0.0008168696076609194, 0.000786118907853961, 0.1189567968249321, 0.007316005416214466, 0.06655515730381012, 0.0006222910014912486, 0.0014744341606274247, 0.0028366162441670895, 0.0012426552129909396, 0.0006141358753666282, 0.010740597732365131, 0.052965424954891205, 0.0007884105434641242, 0.0005491781048476696, 0.0005718893953599036, 0.0006828366313129663, 0.0007927287369966507, 0.0005412700120359659, 0.0007937340997159481, 0.4001220762729645, 0.0006567651871591806, 0.0020364008378237486, 0.0005593685782514513, 0.0010072696022689342, 0.000970486318692565, 0.0007294456008821726, 0.0010255631059408188, 0.0020513078197836876, 0.01438402570784092, 0.20403185486793518, 0.0008024964481592178, 0.0006552371778525412, 0.0005646063946187496, 0.0008905949653126299, 0.00069004314718768, 0.0005991557263769209, 0.0012432258808985353, 0.0008829226717352867, 0.0007436018786393106, 0.0008344682864844799, 0.0013672710629180074, 0.0008916499209590256, 0.0005918911192566156, 0.0021748056169599295, 0.0006254438776522875, 0.0005824557156302035, 0.002452146029099822, 0.04454440623521805, 0.9506314992904663, 0.0007773496909067035, 0.0017533120699226856, 0.0008193443645723164, 0.011478222906589508, 0.0006637042970396578, 0.0009176053572446108, 0.0006896349368616939, 0.002679063705727458, 0.0008940021507441998, 0.0010478092590346932, 0.0013785817427560687, 0.0008964797016233206, 0.001087469281628728, 0.001948304008692503, 0.0008340115309692919, 0.0008919898536987603, 0.0009234194294549525, 0.0015240003122016788, 0.0008282259223051369, 0.000990790082141757, 0.005742290988564491, 0.9717150330543518, 0.001403698232024908, 0.0006253732717595994, 0.0009072379907593131, 0.0009439451969228685, 0.002663959050551057, 0.030430277809500694, 0.0008470917819067836, 0.0013880380429327488, 0.0008484189747832716, 0.0015761122340336442, 0.0006275447085499763, 0.0007257297984324396, 0.0007315403199754655, 0.7371771335601807, 0.0007918238989077508, 0.0009865837637335062, 0.001595790614373982, 0.004826395306736231, 0.0008553979569114745, 0.0010588665027171373, 0.002194879110902548, 0.000982420751824975, 0.0005870392196811736, 0.00527616823092103, 0.0005757895996794105, 0.001968048047274351, 0.0018795316573232412, 0.0009238902712240815, 0.0006808177568018436, 0.0015770085155963898, 0.007110728416591883, 0.000567194598261267, 0.0006687638233415782, 0.0035184728913009167, 0.0007238834514282644, 0.0005789895076304674, 0.0008189057698473334, 0.0006464095786213875, 0.13045385479927063, 0.011389846913516521, 0.0007072380976751447, 0.0008336385362781584, 0.0008668772061355412, 0.000886420370079577, 0.0012065001064911485, 0.0015226035611703992, 0.09143546968698502, 0.0006992348935455084, 0.0008792144944891334, 0.0007218729588203132, 0.0007866258965805173, 0.0006132135167717934, 0.0006465649348683655, 0.0352068692445755, 0.0005725403316318989, 0.0005685902433469892, 0.0005594021058641374, 0.0027545541524887085, 0.0010542043019086123, 0.0060975621454417706, 0.0006649255519732833, 0.0006856981199234724, 0.0006618027691729367, 0.0009395350934937596, 0.002641597529873252, 0.0005568218766711652, 0.001442298642359674, 0.0006757336668670177, 0.0016102753579616547, 0.0109366774559021, 0.008992030285298824, 0.026005595922470093, 0.0030627278611063957, 0.0015317986253648996, 0.04118867218494415, 0.0017707269871607423, 0.034069791436195374, 0.001098761335015297, 0.0009902511956170201, 0.0011720563052222133, 0.0007267984328791499, 0.001411483739502728, 0.012577224522829056, 0.000972399371676147, 0.000826493080239743, 0.008011054247617722, 0.005521443672478199, 0.0066571906208992004, 0.0006900763837620616, 0.0014018146321177483, 0.0006477361312136054, 0.0766393318772316, 0.002446703612804413, 0.09868490695953369, 0.7886319756507874, 0.28134357929229736, 0.0008951583877205849, 0.08406957238912582, 0.0005486420704983175, 0.06553111970424652, 0.0005889611784368753, 0.0010418379679322243, 0.0006082153413444757, 0.026366153731942177, 0.6179684400558472, 0.001964559545740485, 0.0007926233229227364, 0.5845596790313721, 0.11475344002246857, 0.0024583986960351467, 0.0018772680778056383, 0.0006230937433429062, 0.6167809963226318, 0.0006491427193395793, 0.0006202884251251817, 0.07598541676998138, 0.7093944549560547, 0.0030454189982265234, 0.0007506633992306888, 0.0005534147494472563, 0.001949609024450183, 0.0008860442321747541, 0.0008634559926576912, 0.020837154239416122, 0.030156170949339867, 0.023107556626200676, 0.0012036975240334868, 0.0010569370351731777, 0.0027616943698376417, 0.000868381408508867, 0.002058799611404538, 0.020158149302005768, 0.0007300791912712157, 0.0024719845969229937, 0.017255079001188278, 0.0008830298320390284, 0.022538213059306145, 0.02452329359948635, 0.0033705441746860743, 0.0007562447572126985, 0.0018155117286369205, 0.0011221942258998752, 0.0009144747164100409, 0.0009884387254714966, 0.0005900368560105562, 0.0015480872243642807, 0.02553480863571167, 0.8296298384666443, 0.0028047519735991955, 0.000998504227027297, 0.04761512205004692, 0.000670287583488971, 0.001030334853567183, 0.11144305020570755, 0.0015153714921325445, 0.03591219708323479, 0.008470965549349785, 0.0181776974350214, 0.025561491027474403, 0.0006931883981451392, 0.031731016933918, 0.32195067405700684, 0.0012230671709403396, 0.0010426059598103166, 0.00069177255500108, 0.021061990410089493, 0.0017832069424912333, 0.0009846747852861881, 0.0012098696315661073, 0.00064979208400473, 0.0009037214331328869, 0.0005689401878044009, 0.0014627408236265182, 0.05317268520593643, 0.0036770831793546677, 0.09539619833230972, 0.0006071646930649877, 0.0005887176375836134, 0.007013790775090456, 0.00643651420250535, 0.000686747778672725, 0.0008764512604102492, 0.001511026406660676, 0.010847670026123524, 0.000661926344037056, 0.011585287749767303, 0.0006474615074694157, 0.0017794161103665829, 0.0006693816976621747, 0.03106880746781826, 0.9553954601287842, 0.001007610815577209, 0.0007595044444315135, 0.0008482832345180213, 0.0007544124964624643, 0.001080950372852385, 0.0007659810944460332, 0.028765466064214706, 0.0006052638054825366, 0.0006054120603948832, 0.0006158570758998394, 0.005888709332793951, 0.000680108554661274, 0.062360383570194244, 0.028983253985643387, 0.006121721584349871, 0.0006208106642588973, 0.0007472634315490723, 0.0011089288163930178, 0.0007186040747910738, 0.0007840358885005116, 0.0005520478007383645, 0.005213629454374313, 0.0011512466007843614, 0.0007000610348768532, 0.0009579125326126814, 0.0018496554112061858, 0.000679355172906071, 0.0007052647415548563, 0.0008322439971379936, 0.0006306673749350011, 0.0011325041996315122, 0.0005853204056620598, 0.0005785677349194884, 0.0006440891302190721, 0.0006645717076025903, 0.0016789896180853248, 0.0007109186262823641, 0.0012765651335939765, 0.000639889040030539, 0.0007103290990926325, 0.000698280637152493, 0.0006317538791336119, 0.007184003479778767, 0.0035245839972049, 0.0013820258900523186, 0.00262545351870358, 0.0010077259503304958, 0.00300866668112576, 0.002475293120369315, 0.0007255679811351001, 0.0011917873052880168, 0.0008884730050340295, 0.0007591795874759555, 0.00145871436689049, 0.0007999719819054008, 0.1717062145471573, 0.0013746257172897458, 0.0007640036637894809, 0.001072844723239541, 0.0013743136078119278, 0.0005686718504875898, 0.0006897226558066905, 0.0008954002405516803, 0.001270165666937828, 0.0012506357161328197, 0.0006091789691708982, 0.0009103288175538182, 0.0009127776138484478, 0.8954711556434631, 0.002504209987819195, 0.0005616173730231822, 0.0006281083915382624, 0.0006275683408603072, 0.0007931121508590877, 0.0005667339428327978, 0.015235294587910175, 0.0010200882097706199, 0.0005748001276515424, 0.0008866151329129934, 0.0007851945119909942, 0.0007070151041261852, 0.0016488659894093871, 0.0006059749284759164, 0.0012582666240632534, 0.0005559960845857859, 0.0007348477374762297, 0.0009152221609838307, 0.0005747779505327344, 0.0008080062689259648, 0.05602025240659714, 0.0007120845257304609, 0.0008582309819757938, 0.0006049754447303712, 0.0006338212406262755, 0.0017802310176193714, 0.10085661709308624, 0.0018668113043531775, 0.0006300296518020332, 0.0011930435430258512, 0.0006674448377452791, 0.0006593965226784348, 0.0006102235056459904, 0.0005417213542386889, 0.0005414540064521134, 0.0007546709384769201, 0.004444824997335672, 0.0005467541050165892, 0.0005798314232379198, 0.0005653597763739526, 0.0006588698015548289, 0.0006054198602214456, 0.0008162918966263533, 0.0006696130149066448, 0.0006982632912695408, 0.0007491668802686036, 0.0008649386581964791, 0.0008635296253487468, 0.0007233221549540758, 0.0007468227995559573, 0.0008330167620442808, 0.000777633860707283, 0.0005707371165044606, 0.17134325206279755, 0.0006415515090338886, 0.0006476914277300239, 0.0008257590234279633, 0.0006399658741429448, 0.973655641078949, 0.9216688871383667, 0.0007525075925514102, 0.0005976961692795157, 0.0006295776693150401, 0.017440851777791977, 0.0007507502450607717, 0.001169237308204174, 0.002858418505638838, 0.0006586845847778022, 0.0006832624203525484, 0.0005915552610531449, 0.001002516713924706, 0.0007140375673770905, 0.0009891310473904014, 0.0007977106142789125, 0.0008035171777009964, 0.0008202415192499757, 0.005632027518004179, 0.0006265899864956737, 0.000758252979721874, 0.0007752107339911163, 0.0005492655327543616, 0.0009155552252195776, 0.0009774290956556797, 0.003114056307822466, 0.00112699787132442, 0.0005619123694486916, 0.001366799115203321, 0.04204072058200836, 0.0006145735387690365, 0.0016417624428868294, 0.0006872735684737563, 0.002995497779920697, 0.004443898797035217, 0.0005996069521643221, 0.008148298598825932, 0.0008325885864906013, 0.0005484138964675367, 0.0009667326812632382, 0.0010812202235683799, 0.001158665050752461, 0.0006693338509649038, 0.0024651060812175274, 0.0007068661507219076, 0.0012230596039444208, 0.0006406985339708626, 0.0007752354722470045, 0.23532217741012573, 0.10930497944355011, 0.004756477195769548, 0.0008979735430330038, 0.0022529144771397114, 0.015641475096344948, 0.0038375770673155785, 0.0037962007336318493, 0.25044646859169006, 0.0006688626599498093, 0.0006902561872266233, 0.0011313834693282843, 0.0009526686044409871, 0.03319045528769493, 0.0006063146283850074, 0.0006597831379622221, 0.2602487802505493, 0.0010411578696221113, 0.033144135028123856, 0.0018315736670047045, 0.006156723015010357, 0.0006495347479358315, 0.0006007742485962808, 0.00067365966970101, 0.06735540181398392, 0.0006918213330209255, 0.0024198731407523155, 0.0028049375396221876, 0.0006454670801758766, 0.0006600802880711854, 0.0006438414566218853, 0.0006199822528287768, 0.0009269834263250232, 0.0008071297779679298, 0.0005998401902616024, 0.0017239084700122476, 0.0007182942936196923, 0.0007673527579754591, 0.005053945351392031, 0.0448906235396862, 0.6599375605583191, 0.0006805409793742001, 0.0006859268760308623, 0.0006063475157134235, 0.0008377949707210064, 0.0005660601891577244, 0.0036339398939162493, 0.014581406489014626, 0.0025792501401156187, 0.016689030453562737, 0.06848175823688507, 0.006914740428328514, 0.9459126591682434, 0.3711934983730316, 0.6412934064865112, 0.0006423257873393595, 0.0008010246092453599, 0.3302365243434906, 0.0014105545124039054, 0.005110930185765028, 0.0005981968133710325, 0.000661553698591888, 0.0006817214889451861, 0.016539203003048897, 0.0007866533123888075, 0.03916981816291809, 0.019332632422447205, 0.3084411323070526, 0.0049961647018790245, 0.0010718415724113584, 0.0007805753266438842, 0.0007675323286093771, 0.0015968256630003452, 0.004631764721125364, 0.002112345537170768, 0.03463863953948021, 0.007039471995085478, 0.0008692932897247374, 0.0006279043154790998, 0.0052274479530751705, 0.0007418787572532892, 0.017161525785923004, 0.0006471789092756808, 0.0006389173213392496, 0.000863775669131428, 0.0006125925574451685, 0.000640743353869766, 0.0022052146960049868, 0.0006307614385150373, 0.00300526712089777, 0.0008545031305402517, 0.0011189394863322377, 0.038061629980802536, 0.0006887465715408325, 0.0006038955762051046, 0.0007710459176450968, 0.0027833895292133093, 0.989763617515564, 0.0007289439090527594, 0.0018540006130933762, 0.0016032991698011756, 0.0006290864548645914, 0.0037967904936522245, 0.0014454155461862683, 0.0005819436046294868, 0.0006409641937352717, 0.002324421424418688, 0.002221934963017702, 0.001760111190378666, 0.28226807713508606, 0.6099458336830139, 0.0008594892569817603, 0.0009308591834269464, 0.003170284442603588, 0.0017584387678653002, 0.001241583377122879, 0.0010969196446239948, 0.0005385255790315568, 0.0007527091656811535, 0.0010659766849130392, 0.0006516920402646065, 0.0008112851646728814, 0.0010734888492152095, 0.0006069312803447247, 0.0010530188446864486, 0.0007020432385616004, 0.0007374914712272584, 0.0015889897476881742, 0.0009639454656280577, 0.000803690985776484, 0.001105503411963582, 0.3429511487483978, 0.006885661743581295, 0.0012625110102817416, 0.0009308670996688306, 0.001386749092489481, 0.1178123950958252, 0.0006138684111647308, 0.0010727139888331294, 0.0006804852746427059, 0.0005481552216224372, 0.0005640918388962746, 0.0006183178629726171, 0.000579523912165314, 0.0005257083685137331, 0.0006976573495194316, 0.0005488675087690353, 0.0006030426011420786, 0.0007076264591887593, 0.0015480151632800698, 0.0008890526951290667, 0.000608379952609539, 0.5132225751876831, 0.0006615460733883083, 0.003290440421551466, 0.0007400918984785676, 0.002253185724839568, 0.0007212135242298245, 0.0008154968963935971, 0.0007518377969972789, 0.0007442214991897345, 0.0008405031985603273, 0.3620581030845642, 0.009277650155127048, 0.004182823467999697, 0.42556536197662354, 0.9690532088279724, 0.5549453496932983, 0.5808479189872742, 0.0006338553503155708, 0.0011650437954813242, 0.0008457090007141232, 0.020004039630293846, 0.0023583117872476578, 0.00133093586191535, 0.0011129264021292329, 0.0005923106800764799, 0.0005962190916761756, 0.0016988231800496578, 0.001009235973469913, 0.001386720105074346, 0.0006151417037472129, 0.0006189292762428522, 0.029012367129325867, 0.10990769416093826, 0.0625622570514679, 0.05735529959201813, 0.010509317740797997, 0.015434700064361095, 0.04862344637513161, 0.0011533364886417985, 0.23542512953281403, 0.09669844806194305, 0.019079720601439476, 0.0011880096280947328, 0.0012036601547151804, 0.7678697109222412, 0.6983551979064941, 0.0010503242956474423, 0.0008732225396670401, 0.0015408825129270554, 0.001949845696799457, 0.0008392476011067629, 0.29739633202552795, 0.0009509609662927687, 0.9306807518005371, 0.0007678384426981211, 0.000753392989281565, 0.0007988719153217971, 0.0008735149749554694, 0.0008584432071074843, 0.0006676733028143644, 0.0018961140885949135, 0.0009024676983244717, 0.0009211448486894369, 0.010740131139755249, 0.0030203836504369974, 0.04373583942651749, 0.0008108933106996119, 0.0007979284855537117, 0.0007739138673059642, 0.012262909673154354, 0.0006967682857066393, 0.000936247524805367, 0.002527299104258418, 0.0007802336476743221, 0.929314911365509, 0.001727203605696559, 0.0010642532724887133, 0.0007022145437076688, 0.0018033088417723775, 0.00131381512619555, 0.9584291577339172, 0.0009813803480938077, 0.0006800165283493698, 0.12914787232875824, 0.0010349754011258483, 0.028409000486135483, 0.04106936976313591, 0.0006696162163279951, 0.005263550207018852, 0.049110133200883865, 0.0009583064238540828, 0.003696330124512315, 0.03324707970023155, 0.0015108715742826462, 0.030970122665166855, 0.008600913919508457, 0.0005501743871718645, 0.0006134885479696095, 0.0007229610928334296, 0.0015577622689306736, 0.0007258850964717567, 0.000814009690657258, 0.001004867604933679, 0.0014752460410818458, 0.001051433035172522, 0.0011693509295582771, 0.0007677375106140971, 0.0005997830303385854, 0.0006456941482611, 0.0006978458841331303, 0.010858414694666862, 0.005477297585457563, 0.0012232292210683227, 0.0038631251081824303, 0.0007432625279761851, 0.0010874210856854916, 0.0006258356152102351, 0.0008018703665584326, 0.0013485437957569957, 0.0007085752440616488, 0.4933125376701355, 0.018432198092341423, 0.0034974871668964624, 0.3839828670024872, 0.0033683362416923046, 0.0011371667496860027, 0.0017043978441506624, 0.0011184642789885402, 0.0010842743795365095, 0.0007081266958266497, 0.026222193613648415, 0.000851934019010514, 0.0008744209771975875, 0.0007697494584135711, 0.0013927879044786096, 0.49923548102378845, 0.0007633289787918329, 0.0006658200290985405, 0.0007161869434639812, 0.0005897496012039483, 0.0007377020083367825, 0.0006535174325108528, 0.0008845333941280842, 0.0007040264317765832, 0.0009472313104197383, 0.0008961278363130987, 0.006098198238760233, 0.015849124640226364, 0.0006895622937008739, 0.0009928008075803518, 0.0007970199803821743, 0.001878432696685195, 0.0006459588184952736, 0.0007214819779619575, 0.00102417659945786, 0.0005594036774709821, 0.0008990501519292593, 0.7010577917098999, 0.0287465862929821, 0.00089502107584849, 0.0006865423056297004, 0.006110919639468193, 0.0005961217102594674, 0.0018710383446887136, 0.0006571354460902512, 0.0023368550464510918, 0.0015645736129954457, 0.028209414333105087, 0.0007166877621784806, 0.0007507553091272712, 0.0008109273039735854, 0.0009077853173948824, 0.0006907439092174172, 0.0007792168180458248, 0.0008971055503934622, 0.0005888770101591945, 0.000608544098213315, 0.001075177569873631, 0.002263145986944437, 0.019606877118349075, 0.015662429854273796, 0.002529759658500552, 0.0008316771709360182, 0.0006987479282543063, 0.0010922561632469296, 0.0006579789915122092, 0.0009698711219243705, 0.3049752712249756, 0.013753926381468773, 0.0007078527705743909, 0.004652205388993025, 0.0012786496663466096, 0.0006693683099001646, 0.0006971695111133158, 0.000580090912990272, 0.0006186558748595417, 0.004258440807461739, 0.0024582352489233017, 0.033115752041339874, 0.012586638331413269, 0.575747549533844, 0.0008481566910631955, 0.025927674025297165, 0.007039405405521393, 0.0015025959582999349, 0.010448753833770752, 0.005484058056026697, 0.00123037479352206, 0.0013851611874997616, 0.0011737087043002248, 0.0013160688104107976, 0.000577207247260958, 0.0007344041368924081, 0.008432116359472275, 0.001423622714355588, 0.00592463742941618, 0.0012026133481413126, 0.0013403586344793439, 0.0026816243771463633, 0.0023287604562938213, 0.0036694342270493507, 0.0006315612117759883, 0.014075043611228466, 0.0008618490537628531, 0.0015820716507732868, 0.0009529106318950653, 0.029735242947936058, 0.0006305021233856678, 0.0008047785377129912, 0.018614862114191055, 0.0032717164140194654, 0.0033624693751335144, 0.0036183693446218967, 0.0019361104350537062, 0.010490947403013706, 0.0010448710527271032, 0.0011573397787287831, 0.039855241775512695, 0.01274511031806469, 0.0025317627005279064, 0.0010212089400738478, 0.0007907520048320293, 0.0007216593367047608, 0.0008896476356312633, 0.0006754136993549764, 0.0009203385561704636, 0.0006126760854385793, 0.0015799852553755045, 0.0021265968680381775, 0.0033369925804436207, 0.0007046899409033358, 0.0006704633124172688, 0.0020217953715473413, 0.07547654211521149, 0.009180610999464989, 0.0007058238261379302, 0.0006839066627435386, 0.001113058882765472, 0.0008665171335451305, 0.004488829988986254, 0.000583080924116075, 0.005311514716595411, 0.000907349050976336, 0.0008691627881489694, 0.0007735072867944837, 0.0007210688781924546, 0.001005549100227654, 0.0006795403896830976, 0.0008092757780104876, 0.0009853109950199723, 0.0008886656723916531, 0.003652889048680663, 0.0017707606311887503, 0.0010724022286012769, 0.0007846016669645905, 0.2373368889093399, 0.0012861945433542132, 0.015207662247121334, 0.001278240466490388, 0.0015327287837862968, 0.05571726709604263, 0.0005841026431880891, 0.0011127355974167585, 0.01072568167001009, 0.0013102568918839097, 0.8136352300643921, 0.0028365945909172297, 0.0027199257165193558, 0.10074147582054138, 0.0005571414949372411, 0.000978311407379806, 0.0008717921446077526, 0.0006658691563643515, 0.0007794373668730259, 0.0026379756163805723, 0.0006175966700538993, 0.008456983603537083, 0.0009883209131658077, 0.01022362057119608, 0.0022870765533298254, 0.0007627895101904869, 0.028592869639396667, 0.0007446371600963175, 0.0015408655162900686, 0.0007995382184162736, 0.19943717122077942, 0.25574880838394165, 0.0005870179738849401, 0.046770352870225906, 0.0010059389751404524, 0.000791064347140491, 0.0006216283072717488, 0.02790515124797821, 0.0009131995611824095, 0.2865409255027771, 0.0008020492387004197, 0.9489681720733643, 0.0008610774530097842, 0.0007114269537851214, 0.001396146952174604, 0.9392934441566467, 0.00933246873319149, 0.00903839897364378, 0.0649382472038269, 0.0008980612619780004, 0.0006328964955173433, 0.36903953552246094, 0.0006611748831346631, 0.0007246852037496865, 0.0005904807476326823, 0.0009994303109124303, 0.19707831740379333, 0.0005955903907306492, 0.0006537862354889512, 0.003215768840163946, 0.0005516599048860371, 0.00446173083037138, 0.01853262074291706, 0.0009921214077621698, 0.0005870268796570599, 0.0008145435713231564, 0.028356341645121574, 0.0057186284102499485, 0.000763265008572489, 0.0007521458901464939, 0.0008059158571995795, 0.0011021617101505399, 0.0009646294638514519, 0.0025788990315049887, 0.0005603829631581903, 0.14416758716106415, 0.07035357505083084, 0.0008393891621381044, 0.0326545350253582, 0.0012796163791790605, 0.9917639493942261, 0.0010294478852301836, 0.0008869103621691465, 0.0006095105782151222, 0.0009475404513068497, 0.01143011637032032, 0.0007177075603976846, 0.013194828294217587, 0.15664592385292053, 0.12190799415111542, 0.0012783294077962637, 0.0011996865505352616, 0.0012697640340775251, 0.0008698948659002781, 0.28044959902763367, 0.001646102056838572, 0.0012289410224184394, 0.0010802580509334803, 0.03315405920147896, 0.025431817397475243, 0.9526540637016296, 0.0006899205618537962, 0.6784210205078125, 0.0008620860171504319, 0.0008092032512649894, 0.0013690489577129483, 0.001086900127120316, 0.8502601385116577, 0.005320798605680466, 0.01948658563196659, 0.6441633701324463, 0.0028491453267633915, 0.1969851404428482, 0.006701976992189884, 0.058215636759996414, 0.3274593949317932, 0.4327794909477234, 0.1376579999923706, 0.0007624144782312214, 0.002823342802003026, 0.21657150983810425, 0.0013524506939575076, 0.001026693731546402, 0.000704787380527705, 0.0023821736685931683, 0.8174841403961182, 0.007128377445042133, 0.06057407334446907, 0.013288597576320171, 0.0005804282845929265, 0.0005468891467899084, 0.006296913139522076, 0.013207679614424706, 0.035190414637327194, 0.001325777848251164, 0.0005606118938885629, 0.0008045349968597293, 0.0006328626768663526, 0.0008159535937011242, 0.02541799284517765, 0.01619838736951351, 0.0008829200523905456, 0.0005888326559215784, 0.060980476438999176, 0.0005606383783742785, 0.012777923606336117, 0.00530287018045783, 0.022723548114299774, 0.0005627032369375229, 0.04204634577035904, 0.9746662378311157, 0.015371005050837994, 0.001400946406647563, 0.0006702013779431581, 0.0007004900835454464, 0.001010578591376543, 0.0024230601266026497, 0.058491215109825134, 0.0013956360053271055, 0.0037436841521412134, 0.0018188287504017353, 0.000752307940274477, 0.000621388666331768, 0.0015658694319427013, 0.0014331035781651735, 0.001594730420038104, 0.07408586889505386, 0.7439602017402649, 0.01950717903673649, 0.0007555283955298364, 0.014780053868889809, 0.025632312521338463, 0.001253903959877789, 0.0007448844844475389, 0.000852928205858916, 0.0024116074200719595, 0.11465082317590714, 0.7035142183303833, 0.002031064359471202, 0.021371740847826004, 0.12751220166683197, 0.0015239749336615205, 0.022622503340244293, 0.0015862006694078445, 0.0007434395956806839, 0.0009886468760669231, 0.004299106076359749, 0.9089148640632629, 0.0016864335630089045, 0.002038720063865185, 0.0322524756193161, 0.019781149923801422, 0.001153137069195509, 0.7933077812194824, 0.39093631505966187, 0.009552864357829094, 0.0011204301845282316, 0.6623830199241638, 0.0007319719879887998, 0.0011562813306227326, 0.002426908118650317, 0.34455692768096924, 0.059970758855342865, 0.0006506973877549171, 0.006582099944353104, 0.0012544499477371573, 0.00596375297755003, 0.0015412523644044995, 0.004966989625245333, 0.0016712156357243657, 0.9591061472892761, 0.037249721586704254, 0.0011508951429277658, 0.0009387540048919618, 0.0008895971113815904, 0.0011577174300327897, 0.04206058010458946, 0.0005957780522294343, 0.0009792601922526956, 0.0009635597234591842, 0.0005695277941413224, 0.0006217998452484608, 0.0007709952187724411, 0.0027161529287695885, 0.0007358581642620265, 0.0014483663253486156, 0.0025474531576037407, 0.000821041117887944, 0.0009764996357262135, 0.0007000079494901001, 0.0007114401669241488, 0.0025226932484656572, 0.0009334066999144852, 0.0038314552512019873, 0.001182924141176045, 0.0008535541710443795, 0.014274101704359055, 0.001182800275273621, 0.006367343943566084, 0.04635917395353317, 0.0008516191155649722, 0.7861760854721069, 0.0009655714384280145, 0.0008946535526774824, 0.0014504995197057724, 0.0005941222771070898, 0.0007876997115090489, 0.0006621244829148054, 0.0006445210892707109, 0.0007689983467571437, 0.0006989540415816009, 0.0006771503249183297, 0.0010054997401311994, 0.01838880591094494, 0.1881917119026184, 0.0008986283210106194, 0.0010582448448985815, 0.0008470207103528082, 0.0006888706120662391, 0.2518029808998108, 0.0007195209618657827, 0.0006500525050796568, 0.010617421008646488, 0.0008852150640450418, 0.003880765987560153, 0.00893875677138567, 0.0006606222013942897, 0.05049952492117882, 0.0008114517549984157, 0.004580842796713114, 0.0006241951487027109, 0.0010241562267765403, 0.001182924141176045, 0.009683432057499886, 0.0012863280717283487, 0.0035133108031004667, 0.0007669301703572273, 0.0006565154762938619, 0.0007038043695501983, 0.001027792110107839, 0.0005908680614084005, 0.053655609488487244, 0.001176521647721529, 0.0006011411314830184, 0.0011012727627530694, 0.0010094863828271627, 0.0005925780860707164, 0.0006317408988252282, 0.0016747030895203352, 0.0009100110037252307, 0.0008274614810943604, 0.0007138476939871907, 0.000589909206610173, 0.0061138710007071495, 0.0015672454610466957, 0.0013272769283503294, 0.0011431435123085976, 0.0008367294794879854, 0.0006734937196597457, 0.0006386497989296913, 0.0009804986184462905, 0.0006439571734517813, 0.03899617865681648, 0.0006107058725319803, 0.08162029832601547, 0.0013136088382452726, 0.0047896248288452625, 0.001559040741994977, 0.0011067199520766735, 0.7098299264907837, 0.0008169817156158388, 0.0010076395701617002, 0.02972664125263691, 0.0012797870440408587, 0.02712625451385975, 0.0009937306167557836, 0.0007977981003932655, 0.0007215400692075491, 0.003588935825973749, 0.0007917340262793005, 0.0008816095069050789, 0.0021705704275518656, 0.0007456966559402645, 0.0006963431369513273, 0.0007371605024673045, 0.0009802754502743483, 0.0006842390866950154, 0.0009500281885266304, 0.0007397289737127721, 0.0006482558674179018, 0.013737074099481106, 0.0007421831251122057, 0.006587312091141939, 0.002125437604263425, 0.011641516350209713, 0.0006918239523656666, 0.0007112879538908601, 0.1683172583580017, 0.0009373632492497563, 0.0007952963351272047, 0.001941707800142467, 0.05492832511663437, 0.012462850660085678, 0.0007688569603487849, 0.001573951099999249, 0.0007829100359231234, 0.0012693844037130475, 0.0006609669653698802, 0.0006147077074274421, 0.0012316838838160038, 0.0008054351783357561, 0.001160982414148748, 0.908825159072876, 0.025769950821995735, 0.0034728022292256355, 0.3582741618156433, 0.44677218794822693, 0.016435613855719566, 0.0011564100859686732, 0.0008160161669366062, 0.009733961895108223, 0.001796247437596321, 0.0010228976607322693, 0.002350765746086836, 0.014334672130644321, 0.0013060064520686865, 0.004791957326233387, 0.01599162444472313, 0.0006620778003707528, 0.0008841255912557244, 0.004433571361005306, 0.0009467689669691026, 0.0014153220690786839, 0.0012036975240334868, 0.008130909875035286, 0.0011855942429974675, 0.0011267124209553003, 0.0008358024060726166, 0.0022716938983649015, 0.006784345023334026, 0.0011970476480200887, 0.32294610142707825, 0.0009038122952915728, 0.0023742769844830036, 0.007040269207209349, 0.012705500237643719, 0.0009792177006602287, 0.000983272329904139, 0.023365262895822525, 0.000638586760032922, 0.000749341503251344, 0.0008191960514523089, 0.0007320005679503083, 0.0009003308950923383, 0.0006022883462719619, 0.0040969243273139, 0.0009404926095157862, 0.001539099495857954, 0.0005762408836744726, 0.000587164016906172, 0.0007504158420488238, 0.0009040310396812856, 0.0011704369680956006, 0.0006774392095394433, 0.0012932688696309924, 0.0011290137190371752, 0.0007127893040888011, 0.007568089757114649, 0.0006099530728533864, 0.0011223769979551435, 0.004794281907379627, 0.00233644712716341, 0.0017984973965212703, 0.0007077225600369275, 0.0010388200171291828, 0.0007568044820800424, 0.00801003072410822, 0.0020288878586143255, 0.0008102348074316978, 0.0018216096796095371, 0.0009112226543948054, 0.0006685213884338737, 0.0008157180272974074, 0.003298800438642502, 0.0006163239013403654, 0.006827168166637421, 0.0006492235115729272, 0.0026277995202690363, 0.0008981673163361847, 0.0012904321774840355, 0.0012313794577494264, 0.0008090853225439787, 0.004386641085147858, 0.0008225751807913184, 0.0008156364201568067, 0.013964525423943996, 0.001191765652038157, 0.001317479065619409, 0.015193686820566654, 0.0015638250624760985, 0.0013336119009181857, 0.8025222420692444, 0.03963236138224602, 0.1190430298447609, 0.3869498670101166, 0.0013528397539630532, 0.000831540790386498, 0.18884851038455963, 0.0006439629942178726, 0.0022053804714232683, 0.21241389214992523, 0.0007444782531820238, 0.012219362892210484, 0.0031334266532212496, 0.00801282748579979, 0.0006443162565119565, 0.000795288011431694, 0.0014182963641360402, 0.0008110938360914588, 0.001158911269158125, 0.0021019051782786846, 0.0009436578839085996, 0.000965050479862839, 0.001386256655678153, 0.06279594451189041, 0.0012556255096569657, 0.0006983894272707403, 0.0036431646440178156, 0.0009494771948084235, 0.01164038572460413, 0.0096852146089077, 0.0007347856881096959, 0.15612109005451202, 0.3672853112220764, 0.0007032137364149094, 0.001658175722695887, 0.0008933625649660826, 0.002536806045100093, 0.0028454577550292015, 0.0007000142941251397, 0.005016142502427101, 0.0014808401465415955, 0.0028441455215215683, 0.0007496125181205571, 0.0012630197452381253, 0.0038155815564095974, 0.005054364912211895, 0.0017063202103599906, 0.0041634258814156055, 0.0039899409748613834, 0.0009383520227856934, 0.0006986900116316974, 0.0016783581813797355, 0.005288929678499699, 0.0007111459271982312, 0.012919657863676548, 0.02397802099585533, 0.009694114327430725, 0.0008588879136368632, 0.0016363312024623156, 0.0014149898197501898, 0.0012076544808223844, 0.0073830303736031055, 0.0007725198520347476, 0.1107148602604866, 0.06179417669773102, 0.0006177070899866521, 0.0011515344958752394, 0.0007211341871879995, 0.0013911519199609756, 0.0007630126783624291, 0.000812994665466249, 0.0009519627201370895, 0.0016833061818033457, 0.004835039377212524, 0.0023363817017525434, 0.010028012096881866, 0.021537423133850098, 0.0014525149017572403, 0.0006178503972478211, 0.0007528676651418209, 0.0023424748796969652, 0.0005980178248137236, 0.0018419254338368773, 0.0008823918760754168, 0.0008208401268348098, 0.0011756888125091791, 0.0006160232587717474, 0.0005687398370355368, 0.4001859426498413, 0.0010836533037945628, 0.001030433108098805, 0.0007342887693084776, 0.001025632955133915, 0.17423735558986664, 0.0008157033007591963, 0.009758302941918373, 0.0007129482692107558, 0.12834900617599487, 0.001113615813665092, 0.0006799057009629905, 0.0009378743125125766, 0.0006890429649502039, 0.0007618400268256664, 0.0013555093901231885, 0.0009669141145423055, 0.0012669552816078067, 0.0024647286627441645, 0.0012086320202797651, 0.0007420954643748701, 0.0005998018896207213, 0.007046922110021114, 0.00699962442740798, 0.010967958718538284, 0.0017821182264015079, 0.01068362221121788, 0.0010256104869768023, 0.001351720653474331, 0.03078167326748371, 0.18102988600730896, 0.0024402437265962362, 0.002430523280054331, 0.001429339754395187, 0.0010121496161445975, 0.0011130520142614841, 0.0007867825916036963, 0.0006772145279683173, 0.000856977014336735, 0.0006523674819618464, 0.0007804061751812696, 0.0006172377034090459, 0.0013982887612655759, 0.0007323365425691009, 0.47162801027297974, 0.02962942235171795, 0.00101151829585433, 0.001133577199652791, 0.0008554828236810863, 0.0013897516764700413, 0.0010217975359410048, 0.0006617396720685065, 0.00658165430650115, 0.0005918793031014502, 0.0008956578094512224, 0.10095251351594925, 0.00451238127425313, 0.0031767208129167557, 0.0007203144486993551, 0.0013881708728149533, 0.0007118257344700396, 0.0026342221535742283, 0.0008004455012269318, 0.0013779484434053302, 0.0013140185037627816, 0.0005837320350110531, 0.000590302690397948, 0.01367421355098486, 0.051217734813690186, 0.0006213297601789236, 0.001364244380965829, 0.0006069251685403287, 0.0005401883972808719, 0.0037542397622019053, 0.0008755578310228884, 0.0009523541666567326, 0.0008378943311981857, 0.0021113739348948, 0.0010993388714268804, 0.0015515818959102035, 0.012685120105743408, 0.03863563761115074, 0.08688613772392273, 0.0005677451845258474, 0.0008866717107594013, 0.10973085463047028, 0.05429382994771004, 0.001814279705286026, 0.0005830250447615981, 0.002975994488224387, 0.0930248349905014, 0.0009036210831254721, 0.0010815184796229005, 0.0008360317442566156, 0.003769125323742628, 0.0011227962095290422, 0.0006319363019429147, 0.0007401627372018993, 0.001704521244391799, 0.024966541677713394, 0.0006576514570042491, 0.0008554896921850741, 0.0006925007328391075, 0.0018449128838256001, 0.0006404353771358728, 0.0006104614003561437, 0.0005900987307541072, 0.0005563203012570739, 0.000733241206035018, 0.0006190791027620435, 0.0022578686475753784, 0.0023942533880472183, 0.0007417023298330605, 0.0009642278891988099, 0.0007827589870430529, 0.0005570001667365432, 0.0011109134647995234, 0.0006277430220507085, 0.0007450986304320395, 0.03365883231163025, 0.0007497682236135006, 0.004142130259424448, 0.0009577651508152485, 0.0013563849497586489, 0.0006402974249795079, 0.000771945808082819, 0.0010414981516078115, 0.0005792806623503566, 0.000723866862244904, 0.0006839096313342452, 0.0006564513314515352, 0.0026503708213567734, 0.0007743616588413715, 0.0012423860607668757, 0.002698336262255907, 0.00392146734520793, 0.000880453095305711, 0.0009230003342963755, 0.029425743967294693, 0.0007841151091270149, 0.0010094421450048685, 0.0021102800965309143, 0.0016844974597916007, 0.0077585456892848015, 0.00119931367225945, 0.0013505001552402973, 0.0007123268442228436, 0.019693396985530853, 0.021909987553954124, 0.23253966867923737, 0.012321839109063148, 0.0006325310096144676, 0.0026199291460216045, 0.0016527252737432718, 0.053764458745718, 0.0014053796185180545, 0.0006689879228360951, 0.02493378333747387, 0.0008450126042589545, 0.0030141668394207954, 0.014295540750026703, 0.0019624168053269386, 0.0013364359037950635, 0.0007762907771393657, 0.0012626342941075563, 0.000626196269877255, 0.005820263177156448, 0.0006512859254144132, 0.0006124507053755224, 0.0006462704623118043, 0.0008335749735124409, 0.0008379046921618283, 0.003287262748926878, 0.0005236358847469091, 0.0010527330450713634, 0.0009305860148742795, 0.0010469546541571617, 0.0007915244204923511, 0.0015780134126543999, 0.0006233919411897659, 0.0006604503141716123, 0.0015985865611582994, 0.005062826443463564, 0.006921298336237669, 0.0008387542911805212, 0.002409522421658039, 0.0018250724533572793, 0.07863585650920868, 0.0032034183386713266, 0.1716187447309494, 0.06004241853952408, 0.0006693762843497097, 0.000540420413017273, 0.0011158999986946583, 0.0005924403085373342, 0.443646103143692, 0.0007091589504852891, 0.0007935230969451368, 0.0006681857630610466, 0.0006015907856635749, 0.0008996962569653988, 0.0008862543618306518, 0.12141776829957962, 0.27564138174057007, 0.008224491029977798, 0.055387698113918304, 0.0005840820958837867, 0.0006415952229872346, 0.0005740858614444733, 0.272605299949646, 0.0007818513549864292, 0.0006993661518208683, 0.0006661008228547871, 0.0011267332592979074, 0.0007926002726890147, 0.0010655359365046024, 0.0008646869682706892, 0.24721644818782806, 0.0014037176733836532, 0.0010400637984275818, 0.0007433468708768487, 0.0006664053071290255, 0.039193570613861084, 0.0006322462577372789, 0.0040986621752381325, 0.18601351976394653, 0.46078845858573914, 0.0007466918905265629, 0.0007450943230651319, 0.0011085051810368896, 0.000623389205429703, 0.0008200262673199177, 0.032396331429481506, 0.01745469681918621, 0.0013769620563834906, 0.07020528614521027, 0.0022228907328099012, 0.002938765101134777, 0.000665501574985683, 0.0006049051298759878, 0.0032101322431117296, 0.001050370279699564, 0.14618779718875885, 0.0008300078916363418, 0.0008319771732203662, 0.0011626911582425237, 0.0011075905058532953, 0.6472622752189636, 0.032166365534067154, 0.001129278913140297, 0.4856540858745575, 0.9645873308181763, 0.0012910086661577225, 0.0019515565363690257, 0.0010887696407735348, 0.0011040595127269626, 0.0015994642162695527, 0.0008133631199598312, 0.012028994970023632, 0.0030389269813895226, 0.941016435623169, 0.18437893688678741, 0.010479493997991085, 0.08629993349313736, 0.000845933856908232, 0.00165119010489434, 0.9616003036499023, 0.06657329201698303, 0.976626455783844, 0.0007951727602630854, 0.0010902757057920098, 0.1004670187830925, 0.001515245996415615, 0.0009477580897510052, 0.0006190548883751035, 0.0007258110563270748, 0.0033447372261434793, 0.0009900762233883142, 0.03431057184934616, 0.02272932603955269, 0.00061571947298944, 0.0018821770790964365, 0.0005806144326925278, 0.005976974964141846, 0.0007653689244762063, 0.12052854150533676, 0.0027225848753005266, 0.06463836133480072, 0.0041603706777095795, 0.0005815856857225299, 0.018401604145765305, 0.018295245245099068, 0.0007862612837925553, 0.0025077403988689184, 0.0021452540531754494, 0.0008372889715246856, 0.0006648327689617872, 0.000849662465043366, 0.0057384842075407505, 0.9145979285240173, 0.01537060085684061, 0.0047116875648498535, 0.0006455759867094457, 0.02632996253669262, 0.00838970672339201, 0.0018109470838680863, 0.002341051120311022, 0.0007466099923476577, 0.006536437198519707, 0.0019159566145390272, 0.8717049956321716, 0.0008326750830747187, 0.03951646760106087, 0.000697119627147913, 0.002530499827116728, 0.0009991131955757737, 0.025319263339042664, 0.005575547926127911, 0.08702972531318665, 0.0008627911447547376, 0.0010499616619199514, 0.0006603719666600227, 0.0006912318640388548, 0.0007008149987086654, 0.0056330799125134945, 0.0071927388198673725, 0.018276864662766457, 0.0030237988103181124, 0.0008411469752900302, 0.0013055562740191817, 0.003680599620565772, 0.003738327883183956, 0.0006177117465995252, 0.010133865289390087, 0.0006357290549203753, 0.004794411361217499, 0.03383314609527588, 0.017479296773672104, 0.005185891408473253, 0.000840750290080905, 0.0007331667584367096, 0.0022894779685884714, 0.0010708984918892384, 0.000780723465140909, 0.0007502446533180773, 0.0006595831946469843, 0.000678522395901382, 0.0007500688079744577, 0.030532849952578545, 0.0008204025216400623, 0.0017588448245078325, 0.0008201684686355293, 0.006739912088960409, 0.5015800595283508, 0.3327431082725525, 0.4891504943370819, 0.0008394386968575418, 0.014243205077946186, 0.0060242959298193455, 0.1017368733882904, 0.001994694583117962, 0.00286927935667336, 0.000726866303011775, 0.0007828656234778464, 0.0006623153458349407, 0.0006874117534607649, 0.02290593460202217, 0.15820957720279694, 0.0006297643412835896, 0.0012799795949831605, 0.0007030793931335211, 0.009000901132822037, 0.11271969974040985, 0.005311429034918547, 0.0009398596594110131, 0.0011167741613462567, 0.0006681280792690814, 0.001190382638014853, 0.001110825571231544, 0.0018406608141958714, 0.001754014054313302, 0.001362148323096335, 0.0006562705966643989, 0.13695178925991058, 0.0008301474736072123, 0.0006310492171905935, 0.0007404258940368891, 0.0011536100646480918, 0.0019354268442839384, 0.0021994912531226873, 0.0015827700262889266, 0.0007034288719296455, 0.0015112472465261817, 0.0038561858236789703, 0.0006925835623405874, 0.0021160668693482876, 0.01248073298484087, 0.9175152778625488, 0.0012873673113062978, 0.0017233758699148893, 0.0031068986281752586, 0.033516786992549896, 0.0008002230897545815, 0.004828834906220436, 0.027243932709097862, 0.0011080518597736955, 0.2442113161087036, 0.0278575848788023, 0.029743734747171402, 0.014305772259831429, 0.0039223856292665005, 0.0012870272621512413, 0.08365658670663834, 0.0011583025334402919, 0.4970718324184418, 0.2985413670539856, 0.6276041865348816, 0.008717991411685944, 0.007753155659884214, 0.0012947823852300644, 0.008222157135605812, 0.02599877119064331, 0.0006333496421575546, 0.0031919837929308414, 0.0010081696091219783, 0.005615074187517166, 0.2274928092956543, 0.021659530699253082, 0.056521590799093246, 0.0009938196744769812, 0.0020755550358444452, 0.02253449521958828, 0.010517725721001625, 0.044207919389009476, 0.2813906967639923, 0.1977437138557434, 0.0009955562418326735, 0.0006237960187718272, 0.0010795533889904618, 0.0007355749839916825, 0.8859294056892395, 0.0005856875795871019, 0.004656034056097269, 0.0009975661523640156, 0.0006938643055036664, 0.0008598246495239437, 0.008907766081392765, 0.08999741077423096, 0.0006220837240107358, 0.028911147266626358, 0.003399344626814127, 0.04734779894351959, 0.0017615234246477485, 0.0010747110936790705, 0.0031312736682593822, 0.006070713512599468, 0.0007323762984015048, 0.0008120582206174731, 0.0022394878324121237, 0.02075320854783058, 0.0005588401108980179, 0.049330275505781174, 0.0013665928272530437, 0.0017245379276573658, 0.0007085016695782542, 0.0008968781912699342, 0.0006583849317394197, 0.00082879833644256, 0.0007060323841869831, 0.0008004553383216262, 0.0012000889983028173, 0.0019332164665684104, 0.0008197082788683474, 0.0006611934513784945, 0.0007613617344759405, 0.0010039103217422962, 0.06944169849157333, 0.0008158101700246334, 0.636188268661499, 0.3087218403816223, 0.441952109336853, 0.1519649773836136, 0.001305838581174612, 0.0007371394312940538, 0.0039009025786072016, 0.0014955890364944935, 0.0008203427423723042, 0.000657716067507863, 0.0010971167357638478, 0.001525082509033382, 0.0011967255268245935, 0.04226474463939667, 0.002528916345909238, 0.0008096401579678059, 0.04557281732559204, 0.0011647341307252645, 0.0008035324863158166, 0.0008783696102909744, 0.0662248507142067, 0.8633455634117126, 0.000952460803091526, 0.0011294912546873093, 0.015399349853396416, 0.08712780475616455, 0.003889372805133462, 0.0035125112626701593, 0.07921338081359863, 0.00314595689997077, 0.0009520289022475481, 0.0006264571566134691, 0.0013359020231291652, 0.013816711492836475, 0.017783738672733307, 0.0011267472291365266, 0.3361407220363617, 0.001180447288788855, 0.003135139588266611, 0.003390398807823658, 0.037290021777153015, 0.07826361060142517, 0.0027292983140796423, 0.29993799328804016, 0.017250414937734604, 0.00399445928633213, 0.0025737909600138664, 0.004118066281080246, 0.02126966416835785, 0.00070012710057199, 0.31725919246673584, 0.0014773434959352016, 0.0015546156791970134, 0.0020261595491319895, 0.0009295757627114654, 0.5590987205505371, 0.0011368261184543371, 0.0006832001963630319, 0.000726786267478019, 0.09179452061653137, 0.0006966766668483615, 0.009843142703175545, 0.004119335673749447, 0.002485856879502535, 0.0009776055812835693, 0.25523748993873596, 0.002078615128993988, 0.03938102349638939, 0.002040129154920578, 0.0009004630264826119, 0.7746174931526184, 0.3848707377910614, 0.0006493568071164191, 0.0005790899158455431, 0.019649147987365723, 0.0009997811866924167, 0.015361410565674305, 0.0006122379563748837, 0.0016639909008517861, 0.0009783738059923053, 0.0012920781737193465, 0.020024199038743973, 0.0008914396748878062, 0.000975362432654947, 0.07927362620830536, 0.010649606585502625, 0.004020934924483299, 0.0006191171705722809, 0.03804447874426842, 0.0006636043544858694, 0.0011657258728519082, 0.005581648554652929, 0.000713307352270931, 0.0007537510246038437, 0.0005849578883498907, 0.0005750480922870338, 0.01023811660706997, 0.000607767142355442, 0.008226062171161175, 0.12460047006607056, 0.003973400220274925, 0.0014124008594080806, 0.000647401378955692, 0.001193456701003015, 0.0011544764274731278, 0.06339622288942337, 0.5668067336082458, 0.0008933740900829434, 0.0009742855909280479, 0.0008753284346312284, 0.10928172618150711, 0.0005793394520878792, 0.0005959648988209665, 0.0007964843534864485, 0.0010682004503905773, 0.0008005095296539366, 0.0006242067320272326, 0.058414213359355927, 0.0006057312712073326, 0.0006985941436141729, 0.0008587337215431035, 0.028413912281394005, 0.0006027836934663355, 0.0005831997841596603, 0.0006506583886221051, 0.005237457808107138, 0.00314402231015265, 0.0005552065558731556, 0.0005873487098142505, 0.0012355137150734663, 0.0006063668988645077, 0.0006171638960950077, 0.0006852617370896041, 0.0008194283000193536, 0.03502221405506134, 0.0014372037257999182, 0.0007786141359247267, 0.0007432865677401423, 0.0009463919559493661, 0.0007078851340338588, 0.001812492380850017, 0.0006375654484145343, 0.001465782057493925, 0.0007337144343182445, 0.0007963086827658117, 0.009441634640097618, 0.0036962071899324656, 0.0007303233724087477, 0.0005791213479824364, 0.0008718714816495776, 0.0008378656348213553, 0.0008662404725328088, 0.001115997671149671, 0.010949661955237389, 0.010366195812821388, 0.13826608657836914, 0.0006607112591154873, 0.005007529631257057, 0.0006429673521779478, 0.0013888037065044045, 0.0005916894879192114, 0.004537464585155249, 0.0007115984917618334, 0.0007618062663823366, 0.0014293622225522995, 0.0008713843417353928, 0.004493637476116419, 0.0115513252094388, 0.0006273937760852277, 0.0022360978182405233, 0.0021234320010989904, 0.41027170419692993, 0.0007729929639026523, 0.054204244166612625, 0.0008413288742303848, 0.0006435043178498745, 0.0010098692728206515, 0.0006129041430540383, 0.0006940332241356373, 0.01161287259310484, 0.15023985505104065, 0.0007239844999276102, 0.0006534050917252898, 0.008865144103765488, 0.010758724063634872, 0.08678331971168518, 0.0009787303861230612, 0.003199704922735691, 0.010939101688563824, 0.008267124183475971, 0.019718186929821968, 0.000682949903421104, 0.0010089580900967121, 0.00342630036175251, 0.0007103199604898691, 0.03318445011973381, 0.0008643066976219416, 0.21461206674575806, 0.0008360830834135413, 0.008775205351412296, 0.05790180712938309, 0.0013757769484072924, 0.0012684543617069721, 0.0008104629814624786, 0.0007838024757802486, 0.0012054834514856339, 0.0034156411420553923, 0.031416263431310654, 0.005966467782855034, 0.0009593350696377456, 0.0006289344164542854, 0.001320870709605515, 0.049695003777742386, 0.001676788437180221, 0.0005975603125989437, 0.008326942101120949, 0.0013178392546251416, 0.9401527643203735, 0.0007920498610474169, 0.042092323303222656, 0.0006317559164017439, 0.0009099056478589773, 0.0005447423318400979, 0.9441092610359192, 0.9634155035018921, 0.0008842376992106438, 0.013591697439551353, 0.0007111296872608364, 0.0007229059119708836, 0.004069387912750244, 0.0007495399913750589, 0.011469671502709389, 0.002647184766829014, 0.0006403599982149899, 0.001066920580342412, 0.06001213937997818, 0.04511336237192154, 0.0008679970633238554, 0.0008181908633559942, 0.0008952555363066494, 0.0008750715642236173, 0.0009299115627072752, 0.0007997417123988271, 0.000841862172819674, 0.005459538660943508, 0.504431962966919, 0.020085006952285767, 0.0009253041935153306, 0.03933696448802948, 0.009634465910494328, 0.0014299782924354076, 0.013552316464483738, 0.001077940920367837, 0.0016909311525523663, 0.0006398185505531728, 0.000901615887414664, 0.0010614030761644244, 0.0006318219238892198, 0.0011981906136497855, 0.2602011561393738, 0.0012203592341393232, 0.5608205199241638, 0.0021718351636081934, 0.0012463197344914079, 0.013741519302129745, 0.0007950795697979629, 0.013669983483850956, 0.0009473098325543106, 0.000826433184556663, 0.0006715664057992399, 0.03151576966047287, 0.0031839662697166204, 0.0005851779133081436, 0.0008045622962526977, 0.0473761223256588, 0.0011522438144311309, 0.00075108977034688, 0.0025210189633071423, 0.6919124126434326, 0.001821330632083118, 0.0012842090800404549, 0.0336938314139843, 0.008184030652046204, 0.0018804908031597733, 0.08279579877853394, 0.0006601799977943301, 0.0005976417451165617, 0.012353431433439255, 0.001956711523234844, 0.0020017807837575674, 0.0008115027449093759, 0.0005480763502418995, 0.000866318994667381, 0.0009687800193205476, 0.0007236003293655813, 0.0010683245491236448, 0.00152208236977458, 0.0018788377055898309, 0.0014351917197927833, 0.0008208980434574187, 0.007645635399967432, 0.0018579987809062004, 0.0006321579567156732, 0.0011269458336755633, 0.0007040841155685484, 0.0006501336465589702, 0.16803216934204102, 0.000590705662034452, 0.0012792727211490273, 0.0014913518680259585, 0.0024669512640684843, 0.0010838861344382167, 0.0015032794326543808, 0.00099387695081532, 0.0007732700323686004, 0.0006612372235395014, 0.0006680510705336928, 0.0013231680495664477, 0.0007527137640863657, 0.0013379965675994754, 0.046632058918476105, 0.023855580016970634, 0.0007056206814013422, 0.009694993495941162, 0.0006258194916881621, 0.000693405163474381, 0.000774975458625704, 0.0006813752697780728, 0.0043820664286613464, 0.0007950420840643346, 0.0005834013572894037, 0.000628389825578779, 0.0011076760711148381, 0.0006094167474657297, 0.0018384341383352876, 0.0111946826800704, 0.6188257932662964, 0.0006915289559401572, 0.0018457763362675905, 0.0008521624840795994, 0.001030603307299316, 0.007255610078573227, 0.0013324508909136057, 0.002019660547375679, 0.0005454695201478899, 0.0006115130963735282, 0.05009227618575096, 0.47792595624923706, 0.09737437963485718, 0.056115053594112396, 0.009912533685564995, 0.0009429465280845761, 0.05019519478082657, 0.0011684941127896309, 0.0005983348237350583, 0.0005872272304259241, 0.004026922397315502, 0.990561306476593, 0.0013128170976415277, 0.009165000170469284, 0.0010837672743946314, 0.24688519537448883, 0.8547865152359009, 0.001896910136565566, 0.04136200621724129, 0.046473123133182526, 0.0014275277499109507, 0.0008150564390234649, 0.05709391459822655, 0.006713357288390398, 0.0012193316360935569, 0.004335328470915556, 0.14057929813861847, 0.0007594472845084965, 0.0009632256114855409, 0.8518890738487244, 0.11128734052181244, 0.0014336011372506618, 0.0009054047404788435, 0.003177158534526825, 0.004741519223898649, 0.0007569019217044115, 0.0006770570762455463, 0.0006345876608975232, 0.016186105087399483, 0.0008490703767165542, 0.002876200247555971, 0.0008123472798615694, 0.0008035750361159444, 0.0009352561319246888, 0.0009644478559494019, 0.0008317996980622411, 0.0008826395496726036, 0.004157497081905603, 0.0008351109572686255, 0.0010403294581919909, 0.000793629267718643, 0.0005971569335088134, 0.0007681293645873666, 0.004810217767953873, 0.001850044704042375, 0.0007328545907512307, 0.0011615620460361242, 0.0006795281078666449, 0.001503792474977672, 0.001463080756366253, 0.0005770403076894581, 0.0011253634002059698, 0.0024950229562819004, 0.0007455421728082001, 0.002217718632891774, 0.002083233557641506, 0.0006878767744638026, 0.0008595121325924993, 0.0008206840138882399, 0.000600894563831389, 0.0006280572270043194, 0.008554337546229362, 0.0006179679185152054, 0.0006382433348335326, 0.000779803260229528, 0.0010230463230982423, 0.0008405247936025262, 0.0005997824482619762, 0.008035289123654366, 0.0022349886130541563, 0.000537304556928575, 0.006101577542722225, 0.0011262960033491254, 0.0007361258030869067, 0.0005883998819626868, 0.0010770171647891402, 0.0006497904541902244, 0.0008087037713266909, 0.002362110186368227, 0.0012691800948232412, 0.0006049979128874838, 0.0006371884956024587, 0.005436355713754892, 0.001958920620381832, 0.018489602953195572, 0.07327726483345032, 0.010410657152533531, 0.0016802289756014943, 0.0011932139750570059, 0.06990126520395279, 0.0007150144083425403, 0.002505037933588028, 0.0033414820209145546, 0.0011646387865766883, 0.0006237381021492183, 0.0011511703487485647, 0.0007715667015872896, 0.0009042723104357719, 0.0015547297662124038, 0.05591066554188728, 0.0006915908888913691, 0.0006613961304537952, 0.0009628550033085048, 0.0006039505242370069, 0.0007959422655403614, 0.0011521532433107495, 0.0005773021257482469, 0.006167121231555939, 0.0018785659922286868, 0.0006789936451241374, 0.010833092965185642, 0.0008637814898975194, 0.0038001106586307287, 0.0008199464646168053, 0.0010283049196004868, 0.0006603364017792046, 0.005985323339700699, 0.000658000644762069, 0.0006062348838895559, 0.0006087897927500308, 0.0009240153012797236, 0.0015775784850120544, 0.000597831211052835, 0.012779522687196732, 0.009324554353952408, 0.0021373529452830553, 0.08510317653417587, 0.0019296088721603155, 0.0007867874228395522, 0.014022198505699635, 0.0900103971362114, 0.003272681962698698, 0.0007984385010786355, 0.001102884765714407, 0.000699909869581461, 0.0006246286793611944, 0.0005698850727640092, 0.0008848499273881316, 0.0022164657711982727, 0.008303087204694748, 0.002034856704995036, 0.0007434572908096015, 0.0037963001523166895, 0.0005188187351450324, 0.0009977425215765834, 0.676878809928894, 0.0011087518651038408, 0.0015649504493921995, 0.0026581415440887213, 0.011664307676255703, 0.011204921640455723, 0.018877310678362846, 0.4791978895664215, 0.000853959412779659, 0.0016406991053372622, 0.0008968103211373091, 0.0006765458965674043, 0.06922191381454468, 0.0011555980890989304, 0.0010413751006126404, 0.0016327182529494166, 0.00174709630664438, 0.0009114580461755395, 0.08855818212032318, 0.001558899530209601, 0.0006840566056780517, 0.01711769960820675, 0.000824641203507781, 0.016528494656085968, 0.0006758618401363492, 0.0007498458144254982, 0.000741436320822686, 0.018366001546382904, 0.9675483107566833, 0.008026965893805027, 0.0009159644832834601, 0.0006039352738298476, 0.12430071830749512, 0.0013333781389519572, 0.3208419680595398, 0.014364218339323997, 0.8211716413497925, 0.013291923329234123, 0.0007720962748862803, 0.0005567183834500611, 0.002228156430646777, 0.0011685359058901668, 0.01510521862655878, 0.0007357396534644067, 0.0038012175355106592, 0.03926302120089531, 0.001281802891753614, 0.001263182144612074, 0.002392091555520892, 0.0005935027729719877, 0.0010584858246147633, 0.0021169560495764017, 0.0013674586080014706, 0.001636690110899508, 0.0009783509885892272, 0.0006769299507141113, 0.0008806163095869124, 0.0008136623655445874, 0.0007860081386752427, 0.0008471684413962066, 0.0010461166966706514, 0.0015243724919855595, 0.0006087929359637201, 0.0005876236245967448, 0.0019231884507462382, 0.001019132323563099, 0.001544638886116445, 0.0006844332092441618, 0.0012231621658429503, 0.0005661896429955959, 0.0006298143998719752, 0.000747369893360883, 0.0009848957415670156, 0.0006811311468482018, 0.000559023697860539, 0.00106875563506037, 0.0006382506107911468, 0.000670116045512259, 0.0007490087300539017, 0.03235642611980438, 0.0011202614987269044, 0.007699151523411274, 0.0006348677561618388, 0.0007263383595272899, 0.003879509400576353, 0.0006966753280721605, 0.0019769712816923857, 0.0011091289343312383, 0.0008443276747129858, 0.01872575841844082, 0.01441364549100399, 0.0980582907795906, 0.0026143963914364576, 0.0026269848458468914, 0.000632912153378129, 0.0007762304157949984, 0.0007988730794750154, 0.0006310188327915967, 0.001592332380823791, 0.0008323454530909657, 0.0007324873004108667, 0.0005609684158116579, 0.0005778273334726691, 0.0007262182189151645, 0.0005845348932780325, 0.020374586805701256, 0.0006524900090880692, 0.0006982982740737498, 0.8592743277549744, 0.011414711363613605, 0.000775290944147855, 0.0006671418086625636, 0.0006470148800872266, 0.000861689739394933, 0.013034965842962265, 0.000645233376417309, 0.0007696177344769239, 0.0006279838853515685, 0.001990864286199212, 0.947973370552063, 0.0006239191279746592, 0.0318932980298996, 0.18020078539848328, 0.0006593462312594056, 0.1212802454829216, 0.021998904645442963, 0.0007321868324652314, 0.0025101068895310163, 0.0008388126152567565, 0.00526516605168581, 0.001295789028517902, 0.0009356094524264336, 0.0005902823759242892, 0.0007885179948061705, 0.0019744131714105606, 0.0007774371188133955, 0.0008199464646168053, 0.0008695906726643443, 0.0006549740210175514, 0.0010397022124379873, 0.0005639424198307097, 0.0006689633592031896, 0.0009108437225222588, 0.003326689125970006, 0.0006031023804098368, 0.0013312959345057607, 0.0005412930040620267, 0.0007765834452584386, 0.0005909815663471818, 0.0007073196466080844, 0.0005987880867905915, 0.0007812506519258022, 0.0027691491413861513, 0.0007479142514057457, 0.7702313661575317, 0.0006918641738593578, 0.0008880451787263155, 0.0008772822329774499, 0.0006054709665477276, 0.002043378073722124, 0.0006659269565716386, 0.0009059388539753854, 0.0007958458736538887, 0.0007390783866867423, 0.000737980764824897, 0.0006766277947463095, 0.0005985278985463083, 0.0005820054211653769, 0.0028107811231166124, 0.0007259331177920103, 0.0009382930584251881, 0.001262167003005743, 0.0014429352013394237, 0.001719553954899311, 0.0022886665537953377, 0.1976325362920761, 0.0007268215995281935, 0.0008336309692822397, 0.14655762910842896, 0.0007192295743152499, 0.0006143685895949602, 0.003632699139416218, 0.0014025551499798894, 0.024526778608560562, 0.0012802290730178356, 0.0005890162428840995, 0.0009583311039023101, 0.0009576857555657625, 0.001268672989681363, 0.0006253946921788156, 0.0005327830440364778, 0.0005807348061352968, 0.0007424455834552646, 0.002273266902193427, 0.1208454817533493, 0.01443250197917223, 0.017443327233195305, 0.02601906657218933, 0.0012237931368872523, 0.0008908745949156582, 0.0005771079449914396, 0.0008312113350257277, 0.000518517685122788, 0.0016872574342414737, 0.10824408382177353, 0.0006353304488584399, 0.0009727700380608439, 0.0007591640460304916, 0.0008806599071249366, 0.0029561102855950594, 0.0006012720405124128, 0.0010254449443891644, 0.0010691925417631865, 0.00777196791023016, 0.0008106966852210462, 0.0006671809242106974, 0.00532577047124505, 0.0015951244859024882, 0.0008038824889808893, 0.0010380992898717523, 0.061215292662382126, 0.029962776228785515, 0.0015717382775619626, 0.0005892071058042347, 0.0005386244156397879, 0.0007687034085392952, 0.005921678151935339, 0.003855927614495158, 0.008130594156682491, 0.0008733985014259815, 0.000995734124444425, 0.004570146556943655, 0.001452546683140099, 0.0008573854574933648, 0.0012627352261915803, 0.0008028425509110093, 0.0007657202077098191, 0.0009787071030586958, 0.0007906898390501738, 0.004529253114014864, 0.0006246602279134095, 0.004193730186671019, 0.9638898372650146, 0.004100246354937553, 0.0007944328244775534, 0.09400882571935654, 0.027058390900492668, 0.03010263293981552, 0.0006324825226329267, 0.0031099868938326836, 0.10094444453716278, 0.014865102246403694, 0.0006086507928557694, 0.0006904529873281717, 0.0010866248048841953, 0.0010273135267198086, 0.0010886373929679394, 0.012050667777657509, 0.0008131008362397552, 0.0006415570387616754, 0.0006803555297665298, 0.01934957318007946, 0.0006695255869999528, 0.0009581553167663515, 0.0071387761272490025, 0.000902926956769079, 0.016218142583966255, 0.0006476734997704625, 0.0007007108069956303, 0.007989819161593914, 0.0009792778873816133, 0.0009368016617372632, 0.0007282693404704332, 0.002220386639237404, 0.013395293615758419, 0.0006547898519784212, 0.0015490849036723375, 0.000572247605305165, 0.0006030186777934432, 0.0005236082361079752, 0.0008462914847768843, 0.0017439000075682998, 0.0005610533989965916, 0.0008957803365774453, 0.0006378327962011099, 0.0008574863313697278, 0.004412494599819183, 0.0021097571589052677, 0.0010924771195277572, 0.0007484914967790246, 0.0008213450782932341, 0.0009865490719676018, 0.0006127633969299495, 0.003174173180013895, 0.0010396348079666495, 0.001462331973016262, 0.000983065809123218, 0.0005559531855396926, 0.010064528323709965, 0.0006951698451302946, 0.022031104192137718, 0.0011579407146200538, 0.0007831670809537172, 0.9249999523162842, 0.0025122566148638725, 0.002501057693734765, 0.0010692669311538339, 0.0007463422371074557, 0.0006853724480606616, 0.0009012707159854472, 0.0005933152860961854, 0.0036752037703990936, 0.0010505624813959002, 0.001071434817276895, 0.0006652440642938018, 0.0009016180993057787, 0.0006745861028321087, 0.0007131863967515528, 0.0005634193657897413, 0.0010074053425341845, 0.000596116587985307, 0.01681145466864109, 0.0010556087363511324, 0.005830060690641403, 0.024458836764097214, 0.002877644496038556, 0.002633337862789631, 0.00319721014238894, 0.03231292590498924, 0.009637929499149323, 0.0009046743507497013, 0.0009605199447833002, 0.0005465571884997189, 0.0008689218084327877, 0.0007409068639390171, 0.4414159059524536, 0.004909571725875139, 0.0006770332111045718, 0.22603638470172882, 0.001766698551364243, 0.0006211962318047881, 0.0005866395658813417, 0.012799385003745556, 0.17784886062145233, 0.8827036023139954, 0.000836688035633415, 0.8110048770904541, 0.0008109558839350939, 0.0010326948249712586, 0.0017699947347864509, 0.0013460571644827724, 0.0007683053845539689, 0.0006215101457200944, 0.0005513345240615308, 0.0010004487121477723, 0.0013846573419868946, 0.0005714657600037754, 0.0013588706497102976, 0.001028381404466927, 0.005090927239507437, 0.7346343398094177, 0.0008212508400902152, 0.0009287139400839806, 0.0005926986923441291, 0.0006511682877317071, 0.0014515725197270513, 0.0006240169750526547, 0.0046853856183588505, 0.0006318598170764744, 0.0010266541503369808, 0.0005687333759851754, 0.0012124815257266164, 0.00908479280769825, 0.010148655623197556, 0.1691177487373352, 0.0006778254173696041, 0.0021247374825179577, 0.0007291255751624703, 0.0032301300670951605, 0.008525712415575981, 0.001230510650202632, 0.9767097234725952, 0.001548298168927431, 0.10958244651556015, 0.000921592116355896, 0.0009676965419203043, 0.000556867802515626, 0.0005728157120756805, 0.0005613722605630755, 0.0011418985668569803, 0.0018533883849158883, 0.0008085558656603098, 0.0007016974850557745, 0.0009799490217119455, 0.0014765544328838587, 0.0006991448462940753, 0.0025395487900823355, 0.0007140504312701523, 0.0023118099197745323, 0.0007620007963851094, 0.000995158450677991, 0.0012076371349394321, 0.0008990488713607192, 0.001055058790370822, 0.0006614071317017078, 0.0012653580633923411, 0.001984970411285758, 0.010368348099291325, 0.002169074257835746, 0.020183417946100235, 0.0005929102771915495, 0.001175193814560771, 0.0005807880079373717, 0.0008705091895535588, 0.0005809888825751841, 0.0005344918463379145, 0.0006179287447594106, 0.0031679722014814615, 0.0005800286890007555, 0.0006096790311858058, 0.0005613171379081905, 0.0005390989826992154, 0.0017734868451952934, 0.0007265082676894963, 0.0005822070525027812, 0.0006738705560564995, 0.0007247321773320436, 0.030989859253168106, 0.21501460671424866, 0.0007087748381309211, 0.0007757142884656787, 0.00796188972890377, 0.0005918925744481385, 0.0008297255844809115, 0.0019058125326409936, 0.005488579627126455, 0.00679131131619215, 0.0026246882043778896, 0.01695330999791622, 0.0012962081236764789, 0.0006912657408975065, 0.23086054623126984, 0.09731390327215195, 0.0023102927953004837, 0.0020107096061110497, 0.0008680359460413456, 0.00106240960303694, 0.0011339638149365783, 0.0008305893861688673, 0.000698964053299278, 0.8679822087287903, 0.0007062736549414694, 0.0006289565935730934, 0.0006957381265237927, 0.001569428015500307, 0.0016729390481486917, 0.009372543543577194, 0.47220608592033386, 0.0014295234577730298, 0.8605127930641174, 0.000688263971824199, 0.000745207944419235, 0.0007864010985940695, 0.0012544331839308143, 0.004265424329787493, 0.01621760055422783, 0.0006052741664461792, 0.0005485106375999749, 0.0008810245781205595, 0.0006287531577982008, 0.001155733480118215, 0.03463222086429596, 0.0005760627100244164, 0.056576747447252274, 0.0005344992387108505, 0.001014510984532535, 0.004274947568774223, 0.0073354062624275684, 0.6916025280952454, 0.000943460559938103, 0.0007287921034730971, 0.0007513331947848201, 0.0010611052857711911, 0.0008038231753744185, 0.0006055127596482635, 0.005197707563638687, 0.7481059432029724, 0.0010828323429450393, 0.0008646905771456659, 0.6829643845558167, 0.0006759482203051448, 0.0024415082298219204, 0.0005847574793733656, 0.21882040798664093, 0.8595033288002014, 0.015244046226143837, 0.000849038886372, 0.0007225742447189987, 0.0016740239225327969, 0.07700832188129425, 0.00254266825504601, 0.003977181855589151, 0.0009399958653375506, 0.2488330453634262, 0.0008725287625566125, 0.001160796033218503, 0.001197329256683588, 0.0007995634223334491, 0.001143648405559361, 0.0007041978533379734, 0.0008005396812222898, 0.0005527127650566399, 0.0005747368559241295, 0.0006169562693685293, 0.0005857408978044987, 0.0006067866343073547, 0.0006337218801490963, 0.000860330299474299, 0.0005532812792807817, 0.0005696116713806987, 0.01281912624835968, 0.00103083997964859, 0.0008312101708725095, 0.000584654975682497, 0.0008919982938095927, 0.0007728702621534467, 0.0008492355118505657, 0.000908887479454279, 0.0021730896551162004, 0.0010274872183799744, 0.003008614992722869, 0.04053507372736931, 0.024093205109238625, 0.0018423101864755154, 0.004165913909673691, 0.02099539153277874, 0.005907502956688404, 0.0006971210241317749, 0.0005738441250286996, 0.0006311360630206764, 0.0006727620493620634, 0.026617880910634995, 0.00197086064144969, 0.0006264398107305169, 0.008791590109467506, 0.0013320264406502247, 0.001527567976154387, 0.0008336626924574375, 0.0006432618829421699, 0.0017317787278443575, 0.004003923386335373, 0.000629981339443475, 0.0242120660841465, 0.005477325525134802, 0.0010528217535465956, 0.0008379966020584106, 0.11001616716384888, 0.0007975149201229215, 0.01894461363554001, 0.0005673576379194856, 0.000600971223320812, 0.0011443725088611245, 0.0007345423800870776, 0.0007086238474585116, 0.0007325169281102717, 0.0013709956547245383, 0.005005757790058851, 0.001032717409543693, 0.0012228406267240644, 0.0006798580870963633, 0.0006339185056276619, 0.0005440094391815364, 0.0005377718480303884, 0.19404873251914978, 0.0005720534827560186, 0.01117314025759697, 0.08116791397333145, 0.6531495451927185, 0.05352558568120003, 0.8523603081703186, 0.0005525645101442933, 0.0005868423031643033, 0.004657198674976826, 0.02496306784451008, 0.0006011935183778405, 0.0005511926719918847, 0.0008066425798460841, 0.005261216312646866, 0.0006210426217876375, 0.22695468366146088, 0.0006161720375530422, 0.0011266699293628335, 0.04448682442307472, 0.0007466459646821022, 0.21371996402740479, 0.0006622444489039481, 0.0009316359646618366, 0.0024978776928037405, 0.0008485346334055066, 0.0006258481298573315, 0.0009229233837686479, 0.0024512808304280043, 0.0012230077991262078, 0.0006547468365170062, 0.004092366434633732, 0.0008283028146252036, 0.10831550508737564, 0.7853075265884399, 0.041415873914957047, 0.0006579332402907312, 0.41628503799438477, 0.002090463414788246, 0.0007807055953890085, 0.09603742510080338, 0.0005963185685686767, 0.0006485790945589542, 0.000893695920240134, 0.002300117863342166, 0.0007527052075602114, 0.00530708534643054, 0.14975398778915405, 0.05004794895648956, 0.0012323521077632904, 0.02444603480398655, 0.000628764508292079, 0.0006418395787477493, 0.0007379297749139369, 0.0006646845140494406, 0.0005598803400062025, 0.0006078284932300448, 0.0006531855906359851, 0.003129377728328109, 0.00522639648988843, 0.0007939477218315005, 0.0009484323672950268, 0.000780413975007832, 0.000660827150568366, 0.0006486331694759429, 0.0008615005644969642, 0.1054387018084526, 0.0005319260526448488, 0.18119841814041138, 0.0009773783385753632, 0.0008411534363403916, 0.0006472967797890306, 0.0007522251689806581, 0.0011143824085593224, 0.0005866116262041032, 0.001195235992781818, 0.0005360004724934697, 0.0006543581839650869, 0.0006962904008105397, 0.030441246926784515, 0.002102858619764447, 0.0006860520225018263, 0.003731984179466963, 0.0008121333085000515, 0.0007032445864751935, 0.0005397172644734383, 0.029972590506076813, 0.009767632931470871, 0.0008597517153248191, 0.002735198475420475, 0.0005791661096736789, 0.026803787797689438, 0.0007352049578912556, 0.0006491953390650451, 0.0007543301908299327, 0.0006659383652731776, 0.0005961341666989028, 0.0006288107251748443, 0.0005766571266576648, 0.0037373583763837814, 0.0016499001067131758, 0.0009032432571984828, 0.0005609395448118448, 0.0034320950508117676, 0.001004523946903646, 0.020512450486421585, 0.14426518976688385, 0.0595909059047699, 0.0008310771081596613, 0.01694948971271515, 0.012889501638710499, 0.0006666003027930856, 0.000983216566964984, 0.001634756801649928, 0.0016416781581938267, 0.0013666871236637235, 0.0006300260429270566, 0.044037770479917526, 0.0006237879861146212, 0.0005969837075099349, 0.000625498709268868, 0.0005687479861080647, 0.0006962960469536483, 0.0005954518564976752, 0.0014911167090758681, 0.0008885699207894504, 0.0010568484431132674, 0.0010679964907467365, 0.008209961466491222, 0.0008231209358200431, 0.0006289785378612578, 0.000907603302039206, 0.0009485282353125513, 0.0005746689275838435, 0.0008705058717168868, 0.002798687666654587, 0.0010703736916184425, 0.08056417107582092, 0.0006620986387133598, 0.000843833084218204, 0.0007104966789484024, 0.0006971123511902988, 0.0015158816240727901, 0.000674786395393312, 0.0005454564816318452, 0.01489184144884348, 0.0013542622327804565, 0.0013655382208526134, 0.0007497985498048365, 0.0012762005208060145, 0.09120707958936691, 0.0009190189884975553, 0.0009014270035549998, 0.0015434104716405272, 0.0006158148171380162, 0.5649017691612244, 0.0008151274523697793, 0.02305135317146778, 0.004202279727905989, 0.0009652370936237276, 0.0008843744872137904, 0.0007561755483038723, 0.0009101025061681867, 0.0007689202902838588, 0.0007518603815697134, 0.0006251333397813141, 0.0008912099292501807, 0.0005508085014298558, 0.0006429710192605853, 0.000676020048558712, 0.0011914382921531796, 0.0009907259372994304, 0.0005683997878804803, 0.0006968085072003305, 0.0007057427428662777, 0.0008515461231581867, 0.0014126000460237265, 0.0007656383677385747, 0.0009136682492680848, 0.0010780878365039825, 0.0011279414175078273, 0.0025504452642053366, 0.0008657190483063459, 0.0007070386782288551, 0.0006521595641970634, 0.009946353733539581, 0.0006380839622579515, 0.0008312327554449439, 0.0006922190077602863, 0.0006491055828519166, 0.0006012792000547051, 0.0022596290800720453, 0.0038253029342740774, 0.0013225688599050045, 0.000597736332565546, 0.0007002785569056869, 0.0014396028127521276, 0.000650151283480227, 0.0005964709562249482, 0.0007102295639924705, 0.0008568023331463337, 0.0010951029835268855, 0.0010891471756622195, 0.0008476331713609397, 0.0007300791912712157, 0.06728658825159073, 0.03326582908630371, 0.0007169422460719943, 0.0009324108250439167, 0.0006193396984599531, 0.0010835252469405532, 0.0008415317279286683, 0.0013495299499481916, 0.0007546275155618787, 0.0008807509439066052, 0.0009403869044035673, 0.0006862313020974398, 0.0013013193383812904, 0.0008363381493836641, 0.001102685695514083, 0.0010237654205411673, 0.0006598315667361021, 0.0008490203181281686, 0.0009123802883550525, 0.002545768627896905, 0.005098374094814062, 0.0008053070632740855, 0.0014781393110752106, 0.0010804804041981697, 0.0010164212435483932, 0.010607607662677765, 0.0008296725573018193, 0.0006977055454626679, 0.0016259057447314262, 0.0023073337506502867, 0.0008219894953072071, 0.0005404265830293298, 0.003274817019701004, 0.0015804313588887453, 0.0008541673305444419, 0.0012983549386262894, 0.0014600118156522512, 0.0013642131816595793, 0.014573727734386921, 0.0007040424970909953, 0.08284580707550049, 0.0007636488298885524, 0.0009385317680425942, 0.04237696900963783, 0.001087280223146081, 0.0007236217497847974, 0.0006745556020177901, 0.000879488477949053, 0.0023475203197449446, 0.0009173339931294322, 0.000950002868194133, 0.10226079821586609, 0.0017372898291796446, 0.0006160728516988456, 0.0016203545965254307, 0.27632686495780945, 0.0010605731513351202, 0.0006357226520776749, 0.00339937349781394, 0.029704099521040916, 0.829291820526123, 0.09041144698858261, 0.046078283339738846, 0.001393468352034688, 0.001446818234398961, 0.001044849748723209, 0.0006224031676538289, 0.0008664056076668203, 0.0007175611681304872, 0.010654455982148647, 0.001196466851979494, 0.0007458057953044772, 0.0006411966169252992, 0.0005975494859740138, 0.04931563138961792, 0.0007948160055093467, 0.016855917870998383, 0.0016666180454194546, 0.0012319647939875722, 0.0009055837290361524, 0.003072273451834917, 0.0005996538675390184, 0.0006507902289740741, 0.0005832373863086104, 0.0018743477994576097, 0.005486276000738144, 0.001329063787125051, 0.0006370855262503028, 0.0011576567776501179, 0.0036661182530224323, 0.0006578843458555639, 0.0006074491539038718, 0.0015412588836625218, 0.0007778287399560213, 0.020687391981482506, 0.001960715977475047, 0.0024847774766385555, 0.0010242785792797804, 0.000699609809089452, 0.002080402337014675, 0.0034498623572289944, 0.3266216814517975, 0.22621627151966095, 0.001703915186226368, 0.0008540102280676365, 0.001016733585856855, 0.0006856308318674564, 0.005658457055687904, 0.003107003401964903, 0.023934900760650635, 0.0012393372599035501, 0.0007080463692545891, 0.0007304243627004325, 0.4944987893104553, 0.0008922291453927755, 0.000618106045294553, 0.003791626775637269, 0.0007752502569928765, 0.004445926286280155, 0.0007452928111888468, 0.10830744355916977, 0.0070579382590949535, 0.013336919248104095, 0.001090332749299705, 0.0007111500017344952, 0.0005986955948174, 0.0005720995832234621, 0.0007726814365014434, 0.000726123049389571, 0.001064217765815556, 0.007308722008019686, 0.0008899964741431177, 0.9610224962234497, 0.0009458123240619898, 0.0013868461828678846, 0.0006256161723285913, 0.003387716831639409, 0.0012563985073938966, 0.05938940495252609, 0.0006816815002821386, 0.01798998937010765, 0.9555671811103821, 0.0005831200396642089, 0.018506767228245735, 0.0034248465672135353, 0.0009695366607047617, 0.016191892325878143, 0.0007880391203798354, 0.2140142172574997, 0.0009060955489985645, 0.013977663591504097, 0.0006729240412823856, 0.0014589311322197318, 0.0006444375612773001, 0.0006781629635952413, 0.007014834322035313, 0.002611186821013689, 0.000625245098490268, 0.0032755096908658743, 0.0010479585034772754, 0.0008280384936369956, 0.019099868834018707, 0.0008963519940152764, 0.0006090999813750386, 0.0006093272822909057, 0.0005969306803308427, 0.0009097050060518086, 0.0010934575693681836, 0.0013719047419726849, 0.0027556680142879486, 0.0010727441404014826, 0.0011610372457653284, 0.0060353525914251804, 0.0006738674128428102, 0.000622290710452944, 0.0014065044233575463, 0.0006983667844906449, 0.0052741216495633125, 0.0005749653792008758, 0.00996981281787157, 0.6320454478263855, 0.04699422046542168, 0.001026045880280435, 0.0006821446004323661, 0.0007692925864830613, 0.0008945504087023437, 0.002127791987732053, 0.03398486226797104, 0.0023986524902284145, 0.8555777668952942, 0.9666088819503784, 0.02523939497768879, 0.0012839693808928132, 0.0009699968504719436, 0.001130109652876854, 0.0006354734068736434, 0.0037177999038249254, 0.0450548455119133, 0.0005807237466797233, 0.000979437492787838, 0.01178131252527237, 0.0008212543907575309, 0.0005752920405939221, 0.0014918126398697495, 0.001118500018492341, 0.0006355415098369122, 0.0008111587376333773, 0.0009500599117018282, 0.0036067236214876175, 0.0010797112481668591, 0.0007488846313208342, 0.0011058284435421228, 0.0007910621352493763, 0.0025843484327197075, 0.01613917015492916, 0.0008171281078830361, 0.0007604854181408882, 0.0012934973929077387, 0.07682940363883972, 0.8639515042304993, 0.0012505203485488892, 0.0008050856995396316, 0.001842293655499816, 0.001293594017624855, 0.0010676586534827948, 0.0011071686167269945, 0.000654970237519592, 0.0008328203693963587, 0.000776292581576854, 0.000814040016848594, 0.0008424741099588573, 0.785149872303009, 0.0007474831654690206, 0.0017522831913083792, 0.0006371283670887351, 0.0006549256504513323, 0.0008175140246748924, 0.001061086542904377, 0.0008288286626338959, 0.0016887608217075467, 0.0014355102321133018, 0.0008572486112825572, 0.0011560543207451701, 0.0012474290560930967, 0.0052697258070111275, 0.0008852868340909481, 0.001335221459157765, 0.0006750819738954306, 0.2248571217060089, 0.0009731213212944567, 0.9679200649261475, 0.0010432323906570673, 0.0011697742156684399, 0.0012322276597842574, 0.0006224432145245373, 0.007018245756626129, 0.0005960679845884442, 0.003676763502880931, 0.0005742419161833823, 0.9134103655815125, 0.0007674613734707236, 0.3859354257583618, 0.712336540222168, 0.00291465618647635, 0.002297715051099658, 0.0008817010675556958, 0.0006215423927642405, 0.001971862744539976, 0.002913139294832945, 0.024920331314206123, 0.017379362136125565, 0.11379790306091309, 0.025082627311348915, 0.020539406687021255, 0.000979003612883389, 0.8007202744483948, 0.10281170159578323, 0.000735200010240078, 0.0007334197289310396, 0.00105826195795089, 0.0013594155898317695, 0.005083660129457712, 0.0009386747842654586, 0.0006914828554727137, 0.006289117969572544, 0.03405717387795448, 0.004776457324624062, 0.0012604641960933805, 0.0011000465601682663, 0.026873856782913208, 0.8172469139099121, 0.002963300561532378, 0.008442888036370277, 0.0012781753903254867, 0.1365782469511032, 0.009175360202789307, 0.01795768178999424, 0.0016741497674956918, 0.024679629132151604, 0.004322660155594349, 0.01735970750451088, 0.0008552322397008538, 0.0006239684880711138, 0.0011725767981261015, 0.005080547649413347, 0.0015002097934484482, 0.007137269712984562, 0.0008837638306431472, 0.0009367686579935253, 0.0011937124654650688, 0.03061351366341114, 0.0010284000309184194, 0.009220218285918236, 0.001538204262033105, 0.006156945135444403, 0.022668661549687386, 0.0007176565704867244, 0.0022200793027877808, 0.0011134683154523373, 0.0005733927828259766, 0.000751788669731468, 0.0010765730403363705, 0.0006327478331513703, 0.0011494182981550694, 0.0005759951309300959, 0.0006050844676792622, 0.0009344741120003164, 0.01161255594342947, 0.0011458942899480462, 0.0013148724101483822, 0.0008398715290240943, 0.004645802080631256, 0.006839361507445574, 0.0008493608911521733, 0.0006519489106722176, 0.010204227641224861, 0.0005835798801854253, 0.43565723299980164, 0.8098134994506836, 0.23995104432106018, 0.005485826637595892, 0.0026298873126506805, 0.000627263099886477, 0.0011217377614229918, 0.0030663032084703445, 0.0007878971518948674, 0.044889163225889206, 0.0011376359034329653, 0.001419536885805428, 0.0008307433454319835, 0.001128402422182262, 0.0013101475778967142, 0.004004897549748421, 0.0010091066360473633, 0.007067916914820671, 0.0005969150806777179, 0.0007262760191224515, 0.0006238804780878127, 0.0026038093492388725, 0.0006193231674842536, 0.0007739869179204106, 0.0007431417470797896, 0.0028335144743323326, 0.0006868165219202638, 0.0006201607175171375, 0.002001605462282896, 0.0006053944816812873, 0.006894399877637625, 0.0017812643200159073, 0.008655434474349022, 0.0006130490219220519, 0.38037875294685364, 0.0006744677666574717, 0.0009049329091794789, 0.0008102113497443497, 0.0008021264220587909, 0.0008449853048659861, 0.0007264864398166537, 0.0020359454210847616, 0.0006534290150739253, 0.007077587768435478, 0.0007308472995646298, 0.0010436807060614228, 0.000570136122405529, 0.0009723122348077595, 0.002411115216091275, 0.0008178326534107327, 0.004135120194405317, 0.0022843533661216497, 0.005353966262191534, 0.0005816956982016563, 0.0006155088194645941, 0.0006948078516870737, 0.0008129144553095102, 0.0005750936106778681, 0.8324241638183594, 0.0024545337073504925, 0.0006786760059185326, 0.0028914748691022396, 0.005801874678581953, 0.0009614625014364719, 0.002557225525379181, 0.0007671173079870641, 0.0017306199297308922, 0.0007153465994633734, 0.0007290053181350231, 0.005542647559195757, 0.0011013724142685533, 0.0005607751663774252, 0.0014695192221552134, 0.05781931057572365, 0.02451266534626484, 0.0005644024931825697, 0.05353875458240509, 0.0006399750709533691, 0.027838679030537605, 0.0010946221882477403, 0.0008528148173354566, 0.0008520534029230475, 0.7327626347541809, 0.011308548972010612, 0.07142980396747589, 0.030941061675548553, 0.000978665193542838, 0.015328432433307171, 0.011683099903166294, 0.018041880801320076, 0.0016156313940882683, 0.019300447776913643, 0.4332636892795563, 0.001417379011400044, 0.04310317710042, 0.0006391232018359005, 0.0006771287298761308, 0.001686232048086822, 0.0013154471525922418, 0.008739139884710312, 0.0009234634344466031, 0.3364551067352295, 0.0006328626768663526, 0.005267981439828873, 0.34171441197395325, 0.3432721197605133, 0.002318601356819272, 0.04164991155266762, 0.10685291886329651, 0.012687860056757927, 0.2500705420970917, 0.4879801869392395, 0.0011505000293254852, 0.002982919570058584, 0.07039327174425125, 0.0006960906321182847, 0.0006274615880101919, 0.007221630308777094, 0.001065860386006534, 0.04756025969982147, 0.31551918387413025, 0.32939282059669495, 0.2446192353963852, 0.0022437016014009714, 0.015886347740888596, 0.01960986852645874, 0.0008153213420882821, 0.006927965208888054, 0.0015572565607726574, 0.1506013721227646, 0.0006345374858938158, 0.005690794438123703, 0.030760478228330612, 0.6125953793525696, 0.0012610196135938168, 0.0011105043813586235, 0.0008199464646168053, 0.0005974489613436162, 0.11789251863956451, 0.0024957945570349693, 0.0008977623074315488, 0.0006489114020951092, 0.0017552885692566633, 0.002561122877523303, 0.0008605073671787977, 0.0009639151976443827, 0.004804091062396765, 0.0005733818979933858, 0.025255076587200165, 0.02253774367272854, 0.05895606055855751, 0.0006415649550035596, 0.8011721968650818, 0.0007496564066968858, 0.0014328279066830873, 0.0010755422990769148, 0.042877327650785446, 0.48906299471855164, 0.0006314092315733433, 0.9771661758422852, 0.00960079301148653, 0.0008100256673060358, 0.0007021576748229563, 0.0013120113871991634, 0.14279474318027496, 0.001335889333859086, 0.000948815606534481, 0.0012953861150890589, 0.7829022407531738, 0.9829702377319336, 0.000948069675359875, 0.0009783761342987418, 0.00827902089804411, 0.0007679471164010465, 0.4247249662876129, 0.2055470496416092, 0.0008214178960770369, 0.31310027837753296, 0.00821386743336916, 0.005278103053569794, 0.0024067102931439877, 0.012814010493457317, 0.007807499263435602, 0.0014809846179559827, 0.0007718554115854204, 0.00101421435829252, 0.0009210521820932627, 0.2408105581998825, 0.1027740091085434, 0.0010504729580134153, 0.0005965982563793659, 0.07412070780992508, 0.43627792596817017, 0.0007671326166018844, 0.6222514510154724, 0.04409896582365036, 0.0005966184544377029, 0.0007272771908901632, 0.0011052528861910105, 0.0006454929825849831, 0.00599281769245863, 0.0026998186949640512, 0.004635329358279705, 0.0006562646012753248, 0.0006347645539790392, 0.030460378155112267, 0.0010219193063676357, 0.0012275903718546033, 0.01607486978173256, 0.003180696163326502, 0.0014674984849989414, 0.004793874453753233, 0.0007317375857383013, 0.0009480551816523075, 0.009214718826115131, 0.0017870712326839566, 0.0005932556814514101, 0.0017805022653192282, 0.0009024311439134181, 0.0006165680242702365, 0.13680872321128845, 0.016767792403697968, 0.0007916450267657638, 0.0017681681783869863, 0.0008779875934123993, 0.0006983614875935018, 0.0009600844350643456, 0.0014723669737577438, 0.0008112441864795983, 0.000953418668359518, 0.0010718987323343754, 0.0006313521298579872, 0.00391133688390255, 0.0013499478809535503, 0.0005563622107729316, 0.0014566323952749372, 0.006827847100794315, 0.20888546109199524, 0.001542821992188692, 0.03261074051260948, 0.028961852192878723, 0.010294707491993904, 0.0007342288736253977, 0.020492857322096825, 0.0006178963230922818, 0.0012357861269265413, 0.0006650983123108745, 0.0007821355829946697, 0.12653136253356934, 0.09242425113916397, 0.0006068708025850356, 0.0005524323205463588, 0.0015765947755426168, 0.0006212125299498439, 0.10118447989225388, 0.0012228429550305009, 0.000771843537222594, 0.0008209890802390873, 0.8827764391899109, 0.7320447564125061, 0.007863771170377731, 0.0018921727314591408, 0.0014269454404711723, 0.0008009215816855431, 0.0006787313031964004, 0.0007344954647123814, 0.003109241835772991, 0.0009306082502007484, 0.0014864412369206548, 0.0006944358465261757, 0.033203113824129105, 0.0010335914557799697, 0.0023343563079833984, 0.0011302911443635821, 0.004730330780148506, 0.0017523198621347547, 0.0019850300159305334, 0.004269585944712162, 0.0013144973199814558, 0.010451835580170155, 0.0006665088003501296, 0.002852239878848195, 0.0017666782950982451, 0.0008860999369062483, 0.12476803362369537, 0.0007114079780876637, 0.11572427302598953, 0.0005806587287224829, 0.0007815485587343574, 0.001989860087633133, 0.0006282870890572667, 0.13350626826286316, 0.0006578702596016228, 0.0006191938882693648, 0.0019290714990347624, 0.0008073286153376102, 0.000880912528373301, 0.010806942358613014, 0.0007872363203205168, 0.0008363588131032884, 0.013150682672858238, 0.03243475779891014, 0.0007109639700502157, 0.014757822267711163, 0.15015847980976105, 0.0008817098569124937, 0.9691658020019531, 0.6236786842346191, 0.0008345581009052694, 0.0010098668280988932, 0.002679227851331234, 0.0007986145792528987, 0.0016482389764860272, 0.0005748143885284662, 0.0005739748012274504, 0.002174969296902418, 0.0009079206502065063, 0.0007018516771495342, 0.0011013724142685533, 0.0006784622673876584, 0.0006588560063391924, 0.002821438480168581, 0.0015603952342644334, 0.024605102837085724, 0.0005695068975910544, 0.0013427863596007228, 0.1544809639453888, 0.0006894061807543039, 0.11555597931146622, 0.8414478898048401, 0.0010098278289660811, 0.000785798067227006, 0.0007352287066169083, 0.010879243724048138, 0.09549268335103989, 0.0013030699919909239, 0.0006955508724786341, 0.574606716632843, 0.018585992977023125, 0.004535795655101538, 0.0006165615632198751, 0.00060411257436499, 0.0008568385965190828, 0.0010868908138945699, 0.0060244412161409855, 0.0007280191639438272, 0.0007409154204651713, 0.0006540592294186354, 0.016762590035796165, 0.0013231075135990977, 0.9174630641937256, 0.001018514041788876, 0.0006216911133378744, 0.000681548670399934, 0.0006107919616624713, 0.0006460394943132997, 0.0010787498904392123, 0.0008932753698900342, 0.9863002896308899, 0.04244120419025421, 0.02884492091834545, 0.01086177583783865, 0.000850023643579334, 0.0005908258608542383, 0.0012732385657727718, 0.005974023602902889, 0.0006570628611370921, 0.0009149714605882764, 0.0007112110033631325, 0.08553007245063782, 0.004185279831290245, 0.07068663090467453, 0.0006029175710864365, 0.0008371952571906149, 0.0007629480096511543, 0.0005984654417261481, 0.0008243112242780626, 0.0007385520148091018, 0.0011300083715468645, 0.001234472612850368, 0.012462792918086052, 0.0008474934729747474, 0.0013939004857093096, 0.0005791138974018395, 0.0014904020354151726, 0.0005972468643449247, 0.023182624951004982, 0.12410984188318253, 0.005177425220608711, 0.0020767920650541782, 0.0006075612036511302, 0.0006379386759363115, 0.0015627957182005048, 0.9922264814376831, 0.0025834119878709316, 0.0006807087338529527, 0.0008952581556513906, 0.0015309302834793925, 0.0006410939968191087, 0.0008306320523843169, 0.0006980327307246625, 0.008869695477187634, 0.000849891162943095, 0.0007993748877197504, 0.0007755384431220591, 0.001085897209122777, 0.2241314947605133, 0.0018743496621027589, 0.0006431070505641401, 0.001262037199921906, 0.0006966401706449687, 0.002902108943089843, 0.00930025428533554, 0.0006529111415147781, 0.000567896175198257, 0.0007392766419798136, 0.0026281282771378756, 0.0006153686554171145, 0.0020014247857034206, 0.0006591002456843853, 0.0006932872347533703, 0.3663603663444519, 0.03714470565319061, 0.001755434786900878, 0.0006632230943068862, 0.013624000363051891, 0.0007907694089226425, 0.008039036765694618, 0.9158877730369568, 0.1446366012096405, 0.020481545478105545, 0.012988119386136532, 0.0026875457260757685, 0.0007333208923228085, 0.0006896050181239843, 0.001071400591172278, 0.0006346172885969281, 0.0007261252030730247, 0.0006712448666803539, 0.000654534378554672, 0.025443673133850098, 0.002705355640500784, 0.0007627927116118371, 0.0006626134272664785, 0.0012563463533297181, 0.0014340721536427736, 0.001482054591178894, 0.0009543946944177151, 0.0005190972005948424, 0.2179308831691742, 0.0006412476650439203, 0.0007257612887769938, 0.0006607795367017388, 0.056598398834466934, 0.0005695712170563638, 0.0007208139286376536, 0.0005834157927893102, 0.0005843900144100189, 0.0006498087896034122, 0.0007216862868517637, 0.004220052156597376, 0.0009359211544506252, 0.0006915556732565165, 0.028148850426077843, 0.0012909028446301818, 0.03075908124446869, 0.000822368310764432, 0.0008305560913868248, 0.0014817577321082354, 0.0008152653463184834, 0.0006017630803398788, 0.0006504835328087211, 0.003655580338090658, 0.005368044599890709, 0.2105894833803177, 0.0005985227762721479, 0.0005714945727959275, 0.000728844606783241, 0.006938109174370766, 0.0006625487003475428, 0.0005741444765590131, 0.0009676881600171328, 0.004345526918768883, 0.3608417809009552, 0.000750152044929564, 0.000781388022005558, 0.0006530918763019145, 0.0017286810325458646, 0.0021340998355299234, 0.020503751933574677, 0.0007625590660609305, 0.0015379047254100442, 0.0009512142860330641, 0.0006261840462684631, 0.0005919514806009829, 0.0005398842040449381, 0.0009484356269240379, 0.0006587187526747584, 0.0009137509041465819, 0.0006649404531344771, 0.0006180409691296518, 0.0008759633055888116, 0.0006551194237545133, 0.0008808319689705968, 0.0019928044639527798, 0.0005955375963822007, 0.0007753178360871971, 0.000802218506578356, 0.0013940511271357536, 0.0016869264654815197, 0.0006919127190485597, 0.0007173327612690628, 0.0011469742748886347, 0.0010506705148145556, 0.0006486210622824728, 0.0006516262074001133, 0.000654516916256398, 0.3861508071422577, 0.0011604749597609043, 0.002921737963333726, 0.01803314872086048, 0.008579670451581478, 0.0009931116364896297, 0.0005271823611110449, 0.0006691706366837025, 0.0012329567689448595, 0.0006386808236129582, 0.0008086000452749431, 0.0006613188306801021, 0.0006568803219124675, 0.0023729896638542414, 0.0005586944753304124, 0.0007579376688227057, 0.0008460305980406702, 0.0008961858693510294, 0.0005926831508986652, 0.0008412295137532055, 0.004707161337137222, 0.007196454796940088, 0.0006077063153497875, 0.069405198097229, 0.0011602560989558697, 0.061847470700740814, 0.0011820034123957157, 0.0007631857297383249, 0.000779972760938108, 0.0009584663202986121, 0.000590120384003967, 0.0007039771298877895, 0.001659134984947741, 0.0012485012412071228, 0.10942091047763824, 0.028126265853643417, 0.0018100619781762362, 0.0007613867637701333, 0.002027129754424095, 0.0006257017375901341, 0.008764411322772503, 0.00374435493722558, 0.06330663710832596, 0.0006297663785517216, 0.0007730710203759372, 0.0007127614808268845, 0.0010383104672655463, 0.0006375614902935922, 0.008149239234626293, 0.0009300329838879406, 0.0033482967410236597, 0.0008724095532670617, 0.0014794800663366914, 0.0015242812223732471, 0.0006530496175400913, 0.0009281743550673127, 0.011809485964477062, 0.0009650003630667925, 0.0014739233301952481, 0.0008885979186743498, 0.000856228987686336, 0.0011069192551076412, 0.0006696194177493453, 0.001154729863628745, 0.0005415414343588054, 0.0008153314120136201, 0.00068335747346282, 0.0013919338816776872, 0.006773946341127157, 0.0008348837727680802, 0.0047036996111273766, 0.0008710767142474651, 0.0007094411412253976, 0.005382815841585398, 0.06976770609617233, 0.0006875800900161266, 0.016327647492289543, 0.001102909562177956, 0.004152828827500343, 0.0007490097777917981, 0.0040526799857616425, 0.008774101734161377, 0.4916057884693146, 0.008116120472550392, 0.5520964860916138, 0.000595665886066854, 0.000822028610855341, 0.0019702943973243237, 0.0019913427531719208, 0.0011724554933607578, 0.0018465900793671608, 0.0016584108816459775, 0.03092360869050026, 0.014233033172786236, 0.0007535186596214771, 0.03120466135442257, 0.0006327556329779327, 0.0005875214119441807, 0.001883417135104537, 0.0005728825926780701, 0.0006840761634521186, 0.0011402886593714356, 0.0037249878514558077, 0.013026981614530087, 0.00062330043874681, 0.0005895112990401685, 0.005881344433873892, 0.0017762157367542386, 0.010179487988352776, 0.027937334030866623, 0.0008874040795490146, 0.0009533422999083996, 0.001436690567061305, 0.0005645248456858099, 0.001654287800192833, 0.0006329229800030589, 0.005153493024408817, 0.0005578324780799448, 0.0007448703399859369, 0.0005965587915852666, 0.00319306761957705, 0.4229516386985779, 0.0007420537294819951, 0.0007540102815255523, 0.0006697556818835437, 0.0005504151340574026, 0.000922285602428019, 0.883200466632843, 0.0005380464135669172, 0.0011204760521650314, 0.0009239096543751657, 0.011288420297205448, 0.0006771729094907641, 0.0012879008427262306, 0.0005787221598438919, 0.0007845635409466922, 0.001396629144437611, 0.0006171021377667785, 0.003290377790108323, 0.0005781330983154476, 0.0006625470705330372, 0.0010643115965649486, 0.001147555187344551, 0.0027654459699988365, 0.0006899149739183486, 0.003088611178100109, 0.0006587429088540375, 0.004236613400280476, 0.14625798165798187, 0.10785666108131409, 0.017210712656378746, 0.0006457639974541962, 0.000971471075899899, 0.008804506622254848, 0.0006711124442517757, 0.002916357247158885, 0.000836885825265199, 0.03991026431322098, 0.0008231146493926644, 0.0006793458014726639, 0.0010753291426226497, 0.0009078537113964558, 0.001355692045763135, 0.0018219088669866323, 0.0054454742930829525, 0.0011272276751697063, 0.002116450574249029, 0.0015433912631124258, 0.0007761376327835023, 0.000798054737970233, 0.001103983260691166, 0.0007610045140609145, 0.0033916442189365625, 0.0016036875313147902, 0.0008679528255015612, 0.0007416613516397774, 0.0011866948334500194, 0.0007556540076620877, 0.0012791050830855966, 0.0006518917507492006, 0.0008587095071561635, 0.03771724924445152, 0.0006193461595103145, 0.000824419257696718, 0.0033578691072762012, 0.0006268703727982938, 0.007599113509058952, 0.0009092577965930104, 0.0006753876805305481, 0.0014320850605145097, 0.000695365946739912, 0.0006781478296034038, 0.0038021330256015062, 0.017888527363538742, 0.001645212178118527, 0.0006805199664086103, 0.008203743025660515, 0.03778737783432007, 0.0009961648611351848, 0.0032680658623576164, 0.007976534776389599, 0.0009927810169756413, 0.0009822255233302712, 0.0006085269851610065, 0.0721958577632904, 0.0005940877599641681, 0.0037226194981485605, 0.0010645497823134065, 0.0010632179910317063, 0.0007340375450439751, 0.009804923087358475, 0.0009908982319757342, 0.002777337096631527, 0.0008781829965300858, 0.01753128319978714, 0.0008169159991666675, 0.00143620150629431, 0.0009073801920749247, 0.7499675750732422, 0.00654903007671237, 0.0006548264645971358, 0.0008321119821630418, 0.0011860557133331895, 0.029112353920936584, 0.002891210839152336, 0.02576754428446293, 0.31791800260543823, 0.0042831432074308395, 0.0005413633771240711, 0.0007900184718891978, 0.0010399975581094623, 0.0007146451389417052, 0.0005799493519589305, 0.004970072768628597, 0.0007889241678640246, 0.0013877201126888394, 0.0007633075583726168, 0.0017415496986359358, 0.0010319262510165572, 0.0006453960668295622, 0.0007272401126101613, 0.020104477182030678, 0.011320038698613644, 0.0006644827662967145, 0.0019228882156312466, 0.01303909532725811, 0.0008372567244805396, 0.0008718378376215696, 0.0006008098134770989, 0.002061686711385846, 0.0006961311446502805, 0.0018119971500709653, 0.09416574239730835, 0.010726358741521835, 0.0019644652493298054, 0.002298029838129878, 0.8414897918701172, 0.000879587372764945, 0.0009530208189971745, 0.0041399127803742886, 0.8964826464653015, 0.0006446731276810169, 0.00567310256883502, 0.0006813175277784467, 0.0007747107883915305, 0.11116155982017517, 0.44165176153182983, 0.0007467722753062844, 0.0013726254692301154, 0.20688825845718384, 0.0015660886419937015, 0.002130290260538459, 0.0011780557688325644, 0.0009610966080799699, 0.0009122946648858488, 0.010148890316486359, 0.0027679631020873785, 0.0007767276838421822, 0.0008364226086996496, 0.013791550882160664, 0.00077677215449512, 0.0027514896355569363, 0.0006683350657112896, 0.0008229181985370815, 0.0009052157984115183, 0.00276007829234004, 0.0008362452499568462, 0.035263918340206146, 0.010588527657091618, 0.0006207236438058317, 0.0012785723665729165, 0.0010030966950580478, 0.0016297076363116503, 0.0010913704754784703, 0.0310683436691761, 0.0008105445303954184, 0.0007344045443460345, 0.005812818184494972, 0.0008274197462014854, 0.0009058965952135623, 0.08423691987991333, 0.001078566536307335, 0.000545679300557822, 0.0005661885952576995, 0.002716674702242017, 0.0006158042815513909, 0.0008026111754588783, 0.0006832594517618418, 0.000602089217863977, 0.0005649689119309187, 0.000778132351115346, 0.0016539704520255327, 0.0007061575306579471, 0.0009172667050734162, 0.0005429513985291123, 0.03490977734327316, 0.00068899110192433, 0.0006098136072978377, 0.0006980886682868004, 0.0005518768448382616, 0.0010269162012264132, 0.0006380191771313548, 0.0005274993018247187, 0.0012307919096201658, 0.005445144139230251, 0.0006936893914826214, 0.0006258395151235163, 0.00060666399076581, 0.4679214358329773, 0.0008918300154618919, 0.0008586869807913899, 0.011779386550188065, 0.010731572285294533, 0.0009262294042855501, 0.0008205909980461001, 0.0006169774569571018, 0.0014034798368811607, 0.0007456916500814259, 0.0006486516795121133, 0.0006876250845380127, 0.046263109892606735, 0.0018472940428182483, 0.0014850256266072392, 0.000869063485879451, 0.0024297949858009815, 0.0019803140312433243, 0.0009900550357997417, 0.0007490434218198061, 0.0006469563231803477, 0.0011109663173556328, 0.0008071993943303823, 0.04369712620973587, 0.019260348752141, 0.00064402527641505, 0.0006017189007252455, 0.0033312723971903324, 0.014318322762846947, 0.005834645126014948, 0.0008939910330809653, 0.0034357584081590176, 0.008162064477801323, 0.0063123758882284164, 0.013892688788473606, 0.0006500234012492001, 0.0009883365128189325, 0.08757443726062775, 0.0007730773068033159, 0.012584943324327469, 0.004192927852272987, 0.02878877893090248, 0.0013448206009343266, 0.01870706118643284, 0.005840985104441643, 0.0006262950482778251, 0.0007084048120304942, 0.013656135648488998, 0.0018800597172230482, 0.0006689894944429398, 0.0007984323892742395, 0.0006407073815353215, 0.0009718510555103421, 0.0009008779306896031, 0.0010071640135720372, 0.0010560950031504035, 0.0006181057542562485, 0.0008236576104536653, 0.0007551148300990462, 0.0009652550797909498, 0.0009424229501746595, 0.006669699680060148, 0.0005590908695012331, 0.0011199078289791942, 0.0013459814945235848, 0.0014500810066238046, 0.002604976063594222, 0.001302019227296114, 0.0013226872542873025, 0.001957327127456665, 0.0006406972534023225, 0.0008535713423043489, 0.0012254157336428761, 0.021409519016742706, 0.0006494441186077893, 0.16348795592784882, 0.0066772568970918655, 0.12372743338346481, 0.0028560669161379337, 0.010542512871325016, 0.0006753239431418478, 0.0007763599278405309, 0.0020757950842380524, 0.0008300964836962521, 0.015602655708789825, 0.0008668866357766092, 0.0009139660396613181, 0.0010424228385090828, 0.007722025737166405, 0.001447050366550684, 0.0008859939407557249, 0.0005648389342240989, 0.02933271788060665, 0.40189722180366516, 0.002772483741864562, 0.005899387877434492, 0.0010850969702005386, 0.0009044437319971621, 0.0007492357399314642, 0.0005550867062993348, 0.0009071347303688526, 0.000785674958024174, 0.23410913348197937, 0.008577704429626465, 0.0010475512826815248, 0.09168128669261932, 0.0036583649925887585, 0.000709035259205848, 0.001790241920389235, 0.0006911152158863842, 0.0009602280333638191, 0.0007825940847396851, 0.008488834835588932, 0.0039176917634904385, 0.0006313864141702652, 0.0009060372249223292, 0.0006534106796607375, 0.0005656071589328349, 0.0005645068013109267, 0.0013633858179673553, 0.0006876607658341527, 0.0010108968708664179, 0.0022254856303334236, 0.0009841106366366148, 0.002056311583146453, 0.0006577764870598912, 0.0005462460685521364, 0.0010064648231491446, 0.000629139191005379, 0.09392545372247696, 0.005592647939920425, 0.22242137789726257, 0.02312448062002659, 0.0007601857651025057, 0.0008380759973078966, 0.0009488677023909986, 0.0005786402616649866, 0.0007467021932825446, 0.0007123557734303176, 0.003206717548891902, 0.0008442766265943646, 0.001268258085474372, 0.03336416929960251, 0.0007544721593149006, 0.0015179585898295045, 0.04435548186302185, 0.0013376297429203987, 0.04625614732503891, 0.0017345886444672942, 0.0020030797459185123, 0.0012153241550549865, 0.002887074602767825, 0.0014828367857262492, 0.005291064735502005, 0.005511808674782515, 0.007879837416112423, 0.005726526025682688, 0.000758577196393162, 0.39212194085121155, 0.002860767999663949, 0.0011258100857958198, 0.006272672209888697, 0.0030260419007390738, 0.0030639993492513895, 0.0005820195656269789, 0.9176315069198608, 0.0013531353324651718, 0.012921665795147419, 0.0007316926494240761, 0.0009161731577478349, 0.0018618975300341845, 0.0023628845810890198, 0.0006289140437729657, 0.0006543027120642364, 0.0007077580085024238, 0.0036551528610289097, 0.0034348967019468546, 0.004237500950694084, 0.0005595117108896375, 0.0006700180820189416, 0.0010170325404033065, 0.0005676180589944124, 0.0009894935647025704, 0.0017723907949402928, 0.0043197693303227425, 0.001250176690518856, 0.0006397088291123509, 0.001480789389461279, 0.0007096690242178738, 0.0016855242429301143, 0.004647888708859682, 0.004377456381917, 0.0007745808688923717, 0.06652683019638062, 0.0010271447245031595, 0.0009060044540092349, 0.0007568878354504704, 0.0010047422256320715, 0.003607518970966339, 0.003687038319185376, 0.0005524502485059202, 0.04600087180733681, 0.0010569012956693769, 0.0009245459223166108, 0.0011090587358921766, 0.0016434633871540427, 0.0025134352035820484, 0.41999688744544983, 0.16510316729545593, 0.0008693913696333766, 0.003988008480519056, 0.0006632088916376233, 0.0017638163408264518, 0.0008566516917198896, 0.0012384309666231275, 0.0006883409805595875, 0.006249868776649237, 0.000795327010564506, 0.005828096531331539, 0.0017621162114664912, 0.0008789728744886816, 0.0009912466630339622, 0.001397414831444621, 0.004854345694184303, 0.009787964634597301, 0.006114916875958443, 0.0013893962604925036, 0.004596823826432228, 0.0006138806929811835, 0.007580712903290987, 0.0007373414700850844, 0.00904776155948639, 0.0038212586659938097, 0.0017397773917764425, 0.9765384793281555, 0.24235425889492035, 0.002501564333215356, 0.025118395686149597, 0.0014992273645475507, 0.001481519895605743, 0.06542560458183289, 0.0011016951175406575, 0.0010031769052147865, 0.0007713031372986734, 0.0007364355260506272, 0.003086588578298688, 0.0013076919130980968, 0.0009254479082301259, 0.012207224033772945, 0.015775000676512718, 0.0015408978797495365, 0.02539047971367836, 0.2562505602836609, 0.0009409425547346473, 0.004510672762989998, 0.5346986055374146, 0.011490067467093468, 0.0013673609355464578, 0.007559430785477161, 0.03828435018658638, 0.001483392552472651, 0.029860729351639748, 0.0010276057291775942, 0.07612334191799164, 0.000799836590886116, 0.02386048622429371, 0.0010133630130439997, 0.004462429787963629, 0.03961142897605896, 0.017293035984039307, 0.0017347628017887473, 0.0009661963558755815, 0.0019686701707541943, 0.0009467016789130867, 0.0006401580176316202, 0.0035316848661750555, 0.0020641221199184656, 0.0008063694695010781, 0.0007682479335926473, 0.0006607540999539196, 0.0009525129571557045, 0.003008452011272311, 0.020259901881217957, 0.0006183249643072486, 0.0021012171637266874, 0.0041985600255429745, 0.0007917740731500089, 0.000787582655902952, 0.005990148521959782, 0.04326825961470604, 0.0007225536974146962, 0.0011213035322725773, 0.01438959687948227, 0.0009412209037691355, 0.012179557234048843, 0.0008215591660700738, 0.0014805877581238747, 0.0007071751169860363, 0.005438650492578745, 0.00272550992667675, 0.0012663672678172588, 0.008097922429442406, 0.0015083481557667255, 0.0022987055126577616, 0.0007868399261496961, 0.000708268431480974, 0.001043760683387518, 0.0037927133962512016, 0.0067790173925459385, 0.0006037490675225854, 0.0007856973679736257, 0.0015887097688391805, 0.0007360191666521132, 0.0006588961696252227, 0.0006408399203792214, 0.0013644762802869081, 0.0011738736648112535, 0.05496640130877495, 0.0005693918210454285, 0.00488416338339448, 0.0013422429328784347, 0.0006458320422098041, 0.0008888498414307833, 0.001208475441671908, 0.0009393332875333726, 0.0006232698215171695, 0.000954957737121731, 0.026059649884700775, 0.0006901789456605911, 0.0006847744225524366, 0.016414785757660866, 0.0006465442129410803, 0.0016024985816329718, 0.11760415881872177, 0.0009515914134681225, 0.08075477182865143, 0.0033147188369184732, 0.0007357165450230241, 0.0575130395591259, 0.0030111062806099653, 0.0023909530136734247, 0.0012138312449678779, 0.0009911536471918225, 0.0017960439436137676, 0.0007552141905762255, 0.0006868132622912526, 0.0013785817427560687, 0.0006387268076650798, 0.007433145307004452, 0.0015900129219517112, 0.006345127243548632, 0.0017914226045832038, 0.0008790431311354041, 0.0008829768630675972, 0.0007205935544334352, 0.0007929485873319209, 0.0017878992948681116, 0.00067654944723472, 0.0006649575661867857, 0.0012150406837463379, 0.0007690447964705527, 0.0008149535278789699, 0.0006893776007927954, 0.0019627336878329515, 0.7546861171722412, 0.0037989537231624126, 0.0019819792360067368, 0.0010342419845983386, 0.0010513459565117955, 0.00348646123893559, 0.0007006193627603352, 0.0006091768736951053, 0.0006499899318441749, 0.15033593773841858, 0.0012775729410350323, 0.027659131214022636, 0.05305812135338783, 0.0012219346826896071, 0.047385599464178085, 0.006504057440906763, 0.001134769874624908, 0.0006679418147541583, 0.0007601988618262112, 0.0006820344133302569, 0.0011991045903414488, 0.0071493894793093204, 0.0006381186540238559, 0.0008742127101868391, 0.010867202654480934, 0.001047105761244893, 0.0009735656203702092, 0.0007014450384303927, 0.0006393985822796822, 0.0046885753981769085, 0.02591567486524582, 0.000705460668541491, 0.000874532270245254, 0.0009184674127027392, 0.0010348461801186204, 0.0011452995240688324, 0.023081978783011436, 0.029974116012454033, 0.0022851130925118923, 0.10030456632375717, 0.0006399829289875925, 0.025192053988575935, 0.0007076760521158576, 0.002989745931699872, 0.011818978004157543, 0.0010581581154838204, 0.010201569646596909, 0.0010003967909142375, 0.019495731219649315, 0.000834402977488935, 0.0011957735987380147, 0.1264803260564804, 0.000899121689144522, 0.0005480941035784781, 0.0010788162471726537, 0.0006428147898986936, 0.0011646831408143044, 0.0010246416786685586, 0.00062116130720824, 0.0006416371325030923, 0.0008851995225995779, 0.0016354697290807962, 0.0006987989181652665 ]

