Datasets:

tomekkorbak

/

detoxify-pile-chunk3-150000-200000

like 0

[ "Patrice Evra has been informed that he may have difficulty proving he was the victim of racial abuse from Luis Suárez, because of a counter-argument that certain variations of the N-word are not deemed offensive where the Liverpool player grew up, in Uruguay.", "\n\nThe Manchester United defender has accused Suárez of using racist language during a 1-1 draw at Anfield on 15 October and is waiting to discover whether, almost a month later, the Football Association will charge the Liverpool striker with misconduct. ", "Top-level sources at Old Trafford say the offending word was uttered in Spanish and allegedly was a derivative of \"negro\", with Evra stating that it was used \"at least 10 times\".", "\n\nHowever, Suárez has categorically denied racially abusing the Senegal‑born France player and the FA's investigators are having to consider the different context with which words that would be considered offensive in England are commonly used in Uruguay and other Spanish-speaking countries.", "\n\n\"Negrito\", for example, could have shocking connotations for someone without full knowledge of the nuances of the language. ", "But the counter-argument is that this is one of several derivations that are used in many countries, with no derogatory meaning – often in the same way someone could be called \"pal\" or \"\n\nmate\". ", "An illustration of this comes in the form of the message Dani Pacheco, the Liverpool player who is currently on loan at Rayo Vallecano, sent to his Spain Under-21 team-mate Thiago Alcântara via Twitter on Friday. ", "It begins: \"Negrito, enjoy yourself …\"\n\nThis was a conversation between two friends. ", "In Uruguay, it is quite common for commentators to use the same word to describe Premier League players. ", "Visitors to the country can be taken aback by this form of language. ", "But other derivatives are also commonly used, often to describe people of all races in affectionate terms, including family members.", "\n\nWhether Evra was aware of these nuances at the time is not clear, but he and United have subsequently been informed that the case does not merely rest on what Suárez said but also, crucially, the context in which his words were used. ", "The two players were arguing at the time and it is beyond argument that Suárez was trying to wind up his opponent, but the crux of the matter is the meaning of whatever was said and differentiating between something that would not be offensive in one country but shocking in another.", "\n\nSuárez, backed by Liverpool, has repeatedly protested his innocence. ", "The forward, who scored all four goals as Uruguay beat Chile 4-0 on Friday, has not publicly disclosed the words he used. ", "He said last week that it was not an insult but just a \"way of expressing myself. ", "I called him something his team-mates at Manchester call him, and even they were surprised by his reaction.\"", "\n\nThe complexities of a difficult, highly sensitive case help to explain why the FA has taken so long to decide whether to take action against Suárez. ", "The player's poor grasp of English has also contributed, as all his interviews have been in Spanish, requiring careful translation.", "\n\nAny case against him would also have to prove that, having played in Europe since 2006, he should be aware of what is acceptable or not. ", "However, this would be a difficult task. ", "If Suárez accepts he used one of the N‑words, he would have the scope to argue it is a common and inoffensive term for someone of his background, citing a clash of language and culture between one player from South America and Europe.", "\n\nLiverpool have let it be known they will ask the FA to take action against Evra if the governing body concludes that Suárez has no case to answer. ", "However, the latest revelations throw up the possibility that both players have given a legitimate account of what happened, rather than it being a case of one man's word against another.", "\n\nKenny Dalglish, the Liverpool manager, has voiced his objections about the length of time the case is taking the FA, but it is still not clear when an announcement will be made. ", "The case is so complex it may be that the FA needs to take advice from South America about the relevant linguistic issues before deciding whether or not to proceed any further." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0007744520553387702, 0.00251383101567626, 0.0059677064418792725, 0.0007936719921417534, 0.0034536069724708796, 0.0006507789948955178, 0.0005634507979266346, 0.020611975342035294, 0.0005569248460233212, 0.0005212324322201312, 0.0005946691962890327, 0.0005640703602693975, 0.0007863280479796231, 0.0008485640282742679, 0.00064649130217731, 0.0006495128036476672, 0.0005957155954092741, 0.0006052983808331192, 0.005885304883122444, 0.0005650667008012533, 0.0006376055534929037, 0.0005544746527448297, 0.0006413576775230467, 0.0006200685165822506, 0.0006228238926269114, 0.0005449698073789477 ]

[ "Q:\n\nfind which database table is connected by admin panel\n\nwe are using magento extension.", "\nusing that extension we are storing values in admin panel.", "\ni want to know what is the database table name the values are storing\n\nA:\n\nAs per XML might be it is storing in checkdelivery table.", "\n<entities>\n <checkdelivery>\n <table>checkdelivery</table>\n </checkdelivery>\n</entities>\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006232350715436041, 0.0005743754445575178, 0.0005828694556839764, 0.0010138183133676648 ]

[ "PROTESTERS DISRUPT HILLARY’S POST-PNEUMONIA RALLY!", "\n\nThis was wild!", "\n\nBecause the crowd is so small the hecklers really sounded very loud!", "\n\nHeckler escorted out, overpowered by chants of Hillary at UNC Greensboro #wcnc #hillaryclinton — Ty Chandler (@TyChandler_News) September 15, 2016\n\nTRENDING: Unhinged Quebec Woman Pascale Ferrier Identified as Suspect in Case of Ricin Letter Sent to Trump White House\n\nThe hecklers screamed, “F*ck Hillary!” ", "during the rally!", "\n\n" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.01590721309185028, 0.02388436533510685, 0.03933347389101982, 0.8175364136695862, 0.0008230424718931317, 0.001995444530621171 ]

[ "We also offer different finishes in all components you purchase to make it easy for our systems to become part of your range of products.", "\n\nWe provide geographical exclusivity, ensuring room for commercial influence and its potential expansion.", "\n\nl\n\nONLINE QUOTATIONS\n\nLikewise, we have developed an online pricing program; this will be able to allow you obtain the exact price of you folding sliding doors, in a quick and easy way. ", "The price will be calculated as per specs of your system, such as measures, finished of profiles and/or series chosen.", "\n\n\n\nR+D\n\nOur highly qualified technical department, which is in charge of maintaining the high levels of quality and innovation of our products will be at your entire disposal. ", "You will benefit from a continuous improvement of our systems and we are open to any improvement you suggest to increase your market share.", "\n\nHelping you out making your projects come true worldwide\n\nAny questions about your project?", "\n\nONLINE QUOTATIONS\n\nLikewise, we have developed an online pricing program; this will be able to allow you obtain the exact price of you folding sliding doors, in a quick and easy way. ", "The price will be calculated as per specs of your system, such as measures, finished of profiles and/or series chosen.", "\n\n\n\nR+D\n\nOur highly qualified technical department, which is in charge of maintaining the high levels of quality and innovation of our products will be at your entire disposal. ", "You will benefit from a continuous improvement of our systems and we are open to any improvement you suggest to increase your market share.", "\n\nWorking methods and custom solutions\n\nWe detail the entire manufacturing process of the different series. ", "We also offer non-standard manufacturing solutions in order to make special folding sliding door for difficult applications.", "\n\nOn the other hand, we offer working methods for the more complicated products such as curved folding sliding door which, learning from the experts, will become a simple task both in the development and manufacturing.", "\n\nZ\n\nSOFTWARE\n\nWe hand over to you the manufacturing program, developed by us, that quickly and easily calculates the material needed to manufacture – both profiles and accessories. ", "The program chooses the right number and accessory right according to the opening, series and dimension of the folding sliding door. ", "In the case of profiles, it also prepares a list with the number of bars for each profile required, the shears and discounts to be done, calculating that the trims are as few as possible.", "\n\nNever forget the great advantage of working upon an already existing database.", "\n\nZ\n\nMANUFACTURING MANUAL\n\nA complete manufacturing manual where you will find instructions for all cutting, machining, processes as well as processes fitting, glass, etc.", "\n\nHow you have to cut each profile that makes up the system, with the proper cutting, machining and cutting formulas, depending on the series and the number of leaves and the type of glass.", "\n\nAll issues related to the installation of the locking components and their machining profiles.", "\n\nLocation of fittings and joints.", "\n\nZ\n\nMACHINERY & TOOLS\n\nWe will provide the tools, milling and machinery developed for the manufacture of the different systems.", "\n\nZ\n\nTRAINING\n\nTo learn everything that is necessary for the product, we will accompany you and advice throughout the process. ", "First, there will be training sessions at our facilities, dealing with commercial and technical issues. ", "This training course focuses on practical measurements, manufacture and the assembly of the chosen system. ", "In the same way, you will learn first hand the way we work, we will discuss the optimum commercial, administrative and production line of work.", "\n\nWe will guide you throughout the process. ", "That is why we advise you on the setting up of the production process at your facilities and you will be supported by means of a monitor, in the manufacture of your first units.", "\n\nWorking methods and custom solutions\n\nWe detail the entire manufacturing process of the different series. ", "We also offer non-standard manufacturing solutions in order to make special folding sliding door for difficult applications.", "\n\nOn the other hand, we offer working methods for the more complicated products such as curved folding sliding door which, learning from the experts, will become a simple task both in the development and manufacturing.", "\n\nZ\n\nSOFTWARE\n\nWe hand over to you the manufacturing program, developed by us, that quickly and easily calculates the material needed to manufacture – both profiles and accessories. ", "The program chooses the right number and accessory right according to the opening, series and dimension of the folding sliding door. ", "In the case of profiles, it also prepares a list with the number of bars for each profile required, the shears and discounts to be done, calculating that the trims are as few as possible.", "\n\nNever forget the great advantage of working upon an already existing database.", "\n\nZ\n\nMANUFACTURING MANUAL\n\nA complete manufacturing manual where you will find instructions for all cutting, machining, processes as well as processes fitting, glass, etc.", "\n\nHow you have to cut each profile that makes up the system, with the proper cutting, machining and cutting formulas, depending on the series and the number of leaves and the type of glass.", "\n\nAll issues related to the installation of the locking components and their machining profiles.", "\n\nLocation of fittings and joints.", "\n\nZ\n\nMACHINERY & TOOLS\n\nWe will provide the tools, milling and machinery developed for the manufacture of the different systems.", "\n\nZ\n\nTRAINING\n\nTo learn everything that is necessary for the product, we will accompany you and advice throughout the process. ", "First, there will be training sessions at our facilities, dealing with commercial and technical issues. ", "This training course focuses on practical measurements, manufacture and the assembly of the chosen system. ", "In the same way, you will learn first hand the way we work, we will discuss the optimum commercial, administrative and production line of work.", "\n\nWe will guide you throughout the process. ", "That is why we advise you on the setting up of the production process at your facilities and you will be supported by means of a monitor, in the manufacture of your first units.", "\n\nCommercial, technical and information catalogues\n\nWe give all the technical material needed to help clients understand the system. ", "We have a specific catalogue for each system: product, technical sheets, assembly instructions, etc.", "\n\nYou will have a variety of promotional catalogues, brochures, displays, photographs and advertisement catalogues, with slogans and different approaches depending on the final customer. ", "With graphic design and a special presentation designed for the promotion of these products. ", "In this way, you can save time in advertising tasks and directly send the materials to the printer, with the significant savings in design services that entails.", "\n\nYou will be able to begin a marketing campaign with full commercial advice and backing necessary to introduce this new system in the market, offering your clients the best way to promote and show the customer the advantages offered by this product.", "\n\nSystems for your own production was last modified: February 5th, 2019 by Araceli Gil" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005439838278107345, 0.0005367131088860333, 0.0005901848198845983, 0.0006600884953513741, 0.0006872342783026397, 0.000573284865822643, 0.0008380836225114763, 0.0005730310804210603, 0.0006600884953513741, 0.0006872342783026397, 0.000573284865822643, 0.0005175900878384709, 0.0005554269882850349, 0.0005560946883633733, 0.0005583825404755771, 0.000566815200727433, 0.0006242941599339247, 0.0007823067135177553, 0.000580050575081259, 0.0006096909055486321, 0.0005527312750928104, 0.0005856538191437721, 0.0005448981537483633, 0.0005639362498186529, 0.0005212208488956094, 0.0005439125234261155, 0.000520777830388397, 0.0005221178289502859, 0.0005125013994984329, 0.0005175900878384709, 0.0005554269882850349, 0.0005560946883633733, 0.0005583825404755771, 0.000566815200727433, 0.0006242941599339247, 0.0007823067135177553, 0.000580050575081259, 0.0006096909055486321, 0.0005527312750928104, 0.0005856538191437721, 0.0005448981537483633, 0.0005639362498186529, 0.0005212208488956094, 0.0005439125234261155, 0.000520777830388397, 0.0005221178289502859, 0.0005125013994984329, 0.0005624964833259583, 0.0005349956918507814, 0.0005543734296225011, 0.0005655739805661142, 0.0005542379221878946, 0.0005207036156207323, 0.000732849002815783 ]

[ "Fully Adjustable Dental Halter\n\n$155.00\n\n(Priced in USD)\n\nThis exceptionally constructed, FULLY ADJUSTABLE dental halters are made with high quality nylon webbing, brass fittings, reinforced chin support and a quick release rope system. ", "They are fully adjustable to ensure you are able to work comfortably with the correct sized halter. ", "Our halters are individually made and may be special ordered in one of five colors or a combination of colors to match your stable colors.", "\n\nDescription\n\n(Priced in USD)\n\nThis exceptionally constructed, fully adjustable dental halter provides the user with the option or using it with or without assistance. ", "The fifteen-foot nylon rope and quick release cleat system ensure the safety of both the veterinarian and patient alike. ", "All halters are made with the highest quality nylon webbing, brass fittings, reinforced chin support and a quick release rope system. ", "They are fully adjustable to ensure you are able to work comfortably with the correct sized halter at all times.", "\n\nOur halters are individually made and may be special ordered in one of five colors or a combination of colors to match your stable or clinic colors. ", "Please contact us if you require a color combination." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006581515190191567, 0.0006219634669832885, 0.0006919149891473353, 0.000561640365049243, 0.0008149333298206329, 0.0007979159709066153, 0.0006061568856239319, 0.0006513675325550139, 0.0005320527707226574 ]

[ "Tocotrienols potentiate lovastatin-mediated growth suppression in vitro and in vivo.", "\n3-Hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase is the rate-limiting enzyme in the mevalonate pathway that provides essential intermediates for the membrane anchorage and biologic functions of growth-related proteins. ", "Contrary to preclinical studies showing the growth-suppressive activity of statins, competitive inhibitors of HMG CoA reductase, clinical application of statins in cancer is precluded by their lack of activity at levels prescribed for the prevention of cardiovascular disease and by their dose-limiting toxicities at high doses. ", "The dysregulated and elevated HMG CoA reductase activity in tumors retains sensitivity to the isoprenoid-mediated posttranscriptional down-regulation, an action that complements the statin-mediated inhibition and may lead to synergistic impact of blends of isoprenoids and lovastatin on tumor HMG CoA reductase activity and consequently tumor growth. ", "d-gamma- and d-delta-tocotrienols, vitamin E isomers containing an isoprenoid moiety, and lovastatin-induced concentration-dependent inhibition of the 48-hr proliferation of murine B16 melanoma cells with IC50 values of 20 +/- 3, 14 +/- 3, and 1.5 +/- 0.4 microM respectively. ", "A blend of lovastatin (1 microM) and d-gamma-tocotrienol (5 microM) totally blocked cell growth, an impact far exceeding the sum of inhibitions induced by lovastatin (12%) and d-gamma-tocotrienol (8%) individually. ", "Synergistic impact of these two agents was also shown in human DU145 prostate carcinoma and human A549 lung carcinoma cells. ", "C57BL6 mice were fed diets supplemented with 12.5 mg lovastatin/kg body weight, 62.5 mg d-delta-tocotrienol/kg body weight, or a blend of both agents for 22 days following B16 cell implantation; only the latter had significantly lower tumor weight than those with no supplementation. ", "Co-administration of isoprenoids that posttranscriptionally down-regulate tumor reductase may lower the effective dose of statins and offer a novel approach to cancer chemo-prevention and/or therapy." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006174727459438145, 0.0007213386124931276, 0.0007513872697018087, 0.000751216197386384, 0.0007581030367873609, 0.0007072621374391019, 0.0007760677835904062, 0.0008160150027833879, 0.0007451837882399559 ]

[ "Ask HN: Top request from the new MacBook? - ", "thesanerguy\n======\nfgandiya\nNot like I can afford one at the moment, but I can dream.", "\n\n* 32GB RAM\n\n* An Nvidia GPU\n\n* Official EGPU support\n\n* Include all the dongles one might need to make the transition to USB C. Right now, the dongle requirements feel like in app purchases/DLC\n\n* Bring back Magsafe and the adapter they used to have\n\n* Pull an SE and have A MacBook variant with the old pro body but newer internals and lower price.", "\n\n------\n27182818284\nThe 2012 model, but with more current hardware honestly.", "\n\nI can't think of anything that the late 2012 models got really wrong. ", "Maybe\nthe strength of the cord on the mag-safe, which frayed for lots of people\nincluding myself.", "\n\n------\nsigjuice\n15\" MBP without Touch Bar. ", "Will pay Touch Bar price.", "\n\n------\nblastofpast\nPlease don't remove the headphone jack!", "\n\n------\nthesanerguy\nRemove escape key from the TouchBar\n\n~~~\nfgandiya\nHow come?", "\n\n" ]

{ "pile_set_name": "HackerNews" }

[ 0.0007448575343005359, 0.003376488806679845, 0.0008602364687249064, 0.0006417699041776359, 0.0006115084397606552, 0.0006654171738773584, 0.0011547425528988242, 0.0034618948120623827, 0.003590999636799097, 0.0019537133630365133, 0.001995444530621171 ]

[ "Iran and the Taliban: A Tactical Alliance?", "\n\nIran and the Taliban: A Tactical Alliance?", "\n\nIran and the Taliban: A Tactical Alliance?", "\n\nIran and the Taliban have long had their ups and downs. ", "In 1998, the two sides nearly came to a direct clash when Taliban forces killed Iranian diplomats, though the incident ended without a major conflict. ", "However, the 2001 US invasion of Afghanistan, the fear of a resurgent ISIS in Afghanistan, and water issues have prompted Tehran to ramp up its engagement with the Taliban. ", "This tactical alliance will enable Iran to further expand its influence in Afghanistan.", "\n\nIran has had covert contacts with the Taliban, the most dangerous terror group in Afghanistan, for many years. ", "But recently, Ali Shamkhani, the secretary of Iran’s Supreme National Security Council (SNSC), went public with the relationship, claiming that contacts had been made with the aim of “curbing the security problems in Afghanistan.”", "\n\nThe announcement came as a surprise not because the public was unaware of Iran’s secret relations with the Taliban, but because Tehran has always tried to keep its ties to terror groups an “open secret” in an attempt to maintain plausible deniability. ", "Why did Tehran decide to go public about the Taliban connection now?", "\n\nA review of the relationship’s history may help to explain the mullahs’ thinking. ", "Relations between Iran and the Taliban have long had their ups and downs. ", "During the period of Taliban rule, Iran saw the group as a threat to its interests. ", "The two sides almost came to a direct clash in September 1998, when Taliban forces kidnapped and killed nine Iranian diplomats and one journalist in the Iranian consulate in Mazar-i-Sharif. ", "Iran’s Islamic Revolutionary Guards (IRGC) vowed revenge and prepared to launch an all-out attack. ", "But the crisis ended without a major clash, perhaps due to the fear that Islamabad would retaliate in support of the Taliban or that Afghanistan might become a quagmire for Iranian forces similar to that experienced by the Soviet Union in 1979-89.", "\n\nThe 2001 US-led military operation that led to the collapse of Taliban rule prompted the Iranian leadership to reconsider its original calculation and recalibrate its approach. ", "It welcomed high-level Taliban figures who escaped to Iran (e.g., Abdul Qayum Zakir and Mullah Naim Barich) and began extending support to Taliban fighters.", "\n\n—\n\nRead More: BESA Center\n\nIran Briefing | News Press Focus on Human Rights Violation by IRGC, Iran Human Rights" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0011852364987134933, 0.0011852364987134933, 0.0011852364987134933, 0.007376787718385458, 0.0018014326924458146, 0.0009361432166770101, 0.0006516249268315732, 0.0010497120674699545, 0.0005858042859472334, 0.0007338690338656306, 0.0008314065635204315, 0.0005195244448259473, 0.0012620060006156564, 0.0015731975436210632, 0.0017771398415789008, 0.10439563542604446, 0.0014130680356174707, 0.0006584733491763473, 0.0011065854923799634, 0.000615597702562809 ]

[ "BARRIERS TO GENE EXCHANGE BETWEEN CLOSELY RELATED CRICKET SPECIES. ", "II. ", "LIFE CYCLE VARIATION AND TEMPORAL ISOLATION.", "\nThe closely related field crickets Gryllus firmus and Gryllus pennsylvanicus are known to hybridize in a zone of contact that extends over more than 800 km from the Blue Ridge in Virginia to southern Connecticut. ", "Here I present evidence that the extent of temporal reproductive isolation of the two cricket species varies along the length of the zone. ", "Adults of G. firmus and G. pennsylvanicus occur synchronously in Connecticut but G. firmus matures significantly later than G. pennsylvanicus along the Blue Ridge in Virginia. ", "Variation in the extent of temporal isolation is a consequence of intrinsic differences in the egg-to-adult development time of G. firmus from the two localities. ", "In laboratory rearing experiments, there is little variation in development time among crickets from G. pennsylvanicus populations ranging from Vermont to Virginia. ", "However, G. firmus from Virginia takes significantly longer to mature than G. firmus from Connecticut. ", "Comparisons between species from neighboring localities show that lowland Virginia G. firmus take much longer to develop and are larger as adults than montane Virginia G. pennsylvanicus. ", "In Connecticut, crickets of the two species differ very little in development time and body size. ", "Patterns of variation in development time and body size are compared with similar data for frogs along one of the same environmental gradients and for field crickets along similar gradients elsewhere. ", "Although G. firmus and G. pennsylvanicus are temporally isolated in Virginia, adults of the two species do occur together. ", "Examination of Esterase genotypes of field-inseminated females and their progeny from a mixed population on the Blue Ridge suggests that pre-mating barriers other than temporal isolation are not effective in preventing gene exchange." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006857974804006517, 0.0011519683757796884, 0.0005803950480185449, 0.0007732301601208746, 0.0005928418831899762, 0.0009188193362206221, 0.0006726520950905979, 0.0006830611964687705, 0.0006642842781729996, 0.0007732257945463061, 0.0006465103360824287, 0.0006295008352026343, 0.0006645353278145194, 0.0007301507866941392 ]

[ "The Typhinite Wastelands\n\nSummary: Falling in love is easy. ", "Keeping that love is difficult. ", "Especially when your life is threatened, the one you love is kidnapped, and you find yourself in a barren wasteland trying to survive.", "\n\nTeasel's Proposal\n\nRough bark dug into Lakita’s skin as she climbed the tree, but she didn’t slow her ascent. ", "She had to hurry if she was going to reach the top of the tree in time. ", "Using the branches almost like steps to climb, she was grateful for the perfect way they’d been placed. ", "It was almost as if they’d been designed for her need to climb the great tree. ", "She smiled at that thought, remembering again way she was out so early.", "\n\nGrabbing one more branch, Lakita hoisted herself to the very top of the tree, sitting on the highest branch and looking eastward. ", "The air was still and the land quiet, as most were still sleeping, waiting for the day to dawn. ", "She waited, too, for that was precisely why she was there. ", "At this height, she had the best vantage point to watch the sun rise.", "\n\nHer breath caught in her throat and her eyes sparkled as the first tip of the sun peeked over the horizon. ", "She would never get tired of watching the beauty of the sunrise. ", "Thank you,Biden, for your beauty, and for the constant reminder of your love and provision. ", "Excitement flooded her soul as she watched the sun continue to rise, bringing light and life to the world below her. ", "All the while she watched, she continued to offer silent praises to Biden, the Creator of all. ", "Without Him, she was nothing.", "\n\nWhen the sun had finally risen fully above the horizon, Lakita closed her eyes, taking a breath, letting the peace of the moment wash over her. ", "She loved watching the sun rise. ", "It always reminded her of newness. ", "Every day the sun rose was a new day to leave her troubles behind and begin again. ", "That had especially been true for her five years ago when she’d lost her way. ", "When she’d found her way back to her faith again, the first thing she’d seen after was the sun rising in the East. ", "That image had stuck with her ever since, as had the peace that had come from her eyes being reopened by seeing the sun again, as if for the first time.", "\n\nLetting out a contented sigh, Lakita smiled, turning to climb back down the tree. ", "As she did, a loud screech rent the air. ", "It sounded shrill, almost like a hawk, but stronger, and deeper; almost angry. ", "Curious, she turned about to look. ", "Glancing in all directions, she saw nothing.", "\n\nWith a shrug, not knowing where the sound had come from, she turned to climb down the tree again. ", "Whatever creature the call had come from was probably down below where she couldn’t see it. ", "As she reached for a nearby branch to use as support, the screech from earlier sounded again, only this time it was almost right next to her. ", "Unable to contain the gasp on her lips, she spun toward the screech, only to lose her balance on the branch she sat on. ", "At the same time, a dark and frightening creature flew at her, reaching out to her with sharp talons, ready to dig them into her skin.", "\n\nThe creature missed as she fell away from it and the tree, but it was little comfort as she reached back for the branch she’d been sitting on, unable to grab it. ", "Everything seemed to be happening in slow motion, yet also at a horrifying speed. ", "The ground seemed to be getting ever closer. ", "All she could do was let out a yell of panic, her earlier peace stolen from her.", "\n\nUncontrollable fear filled her and she was sure she was doomed. ", "If the fall didn’t kill her, the dark creature surely would. ", "Even now it dove at her again, its claws ready to strike. ", "She waited for it to screech again, letting her know it was upon her, but instead her ears heard a new sound. ", "It was the bellow of a dragon.", "\n\nRelief filled her and she couldn’t stop the happy tears that sprang to her eyes as she looked to the distance.", "\n\n“Maya!” ", "She shouted barely above a whisper. ", "Her faithful dragon was here to save her.", "\n\nChancing a glance upward, she saw the dark creature hesitate, then stop its dive toward her, flying off into the distance. ", "It clearly didn’t want to mess with the dragon.", "\n\nMaya continued toward her, then dove below her. ", "Lakita soon felt her body hit Maya’s, and she began sliding down the smooth scales. ", "Spinning about, she reached up, grabbing one of the spines that ran the length of Maya’s back. ", "She held on tightly, her body dangling off the side of the great dragon’s back.", "\n\nLarge, leathery wings flapped in front of her as Maya continued her flight away from the tree, lowering in the sky as she went until the tips of her wings were skimming the ground. ", "Lakita released her hold on Maya’s spine and landed lightly on the ground. ", "Maya circled and landed on the ground nearby. ", "A wide smile lit up Lakita’s face as she ran toward the dragon and wrapped her arms around her lowered neck.", "\n\n“Oh, Maya, I’ve never been so relieved to see you!” ", "She came out of the hug and rubbed Maya’s chin in thanks.", "\n\nThough she was clearly enjoying it, Maya quickly shook her, pulling away. ", "She moved her head level with Lakita’s, and her dark eyes pierced her, stern and serious. ", "Lakita knew she was in trouble. ", "As well as being a loyal friend, Maya was also like a mother to her.", "\n\n“Lakita, what happened?” ", "She asked. ", "To anyone else it would have sounded like unintelligible chirping, but five years ago, Lakita had been blessed by Biden with the gift of being able to understand not only the dragon language, but also the language of any living creature.", "\n\nLakita shrugged, unsure herself what had happened. “", "I’m not really sure. ", "Some odd creature flew at me, knocking me from the tree.”", "\n\nShe glanced back to the tree and had to hold back a shiver. ", "The creature was unlike anything she’d ever seen. ", "It was dark, the color of the night sky. ", "If not for that, it could have easily been an eagle. ", "But then, it had a long tail like a dragon’s, and was almost twice as large as an eagle, and when it opened its mouth… The urge to shiver came back to her as she pictured the teeth there, sharp and destructive, but she restrained it, shaking her head. “", "I’m not sure what it was.”", "\n\n“Are you sure it wasn’t the wind?” ", "Maya asked, pushing herself into Lakita and knocking her forward.", "\n\nAngry, Lakita spun around to face her. “", "Of course not! ", "I know what I…” She cut herself off as she noticed the playful grin on Maya’s face. ", "She almost laughed. “", "Hey! ", "Who taught you a sense of humor?”", "\n\nMaya nudged her again, smiling a dragon smile, then rested her head on her shoulder. ", "Lakita wrapped an arm around the side of Maya’s head and rested her own against it, once again grateful for her.", "\n\n“Why were you in a tree, anyway?” ", "Maya asked as she pulled out of the affectionate embrace.", "\n\n“I do it at least once a week.” ", "She glanced back to the tree and Maya joined her. “", "It’s the highest place I can get to, to watch the sunrise with Biden.” ", "She turned back to Maya, the joy of the sunrise returning to her. “", "They’re marvelous.”", "\n\nMaya nodded. “", "Marvelous they may be, but you really shouldn’t go off on your own like that.”", "\n\n“And why not? ", "I don’t need a chaperone.”", "\n\n“No, but it is dangerous.”", "\n\nLakita smiled, unafraid, turning quickly to face Maya. ", "She laughed, “Dangerous?! ", "I’m in Dentaria! ", "There hasn’t been any danger here in years. ", "Besides, if there were, you’d be there in an instant to save me! ", "You can sense whenever I’m in danger.” ", "Still smiling, she stepped back, feigning to trip.", "\n\nMaya caught her with one of her wings, pushing her up to her feet again, but there was no joy in her eyes at Lakita’s attempt at humor. “", "I didn’t today.”", "\n\nLakita’s own joy left her, replaced by worry, as Maya’s sad seriousness weighed down on her. “", "Why not? ", "I wasn’t more than a few miles from you!”", "\n\nLakita frowned, crossing her arms over her chest. “", "But what?” ", "She didn’t like not knowing. ", "As she thought it over, trying to come up with an answer, a new question presented itself. ", "She turned quickly to Maya. “", "And how did you rescue me if you didn’t know I was in danger?”", "\n\nTo Lakita’s surprise, Maya grinned. “", "Luck?”", "\n\nLakita eyed her, skeptically, knowing her friend was hiding something. ", "Maya finally chuckled, gently. “", "I just happened to be looking for you, and noticed you falling just in time.”", "\n\n“You were looking for me?”", "\n\n“All of Dentaria was looking for you!”", "\n\nShock filled Lakita. ", "Why would the entire country be looking for her? ", "She wasn’t anything special, and wouldn’t have guessed anyone would have noticed her missing from her room.", "\n\n“When your bed turned up empty this morning, we all got worried. ", "Then, when I couldn’t sense where you were, well, the worry doubled.” ", "Maya explained. ", "Still, Lakita couldn’t understand what all the fuss was about.", "\n\nShe shook her head. “", "You really shouldn’t worry over me.”", "\n\n“And what about Ovatus? ", "He vowed to get his revenge on you.” ", "Maya’s seriousness was back.", "\n\nLakita let out a breath, wishing everyone would let the whole thing go. “", "And it’s been five years.” ", "She shook her head. “", "We can’t continue to live in fear. ", "I don’t.”", "\n\nHer words were true. ", "She wasn’t afraid of Ovatus. ", "Perhaps it was because she knew him better than the others that she wasn’t afraid, though most would claim that would give her more reason to be. ", "She’d met the man five years ago, and in grief over losing her mother, had bonded with him, seeking solace with him as she joined him on a quest to rid the world of dark magic, the source of both of their sufferings. ", "It was only when she learned his true intentions that she realized her mistake in trusting him. ", "He had been the cause of her mother’s death, and had used her to make his own dark magic stronger so that he could finish the war he’d already started on Dentaria. ", "When she’d put an end to that war by destroying most of his dark magic, he’d vowed his revenge. ", "She’d seen his powers up close, and knew how skilled he was, but she also knew she’d dealt a devastating blow to him, and that Biden was stronger and would always protect her. ", "She hadn’t seen nor heard from him in five years, and so figured the weakened worm had crawled into a hole to hide and plan. ", "He was a man who didn’t seem to mind waiting to act. ", "Whether he ever would or not, she didn’t know, but she refused to stop enjoying life by allowing fear to fill her heart, causing her to always be looking over her shoulder.", "\n\n“But you should still use caution,” Maya replied to her earlier statement.", "\n\nLakita sighed, giving in. “", "Agreed.”", "\n\nMaya had lowered her head next to hers as she’d spoken, and now Lakita reached up to stroke her chin.", "\n\nMaya smiled. “", "Perhaps you’d like to know why we were looking for you before our worry set in.”", "\n\n“Sure.”", "\n\n“Oh, just a message for you from a… King Teasel?” ", "Maya couldn’t hide her grin as she finished.", "\n\nLakita’s eyes lit up as excitement filled her. “", "Teasel? ", "Really?!”", "\n\nMaya nodded, seeming just as excited as Lakita felt.", "\n\n“What did he want? ", "I haven’t heard from him in awhile.” ", "Teasel was her best friend, and since she’d been staying in Dentaria more often to be with Maya, she missed his company.", "\n\n“Only to see you in Arenaria this morning.”", "\n\n“This morning? ", "We’re running late! ", "Better go!”", "\n\nMaya chuckled. “", "My thoughts exactly.” ", "She lowered her body closer to the ground and Lakita climbed on, sitting comfortably behind Maya’s neck, eager to head to Arenaria and see her friend, who just so happened to be the king of that country.", "\n\nTeasel sat at the desk in his royal study, looking over the papers before him. ", "As king of Arenaria, it was his responsibility to deal with many things. ", "It seemed his work was never done. ", "But he didn’t mind. ", "Though he’d not wanted to be king when first forced onto the throne almost eight years ago, he had grown to enjoy it. ", "He had a great responsibility to his people, and that sometimes weighed on him, but with that responsibility came the ability to help people and make them happy, and that was what he’d grown to enjoy so much about being king.", "\n\nThe bellow of a dragon pulled Teasel away from his work. ", "Glancing to one of the tall windows lining the wall to his right, he saw the great dragon fly by, and knew at once that it was Maya, his friend, Lakita’s, dragon. ", "This was a welcome distraction. ", "Smiling, he got to his feet and hurried from the room to meet the new arrival.", "\n\nThe castle of Arenaria wasn’t as large as the one in Dentaria, and wasn’t as attractive as the one in Durior, but it would always be Lakita’s favorite. ", "It had been the first castle she’d ever seen since venturing from her home in Altissima nearly eight years ago. ", "Since then she’d been to many places, but Altissima would always be home. ", "Arenaria was a close second, not only because it was quite close, but also because it was home to one of her most dear friends. ", "Now, he had summoned her here, and she would find out why.", "\n\nMaya landed gently before the welcoming castle, and Lakita looked to it. ", "Two of Teasel’s guardsmen were stationed on either side of the castle door, and stood waiting to welcome her within.", "\n\n“Hello Lakita! ", "Where’ve you been?” ", "One of them asked, pleasantly.", "\n\nShe turned to him with a smile. “", "I’m spending the week in Dentaria with Maya.” ", "She reached up reflexively to stroke the top of Maya’s head. “", "She misses me when I’m not around.”", "\n\nMaya groaned, pulling away from Lakita’s hand. ", "Lakita grinned at the dragon’s outrage, hearing the question in her moan. “", "Of course I miss you, too, Maya.” ", "She said, causing the two guardsmen to laugh.", "\n\n“Still amazes me how you can understand those amazing creatures,” one of the men said.", "\n\nLakita turned to him, ready to say she agreed, when the door between the two men suddenly burst open, king Teasel marching from within, a stern expression on his face.", "\n\n“Well, look what the dragon dragged in,” he said as he marched with purpose toward her, stopping before Maya and looking up. “", "You know, I’m not sure, but I could have sworn my message said to meet me here, this morning…”\n\nHe glared at her, clearly upset, and for a split second, Lakita almost grew worried. ", "But then Teasel couldn’t hold back his joy any longer, letting a wide grin spread across his face.", "\n\nLakita smiled, sliding off Maya’s back, her own joy at seeing Teasel again coming back to her. “", "I was a bit delayed, that’s all. ", "Quite a busy morning in Dentaria. ", "Maya had a lot to do.”", "\n\nShe moved away from Maya quickly, knowing the dragon would protest her words. ", "She wasn’t wrong. ", "The incensed dragon soon stomped her back foot on the ground, causing it to shake. ", "Lakita crouched to steady herself, grinning, as the two guardsmen at the door laughed.", "\n\nAs the slight vibrations stopped, Lakita stood, turning to Maya, still grinning. “", "What? ", "You did have a lot to do this morning. ", "What with finding me… And rescuing me…” She held up her fingers to count as she went along. ", "Now she frowned at Maya, growing a bit annoyed. “", "And lecturing me! ", "Could have done without that one, Maya.”", "\n\nShe was ready to go on, when Teasel interrupted. “", "She rescued you?”", "\n\nLakita turned to him and she could see the concern written in his eyes. ", "She smiled. “", "Doesn’t she always?”", "\n\nShe laughed, and Teasel joined in before speaking again. “", "If you didn’t go off on your own so often, maybe she wouldn’t have to.”", "\n\n“You two are worse than my mother!” ", "She said, shaking her head and moving away from the two of them, slightly annoyed over their behavior. “", "Honestly, you don’t let me do anything!”", "\n\nBehind her, Teasel addressed Maya. “", "So, where was she?”", "\n\nLakita was shocked, spinning around to face him in mild rage. “", "Teasel!”", "\n\nHe turned away from Maya to face her with a smile. “", "What? ", "I’ve a right to know. ", "You are one of my subjects.”", "\n\nLakita shook her head, firmly, her anger leaving her. ", "But she wouldn’t let Teasel know that. “", "Not quite. ", "I’m from Altissima, not Arenaria. ", "For which, I’m very thankful. ", "I don’t think I could stand being under your iron rule.”", "\n\nTurning to head toward the castle again, she stopped feigning her anger and allowed the grin playing at the edges of her lips to surface completely.", "\n\n“Well, then, I guess you wouldn’t be interested in learning that I’ve a new position open on my council and had hoped that you would fill it.”", "\n\nLakita stopped dead in her tracks, shocked. ", "Had she just heard him right? ", "She spun around to face him, unable to control her excitement. “", "Your council?! ", "An open position?”", "\n\nTeasel nodded, a smile on his face. ", "Lakita ran to him, ecstatic, letting out a joyful laugh. “", "And you really want me to fill it?”", "\n\nTeasel shrugged. “", "Why not? ", "You’ve a good head on your shoulders.” ", "He smiled again. “", "And I value your input.”", "\n\n“Oh, goodness! ", "Thank you, Teasel!” ", "She spun about, as it seemed the only way to keep from lifting off the ground in her excitement. ", "Never had she known such joy. “", "I can’t believe it,” she said quietly to herself, taking it all in. “", "A councilor to the king.”", "\n\nComing out of her spin, she turned to Teasel, still overflowing with joy. “", "When do I start?”", "\n\n“I had a feeling you might ask me that.” ", "He glanced over his shoulder at Maya. ", "The great dragon smiled, nodding.", "\n\nLakita frowned, looking to Maya. “", "Wait a minute… you knew?”", "\n\nMaya shrugged. “", "Oh, you know, Teasel and I are always conspiring against you.” ", "She laughed. “", "Especially when it comes to protecting you.”", "\n\nStill laughing, she spread her wings and took to the sky, flying away to the North. “", "See you later today. ", "Have fun at your meeting!” ", "She called as she glanced back over her shoulder.", "\n\nLakita waved, unable to keep from smiling. “", "Bye Maya!”", "\n\nTeasel was soon beside her. “", "We wanted to surprise you.”", "\n\nLakita turned to him. “", "I’m glad you did.”", "\n\n“Your first meeting is at noon,” Teasel continued, motioning toward the castle.", "\n\nLakita smiled, her great joy at what was to come returning to her. ", "She’d always wanted to do something great with her life, and she never knew what that would be. ", "She’d grown up in Altissima where women merely had kids and stayed at home to raise them. ", "She’d wanted to do so much more than that. ", "After venturing from home and learning of Arenaria, hope at finding another calling presented itself, but she still hadn’t found it. ", "She knew she was the daughter of Biden, and would help change the world for the better just by standing for that, but still she wanted more. ", "Now, it seemed, Biden had brought it to her. ", "Through Teasel. ", "Her smile widening, she hurried toward the castle.", "\n\nTeasel sat at the head of the long table in his council chamber. ", "Windows lined the wall to his left, the noonday sun spilling through them and onto the gathered council. ", "Twelve members made up his council, and Lakita was the newest member. ", "She sat in the first chair to his left, and he was very glad to have her there with him. ", "He knew she’d be a great addition to his council. ", "She was very wise and wasn’t afraid to push back if she didn’t agree with something.", "\n\nLooking around the room at the men gathered, from the stern and outspoken Calamus, to the quiet, kind Androwsii, Lakita seemed quite at ease among them. ", "From Arvense, the oldest member on the council, in his seventies, to Abutilon, the youngest, four years older than himself at twenty-nine, she didn’t seem nervous at all. ", "Though this had been a lighter meeting, with no serious decisions to be made, Teasel knew she’d be just as comfortable and confident if it had been. ", "He didn’t regret for one minute his decision to bring her on, even if there had never been a woman on the council before. ", "He also knew that none of the other councilors would regret it, either. ", "In fact, they hadn’t even put up a fight. ", "All knew Lakita, and knew she was perhaps exactly what they needed, but more than that, all of them trusted his decision.", "\n\n“And that brings us to our preparations for the Winter Celebration.” ", "Arvense’s voice drew Teasel from his thoughts.", "\n\nHe nodded, turning to the others. “", "Yes, it will be upon us before we know it. ", "Any suggestions to make this year special?”", "\n\n“What about Cake? ", "Cake goes good with any celebration,” Lakita said, her eyes twinkling with mischief.", "\n\nTeasel couldn’t stop a grin from spreading on his face as he met her eye. “", "Yes, everyone likes cake,” he repeated their words from five years ago, remembering their time together as they discussed another celebration.", "\n\nLakita turned away, and Teasel pulled himself from his thoughts, turning back to his councilors. “", "Cake shall be our chosen dessert for the evening, but what about entertainment?”", "\n\n“That would be the Singing Sanguine Sisters,” Calamus said, waving his hand as if to dismiss the idea, growing bored. “", "And we do that every year…”\n\nOne of the other men nodded in agreement. “", "It does grow old.”", "\n\n“What about someone new, then?” ", "Lakita asked.", "\n\nAbutilon turned to her to explain. “", "There is no one new. ", "Not much talent here in Arenaria other than farming and fighting.”", "\n\n“Then why not get talent from somewhere else?”", "\n\nAndrowsii nodded. “", "Not a bad idea.”", "\n\n“Where do you suggest?” ", "Arvense asked.", "\n\nLakita shrugged. “", "What about Dentaria?”", "\n\nTeasel turned to her, nodding. “", "Very well, then, since you’re a weekend regular in Dentaria, I charge you with finding out what talent they harbor.” ", "He turned back to address everyone. “", "As for the rest of you, continue to think of all that needs to be done for the celebration. ", "We’ll continue to discuss this at our next meeting.” ", "Finally, he turned to Gronovii, a man in his early forties, with light brown hair pulled back at his neck. “", "And, Gronovii, post notices for volunteers. ", "Have them report to Arvense and he’ll keep a running tally.”", "\n\nHe looked around the table, into the eyes of everyone gathered, then nodded, sure that no one had anything left unspoken, and that nothing more needed to be discussed. “", "Dismissed Gentlemen.”", "\n\nBeside him, Lakita cleared her throat. ", "He looked to her, unsure. ", "She raised her brows. “", "Oh,” he said in realization, feeling a bit embarrassed by her correction.", "\n\nHe turned back to the men, clearing his throat. “", "Dismissed, everyone.”", "\n\nLakita nodded with a pleased smile as she stood to file out of the room through the door to Teasel’s right along with everyone else. ", "Teasel shook his head. ", "She was certainly one to get what she wanted, even if it seemed a silly thing.", "\n\nTeasel remained seated, allowing everyone else to leave before him, organizing his notes as they left. ", "Arvense was the last to leave, looking to him, curiously. “", "Cake, my Lord?”", "\n\nTeasel smiled as the memory stirred again. “", "An inside joke, Arvense.”", "\n\nGetting to his feet, he motioned toward the door. ", "Arvense took the cue and started through it, Teasel following.", "\n\nStepping into the hall, he watched his councilors leave together. ", "His eyes caught on Lakita and he smiled. ", "Seeing his friend always made him smile. ", "She was talking with Abutilon, and as he watched them interact, he grew suddenly jealous, a frown replacing his smile.", "\n\nAs Lakita walked down the hall with the rest of Teasel’s councilors, Abutilon was soon by her shoulder, smiling brightly. “", "So, a councilor to the king… How do you like it?”", "\n\n“It’s great! ", "I love being in a position of such power,” she answered honestly, then stopped to think, trying to come up with the words to explain even to herself why she enjoyed it so much. “", "It feels so… useful.”", "\n\nShe smiled as she thought on that. ", "It really did feel great to be doing something worthwhile.", "\n\nAbutilon returned her smile. “", "Yes, we do help out a lot. ", "Like with this Winter Celebration. ", "It should be fun, huh?”", "\n\nLakita nodded, her joy mounting. “", "Indeed. ", "But I have to admit, I never knew the king’s councilors helped him with matters like this. ", "I mean, does he really need help planning special events?”", "\n\n“Of course! ", "We have to make sure we’re going to have a good time!” ", "Abutilon’s serious ruse fell away as he couldn’t keep the grin from his face.", "\n\nLakita couldn’t keep herself from laughing. “", "Oh, of course!”", "\n\nAs they continued down the hall, she laughed again, shaking her head as Abutilon chuckled lightly.", "\n\nSoon, Teasel was approaching them, and Abutilon quickly bowed to his king as they all stopped walking. “", "My Lord.” ", "Coming out of the bow, he turned to her, still smiling. “", "See you later, Lakita. ", "Tell Acanthus we’re still on for Monday night.”", "\n\nShe nodded, watching him go, then turned to Teasel.", "\n\n“So, how did you like your first meeting?” ", "He asked.", "\n\nShe yawned. “", "Oh, I don’t know. ", "It was a little boring. ", "Only…” She paused, unable to pretend to be uninterested any longer as a wide grin spread across her face. “", "The greatest thing that’s ever happened to me! ", "Thanks again, Teasel.”", "\n\nHe laughed at her excited outburst, nodding. “", "Don’t mention it.” ", "He motioned down the hall. ", "She started forward again and he took stride beside her. “", "You proved useful.” ", "He glanced to her, grinning. “", "The cake?”", "\n\nLakita laughed, enjoying the memory. “", "Did you ever find out if Biden likes it or not?”", "\n\n“Oh, yes, he does,” Teasel replied, nodding.", "\n\nTheir laughter followed them down the hall as they continued on toward the entrance hall.", "\n\nSoon Lakita was stepping out of the castle, watching as the other council members mounted their horses, which the stable hands had ready and waiting. ", "Arvense bid the men good-bye as they left, and they returned the farewell. ", "He was the only one among them who wouldn’t be leaving the castle, as Teasel had given him almost half the castle to call his own. ", "As she watched them go, Lakita still couldn’t believe she was among them, one of Teasel’s councilors. ", "She was sure she’d wake up from the dream any minute.", "\n\nShe stopped with Teasel, who still walked with her, as Maya landed gracefully nearby. ", "She wouldn’t be leaving on a horse. ", "Teasel glanced to the dragon. “", "Will you head back to Dentaria?”", "\n\nLakita shook her head. “", "No, now that I’m here, I’ll head home.” ", "She paused, glancing to Teasel. “", "Unless, you wanted to do something?”", "\n\n“Ha! ", "I’ve got plenty to do.” ", "He made a face. “", "Just nothing fun.”", "\n\nShe shrugged. “", "Well, maybe some other time.”", "\n\nShe moved to Maya and climbed up her side. ", "As she positioned herself comfortably on Maya’s back, Teasel waved, calling up to her. “", "Sorry!”", "\n\nShe glanced down to him. “", "Hey, you’re a king! ", "It comes with the job, right?!”", "\n\nHe laughed. “", "See you later!”", "\n\n“See you later!”", "\n\nMaya spread her wings and used them to lift herself into the air. ", "Lakita returned Teasel’s wave as the dragon turned west and started for Altissima.", "\n\nRuby O'Keeffe:\nI'm only a few chapters in and I love this book! ", "The writing style fits the setting and theme perfectly, and the descriptions of the characters, setting and more are beautiful! ", "I would love to read to read more from this author!", "\n\nMarijana1:\nThe melancholy present throughout this story has the power to influence and etch into the minds of the readers, to stay there and refuse to leave even after they have finished reading the story. ", "This is a deep, powerful story, making the readers wonder about everything – about love, about their e...\n\nKerryMI:\nOne would think the idea of vampire loving man has been over flogged, yet this story's fresh perspective on Vampires, how they live and how they connect with humans is so effortlessly narrated that it almost becomes truth. ", "Your writing was fast enough to keep me greedily turning each page but slo...\n\nuccowade:\nim not quite done....200 pages left. ", "very well written. ", "my only criticism would be the minor spelling, grammar and structure errors. ", "needs more polishing....regardless I was able determine how word or sentences were likely intended to be written. ", "errors we're relatively minor in frequency and...\n\naoifecollopy22:\nI loved how the author had the conflict come back later in the story. ", "Also how they passed time without going over anything. ", "That really helped move the story along. ", "This kept my up for a few hours. ", "YOU SHOULD READ THIS\n\nnehmeyasmin:\nIt was the most heart warming but heart breaking story ever and I want the next part right away. ", "It kept me hooked until the end even though there were a couple mistakes it was truly amazing. ", "I think this book could go far if it wanted to\n\nbloodrosemaiden:\nI love this book!! ", "I have read it several times and though there could be improvements I applaud the author. ", "I know positive feed back is appreciated!! ", "I enjoy reading about the learning the different character's backstories, and the affects in the overall story!", "\n\nArgyrisMetaxas:\nThrilling story which builds layer ontop of layer. ", "A few mis spellings every few chapters.", "What I found special was that it took a modern day problem and took it to its logical conclusion and plays this realism with gritting precision. ", "I'm always on edge ready to shout from adrenaline. ", "This is gre...\n\nOther Collections\n\nAbout Us:\n\nInkitt is the world’s first reader-powered book publisher, offering an online community for talented authors and book lovers. ", "Write captivating stories, read enchanting novels, and we’ll publish the books you love the most based on crowd wisdom." ]

{ "pile_set_name": "Pile-CC" }

[ 0.045221470296382904, 0.0009225738467648625, 0.163793683052063, 0.00195485632866621, 0.0007806033245287836, 0.0005793985328637064, 0.0008843884570524096, 0.0006080426392145455, 0.0010010622208938003, 0.0014590187929570675, 0.0006595310405828059, 0.0005998908309265971, 0.002408091677352786, 0.0010003304341807961, 0.0005631987587548792, 0.0008687616209499538, 0.0006600504275411367, 0.23980431258678436, 0.0009772274643182755, 0.0009912801906466484, 0.0007575780618935823, 0.0013401077594608068, 0.0011690881801769137, 0.0009047557832673192, 0.0007741757435724139, 0.0008879026281647384, 0.10094574093818665, 0.001298168208450079, 0.0008187118219211698, 0.0010710638016462326, 0.0009965853532776237, 0.0012467686319723725, 0.0012559735914692283, 0.012903311289846897, 0.05105473846197128, 0.0011470409808680415, 0.0006894479156471789, 0.000847269780933857, 0.050679709762334824, 0.07514587789773941, 0.1300206035375595, 0.04133884236216545, 0.00497602391988039, 0.014026828110218048, 0.0009053719695657492, 0.003799177473410964, 0.0019874838180840015, 0.004204117693006992, 0.0023237739223986864, 0.005896936170756817, 0.0018154459539800882, 0.0016323002055287361, 0.006096825934946537, 0.008707518689334393, 0.0020810498390346766, 0.010914371348917484, 0.0009382589487358928, 0.007977564819157124, 0.0013339936267584562, 0.0022505028173327446, 0.0009777662344276905, 0.0021697806660085917, 0.00715208426117897, 0.0038400699850171804, 0.0008803406963124871, 0.001659683301113546, 0.0009599504410289228, 0.0007373934495262802, 0.000703988247551024, 0.01000012643635273, 0.0010698370169848204, 0.013043084181845188, 0.0012114904820919037, 0.0008005258860066533, 0.0030104706529527903, 0.0007631639018654823, 0.0010201333789154887, 0.03320763632655144, 0.06344493478536606, 0.0034739868715405464, 0.02803364396095276, 0.0010152023751288652, 0.0025768503546714783, 0.0012128159869462252, 0.008246109820902348, 0.004394945688545704, 0.004848944954574108, 0.0011344569502398372, 0.000673005182761699, 0.0010451319394633174, 0.0006874218815937638, 0.0008675927529111505, 0.0029627950862050056, 0.000846139038912952, 0.008563785813748837, 0.000962186953984201, 0.002084816340357065, 0.0008877871441654861, 0.00162738177459687, 0.011879472061991692, 0.00626352708786726, 0.0007224028813652694, 0.01194324716925621, 0.0012445896863937378, 0.009467612020671368, 0.0016346756601706147, 0.0011444810079410672, 0.00219716620631516, 0.0010402565822005272, 0.002846337156370282, 0.009526178240776062, 0.0010255083907395601, 0.0027447256725281477, 0.0006172274006530643, 0.0008439167286269367, 0.0014052839251235127, 0.0008301949128508568, 0.0008573224768042564, 0.0009155164589174092, 0.0007960560033097863, 0.0011492430930957198, 0.0015780802350491285, 0.020300420001149178, 0.007358678616583347, 0.0015387939056381583, 0.003158794017508626, 0.01854676753282547, 0.0007910248241387308, 0.0007730094948783517, 0.001056903856806457, 0.05733198672533035, 0.0016255240188911557, 0.0009347060113213956, 0.4244839549064636, 0.009947072714567184, 0.0012736867647618055, 0.0008268660167232156, 0.05733198672533035, 0.041064292192459106, 0.0013209833996370435, 0.0007550881709903479, 0.0010019027395173907, 0.0007272726506926119, 0.001875412417575717, 0.0007885976228863001, 0.020646803081035614, 0.06079505756497383, 0.004585258662700653, 0.0021950274240225554, 0.006873825564980507, 0.001985680079087615, 0.0006005254690535367, 0.000726024154573679, 0.0006136599113233387, 0.004930209834128618, 0.0007638114620931447, 0.0010168013395741582, 0.0007014969014562666, 0.0010905649978667498, 0.0027556836139410734, 0.0007976137567311525, 0.0013486319221556187, 0.001919589121825993, 0.0006788122118450701, 0.0011866202112287283, 0.0006504100747406483, 0.0012108455412089825, 0.0007888013496994972, 0.0008730643894523382, 0.012585701420903206, 0.002992158755660057, 0.0008379754144698381, 0.0005969256162643433, 0.011585960164666176, 0.0008258529705926776, 0.000673204252962023, 0.0008673038682900369, 0.0010991879971697927, 0.0014094561338424683, 0.0007533951429650187, 0.005330619867891073, 0.0008802157826721668, 0.0007390143000520766, 0.0010003556963056326, 0.0009367539314553142, 0.0009261950617656112, 0.0007922601653262973, 0.0006231976440176368, 0.0016944563249126077, 0.000633204763289541, 0.0020256000570952892, 0.0012964876368641853, 0.001781503320671618, 0.0007406238000839949, 0.0009632114670239389, 0.001836290000937879, 0.013535892590880394, 0.0034135719761252403, 0.0015272791497409344, 0.012230048887431622, 0.0047501251101493835, 0.015111690387129784, 0.0006133347633294761, 0.0009863638551905751, 0.0007466527749784291, 0.0014013408217579126, 0.0025202599354088306, 0.01785171590745449, 0.0008602733141742647, 0.0008265891228802502, 0.0012594392756000161, 0.0012093493714928627, 0.0009936951100826263, 0.01936054788529873, 0.0012880910653620958, 0.0007138473447412252, 0.000964215025305748, 0.0007633828208781779, 0.001293250359594822, 0.0011740056797862053, 0.05928067862987518, 0.0009472187957726419, 0.0009798355167731643, 0.007458238862454891, 0.0008399811340495944, 0.0008089668699540198, 0.00138524838257581, 0.0008474510395899415, 0.003241246100515127, 0.6244761347770691, 0.007118641398847103, 0.06813222914934158, 0.0008376233745366335, 0.0015831377822905779, 0.06962905079126358, 0.0028542231302708387, 0.0034429661463946104, 0.000964215025305748, 0.0006954743294045329, 0.0393480621278286, 0.029448339715600014, 0.0012166713131591678, 0.0008619923028163612, 0.001008064136840403, 0.0005472309421747923, 0.007452786900103092, 0.015695124864578247, 0.0005750182317569852, 0.0031505869701504707, 0.0007084271055646241, 0.0019582915119826794, 0.005868005100637674, 0.0007940930081531405, 0.0013236230006441474, 0.001177963218651712, 0.0010964344255626202, 0.0009542987099848688, 0.0010402565822005272, 0.020024260506033897, 0.0007668077596463263, 0.0005744167719967663, 0.004810058046132326, 0.0006746311555616558, 0.0013978253118693829, 0.0014343863585963845, 0.0007438652100972831, 0.0012627857504412532, 0.0011219136649742723, 0.0014693491393700242, 0.0005861729150637984, 0.0019054426811635494, 0.0006164052756503224, 0.0008020565146580338, 0.0011076206574216485, 0.0008622158784419298, 0.014210136607289314, 0.0018158487509936094, 0.0018647840479388833, 0.0043324357829988, 0.0008145731408149004, 0.0008191453525796533, 0.0024985228665173054, 0.0008326790994033217, 0.005167858209460974, 0.0012511982349678874, 0.0007663443102501333, 0.000969124783296138, 0.0008618642459623516, 0.0008031926699914038, 0.0006960010505281389, 0.0007175611681304872, 0.02147565223276615, 0.0008279351168312132, 0.000668572960421443, 0.0006850015488453209, 0.000725496734958142, 0.0007668457692489028, 0.0009085836354643106, 0.0007273925584740937, 0.0015471286606043577, 0.0007928159320726991, 0.0008203692850656807, 0.0008034681668505073, 0.0006115728756412864, 0.0007511517615057528, 0.0010179702658206224, 0.000586027919780463, 0.0009123490308411419, 0.0010573272593319416, 0.001582132768817246, 0.0006441035657189786, 0.0005752448923885822, 0.001310925930738449, 0.0008238263544626534, 0.00476102577522397, 0.0007479224586859345, 0.0015423092991113663, 0.0008082861313596368, 0.00514574907720089, 0.0005857068463228643, 0.001437066006474197, 0.0007473514415323734, 0.001870242296718061, 0.0005650136154145002, 0.0015043711755424738, 0.0007280143327079713, 0.001308491569943726, 0.0007776686688885093, 0.0009029575157910585, 0.0007829316891729832, 0.0009820444975048304, 0.0008254325366578996, 0.000994415837340057, 0.0008838096400722861, 0.0010596768697723746, 0.0008028770098462701, 0.0012187091633677483, 0.0009286343702115119, 0.0010142911924049258, 0.0007918326300568879, 0.000730434781871736, 0.0005542062572203577, 0.001838211202993989, 0.0007433535647578537, 0.0010806971695274115, 0.0006472428212873638, 0.0006532341940328479, 0.0008795772446319461, 0.0006774963112547994, 0.008468994870781898, 0.0007684804731979966, 0.0019692399073392153, 0.0007772119133733213, 0.0012656099861487746, 0.027304241433739662, 0.0059473272413015366, 0.0006469952058978379, 0.0010442502098158002, 0.002871633507311344, 0.0007101436494849622, 0.001010250300168991, 0.009056723676621914, 0.0007189781172201037, 0.0017193607054650784, 0.0008159535937011242, 0.0005968707264401019, 0.0008380280341953039, 0.001654403517022729, 0.001292968401685357, 0.000713834073394537, 0.0006295872735790908, 0.000746321224141866, 0.0005906529841013253, 0.0005446299910545349, 0.0008323502261191607, 0.0005547418259084225, 0.0007893667789176106, 0.0008652370306663215, 0.0007124642725102603, 0.000812071724794805, 0.0006793626234866679, 0.0006927885115146637, 0.0009388260659761727, 0.000684242753777653, 0.01687529683113098, 0.015117539092898369, 0.0011573756346479058, 0.0009622052311897278, 0.0007598309894092381, 0.000893490738235414, 0.001030816463753581, 0.0009557072771713138, 0.002017759485170245, 0.0010777320712804794, 0.0007134628249332309, 0.0015600193291902542, 0.0011194433318451047, 0.0010107880225405097, 0.0032903526443988085, 0.001922663301229477, 0.0024907842744141817, 0.0006690309965051711, 0.0006683015963062644, 0.0009913287358358502, 0.018345870077610016, 0.0008353210287168622, 0.0009938149014487863, 0.0009256221237592399, 0.0012194744776934385, 0.0006448682397603989, 0.0012273589381948113, 0.0007137769716791809, 0.0024920508731156588, 0.0012492643436416984, 0.0007562714163213968, 0.004536740481853485, 0.0016570014413446188, 0.006027145776897669, 0.0007455726736225188, 0.008140459656715393, 0.0011414358159527183, 0.02258717454969883, 0.004349039867520332, 0.004384024068713188, 0.000758286623749882, 0.0012062425957992673, 0.0047682179138064384, 0.0007277916301973164, 0.13210074603557587, 0.0011471223551779985, 0.0010312894592061639, 0.0007365590427070856, 0.001333615742623806, 0.004937192890793085, 0.0010381872998550534, 0.0009802370332181454, 0.1350509077310562, 0.0012349312892183661, 0.0017520231194794178, 0.001401376910507679, 0.0013678226387128234, 0.0021864697337150574, 0.0009954158449545503, 0.0006682223174721003, 0.0005504752043634653, 0.0005704138311557472, 0.0006196603062562644, 0.0007641587289981544, 0.0020842240191996098, 0.0005848302389495075, 0.0009121643379330635, 0.0006797375390306115, 0.0006664478569291532, 0.0006145864608697593, 0.0005506087327376008, 0.0007958448259159923, 0.0006067472859285772, 0.0005730106495320797, 0.000931217975448817, 0.0005054266657680273, 0.0006848386838100851, 0.0005409045843407512, 0.0006856409600004554, 0.0006409348570741713, 0.000609164999332279, 0.0027253907173871994, 0.0006089595262892544, 0.0008449321612715721 ]

[ "1. ", "Field of the Invention\nThe present invention relates to a recording/reproducing device, and more particularly to a recording/reproducing device which can securely load a tape cassette to a given cassette loading position.", "\n2. ", "Description of the Related Art\nIn a recording/reproducing device using a tape cassette having a cassette case, tape reels rotatably provided in the cassette case, and a tape as a recording medium wound around the tape reels, the tape cassette is positioned in the recording/reproducing device by engaging positioning pins provided in the recording/reproducing device with positioning pins formed in the tape cassette.", "\nConventionally, until the positioning holes start engaging with the positioning pins, the tape cassette is positioned only by a cassette holder for holding the tape cassette and moving it to a given cassette loading position. ", "The related art of the present invention is known from U.S. Pat. ", "No. ", "5,316,236 and European Patent Laid-open No. ", "0,572,925 (corresponding to U.S. patent application Ser. ", "No. ", "67,811, filed May 27, 1993, now issues as U.S. Pat. ", "No. ", "5,390,870 to the present applicant.", "\nHowever, in the recording/reproducing device as mentioned above, until the positioning holes of the tape cassette start engaging with the positioning pins, a position error of the tape cassette decided in the cassette holder is large. ", "In such a specification that the position error of the tape cassette permitted until it is loaded to the given cassette loading position is small, it is difficult to design a recording/reproducing device meeting this specification.", "\nIn particular, while there is a tendency to reduce the size of the tape cassette at present, the size of a device such as LED itself is not reduced. ", "Accordingly, the clearance between each positioning hole and its corresponding positioning pin must be increasingly reduced, and the difficulty of designing of the recording/reproducing device becomes remarkable.", "\nFurther, known is another type of recording/reproducing device allowing selective loading of two different-sized tape cassettes wherein the space between a supply reel and a take-up reel for winding a tape is different. ", "In this recording/reproducing device, two reel tables adapted to individually engage with the supply reel and the take-up reel are moved to positions corresponding to the two reels of each of the different-sized tape cassettes. ", "Accordingly, the positioning of each tape cassette in the cassette holder is more difficult than that in a recording/reproducing device using a single-sized tape cassette." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0009391900966875255, 0.0006258409703150392, 0.001185585861094296, 0.0006816685199737549, 0.0006950416718609631, 0.0006489763036370277, 0.0013785817427560687, 0.0006521163159050047, 0.0006477796705439687, 0.0013785817427560687, 0.0006925852503627539, 0.0013785817427560687, 0.0006097316509112716, 0.000634911353699863, 0.0006859739660285413, 0.0006261213566176593, 0.0005943689029663801, 0.0007704076706431806, 0.0006870587239973247, 0.0006376343662850559 ]

[ "13 Fishing Wicked Ice Rod/Reel Combos offer tremendous value with an ultra-light front drag spinning reel and a premium quality ice rod. ", "These combos feature a Wicked Ice Spinning Reel in a regular stem or long stem version with an aluminum spool and a five stainless steel ball bearing drive system for smooth operation. ", "The instant anti-reverse helps to ensure positive hook sets. ", "An interchangeable handle allows for either left or right handed retrieve.", "\n\nThe Wicked Ice rod features solid Toray Carbon blanks and Evolve Performance guides, these rods are sure to feel every bite. ", "The handles feature the Evolve Carbon-Divide up-locking reel seat.", "\n\nFeatures of 13 Fishing Wicked Ice Rod/Reel Combos include:\n\nComposite Body\n\nAluminum Spool and Handle\n\nInstant Stop Anti-Reverse\n\nFat Bail Design\n\nLong Stem - Model WLC\n\nSpecifications for 13 Fishing Wicked Ice Rod/Reel Combos can be seen on the Specifications tab above.", "\n\nSpecifications\n\n13 Fishing Wicked Ice Rod/Reel CombosSpecifications\n\nModel\n\nLength\n\nAction\n\nRetrieve(Right, Left,or Both)\n\nGearRatio\n\nReelWeight(oz.)", "\n\nMonoCapacity(lb./yds.)", "\n\nBearings\n\nWC20SUL\n\n20\"\n\nSuperUltra Light\n\nBoth\n\n4.8:1\n\n5.2\n\n4/1606/1208/70\n\n5BB\n\nWC24UL\n\n24\"\n\nUltra Light\n\nBoth\n\n4.8:1\n\n5.2\n\n4/1606/1208/70\n\n5BB\n\nWC25L\n\n25\"\n\nLight\n\nBoth\n\n4.8:1\n\n5.2\n\n4/1606/1208/70\n\n5BB\n\nWLC25L(Long Stem)\n\n25\"\n\nLight\n\nBoth\n\n4.8:1\n\n5.2\n\n4/1606/1208/70\n\n5BB\n\nWC25M\n\n25\"\n\nMedium\n\nBoth\n\n4.8:1\n\n5.2\n\n4/1606/1208/70\n\n5BB\n\nWC26ML\n\n26\"\n\nMed. ", "Light\n\nBoth\n\n4.8:1\n\n5.2\n\n4/1606/1208/70\n\n5BB\n\nWLC26ML(Long Stem)\n\n26\"\n\nMed. ", "Light\n\nBoth\n\n4.8:1\n\n5.2\n\n4/1606/1208/70\n\n5BB\n\nWC27UL\n\n27\"\n\nUltra Light\n\nBoth\n\n4.8:1\n\n5.2\n\n4/1606/1208/70\n\n5BB\n\nWLC27UL(Long Stem)\n\n27\"\n\nUltra Light\n\nBoth\n\n4.8:1\n\n5.2\n\n4/1606/1208/70\n\n5BB\n\nWC31MH\n\n31\"\n\nMed. ", "Heavy\n\nBoth\n\n4.8:1\n\n5.2\n\n4/1606/1208/70\n\n5BB\n\nReviews\n\nReview Summary\n\n4.8\n\n( 5 Reviews )\n\nof customers would recommend this product.100%\n\nReviewer Profile:\n\nPros\n\nQuality rod\n(3)sensitive\n(3)anti reverse reel\n(2)\n\nCons\n\nNone\n(3)\n\nBest Uses\n\nGreat!", "\n\n2/23/2015\n\nVerified Buyer\n\nsharps101\n\nCentral PA\n\nAbout Me:none\n\nI have 5 ice rods and this is the nicest one I own. ", "The reel is very smooth and overall it is a great set up. ", "Highly recommend!", "\n\nI bought this as I wanted to retire a pre 1960 jigging rod. ", "I have nothing but good to say about this rod very good balance and you can feel the hits very good. ", "I bought the medium it is a little narrow but there is a lot of back bone in this rod\n\nThe rod is really nice and has a great action. ", "I got the medium and the action is perfect. ", "This rod feels very sensitive. ", "The reel is your average reel. ", "Not great and not bad. ", "Nothing wrong with it. ", "I'm not one to normally order combos. ", "If you think about it you only paying about $18 bucks for the reel so it's good deal for a solid reel. ", "The finish and detail is really well done. ", "Wraps and guida are nice and the quality is there.", "\n\nThank you for submitting your product review on FishUSA.", "\n\nYour review is awaiting moderation. ", "Your review will become visible after it has been approved by FishUSA.", "\n\nYour email address is not verified.", "\n\nAn email has been sent to the email address you provided. ", "If you would prefer to use a different email address, simply submit the email below and we'll send you an email. ", "Follow the link included in the email to verify your email address.", "\n\nBy verifying your email address you will be a Verified Reviewer whenever you submit product reviews using that email address.", "\n\nVerified Reviewer\n\nSubmit a different email address:Please enter a valid email address\n\nIf you have purchased this product from us, please enter the email address that you used when purchasing the product and you will become a Verified Buyer." ]

{ "pile_set_name": "Pile-CC" }

[ 0.000703986850567162, 0.0009072479442693293, 0.0005933712818659842, 0.0006081347819417715, 0.0007212873897515237, 0.0007570303278043866, 0.0007197109516710043, 0.0007077131303958595, 0.0007754235411994159, 0.0009752277401275933, 0.0007440761546604335, 0.000901409424841404, 0.0006443015881814063, 0.0006395908421836793, 0.0006289102020673454, 0.0007005191873759031, 0.006962025072425604, 0.0005558136035688221, 0.0007066917605698109, 0.000568774004932493, 0.0041235885582864285, 0.008728749118745327, 0.0008263583877123892, 0.0008062864071689546, 0.001441699219867587, 0.0006294220220297575, 0.0005396816995926201, 0.0005552319344133139, 0.0005827478016726673, 0.0005788804846815765, 0.0006258427747525275, 0.0007111767772585154, 0.0005583285237662494, 0.0005760572385042906, 0.0005757797043770552, 0.0005355803878046572, 0.0005093608633615077 ]

[ "NURSERY WALL ART TO CHERISH - Our modern nursery decor makes the perfect gift for doting new parents. ", "With an adorable elephant design and contemporary art theme, this nursery art will brighten any nursery and be cherished by parents and children for years!", "\n\nMuralMax Personalized wall art & customization all takes place in our South Florida Studio, where we use only the best reproduction method available to the industry.", "\n\nTo order simply select any of the available size's in the dropdown menu. ", "All of our Paper Print Products come ready for framing. ", "Frames Not Included:\n\nMuralmax Paper Prints have the texture of Paper Canvas which is subtle, yet it will add dimension to your image. ", "Our Paper Canvas has a microporous photo matte coating with 60lb x 11mill of the highest quality.", "\n\nAll of our Paper Prints come ready for framing, while adding elegance & character to your home decor & will last a life time.", "\n\nYour satisfaction is guaranteed: Our Personalized Paper Prints make the PERFECT PRESENT for any occasion, and are Proudly Made in the U.S.A.\n\nPurchasing & Delivery\n\nBefore you make your purchase, it’s helpful to know the measurements of the area you plan to place the artwork.", "\n\nDouble - Check\n\nDouble check the personalization information you enter in the text fields.", "\nWe can only fore fill your order based on what you have entered.", "\n\nDelivery\n\nBecause we make most of our products upon order, items typically leave our building within 3-5 business days. ", "If you opt to pay for quicker shipping, the ship time would be from the date the order leaves our building. ", "We do offer Priority Shipping on some customer favorites.", "\n\nProfessional Shipping\n\nYour canvas print will be shrink-wrapped and placed in a custom packaging that will guarantee your print arrives safely.", "\n\nDamaged Product\n\nRarely, items get damaged during shipping. ", "If you receive a damaged item please contact us within 5 days of receipt at sales@muralmax.com We will need specific details of the damage and a photo of the product prior to sending a replacement. ", "All damage must be reported within 5 days of receiving order.", "\n\nPayment Information\n\nSecure Payment Processing. ", "We accept credit card payments from Visa, MasterCard, Discover and American Express. ", "We also accept PayPal. ", "Due to the custom nature of many of our products, we charge at the time your order is placed." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0024746209383010864, 0.0008221148164011538, 0.0005601277225650847, 0.0006632224540226161, 0.0005536191747523844, 0.0005662601324729621, 0.0006344467401504517, 0.0006284928531385958, 0.0005231195827946067, 0.0006606709212064743, 0.0006267752032727003, 0.0005971529171802104, 0.0006027256604284048, 0.0005411673337221146, 0.0005719540058635175, 0.0009060255833901465, 0.0006273501203395426, 0.0012563546188175678, 0.0006182418437674642, 0.0005721148336306214, 0.0006124784122221172, 0.0005557717522606254 ]

[ "上田さやか最新番号\r\n【RD-290】淑女妻の恥じらい 焦らされ続けた女はむせび泣きながら乱れていく</a>2009-07-03アテナ映像$$$ATHENA105分钟" ]

{ "pile_set_name": "Github" }

[ 0.0011162401642650366 ]

[ "Perforation of the upper and lower segments of atretic esophagus (type C) secondary to nasogastric tube insertion.", "\nWe report an unusual case of nasogastric tube, during insertion, perforating the upper and lower segments of atretic esophagus (type C) and ending up in the stomach. ", "Symptoms and imaging of the newborn are presented and the causative factors of the incident discussed." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.005409703589975834, 0.0026396182365715504, 0.0005365476245060563 ]

[ "Q:\n\nhow to get ip address of iphone programmatically\n\nI got a webserver up and running in iphone by using Mongoose. ", "But the problem is how can I get the ip address of my iphone/ipad to let the user's know where they can access the server. ", "I found that [NSHost addresses] can do the job but I am developing for app store and this is undocumented method.", "\n\nA:\n\n#include <ifaddrs.h>\n#include <arpa/inet.h>\n\n// Get the INTERNAL ip address\n\n- (NSString *)getIPAddress {\n\n NSString *address = @\"error\";\n struct ifaddrs *interfaces = NULL;\n struct ifaddrs *temp_addr = NULL;\n int success = 0;\n // retrieve the current interfaces - returns 0 on success\n success = getifaddrs(&interfaces);\n if (success == 0) {\n // Loop through linked list of interfaces\n temp_addr = interfaces;\n while(temp_addr !", "= NULL) {\n if(temp_addr->ifa_addr->sa_family == AF_INET) {\n // Check if interface is en0 which is the wifi connection on the iPhone\n if([[NSString stringWithUTF8String:temp_addr->ifa_name] isEqualToString:@\"en0\"]) {\n // Get NSString from C String\n address = [NSString stringWithUTF8String:inet_ntoa(((struct sockaddr_in *)temp_addr->ifa_addr)->sin_addr)];\n\n }\n\n }\n\n temp_addr = temp_addr->ifa_next;\n }\n }\n // Free memory\n freeifaddrs(interfaces);\n return address;\n\n} \n\nhttps://web.archive.org/web/20160527165909/http://www.makebetterthings.com/iphone/how-to-find-ip-address-of-iphone/\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.006905152462422848, 0.0009428522316738963, 0.0006353904609568417, 0.0021444489248096943, 0.008333657868206501 ]

[ "Q:\n\nRegex to extract string between quotes\n\nI'm trying to extract a string between two quotes, and I thought I had my regex working, but it's giving me two strings in my GroupCollection, and I can't get it to ignore the first one, which includes the first quote and ID=\nThe string that I want to parse is\n\nTest ID=\"12345\" hello\n\nI want to return 12345 in a group, so that I can manipulate it in code later. ", " I've tried the following regex: http://regexr.com/3bgtl, with this code:\nnodeValue = \"Test ID=\\\"12345\\\" hello\";\nGroupCollection ids = Regex.", "Match(nodeValue, \"ID=\\\"([^\\\"]*)\").Groups;\n\nThe problem is that the GroupCollection contains two entries:\n\nID=\"12345\n12345\n\nI just want it to return the second one.", "\n\nA:\n\nUse positive lookbehind operator:\nGroupCollection ids = Regex.", "Match(nodeValue, \"(?", "<=ID=\\\")[^\\\"]*\").Groups;\n\nYou also used a capturing group (the parenthesis), this is why you get 2 results.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006119497702457011, 0.0006474867695942521, 0.0008787550614215434, 0.001172068645246327, 0.0006595064769499004, 0.0007262742728926241, 0.001995444530621171 ]

[ "Food\n\nFoodWhat?! ", "Sourness is brought on by the style of acids , akin to vinegar in alcoholic drinks. ", "Sour foods embrace citrus , particularly lemons , limes , and to a lesser degree oranges Sour is evolutionarily vital as it’s a sign for a food that will have gone rancid on account of micro organism. ", "21 Many foods, nevertheless, are slightly acidic, and assist stimulate the taste buds and improve taste.", "\n\nEat Zinc rich foods: Oysters, nuts, and seeds are wealthy in zinc and vitamin B. Each the constituents are essential for manufacturing of Testosterone (sex hormone). ", "Testosterone will increase sexual desire in men. ", "The Eat Well Information helps consumers find regionally grown and sustainably produced food. ", "Listings embody farms, eating places, shops, farmers’ markets, and CSAs all through the United States.", "\n\nInformation on food intake, food waste, and agricultural practices in producing sure forms of foods had been collected from various government sources, the report stated. ", "In the meantime, eating regimen quality was assessed utilizing the 2015 Healthy Eating Index, which is produced by the USDA’s Heart for Nutrition Policy and Promotion.", "\n\nMore than 40 million Americans receive SNAP advantages, making it one of the greatest security web applications within the U.S., and because it’s relatively easy to qualify, it’s most likely the most aware of changes in economic need. ", "Although it’s referred to as a farm bill,” food stamp spending represents about 80 p.c of the full price of the legislation.", "\n\nAlthough allergies to milk, egg, wheat and soy often resolve in childhood, kids seem like outgrowing some of these allergy symptoms more slowly than in earlier many years, with many kids still allergic past age 5. ", "Sign as much as receive email updates, action alerts, healthy eating suggestions, promotions to assist our work and extra from EWG! ", "You can choose out at any time.", "\n\nSo right here I will be listing the foods that may naturally raise your physique’s estrogen ranges or cut back your physique’s testosterone ranges and make it tougher to burn chest fats. ", "The following pointers not only apply to those with Gynecomastia, but in addition to these with Pseudogynecomastia as a result of I embody fatty foods in the “keep away from it” checklist." ]

{ "pile_set_name": "Pile-CC" }

[ 0.02294921688735485, 0.0015268879942595959, 0.0013365624472498894, 0.0005454447818920016, 0.0009869919158518314, 0.3355458676815033, 0.0005527428584173322, 0.0005968547775410116, 0.0006715005147270858, 0.0005667228251695633, 0.0005679370951838791, 0.0006424190942198038, 0.0012208643602207303, 0.0020566186867654324, 0.0005731895216740668, 0.5739917159080505, 0.04635905101895332 ]

[ "DANCE MORE DANCES! ", "@Fratelli Lounge & Club\n\nThis Friday and Saturday are you coming to Dance more Dances? ", "Fratelli Lounge & Club hosts the heroes of sounds, the masters of all our unforgettable nights, the perfect entertainers in town , DJ John Junior and DJ Tony Q.\n\nWe all know that in Fratelli we’re dancing to express, not to impress. ", "So, get ready for two stunning nights to remember because our deejays are on going to put into motion unseen forces that guide you trough the dance floor!", "\n\nSee you this weekend, after 11.30pm! ", "WARNING: Dangerous night ahead!", "\n\nREZERVATIONS\n\nFree entrance until 00.00. ", "For reservations: officeiasi@fratelli.ro / 0756.56.11.11. ", "Fratelli reserves the right to select its clients, due to the capacity of the locations and the reservation list." ]

{ "pile_set_name": "Pile-CC" }

[ 0.013934813439846039, 0.0012358910171315074, 0.0010536802001297474, 0.003675582818686962, 0.0010184873826801777, 0.008066858164966106, 0.0007020573248155415, 0.000695121823810041, 0.00055148039245978 ]

[ "The investigators hypothesize that centenarians, by virtue of their rarity and their ability to live the vast majority of their lives in excellent health, are a valuable cohort for the study of environmental and genetic factors which attenuate the rate of aging and which facilitate a delay in onset or even escape from diseases normally associated with aging. ", "Evidence is also rapidly accumulating supporting the familiality of extreme longevity (shared genes and environmental factors). ", "However, few centenarian studies have been performed and their design and methods vary to the degree that correlations are impossible. ", "Furthermore, valuable opportunities for the collection, storage and analyses of genetic material have been missed. ", "Drawing upon the experience of two well-established population-based centenarian studies, the aims of this R21 planning grant are as follow: (I) to establish a network of epidemiologists, clinicians, analysts and geneticists at five coordinated study sites, which will be called the \"Centenarian Studies Network\"; (II) to design and produce a program project application which links five centenarian studies; in addition to having common protocols and standardized instruments and procedures, the Network will have central sites for coordination, data management and analyses, genotyping, establishment of cell lines and storage of genetic material; and (III) to produce preliminary data in support of the program project application. ", "The proposed five study centers of the Network, which will ensure the creation of phenotypic and genetic data and material \"banks\" for approximately one thousand centenarians, are as follow: (1) the Ashkenazi Jews study (n=200) in New York and Israel representing a well-established founder population; (2) the Japanese Americans (n=300) in the Honolulu Asia Aging study which have been longitudinally studied for the past thirty years; Japanese Americans have the longest life expectancy of any ethnic group in the U.S., and this site brings significant epidemiological and data management experience and expertise to the proposed collaborative effort; (3) the centenarians of Nova Scotia (n=200) which appear to have twice the prevalence rate of other industrialized areas; (4) 4) the Sardinian Centenarian Study (n=200), and (5) the New England Centenarian studies (n=100) which are well-established and bring to the collaborative effort a wealth of experience in the conduct of population-based phenotypic studies of centenarians. ", "A Genetics Epidemiology Committee, co-directed by experts in the genetics of aging, Drs. ", "Jan Vijg and Claudio Franceschi, and which also includes geneticists from the study sites (Louis Kunkel from Harvard Medical School and Leonid Kruglyak from the Whitehead Institute) will guide the genotyping and genetic material banking effort." ]

{ "pile_set_name": "NIH ExPorter" }

[ 0.0007125118281692266, 0.0005898007075302303, 0.0006647186819463968, 0.0005466772709041834, 0.0005766026442870498, 0.0005895638023503125, 0.000624795095063746, 0.0005857082433067262 ]

[ "Speaking at the Heritage Foundation, a conservative Washington think tank, Pompeo rattled off a 12-point list of what he called “basic requirements” of a new way forward with Iran (really little more than a rehashing of the decades-old laundry list of Washington’s beefs with the country).", "\n\nPompeo wants Iran to give up its ballistic missile program, cease and desist its involvement in every country it’s currently involved in, completely shut down its nuclear enrichment, and at the same time release Americans unjustly imprisoned in Iran – all just because we say so.", "\n\nSounds great. ", "But it’s also completely divorced from reality.", "\n\nIf Iran would only capitulate on all 12 points, Pompeo declared, it could look forward to rejoining what Pompeo referred to as the “league of nations.” (", "Note: The League of Nations, the precursor of today’s United Nations, existed from 1920 to 1946.)", "\n\nPompeo, though, promised that Iran would face the toughest economic sanctions in history if it fails to comply. “", "After our sanctions come into full force, it will be battling to keep its economy alive,” he said. “", "Iran will be forced to make a choice — either fight to keep its economy off life support at home or keep squandering precious wealth on fights abroad. ", "It will not have the resources to do both.”", "\n\nWhat remains entirely unclear is how the Trump administration plans to pull this off without the support of key U.S. allies in the European Union who are all committed to remaining in the nuclear deal with Iran and ramping up commercial ties with it.", "\n\nOddly, officials in the administration consistently point to their solidarity with the people of Iran as the main motivator in targeting Tehran’s bad behavior, and Pompeo’s speech was no exception. “", "It is America’s hope that our labors toward peace and security will bear fruit for the long-suffering people of Iran. ", "We long to see them prosper and flourish as in decades past, and as never before,” Pompeo said.", "\n\nPompeo referred to recent anti-government protests in Iran that he says “show that the Iranian people are deeply frustrated with their own government’s failures. ", "The Iranian economy is struggling as a result of bad Iranian decisions. ", "Workers aren’t getting paid, strikes are a daily occurrence, and the rial is plummeting. ", "Youth unemployment is at a staggering 25 percent.”", "\n\nAll of these things may be true. ", "But there is nothing new about any of them, and assuming that this time around the Iranian people can compel their government to bend to America’s will seems — at least to anyone who has spent significant time in Iran in recent decades — fantastical.", "\n\nThe reality is that the punitive measures to come could hurt Iranian officials more than previous ones, but the real victims again will be average Iranians. ", "And let’s be honest, that’s the whole point.", "\n\nPompeo tipped his hand in that direction when asked by the Heritage Foundation’s president, Kay Coles James, about a time frame on rolling out new anti-Iran sanctions.", "\n\nHe couldn’t provide one and put the onus on the people of Iran who, he said, “will get to make a choice about their leadership. ", "If they make the decision quickly, that would be wonderful. ", "If they choose not to do so, we will stay hard at this until we achieve the outcomes that I set forward today.”", "\n\nThat translates roughly as, “Topple your regime, or we’re going to do it for you.”", "\n\nIran is certainly responsible for much of what the Trump administration is accusing it of, so it seemed superfluous to add Bush-era accusations about Iran’s support of the Taliban and its supposed harboring of top al-Qaeda officials.", "\n\nBut it’s hard to agree with Pompeo’s assertion that Iran represents a threat to the American way of life, because of its nefarious activities in a contentious region that is home to U.S. allies who are better armed and better funded than Iran.", "\n\nPompeo’s remarks sounded eerily akin to the sorts of statements that Donald Rumsfeld and others were making in the run-up to the invasion of Iraq. ", "The maximalist rhetoric after the 9/11 attacks resonated with many Americans precisely because we felt threatened.", "\n\nThe major difference this time around is that Pompeo sounds less confident about the case he’s trying to make. ", "I just can’t work out whether that’s because he understands that he doesn’t really know what he’s talking about, or because he knows his audience is a more knowledgeable and skeptical one than the George W. Bush administration faced in 2003.", "\n\nWe are a participant in the Amazon Services LLC Associates Program, an affiliate advertising program designed to provide a means for us to earn fees by linking to Amazon.com and affiliated sites.", "\n\nJason RezaianJason Rezaian is a writer for Global Opinions. ", "He served as The Post's correspondent in Tehran from 2012 to 2016. ", "He spent 544 days unjustly imprisoned by Iranian authorities until his release in January 2016. ", "Follow" ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006363349384628236, 0.009890357032418251, 0.0005726336967200041, 0.0008874713093973696, 0.0006997968885116279, 0.0005761831998825073, 0.00314332009293139, 0.0011279263999313116, 0.004577022045850754, 0.0007252623909153044, 0.0006619197665713727, 0.0006693906616419554, 0.0026979295071214437, 0.0007119504734873772, 0.00118251983076334, 0.0015395061345770955, 0.03812994062900543, 0.018865281715989113, 0.0005877549410797656, 0.0006531765684485435, 0.01761050894856453, 0.0007253805524669588, 0.0006848279153928161, 0.0023557955864816904, 0.000541168381460011, 0.0005453535704873502, 0.022259805351495743, 0.0006976576987653971, 0.0009945811470970511, 0.0007237407262437046, 0.0008915700600482523, 0.0006165879894979298, 0.0006652703741565347, 0.000529151817318052, 0.0006814580410718918, 0.0005866560386493802, 0.0024284936953336, 0.0017066417494788766 ]

[ "Ozone air pollution and daily mortality in Genoa, Italy between 1993 and 1996.", "\nThe association between ozone (O3) and daily mortality was investigated in Genoa, an Italian city characterized by a Mediterranean climate and a high prevalence of elderly inhabitants. ", "The O3 effect, adjusted for long time trend, seasonality and weather, was assessed using Poisson regression modelling, allowing for overdispersion and autocorrelation, and expressed as mean variation percent of daily mortality per 50 microg/m3 increase (MV). ", "Significant MVs for overall (+4.0%) and cardiovascular (+7.2%) mortality were detected at 1-day lag. ", "The effects were stronger in the warmer season (May-October). ", "Similar estimates were found after restricting the analyses to the elderly (>or=75 years). ", "Furthermore, in this group, higher MVs were observed for total mortality at 2-day lag. ", "A statistically significant synergistic effect between O3 and temperature was observed for cardiovascular mortality, particularly in elderly people, with an evident increase in mortality risk above 26 degrees C (MV +30.0% for the whole population and +40.0% for the elderly, respectively). ", "This investigation highlights the importance of taking local climatic and demographic features into account when comparing different time-series studies, and substantiates the influence of photochemical pollution on mortality trends in small urban areas." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0005685222567990422, 0.0005260993493720889, 0.0005819657235406339, 0.0007473250152543187, 0.0005900554242543876, 0.0005717087187804282, 0.0006591351702809334, 0.000578627863433212, 0.0005523970467038453 ]

[ " COURT OF APPEALS OF VIRGINIA\n\n\nPresent: Judges Benton, Willis and Bray\nArgued at Richmond, Virginia\n\n\nMARC KLOKOW, S/K/A\n MARC SERGE KLOKOW\n\nv. Record No. ", "2659-94-3 MEMORANDUM OPINION * BY\n JUDGE JERE M. H. WILLIS, JR.", "\nCOMMONWEALTH OF VIRGINIA FEBRUARY 13, 1996\n\n\n FROM THE CIRCUIT COURT OF CAMPBELL COUNTY\n J. Michael Gamble, Judge\n Bryan K. Selz (Overbey, Hawkins & Selz, on\n brief), for appellant.", "\n\n H. Elizabeth Shaffer, Assistant Attorney\n General (James S. Gilmore, III, Attorney\n General, on brief), for appellee.", "\n\n\n\n On July 28, 1992, the General District Court of Campbell\n\nCounty sentenced Marc Serge Klokow to a $3,000 fine and twelve\n\nmonths in jail. ", " The court then suspended the entire sentence on\n\ncondition that \"defendant [was] not to contact Mary Katherine\n\nLemon or enter Fairfields Subdivision or trespass on the property\n\nof Ms. Lemon or Ms. Raasch or call their phone numbers.\" ", " The\n\norder specified no term of suspension.", "\n\n On June 16, 1994, the general district court issued a show-\n\ncause summons against Klokow, alleging that he had violated the\n\ncondition of the suspension of his sentence by conduct in which\n\nhe had engaged on May 24, 1994. ", " The general district court\n\nthereafter revoked the suspension of sentence and sentenced\n *\n Pursuant to Code § 17-116.010 this opinion is not\ndesignated for publication.", "\n\fKlokow to serve twelve months in jail. ", " Upon trial de novo, the\n\ntrial court made the same finding and imposed the same judgment\n\nand sentence. ", " On appeal, Klokow contends that the trial court\n\nerred because on May 24, 1994, the time period covered by the\n\nsuspended sentence had expired. ", " We agree and reverse the\n\njudgment of the trial court.", "\n\n Code § 19.2-306 provides, in pertinent part:\n The court may, for any cause deemed by it sufficient\n which occurred at any time within the probation period,\n or if none, within the period of suspension fixed by\n the court, or if neither, within the maximum period for\n which defendant might originally have been sentenced to\n be imprisoned, revoke the suspension . . . ", "and cause\n the defendant to be arrested and brought before the\n court at any time within one year after the period of\n suspension fixed by the court . . . .", "\n\n The sentencing order imposed no term of suspension. ", " Thus,\n\nthe term of suspension was \"the maximum period for which the\n\ndefendant might originally have been sentenced to be imprisoned.\"", "\n\nCode § 19.2-306; see Grant v. Commonwealth, 223 Va. 680, 686,\n\n292 S.E.2d 348, 351 (1982). ", " The maximum period that Klokow could\n\nhave been imprisoned was twelve months. ", " Twelve months from the\n\ndate of the sentencing order expired on July 28, 1993. ", " The\n\nconduct which was the cause of the suspension proceeding occurred\n\non May 24, 1994. ", " Because the term of suspension of Klokow's\n\nsentence had expired, his conduct on May 24, 1994, could not\n\nsupport the revocation of the suspension.", "\n\n The Commonwealth argues that the term of Klokow's suspended\n\nsentence that \"defendant [was] not to contact Mary Katherine\n\n\n\n - 2 -\n\fLemon,\" meant that he should not contact her forever. ", " Such a\n\nrequirement was not made clear in the sentencing order. ", " \"A\n\nrestraint on an individual's freedom, and the imposition of\n\npotential liability for punishment, must be expressly and clearly\n\nstated.\" ", " Reinemer v. Commonwealth, 16 Va. App. ", "462, 465, 431\n\nS.E.2d 68, 70 (1993).", "\n\n The judgment of the trial court is reversed, and the\n\nappellant is discharged.", "\n Reversed.", "\n\n\n\n\n - 3 -\n\f" ]

{ "pile_set_name": "FreeLaw" }

[ 0.0006717942887917161, 0.0006640206556767225, 0.0006237600464373827, 0.0006547817611135542, 0.003650281811133027, 0.0018287096172571182, 0.0006166209350340068, 0.0008795266621746123, 0.0006583830108866096, 0.32822510600090027, 0.0007277215481735766, 0.0007431346457451582, 0.0005797791527584195, 0.0006413033115677536, 0.0009600715711712837, 0.0006133205024525523, 0.0006674849428236485, 0.0006387940375134349, 0.0007121388334780931, 0.0006113642011769116, 0.0006120483740232885, 0.0008606595220044255, 0.0006873871898278594, 0.0006280757370404899, 0.0005691737169399858, 0.0008566590258851647, 0.0007412670529447496, 0.0006946923094801605, 0.0009353403584100306, 0.00075014668982476 ]

[ "Mehran Kookherd\n\nMehran Kookherd () is a village in Kukherd Rural District, Kukherd District, Bastak County, Hormozgan Province in the south of Iran.", "\n\nMehran Kookherd the small village from Kukherd District () in the city of Bastak (Bastak County شهرستان بستک) Hormozgan Province.", "\n\nAt the 2006 census, its population was (7), in (1) family.", "\n\nSee also \n\nKookherd\nBastak \nBandar Abbas\nMorbagh\nBandar Lengeh\nHormozgān \nLarestan\nLar, Iran\nEvaz\nMorbagh\nBandar Abbas\nFareghan\nRavidar\nKish Island\nAL madani\nMaghoh\nChale Kookherd\n\nReferences\n\nExternal links \n Kookherd Website.", "\n\nCategory:Populated places in Bastak County\nCategory:Bakhshe Kookherd" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0013875833246856928, 0.0006485499907284975, 0.0007968119462020695, 0.000832237652502954, 0.0007017977768555284 ]

[ "Q:\n\njquery codes dont work on my plugin wordpress\n\nI use this to hook my scripts and styles to my plugin\nadd_action('admin_init', 'the_box_init' );\n\n// Init plugin options to white list our options\nfunction the_box_init(){\n register_setting( 'the_box_options', 'the_box', 'the_box_validate' );\n wp_enqueue_style( 'myprefix-style', plugins_url('theboxstyle.css', __FILE__) );\n wp_enqueue_script( 'myprefix-script', plugins_url('theboxjs.js', __FILE__) ); //this hook my custom js, preferrably which contents almost my jquery codes.", "\n\n}\n\nhowever, the jquery codes doesn't work even in this simple codes (refer below)\n$( document ).ready(function() {\nalert(\"asdasd\");\n}); \n\nand only javascript did work..\nwhat does suppose my implementation get wrong that jquery didnt work?", "\nim open in any suggestions, recommendations and idea's. ", "Thank you in advance.", "\n\nA:\n\nTry to put your code in a closure:\n(function($){\n alert(\"asdasd\");\n})(jQuery);\n\nor:\n$.noConflict();\njQuery(document).ready(function($) {\n alert(\"asdasd\");\n});\n\nThis will helps you to prevent the conflict between Wordpress and jQuery\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.001450896728783846, 0.0007569415611214936, 0.0006672005984000862, 0.0005381051450967789, 0.0008713178685866296 ]

[ "HomeHorse FeedA-Z Horse Feed By BrandEquerry - Horse Feeds\n\nEquerry - Minty Treats - Horse Treats - 20kg\n\nEquerry Minty Horse Treats are a deliciously crunchy treat that is suitable for horses as a reward for good behaviour or after doing something particularly hard.", "\n\n£10.75\n£11.50\n\nQTY\n\nYou will earn 10 points with this purchase\n\nDetailsReviewsSpecifications\n\nEquerry Minty Horse Treats are a deliciously crunchy treat that is suitable for horses as a reward for good behaviour or after doing something particularly hard. ", "The treats combine the natural goodness of peppermint & spearmint to create a low sugar, cereal & grain free snack that horses will simply love to nibble on." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0011944238794967532, 0.0009423914598301053, 0.0019797366112470627 ]