[ "See related research by Havey et al., ", "<http://ccforum.com/content/15/6/R267>\n\nReducing duration of antibiotic therapy without a diminution in efficacy decreases cost, side effects, antibiotic related diarrhoea, and bacterial resistance. ", "Havey and colleagues \\[[@B1]\\] reported the results of a systematic review and meta-analysis of antibiotic duration in bacteraemia and deduced short course therapy (\\<7 days) might be as effective as longer treatments. ", "It is surprising given the obvious benefits and the frequency with which bacteraemia is documented in critically ill patients that there is such a paucity of randomised clinical trials (RCTs) comparing duration of therapy. ", "Only one RCT, in neonates, had been performed in patients solely with bacteraemia. ", "Accordingly, Havey and colleagues concluded that duration of antibiotic therapy in bacteraemia is poorly studied and would benefit from a large RCT.", "\n\nDaneman and colleagues \\[[@B2]\\] performed a survey of Canadian infectious disease and critical care specialists to gauge the optimal duration of therapy in bacteraemic critically ill patients. ", "Considerable variability existed amongst clinicians and undoubtedly reflects the lack of robust data to guide best practice. ", "However, length of treatment is only one aspect of optimising outcomes from antibiotic use. ", "Future RCTs need to take into account whether adequate source control has been achieved, as this will bias duration of therapy. ", "Moreover, it is clear that since many antibiotics deployed in critical care demonstrate time-dependent killing, inadequate doses are frequently used, which increases treatment failure and the emergence of resistance \\[[@B3],[@B4]\\]. ", "Pharmacokinetic optimisation that ensures adequate time above minimum inhibitory concentration should therefore be an integral component of any trial that compares duration of antibiotic therapy \\[[@B5]\\].", "\n\nAbbreviations\n=============\n\nRCT: randomised clinical trial.", "\n\nCompeting interests\n===================\n\nThe authors declare that they have no competing interests.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.0005798490601591766, 0.0013467016397044063, 0.0006809604819864035, 0.0007510762079618871, 0.002282951958477497, 0.0006921586464159191, 0.0007721032598055899, 0.0005493909120559692, 0.0006194291054271162, 0.0005839100922457874, 0.0007397304871119559, 0.0014511985937133431, 0.0007007672684267163, 0.0006653299788013101, 0.001995444530621171 ]

[ "I'll try and give you guys a call this weekend from there. ", " Should be fun! ", " \n\nlove,\ncoop\n\n\n\n \n\n\tEnron Capital & Trade Resources Corp. From: Richey Holly <Richey_Holly@prc.com> 05/17/2001 09:04 AM\t\n\t\t\n\n\nTo:\t\"'Cooper.Richey@enron.com'\" <Cooper.Richey@enron.com>\ncc:\t \nSubject:\tRE: Weather This Weekend\n\n\nSounds like just what you need. ", " Say hello to Coz. ", " Have a great time.", "\nWon't plan to talk to you until mid-week next week. ", " Luv, Mom\n\n-----Original Message-----\nFrom: Cooper.Richey@enron.com [mailto:Cooper.Richey@enron.com]\nSent: Thursday, May 17, 2001 9:54 AM\nTo: Richey_Holly@prc.com\nSubject: RE: Weather This Weekend\n\n\n\nGoing down for some work, but hanging out for the weekend to see friends,\netc.", "\n\nbe travelling alot this month... don't know how dad does it.", "\n\nlove,\ncoop\n\n\n\n\n\n\n\n (Embedded Enron Capital & Trade Resources Corp.\n image moved\n to file: From: Richey Holly\n pic32544.pcx) <Richey_Holly@prc.com>\n 05/17/2001 06:29 AM\n\n\n\n\n\n\nTo: \"'Cooper.Richey@enron.com'\" <Cooper.Richey@enron.com>\ncc:\nSubject: RE: Weather This Weekend\n\n\nCoop: What are you doing in Portland? ", " Luv, Mom\n\n-----Original Message-----\nFrom: Cooper.Richey@enron.com [mailto:Cooper.Richey@enron.com]\nSent: Wednesday, May 16, 2001 6:20 PM\nTo: Richey_Holly@prc.com\nSubject: Re: Weather This Weekend\n\n\n\nexcept i'll be in portland this weekend... trying to line up a game for\nthe next weekend, though. ", " i'll let you know...\n\nlove,\ncoop\n\n\n\n\n\n\n (Embedded Enron Capital & Trade Resources Corp.\n image moved\n to file: From: Richey Holly\n pic24750.pcx) <Richey_Holly@prc.com>\n 05/16/2001 01:41 PM\n\n\n\n\n\n\nTo: \"'Cooper Richey'\" <crichey@ect.enron.com>\ncc:\nSubject: Weather This Weekend\n\n\nCoop: Just checked the Calgary weather. ", " Looks like it'll be good for golf\nthis weekend. ", " Luv, Mom\n\nHolly Richey\nLitton PRC, a Subsidiary of Northrop Grumman\n703.556.3634" ]