[ "---\nabstract: 'We consider two problems regarding vanishing patterns in the Betti table of edge ideals $I$ in polynomial algebra $S$. First, we show that the $j$-strand is connected if $j=3$ (for $j=2$ this is easy and known), and give examples where the $j$-strand is not connected for any $j>3$. Next, we apply our result on strand connectivity to establish the subadditivity conjecture for edge ideals, $t_{a+b}\\leq t_a+t_b$, in case $b=2,3$ (the case $b=1$ is known). ", "Here $t_i$ stands for the maximal shifts in the minimal free $S$-resolution of $S/I$.'\naddress:\n- 'Einstein Institute of Mathematics, The Hebrew University of Jerusalem, Jerusalem, Israel'\n- 'Einstein Institute of Mathematics, The Hebrew University of Jerusalem, Jerusalem, Israel'\nauthor:\n- Abed Abedelfatah and Eran Nevo\ntitle: 'On vanishing patterns in $j$-strands of edge ideals'\n---\n\nIntroduction\n============\n\nLet $S=K[x_1,\\ldots,x_n]$ denote the polynomial ring with $n$ variables over the fixed field $K$, graded by setting $\\deg(x_i)=1$ for each variable. ", "Since Hilbert’s syzygy theorem, minimal free resolutions of graded finitely generated $S$-modules, and particularly their graded Betti numbers, became central invariants of study in Commutative Algebra, with applications in other areas, e.g. in algebraic geometry, hyperplane arrangements, and combinatorics. ", "Many important invariants of such $S$-modules are determined just by the *vanishing pattern* of the graded Betti numbers, namely which ones are zero and which are nonzero, e.g. the regularity, projective dimension etc. ", "Restricting to $S$-modules $S/I$ for monomial ideals $I$, and particularly to edge ideals, makes combinatorial, and particularly graph theoretical, tools available. ", "This perspective proved to be very fruitful in recent decades; see the recent textbooks [@Herzog-Hibi; @Peeva] for more background and references.", "\n\nIn this paper we consider the following two problems on vanishing patterns in the Betti table of edge ideals; we completely resolve the first and use it to partially resolve the second.", "\n\n\\(I) In a private communication, Aldo Conca asked us the following question, based on computer experiments; see also Whieldon \\[,Question 7.1(2)\\]:\n\n\\[q:Aldo\\] Is the Betti diagram of any monomial ideal $I$ generated in degree 2, for any $j\\geq 2$, $j$-strand connected? ", "I.e. if $j\\geq2$, $\\beta_{i,j}(I)$ and $\\beta_{i+k,j+k}(I)$ are both non-zero, where $k>0$ and $i\\geq 0$, then $\\beta_{i+m,j+m}(I)\\neq0$ for all $0\\leq m\\leq k$.\n\nThe answer to this question, over any field, is “Yes” when $j=2$. This follow from the fact that if $\\cdots\\rightarrow F_1\\rightarrow F_0\\rightarrow I\\rightarrow 0$ is the minimal graded free resolution of $I$ and $r$ is the minimum degree of the generators of $F_i$, then the minimum degree of the generators of $F_{i+1}$ is at least $r+1$. So if $(\\beta_{0,2}(I),\\beta_{1,3}(I),\\dots)$ is the first strand and $\\beta_{i,i+2}(I)=0$ for some $i\\geq0$, then $\\beta_{t,t+2}(I)=0$ for all $t\\geq i$. We show that the answer is “Yes\" for $j=3$ and “No\" for any $j>3$:\n\n\\[thm:I\\] Over any field, any monomial ideal generated in degree 2 is $j$-strand connected for $j=3$ or $2$.\n\nFor any $j>3$, there is a monomial ideal generated in degree 2 which is not $j$-strand connected, over any field.", "\n\nWithout the assumption on generation in degree $2$, easier examples in Remark \\[rem\\] show that the answer is “No” for any $j>2$.\n\nBy polarization, we can reduce the problem to squarefree monomial ideals. ", "Using Hochster formula, we answer Question \\[q:Aldo\\] by topological combinatorics arguments; see Section \\[sec:Proofs\\].", "\n\nTheorem \\[thm:I\\] can be visualized as a *vanishing pattern* on the Betti table of $I$, where in the $(i,j)$ entry we put $X$ if $\\beta_{i,i+j}(I)\\neq 0$ and $0$ otherwise; call it the *vanishing table* of $I$. Then our result says that if a monomial ideal $I$ is generated in degree $2$ then its vanishing table has no subsequence with internal zeros $(X,0,\\ldots,0,X)$ in any of the first two rows. ", "For other recent results on other vanishing patterns, see e.g. [@Oscar; @Torrente-Varbaro].", "\n\n\\(II) Second, we consider the subadditivity problem for edge ideals. ", "Given a graded ideal $I$ in $S$ let $t_i$ denote the maximal shifts in the minimal graded free $S$-resolution of $S/I$, namely $$t_i=t_i(S/I):= \\max(j:\\ \\beta_{i,j}(S/I)\\neq 0).$$ The subadditivity relation $$(*) \\ \\ t_{a+b}\\leq t_a + t_b$$ was proved under certain conditions on $I$ or for certain values of $a$ and $b$, e.g. in [@Conca-Sub; @Eisenbud-Sub; @Herzog-Srinivasan; @Srinivasan-New], and is conjectured to hold under other conditions on $I$ for all values $a$ and $b$ [@Conca-Sub Conjecture 6.4]. ", "While counterexamples to (\\*) for general graded ideals are indicated in [@Conca-Sub Section 6.1], no counterexamples to (\\*) are known for monomial ideals. ", "When $I$ is generated by monomials, Herzog and Srinivasan [@Herzog-Srinivasan Corollary 4] proved (\\*) for $b=1$, which was proved earlier for edge ideals in [@Oscar Theorem 4.1].", "\n\n\\[thm:II\\] For any edge ideal over any field, the subadditivity relation (\\*) holds for $b=1,2,3$ and any natural number $a$.\n\nThe proof of the case $b=3$ uses the connectivity of the $3$-strand, see Theorem \\[thm:I\\]. ", "Topological combinatorics arguments are used here too; see Section \\[sec:App\\].", "\n\nPreliminaries \n==============\n\nFix a field $K$. Let $S=K[x_1,\\dots,x_n]$ be the graded polynomial ring with $\\deg(x_i)=1$ for all $i$, and $M$ be a graded $S$-module. ", "The integer $\\beta_{i,j}^S(M)=\\dim_KTor_i^S(M,K)_j$ is called the $(i,j)$*th graded Betti number of* $M$. Note that if $I$ is a graded ideal of $S$, then $\\beta_{i+1,j}^S(S/I)=\\beta_{i,j}^S(I)$ for all $i,j\\geq 0$.\n\nFor a simplicial complex $\\Delta$ on the vertex set $\\Delta_0=[n]=\\{1,\\dots,n\\}$, its *Stanley-Reisner ideal* $I_{\\Delta}\\subset S$ is the ideal generated by the squarefree monomials $x_F=\\prod_{i\\in F}x_i$ with $F\\notin \\Delta$, $F\\subset [n]$. A simplicial complex is called *flag* if its Stanley-Reisner ideal is generated by squarefree monomials of degree two. ", "Flag simplicial complexes are closely related to simple graphs. ", "Let $G$ be a simple graph on the set $[n]$ and denote by $E(G)$ the set of its edges. ", "We define the *edge ideal* of $G$ to be the ideal $$I(G)=\\langle x_ix_j:~\\{i,j\\}\\in E(G)\\rangle\\subset S.$$ So if $\\Delta$ is a flag simplicial complex and $H$ is the graph of minimal non-faces of $\\Delta$, then $I_\\Delta=I(H)$.\n\nFor $W\\subset V$, we write $$\\Delta[W]=\\{F\\in\\Delta~:~F\\subset W\\}$$ for the induced subcomplex of $\\Delta$ on $W$. We denote by $\\beta_i(\\Delta)=\\dim_K \\widetilde{H}_i(\\Delta;K)$ the dimension of the $i$-th reduced homology group of $\\Delta$ with coefficients in $K$. Let $F$ be a face of $\\Delta$. The *link* of $F$ in $\\Delta$ is the following simplicial complex: $$\\operatorname{Link}_\\Delta F=\\{F'~|~F'\\cup F\\in \\Delta~\\mathrm{and}~F'\\cap F=\\emptyset\\}.$$ The *Alexander dual complex* of $\\Delta$ is $$\\Delta^{\\vee}=\\{[n]\\setminus F~|~F\\notin \\Delta,\\ F\\subseteq [n]\\}.$$ The following result is known as Hochster’s formula for graded Betti numbers.", "\n\nLet $\\Delta$ be a simplicial complex on $[n]$. Then $$\\beta_{i,j}(I_{\\Delta})=\\sum_{W\\subset[n],~|W|=j}\\beta_{j-i-2}(\\Delta[W])$$ for all $i\\geq0$ and $j\\geq i+1$.\n\nFrom Hochster’s formula, if we denote $r=j-i-2$ then we obtain the following equivalent topological version of Question \\[q:Aldo\\].", "\n\n\\[q2:Aldo\\] Let $r\\geq0$ and $\\Delta$ is a flag complex. ", "Assume that $\\beta_r(\\Delta[W])\\neq 0$ and $\\beta_r(\\Delta[W'])= 0$ for any $W'$ with $|W'|=|W|-1$. Does it follow that $\\beta_r(\\Delta[W\"])= 0$ for any $W\"$ with $|W\"|<|W|$?", "\n\nEagon and Reiner [@eagon] introduced a variant of Hochster’s formula that uses Alexander duality.", "\n\n\\[alex\\] Let $\\Delta$ be a simplicial complex on $[n]$. Then $$\\beta_{i,j}(I_\\Delta)=\\sum_{F\\in \\Delta^{\\vee},~|F|=n-j}\\beta_{i-1}(\\operatorname{Link}_{\\Delta^{\\vee}}F)$$ for all $i\\geq0$ and $j\\geq i+1$.\n\nBy Theorem \\[alex\\], we obtain the following equivalent version of Question \\[q2:Aldo\\] using the links of faces of the Alexander dual.", "\n\nLet $r\\geq1$ and $\\Delta$ is a flag complex. ", "Assume that $\\beta_r(\\operatorname{Link}_{\\Delta^{\\vee}}F)\\neq 0$ and $\\beta_{r-1}(\\operatorname{Link}_{\\Delta^{\\vee}}F')= 0$ for any $F'$ with $|F'|=|F|+1$. Does it follow that $\\beta_{r-k}(\\operatorname{Link}_{\\Delta^{\\vee}}F\")= 0$ for any $F\"$ with $|F\"|=|F|+k$ and $k\\geq 1$?", "\n\nIf $\\Delta_1$ and $\\Delta_2$ are two subcomplexes of $\\Delta$ such that $\\Delta=\\Delta_1\\cup \\Delta_2$, then there is a long exact sequence of reduced homologies (with $K$-coefficients), called the *Mayer-Vietoris sequence* $$\\cdots \\rightarrow \\widetilde{H}_i(\\Delta_1\\cap\\Delta_2)\\rightarrow \\widetilde{H}_i(\\Delta_1)\\oplus \\widetilde{H}_i(\\Delta_2)\\rightarrow \\widetilde{H}_i(\\Delta)\\rightarrow \\widetilde{H}_{i-1}(\\Delta_1\\cap\\Delta_2)\\rightarrow\\cdots$$\n\nUsing the Mayer-Vietoris sequence, Fern[á]{}ndez-Ramos and Gimenez proved the following, from which the case $b=1$ in Theorem \\[thm:II\\] readily follows.", "\n\n([@Oscar Theorem 2.1])\\[lem:corner\\] For an edge ideal $I=I(G)$, over any field, if $\\beta_{i,j}(S/I)=0=\\beta_{i,j+1}(S/I)$ then $\\beta_{i+1,j+2}(S/I)=0$.\n\nStrand connectivity {#sec:Proofs}\n===================\n\nWe begin with the following remark.", "\n\n\\[rem\\] Without the assumption on generation in degree 2 in Question \\[q:Aldo\\], easier examples show that the answer in “No” for any $j>2$. Just take the Stanley-Reisner ideal of the join of the boundary of a $(j-1)$-simplex with the barycentric subdivision of this boundary complex. ", "For $j=3$ this is the join of a $3$-cycle and a $6$-cycle.", "\n\nThe only subsets of vertices on which the induced complex has nonzero $(j-2)$-homology are those of each of the two components of the join.", "\n\nNext, we give a counterexample to Question \\[q2:Aldo\\] for all $r\\geq2$, thus also to Question \\[q:Aldo\\] for all $j\\geq 4$.\n\n\\[ex\\] Fix $i\\ge 2$. Let $S$ be a flag sphere of dimension $i$ that contains a subset $A$ of vertices of size $|A|=2i+4$. Denote by $G$ the 1-skeleton of $S$. There exists such $S$ and $A$ with $d(a,b)\\geq3$ for all $a,b\\in A$, where $d(\\cdot,\\cdot)$ is the graph metric in $G$. Let $O$ be an octahedral sphere of dimension $i+1$ on the vertices of $A$. ", "Let $a$ and $b$ be opposite vertices in $O$ and $\\Delta=S\\cup O$. Then $\\beta_i(\\Delta)$ and $\\beta_i(\\Delta[A-\\{a,b\\}])$ are both non-zero but $\\beta_i(\\Delta-x)=0$ for all $x\\in \\Delta_0$.\n\nSince $d(a,b)\\geq3$ for all $a,b\\in A$, it follows that $\\Delta$ is a flag complex. ", "The complex $S\\cap O$ is the complex of isolated vertices $A$ (denote it also by $A$, abusing notation). ", "By the construction, we have $\\widetilde{H}_i(A)=\\widetilde{H}_i(O)=\\widetilde{H}_{i-1}(A)=0$ (note that $i-1>0$), and $\\widetilde{H}_i(S)\\neq 0$. Using Mayer-Vietoris sequence $$\\cdots \\rightarrow \\widetilde{H}_i(A)\\rightarrow \\widetilde{H}_i(S)\\oplus \\widetilde{H}_i(O)\\rightarrow \\widetilde{H}_i(\\Delta)\\rightarrow \\widetilde{H}_{i-1}(A)\\rightarrow\\cdots$$ we get $\\widetilde{H}_i(\\Delta)\\neq0$.\n\nSince $\\Delta[A-\\{a,b\\}]$ is an octahedral sphere of dimension $i$, it follows that $\\widetilde{H}_i(\\Delta[A-\\{a,b\\}])\\neq0$. Consider a vertex $x\\in \\Delta_0$.\n\nIf $x\\in \\Delta_0-A$ then $\\Delta-x=O\\cup(S-x)$ and $O\\cap(S-x)=A$. Using the fact that $\\widetilde{H}_i(S-x)=0$ and the Mayer-Vietoris sequence $$\\cdots \\rightarrow \\widetilde{H}_i(A)\\rightarrow \\widetilde{H}_i(S-x)\\oplus \\widetilde{H}_i(O)\\rightarrow \\widetilde{H}_i(\\Delta-x)\\rightarrow \\widetilde{H}_{i-1}(A)\\rightarrow\\cdots$$ we get $\\beta_i(\\Delta-x)=0$.\n\nIf $x\\in A$ then $\\Delta-x=(S-x)\\cup(O-x)$ and $(S-x)\\cap(O-x)=A-x$. Note that $O-x$ is an $(i+1)$-ball and so $\\widetilde{H}_i(O-x)=0$. Again, the Mayer-Vietoris sequence implies $\\beta_i(\\Delta-x)=0$.\n\nIn the following theorem, we prove Question \\[q2:Aldo\\] for $r=1$, thus complete the proof of Theorem \\[thm:I\\].", "\n\n\\[strand2\\] Let $\\Delta$ be a flag simplicial complex. ", "Assume that $\\beta_1(\\Delta[W])\\neq 0$ and $\\beta_1(\\Delta[W'])= 0$ for any $W'$ with $|W'|=|W|-1$. Then $\\beta_1(\\Delta[W\"])= 0$ for any $W\"$ with $|W\"|<|W|$.\n\nStep 1: We claim $\\Delta[W]$ is an induced cycle.", "\n\nProof: as $\\beta_1(\\Delta[W])\\neq 0$, there is a nontrivial cycle $C \\subseteq \\Delta[W]$. A chord $e$ in $C$ splits $C$ into two cycles with intersection $e$; at least one of these two cycles is nontrivial, else $C$ would be trivial. ", "Thus, we may assume $C$ is an induced cycle, i.e. chordless. ", "It is left to show that $V(C)=W$. If not, then there is a subset $W'$ of size $|W'|=|W|-1$ s.t. ", "$V(C)\\subseteq W'\\subseteq W$, so $C$ is nontrivial in $\\Delta[W']$, a contradiction to $\\beta_1(\\Delta[W'])=0$. Denote $C:=\\Delta[W]$.\n\nStep 2: Assume by contradiction there is $W\"$ with $|W\"|<|W|-1$ and $\\beta_1(\\Delta[W\"])\\neq 0$. We may assume $C\":=\\Delta[W\"]$ is an induced cycle (see step 1); and $|W\"|\\geq 4$ as $\\Delta$ is flag.", "\n\nLook on the vertices of $C\"$ in cyclic order. ", "We claim that between any two vertices in $W\\cap W\"$ there is a vertex in $W\"-W$. In particular (using $|W\"|\\geq 4$), there are two vertices $a,b\\in W\"-W$ which are non-neighbors in $C\"$. In case $W\\cap W\"$ is nonempty, we can choose $a,b$ so that they have a common neighbor in $W\\cap W\"$; and so we choose.", "\n\nProof: let $x,y\\in W\\cap W\"$ be consecutive in the cyclic order induced on $W\\cap W\"$ from $C\"$, and assume by contradiction that $xy$ is an edge in $C\"$. As $C$ is induced, $xy$ must be an edge of $C$ as well. ", "This leads to a contradiction, as follows: in $W\\cup W\"$, remove vertices from $W-W\"$ to obtain a subset $W'$ of size $|W|-1$. By assumption, $\\beta_1(\\Delta[W'])=0$, thus the cycle $C\"$ is trivial in $\\Delta[W']$; in particular there is a triangle $xyz\\in \\Delta[W']$. However, $z\\notin W\"$ and $z\\notin W$ as both $C$ and $C\"$ are induced cycles of length $\\geq 4$, a contradiction.", "\n\nStep 3: as $|W|\\geq 6$, there exist $x,y,z\\in C=\\Delta[W]$ such that $xy$ is an edge and $z$ not a neighbor of either of $x,y$. Thus, $C-\\{x,y,z\\}$ is the union of two disjoint nonempty paths, denoted $P$ and $Q$. As $W':=P\\cup Q\\cup \\{a,b\\}$ (see Step 2 for who $a,b$ are) has size $|W|-1$, by assumption $\\beta_1(\\Delta[W'])=0$.\n\nNote that in the suspension of $P\\cup Q$ by $a,b$ any cycle of the form $(a,P',b,Q',a)$, where $P'\\subseteq P$ and $Q'\\subseteq Q$ are nonempty subpaths, is nontrivial. ", "Thus, the following claim finishes the proof:\n\n(\\*\\*) There exists a choice of $x,y,z\\in C$ as above such that there are vertices $p_a,p_b\\in P$ (they may be equal) and $q_a,q_b\\in Q$ such that the four edges $ap_a,aq_a,bp_b,bq_b\\in \\Delta$ exist.", "\n\nStep 4: to prove (\\*\\*), we first claim that each of $a$ and $b$ has at least 6 neighbors in $W$.\n\nProof: for any $W'$ of size $|W'|=|W|-1$ where $W\"\\subseteq W'\\subseteq W\"\\cup W$, the induced cycle $C\"$ is trivial in $\\Delta[W']$, thus each of its edges belong to some triangle, so each of $a,b$ has a neighbor in $W'-W\"$.\n\nRecall $|W\"|\\geq 4$. If $W\\cap W\"=\\emptyset$, we throw at least 5 vertices of $W-W\"$ ($=W$) from $W\\cup W\"$ to obtain $W'$, so each of $a,b$ has at least 6 neighbors in $W-W\"$; if $|W\\cap W\"|=1$ we throw at least 4 vertices of $W-W\"$, so each of $a,b$ has at least 5 neighbors in $W-W\"$ and another neighbor is in $W\\cap W\"$. Thus assume $|W\\cap W\"|>1$. The only case when we throw less than 4 vertices of $W-W\"$ is when $a,b$ are the only vertices of $W\"-W$, in which case we throw 3 vertices of $W-W\"$ and both $a$ and $b$ have 2 neighbors in $W\\cap W\"$ (and $C\"$ is a $4$-cycle); so again each of $a$ and $b$ has at least 6 neighbors in $W$, as claimed.", "\n\nStep 5, proof of (\\*\\*): fix an orientation on $C$. ", "Denote some 6 neighbors of $a$ as guaranteed in Step 4 by $(a_1,a_2,a_3,a_4,a_5,a_6)$ in cyclic order on $C$, and similarly $(b_1,b_2,b_3,b_4,b_5,b_6)$ for $b$ (possibly some $a_i=b_j$). ", "For a vertex $v\\in C$ denote by $v'$ the vertex right after it on $C$ in the cyclic order. ", "Tentatively, let $z=a_2, x=a_5, y=a_5'$; so $a$ has a neighbor both in $P$ and $Q$. If $b$ does not have a neighbor in both $P$ and $Q$, one of the following 2 cases must occur:\n\nCase A: there are (at least) 3 $b_j$’s in the segment $P$, $a_2(P)a_5$; by relabeling $(b_1,\\ldots,b_6)$ by a cyclic permutation we may assume they are $b_1,b_2,b_3$. Change the tentative choice to $z=b_2, x=a_6, y=a_6'$. Then $a_2,b_1$ are in (say) $P$ and $b_3,a_5$ are in $Q$.\n\nCase B: there are (at least) 3 $b_j$’s in the segment $Q$, $a_5'(Q)a_2$; by relabeling by a cyclic permutation we may assume they are $b_1,b_2,b_3$. Change the tentative choice to $z=b_2, x=a_3, y=a_3'$. Then $a_2,b_3$ are in (say) $P$ and $b_1,a_5$ are in $Q$.\n\nThis finishes the proof of (\\*\\*), and the proof of the theorem.", "\n\nCounterexample \\[ex\\] naturally rises the following general question:\n\nFor any $j\\geq 4$, relate the connectedness of the $j$-strand of an edge ideal to classical graph theoretic properties of the corresponding graph (or its complement).", "\n\nApplication to the subadditivity problem {#sec:App}\n========================================\n\nIn this section we prove Theorem \\[thm:II\\]. ", "First we treat the cases in Theorem \\[thm:II\\] where $b=2,3$ and $t_b\\in\\{2b,2b-1\\}$, next we treat the remaining case $t_3=4$. Let $I=I(G)$ be the edge ideal of a graph $G$. By considering Taylor’s resolution of $S/I$, we observe that $t_i\\leq 2i$. On the other hand, since the resolution is minimal, we have $t_i\\geq i+1$ when $t_i\\neq0$. It follows that if $t_i\\neq 0$ then $i+1\\leq t_i \\leq 2i$ for all $i\\geq1$.\n\n\\[a=2\\] Over any field, if $I=I(G)$ is the edge ideal of a graph $G$, $b\\in\\{2,3\\}$ and $t_b\\in\\{2b,2b-1\\}$, then for all $a\\geq0$, $$t_{a+b}\\leq t_a+t_b.$$\n\nLet $\\Delta$ be the simplicial complex such that $I_{\\Delta}=I$. If $t_b=2b$ then the known inequality $t_{a+1}\\leq t_a +t_1$ implies $$t_{a+b}\\leq t_a+bt_1=t_a+2b=t_a+t_b.$$ Assume $t_b=2b-1$. Let $W\\subseteq [n]$ so that $|W|=t_{a+b}$ and $\\widetilde{H}_{j}(\\Delta[W])\\neq 0$ for $j=t_{a+b}-(a+b)-1$. Denote $N=\\Delta[W]$.\n\nWe claim that there is a vertex of degree $\\geq 2$ in $H=G[W]$. Else, $H$ would be a disjoint union of edges, i.e. a matching (there are no isolated vertices as $N$ is not acyclic, in particular not a cone). ", "The Taylor resolution shows that $H$ has at least $a+b$ edges. ", "Thus, $t_b=2b$, a contradiction.", "\n\nLet $v$ be a vertex of $H$ of degree $\\deg_H(v)\\geq2$. Let $x_1,x_2$ be two neighbors of $v$ in $H$. Clearly, $N=(N-v)\\cup(N-\\{x_1,x_2\\})$. Set $\\Delta_1=N-v$ and $\\Delta_2=N-\\{x_1,x_2\\}$. We may assume that $\\widetilde{H}_{j}(\\Delta_1)=0$. For otherwise, we obtain that $\\beta_{a+b-1,t_{a+b}-1}(S/I)\\neq0$ and so, $t_{a+b}\\leq t_{a+b-1}+1$; for $b=2$ this yields, using (\\*) for $b=1$, $$t_{a+2}\\leq t_a+t_1+1=t_a+3=t_a+t_2$$ as desired, and for $b=3$, after we finish the proof for $b=2$ below, it yields $$t_{a+3}\\leq t_a+t_2+1\\leq t_a+5=t_a+t_3.$$ Using the Mayer-Vietoris sequence for $N=\\Delta_1\\cup \\Delta_2$ we have $\\widetilde{H}_j(\\Delta_2)\\neq0$ or $\\widetilde{H}_{j-1}(\\Delta_1\\cap\\Delta_2)\\neq0$.\n\nIf $\\widetilde{H}_j(\\Delta_2)\\neq0$, then $\\beta_{a+b-2,t_{a+b}-2}(S/I)\\neq0$ and so $t_{a+b}\\leq t_{a+b-2}+2$. For $b=2$ this gives $t_{a+2}\\leq t_a+2<t_a +t_2$ as desired, and for $b=3$ it gives $t_{a+3}\\leq t_{a+1}+2\\leq t_a+t_1+2=t_a +4<t_a+t_3$ as desired.", "\n\nFinely, if $\\widetilde{H}_{j-1}(\\Delta_1\\cap\\Delta_2)\\neq0$, then $\\beta_{a+b-2,t_{a+b}-3}(S/I)\\neq0$, and similarly we obtain for $b=2,3$, $$t_{a+b}\\leq t_{a+b-2}+3 \\leq t_a+t_b.$$ This completes the proof.", "\n\nNext we prove the remaining case in Theorem \\[thm:II\\]:\n\n\\[a=3\\] Over any field, if $I=I(G)$ is the edge ideal of a graph $G$ and $t_3=4$, then for all $a\\geq0$, $$t_{a+3}\\leq t_a+t_3.$$\n\nWe split the proof according to the possible values of $t_2$.\n\nIf $t_2=4$, then combined with $t_3=4$, Theorem \\[strand2\\] (connectivity of the $3$-strand of $I$, equivalently of the $2$-strand of $S/I$) says $\\beta_{2+k,4+k}(S/I)=0$ for any $k>0$. Further, by Lemma \\[lem:corner\\] we conclude that $t_k\\leq k+1$ for all $k\\geq 3$. In particular, if $t_{a+3}\\neq0$, then $t_{a+3}\\leq a+4\\leq t_a+t_3$ as desired. ", "Thus we may assume $t_2=3$. By Proposition \\[a=2\\] we may also assume $a\\geq3$. Let $\\Delta$ be the simplicial complex such that $I_{\\Delta}=I$ and let $W\\subseteq [n]$ so that $|W|=t_{a+3}$ and $\\widetilde{H}_{t_{a+3}-(a+3)-1}(\\Delta[W])\\neq0$. First, we claim that there exists a vertex $v$ in $H=G[W]$ such that $\\deg_H(v)\\geq3$. Assume on contrary, that $\\deg_H(v)\\leq2$ for all $v$ in $H$. Then $H$ is the disjoint union of cycles and paths, and as $\\Delta[W]$ is not acyclic it has no isolated vertices. ", "Further, as $t_2<4$, $H$ has no two disjoint edges which form an induced subgraph. ", "Thus, $H$ is either an induced $t$-cycle $C_t$, where $3\\leq t\\leq 5$, or a path with at most three edges. ", "On the other hand, since $\\beta_{a+3,t_{a+3}}(S/I(H))\\neq0$ and $a\\geq3$, it follows from the Taylor resolution that there are at least 6 edges in $H$, a contradiction. ", "Let $v\\in W$ with $\\deg_H(v)\\geq3$. Let $x_1,x_2,x_3$ be three neighbors of $v$ in $H$. Clearly, for $N=\\Delta[W]$, $N=(N-v)\\cup(N-\\{x_1,x_2,x_3\\})$. Set $\\Delta_1=N-v$ and $\\Delta_2=N-\\{x_1,x_2,x_3\\}$. We may assume that $\\widetilde{H}_{j}(\\Delta_1)\\neq0$. For otherwise, we obtain that $\\beta_{a+2,t_{a+3}-1}(S/I)\\neq0$ and so $$t_{a+3}\\leq t_{a+2}+1\\leq t_a+t_2+1=t_a+4=t_a+t_3$$ as desired. ", "Using the Mayer-Vietoris sequence we have $\\widetilde{H}_j(\\Delta_2)\\neq0$ or $\\widetilde{H}_{j-1}(\\Delta_1\\cap\\Delta_2)\\neq0$. If $\\widetilde{H}_j(\\Delta_2)\\neq0$, then $\\beta_{a,t_{a+3}-3}(S/I)\\neq0$, and so $$t_{a+3}\\leq t_{a}+3 < t_a+t_3.$$ Finally, if $\\widetilde{H}_{j-1}(\\Delta_1\\cap\\Delta_2)\\neq0$, then $\\beta_{a,t_{a+3}-4}(S/I)\\neq0$, and so $$t_{a+3}\\leq t_a+4=t_a+t_3.$$\n\n**Acknowledgements.** ", "The authors thank Aldo Conca for helpful comments and discussion.", "\n\n[99]{} L. L. Avramov, A. Conca, S. Iyengar, *Subadditivity of syzygies of Koszul algebras*, Math. ", "Ann. ", "361 (2015), 511-534.", "\n\nJ. A. Eagon, V. Reiner, *Resolutions of Stanley-Reisner rings and Alexander duality*, J. Pure Appl. ", "Algebra 130 (1998), 265-275.", "\n\nD. Eisenbud, C. Huneke, B. Ulrich, *The regularity of Tor and graded Betti numbers*, Amer. ", "J. Math. ", "128 (2006), no. ", "3, 573–605.", "\n\nO. Fern[á]{}ndez-Ramos, P. Gimenez, *Regularity 3 in edge ideals associated to bipartite graphs*, J. Algebraic Combin. ", "39 (2014), 919-937.", "\n\nJ. Herzog, T. Hibi, *Monomial Ideals*, volume 260. ", "Springer Verlag, 2010.", "\n\nJ. Herzog, H. Srinivasan, *A note on the subadditivity problem for maximal shifts in free resolutions*, to appear in MSRI Proceedings, arXiv preprint arXiv:1303.6214, 2013.", "\n\nS. E. Khoury, H. Srinivasan, *A note on the subadditivity of Syzygies*, arXiv preprint arXiv:1602.02116, 2016.", "\n\nI. Peeva, *Graded syzygies*, Algebra and Applications 14, Springer, 2011.", "\n\nM. L. Torrente, M. Varbaro, *An alternative algorithm for computing the Betti table of a monomial ideal*, arXiv preprint arXiv:1507.01183, 2015.", "\n\nG. Whieldon, *Jump sequences of edge ideals*, arXiv preprint arXiv:1012.0108, 2010.", "\n" ]

{ "pile_set_name": "ArXiv" }

[ 0.0007058386690914631, 0.0009725146810524166, 0.000776731816586107, 0.0011784014059230685, 0.0009550368995405734, 0.0005382702802307904, 0.0005813082680106163, 0.0007045100210234523, 0.01159155834466219, 0.0009407812030985951, 0.0006569082615897059, 0.0014955163933336735, 0.0005504339933395386, 0.0007532660383731127, 0.003535753581672907, 0.0006569573888555169, 0.0007284664316102862, 0.0008371242438443005, 0.0006051657837815583, 0.023970767855644226, 0.007556103635579348, 0.0006275189807638526, 0.0017325601074844599, 0.025022944435477257, 0.0027433724608272314, 0.0282073263078928, 0.007456679362803698, 0.0007386284414678812, 0.003415296785533428, 0.01735096424818039, 0.052751991897821426, 0.006991512607783079, 0.0009455347899347544, 0.0007036172901280224, 0.0009508010116405785, 0.0008626620401628315, 0.005253717768937349, 0.06534027308225632, 0.0034529210533946753, 0.038034096360206604, 0.004426123108714819, 0.002522704191505909, 0.0014565873425453901, 0.0008002693066373467, 0.0014432913158088923, 0.0076869637705385685, 0.0008194997790269554, 0.0010733072413131595, 0.001987688010558486, 0.0037996575701981783, 0.004190437495708466, 0.004335489124059677, 0.0051742857322096825, 0.0010419432073831558, 0.0006876043626107275, 0.001031499239616096, 0.0017974738730117679, 0.0007910323911346495, 0.001231134869158268, 0.012734722346067429, 0.0008086267043836415, 0.0017347802640870214, 0.2147597372531891, 0.012334775179624557, 0.002108396263793111, 0.006896998733282089, 0.0008730219560675323, 0.013157478533685207, 0.0010814802953973413, 0.07050235569477081, 0.006759386043995619, 0.0005063414573669434, 0.0007844188949093223, 0.0015625481028109789, 0.0007223543361760676, 0.0007016108720563352, 0.000621570274233818, 0.0008100291015580297, 0.0008191433735191822, 0.0007366043282672763, 0.0009370431071147323, 0.0006955190328881145, 0.0007289417553693056, 0.0006466126069426537, 0.0006369325565174222, 0.0006165641825646162, 0.0008685398497618735, 0.0008636115817353129, 0.0006765578291378915, 0.0006751266773790121, 0.001995444530621171 ]

[ "What starts as an intriguing and promising premise falls by the wayside not too far in.", "\n\nCassie is blind, off to explore an empty mansion in Gloucester Massachusetts in pursuit of a what she has seen in her nightmares.", "\n\nBeing blind means being in the dark, and the dark is fearful in and of itself. ", "Take a step and get a small \"enlightenment\" of the immediate surroundings. ", "Tap your cane, and echolocation produces a broader perspective that will fade. ", "It's a jigsaw puzzle, seeing what you can, piecing the environment together, before the dark comes back.", "\n\nThen the Presence appears. ", "He killed me once, and apparently responds to frequent tapping of the cane. ", "I have found a bed and a chest, both of which offer the capacity to hide. ", "I assume it is from \"it\" but haven't availed myself yet.", "\n\nI don't mind dying. ", "I do mind that it throws me back to the last autosave, which was about 30 minutes of playtime before. ", "Its hard enough navigating in the dark; the autosave feature makes it un-fun.", "\n\nI read a review that also says the house reconfigures, which if true will just add to the frustration.", "\n\nThen I struck a glitch, which forced me to exit and start from the last save point.", "\n\nI liked the first 20 minutes. ", "I didn't much like the way the next 30 panned out. ", "The glitch finished me. ", "I won't be back." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005814060568809509, 0.009867846965789795, 0.01544096227735281, 0.000754697248339653, 0.0017223547911271453, 0.00345808663405478, 0.0013140373630449176, 0.01788000389933586, 0.002431674860417843, 0.0006475411355495453, 0.16160166263580322, 0.0009238330530934036, 0.0009855888783931732, 0.0008091072668321431, 0.0034548265393823385, 0.0006167202373035252, 0.001112335012294352, 0.005666618701070547, 0.006828981917351484 ]

[ "Q:\n\nregex string replace\n\nI am trying to do a basic string replace using a regex expression, but the answers I have found do not seem to help - they are directly answering each persons unique requirement with little or no explanation.", "\nI am using str = str.replace(/[^a-z0-9+]/g, ''); at the moment. ", "But what I would like to do is allow all alphanumeric characters (a-z and 0-9) and also the '-' character.", "\nCould you please answer this and explain how you concatenate expressions. ", "\n\nA:\n\nThis should work :\nstr = str.replace(/[^a-z0-9-]/g, '');\n\nEverything between the indicates what your are looking for\n\n/ is here to delimit your pattern so you have one to start and one to end\n[] indicates the pattern your are looking for on one specific character\n^ indicates that you want every character NOT corresponding to what follows\na-z matches any character between 'a' and 'z' included\n0-9 matches any digit between '0' and '9' included (meaning any digit)\n- the '-' character\ng at the end is a special parameter saying that you do not want you regex to stop on the first character matching your pattern but to continue on the whole string\n\nThen your expression is delimited by / before and after. ", "\nSo here you say \"every character not being a letter, a digit or a '-' will be removed from the string\".", "\n\nA:\n\nJust change + to -:\nstr = str.replace(/[^a-z0-9-]/g, \"\");\n\nYou can read it as:\n\n[^ ]: match NOT from the set\n[^a-z0-9-]: match if not a-z, 0-9 or -\n/ /g: do global match\n\nMore information:\n\nhttps://developer.mozilla.org/en-US/docs/JavaScript/Guide/Regular_Expressions\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007498885970562696, 0.000708050443790853, 0.0006019796128384769, 0.000555141712538898, 0.0006623160443268716, 0.0006389800691977143, 0.0006849946803413332 ]

[ "\nNew capabilities and entrepreneurialism are making space exciting again - martincmartin\nhttp://www.economist.com/technology-quarterly/2016-25-08/space-2016\n======\nvanattab\nI was pleasantly surprised by the quality of the article. ", "It contains a number\nof interesting details I had not heard before and I follow the industry to\nsome degree.", "\n\n~~~\nigravious\nI agree. ", "Interesting times ahead for the entire industry.", "\n\nIn the grand scheme of things, according to the article, SpaceX may be getting\nthe lion's share of the attention (at least on this site) but innovation in\n“smallsats” and small rockets is the more likely path to revolutionising and\ndemocratising space.", "\n\nSo many projects to keep an eye on: Blue Origin, Rocket Lab, Virgin Galactic,\nand the oh so cute Firefly (I want them to succeed based on their name\nalone!).", "\n[http://infographics.economist.com/TQ/images/scrollchart_bg.p...](http://infographics.economist.com/TQ/images/scrollchart_bg.png)\n\nAnd so many satellite companies … OneWeb\n[http://oneweb.world/](http://oneweb.world/) being (perhaps) the most\nintriguing.", "\n\nThe next five years are going to be very very interesting.", "\n\nedit: SpaceX caveat; Of course if it is the long term mission of Musk & co. to\nenable humanity to go multi-planetary then they are in a different ball-game\nto all but national operators really …\n\n------\nuntilHellbanned\nCan someone say when ROI from space will happen?", "\n\n~~~\nnkoren\nI suppose it will be when weather satellites can tell us when a hurricane is\ninbound, and when navigation satellites can tell us our location at any time,\nand when communications satellites can provide us with near-instantaneous\nbandwidth from anywhere in the world, and when imaging satellites provide us\nwith mapping services that improve everything from agriculture to urban\nplanning to national defence.", "\n\nso... somewhere between 20-40 years ago, I'd reckon?", "\n\n" ]

{ "pile_set_name": "HackerNews" }

[ 0.0005720417248085141, 0.000538915628567338, 0.0010867298115044832, 0.0005435463972389698, 0.0006436273688450456, 0.0007140430388972163, 0.0006192145519889891, 0.0005689908866770566, 0.000971255823969841, 0.0006463603349402547, 0.0006854354869574308, 0.001995444530621171 ]

[ "Reversible flocculation of nanoparticles by a carbamate surfactant.", "\nFatty alkyldiamine readily reacts with CO2 in aqueous solution at pH 12 to reversibly form surface active carbamate species. ", "The carbamate can be reverted to the amine by exposure to N2 and heat. ", "In this work, a carbamate-based surfactant (Y12-carbamate) has been used to disperse and stabilize hydrophobic nanoparticles. ", "This state could be regarded as the \"on\" state of a series of cycle. ", "The nanoparticles were then flocculated when the carbamate groups were cleaved by exposure to N2 and heating, corresponding to the \"off\" state. ", "In a subsequent cycle, the nanoparticles were re-dispersed by exposure to CO2, while the pH remained at 12. ", "This cycle of re-dispersion and flocculation could be repeated two times without impairing the particle size. ", "However, further cycles increased the particle size, indicating that all particles could not be completely re-dispersed. ", "In addition, we also investigated the effect of pH on the colloidal stability with sodium Y12-carbamate, by measuring particle size and electrophoretic mobility. ", "The results showed that pH strongly influenced the stability of the nanoparticles. ", "Sodium Y12-carbamate stabilized the particles with a negative electrophoretic mobility at pH well above pKa whereas at pH close to pKa of Y12-amine (pKa = 9.0), the particles quickly flocculated, as a result of an ion-pair formation between Y12-ammonium and Y12-carbamate." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0615115612745285, 0.0168097373098135, 0.0009219131316058338, 0.0006763869896531105, 0.0006462360033765435, 0.0011634108377620578, 0.0006071797688491642, 0.04211464896798134, 0.0006082048639655113, 0.0005885061109438539, 0.0005559622077271342, 0.0008668664959259331 ]

[ "1/ It’s not clear how long—3, 5, 10 years—but I believe end users & developers ultimately won’t care about the underlying protocols, & there will be a Google for #crypto that indexes, discovers & auto schedules & routes work to the right chain. ", "If you’re working on this DM me...\n\n2/ The implication would be that L1 protocols will over time commoditize and centralize (and value will continue to accrue to higher layers of the stack). ", "Around what? ", "Beliefs, values, people, communities, geographies, industries, domains, expertise, services, support, etc.", "\n\n3/ Another is that value will accrue to higher layers of the stack, e.g., L2 solutions, dapps & vertical opportunities that deliver value to the end user. ", "This will likely take a long time for more infrastructure to be built and mature, but it's not too early to think about this\n\nNot enough importance, energy, or discipline has been put into #7, nor how it affects #1-#6. ", "I'll explain how...\n\n1. ", "Team.", "\n\nMost projects don't have experienced product or design co-founders, or they hire a head of product or design too late.", "\n\nLike startups today (e.g., Airbnb, Slack, Pinterest), bring them in at the beginning to balance deep tech with user-centric design.", "\n\n2. ", "Vision.", "\n\n@m2jr looks for founding teams with \"earned secrets,\" which often come from deep experience in the field working (& seeing pain points) with customers & users at a granular level. ", "Teams & visions should be configured this way. ", "How do we know X should be decentralized?", "\n\n1/ For years, people have been waiting and hoping for crypto's \"Netscape\" moment. ", "The gateway to the web that brought the internet to the main stream.", "\n\nIMHO, looking for the Netscape for the #crypto space is not a relevant or applicable analogy. ", "Here's why...\n\n2/ The way people imagine crypto's \"Netscape moment\" is very literal: as a window, gateway, or browser (just like Netscape) to easily acquire, save, and use crypto and access the decentralized web.", "\n\n3/ But that sounds a lot like a wallet and exchange, which already exists. ", "And yet, even with these onramps and \"browsers\" into crypto, we haven't had that \"Netscape moment\" people are hoping for in terms of mass adoption.", "\n\n1/ *Centralized* apps building atop decentralized protocols may be the winning combination, each furthering the adoption of the other.", "\n\n2/ As many have pointed out, “decentralize all the things” is a mistake. ", "Decentralize the things that benefit from decentralization.", "\n\n3/ Starting with centralized apps (think @coinbase@circlepay etc), if you’ve been paying attention, they are utilizing an increasing amount of decentralized protocols & open-source crypto infrastructure, to the benefit of their end users.", "\n\n@Mainframe_HQ 2/ A simple illustration of how information is transferred over the internet. ", "Mr. A. switches on his data, his ID assigns him an IP address using DHCP (Dynamic Host Configuration Protocol).", "\n\nThe IP address contains personal info. ", "about Mr. A such as his geographical location.", "\n\n1/ Imagine investing in internet stocks and never experiencing the products that the companies create.", "\n\n2/ While I wasn't investing in the 90s, I imagine many investors were minimally familiar w/ the technology behind the companies they were investing in... kind of like many retail #crypto investors today.", "\n\n3/ From the birth of the Web in the early 90s through to now, we've seen increasing alignment between what the markets valued early (at ridiculous multiples), and what consumers use today -- which is Web." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006719056982547045, 0.0006825054879300296, 0.0007921397336758673, 0.000585316214710474, 0.0005732496501877904, 0.0005480920081026852, 0.0007341760210692883, 0.0007792305550538003, 0.0007290957146324217, 0.0007118399371393025, 0.001185585861094296, 0.0007088799029588699, 0.0005553605151362717, 0.0005426104180514812, 0.0010355025297030807, 0.0005958802648819983, 0.0006344836438074708, 0.0007411702536046505, 0.0008053476922214031, 0.0006275210762396455, 0.0006385560263879597, 0.0005983291193842888, 0.0010679002152755857, 0.0007664823206141591, 0.0005596151459030807, 0.0005351790459826589, 0.0006509148515760899, 0.0006209550192579627, 0.0006715116905979812, 0.0006218327907845378, 0.0005912379128858447, 0.0006420955760404468 ]