{ "pile_set_name": "Enron Emails" }

[ 0.0007455140585079789, 0.0008383698877878487, 0.000603065243922174, 0.0006244649412110448, 0.0007725397008471191, 0.0007138303481042385, 0.000987422652542591, 0.002439768984913826, 0.0006175492890179157, 0.001173363416455686, 0.0005780294886790216, 0.00059122295351699, 0.0011469186283648014 ]

[ "Verseon Corporation (“Verseon” or the “Company”)\n\nAdditional Listing and Total Voting Rights\n\nVerseon, a technology-based pharmaceutical company, announces that application has been made for 35,958 Common Shares of par value $0.001 each (the \"Common Shares\") to be admitted to trading on AIM pursuant to the exercise of warrants and options issued and restricted stock grants (the \"Exercise\").", "\n\nOf the 35,958 Common Shares issued, 4,322 Common Shares were issued to Dr. Thomas Hecht, Non-Executive Chairman of the Company, in relation to payment of his Director's fees in the form of restricted stock totalling 17,921 Common Shares vesting quarterly in equal proportions over a one year period. ", "Following Admission, Dr. Hecht will hold 4,322 Common Shares, representing 0.003% of the Company's issued share capital.", "\n\nThe 35,958 new Common Shares issued pursuant to the Exercise will rank pari passu with the Company's existing Common Shares and admission to trading on AIM is expected to take place on 30 September 2015 (\"Admission\").", "\n\nTotal Voting Rights\n\nFollowing Admission, the issued share capital of the Company will consist of 150,854,809 Common Shares. ", "The Company does not hold any shares in treasury. ", "Therefore the total number of Common Shares in the Company with voting rights will be 150,854,809. ", "This figure may be used by shareholders in the Company as the denominator for the calculations by which they will determine if they are required to notify their interest in, or a change in their interest in, the share capital of the Company under the FCA's Disclosure and Transparency Rules." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005923823919147253, 0.0006298786611296237, 0.0005966292228549719, 0.0005600206786766648, 0.0005845942068845034, 0.0007352284155786037, 0.0006581690395250916, 0.0005525634624063969 ]