[ "Introduction {#s1}\n============\n\n*Anaplasma phagocytophilum, Ehrlichia chaffeensis,* and Neorickettsia sennetsu are small (approximately 0.4--1.5 μm), pleomorphic α-Proteobacteria. ", "These bacteria are human pathogens that replicate in membrane-bound compartments inside host granulocytes *(A. phagocytophilum)* or monocytes/macrophages *(E. chaffeensis* and *N. sennetsu)* \\[[@pgen-0020021-b001]--[@pgen-0020021-b003]\\]. ", "They are obligate intracellular pathogens with a life cycle that involves both vertebrate and invertebrate hosts. ", "A. phagocytophilum and *E. chaffeensis* depend on hematophagous ticks as vectors and wild mammals as reservoir hosts ([Table 1](#pgen-0020021-t001){ref-type=\"table\"}) \\[[@pgen-0020021-b002],[@pgen-0020021-b004]\\]. ", "Unknown trematodes are suspected to be the vector and reservoir of N. sennetsu \\[[@pgen-0020021-b001]\\]. ", "No vaccine exists for any of these human pathogens.", "\n\n###### \n\nBiological Characteristics of the Rickettsiales\n\n![](", "pgen.0020021.t001)\n\nA. phagocytophilum is the causative agent of human granulocytic anaplasmosis (HGA), formerly recognized as human granulocytic ehrlichiosis (HGE) \\[[@pgen-0020021-b005],[@pgen-0020021-b006]\\]. ", "Infection with A. phagocytophilum causes fever, headache, myalgia, anorexia, and chills \\[[@pgen-0020021-b007]\\]. ", "Prior to 1994, only ruminant and equine ehrlichiosis were known to be caused by this organism \\[[@pgen-0020021-b001]\\]. ", "A. phagocytophilum is transmitted by *Ixodes* spp. ", "Cases of HGA correspond to the distribution of *Ixodes* spp. ", "being identified in New England, the mid-Atlantic region, the upper Midwest, and northern California in the United States, as well as in parts of Europe. ", "A. phagocytophilum is one of the leading causes of ehrlichiosis in the world. ", "Recent serological data suggest that as much as 15%--36% of the population in endemic areas has been infected \\[[@pgen-0020021-b008]\\]. ", "Far fewer individuals are diagnosed with a symptomatic infection that varies in severity from fever to death \\[[@pgen-0020021-b008]\\]. ", "Half of all symptomatic patients require hospitalization, and 5%--7% require intensive care \\[[@pgen-0020021-b008]\\].", "\n\nHuman monocytic ehrlichiosis (HME), caused by *E. chaffeensis,* was discovered in 1986 \\[[@pgen-0020021-b009]--[@pgen-0020021-b011]\\]. ", "HME is a systemic disease indistinguishable from HGA \\[[@pgen-0020021-b012]\\]. ", "E. chaffeensis has been most commonly identified in the Lone Star tick *(Amblyomma americanum),* with white-tailed deer considered to be the major reservoir. ", "Over 500 cases of HME were diagnosed from 1986 to 1997, predominantly in the south-central and southeastern United States \\[[@pgen-0020021-b012]\\]. ", "The recognition and increased prevalence of the disease has been proposed to be related to changes in the host-vector ecology \\[[@pgen-0020021-b012]\\]. ", "As with all emerging diseases, it is likely outbreaks occurred in the preceding decades. ", "Notably, 1,000 troops training in Texas contracted an unexplained disease with similar symptoms after exposure to the vector from 1942 to 1943 \\[[@pgen-0020021-b012]\\].", "\n\nN. sennetsu is a monocytotropic species that causes sennetsu ehrlichiosis, an infectious mononucleosis-like disease with fever, fatigue, general malaise, and lymphadenopathy \\[[@pgen-0020021-b001],[@pgen-0020021-b013]\\]. ", "Less is known about the distribution of N. sennetsu when compared to *Anaplasma* and *Ehrlichia*. ", "However, sequencing of its genome allows for interesting comparisons, since tissue tropism and clinical symptoms are similar but the vector (unknown trematodes) is different. ", "Additionally, in the United States and Canada, domestic animals infected with the closely related N. risticii develop Potomac horse fever, an acute febrile disease accompanied by diarrhea with high morbidity and mortality \\[[@pgen-0020021-b014],[@pgen-0020021-b015]\\]. ", "The related N. helminthoeca causes acute and highly fatal salmon-poisoning disease of domestic and wild canines \\[[@pgen-0020021-b014],[@pgen-0020021-b016]\\].", "\n\nAlong with *Wolbachia,* these bacteria are members of the Anaplasmataceae family ([Figure 1](#pgen-0020021-g001){ref-type=\"fig\"}) \\[[@pgen-0020021-b003]\\]. *", "Wolbachia* infect arthropods and filarial nematodes, but have not been shown to infect vertebrates directly.", "\n\n{ref-type=\"sec\"}). ", "The Anaplasmataceae (purple) and the Rickettsiaceae (yellow) are highlighted.](pgen.0020021.g001){#pgen-0020021-g001}\n\nTogether with the Rickettsiaceae, the Anaplasmataceae are members of the order Rickettsiales ([Figure 1](#pgen-0020021-g001){ref-type=\"fig\"}) \\[[@pgen-0020021-b003]\\]. ", "The Rickettsiaceae include the obligate intracellular *Rickettsia* spp. ", "Like the Anaplasmataceae, the Rickettsiaceae are obligate intracellular pathogens with a life cycle that involves both vertebrate and invertebrate hosts, but they replicate directly in the cytosol of endothelial cells. ", "All organisms in the order Rickettsiales have relatively small genomes (0.8--1.5 Mb) that have arisen through reductive evolution as they developed dependence on the host cell for necessary functions \\[[@pgen-0020021-b017]\\]. ", "The Rickettsiales and other α-Proteobacteria also have an unresolved evolutionary relationship with the progenitor of the mitochondria \\[[@pgen-0020021-b018],[@pgen-0020021-b019]\\].", "\n\nThree Rickettsiaceae genomes have been published: *Rickettsia prowazekii, R. conorii,* and R. typhi \\[[@pgen-0020021-b018],[@pgen-0020021-b020],[@pgen-0020021-b021]\\]. ", "Four Anaplasmataceae genomes have been published: the insect parasite *W. pipientis w*Mel, the filarial nematode endosymbiont *Wolbachia* sp. *", "w*Bm, the bovine pathogen *Anaplasma marginale,* and the bovine pathogen Ehrlichia ruminantium \\[[@pgen-0020021-b019],[@pgen-0020021-b022]--[@pgen-0020021-b024]\\].", "\n\nWe present here a comparison of the previously completed Rickettsiales genomes to the first complete genomes of three representative Anaplasmataceae human pathogens: *A. phagocytophilum, E. chaffeensis,* and N. sennetsu. ", "The complete genome sequence of these human pathogens will enhance the opportunities for investigation of virulence factors, pathogenesis, immune modulation, and novel targets for antimicrobial therapy and vaccines.", "\n\nResults/Discussion {#s2}\n==================\n\nGenome Anatomy {#s2a}\n--------------\n\n*A. phagocytophilum, E. chaffeensis,* and N. sennetsu each have a single circular chromosome ([Figure S1](#pgen-0020021-sg001){ref-type=\"supplementary-material\"}). ", "Most genomic features are typical of the sequenced Rickettsiales ([Table 2](#pgen-0020021-t002){ref-type=\"table\"}). *", "W. pipientis w*Mel, *Ehrlichia* spp., ", "and *Anaplasma* spp., ", "which are most closely related, all have numerous repeats in their genomes. ", "In contrast, N. sennetsu and R. prowazekii have only six repeats in their respective genomes ([Table 2](#pgen-0020021-t002){ref-type=\"table\"}). ", "The repetitive nature of the *Ehrlichia* and *Anaplasma* genomes is exemplified by the expansion of outer membrane proteins of the OMP-1/P44/Msp2 family (discussed below). ", "In addition numerous other functionally important genes are duplicated including those involved in type IV secretion and vitamin/cofactor biosynthesis.", "\n\n###### \n\nGenome Properties\n\n![](", "pgen.0020021.t002)\n\nThe origin of replication was not experimentally determined in any of the genomes. ", "As with other Rickettsiales \\[[@pgen-0020021-b018]\\], genes typically clustered near the origin *(dnaA, gyrA, gyrB, rpmH, dnaN, parA,* and *parB)* were dispersed throughout the genomes. ", "For E. chaffeensis and *N. sennetsu,* a clear shift in GC-skew occurs near *parA* and *parB* ([Figure 2](#pgen-0020021-g002){ref-type=\"fig\"}). ", "Therefore, basepair 1 was set in the intergenic region between the two genes. ", "In *A. phagocytophilum,* none of these genes were found near the GC-skew transition. ", "Therefore, basepair 1 was set in the intergenic region near *polA*. ", "For E. chaffeensis and *A. phagocytophilum,* these predictions coincide with the predictions for E. ruminantium \\[[@pgen-0020021-b024]\\] and A. marginale \\[[@pgen-0020021-b023]\\].", "\n\n{ref-type=\"sec\"}) and visualized with Sybil. ", "The genes along each ordered chromosome were colored on a gradient from yellow to blue. ", "The ortholog clusters for each query genome were then plotted relative to the order of the reference genome. ", "Regions of synteny are then seen as continuous gradients across large regions of the genome. ", "Above the synteny gradient display is the atypical nucleotide composition. ", "Below the gradient display are the predicted coding regions on the plus strand and the minus strand, and the GC-skew. ", "Representatives of all the Rickettsiales (A) and representative *Ehrlichia* spp. ", "and *Anaplasma* spp. (", "B) were compared separately. ", "AMA, A. marginale St. Maries; APH, A. phagocytophilum HZ; ECH, E. chaffeensis Arkansas; ERU, E. ruminantium Welgevonden; NES, N. sennetsu Miyayama; RPR, R. prowazekii Madrid E; WOL, *W. pipientis w*Mel.](pgen.0020021.g002){#pgen-0020021-g002}\n\nOnly three islands of synteny over 10 kb in length are conserved among all the sequenced Anaplasmataceae, and these islands are shared among all the Rickettsiales ([Figure 2](#pgen-0020021-g002){ref-type=\"fig\"}). ", "They include two operons of ribosomal proteins and one operon of proteins encoding portions of the type IV secretion system. ", "Similar to the other Rickettsiales sequenced, all three genomes have the equivalent of a single rRNA operon with the 16S rRNA separated from the 23S-5S gene pair, as previously described for this order of bacteria \\[[@pgen-0020021-b018]\\].", "\n\nOf genes typically clustered near the origin, *parA* and *parB* were not identified in A. phagocytophilum. ", "Likewise, *parA* and *parB* are truncated in the *Wolbachia* sp. *", "w*Bm. ", "In various mutational studies in free-living prokaryotes, the effects of inactivation of *parA* or *parB* range from lethality to production of anucleated cells at low copy number \\[[@pgen-0020021-b025],[@pgen-0020021-b026]\\]. ", "Without *parA* and *parB, A. phagocytophilum* and the *Wolbachia* sp. *", "w*Bm may have random chromosome partitioning, may require an alternate partitioning factor, or may have inefficient chromosome partitioning.", "\n\nOf all the sequenced Anaplasmataceae, only the *Anaplasma* spp. ", "and *Ehrlichia* spp. ", "share conserved gene order (synteny) across their chromosome ([Figure 2](#pgen-0020021-g002){ref-type=\"fig\"}). ", "E. ruminantium and E. chaffeensis have a single symmetrical inversion near two duplicate Rho termination factors ([Figure 3](#pgen-0020021-g003){ref-type=\"fig\"}). ", "Symmetrical inversions around the origin are the most common large-scale rearrangements in microbial genomes \\[[@pgen-0020021-b027]\\]. ", "Genomic rearrangements between these Rho termination factors are also apparent in A. marginale. ", "The presence of the same break in both the *Anaplasma* and *Ehrlichia* lineages suggests that the duplicate Rho termination factors allow for repeated inversions across this region of the genome.", "\n\n{#pgen-0020021-g003}\n\nIn addition to the synteny breaks near the Rho termination factors, A. marginale has rearrangements located near the *msp2* and *msp3* expression loci and their corresponding pseudogenes ([Figure 3](#pgen-0020021-g003){ref-type=\"fig\"}). ", "Likewise, numerous boundaries of genome rearrangements are located near the homologous *p44* expression locus (*p44ES*/APH_1221) and silent genes. ", "In both *Anaplasma* spp., ", "the silent *p44* and *msp2* genes stored in reserve in the genome can recombine into the corresponding expression locus to generate antigenic variation in the immunodominant surface protein (discussed in detail below). ", "These exact, repeated sequences throughout the genome facilitate recombination for antigenic variation and may also provide sites where chromosomal inversions occur.", "\n\nGenome Comparisons {#s2b}\n------------------\n\nIn order to compare the genomic content of the Rickettsiales to that of other intracellular bacteria, ortholog clusters were delineated for 19 representatives of obligate and facultative intracellular pathogens and endosymbionts (see [Materials and Methods](#s3){ref-type=\"sec\"}). ", "Such comparisons show conservation of 176 ortholog clusters across these intracellular bacteria ([Table S1](#pgen-0020021-st001){ref-type=\"supplementary-material\"}), most of which correspond to housekeeping functions.", "\n\nEleven ortholog clusters present in all the Rickettsiales distinguish the Rickettsiales from other intracellular bacteria examined ([Table S2](#pgen-0020021-st002){ref-type=\"supplementary-material\"}). ", "These include a type I secretion system ATPase, a pyridine nucleotide-disulfide oxidoreductase family protein, a putative transporter, and type IV secretion system proteins VirB9 and VirB8. ", "Thirteen ortholog clusters composed of 12 conserved hypothetical proteins and a GNAT family acetyltransferase distinguish all the Anaplasmataceae from the Rickettsiales ([Table S3](#pgen-0020021-st003){ref-type=\"supplementary-material\"}).", "\n\nFive genera in the Rickettsiales order have at least one representative sequenced. ", "In order to compare these five genera, the following genomes were compared: *R. prowazekii, N. sennetsu, W. pipientis, A. phagocytophilum,* and *E. chaffeensis.* ", "This comparison shows conservation of 423 ortholog clusters ([Table S4](#pgen-0020021-st004){ref-type=\"supplementary-material\"}) generally associated with housekeeping functions. ", "Most genes in the five compared genomes are either conserved among all genomes or unique to a given genome. ", "Indeed, 60% of the two-, three-, and four-way comparisons shared fewer than ten ortholog clusters ([Figure 4](#pgen-0020021-g004){ref-type=\"fig\"}). ", "In the three-way comparisons, the BDE *(A. phagocytophilum, E. chaffeensis,* and *N. sennetsu)* and CDE *(A. phagocytophilum, E. chaffeensis,* and *W. pipientis)* intersections harbor more than 20 ortholog clusters ([Figure 4](#pgen-0020021-g004){ref-type=\"fig\"}). ", "The BDE intersection includes the organisms sequenced here and represents the human pathogens with very similar disease outcomes. ", "Ortholog clusters conserved between these organisms include those for vitamin and cofactor biosynthesis enzymes, a monovalent cation/proton antiporter, a dicarboxylate transporter, and a DNA-binding protein ([Table S5](#pgen-0020021-st005){ref-type=\"supplementary-material\"}). ", "Vitamin and cofactor biosynthesis is specific to the human ehrlichiosis agents, suggesting a niche adaptation or pathogenic trait. ", "The CDE intersection is composed of the most closely related organisms. ", "These ortholog clusters include genes for amino acid, fatty acid and nucleotide biosynthesis, an M48 family peptidase, a cytochrome c-type biogenesis protein, and the type IV secretion system protein VirB4 ([Table S6](#pgen-0020021-st006){ref-type=\"supplementary-material\"}).", "\n\n{ref-type=\"sec\"}) of representative Rickettsiales (A), *Ehrlichia* spp. (", "B), and *Anaplasma* spp. (", "C) were compared. ", "Numbers within the intersections of different ovals indicate ortholog clusters shared by 2, 3, 4, or 5 organisms. ", "Species compared are indicated in diagram intersections as follows. ", "A, *R. prowazekii;* B, *N. sennetsu;* C, *W. pipientis;* D, *A. phagocytophilum;* E, *E. chaffeensis;* F, *A. marginale;* G, E. ruminantium Gardel; and H, E. ruminantium Welgevonden.](pgen.0020021.g004){#pgen-0020021-g004}\n\nIn two-way comparisons, the AC *(R. prowazekii* and *W. pipientis)* and DE *(A. phagocytophilum* and *E. chaffeensis)* intersections contain more than twenty ortholog clusters. ", "Genes shared only by R. prowazekii and W. pipientis include those for cell wall biosynthesis, subunits of cytochrome D ubiquinol oxidase, a biotin transporter, a dinucleoside polyphosphate hydrolase, and an amino acid permease ([Table S7](#pgen-0020021-st007){ref-type=\"supplementary-material\"}). ", "The presence of genes for cell wall biosynthesis in only R. prowazekii and W. pipientis likely reflects differences in the cell surface; *A. phagocytophilum, E. chaffeensis,* and N. sennetsu do not synthesize peptidoglycan \\[[@pgen-0020021-b028]\\]. ", "The peptidoglycan biosynthesis genes are also found in *A. marginale,* which suggests that if these genes are expressed, A. marginale may have a peptidoglycan layer \\[[@pgen-0020021-b023]\\]. ", "Since the peptidoglycan genes are present in A. marginale and W. pipientis but not in the other Anaplasmataceae, these genes have either been horizontally acquired in these organisms or have been lost numerous times in the Anaplasmataceae. ", "Peptidoglycan binding to the Toll-like receptor 2 activates leukocytes. ", "Neither A. marginale nor W. pipientis infects the immune cells of a vertebrate host. ", "The peptidoglycan layer may have been lost to allow the organism to successfully infect vertebrate immune cells.", "\n\nGenes shared only by A. phagocytophilum and E. chaffeensis include those encoding thiamine biosynthetic proteins, a potassium transporter, a peptide deformylase, and an ankyrin repeat protein ([Table S8](#pgen-0020021-st008){ref-type=\"supplementary-material\"}). ", "Thiamine biosynthesis is distinctly absent from *N. sennetsu,* suggesting a possible trematode niche-specific adaptation.", "\n\n*A. phagocytophilum, E. chaffeensis,* and N. sennetsu have 462, 312, and 303 open reading frames (ORFs) or paralog clusters that are unique with respect to the five-organism ortholog cluster analysis, respectively. ", "The vast majority of these unique genes encode hypothetical, conserved hypothetical, and conserved domain proteins, as well as uncharacterized membrane proteins and lipoproteins. ", "Other A. phagocytophilum-specific genes include those encoding the P44 outer membrane proteins and the HGE-14 and HGE-2 antigenic proteins ([Table S9](#pgen-0020021-st009){ref-type=\"supplementary-material\"}). ", "E. chaffeensis-specific genes include those for the OMP-1 family of proteins, arginine biosynthesis, a major facilitator family transporter, and a variable-length PCR target protein ([Table S10](#pgen-0020021-st010){ref-type=\"supplementary-material\"}). ", "N. sennetsu-specific genes include those for an F-type ATPase beta subunit, a cyclophilin-type peptidyl-prolyl cis-trans isomerase, a branched-chain amino acid transporter, a sensor histidine kinase, a strain-specific surface antigen, thioredoxin, and the type IV secretion system proteins VirB2 and VirB4 ([Table S11](#pgen-0020021-st011){ref-type=\"supplementary-material\"}).", "\n\nOf the organism-specific genes detected in this five-way comparison, over half were hypothetical proteins, many of which formed genomic islands of hypothetical proteins ([Figure 2](#pgen-0020021-g002){ref-type=\"fig\"}). ", "The majority of the genes identified as unique were not just unique to the genus, but to the species. ", "Of the 462 A. phagocytophilum-unique genes in this comparison, 448 are also unique when compared with A. marginale. ", "The 21 ortholog clusters shared only between *Anaplasma* spp. ", "include conserved hypothetical proteins, OMP-1 proteins, membrane proteins, and HGE-2 ([Table S12](#pgen-0020021-st012){ref-type=\"supplementary-material\"}). ", "Likewise, of the 312 E. chaffeensis-unique ORFs or paralog clusters in the five-way comparison, 267 are unique upon comparison with either E. ruminantium strain. ", "The 52 ortholog clusters shared only between the *Ehrlichia* spp. ", "include OMP-1 proteins, arginine biosynthetic proteins, a pyrroline-5-carboxylate reductase, a major facilitator protein, conserved hypothetical proteins, membrane proteins, and lipoproteins ([Table S13](#pgen-0020021-st013){ref-type=\"supplementary-material\"}).", "\n\nOnly one ortholog cluster containing conserved hypothetical proteins is shared between the animal pathogens E. ruminantium (Erum1840, ERGA_CDS_01780) and A. marginale (AM279) and are absent from the human pathogens *E. chaffeensis, A. phagocytophilum,* and N. sennetsu. ", "In addition, a homolog of these proteins is present in the Ehrlichia canis Jake publicly available shotgun sequence. ", "Since A. phagocytophilum and E. chaffeensis are maintained in animal reservoirs, presence of this gene is not associated with animal infection. ", "Instead, loss of this protein could be required to establish infection in humans. ", "These conserved hypothetical proteins have some homology to the eukaryotic patatin family of phospholipases. ", "Patatin has been characterized to have phospholipase A-like activity \\[[@pgen-0020021-b029]\\].", "\n\nExcept for *N. sennetsu,* all of the sequenced pathogenic Anaplasmataceae require an arthropod-vector that feeds on blood ([Table 1](#pgen-0020021-t001){ref-type=\"table\"}). ", "Three ortholog clusters, including one for bacterioferritin and two for conserved hypothetical proteins, are absent in all of the tick-, flea-, and louse-borne Rickettsiales, but are present in *Wolbachia* spp. ", "and N. sennetsu ([Table S14](#pgen-0020021-st014){ref-type=\"supplementary-material\"}). ", "The proteins in these ortholog clusters may be correlated to the lack of a blood-sucking arthropod in the life cycles of these organisms.", "\n\nThe tick-borne Anaplasmataceae (*Ehrlichia* spp. ", "and *Anaplasma* spp.) ", "are the only Rickettsiales that are not transmitted transovarially in the invertebrate host. ", "One ortholog cluster containing a class II aldolase/adducing domain protein (NSE_0849, RC0678, RP493, RT0479, WD0208) is absent only from *Ehrlichia* spp. ", "and *Anaplasma* spp. ", "Lack of this aldolase/adducing domain protein may prevent transovarial transmission in the arthropod vector.", "\n\nFour ortholog clusters of conserved hypothetical proteins are present in all the pathogenic Rickettsiales but none of the endosymbionts. ", "These proteins, which remain to be characterized, may be essential for pathogenesis or survival in the vertebrate host ([Table S15](#pgen-0020021-st015){ref-type=\"supplementary-material\"}).", "\n\nA. phagocytophilum Strain Comparison {#s2c}\n------------------------------------\n\nAs an initial effort to use these genome sequences to identify the conserved genomic content of unsequenced members of these species, we conducted microarray-based comparative genome hybridization analyses with two A. phagocytophilum strains. ", "Except for four *p44* hypervariable regions (discussed below), the genomic content across all three strains is conserved (ratio \\< 3). ", "Although A. phagocytophilum and A. marginale have very different complements of unique genes, the genomic content within the strains of A. phagocytophilum is highly conserved. ", "Conservation of the gene content of the strains may explain the similarity of clinical signs of HGA from two geographic regions (New York, Minnesota) and equine ehrlichiosis in California \\[[@pgen-0020021-b007]\\].", "\n\nFree-Living and Obligate-Intracellular α-Proteobacteria {#s2d}\n-------------------------------------------------------\n\nIn order to understand the differences between these obligate intracellular pathogens and a closely related free-living organism, the number of genes in each role category was compared between representative Anaplasmataceae and Caulobacter crescentus ([Table 3](#pgen-0020021-t003){ref-type=\"table\"}). ", "C. crescentus is a closely related and sequenced free-living α-Proteobacteria to the Rickettsiales \\[[@pgen-0020021-b030]\\]. ", "The scope of this comparison was limited to only these five α-Proteobacteria, as only these organisms had role categories assigned in an identical manner.", "\n\n###### \n\nComparison of Role Category Breakdown\n\n![](", "pgen.0020021.t003)\n\nAll of the Anaplasmataceae examined have significantly higher percentages of their genomes involved in nucleotide biosynthesis, cofactor and vitamin biosynthesis, and protein synthesis. ", "Enzymes in these biosynthetic pathways are likely to play an important role in interactions with their hosts and intracellular survival, as discussed below. ", "The protein synthesis category includes many essential genes such as those encoding ribosomal proteins, tRNA synthetases, RNA modification enzymes, and translation factors. ", "These genes are essential and cannot be sacrificed as the genome reduces. ", "Therefore, as the genome size decreases, the proportion of genes involved in protein synthesis increases.", "\n\nAll of the Anaplasmataceae examined have a significantly lower coding capacity for central intermediary metabolism, transport, and regulatory functions. ", "The decrease in central intermediary metabolism and transport reflects the differences in acquiring nutrients and energy. ", "Since intracellular bacteria are exposed to a relatively restricted complement of nutrients and energy sources, they have evolved to be specialists in acquiring specific compounds from their hosts.", "\n\nLikewise, these intracellular bacteria live in a homeostatic environment and have fewer regulatory genes. ", "ORFs encoding σ^70^ and σ^32^ were identified (*rpoD* and *rpoH,* respectively), but σ^24^ and σ^54^ were not detected (*rpoE* and *rpoN,* respectively). ", "Several two-component regulatory systems are retained and may be employed as these bacteria transition between their vertebrate and invertebrate hosts. ", "Despite being identified in *Rickettsia* spp. ", "\\[[@pgen-0020021-b021]\\], stringent response (a global regulatory response) may not be expected in the Anaplasmataceae, since neither RelA nor SpoT proteins were identified.", "\n\nThere are several role categories in which only specific organisms have significant differences from, or similarities to, *C. crescentus.* ", "All the bacteria except E. chaffeensis have a statistically significant decrease in amino acid biosynthesis. ", "The difference between *Ehrlichia* spp. ", "and the other Anaplasmataceae is due to the presence of lysine and arginine biosynthesis pathways in *Ehrlichia* spp., ", "as discussed below. ", "A. phagocytophilum has a significant increase in the percentage of genes dedicated to the cell envelope due to expansion of the OMP-1 family in *Anaplasma* spp. (", "discussed below). ", "W. pipientis has a significantly higher percentage of its genome involved in mobile and extrachromosomal functions due to the unique presence of phage and transposons in its genome \\[[@pgen-0020021-b019]\\]. *", "E. chaffeensis, A. phagocytophilum,* and N. sennetsu have a significant decrease in mobile elements, as they have no intact prophage, no transposable elements, and only a few phage core components (HK97-like portal, major capsid, and prohead protease) scattered throughout their genomes. ", "Lastly, A. phagocytophilum and W. pipientis both have an increased number of disrupted reading frames.", "\n\nBased on comparisons of the intracellular and free-living α-Proteobacteria, the only overall theme that emerges is the conservation of housekeeping genes and the shuffling of the genomes resulting in the loss of many operon structures.", "\n\nPathogenesis {#s2e}\n------------\n\nLittle is known about the genetic determinants required for the Rickettsiales to invade a host and cause disease. ", "Putative pathogenesis genes were identified, including enzymes to neutralize reactive oxygen species, outer membrane proteins, and protein secretion systems.", "\n\n### Oxidative stress response. {#", "s2e1}\n\nReactive oxygen species have been implicated in both host defense to infection and host cell injury \\[[@pgen-0020021-b031]--[@pgen-0020021-b033]\\]. ", "All of the Rickettsiales contain *sodB,* an iron superoxide dismutase. ", "This superoxide dismutase may have an important role in pathogenesis since *sodB* is cotranscribed with components of the type IV secretion system in E. chaffeensis and A. phagocytophilum \\[[@pgen-0020021-b034]\\].", "\n\nFurther examination of conserved genes without functional annotation (e.g., conserved hypothetical proteins, conserved domain proteins) shows two other ortholog clusters of proteins that may be involved in response to oxidative stress---a putative heme copper oxidase and a putative flavohemoglobin. ", "In both cases, there is no significant similarity to a protein of known function, but several conserved domains were identified. ", "From a particular combination of domains and conservation of metal/cofactor ligands, a function of response to oxidative stress can be proposed for these proteins \\[[@pgen-0020021-b035]\\].", "\n\nIndeed, ECH_1079, NSE_0121, and APH_1205 each contain the 12 transmembrane segments and six conserved histidine residues consistent with members of the heme-copper oxidase family. ", "Members of this protein family include cytochrome oxidase subunit I, FixN for nitrogen fixation, and NorB for nitric oxide reduction \\[[@pgen-0020021-b036]\\]. ", "Each of these organisms is unlikely to be fixing nitrogen and already has a functional subunit I of cytochrome oxidase (ECH_1003, NSE_0622, and APH_1085), so these orthologs may be nitric oxide reductases. ", "Alternatively, there may be another, as yet to be identified, role for this oxidase, which was identified in all the Rickettsiales genomes except the *Wolbachia* sp. *", "w*Bm where it is truncated (an ORF that was not annotated but has genomic coordinates from 536343 to 536534).", "\n\nAPH_0545, NSE_0661, and ECH_0778 encode proteins with three functional motifs similar to flavohemoglobins---a heme binding site, an FAD binding domain, and an NAD binding domain. ", "The biological function of the Escherichia coli flavohemoglobin has not been elucidated, but it has been shown to be an efficient alkylhydroperoxide reductase \\[[@pgen-0020021-b037]\\] and a nitric oxide reductase \\[[@pgen-0020021-b038]\\]. ", "This putative flavohemoglobin is conserved among the Anaplasmataceae, but *Wolbachia* spp. ", "are missing the NAD oxidoreductase domain, and R. prowazekii is missing the heme ligands. ", "Although the speculation of a role for these genes in pathogenicity is intriguing, the precise function of each of these proteins will need to be elucidated experimentally.", "\n\n### The OMP-1/MSP2/P44 protein superfamily. {#", "s2e2}\n\nThe Anaplasmataceae all have a diverse complement of outer membrane proteins. ", "Many of these outer membrane proteins (OMPs) are members of Pfam PF01617 \\[[@pgen-0020021-b039]\\] and constitute the OMP-1/MSP2/P44 family. *", "Anaplasma, Ehrlichia,* and *Wolbachia* have each undergone variable levels of expansion of their *omp-1/msp2* gene families ([Figure S2](#pgen-0020021-sg002){ref-type=\"supplementary-material\"}). ", "The *N. sennetsu* genome has only one uncharacterized protein from this family (NSE_0875). *", "W. pipientis w*Mel and the *Wolbachia* sp. *", "w*Bm have the smallest expansion with three *wsp* genes scattered throughout each genome. ", "The largest expansion of this family is in *Ehrlichia* spp. ", "and *Anaplasma* spp. ", "These organisms cannot be transovarially inherited in their arthropod hosts. ", "Instead, ticks acquire *Ehrlichia* or *Anaplasma* by feeding on an infected vertebrate reservoir animal. ", "The expansion of this family may allow persistence in the vertebrate reservoir by providing antigenic variation, thus allowing for effective tick transmission.", "\n\n*E. chaffeensis, E. canis,* and E. ruminantium have 17--22 paralogous tandemly arranged genes from this family that are flanked by a transcription regulator *(tr1)* and a preprotein translocase *(secA)* \\[[@pgen-0020021-b040]--[@pgen-0020021-b042]\\]. ", "These genes all have signal peptides and are likely to be secreted across the cytoplasmic membrane by SecA \\[[@pgen-0020021-b042]\\]. ", "They encode immunodominant major outer membrane proteins that are differentially expressed in ticks and experimentally infected animals \\[[@pgen-0020021-b043]\\].", "\n\nA. marginale St. Maries is reported to have 56 genes that have been placed into this superfamily, including eight *msp2,* eight *msp3,* one *msp4,* three *opag,* 15 *omp-1,* 12 *orfX,* seven *orfY,* and two *msp3* remnants \\[[@pgen-0020021-b023]\\]. ", "These genes are scattered throughout the genome with a bias in location toward the origin of replication. ", "MSP2 and MSP3 are the immunodominant proteins \\[[@pgen-0020021-b044]\\]. ", "The *msp2* and *msp3* gene subsets each include one full-length expression locus and seven reserve/silent sequences that are thought to recombine into the expression locus to generate antigenic variation \\[[@pgen-0020021-b023]\\].", "\n\nThe A. phagocytophilum genome has three *omp-1,* one *msp2,* two *msp2* homologs, one *msp4,* and 113 *p44* loci belonging to the OMP-1/MSP2/P44 superfamily. ", "Although both *Anaplasma* spp. *", "msp2* genes are members of PF01617 and the OMP1/MSP2/P44 superfamily, the *A. marginale msp2* gene is distinct from the *A. phagocytophilum msp2* gene. ", "In addition, the previously identified *omp-1N* is not a member of this Pfam, but is homologous to *E. chaffeensis omp-1N* and the *msp2* operon-associated gene 3 of A. marginale \\[[@pgen-0020021-b045]\\].", "\n\nThe largest expansion of this family is that of *p44* genes in A. phagocytophilum. ", "Only 36 copies of *p44* are in this Pfam, but many smaller regions were identified, resulting in a total of 113 annotated *p44* loci ([Table S16](#pgen-0020021-st016){ref-type=\"supplementary-material\"}). ", "The *p44*s consist of a central hypervariable region of approximately 280 bp containing a signature of four conserved amino acid regions (C, C, WP, A) and conserved flanking sequences longer than 50 bp. ", "Diverse *p44* paralogs *(p44--1* to *p44--65)* are expressed in mammals and ticks and confer antigenic environmental adaptation, especially during tick transmission \\[[@pgen-0020021-b046]--[@pgen-0020021-b049]\\]. ", "The genomic loci of all 65 previously described *p44* genes were determined in the present study ([Figure S3](#pgen-0020021-sg003){ref-type=\"supplementary-material\"}). ", "Twenty-three novel *p44* genes *(p44*-*66* to *p44--88)* were identified by genome sequencing, but have not yet been experimentally identified as being expressed.", "\n\nThe *p44*s were annotated as full-length, silent/reserve, truncated, and fragments ([Figure 5](#pgen-0020021-g005){ref-type=\"fig\"}). ", "There are 22 full-length *p44*s identified that have ORFs longer than 1.0 kb with conserved start and stop codons. ", "By locating highly conserved 5′ and 3′ flanking sequences and signature sequences within the hypervariable region, 64 shorter *p44*s were identified. ", "These ORFs lack a translational start codon and likely serve as reserve/silent *p44*s that can be expressed after recombining into the previously described *p44*-expression locus (*p44ES*/APH_1221) \\[[@pgen-0020021-b045],[@pgen-0020021-b050]\\]. ", "The full-length and silent/reserve *p44* genes are preferentially located near the replication origin ([Figure S3](#pgen-0020021-sg003){ref-type=\"supplementary-material\"}) and symmetrically located around the *p44* expression locus. ", "Localization near the origin, where multiple replication forks coexist, may facilitate recombination between the expression locus and the reserve/silent *p44* genes.", "\n\n{#pgen-0020021-g005}\n\nIn addition to the full-length and silent/reserve *p44* genes, 21 5′ and 3′ fragments and six truncations of *p44* genes larger than 60 nucleotides have been identified in the genome. ", "Truncations include portions of a hypervariable region; fragments did not. ", "The *p44*s annotated as truncated and fragments do not contain both conserved regions flanking the hypervariable region. ", "These *p44*s are not expected to recombine through the homologous recombination model deduced by previous analyses of recombined *p44*s \\[[@pgen-0020021-b049]--[@pgen-0020021-b052]\\].", "\n\nMicroarray-based comparative genomic hybridization reveals that expansion of the *p44* family is a common feature in A. phagocytophilum strains. ", "All but four of the *p44* unique hypervariable sequences used as targets on the microarray are present in the human isolate A. phagocytophilum MN and the horse isolate A. phagocytophilum California MRK ([Figure S3](#pgen-0020021-sg003){ref-type=\"supplementary-material\"}; [Table 4](#pgen-0020021-t004){ref-type=\"table\"}). ", "The *p44*-*12* and *p44*-*9* unique regions are either absent or divergent only in strain MN. ", "The *p44*-*4* and *p44*-*1* unique regions are absent or divergent in strains MN and MRK. ", "This confirms previous results demonstrating that the *p44--1* unique region is absent/divergent in MN and MRK \\[[@pgen-0020021-b052]\\].", "\n\n###### \n\nSelected A. phagocytophilum CGH Results\n\n![](", "pgen.0020021.t004)\n\n### Other important outer membrane proteins. {#", "s2e3}\n\n*N. sennetsu* has a single *p51* gene (NSE_0242) encoding its immunodominant P51 major outer membrane protein \\[[@pgen-0020021-b014]\\]. ", "The *p51* gene is highly conserved among *N. risticii, N. sennetsu,* and the Stellantchasmus falcatus fluke agent, but not in *N. helminthoeca,* the agent causing an acute, highly fatal salmon-poisoning disease of domestic and wild canines \\[[@pgen-0020021-b014]\\]. ", "Although a full-length, highly conserved homolog for P51 was not found in the Rickettsiales genome sequences, P51 was placed in an ortholog cluster of genes conserved among all the Rickettsiales due to short regions of similarity, particularly in a C-terminal region that may include a secretion peptide motif.", "\n\nOther outer membrane proteins have been reported in *A. marginale,* including *msp5, msp1a,* and *msp1b*. ", "The *msp5* gene (a SCO1/SenC family protein) is found in all the Rickettsiales, whereas *msp1a* and *msp1b* are unique to A. marginale.", "\n\nOnly E. chaffeensis and E. canis encode a 120-kDa immunodominant surface protein (ECH_0039) \\[[@pgen-0020021-b053]\\]. ", "The variable-length PCR target useful in distinguishing various strains of E. chaffeensis \\[[@pgen-0020021-b054]\\] is present only in the genome of E. chaffeensis Arkansas (ECH_0170).", "\n\n### Protein secretion systems. {#", "s2e4}\n\nAll of the strains sequenced here contain both a Sec-dependent and Sec-independent protein export pathway for secretion of proteins across the inner membrane. ", "The Sec-independent pathway (Tat pathway) has been implicated in the transport of phospholipases in Pseudomonas aeruginosa \\[[@pgen-0020021-b055]\\]. ", "All of the strains sequenced here also contain two components of a putative type I secretion system, potentially for transporting toxins or proteases carrying a C-terminal secretion signal.", "\n\nAll of the Rickettsiales have a type IVa secretion system that uses a complex of transmembrane proteins and a pilus to deliver effector macromolecules from prokaryotic to eukaryotic cells. ", "The reference Type IVa secretion system is that of *Agrobacterium tumefaciens,* which contains 11 genes in the *vir*B locus and one gene in the *vir*D locus. ", "Several components of the A. tumefaciens type IVa secretion system are conserved in *A. phagocytophilum, E. chaffeensis,* and N. sennetsu. ", "Like R. prowazekii and *W. pipientis,* the three organisms sequenced here are lacking *vir*B1, *vir*B5, and *vir*B7. ", "All but N. sennetsu lack *vir*B2.", "\n\nThe *vir*B3, *vir*B4, and *vir*B6 homologs are contiguous at one locus ([Figure S4](#pgen-0020021-sg004){ref-type=\"supplementary-material\"}). ", "Neighboring this locus in all of these organisms are three or four *vir*B6 homologs. ", "Contiguous at a second locus are *vir*B8, *vir*B9, *vir*B10, *vir*B11, and *vir*D4. ", "The type IV secretion system is one of the few sets of genes syntenic between all of the Rickettsiales sequenced, suggesting that tight coordination of expression of these genes is critical.", "\n\nIn *A. tumefaciens,* translocated type IV effector proteins have the consensus sequence R-X~7~-R-X-R-X-R-X-X~n~, where lysine can substitute for arginine with no noticeable effect \\[[@pgen-0020021-b056]\\]. ", "In addition, effector molecules are often localized to a region of the chromosome near the type IV secretion apparatus. ", "Examination of the regions around the type IV operons in A. phagocytophilum revealed numerous genes encoding HGE-14, which contain C-terminal sequences similar, but not identical, to this motif ([Table S17](#pgen-0020021-st017){ref-type=\"supplementary-material\"}), suggesting that it may be an excreted effector molecule. ", "Subsequent searches of the Anaplasmataceae genomes with motifs like that found in HGE-14 did not reveal other potential effector molecules.", "\n\nMetabolism {#s2f}\n----------\n\nThe metabolic potentials of *A. phagocytophilum, E. chaffeensis,* and N. sennetsu were compared to that of R. prowazekii and W. pipientis \\[[@pgen-0020021-b018],[@pgen-0020021-b019]\\]. ", "Overall, the Anaplasmataceae have very similar metabolic pathways but are quite distinct from those of R. prowazekii ([Figure 6](#pgen-0020021-g006){ref-type=\"fig\"}). ", "W. pipientis differs from the other Anaplasmataceae in its inability to synthesize some cofactors.", "\n\n{#pgen-0020021-g006}\n\n### Nucleotide and cofactor biosynthesis. {#", "s2f1}\n\n*E. chaffeensis, A. phagocytophilum, N. sennetsu,* and W. pipientis have the ability to synthesize all nucleotides. ", "This differs from *R. prowazekii,* which cannot make purines or pyrimidines, and therefore must rely on nucleotide translocases and interconversion of the bases to obtain the full complement of nucleotides \\[[@pgen-0020021-b018]\\]. *", "E. chaffeensis, A. phagocytophilum,* and N. sennetsu are able to synthesize most vitamins and cofactors. ", "In contrast to the other Anaplasmataceae, W. pipientis has lost some of its ability to synthesize cofactors, and it has completely lost the biosynthetic pathways for biotin, thiamine, and NAD. ", "In addition, it may be in the process of losing the ability to synthesize folate. ", "R. prowazekii has also lost the ability to synthesize these cofactors as well as FAD, pantothenate, and pyridoxine-phosphate.", "\n\nBiotin is one of the essential cofactors only synthesized by the vertebrate-infecting Anaplasmataceae. ", "In most organisms, biotin is required for many carboxylation reactions, but is not synthesized by many multicellular eukaryotes. ", "RT-PCR analysis showed that all four genes in the biotin biosynthesis pathway *(BioA/B/D/F)* were expressed by E. chaffeensis and A. phagocytophilum in THP-1 and HL-60 cells, respectively, at both 2 d and 3 d post infection ([Figure S5](#pgen-0020021-sg005){ref-type=\"supplementary-material\"}).", "\n\nThe presence of nucleotide, vitamin, and cofactor biosynthetic pathway in *E. chaffeensis, A. phagocytophilum,* and *N. sennetsu* suggests that they do not need to compete with the host cell for, and may even supply host cells with, essential vitamins and nucleotides. ", "It has been previously proposed that *Wigglesworthia glossinidia* supplies its host with vitamins that are rare in the blood meal of its arthropod host (tsetse fly) \\[[@pgen-0020021-b057]\\]. ", "Interestingly, *Ehrlichia* spp. ", "and *Anaplasma* spp., ", "the two tick-borne intracellular pathogens sequenced, both have a complement of pathways for cofactor and amino acid biosynthesis similar to *W.* *glossinidia* ([Table 5](#pgen-0020021-t005){ref-type=\"table\"}). ", "This raises the possibility that these pathogens may currently be, or historically have been, able to provide a benefit to their tick hosts by providing necessary cofactors.", "\n\n###### \n\nAmino Acid and Cofactor Biosynthesis in Intracellular Bacteria\n\n![](", "pgen.0020021.t005)\n\n### Amino acid biosynthesis. {#", "s2f2}\n\nThe Rickettsiales have a very limited ability to synthesize amino acids and must rely on transporting them from the host ([Figure 6](#pgen-0020021-g006){ref-type=\"fig\"}). ", "All four of the Anaplasmataceae sequenced have the ability to make glycine, glutamine, glutamate, and aspartate. ", "Additionally, E. chaffeensis is predicted to be able to synthesize arginine and lysine like E. ruminantium \\[[@pgen-0020021-b024]\\]. ", "One possible role for arginine biosynthesis may be to recover an intracellular arginine pool after exposure to inducible host nitric oxide. ", "Nitric oxide is synthesized by nitric oxide synthases that convert arginine to citrulline and nitric oxide \\[[@pgen-0020021-b058]\\]. ", "The production of nitric oxide is likely to deplete the intracellular pool of arginine, further hampering intracellular growth. ", "The presence of an arginine biosynthesis pathway and putative nitric oxide reductase(s) may allow *Ehrlichia* spp. ", "to recover more rapidly and subvert the host immune response. ", "This would be similar to the proposed retention of select tryptophan biosynthetic genes in *Chlamydia* spp. ", "in order to replenish tryptophan pools after host enzymatic degradation of tryptophan in response to IFN-γ \\[[@pgen-0020021-b059]\\].", "\n\n### Glycolysis, tricarboxylic acid cycle, pentose phosphate, and respiration. {#", "s2f3}\n\nA complete pyruvate dehydrogenase, tricarboxylic acid cycle, F~0~F~1~-ATPase, and electron transport chain were found in all of the organisms. ", "All five organisms are likely to use host-derived carboxylates and amino acids, but none of these organisms can obtain carbon or energy from fatty acids or actively carry out glycolysis. ", "The glycolysis enzymes present are limited to those that produce glyceraldehyde-3-phosphate and dihydroxyacetone phosphate from phosphoenolpyruvate ([Figure 6](#pgen-0020021-g006){ref-type=\"fig\"}). ", "The glyceraldehyde-3-phosphate produced in this manner is used in the nonoxidative pentose phosphate pathway, resulting in the production of pentoses needed for cofactor and nucleotide biosynthesis. ", "Consistent with this role for the glycolytic enzymes, R. prowazekii and R. conorii retain neither the glycolytic enzymes nor the enzymes needed for the biosynthesis of nucleotides or cofactors from pentose. ", "Similarly, dihydroxyacetone phosphate from these glycolytic enzymes can be converted to glycerol-3-phosphate for phospholipid biosynthesis in the Anaplasmataceae. ", "Without the glycolytic enzymes, *Rickettsia* spp. ", "must obtain glycerol-3-phosphate from the host via a glycerol-3-phosphate transporter.", "\n\nEvolution and DNA Repair {#s2g}\n------------------------\n\nA genome-scale phylogenetic analysis using a concatenated alignment of core proteins is consistent with rRNA studies and current taxonomic assignments. ", "This indicates that *Anaplasma* and *Ehrlichia* are sister genera that share a common ancestor with *Wolbachia* ([Figure 1](#pgen-0020021-g001){ref-type=\"fig\"}). *", "Neorickettsia* is the deepest-branching lineage in the group.", "\n\nThe branch lengths on the whole genome tree can be used to get an indication of the relative rates of evolution of these organisms. ", "In general, the branch lengths for these intracellular organisms are longer than those of their free-living relatives. ", "This may be due to either differences in DNA repair or population genetic and selection-related force. ", "For example, many intracellular organisms go through more stringent population bottlenecks, which in turn increase the amount of genetic drift and possibly the rate of accumulation of deleterious mutations.", "\n\nAnalysis of the genome of *W. pipientis w*Mel revealed that it had a longer branch length than the closely related *Rickettsia;* the *Rickettsia* have higher rates of evolution than free-living organisms \\[[@pgen-0020021-b019]\\]. ", "Wu et al. ", "\\[[@pgen-0020021-b019]\\] ascribed this increase to features of *Wolbachia* biology. ", "However, there appears to be a general increase in the rate for all of the Anaplasmataceae ([Figure 1](#pgen-0020021-g001){ref-type=\"fig\"}). ", "Thus, the increase reported for *Wolbachia* \\[[@pgen-0020021-b019]\\] is not likely due to the specific biology of *Wolbachia,* but instead to some feature shared by all Anaplasmataceae.", "\n\nExamination of the putative DNA-repair capabilities of the different species does not reveal any significant differences between the Anaplasmataceae and the *Rickettsia* spp. ([", "Table S18](#pgen-0020021-st018){ref-type=\"supplementary-material\"}). ", "Interestingly, within the Anaplasmataceae, N. sennetsu appears to have the longest branch length and the most limited suite of DNA repair genes within the group. ", "For example, N. sennetsu is missing various glycosylases and exonucleases that contribute to repair, including *uvrABC,* which is involved in nucleotide excision repair. ", "It is possible that the faster rate of evolution in this organism is related to the absence of some of these repair pathways.", "\n\nThe absence of *uvrABC* in N. sennetsu and the absence of *uvrBC* in the *Ehrlichia* spp. ", "suggest that these species do not have nucleotide excision repair (NER). ", "NER is used by other organisms, including bacteria, archaea, and eukaryotes, as a general repair process to remove sections of DNA with gross abnormalities. ", "One important role of NER is in the repair of UV-induced DNA damage, and defects in NER in other species lead to great increases in UV sensitivity. ", "It appears that *Neorickettsia* has compensated for this by acquiring a gene homologous to DNA photolyases, an alternative mechanism for repairing UV damage. ", "The *Neorickettsia* photolyase is not particularly closely related to known photolyases from α-Proteobacteria but is instead most closely related to a photolyase from Coxiella burnetii, a γ-Proteobacteria. ", "The *Ehrlichia* spp., ", "however, do not encode a photolyase homolog, and thus these species may be highly UV-sensitive.", "\n\nConclusions {#s2h}\n-----------\n\nThe dual existence of members of *Anaplasma* spp. ", "and *Ehrlichia* spp. ", "as invertebrate symbionts or commensals and effective human and animal pathogen requires flexibility, a fact reflected in the genome. ", "Both organisms display an expansive inventory of paralogous genes encoding diverse functions that promote survival and success in different environments when compared to *Neorickettsia* spp. ", "and *Wolbachia* spp., ", "which do not require a mammalian host. ", "This capacity is evident from the large repertoire of outer membrane proteins, and partial duplication of some of the virulence determinants (e.g., components of the type IV protein secretion system).", "\n\nThe large number of paralogous genes encoding immunodominant outer membrane proteins in *Anaplasma* spp. ", "and *Ehrlichia* spp. ", "has important implications for the study of pathogenesis and in the development of vaccination strategies. ", "Adaptability in the human host may underlie significant disease manifestations. ", "Genomic-level characterization of the full complement of variable antigens will facilitate the future development of more specific and sensitive diagnostic targets. ", "In light of the growing recognition of the increased global burden of ehrlichiosis, development of such diagnostic targets will impact public health.", "\n\nBetween pairwise comparisons of different species within a single genus, there are hundreds of genes that are not shared. ", "Often these gene differences are immunodominant outer membrane proteins, but the vast majority are genes that are not functionally characterized in any organism. ", "Some are likely to be involved in zoonosis or specific disease characteristics. ", "For instance, A. phagocytophilum is the only sequenced Rickettsiale that infects neutrophils. ", "Therefore, some of the A. phagocytophilum-unique genes (e.g., genes encoding P44 and HGE-14) may be involved in neutrophil invasion.", "\n\nMany pathogens are obligate intracellular bacteria. ", "But since they are difficult or impossible to culture and tools for genetic manipulation are limited, they are less well characterized than the facultative intracellular bacteria or extracellular pathogens. ", "The analysis of the genome sequences provides critical insights into the biology of these intracellular pathogens and will facilitate manipulation of the emerging human ehrlichiosis agents and leukocytotropic pathogens.", "\n\nMaterials and Methods {#s3}\n=====================\n\nIntracellular bacteria purification and DNA preparation. {#", "s3a}\n--------------------------------------------------------\n\nOrganisms (infecting \\~1 × 10^9^ host cells; 50--100 175-cm^2^ flasks) were cultured in synchrony in respective host cells (E. chaffeensis in DH82 cells, A. phagocytophilum in HL-60 cells, and N. sennetsu in P388D~1~ cells). ", "Bacterial cells were liberated from the infected host cells using Dounce homogenization, differential centrifugation, and Percoll density gradient centrifugation \\[[@pgen-0020021-b060]\\]. ", "Any specimens with host nuclei contamination were excluded. ", "From these isolated bacteria, phenol extraction was used to purify DNA that was minimally fragmented and free of host-cell DNA. ", "Levels of host DNA contamination were verified to be less than 0.001% by PCR using host G3PDH-specific primers. ", "This method was highly successful, with only 14 sequencing reads identified as being of human origin from a total of over 57,000 good sequencing reads.", "\n\nSequencing and annotation. {#", "s3b}\n--------------------------\n\nThe complete genome sequences were determined using the whole-genome shotgun sequencing approach \\[[@pgen-0020021-b061]\\], sequences were assembled into contigs using the Celera Assembler \\[[@pgen-0020021-b062]\\], and all gaps were closed \\[[@pgen-0020021-b063]\\]. ", "ORFs from each genome were predicted and annotated using a suite of automated tools that combine Glimmer gene prediction \\[[@pgen-0020021-b064],[@pgen-0020021-b065]\\], ORF and non-ORF feature identification (e.g., protein motifs), and assignment of database matches and functional role categories to genes \\[[@pgen-0020021-b063]\\]. ", "Frameshifts and point mutations were detected and corrected where appropriate; those remaining were annotated as \"authentic frameshift\" or \"authentic point mutation.\" ", "Repeats were identified using RepeatFinder \\[[@pgen-0020021-b066],[@pgen-0020021-b067]\\] and were manually curated. ", "The complete genome sequences for A. phagocytophilum HZ, E. chaffeensis Arkansas, and N. sennetsu Miyayama have been deposited in GenBank.", "\n\nAnnotation of the *p44* genes. {#", "s3c}\n------------------------------\n\nFull-length *p44*s were defined as having ORFs greater than 1,000 bp with conserved start codon and stop codons. ", "For shorter silent/reserve *p44*s, the ORFs were initially identified by locating highly conserved 5′ and 3′ sequences and signature sequences within the hypervariable region. ", "Since these silent/reserve *p44*s lack a start and stop codon, the 5′ and 3′ ends were annotated on the basis of conserved genome features found in full-length *p44* genes \\[[@pgen-0020021-b050],[@pgen-0020021-b068]\\]. ", "The annotated *p44* fragments are at least 60 nucleotides in length, have either 5′ or 3′ conserved sequences, and may contain a partial hypervariable region ([Figure 5](#pgen-0020021-g005){ref-type=\"fig\"}).", "\n\nGenome comparisons. {#", "s3d}\n-------------------\n\nOrtholog clusters were delineated for R. prowazekii Madrid E \\[[@pgen-0020021-b018]\\], R. typhi Wilmington \\[[@pgen-0020021-b021]\\], R. conorii Malish 7 \\[[@pgen-0020021-b020]\\], N. sennetsu Miyayama, *Wolbachia* sp. *", "w*Bm \\[[@pgen-0020021-b022]\\], *W. pipientis w*Mel \\[[@pgen-0020021-b019]\\], E. chaffeensis Arkansas, E. ruminantium Gardel (GenBank CR925677.1), E. ruminantium Welgevonden \\[[@pgen-0020021-b024]\\], A. marginale St. Maries \\[[@pgen-0020021-b023]\\], A. phagocytophilum HZ, Brucella suis 1330 \\[[@pgen-0020021-b069]\\], Bartonella henselae Houston-1 \\[[@pgen-0020021-b070]\\], Coxiella burnetii RSA 493 \\[[@pgen-0020021-b071]\\], Tropheryma whipplei Twist \\[[@pgen-0020021-b072]\\], Blochmannia floridanus \\[[@pgen-0020021-b073]\\], *Buchnera* sp. ", "APS \\[[@pgen-0020021-b074]\\], Chlamydia pneumoniae AR39 \\[[@pgen-0020021-b075]\\], and *W. glossinidia brevipalpis* \\[[@pgen-0020021-b076]\\]. ", "For *Wolbachia* sp. *", "w*Bm, the ORFs used in these comparisons were uncurated ORFs predicted and annotated using a suite of automated tools that combine Glimmer gene prediction \\[[@pgen-0020021-b064],[@pgen-0020021-b065]\\], ORF and non-ORF feature identification (e.g., protein motifs), and assignment of database matches and functional role categories to genes \\[[@pgen-0020021-b063]\\]. ", "Upon release of the annotated genome \\[[@pgen-0020021-b022]\\], these uncurated ORFs were paired with the corresponding curated ones where possible, with exceptions noted in the text.", "\n\nParalog clusters within each of the genomes were identified using the Jaccard algorithm with the following parameters: 80% or greater identity and Jaccard coefficient 0.6 or higher \\[[@pgen-0020021-b077], [Text S1](#pgen-0020021-sd001){ref-type=\"supplementary-material\"}\\]. ", "Members of paralog clusters were then organized into ortholog clusters by allowing any member of a paralog cluster to contribute to the reciprocal best matches used to construct the ortholog clusters. ", "The conservation of ortholog clusters across the various genomes analyzed was determined using Sybil, a web-based software package for comparative genomics developed at TIGR (<http://sybil.sourceforge.net>). ", "The database of these clusters and corresponding tools can be accessed through TIGR (<http://www.tigr.org/sybil/rcd>). ", "Metabolic pathways and transporters were compared across genomes using (1) these calculated ortholog clusters, (2) Genome Properties \\[[@pgen-0020021-b078]\\], (3) TransportDB \\[[@pgen-0020021-b079]\\], and (4) Biocyc \\[[@pgen-0020021-b080]\\].", "\n\nSignificant differences in the role category composition was determined using χ^2^ calculated using the Yates continuity correction. ", "A *p*-value less than 0.01 was considered significant.", "\n\nGC-skew and origin prediction. {#", "s3e}\n------------------------------\n\nThe GC-skew was calculated as (C − G)/(C + G) in windows of 1,000 bp along the chromosome \\[[@pgen-0020021-b081]\\]. ", "The origin of replication was not experimentally determined in any of the genomes. ", "For E. chaffeensis and *N. sennetsu,* a clear shift in GC-skew occurs near *parA* and *parB*. ", "Therefore basepair 1 was set in the intergenic region between the two genes. ", "In *A. phagocytophilum,* a GC-skew transition occurs near *polA.* Therefore, basepair 1 was set in the intergenic region near *polA*.", "\n\nAtypical nucleotide composition. {#", "s3f}\n--------------------------------\n\nRegions of atypical nucleotide composition were identified by the χ^2^ analysis: the distribution of all 64 trinucleotides was computed for the complete genome in all six reading frames, followed by the trinucleotide distribution in 5,000-bp windows overlapping by 500 bp. ", "For each window, the χ^2^ statistic was computed based on the difference between the trinucleotide content in that window and that of the whole genome. ", "Peaks indicate regions of atypical nucleotide composition.", "\n\nGenome tree construction. {#", "s3g}\n-------------------------\n\nProtein sequences of 31 housekeeping genes *(frr, infC, nusA, pgk, pyrG, rplA, rplB, rplC, rplD, rplE, rplF, rplK, rplL, rplM, rplN, rplP, rplS, rplT, rpmA, rpoB, rpsB, rpsC, rpsE, rpsI, rpsJ, rpsK, rpsM, rpsS, smpB,* and *tsf)* from complete α-Proteobacteria genomes were aligned to predefined HMM models and ambiguous regions were autotrimmed according to an embedded mask. ", "Concatenated alignments were then used to build a maximum likelihood tree with bootstrapping using PHYML \\[[@pgen-0020021-b082]\\]. ", "The γ-Proteobacteria E. coli and the β-Proteobacteria Neisseria meningitidis were used as outgroups to root the tree.", "\n\nArray construction and hybridizations. {#", "s3h}\n--------------------------------------\n\nOligonucleotides (70-mer) were designed from the unique ORFs of each of the three genomes. ", "The oligonucleotides (Illumina, San Diego, California, United States) were diluted to 25 μM in DMSO and spotted in quadruplicate onto UltraGap slides (Corning, Acton, Massachusetts, United States). ", "Cy3 and Cy5 probes were synthesized from genomic DNA as previously described \\[[@pgen-0020021-b083]\\]. ", "In order to obtain enough DNA for microarray analysis, small amounts of DNA were prepared in the manner described above for genome sequencing. ", "This DNA was then quantitatively amplified using GenomiPhi (Amersham, Piscataway, New Jersey, United States).", "\n\nAppropriately labeled query and reference probes were hybridized overnight, washed, and scanned using an Axon GenePix 4000B scanner (Axon Instruments, Union City, California, United States). ", "The corresponding images were analyzed with TIGR Spotfinder \\[[@pgen-0020021-b084]\\]. ", "Log mode centering was used to normalize the data alleviating the bias of expression microarray normalization methods, which expect a normal distribution of data. ", "Briefly, a Perl script was designed to construct the histogram of the log~2~ of the ratio and adjust the histogram mode to zero. ", "The data presented are the geometric means of the normalized ratios from at least two slides with different reference Cy dyes and with oligonucleotides printed in quadruplicate.", "\n\nTranscript analysis of biotin biosynthetic genes. {#", "s3i}\n-------------------------------------------------\n\nTotal RNA was extracted from E. chaffeensis or A. phagocytophilum-infected THP-1 or HL-60 cells at 2 d or 3 d postinfection using RNeasy (Qiagen, Valencia, California, United States). ", "RNA was DNase I treated (Invitrogen, Carlsbad, California, United States) in the presence of 40 U of RNaseOUT (Invitrogen) for 15 min at room temperature, followed by inactivation at 65 °C in the presence of 2.5 mM EDTA for 10 min. ", "For cDNA synthesis, total RNA (0.5 μg) was reverse-transcribed at 42 °C for 1 h in 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl~2~, 0.5 mM of each dNTP, 1 U of RNase inhibitor (Invitrogen), 1.5 μM random hexamers (Invitrogen), and 10 U of Superscript II reverse transcriptase (Invitrogen). ", "The reaction was terminated by heat inactivation at 70 °C for 15 min. ", "To ensure the absence of DNA contamination in the RNA preparations, the assay was duplicated without reverse transcriptase. ", "The subsequent amplification was conducted with standard conditions for 25 cycles of 95 °C for 45 s, 54 °C for 45 s, and 72 °C for 1 min and with the PCR primer pair ([Table S19](#pgen-0020021-st019){ref-type=\"supplementary-material\"}).", "\n\nSupporting Information {#s4}\n======================\n\n###### Linear Representation of E. chaffeensis Arkansas, A. phagocytophilum HZ, and N. sennetsu Miyayama Genomes\n\nORFs are oriented along the molecule and are color-coded by role category: violet, amino acid biosynthesis; light blue, biosynthesis of cofactors, prosthetic groups, and carriers; light green, cell envelope; red, cellular processes; brown, central intermediary metabolism; yellow, DNA metabolism; light gray, energy metabolism; black, mobile/extrachromosomal functions and truncated ORFs; magenta, fatty acid and phospholipid metabolism; pink, protein synthesis and fate; orange, purines, pyrimidines, nucleosides, and nucleotides; olive, regulatory functions and signal transduction; dark green, transcription; teal, transport and binding proteins; gray, unknown function; crosshatched, conserved hypothetical proteins; white, hypothetical proteins; salmon, other categories. ", "The tRNA genes and rRNA genes are represented by their secondary structure. ", "Repeats are shown by dual-arrowed line segments; paralogs are represented by arrows.", "\n\n(10.4 MB PDF)\n\n###### \n\nClick here for additional data file.", "\n\n###### Phylogenetic Tree of OMP1 Proteins\n\nThe protein sequences of all the members of PFAM01617 were aligned and a phylogenetic tree inferred. ", "The divergence of the OMP1/MSP2/P44 proteins in this superfamily did not permit robust inferences about the evolution of these proteins, but allowed classification of the proteins into superfamilies as reflected in their annotation. ", "Particular families within this superfamily are highlighted, including the P44 proteins (pink), the OMP-1s (blue), and the Wsp (yellow).", "\n\n(876 KB PDF)\n\n###### \n\nClick here for additional data file.", "\n\n###### Distribution of the *p44* Genes in A. phagocytophilum Strains\n\nRims 1 and 2: predicted coding regions on the plus and minus strands, respectively, color-coded by role categories. ", "Rim 3: atypical nucleotide composition. ", "Rim 4: distribution of *p44* silent genes (green), expression locus (cyan), full-length genes (magenta), fragments (brown), and truncations (blue). ", "Rims 5 and 6: microarray-based comparative genome hybridization results for A. phagocytophilum strain HZ against strains MRK and MN. ", "The ratios \\[(HZ normalized intensity)/(query normalized intensity)\\] were divided into three categories: ratio \\> 10 (red; absent); ratio 3--10 (blue; absent/divergent); and ratio \\< 3 (not plotted; present).", "\n\n(1.0 MB PDF)\n\n###### \n\nClick here for additional data file.", "\n\n###### Type IV Secretion Systems in Rickettsiales\n\nGenes encoding the type IV secretion system components can be found at two distinct regions of the Rickettsiales genome. ", "At the larger of these regions, *virB3, virB4,* and *virB6* show a typical arrangement. ", "These are followed by a series of genes in the *virB6* family that have been shown to be cotranscribed in *W. pipientis w*Mel. ", "Each of these regions is presented with ortholog clusters (see [Materials and Methods](#s3){ref-type=\"sec\"}) and color coded: cyan, *virB3;* orange, *virB4;* green, *virB6;* and purple, a *virB6* family of genes. ", "Orthologs conserved in location are connected with gray bars. ", "The *virB3* gene is not always annotated, due to its small size, but it is present in all Rickettsiales genomes examined.", "\n\n(616 KB PDF)\n\n###### \n\nClick here for additional data file.", "\n\n###### Transcript Analysis of Biotin Biosynthetic Genes\n\nDNase-treated total RNA was reverse-transcribed and subsequently PCR amplified using primers specific to each biotin biosynthesis gene. ", "RT-PCR analysis showed that all four genes in the biotin biosynthesis pathway *(BioA/B/D/F)* were expressed by E. chaffeensis and A. phagocytophilum in THP-1 and HL-60 cells, respectively, at 2 d (unpublished data) and 3 d postinfection.", "\n\n(61 KB JPG)\n\n###### \n\nClick here for additional data file.", "\n\n###### Ortholog Clusters Conserved across All Representative Obligate and Facultative Intracellular Pathogens and Endosymbionts Presented in a Tab-Delimited Format\n\n(640 KB DOC)\n\n###### \n\nClick here for additional data file.", "\n\n###### Ortholog Clusters Present in All the Rickettsiales but Not in Any Other Intracellular Bacterium Examined\n\n(49 KB DOC)\n\n###### \n\nClick here for additional data file.", "\n\n###### Ortholog Clusters Present in All Anaplasmataceae but Not the Rickettsiales or Other Intracellular Bacterium Examined\n\n(47 KB DOC)\n\n###### \n\nClick here for additional data file.", "\n\n###### Ortholog Clusters Present in All of Five Representatives of the Genera in the Rickettsiales That Have at Least One Representative Sequenced\n\nThe following genomes were compared: *Rickettsia prowazekii, Neorickettsia sennetsu, Wolbachia pipientis, Anaplasma phagocytophilum,* and Ehrlichia chaffeensis.", "\n\n(424 KB DOC)\n\n###### \n\nClick here for additional data file.", "\n\n###### Ortholog Clusters Present in *Neorickettsia sennetsu, Anaplasma phagocytophilum,* and *Ehrlichia chaffeensis,* but Not in Wolbachia pipientis and Rickettsia prowazekii\n\n(44 KB DOC)\n\n###### \n\nClick here for additional data file.", "\n\n###### Ortholog Clusters Present in *Wolbachia pipientis, Anaplasma phagocytophilum,*and *Ehrlichia chaffeensis,* but Not in Neorickettsia sennetsu and Rickettsia prowazekii\n\n(54 KB DOC)\n\n###### \n\nClick here for additional data file.", "\n\n###### Ortholog Clusters Present in Rickettsia prowazekii and *Wolbachia pipientis,* but Not in *Neorickettsia sennetsu, Anaplasma phagocytophilum,* or Ehrlichia chaffeensis\n\n(41 KB DOC)\n\n###### \n\nClick here for additional data file.", "\n\n###### Ortholog Clusters Present in Anaplasma phagocytophilum and *Ehrlichia chaffeensis,* but Not in *Rickettsia prowazekii, Wolbachia pipientis,* or Neorickettsia sennetsu\n\n(46 KB DOC)\n\n###### \n\nClick here for additional data file.", "\n\n###### Individual Genes (Based on Ortholog Cluster Analysis) Present in *Anaplasma phagocytophilum,* but Not in *Ehrlichia chaffeensis, Rickettsia prowazekii, Wolbachia pipientis,* or Neorickettsia sennetsu\n\n(394 KB DOC)\n\n###### \n\nClick here for additional data file.", "\n\n###### Individual Genes (Based on Ortholog Cluster Analysis) Present in Ehrlichia chaffeensis but Not in *Anaplasma phagocytophilum, Rickettsia prowazekii, Wolbachia pipientis,* or Neorickettsia sennetsu\n\n(244 KB DOC)\n\n###### \n\nClick here for additional data file.", "\n\n###### Individual Genes (Based on Ortholog Cluster Analysis) Present in Neorickettsia sennetsu but Not in *Anaplasma phagocytophilum, Rickettsia prowazekii, Wolbachia pipientis,* or Ehrlichia chaffeensis\n\n(223 KB DOC)\n\n###### \n\nClick here for additional data file.", "\n\n###### Ortholog Clusters Present Only in Anaplasma phagocytophilum and Anaplasma marginale\n\n(57 KB DOC)\n\n###### \n\nClick here for additional data file.", "\n\n###### Ortholog Clusters Present Only in *Ehrlichia chaffeensis, Ehrlichia ruminantium* Welgevonden, and Ehrlichia ruminantium Gardel\n\n(82 KB DOC)\n\n###### \n\nClick here for additional data file.", "\n\n###### Ortholog Clusters That Are Absent in All of the Tick-, Flea-, and Louse-Borne Rickettsiales, but Are Present in *Wolbachia* spp. ", "and Neorickettsia sennetsu\n\n(27 KB DOC)\n\n###### \n\nClick here for additional data file.", "\n\n###### Ortholog Clusters Present in All the Pathogenic Rickettsiales but None of the Endosymbionts\n\n(30 KB DOC)\n\n###### \n\nClick here for additional data file.", "\n\n###### *Anaplasma phagocytophilum p44* Genes\n\n(246 KB DOC)\n\n###### \n\nClick here for additional data file.", "\n\n###### Putative Anaplasma phagocytophilum Type IV Effector Motifs in HGE-14 Proteins\n\n(27 KB DOC)\n\n###### \n\nClick here for additional data file.", "\n\n###### DNA Repair Genes\n\n(110 KB DOC)\n\n###### \n\nClick here for additional data file.", "\n\n###### Sequences of Oligonucleotides Used for RT-PCR\n\n(31 KB DOC)\n\n###### \n\nClick here for additional data file.", "\n\n###### PDF copy of Jaccard et al. ", "reference\n\n(4578 KB PDF)\n\n###### \n\nClick here for additional data file.", "\n\nAccession Numbers {#s4a}\n-----------------\n\nThe GenBank (<http://www.ncbi.nlm.nih.gov>) accession number for the Ehrlichia canis Jake shotgun sequence is ZP_00210380; the complete GenBank genome sequences for A. phagocytophilum HZ, E. chaffeensis Arkansas, and N. sennetsu Miyayama are CP000235, CP000236, and CP00237, respectively.", "\n\nThe ArrayExpress database (<http://www.ebi.ac.uk/arrayexpress>) accession numbers for the microarray slide type and study are E-TIGR-125 and A-TIGR-21.", "\n\nWe acknowledge Jessie Goodman, University of Minnesota, for providing the stock culture of A. phagocytophilum MN; Robert F. Massung at the Centers for Disease Control and Prevention, Atlanta for providing the stock culture of A. phagocytophilum MRK; Derrick Fouts for examination of the genomes for prophage elements; Robert DeBoy for examination of the genome for transposons; Leka Papazisi for assistance with statistical analysis; Karen Nelson, Ian Paulsen, and Emmanuel Mongodin for helpful discussions; Chun-Ha Wan for assistance depositing data in ArrayExpress; Robert Munson at Children\\'s Hospital, Ohio State University for assistance with the grant proposal; David Dyer at University of Oklahoma for initial sequencing efforts; and our reviewers for their helpful comments and suggestions.", "\n\n**Author contributions.** ", "H. Tettelin coordinated genome sequencing. ", "Y. Rikihisa performed general project coordination and strategy. ", "J. C. Dunning Hotopp, M. Lin, S. V. Angiuoli, J. Crabtree, J. Sundaram, Y. Rikihisa, and H. Tettelin performed sequence analysis and comparative genomics. ", "C. Zhang, N. Ohashi, H. Niu, N. Zhi, and M. Lin cultured bacteria, purified bacteria, and purified DNA. ", "R. Madupu, L. M. Brinkac, Q. Lin, R. J. Dodson, M. J. Rosovitz, W. Nelson, S. C. Daugherty, A. S. Durkin, M. Gwinn, D. H. Haft, J. D. Selengut, S. A. Sullivan, L. Zhou, and O. White annotated the genomes. ", "S. V. Angiuoli, J. Crabtree, J. Sundaram, M. Lin, T. Davidsen, N. Zafar, and O. White managed data. ", "T. R. Utterback, S. Smith, M. Lewis, H. Khouri, F. Benahmed, H. Forberger, R Halpin, S. Mulligan, and J. Robinson sequenced and finished the genomes. ", "J. Eisen, R. Seshadri, Q. Ren, and M. Wu performed specific analyses. ", "M. Lin and J. C. Dunning Hotopp performed RT-PCR and CGH experiments, respectively. ", "J. C. Dunning Hotopp, Y. Rikihisa, M. Lin, and H. Tettelin wrote the paper.", "\n\n**Funding.** ", "This project was supported by National Institutes of Health grant R01 AI47885 to YR. ", "In addition, JCDH was partially supported by National Science Foundation grant EF-0328363.", "\n\n**Competing interests.** ", "The authors have declared that no competing interests exist.", "\n\nHGA\n\n: human granulocytic anaplasmosis\n\nHGE\n\n: human granulocytic ehrlichiosis\n\nHME\n\n: human monocytic ehrlichiosis\n\nNER\n\n: nucleotide excision repair\n\nOMP\n\n: outer membrane protein\n\nORF\n\n: open reading frame\n\n[^1]: ¤a Current address: Developmental and Regenerative Neurobiology Program, Department of Neurology, Institute of Molecular Medicine and Genetics, Medical College of Georgia, Augusta, Georgia, United States of America\n\n[^2]: ¤b Current address: Laboratory of Environmental Microbiology, Institute for Environmental Sciences, Suruga, Shizuoka, Japan\n\n[^3]: ¤c Current address: National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, Maryland, United States of America\n\n[^4]: ¤d Current address: Eastern Virginia Medical School, Norfolk, Virginia, United States of America\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.0014643993927165866, 0.0013184323906898499, 0.0031918655149638653, 0.0271350909024477, 0.0008500742842443287, 0.0006546582444570959, 0.0009448953787796199, 0.002101101214066148, 0.02517475001513958, 0.007316005416214466, 0.007622500881552696, 0.0009434673702344298, 0.0005538033437915146, 0.0033877575770020485, 0.0007769927615299821, 0.0021175877191126347, 0.002021034248173237, 0.0009388377075083554, 0.0027043945156037807, 0.0010253667132928967, 0.0005797086632810533, 0.0005805109394714236, 0.0006374536314979196, 0.0008481902186758816, 0.010760003700852394, 0.0006728704320266843, 0.0005561111611314118, 0.0033952195663005114, 0.0020378045737743378, 0.0006697866483591497, 0.001931784558109939, 0.0019055769080296159, 0.0005717201856896281, 0.0006269923178479075, 0.002769207116216421, 0.0007564721163362265, 0.0006422869046218693, 0.0008636793936602771, 0.0006689063156954944, 0.0013054587179794908, 0.0012680551735684276, 0.0005922593409195542, 0.0005466038710437715, 0.0008813738822937012, 0.0005899615352973342, 0.0015469135250896215, 0.0008030800963751972, 0.0005844075349159539, 0.0006271637976169586, 0.0005779165658168495, 0.0005945079610683024, 0.0007996212807483971, 0.0006336488295346498, 0.0007873829454183578, 0.0007326691411435604, 0.0005725594237446785, 0.001597816008143127, 0.000583058106712997, 0.0012335217325016856, 0.0019055769080296159, 0.0006005426403135061, 0.0005622051539830863, 0.0005756027530878782, 0.0006429731729440391, 0.0007272720104083419, 0.000635659322142601, 0.0006949373055249453, 0.0007293604430742562, 0.0006068103248253465, 0.0007918426999822259, 0.0007225974113680422, 0.0008020350942388177, 0.0009483668836764991, 0.0012506595812737942, 0.4027514159679413, 0.0007725495961494744, 0.005909908562898636, 0.0010228226892650127, 0.0006458249990828335, 0.0011006576241925359, 0.0005885080900043249, 0.000615848577581346, 0.0006610412965528667, 0.0006564998184330761, 0.0006185258971527219, 0.0019055769080296159, 0.0012241341173648834, 0.001427366747520864, 0.0011006576241925359, 0.0006416590767912567, 0.0006726626888848841, 0.0006395472446456552, 0.000625473097898066, 0.0007629959145560861, 0.0005894082132726908, 0.0007307707564905286, 0.0006503279437310994, 0.0005692258127965033, 0.0006211702129803598, 0.0005569746717810631, 0.0006165929953567684, 0.0009408834157511592, 0.0006634924211539328, 0.0006151788984425366, 0.0006233063177205622, 0.0005867091822437942, 0.0005943842115812004, 0.0006189603009261191, 0.0007081280346028507, 0.0005601296434178948, 0.0005785368848592043, 0.000574865669477731, 0.0005841174279339612, 0.0006215527537278831, 0.0019055769080296159, 0.0005955160013400018, 0.000778579618781805, 0.0006581728812307119, 0.0006118022720329463, 0.0005643849726766348, 0.0015090872766450047, 0.0006277038482949138, 0.0008194162510335445, 0.0007516919868066907, 0.0006428190390579402, 0.0014030341990292072, 0.0008844162221066654, 0.0008527441532351077, 0.0007171133765950799, 0.0006978874444030225, 0.0006877807318232954, 0.0006160393822938204, 0.0006795912049710751, 0.000580631080083549, 0.0005908723105676472, 0.0005556750693358481, 0.0005667611840181053, 0.0009251102455891669, 0.0008265060605481267, 0.0005788449198007584, 0.0006304564885795116, 0.0012192914728075266, 0.0006583318463526666, 0.000827274692710489, 0.0009143475326709449, 0.000833806989248842, 0.0007570050656795502, 0.0008839790243655443, 0.0010836207075044513, 0.0007053911103866994, 0.0010670312913134694, 0.0005953726940788329, 0.007087023928761482, 0.0007830536924302578, 0.0006938949809409678, 0.0032668563071638346, 0.0007231250056065619, 0.0008186778286471963, 0.0007200261461548507, 0.0009042163146659732, 0.0005416485364548862, 0.00084870116552338, 0.000604802742600441, 0.0010096936021000147, 0.000625543761998415, 0.0006701591773889959, 0.0008848646539263427, 0.000603491032961756, 0.0008121406426653266, 0.0006109212408773601, 0.000537260202690959, 0.0005430052406154573, 0.0006110153044573963, 0.0006045514601282775, 0.0005752596771344543, 0.0005255798459984362, 0.0005771726137027144, 0.0007404756033793092, 0.0007091389852575958, 0.0005764795932918787, 0.0006495657726190984, 0.0006421033176593482, 0.0006171450368128717, 0.0006338414968922734, 0.0008510986808687449, 0.000715441710781306, 0.0005958921974524856, 0.0008199676522053778, 0.0006278746877796948, 0.0007181748514994979, 0.0007777279824949801, 0.0007658241083845496, 0.0006254591280594468, 0.0008340449421666563, 0.0005847452557645738, 0.0008854635525494814, 0.0007980623049661517, 0.0020156768150627613, 0.0008385521941818297, 0.0006505762576125562, 0.0005683144554495811, 0.0006147472886368632, 0.0006966872606426477, 0.0007096166373230517, 0.000657660246361047, 0.0006898264982737601, 0.0012592629063874483, 0.0016397247090935707, 0.0009765983559191227, 0.0014182120794430375, 0.0013427645899355412, 0.0005238900193944573, 0.0007325441692955792, 0.0006216164911165833, 0.0007194085628725588, 0.0006095613935030997, 0.00064944161567837, 0.01573123224079609, 0.010826866142451763, 0.000670231063850224, 0.0008186778286471963, 0.0011171927908435464, 0.01018989086151123, 0.0006065833731554449, 0.0008708535460755229, 0.0006765388534404337, 0.0013802561443299055, 0.0008148654014803469, 0.0005616875132545829, 0.002340556588023901, 0.0006701865931972861, 0.0011496044462546706, 0.0007695745443925261, 0.0012460342841222882, 0.0007975301705300808, 0.0011318016331642866, 0.0007292162626981735, 0.0008195833070203662, 0.0006931560928933322, 0.0005740303895436227, 0.0005964399315416813, 0.000750084116589278, 0.0013015065342187881, 0.000691281515173614, 0.0007966274861246347, 0.0005557762924581766, 0.0005751083954237401, 0.0019055769080296159, 0.0007048581610433757, 0.0005604436155408621, 0.0006781377596780658, 0.0006405903841368854, 0.0005809133290313184, 0.0010548854479566216, 0.000701063429005444, 0.0006710651214234531, 0.0005190173396840692, 0.0006772593478672206, 0.0006580132176168263, 0.001659452449530363, 0.0015019559068605304, 0.0006974525167606771, 0.0006715987110510468, 0.0006763808778487146, 0.0006739804521203041, 0.0006081408355385065, 0.012730514630675316, 0.0006947180954739451, 0.0008419103687629104, 0.001269943662919104, 0.0006636814796365798, 0.0006330804899334908, 0.0008646892965771258, 0.0007392607512883842, 0.0005774639430455863, 0.0008063206332735717, 0.0006268455763347447, 0.0007370046223513782, 0.0006832386134192348, 0.0010493671288713813, 0.0008788756676949561, 0.0013566588750109076, 0.0020907381549477577, 0.013698205351829529, 0.0007531220908276737, 0.0008998411358334124, 0.013627891428768635, 0.0009278339566662908, 0.000880985171534121, 0.0006523345946334302, 0.000963935861364007, 0.0006073035765439272, 0.000873756012879312, 0.0005956020322628319, 0.0008380516082979739, 0.0019055769080296159, 0.0005947562167420983, 0.0005806346307508647, 0.0006432419177144766, 0.0013027858221903443, 0.0008843816467560828, 0.0007777068531140685, 0.0008467754814773798, 0.0009250009898096323, 0.0018407212337478995, 0.0007505392422899604, 0.0007357302238233387, 0.0006014390964992344, 0.0006495678680948913, 0.0009586398373357952, 0.0008374094613827765, 0.0008030800963751972, 0.0005896762595511973, 0.000595074612647295, 0.0010224831057712436, 0.0008973140502348542, 0.0007023403886705637, 0.0007750969962216914, 0.0018603208009153605, 0.0011583748273551464, 0.007377357222139835, 0.0019527670228853822, 0.0009376790258102119, 0.0009501050808466971, 0.0008380843792110682, 0.0010400773026049137, 0.000919037323910743, 0.0007573874900117517, 0.0007817187579348683, 0.0006639583152718842, 0.0007339571020565927, 0.0006852290825918317, 0.0008125559543259442, 0.0009185777162201703, 0.0008287591626867652, 0.0006280177040025592, 0.0006506242207251489, 0.0006819570553489029, 0.0005447104340419173, 0.0005814318428747356, 0.0006321013788692653, 0.0007010290864855051, 0.0007803288754075766, 0.0007917797775007784, 0.0008421422098763287, 0.0005559683195315301, 0.0006507241050712764, 0.0005558941629715264, 0.0006309860036708415, 0.0005679811583831906, 0.0008654138655401766, 0.0005795755423605442, 0.000974116672296077, 0.0009069187217392027, 0.0007142787799239159, 0.0007111792219802737, 0.000956868170760572, 0.0008066000300459564, 0.0009410693310201168, 0.0007903052610345185, 0.0008136352407746017, 0.0011006576241925359, 0.0008767331601120532, 0.0005970192141830921, 0.0008943603606894612, 0.0006466610357165337, 0.0006051388918422163, 0.0006993205170147121, 0.0011006576241925359, 0.0006385198794305325, 0.0005808491259813309, 0.0005377918132580817, 0.000604372879024595, 0.0005873243208043277, 0.0006254188483580947, 0.000556986196897924, 0.01743016578257084, 0.0009602371137589216, 0.002217163797467947, 0.0006590409320779145, 0.0005456116632558405, 0.0007353047258220613, 0.0009259423823095858, 0.0009520715684629977, 0.0005695476429536939, 0.0006637172191403806, 0.0006311610341072083, 0.0006003423477523029, 0.0007179093663580716, 0.0008056678343564272, 0.0006754610221832991, 0.0005979961715638638, 0.0006842342554591596, 0.0006462731980718672, 0.0007251127972267568, 0.0011903817066922784, 0.0006177921313792467, 0.0008744443184696138, 0.000620179926045239, 0.0006337249069474638, 0.0013281696010380983, 0.013127985410392284, 0.0020363503135740757, 0.001267040497623384, 0.0008625461487099528, 0.0005834689945913851, 0.0005888122250325978, 0.0005980953574180603, 0.0005721881752833724, 0.0005399462534114718, 0.0006438414566218853, 0.0005532965296879411, 0.004388764034956694, 0.0006723182159475982, 0.0012024764437228441, 0.00057823775568977, 0.0010241074487566948, 0.000566701462958008, 0.0008272916311398149, 0.0007641937118023634, 0.0007736318511888385, 0.0005845983396284282, 0.0006093801930546761, 0.0006423768936656415, 0.0008098732796497643, 0.0007603485137224197, 0.000784107658546418, 0.0006369291804730892, 0.000845263886731118, 0.0006744510610587895, 0.0006652094889432192, 0.000545318762306124, 0.0006577930762432516, 0.0005645829369314015, 0.0006128062959760427, 0.0006918249418959022, 0.0007401496404781938, 0.0006072343676351011, 0.0006039882428012788, 0.0010841882321983576, 0.0006419998244382441, 0.0006399942212738097, 0.0006079994491301477, 0.000607814290560782, 0.0005829105502925813, 0.0007698308327235281, 0.0005706289666704834, 0.0006618154002353549, 0.0006121600745245814, 0.0006067369249649346, 0.0005882038967683911, 0.0005419953376986086, 0.0006224351818673313, 0.0009876282420009375, 0.0006527959485538304, 0.0005864548147656024, 0.0007353786495514214, 0.0006241558585315943, 0.0006222426891326904, 0.0008670659153722227, 0.0006122400518506765, 0.0009143793140538037, 0.000587140501011163, 0.0007949823047965765, 0.0006130844121798873, 0.0006234742468222976, 0.0006484786281362176, 0.0006406869506463408, 0.0006137148593552411, 0.0008421294041909277, 0.0006474232650361955, 0.0006125498912297189, 0.0007606883882544935, 0.0006244381656870246, 0.0008361353538930416, 0.0008335590828210115, 0.0009410599013790488, 0.0008595777326263487, 0.0007089714054018259, 0.000709309708327055, 0.0007249787449836731, 0.0008368646376766264, 0.0007935971952974796, 0.006877928506582975, 0.0006304347771219909, 0.0009774090722203255, 0.0026563405990600586, 0.0017586881294846535, 0.0006166720413602889, 0.0007259093108586967, 0.0008012384059838951, 0.0005989458877593279, 0.0007091457373462617, 0.0005773594602942467, 0.0006454819231294096, 0.0006544654606841505, 0.0006605960661545396, 0.0005945757147856057, 0.0006661509978584945, 0.0006897670100443065, 0.0007957143825478852, 0.0007217202801257372, 0.0006952469702810049, 0.0006483917823061347, 0.0006438684649765491, 0.0006701649399474263, 0.0007677400135435164, 0.0006053134566172957, 0.0005738518084399402, 0.0006738313823007047, 0.0006123164785094559, 0.000645026215352118 ]

[ "Linezolid is the first member of a new synthetic class of anti-microbials known as oxazolidinones with activity against many important pathogens including multidrug-resistant tubercle bacillus, methicillin-resistant staphylococcus and streptococcus. ", "We report a case of toxic optic neuropathy due to linezolid occurring in a patient who was on concurrent linezolid and ethambutol therapy for extensively drug-resistant pulmonary tuberculosis (XDR-TB).", "\n\nCase Report {#sec1-1}\n===========\n\nA 45-year-old man presented to our outpatient department with painless progressive diminution of vision both eyes for the past 10 days. ", "Medical history included XDR-TB on treatment with linezolid (600 mg/day), ethambutol (800 mg/day), moxifloxacin (400 mg/day), cycloserine (500 mg/day), ethionamide (500 mg/day), and kanamycin (750 mg/day) for the past 6 months. ", "He was a non-smoker and non-alcoholic.", "\n\nOn examination, his visual acuity was 20/200 (OU), not improving with pin hole. ", "Color vision was defective in both eyes. ", "Anterior segment examination was unremarkable and pupils were 3 mm, round, regular, and reacting to light in both eyes (Direct and Indirect). ", "There was no relative afferent pupillary defect (RAPD).", "\n\nFundus examination revealed hyperemic disc with blurred margins (OU) \\[Figs. [", "1](#F1){ref-type=\"fig\"} and [2](#F2){ref-type=\"fig\"}\\]. ", "Visual field evaluation by Humphrey field analyzer showed peripheral constriction and quadrantanopia in the right eye \\[[Fig. ", "3](#F3){ref-type=\"fig\"}\\] and low reliable fields in the left eye \\[[Fig. ", "4](#F4){ref-type=\"fig\"}\\]. ", "Optical coherence tomography (OCT) revealed increased retinal nerve fiber layer (RNFL) thickness in both eyes \\[[Fig. ", "5](#F5){ref-type=\"fig\"}\\].", "\n\n{#F1}\n\n{#F2}\n\n{#F3}\n\n{#F4}\n\n{#F5}\n\nEthambutol-induced toxic optic neuropathy was initially suspected and tablet ethambutol was discontinued after discussing with the treating physician. ", "After two weeks, the patient\\'s visual acuity had dropped to 20/400 in both eyes, and the fundus picture remained unchanged. ", "Hence, the possibility of toxic optic neuropathy due to linezolid was considered as reported in the literature and linezolid was discontinued (A total cumulative dose of 126 g had been already consumed by the patient).", "\n\nRapid improvement in visual acuity was seen four days after discontinuation of linezolid. ", "Color vision was restored to normal and patient\\'s vision was restored to 20/20 after one month. ", "Fundus examination revealed resolved optic disc edema with setting in of temporal pallor in both eyes \\[Figs. [", "6](#F6){ref-type=\"fig\"} and [7](#F7){ref-type=\"fig\"}\\]. ", "Follow-up of visual field showed partial improvement with residual quadrantanopia \\[Figs. [", "8a](#F8){ref-type=\"fig\"} and [b](#F9){ref-type=\"fig\"}\\] and OCT demonstrated normalization of RNFL \\[[Fig. ", "9](#F10){ref-type=\"fig\"}\\]. ", "Tablet ethambutol was restarted at the instance of the physician. ", "The patient is under regular follow-up and no toxic effects have been noted at three months of follow-up.", "\n\n{#F6}\n\n{#F7}\n\n{#F8}\n\n{#F9}\n\n{#F10}\n\nDiscussion {#sec1-2}\n==========\n\nToxic optic neuropathies are characterized by gradual, progressive, painless, bilaterally symmetric visual loss affecting central vision, and causing central or centrocecal scotoma.", "\n\nXDR-TB is defined as resistance to at least rifampicin and isoniazid among the first-line anti-TB drugs (which is the definition of multidrug-resistant TB) in addition to resistance to any fluoroquinolone and at least one of the three injectable second-line anti-TB drugs (capreomycin, amikacin, kanamycin).", "\n\nLinezolid inhibits protein synthesis by preventing formation of the ribosome complex that initiates protein synthesis. ", "Its unique binding site located on 23S ribosomal RNA of the 50s subunit results in no cross resistance with other drug classes. ", "Hence, linezolid is being increasingly used for the treatment of infections caused by multidrug-resistant Gram-positive bacteria. ", "Long-term linezolid interferes with bacterial ribosomes and also with mammalian ribosomes, thereby disrupting mitochondrial oxidative phosphorylation and protein synthesis.\\[[@ref1]\\]\n\nLinezolid is usually well tolerated with few described adverse effects. ", "Serious adverse reactions demanding withdrawal of the drug include myelosuppression, peripheral and optic neuropathy, lactic acidosis, and serotonin syndrome.\\[[@ref2]\\] The safety of linezolid treatment has been established for use only up to 28 days.\\[[@ref3]\\] There are several case reports of linezolid-induced optic or peripheral neuropathy in patients treated for a time period beyond 28 days.\\[[@ref4]\\] Only two cases of toxic optic neuropathy have been reported following short-term linezolid treatment of 16 days.\\[[@ref5][@ref6]\\] Fundus picture can be varied, showing temporal pallor, disc edema, or essentially normal. ", "Complete visual recovery has been reported in all cases except one.\\[[@ref5]\\] Peripheral neuropathy has been reported to be irreversible.\\[[@ref7]\\] The most common indication for long-term linezolid therapy in these patients has been infection with methicillin-resistant *Staphylococcus aureus*.", "\n\nIn our case, neuropathy occurred after linezolid had been used for six months at a dose of 600 mg per day for infection with *Mycobacterium tuberculosis*. ", "The co-administration of ethambutol could have potentiated the toxicity. ", "We attribute toxic optic neuropathy to linezolid in our patient because even two weeks after stopping ethambutol there was deterioration of vision, and it was only after withdrawal of linezolid that visual improvement started.", "\n\nLinezolid is recommended by the World Health Organization (WHO) to treat drug-resistant tuberculosis as a medicine with \"unclear efficacy\".\\[[@ref8]\\] Linezolid, approved for Gram-positive infections in 2000 has been used off-label for drug-resistant tuberculosis. ", "There is limited data available regarding the efficacy and safety of linezolid in multidrug-resistant TB since it is always administered as part of combination therapy.", "\n\nLinezolid may improve the chance of bacteriological cure only in the most complicated XDR-TB cases. ", "Its safety profile precludes its use in cases for which there are other alternatives.\\[[@ref9]\\]\n\nWith increasing emergence of XDR-TB, for which treatment options are limited, physicians are compelled to resort to new drug therapies. ", "Although ethambutol is the most common antitubercular drug implicated to cause toxic optic neuropathy, it is pertinent to be aware that if withdrawal of one drug does not show visual recovery or there is further deterioration of vision, the possibility of toxicity due to other drugs should be thought of. ", "With our country bearing the brunt of tuberculosis, where multiple drug therapy is the rule, this is even more relevant. ", "Ophthalmologists and physicians must be aware that monitoring of visual function is important in patients on long-term linezolid therapy and that early recognition of toxicity and discontinuation of drug results in complete visual recovery.", "\n\n**Source of Support:** Nil.", "\n\n**Conflict of Interest:** None declared.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.0010825962526723742, 0.0007685119053348899, 0.0031368776690214872, 0.0006611934513784945, 0.29798054695129395, 0.0008151659858413041, 0.010236762464046478, 0.0005869035376235843, 0.0006534763379022479, 0.001268506981432438, 0.0007529376307502389, 0.0008202239405363798, 0.0007684225565753877, 0.0007225433364510536, 0.0006452974048443139, 0.0007297323900274932, 0.0019055769080296159, 0.0008882259135134518, 0.0009419866255484521, 0.0011808128328993917, 0.0007163071422837675, 0.0008140054997056723, 0.001550149405375123, 0.0008418140932917595, 0.0006332690827548504, 0.0005954504595138133, 0.0006675542681477964, 0.0007562371320091188, 0.0006123587372712791, 0.0007373375701718032, 0.0007212131749838591, 0.0006264980183914304, 0.0006131778936833143, 0.0019055769080296159, 0.0008412271272391081, 0.0009077723370864987, 0.0007706496980972588, 0.0007813813863322139, 0.0015198462642729282, 0.0008039142703637481, 0.0008989948546513915, 0.0005967731704004109, 0.0006813295185565948, 0.0009435976971872151, 0.0012222350342199206, 0.0013857537414878607, 0.001100204768590629, 0.0006672372110188007, 0.0007982300012372434, 0.0006106639630161226, 0.0006190160056576133, 0.0008139186538755894, 0.0006857174448668957, 0.0008261898765340447, 0.0006662433734163642, 0.0006406334578059614, 0.0013584864791482687, 0.0007576480857096612, 0.001995444530621171 ]

[ "\"Writings, ramblings, rants, etc.\" – ", "A reader\n\nNow to find some good sausage to grill\n\nA coworker shared some yellow squash the other day, so I’m pickling it, some red onion, and zucchini – courgette if you prefer – using this recipe. ", "Three days to cure, so I have some time to ponder which sort of sausage.", "\n\nRelated\n\nPost navigation\n\nOne thought on “Now to find some good sausage to grill”\n\nBecause this is a somewhat sweet pickle recipe, a hot Italian sausage was a good choice. ", "Made for a great relish.", "\n\nYou can tell that the photo at the recipe link above was taken immediately after the ingredients were put together, not when it was actually ready to eat. ", "The red onions go a soft pink with no red edge at all after three curing days." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0007042576326057315, 0.035687196999788284, 0.02638169191777706, 0.00141528295353055, 0.0007193242199718952, 0.0005652072723023593, 0.0028084274381399155 ]

[ "KRASNAYA POLYANA, Russia -- Vic Wild and wife Alena Zavarzina have some new jewelry to go with their wedding rings: Olympic medals.", "\n\nWild rolled to victory in men's snowboarding parallel giant slalom on Wednesday, ripping past Nevin Galmarini in the second run of the finals to win gold for his adopted country of Russia. ", "Zan Kosir of Slovenia took the bronze.", "\n\nVic Wild and wife Alena Zavarzina celebrate after winning gold and bronze medals, respectively, in the snowboarding parallel giant slalom on Wednesday. ", "Lars Baron/Getty Images\n\nWild's triumph came just minutes after his wife raced to bronze in the women's event.", "\n\n\"It's incredible to win it along with Alena,'' Wild said. \"", "We're together all the time. ", "If one of us has success and one of us doesn't, it's great -- but it's not that great.", "\n\n\"For both of us to have success on the same day, it's truly incredible. ", "I don't know how this happened. ", "It's too good to be true.''", "\n\nAfter weeks of warm sunshine, a front that moved through Tuesday dumped a fresh batch of snow. ", "Officials tried to protect the course, but it was a bit of a hard mess in which racers struggled with their lines as they rolled from gate to gate.", "\n\nWild had his moments, too. ", "He nearly washed out twice during the first finals run, barely holding on after it appeared his board was ready to tip over. ", "Moving from the blue course to the seemingly faster red course for the second run, he overcame the 0.54-second deficit he faced with relative ease.", "\n\nHe thrust his arms skyward in victory, leading to the unusual sight of an American born near the end of the Cold War being showered with adoration from a highly partisan home crowd of Russian fans.", "\n\n\"I'm so stoked to win it for Russia,'' he said. \"", "Everybody thinks, 'But he's American, he's American.' ", "It's not true. ", "I'm not some dude in the U.S. who decides it'll be easy for me to make the Olympics in a country that doesn't do any snowboarding. ... ", "I went the hard way.''", "\n\nZavarzina sprinted to embrace her husband after he captured gold while a large, heavily pro-Russian crowd waved flags and roared its appreciation. ", "After the flower ceremony, Wild and his wife stood side by side holding a massive Russian flag and drinking in the moment.", "\n\nIt started five years ago while they were traveling in the same pack on the World Cup snowboard racing circuit. ", "Vic, born and raised in White Salmon, Wash., competed for the United States. ", "Alena, a native of Novosibirsk, rode for Russia." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006746532744728029, 0.0009045553742907941, 0.0006516007124446332, 0.0006516280700452626, 0.0006080501480028033, 0.0006347442977130413, 0.0007104682154022157, 0.00074899906758219, 0.0005390183068811893, 0.000747562968172133, 0.0006239661015570164, 0.0007798764272592962, 0.0006508921505883336, 0.0014492948539555073, 0.0014897598884999752, 0.0008523420547135174, 0.0015427778707817197, 0.0006551245460286736, 0.03490515053272247, 0.0011740318732336164, 0.0014641707530245185, 0.0006029756623320282, 0.0007263891748152673, 0.0007649234030395746, 0.0005960696726106107, 0.0008279327303171158, 0.001135870348662138 ]

[ "Q:\n\nHow can I display more information of my option, when I open the dropdown of my selectbox?", "\n\nIn my selectbox I want to display for the selected value only for example Volvo. ", "Only if I click on the selectbox and the dropdown with the options is visible, I want to display all the information Volvo (color: yellow, prize: 2000 Euro). ", "Is this possible? ", " \n <select>\n <option value=\"green\">Volvo (color: yellow, prize: 2000 Euro)</option>\n <option value=\"saab\">Saab (color: red, prize: 4000 Euro)</option>\n <option value=\"mercedes\">Mercedes (color: blue, prize: 3000 Euro)</option>\n <option value=\"audi\">Audi (color: green, prize: 5000 Euro)</option>\n</select> \n\nBy default the selectbox should look like this:\nhttp://www.fotos-hochladen.net/view/bildschirmfoto01wtm72krs.png\nand if I click on the box it should look like this:\nhttp://www.fotos-hochladen.net/view/bildschirmfotoeaoi6tnsy7.png\n\nA:\n\nThis is complete new solution. ", "All past solutions are deleted.", "\nThere is Fiddle example ...\nNow, there is one div container. ", "Inside container are one div for showing result and select which would be show or hide depend onclick.", "\nselect is hidden, and, when You click on div for results select will be showed. ", "If You click again, select will hide. ", "When You click on some value, js will extract only car name and show in result div.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006100478931330144, 0.0005345942336134613, 0.000552958867046982, 0.0007203164859674871, 0.0006899773725308478, 0.0007691786158829927, 0.0006451986264437437, 0.0009837285615503788, 0.0005978707922622561, 0.0008800291107036173, 0.0005991465877741575, 0.001995444530621171 ]

[ "The present invention is directed to a drive system for a conveyor with a belt, and in particular a drive system employing a driven roller.", "\nBelt conveyors are employed for conveying items, where belts are disposed around rollers. ", "The rollers may include motorized rollers for driving the belts, where the motorized rollers are disposed at the conveyance plane of the conveyor. ", "The belts of the conveyor may be disposed over multiple rollers or may be disposed over slider pans to define a conveying surface." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0007065213867463171, 0.0007376587600447237, 0.0007730290526524186, 0.0006693871691823006 ]

[ "Gill metal binding and stress gene transcription in brown trout (Salmo trutta) exposed to metal environments: the effect of pre-exposure in natural populations.", "\nBrown trout (Salmo trutta) from two native populations from the Røros area in Central Norway, acclimated in mining-affected habitats to different levels of Cd/Zn and Cu, together with trout from a nearby unaffected river (reference) were transferred to a nearby lake with higher levels of Cu, Cd, and Zn than those in their respective native rivers. ", "This experiment was conducted to gain information about the underlying resistance mechanisms developed in fish exposed to metal environments. ", "The focus was on gill metal accumulation and transcription of the metal-responsive stress genes metallothionein-A (MT-A), Cu/Zn-superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx), glutathione reductase (GR), and heat shock protein 70 (HSP-70). ", "The only shared response shown between the three groups after transfer were Cu accumulation and MT-A induction. ", "The Cu-acclimated trout produced mucus to reduce the uptake of Cu into the gills. ", "The MT-A levels were highest in the Cd/Zn-acclimated trout both before and after transfer. ", "Before transfer, antioxidant transcription (SOD and GPx) was higher in gills of Cu-acclimated compared to the Cd/Zn-acclimated trout, but increased transcription of antioxidant stress genes was observed after transfer in both metal-acclimated groups. ", "The metal-acclimated trout groups also showed an increase in the transcription of HSP-70. ", "Compared to the reference population not previously exposed to metals, stress gene transcription increased faster in the metal-acclimated populations. ", "The exception was induction of CAT, which appeared to be depressed after transfer in Cd/Zn-acclimated trout. ", "The data indicate that acclimation to chronic metal exposure involves different strategies to cope with different metals and that these strategies involve both physiological mechanisms (mucus production) as well as metal-related stress gene transcription." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0008399864891543984, 0.0007576834759674966, 0.0005862388061359525, 0.0007165347924456, 0.0005779003258794546, 0.010168073698878288, 0.0008809084538370371, 0.0010550236329436302, 0.0007108078571036458, 0.0006136634619906545, 0.0015639554476365447, 0.0005978234694339335 ]

[ "The statements in this section merely provide background information related to the present disclosure and may not constitute prior art.", "\nThe present disclosure broadly relates to compositions and methods for controlling fluid flow between a wellbore and a subterranean formation.", "\nDuring well construction, well production and well abandonment it may be necessary to perform operations which require minimizing or terminating fluid flow between wellbore and formation. ", "In the majority of cases, such operations are performed to restore, prolong or enhance the production of hydrocarbons. ", "In addition, the production tubing, artificial lift equipment or casing may be removed and replaced during a workover operation.", "\nTo maintain well control, workover operations require that the well be filled with fluid with hydrostatic pressure in excess of the reservoir pressure. ", "It is commonly referred as well “kill” operation. ", "Well kills may be achieved by a variety of means, including the introduction of drilling or completion fluids that exert sufficient hydrostatic pressure in the wellbore to prevent formation fluid production. ", "The fluid is often maintained in the wellbore for the entire duration of the workover operation. ", "In some instances fluid leaks off into formation and fluid level cannot be maintained. ", "Differential depletion of reservoir layers or large height of the reservoir presents another challenge—workover or kill fluid may be lost into one layer while other(s) flow reservoir fluids or gas into the wellbore. ", "It is necessary to prevent formation fluids from entering the well during the procedures." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.00064742227550596, 0.0005735084414482117, 0.0006108004017733037, 0.0005689621320925653, 0.0005738416803069413, 0.0006724243285134435, 0.020328549668192863, 0.0006828460609540343, 0.0006786323501728475, 0.0006321094697341323, 0.0008381346124224365, 0.0007353292894549668 ]

[ "Women in United States juries\n\nThe representation of women in United States juries has increased during the last hundred years, due to legislation and court rulings. ", "Up until the late twentieth century, women were routinely excluded or allowed to opt out from jury service. ", "The push for women's jury rights generated debate similar to the women's suffrage movement, permeating the media with arguments for and against. ", "Federal and state court case rulings increased women's participation on juries. ", "Some states allowed women to serve on juries much earlier than others. ", "States also differed on whether women's suffrage implied women's jury service.", "\n\nHistory\n\nThe jury of matrons was an early exception to the exclusion of women from juries. ", "Stemming from English common law, matrons in the American colonies were occasionally called upon in cases involving pregnant women to offer expertise on pregnancy and childbirth. ", "William Blackstone spearheaded the idea of women's exclusion as a result of \"propter defectum sexus\" (based on the defect of sex), and his beliefs were integrated into the legal systems of the United States, including the ideals of coverture. ", "Women's place on the jury would be challenged for decades with arguments including their lack of intelligence, emotional stability, and need to tend to home life. ", "Women would find themselves in between the two ends of the spectrum: full legal right to participate on a jury or barred from participation.", "\n\nMost arguments for exclusionary policies relied on the belief that women had other preceding duties in the home. ", "The belief that women were too sensitive or incompetent to be jurors was also widespread. ", "Some opponents of female jurors sought to shield women from the unpleasant content of many court cases. ", "At a time when women were beginning to assert their sameness with men, the movement for jury rights often required them to emphasize their differences, arguing that men and women were not interchangeable.", "\n\nThe movement to include women on juries largely coincided with the women's suffrage movement. ", "However, when women gained the right to vote, it was not automatically clear that women also had the right to serve on juries. ", "In fact, with federal women's suffrage came many questions about women's citizenship like whether women could remain citizens after marrying a foreigner, hold a political office, or serve on a jury. ", "The movement for women's jury rights has been described as “something very like a second suffrage campaign.”", "\n\nAs jury trial is guaranteed by the Sixth Amendment to the United States Constitution by the phrase \"a speedy and public trial, by an impartial jury\" and the Equal Protection Clause in the Fourteenth Amendment, gender representation in American juries has mainly been decided by Supreme court rulings.", "\n\nWith current state legislation, all-female juries are possible. ", "The jury of the State of Florida v. George Zimmerman got attention for its all-woman composition.", "\n\nGrowing acceptance after suffrage \n\nIn the 1930s and 1940s, \"middle class women demanded to serve on juries as a right of equal citizenship.\" ", "When the Great Depression struck the nation in the 1930s, the intelligent and qualified men that the FGJA had sought out would be removed from their positions at work to help serve. ", "With funds tight and the need for work vital, the FGJA began to expand their requirements for those who could serve on juries in order to keep working men in their positions and have enough jurors serving in the court. ", "At this time, the League of Women Voters and the National Woman's Party demanded for the right to be considered for jury duty; although women had gained the right to vote in 1920, they were not given the same obligation to the state as men in serving on a jury. ", "Woman began to demand service on the basis of \"female equity and citizenship\" and noticed that, though they were allowed to serve in similar governmental positions, they were not allowed to serve on the juries themselves. ", "In 1937, woman federal jurors won official approval and in some states, including California, Indiana, Iowa, Maine, Minnesota, Michigan, Nebraska, New Jersey, Ohio and Pennsylvania, participation on a jury was compulsory. ", "In the late 1930s, the perspectives on women jurors transitioned from a place of sentiment to one of special competence. ", "Women became \"law abiding, attentive to detail, and less likely to be swayed by emotion than men,\" and they were able to see through lies because they had been \"sifting truth from falsehood due to their years of dealing with children who try to escape punishment by fibbing.\" ", "Rather than being seen as overly sensitive and emotional, women began to gain the identity as more \"civilized\" than men and they were placed on a pedestal of \"moral superiority.\" ", "However, despite the fact they women were allowed to participate on juries, the women who desired to serve had to do so through voluntary submission. ", "This narrowed the female pool to middle class women who were strong activists in the women's movement; the women desired to exercise their minds and put their discernment to the test.", "\n\nJudge John C. Knox had advocated for the expansion of the qualifications for jurors and even promoted women to serve on the jury. ", "He argued for the expansion of the juries to be \"truly representative of the community\"; however, he believed that jurors had to be able to complete a series of tests that proved their literacy and intelligence. ", "His hope was for the federal courts to create a system of \"hand-picked juries\" that would ultimately be limited to educated, middle-class men. ", "The tests given to potential jurors created rules and regulations that barred the unemployed as well as those who had different clothing, speech patterns or spelling than what was deemed acceptable to those who ran the screening process.", "\n\nPortrayals of women as jurors \nThe media portrayed female jurors in both positive and negative ways as women throughout the country pushed to gain the right to serve on juries. ", "This mirrors the ways in which women's suffrage was displayed in the media. ", "Many of the same arguments both for and against women's suffrage were used in the case of women's jury service. ", "For example, an argument against both suffrage and jury service was that both would be disruptive to women's’ responsibilities in the home. ", "In addition to this, it was believed that jury duty might not be suitable for women and their perceived delicate nature. ", "Some media portrayals claimed that women would be swayed by handsome male criminals and allow guilty men to walk free. ", "The opposite argument was that men were already being swayed by the beauty of some women criminals, and that women on juries would temper this occurrence.", "\n\nAlthough some states allowed women to participate in juries as soon as they were out of the gate with their ballot, most women found themselves in states where they needed to fight for their right to participate on a jury. ", "In the 1920s, elite white males were the favored samplings of the population to be included on juries. ", "The Federal Grand Jury Association (FGJA) focused its energies on screening jurors, creating a jury pool of middle to upper class white males while excluding those whose race, class, intelligence, or gender seemed \"unfit\" for service on a jury. ", "Although portrayed as a \"mirror of society,\" juries were biased in their exclusion of minorities, including the female population. ", "In the 1920s, common arguments revolved around the concept of sentiment and women were stereotyped to be unhelpful on a jury. ", "A 1927 article from the New York Times claims that courts would have to tend to \"fainting fits and outbursts of tears\" if women were to be included as potential jurors. ", "Furthermore, research from the past shows that the women were typically attributed toward \"the tendency to be emotional, submissive, envious and passive,\" thus creating biased juries.", "\n\nCourt cases \nCourt cases shaped the movement to include women in jury service. ", "Key court cases took gradual steps towards full inclusion of women, first targeting opt-in policies, then opt-out policies, and later peremptory strikes based on gender. ", "The debate often centered around whether jury service was a duty or a privilege of citizenship and whether or not it could be optional.", "\n\nStrauder v. West Virginia (1879) \nAfter an African-American man killed his wife and was tried by a jury of all white men, Strauder v. West Virginia was primarily concerned with the exclusion of African Americans from juries. ", "However, while the Supreme Court ruled that excluding African-Americans from juries was unconstitutional, it allowed for the exclusion of women from juries, stating that a state “may confine the selection [of jurors] to males.” ", "Strauder v. West Virginia set a precedent that was followed years later in Hoyt v. Florida.", "\n\nGlasser v. United States (1942) \nGlasser v. United States was one of the first notable cases where the defendants argued that their jury was unconstitutional because women had been excluded from the jury pool. ", "Ultimately, the Supreme Court decided that the all-male jury make-up was acceptable. ", "The phrase “cross-section of the community,” commonly used throughout the rest of the women's jury movement, first appeared in this court case. ", "It reads, “[Officials] must not allow the desire for competent jurors to lead them into selections which do not comport with the concept of the jury as a cross-section of the community.”", "\n\nHoyt v. Florida (1961) \n\nIn Hoyt v. Florida, the Supreme Court upheld Florida's “opt-in” policy for female jurors. ", "Mrs. Gwendolyn Hoyt and her husband Clarence Hoyt spent years in a strained marriage. ", "He was physically abusive to his wife, involved in affairs, and often gone on trips. ", "One day in 1957, a tense conversation led Mrs. Hoyt to strike her husband over the head with a broken baseball bat; he died two days later. ", "She was charged with second-degree murder and, after a 25 minute deliberation by an all male jury, she was sentenced to thirty years in prison. ", "At the time, women were allowed to serve on juries in Florida, but they had to opt-in to be on the jury list instead of automatically being registered like men. ", "In Hoyt's county, only 220 women were registered for jury service, whereas 46,000 women were registered to vote. ", "Hoyt argued that she did not receive a trial by an impartial jury due to this opt-in policy, but she lost the case. ", "The logic behind the ruling relied on the assumption that jury service was a burden to women, rather than a responsibility or a privilege. ", "The court allowed universal exemption of women from jury service so women could attend to their duties in the home.", "\n\nHealy v. Edwards (1973) \nAlthough not a Supreme Court case, Healy v. Edwards, fought in the U.S. District Court for the Eastern District of Louisiana, was among the first to oppose previous rulings of Strauder v. West Virginia and Hoyt v. Florida. ", "Ruth Bader Ginsburg served as the attorney representing Marsha Healy in opposing Louisiana's optional jury service for women. ", "In her statements, Ginsburg expanded the plaintiffs to include three groups: women like Healy whose citizenship was diminished by making citizenship duties optional, women defendants who were denied the right to a jury of their peers by not having women on their jury, and men who had to be called in more often for jury duty because women weren't required to. ", " Ginsburg argued that “a flavor, a distinct quality is lost if either sex is excluded.”", "\n\nTaylor v. Louisiana (1975) \nTaylor v. Louisiana’s ruling was similar to Healy v. Edwards, but it was fought in the Supreme Court so it overturned Hoyt v. Florida. ", "Billy Taylor kidnapped and robbed a woman, her daughter, and her grandson and raped the woman. ", "Louisiana had an “opt-in” policy similar to Florida's. ", "Taylor's jury was called from a pool of all men, which, like Hoyt, Taylor argued violated his right to an impartial jury. ", "Opposing attorneys argued that Taylor didn't have a right to this argument because he wasn't a part of the excluded minority—he wasn't a woman. ", "However, the judge rejected this argument and ruled in favor of Taylor, stating that every defendant deserved a jury from a fair cross section of his peers. ", "Taylor v. Louisiana largely takes its argument from the 1946 Supreme Court case Ballard v. United States. ", "Ballard ruled that excluding women from the jury pool didn't make for a fair cross section of the community, but it had little effect because only federal courts were subject to the ruling. ", "In 1968, Duncan v. Louisiana made the Sixth Amendment, the right to an impartial jury, apply to states as well, which political scientist Eric Kasper suggests explains the difference between the rulings in Hoyt v. Florida and Taylor v. Louisiana.", "\n\nDuren v. Missouri (1979) \nBy 1979, many states had “opt-out” jury service policies for women rather than “opt-in” policies, making women eligible for automatic exemption from jury service. ", "Supreme Court case Duren v. Missouri challenged these policies. ", "Ruth Bader Ginsburg served as the challenging attorney. ", "The court produced a three-part test to identify discrimination in jury selection. ", "In order to pass, the jury pool must regularly reflect an accurate proportion of members of a distinct group in the general population—in this case, women. ", "The court ruled that opt-out policies did not meet these criteria and, thus, were unconstitutional.", "\n\nJEB v. Alabama (1994) \nSupreme Court case JEB v. Alabama involved a woman who was trying to get child support after her child's father abandoned them. ", "The attorneys used peremptory strikes to eliminate all the male jurors. ", "Following the precedent of Batson v. Kentucky, which banned peremptory strikes based on race, the Supreme Court also banned peremptory strikes based on gender. ", "While previous court decisions relied on the Sixth Amendment and the idea of a jury being a fair cross-section of the community, JEB v. Alabama cited the Equal Protection Clause of the Fourteenth Amendment.", "\n\nTimeline\nThe push for women's jury rights was largely fought for on a state-by-state basis, with each state facing its own unique challenges.", "\n\nWomen's jury service today \nToday, women frequently serve on juries. ", "In many states, specific exemptions are available for people involved in child care. ", "For example, Illinois, Iowa, Kansas, Mississippi, Nebraska, Oklahoma, Oregon allow exemptions to jury service for nursing mothers.", "\n\nSee also\n Jury selection in the United States\nRacial discrimination in jury selection\nWomen's suffrage\nWomen in government\nJuries in the United States\nCitizenship of the United States\n\nReferences\n\nCategory:Juries in the United States\nJuries" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0015995047288015485, 0.003147256327793002, 0.0008265123469755054, 0.004396222997456789, 0.003971700090914965, 0.0007750848308205605, 0.007870832458138466, 0.0006902273162268102, 0.0037173000164330006, 0.0021535237319767475, 0.0052986592054367065, 0.005535518750548363, 0.3095662295818329, 0.05644192919135094, 0.001239061588421464, 0.0009618189069442451, 0.006401886232197285, 0.0009906981140375137, 0.00091840437380597, 0.0007012354908511043, 0.007504680193960667, 0.0006461574230343103, 0.0008967428002506495, 0.0009277596836909652, 0.0014923426788300276, 0.0009970322716981173, 0.00480169290676713, 0.0007994669722393155, 0.0007066196994856, 0.05701686814427376, 0.002623380161821842, 0.001601150375790894, 0.0022020768374204636, 0.0012323621194809675, 0.0006834342493675649, 0.0017747028032317758, 0.0007963064126670361, 0.005161530338227749, 0.0007814439013600349, 0.0007752003730274737, 0.0007739345310255885, 0.0013026547385379672, 0.05309820920228958, 0.009548728354275227, 0.005767673719674349, 0.014733042567968369, 0.0022012428380548954, 0.06658276915550232, 0.0007333139074034989, 0.0077573680318892, 0.004761712625622749, 0.001766782603226602, 0.001954368082806468, 0.0006162008503451943, 0.011654725298285484, 0.00450796727091074, 0.0007876456365920603, 0.0017015490448102355, 0.000840456341393292, 0.0006530038081109524, 0.0006695291376672685, 0.0026415246538817883, 0.0013426616787910461, 0.032809656113386154, 0.010263882577419281, 0.04222899302840233, 0.0016460551414638758, 0.0024974916595965624, 0.0010011184494942427, 0.0009884391911327839, 0.0051527745090425014, 0.0006662119994871318, 0.0029203363228589296, 0.0006999176112003624, 0.000882290187291801, 0.0006614875164814293, 0.7815510034561157, 0.0009824392618611455, 0.0008959528058767319, 0.0013221469707787037, 0.0007279251585714519, 0.0006255779881030321, 0.0010516088223084807, 0.0006860844441689551, 0.001427559764124453, 0.0007192560005933046, 0.0009864794556051493, 0.0006386598106473684, 0.0009185912786051631, 0.0007471908465959132, 0.0010019748006016016, 0.008034582249820232, 0.0017225082265213132, 0.0006222687661647797, 0.00073612155392766, 0.011670151725411415, 0.000640275829937309, 0.0009428715566173196, 0.0013145223492756486 ]

[ "Sri Vasavi Engineering College, Andhra Pradesh has advertised in the Eenadu newspaper for the recruitment of Teaching Faculty- Professors, Associate Professor, Lecturers and Assistant Professor jobs vacancies. ", "Interested and eligible job aspirants are requested to apply latest by 08th May 2016. ", "Check out further more details below.", "\n\nName of the College: Sri Vasavi Engineering College\n\nAbout College: Sri Vasavi Engineering College was established in 2001 and provides an inspiring education that engages students with rigorous academic and creative study grounded in liberal learning and promotes civic values of personal and social responsibility. ", "Sri Vasavi faculty works with more than 2,500 students in undergraduate, graduate, and professional programs and has regularly been ranked best among the private engineering colleges in the coastal area. ", "The intake of two UG Programmes is being enhanced and a few new courses in PG and Diploma in Engineering are being introduced from the academic year 2013-14.", "\n\nQualification: You should have completed M.E/M.Tech/B.E/B.Tech/Ph.", "D as per AICTE Norms\n\nJob Location: Andhra Pradesh\n\nSalary: As per AICTE norms\n\nHow to Apply: Interested candidates are requested to send application along with resume, copies of academic qualification and experience, pass port size photography to the following Email/Postal address on or before 8th May 2016" ]

{ "pile_set_name": "Pile-CC" }

[ 0.000825040100608021, 0.0005834096809849143, 0.0005741575732827187, 0.0005505551816895604, 0.000569528026971966, 0.0005953582585789263, 0.0006646487163379788, 0.0005854799528606236 ]

[ "Preparation and Characterization of a π-Conjugated Donor-Acceptor System Containing the Strongly Electron-Accepting Tetraphenylborolyl Unit.", "\nA novel thiophene-bridged donor-acceptor system was synthesized with a carbazole as donor and a borole as acceptor unit. ", "The borole group was successfully installed via the tin-boron exchange reaction of 1,1-dimethyl-2,3,4,5-tetraphenylstannole with 9-(5-(dibromoboryl)thiophen-2-yl)carbazole. ", "The effect of the borole on the optoelectronic properties of the donor-acceptor system was explored by spectroscopic (UV/Vis and fluorescence spectroscopy), electrochemical (cyclic voltammetry) and theoretical (TD-DFT) methods as well as by modifying its structure. ", "The corresponding donor-acceptor compound bearing the widely employed dimesitylboryl acceptor group was also synthesized for comparison." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0007262164726853371, 0.0008433523471467197, 0.0014278615126386285, 0.0006017424166202545, 0.000582479580771178 ]

[ "Relations between environment, migration and reproduction in a seed bug, Neacoryphus bicrucis (Say) (Heteroptera: Lygaeidae).", "\nThe seed feeding bug Neacoryphus bicrucis migrates by flight, often at great altitudes, and evidently is able to disperse over long distances. ", "Non-diapausing females provided with ample food and mates histolyze their flight muscles soon after adult eclosion, and thus undertake very little flight. ", "If food density is below a certain threshold flight ability is retained at a constant high level through most of adult life, while egg production becomes a linear function of the logarithm of food density. ", "Bugs totally starved from adult eclosion onwards survive for a month or more with only a minor decrease in flight ability. ", "Females also retain their flight potential when subjected to lack of mates or diapause-inducing photoperiodic conditions. ", "Most males are able to fly throughout their adult lives under all conditions studied, but the tendency to fly is enhanced by lack of food or mates." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.000794937543105334, 0.001434366567991674, 0.018944690003991127, 0.0007030582637526095, 0.0016610126476734877, 0.004391377326101065, 0.0017353930743411183 ]

[ "1. ", "Field of the Invention\nThe invention relates to a computer user interface and, more particularly, the invention relates to a computer user interface for displaying protected information.", "\n2. ", "Background of the Related Art\nAs more and more information is stored using electronic devices, the need for security has correspondingly increased. ", "A security measure commonly used with computers is requiring a password prior to access. ", "Conventionally, a computer user inputs a password into a password field on a computer display. ", "However, rather than displaying actual text of an inputted password, conventionally a substitute symbol is used for each character. ", "Examples of substitute symbols include, but are not limited to, X\"\"s and asterisks. ", "Accordingly, substitute or masking symbols are displayed to disguise an inputted password to curtail unauthorized disclosure to persons within visual range of the computer display.", "\nHowever, because of increased concerns for security, passwords are becoming more complex. ", "For example, a password of at least eight characters is conventionally required to reduce susceptibility to attack Moreover, alpha-characters and numeric-characters may be interchangeably mixed to reduce the likelihood of deducing a password.", "\nThus, a user may type a long complicated password displayed only as some masking symbol and be denied access owing to something as trivial as a typographical error. ", "Moreover, in some systems, after a number of failed attempts to gain access, a system administrator must be contacted to reset the password. ", "In either case, time and effort are wasted due to a typographical error. ", "Moreover, such errors may cause a degree of frustration, which may lead to avoiding proper security measures, such as not logging off a computer system, using a short or otherwise inadequate password, or storing a password on a computer system.", "\nTherefore, a need exists in the art for an ability to identify one or more clerical inadvertences in an inputted password without significantly compromising security.", "\nThe invention provides a method for selectively displaying a portion of a password undisguised. ", "In one aspect, a graphical user interface configured with a password field is displayed on a display device. ", "The password is entered into the password field. ", "A password access mode is invoked to provide access to at least a portion of the password.", "\nAnother aspect of the invention provides a method for selectively displaying a portion of a first password on a display device in communication with a programmed computer. ", "The programmed computer is in communication with a cursor positioning device and a keyboard. ", "A cursor object is invoked for display on the display device, and a graphical user interface is invoked for display on the display device. ", "The graphical user interface is configured with a password field to receive the first password. ", "A password access mode is invoked at least in partial response to the cursor object having a positional association with a portion of the graphical user interface. ", "The password access mode is configured to provide access to at least a portion of the password in response to a second password.", "\nThe above as well as additional aspects of the present invention will become apparent in the following detailed written description." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0009391900966875255, 0.0005818811478093266, 0.001185585861094296, 0.0005473117926158011, 0.0006647855625487864, 0.0007575578056275845, 0.0006096718134358525, 0.000720847281627357, 0.0007057780749164522, 0.00061353127239272, 0.0006907418719492853, 0.0008732774294912815, 0.0006188950501382351, 0.0008892606711015105, 0.0012553337728604674, 0.0006673237076029181, 0.0006648682174272835, 0.0005883002886548638, 0.0006734243943355978, 0.0006275431951507926, 0.0007146097486838698, 0.0007506529218517244, 0.0006578040774911642, 0.0007013929425738752, 0.0006639949860982597, 0.0006764185964129865, 0.0005337920156307518 ]

[ "Wireless telecommunication networks typically have central management stations which manage and control a plurality of remote sites. ", "Devices at the remote sites collect analog sensor measurements and provide that information to the central management station. ", "For example, see U.S. Pat. ", "Nos. ", "6,640,101 and 7,567,519, the disclosures of which are expressly incorporated herein in their entireties.", "\nThis information provided to the central management station from the remote sites is often limited such as, for example, to current or voltage measurements taken as analog inputs, internal temperatures, and incoming power voltages. ", "While this information from the remote sites can provide a wealth of information about the remote sites, it does not help anticipate or resolve many problems at the remote cites. ", "Additionally, there is an ongoing and increasing desire to reduce the number of occasions that it is necessary to send maintenance personnel to the remote sites.", "\nAccordingly, there is a need in the art for improved management systems and methods for monitoring and controlling remote sites and equipment." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.000654393108561635, 0.0005562898004427552, 0.0006730952300131321, 0.0008322071516886353, 0.0006853616796433926, 0.0005388883873820305, 0.0005483354907482862, 0.0005371634615585208, 0.000611555646173656 ]

[ "# Copyright 1999-2019 Gentoo Authors\n# Distributed under the terms of the GNU General Public License v2\n\nEAPI=5\n\n# ebuild generated by hackport 0.4.4.9999\n#hackport: flags: -werror,-hlint\n\nCABAL_FEATURES=\"lib profile haddock hoogle hscolour test-suite\"\ninherit haskell-cabal\n\nDESCRIPTION=\"A faster time library\"\nHOMEPAGE=\"https://github.com/liyang/thyme\"\nSRC_URI=\"https://hackage.haskell.org/package/${P}/${P}.tar.gz\"\n\nLICENSE=\"BSD\"\nSLOT=\"0/${PV}\"\nKEYWORDS=\"~amd64 ~x86\"\nIUSE=\"+bug-for-bug lens show-internal\"\n\nRESTRICT=test # optimization-dependent\n\nRDEPEND=\">=dev-haskell/aeson-0.6:=[profile?]", "\n\t>=dev-haskell/attoparsec-0.10:=[profile?]", "\n\t>=dev-haskell/mtl-1.1:=[profile?]", "\n\t>=dev-haskell/quickcheck-2.4:2=[profile?]", "\n\tdev-haskell/random:=[profile?]", "\n\t>=dev-haskell/text-0.11:=[profile?]", "\n\t>=dev-haskell/vector-0.9:=[profile?]", "\n\t>=dev-haskell/vector-space-0.8:=[profile?]", "\n\t>=dev-haskell/vector-th-unbox-0.2.1.0:=[profile?]", "\n\t>=dev-lang/ghc-7.4.1:=\n\tlens? ( ", ">=dev-haskell/lens-3.9:=[profile?] )", "\n\t!", "lens? ( ", ">=dev-haskell/profunctors-3.1.2:=[profile?] )", "\n\"\nDEPEND=\"${RDEPEND}\n\t>=dev-haskell/cabal-1.10\n\ttest? ( ", ">=dev-haskell/system-posix-redirect-1.1 )\n\"\n\nsrc_configure() {\n\thaskell-cabal_src_configure \\\n\t\t$(cabal_flag bug-for-bug bug-for-bug) \\\n\t\t--flag=-hlint \\\n\t\t$(cabal_flag lens lens) \\\n\t\t$(cabal_flag show-internal show-internal) \\\n\t\t--flag=-werror\n}\n" ]

{ "pile_set_name": "Github" }

[ 0.0008432961767539382, 0.0007652346394024789, 0.0007812745170667768, 0.0007989548612385988, 0.0007483296212740242, 0.0007561895763501525, 0.0007476388709619641, 0.0007419915054924786, 0.000842995650600642, 0.000693365465849638, 0.0007232797797769308, 0.010120762512087822, 0.0006577307940460742, 0.0007635113433934748, 0.0006803691503591835, 0.0008980857091955841 ]