[ "Introduction {#s1}\n============\n\nMotor imagery (MI) refers to the mental rehearsal of a movement without overtly performing the respective action [@pone.0038506-Crammond1]. ", "It provides an intriguing way to learn and improve motor acts and as such has a number of applications in neurorehabilition, sports, and artistic performance. ", "Moreover, MI is an excellent tool to study the functionality of the motor system beyond simple motor acts easily performed in laboratory settings. ", "Consequently, a vast amount of research has been conducted characterizing MI. ", "One basic pattern of results is that MI and overt motor execution (ME) draw on similar cognitive and neural mechanisms, which is in line with theoretical accounts of MI [@pone.0038506-Decety1], [@pone.0038506-Jeannerod1]. ", "This notion of equivalence is well evidenced for a range of parameters such as speed-accuracy tradeoff [@pone.0038506-Decety2], corticomotor excitability [@pone.0038506-PascualLeone1], [@pone.0038506-Stinear1], cortical surface activity [@pone.0038506-Miller1], and advanced motor preparation [@pone.0038506-Kranczioch1], as well as the network of brain areas controlling motor functions [@pone.0038506-Jeannerod1], [@pone.0038506-Lotze1]--[@pone.0038506-Porro1]. ", "However, some characteristics of MI remain largely unexplored.", "\n\nIn particular, in our everyday life many actions are bimanual in nature, such as tying shoelaces, folding a sheet of paper, or buttoning a shirt. ", "Such actions require that both hands move cooperatively. ", "For instance, when tying shoelaces the hands interact so closely that the movement of one hand is meaningless without the accompanying movements of the other hand. ", "This strong coupling and inter-dependence requires additional processes related to the coordination of both limbs, which are not required during unimanual actions [@pone.0038506-Swinnen1], [@pone.0038506-Guiard1]. ", "Since these demands in bimanual actions exceed what would be expected by the mere sum of two separate unimanual actions, we consider them as \"over-additive\". ", "The bimanual coordination processes may be realized by at least two (non-exclusive) mechanisms. ", "First, they may be realized by increased neural activity, resulting in increased BOLD signal as measured by fMRI. ", "Second, they may be realized by a change in how brain areas are functionally connected with each other, resulting in changed functional connectivity as measured by psychophysiological interactions. ", "The aim of the present study was to identify these additional demands in MI of everyday tasks and to test by which mechanism(s) they are realized.", "\n\nSince no previous study investigated this particular question, hypotheses can only be derived from related research. ", "For instance, Grefkes et al. [", "@pone.0038506-Grefkes1] has shown that overt bimanual movements result in activation of the SMA and increased connectivity between areas of the motor system as assessed by structural equation modeling (SEM). ", "However, the activity of the SMA actually did not seem to have exceeded the activity expected by the mere sum of left and right hand actions and therefore may not be related to bimanual coordination at all [@pone.0038506-Grefkes1], [@pone.0038506-Szameitat1]. ", "This is in line with Puttemans et al. [", "@pone.0038506-Puttemans1] who showed that overt performance of overlearned bimanual movements induced activations related to bimanual coordination effort only in two sub-cortical but no cortical areas. ", "Consequently, we predicted that the bimanual coordination demands in MI are reflected only to a small extent, if at all, by changes in cortical activation, and that they are predominantly reflected by changes in functional connectivity.", "\n\nWe chose to use MI of everyday tasks instead of more simplistic laboratory actions for a number of reasons [@pone.0038506-Szameitat2]. ", "First, theoretical accounts of MI strongly depend on the equivalence of MI and overt execution [@pone.0038506-Decety1], [@pone.0038506-Jeannerod1]. ", "Therefore, it is important from a theoretical point of view to confirm that also MI of ecologically valid everyday tasks show characteristics found in overt performance. ", "Second, MI is widely used in applied fields such as motor rehabilitation and sports, for instance in the form of mental practice. ", "However, while these applications often use complex everyday tasks their theoretical foundation is based on highly simplistic laboratory tasks such as fist making or button presses, which may be an invalid transfer [@pone.0038506-Fourkas1].", "\n\nPresently, it is an open question in how far the results gained by rather simplistic laboratory tasks (e.g. fist making [@pone.0038506-Grefkes1]) can be generalized to ecologically valid everyday tasks, because the demands on bimanual coordination differ profoundly. ", "When tying shoelaces, as mentioned above, the hands need to be tightly coordinated to form a coherent meaningful action. ", "When participants are instructed to simultaneously make fists, at most the movement onsets need to be coordinated, while there is no further demand for continuous bimanual coordination. ", "On the other hand, an often employed simple modification to the task instruction can make fist making a highly demanding task, that is asking the participants to perform the cyclic movement of each hand with a different frequency (e.g. make a fist three times with the left hand while only two times with the right hand, a 3∶2 frequency ratio). ", "These tasks, however, seem much more complex and arbitrary than ecologically valid everyday actions, so that their coordination demands may be associated with different neural correlates as compared to everyday actions. ", "Of course all these laboratory tasks have been proven to be highly useful to illuminate the workings of the motor system in bimanual coordination, our point is merely that the results of these previously used tasks may not be generalized to ecologically more valid everyday tasks in a straightforward way.", "\n\nHere we report data from 17 participants. ", "The analysis is divided into two parts. ", "First, a univariate fMRI analysis is employed to test for condition-specific differences in neural activation [@pone.0038506-Friston1] and to determine the seed regions for a connectivity analysis. ", "Due to the lack of prior evidence and ambiguity as to whether the results of simple laboratory tasks can be generalized to everyday tasks, we used, in the second part of the analysis, a multi psychophysiologic interaction (mPPI) approach [@pone.0038506-Friston2]. ", "MPPI is a data-driven approach in that it does not require one to specify *a priori* hypotheses about connectivity profiles (as required e.g. by SEM and by dynamic causal modeling, DCM).", "\n\nIn more detail, participants completed five different kinesthetic motor imagery conditions, MI of bimanual actions (B[iman]{.smallcaps}, e.g. tying shoelaces), MI of simple unimanual tasks (e.g. pressing a button) with the left (S[imple]{.smallcaps}-L) and right (S[imple]{.smallcaps}-R) hand, MI of complex unimanual tasks (e.g. writing) with the left (C[omplex]{.smallcaps}-L) and right (C[omplex]{.smallcaps}-R) hand, and a resting baseline (B[aseline]{.smallcaps}). ", "We included two types of unimanual conditions, i.e. simple and complex tasks, because unimanual and bimanual actions may differ in their complexity. ", "In the following the combination of the unimanual conditions S[imple]{.smallcaps}-L and C[omplex]{.smallcaps}-L is referred to as U[ni]{.smallcaps}-L, the combination of S[imple]{.smallcaps}-R and C[omplex]{.smallcaps}-R is referred to as U[ni]{.smallcaps}-R, and all four unimanual tasks are referred to as U[niman]{.smallcaps}.", "\n\nResults {#s2}\n=======\n\nBehavioral Data {#s2a}\n---------------\n\nBefore the experiment started participants were asked to rate how difficult it would be to overtly perform perform the movements used in the present experiment. ", "Participants rated the perceived difficulty for each movement when performed with the left and right hand, respectively, using a scale ranging from 1 (\"very easy\") to 5 (\"very hard\"). ", "Ratings of different unimanual tasks were significantly different for complex and simple actions (non-parametric Wilcoxon tests (N = 17), see [Fig. ", "1](#pone-0038506-g001){ref-type=\"fig\"}, black bars). ", "Imagination of left hand actions was perceived to be more difficult than right hand actions for both categories of complexity (S[imple]{.smallcaps}: Z = 2.640, p\\<.01; C[omplex]{.smallcaps}: Z = 3.720, p\\<.001). ", "In addition, S[imple]{.smallcaps} tasks were easier than C[omplex]{.smallcaps} tasks when performed with the left hand (Z = 3.743, p\\<.001), but not when performed with the right hand (Z = 1, p = .317). ", "Compared to unimanual conditions (derived from the study sample), B[iman]{.smallcaps} actions were easier than C[omplex]{.smallcaps}-L actions (Z = 5.141, p\\<.001), showed a trend to be more difficult than S[imple]{.smallcaps}-R actions (Z = 2.659; p = .079), and were equivalent to S[imple]{.smallcaps}-L and C[omplex]{.smallcaps}-R (both p\\>.15). ", "Therefore, the bimanual actions were rated to be in the same difficulty range as the unimanual actions.", "\n\n{ref-type=\"sec\"}). ", "For illustration purposes interval scale level was assumed for the Difficulty and QoI rating values and means and SEMs are displayed. ", "Error bars denote SEM.](pone.0038506.g001){#pone-0038506-g001}\n\nTo test for potential movements during motor imagery, participants held two force sensitive grips in their hands [@pone.0038506-Hou1]. ", "Hand grip data recorded during the scanning session were averaged for each condition and participant. ", "Force levels during the different MI conditions differed not significantly from the force levels during the baseline, with the only exception being during the C[omplex]{.smallcaps}-L condition. ", "In this condition, participants exerted 0.0588 N more force on the right grip than during B[aseline]{.smallcaps} (t(16) = 2.403, p = .029). ", "We observed no significant differences between MI conditions, neither for the left hand, the right hand, nor the average of both hands ([Fig. ", "1](#pone-0038506-g001){ref-type=\"fig\"}, white bars; all t(16)\\<1.795; all p\\>.05).", "\n\nDirectly after scanning, we assessed the subjective quality of imagination (QoI) for each movement individually on a scale from 1 (\"bad/hard to imagine\") to 7 (\"perfect/very vivid & lively imagination\") and calculated the median values for each condition and participant ([Fig 1](#pone-0038506-g001){ref-type=\"fig\"}, gray bars). ", "To control for the potentially confounding effect of QoI, we compared the QoI ratings of B[iman]{.smallcaps} with the unimanual conditions. ", "Non-parametric Wilcoxon signed ranks tests showed that, most importantly, QoI did not differ between the bimanual and the combined unimanual conditions (Z = .877; p = .531). ", "Comparisons of B[iman]{.smallcaps} with each of the four unimanual conditions further showed that QoI for B[iman]{.smallcaps} was significantly better than for C[omplex]{.smallcaps}-L (Z = 2.801; p\\<.01), but equivalent to the remaining three unimanual conditions (all Z\\<1.667; all p\\>.180). ", "Taken together, the quality of imagination was comparable for the bimanual and unimanual conditions.", "\n\nUnivariate Approach -- Localizing Increased Neural Processing {#s2b}\n-------------------------------------------------------------\n\nIn a first step we identified brain areas generally involved in motor imagery by comparing all I[magery]{.smallcaps} conditions with B[aseline]{.smallcaps} (i.e. ((C[omplex]{.smallcaps}-L + C[omplex]{.smallcaps}-R + S[imple]{.smallcaps}-L + S[imple]{.smallcaps}-R + B[iman]{.smallcaps})/5) -- B[aseline]{.smallcaps}). ", "Because the main purpose of this contrast was to identify cortical areas for the subsequent analysis of functional connectivity, we utilized a sensitive contrast which may even reveal brain areas showing only subthreshold activation in some of the five motor imagery conditions. ", "Consequently, areas identified by this contrast are not necessarily significantly active in all five motor imagery conditions, as would for instance be indicated by a conjunction analysis.", "\n\nThe comparison of all I[magery]{.smallcaps} conditions with B[aseline]{.smallcaps} revealed a network of activations primarily comprising premotor and parietal areas ([Table 1](#pone-0038506-t001){ref-type=\"table\"}, [Fig. ", "2a](#pone-0038506-g002){ref-type=\"fig\"}). ", "In detail, premotor activation was located in the bilateral supplementary motor area (SMA; BA 6) extending into dorsal premotor cortices of both hemispheres (BA 6), and in the left rolandic operculum extending into the precentral gyrus (BA 6). ", "Parietal activations were evident in the left postcentral gyrus, (BA 1/2), right supramarginal gyrus (BA 40) and bilateral angular (BA39) gyri. ", "These activation peaks ([Table 1](#pone-0038506-t001){ref-type=\"table\"}) served as seed regions for the connectivity analysis (see below).", "\n\n{#pone-0038506-g002}\n\n10.1371/journal.pone.0038506.t001\n\n###### Anatomical locations and MNI coordinates of activation peaks for the comparison I[magery]{.smallcaps} -- B[aseline]{.smallcaps}.", "\n\n![](", "pone.0038506.t001){#pone-0038506-t001-1}\n\n MNI coordinate \n -------------------------- ---------------- ----- ----- ----- ---- ------- -------\n L rolandic operculum N/A N/A −56 10 0 9.08 0.008\n L precentral G 6 70% −58 4 32 7.92 0.033\n R SMA 6 70% 2 0 52 10.07 0.002\n L SMA 6 90% −4 −8 64 13.73 0.000\n R superior frontal G 6 60% 22 −8 70 10.95 0.001\n R supramarg G (area PFt) 40 60% 54 −30 44 8.91 0.010\n L postcentral G 1 60% −48 −34 56 8.53 0.016\n L postcentral G 2 40% −38 −42 58 8.35 0.020\n L angular G (area PGp) N/A 20% −58 −66 12 11.1 0.001\n R angular G (area PGp) 39 50% 56 −68 18 7.99 0.030\n\nProbability (Prob) of the location according to the Anatomy toolbox. ", "N/A if region is not assigned by Anatomy toolbox.", "\n\nAbbreviations. ", "G  =  gyrus; SMA  =  supplementary motor area; supramarg  =  supramarginal; Prob  =  probability; BA  =  Brodmann\\'s area; R/L  =  right/left hemispheric activation, respectively.", "\n\nTo test for changes in the BOLD response specific to bimanual MI, we determined over- and underadditive effects by comparing bimanual MI with the summed effects of unimanual MI \\[(B[iman]{.smallcaps} -- U[ni]{.smallcaps}-R) -- (U[ni]{.smallcaps}-L -- B[aseline]{.smallcaps})\\] (with U[ni]{.smallcaps}-R  =  (S[imple]{.smallcaps}-R + C[omplex]{.smallcaps}-R)/2 and U[ni]{.smallcaps}-L  =  (S[imple]{.smallcaps}-L + C[omplex]{.smallcaps}-L)/2). ", "Due to the nature of this interaction contrast, which pools activity of MI of bimanual actions and the resting baseline (see section *4.5 Statistics* in the Experimental Procedures for details), we expected strong visual cortex activation, since participants had their eyes opened only during the resting baseline. ", "The analysis revealed that except for the visual cortex, no voxels were activated with the chosen threshold of p\\<.05 (FWE corrected). ", "Lowering the threshold to a more liberal criterion of p\\<.001 (uncorrected) with an extent threshold of 20 voxels revealed activation clusters in the cerebellar vermis, the right dorsal prefrontal cortex, and the white matter near the left hippocampus or thalamus.", "\n\nUnderadditive activation was evident in two areas, the left SMA (−6*x*, −6*y*, 64*z*; t(16) = 8.85; p~FWE~\\<.01; cluster of 53 voxel) which was assigned to BA 6 (probability 70%) by the Anatomy toolbox, and the left inferior frontal gyrus (−54*x*, 12*y*, 0*z*; t(16) = 7.87; p~FWE~\\<.05; 12 voxel).", "\n\nPlease note that part of the data (regarding laterality effects in MI, i.e. comparison of MI with the right versus the left hand) was published before [@pone.0038506-Szameitat3].", "\n\nFunctional Connectivity (PPI) {#s2c}\n-----------------------------\n\nThe PPI analysis employed the activation peaks determined in the I[magery]{.smallcaps} -- B[aseline]{.smallcaps} contrast ([Table 1](#pone-0038506-t001){ref-type=\"table\"}) as seed regions, with connectivity changes being calculated between all pairs of seed regions. ", "This analysis showed that the contribution of two seed regions to the signal of a number of other seed regions was significantly increased under bimanual MI as compared to unimanual MI ([Table 2](#pone-0038506-t002){ref-type=\"table\"} and [Fig. ", "2b](#pone-0038506-g002){ref-type=\"fig\"}; there were no significant decreases in connectivity). ", "The first seed region was located in the right supramarginal gyrus and showed increased connectivity with five regions: (1) the right superior frontal gyrus, i.e., an ipsilateral premotor area, (2) the right angular gyrus, (3) the left SMA and (4) the left precentral gyrus, i.e. two contralateral premotor regions, and (5) the left postcentral gyrus (BA 2). ", "The second seed region was located in the right superior frontal gyrus and showed increased connectivity with six regions: (1) the right supramarginal gyrus, (2) the left postcentral gyrus (BA 1), (3) the right angular gyrus, and three contralateral (i.e., left hemispheric) premotor areas, (4) SMA, (5) precentral gyrus, and (6) rolandic operculum. ", "This pattern suggests that inter- and intrahemispheric connectivity between parietal and premotor areas is increased when bimanual movements are imagined.", "\n\n10.1371/journal.pone.0038506.t002\n\n###### Pattern of connectivity changes between seed regions (leftmost column) and target regions (top row).", "\n\n![](", "pone.0038506.t002){#pone-0038506-t002-2}\n\n L roland operculum L precentral G R SMA L SMA R superior frontal G R supramargin (PFt) L postcentral G (1) L postcentral G (2) L angular G (PGp) R angular G (PGp)\n ---------------------- -------------------- ---------------- ------- ------- ---------------------- --------------------- --------------------- --------------------- ------------------- -------------------\n L rolandic operculum \n L precentral G \n R SMA \n L SMA \n R superior frontal G L **B** **B** L **B** **B** **B** **B**\n R supramargin (PFt) L R **B** **B** **B** **B** **B**\n L postcentral G (1) L R \n L postcentral G (2) L R R \n L angular G (PGp) L R L R L L \n R angular G (PGp) L R L R L R L R L R L R \n\nSignificant changes (p\\<.05, FWE) for the comparisons of U[ni]{.smallcaps}-L vs B[aseline]{.smallcaps} (L), U[ni]{.smallcaps}-R vs B[aseline]{.smallcaps} (R), and B[iman]{.smallcaps} vs U[niman]{.smallcaps} (B).", "\n\nAbbreviations. ", "G  =  gyrus; SMA  =  supplementary motor area; supramarg  =  supramarginal; Prob  =  probability; BA  =  Brodmann\\'s area; R/L  =  right/left hemispheric activation, respectively.", "\n\nIn addition, we tested for changes in functional connectivity for unimanual MI by calculating PPI analyses for U[ni]{.smallcaps}-L vs B[aseline]{.smallcaps} and U[ni]{.smallcaps}-R vs B[aseline]{.smallcaps}. ", "Like above, in both analyses connectivity changes were calculated between all pairs of seed regions identified in the I[magery]{.smallcaps} -- B[aseline]{.smallcaps} contrast ([Table 1](#pone-0038506-t001){ref-type=\"table\"}). ", "Results ([Table 2](#pone-0038506-t002){ref-type=\"table\"}) showed that while the pattern of connectivity changes was virtually identical for both unimanual conditions U[ni]{.smallcaps}-L and U[ni]{.smallcaps}-R, it was clearly distinct from the pattern observed for B[iman]{.smallcaps}. ", "Specifically, we found that in B[iman]{.smallcaps} the right superior frontal gyrus und right supramarginal gyrus were two seed regions changing their connectivity with a number of areas, in U[niman]{.smallcaps} mainly the left and right angular gyri were such seed regions with a number of connectivity changes.", "\n\nDiscussion {#s3}\n==========\n\nWe investigated the neural mechanisms of MI of bimanual everyday actions. ", "A univariate analysis revealed no evidence for significantly increased neural activity during MI of bimanual actions as compared to MI of unimanual actions. ", "Psychophysiological interaction analyses, however, revealed a profound increase in intra- and interhemispheric functional connectivity between parietal and premotor cortices for bimanual actions. ", "As such the data confirm our hypothesis that the increased complexity in the imagery of bimanual actions is reflected in increased connectivity between areas rather than an overall increase in neural activation.", "\n\nCortical Areas Specifically Involved in MI of Bimanual Actions {#s3a}\n--------------------------------------------------------------\n\nControlling bimanual movements places greater demands on the motor system, for instance due to the need to coordinate both limbs [@pone.0038506-Swinnen1], [@pone.0038506-Guiard1]. ", "However, the present study found no evidence for activations specific to bimanual MI. ", "Even at a lower threshold of p\\<.001, uncorrected, circumscribed activations were found only in the cerebellar vermis, the white matter around the hippocampus, and the dorsolateral prefrontal cortex. ", "Since there should be no task related fMRI signal variations in the white matter, we propose this to be an artifact. ", "While the remaining two activations have been reported in studies investigating overt bimanual tasks [@pone.0038506-Debaere1]--[@pone.0038506-Wenderoth1], important components of the motor network, such as the SMA, lateral premotor cortices, or parietal cortices [@pone.0038506-Swinnen1], showed no overadditive activation even when uncorrected thresholds were applied. ", "We therefore conclude that our data provides no evidence for stronger activation of the cortical motor system specific to bimanual MI, a conclusion echoing findings on overt performance of trained bimanual actions [@pone.0038506-Puttemans1].", "\n\nCortical Areas Involved in MI {#s3b}\n-----------------------------\n\nTo identify seed regions for the PPI analysis, we compared all MI conditions to the baseline. ", "The resulting network was largely in line with previous studies. ", "For instance, the most prominent activation, i.e. bilateral SMA extending into both dorsal premotor cortices, is virtually always observed in MI [@pone.0038506-Porro1], [@pone.0038506-Bakker1]--[@pone.0038506-Naito1]. ", "This finding further confirms the simulation hypothesis of MI [@pone.0038506-Jeannerod1], which proposes high levels of equivalence between MI and ME. ", "Such equivalence leads to the prediction that MI should heavily rely on areas primarily associated with motor planning and movement preparation, such as the presently observed premotor areas.", "\n\nThe inferior parietal areas observed in the present study, i.e. the bilateral angular gyrus and the right supramarginal gyrus, have been frequently observed in MI [@pone.0038506-Boecker1]--[@pone.0038506-Fleming1]. ", "The inferior parietal cortex mainly consists of multi-modal association areas involved in the implementation of complex actions and tool use. ", "Damage to these areas typically results in different forms of apraxia [@pone.0038506-Goldenberg1]. ", "Therefore, we think that the use of highly complex actions for MI, often involving some form of object manipulation, may have driven the inferior parietal activity in the present study.", "\n\nActivation in the left postcentral gyrus may be related to the internal simulation of the tactile and haptic aspects of the imagined actions, since it has been shown that motor imagery as well as action observation can activate somatosensory cortices [@pone.0038506-Gazzola1]--[@pone.0038506-Wolbers1]. ", "While the exact function of the rolandic operculum for MI is unclear, it has been observed during MI of hand movements before [@pone.0038506-KuhtzBuschbeck1].", "\n\nInterestingly, most of the brain regions listed above have been implicated in overt bimanual tasks as well. ", "For instance, Puttemans et al. [", "@pone.0038506-Puttemans1] identified, among other areas, the SMA, dorsal premotor cortex, rolandic operculum, and the postcentral and supramarginal gyri as associated with bimanual task performance or bimanual task learning [@pone.0038506-Swinnen1].", "\n\nTaken together, the activation of predominantly premotor and parietal areas is consistent with the assumed functionality of these areas for overt movement, including bimanual movements. ", "In addition, these areas form part of the human mirror neuron system [@pone.0038506-Gazzola1] and have frequently been reported in various types of MI. ", "Thus, the present findings confirm that MI of everyday movements relies on a comparable network of brain areas as MI and overt movement of more simple laboratory tasks [@pone.0038506-Szameitat2]. ", "This finding is important, because the presently identified areas served as basis for the connectivity analysis presented next.", "\n\nFunctional Connectivity of Bimanual MI {#s3c}\n--------------------------------------\n\nThe present study is the first to test for the neural correlates of bimanual coordination demands in MI. ", "While there was no bimanual-specific activation of motor areas, the data revealed that MI of bimanual actions increased inter- and intrahemispheric functional connectivity. ", "In particular, the right supramarginal gyrus showed greater connectivity with the (ipsilateral) right superior frontal and angular gyrus, and with the (contralateral) left SMA and left post- and precentral gyrus. ", "In addition, the right superior frontal gyrus showed increased connectivity with the (ipsilateral) right supramarginal and angular gyrus, and with the (contralateral) left SMA, post- and precentral gyrus, and left rolandic operculum. ", "Taken together, all three seed regions in the right hemisphere increased their connectivity between each other. ", "In addition, two of the seed regions in the right hemisphere (superior frontal gyrus and supramarginal gyrus) increased the connectivity to virtually all seed regions of the contralateral hemisphere. ", "The seed regions in the left hemisphere, however, showed no increases in connectivity among each other.", "\n\nWe believe that this pattern is best explained by two rather independent effects, increased interhemispheric information exchange and left-hand proficiency, which are discussed in detail below.", "\n\n### Interhemispheric information exchange {#s3c1}\n\nThe increased connectivity between the hemispheres most likely reflects the demands of coordinating the action of both hands. ", "The everyday actions we used required not only simultaneous use of both hands, but also fine-grained interactions between the hands. ", "A prototypical example of this is tying shoelaces [@pone.0038506-Swinnen1] in which each single movement of a hand does not make sense without the concurrent movement of the other hand. ", "This strong interdependency of the movements of the hands requires communication between the motor systems controlling each hand [@pone.0038506-Guiard1], [@pone.0038506-Debaere2], [@pone.0038506-Stephan2]. ", "We propose that the increase in interhemispheric connectivity reflects this increased information exchange [@pone.0038506-Sun1], [@pone.0038506-Andres1], [@pone.0038506-Gerloff1]. ", "In more detail, for bimanual actions connectivity increased between the right supramarginal gyrus and the left pre- and postcentral gyrus and the left SMA. ", "Complex actions are often realized by an interplay of parietal and premotor areas in one hemisphere [@pone.0038506-Cabeza1]. ", "Our findings show that this interplay becomes interhemispheric in the case of bimanual actions. ", "The most likely interpretation of this finding is that left hemispheric premotor areas employ information represented in the right supramarginal gyrus to plan the right hand movement. ", "In addition, the right supramarginal gyrus showed increased connectivity with the left postcentral gyrus. ", "In which way the somatosensory information of the left hemisphere and the motor planning information of the right hemisphere interact is unclear. ", "It might be conceivable, however, that the motor planning processes in the right supramarginal gyrus, which require positional information of the right hand [@pone.0038506-Guiard1], influence somatosensory processing in the left postcentral gyrus. ", "Absence of the reverse pattern, i.e. left supramarginal gyrus connected with right somatosensory cortex, may be due to the fact that all our participants were right handed and that left hand imagery was less vivid (lower QoI score), which may have resulted in insufficient activity in the right somatosensory cortex [@pone.0038506-OlivettiBelardinelli1], [@pone.0038506-Lorey1].", "\n\nAs the second seed region, the right superior frontal gyrus showed increased connectivity with contralateral areas, i.e. the left SMA, the left rolandic operculum, and the left pre- and postcentral gyrus. ", "This pattern is virtually identical to the right supramarginal gyrus, with the exception that the rolandic operculum is also involved. ", "Accordingly, these results lend further support to our hypothesis that complex actions rely on an interplay of ipsilateral premotor and parietal areas, and that this interplay spans both hemispheres in the case of bimanual actions.", "\n\n### Left-hand proficiency {#s3c2}\n\nThe second, in our view rather independent, effect is the increase of connectivity within the right hemisphere, i.e. between right superior frontal gyrus, right supramarginal gyrus, and right angular gyrus. ", "One reason for this finding may be that the proficiency of left hand movement in the context of left hand actions and bimanual actions is different in right-handed participants [@pone.0038506-Gao1]. ", "In our experiment unimanual left hand imagery comprised tasks that are typically performed with the dominant (right) hand (e.g. writing) and therefore required the imagery of relatively unfamiliar movements. ", "The bimanual actions, however, were actions most participants did frequently and the left-hand element in these tasks was well practiced (e.g. tying shoelaces). ", "We therefore speculate that the higher proficiency of the left hand component in bimanual movements resulted in a more vivid imagery and hence a better internal simulation of the motor act [@pone.0038506-OlivettiBelardinelli1], [@pone.0038506-Lorey1]. ", "The latter may explain why the cortical areas coordinating left hand action show increased connectivity in the bimanual condition [@pone.0038506-Gao1].", "\n\nAn alternative explanation for the increased connectivity in the right hemisphere might be found in studies indicating that in particular the non-dominant hemisphere (i.e., the right-hemisphere in the present study) is involved in the overt execution of bimanual movements [@pone.0038506-Halsband1], [@pone.0038506-vandenBerg1]. ", "Interestingly, this suggestion has been derived based on the effects of lesions [@pone.0038506-Halsband1] or disruptive TMS [@pone.0038506-vandenBerg1] on bimanual motor performance and is therefore compatible with our argument that the demands of bimanual coordination may be reflected mainly by increased connectivity rather than distinct activation patterns.", "\n\nPrevious Evidence on Connectivity of Overt Bimanual Movements {#s3d}\n-------------------------------------------------------------\n\nAs there are no studies on the connectivity of bimanual MI, we discuss studies using overt bimanual movements. ", "Sun et al., (", "2007) compared a bimanual task to a resting baseline and observed a network only partially overlapping with the presently observed activations, consisting of primary sensorimotor cortices, dorsal premotor cortices, dorsal prefrontal cortices, intraparietal sulci, SMA, cingulate motor area, and cuneus. ", "When compared to a resting baseline, the bimanual condition resulted in increased connectivity between a number of areas. ", "In particular, the dorsal premotor cortex showed increased connectivity with the respective other, contralateral dorsal premotor cortex, the ipsilateral SMA, bilateral sensorimotor cortices, and the posterior parietal cortex. ", "Further seed regions in the sensorimotor cortex, the SMA, and the intraparietal sulcus also showed increased inter- and intrahemispheric connectivity. ", "Thus, while there are differences in the exact components involved in the cortical network controlling bimanual actions, Sun and colleagues also observed increased connectivity between premotor and (superior) parietal areas within and between hemispheres.", "\n\nThere are a number of factors that could explain the differences in findings between our and Sun et al's study [@pone.0038506-Sun1], most notably the fact that we used MI while Sun et al. ", "used overt movements. ", "Overt and imagined movements rely on an overlapping network, however, clear differences have been noted as well [@pone.0038506-Gerardin1], [@pone.0038506-Macuga1]. ", "Moreover, in Sun et al.", "'s study the bimanual condition was compared to a rest condition and to another bimanual condition. ", "For the comparison with rest, it cannot be ruled out that the same changes in connectivity would have been observed with a unimanual task. ", "Therefore, our results, which were derived by comparison with unimanual conditions, extend the previous knowledge by showing changes in connectivity unequivocally associated with bimanual MI. ", "Finally, the task employed by Sun et al. ", "required no simultaneous bimanual action, but a pattern of alternating button presses (one hand after the other). ", "While the effect of this difference in tasks on the pattern of connectivity is presently unclear, it is interesting to note that the exact amount of temporal overlap of two actions can profoundly influence the processing demands associated with a task [@pone.0038506-Pashler1]--[@pone.0038506-Szameitat4].", "\n\nA further study investigating connectivity in overt bimanual movements was conducted by Grefkes et al. [", "@pone.0038506-Grefkes1]. ", "In this study, participants had to make fist movements with the left, right, or both hands, and connectivity changes were assessed between 6 ROIs (SMA, premotor cortex, and primary motor cortex of each hemisphere, respectively) using DCM. ", "First, it is interesting to note that Grefkes et al. ", "also found only weak evidence for increased neural processing during bimanual as compared to unimanual performance. ", "A comparison of bimanual with unimanual tasks revealed, however, profound changes in functional connectivity. ", "In particular, connectivity increased intra- and interhemispherically between the SMA and primary motor cortex, while the premotor cortex showed only intrahemispheric increases with SMA and primary motor cortex. ", "The parallel between the two studies is the finding of increased connectivity between the right premotor cortex and the left SMA. ", "While the premotor cortices did not show interhemispheric connectivity changes in Grefkes et al., ", "they did so in the present study. ", "This discrepancy may be due to the different modalities of motor stimulation (imagery vs execution). ", "Alternatively, the bimanual movements employed by us (e.g. tying shoelaces) required much stronger interlimb coordination than the movements used by Grefkes et al., ", "i.e. fist making, [@pone.0038506-Swinnen1], which may have resulted in increased demands on interhemispheric coordination. ", "On a broader level, however, the results of Grefkes et al. ", "and the present study converge in that both show that the demands of bimanual coordination are met by inter- and intrahemispheric changes in connectivity and not by changes in activation level.", "\n\nClinical Aspects {#s3e}\n----------------\n\nThe current findings are relevant for the rehabilitation of patients suffering from motor deficits in at least three aspects. ", "First, some patients' residual movement abilities are too poor to permit standard rehabilitation. ", "For such patients, MI may be a way to initiate recovery, at least to a level at which standard approaches with overt movement are possible [@pone.0038506-Ertelt1]--[@pone.0038506-Garrison1]. ", "However, for MI to be most effective a vivid mental image is required, which may be easier to generate when everyday actions are used which have been performed numerous times before the brain damage occurred [@pone.0038506-Olsson1], [@pone.0038506-Toussaint1]. ", "For instance, Fourkas et al. [", "@pone.0038506-Fourkas1] demonstrated that during kinesthetic motor imagery corticospinal facilitation was present only in experts imagining the movement of their expertise. ", "Critically, the present results show that MI of everyday actions not only engages the premotor system in terms of activation, but highlight that bimanual MI also increases the functional connectivity between premotor areas.", "\n\nThis finding of increased connectivity in bimanual MI is perfectly in line with the observation that bimanual rehabilitation procedures can be more beneficial for recovery than unimanual procedures [@pone.0038506-Cauraugh1]--[@pone.0038506-Renner1], presumably because the affected motor system is facilitated (or disinhibited) by the intact motor system [@pone.0038506-Stinear2], [@pone.0038506-Woldag1]. ", "At the same time, recent evidence suggests a positive association between connectivity and recovery [@pone.0038506-Grefkes1], [@pone.0038506-Sharma2]. ", "Although it is presently unclear whether loss of connectivity limits motor recovery or, alternatively, improving motor recovery increases connectivity, it seems promising, given the present results, to develop a training regime based on MI which explicitly aims for improving the connectivity between areas, e.g. based on bimanual training.", "\n\nOur finding of additional increases of connectivity beyond the ones observed during unimanual MI might further suggest that.bimanual MI is a more effective form of covert movement for rehabilitation. ", "In more detail, the performance of unimanual MI resulted in increased connectivity between several areas involved in MI. ", "Thereby the connectivity changes during bimanual MI were quite distinct from those observed for unimanual MI, i.e. they were between different pairs of seed regions. ", "This dissociation is in line with our suggestion that bimanual coordination requires additional processes not demanded during unimanual MI. ", "It is an intriguing question for future research whether this additional connectivity causally improves motor rehabilitation.", "\n\nThe present results were based on investigating healthy participants and should be confirmed in neurological patients [@pone.0038506-Stinear3]. ", "In addition, one should be aware that certain brain areas, such as specific parts of the parietal cortex, need to be intact to ensure that patients can properly perform MI [@pone.0038506-Fleming1], [@pone.0038506-Sirigu1]. ", "However, these rather minor limitations should not disregard the clinical potential of using bimanual MI in motor rehabilitation.", "\n\nMaterials and Methods {#s4}\n=====================\n\nEthics Statement {#s4a}\n----------------\n\nPrior to scanning, written informed consent was obtained. ", "The protocol was approved by the University of Surrey ethical review board.", "\n\nParticipants {#s4b}\n------------\n\n17 neurologically healthy participants (6 male), aged 19 to 31 years (mean 22), took part in the experiment. ", "All participants were right handed with a mean handedness score of 82, range 53--100, as assessed with the Edinburgh Inventory [@pone.0038506-Oldfield1]. ", "Participants received £ 15 for participation.", "\n\nTask and Procedure {#s4c}\n------------------\n\nWhile lying in the MRI-scanner, participants viewed a projection screen via a mirror attached to the head coil with a distance of approximately 2--5 cm to the eyes. ", "The display was back-projected onto a 60cm-diameter screen situated approximately 30--40 cm away from the mirror.", "\n\nThe paradigm comprised five conditions, B[iman]{.smallcaps}, S[imple]{.smallcaps}-L, S[imple]{.smallcaps}-R, C[omplex]{.smallcaps}-L, C[omplex]{.smallcaps}-R, and B[aseline]{.smallcaps}. ", "Except for B[aseline]{.smallcaps}, each condition was repeated seven times. ", "The experiment used a block design consisting of 35 one-minute cycles. ", "Each cycle embodied an instruction and preparation period (12 s), an imagination period (24 s), and a resting baseline period (B[aseline]{.smallcaps}, 24 s) ([Figure 3](#pone-0038506-g003){ref-type=\"fig\"}). ", "To optimize BOLD signal recovery the unimanual imagery conditions were presented in two basic patterns alternating hand and complexity, i.e.: S[imple]{.smallcaps}-L, C[omplex]{.smallcaps}-R, S[imple]{.smallcaps}-L, C[omplex]{.smallcaps}-R, and so forth and S[imple]{.smallcaps}-R, C[omplex]{.smallcaps}-L, S[imple]{.smallcaps}-R, C[omplex]{.smallcaps}-L, and so forth. ", "The randomization pattern was switched after every B[iman]{.smallcaps} condition, which was presented randomly every third to fifth cycle. ", "The experiment was split in two runs of 18 min (18 cycles) and 17 min (17 cycles) respectively.", "\n\n{#pone-0038506-g003}\n\nIn the instruction period the movement to be imagined next was presented on a screen using black letters on white background. ", "Participants were instructed to use this period to prepare the imagination by setting up an action plan. ", "Commencement of the imagination period was indicated by the screen turning black. ", "Participants were asked to close their eyes to perform the imagination. ", "Participants were instructed to open the eyes again when the screen turned white, which, due to the intense change in luminance, was easy to recognize through the closed eye lids. ", "The imagination period was followed by a baseline period (B[aseline]{.smallcaps}), during which participants had to fixate a cross on the screen. ", "After this baseline period, the next cycle started with the instruction and preparation period.", "\n\nTo test for potential movements during motor imagery, participants held two custom made force sensitive grips in their hands [@pone.0038506-Hou1] which acquired data continuously throughout all conditions with a 250 Hz sampling rate. ", "The grips are highly sensitive to force changes and are able to detect force variations not visible by visual inspection. ", "Typically, participants held the grip so that thumb and fingers were opposed and force variations were identified for all five fingers. ", "However, during the session some participants may have changed the way they held the grip so that force variations of the thumb may have stayed undetected. ", "While it could be argued that holding the grips is in itself a motor act and, therefore, may interfere with the vivid generation of kinesthetic MI, we think that this is unlikely to affect our results for two reasons. ", "Firstly, participants held the grip loosely, resting their hands on the scanner bed and gently closing their hands around the grip. ", "Secondly, it seems plausible to assume that MI performance would be affected in all MI conditions. ", "We therefore argue that any bias induced by holding the grips would be constant across conditions and hence would not confound differential effects between conditions.", "\n\nParticipants were instructed to imagine the movements in a kinesthetic first person perspective, i.e. they were asked to imagine performing the movement by themselves, rather than watching themselves or others performing the movement [@pone.0038506-Stinear1], [@pone.0038506-Solodkin1]. ", "The instruction further emphasized that the imagination should be \"action loaded\", i.e. participants should perform the imagined movement with high frequency and engage intensely. ", "Participants were instructed to actively imagine throughout the imagination period and, if a movement finished early, to start over with the same movement until the imagination period finished.", "\n\nThe movements of the B[iman]{.smallcaps} condition were (1) Tie shoelaces, (2) Button a shirt or blouse, (3) Fold a letter and put in an envelope, (4) Fold laundry, (5) Tear paper apart, (6) Pull up socks, (7) Dry your back using a towel. ", "The simple unimanual movements (S[imple]{.smallcaps}-L and -R) were (1) Scratch your nose (2) Use a light switch (turn light on and off) (3) Open cupboard door (left/right door if performed with left/right hand, respectively), (4) Drink glass of water placed on a table, (5) Press a button (e.g. in a lift), (6) Turn round knob (e.g. volume control at HiFi), (7) Hang your coat on a hook. ", "The complex unimanual movements (C[omplex]{.smallcaps}-L and -R) were (1) Write on a piece of paper using a pen, (2) Brush your teeth, (3) Use a computer mouse, (4) Eat soup or cereals using a spoon, (5) Throw something (in the trash bin/darts), (6) Lock/unlock a door using a key, (7) Shake hands.", "\n\nTo assess the difficulty of the movements, participants rated the perceived difficulty for each movement when performed with the left and right hand, respectively, using a scale ranging from 1 (\"very easy\") to 5 (\"very hard\"). ", "This rating took place before the experiment and asked the participants to rate how difficult it would be to overtly perform the respective movements. ", "We tested for significant differences between conditions using non-parametric Wilcoxon tests. ", "Retrospectively an independent sample of 17 participants completed an adapted version of this questionnaire which included items relating to difficulty of bimanual actions as we did not test this particular aspect prior to the study. ", "There were no significant differences between the original study group and the independent set of participants regarding the estimated difficulty of the four unimanual conditions (Mann-Whitney U test; all Z\\<1.560; all p\\>.193). ", "Accordingly, we treated the estimated difficulty of the B[iman]{.smallcaps} condition derived from the independent sample as representative for the study sample. ", "All comparisons between bimanual and unimanual conditions employed the independent-samples Mann-Whitney U test.", "\n\nVividness of the imagery was assessed through a short questionnaire completed immediately after the MRI scanning, which measured the subjective quality of the imagination (QoI) during the experiment on a scale from 1 (\"bad/hard to imagine\") to 7 (\"perfect/very vivid & lively imagination\").", "\n\nMRI Procedure {#s4d}\n-------------\n\nImaging was carried out at the Royal Holloway University London, UK, using a 3T scanner (Trio, Siemens, Erlangen, Germany) equipped with an array head coil. ", "Participants were supine on the scanner bed, and cushions were used to reduce head motion. ", "36 axial slices (192×192 mm field of view (FOV), 64×64 matrix, 3×3 mm in-plane resolution, 4 mm thickness, no gap, interleaved slice acquisition) were acquired using a BOLD sensitive gradient echo EPI sequence (TR 2 s, TE 30 ms, 90° flip angle). ", "Two functional runs, the first with 540 and the second with 510 volumes were administered, with each volume sampling all 36 slices. ", "In the same session, high-resolution whole brain images were acquired using a T1-weighted MPRAGE sequence (TR 1830 ms, TE 4.43 ms, 11° flip angle, 176 slices, 256×256 mm FOV, 1×1×1 mm voxel size).", "\n\nData Analysis {#s4e}\n-------------\n\n### Preprocessing {#s4e1}\n\nThe data were analyzed using the SPM2 software package (<http://www.fil.ion.ucl.ac.uk/spm/software/spm2/>). ", "In a first step, the origin of the functional images was manually set to the anterior commissure and all images were reoriented. ", "To correct for movements, all functional volumes were spatially realigned to the first functional volume. ", "In the same processing step (\"Realign & Unwarp\" in SPM2), signal changes due to head motion and magnetic field inhomogenities were corrected [@pone.0038506-Andersson1]. ", "Next, the normalization was performed. ", "For this, first the anatomical and functional images were co-registered, then the anatomical image was normalized into a standard stereotaxic space using the T1 template provided by the Montreal Neurological Institute (MNI) delivered with SPM, and finally the transformation parameters derived from this transformation were applied to the functional images. ", "Functional data were spatially smoothed using a Gaussian kernel with a FWHM of 8 mm.", "\n\nStatistics {#s4f}\n----------\n\n### Univariate approach {#s4f1}\n\nStatistical analysis was based on a voxelwise least squares estimation using the general linear model for serially autocorrelated observations [@pone.0038506-Friston1], [@pone.0038506-Friston3]. ", "All conditions (including B[aseline]{.smallcaps}) were modeled using the standard hemodynamic response function implemented in SPM2. ", "Low-frequency signal drifts were controlled for by applying a temporal highpass filter with a cutoff frequency of 1/300 Hz. ", "To test for imagery related activation individual contrast maps were calculated for the comparison I[magery]{.smallcaps} -- B[aseline]{.smallcaps} (i.e. ((C[omplex]{.smallcaps}-L + C[omplex]{.smallcaps}-R + S[imple]{.smallcaps}-L + S[imple]{.smallcaps}-R + B[iman]{.smallcaps})/5) -- B[aseline]{.smallcaps}). ", "To test for activations specific to MI of bimanual actions we considered our design as a 2×2 factorial design with the factors MI of right hand (levels present/absent) and MI of left hand (levels present/absent) [@pone.0038506-Szameitat1]. ", "Both hands absent reflects the resting baseline (B[aseline]{.smallcaps}), only left or right hand present reflect the two unimanual conditions, and both hands present reflects the B[iman]{.smallcaps} condition. ", "This design enables to test for overadditive activation in B[iman]{.smallcaps} which cannot be reduced to the summed activations of the two unimanual conditions by the interaction contrast \\[(B[iman]{.smallcaps} -- U[ni]{.smallcaps}-R) -- (U[ni]{.smallcaps}-L -- B[aseline]{.smallcaps})\\], with U[ni]{.smallcaps}-R  =  (S[imple]{.smallcaps}-R + C[omplex]{.smallcaps}-R)/2 and U[ni]{.smallcaps}-L  =  (S[imple]{.smallcaps}-L + C[omplex]{.smallcaps}-L)/2. ", "Resolving the brackets results in the comparison (B[iman]{.smallcaps} + B[aseline]{.smallcaps} -- U[ni]{.smallcaps}-R -- U[ni]{.smallcaps}-L). ", "The second-level analysis consisted of random-effects paired t-tests with p value threshold set to p\\<.05 (FWE corrected for multiple comparisons). ", "Anatomical locations were determined using the Anatomy toolbox version 1.6 [@pone.0038506-Eickhoff1].", "\n\n### Multivariate connectivity analysis {#s4f2}\n\nA multi psychophysiologic interaction (mPPI) protocol was implemented using the process of signal deconvolution embedded in SPM2 [@pone.0038506-Friston2]. ", "Firstly, we identified seed regions of interest based on the peak activations of clusters derived from the second-level contrast I[magery]{.smallcaps} -- B[aseline]{.smallcaps} of the univariate approach (*p*\\<0.05, FWE). ", "For each subject, the largest effect of this contrast (individual SPMs generated at *p*\\<0.001, uncorrected) was found within a four millimeter radius of the coordinate derived from the second level effect, and this new coordinate became the individual\\'s seed for that region. ", "The first eigenvariables were calculated for each individual seed (sphere with 4mm radius to maintain signal specificity, Gonçalves & Hall, 2003) and constituted the physiological component. ", "The psychological component was modeled as a B[iman]{.smallcaps} \\> U[niman]{.smallcaps} (averaged across S[imple]{.smallcaps} and C[omplex]{.smallcaps} unimanual tasks) contrast. ", "The design matrix composed four regressors per session. ", "The interaction between the psychological component and the physiological component was used as the regressor of interest. ", "Additionally, both the psychological and physiological components were input as regressors of no interest. ", "The fourth regressor constituted the error term. ", "The contrast of the effect of the PPI was calculated for each subject. ", "Each of the subject-specific contrasts, for each ROI, was subjected to a second level analysis in which one-sample t tests were calculated. ", "Therefore, each seed region yielded one second level set of results. ", "A mask image was created which included all voxels within 8mm of a seed voxel. ", "Statistical Parametric Maps (SPMs) were calculated within these mask regions and corrected accordingly using the SPM2 small volume correction tool (p\\<.05, FWE).", "\n\nWe thank Ari Lingeswaran for assistance in data acquisition.", "\n\n**Competing Interests:**The authors have declared that no competing interests exist.", "\n\n**Funding:**This study was funded by the Medical Research Council, UK (CEG 61501; Dr Sterr). ", "The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.", "\n\n[^1]: Conceived and designed the experiments: AJS AS. ", "Performed the experiments: AJS SS. ", "Analyzed the data: AJS AM. ", "Contributed reagents/materials/analysis tools: AM. ", "Wrote the paper: AJS AM AS.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.0008030992466956377, 0.0009622932993806899, 0.0005486525478772819, 0.0005425595445558429, 0.0006061895401217043, 0.0008607259951531887, 0.0005655375425703824, 0.0008469642489217222, 0.000641142891254276, 0.0006598579348064959, 0.0005994398961775005, 0.0006602171342819929, 0.0005652175168506801, 0.0005314977606758475, 0.0006579853361472487, 0.0005671210237778723, 0.0005682177725248039, 0.000628177251201123, 0.0006691224407404661, 0.0008831841987557709, 0.0006276697968132794, 0.0007860624464228749, 0.0005665040807798505, 0.0005942955031059682, 0.0006395317614078522, 0.000538256426807493, 0.0006570011610165238, 0.0005954124499112368, 0.0006127067608758807, 0.0005515589728020132, 0.0006022343877702951, 0.0006684461841359735, 0.0006153909489512444, 0.0005867673899047077, 0.0005625176709145308, 0.000591140182223171, 0.0005740686901845038, 0.0005879942327737808, 0.0007272903458215296, 0.0006513982661999762, 0.0006229669088497758, 0.0008479368407279253, 0.000639794219750911, 0.0005953366635367274, 0.0005890954053029418, 0.0007692566723562777, 0.0007074092864058912, 0.0007964168325997889, 0.0006862237933091819, 0.0006962426123209298, 0.0019055769080296159, 0.0006199913914315403, 0.0005634903209283948, 0.000680387718603015, 0.0005654133856296539, 0.0005509817274287343, 0.0006719899247400463, 0.0005469347815960646, 0.0006026604678481817, 0.000848184572532773, 0.0006124699721112847, 0.0007930384599603713, 0.0005515684024430811, 0.0006317559164017439, 0.0006087514339014888, 0.000636075739748776, 0.0005323901423253119, 0.0007706169271841645, 0.0006448280182667077, 0.0005703896749764681, 0.0006457034032791853, 0.0006624082452617586, 0.0006309875170700252, 0.009818894788622856, 0.0005728504038415849, 0.0019055769080296159, 0.0007514602621085942, 0.000622649968136102, 0.0011870899470523, 0.0012735376367345452, 0.002288747113198042, 0.000620492675807327, 0.0006426410982385278, 0.0009552033734507859, 0.001259061973541975, 0.0005777546321041882, 0.0005721639026887715, 0.0017716046422719955, 0.0013487732503563166, 0.0005997862317599356, 0.0006367089226841927, 0.0005771629512310028, 0.000612632546108216, 0.0024150547105818987, 0.0028473103884607553, 0.0007581540266983211, 0.0006868407945148647, 0.0012735376367345452, 0.07502526789903641, 0.0006426410982385278, 0.0009552033734507859, 0.0006827660254202783, 0.0005766070680692792, 0.0006405733292922378, 0.0012630935525521636, 0.0007533069001510739, 0.0006773087661713362, 0.0007217670208774507, 0.000562660803552717, 0.0008620026637800038, 0.0008912672637961805, 0.0010736288968473673, 0.000563231180422008, 0.0006838665576651692, 0.0007139806402847171, 0.0005912956548854709, 0.000630867900326848, 0.0006505309138447046, 0.000587605987675488, 0.0006074520642869174, 0.024103209376335144, 0.0008567051845602691, 0.00113919738214463, 0.0006990889669395983, 0.009559670463204384, 0.0007615162758156657, 0.0007914036978036165, 0.0006162951467558742, 0.0008362389635294676, 0.0005974703235551715, 0.0006551844417117536, 0.0008119731210172176, 0.0005241787293925881, 0.0007026055245660245, 0.000707710103597492, 0.030530061572790146, 0.009651096537709236, 0.0005430543678812683, 0.0013016924494877458, 0.0005722743808291852, 0.0005255387513898313, 0.0005832495517097414, 0.0005948494654148817, 0.0006701869424432516, 0.0007103951065801084, 0.0006117987213656306, 0.01168203167617321, 0.0006509849918074906, 0.0006405290332622826, 0.0011235099518671632, 0.08520343899726868, 0.0006447284249588847, 0.011720290407538414, 0.010037191212177277, 0.005944148171693087, 0.0050120484083890915, 0.0007499965722672641, 0.00543389655649662, 0.0007042874931357801, 0.0006607197574339807, 0.0006423150189220905, 0.0006862966693006456, 0.0007562062237411737, 0.0006011947407387197, 0.0005974663654342294, 0.0006906968192197382, 0.0006145518855191767, 0.000887823523953557, 0.0005393667379394174, 0.0006887915078550577, 0.0008125837775878608, 0.0007507645641453564, 0.0005746250972151756, 0.000772657513152808, 0.0006085507338866591, 0.0006518103182315826, 0.0008464834536425769, 0.0005562837468460202, 0.0006380952545441687, 0.0006022820598445833, 0.0007480818312615156, 0.0005686284857802093, 0.0005613642279058695, 0.0010082070948556066, 0.0006381076527759433, 0.0006455621914938092, 0.0006211349973455071, 0.0006073959521017969, 0.0006713587208651006, 0.0005698579479940236, 0.0006628129631280899, 0.0006106438231654465, 0.0006957689765840769, 0.0006106773507781327, 0.0006857729167677462, 0.0005788164562545717, 0.0006031816592440009, 0.0007624148856848478, 0.0010170363821089268, 0.000601431354880333, 0.0012060990557074547, 0.0006001736037433147, 0.0007409252575598657, 0.0006599872140213847, 0.0007084817625582218, 0.0005817128112539649, 0.0005565968458540738, 0.0005865753046236932, 0.0005241832113824785, 0.0006330382893793285, 0.0007714508683420718, 0.0005411489983089268, 0.0005552652874030173, 0.0008981199353002012, 0.0006706115673296154, 0.0006388667970895767, 0.0005401152884587646, 0.0006411911454051733, 0.0009419377893209457, 0.0005498818354681134, 0.0007035385351628065, 0.0006874717073515058, 0.0007303530001081526, 0.0007047470426186919, 0.0006656020996160805, 0.0005725184455513954, 0.0007206281297840178, 0.0006273342878557742, 0.0006458754651248455, 0.0019055769080296159, 0.000682503217831254, 0.0005160904838703573, 0.000779774272814393, 0.0008482941193506122, 0.0005874116905033588, 0.000634905241895467, 0.0005608962965197861, 0.0005650421953760087, 0.0006323737325146794, 0.0006507408106699586, 0.000568326679058373, 0.0006247756537050009, 0.000674903450999409, 0.0006044169422239065, 0.0006473942776210606, 0.0005607038037851453, 0.0005517532117664814, 0.0005137103726156056, 0.02184007503092289, 0.0018733659526333213, 0.008018635213375092, 0.0005593893583863974, 0.0005569322383962572, 0.0005453792400658131, 0.0005502970889210701, 0.0005957785760983825, 0.0005468935705721378, 0.0006672018789686263, 0.0005393811734393239, 0.000575460959225893, 0.0014431263552978635, 0.0006100818864069879, 0.0005908216116949916, 0.0006203463417477906, 0.0006586535018868744, 0.0005456985672935843, 0.0005519462865777314, 0.0005818706122227013, 0.0006164176156744361, 0.0005518108373507857, 0.0006973592098802328, 0.0007092715241014957, 0.0006896243430674076, 0.0008129273192025721, 0.0006522499606944621, 0.0006641782238148153, 0.0006384733133018017, 0.0015464246971532702, 0.000866943271830678, 0.0005972955259494483, 0.0006045218324288726, 0.0006636283942498267, 0.0005691408296115696, 0.000688514206558466, 0.0005796838086098433, 0.000841862172819674, 0.0005973040242679417, 0.0006084197084419429, 0.0006065550842322409, 0.0007107302662916481, 0.0006273470935411751, 0.0005773907178081572, 0.0005909232422709465, 0.0007143254042603076, 0.0006207748665474355, 0.0005409739096648991, 0.0006150376866571605, 0.0005671210237778723, 0.0006049359799362719, 0.0006836343090981245, 0.0007533994503319263, 0.0006384513690136373, 0.000636099954135716, 0.0008110810886137187, 0.001995444530621171 ]

[ "The mission of the Los Alamos Public Schools Foundation is to enrich the educational experience of our students through community investment\n\nThe school children of Los Alamos are our future. ", "A quality education prepares our children to meet the demands of an increasingly complex workplace and world.", "\n\nAs an independent organization, the Los Alamos Public Schools Foundation supports, challenges and invests in a successful future for all LAPS students.", "\n\nLos Alamos Public Schools is a Other organizationEnrollment: 3614No. ", "of Schools: 7\n\nFor More Information\n\nTo view this employer's contact or application information you must be a registered job seeker with Education America. ", "If you are already a registered member log in below.", "\nIf you are not yet registered with Education America click here.", "\n\nAny logos and trademarks of Los Alamos Public Schools are copyright Los Alamos Public Schools .", "\nEducation America does not take responsibility for the validity of any information provided by Los Alamos Public Schools . ", "Individuals\nshould refer to the organization for clarification and confirmation. ", "Information provided\ndirectly from Los Alamos Public Schools will take precedence over any information provided on this site." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006497233407571912, 0.0007145702256821096, 0.0006218093330971897, 0.0007838337915018201, 0.0005599448923021555, 0.000629710906650871, 0.0006826941389590502, 0.000646520871669054, 0.0006461885059252381, 0.000505175965372473, 0.0005550951464101672 ]