[ "k) be the first derivative of 3*k**2 + 2*k - 269. ", "Let t(q) = -16 + 7*q - 17 + 36. ", "Suppose 5*i + 13 = 3*u, 4*i + 0*i + 4*u = -36. ", "Give i*a(f) + 4*t(f).", "\n-2*f + 2\nLet s be -1 + (115/69)/((-5)/(-12)). ", "Let q(p) = 3*p + 10*p - 12*p + 4*p - s. Let c be (11/(-3))/((-2)/(-6)). ", "Let k(l) = -2*l + 1. ", "Calculate c*k(h) - 4*q(h).", "\n2*h + 1\nLet u be 5/2 + 2/4. ", "Let w(m) be the second derivative of m**3/2 - m**2/2 + 17*m - 235. ", "Let d(t) = -1. ", "Determine u*d(a) - w(a).", "\n-3*a - 2\nLet l(u) = 61*u**3 + 3*u**2 - 3*u. ", "Let b be (-1539)/95 - -16 - 16/(-5). ", "Let g(w) = -2378*w**3 - 116*w**2 + 116*w. ", "Calculate b*g(k) + 116*l(k).", "\n-58*k**3\nLet j be (-6)/(-21) - 2210/(-1820). ", "Let h(v) be the first derivative of -4 - 2*v - j*v**2. ", "Let k(p) = -p - 1. ", "Give -h(b) + 4*k(b).", "\n-b - 2\nLet v(p) be the third derivative of 1/3*p**6 + 0*p**5 + 0 + 46*p**2 + 0*p + 0*p**3 + 0*p**4. ", "Let o(h) = 13*h**3. ", "Determine -10*o(j) + 3*v(j).", "\n-10*j**3\nSuppose -16*n + 20*n + 24 = 0. ", "Let g = 7 + n. Let h(k) = 3*k**2 - 24*k**2 + k**2. ", "Let m(r) = -r**2. ", "Calculate g*h(v) - 24*m(v).", "\n4*v**2\nLet z(q) = -2*q + 1. ", "Let y(i) = -4*i + 2. ", "Let n(h) = -6*y(h) + 11*z(h). ", "Let x(r) be the second derivative of r**3/3 - r**2 - 22327*r. ", "Determine 3*n(o) - 4*x(o).", "\n-2*o + 5\nLet z(h) = 4*h + 2. ", "Let w(s) = -s - 1. ", "Suppose 12*i - 13*i = -17. ", "Let m = i + -1. ", "Suppose -m*q = -20*q - 40. ", "Give q*w(g) - 3*z(g).", "\n-2*g + 4\nLet u(b) = b**2 + 1. ", "Let s be (-92)/(-20) - 4/(-10). ", "Let n(c) = -s*c**3 - c**3 - 20*c**2 + 2*c**3 - 20. ", "Let j = -202636 + 202616. ", "Calculate j*u(a) - n(a).", "\n4*a**3\nLet n(r) = 3*r**3 - 4*r**2 + 13*r - 13. ", "Let d(z) = -639*z**3 + 638*z**3 - 6*z + 6 - 21*z**2 + 13*z**2 + 10*z**2. ", "Determine 13*d(o) + 6*n(o).", "\n5*o**3 + 2*o**2\nLet h(c) = 181*c**2 + 22. ", "Let n(t) = 183*t**2 + 24. ", "What is 5*h(o) - 4*n(o)?", "\n173*o**2 + 14\nSuppose 4*p - 60 = 3*n, -3*n + 10 + 38 = 5*p. ", "Let z(c) = 2*c**2 + c - 2 + 2. ", "Let y(d) = d**2 + d. Determine n*y(u) + 4*z(u).", "\n4*u**2\nLet k(l) = l**3 - 2*l**2 + 15*l + 1. ", "Let i(p) = -4*p**3 + 7*p**2 - 52*p - 4. ", "Let v(d) = 2*i(d) + 7*k(d). ", "Let u(f) = 11*f**3 - 6*f + 6. ", "Give 5*u(o) + 30*v(o).", "\n25*o**3\nLet k(r) = -25*r**3 + 6*r**2 + 6*r - 6. ", "Let o(m) = 25*m**3 - 5*m**2 - 5*m + 5. ", "Suppose -283*y + 204*y = -354 - 120. ", "What is y*o(h) + 5*k(h)?", "\n25*h**3\nLet r(n) = -54*n + 11340. ", "Let p(w) = -43*w + 11332. ", "Calculate -5*p(c) + 4*r(c).", "\n-c - 11300\nLet f(q) = -3*q + 11. ", "Let n(r) = -4*r**2 + 301*r + 1198. ", "Let w be n(79). ", "Let p(l) = -l + 5. ", "Let s = -5 + 11. ", "Suppose -2*c - s = -c. ", "Calculate c*f(b) + w*p(b).", "\n5*b - 1\nLet o(l) = 3*l - 1. ", "Suppose -861*w + 4 = -857*w. ", "Let x(p) = p + 1. ", "Suppose 3*a = 3*q - 12, 4*a + 18 = 5*q - 0. ", "Give q*x(u) + w*o(u).", "\n5*u + 1\nLet j(y) = -6*y**3 - 68*y**2 + 6*y - 6. ", "Let l(q) = -12*q**3 - 137*q**2 + 14*q - 13. ", "Determine -9*j(b) + 4*l(b).", "\n6*b**3 + 64*b**2 + 2*b + 2\nLet b(i) = 2*i + 6. ", "Let y(f) be the second derivative of f**2/2 - 442*f. ", "Give b(c) - 3*y(c).", "\n2*c + 3\nLet j be (590/708)/((-1)/(-2*3)). ", "Let z(b) = -9*b + 3. ", "Let p(h) = h + 1. ", "Let y(n) = 1. ", "Let a(t) = -4*p(t) + 5*y(t). ", "Give j*a(o) - 2*z(o).", "\n-2*o - 1\nLet j(y) = 34*y - 248. ", "Let t(o) = -41*o + 249. ", "Give 5*j(b) + 4*t(b).", "\n6*b - 244\nLet t(x) = 486*x + 4 + 491*x - 976*x. ", "Let v(p) = -2*p - 5. ", "Let f = 35 - 23. ", "Suppose 0 = 3*a + a + f. Determine a*v(j) - 4*t(j).", "\n2*j - 1\nLet b(d) = 84 + 28*d + 58*d + 85 + 88 - 274. ", "Let t(p) = -29*p + 6. ", "What is -4*b(g) - 11*t(g)?", "\n-25*g + 2\nLet x(d) = 10*d - 6. ", "Let w(z) = 658 - 210 + 3*z - 225 - 225. ", "Let h(q) = -q - 2. ", "Let v be h(0). ", "What is v*x(j) + 7*w(j)?", "\nj - 2\nLet n(z) = -9*z**3 - 10*z**2 + 39*z + 5. ", "Let x(t) = -14*t**3 - 14*t**2 + 58*t + 7. ", "What is -7*n(w) + 5*x(w)?", "\n-7*w**3 + 17*w\nLet v(q) = -3*q + 1. ", "Let t(n) = -n**3 + 19*n**2 - 45*n - 3. ", "Let u be t(3). ", "Let j(p) = 5*p - 2. ", "Determine u*j(i) + 13*v(i).", "\n-9*i + 1\nLet m(k) = 141*k**2 - 413*k + 103. ", "Let l(c) = -24*c**2 + 69*c - 18. ", "Give -23*l(q) - 4*m(q).", "\n-12*q**2 + 65*q + 2\nLet s(p) = 5*p**2 + 2*p - 1. ", "Let o be ((-5)/(-15))/(2/66). ", "Suppose 10 = 7*g + 24. ", "Let i(v) = v**3 + 26*v**2 + 11*v - 6. ", "Determine g*i(l) + o*s(l).", "\n-2*l**3 + 3*l**2 + 1\nLet u(g) = -4*g**3 - 2*g**2 - 2*g + 9. ", "Let n(j) = 2*j**3 + j + 7. ", "Determine n(h) - u(h).", "\n6*h**3 + 2*h**2 + 3*h - 2\nLet h(b) = -4*b - 222. ", "Let f be h(-56). ", "Let i(k) = -10*k - 17. ", "Let s(t) = 3*t + 6. ", "Give f*i(l) + 7*s(l).", "\nl + 8\nLet t(v) = 10*v - 6. ", "Let c(q) = -20*q + 11. ", "Let i(f) = -88*f + 1941. ", "Let m be i(22). ", "Determine m*t(y) + 3*c(y).", "\n-10*y + 3\nLet s(c) = 95*c**2 - 49*c - 1. ", "Let o(w) = 27*w**2 - 17*w. ", "Determine -7*o(y) + 2*s(y).", "\ny**2 + 21*y - 2\nLet i(k) = 13195*k - 5. ", "Let u(v) = -26425*v + 8. ", "Determine -5*i(w) - 3*u(w).", "\n13300*w + 1\nLet z(f) = -34*f + 1531. ", "Let q(n) = -86*n + 3063. ", "Calculate -2*q(m) + 5*z(m).", "\n2*m + 1529\nLet r(q) = 17*q + 215. ", "Let p(s) = -15*s - 218. ", "Calculate -6*p(g) - 5*r(g).", "\n5*g + 233\nLet l(h) = 3*h**2 + 2*h. ", "Let s(p) = -p. ", "Let f = 11389 - 11395. ", "Calculate f*s(m) - 3*l(m).", "\n-9*m**2\nSuppose 42 = 163*w - 170*w. ", "Let m(z) be the second derivative of 2*z**4/3 + z**3 - 3*z**2 + 43*z + 2. ", "Let x(o) = 9*o**2 + 7*o - 6. ", "Give w*x(y) + 7*m(y).", "\n2*y**2 - 6\nLet h(q) = q - 3. ", "Let t(g) = -g + 1. ", "Let w = -359 + 351. ", "Let y be 9 + w/(-6)*-3. ", "What is y*t(v) + 2*h(v)?", "\n-3*v - 1\nLet g(o) = -12*o + 1737. ", "Let k(p) = -2*p + 285. ", "Determine -2*g(y) + 13*k(y).", "\n-2*y + 231\nLet v(m) = 7*m**3 - 37*m**2 - 14*m - 33. ", "Let q(y) = 4*y**3 - 21*y**2 - 8*y - 17. ", "What is 5*q(l) - 3*v(l)?", "\n-l**3 + 6*l**2 + 2*l + 14\nLet t(b) = 2*b - 289. ", "Let k(y) = -6*y + 857. ", "What is -3*k(i) - 8*t(i)?", "\n2*i - 259\nLet i(h) = -4*h**3 - 7*h**2 - 2. ", "Let b(v) = -v**3 - v**2 - 1. ", "Suppose 612 = 5*w + g, w = 5*g - 4*g + 120. ", "Let y = 123 - w. Determine y*i(r) - 2*b(r).", "\n-2*r**3 - 5*r**2\nLet f(s) = 3*s**2 + 5*s + 2*s**2 + 3 - 11*s**2 + 5*s**2. ", "Let x(q) = 11*q + 1 - 20*q + 10*q. ", "Give f(p) - 4*x(p).", "\n-p**2 + p - 1\nLet a(b) = 4*b - 16. ", "Let x be ((1/(-2))/(1/(-10)))/(1383/1383). ", "Let y(r) = -1. ", "Calculate x*y(g) - a(g).", "\n-4*g + 11\nLet s(g) = 3*g**2 - 3*g - 3. ", "Let x be (-580)/261 + ((-32)/(-36))/4. ", "Let p(d) = -3*d**2 + 2*d + 2. ", "Determine x*s(i) - 3*p(i).", "\n3*i**2\nLet b(f) = -9*f**3 - 15*f**2 + 4*f. ", "Let s = -672 + 703. ", "Suppose -5*n = 4*h + 75, n + 3*h + s = -h. ", "Let d(q) = -5*q**3 - 8*q**2 + 2*q. ", "Determine n*d(p) + 6*b(p).", "\np**3 - 2*p**2 + 2*p\nLet l(r) = -21*r - 5. ", "Let x(d) = -11*d - 3. ", "Suppose -2*z - 4*a - 10 = 0, -6*z = -7*z + a + 7. ", "Give z*l(t) - 5*x(t).", "\n-8*t\nLet s(f) = -2*f**2 - f - 5. ", "Let c be (-33)/11 - 6*-1. ", "Let k(m) = -3*m + 25. ", "Let p be k(6). ", "Let j(w) = -5 - 3 + p. Calculate c*j(i) - s(i).", "\n2*i**2 + i + 2\nLet x(a) = 6*a**2 - 5*a - 54. ", "Let k(v) = -9*v**2 + 3*v + 49. ", "What is -3*k(w) - 4*x(w)?", "\n3*w**2 + 11*w + 69\nLet t(b) = -4*b**3 + b**2 - 9*b - 17. ", "Let s(y) = -2*y**3 + y**2 - 7*y - 17. ", "Determine -4*s(k) + 3*t(k).", "\n-4*k**3 - k**2 + k + 17\nLet v(z) = -9*z - 5. ", "Let l(b) be the second derivative of -5*b**3/6 - b**2 - 13*b - 3. ", "Give -5*l(a) + 2*v(a).", "\n7*a\nLet q = 27 + -23. ", "Let o(v) = 2*v + 2. ", "Suppose -3*l - 3 = 5*i, 0 - 3 = 3*l. ", "Let g be 7/(-14)*(i + 2). ", "Let h(d) = 1. ", "What is g*o(y) + q*h(y)?", "\n-2*y + 2\nSuppose 0 = -4*w - w + 4*g + 11, -4*w - 4*g + 16 = 0. ", "Let u(x) = 7 - 8 - 12 + 3 + 45*x - 9*x. ", "Let d(n) = 7*n - 2. ", "Calculate w*u(f) - 16*d(f).", "\n-4*f + 2\nLet y(i) = 3 + 2 - 1 - 4*i**2. ", "Let x(w) = -3*w**2 + w + 29. ", "Let z(o) = o + 26. ", "Let k(r) = -x(r) + z(r). ", "Let l = -6 + 1. ", "Give l*y(q) - 7*k(q).", "\n-q**2 + 1\nSuppose 2*d = -8*d + 640. ", "Suppose 0 = -50*u + d*u - 154. ", "Let r(c) = c**2 - 7*c + 5. ", "Let o(w) = 2*w**2 - 13*w + 9. ", "Determine u*r(g) - 6*o(g).", "\n-g**2 + g + 1\nLet j be 4*50/12*(-75)/(-250). ", "Let d(i) = -19*i**2 + 5. ", "Let x(r) = 1. ", "Give j*x(u) - d(u).", "\n19*u**2\nLet u(q) = -q. ", "Let x = 224 + -105. ", "Let a = x + -124. ", "Let o(v) = 4*v**2 - 5*v. ", "Let k(s) = -s**3 + 8*s**2 - 6*s - 6. ", "Let z be k(7). ", "Calculate a*u(y) + z*o(y).", "\n4*y**2\nLet w(m) = 11*m**3 + 6*m**2 + 2*m + 3. ", "Let z(k) = -34*k**3 - 17*k**2 - 6*k - 13. ", "Give 17*w(f) + 6*z(f).", "\n-17*f**3 - 2*f - 27\nLet f be (-73 - -81)/((-8)/(-3)). ", "Let h(g) = -13*g - 2 + 18*g**f - 2 - 1 - 20*g**3. ", "Let t(s) = s**3 + 7*s + 3. ", "Determine 6*h(o) + 10*t(o).", "\n-2*o**3 - 8*o\nLet u(i) = 3*i**3 + 8*i**2 + 4*i. ", "Let d(g) = 120*g - g**3 + 0*g**2 - 3*g**2 + 106*g - 227*g. ", "Give -8*d(r) - 3*u(r).", "\n-r**3 - 4*r\nSuppose -2*u + 240 = u. Let b = u - 62. ", "Suppose 3*k - 21 + b = 0. ", "Let a(w) = 6*w**2 + 6*w - 3. ", "Let q(l) = l**2 + l - 1. ", "What is k*a(y) - 4*q(y)?", "\n2*y**2 + 2*y + 1\nLet u be 2/11 + (-1728)/(-297). ", "Let h(r) = -10*r**2 -" ]

{ "pile_set_name": "DM Mathematics" }

[ 0.874056339263916, 0.0035791322588920593, 0.10082358121871948, 0.8940603733062744, 0.0043234871700406075, 0.036088768392801285, 0.12440645694732666, 0.951263427734375, 0.049078088253736496, 0.003909405320882797, 0.002591355238109827, 0.0381765216588974, 0.41207218170166016, 0.001156309968791902, 0.018798459321260452, 0.22639799118041992, 0.8805477619171143, 0.0028270722832530737, 0.0057637132704257965, 0.9301591515541077, 0.04654601588845253, 0.01512324158102274, 0.0013077165931463242, 0.005524434149265289, 0.9674052596092224, 0.0118995551019907, 0.005861463490873575, 0.01982388272881508, 0.009743178263306618, 0.02322004735469818, 0.0021885796450078487, 0.03836999461054802, 0.024664878845214844, 0.0031301199924200773, 0.0013654050417244434, 0.004985068924725056, 0.0019912980496883392, 0.15810956060886383, 0.2798490524291992, 0.0008221403113566339, 0.3110443651676178, 0.0012456694385036826, 0.17107900977134705, 0.3527822196483612, 0.018582310527563095, 0.029906297102570534, 0.2705295979976654, 0.042538221925497055, 0.20638976991176605, 0.07089763134717941, 0.02441094070672989, 0.11860250681638718, 0.9815382957458496, 0.021807048469781876, 0.7066684365272522, 0.9167434573173523, 0.3992187976837158, 0.9690629243850708, 0.056810516864061356, 0.0009882089216262102, 0.9137113094329834, 0.1581873595714569, 0.0025316495448350906, 0.01144164614379406, 0.009696257300674915, 0.0062135667540133, 0.0021393836941570044, 0.005516917910426855, 0.0018041296862065792, 0.01049908809363842, 0.5581477284431458, 0.018317025154829025, 0.0017439920920878649, 0.0023080199025571346, 0.0031112334690988064, 0.6522199511528015, 0.03240881487727165, 0.004410804249346256, 0.0008264402858912945, 0.09976151585578918, 0.7261806726455688, 0.06786224246025085, 0.0034699796233326197, 0.004505831748247147, 0.007124773692339659, 0.004594284109771252, 0.14649829268455505, 0.1940336525440216, 0.015841860324144363, 0.07501687854528427, 0.10572423040866852, 0.007792612072080374, 0.005901942029595375, 0.00125857163220644, 0.019960889592766762, 0.013361508026719093, 0.00640429463237524, 0.02165965549647808, 0.006351906806230545, 0.0012780171819031239, 0.001550036482512951, 0.003011522814631462, 0.02319665439426899, 0.06178859993815422, 0.03532424196600914, 0.016594430431723595, 0.0345577597618103, 0.11728452891111374, 0.010092830285429955, 0.00367395905777812, 0.01132761500775814, 0.9445926547050476, 0.02735029347240925, 0.00946334283798933, 0.015351712703704834, 0.0028434249106794596, 0.0014427931746467948, 0.04494206979870796, 0.16183477640151978, 0.4410969018936157, 0.014456553384661674, 0.006906810216605663, 0.018083609640598297, 0.001967277377843857, 0.7737953066825867, 0.009357547387480736, 0.9778337478637695, 0.01347231213003397, 0.0020817480981349945, 0.020538290962576866, 0.0013508815318346024, 0.10707489401102066, 0.063117116689682, 0.022581223398447037, 0.0017932301852852106, 0.8624259233474731, 0.0026075083296746016, 0.00484409648925066, 0.04591456428170204, 0.0014850320294499397, 0.0013639811659231782, 0.0037575585301965475, 0.014687429182231426, 0.009450611658394337, 0.016852520406246185, 0.0020006487611681223, 0.0012003467418253422, 0.8219330310821533, 0.0034786025062203407, 0.006043101195245981, 0.047702472656965256, 0.12610550224781036, 0.006048594601452351, 0.00633207755163312, 0.001176739577203989, 0.0016264206496998668, 0.07633130997419357, 0.054192595183849335, 0.03667648136615753, 0.42937594652175903, 0.03782603517174721, 0.012283574789762497, 0.00559195876121521, 0.02081562951207161, 0.05616680160164833, 0.8716602325439453, 0.020656369626522064, 0.013137496076524258, 0.014655189588665962, 0.0043617854826152325, 0.8396701812744141, 0.005830724257975817, 0.013073215261101723, 0.02858964540064335, 0.0011425665579736233, 0.0021541365422308445, 0.0060797519981861115, 0.06173698976635933, 0.0007955225300975144, 0.029683828353881836, 0.022433161735534668, 0.9633576273918152, 0.0014073163038119674, 0.037675295025110245, 0.024376170709729195, 0.00817476212978363, 0.11645366251468658, 0.002072314266115427, 0.003002940909937024, 0.10271278023719788, 0.9140238165855408, 0.0013884082436561584, 0.14795857667922974, 0.0017966809682548046, 0.3677188456058502, 0.03674357011914253, 0.6314041614532471, 0.6388266086578369, 0.2858502268791199, 0.008540437556803226, 0.20209068059921265, 0.9695582389831543, 0.0028635330963879824, 0.03139490634202957, 0.0015958361327648163, 0.011053020134568214, 0.010260953567922115, 0.001628070487640798, 0.001663635135628283, 0.088618203997612, 0.012995426543056965, 0.020388007164001465, 0.015327426604926586, 0.4707382917404175, 0.37002313137054443, 0.004436325281858444, 0.00652740802615881, 0.026479149237275124, 0.0017519204411655664, 0.9086494445800781, 0.003370922291651368, 0.043187618255615234, 0.08039767295122147, 0.02211691439151764, 0.07683224976062775, 0.03284715116024017, 0.017521357163786888, 0.0013212802587077022, 0.14814236760139465, 0.06798828393220901, 0.0012374116340652108, 0.0020878820214420557, 0.03134983777999878, 0.9139400720596313, 0.001902485964819789, 0.20316393673419952, 0.09988150000572205, 0.976152777671814, 0.28100791573524475, 0.8209522366523743, 0.30425626039505005, 0.05948641151189804, 0.02818589098751545, 0.412147581577301, 0.10768820345401764, 0.4942900240421295, 0.0849563479423523, 0.47340163588523865, 0.00713192205876112, 0.004496104083955288, 0.8981941342353821, 0.018228765577077866, 0.04593730717897415 ]

[ "Understand Men. ", "Find Love.", "\n\nMenu\n\nAre Men Manly Enough?", "\n\nRecently, 8 authors, bloggers and comedians participated in a discussion in the Room for Debate area of the NY Times called “Are Modern Men Manly Enough?” ", "The New York Times asked:\n\nAre men spending too much time at the spa and the gym in lieu of grittier, manlier pursuits? ", "And if so, is this making them less masculine?", "\n\nThe debate includes short pieces that advocate a return to manliness. ", "A few excerpts…\n\n“Rediscover the Don Draper Within” by Joel Stein, columnist:\n\nWe can’t solve this man-crisis by sitting on a couch watching “Ice Road Truckers.” ", "We’ve got to start fixing our own toilets, exercising outside at 6 a.m. and hunting the meat that we cowardly eat from far crueler factory farms. ", "Otherwise, the tribe down the street might raid us and pillage our apartment.", "\n\n“Where are the Meat and Potato Men?” ", "by Natasha Scripture, blogger and author:\n\nCome to think of it, I haven’t met a manly man in quite some time. ", "Maybe because most of them live in Montana. ", "Or Texas. ", "Or Sicily! ", "They’re certainly rare sightings in New York City because here the abundant local species seems to be the metrosexual.", "\n\nLot of jokes at men’s expense, many of them funny. ", "But what is there to really learn from this? ", "How did men get this way? ", "Is this a good thing or a bad thing?", "\n\nIf you prefer a world where men are the he-man type, then you must advocate for a world where women are the docile and helpless type.", "\n\nNot surprisingly, I’ll say that it’s both.", "\n\nWhat’s bad about men – and, well, women as well- is that we’re completely not self-sufficient. ", "I’ve long ago accepted that I’d be the first person kicked off Survivor island. ", "The lack of air-conditioning alone would spell my demise. ", "I own a wrench but can’t use it. ", "I have a very active subscription on Angie’s List. ", "I hire a handyman to hang big picture frames. ", "And I’m not really ashamed at all. ", "Because really, who said that you’re more of a man because you can use tools, fix computers, or hunt for food?", "\n\nWe’re fortunate enough to live in a world where I don’t have to do these things. ", "If I DID have to do these these things for a) survival or b) to be attractive to women, I’d be at a disadvantage. ", "But I don’t. ", "I have a plumber and a gardener and a handyman and a pool guy. ", "And my wife has a nail woman and a monthly cleaning lady and a daytime babysitter to take things off of her plate that she either couldn’t or wouldn’t want to do herself. ", "We’re lucky. ", "But we’re not lesser men or women for it.", "\n\nTo me the one guy who really got it right in that NYT piece was Lawrence Schlossman, blogger:\n\nI want to tell the modern man that he doesn’t have to look like a gold rush-era carnival worker or brew his own micro whatever to be considered a man in my eyes. ", "No, it’s way easier than that. ", "How about being a good guy, a good person.", "\n\nWhen women say they want a “man, not a boy”, I’m pretty sure that this is the crux of it. ", "Sure, it’s a bonus if you can build a deck in your backyard. ", "But really, what separates the men from the boys? ", "It’s integrity. ", "Honor. ", "Responsibility. ", "Sticking with your word. ", "Knowing how to sacrifice. ", "Putting loved ones first. ", "It’s certainly not about manual labor, ability to survive in the wilderness or fighting for your honor. ", "Those are remnants of a 19th century world. ", "Many of us don’t want to return to that world.", "\n\nTo be fair, I’ve heard the lamentations from women about men losing their masculinity; those same women better take a good look in the mirror about how they’ve lost their femininity. ", "You can’t have it both ways. ", "If you prefer a world where men are the he-man type, then you must advocate for a world where women are the docile and helpless type. ", "And if you think that’s silly, I would ask you: why? ", "Why should men continue to embody ancient stereotypes but women shouldn’t?", "\n\nThat’s right: they shouldn’t.", "\n\nWhat we need to do is recognize that many men have become more like women – helping at home, believing in monogamy and pacifism and community. ", "And many women have become more like men: direct, challenging, ambitious, driven. ", "There’s nothing wrong with acknowledging these original stereotypes, or admitting that the lines have been blurred between the genders. ", "What I hope to offer to you, as a reader, is a knowledge that if you’re looking for a typically masculine man, you’re better off being a typically feminine woman. ", "If you’re a typically masculine woman, you’ll have a better fit with a typically feminine man.", "\n\nAs for me, despite my lack of traditional manly skills, I’m still a man. ", "I’m the traditional breadwinner and my wife is the happy stay-at-home mom. ", "And I can assure you that, by abdicating responsibility for home improvement, I am doing what’s best for everyone involved. ", "I don’t have to get frustrated with my failure to wire the lamps in my backyard, my wife won’t be widowed because I haven’t electrocuted myself, I have more time to spend with my family, AND I’m contributing to the U.S. economy!", "\n\nSo to all you Do-It-Yourselfers: you want to be a better man than I am? ", "Great. ", "Hunt me some chicken and I’ll give you $10 before I cook it on my George Foreman grill.", "\n\nRead all of the entries in the discussion here. ", "I look forward to hearing your thoughts on what makes a man into “a man”.", "\n\nPost navigation\n\nComments:\n\n61\n\nLucy\n\n“But, with the exception of those cases where I clearly initiated, what I have found is that if a man will not pay – or even worse, when he tries to stick the bill on the woman or pay less than his fair share – that often speaks to a bigger flaw in his character that reveals itself in time. “", "\n\nThis is very true. ", "My mother told me this. ", "She said that my boyfriend did not spend enough money on me. ", "I dismissed her advice as old-fashioned but now I realise what she was getting at. ", "It wasn’t the fact that money was involved, it was the fact that he didn’t want to do anything for me that would incur cost. ", "He resented the idea of spending money on me. ", "Despite the fact I’m thousands in debt, and he was born with a silver spoon in his mouth, he was reluctant to take me out to dinner and all that kind of couple stuff. ", "Now silly me is in even more in debt because of a spontaneous decision to book a transatlantic flight to visit him in the States.", "\n\nI agree with the above. ", "A man should at least offer to pay, because he can’t be trying that hard to impress me if he wants me to pay the bill. ", "I believe in chivalry. ", "This does not make me anti-feminist. ", "I’m hardened by experiences of dating terrible guys. ", "These men claimed to be feminists and believe in equal treatment but their behaviour showed they have little respect for women. ", "Now I’d rather see the intent behind what a man does, and you’ve got to judge them on what they do and not what they say.", "\n\nVery interesting thread. ", "The concepts of “manly” and “womanly” used to be clearly defined, and what comes across in this debate is that as society, the workplace and income structures have changed, we now have to redefine what “manly” and “womanly” mean, because biologically they are very important concepts as far as mating/pair-bonding/relationships are concerned. ", "For sexual attraction to develop, (a necessary prerequisite to bonding, relationships and marriage) we need to feel sexually excited by out potential partner, and that part is a biological reaction (intellectual and emotional compatibility play into it, but its a biological reaction) that is based on the differences between men and women. ", "It occurs to me that in a strange way this may be why we have become overly obsessed with physical appearances in recent years- the man with great abs, the woman with huge barbie boobs – the ambiguity over societal roles has led us to seek SOMETHING to classify each other as “manly” or “womanly”. ", "In the past, mens and womens roles were so different that a woman didn’t HAVE to have big boobs to be considered a woman – all women were so obviously womanly in their roles, expectations and behaviours that physical appearance was not the only thing that differentiated us. ", "Same goes for men. ", "Now, what else do we have??! ", "I think the yearning for chivalry, DIY etc.. stems from this – we need to hang on to the sense that men are men and we need there to be things that mark this out, in some wy or another, in order to feel attracted to them. ", "Does tht mean men should all go hunting or mend toilets just to show us they are men – no, but it means that both sexes feel the need to preceive the manliness or womanliness of their mate in some form or another. ", "If we all sound a bit mixed up and contradictory about this right now, its because we all ARE a bit mixed up.", "\n\nMy new man earns a lot less money than I do, but I consider him extremely manly. ", "Why? ", "because he buys me dinner EVEN THOUGH he earns less money than me, because he doesn’t sulk or fret about the income difference, and because he remains very confident in his masculinity and is sexually assertive in the bedroom. ", "He also has a physical job and is very good at fixing things. ", "How do I transmit my “womanliness” to him, despite my high powered job and high income? ", "By dressing femininly, appreciating his efforts, letting him take decisions and drive me places and finding ways to pay for things that he can feel comfortable with. ", "The fact that he is not intimidated by my income or my job make him very manly, in my opinion.", "\n\nExcellent points and examples. ", "I’ll add one: the guy who wants to split the bill evenly amongst his companion(s) when he has ordered more alcoholic beverages (or more expensive ones) than others in his party. ", "Thus he actually pays less of the bill and tip than he would have with separate checks.", "\n\nUnder-tipping itself can be an issue with some fellows. ", "They chip in 5% of the total bill, making their companions cough up more than their fair share to take care of the server.", "\n\nMy original comment was only to say no woman would DISLIKE chivalry. ", "That’s pretty clear, and still true. ", "I never once said it was required or expected. ", "Just that no sane woman would not like it. *", "knock knock* are you there guys? ", "This blog talks a lot about how women should behave around men, and as soon as I suggest something about how men could behave…It’s all entitlement, expectations and demands for equality! “", "Chivalry is antiquated!”. ", "Lets pray the BJ’s you love so much never become antiquated…\n\nChivalry is not antiquated. ", "Not my idea of it anyway! ", "I’m only learning what it really means in the past year and a half and only because a MAN is showing me…\n\nYes, holding doors for anyone, offering your jacket, offering to pay, giving up your seat on the bus, offering to help carry heavy things, offering to return a shopping cart for an elderly woman, asking “do you want or need?”, ", "rubbing a sore back, saying “I love you” without prompting.", "\n\nThese are not antiquated actions…They are behaviors that speak to the character of a man. ", "No…they are not ALL requirements. ", "Ask yourself why you would argue that it’s too much to think a man embody all these traits?", "\n\nWould the man who thinks to return someones shopping cart not think to open a door? ", "Would the man who rubs your back not think to say “I love you” un-prompted? ", "Would the man who snatches away heavy things not think to ask if you need anything?", "\n\n“The funny thing is, though, that although some women have these long, contradictory list, they tend to get fixated on things like actions that appear chivalrous, like a guy who always holds doors open or drives you around on dates, or whether men are willing to pay for all the dates and/or schedule and direct all the dates – things that are fairly superficial in the long run.”", "\n\nwhat makes a man manly? ", "funny…i just blogged on this myself a couple of weeks ago. ", "Some of my male friends describe others as ”not very manly” and i think they mean they are not ”fixers” or masculine in the tradtional sense. ", "but for me, manly is it was has kind of disappeared into our new world of IT guys and metrosexuals. ", "And I don’t think – much like Evan – that is is necessarily a bad thing. ", "So a guy doesn’t get sweaty, or play football, or build a deck. ", "The guy who is man enough to say out loud that he loves his wife and kids, that sees his role as provider and protector, that has a firm handshake and a solid sense of honour and integrity (as mentioned so often above) – that’s manly enough for me.", "\n\nA man paying for a date shows he has interest in a woman, if a man didn’t pay for me when we went out I would know that he was not interested in me. ", "I’ve never gone out with a man who didn’t automatically just pay, there is never even a moment to do the fake wallet grab. ", "Its a basic courtesy that most men are 100% willing to do.", "\n\nLikewise, if I showed up to a date without makeup on, with my hair in a ponytail and jeans and a tshirt I would be sending the man I was going out with a very clear message: that I am not trying to impress him. ", "To the men on here complaining about paying (I really do believe you are the minority) how would you feel about a date who didn’t put time into her appearance? ", "Believe it or not, on dates that I am excited about, I will go and get my hair done, maybe get a touch up on my manicure, sometimes I will even buy a pretty dress or earrings. ", "These are also costs women put into dating, does it give you some perspective?", "\n\n“NO! ", "We men should not have to have all those GOOD qualities. ", "Generous actions and behaviors are antiquated! ", "Lower your expectations. ", "Don’t appreciate it when a man does nice things for you. ", "That makes you entitled!!”", "\n\nCome off it guys. ", "You don’t even realize how what you’re saying looks…. ", "Like a lot of whiny little boys who think WHO THEY ARE is not represented by how they treat others.", "\n\nAm fascinated by how my views have been distorted by a few of you here. ", "Rachael, I never spoke against any of the examples you offer, and I agree that they are indicators of character. ", "I keep an eye out for most of these, or the lack of them, when on dates with women. ", "At the same time, people can and do use these kind of actions as a way to promote a false persona. ", "There are countless stories of women writing about, or commenting about, men who took charge of everything, acted chivalrous, got themselves some sex, and then disappeared or strung their girlfriends along for months on end while dating other women at the same time.", "\n\nMy point is that things like holding doors and paying for dates aren’t, in and of themselves, great signs of character over the long run. ", "They might be worth noting, but it seems like there are still a lot of women who will drop a guy in a hot minute if he doesn’t pony up for dinner, have every detail of the date in order, or forgets to hold the door open for her on the way into a restaurant. ", "As I said before, men have their versions of this kind of behavior. ", "And again, I do think it’s superficial. ", "Some people are so in a rush to find the flaws and push the reject button that they never give anyone a decent chance. ", "They claim to not want to “waste time,” but they end up spending years playing the field because no one measures up.", "\n\nOn the other hand, it’s much more difficult to fake true respect, caring, loyalty, supportiveness, honest communication, and the rest. ", "If you find a lifelong partner, I doubt the thing you’ll most remember and treasure is that he paid for your dinner. ", "It will most like be the continued specific acts of kindness, which may or may not fit into the standard chivalry narrative. ", "Lucy’s story is a good example of a man who didn’t demonstrate these. ", "He had a lot more financially, but was entirely stingy over a longer period of time. ", "But she couldn’t have known this from going on one or two dates with him. ", "Perhaps everything else about him seemed good early on. ", "Or maybe she overlooked a lot of other signs that he wasn’t a good match due to hotness or whatever. ", "The fact that she still is looking for men to “impress” her makes me think it was the latter.", "\n\nFirst dates shouldn’t be about putting on a show. ", "And if you want that, you’ll probably continued to get fooled by people who’ll do anything to look good in the short term, but have no intention to be with you over the long term.", "\n\nNathan, first impressions are important because initially they are all we have to go on. ", "I could turn up to a job interview not dressed immaculately, not having done my research, not at my sharpest and say it’s all about the qualifications – after all I know I’m good at what I do. ", "However, it won’t work out too well because I didn’t give the right first impression to the potential employer. ", "It is a bit like that with a date. ", "If a guy wants to show up not making much of an effort and making the woman pay for her half of the date, he might well be a great guy underneath but that isn’t the impression he is giving and that impression is all we have to go on. ", "This isn’t a case of women being superficial – if that is the way a man starts off behaving, I can only assume he is never going to put any effort into me. ", "That doesn’t mean that some people who make good first impressions don’t turn out to be pretty awful partners later on.", "\n\nRachael, you are still conflating generosity, respect and decency with chivalry – there is a difference. ", "Most of the examples you offered are just regular examples of ordinary decent behaviour, and relating chivalry to oral sex is just silly.", "\n\nJulie“I will get my hair done…sometimes buy a dress…these are costs that women put into dating” I always find it amusing that women seem to think that men get their hair cut and clothes for free.", "\n\nLook, I don’t really want to get into the whole “who should pay” debate because it’s been beaten to death on this blog and others. ", "Nathan is right; it’s so easy to appear like a perfect gentleman that judging someone’s long term potential on these traits is naïve. ", "I’m always impeccably polite, punctual and well-mannered on dates and I will always pay but I only want to get laid so all those “indicators” are irrelevant. ", "I will stand on my head if that’s what it takes to get laid so it’s fairly easy to open a door, pull back a chair etc.", "\n\nThat’s why in general I feel sorry for women when they are choosing a potential partner – on first impressions it’s almost impossible to know whether a man is serious or not. ", "I can safely assume that when I date a woman there’s a 90% chance it could go further if I wanted – for women the chances are surely lower.", "\n\nNathan, In my dating experience, I found it true that a good “show”, so to speak, didn’t necessarily mean the guy was going to be a long-term quality partner. ", "He could have been the most chivalrous man in the world and still be a terrible person in many other ways.", "\n\nHowever, in every good relationship I had, the man did indeed have all of those chivalrous qualities that are being written off as superficial… and the chivalrous men were always more likely to also demonstrate the true respect, caring, loyalty, honest communication and all of those other important qualities you mentioned.", "\n\nOn the other hand, I found that the men who had no interest in showing chivalry from the beginning also had no interest in showing true respect, caring, loyalty and supportiveness either.", "\n\nSo yes, first impressions and chivalrous behavior on early dates have been pretty accurate signals of a man’s overall character. ", "Sure, some of the chivalrous men have behaved poorly in other ways, but none of the non-chivalrous men I dated demonstrated positive qualities in other areas either.", "\n\nYep, I’ll keep recommending chivalry as a positive sign… not as the end all, be all, but as an initial positive sign of a man’s overall character.", "\n\nWhen I think “manly”, my three immediate thoughts are: integrity; the ability and desire to take charge; and someone physically bigger/stronger than me.", "\n\nBut I think that what a woman wants in a man can include a lot more than just “manly” things, and if a man satisfies a lot of those “wants”, often he doesn’t have to be as manly to appeal. ", "I’d imagine same goes for a man and what he thinks of as womanly, in comparison to, or in addition to, what he personally wants in a woman. ", "I thought one of the most interesting points in the article was the question, “What makes a woman womanly?” ", "Which led me to wonder….”And how much does it matter how manly a man is, or how womanly a woman is?” ", "How important is that to attraction? ", "That’s not a rhetorical question…I am truly interested in pondering that.", "\n\nI’ve always been jealous of men and wished I was one because masculinity is superior to feminity, according to the traditional definitions. ", "At least when men want to be more attractive to the opposite sex, they can do things that are positive beyond merely dating, things that are exciting and interesting and have value, like starting companies, making money, traveling, learning to do stuff. ", "A woman’s only value is being pretty and receptive and having sex and babies, according to traditional feminine standards, and nowadays most men don’t even care too much about the cooking part. ", "I mean, really? ", "Men also get to “choose,” they get to win someone over, they get to have sex with no consequences, they can build a great life and not worry about settling down, ever, and they’re less emotionally needy! ", "Damn, I want to be a man so badly.", "\n\nI wrote my previous post before reading everybody’s debate on paying for dates, etc. ", "I think that the asker should offer to pay the whole date. ", "That’s just good manners. ", "My boyfriend always pays– he also earns five times as much as me and is the “asker” 9 out of 10 times. ", "Having said that, from date one, I have always offered to pay the tip, as one of my many small ways of showing my gratitude. ", "He usually accepts this offer, which makes me feel good. ", "If I suggest we go to a movie I want to see, I offer to pay. ", "If I offer to make him dinner, I go and buy the groceries at Whole Foods, and pick up dessert, too– without a second thought, of course. ", "Tom, women are fully aware that most men just want to get laid. ", "All too aware: ) Maybe that’s why we’re so alarmed if a man doesn’t have the good sense to pull out his wallet at the end of the date. ", "If he’s not smart enough to realize that paying for the date is going to improve his chances of getting laid, then he’s probably not even worth it for the sex, let alone any type of future : D Joking aside, I guess I sort of have a foot in both the men’s and the women’s arguments in this thread. ", "I think good manners are universally appealing in both genders….I also think that some things we think of as “simply good manners” also have assumptions about gender roles built right into them. ", "We think of manners as “common courtesy” but they are very steeped in gender-biased cultural tradition and they take a looong time to change.", "\n\nI feel like there are a lot of conflicting definitions of “chivalry” being floated around here. ", "If chivalry means demonstrating kindness, giving full attention on dates, being willing to lift something heavy if needed, getting up for a person in obvious need of a seat – then I’m all for that. ", "I honestly don’t understand how anyone reading my comments could think otherwise.", "\n\nHowever, when those behaviors get conflated with things like paying for all or most of the dates, being expected to take charge and have everything planned all or most of the time, and gestures like pushing in a woman’s chair (which often come off as trying too hard) – that’s where I am in disagreement. ", "SS brings up personal experience. ", "Well, in my experience, the women where I had to do all the work, where a major amount of chasing was involved, really weren’t interested. ", "It’s always been the case for me that when a woman was genuinely interested, she stepped up quickly and began sharing the paying for dates, offering acts of kindness, calling, etc. ", "Like Tom, I’m entirely bored with the paying for first date discussion, but I do think that once you move beyond that, it really should be more of a shared experience. ", "And not just financially. ", "I know that doesn’t fly with some of the women here, and certainly some men are all over taking charge and staying in charge. ", "But others of us aren’t. ", "Men are diverse in that way – go figure.", "\n\nI love Hope’s questions in 79, especially the idea that being manly or womanly isn’t the only thing behind attraction.", "\n\nFiona, if a man otherwise impressed you, was kind, attentive, funny, etc. ", "but didn’t want to pay for the whole first date, would you still reject him? ", "I agree with you that first impressions are important, but I think a good first impression can come in many forms. ", "It’s kind of sad how some women still zero in on money spent as the major indicator of a man’s interest. ", "I say that because whenever the topic comes up, more than a few of you on every dating forum will fight tooth and nail to explain how important it is that a guy pays for the date. ", "Just as there are more than a few men that will fight tooth and nail to explain how important it is that a woman is a 9 or a 10 in the looks department.", "\n\nOne last point. ", "I think a lot of people – regardless of gender – forget how different online dating and blind dating in general are from what most of our parents, grandparents, and ancestors did in the past. ", "Going on a date with someone in the past usually meant being tied to an intricate set of social connections. ", "You were connected through peers. ", "The parents of both daters sometimes knew each other. ", "Perhaps you were both part of the same spiritual community. ", "Anyway, there was a stronger sense of urgency around treating the other person well on a date, even if nothing came of it. ", "Because if you didn’t, it could quickly burn your reputation. ", "This, coupled with the fact that men were the breadwinners and were expected to be in control of relationships, brought about a lot of what is considered chivalrous behavior. ", "Obviously, plenty of people still experience these kinds of social webs when dating. ", "But with online dating and other forms that bring strangers together, the dynamic is different. ", "You are often total strangers. ", "More than half the time, you’ll never see each other again. ", "And because it’s so easy to share horror stories and publicly rant about all the things people dislike about each other these days, any little thing can and sometimes is used as an excuse for rejection. ", "Not because it’s a sound reason, but because people are strangers grasping at straws. ", "They can’t go to the friend who introduced them, or the people in the community that know them to suss out any back-story. ", "So, I get it why some of these things are being used as indicators. ", "I just don’t think they are as great of indicators for long term success as some of you think.", "\n\nAt the end of the day, with online dating and blind dating, going on a single date with someone only gives you a tiny slice of information. ", "Unless someone is totally off, it really is mostly a gut decision whether or not you decide to go out again. ", "How much can you truly know about a stranger after a few hours together? ", "And how much can they know about you?", "\n\nI agree with SS. ", "A man who pays for a first date (and subsequent dates) is not necessarily a keeper – but for sure, he has a much better chance of being one than the fellow who asks the woman out then refuses to pay for her. ", "A guy who has no interest in showing chivalry from the beginning is emphatically not a keeper. ", "Experience has borne this out again and again.", "\n\nWhere’s Lance, who used to post here? ", "I can just imagine him writing a post in his blog directed to those guys who argue up and down that they shouldn’t pay for the woman – some nice round rejoinder about how to man it up.", "\n\nI did not compare bj’s to chivalry. ", "I made reference to how we are on a blog focused mainly on advising women how to behave. ", "All I said was that a woman wouldn’t dislike chivalry and suddenly we’re going off about expectations.", "\n\nThe comparison is in expectations. ", "I don’t want to be told i’m acting “entitled” to state some nice behaviors I appreciate.", "\n\nWhen the purpose of this site is to tell me what nice behaviors men appreciate.", "\n\nI don’t have my head in the clouds gentlemen. ", "I’m not about to get played and I don’t have an epic expectations list. ", "I have 1 ex-husband and 1 current boyfriend. ", "No other exes, but I have dated plenty. ", "I have no problem seeing people for who they are.", "\n\nI am here to learn how to be a better partner and that’s it. ", "It’s just irritating to be lumped in and at this point, used as the example for expectant women.", "\n\nI consider myself a manly man. ", "I fix anything and do everything myself. ", "From lawncare and gardening to home construction, from fixing cars to making a cat tree, there isn’t much I’d hire out. ", "Here’s the rub though, I don’t want a dainty wimpy chick, I want a damn real woman. ", "If you can’t stand being out of the A/C for 15 minutes, or getting dirt under your nails, then I don’t want you, you would be better matched with one of those “metrosexuals” as you call them. ", "Don’t get me wrong, I clean up well, but if a woman whines that I’m always working on the car or doing other projects, she can hit the road.", "\n\nThere has to be some regional, class, and perhaps political differences going on here. ", "I don’t run into the level of emphasis on men paying and chivalry amongst the lower middle class, liberal/ progressive Midwestern women I know and go on dates with. ", "Not to say that it never comes up, but certainly not to the level I see online – especially with New Yorkers and some big city Southerners.", "\n\nNathan, thank goodness there are men out there like you who realize the fallacy in trying to be with a girl when there’s a major amount of chasing involved. ", "It’s one of my biggest frustrations with men – I’m pretty independent minded and have a full life, and don’t chase men down or anything, but at the same time I don’t like the idea of having to be some “challenge” for a man to appreciate me. ", "I’m also pretty mixed about this whole “let the guy do everything” attitude. ", "I really do like and need that in the first couple weeks/month … after that, I know that there is something wrong if I don’t feel comfortable calling the guy once in awhile and falling into a more natural back and forth.", "\n\nI’ve also come to understand that it’s perfectly fine for a woman to initiate contact with a guy she’s seeing but isn’t yet her boyfriend – as long as a.) there is no below the belt fooling around/sex, and b.) as long as it’s clear that she has a fun, active, full life and isn’t desperate. ", "I think I’m also done with guys trying to woo me over bar and dinner dates – it’s just so stilted. ", "I’ve started hanging out with a guy who so far has invited me to go rock climbing, kayaking, and to the shooting range, and I can tell you it’s a huge relief to be with someone who doesn’t date the stereotypical way and shares my interests. ", "He didn’t call me for a few days, so I just called him up, he was happy to hear from me, we talked for awhile, and when I mentioned this random weird work thing I had to do at a downtown club at 1.30 in the morning, he asked if he could go with me and we could make a fun night out of it. ", "This kind of dynamic feels a lot more likely to lead to something real than the traditional guy-makes-all-the-moves-and-wines-and-dines-girl-over-dinner-to-try-to-get-in-her- pants bullshit.", "\n\nI don’t consider paying a bill chivalrous…I consider it very generous. ", "I’m happy enough to pay for my own damn self. ", "I prefer a home cooked meal anyways. ", "Eating out is too expensive. ", "Blowing money is not on my “to do” list. ", "I’m more of an adventurous experience kind of girl. ", "Not a wine me and dine me type. ", "I want to know if a man is my kind of person, not if he’s willing to pay for my company.", "\n\n“Women don’t like players, but it’s not like the guy is honest with you and says, “I’m just going to pretend to like you until sleep with me. ", "I’m going to pump and dump you.” ", "If women were informed that his buying flowers, drinks, taking you to dinner, spending time with you, calling you on the phone, texting, etc. ", "were just a means to get you into bed and then disappear, there would be a whole lot less sex going on.”", "\n\nWould there?", "\n\nAny woman who has early/easy sex with an attractive prospect, can’t genuinely claim to be hindered by rational foresight.", "\n\n@ Nathan\n\n“Women say they want men who are more vulnerable, open about their emotions, willing to share the household chores, etc. ", "Yet, when men step up and embrace some of this, they’re labeled unmanly, weak, and sensitive.”", "\n\nI have observed that this merely tends to be a pretext explanation, for rejecting men for whom they feel no sexual chemistry.", "\n\n– @ John\n\n“Now I must say I am impressed you can do those particular exercises. ", "Besides the good shape you must be in to that, I am equally impressed with the fact that you know how effective those exercises are. ", "So many people waste so much time in the gym doing the most inefficient exercises. ", "If people focused on the bigger bang for your buck exercises like I mentioned, they workouts woul dbe far more productive.”", "\n\nHigh intensity cardio has given me a new appreciation for rigor – an hour of max intensity stairclimbing(apparently impossible for the majority of male gym-rats, who appear to be ecto-mesomorphs whose physiques resemble competitive swimmers, only with chicken legs), 5 days a week impresses me more than any feat in the weight-room.", "\n\nMutual sexual attraction, traditionally, has not been a requirement for long-terms relationships.", "\n\nRather, sexual chemistry was(and in many cultures still is) a frequent trade-off that women were expected to make, in securing a long term mate – the reason being, that women are so selective in terms of sexual chemistry, as to render an insoluble scarcity of males to satisfy this requirement under assumptions of a monogamous mating system.", "\n\nFemale sexual liberation(where they are no longer economically dependent on their mates), has engendered in effected female populations a kind of romantic ideal, that, for many, will be impossible to realize.", "\n\nAnd it is these kinds of unrealistic expectations that form the basis for much of the prevailing conflict between the sexes in the Western world.", "\n\n” It occurs to me that in a strange way this may be why we have become overly obsessed with physical appearances in recent years- the man with great abs, the woman with huge barbie boobs – the ambiguity over societal roles has led us to seek SOMETHING to classify each other as “manly” or “womanly”.", "\n\nThe difference, of course, is that boobs are a secondary sexual characteristic(of the female sex), while six pack abs are not a uniquely male trait(have you been watching the olympics – plenty of females sporting six pack abs there).", "\n\nIn fact, rather than as a reliable indication of fitness, the ability to display six-pack abs signifies one quality alone – a tendency towards lean body mass(which can be a distinct disadvantage in many evolutionary contexts, where energy requirements are high, but supply is low).", "\n\n@ Rachael\n\n“My original comment was only to say no woman would DISLIKE chivalry. ", "That’s pretty clear, and still true. ", "I never once said it was required or expected. ", "Just that no sane woman would not like it. *", "knock knock* are you there guys?”", "\n\nI think it is obvious that women appreciate chivalrous behavior.", "\n\nWhat is not so obvious, is how they encourage that behavior – if they can be seen to be privileging unchilvalrous players, above chivalrous nice guys, then they are communicating a very clear message that ‘chivalry’ is not a strong determinant in their mating/relationship choices.", "\n\nIt occurs that the kinds of men women say they want, and the kinds of men they choose, are frequently different quantities(these differences have seen the ascendance of the game culture, which observes that chivalry has been devalued, not by men, but by women ).", "\n\nIn this sense, women are selecting for ‘unchivalrous’ behavior.", "\n\nAm I personally chivalrous?", "\n\nYes.", "\n\nBut, I am also selective in reserving that chivalry for women are are not representative of a female culture that devalues it.", "\n\nNathan, the only two times in my life that a man made me pay for my half of a first date they later turned out to be really mean with money. ", "If they were struggling financially this would have perhaps been understandable but one earned three times my salary and the other was the son of a millionaire so I agree with Helen. ", "It is a big alarm bell.", "\n\nNathan, I am also wondering if some women are rejecting you for second dates in your region because you don’t pay. ", "If that is the case, she is unlikely to tell you or create a scene. ", "She is likely just to decide she doesn’t want to see you again.", "\n\n@ Mia81 Men also get to “choose,” they get to win someone over, Men get to set their hearts on someone and then be rejected (and then someone else, and then someone else, etc.) ", "This is no picnic.", "\n\nthey get to have sex with no consequences, Women can too…it is called the diaphram or the birth control pill.", "\n\n[Men] can build a great life and not worry about settling down, ever, Why can’t a woman do this? ", "If a man does not want to have children, he does not have to. ", "If a woman does not want to have children, she does not have to.", "\n\nand they’re less emotionally needyI see the word “needy” used so much in so many different ways that its meaning here is not clear. ", "Do you mean men don’t become lonely or frustrated when a woman they are interested in does not reciprocate? ", "They do. ", "Just some don’t let it wreck their lives. ", "I think there are many women who do the same.", "\n\nHappy Clients\n\n\"I cannot say enough good things about this man.\"", "\n\nHe is a beautiful person and he is so generous, affectionate, well spoken and accomplished. ", "He is tall and athletic and totally hot. ", "He is 53, but I am here to tell you 53 can be pretty damn impressive. ", "All this from a woman who a year before had equated dating with despair, rejection and pain.", "\n\nCharlene J.\n\n\"Thank you, Evan, for enlightening me, having faith in women, and being honest with what 'is'!!\"", "\n\nThe result of giving up the search for “why” is losing the worry, the wringing of the hands, the wondering if he will call, and all the stress and sadness that goes with the worry.", "\n\nJulie H.\n\n“Without your help, I never could have imagined that I could be in a relationship like this one.”", "\n\nI'm in my 60's and expected that I would not have a committed relationship again. ", "I'm still dealing with issues internally of fear and past experiences, as is he. ", "But we can talk about these things and know that we have something special.", "\n\nAnn S.\n\n\"Thank you for what you do, Evan.\"", "\n\nHere's the deal. ", "I read your blog - I devour your newsletters. ", "I've learned so much about men (and myself) through the process.", "\n\nCathy C.\n\n\"I'm in love, getting married and hopefully starting a family soon. ", "I couldn't be any happier.\"", "\n\nYou didn't always tell me what I wanted to hear, but what I needed to hear. ", "You were honest with me even when I didn't like it. ", "You put a mirror to my face...no one enjoys that but it's important if you really want to make a change and find the real thing." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0007995683699846268, 0.005736046936362982, 0.0027122043538838625, 0.0009252072777599096, 0.0007497696788050234, 0.0014527044259011745, 0.0007133461185730994, 0.001337848836556077, 0.13850809633731842, 0.24883683025836945, 0.010039038956165314, 0.0005776704056188464, 0.0008835146436467767, 0.0007406322401948273, 0.0010143936378881335, 0.0015383381396532059, 0.005331949796527624, 0.0007599432137794793, 0.0008325997623614967, 0.001128673437051475, 0.07310445606708527, 0.0006508674123324454, 0.07081642001867294, 0.0030300768557935953, 0.027881039306521416, 0.0028487863019108772, 0.005456792190670967, 0.0011486082803457975, 0.0014817541232332587, 0.035818420350551605, 0.0007096690242178738, 0.005086731631308794, 0.0009431402431800961, 0.0009432596853002906, 0.06892497092485428, 0.0006434151437133551, 0.004930692259222269, 0.0016721554566174746, 0.0007251048227772117, 0.0006886998889967799, 0.03968213498592377, 0.0008034432539716363, 0.0008492633933201432, 0.0007449497934430838, 0.0006596196326427162, 0.000743530981708318, 0.005031275097280741, 0.0008772103465162218, 0.0012036958942189813, 0.001545026432722807, 0.000977440271526575, 0.002452416578307748, 0.013801081106066704, 0.000706592109054327, 0.07310445606708527, 0.05308697745203972, 0.04890773817896843, 0.0023224232718348503, 0.0016654219944030046, 0.0028128321282565594, 0.0006614840240217745, 0.05111650750041008, 0.05931032821536064, 0.000881860323715955, 0.0052486020140349865, 0.0006991405971348286, 0.005447555799037218, 0.03868214040994644, 0.0012049432843923569, 0.06942568719387054, 0.0005970732308924198, 0.0006705392734147608, 0.0007631952175870538, 0.0007091133156791329, 0.0010710152564570308, 0.022648438811302185, 0.000721558288205415, 0.0018100895686075091, 0.00140817288774997, 0.010079395025968552, 0.13377229869365692, 0.0005851323949173093, 0.0033634125720709562, 0.0022712985519319773, 0.009080016054213047, 0.00789619330316782, 0.030621973797678947, 0.0012603141367435455, 0.0006552631384693086, 0.0009302172693423927, 0.007642047479748726, 0.0663561001420021, 0.09901811927556992, 0.0009469529613852501, 0.0017350593116134405, 0.0007525707478635013, 0.018969226628541946, 0.0005753159057348967, 0.0010501091601327062, 0.0009686383418738842, 0.06491242349147797, 0.0009029304492287338, 0.011373396031558514, 0.0005799385835416615, 0.0011997682740911841, 0.0005486593581736088, 0.0008471132023259997, 0.0008286469965241849, 0.0006868381169624627, 0.0012105479836463928, 0.012431451119482517, 0.0006421748548746109, 0.0007305924082174897, 0.010681429877877235, 0.11125270277261734, 0.002987450920045376, 0.02912714332342148, 0.039992962032556534, 0.0011480930261313915, 0.0010722087463364005, 0.0565674863755703, 0.0007840818143449724, 0.0008576889522373676, 0.0009581612539477646, 0.003227777546271682, 0.04065072908997536, 0.0021550243254750967, 0.00530898105353117, 0.008932831697165966, 0.0005820298101752996, 0.00398713955655694, 0.16235525906085968, 0.0025796450208872557, 0.005547133274376392, 0.0007381383329629898, 0.013470105826854706, 0.014956333674490452, 0.0007410901598632336, 0.0037545913364738226, 0.059683457016944885, 0.002091885544359684, 0.0599428191781044, 0.0036038528196513653, 0.0006715475465171039, 0.0006935977726243436, 0.007596028968691826, 0.0006125484360381961, 0.0024489976931363344, 0.0029866802506148815, 0.0014740250771865249, 0.2881161868572235, 0.0007155691855587065, 0.0005965448217466474, 0.08594100177288055, 0.0007113533793017268, 0.016392065212130547, 0.0007778239669278264, 0.014042900875210762, 0.001965712755918503, 0.0008319874759763479, 0.002075038617476821, 0.006184189114719629, 0.0006365162553265691, 0.0007505721296183765, 0.00075342389754951, 0.0007082573138177395, 0.0006413094233721495, 0.0007780311862006783, 0.0005467875162139535, 0.0015110961394384503, 0.0021874955855309963, 0.009572948329150677, 0.0009027764317579567, 0.0005462095723487437, 0.0006575972656719387, 0.0006748549058102071, 0.000812362355645746, 0.007304222788661718, 0.02490442432463169, 0.0007012886926531792, 0.0012480031000450253, 0.1955747753381729, 0.03526260331273079, 0.006208234466612339, 0.0010745346080511808, 0.014000367373228073, 0.02566256746649742, 0.004569810349494219, 0.021725768223404884, 0.0005882155965082347, 0.006005872972309589, 0.000686425541061908, 0.0006826596800237894, 0.0006640544743277133, 0.0008293832652270794, 0.0007780003943480551, 0.0007046405808068812, 0.002172816777601838, 0.002025410532951355, 0.002287433249875903, 0.020890749990940094, 0.0009573354618623853, 0.0005739182233810425, 0.0007592131732963026, 0.012038502842187881, 0.17059476673603058, 0.0007974146283231676, 0.4845356047153473, 0.8282343745231628, 0.0005717556341551244, 0.001399325206875801, 0.0008186548366211355, 0.16555221378803253, 0.0005464629502967, 0.0005392513703554869, 0.00240882346406579, 0.0008708278182893991, 0.7422234416007996, 0.0022402466274797916, 0.04839199036359787, 0.0006103639607317746, 0.004398882854729891, 0.0007368156802840531, 0.0008028047159314156, 0.0009125546202994883, 0.008614684455096722, 0.0006095439312048256, 0.0007019219337962568, 0.000597821781411767, 0.0006223251111805439, 0.0008012230973690748, 0.005549251567572355, 0.0008583266753703356, 0.0005875480710528791, 0.0012665294343605638, 0.0006352266645990312, 0.004634744022041559, 0.0005313769215717912, 0.07103561609983444, 0.018563376739621162, 0.08418209105730057, 0.0007276675314642489, 0.0009633757290430367, 0.0007548928842879832, 0.0006278955843299627, 0.0006831686478108168, 0.0007251549395732582, 0.0005518508260138333, 0.11868977546691895, 0.0008665273780934513, 0.0006547312368638813, 0.000678323267493397, 0.046703487634658813, 0.0015733465552330017, 0.001185986795462668, 0.0009119457099586725, 0.0006476287380792201, 0.0006260978407226503, 0.0006569079123437405, 0.0016531022265553474, 0.0021509185899049044, 0.000621796294581145, 0.0011458892840892076, 0.0009478091960772872, 0.006691531743854284, 0.010055657476186752, 0.0006005755858495831, 0.0040152231231331825, 0.002185828983783722, 0.013234542682766914, 0.002241642214357853, 0.00815649889409542, 0.0006180880591273308, 0.0005865442217327654, 0.0005661305622197688, 0.0020963246934115887, 0.002150106942281127, 0.00465041771531105, 0.010733825154602528, 0.0007440594490617514, 0.0007069005514495075, 0.10524139553308487, 0.0006119185709394515, 0.0010321660665795207, 0.0008265600190497935, 0.8603509664535522, 0.6229395866394043, 0.03060893341898918, 0.0006149936816655099, 0.002351094502955675, 0.0011487461160868406, 0.20574787259101868, 0.001621281262487173, 0.0008157595875672996, 0.0005422759568318725, 0.03341102972626686, 0.0025712763890624046, 0.0009977667359635234, 0.0005783326341770589, 0.8169800043106079, 0.0008998552802950144, 0.77388995885849, 0.0006896690465509892, 0.021963948383927345, 0.07698853313922882, 0.000996855553239584, 0.006521875038743019, 0.002108376007527113, 0.7644467949867249, 0.9181118607521057, 0.060924701392650604, 0.543870747089386, 0.0008175841066986322, 0.06503427028656006, 0.0008827480487525463, 0.08560077100992203, 0.004675871226936579, 0.0007705817115493119, 0.0005250453250482678, 0.10194852948188782, 0.0010324626928195357, 0.0021052572410553694, 0.007422966882586479, 0.003424548776820302, 0.009070012718439102, 0.0006648615817539394, 0.0818961039185524, 0.29780635237693787, 0.0006400918355211616, 0.01486938912421465, 0.0006421748548746109, 0.0007305924082174897, 0.010681429877877235, 0.14370732009410858, 0.014489994384348392, 0.002417581155896187, 0.0013276903191581368, 0.2472761571407318, 0.0023998806718736887, 0.0008940021507441998, 0.009205655194818974, 0.004312701523303986, 0.0006722026155330241, 0.0015698315110057592, 0.1979440301656723, 0.0006925654597580433, 0.006577000953257084, 0.0021662628278136253, 0.0010164226405322552, 0.8078956007957458, 0.010821127332746983, 0.0049059526063501835, 0.032734815031290054, 0.0007434661383740604, 0.006587464828044176, 0.0009742015972733498, 0.0056740278378129005, 0.018115965649485588, 0.0005535278469324112, 0.0006084692431613803, 0.0021436591632664204, 0.08025529980659485, 0.012358290143311024, 0.0012371883494779468, 0.0012446773471310735, 0.0008461273391731083, 0.0012499975273385644, 0.0006040627486072481, 0.0005314815789461136, 0.000624768843408674, 0.0009370703483000398, 0.014703094027936459, 0.0005898482631891966, 0.0009601324563845992, 0.0007311465451493859, 0.0007755170809105039, 0.0007944275275804102, 0.026520907878875732 ]

[ " = 2*i - 3*h - 3017, -4*i = h - 3021. ", "Is i a composite number?", "\nTrue\nLet s = -1567 + 952. ", "Let a = s - -1172. ", "Is a a prime number?", "\nTrue\nSuppose 78*s = 60*s. ", "Suppose -31*z + 20573 = 4*x - 28*z, -3*x + 4*z + 15461 = s. Is x a composite number?", "\nFalse\nLet d be ((-13)/(-26))/((-1)/(-2)). ", "Let f be (6/9 - d) + 10/3. ", "Suppose -5*x - 212 - 78 = -w, f*w + x - 790 = 0. ", "Is w a prime number?", "\nFalse\nIs -18 - 12*(-1921930)/40 composite?", "\nTrue\nLet m(l) = -l**2 - 10*l + 12. ", "Let k be m(-8). ", "Let o = k + -5. ", "Suppose -19*b + o*b = 388. ", "Is b composite?", "\nFalse\nLet u = 1699 + -240. ", "Let s = u - 580. ", "Suppose 0 = m + 2*m - s. Is m a composite number?", "\nFalse\nLet x(g) = 3*g**2 - 50. ", "Let c be x(-12). ", "Let i = c + 11985. ", "Is i a prime number?", "\nFalse\nSuppose 2*r + l - 49 = 0, -r + 0*r + 3*l + 21 = 0. ", "Let v(c) = 377*c + 53. ", "Is v(r) a prime number?", "\nFalse\nSuppose k + 1421563 = -4*p, -2*k = 4*p + 1200582 + 220984. ", "Is (p/(-50))/(2/10) composite?", "\nTrue\nLet p(n) = n**3 + 8*n**2 - 3*n - 20. ", "Let o be p(4). ", "Is ((-8)/(o/14610))/((-2)/4) composite?", "\nTrue\nLet g be (-2)/(-4)*1 - 21675/(-170). ", "Is 674752/g - 3/(-2) composite?", "\nFalse\nSuppose 0 = -42*y - 3755 + 899. ", "Is (-177718)/y*2*7 composite?", "\nTrue\nLet g be ((0 - 5) + 5)/(-1). ", "Suppose g = -3*d + 4*d - 1361. ", "Is d a composite number?", "\nFalse\nSuppose -180 = -4*w - 168. ", "Suppose 28*o - 88198 = 24*o + w*t, 0 = -5*o + 5*t + 110245. ", "Is o a prime number?", "\nTrue\nLet m(v) = v**3 - 23*v**2 - 13*v - 56. ", "Let b be m(24). ", "Let k(z) = -12*z + 3. ", "Let h be k(-8). ", "Let r = b + h. Is r prime?", "\nTrue\nSuppose -2*x - w + 94904 - 19004 = 0, 37949 = x + w. Is x a prime number?", "\nTrue\nSuppose -155*f = -161*f - 28890. ", "Let v = 6860 + f. Is v a composite number?", "\nTrue\nLet t(b) = -11*b + 253. ", "Let n be t(15). ", "Is (1 + (979 - -2))/(176/n) composite?", "\nFalse\nSuppose -3*c = -842 - 7894. ", "Suppose -k - 2*d = -0*k - c, 0 = d - 5. ", "Is k a prime number?", "\nFalse\nLet f(d) = d**2 - 12*d + 5. ", "Let w be f(12). ", "Suppose -2*g + w*h - 43 = 8*h, 0 = g - 4*h - 6. ", "Let l(v) = -2*v**3 - 15*v**2 - 4*v + 1. ", "Is l(g) a prime number?", "\nFalse\nLet o = -51 + 59. ", "Suppose 30237 = -5*l + o*l. ", "Suppose 2*a + 0*a + 10089 = 5*h, 0 = 5*h + 3*a - l. Is h a composite number?", "\nFalse\nSuppose 0 = 66*q - 103*q + 4642871. ", "Is q prime?", "\nFalse\nIs ((-34)/102)/((-3)/394677) a composite number?", "\nFalse\nSuppose -36 = 22*o - 16*o. ", "Is o/(-81) - 2683295/(-621) composite?", "\nTrue\nLet z(p) = -p**3 - 2*p**2 + 5*p. ", "Let u be z(-5). ", "Let o = 51 - u. Is (o/2)/(0 + 2/212) a composite number?", "\nFalse\nLet z(h) = h**3 - 5*h**2 - h + 3. ", "Let l be z(5). ", "Let w be l + 4 - (2 + -1 - -4). ", "Is (1/w - 26/39) + 315 a prime number?", "\nFalse\nSuppose -30859 - 472997 = -24*j + 910632. ", "Is j a composite number?", "\nFalse\nLet c = 208136 - 132657. ", "Is c a composite number?", "\nFalse\nSuppose -v + 5*s = -21, -4*v + 2*v - 5*s - 3 = 0. ", "Is (-1796)/v*87/(-58) prime?", "\nTrue\nLet i(l) = -598*l - 19 - 578*l + 1348*l. ", "Is i(21) composite?", "\nFalse\nLet z = -66734 + 106393. ", "Is z composite?", "\nFalse\nLet i(c) = -180*c + 17. ", "Let o = -364 - -345. ", "Is i(o) a prime number?", "\nFalse\nLet l = -40 + 43. ", "Suppose -12 = 5*q + l, -3*q - 5550 = -3*m. ", "Is m a composite number?", "\nFalse\nLet g(q) = 6*q**2 - 5*q - 10. ", "Let k(u) = -5*u**2 + 5*u + 11. ", "Suppose -4*m - 6 = 2*x, -3*x + 3 = 3*m - 0. ", "Let c(h) = m*g(h) - 5*k(h). ", "Is c(-7) a prime number?", "\nFalse\nIs ((-99959)/(-19))/(1/5) a composite number?", "\nTrue\nLet j(z) = -8*z**3 - 7*z**2 + 17*z + 88. ", "Let a be j(-7). ", "Is a - 1 - (-136)/68 a prime number?", "\nTrue\nLet r = 57 - 52. ", "Suppose -r*k = 4*o - 0*o - 56, o = k + 23. ", "Suppose 0 = -16*z + o*z - 11361. ", "Is z prime?", "\nFalse\nSuppose -5*y - 19*i = -14*i - 3321950, 3*y - i = 1993198. ", "Is y a composite number?", "\nTrue\nSuppose 0 = 2*t + 38 - 124. ", "Let u = t + -41. ", "Suppose -2*b + 526 = 2*o, -3*b = -7*b - u*o + 1056. ", "Is b a prime number?", "\nFalse\nLet v be (-4)/(-30)*-3 - 36/(-15). ", "Suppose -2*x = -f + v*x + 12, 2*x = -f. ", "Is -9*f/(-12) + 1940 prime?", "\nFalse\nLet i(g) = -1225*g + 3. ", "Let h be i(-1). ", "Suppose -9*u + 13*u - h = 0. ", "Is u composite?", "\nFalse\nSuppose -9*m + 473905 - 109828 = 0. ", "Suppose 0 = -2*p + 5*y + 40423, -5*y + m = 24*p - 22*p. ", "Is p a composite number?", "\nFalse\nSuppose 2*f - 30 = -4*p, 26 = 4*p + 10*f - 12*f. ", "Let z(j) = -7*j + 2*j**2 - 9 - 1 + 0. ", "Is z(p) composite?", "\nTrue\nLet p(o) = -85*o**2 - o + 11. ", "Let b(c) = -85*c**2 + 11. ", "Let y(i) = 2*b(i) - 3*p(i). ", "Suppose -11 - 17 = 3*a - 10. ", "Is y(a) prime?", "\nFalse\nSuppose -18 = 21*u - 23*u + 3*k, -5*u - 2*k = -45. ", "Suppose -h = u*h - 22030. ", "Is h prime?", "\nTrue\nLet u(f) = 28493*f**2 + 162*f - 319. ", "Is u(2) a composite number?", "\nTrue\nLet h(t) = t**3 + 21*t**2 + 10*t + 3. ", "Suppose -2*f + 5 = -4*c + f, -5 = 3*c - 2*f. ", "Let r(q) = -2*q**2 - 8*q - 6. ", "Let v be r(c). ", "Is h(v) prime?", "\nTrue\nSuppose -5*w + 95317 = -v, -8*w - v = -4*w - 76259. ", "Is (-4 - (-25)/10)/((-6)/w) composite?", "\nTrue\nLet f(x) = x**3 + 3*x**2 - 27*x + 9. ", "Let l be f(-7). ", "Suppose 3*o - 3489 = -6*g + l*g, 4*o - 4652 = 3*g. ", "Is o prime?", "\nTrue\nLet x(g) = -976*g + 130. ", "Let y be x(-13). ", "Let n = y - 8067. ", "Is n a prime number?", "\nTrue\nSuppose 2*z - 30 = -3*z. ", "Let g be ((-12)/z)/((-2)/4). ", "Is (-46928)/(-48) + -1*g/6 prime?", "\nTrue\nLet d(g) be the first derivative of 16 + 607*g**2 - 8 - 4 - g + 13. ", "Is d(1) a composite number?", "\nFalse\nLet u(m) = m**2 - 5*m + 8. ", "Let z be u(3). ", "Suppose z*q = -x + 4841, x = 7*q - 2*q + 4876. ", "Suppose -682 = 11*o - x. Is o a prime number?", "\nTrue\nSuppose -20*n + 111053 = 23193. ", "Is n prime?", "\nFalse\nSuppose -6*l + 99*l - 5878623 = 0. ", "Is l a composite number?", "\nFalse\nSuppose -7*j - 1125429 + 4211218 = 10*j. ", "Is j composite?", "\nTrue\nSuppose 3*g = -v + 7007, 0 = -v + 2*v + 4*g - 7004. ", "Suppose -4*n = 2*l - 184, 2*n - l = 4*l + 116. ", "Is (v/(-32))/(3/(n/(-2))) a prime number?", "\nFalse\nSuppose -129*x + 131*x = -168. ", "Let n = x + 703. ", "Is n a composite number?", "\nFalse\nLet m = 7 + -5. ", "Let a be ((2 + 3)*(-10)/(-25))/m. ", "Is (2/4 + -1)*a*-1786 composite?", "\nTrue\nLet s = 24375 + -10558. ", "Is s prime?", "\nFalse\nLet i = 4 + -1. ", "Let m(o) = -10*o**3 - 49*o**2 - 9*o - 6. ", "Let y(n) = -2*n**3 - 10*n**2 - 2*n - 1. ", "Let a(g) = -6*m(g) + 29*y(g). ", "Is a(i) composite?", "\nTrue\nLet x be -254*2/60*18*-60. ", "Let p = x + -6247. ", "Is p prime?", "\nTrue\nLet l(u) = 14*u + 7*u**2 + 16*u + 24*u - 48*u - 5. ", "Let h(m) = 21*m**2 + 19*m - 16. ", "Let w(d) = 6*h(d) - 17*l(d). ", "Is w(8) composite?", "\nTrue\nIs ((-19)/(-114))/((-9)/(-408942)) a prime number?", "\nTrue\nLet t(o) = 2236*o**3 + 2*o**2 + 3*o - 4. ", "Suppose -1 = -10*v + 9. ", "Is t(v) composite?", "\nFalse\nIs (-18509)/(0 + 3 + (-3 - 1)) a prime number?", "\nFalse\nIs ((-3782079)/(-81) - -7)*(3/2 + 0) composite?", "\nTrue\nLet d(h) = -3*h - 48. ", "Let j(f) = 19*f**3 + 4*f**2 + 2*f. ", "Let p be j(-1). ", "Let k be d(p). ", "Is ((-174)/18)/(2/(-12)) - k a prime number?", "\nFalse\nSuppose -2*w + 4*q + 20 = 0, -w + 48 = 3*w - 4*q. ", "Let i be 90/1*(105/w + -5). ", "Let a = i + 98. ", "Is a composite?", "\nTrue\nSuppose i + 3*h - 92603 = -21027, 3*i = 5*h + 214686. ", "Is i prime?", "\nFalse\nLet s(h) = h**2 - 5*h - 8. ", "Let a be s(-4). ", "Suppose 6*v + 80 + a = 0. ", "Is (-3 - v/4)*(-524)/(-6) a composite number?", "\nFalse\nSuppose -7 = 2*y + 5*a, y + 2*y - 3 = -3*a. ", "Suppose -5*v + 9*v = -y*v. ", "Suppose v*n + 2*u = -5*n + 5613, -5*n - 5*u = -5610. ", "Is n composite?", "\nFalse\nLet l(m) be the third derivative of 3*m**5/5 + m**4/3 + 5*m**3/6 - 22*m**2 - 1. ", "Is l(-5) composite?", "\nTrue\nLet h be (192/80)/((-2)/5). ", "Let d be (-11240)/16*h/5. ", "Suppose 4*w - m - 3517 = -162, w - d = -4*m. ", "Is w prime?", "\nTrue\nLet k = 43343 - -2034. ", "Is k composite?", "\nFalse\nSuppose -27*p - 2980956 = -159*p. ", "Is p composite?", "\nTrue\nSuppose 0 = 8*u + 55 + 41. ", "Let r(q) = -63*q - 47. ", "Is r(u) a prime number?", "\nTrue\nLet f(y) be the third derivative of y**5/60 + y**4/8 + 1439*y**3/6 + 63*y**2. ", "Is f(0) a prime number?", "\nTrue\nLet i(y) = -3224*y - 96. ", "Let j be i(-11). ", "Is -1*j/((-56)/7) composite?", "\nFalse\nLet c = -37094 + 69067. ", "Is c a prime number?", "\nTrue\nLet z = 6946 - 353. ", "Is z a prime number?", "\nFalse\nSuppose -14805 = -12*s + 24555. ", "Let b = 2835 - 4572. ", "Let c = s + b. Is c prime?", "\nTrue\nLet u = -483148 - -679587. ", "Is u composite?", "\nFalse\nLet h(n) = n**3 + n**2 + 4*n - 1776. ", "Let t be h(0). ", "Let s = 4019 + t. Is s a composite number?", "\nFalse\nSuppose -2*x = -3*x + 8. ", "Suppose 0 = x*a - a - 14. ", "Is (-2 + a - 1)*(-3 - 500) composite?", "\nFalse\nSuppose -o = -3*s - 400499 + 2088655, -2*o + 14 = 0. ", "Is s a composite number?", "\nFalse\nLet r(s) = 298*s**2 - 18*s + 375. ", "Is r(-28) a prime number?", "\nTrue\nLet r(u) = 6*u**3 - 4*u**2 - 21*u + 2. ", "Let o be r(-11). ", "Let s = o - -16522. ", "Is s composite?", "\nTrue\nSuppose 8736 = 3*j + 219" ]

{ "pile_set_name": "DM Mathematics" }

[ 0.0018804660066962242, 0.001707912189885974, 0.0009850641945376992, 0.0028854580596089363, 0.0015386063605546951, 0.0032544706482440233, 0.002361575374379754, 0.0011455760104581714, 0.0020589318592101336, 0.3011646568775177, 0.003142157569527626, 0.0009305416606366634, 0.0033555191475898027, 0.0029796427115797997, 0.03644595295190811, 0.00981977116316557, 0.0009501078748144209, 0.0024161164183169603, 0.0014947931049391627, 0.002732898574322462, 0.008267894387245178, 0.0011156735708937049, 0.0008633144898340106, 0.0026287143118679523, 0.006943446584045887, 0.0024757818318903446, 0.0017355928430333734, 0.20331202447414398, 0.0006968035013414919, 0.0735831931233406, 0.004265175200998783, 0.0007357446593232453, 0.0010744930477812886, 0.0007825150387361646, 0.0016520402859896421, 0.0007215018849819899, 0.001291622407734394, 0.0017293328419327736, 0.0012813092907890677, 0.001791668008081615, 0.0674896240234375, 0.0019331971416249871, 0.00853064376860857, 0.0016726115718483925, 0.03771127015352249, 0.0020302042830735445, 0.005769839510321617, 0.0012061881134286523, 0.0045701381750404835, 0.001886739395558834, 0.0021531188394874334, 0.006696284282952547, 0.0007810192764736712, 0.0013349163345992565, 0.7709280848503113, 0.0022813971154391766, 0.060189709067344666, 0.0020570741035044193, 0.017108852043747902, 0.015779050067067146, 0.0016743880696594715, 0.004495901055634022, 0.00811194907873869, 0.0037284684367477894, 0.0016169894952327013, 0.001331563456915319, 0.0011604141909629107, 0.005182563792914152, 0.0007403478375636041, 0.01861652545630932, 0.0020670993253588676, 0.0027758912183344364, 0.013306433334946632, 0.001183302840217948, 0.001960465917363763, 0.0009149767574854195, 0.001132563571445644, 0.002002893714234233, 0.0012307813158258796, 0.001237622112967074, 0.005496766418218613, 0.0008646873175166547, 0.002789061516523361, 0.0007609914755448699, 0.0015294512268155813, 0.0011166150216013193, 0.010087143629789352, 0.0015527080977335572, 0.0015553856501355767, 0.002181094838306308, 0.004568665754050016, 0.0013693515211343765, 0.008175902999937534, 0.9891083240509033, 0.004137599375098944, 0.7904452681541443, 0.0013006385415792465, 0.0012469460489228368, 0.005245945882052183, 0.0011734588770195842, 0.0009703059331513941, 0.0008443204569630325, 0.7468876838684082, 0.008481769822537899, 0.001138383406214416, 0.001458258950151503, 0.0013488585827872157, 0.0011305672815069556, 0.012846307829022408, 0.05616895109415054, 0.0015938825672492385, 0.0020016436465084553, 0.0345383882522583, 0.005805539432913065, 0.005372079089283943, 0.0018998140003532171, 0.010309395380318165, 0.0016818789299577475, 0.0011837042402476072, 0.01220083236694336, 0.0016792454989627004, 0.1654186099767685, 0.01001520175486803, 0.0014247809303924441, 0.0558629035949707, 0.04010070115327835, 0.07381414622068405, 0.0010878946632146835, 0.001133300131186843, 0.945851743221283, 0.022273996844887733, 0.0010123916435986757, 0.7702621817588806, 0.005395152140408754, 0.05255747213959694, 0.3540583550930023, 0.0037808623164892197, 0.0046561043709516525, 0.002034973818808794, 0.0014097059611231089, 0.0007461231434717774, 0.05285382270812988, 0.0016108228592202067, 0.025132689625024796, 0.000988269574008882, 0.0017043929547071457, 0.0011252600234001875, 0.0021928083151578903, 0.002468210645020008, 0.001221685204654932, 0.0012008522171527147, 0.000968179723713547, 0.0035030588041990995, 0.0017447195714339614, 0.0947926938533783, 0.004903699737042189, 0.0021070202346891165, 0.0015502601163461804, 0.0009769444586709142, 0.001691945712082088, 0.0014737140154466033, 0.0012151222908869386, 0.001111550023779273, 0.0010354418773204088, 0.005426183808594942, 0.025668535381555557, 0.0011137621477246284, 0.0013424910139292479, 0.0019583976827561855, 0.0018605147488415241, 0.0034055225551128387, 0.0015676835319027305, 0.0007027551764622331, 0.0008463636040687561, 0.0010573973413556814, 0.002560012275353074, 0.2873157560825348, 0.11513908207416534, 0.026554450392723083, 0.0008274398278445005, 0.002575674094259739, 0.0010217708768323064, 0.0010990520240738988, 0.08240112662315369, 0.021264581009745598, 0.009571714326739311, 0.0008180224685929716, 0.0009662486263550818, 0.05158265307545662, 0.0012483098544180393, 0.0010352081153541803, 0.0015373585047200322, 0.001349927275441587, 0.0027474339585751295, 0.937374472618103, 0.0017332291463389993, 0.007285968866199255, 0.0011992302024737, 0.010537411086261272, 0.0009605029481463134, 0.004550138022750616, 0.0009223299566656351, 0.001497859600931406, 0.0013048421824350953, 0.00791209563612938, 0.0021607154048979282, 0.0013970289146527648, 0.0008433664334006608, 0.005048330407589674, 0.007927310653030872, 0.13887949287891388, 0.0013967801351100206, 0.008414079435169697, 0.0008489482570439577, 0.000958263932261616, 0.005538016092032194, 0.006459216587245464, 0.00139333913102746, 0.0009073516703210771, 0.0010270790662616491, 0.0018139213789254427, 0.0011211108649149537, 0.0013792574172839522, 0.0012865840690210462, 0.004910074174404144, 0.09332320094108582, 0.004559207707643509, 0.0012388115283101797, 0.0015165364602580667, 0.0007450691191479564, 0.0019297831458970904, 0.0016557390335947275, 0.0008652955293655396, 0.0020140919368714094, 0.0011759502813220024, 0.0009161129128187895, 0.005997927393764257, 0.001184425433166325, 0.0016818789299577475, 0.028609104454517365, 0.003474077908322215, 0.00238016783259809, 0.0016730560455471277, 0.004105924163013697, 0.0008104193257167935, 0.004981135483831167, 0.0015657488256692886, 0.0029379911720752716, 0.0014187463093549013, 0.03720642998814583, 0.005427375435829163, 0.0018520982703194022, 0.0009554755524732172, 0.0012098794104531407 ]