[ "\n\n\n\n\n\n\n\nIf Your Circle Stays Unbroken\n\nThen You’re a Lucky Man\n\n‘Cause it Never, Never, Never has for me\n\nNo words spoken by Ronnie James Dio rang truer than the lyrics to “Invisible.” ", "Heartfelt and honest, the statement finds Dio reflecting on the past while in the midst of reinvention. ", "His story is one of broken dreams and unimaginable triumphs. ", "In the end, Dio emerged a legend whose legacy continues to strengthen after his death.", "\n\nDio was no stranger to change. ", "An elder statesman, Ronnie’s music career pre-dates the very existence of heavy rock. ", "In the absence of roaring Marshall stacks, he lent his golden pipes to the soothing sounds of Doo-Wop. ", "A confident crooner, Dio’s days with Ronnie and the Redcaps, and later Ronnie Dio and the Prophets, provide a stark contrast to his metal icon persona.", "\n\n\n\n\n\n\n\n\n\n\n\nSoon the sound of distorted guitars transformed the musical landscape. ", "Ronnie and the Redcaps morphed into The Electric Elves, before changing their name to The Elves, and later Elf. ", "Prophetic clips of Ronnie singing Sabbath are historically significant but Elf were primarily a creative force whose compositional talents earned them a recording contract.", "\n\nIt certainly helped that they had befriended Deep Purple. ", "Roger Glover and Ian Paice produced their album and often took the band out on tour. ", "As a frequent opening act, Elf gained valuable exposure playing to legions of devoted rock fans.", "\n\nThe musicians in Deep Purple were more than willing to tap into Elf’s talents when working on side projects. ", "Roger Glover’s rock opera, The Butterfly Ball and the Grasshopper’s Feast, was particularly ambitious. ", "Based on a 19th century children’s poem, notable vocalists were recruited to voice each character. ", "Dio was tapped to sing on the track, “Love is All.”", "\n\nReleased as a single, “Love is All,” became an international hit. ", "As part of the animated film, The Butterfly Ball, psychedelic cartoon animals danced across the screen as Dio sang of the transformative power of love. ", "The song became seared into the psyches of French children after frequent airings on national public television. ", "Children shows in the states also broadcasted the cheery video. “", "Love is All” even became a fixture on Australian TV.", "\n\nRitchie Blackmore also had aspirations beyond Deep Purple. ", "The man in black intended to record a solo album under the name Rainbow. ", "Recruiting the members of Elf to record his new project, Blackmore found a writing partner in Dio. ", "Not only was Ronnie’s voice the perfect foil to Blackmore’s dominate presence, Dio’s lyrical contributions helped shift the dynamic from solo record to genuine band.", "\n\n\n\n\n\n\n\n\n\nThese sessions resulted in Ritchie Blackmore’s Rainbow. ", "It was all in the name. ", "To many, the project WAS Blackmore’s band. ", "Promotional materials cemented this distinction. ", "Despite yielding a hit with “Man on the Silver Mountain” there was no supporting tour and many expected Rainbow to be a one-off album.", "\n\n\n\n\n\n\n\nRainbow did continue, but not without major changes. ", "Blackmore promptly fired the band with the exception of Dio. ", "Few could argue with the results. ", "The new rhythm section of Cozy Powell and Jimmy Bain had an immediate impact. ", "Immediately, the band sounded bigger with a complexity that was missing from the straight rock of Rainbow’s first record.", "\n\nKeyboardist Tony Carey took the transformation a step further. ", "A virtuoso that had played Bach during his audition, his notes weaved in and out of Blackmore’s fluid guitar lines. ", "Harmonizing, intersecting, even taunting, there seemed to be a friendly rivalry between two master musicians. ", "Rainbow was now a veritable super group of talent hand-selected by Blackmore.", "\n\nAt the center of it all stood Ronnie James Dio. ", "Few singers could command attention on stage with the greatest musicians in the rock universe. ", "His soaring voice and fantasy themed lyrics were the final touch in making the new incarnation of Rainbow a formidable force.", "\n\nRainbow Rising was released to critical acclaim in 1976. ", "Recognizing the collective efforts of each member, Ritchie Blackmore’s Rainbow was now simply Rainbow. ", "Inside the gatefold, Ronnie James Dio sat front and center, just as a singer should.", "\n\nRegardless of the simplified name, Blackmore still called the shots. ", "Despite the album’s massive success, Jimmy Bain and Tony Carey were soon dismissed from the group. ", "Dio would only last for another studio and live record. ", "As Blackmore steered Rainbow towards commercially viable sounds, Dio was left behind.", "\n\n\n\n\n\n\n\n\n\nElsewhere in the metal universe, Tony Iommi was also reeling from the collapse of a successful band. ", "With Ozzy Osbourne sacked from Sabbath, the future was all but certain. ", "After all, what singer could possibly fill the shoes of a personality as beloved as Ozzy? ", "Unsure of how to proceed, the esteemed guitarist had been considering starting a whole new band rather than replace the irreplaceable.", "\n\nIt was under the pretense of a new project that Iommi first reached out to Dio. ", "With Bill Ward and Geezer Butler in the mix, it only made sense to take the proposed partnership a step farther. ", "Ronnie James Dio was invited to a Black Sabbath rehearsal.", "\n\nAs sessions unfolded, the chemistry between musicians quickly became apparent. ", "After playing what would become “Children of the Sea,” Ronnie had an instant melody. ", "A long-dormant song from the final days with Ozzy suddenly lived again.", "\n\nNext came a snippet of “Lady Evil.” ", "Again, Dio immediately sprang into action with a fresh idea. ", "Tony, Geezer and Bill were sold. ", "Ronnie James Dio was the new singer of Black Sabbath!", "\n\nWith the help of Rainbow producer Martin Birch, Black Sabbath convened in the studio with Ronnie at the helm. ", "Heaven and Hell was still Sabbath, but a different Black Sabbath. ", "A new generation of fans were turned on to the band as hordes of the old faithful returned in droves. ", "Like Rainbow Rising before it, Heaven and Hell earned a reputation as a classic album. ", "Dio had struck gold twice!", "\n\nDespite their success, turmoil still threatened the band. ", "Bill Ward’s alcoholism had spiraled out of control. ", "Things had gotten so bad that Ward has no recollection of the Heaven and Hell sessions. ", "By all accounts, he played confidently and precisely in the studio. ", "It was the madness of life on the road that caused Ward to come undone.", "\n\nOn tour he snapped. ", "Hours before a concert Ward quietly left. ", "It was only after he was long gone that any contact with the band was made. ", "Bill was sick and needed to get better. ", "The gig was cancelled.", "\n\nWith a huge outdoor concert only days away, the band was in a quandary. ", "A new drummer would only have 36 hours to learn an entire set before performing in front of a festival crowd. ", "Scrambling for a last minute replacement, little-known drummer Vinny Appice was given the shot of a lifetime. ", "Appice pulled off the gig, earning him a permanent spot behind the drum kit. ", "It was this incarnation of Black Sabbath that would forever be associated with the Dio years.", "\n\nDio found more than a drummer in Appice. ", "Tony and Geezer had a long relationship dating back to their youthful days in Birmingham. ", "As the two “new guys,” Ronnie and Vinnie quickly bonded, forming a life-long friendship.", "\n\nWith Dio front and center, the mighty Black Sabbath managed to reinvent themselves and reclaim their rightful place at the top of the metal world. ", "Ronnie had found stability in the unstable music business. ", "Then, it all came crashing down.", "\n\nUnexplained studio problems plagued the Live Evil sessions. ", "Somehow, each morning, the mix sounded different than the day before. ", "Could Ronnie have been returning at night to tamper with the work of Tony and Geezer? ", "Some have suggested the possibility though it’s an accusation that Dio flatly denied. ", "Either way, things got ugly. ", "Both Dio and Appice were dismissed from the band.", "\n\nDazed but determined, Dio vowed to begin anew. ", "Rather than seek out another established act, the singer opted to form a band that was truly his own. ", "With Vinny Appice by his side, Ronnie began an exhaustive search for a new guitarist.", "\n\nEven with 50% of Black Sabbath as a starting point, building a professional band was no easy task. ", "Imagine playing with Ritchie Blackmore and Tony Iommi. ", "Scores of wanna-be guitar heroes paled in comparison during auditions. ", "To help find the right guitarist, Ronnie turned to his old Rainbow pal, Jimmy Bain.", "\n\nBain had kept himself busy since Rainbow. ", "There were countless projects, tours, and records made, most notably with Brian Robertson and Phil Lynott of Thin Lizzy. ", "Bain’s was an opinion Dio could trust. ", "Not only would Jimmy know what to look for in a guitar player, he’d likely have jammed with them at some point in his crazy adventures.", "\n\nBain actually suggested two guitarists, John Sykes and Sweet Savage guitarist Vivian Campbell. ", "Both were promising, but Dio was particularly impressed with the latter’s rehearsal tape. ", "Out of nowhere, Campbell would slip in a Chuck Berry riff amongst other eccentricities. ", "It was precisely the out-of-the-box thinking Ronnie was looking for. ", "Vivian was promptly flown out to join the band in Los Angeles.", "\n\nWhen Campbell arrived for auditions, Jimmy Bain tagged along unannounced. ", "With bass in hand, Bain set up, jammed, and joined the band. ", "A hybrid of past and present with a firm eye on the future, DIO was complete. ", "Ronnie set out to conquer the world yet again.", "\n\nNo mere session players, the carefully chosen musicians were given full reign to create. ", "Nine songs were born in the creative upswing of those early sessions. ", "With new mascot Murray appearing on the front cover, Holy Diver was released to critical acclaim. ", "Like Rainbow Rising and Heaven and Hell before it, Holy Diver quickly became a classic album.", "\n\nDio promptly hit the road for a U.S. tour. ", "Mixing classic Rainbow and Black Sabbath songs with new material, fans were ecstatic to witness a metal legend reborn. ", "The momentum continued as the band made its debut UK appearance at the legendary Monsters of Rock festival. ", "It was a pivotal moment as Ronnie stood before an endless sea of fans at Castle Donington. ", "Just a year before, he had been cast out from Black Sabbath. ", "Now, fronting his own band, the future burned bright for Ronnie James Dio.", "\n\nMore good fortune followed. ", "The Last in Line further validated Dio as a metal institution. ", "With another successful record and tour under their belts, extravagance of the highest order became possible. ", "No expense was spared as Dio built a stage set for the ages. ", "Amongst the lights and lasers, a giant dragon came to life in stunning detail. ", "Each night, Ronnie held forth his sword and attacked the beast as the band played on. ", "Epic and grand, a metal god 30 years in the making stood in his glory.", "\n\nA brilliant close-up of Ronnie slaying the dragon appeared on the next Dio record. ", "Released in tandem with a full-length VHS, the live EP Intermission documented the Sacred Heart tour. ", "Live versions of Dio songs were mixed with Rainbow classics, while a new studio recording kept a sense of forward momentum.", "\n\nThe photograph on the back cover revealed big changes. ", "Vivian Campbell was noticeably absent. ", "New guitarist Craig Goldy and keyboardist Claude Schnell flanked Ronnie. ", "At opposite ends, Vinny and Jimmy remained as proud links to a storied past.", "\n\nPolished and melodic, new song “Time to Burn” offered a glimpse at what to expect from the next incarnation of Dio. ", "Dream Evil followed with the distinction of being the only eighties LP to feature Goldy on guitar.", "\n\n\n\n\n\nLock Up The Wolves ushered in the 90’s with a complete overhaul of the band. ", "The new line-up was a mix of fresh new talent and seasoned professionals. ", "This latest incarnation would never have a chance to reach their potential. ", "Shortly after the album’s release, the unthinkable happened. ", "Ronnie James Dio found himself back in Black Sabbath.", "\n\nNews of the Sabbath reunion sent shockwaves through the metal world. ", "Dehumanizer was their first album together in a decade. ", "Fans dismayed with synth-heavy Black Sabbath rejoiced as Iommi reprised his role as metal’s ultimate riff master. ", "A relic from the golden age of heavy metal was reborn and met with unbridled enthusiasm.", "\n\nThe subsequent tour was well received in packed theatres across the world. ", "With bands like Danzig and Testament as touring support, Sabbath were undisputed kings in a metal scene that bore little resemblance to the early eighties. ", "There was every reason to expect that the newly rejuvenated Black Sabbath would continue. ", "Then, on tour, it all came crashing down again.", "\n\nAt issue were proposed concerts as the opening act for Ozzy Osbourne. ", "Naturally, the original Black Sabbath would be expected to reunite as an encore. ", "Without considering the awkward position of Ronnie, Sabbath accepted the invitation. ", "Dio promptly quit, understandably hurt. ", "Once again, the union of Ronnie James Dio and Black Sabbath ended on bad terms.", "\n\nSimply resurrecting the Dio band, it was business as usual. ", "With a fluid line-up of top-notch musicians, Dio released a series of albums that consistently lived up to his reputation. ", "From Strange Highways to Master of the Moon, Ronnie kept writing. ", "In the process, he created some of the most memorable albums of his long career.", "\n\n\n\n\n\n\n\n\n\n\n\nAlways one to embrace the past, Dio performed Holy Diver in its entirety before a sold out crowd in 2005. ", "As a special treat for fans, Ronnie pulled out deep Rainbow cuts like “Tarot Woman” and “Gates of Babylon” alongside revered Sabbath classics. ", "Released as a DVD, Holy Diver Live became the 6th home video to capture the spectacle of a Dio concert.", "\n\nIt’s funny how the stars align. ", "Just as Ronnie was celebrating past achievements, Rhino Records had been busy assembling a compilation of Sabbath’s Dio years. ", "It all began with a simple inquiry. ", "Did the band have any unfinished recordings they could release as bonus tracks? ", "They did not, but an idea was hatched. ", "Why not get-together and informally play music. ", "If it felt right, they’d record a few new songs.", "\n\nNaturally the initial spark that fueled Sabbath still burned. ", "Rather than the proposed two tracks, the old friends turned in three. ", "It was incredibly strong material that held up when paired with vintage classics.", "\n\nWith the classic line-up of Dio, Iommi, Butler and Appice making music again, a tour soon followed. ", "This time they reconvened, not as Black Sabbath, but as Heaven and Hell. ", "Beyond preventing confusion with the recently active Ozzy incarnation, the band was no longer bound to perform songs like “Paranoid” and “War Pigs.” ", "With a setlist drawing exclusively from the Dio years, the shows were a dream come true for metal fans.", "\n\nA triumphant show was filmed for prosperity at New York’s Madison Square Garden. ", "Ronnie’s voice sounded untouched by age. ", "The scream in “Mob Rules” came through loud and clear as if it were 1981. ", "The mighty Black Sabbath were back in all but name.", "\n\nInitially, the plan had been to simply tour. ", "With an overwhelming fan response and undeniable chemistry, writing sessions soon unfolded. ", "The result was The Devil You Know. ", "The first and only studio album released under the moniker Heaven and Hell, new classics like “Bible Black” were added to the growing repertoire of timeless metal perfection.", "\n\nIt was to be the best of both worlds. ", "There would be extensive touring behind The Devil You Know. ", "European dates were scheduled for DIO and Ronnie’s solo band had begun writing a sequel to the revered Magica album. ", "There were even whispers of a possible Elf reunion. ", "Anything was possible.", "\n\nWe’ll never know what surprises Ronnie had in store. ", "Dio was diagnosed with stomach cancer in 2009. ", "In the beginning, there was boundless optimism. ", "When a series of Heaven and Hell dates were cancelled, the situation looked dire. ", "Privately, close friends and relatives rushed to his bedside for final goodbyes. ", "It was truly the end. ", "Ronnie James Dio left this world on May 16th, 2010 at 7:45 am. ", "He was 67 years old.", "\n\nGone forever, his legacy remains. ", "With a sea of classic albums spanning five decades, Dio has left an indelible mark upon the music world. ", "As younger fans discover Ronnie’s music, his popularity continues to grow. ", "A true metal legend with an immortal body of work, the magic of Ronnie James Dio will never die!", "\n\n\n\n\n\n\n\n" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0010072177974507213, 0.000612011062912643, 0.001070265076123178, 0.000850063341204077, 0.002669546753168106, 0.0006976090953685343, 0.0007138926303014159, 0.01129962783306837, 0.0006406508618965745, 0.0017907924484461546, 0.0006237732013687491, 0.0006715382914990187, 0.0006875831168144941, 0.0007914266898296773, 0.0006429363857023418, 0.0006102778716012836, 0.0006524989730678499, 0.0007050486747175455, 0.0012063723988831043, 0.0007737461128272116, 0.0017557807732373476, 0.0006282535614445806, 0.0012761756079271436, 0.0007122100796550512, 0.0012861627619713545, 0.0008342802175320685, 0.0008612732053734362, 0.0008052445482462645, 0.0007861230988055468, 0.0007566541898995638, 0.0005532451323233545, 0.00108507985714823, 0.0006094789132475853, 0.006892979145050049, 0.0006937052239663899, 0.0006103590130805969, 0.0006342033739201725, 0.0006349016330204904, 0.0008703438215889037, 0.0006481418968178332, 0.0012533385306596756, 0.0007064540986903012, 0.0008149543427862227, 0.0006597645697183907, 0.0005752580473199487, 0.0005662862677127123, 0.0006905243499204516, 0.0006898442516103387, 0.0008955913363024592, 0.0009643537341617048, 0.0006298921653069556, 0.0009878483833745122, 0.001018390292301774, 0.0008540781564079225, 0.0007984331459738314, 0.0008823065436445177, 0.0006776325171813369, 0.0007797304424457252, 0.0005373741732910275, 0.0007332897512242198, 0.0009091824176721275, 0.16501057147979736, 0.0007590898312628269, 0.002515297383069992, 0.004663574974983931, 0.0005822756211273372, 0.03047548606991768, 0.002689940622076392, 0.001052241655997932, 0.001394693972542882, 0.0011649427469819784, 0.053693123161792755, 0.0011744670337066054, 0.0006071649258956313, 0.0076818689703941345, 0.0007600257522426546, 0.0006104203639551997, 0.0008003100519999862, 0.08250152319669724, 0.0008951089112088084, 0.0008768987026996911, 0.0007655957597307861, 0.0008239821181632578, 0.001319793052971363, 0.0020518230739980936, 0.0009523301268927753, 0.0007640295079909265, 0.0007942829397507012, 0.0030647788662463427, 0.0006282289978116751, 0.0011363952653482556, 0.0010082090739160776, 0.0005958745605312288, 0.0023232949897646904, 0.0006460450822487473, 0.03933733329176903, 0.0015602308558300138, 0.0007418179302476346, 0.0009144145296886563, 0.0007914549787528813, 0.0015516453422605991, 0.0008356586331501603, 0.0006071673124097288, 0.0006585275987163186, 0.0010645178845152259, 0.000634314666967839, 0.00087644875748083, 0.0031349491328001022, 0.0006770903128199279, 0.000589722883887589, 0.0008035672944970429, 0.0006833906518295407, 0.0006294912891462445, 0.0007676295936107635, 0.0007401362527161837, 0.0007522079395130277, 0.0076256259344518185, 0.000664121878799051, 0.0005993199301883578, 0.0006916206330060959, 0.0008692489354871213, 0.00194565299898386, 0.0006140691693872213, 0.0005617463611997664, 0.0005933819920755923, 0.004440644755959511, 0.0012765664141625166, 0.0005437896470539272, 0.0010672061471268535, 0.0009194485610350966, 0.0008973889634944499, 0.0010080899810418487, 0.0037900456227362156, 0.0008293950813822448, 0.0006899708532728255, 0.0005708347889594734, 0.0005706188385374844, 0.0005788843845948577, 0.0009053684188984334, 0.000683601712808013, 0.0012981898616999388, 0.005201308522373438, 0.0009389593033120036, 0.001049113692715764, 0.0006036803242750466, 0.0009499332518316805, 0.0007717821863479912, 0.0033163242042064667, 0.0008347703842446208, 0.0017770681297406554, 0.0014196619158610702, 0.0006409571506083012, 0.0005599340074695647, 0.001034606248140335, 0.00463262852281332, 0.0008172219968400896, 0.0006713239126838744, 0.0006870325305499136, 0.0005822895327582955, 0.016926715150475502, 0.0011719005415216088, 0.0007948076818138361, 0.0006905815680511296, 0.0006267536664381623, 0.0006176349706947803, 0.0007263639126904309, 0.0011789785930886865, 0.0009731302270665765, 0.0005991166108287871, 0.0011189187644049525, 0.000612387084402144, 0.0006316039361990988, 0.0006385344895534217, 0.0007997127831913531, 0.0006346572190523148, 0.0009542765910737216, 0.0006511493702419102, 0.0005379110225476325, 0.0008063747663982213, 0.006655513308942318, 0.021249519661068916, 0.000696323171723634, 0.0005606241757050157, 0.0006437494303099811, 0.002131768735125661, 0.02337336167693138, 0.0006527869845740497, 0.0005485720466822386, 0.22167983651161194, 0.0008708336390554905, 0.0006251095910556614, 0.015514343045651913, 0.0006576479645445943, 0.0005848400178365409, 0.000685248349327594, 0.0006760734831914306, 0.010269062593579292, 0.0006120827747508883, 0.0008929757750593126, 0.0005410984740592539, 0.003276893636211753, 0.001046659890562296, 0.006693247240036726, 0.000957614101935178, 0.0006696960190311074, 0.0005920155090279877, 0.0156926941126585, 0.001995444530621171 ]

[ "You want to break up with me? ", "I will hurt myself and threaten to take my life every time.", "\n\n312 shares" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.02890809066593647, 0.6685768961906433, 0.0010633482597768307 ]

[ "Q:\n\nC using malloc and free correctly in a program I wrote\n\nIn a course I take, there's a pset that involves reading a dictionary file, and creating a hash-table out of it, checking the correct spelling of words in another file by means of checking whether a word in text can be found in the hashtable. ", "Then unloading it from memory.", "\nThere are two files in the program. ", "One file that I didn't write (and has no problems for sure), that runs first and calls the functions of the .c file that I wrote: \n#include <stdbool.h>\n#include <stdlib.h>\n#include <stdio.h>\n#include <string.h>\n#include <ctype.h>\n\n#include \"dictionary.h\"\n\n#define DICSIZE 10000\n\ntypedef struct node\n{\n\n char* word;\n struct node* next;\n\n} \nnode;\n\ntypedef struct table\n{\n node** table;\n unsigned int wordCount;\n}\ntable;\n\n// initialize table for scope purposes\nstruct table* hashTable = NULL;\n\n// declaration of the hash function\nunsigned long hashDJB2(unsigned char *str);\n// declaration of the string duplication function\nchar* mystrdup(const char* s);\n// declaration of the lowercase function\nchar* returnLowerCase(const char* str);\n\n/**\n * Returns true if word is in dictionary else false.", "\n */\nbool check(const char* word)\n{\n node* list = NULL;\n char* wrd = returnLowerCase(word);\n unsigned long hashValue = hashDJB2((unsigned char*) wrd);\n for (list = hashTable->table[hashValue]; list !", "= NULL; list = list->next) {\n\n if (strcmp(list->word, wrd) == 0) {\n return true;\n }\n }\n free(wrd);\n return false;\n}\n\n/**\n * Loads dictionary into memory. ", " Returns true if successful else false.", "\n */\nbool load(const char* dictionary)\n{\n\n // allocation of memory for the table structure\n if ((hashTable = malloc(sizeof(struct table))) == NULL) {\n\n printf(\"Error allocating memory for table pointer\\n\");\n return false;\n\n }\n\n // allocate pointers to table itself\n if ((hashTable->table = malloc((sizeof(node*) * DICSIZE) + sizeof(unsigned int))) == NULL) {\n\n printf(\"Error allocating memory for heads of list\\n\");\n return false;\n\n }\n\n // initialize head nodes to NULL\n for (int i = 0; i < DICSIZE; i++) {\n\n hashTable->table[i] = NULL;\n }\n\n // initialize wordCount to zero\n hashTable->wordCount = 0;\n\n /*\n * Till now, was the creation of the backbone structure.", "\n * Now, implementation of hash() function and loading the words\n * onto the table.", "\n */ \n\n FILE* dp;\n dp = fopen(dictionary, \"r\");\n\n if (dp == NULL) {\n printf(\"Error in reading from dictionary\\n\");\n return false;\n }\n\n // reading words from dictionary\n char newWord[LENGTH + 1];\n while (fscanf(dp, \"%s\", newWord) == 1) {\n\n // determine the hash value of the \n unsigned long hashValue = hashDJB2((unsigned char*) newWord);\n\n // in the pset, they say i don't have to check whether the word already exists\n // if (! ", "check((const char*) newWord)) {\n\n // if not, insert a new node:\n\n // attempt to create a new node\n node* newNode = NULL;\n if ((newNode = malloc(sizeof(node))) == NULL) {\n\n printf(\"Error: couldnt allocate a new node\\n\");\n return false;\n }\n\n // insert new node to the beginning of the list\n newNode->word = mystrdup(newWord);\n newNode->next = hashTable->table[hashValue];\n hashTable->table[hashValue] = newNode;\n hashTable->wordCount++;\n\n //}\n } \n //free(dp);\n return true;\n}\n\n/**\n * Returns number of words in dictionary if loaded else 0 if not yet loaded.", "\n */\nunsigned int size(void)\n{\n\n unsigned int wordCount = hashTable->wordCount;\n return wordCount;\n}\n\n/**\n * Unloads dictionary from memory. ", " Returns true if successful else false.", "\n */\nbool unload(void)\n{\n\n node* head = NULL;\n long i = 0;\n for (head = hashTable->table[i]; head !", "= NULL; head = hashTable->table[++i]) {\n\n node* list = NULL;\n for (list = head; list !", "= NULL; list = head) {\n\n head = head->next;\n free(list->word);\n free(list);\n }\n }\n free(hashTable->table);\n free(hashTable);\n return true;\n}\n\n// djb2 algorithm, created by Dan Bernstein\nunsigned long hashDJB2(unsigned char *str)\n{\n unsigned long hash = 5381;\n int c;\n\n while ((c = *str++))\n hash = ((hash << 5) + hash) + c; /* hash * 33 + c */\n\n return hash % DICSIZE;\n}\n\nchar* mystrdup(const char* s)\n{\n char* p = malloc(sizeof(char) * strlen(s)+1);\n if (p) strcpy(p, s);\n return p;\n}\n\nchar* returnLowerCase(const char* str) {\n\n int len = strlen(str);\n char* p = malloc(sizeof(char) * (len + 1));\n for (int i = 0; i < len; i++) {\n p[i] = tolower(str[i]);\n }\n p[len + 1] = '\\0'; // this line made the program crash. ", "It was fixed already.", "\n\n return p;\n}\n\nFirst the \"speller.c\" (which I got from the pset) calls the load() function, then calls the check() function several tens of thousands times (depends on the number of words in the text), then unload(). ", "I have a problem with the checking and unloading part. ", "When the text is small the check() functions properly, but when It gets larger I get an error like this:\n\nspeller: malloc.c:2372: sysmalloc: Assertion `(old_top == (((mbinptr) (((char *) &((av)->bins[((1) - 1) * 2])) - __builtin_offsetof (struct malloc_chunk, fd)))) && old_size == 0) || ((unsigned long) (old_size) >= (unsigned long)((((__builtin_offsetof (struct malloc_chunk, fd_nextsize))+((2 *(sizeof(size_t))) - 1)) & ~((2 *(sizeof(size_t))) - 1))) && ((old_top)->size & 0x1) && ((unsigned long) old_end & pagemask) == 0)' failed.", "\n Aborted (core dumped)\n\nThe first problem is, It seems that there is a problem in the way I allocate memory. ", "The other problem is that I don't manage to free all the memory I've allocated.", "\nFor some reason, valgrinds --track-origins=yes doesn't work so all I've got from It is this:\n==3852== \n==3852== HEAP SUMMARY:\n==3852== in use at exit: 101,650 bytes in 18,547 blocks\n==3852== total heap usage: 305,376 allocs, 286,829 frees, 2,730,448 bytes allocated\n==3852== \n==3852== LEAK SUMMARY:\n==3852== definitely lost: 101,298 bytes in 18,546 blocks\n==3852== indirectly lost: 0 bytes in 0 blocks\n==3852== possibly lost: 0 bytes in 0 blocks\n==3852== still reachable: 352 bytes in 1 blocks\n==3852== suppressed: 0 bytes in 0 blocks\n==3852== Rerun with --leak-check=full to see details of leaked memory\n==3852== \n==3852== For counts of detected and suppressed errors, rerun with: -v\n==3852== Use --track-origins=yes to see where uninitialised values come from\n==3852== ERROR SUMMARY: 57191 errors from 5 contexts (suppressed: 0 from 0)\n\nI would love to get some help at that.", "\n\nA:\n\nOne bug (there may be others), in returnLowerCase():\np[len + 1] = '\\0';\n\nshould be:\np[len] = '\\0';\n\n(You have allocated len + 1 chars, so the valid indices are 0..len inclusive, with the actual string being at indices 0..len-1 and the \\0 terminator at index len.)", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007539051002822816, 0.000673344184178859, 0.0006260545342229307, 0.00435276422649622, 0.014243332669138908, 0.015191745944321156, 0.0008207531645894051, 0.007536754477769136, 0.0006688699359074235, 0.0030722382944077253, 0.0029252225067466497, 0.0012420647544786334, 0.0008207531645894051, 0.11804580688476562, 0.055969707667827606, 0.061767902225255966, 0.0006141399499028921, 0.0007866600644774735, 0.0008367557893507183, 0.0026835931930691004, 0.0007475137826986611, 0.0010810615494847298, 0.0012329596793279052, 0.0014360961504280567, 0.001995444530621171 ]

[ "\n314 B.R. 524 (2004)\nIn re ENRON CORP., ", "et al., ", "Debtors.", "\nEnron Corporation, Enron Energy Services, Inc., Enron Energy Services Operations, Inc., Enron Energy Services, LLC, Enron North America Corp., and Enron Power Marketing, Inc., Plaintiffs,\nv.\nPeople of the State of California, ex rel. ", "Bill Lockyer, Attorney General of the State of California, Defendants.", "\nBankruptcy No. ", "01-16034 (AJG). ", "Adversary No. ", "04-03386.", "\nUnited States Bankruptcy Court, S.D. New York.", "\nSeptember 29, 2004.", "\n*525 Mark C. Ellenberg, David F. Williams, Edward Smith, Of Counsel, Cadwalader, Wickersham & Taft LLP, New York, NY, for Enron Corp., Enron Energy Services, Inc., Enron Energy Services Operations, Inc., Enron Energy Services, LLC, Enron North America Corp., and Enron Power Marketing, Inc.\nBill Lockyer, Attorney General of the State of California, Tom Greene, Chief Assistant Attorney General, Danette E. Valdez, Supervising Deputy Attorney General, Keith Yamanaka, Deputy Attorney General, Martin Goyette, Deputy Attorney General, Steven H. Felderstein, Christa K. McKimmy, Of Counsel, Felderstein, Fitzgerald, *526 Willoughby & Pascuzzi LLP, Sacramento, CA, for the People of the State of California ex rel. ", "Bill Lockyer, Attorney General of the State of California.", "\nLuc A. Despins, Susheel Kirpalani, Of Counsel, Milbank, Tweed, Hadley & McCloy LLP, New York, NY, for the Official Committee of Unsecured Creditors of Enron Corp., et al.", "\nMEMORANDUM DECISION REGARDING THE ENRON PLAINTIFFS' APPLICATION FOR DECLARATORY JUDGMENT AND PRELIMINARY AND PERMANENT INJUNCTION TO ENFORCE THE AUTOMATIC STAY OR OTHER EXPEDITED RELIEF\nARTHUR J. GONZALEZ, Bankruptcy Judge.", "\nBefore the Court is the Complaint for Declaratory Judgment and Preliminary and Permanent Injunction filed by Enron Corp. and certain of its direct and indirect subsidiaries, as debtors and debtors in possession (collectively, the \"Debtors,\" or \"Enron Plaintiffs\"), on July 9, 2004; Debtors' Memorandum of Law in Support of Application for Preliminary Injunction to Enforce the Automatic Stay or Other Expedited Relief, and Declaration of Edward Smith, filed on July 9, 2004; Opposition to the Enron Plaintiffs' Request for Preliminary Injunction to Enforce the Automatic Stay or Other Expedited Relief, filed by the State of California Attorney General's (the \"Attorney General\") office on July 16, 2004, (\"State's Opposition\"); Declarations of Steven H. Felderstein, Martin Goyette, and Keith Yamanaka in Support of Opposition to Enron's Request for Preliminary Injunction to Enforce the Automatic Stay or Other Expedited Relief, filed on July 16, 2004; Debtors' Reply Memorandum of Law in Further Support of Application for Preliminary Injunction, and Reply Declaration of David F. Williams, filed on July 16, 2004; Motion of Official Committee of Unsecured Creditors of Enron Corp., et al. (", "the \"Committee\") for Entry of Order, Pursuant to 11 U.S.C §§ 105(a) and 1109(b) and Fed.", "R.Civ.", "P. 24(a) Granting Right to Intervene in Adversary Proceeding, filed on July 16, 2004; Objection to Claims and Complaint for Declaratory and Injunctive Relief Pursuant to 11 U.S.C. §§ 105(a), 502, 510(c), 725(a)(4), and Fed. ", "R. Bankr.", "P. 3007 and 7001, and 28 U.S.C. § 2201, filed by the Committee on July 22, 2004; the Attorney General's Supplemental Opposition to the Enron Plaintiffs' Request for Preliminary Injunction to Enforce the Automatic Stay or Other Expedited Relief, filed on July 26, 2004; the Debtors' Sur-Reply Memorandum of Law in Further Support of Motion for a Permanent Injunction and Supplemental Declaration of Edward Smith, filed on August 2, 2004; the Statement of the Committee With Respect to Debtors' Request for Injunction Against People of State of California, ex rel. ", "Bill Lockyer, filed August 2, 2004; Debtors' Letter in response to the August 11, 2004 Conference Call, dated August 20, 2004; the State's Letter in response to the August 11, 2004 Conference Call, dated August 20, 2004; and the Committee's Letter in response to the August 11, 2004 Conference Call, dated August 20, 2004.", "\n\nJURISDICTION AND VENUE\nThe Court has subject matter jurisdiction over this adversary proceeding under sections 1334(b) and 157(a) of title 28 of the United States Code and the \"Standing Order of Referral of Cases to Bankruptcy Judges\" of the United States District Court, dated July 10, 1984 (Ward, Acting C.J.). ", "This is a core proceeding pursuant to section 157(b)(2) of title 28 of the United States Code.", "\n*527 Venue is proper before this Court pursuant to section 1409(a) of title 28 of the United States Code.", "\n\nBACKGROUND\nA. Case Background\nCommencing on December 2, 2001, the Debtors filed voluntary petitions for relief under chapter 11 of title 11 of the United States Code (the \"Bankruptcy Code\"). ", "On December 12, 2001, the United States Trustee appointed the Committee, which appointment has been amended from time to time thereafter. ", "The Committee represents the interests of all of the unsecured creditors of the Debtors. ", "The Committee is statutorily authorized to investigate the assets and liabilities of the Debtors and the operation of their businesses, and is empowered to perform such other services as are in the interests of unsecured creditors generally. ", "See 11 U.S.C. § 1103(c). ", "As of the date hereof, the Debtors continue to operate their businesses and manage their properties as debtors in possession in accordance with sections 1107 and 1108 of the Bankruptcy Code. ", "On June 3, 4, 7, 8, 9, 10, 14, 16, 17, and 18, 2004, this Court held a confirmation hearing (the \"Confirmation Hearing\") to consider a plan of reorganization under chapter 11 of the Bankruptcy Code proposed by Debtors. ", "Following the conclusion of the Confirmation Hearing, on July 2, 2004, the Debtors filed their Modified Fifth Plan of Reorganization, dated June 1, 2004 (the \"Modified Plan\"), which reflects certain agreements made during the Confirmation Hearing. ", "On July 15, 2004, the Court entered findings of fact and conclusions of law supporting confirmation of the Debtors' Fifth Amended Joint Plan of Affiliated Debtors Pursuant to Chapter 11 of the United States Bankruptcy Code (the \"Plan\"), and entered an order confirming the Plan and the global compromise of inter-estate issues embodied in the motion filed by the Debtors, approving the global compromise in the event the Plan is not confirmed or does not become effective for one or more of the proponents of the Plan. ", "The Plan provides for the disposition of all of the Debtors' assets and the distribution of value realized therefrom in accordance with the priority scheme of the Bankruptcy Code.", "\nThe Plan now having been confirmed, and upon the occurrence of certain conditions subsequent, all prepetition claims against the Enron Plaintiffs will be discharged. ", "Plan, § 42.3; 11 U.S.C. § 1141(d)(1). ", "The Plan also enjoins persons asserting discharged claims from asserting those claims against the Enron Plaintiffs other than in connection with a properly filed proof of claim. ", "The Court has entered an order providing that October 15, 2002 was the last date for filing prepetition claims against the Enron Plaintiffs.", "\nThe Attorney General had notice of, and actively participated in, the Confirmation Hearing. ", "Near the conclusion of the Confirmation Hearing, the Attorney General filed the California Complaint.[1]\nB. Enron's Participation in the California Energy Markets\nIn September 1996, the California Legislature enacted legislation to restructure and deregulate the state's wholesale electricity industry. ", "That legislation, among other things, established two new institutions: CalPX and CalISO. ", "CalPX was established to operate and administer auction-style markets for the purchase and *528 sale of electricity in California. ", "Until it terminated its operations of the wholesale electricity markets in January 2001, CalPX administered markets through which wholesale electricity was bought and sold in the State of California.", "\nCalISO was established to operate the electricity transmission grid serving most of the state and was responsible for all real-time operations, such as balancing generation and load and managing congestion of the grid. ", "In addition to operating the congestion management system, CalISO also administered a variety of auction markets to purchase the electricity necessary to operate the transmission system reliably. ", "These markets included the \"real-time\" (also known as the \"imbalance\") energy market for purchase of power needed to match the amount of power being supplied to the grid with the amount of energy being demanded by customers, and certain ancillary services markets, through which CalISO purchased electricity to respond to a grid system emergency or to correct a routine imbalance on the grid.", "\nThe Enron Plaintiffs participated in the California wholesale electricity markets operated and administered by CalPX and CalISO, pursuant to tariffs approved by the Federal Energy Regulatory Commission (\"FERC\"). ", "Between May 2000 and June 2001 — the period marking what is now known as the California Energy Crisis — the price of wholesale power in California rose to levels well above historical norms. ", "On January 29, 2001, CalPX effectively ceased operations by suspending trading in its markets. ", "CalPX filed a petition for relief under chapter 11 of the Bankruptcy Code on March 9, 2001. ", "The CalISO continues to operate, but under a revised tariff that addresses the conditions that gave rise to the energy crisis.", "\nC. FERC Investigations and Proceedings Regarding Enron Trading Strategies and Other Market Practices\nFERC has launched a comprehensive investigation of Enron's trading activities in the California electricity markets, including the commencement of enforcement proceedings against Enron (and other market participants) for monetary and other remedies. ", "On March 26, 2003, following completion of a Final Report by FERC investigation staff concerning price manipulation in the western states' energy markets, FERC issued an order (the \"Show Cause Order\") directing EPMI and EES to show cause why their authority to sell power at market-based rates should not be revoked. ", "68 Fed.", "Reg. ", "15,712 (2003). ", "On June 25, 2003, FERC issued an order (the \"Revocation Order\") immediately revoking the blanket licenses of EPMI and EES to sell power in various markets, including the California wholesale electricity markets that are the subject of the California Complaint. ", "103 FERC ¶ 61,343, 2003 WL 21480248 (June 25, 2003). ", "FERC found in the Revocation Order, inter ali a, that EPMI and EES had engaged in \"gaming\" in the form of inappropriate trading strategies. ", "The \"trading strategies\" identified by FERC included the same trading strategies listed in the California Complaint (e.g., \"Deathstar\", \"Ricochet\"). ", "FERC stated in the Revocation Order that any Enron company with any plan to market wholesale power following reorganization must apply to FERC for a new authorization. ", "Otherwise, stated FERC, \"Enron would be free to continue the status quo ante through an individual . . . ", "electric power marketer that has retained its authorization.\" ", "Revocation Order at 6. ", "By Order dated January 22, 2004, FERC denied requests for rehearing of the Revocation Order. ", "106 FERC ¶ 61,024, 2004 WL 1483824 (Jan. 22, 2004). ", "In companion *529 orders also issued June 25, 2003 (the \"Gaming and Partnership Orders\"), FERC found that EPMI and EES, and others who had engaged in certain trading activities in the California electricity markets, could also be found to have engaged in \"gaming and/or anomalous market behavior\" in violation of the CalISO and CalPX tariffs during the period from January 1, 2000 through June 20, 2001. ", "FERC ordered EPMI, EES, and other entities to show cause in a trial-type evidentiary proceeding why they should not be found to have engaged in prohibited gaming practices, and authorized the Administrative Law Judge to recommend monetary remedies of disgorgement of unjust profits and any other appropriate nonmonetary remedies. ", "103 FERC ¶ 61,345, 2003 WL 21480252 (June 25, 2003) (Gaming Order); 103 FERC ¶ 61,346, 2003 WL 21480249 (June 25, 2003) (Partnership Order). ", "The FERC-ordered evidentiary proceeding is currently in the pre-trial phase. ", "FERC is also considering claims by third-party purchasers of electricity in the California markets administered by CalPX and CalISO seeking refunds from EPMI, EES, and other market participants for the difference between the actual prices paid and the market prices that allegedly should have prevailed absent the alleged dysfunction in those markets (the \"Refund Proceedings\"). ", "The Refund Proceedings are ongoing.", "\nThe Attorney General is a very active party in all three of the ongoing FERC proceedings noted above: the Partnership proceeding, Gaming proceeding, and the Refund Proceeding. ", "Further he has filed, and is prosecuting, claims against EPMI and other participants in the CalISO and CalPX markets. ", "Written testimony submitted to FERC on behalf of the Attorney General describes the claims asserted in terms that are substantially identical to the claims asserted in the California Complaint. ", "The written testimony further states that the Enron Plaintiffs are liable to the State of California for damages of approximately $1.1 billion.", "\nD. The Federal Government's Criminal Proceedings Involving the Enron Trading Strategies and Other Practices\nIn the wake of Enron's collapse and its entry into chapter 11 in December 2001, the United States government launched one of the most extensive investigations into allegations of corporate fraud and wrongdoing in the nation's history. ", "In January 2002, the U.S. Department of Justice, with the assistance of the Treasury Department, established the Enron Task Force, which (in the words of the First Year Report to the President from the Corporate Fraud Task Force dated July 22, 2003) was charged \"to investigate and prosecute all criminal matters relating to the sudden collapse of Enron Corp.\" The Enron Task Force includes experienced prosecutors, FBI, and IRS agents, and is coordinating its efforts with numerous other government agencies including the SEC, the CFTC, and FERC. ", "The Enron Task Force constitutes part of the broader Corporate Fraud Task Force established by President Bush in July 2002 to investigate allegations of fraud and corruption at U.S. corporations.", "\nSince June 2002, the Enron Task Force has brought criminal charges against 30 individuals, including 22 former Enron executives. ", "These indictments include many of Enron's former top officials, including former Chairman and CEO Kenneth Lay, former CEO Jeffrey Skilling and former CFO Andrew Fastow. ", "Ten defendants (in addition to the Arthur Andersen accounting firm) have been convicted to date, all pursuant to plea agreements. ", "The work of the Enron Task Force is ongoing. ", "A significant *530 part of the Enron Task Force's focus has been on California's energy markets. ", "The United States Attorney's Office for the Northern District of California has charged three of Enron's top former energy traders based on conduct in those markets. ", "At the time of the filing of the California Complaint, two of three energy traders, Timothy Belden and Jeffrey Richter, had pleaded guilty, and the other, John Forney, was under indictment. ", "Some time after the filing of the California Complaint, John Forney pleaded guilty. ", "In a press release dated August 5, 2004, (the \"Press Release\"), the United States Attorney for the Northern District of California stated: \"With the guilty plea of John Forney, we have now obtained convictions of the top three Enron executives most directly responsible for manipulating the energy markets in California at a time unique in our history, when the lights were going off and the grid was in danger of shutting down. ", "These executives will now be required to help obtain restitution for the same victims they defrauded, namely the citizens of California and other Western states.\" ", "U.S. Dep't of Justice Press Release (August 5, 2004), http://www.usdoj.gov/usao/can/press/html/2004_08 _05_forney.html.", "\nE. Proofs of Claim Filed by the Attorney General in the Enron Bankruptcy Cases\nOn August 1, 2002, this Court entered an order establishing a bar date of October 15, 2002 for the filing of claims against the Enron Plaintiffs in these cases (the \"Bar Date Order\"). ", "Any claim not filed within the period prescribed by the Bar Date Order would be forever barred.", "\nOn October 11, 2002, the Attorney General filed a series of substantively identical proofs of claim (each accompanied by a \"Supplemental Statement\") in the Enron Plaintiffs' bankruptcy cases (the \"California Claim(s)\"). ", "The California Claims contain allegations that are substantially similar to the allegations contained in, and by their express terms include all of the monetary relief sought by, the California Complaint. ", "Each California Claim states that the Attorney General's claim \"is based on the evidence that Debtors have improperly and illegally manipulated energy markets in California and the Western United States, overcharged for energy, and violated state and federal laws and regulations. . . .\" (", "Supplemental Statement, p. 1). ", "The California Claims then state:\nEnron's revenues from California were obtained from, among other things, the improper use of market power, market manipulation, and misrepresentations concerning power and ancillary services it was to supply and load it was to serve, and congestion it claimed to relieve. ", "Enron's schemes included \"Fat Boy\", \"Ricochet\", \"Load Shift\", \"Death Star\", \"Non-firm Export\", selling of non-firm energy as firm energy, and others described in a Dec. 8, 2000 memo by Enron lawyers. (", "Exh. ", "C hereto.) ", "The evidence so far obtained indicates that the activities of Enron may have violated, or be actionable under, many laws including but not limited to the Cartwright Act, Cal. ", "Business and Professions Code §§ 16720 et seq., ", "the Unfair Competition law, Cal. ", "Business and Processions Code §§ 17200 et seq., ", "the False Claims Act, Cal. ", "Government Code §§ 12650 et seq., ", "Cal.", "Penal Code §§ 395 and 396, Cal. ", "Public Utilities Code § 2111, federal antitrust, mail and wire fraud, and RICO statutes (15 U.S.C. § 1 et seq., ", "18 U.S.C. §§ 1341 et seq., ", "1961 et seq.), ", "and as constituting fraud, misrepresentation, and conversion. ", "In addition to compensatory damages, restitution or disgorgement, Enron may be liable for punitive *531 damages, and in some instances treble damages and penalties.", "\nThe California Claims continue, \"This claim is asserted for all injury and damages caused by Enron and its affiliates and subsidiaries of any kind whatsoever to the People of the State of California by reason of energy market misconduct and overcharges. . . .\" (", "Id. p. 4).", "\nF. The California Complaint Filed in California State Court\nToward the end of the confirmation hearing, on or about June 17, 2004, the Attorney General filed the California Complaint in the Superior Court of the State of California for the County of Alameda. ", "The complaint is captioned \"COMPLAINT FOR RESTITUTION, DISGORGEMENT, AND/OR DAMAGES, AND CIVIL PENALTIES, (CALIFORNIA BUSINESS & PROFESSIONS CODE § 17200, CALIFORNIA CORPORATIONS CODE § 29536); DEMAND FOR JURY TRIAL.\" ", "Paragraph No. ", "1 of the California Complaint alleges, inter alia: \"This is a law enforcement action brought by the Attorney General of the State of California to enforce the State's police and regulatory powers. . . .\" ", "The California Complaint alleges that, between 1998 and 2001, the Enron Plaintiffs (there defined as the Enron Defendants) engaged in a series of \"manipulative and fraudulent\" trading strategies (the \"Enron Trading Strategies\") through which they earned massive profits. ", "Smith Decl. ", "Ex. ", "1, ¶ 53. ", "The California Complaint contains descriptive allegations of the Enron Trading Strategies, which were labeled with the following terms: \"Deathstar\", \"Wheel-Out\", Non-Firm Export\", \"Get Shorty\", \"Fat Boy\", and \"Ricochet\" (also known as \"Megawatt Laundering\"). ", "Id. The complaint suggests that the California energy crisis, which was alleged to have lasted from May 2000 through June 2001, was precipitated by the Enron Trading Strategies (presumably along with the market manipulation activities of other traders).", "\nThe First Cause of Action in the California Complaint alleges that the Enron Trading Strategies were unlawful, unfair, and fraudulent business practices under the California Business and Professions Code § 17200 et seq. ", "Smith Decl. ", "Ex. ", "1, ¶ ¶ 65-71. ", "The Second Cause of Action alleges that the Enron Trading Strategies were willful and fraudulent business practices in violation of California Corporations Code § 29500 et seq. ", "Id. at ¶ ¶ 73-81. ", "The California Complaint alleges that, as a result, \"California businesses and residents were subjected to the risks and dangers of power supply interruptions, rolling blackouts and other adverse consequences.\" ", "Id. at ¶ ¶ 71, 81. ", "In the Prayer for Relief, the Attorney General requests an injunction against the Enron Plaintiffs permanently enjoining them from violating California Business & Professions Code § 17200 and California Corporations Code § 29536; an order \"directing Defendants to pay restitution, disgorgement and/or damages\" in an unspecified amount; an order assessing civil penalties; and the award of costs.", "\nShortly before filing the California Complaint, the Attorney General announced his plans to sue Enron. ", "According to press reports, the Attorney General made clear that the purpose of the lawsuit was to seek \"separate damages to compensate the State for Enron's alleged market manipulation.\" ", "A spokesperson from the Attorney General's office was quoted as saying: \"It'd be a different pot of money.\"", "\nFollowing the filing of the California Complaint, the Debtors notified the Attorney General's office on July 8, 2004 that they intended to file an adversary complaint in this case seeking a stay and dismissal of the California Litigation and an immediate temporary restraining order on *532 the ground that the California Litigation violates the automatic stay, unless the Attorney General agreed by 11 a.m. on July 9th to dismiss the California Litigation with prejudice. ", "See Decl. ", "Yamanaka ¶ 2. ", "Enron subsequently notified the Attorney General's Office that rather than seeking a TRO, it would seek a preliminary injunction at a hearing on July 15th. ", "Id.\nOn July 9, 2004, the Enron Plaintiffs commenced an adversary proceeding against the Attorney General in this Court for a declaratory judgment and preliminary and permanent injunctive relief declaring that the California Litigation violates the automatic stay of Bankruptcy Code section 362(a) and, consequently, is void ab initio, and an order staying, restraining and enjoining the commencement or continuation of the California Litigation under Bankruptcy Code sections 362(a) and 105. ", "Contemporaneously therewith, the Enron Plaintiffs filed an application for a preliminary injunction to enforce the automatic stay or for other expedited relief on those same grounds (the \"Stay Motion\"). ", "The Enron Plaintiffs sought an expedited hearing on the Stay Motion because of an impending answer date of July 21, 2004 to answer or otherwise respond to the California Litigation. ", "On July 9, 2004, the Court issued an Order to Show Cause that scheduled the hearing on the Stay Motion for 2:00 p.m. on July 19, 2004.", "\nOn July 14, 2004, the Attorney General, on his own motion, obtained an extension of time for Enron to file responsive pleadings to the California Complaint until September 20, 2004. ", "See Decl. ", "Goyette ¶ 5; Reply Decl. ", "Williams ¶ 6. ", "Counsel for the Attorney General promptly notified counsel for Enron of the extension. ", "See Decl. ", "Goyette ¶ 5. ", "Enron did not agree to adjourn the hearing set for July 19, 2004, seeking an immediate injunction barring further action by the Attorney General in the California Litigation. ", "Reply Decl. ", "Williams ¶ 5. ", "The California state court issued an order extending the time for Enron to respond to the complaint to September 20, 2004. ", "Id. The case has since been removed by the Enron Plaintiffs to the District Court for the Northern District of California. ", "On July 19, 2004, the Court issued a Minute Order \"so ordering\" the agreement between the parties set forth on the record at that hearing. ", "Pursuant to the agreement, the State of California would not file its remand motion until the earlier of the Court's ruling on the injunction following the August 4, 2004 permanent injunction hearing, or August 13, 2004. ", "The remaining issue before the Court regarding the Enron Plaintiffs' prayer for permanent injunctive relief under sections 362 and 105 of the Bankruptcy Code was scheduled to be heard on August 4, 2004. ", "The Court held a hearing on that date regarding the permanent injunctive relief sought. ", "At the Court's direction, members of its staff held a conference call on August 11, 2004 to request responses from the parties regarding the Press Release issued on August 5, 2004 by the United States Attorney's Office for the Northern District of California. ", "The parties responded individually, by letters to the Court, on August 20, 2004. ", "On August 12, 2004, the parties reached an agreement to extend the deadline for the State of California to file its remand motion from August 13, 2004 to and including August 30, 2004. ", "The State of California filed its remand motion on August 30, 2004.[2]\n\n\n*533 ISSUE PRESENTED\n\nThe primary basis for the injunctive relief sought by the Enron Plaintiffs is premised upon a determination as to whether the California Complaint violated the automatic stay under section 362(a). ", "Therefore, the principal issue before the Court is whether the California Complaint is filed in violation of section 362(a) or is excepted from the automatic stay by section 362(b)(4). ", "If the automatic stay applies, the California Complaint would be void ab initio as a violation of the automatic stay. ", "The underlying claims would be determined either in the claims adjudication process or relief from the stay granted to be determined in another forum. ", "If the exception in section 362(b)(4) applies, then such action can proceed outside the claims process without relief from the automatic stay. ", "The determination of whether the section 362(b)(4) exception applies does not effect the allowability of a refund claim or any other claim alleged in the California Complaint or what priority such a claim should receive.", "\n\nLEGAL STANDARD\nThe filing of a bankruptcy petition operates as a stay applicable to all entities regarding the commencement or continuation of judicial proceedings against the debtor. ", "See 11 U.S.C. § 362(a)(1).[3] The protections of the stay are automatic and mandatory with the filing of the bankruptcy petition. ", "Elder-Beerman Stores Corp. v. Thomasville Furniture Indus. ", "Inc. (In re Elder-Beerman Stores Corp.), 195 B.R. 1019, 1023 (Bankr.", "S.D.Ohio 1996). ", "The automatic stay applies to the commencement or continuation of declaratory judgment actions against the debtor. ", "See Commercial Union Ins. ", "Co. v. Johns-Manville Corp. (In re Johns-Manville Corp.), 31 B.R. 965, 970 (S.D.N.Y.1983) (affirming bankruptcy court's conclusion that automatic stay applied to pending declaratory judgment action); Advanced Computer Servs. ", "v. MAI Sys. ", "Corp., 161 B.R. 771, 774-75 (E.D.Va.1993) (concluding that section 362(a)(1) applied to complaint filed postpetition seeking declaratory and equitable relief).", "\nThe scope of the automatic stay is broad, see AP Indus., ", "Inc. v. SN Phelps & Co. (In re AP Indus., ", "Inc.), 117 B.R. 789, 798 (Bankr.", "S.D.N.Y.1990) (\"Congress intended that the scope of the automatic stay be broad in order to effectuate its protective purposes on behalf of both debtors and creditors. . . .\"), ", "and is a fundamental debtor protection, e.g., Eastern Refractories Co. Inc. v. Forty Eight Insulations Inc., 157 F.3d 169, 172 (2d Cir.1998) (citing legislative sources), that not only protects debtors but protects creditors as well. ", "See, e.g., Keene Corp. v. Coleman (In re Keene Corp.), 164 B.R. 844, 849 (Bankr.", "S.D.N.Y.1994). ", "It has been observed that:\nThe automatic stay . . . ", "promote[s] two principal purposes of the Bankruptcy *534 Code. ", "First, the automatic stay provides the debtor with a breathing spell from . . . ", "creditors. [", "Second,] the automatic stay allows the bankruptcy court to centralize all disputes concerning property of the debtor's estate in the bankruptcy court so that reorganization can proceed efficiently, unimpeded by uncoordinated proceedings in other arenas.", "\nShugrue v. Air Line Pilots Ass'n, Int'l (In re Ionosphere Clubs, Inc.), 922 F.2d 984, 989 (2d Cir.1990) (internal citations and quotation marks omitted). ", "Section 362(b) of the Bankruptcy Code provides for certain limited exceptions to the automatic stay, including actions by a governmental unit to enforce its police or regulatory power. ", "Section 362(b)(4) of the Bankruptcy Code provides that the filing of a bankruptcy petition does not operate as a stay against:\nthe commencement or continuation of an action or proceeding by a governmental unit . . . ", "to enforce such governmental unit's or organization's police and regulatory power, including the enforcement of a judgment other than a monetary judgment, obtained in an action or proceeding by the governmental unit to enforce such governmental unit's or organization's police or regulatory power.", "\nId. However, even if a government action is a proper exercise of the police power, the collection of a money judgment is barred by the stay and can only occur (if at all) in the bankruptcy court in connection with the debtor's distribution of estate assets to creditors. ", "Id.; see also, e.g., City of New York v. Exxon Corp., 932 F.2d 1020, 1024 (2d Cir.1991).", "\nThe legislative history of section 362(b) makes clear that Congress intended that courts give the exceptions in section 362(b) a narrow construction:\nThis section is intended to be given a narrow construction in order to permit governmental units to pursue action to protect the public health and safety and not to apply to actions by a governmental unit to protect a pecuniary interest in property of the debtor or property of the estate.", "\nIn re Chateaugay, 115 B.R. 28, 32 (Bankr.", "S.D.N.Y.1988) (citing 124 Cong. ", "Rec. ", "32, 395 (1978) (Statement of Rep. Edwards); 124 Cong. ", "Rec. ", "33,995 (identical statement of Sen. DeConcini)). ", "In adopting section 362(b)(4), the police power exception to the automatic stay, Congress explained that \"where a governmental unit is suing a debtor to prevent or stop violation of fraud, environmental protection, consumer protection, safety, or similar police or regulatory laws, or attempting to fix damages for violation of such law, the action or proceeding is not stayed under the automatic stay.\" ", "H.R.Rep. ", "No. ", "595, 95th Cong., ", "1st Sess. ", "343 (1977), reprinted in 1978 U.S.C.C.A.N. 5963, 6299, S.Rep. ", "No. ", "989, 95th Cong., ", "2d Sess. ", "52 (1978), reprinted in 1978 U.S.C.C.A.N. 5787, 5838 (emphasis added).", "\nIn Board of Governors v. MCorp Fin., ", "Inc., 502 U.S. 32, 40, 112 S.Ct. ", "459, 116 L.Ed.2d 358 (1991), the United States Supreme Court rejected the theory that a bankruptcy court must first determine \"whether the proposed exercise of police or regulatory power is legitimate\", as that \"would require bankruptcy courts to scrutinize the validity of every administrative or enforcement action brought against a bankrupt entity.\" ", "Id., 112 S.Ct. ", "at 465. ", "The Court further enumerated that \"[s]uch a reading [of section 362(b)(4)] is problematic, both because it conflicts with the broad discretion Congress has expressly granted many administrative entities and because it is inconsistent with the limited authority Congress has vested in bankruptcy courts.\" ", "Id.\n*535 After MCorp, 502 U.S. 32, 112 S.Ct. ", "459, courts moved away from any analysis of the legitimacy of the underlying action. ", "Instead, courts look only to the purpose of the law that the governmental unit is attempting to enforce to determine whether the section 362(b)(4) exception applies. ", "Safety-Kleen, Inc. v. Wyche, et al. (", "In re Pinewood), 274 F.3d 846, 865 (4th Cir.2001). ", "The exception applies if the purpose of the law is to promote \"public safety and welfare\" or to effectuate public policy. ", "Id. at 865 (quoting Universal Life Church, Inc. v. United States (In re Universal Life Church, Inc.), 128 F.3d 1294, 1297 (9th Cir.1997)). ", "However, if the purpose of the law relates \"to the protection of the government's pecuniary interest in the debtor's property,\" or to adjudicate private rights, the exception is inapplicable and the automatic stay applies. ", "Id. The inquiry to determine whether the governmental entity is acting pursuant to its \"police and regulatory power\" or acting to protect is status as a creditor is objective. ", "Id. at 865. ", "The court is to \"examine the purpose of the law that the state seeks to enforce rather than the state's intent in enforcing the law in a particular case.\" ", "Id. (internal citations omitted).", "\nWhen the law that a governmental entity is seeking to enforce has a dual purpose of promoting the public welfare as well as protecting the entity's pecuniary interest, the court must \"determine the primary purpose of the law that the [entity] is attempting to enforce.\" ", "Id.; see Yellow Cab Coop. ", "v. Metro Taxi, Inc. (In re Yellow Cab Coop.), ", "132 F.3d 591, 597 (10th Cir.1997); Javens, 107 F.3d at 367-68.[4]\n\nDISCUSSION\nThe Attorney General seeks relief provided for under the California consumer protection laws, including civil penalties, injunctive relief, restitution, disgorgement, and money damages. ", "The Attorney General filed the California Litigation pursuant to his authority under the police and regulatory power to allegedly protect the health, safety, and welfare of California's citizens under the consumer protection laws of California, specifically, California's Unfair Competition Law and Commodity Law. ", "The California Supreme Court has recognized that a consumer protection action brought by the state \"seeking injunctive relief and civil penalties is fundamentally a law enforcement action designed to protect the public and not to benefit private parties.\" ", "People v. Pacific Land Research Co., 20 Cal.3d 10, 17, 141 Cal.", "Rptr. ", "20, 569 P.2d 125 (Cal.1977) (emphasis added). ", "The California Supreme Court further explained the purposes of consumer protection actions: \"[t]he purpose of injunctive relief is to prevent continued violations of law and to prevent violators from dissipating funds illegally obtained. ", "Civil penalties . . . ", "are designed to penalize a *536 defendant for past illegal conduct. ", "The request for restitution . . . ", "is only ancillary to the primary remedies sought for the benefit of the public.\" ", "Id. (emphasis added) (internal citations omitted). ", "In Pacific Land Research, the California Supreme Court further stated that restitution, while often the primary purpose of a private class action, is not the primary object of a consumer protection action. ", "Id. at 18, 141 Cal.", "Rptr. ", "20, 569 P.2d 125. ", "As explained by the California Supreme Court, the consumer protection laws in California have multiple purposes, the primary purpose designed to protect the public safety. ", "The Court finds that the California Litigation, brought pursuant to the consumer protection laws of California, should be analyzed as a dual purpose law.", "\n1. ", "The \"Pecuniary Interest\" Test: The Primary Purpose of the Consumer Protection Laws that the Attorney General Seeks to Enforce Is to Seek Monetary Relief and Not to Protect the Public Safety\nThe Attorney General initiated the California Litigation more than two years after the allegations regarding Enron's manipulation of the energy markets in California became widely known and almost two years after he articulated virtually identical causes of action and legal theories in the California Claims.[5] In order to meet the section 362(b)(4) exception to the automatic stay, when a law has multiple purposes, the Court must find that the action is brought primarily to enforce the law's protection of the public safety or health of the citizens of California and not primarily to protect the State's pecuniary interest. ", "Here the Attorney General advances the California Litigation primarily for restitution, which is only an ancillary purpose of the California consumer protection laws. ", "Pacific Land Research, 20 Cal.3d at 17, 141 Cal.", "Rptr. ", "20, 569 P.2d 125 (holding that the request for restitution in a consumer protection action \"is only ancillary to the primary remedies sought for the benefit of the public.\"). ", "According to press reports, the Attorney General made clear that the purpose of the California Litigation was to seek \"separate damages to compensate the State for Enron's alleged market manipulation.\" ", "A spokesperson from the Attorney General's office was quoted as saying: \"It'd be a different pot of money.\" ", "The Attorney General is seeking to enforce the purpose of the law that relates to the protection of the State of California's pecuniary interest.", "\nThe State of California acknowledges that the purpose of the litigation is to seek restitution for wrongs to its citizens and contends that the litigation is brought also to deter future wrongdoers, including Enron. ", "The injunctive relief sought, however, is not brought to \"prevent continued violations of law [or] to prevent violators from dissipating funds illegally obtained,\" Pacific Land Research, 20 Cal.3d at 17, 141 Cal.", "Rptr. ", "20, 569 P.2d 125, but as the Attorney General argued, to provide an easier course of action to penalize Enron if it were to enter into business again. ", "Aug. 4, 2004 Hearing Tr. ", "48:8-49:14. ", "In that if Enron, some time in the future, (1) applied for, (2) was granted reinstatement of its license, (3) engaged in business in California, and (4) violated the consumer protection laws at issue in the California Litigation; the State of California could bring an action for the violation of a court order as well as an action based upon the violation of the consumer protection laws. ", "Id. Furthermore, *537 the Court finds that the injunctive relief sought by the Attorney General under the circumstances presented is a meaningless request. ", "The record of the Enron bankruptcy and FERC's actions make it practically impossible for Enron to resume trading and therefore, the need for an injunction to prevent Enron's participation in the California markets has been eviscerated. ", "The Attorney General in its Opposition acknowledges that Enron may never again engage in energy trading. ", "In fact, Enron sold its trading operations to UBS AG in January 2002.[6]See Order Pursuant to Sections 105, 363, and 365 of the Bankruptcy Code (1) Approving the Terms and Conditions of Agreements for the License and Related Transactions in Respect of Enron's Wholesale Trading Business, and (2) Authorizing the Consumption of the Transactions Contemplated Therein, Docket No. ", "1030 (January 22, 2002), (the \"Order Granting the UBS Sale\"). ", "During the August 4, 2004 permanent injunction hearing, the Attorney General also acknowledged that the Enron chapter 11 cases are in liquidation. ", "Id. at 57:23-58:3 (\". . . ", "this $11 billion estate that is only going to be at the liquidation stage.\").", "\nMoreover, on June 25, 2003, FERC issued an order immediately revoking the blanket licenses of EPMI and EES to sell power in various markets, including the California wholesale electricity markets that are the subject of the California Complaint. ", "103 FERC ¶ 61,343, 2003 WL 21480248 (June 25, 2003). ", "FERC stated in the Revocation Order that any Enron company with any plan to market wholesale power following reorganization must apply to FERC for a new authorization. ", "The Attorney General argued that an injunction is appropriate to prevent Enron from engaging in future wholesale power sales: \"the fact that [FERC] revoked [Enron's] license doesn't mean that [Enron] can't be in that business again by reapplying or in some other manner getting that business.\" ", "Aug. 4, 2004 Hearing Tr. ", "48:12-15. ", "The Attorney General acknowledged that it is not Enron's intention to reapply for a license or to sell an operating entity and that \"it is not [Enron's] plan to do it and they probably won't, but the injunction would still be appropriate in light of the fact that they could.\" ", "Id. at 48:21-24. ", "The Court finds the Attorney General's argument is premised upon an extremely remote possibility laden with numerous contingencies that have no basis in reality. ", "In early 2002, Enron sold its trading operations and facilitated the transfer of its traders to UBS AG. ", "See Order Granting the UBS Sale. ", "The Court finds it difficult to believe that the Enron trading name could have any value that would lead Enron to seek reinstatement of its trading authority, either (1) to engage in the trading business itself, or (2) sell a trading entity with the Enron name. ", "In addition, based upon the Court's understanding of the UBS AG sale, Enron's consideration from the sale is based upon the future success of UBS AG's operation of the trading business, hence, Enron's entry into that business or its facilitation of another's entry would be in conflict with Enron's economic interest in any potential recovery resulting from the UBS AG sale. ", "See Disclosure Statement for Fifth Amended Joint Plan of Affiliated Debtors Pursuant to Chapter 11 of the United States Bankruptcy Code at 248, Docket No. ", "15414 (January 12, 2004). ", "The request for injunctive relief, under the circumstances *538 presented, is an attempt to portray the California Complaint as a police and regulatory action when it is in fact solely brought in furtherance of the State of California's pecuniary interest.[7]\nThe remaining relief that the State of California seeks is money damages in restitution, disgorgement, civil penalties, and money damages. ", "When the primary purpose of a government lawsuit is to seek money damages or other monetary relief for past conduct, and not to prevent future conduct that could harm the public health or safety, the courts hold that the police power exception to the automatic stay does not apply. ", "See, e.g., U.S. v. Seitles, 106 B.R. 36, 39 (S.D.N.Y.1989), vacated on other grounds 742 F.Supp. ", "1275 (S.D.N.Y.1990); Chateaugay, 115 B.R. at 31-33; U.S. v. Wellham (In re Wellham), 53 B.R. 195, 198 (Bankr.", "M.D.Tenn.1985) (automatic stay applied because government action was for money damages for past conduct and did not purport to stop any continuing misconduct by the debtor). ", "The Court acknowledges the Attorney General's argument that the relief sought need not be prospective in order to satisfy the interests of public safety, however, the relief must have a deterrent impact.", "\nIn Seitles, the court ruled that the government's action against a corporate debtor under the False Claims Act for damages and civil penalties was barred by the automatic stay, stating that \"the presence or absence of continuing harm as well as a threat to public health is relevant in determining the applicability of § 362(b)(4)\", 106 B.R. at 39, the court concluded that \"the present case involves no threat to public health or safety\" and that the misconduct in question (fraudulently obtained printing contracts) \"posed only a monetary, not a safety, threat to the government.\" ", "Id. Furthermore, because the corporation no longer supplied its services to the government and its president had been convicted in a criminal trial, the court concluded that the lawsuit \"does not serve to stop any continuing misconduct by the debtor.\" ", "The government's real motive, stated the court, appeared to be \"a purely pecuniary endeavor which may be addressed after the orderly settlement of the bankrupt estate.\" ", "Id. at 40. ", "Any Enron entity's viability as a wholesale energy trading entity was lost as a practical matter with the filing of the bankruptcy in December 2001. ", "The decision by Enron, following the bankruptcy filing in late December 2001, to enter into a sale process for the energy trading structure, which ultimately lead to the UBS AG sale, was a recognition by Enron that it could no longer engage in the wholesale energy trading market. ", "Thereafter, the actions by FERC, the United States Attorney's Office for the Northern District of California, and other governmental entities, make abundantly clear what was already a foregone conclusion — Enron's energy trading days were over following the bankruptcy filing and the overall collapse of the energy trading market.", "\nThe articulated \"deterrent effect\" that would be sought pursuant to the California consumer protections laws is to prevent continued violations and to prevent the dissipation of improperly acquired funds from the alleged violation. ", "See Pacific *539 Land Research, 20 Cal.3d at 17, 141 Cal.", "Rptr. ", "20, 569 P.2d 125. ", "The California Litigation serves no additional deterrent value to that which is served by the FERC proceedings and the assertions regarding the criminal prosecutions. ", "Here, as in the discussion of Wellham and Seitles, infra, there is no likelihood of any continuing misconduct by the Enron Plaintiffs. ", "As stated above, Enron, as a trading entity, no longer exists and therefore, any concern over the possibility for the Enron Plaintiffs to violate the laws of California in the future is not a realistic concern. ", "The Attorney General contends that, \"[e]ven if Enron never again engages in energy trading, the [California Litigation] will serve as a deterrent to other wrongdoers.\" ", "State's Opposition at 11. ", "However, where criminal and other proceedings have been initiated against the debtor and/or the debtor's executives, courts have not been persuaded that deterrence is indeed the primary purpose in filing the government action. ", "See, e.g., Seitles, 106 B.R. at 39-40 (the court was not convinced that the public policy reasons of loss reimbursement and deterrence were the government's primary motivation in filing its damages action where the company's president had already been ordered to pay restitution in the criminal matter, and that the deterrent value of the civil action had already been largely served by the president's criminal conviction) (internal quotations omitted).", "\nIn this case, there have been several criminal indictments, including, according to the lead prosecutor, the convictions of the top three Enron energy executives primarily responsible for manipulating the energy markets in California. ", "As part of their guilty pleas, the three Enron executives will be required to assist the government in \"determining whether other individuals at Enron should be charged in connection with the illegal manipulation of the energy markets in California and the Western states . . . [", "and] whether other companies carried out schemes similar to Enron's for purpose of manipulating the energy markets.\" ", "U.S. Dep't of Justice Press Release, supra.[8] Additionally, the three executives will \"assist in other federal and state investigation of Enron's action during the energy crisis and assist the California parties who are trying to recover money\" for the citizens of California and other Western states. ", "Id. The Court is not persuaded that the California Litigation will serve an additional deterrent value than is served by these assertions regarding the federal criminal prosecutions.", "\nFurther, without reaching the merits of whether the California Litigation is preempted by the ongoing FERC proceedings in this case, as such determination would be prohibited by MCorp., ", "502 U.S. 32, 112 S.Ct. ", "459, the Court finds that the FERC proceeding also addresses the public policy concerns raised by the Attorney General and the California Litigation, and is therefore duplicative. ", "FERC has launched a comprehensive investigation of Enron's trading activities in the California electricity markets, including the commencement of enforcement proceedings against Enron (and other market participants) for monetary and other remedies. ", "On June 25, 2003, FERC revoked the licenses of EPMI and EES to participate in the California energy market and also issued *540 companion orders Gaming and Partnership Orders, finding that EPMI and EES could also be found to have engaged in \"gaming and/or anomalous market behavior\" in violation of the CalISO and CalPX tariffs during the period from January 1, 2000 through June 20, 2001. ", "FERC ordered EPMI, EES and other entities to show cause in a trial-type evidentiary proceeding why they should not be found to have engaged in prohibited gaming practices, and authorized the Administrative Law Judge to recommend monetary remedies of disgorgement of unjust profits and any other appropriate non-monetary remedies. ", "103 FERC ¶ 61,345, 2003 WL 21480252 (June 25, 2003) (Gaming Order); 103 FERC ¶ 61,346, 2003 WL 21480249 (June 25, 2003) (Partnership Order). ", "The FERC-ordered evidentiary proceeding is currently in the pre-trial phase. ", "The Attorney General has been an active participant in these proceedings.[9] The proceedings and investigation before FERC serve as deterrence to potential wrongdoers, including to those who may enter the energy markets in California. ", "The Court finds that the California Litigation would not serve any additional deterrence beyond that which is served by the FERC proceedings.", "\nThe Court notes that this is not a case where a wrongdoer is trying to hide in Bankruptcy Court. ", "The public interest concerns are already being addressed by, among other governmental actions, FERC and the United States Attorney's Office for the Northern District of California. ", "The economic interests of the State of California, which are not subject to the section 362(b)(4) exception from the automatic stay, have been asserted in the bankruptcy proceedings. ", "Therefore, having reviewed the arguments of the parties reading the \"pecuniary interest\" test, the Court finds that the California Litigation was brought primarily to protect the State of California's pecuniary interest and not primarily to protect the public safety or health of the citizens of California. ", "The Court's decision has no impact upon any refund or other claims alleged in the California Complaint; those issues will ultimately be adjudicated, either (1) in this forum in the claims adjudication process, or (2) in another forum if an application to lift the section 362(a) automatic stay were to be granted.", "\n2. ", "The \"Public v. Private Rights\" Test: The California Litigation Is an Exercise in Forum Shopping and the Adjudication of Private Rights\nAdditionally, the Court finds that in bringing the California Litigation, the Attorney General has sought to adjudicate the rights of a private litigant. ", "The California Litigation is an action for monetary relief where the Attorney General is seeking to liquidate its claims against the Debtors outside the Bankruptcy Court without having to seek relief from the section 362(a) automatic stay. ", "Because restitution is the primary aim of the California Litigation, the Attorney General is merely acting as a creditor or an entity in a private class action. ", "See Pacific Land Research, 20 Cal.3d at 17, 141 Cal.", "Rptr. ", "20, 569 P.2d 125 (\"the return of the money illegally obtained . . . ", "is not the primary object of the *541 suit, as it is in most private class actions.\"). ", "The Court finds that the Attorney General is simply trying to adjudicate the claims that are pending in this Court outside the claims adjudication process without establishing cause to lift the section 362(a) automatic stay. ", "Having reviewed the arguments of the parties regarding the \"public v. private rights\" test, the Court finds that the California Litigation was brought to protect the State of California's \"private\" rights, and therefore, is not excepted under section 362(b)(4) from the section 362(a) automatic stay. ", "The act of bringing the California Litigation was nothing more than seeking to adjudicate the State of California' pecuniary interest in the forum of its choice without the burden of establishing cause to do so under section 362(a).", "\nAs stated above, the Court finds that the California Litigation was brought primarily in the State of California's pecuniary interest and to protect its private rights, and not primarily to promote public safety and welfare or to effectuate public policy. ", "Hence, the automatic stay applies and the California Litigation is void ab initio. ", "As stated above, the Court's decision has no impact upon any refund or other claims alleged in the California Complaint; those issues will ultimately be adjudicated either in this forum, in the claims adjudication process, or in another forum, if an application to lift the section 362(a) automatic stay were to be granted. ", "Further, as noted above, the Court finds that the California Litigation would not serve any additional deterrence beyond that which is served by the FERC proceedings and the United States Attorney's criminal prosecutions.", "\n\nCONCLUSION\nFor the foregoing reasons, the California Complaint is void ab initio as the Court finds that the California Complaint is filed in violation of section 362(a) and is not excepted from the automatic stay by section 362(b)(4). ", "Therefore, the Attorney General is directed to take all action necessary to dismiss the action pending in the United States District Court for the Northern District of California within five (5) business days of the entry of an order consistent with this memorandum decision. ", "Further, the evidentiary objections by the Attorney General are hereby overruled. ", "The Court does not find that the Enron Plaintiffs' request for a permanent injunction under Rule 65 of the Federal Rules of Civil Procedure, made applicable hereto by Rule 7065 of the Federal Rules of Bankruptcy Procedure, is warranted at this time. ", "With respect to the alternative relief sought by the Enron Plaintiffs' under section 105, the Court, having determined the California Litigation is void ab initio, need not reach the issues raised regarding that request for relief.", "\nNOTES\n[1] The California Complaint is defined as the complaint filed by the Attorney General in the Superior Court of the State of California for the County of Alameda California state court, on or about June 17, 2004.", "\n[2] At the Court's direction, a member of its staff held a conference call on September 22, 2004 to ascertain whether the remand motion had been filed by the State of California, and if so, on what date was Enron Plaintiffs' response due. ", "The Court was informed that the deadline for the Enron Plaintiffs to respond to the remand motion has been extended to January 20, 2005. ", "Further, the Court was informed that pursuant to a stipulation between the parties, the deadline for the Enron Plaintiffs to file its Answer to the California Complaint has been extended to October 20, 2004.", "\n[3] Section 362(a)(1) provides:\n\nExcept as provided in subsection (b) of this section, a petition filed under section 301, 302, or 303 of this title, or an application filed under section 5(a)(3) of the Securities Investor Protection Act of 1970, operates as a stay, applicable to all entities, of —\nthe commencement or continuation, including the issuance or employment of process, of a judicial, administrative, or other action or proceeding against the debtor that was or could have been commenced before the commencement of the case under this title, or to recover a claim against the debtor that arose before the commencement of the case under this title.", "\n[4] The Court notes that the United States Court of Appeals for the Ninth Circuit in Universal Life Church, 128 F.3d at 1299, also acknowledged that most governmental actions have some pecuniary component. ", "The Ninth Circuit, however, appears to have misquoted the Bankruptcy Appellate Panel in In re Thomassen, 15 B.R. 907 (9th Cir. ", "BAP 1981) stating, that \"[o]nly if the action is pursued solely to advance a pecuniary interest of the governmental unit will the automatic stay bar it.\" ", "Universal Life Church, 128 F.3d at 1299 (quoting In re Thomassen, 15 B.R. at 909). ", "The Ninth Circuit Bankruptcy Appellate Panel, in In re Thomassen, stated that \"[s]tate and local governmental units cannot, by an exercise of their police or regulatory powers, subvert the relief afforded by the federal bankruptcy laws. ", "When they seek to do so for a pecuniary purpose, they are automatically stayed, notwithstanding the exception found at 11 U.S.C. 362(b)(4).\" ", "15 B.R. at 909.", "\n[5] As previously defined, the California Claims refers to the proofs of claim filed on behalf of the State of California.", "\n[6] As an integral part of the sale of its wholesale trading business, Enron facilitated the transfer of its traders to UBS AG. ", "Further, the consideration Enron received for the transaction was an economic interest in the purchaser's future success in the wholesale trading business.", "\n[7] Even if it were argued that the injunctive relief sought in the California Complaint, although lacking any practical consequences at this time and likely at any time in the future, separately survives the \"pecuniary purpose\" or the \"public v. private rights\" tests, the Court finds that relief under section 105 would be appropriate to prevent the injunctive relief from going forward until the Enron Plaintiffs took some action, at a minimum, to seek reinstatement of its license before FERC (e.g., to indicate that Enron was beginning the process to enable it to engage in a business activity that would be subject to the California consumer protection laws).", "\n[8] The State has objected to the use of the Press Release as evidence of truth of the matter asserted therein. ", "The admission of the Press Release is not done so for the truth of the matter asserted but for the fact that the assertions were made and by whom. ", "The Attorney General does not dispute that the United States Attorney for the Northern District of California, the lead prosecutor regarding the California energy crisis, made the assertions. ", "Therefore, the objection is overruled and the Press Release is admitted into evidence for the limited purpose set forth above.", "\n[9] Recently, the United States Court of Appeals for the Ninth Circuit rendered a decision with respect to a FERC ruling. ", "See State of California, ex rel. ", "Lockyer v. F.E.R.C., 383 F.3d 1006, 1008, 2004 WL 2002833, at *1 (9th Cir.2004). ", "In State of California, ex rel. ", "Lockyer v. F.E.R.C., the Ninth Circuit upheld FERC's market rate based pricing, however, it reversed FERC's determination that refunds could not be awarded for violations of its reporting requirements, and remanded the case to FERC for refund proceedings. ", "Id. It is the Court's understanding that the State of California was the lead plaintiff in that litigation.", "\n" ]

{ "pile_set_name": "FreeLaw" }

[ 0.0006562143098562956, 0.0006850148783996701, 0.044624749571084976, 0.0007703584851697087, 0.0007050379063002765, 0.0009652508306317031, 0.0006615357124246657, 0.0008268837118521333, 0.0012003866722807288, 0.00072760961484164, 0.0007080420036800206, 0.0006822248105891049, 0.0007865798543207347, 0.0006380158010870218, 0.0006341487169265747, 0.0007005715742707253, 0.0006370366900227964, 0.0010372980032116175, 0.0006796566303819418, 0.0009485376649536192, 0.0006733772461302578, 0.0006254298496060073, 0.0005936829838901758, 0.0005992844817228615, 0.0006210284191183746, 0.0005914498469792306, 0.0005433246842585504, 0.0006195117603056133, 0.0006309719174169004, 0.000670401263050735, 0.0006756985676474869, 0.0007286164327524602, 0.0006003286689519882, 0.0006005031755194068, 0.0006445386097766459, 0.0005878020892851055, 0.0006998119060881436, 0.0007934693712741137, 0.0006999229080975056, 0.0005926040466874838, 0.0006060554878786206, 0.0006107491790316999, 0.0005946641322225332, 0.0006323559791781008, 0.0005939928232692182, 0.0005905299913138151, 0.0006023742607794702, 0.0006028561037965119, 0.0006505585624836385, 0.0007670862250961363, 0.0006408197223208845, 0.0006010846700519323, 0.0005829964065924287, 0.000643345876596868, 0.0009997845627367496, 0.0018868775805458426, 0.0006864925962872803, 0.0007452096906490624, 0.0006255705375224352, 0.000637390767224133, 0.0005820580990985036, 0.0005893304478377104, 0.0006499251467175782, 0.0006316638318821788, 0.0006647608242928982, 0.0006355639779940248, 0.000633014424238354, 0.0005818151403218508, 0.0007659230032004416, 0.0006305117276497185, 0.0006014895625412464, 0.0006194353336468339, 0.0006280922680161893, 0.0006267655990086496, 0.0006935796118341386, 0.0005986142787151039, 0.0009542615152895451, 0.0006582584464922547, 0.0005884018028154969, 0.0007480308413505554, 0.0007379899034276605, 0.0006431554793380201, 0.0006350750336423516, 0.0005675004213117063, 0.0005840564845129848, 0.0005872675683349371, 0.0007397688459604979, 0.0007837950251996517, 0.0005854040500707924, 0.0006243129028007388, 0.0007077889749780297, 0.0005968362675048411, 0.0006966082728467882, 0.0006141268531791866, 0.0006583312060683966, 0.0006218431517481804, 0.0006326850852929056, 0.0005945312441326678, 0.0006851327489130199, 0.00242438493296504, 0.0008028073352761567, 0.0005982127622701228, 0.0006181375356391072, 0.0008217800059355795, 0.0006483052857220173, 0.0009507594513706863, 0.00067362398840487, 0.002203368814662099, 0.0008721103076823056, 0.0007805437780916691, 0.0007835885626263916, 0.0006687361747026443, 0.001793673262000084, 0.0016145281260833144, 0.0007010714616626501, 0.0008487051236443222, 0.0006089200614951551, 0.0006940203020349145, 0.0007628926541656256, 0.0006757536320947111, 0.0007409270037896931, 0.001544654369354248, 0.0009988500969484448, 0.0006835535168647766, 0.0012820074334740639, 0.0005964956362731755, 0.000849686679430306, 0.001544654369354248, 0.0009988500969484448, 0.0006419423152692616, 0.0014993015211075544, 0.0009653750457800925, 0.0006887265481054783, 0.0009654694003984332, 0.0006679908256046474, 0.002525211777538061, 0.0006862403824925423, 0.000653360562864691, 0.000677482457831502, 0.0008875854546204209, 0.0006940669263713062, 0.0006172715220600367, 0.0007023069774731994, 0.0005969344056211412, 0.0006963743362575769, 0.0006347678718157113, 0.0006692350143566728, 0.0008875854546204209, 0.0007242070860229433, 0.0006681885570287704, 0.0006031342782080173, 0.0008875854546204209, 0.0006603218498639762, 0.0006836538086645305, 0.0011131385108456016, 0.0006743017002008855, 0.000651906302664429, 0.0007398996967822313, 0.0005738958134315908, 0.000575812126044184, 0.0006257849163375795, 0.0007430323748849332, 0.0005583426100201905, 0.0005692209233529866, 0.0005763955414295197, 0.0007208686438389122, 0.0007142307586036623, 0.0009442659211345017, 0.0005663799238391221, 0.0006486096535809338, 0.0006689923466183245, 0.0006404573214240372, 0.0006423973245546222, 0.0007428507669828832, 0.0007299302378669381, 0.0007297477568499744, 0.0008244910859502852, 0.0006717568612657487, 0.0007388846715912223, 0.0017665446503087878, 0.0006883725291118026, 0.0006216919864527881, 0.0009739004890434444, 0.0007710334612056613, 0.0006800379487685859, 0.0007866076193749905, 0.0007350202649831772, 0.0008151321671903133, 0.0006049993680790067, 0.0007180270622484386, 0.006316178012639284, 0.0007248395122587681, 0.0006881767185404897, 0.04120005667209625, 0.0006233785534277558, 0.0006952427211217582, 0.0006681204540655017, 0.0007397163426503539, 0.000715189496986568, 0.0006564973737113178, 0.0007411317783407867, 0.0007497414480894804, 0.0007775345584377646, 0.0006622150540351868, 0.0007775345584377646, 0.0007086934056133032, 0.0006290139281190932, 0.0010264026932418346, 0.0013785817427560687, 0.0008604450849816203, 0.001190408831462264, 0.0007257774705067277, 0.0013785817427560687, 0.0009107200894504786, 0.001008407911285758, 0.0006251298473216593, 0.0007840837351977825, 0.0008209183579310775, 0.0008224197081290185, 0.0012623643269762397, 0.0007544627878814936, 0.0030106124468147755, 0.0014550677733495831, 0.000707685190718621, 0.0006379240658134222, 0.0006616826285608113, 0.0006548707606270909, 0.0006842404254712164, 0.000748446851503104, 0.0008209816878661513, 0.0006440838915295899, 0.0024657370522618294, 0.0006502316100522876, 0.0006559820030815899, 0.0006430381326936185, 0.0013630520552396774, 0.0007039019837975502, 0.000710883759893477, 0.0006671980954706669, 0.0006678651552647352, 0.0007455300656147301, 0.0012920480221509933, 0.0006327480659820139, 0.001239471253938973, 0.0007565059931948781, 0.023796183988451958, 0.0008403346873819828, 0.0009392706560902297, 0.0005983972805552185, 0.0006394153460860252, 0.0024161108303815126, 0.0012920480221509933, 0.0008102174615487456, 0.0006193842273205519, 0.0005812650779262185, 0.0009391900966875255, 0.0006993248825892806, 0.0006587664829567075, 0.0006733319605700672, 0.0012920480221509933, 0.0007131235324777663, 0.000665948842652142, 0.000653360562864691, 0.0009171001729555428, 0.0006491495878435671, 0.0008333518053404987, 0.0012920480221509933, 0.0007681450806558132, 0.000679262273479253, 0.0009510829695500433, 0.0005948761245235801, 0.0008726551895961165, 0.0006444710306823254, 0.0006821559509262443, 0.0006351760821416974, 0.0006125037907622755, 0.0005892860353924334, 0.0010910991113632917, 0.0006601441418752074, 0.00070826371666044, 0.0006255705375224352, 0.0005893304478377104, 0.000693219481036067, 0.000679262273479253, 0.0008614205289632082, 0.0006067811627872288, 0.0011983709409832954, 0.0006708662840537727, 0.0006987639353610575, 0.0006222501397132874, 0.0006225392571650445, 0.0006185353850014508, 0.0006598994368687272, 0.0006762835546396673, 0.0008086004527285695, 0.0007914149900898337, 0.0009227449190802872, 0.0008779683848842978, 0.0007664483273401856, 0.0005805466789752245, 0.0008099384140223265, 0.0008574200910516083, 0.0006926096393726766, 0.02982466109097004, 0.0006493029650300741, 0.0006233847816474736, 0.0006189351552166045, 0.000673379807267338, 0.0006836508982814848, 0.0012920480221509933, 0.0008102174615487456, 0.0006293793558143079, 0.0006952168769203126, 0.0006317471852526069, 0.0011901315301656723, 0.0007793612312525511, 0.0007458398467861116, 0.0006296415813267231, 0.0005574067472480237, 0.0006093772826716304, 0.0006383518921211362, 0.000577399565372616, 0.000689242675434798, 0.0006301302346400917, 0.0008713615243323147, 0.0006511987303383648, 0.0005825992557220161, 0.0006384553271345794, 0.0007506658439524472, 0.0006305117276497185, 0.0006014895625412464, 0.0005907565937377512, 0.0006802236312068999, 0.0008341923821717501, 0.0005577157717198133, 0.000627042492851615, 0.000627729285042733, 0.0006601617787964642, 0.001185585861094296, 0.0007226149318739772, 0.0007552479510195553, 0.0008827286656014621, 0.0006317770457826555, 0.0012920480221509933, 0.0007813959382474422, 0.0007331017986871302, 0.0007394287968054414, 0.0006097691366448998, 0.0011769408592954278, 0.0006378566031344235, 0.0009461165172979236, 0.000636192737147212, 0.0006222290685400367, 0.0006735454080626369, 0.0006894338293932378, 0.0007862253696657717, 0.0006088707013987005, 0.0005667414516210556, 0.0006152926944196224, 0.000565206166356802, 0.0006121936603449285, 0.0005952822393737733, 0.0006173274596221745, 0.0006169318803586066, 0.0006882376619614661, 0.004284837748855352, 0.0006591193960048258, 0.0006765701109543443, 0.0006962455809116364, 0.0008247641962952912, 0.0006664348766207695, 0.0006089807138778269, 0.0005543036968447268, 0.0006272020982578397, 0.0006384903099387884, 0.000596455589402467, 0.000611690862569958, 0.000613914686255157, 0.0005942275747656822, 0.0007425700896419585, 0.0008090444025583565, 0.000705559563357383, 0.0006890593795105815, 0.0007807226502336562, 0.001995444530621171 ]

[ "Analysis of the regulation of transcriptional control of osteoblast differentiation has significantly increased our knowledge about skeleton development, and the molecular bases of skeletal dysplasia. ", "This analysis was initiated in the Principal Investigator's group using the promoter of the osteocalcin gene as a tool to identify osteoblast-specific cis-acting elements (OSEs) and osteoblast-specific transcription factors (OSFs). ", "The fact that Cbfa1 was identified as a transcriptional regulator of osteoblast differentiation using the promoter as a tool justifies the use of this promoter to look for other transcriptional activators of osteoblast differentiation. ", "The Principal Investigator has now identified another osteoblast cis-acting element termed OSE1, and has shown that its function is as important as the function of Cbfa1 binding site in regulating osteocalcin expression. ", "Osf1, the nuclear activity binding to OSE1, has been purified and found to be present only in osteoblast nuclear extracts. ", "Importantly, it is absent in nuclear extracts of differentiated osteoblasts suggesting that it may act up stream of Cbfa1. ", "It is suggested that these biological and biochemical preliminary data are an incentive to identify Osf1 and the gene encoding it. ", "There are four specific aims. ", "Aim 1 is to demonstrate the functional importance of OSE1 in vivo and clone a cDNA encoding Osf1. ", "Aim 2 proposes to demonstrate that recombinant Osf1 acts as a transcriptional activator through its binding to OSE1. ", "Aim 3 proposes to study the pattern of expression of endogenous Osf1 during development and after birth, and its regulation of expression by secreted molecules affecting skeleton development. ", "Aim 4 proposes to obtain an Osf1 genomic clone, perform chromosomal mapping, and design a vector to delete the gene through homologous recombination in embryonic stem (E.S.) cells." ]

{ "pile_set_name": "NIH ExPorter" }

[ 0.0006504395278170705, 0.0006783339777030051, 0.0006892412784509361, 0.0008268979145213962, 0.0014315580483525991, 0.001047503319568932, 0.0006250359583646059, 0.0006494162371382117, 0.0006764076533727348, 0.0008494146750308573, 0.0006137693417258561, 0.0007334582041949034 ]

[ "2 Million Jul 13, 2019 /r/gameofthrones hits 2 Million subscribers\n\nTREND Jan 10, 2018 /r/gameofthrones is trending – Trend thread\n\nTREND Nov 18, 2017 /r/gameofthrones is trending – Trend thread\n\nTREND Nov 7, 2017 /r/gameofthrones is trending – Trend thread\n\nNo. ", "1 Non-default Aug 28, 2017 /r/gameofthrones - the fastest growing non-default reddit of the day\n\nTREND Aug 28, 2017 /r/gameofthrones is trending – Trend thread\n\nNo. ", "1 Non-default Aug 22, 2017 /r/gameofthrones - the fastest growing non-default reddit of the day\n\nNo. ", "1 Non-default Aug 21, 2017 /r/gameofthrones - the fastest growing non-default reddit of the day\n\nNo. ", "1 Non-default Aug 14, 2017 /r/gameofthrones - the fastest growing non-default reddit of the day\n\nNo. ", "1 Non-default Aug 10, 2017 /r/gameofthrones - the fastest growing non-default reddit of the day\n\nNo. ", "1 Non-default Aug 9, 2017 /r/gameofthrones - the fastest growing non-default reddit of the day\n\n1 Million Aug 8, 2017 /r/gameofthrones hits 1 Million subscribers\n\nNo. ", "1 Non-default Aug 8, 2017 /r/gameofthrones - the fastest growing non-default reddit of the day\n\nTREND Aug 7, 2017 /r/gameofthrones is trending – Trend thread\n\nNo. ", "1 Non-default Aug 7, 2017 /r/gameofthrones - the fastest growing non-default reddit of the day\n\nTREND Aug 6, 2017 /r/gameofthrones is trending – Trend thread\n\nTREND Jul 24, 2017 /r/gameofthrones is trending – Trend thread\n\nTREND Jul 23, 2017 /r/gameofthrones is trending – Trend thread\n\n900K Jul 19, 2017 /r/gameofthrones hits 900K subscribers\n\nTREND Jun 21, 2017 /r/gameofthrones is trending – Trend thread\n\nTREND May 24, 2017 /r/gameofthrones is trending – Trend thread\n\nTREND Mar 29, 2017 /r/gameofthrones is trending – Trend thread\n\n800K Sep 26, 2016 /r/gameofthrones hits 800K subscribers\n\nTREND Aug 3, 2016 /r/gameofthrones is trending – Trend thread\n\nNo. ", "1 Non-default Jun 28, 2016 /r/gameofthrones - the fastest growing non-default reddit of the day\n\nTREND Jun 27, 2016 /r/gameofthrones is trending – Trend thread\n\nNo. ", "1 Non-default Jun 21, 2016 /r/gameofthrones - the fastest growing non-default reddit of the day\n\nTREND Jun 20, 2016 /r/gameofthrones is trending – Trend thread\n\n700K Jun 7, 2016 /r/gameofthrones hits 700K subscribers\n\nTREND Jun 6, 2016 /r/gameofthrones is trending – Trend thread\n\nTREND May 23, 2016 /r/gameofthrones is trending – Trend thread\n\nTREND May 22, 2016 /r/gameofthrones is trending – Trend thread\n\nNo. ", "1 Non-default May 17, 2016 /r/gameofthrones - the fastest growing non-default reddit of the day\n\nTREND May 16, 2016 /r/gameofthrones is trending – Trend thread\n\nTREND May 9, 2016 /r/gameofthrones is trending – Trend thread\n\nTREND May 2, 2016 /r/gameofthrones is trending – Trend thread\n\nNo. ", "1 Non-default May 2, 2016 /r/gameofthrones - the fastest growing non-default reddit of the day\n\nNo. ", "1 Non-default Apr 26, 2016 /r/gameofthrones - the fastest growing non-default reddit of the day\n\n600K Apr 25, 2016 /r/gameofthrones hits 600K subscribers\n\nNo. ", "1 Non-default Apr 25, 2016 /r/gameofthrones - the fastest growing non-default reddit of the day\n\nTREND Apr 24, 2016 /r/gameofthrones is trending – Trend thread\n\nTREND Apr 11, 2016 /r/gameofthrones is trending – Trend thread\n\nTREND Mar 8, 2016 /r/gameofthrones is trending – Trend thread\n\nNo. ", "1 Non-default Jun 17, 2015 /r/gameofthrones - the fastest growing non-default reddit of the day\n\nNo. ", "1 Non-default Jun 16, 2015 /r/gameofthrones - the fastest growing non-default reddit of the day\n\nTREND Jun 15, 2015 /r/gameofthrones is trending – Trend thread\n\nTREND Jun 1, 2015 /r/gameofthrones is trending – Trend thread\n\nTREND May 31, 2015 /r/gameofthrones is trending – Trend thread\n\nTREND May 25, 2015 /r/gameofthrones is trending – Trend thread\n\n500K May 6, 2015 /r/gameofthrones hits 500K subscribers\n\nTREND Apr 12, 2015 /r/gameofthrones is trending – Trend thread\n\n400K Jun 18, 2014 /r/gameofthrones hits 400K subscribers\n\nTREND Apr 13, 2014 /r/gameofthrones is trending – Trend thread\n\nTREND Apr 10, 2014 /r/gameofthrones is trending – Trend thread\n\nNo. ", "1 Non-default Apr 8, 2014 /r/gameofthrones - the fastest growing non-default reddit of the day\n\nTREND Apr 6, 2014 /r/gameofthrones is trending – Trend thread\n\n300K Mar 21, 2014 /r/gameofthrones hits 300K subscribers\n\n200K May 27, 2013 /r/gameofthrones hits 200K subscribers\n\nTOP 100 Nov 30, 2012 /r/gameofthrones enters TOP 100 subreddits\n\n100K Oct 30, 2012 /r/gameofthrones had 100K subscribers when we started tracking" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0008566137403249741, 0.0006800988339819014, 0.0006911968812346458, 0.0006906369235366583, 0.0006916465936228633, 0.0006941701867617667, 0.0007345595513470471, 0.0006748709711246192, 0.0008657243452034891, 0.0006909887888468802, 0.0009034894173964858, 0.000766142038628459, 0.0006943891639821231, 0.0007116594933904707, 0.0007607953157275915, 0.0007027749088592827, 0.0009505384950898588, 0.0007321805460378528 ]

[ "Monday, April 30, 2007\n\nBe careful what you wish for...\n\nA year ago I was completely obsessed with finding a \"real job,\" so I could quit waiting tables and do something more respectable. ", "I thought having a \"real job\" would make things clearer for me, but apparently not. ", "Some part of me will probably always be wondering what I'm going to do with my life.", "\n\nI've come to the conclusion that the most important things to be learned aren't learned through an institution such as a university, but by living. ", "I used to think that I wanted to go for my PhD - now I feel like I will be lucky if I finish my Master's. ", "I'm not sure why I'm going through all of this education if I don't know what it's for.", "\n\nWhat do I want to do with my life? ", "I'd like to make a home that's ours, travel, take long walks. ", "I'd like to start writing again. ", "I'd like to learn new things, such as painting and photography. ", "Someday I'd even like to have kids.", "\n\nI suppose that sometime in the future I will look back on this time in my life and realize how much easier it was. ", "But it doesn't feel easy right now. ", "However, I am still aware of how lucky I am to have a wonderful husband-to-be, great friends and family, and the world around me." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0007772678509354591, 0.0007368791848421097, 0.001437948434613645, 0.000614932447206229, 0.000620167818851769, 0.0007975678308866918, 0.0017142497235909104, 0.0009757459629327059, 0.0010164962150156498, 0.0006554480060003698, 0.002089584479108453, 0.0005683101480826735, 0.0006569313700310886, 0.0006148038082756102 ]

[ "Sharks in Black and White – A Underwater Video Experiment\n\nAs I mentioned in my last post, I traveled to the Bahamas to dive Tiger Beach in the Bahamas. ", "I met our dive liveaboard charter, the Dolphin Dream in Palm Beach, Florida and sailed first to Grand Bahama Island to clear immigration. ", "We did not spend anytime on land in the Bahamas. ", "We went straight to the dive site after clearing immigration.", "\n\nWeather conditions and visibility were still not back to normal since Hurricane Dorian. ", "Over the next several days, we were not able to located Tiger Sharks or Hammerhead Sharks in their normal locations during our short trip. ", "However, we did meet a lot of resident reef sharks. ", "I shot these videos on a Sealife DC2000 and a Gopro Hero 6 Black cameras.", "\n\nWhile I was editing the underwater footage, I decided to experiment with black and white video. ", "The black and white shark video or short film above was shot completely on my Sealife DC2000 and edited in FCPx. ", "I think sharks presented in black and white appear to be more intimidating then in color videos.", "\n\nI believe all of the sharks in both videos are Caribbean Reef Sharks. ", "There are about 440 different species of sharks. ", "Please let me know if I mis-identified these sharks.", "\n\nI hope you enjoy my black and white experiment!", "\n\nReef Sharks at Tiger Beach in Color.", "\n\nThe color video shot above was completely shot on a Gopro Hero 6 Black and edited in FCPx. ", "I wish we saw Hammerheads and Tigers but weather cannot be controlled. ", "Hopefully, I’ll have another chance before the season ends to dive with the Hammerhead and Tiger Sharks. ", "Otherwise, I will have to try again next year.", "\n\nThe dive trip on the Dolphin Dream charter liveaboard was organized by a local dive shop located in NYC called Pan Aqua.", "\n\nHere’s link to my current underwater camera-set up." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0005783954402431846, 0.0006235894979909062, 0.0007745185866951942, 0.0005643488839268684, 0.0006270093726925552, 0.0006486773490905762, 0.0005903476849198341, 0.0007313063833862543, 0.0005809626309201121, 0.000648707034997642, 0.000575997109990567, 0.0006220686482265592, 0.0006635072641074657, 0.0005674973945133388, 0.005652276333421469, 0.0006142763886600733, 0.0006644491804763675, 0.00083954754518345, 0.0016981702065095305, 0.0009292137110605836, 0.0006450732471421361, 0.0006382673745974898 ]

[ "I can hardly believe the banana wars are over. ", "The dispute started back in 1993 when the European Union set quotas favoring banana imports from Ivory Coast, the Windward Islands and other former colonies at the expense of imports from Latin America. ", "American banana companies and the Latin American countries where they grow their bananas sued the E.U., accusing it of rigging an unfair trade deal, first under the GATT and then under the W.T.O.\n\nThe suit dragged on for years, and at several points threatened to spark an all-out trade war between Washington and Europe. ", "In 1999, after a meeting on Kosovo was hijacked by the banana crisis, the secretary of state then, Madeleine Albright, declared in exasperation: “I never in my life thought I would spend so much time on bananas.”", "\n\nIt finally ended this month when the E.U. said it would continue to grant tariff-free access to its former colonies but would reduce tariffs on Latin American bananas by 35 percent over seven years. ", "The United States and Latin American producers agreed to drop their case. ", "After all the roiling, what strikes me now is how little people seem to care. ", "That says a lot about how attitudes toward trade have changed.", "\n\nWhen this started, trade was trumpeted as the single most important tool for development. ", "Europe insisted that its special treatment of its former colonies was central to its post-imperial responsibilities. ", "The United States and Latin American countries vowed to hold the line for free trade — over bananas at least — to make it a tool of development for all." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.05110752210021019, 0.0007480664644390345, 0.0029806075617671013, 0.0009072410175576806, 0.0007815947174094617, 0.0006475750706158578, 0.028152810409665108, 0.0006180462660267949, 0.000538979540579021, 0.0006327541195787489, 0.0006372789503075182 ]

[ "{\n \"word\": \"Orlop\",\n \"definitions\": [\n \"The lowest deck of a wooden sailing ship with three or more decks.\"", "\n ],\n \"parts-of-speech\": \"Noun\"\n}" ]

{ "pile_set_name": "Github" }

[ 0.0005990481004118919, 0.0006296458304859698 ]

[ "Treaty 11\n\nTreaty 11, the last of the Numbered Treaties, was an agreement established between 1921 and 1922 between King George V and various First Nation band governments in what is today the Northwest Territories.", "\n\nHenry Anthony Conroy was appointed treaty commissioner and conducted the negotiations and signings in 1921. ", "However, he was unable to gain signatures from some bands in the Liard district during that summer. ", "Further complicating matters was Conroy's death in April 1922. ", "Thomas William Harris, the Indian Agent at Fort Simpson, Conroy's replacement, conducted the remaining treaty signings at Liard in July 1922. ", "The signatories included Bishop Gabriel-Joseph-Elie Breynat of the Apostolic Vicariate of Mackenzie.", "\n\nTimeline\n 27 June 1921: Fort Providence signing\n 11 July 1921: Fort Simpson signing\n 13 July 1921: Fort Wrigley signing\n 15 July 1921: Fort Norman signing\n 21 July 1921: Good Hope signing\n 26 July 1921: Arctic Red River signing\n 28 July 1921: Fort McPherson signing\n 22 August 1921: Fort Rae signing\n 27 April 1922: treaty commissioner Henry Anthony Conroy dies\n 17 July 1922: Liard signing under new commissioner Harris\n\nList of Treaty 11 First Nations\n\nAcho Dene Koe First Nation\nAklavik First Nation\nBehdzi Ahda First Nation\nDechi Laoti' First Nation\nDeh Gah Gotie Dene Council\nDeline First Nation\nDog Rib Rae First Nation\nFort Good Hope First Nation\nGameti First Nation\nGwicha Gwich'in First Nation\nInuvik Native First Nation\nJean Marie River First Nation\nKa'a'gee Tu First Nation\nLiidli Kue First Nation\nNahanni Butte First Nation\nPehdzeh Ki First Nation\nSambaa K'e (Trout Lake) Dene First Nation\nTetlit Gwich'in First Nation\nTulita Dene First Nation\nWest Point First Nation\nWha Ti First Nation\n\nSee also\n The Canadian Crown and Aboriginal peoples\n\nReferences\n\nExternal links\nTreaty 11 NWT Historical Timeline, Prince of Wales Northern Heritage Centre\n Treaty 11 photograph of the treaty. ", "Further down the page are pictures of Chief Jimmy Bruneau, one of the original signatories, in his Treaty Suit.", "\n Treaty 11 area map\n Treaty Guide to Treaty No. ", "11 (1921)\n\nCategory:Numbered Treaties\nCategory:Treaties concluded in 1922" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0006093148258514702, 0.0005991260404698551, 0.0007065337849780917, 0.001013828907161951, 0.0008131185895763338, 0.000598086800891906, 0.0015001968713477254, 0.0006144025246612728, 0.0006051755626685917, 0.0005698237218894064 ]

[ "Q:\n\nWhile Creating webview it shown with error like 'java.lang.", "NullPointerException' : Attempt to invoke interface method\n\nWhile Creating Android Webview then after running it generates too much error.", "I already create class like mWebViewClient.java, Splash.java.", "\nIn MainActivity.java\npackage com.shopence.myapp;\n\nimport android.app.", "Activity;\nimport android.content.", "Intent;\nimport android.os.", "Bundle;\nimport android.view.", "Menu;\nimport android.view.", "View;\nimport android.webkit.", "WebSettings;\nimport android.webkit.", "WebView;\nimport android.widget.", "ShareActionProvider;\n\npublic class MainActivity extends Activity {\n\nprivate WebView mWebView;\n\n@Override\nprotected void onCreate(Bundle savedInstanceState) {\n super.onCreate(savedInstanceState);\n setContentView(R.layout.activity_main);\n\n mWebView = (WebView) findViewById(R.id.activity_main_webview);\n WebSettings webSettings = mWebView.getSettings();\n webSettings.setJavaScriptEnabled(true);\n mWebView.loadUrl(\"http://shopence.com/test/\");\n mWebView.setWebViewClient(new com.shopence.myapp.mWebViewClient(){\n @Override\n public void onPageFinished(WebView mWebView, String url) {\n //hide loading image\n findViewById(R.id.progressBar1).setVisibility(View.", "GONE);\n /* show mWebView */\n findViewById(R.id.activity_main_webview).setVisibility(View.", "VISIBLE);\n }});\n}\n\n@Override\npublic void onBackPressed() {\n if(mWebView.canGoBack()) {\n mWebView.goBack();\n } else {\n super.onBackPressed();\n }\n}\n\nprivate ShareActionProvider mShareActionProvider;\n@Override\npublic boolean onCreateOptionsMenu(Menu menu) {\n\n /** Inflating the current activity's menu with res/menu/items.xml */\n getMenuInflater().inflate(R.menu.menu_main, menu);\n\n /** Getting the actionprovider associated with the menu item whose id is share */\n mShareActionProvider = (ShareActionProvider) menu.findItem(R.id.share).getActionProvider();\n\n /** Setting a share intent */\n mShareActionProvider.setShareIntent(getDefaultShareIntent());\n\n return super.onCreateOptionsMenu(menu);\n\n}\n\n/** Returns a share intent */\nprivate Intent getDefaultShareIntent(){\n Intent intent = new Intent(Intent.", "ACTION_SEND);\n intent.setType(\"text/plain\");\n intent.putExtra(Intent.", "EXTRA_SUBJECT, \"shopence.com\");\n intent.putExtra(Intent.", "EXTRA_TEXT,\"Welcome To Shopence\");\n return intent;\n}\n\n}\n\nIn Splash.java\npackage com.shopence.myapp;\n\nimport android.annotation.", "SuppressLint;\nimport android.annotation.", "TargetApi;\nimport android.app.", "ActionBar;\nimport android.app.", "Activity;\nimport android.content.", "Intent;\nimport android.os.", "Build;\nimport android.os.", "Bundle;\n\n@SuppressLint(\"NewApi\")\npublic class Splash extends Activity {\n\n @TargetApi(Build.", "VERSION_CODES.HONEYCOMB)\n @SuppressLint(\"NewApi\")\n @Override\n protected void onCreate(Bundle savedInstanceState) {\n super.onCreate(savedInstanceState);\n setContentView(R.layout.activity_splash);\n\n ActionBar actionBar = getActionBar();\n assert actionBar !", "= null;\n actionBar.hide();\n\n Thread t =new Thread(){\n public void run(){\n try{\n sleep(10000);\n }catch(InterruptedException e){\n e.printStackTrace();\n }finally{\n Intent i =new Intent(Splash.this,MainActivity.class);\n startActivity(i);\n }\n }\n };\n t.start();\n }\n @Override\n public void onPause(){\n super.onPause();\n finish();\n }\n\n}\n\nAfter running that code it show error like \n`'java.lang.", "NullPointerException' : Attempt to invoke interface method.", "`\n 11-02 12:26:03.628 2245-2245/com.shopence.myapp E/AndroidRuntime﹕ FATAL EXCEPTION: main\nProcess: com.shopence.myapp, PID: 2245\njava.lang.", "NullPointerException: Attempt to invoke interface method 'android.view.", "ActionProvider android.view.", "MenuItem.getActionProvider()' on a null object reference\n at com.shopence.myapp.", "MainActivity.onCreateOptionsMenu(MainActivity.java:55)\n at android.app.", "Activity.onCreatePanelMenu(Activity.java:2820)\n at com.android.internal.policy.impl.", "PhoneWindow.preparePanel(PhoneWindow.java:548)\n at com.android.internal.policy.impl.", "PhoneWindow.doInvalidatePanelMenu(PhoneWindow.java:917)\n at com.android.internal.policy.impl.", "PhoneWindow$1.run(PhoneWindow.java:258)\n at android.os.", "Handler.handleCallback(Handler.java:739)\n at android.os.", "Handler.dispatchMessage(Handler.java:95)\n at android.os.", "Looper.loop(Looper.java:135)\n at android.app.", "ActivityThread.main(ActivityThread.java:5221)\n at java.lang.reflect.", "Method.invoke(Native Method)\n at java.lang.reflect.", "Method.invoke(Method.java:372)\n at com.android.internal.os.", "ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:899)\n at com.android.internal.os.", "ZygoteInit.main(ZygoteInit.java:694)\n\nactivity_main.xml File like\n<LinearLayout xmlns:android=\"http://schemas.android.com/apk/res/android\"\n xmlns:tools=\"http://schemas.android.com/tools\"\n android:layout_width=\"match_parent\"\n android:layout_height=\"match_parent\"\n android:paddingLeft=\"@dimen/activity_horizontal_margin\"\n android:paddingRight=\"@dimen/activity_horizontal_margin\"\n android:paddingTop=\"@dimen/activity_vertical_margin\"\n android:paddingBottom=\"@dimen/activity_vertical_margin\"\n android:orientation=\"vertical\"\n tools:context=\".", "MainActivity\">\n\n<ProgressBar\n android:id=\"@+id/progressBar1\"\n style=\"?android:attr/progressBarStyleSmall\"\n android:layout_width=\"wrap_content\"\n android:layout_height=\"match_parent\"\n android:layout_centerHorizontal=\"true\"\n android:layout_marginBottom=\"161dp\"\n android:indeterminate=\"false\"\n android:layout_gravity=\"center\"\n android:max=\"500\"\n android:progress=\"0\" />\n\n<WebView\n android:id=\"@+id/activity_main_webview\"\n android:layout_width=\"match_parent\"\n android:layout_height=\"match_parent\"\n android:visibility=\"gone\" />\n\n</LinearLayout>\n\nAndoidManifest.xml File like\n<?", "xml version=\"1.0\" encoding=\"utf-8\"?", ">\n<manifest xmlns:android=\"http://schemas.android.com/apk/res/android\"\npackage=\"com.shopence.myapp\" >\n<uses-permission android:name=\"android.permission.", "INTERNET\" />\n<application\n android:allowBackup=\"true\"\n android:icon=\"@drawable/logo\"\n android:label=\"@string/app_name\"\n android:theme=\"@android:style/Theme.", "Holo.", "Light\" >\n <activity\n android:name=\".", "MainActivity\"\n android:label=\"@string/app_name\" >\n <intent-filter>\n <action android:name=\"android.intent.action.", "MAIN\" />\n\n <category android:name=\"android.intent.category.", "DEFAULT\" />s\n </intent-filter>\n </activity>\n\n <activity\n android:name=\".", "Splash\"\n android:label=\"@string/app_name\" >\n <intent-filter>\n <action android:name=\"android.intent.action.", "MAIN\" />\n\n <category android:name=\"android.intent.category.", "LAUNCHER\" />\n </intent-filter>\n </activity>\n\n </application>\n\n</manifest>\n\nSo, Please solve my problem that running program properly\n\nA:\n\nYour problem is here: \nmShareActionProvider = (ShareActionProvider) menu.findItem(R.id.share).getActionProvider();\n\nThe menu.findItem(R.id.share) is null. ", "Make sure that you have R.id.share menu item in the menu_main.xml\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007419872563332319, 0.001815507304854691, 0.0011255382560193539, 0.0007945414981804788, 0.0007073001470416784, 0.0010647749295458198, 0.000732090906240046, 0.000729900726582855, 0.0007843449129723012, 0.0007844181382097304, 0.0007394488784484565, 0.0012211935827508569, 0.0007379255257546902, 0.0030353337060660124, 0.0007627117447555065, 0.0007672649808228016, 0.0007716523250564933, 0.001991240307688713, 0.0008248263038694859, 0.0007715458050370216, 0.0007073001470416784, 0.0010647749295458198, 0.001081075519323349, 0.0007170792669057846, 0.0016153875039890409, 0.009465926326811314, 0.000920971913728863, 0.0010894632432609797, 0.0010860152542591095, 0.0009649083949625492, 0.0009901918238028884, 0.0008318772888742387, 0.001028967322781682, 0.0007553706527687609, 0.0008999598794616759, 0.0007833827985450625, 0.000850400363560766, 0.0007594639318995178, 0.0008180310251191258, 0.0007477752515114844, 0.0006830136990174651, 0.0008422982646152377, 0.0011189939687028527, 0.0007465022499673069, 0.0007737335399724543, 0.0006190649583004415, 0.0006574932485818863, 0.0006753164925612509, 0.007222872227430344, 0.0007003729697316885, 0.0007231584168039262, 0.0007270173518918455, 0.0008051616605371237, 0.0007559751975350082, 0.0007270173518918455, 0.002421196084469557, 0.0006811386556364596 ]

[ "Q:\n\nDifference between 夫 and 主人?", "\n\nThe words [夫]{おっと}and [主人]{しゅ・じん} both mean \"husband\". ", "\nWhat's the difference between them?", "\n\nA:\n\nThe meaning is basically the same as you said: husband.", "\nAccording to this website the main difference is in the situation in which you use these words.", "\nSimply put:\n「夫」: You can use it in most situations. ", "\n「主人」: Mostly used when talking with superiors or people you're not very familiar with.", "\nBONUS:\n「旦那{だんな}」: Is used when you are speaking with people you are familiar with.", "\nTo be even more precise it seems that 「夫」 is used as the opposite word of 「妻{つま}」 (wife). ", "On the other hand 主人 bears a bit more the meaning of \"house chief\" or \"master\" (of the house).", "\nI can expand more maybe later (I gotta go back to work now :p ). ", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006495366105809808, 0.0006090175593271852, 0.0007969790021888912, 0.0014579972485080361, 0.0005910564796067774, 0.0005545713356696069, 0.0013594907941296697, 0.0005593480309471488, 0.000563802954275161, 0.000584691995754838, 0.0005560576100833714, 0.001995444530621171 ]

[ "Q:\n\ncp --parents option on mac\n\nOn Linux, I have a --parents option available for the cp command so I can do \ncp --parents test/withintest/go.rb test2\n\nhttp://www.gnu.org/software/coreutils/manual/html_node/cp-invocation.html\nOn Mac, I do not have this option available. ", "Is there a way to do this on Mac? ", "Why is this option not available?", "\nPS. ", "The purpose of --parents is the following:\n\n‘--parents’ Form the name of each destination file by appending to the\n target directory a slash and the specified name of the source file.", "\nThe last argument given to cp must be the name of an existing\n directory. ", "\nFor example, the command:\n cp --parents a/b/c existing_dir \n\ncopies the file a/b/c to existing_dir/a/b/c, creating any missing intermediate directories.", "\n\nA:\n\nThis bothered me quite a lot as well.", "\nA workaround for this could be to use rsync.", "\nrsync -R test/withintest/go.rb test2\n\nhas the same effect as cp --parents and OS X comes standard with rsync.", "\n\nA:\n\nYou can use the ditto command on Mac OS X:\nThe basic form\nditto <src-path> <dst-path>\n\ndoes what you want. ", "There's a lot more options too - check out the man page.", "\n\nA:\n\nYou can install the GNU version of cp using MacPorts.", "\nAfter MacPorts is installed you can install the coreutils packages:\nsudo port install coreutils\n\nThen you will be able to use the GNU version cp and other core utilitites (ls, date, cat, etc.) ", "by prefixing the command with a g:\ngcp --parents test/withintest/go.rb test2\n\nIf you want these GNU versions to be used by default you can add the GNU bin update your path. ", "Add the following to your ~/.bash_profile:\nexport PATH=\"/opt/local/libexec/gnubin:$PATH\"\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006899418658576906, 0.000986674102023244, 0.0006818748661316931, 0.0009656924521550536, 0.0007338654831983149, 0.0006566740921698511, 0.0006785810110159218, 0.0008621772285550833, 0.0006092706462368369, 0.0008312849677167833, 0.00098831532523036, 0.000615354219917208, 0.0008061428088694811, 0.0006558616296388209, 0.0011258755112066865, 0.0007407931843772531 ]