[ "Introduction {#s1}\n============\n\nHyperlipidaemia refers to increased levels of lipids in the blood, including cholesterol and triglycerides. ", "This increase is one of the significant risk factors involved in the development of cardiovascular disease (CVD) [@pone.0070058-Frishman1] and diabetes [@pone.0070058-Pushparaj1]. ", "CVD remains an important cause of mortality and morbidity worldwide [@pone.0070058-WHO1]. ", "Research in the area of CVD is progressing rapidly and evidence and clinical trials for new drugs to treat CVD are continuously emerging. ", "It is well established that increased levels of blood cholesterol especially low density lipoprotein cholesterol (LDL-C) is an important risk factor for cardiovascular complications since it favours lipid deposition in blood vessels. ", "Epidemiological studies have clearly established that reduction of total cholesterol or LDL-C is associated with decreased risk of atherosclerosis and coronary heart disease [@pone.0070058-Sever1], [@pone.0070058-Wilson1].", "\n\nTreatment of hyperlipidaemia includes dietary changes, weight reduction, exercise and lipid-lowering drugs. ", "Nonetheless, the use of these oral medications can lead to side effects [@pone.0070058-Davidson1]. ", "Therefore, there continues to be a high demand for new, more effective and less toxic oral hypolipidaemic drugs. ", "Plant products are frequently considered to be less toxic and relatively free from side effects than synthetic drugs. ", "Hence, plants play a major role in the introduction of new therapeutic agents and have received much attention as sources of biologically active substances including antioxidative, hypoglycaemic and hypolipidaemic agents.", "\n\n*Tamarindus indica*, commonly known as tamarind belongs to the family *Leguminosae*. ", "It is native to tropical Africa, but is now grown all over the tropics. ", "The tamarind tree is a large, frost-tender evergreen tropical tree which can grow to a height of about 30 m. *T. indica* is slow-growing but long-lived and can remain productive for 150 years or longer. ", "The brown sticky pulp is a much-valued food ingredient in many Asian recipes due to its sweet and sour taste. *", "T. indica* has been used in folk medicine for treating diarrhea, stomach disorder, cold, fever, jaundice and as a skin cleanser [@pone.0070058-Doughari1]. ", "Scientifically, the extract of *T. indica* fruit pulp has been shown to have anti-fungal and anti-inflammatory activities [@pone.0070058-Rimbau1]. *", "T. indica* fruit pulp extract has been reported to possess hypolipidaemic effects when fed to hypercholesterolaemic hamsters [@pone.0070058-Martinello1]. ", "However, this study did not report on the potential mechanisms of actions for the hypolipidaemic effects, particularly at the molecular levels. *", "In vitro* analysis carried out by our group suggest that the hypolipidaemic activity of *T. indica* fruit extract involves the regulation of expression of genes associated with lipid metabolism [@pone.0070058-Razali1]. ", "This study was aimed to corroborate the *in vitro* findings in order to further understand the hypolipidaemic effects of *T. Indica* and its protective action against oxidative damage.", "\n\nMaterials and Methods {#s2}\n=====================\n\nReagents and Chemicals {#s2a}\n----------------------\n\nHPLC grade solvents, acetonitrile, ethanol and methanol were purchased from Fisher Scientific (United Kingdom). ", "Polyphenol standards were purchased from Sigma Chemical Co. (St. Louis, USA) and had purities above 95%. ", "Fast SYBR® Green Master Mix and High Capacity RNA-to-cDNA Master Mix was sourced from Applied Biosystems (California, United States). ", "RNAlater™ RNA stabilization reagent, RNase-free DNase set and RNeasy mini kit were obtained from Qiagen (Hilden, Germany). ", "Catalase, glutathione peroxidase and superoxide dismutase assay kits were purchased from Cayman Chemical Co. (Michigan, USA). ", "2,2-diphenyl-1-1 picrylhydrazyl (DPPH), butylated hydroxytoluene (BHT), dimethylsulphoxide (DMSO), 2,4,6-tripyridyl-s-triazine (TPTZ), Trolox and cholesterol were purchased from Sigma Chemical Co. (St. Louis, USA). ", "Potassium persulphate and 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) were sourced from Fluka Chemical (Steinheim, Germany). ", "Sodium carbonate and Folin-Ciocalteu reagent were purchased from Merck (Darmstadt, Germany).", "\n\nPreparation of the Extract of *T. indica* fruit pulp {#s2b}\n----------------------------------------------------\n\n*T. indica* fruit pulp was collected at Universiti Putra Malaysia and identified by comparison with the Voucher Specimen (KLU 45976), deposited at the Herbarium of the Institute of Biological Sciences, University of Malaya, Kuala Lumpur. ", "The fruit pulp was air dried, ground to powder and stored at −20°C until further analyses. ", "Extraction of the fruit pulp was performed by mixing the dried powder with 95% ethanol at a ratio of 1∶20 (g:ml), stirred for one hour, and subsequently incubated in the dark for 48 h at room temperature [@pone.0070058-Razali2]. ", "The resulting extract was then filtered twice using Macherey-Nagel filter paper and the ethanol was evaporated to dryness using a rotary evaporator at 37°C. ", "For *in vitro* analyses of polyphenolic content and antioxidant activities, the extract was dissolved in 10% DMSO and stored at −20°C.", "\n\nPolyphenolic Content Analyses {#s2c}\n-----------------------------\n\nPolyphenolic content was determined using Folin-Ciocalteau assay developed by Singleton and Rossi [@pone.0070058-Singleton1]. ", "Folin-Ciocalteau reagent (1 N) was mixed with the plant extract (1.0 mg/ml) and incubated at room temperature for 5 min before the addition of a sodium carbonate (Na~2~CO~3~) solution (60 g/l). ", "The mixture was subsequently incubated at room temperature for 2 h. Absorbance readings were taken spectrophotometrically at 765 nm. ", "Gallic acid was used as standard and was analyzed as above. ", "Phenolic content was expressed as mg gallic acid equivalents (GAE)/g extract.", "\n\nFlavonoid Content Analyses {#s2d}\n--------------------------\n\nFlavonoid content of the plant extract was determined using the aluminium chloride colorimetric method described by Liu and Qiu [@pone.0070058-Liu1]. ", "Briefly, 100 µl of plant extract (1 mg/ml) was mixed with 10 µl of 5% sodium nitrate and 10 µl of 10% aluminium chloride. ", "The mixture was incubated for 6 min at room temperature. ", "One hundred microlitres sodium hydroxide (1 M) was then added to the mixture and brought to a volume of 250 µl using distilled water. ", "Absorbance of the mixture was measured at 510 nm using a spectrophotometer. ", "Rutin was used as standard and was analyzed as above. ", "Flavonoid content was expressed as mg of rutin equivalents (RE)/g extract.", "\n\nAnalysis of Polyphenols using High Performance Liquid Chromatography (HPLC) {#s2e}\n---------------------------------------------------------------------------\n\nThe *T. indica* fruit pulp extract was subjected to acid hydrolysis before analyses of polyphenolic content using HPLC [@pone.0070058-Razali2]. ", "The hydrolysis process was performed by mixing 20 mg of sample with 1.6 ml of methanol and 0.4 ml of 1.2 M HCl. ", "The mixture was then hydrolyzed at 90°C for 2 h in a tightly-sealed glass reactive vial. ", "Subsequently, the hydrolyzed sample was centrifuged for 5 min at 5000 x g. The supernatant was collected and diluted with trifluoroacetic acid (TFA) (pH 2.6) and 200 µl was injected into the HPLC.", "\n\nThe HPLC system consisted of a Shimadzu dual wavelength absorbance detector (SPD-20A UV-VIS), a Rheodyne 7725i manual injector that comprised a 200 µl sample loop and column oven (CTO-10AS VP) and two pumps (LC 20AC). ", "The mobile phase consisted of TFA (pH 2.6) as solvent A and acetonitrile as solvent B. The flow rate was 0.5 ml/min. ", "Separation of polyphenols in the extract was achieved using the following gradient condition: 7% to 40% B for 20 min, 40% to 100% B for 6 min and 100% to 7% B for 9 min, using a reversed-phased column (NovaPak C~18~, 150×3.0 mm, inner diameter 4 µm). ", "Absorbance of the sample was monitored at 260 nm. ", "Data acquisition and processing were performed using the Lab Solution Chromatography Manager.", "\n\nDPPH Radical Scavenging Activity {#s2f}\n--------------------------------\n\nThe 2,2-diphenyl-1-1picrylhydrazyl (DPPH) radical scavenging activity of the plant extract was determined according to Cos and Rajan [@pone.0070058-Cos1]. ", "Various concentrations of 25 µl of the ethanol extract of *T. indica* fruit pulp was mixed with 150 µl of a 0.04 mg/ml methanolic solution of DPPH. ", "The mixture was vortexed and then incubated in the dark at room temperature for 20 min. ", "Absorbance of the mixture was measured at 515 nm. ", "Trolox was used as the standard and was analysed in the same manner as the sample. ", "DPPH radical scavenging activities of the plant extracts were expressed as mmole Trolox equivalents antioxidant capacity (TEAC) per gram of extract. ", "Ascorbic acid, butylated hydroxytoluene (BHT) and quercetin were used as positive controls. ", "The percentage inhibition of the DPPH radicals by the plant extract was calculated using the following equation:where, is the absorbance of the reaction mixture without the plant extract and is the absorbance of the reaction mixture containing plant extract.", "\n\nABTS Radical Scavenging Activity {#s2g}\n--------------------------------\n\nThe 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulphonic) acid (ABTS) radical scavenging activity of the plant extract was estimated according to the method of Re and Pellegrini [@pone.0070058-Re1]. ", "ABTS^+^ cation chromophore was generated by reacting 7 mM ABTS with 2.45 mM potassium persulfate for 16 h in the dark at room temperature, followed by dilution with methanol to give an absorbance of 0.70±0.02 at 734 nm. ", "For the antioxidant assay, 10 µl of plant extract (0−125 µg/ml) was added to 1.0 ml of the ABTS reagent, incubated in the dark for 15 min before absorbance was read at a wavelength of 734 nm. ", "Trolox was used as the standard and analysed in the same manner as the sample. ", "ABTS radical-scavenging activities of the plant extracts were expressed as mmole Trolox equivalents antioxidant capacity (TEAC) per gram of extract. ", "Ascorbic acid, BHT and quercetin were used as positive controls. ", "The percentage inhibition of the ABTS radicals by the plant extract was calculated using similar equation as the DPPH radical scavenging activity.", "\n\nFerric Reducing Antioxidant Power (FRAP) Activity {#s2h}\n-------------------------------------------------\n\nThe ferric reducing activity of the plant extract was estimated using the method developed by Benzie and Strain [@pone.0070058-Benzie1]. ", "Reagents for the assay consisted of 300 mmol/l acetate buffer, 10 mmol/l 2,4,6-tripyridyl-s-triazine (TPTZ) in 40 mmol/l of HCl and 20 mmol/l of FeCl~3~.6 H~2~O. The working FRAP reagent was prepared fresh by mixing 25 ml of acetate buffer, 2.5 ml of TPTZ solution and 2.5 ml of FeCl~3~.6 H~2~O. The freshly prepared mixture was incubated at 37°C in a water bath for 5 min before a blank reading was taken spectrophotometrically at 593 nm. ", "After that, 30 µl of plant extract or standard and 90 µl of distilled water were added to 900 µl of the FRAP reagent. ", "Absorbance of the mixture was measured immediately and thereafter at an interval of 15 sec for 4 min. ", "The change in absorbance in the 4 min time reaction was calculated. ", "A calibration curve was generated using ferrous sulphate as the standard. ", "Ascorbic acid, BHT and quercetin were used as positive controls and analysed as above. ", "Ferric reducing activity was expressed as µmole Fe(II) per gram of extract.", "\n\nEthics Statement for Animal Study {#s2i}\n---------------------------------\n\nThe protocol for the *in vivo* study was conducted with the approval of the ethics committee for animal experiments, Faculty of Medicine, University of Malaya {ethics no: PM/26/08/2009/AAZ(R)}.", "\n\nAnimal Diet {#s2j}\n-----------\n\n*T. indica* fruit pulp extract (500 mg/kg body weight) for the feeding study was prepared by diluting the dried fruit pulp powder with distilled water. ", "High-cholesterol diet (1%) was prepared by mixing the standard chow with cholesterol. ", "Briefly, standard chow (99 g) was ground into powder and mixed with 1 g of cholesterol, after which 100 ml of distilled water was added and the mixture was shaped into small pellets. ", "The pellets were dried in an oven at 50°C and kept at 4°C before use.", "\n\nTreatment of Hamsters with *T. indica* Fruit pulp Extract {#s2k}\n---------------------------------------------------------\n\nSix week-old male Syrian hamsters (n = 20) were randomly divided into four treatment groups and housed individually in well-ventilated cages under a 12-h light:dark cycle. ", "Diet and water were provided *ad libitum*. ", "Animals were treated for ten weeks with the following diet; Group I: standard chow plus distilled water (5 ml/kg body weight); Group II: standard chow plus *T. indica* fruit pulp extract (500 mg/kg body weight); Group III: high-cholesterol diet plus distilled water (5 ml/kg body weight) and Group IV: high-cholesterol diet plus *T. indica* fruit pulp extract (500 mg/kg body weight). ", "Feeding of *T. indica* fruit pulp extract was conducted through the gavage method once a day.", "\n\nCollection and Preparation of Blood and Liver Samples {#s2l}\n-----------------------------------------------------\n\nAt the end of the feeding experiment, the animals were anaesthetized with a ketamine-xylazine cocktail (90 mg/kg and 2 mg/kg body weight, respectively) and blood was collected through cardiac puncture after an overnight fast. ", "The livers of the animals were excised, homogenized with cold phosphate buffered saline, centrifuged at 2000 x g at 4°C for 15 min and the supernatant stored at −80°C before analysis. ", "For the gene expression study, 1 g of the liver tissues were immediately washed with saline, kept in RNAlater™ RNA Stabilization Reagent (Qiagen) and stored at −80°C until further analysis.", "\n\nBiochemical Analysis {#s2m}\n--------------------\n\nSerum samples were analysed for lipid profiles, fasting blood glucose, alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels using commercially available kits on an automated analyser.", "\n\nAnalyses of Antioxidant Enzyme Activities {#s2n}\n-----------------------------------------\n\nActivities of the antioxidant enzymes, catalase (CAT), glutatione peroxidase (GPx) and superoxide dismutase (SOD) were determined using commercially available assay kits (Cayman, USA). ", "The assays were performed according to the manufacturer's instructions.", "\n\nDetermination of Antioxidant Activities and TBARS in Serum and Liver {#s2o}\n--------------------------------------------------------------------\n\nThe ABTS radical scavenging and FRAP activities of serum and liver homogenate were analysed as described above. ", "Thiobarbituric acid reactive substance (TBARS) assay was used to assess lipid peroxidation in serum and hepatic samples by measuring levels of malondialdehyde (MDA) [@pone.0070058-Mengel1]. ", "A mixture of 100 µl sample and 100 µl trichloroacetic acid (10%) was centrifuged at 3500 rpm at 25°C for 5 min. ", "One hundred and twenty microlitres of 0.67% thiobarbituric acid was added to the clear supernatant and heated at 100°C for 15 min and then cooled at room temperature. ", "Absorbance of the mixture was read at 550 nm. ", "1,1,3,3-tetraethoxypropane was used as standard. ", "Lipid peroxidation was expressed as nmol MDA/ml.", "\n\nGene Expression Analysis {#s2p}\n------------------------\n\nThe expression of selected genes that were associated with antioxidant activity and lipid metabolism ([Table 1](#pone-0070058-t001){ref-type=\"table\"}) were quantitated using real time relative quantitative polymerase chain reaction (qRT-CR) as previously described [@pone.0070058-Razali1].", "\n\n10.1371/journal.pone.0070058.t001\n\n###### Primer sequences used for qRT-PCR analysis of selected genes in hamsters.", "\n\n![](", "pone.0070058.t001){#pone-0070058-t001-1}\n\n Gene (GenBank accession no.) ", " Forward primer (5′--3′) Reverse primer (5′--3′) Size of PCR product\n -------------------------------- ------------------------- ------------------------- ---------------------\n *Apo A1* (AF046919.1) CGCCACCACGTTGACGCTCT GGTCAGCGGCCTTGGTGTGG 133\n *Beta actin* (AJ312092.1) CGACAACGGCTCCGGCATGT TCACGCCCTGGTGCCTAGGG 101\n *Abcg5* (NM_053754.2) GGAAGGGGAGGTGTTTGT GCCAGCATCGCCGTGTAG 138\n Abcg8 (NM_130414.2) CATCATTGGCTTCCTTTA CCGCTCCGAGTGACATTT 139\n *Cyp1A1* (D12977.1) TAAAGCACGCCCGCTGCGAA AGC CCCCTGCTCTGGTGACC 103\n *Gstm1* (M59772.1) AGCTGGGCCTGGACTTCCCC ACACAGGTCGTGCTTGCGGG 107\n *HMG-CoA Reductase* (M12705.1) GCTGTCTGGTGGCCAGCACC GGAAGACGCACCACTGGGCC 112\n *LDL-C Receptor* (M94387.1) GGCAGCGCTGACTGCAAGGA TTCACGGTCACACTGGCGGC 123\n *Mtp* (U14995.1) AGCTGGCCTGGAGAGCAGGG GCCCGGTCCATCTGCATGCA 105\n\n*Apo A1*, Apolipoprotein A1; *Abcg5*, ATP-binding cassette, subfamily G (WHITE), member 5; *Abcg8*, ATP-binding cassette, subfamily G (WHITE), member 8; *Cyp1A1*, Cytochrome P450, family 1, subfamily A, polypeptide 1; *Gstm1*, Glutathione S-transferase mu 1; *Mtp*, Microsomal triglyceride transfer protein.", "\n\nRNA Extraction, Cleanup and Quantitation {#s2q}\n----------------------------------------\n\nTotal cellular RNA (tcRNA) was extracted from 30 mg of the liver of control and treated hamsters using the RNeasy Mini Kit and its accompanying QIAshredder (Qiagen) in accordance with the manufacturer's instructions. ", "Briefly, the tissues were thoroughly ground to fine powder in liquid nitrogen with a mortar and pestle. ", "Highly denaturing guanidine thiocyanate-containing buffer, buffer RLT was then added to the powder and the cell suspension was homogenized using QIAshredder. ", "The homogenate was centrifuged and the lysate was then transferred to a microcentrifuge tube. ", "The lysate was centrifuged and the supernatant was collected. ", "Ethanol (50%) was then added to the supernatant and mixed well by pipetting. ", "The mixture was then transferred to an RNeasy Spin Column and washed with RW1 and RPE buffers (QIAGEN; composition not declared). ", "RNase-free water (40 µl) was added to the RNeasy Spin column and the eluent containing the tcRNA was treated with DNase I for 10 min to remove contaminating DNA using RNase-Free DNase Set (Qiagen). ", "Then, buffer RLT and absolute ethanol were added to the samples and the mixture was transferred to an RNeasy Spin Column. ", "Buffer RPE was added to wash the spin column membrane. ", "In the final step, tcRNA was eluted with RNase-free water into collection tubes. ", "Absorbance of the extracted tcRNA was measured at 260 and 280 nm using GeneQuantpro spectrophotometer. ", "The concentration of the tcRNA was quantified using the 260 nm absorbance reading while its purity was evaluated from the 260∶280 ratio.", "\n\nReverse Transcription of the tcRNA {#s2r}\n----------------------------------\n\nTcRNA (1000 ng) was reverse-transcribed into complementary DNA (cDNA) using a High Capacity RNA-to-cDNA Master Mix (Applied Biosystems) following the manufacturer's instructions. ", "The final reaction volume for the reverse transcription was 20 µl, consisted of 1000 ng TcRNA and 1 X Master Mix which contained magnesium chloride (MgCl~2~), deoxyribonucleotide triphosphate (dNTPs), recombinant RNase inhibitor protein, reverse transcriptase, random primers, oligo(dT) primer and stabilizers. ", "The mixture was pipetted into a microcentrifuge tube and then placed in a thermocycler with the following program: 25°C for 5 min, 42°C for 30 min and 85°C for 5 min. ", "The cDNA was kept at −80°C until further analysis.", "\n\nReal-time Relative Quantitative RT--PCR (qRT--PCR) {#s2s}\n--------------------------------------------------\n\nOligonucleotide primers used for qRT-PCR are listed in [Table 1](#pone-0070058-t001){ref-type=\"table\"}. ", "All cDNA samples were diluted to a final concentration of 5 ng/µl. ", "The final reaction volume for real time PCR was 20 µl, consisted of 10 µl of 2 X Fast SYBR® Green Master Mix (Applied Biosystem) which contained SYBR® Green I Dye, AmpliTaq® Fast DNA Polymerase, UP (Ultra Pure), Uracil-DNA Glycosylase (UDG), ROX™ dye Passive Reference, dNTPs and optimized buffer components, 200 nM of forward primer, 200 nM of reverse primer and 10 ng of cDNA. ", "qRT-PCR was performed using Applied Biosystems StepOne Plus™ Real Time PCR System with a thermal profile consisted of 20 sec of *Taq* DNA Polymerase activation at 95°C, followed by 40 cycles of denaturation at 95°C for 3 sec, primer annealing at 60°C for 30 sec. ", "The melting curves of the real-time PCR products were analysed from 65°C to 95°C to aid in product identification. ", "Each measurement was carried out in triplicate. ", "Differences in gene expression, expressed as fold-change, were calculated using the 2^--ΔΔCt^ method where *beta actin* was used as the reference gene.", "\n\nStatistical Analyses {#s2t}\n--------------------\n\nAll analyses were done in triplicate and data were expressed as means ± standard error of means. ", "Significant differences among the groups were determined by one-way ANOVA using SPSS followed by the post hoc Tukey's Honestly Significant Different test. ", "Values corresponding to *p*\\<0.01 or *p*\\<0.05 were considered to be statistically significant.", "\n\nResults {#s3}\n=======\n\nPolyphenolic and Flavonoid Content and Antioxidant Activities of *T. indica* Fruit pulp {#s3a}\n---------------------------------------------------------------------------------------\n\nThe *T. indica* fruit pulp extract contains considerable amounts of polyphenols and flavonoids ([Table 2](#pone-0070058-t002){ref-type=\"table\"}) and showed moderate antioxidant activities, which were comparable to the positive control BHT but lower than ascorbic acid and quercetin.", "\n\n10.1371/journal.pone.0070058.t002\n\n###### Polyphenol, flavonoid and antioxidant activities of the ethanol extract of *T. indica* fruit pulp.", "\n\n![](", "pone.0070058.t002){#pone-0070058-t002-2}\n\n Polyphenolic content Flavonoid content DPPH ABTS FRAP\n ------------------------ ---------------------- ------------------- -------------- -------------- --------------\n *T. indica* fruit pulp 244.93±10.07 93.93±2.57 0.08±0.01^c^ 0.07±0.04^b^ 0.72±0.03^b^\n Ascorbic acid NA NA 4.05±0.02^a^ 1.13±0.04^a^ 6.52±0.10^a^\n BHT NA NA 0.09±0.02^c^ 0.14±0.04^b^ 0.70±0.07^b^\n Quercetin NA NA 3.94±0.02^b^ 2.93±0.06^a^ 6.46±0.08^a^\n\nValues are expressed as mean ± standard deviation (n = 3). ", "Means with different superscript letters within the same column are significantly different (*p*\\<0.05). ", "Polyphenolic content is expressed as mg GAE/g extract; flavonoid content is expressed as mg RE/g extract; DPPH, 1,1-diphenyl-2-picryl hydrazyl radical scavenging activity and ABTS, 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) radical scavenging activity are expressed as mmole TE/g extract; FRAP, ferric reducing antioxidant power is expressed as mmole of Fe(II)/g extract; NA, not available.", "\n\n[Figure 1](#pone-0070058-g001){ref-type=\"fig\"} shows the chromatogram of hydrolysed *T. indica* fruit pulp analysed by HPLC. ", "Catechin was identified in the fruit pulp sample by comparing the retention times of the peak with the authentic standard.", "\n\n{#pone-0070058-g001}\n\nBody Weight and Liver Weight of Control and Treated Hamsters {#s3b}\n------------------------------------------------------------\n\n[Table 3](#pone-0070058-t003){ref-type=\"table\"} shows the food consumption, body weight and weight of livers of the hamsters. ", "No significant differences were seen in the amount of food consumption among the four groups. ", "With the exception of the hypercholesterolaemic group (Gp. ", "III), the remaining groups showed reduced weight after the 10-week experimental period. ", "There were no significant differences in weight of livers among the control hamsters, hamsters treated with *T. indica* fruit pulp and hypercholesterolaemic hamsters treated with *T. indica* fruit pulp. ", "On the contrary, the hypercholesterolaemic hamsters showed significant increase in liver weight, with the weight twice those of the control group (*p*\\<0.01). ", "However, administration of *T. indica* fruit pulp to hypercholesterolaemic hamsters reduced liver weight by approximately 35% relative to the hypercholesterolaemic hamsters.", "\n\n10.1371/journal.pone.0070058.t003\n\n###### Food consumption, body weight and liver weight of control and hamsters treated with *T. indica* fruit pulp extracts, in the presence or absence of cholesterol.", "\n\n![](", "pone.0070058.t003){#pone-0070058-t003-3}\n\n Group Group I Group II Group III Group IV\n -------------------------- ----------------- ----------------- --------------- -----------------\n Food Consumption (g/day) 8.71±0.32 8.72±0.21 8.51±0.40 8.22±0.24\n Intial body weight(g) 128.80±5.70 137.00±5.15 127.80±1.39 135.40±2.23\n Final body weight (g) 121.60±5.26 130.80±3.99 139.00±4.14 127.00±1.34\n Weight change (g) \\- 7.20±1.69^b^ \\- 6.20±4.60^b^ +7.00±0.71^a^ \\- 5.20±0.45^b^\n Liver weight (g) 3.40±0.24^b^ 3.60±0.24^b^ 6.80±0.20^a^ 4.40±0.24^b^\n\nValues are given as mean ± standard error of mean (n = 5). ", "Values not sharing a common superscript letter within the same row differ significantly at *p*\\<0.01. ", "Group I: standard chow plus distilled water (5 ml/kg body weight); Group II: standard chow plus *T. indica* fruit pulp extract (500 mg/kg body weight); Group III: high-cholesterol diet plus distilled water (5 ml/kg body weight) and Group IV: high-cholesterol diet plus *T. indica* fruit pulp extract (500 mg/kg body weight).", "\n\nEffect of *T. indica* Fruit pulp on Biochemical Parameters in Hamsters {#s3c}\n----------------------------------------------------------------------\n\n[Table 4](#pone-0070058-t004){ref-type=\"table\"} summarizes the serum lipid profiles, glucose, AST and ALT levels of control and hamsters treated with *T. indica* fruit pulp. ", "There was no significant difference in levels of serum triglyceride, total cholesterol, HDL, LDL, glucose, AST and ALT between control hamsters (Gp. ", "I) and hamsters treated with *T. indica* fruit pulp (Gp. ", "II). ", "Feeding a high-cholesterol diet to the hamsters significantly increased all the biochemical parameters. ", "On the contrary, when *T. indica* fruit pulp was fed together with the high-cholesterol diet, levels of triglyceride and LDL-C reduced to amounts similar to the normal untreated group whereas the level of total cholesterol reduced to roughly 50% compared to the control group. ", "However, there was no significant change in HDL levels between the treated and untreated hypercholesterolaemic groups.", "\n\n10.1371/journal.pone.0070058.t004\n\n###### Analyses of biochemical parameters of control and hamsters treated with *T. indica* fruit pulp extracts, in the presence or absence of cholesterol.", "\n\n![](", "pone.0070058.t004){#pone-0070058-t004-4}\n\n Group Group I Group II Group III Group IV\n ----------------------------- ---------------- ---------------- ------------------ ------------------\n Triglyceride (mmol/l) 0.88±0.05^b^ 1.00±0.10^b^ 1.98±0.21^a^ 0.96±0.09^b^\n Total choleste-rol (mmol/l) 2.08±0.12^c^ 1.94±0.08^c^ 5.74±0.55^a^ 3.74±0.14^b^\n HDL-C (mmol/l) 1.34±0.07^b^ 1.25±0.07^b^ 2.20±0.23^a^ 2.27±0.19^a^\n LDL-C (mmol/l) 0.34±0.08^b^ 0.21±0.07^b^ 2.38±0.56^a(\\*)^ 0.95±0.15^b(\\*)^\n Glucose (mmol/l) 8.38±0.62^ab^ 5.18±0.27^b^ 10.00±2.00^a^ 8.66±0.78^ab^\n AST (IU/l) 95.20±13.38^a^ 70.20±12.73^a^ 142.00±29.62^a^ 87.00±9.47^a^\n ALT (IU/l) 51.40±5.81^b^ 62.80±11.21^b^ 243.00±84.10^a^ 104.60±22.69^ab^\n\nValues are given as mean ± standard error of mean (n = 5). ", "Values not sharing a common superscript letter within the same row differ significantly at *p*\\<0.01 and ^\\*^ *p*\\<0.05. ", "Group I: standard chow plus distilled water (5 ml/kg body weight); Group II: standard chow plus *T. indica* fruit pulp extract (500 mg/kg body weight); Group III: high-cholesterol diet plus distilled water (5 ml/kg body weight) and Group IV: high-cholesterol diet plus *T. indica* fruit pulp extract (500 mg/kg body weight).", "\n\nThe levels of glucose only increased in hypercholesterolaemic hamsters (Gp. ", "III) and remained unchanged in the other groups. ", "Although hamsters treated with *T. indica* fruit pulp showed reduced glucose levels compared to control group, the values were not significantly different. ", "There was no significant difference in AST activities among the four groups. ", "Hypercholesterolaemic hamsters showed significant increase in serum ALT compared to control hamsters. ", "Administration of *T. indica* fruit pulp to the hypercholesterolaemic hamsters appeared to reduce ALT levels relative to the hypercholesterolaemic hamsters, however this was not statistically significant.", "\n\nEffects of *T. indica* Fruit pulp on Serum and Liver Oxidative Status in Hamsters {#s3d}\n---------------------------------------------------------------------------------\n\nSerum and liver antioxidant enzymes, antioxidant activities and lipid peroxidation levels are presented in [Table 5](#pone-0070058-t005){ref-type=\"table\"} and [6](#pone-0070058-t006){ref-type=\"table\"}, respectively. ", "Hamsters fed the high-cholesterol diet showed reduced activities of CAT, SOD and GPx in serum and liver. ", "Interestingly, treatment of either the control or hypercholesterolaemic hamsters with *T. indica* fruit pulp significantly increased activities of CAT and SOD in both serum and liver. ", "In contrast, activity of GPx was unchanged in the serum of control hamsters fed *T. indica* fruit pulp although there was increased GPx activities in the hypercholesterolaemic hamsters fed *T. indica* fruit pulp in both serum and liver and also in the liver of control group fed *T. indica* fruit pulp.", "\n\n10.1371/journal.pone.0070058.t005\n\n###### Serum antioxidant enzymes, antioxidant activities and lipid peroxidation in control and hamsters treated with *T. indica* fruit pulp extracts, in the presence or absence of cholesterol.", "\n\n![](", "pone.0070058.t005){#pone-0070058-t005-5}\n\n Group Group I Group II Group III Group IV\n ------------------------------------- --------------- --------------- -------------- ---------------\n Catalase (µmol/min/ml) 3.54±0.21^b^ 4.48±0.19^a^ 2.67±0.04^c^ 3.24±0.04^b^\n Superoxide dismutase (U/ml) 13.34±0.63^b^ 18.67±0.47^a^ 6.25±0.67^c^ 12.00±0.45^b^\n Glutathione peroxidase(µmol/min/ml) 0.60±0.02^a^ 0.63±0.05^a^ 0.22±0.01^c^ 0.43±0.02^b^\n ABTS (µmol/ml serum) 2.53±0.08^b^ 2.93±0.03^a^ 2.14±0.05^c^ 2.41±0.05^b^\n FRAP (µmol Fe (II)/ml serum) 0.32±0.02^b^ 0.40±0.01^a^ 0.28±0.01^b^ 0.30±0.01^b^\n MDA (nmol/ml serum) 0.033±0.001 0.033±0.001 0.036±0.002 0.034±0.001\n\nValues are given as means ± standard error of mean (n = 5). ", "Values not sharing a common superscript letter within the same row are significantly different at *p*\\<0.05. ", "Group I: standard chow plus distilled water (5 ml/kg body weight); Group II: standard chow plus *T. indica* fruit pulp extract (500 mg/kg body weight); Group III: high-cholesterol diet plus distilled water (5 ml/kg body weight) and Group IV: high-cholesterol diet plus *T. indica* fruit pulp extract (500 mg/kg body weight). ", "DPPH, 1,1-diphenyl-2-picryl hydrazyl radical scavenging activity; ABTS, 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) radical scavenging activity; FRAP, ferric reducing antioxidant power; MDA (malondialdehyde).", "\n\n10.1371/journal.pone.0070058.t006\n\n###### *Hepatic* antioxidant enzymes, antioxidant activities and lipid peroxidation in control and hamsters treated with T. indica fruit pulp extracts, in the presence or absence of cholesterol.", "\n\n![](", "pone.0070058.t006){#pone-0070058-t006-6}\n\n Group Group I Group II Group III Group IV\n -------------------------------------- ------------------ ------------------- ------------------- ------------------\n Catalase (µmol/min/ml) 1279.25±34.48^b^ 1857.16±49.07^a^ 958.65±44.48^c^ 1197.41±19.54^b^\n Superoxide dismutase(U/ml) 3616.48±67.98^b^ 4452.17±139.81^a^ 3153.66±110.03^c^ 3592.95±87.34^b^\n Glutathione peroxidase (µmol/min/ml) 8.48±0.63^b^ 10.70±0.33^a^ 6.91±0.20^c^ 8.70±0.43^b^\n ABTS (µmol/g liver) 16.93±0.52^b^ 19.67±0.38^a^ 11.35±0.56^d^ 13.32±0.27^c^\n FRAP (µmol Fe (II)/g liver) 3.26±0.07^a^ 3.43±0.08^a^ 2.07±0.10^c^ 2.48±0.09^b^\n MDA (nmol/g liver) 0.48±0.04^c^ 0.46±0.03^c^ 1.82±0.06^a^ 1.18±0.07^b^\n\nValues are given as means ± standard error of mean (n = 5). ", "Values not sharing a common superscript letter within the same row differ significantly at *p*\\<0.05. ", "Group I: standard chow plus distilled water (5 ml/kg body weight); Group II: standard chow plus *T. indica* fruit pulp extract (500 mg/kg body weight); Group III: high-cholesterol diet plus distilled water (5 ml/kg body weight) and Group IV: high-cholesterol diet plus *T. indica* fruit pulp extract (500 mg/kg body weight). ", "DPPH, 1,1-diphenyl-2-picryl hydrazyl radical scavenging activity; ABTS, 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) radical scavenging activity; FRAP, ferric reducing antioxidant power; MDA (malondialdehyde).", "\n\nThe serum and liver of hypercholesterolaemic hamsters showed reduced ABTS radical scavenging activities although treatment of either the control or hypercholesterolaemic group with *T. indica* fruit pulp significantly increased ABTS radical scavenging activities in both serum and liver. ", "In serum, FRAP values did not differ among the control, hypercholesterolaemic and hypercholesterolaemic group treated with *T. indica* fruit pulp. ", "However, hamsters treated with *T. indica* fruit pulp (Gp. ", "II) showed 20% higher FRAP activities compared to control (Gp. ", "I). ", "In the liver, administration of *T. indica* fruit pulp did not cause any significant change in FRAP activities compared to control group. ", "However, in the hypercholesterolaemic hamsters fed *T. indica* fruit pulp, FRAP activities increased by approximately 20% compared to hypercholesterolaemic hamsters (*p*\\<0.05).", "\n\nThere was no significant difference in serum MDA levels among all the groups. ", "Similarly, lipid peroxidation in the liver of the control (Gp. ", "I) and *T. indica* fruit pulp-treated (Gp. ", "II) hamsters was not significantly altered. ", "High-cholesterol diet induced lipid peroxidation in the liver while treatment of *T. indica* fruit pulp to hypercholesterolaemic hamsters lowered lipid peroxidation by approximately 35%.", "\n\nEffects of Ethanolic Extract of *T. indica* Fruit pulp on the Expression of Selected Hepatic Genes Associated with Lipid Metabolism and Antioxidant Activity in Hamsters {#s3e}\n------------------------------------------------------------------------------------------------------------------------------------------------------------------------\n\n{#pone-0070058-g002}\n\nIn hypercholesterolaemic hamsters, the expression of the *Abcg5* was significantly down-regulated by 1.4-fold and the suppression of the *ApoA-I* gene expression was also significantly reversed when the hypercholesterolaemic hamsters were co-treated with *T. indica* extract. ", "Significant down-regulation was observed for *Abcg8* gene expression in the hypercholesterolaemic hamsters. ", "Unlike the *Abcg5,* the expression of *Abcg8* in the hypercholesterolaemic hamsters was unchanged in the presence of *T. indica* extract. ", "Both *Abcg5* and *Abcg8* were up-regulated by 1.4-fold in hamsters treated with only *T. indica* fruit pulp extract (Gp. ", "II). ", "Besides that, *HMG-CoA reductase* gene expression was significantly up-regulated by 1.5-fold with the hypercholesterolaemic diet relative to that of control. *", "T. indica* extract managed to significantly suppress the *HMGCoA reductase* gene expression in the presence of cholesterol. ", "The expression of *HMG-CoA reductase* was not significantly altered in hamsters receiving only *T. indica* fruit pulp extract.", "\n\n*LDL receptor* gene was significantly down-regulated by 3.0-fold (*p*\\<0.05) in the presence of high cholesterol diet. ", "When given together with *T. indica* fruit extract, the regulation of gene expression was reversed. ", "However, treatment with only *T. indica* fruit extract did not significantly regulate the expression of *LDL receptor* gene.", "\n\nThe expression of microsomal triglyceride transfer protein (*Mtp*) was down-regulated by 1.5-fold in *T. indica*-treated hamsters (Gp. ", "II) compared with control hamsters (Gp. ", "I). ", "Meanwhile, hamsters fed the high-cholesterol diet had increased hepatic expression level of *Mtp* gene by 1.5-fold compared with control hamsters, whereas, *T. indica* fruit pulp extract administration to hypercholesterolaemic hamsters caused down-regulation of *Mtp* gene expression level by 1.6-fold relative to the control hamsters.", "\n\nIn *T. indica* fruit pulp extract supplemented hamsters, the expression level of *Cyp1A1* gene was significantly (*p*\\<0.05) increased by 1.6-fold relative to control hamsters. ", "In contrast, hepatic *Cyp1A1* expression was down-regulated by 2.3-fold in hamsters fed the high-cholesterol diet. ", "Interestingly, treatment of *T. indica* fruit pulp extract to hypercholesterolaemic hamsters for ten weeks significantly (*p*\\<0.05) increased *Cyp1A1* level compared to hypercholesterolaemic hamsters. ", "In addition, the gene expression of *Gstm1* was significantly up-regulated by 1.6-fold with the feeding of *T. indica* fruit pulp extract to control hamsters. ", "In hypercholesterolaemic hamsters, the hepatic gene expression of *Gstm1* was significantly (*p*\\<0.05) reduced (2.3-fold) compared with control. ", "Surprisingly, the administration of *T. indica* fruit pulp extract along with high-cholesterol diet up-regulated *Gstm1* gene expression level by 1.3-fold relative to control hamsters.", "\n\nDiscussion {#s4}\n==========\n\nA few studies have reported various biological activities of *T. indica* [@pone.0070058-Doughari1], [@pone.0070058-Rimbau1]. ", "Our group recently reported the high antioxidant activities of various parts of *T. indica* [@pone.0070058-Razali2] as well as its ability to influence expression of genes and proteins which may explain its reported biological activities [@pone.0070058-Razali1], [@pone.0070058-Chong1]. ", "Although the antioxidant activity of the fruit pulp in this study was lower than that of the leaves [@pone.0070058-Liu1], the fruit pulp was chosen for the animal study as it was the part of the plant that was edible and commonly consumed. *", "T. indica* fruit pulp contains considerable amounts of phenolics and flavonoids as well as antioxidant activities. ", "The antioxidant activities demonstrated by the fruit pulp could be due to the presence of phenolic compounds. ", "Catechin, which was detected in the fruit pulp by HPLC, had been reported to have strong antioxidant activity [@pone.0070058-Katalini1]. ", "In addition to catechin, Sudjaroen and Haubner [@pone.0070058-Sudjaroen1] identified other phenolics in *T. indica* fruit pulp, including epicatechin, taxifolin, apigenin, eriodictyol, luteolin, naringenin and different classes of procyanidins. ", "These compounds were reported to exhibit strong antioxidant properties and lipid-lowering effects [@pone.0070058-Theriault1], [@pone.0070058-Bundy1].", "\n\nEpidemiological studies have shown inverse relationships between the intake of flavonoids from vegetables and fruits and the incidence of heart disease [@pone.0070058-Katan1], [@pone.0070058-He1]. ", "Hence, many plants have been investigated for their potential hypocholesterolaemic properties. ", "Hamsters are a suitable animal model for studying cholesterol metabolism due to their ability to develop hypercholesterolaemia when fed a high-cholesterol diet [@pone.0070058-Martinello1] in addition to having similar characteristics of cholesterol metabolism as humans [@pone.0070058-Hoffmann1].", "\n\nThe increase in liver weight of cholesterol-fed hamsters could be due to accumulation of cholesterol and triglyceride as a result of increased absorption from the diet. ", "Liver is the major site for cholesterol metabolism in hamsters as well as humans [@pone.0070058-Spady1] and a high-cholesterol diet had been reported to increase liver weight of hamsters [@pone.0070058-Alsaif1], [@pone.0070058-Kahlon1]. ", "However, feeding of *T. indica* fruit pulp along with the high-cholesterol diet reversed this condition, possibly as a result of increased excretion and/or metabolism of cholesterol. ", "The increased body weight of hypercholesterolaemic hamsters was likely contributed by the increase in liver weight. ", "Serum AST, indicators of hepatotoxicity, were unchanged in hamsters treated with *T. indica* fruit pulp. ", "Although ALT increased in hypercholesterolaemic hamsters, treatment with *T. indica* fruit pulp reduced the levels back to normal. ", "Increased ALT in hamsters fed a high-cholesterol diet is commonly observed [@pone.0070058-Yazdanparast1], [@pone.0070058-BenKhaled1]. ", "Martinello and Soares [@pone.0070058-Martinello1] reported that administration of *T. indica* fruit pulp to hamsters did not lead to changes in AST and ALT levels, indicating that *T. indica* fruit pulp is not hepatotoxic.", "\n\nIn this study, hamsters fed on the high-cholesterol diet (Gp. ", "III) showed increased triglyceride, total cholesterol, HDL-C and LDL-C compared to normal hamsters (Gp. ", "I). ", "A high-cholesterol diet can reduce the LDL-C clearance rate of hamsters causing increased LDL-C in the circulation [@pone.0070058-Spady1]. ", "Decreasing cholesterol and triglyceride levels in blood prevent the risk of cardiovascular diseases and atherosclerosis [@pone.0070058-Ling1]. ", "In this study, administration of *T. indica* fruit pulp together with high-cholesterol diet decreased triglyceride, total cholesterol and LDL-C but did not alter HDL-C levels. ", "It is interesting to note that feeding *T. indica* fruit pulp to hypercholesterolaemic hamsters reduced LDL-C by more than two-fold. ", "This suggests that the fruit pulp has cholesterol-lowering effect but it does not involve HDL-C directly.", "\n\nTaxifolin, apigenin, naringenin and luteolin, phenolic compounds identified in *T. indica* fruit pulp had been reported to have hypolipidaemic properties, including inhibiting the production of cholesterol, suggesting their possible contribution towards improving the serum lipid profiles in cholesterol-fed hamsters [@pone.0070058-Theriault1], [@pone.0070058-Bundy1], [@pone.0070058-Kim1].", "\n\nSerum HDL-C levels were significantly higher in the hypercholesterolaemic hamsters (Gp. ", "III) compared to those on the normal diet (Gp. ", "I). ", "This observation is in agreement with previous studies in humans and hamsters where high-cholesterol diet caused HDL-C elevation [@pone.0070058-Brinton1], [@pone.0070058-Hayek1]. ", "In addition, the increased HDL-C levels in cholesterol-fed hamsters could also be an adaptive mechanism showing the need to enhance cholesterol efflux through the reverse cholesterol transport pathway in response to the high-cholesterol diet. ", "Moreover, administration of *T. indica* fruit pulp along with the high-cholesterol diet did not produce significant variation in the serum HDL-C levels compared to hamsters fed on the high-cholesterol diet which suggests that *T. indica* fruit pulp had no effect on HDL-C.\n\nA few genes that may contribute to the hypocholesterolaemic effect of *T. indica* fruit pulp were chosen and their expressions were determined by qRT-PCR to evaluate the molecular mechanisms underlying its lipid-lowering effects. ", "We had previously shown that the *T. indica* fruit pulp extracts were able to regulate the expression of genes associated with lipid metabolism in an *in vitro* model, liver HepG2 cells [@pone.0070058-Razali1]. ", "Amongst the regulated genes were those encoding ABCG5, ApoA-1 and MTP. ", "In the same study, the *T. indica* fruit pulp extract did not alter the expression of genes encoding LDL receptor which facilitates cholesterol uptake from the blood circulation as well as HMG-CoA reductase, the rate-limiting enzyme in the *de novo* synthesis of cholesterol. ", "In this study, the *HMG-CoA reductase* gene expression in hypercholesterolaemic hamsters increased in parallel with serum total cholesterol concentration. ", "This result is consistent with previous reports where animals fed a high-cholesterol diet had elevated *HMG-CoA reductase* expression [@pone.0070058-Huang1], [@pone.0070058-Nammi1]. ", "This finding points out the potential role of exogenous cholesterol as a cause for the up-regulation of hepatic *HMG-CoA reductase* expression. ", "The observed increase in gene expression could also be due to the elevated glucose concentration in hamsters fed the high-cholesterol diet since insulin function to increase hepatic *HMG-CoA reductase* activity [@pone.0070058-Ingebritsen1], [@pone.0070058-Lakshmanan1].", "\n\nConsistent with our *in vitro* analysis, hamsters treated with only *T. indica* fruit pulp extract did not show significant changes in the expression of *HMG-CoA reductase* gene compared to the control group. ", "However, hamsters fed on the high-cholesterol diet along with *T. indica* fruit pulp had decreased expression level of *HMG-CoA reductase* compared to hypercholesterolaemic hamsters. ", "This group of animals also had decreased levels of serum triglyceride, total cholesterol and LDL-C. This indicates that in the presence of cholesterol, the hypolipidaemic effect of *T. indica* fruit pulp could have possibly reduced cholesterol levels by reducing hepatic *HMG-CoA reductase* gene expression. ", "Taxifolin had also been shown to have lipid-lowering effects through inhibition of the HMG-CoA reductase activity in HepG2 cells [@pone.0070058-Theriault1]. ", "Therefore, the lipid lowering effect of *T. indica* fruit pulp could be due to the presence of taxifolin through the inhibition of *HMG-CoA reductase* expression.", "\n\nThe metabolism of LDL-C is greatly influenced by the number and activity of LDL receptors [@pone.0070058-White1], [@pone.0070058-Patalay1]. ", "Hence, functional LDL receptors are vital to take up LDL-C in order to decrease their circulating levels in the blood circulation which is one of the contributing factors towards the development of atherosclerosis. ", "The effect of the plant extract on the expression of *LDL receptor* gene was studied to ascertain if the cholesterol-lowering effect of the plant extract occurred through increased production of LDL receptors. ", "In the present study, the gene expression of *LDL receptor* in *T. indica* fruit pulp-fed hamsters was not significantly different from control hamsters. ", "Similarly, the serum concentration of LDL-C in both groups of animals was not significantly different. ", "The expression of *LDL receptor* in hamsters fed on the high-cholesterol diet was significantly down-regulated, signifying the possibility that high intracellular cholesterol reduced and suppressed synthesis of LDL receptors. ", "LDL-C in excess was not efficiently taken up by the limited amounts of LDL receptors, hence decreasing LDL-C clearance from peripheral tissues [@pone.0070058-Huang1], [@pone.0070058-Pitman1]. ", "This could explain the elevation of serum LDL-C observed in the present study. ", "This finding is consistent with another study in hamsters [@pone.0070058-Horton1] where high-cholesterol diet caused down-regulation of *LDL receptor* expression. ", "On the other hand, administration of *T. indica* fruit pulp to hypercholesterolaemic hamsters significantly up-regulated the hepatic mRNA levels of *LDL receptor*. ", "This result suggests that *T. indica* fruit pulp could have induced *LDL receptor* gene expression, causing increased uptake and clearance of LDL-C from peripheral tissues, thus decreasing serum LDL-C concentration in hypercholesterolaemic hamsters. ", "Indeed, plant extracts have been reported to be able to lower LDL-C levels by increasing LDL receptor activities [@pone.0070058-Bursill1]. ", "It was reported that HepG2 cells treated with cacao polyphenols such as catechin elevated LDL receptor activity [@pone.0070058-Yasuda1]. ", "Catechin which is also present in the *T. indica* fruit pulp could have contributed towards reducing LDL-C in the hypercholesterolaemic hamsters by inducing the expression of *LDL receptor.*", "\n\nAnother gene that was measured in this study was *Apo A1* which codes for Apolipoprotein A1 (Apo A1). ", "Apo A1 is one of the major lipoprotein constituents of HDL-C and is involved in cholesterol efflux from tissues to liver for excretion [@pone.0070058-Shoulders1]. ", "Some studies have reported inverse relationship between serum Apo A1 levels and CHD [@pone.0070058-Fruchart1], [@pone.0070058-Miller1]. ", "Similarly, over-expression of *Apo A1* in *Apo A1* transgenic mice has been shown to increase HDL-C and reduce the risk against diet-induced atherosclerosis [@pone.0070058-Rubin1]. ", "The possible mechanism exerted by Apo A1 to provide cardioprotective effects include its role in reversing cholesterol transport which is the main pathway to eliminate excess cholesterol from peripheral tissues and to transport them to the liver. ", "Cholesterol in the liver is then partially converted into bile acids and subsequently excreted in bile. ", "Thus, the concentration of HDL-C is highly correlated with Apo A1 levels and *Apo A1* gene expression may be an essential determinant of HDL-C. Therefore, increasing the production of Apo A1 by enhancing its gene transcription in the liver would be greatly advantageous.", "\n\nIn this study, hepatic expression of *Apo A1* was down-regulated in hamsters fed with high-cholesterol diet compared with control, indicating that the cholesterol-enriched diet suppressed the *Apo A1* expression which could have led to the observed elevated total cholesterol and triglyceride levels. ", "A report showed that high-cholesterol diet decreased the levels of Apo A1 in rabbits [@pone.0070058-Zhao1]. ", "However, in this study, the down-regulation of *Apo A1* expression was not accompanied by a decreased in HDL-C levels in the hypercholesterolaemic hamsters. ", "This is unexpected because suppression of *Apo A1* gene is predicted to also decrease HDL-C levels. ", "It is possible that other mechanisms maybe involved in regulating HDL-C levels. ", "For instance, overexpression of lecithin cholesterol acyltransferase (LCAT) in hamsters had been reported to increase HDL-C levels [@pone.0070058-Zhang1]. *", "T. indica* fruit pulp supplementation to normal hamsters neither altered the expression of hepatic *Apo A1* gene nor the levels of HDL-C. However, in hypercholesterolaemic hamsters, *T. indica* fruit pulp was able to up-regulate *Apo A1* gene expression as well as increase HDL-C levels suggesting the role of the extract in reverse cholesterol transport mechanism.", "\n\nReverse cholesterol transport also includes the secretion of excess cholesterol in the liver into the bile. ", "The efflux of the cholesterol is controlled by adenosine triphosphate (ATP)-binding cassette sub-family G member 5 (ABCG5) and (ATP)-binding cassette sub-family G member 8 (ABCG8) encoded by *Abcg5* and *Abcg8* genes, respectively. ", "They are mainly expressed in the liver and are up-regulated in response to high-cholesterol diet [@pone.0070058-Berge1]. ", "In this study, adding cholesterol to the diet significantly down-regulated hepatic *Abcg5* and *Abcg8* expressions. ", "The suppression of these two genes by cholesterol would limit efflux of cholesterol to the bile duct, resulting in the elevation of serum cholesterol concentrations which was observed in the serum of the hamsters. ", "Interestingly, feeding of *T. indica* fruit pulp to hypercholesterolaemic hamsters significantly up-regulated expression of *Abcg5*. ", "This result suggests that *T. indica* fruit pulp stimulates *Abcg5* in response to the high-cholesterol diet intake to increase cholesterol secretion into the bile and inhibit cholesterol absorption, thus lowering serum cholesterol levels. ", "Yu *et al*. [", "@pone.0070058-Yu1] reported that over-expression of *Abcg5* and *Abcg8* in mice promoted cholesterol efflux and lowered plasma cholesterol concentrations. ", "Transgenic mice expressing both human and mouse *Abcg5* and *Abcg8* genes had 50% reduction in cholesterol absorption and marked increased in biliary cholesterol and faecal neutral sterol secretion [@pone.0070058-Wilund1]. ", "It has been suggested that *Abcg5* and *Abcg8* may work in concert as an apical sterol export pump to promote cholesterol and plant sterol efflux [@pone.0070058-Berge1]. ", "However, data from this study did not support this hypothesis as only the expression of *Abcg5* was up-regulated but there was no significant difference in *Abcg8* expression between hypercholesterolaemic hamsters and hypercholesterolaemic hamsters supplemented with the *T. indica* fruit pulp. ", "Our findings support our previous *in vitro* study [@pone.0070058-Razali1] where only *ABCG5* and not *ABCG8* was up-regulated in response to *T. indica* fruit pulp treatment of HepG2 cells.", "\n\nAnother gene that was studied was *Mtp* which encodes the heterodimeric microsomal triglyceride transfer protein (MTP). ", "MTP is rate-limiting for assembly and secretion of apoB-containing lipoproteins such as very low density lipoprotein (VLDL-C) and chylomicrons [@pone.0070058-Gregg1], [@pone.0070058-Wetterau1]. ", "Diet enriched with cholesterol induced *Mtp* gene expression [@pone.0070058-Du1], [@pone.0070058-Gao1]. ", "In the present study, expression of *Mtp* gene was up-regulated in hypercholesterolaemic hamsters and this was accompanied by elevated triglyceride levels. ", "It is possible that increased amounts of MTP are needed for the clearance of elevated triglyceride accumulated in the liver of hypercholesterolaemic hamsters. ", "Bennett and Bruce [@pone.0070058-Bennett1] showed that hepatic *Mtp* gene expression and triglyceride levels increased in hamsters fed with cholesterol in a dose-dependent manner. ", "Interestingly, the administration of *T. indica* fruit pulp to hypercholesterolaemic hamsters down regulated the expression of *Mtp* gene. ", "This suggests that *T. indica* fruit pulp could provide lipid-lowering effect partially by decreasing hepatic *Mtp* gene expression, hence suppressing the assembly, accumulation and secretion of apo B-containing lipoproteins and triglyceride from liver to blood circulation. ", "One of the active compounds in *T. indica*, naringenin, had been shown to reduce apoB accumulation in HepG2 cells via the inhibition of MTP activity and expression [@pone.0070058-Wilcox1] and this may explain the reduction of triglyceride in the *T. indica* fruit pulp-treated hypercholesterolaemic hamsters.", "\n\nIn this study, we also tested the effects of *T. indica* fruit pulp on markers of oxidative stress and antioxidant activities as plants rich in antioxidants have the potential to protect against oxidative damage. ", "CAT, SOD and GPx are antioxidant enzymes which play a significant role in the cellular defense against deleterious effects of free radicals. ", "A decrease in the activities of these enzymes could increase the availability of O~2~ ^•^ and H~2~O~2~, which can lead to the production of OH^•^, subsequently initiating oxidative damage.", "\n\nThe reduced antioxidant activities as well as CAT, SOD and GPx activities in hypercholesterolaemic hamsters indicated possible oxidative stress conditions, leading to increased levels of O~2~ ^•^ and H~2~O~2~ CAT and SOD had been reported to be inactivated by ROS and lipid peroxides [@pone.0070058-Daniel1], [@pone.0070058-Halliwell1]. ", "Administration of *T. indica* fruit pulp to either control or hypercholesterolaemic hamsters increased antioxidant activities together with activities of CAT, SOD and GPx, although for GPx, this was only significant in the liver. ", "Increased SOD implies increased capacity to detoxify O~2~ ^•^, leading to increased production of H~2~O~2~. Concurrently, increased CAT and GPx allowed for the effective removal of excess H~2~O~2~. Thus *T. indica* fruit pulp could prevent the cholesterol-induced oxidative stress by enhancing and restoring the antioxidant defense systems.", "\n\nMalondialdehyde (MDA), the end product in the oxidative breakdown of unsaturated fatty acids, is a marker used frequently to evaluate lipid peroxidation in tissues. ", "In the present study, the high-cholesterol diet induced lipid peroxidation, suggesting increased oxidative stress. ", "This could be due to increased free radical formation accompanied by reduced antioxidant enzyme and antioxidant activities. ", "Hypercholesterolaemia has been reported to elevate the levels of lipid peroxidation in hamsters [@pone.0070058-Martinello1]. ", "Administration of *T. indica* fruit pulp along with the high-cholesterol diet inhibited lipid peroxidation, demonstrating the protective effects of *T. indica* fruit pulp against oxidative damage. ", "The increased antioxidant activities and antioxidant enzymes could have also contributed towards the protective effects against lipid peroxidation. ", "Phenolics such as catechin, procyanidins and naringenin that are present in *T. indica* fruit pulp have been reported to improve the antioxidative defense mechanism by increasing antioxidant activities, SOD and CAT and inhibiting lipid peroxidation in rats [@pone.0070058-RamiroPuig1], [@pone.0070058-Lee1].", "\n\nBesides measuring the expression of genes in cholesterol metabolism, two genes (*Cyp1A1* and *Gstm1)* involved in xenobiotic metabolism were also evaluated. ", "Their differential expression can provide beneficial information on the effect of the fruit pulp on antioxidant activities and oxidative stress. ", "Xenobiotics and carcinogens are generally detoxified by phase I and phase II enzymes. ", "Phase I detoxifying enzymes mainly composed of cytochrome P450 (CYP) supergene family of enzymes while phase II detoxifying enzymes comprised of glutathione S-transferase (GST) family. ", "Variations in the expression of phase I and phase II detoxification enzymes may explain the carcinogenic effects leading to cancer. ", "Hence, the influence of *T. indica* fruit pulp and cholesterol on the expression of genes related to detoxification was measured by qRT-PCR.", "\n\nCytochrome P450 Cyp1A1 is one of the members of the CYP family involved in the metabolism of drugs, environmental pollutants and carcinogens as well as a small number of endogenous substrates [@pone.0070058-Kittichanun1], [@pone.0070058-Uno1]. ", "In this study, hypercholesterolaemic hamsters showed down-regulation of hepatic *Cyp1A1* expression. ", "However, *T. indica* fruit pulp administration to the hypercholesterolaemic hamsters reversed this condition. ", "The induction of *Cyp1A1* might be essential to provide protection from the harmful effects of disruptors in the environment. ", "Our study also showed that feeding of *T. indica* fruit pulp to hamsters induced *Cyp1A1* gene expression as compared to control hamsters. ", "Quiñones and Lucas [@pone.0070058-Quiones1] reported that people carrying *CYP1A1* polymorphism could be more susceptible to lung cancer induced by environmental pollutants. ", "This may indicate that *T. indica* fruit pulp has the potential to defend against carcinogenic risk via the induction of *Cyp1A1* gene expression. ", "Although some studies have reported the carcinogenic effects of *Cyp1A1* [@pone.0070058-Surekha1], [@pone.0070058-Suzuki1], more recent studies have implied potential detoxication as well as chemoprevention activities of *Cyp1A1* [@pone.0070058-Androutsopoulos1]. ", "Several phytochemicals including the flavonoids quercetin was reported to induce the expression of *Cyp1A1* in MCF-7 breast cancer cells [@pone.0070058-Ciolino1].", "\n\n*Gstm1* encodes the glutathione S-transferase Mu 1, an enzyme involved in phase II detoxification of electrophilic compounds such as products of oxidative stress, environmental toxins and carcinogens and its impairment is associated with increased cancer risk [@pone.0070058-Masood1]. ", "The hepatic *Gstm1* gene expression level was significantly lowered in hamsters fed cholesterol diet compared with control. ", "This signifies that cholesterol potentially inhibits the expression of *Gstm1,* thus enhancing the susceptibility of hypercholesterolaemic hamsters to environmental and carcinogenic challenges. ", "Administration of *T. indica* fruit pulp to hypercholesterolaemic hamsters induced *Gstm1* expression to a level similar to control hamsters. ", "In addition, administration of *T. indica* fruit pulp to control hamsters also increased the hepatic *Gstm1* gene expression significantly. ", "These results suggest that *T. indica* fruit pulp could reverse the detrimental effects of high-cholesterol diet and contribute to the prevention of carcinogenesis by inducing the phase II detoxifying enzyme. ", "Together, the regulation of both *Cyp1A1* and *Gstm1* by *T. indica* fruit pulp seems to be in a coordinated manner.", "\n\nConclusion {#s4a}\n----------\n\nIn conclusion, this study shows that *T. indica* fruit pulp is a natural health food with hypocholesterolaemic and antioxidant properties. *", "T. indica* fruit pulp exerts its potential hypocholesterolaemic action by increasing hepatic gene expression of *Apo A1*, *Abcg5* and *LDL receptor* while suppressing *HMG-CoA reductase* and *Mtp* gene expressions. ", "Hence, *T. indica* fruit pulp could potentially enhance cholesterol efflux, inhibit cholesterol biosynthesis, increase uptake and clearance of LDL-C from peripheral tissues and suppress triglyceride accumulation in the liver. ", "On the other hand, supplementation of *T. indica* fruit pulp to hamsters did not lead to notable changes in lipid profiles compared to control hamsters. ", "These observations imply that the fruit pulp is only beneficial under hypercholesterolaemic conditions. ", "In addition, *T. Indica* fruit pulp can also prevent oxidative damage, particularly oxidation of LDL-C, which is one of the risk factors for atherosclerosis. ", "These beneficial effects may be attributed to the phytochemical constituents, including the many phenolic and flavonoid compounds in the *T. indica* fruit pulp. *", "T. indica* fruit pulp may have clinical applications particularly in individuals with hypercholesterolaemia who may benefit from the cholesterol-lowering effect of this plant as well as its potential protection against oxidative damage. ", "However, further work is needed to confirm the efficacy and proper dosage of the *T. indica* fruit pulp as a potential cholesterol-lowering agent including human trials to gain further insight into its therapeutic effect.", "\n\n[^1]: **Competing Interests:**The authors have declared that no competing interests exist.", "\n\n[^2]: Conceived and designed the experiments: SMJ AAA. ", "Performed the experiments: CYL MAA. ", "Analyzed the data: CYL SMJ AAA. ", "Contributed reagents/materials/analysis tools: SMJ AAA. ", "Wrote the paper: CYL SMJ AAA.", "\n" ]

{ "pile_set_name": "PubMed Central" }

[ 0.0014888870064169168, 0.0006332391640171409, 0.006043588276952505, 0.0006130081601440907, 0.0007568539585918188, 0.000722820870578289, 0.0007654662476852536, 0.0006385329179465771, 0.004254132509231567, 0.0007946823025122285, 0.0006585966912098229, 0.0015345292631536722, 0.0007773818797431886, 0.0007940732757560909, 0.0006889323121868074, 0.006675399839878082, 0.0006626282120123506, 0.00244251755066216, 0.0005515257944352925, 0.0006588129908777773, 0.0006848830380477011, 0.0007275842363014817, 0.0007379553862847388, 0.0005562882288359106, 0.000614566495642066, 0.000946575019042939, 0.0008167808409780264, 0.0008347605471499264, 0.0007372900727204978, 0.0007364204502664506, 0.0005925351288169622, 0.0005764636443927884, 0.0006659184000454843, 0.0005691360565833747, 0.0006760123069398105, 0.0006158236064948142, 0.0005775969475507736, 0.000975128379650414, 0.0012761810794472694, 0.0006916093407198787, 0.0006213843007571995, 0.00057974987430498, 0.0006188275292515755, 0.0005636775167658925, 0.0006046393536962569, 0.0007145831477828324, 0.0009532329277135432, 0.0006504927878268063, 0.0005922039854340255, 0.0007825967622920871, 0.0007716005202382803, 0.0006416010437533259, 0.0006446970510296524, 0.0005632349639199674, 0.0009994026040658355, 0.0007894716691225767, 0.0009100947063416243, 0.0005994044477120042, 0.0005743869114667177, 0.0005612922832369804, 0.0009417541441507638, 0.0010751934023573995, 0.0006781494012102485, 0.0008214833214879036, 0.0008716587908565998, 0.0006267103017307818, 0.0005601507145911455, 0.00074234907515347, 0.001020592637360096, 0.0006613850709982216, 0.0006978096207603812, 0.0006849581259302795, 0.0007587947766296566, 0.0005867379950359464, 0.0006417044205591083, 0.0007552051683887839, 0.0007942012161947787, 0.0005812514573335648, 0.0006104002823121846, 0.0007879632175900042, 0.0007454526494257152, 0.000789195648394525, 0.0010739737190306187, 0.002096344716846943, 0.067948117852211, 0.0006776474183425307, 0.002943666186183691, 0.000745651195757091, 0.0008076698868535459, 0.0006753451307304204, 0.000623115396592766, 0.0006913737743161619, 0.0006683649844489992, 0.0007270596106536686, 0.0006994588766247034, 0.000819220207631588, 0.0010420875623822212, 0.000554175057914108, 0.0010962567757815123, 0.0007494856836274266, 0.0006233277963474393, 0.003226769622415304, 0.0012735376367345452, 0.0007437900057993829, 0.01934807188808918, 0.0007697161054238677, 0.0006406643660739064, 0.0011723008938133717, 0.003884338540956378, 0.0018828526372089982, 0.0006172371795400977, 0.0006777878734283149, 0.0010387097718194127, 0.0006604528171010315, 0.000771325605455786, 0.000734817935153842, 0.0005934521905146539, 0.0005975859821774065, 0.0006175345624797046, 0.0006573551218025386, 0.0007310653454624116, 0.0005968078621663153, 0.0006419967394322157, 0.0007302844314835966, 0.000636081793345511, 0.0005958186229690909, 0.0005442604888230562, 0.0005813600728288293, 0.0006005981704220176, 0.0006307290168479085, 0.0005610633525066078, 0.0007212781929410994, 0.0013311526272445917, 0.0009592249989509583, 0.0012735376367345452, 0.006182018201798201, 0.0008165023755282164, 0.001032114028930664, 0.0007827437366358936, 0.0005714839790016413, 0.0019055769080296159, 0.0007749138167127967, 0.0007372936233878136, 0.0009223005617968738, 0.0005872974870726466, 0.0006896838312968612, 0.0005786921246908605, 0.0033782992977648973, 0.002336999634280801, 0.0034611530136317015, 0.001294867368414998, 0.0012735376367345452, 0.0011798216728493571, 0.0007774904370307922, 0.0006984216743148863, 0.001110169687308371, 0.0011471000034362078, 0.02320144698023796, 0.0008453162154182792, 0.0058416943065822124, 0.0009060662123374641, 0.0007017997559159994, 0.004515239503234625, 0.0012735376367345452, 0.0020260813180357218, 0.0009889830835163593, 0.0006984216743148863, 0.00619469815865159, 0.0005870350287295878, 0.0014209590153768659, 0.0005953752552159131, 0.02121039107441902, 0.001605495112016797, 0.00093298708088696, 0.0038918214850127697, 0.0012179136974737048, 0.0012330807512626052, 0.0020428395364433527, 0.0012735376367345452, 0.00254976493306458, 0.0009232994052581489, 0.0006984216743148863, 0.0011381475487723947, 0.0017270385287702084, 0.0012735376367345452, 0.0019221223192289472, 0.0008219637093134224, 0.0006984216743148863, 0.0011381475487723947, 0.0012103053741157055, 0.0007261829450726509, 0.015442730858922005, 0.0007440425106324255, 0.000832350633572787, 0.0006627946277149022, 0.011444726027548313, 0.0006047062342986465, 0.0008611681405454874, 0.0008999945712275803, 0.002338041551411152, 0.0023421416990458965, 0.003944604657590389, 0.0008183670579455793, 0.0008896840736269951, 0.0006358423852361739, 0.0008593659731559455, 0.0026325329672545195, 0.009037037380039692, 0.0022369162179529667, 0.0008453162154182792, 0.0006810033228248358, 0.0009575279545970261, 0.001253213849849999, 0.001029993873089552, 0.0008822939707897604, 0.0006800000555813313, 0.003982184920459986, 0.013791978359222412, 0.000832350633572787, 0.006298225838690996, 0.0018013493390753865, 0.003156835213303566, 0.0024704739917069674, 0.003982496913522482, 0.005400841124355793, 0.001593344728462398, 0.0006771464832127094, 0.0006254632025957108, 0.0005768233677372336, 0.001223434810526669, 0.0007098198984749615, 0.0007122026872821152, 0.0008632076205685735, 0.0007177937077358365, 0.000685292761772871, 0.0006162208155728877, 0.0019024696666747332, 0.0016714256489649415, 0.0017093410715460777, 0.0033514632377773523, 0.0027921530418097973, 0.03332161530852318, 0.005013610702008009, 0.00269312527962029, 0.0008640893502160907, 0.004079892765730619, 0.006352300755679607, 0.000832350633572787, 0.002051939256489277, 0.0009798351675271988, 0.0007767191855236888, 0.0030229822732508183, 0.0006218597409315407, 0.0007998953224159777, 0.002952153794467449, 0.0007984339026734233, 0.000832350633572787, 0.0011158101260662079, 0.0013193651102483273, 0.0009906814666464925, 0.0006475234986282885, 0.0006000437424518168, 0.0007816636352799833, 0.0014536973321810365, 0.0009042593301273882, 0.0006576994783245027, 0.0012486552586778998, 0.0009549500537104905, 0.011376850306987762, 0.0007512411684729159, 0.0007310556247830391, 0.0009417784167453647, 0.0006038777064532042, 0.0006779814139008522, 0.0005895835347473621, 0.001684358692727983, 0.0006193264271132648, 0.0031670010648667812, 0.0006420527352020144, 0.0005589285865426064, 0.0014930738834664226, 0.004529130179435015, 0.0042362515814602375, 0.0005932421190664172, 0.0007733672391623259, 0.002021420979872346, 0.0006794011569581926, 0.004854300059378147, 0.000590678071603179, 0.000817200867459178, 0.0007983791292645037, 0.022373581305146217, 0.0007140259840525687, 0.000921226863283664, 0.0007614825735799968, 0.005809016525745392, 0.0007095020264387131, 0.0005779562634415925, 0.00291642383672297, 0.0017024930566549301, 0.0015571697149425745, 0.0009800110710784793, 0.0007602170226164162, 0.0008848359575495124, 0.0023680315352976322, 0.0021212403662502766, 0.0007404657662846148, 0.0008470723987556994, 0.000835378363262862, 0.0008213948458433151, 0.0007991848397068679, 0.0009772516787052155, 0.0006517218425869942, 0.000682571844663471, 0.000983131816610694, 0.0008374142344109714, 0.0015050346264615655, 0.0049068862572312355, 0.004782256670296192, 0.0017346455715596676, 0.0011397652560845017, 0.0019339140271767974, 0.0007622088887728751, 0.0009096776484511793, 0.0007310264045372605, 0.001857474446296692, 0.0011422357056289911, 0.0008999367710202932, 0.0008870307938195765, 0.0008357015904039145, 0.0007089494029060006, 0.009995883330702782, 0.0016845791833475232, 0.000977673102170229, 0.0012397641548886895, 0.0005784497479908168, 0.0006180907366797328, 0.0006228627753444016, 0.0008433841285295784, 0.0007190175820142031, 0.0006660777144134045, 0.0007313252426683903, 0.009112530387938023, 0.002078691264614463, 0.000626188179012388, 0.0039970763027668, 0.003006153041496873, 0.0007086353143677115, 0.0006583990179933608, 0.0007726371986791492, 0.0010750234359875321, 0.0017221653833985329, 0.0032240625005215406, 0.017126725986599922, 0.0018835723167285323, 0.0008145486935973167, 0.0006111250258982182, 0.0007850867114029825, 0.0011729130055755377, 0.0008860395173542202, 0.0030194749124348164, 0.0006452343659475446, 0.0008183069876395166, 0.0006163975922390819, 0.0008341518114320934, 0.0005443445406854153, 0.0006029544165357947, 0.0006360829574987292, 0.0006977876764722168, 0.0006606552051380277, 0.0006219074712134898, 0.000747168727684766, 0.001995444530621171 ]

[ "Enroll Online - It's Safe, Secure & Easy\n\nTo begin, please fill out the fields in the form shown. ", "One of our representatives will contact you within one business day to complete the process.", "\n\nThis form supports 256 bit SSL encryption, ensuring that no one else will see your personal information while it is in transit. ", "Please view our Privacy Policy for more information\n\nPersonal Information\n\nFirst Name\n\nOKFirst Name is required\n\nLast Name\n\nOKLast Name is required\n\nSocial Security Number\n\n--\n\nOKSocial Security Number is required\n\nE-mail Address\n\nOKE-mail Address is required\n\nMobile Number\n\n--\n\nOKMobile Number is required\n\nAccount #\n\nOKAccount # is required\n\nAccount Nickname\n\nOptionalOKAccount Nickname is required\n\nAccount Type\n\nOKAccount Type is required\n\nSecond Account #\n\nOptionalOKSecond Account # is required\n\nAccount Nickname\n\nOptionalOKAccount Nickname is required\n\nAccount Type\n\nOKAccount Type is required\n\nThird Account #\n\nOptionalOKThird Account # is required\n\nAccount Nickname\n\nOptionalOKAccount Nickname is required\n\nAccount Type\n\nOKAccount Type is required\n\nAnticipated number of deposits per month\n\nOKAnticipated number of deposits per month is required\n\nAnticipated average deposit AMOUNT per month.00\n\nOKAnticipated average deposit AMOUNT per month is required\n\nWhat types of deposits do you anticipate making? (", "check all that apply)\n\nPayroll\n\nMisc Personal\n\nCashiers Checks or Money Orders\n\nOther\n\nOKWhat types of deposits do you anticipate making? (", "check all that apply) is required\n\nWhat type of device do you plan on using?", "\n\nOKWhat type of device do you plan on using? ", "is required\n\nI am an existing Signature Online Banking user\n\nYes\n\nNo\n\nOKI am an existing Signature Online Banking user is required\n\nPlease enter your desired User Name which must be between 6 and 20 characters and can contain only letters, numbers or dashes “-“. ", "If the User Name you have requested is not available, Signature Bank of Arkansas will provide a similar but alternate User Name for you.", "\n\nUser Name\n\nOKUser Name is required\n\nComments\n\nAnything else you think we need to know?", "\n\nOptionalOKAnything else you think we need to know? ", "is required\n\nSecurity Code\n\nEnter the Security Code\n\nOKEnter the Security Code is required\n\nEach signer authorizes Signature Bank of Arkansas, or any affiliated companies, to request and obtain from time to time, reports or other information from any reporting agencies including, but not limited to, eFunds, Inc." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005306986859068274, 0.0005218620644882321, 0.000824541028123349, 0.0007999147637747228, 0.0031653244514018297, 0.000702532532159239, 0.0015814503422006965, 0.0006066180649213493, 0.000562923145480454, 0.0008826883276924491, 0.0010645752772688866, 0.0005967310862615705 ]

[ "A review of myocardial normothermia: its theoretical basis and the potential clinical benefits in cardiac surgery.", "\nMyocardial protection during cardiac surgery aims to preserve myocardial function while providing a bloodless and motionless operating field to make surgery easier. ", "Myocardial protection is achieved by decreasing the oxygen needs using hypothermia and producing electromechanical cardiac arrest using potassium infusion which allows surgery to be performed on a non-beating heart. ", "The deleterious effects of hypothermia include dysfunction of enzymatic systems, development of acidosis, a decrease in tissue oxygen delivery, an increase in blood viscosity and a decrease in erythrocyte deformability. ", "Ninety percent of the decrease in oxygen consumption is obtained by inducing electromechanical arrest and inducing hypothermia has little additional benefit. ", "Maintenance of systemic and myocardial normothermia reduces problems and provides a more physiological approach for cardiopulmonary bypass (CPB). ", "The current results obtained using normothermic protection are very encouraging, and it is an easier inexpensive option. ", "This review summarizes the current knowledge on the benefits of normothermia, based upon experimental and clinical studies." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0012433768715709448, 0.0017178261186927557, 0.0068685319274663925, 0.008449245244264603, 0.0011649372754618526, 0.00122919213026762, 0.0005806077970191836, 0.0006028403295204043 ]

[ "---\nabstract: 'We use the classical construction of Schottky groups in hyperbolic geometry to produce non-Schottky subgroups of the mapping class group.'", "\naddress:\n- 'Department of Mathematics, Brown University, Providence, RI 02912'\n- 'Department of Mathematics, University of Illinois, Urbana, IL 61801'\nauthor:\n- 'Richard P. Kent IV'\n- 'Christopher J. Leininger'\ndate: 'September 23, 2008'\ntitle: 'A fake Schottky group in $\\mathrm{\\mathbf{Mod}}(S)$'\n---\n\n[^1]\n\n[^2]\n\nIntroduction\n============\n\nIn hyperbolic geometry, a Schottky group is a free convex cocompact Kleinian group, classically constructed as follows. ", "Pick four pairwise disjoint closed balls $B_1^-$, $B_2^-$, $B_1^+$, $B_2^+$ in $S^{n-1}_\\infty$, the ideal boundary of hyperbolic $n$–space. ", "Suppose there are isometries $f_1$ and $f_2$ so that $$f_i(B_i^-) = \\overline{S^{n-1}_\\infty - B_i^+}.$$ Then $\\langle f_1, f_2 \\rangle$ is a Schottky group isomorphic to the free group $F_2$ of rank two.", "\n\nNow let $S$ be a closed surface of genus $g \\geq 2$ and let $\\Mod(S) = \\pi_0({{\\text{Homeo}}}^+(S))$ be its mapping class group. ", "By way of analogy with the theory of Kleinian groups, B. Farb and L. Mosher defined [@FM] a notion of convex cocompactness for subgroups of $\\Mod(S)$. In this setting, a *Schottky group* is a free convex cocompact subgroup of $\\Mod(S)$. In [@KL1; @KL2], we extended Farb and Mosher’s analogy, providing several characterizations of convex cocompactness borrowed from the Kleinian setting (see also Hamenstädt [@H]). ", "The analogy is an imperfect one, see [@KL3] and the references there, and we point out some new imperfections here.", "\n\n\\[funny example1\\] There exist pseudo-Anosov elements $f_1$ and $f_2$ in $\\Mod(S)$ and pairwise disjoint closed balls $B_1^-, B_2^-,B_1^+, B_2^+$ in $\\PML(S)$ for which $$f_i(B_i^-) = \\overline{\\PML(S) - B_i^+}$$ and yet $\\langle f_1, f_2 \\rangle \\cong F_2$ is not a Schottky group.", "\n\nThe construction is based on work of N. Ivanov, and it is clear from his work in [@I] that he was aware of this construction (see also McCarthy [@Mc]). ", "The group $G = \\langle f_1,f_2 \\rangle$ contains reducible elements and so fails to be convex cocompact. ", "It is worth noting that there are sufficiently high powers of the $f_i$ that generate a Schottky group, as proven by Farb and Mosher [@FM], see also [@KL1; @H].", "\n\nPart of the analogy between Kleinian groups and mapping class groups was developed by J. McCarthy and A. Papadopoulos [@MP], who constructed a limit set $\\Lambda_G$ and domain of discontinuity $\\Delta_G \\subset \\PML(S) - \\Lambda_G$ for any subgroup $G < \\Mod(S)$, see Section \\[propersection\\]. ", "Unlike in the Kleinian setting, $\\Delta_G \\neq \\PML(S) - \\Lambda_G$ in general. ", "While examples illustrate the necessity of taking an open set strictly smaller than $\\PML(S) - \\Lambda_G$ as a domain of discontinuity, it is not clear that $\\Delta_G$ is an optimal choice. ", "In [@KL1], we asked whether or not $\\Delta_G$ is the largest open set on which $G$ acts properly discontinuously—see Question 3 there. ", "Here, we answer this in the negative.", "\n\nThere is an obvious open set on which our group $G = \\langle f_1, f_2 \\rangle$ acts properly discontinuously and cocompactly, namely $$\\Omega = \\bigcup_{g \\in G} \\ g \\cdot \\Theta$$ where $\\Theta$ is the closure of the complement of our four balls. ", "To see that $\\Omega$ is open, note that $\\Theta$ is contained in the interior $\\mathcal{U}$ of $$f_1(\\Theta) \\cup f_1^{-1}(\\Theta) \\cup f_2(\\Theta) \\cup f_2^{-1}(\\Theta)$$ and that $$\\Omega = \\bigcup_{g \\in G} \\ g \\cdot \\mathcal{U}$$ If the $f_i$ are chosen carefully, the set $\\Omega$ will contain $\\Delta_G$ properly, and we have the following theorem.", "\n\n\\[pdexample\\] There are irreducible subgroups $G < \\Mod(S)$ for which $\\Delta_G$ is [not]{.nodecor} the largest open set on which $G$ acts properly discontinuously.", "\n\nAsymmetry of the construction provides another domain $\\Omega'$ on which $G$ acts properly discontinuously, and we will also show that $G$ does not act properly discontinuously on the union $\\Omega \\cup \\Omega'$.\n\nThough $\\Delta_G$ is not a maximal domain of discontinuity, we show in Section \\[finalcomments\\] that, for the groups in Theorem \\[pdexample\\], it is nonetheless the intersection of all such maximal domains.", "\n\nSurface dynamics {#prelimsection}\n================\n\nIf $\\mathcal X$ is a subset of $\\PML(S)$, we let $$Z \\mathcal X= \\{ [\\nu] \\in \\PML(S) \\, | \\, i(\\nu,\\mu) = 0 \\mbox{ for some } [\\mu] \\in \\mathcal X \\}$$ be the *zero locus of $\\mathcal{X}$*. ", "If $\\mathcal X =\\{ [x] \\}$ we sometimes write $Z x$ for $Z \\mathcal X$.\n\nIf $f$ is pseudo-Anosov, then it acts with *north–south* dynamics on $\\PML(S)$, meaning that it has unique attracting and repelling fixed points $[\\mu^+_f]$ and $[\\mu^-_f]$, respectively—all other points are attracted to $[\\mu^+_f]$ under iteration of $f$. In fact, for any neighborhood $U$ of $[\\mu^+_f]$ and any compact set $K \\subset \\PML(S) - \\{[\\mu^-_f]\\}$, there is a natural number $N$ so that $$\\label{ping}\nf^n(K) \\subset U$$ for any $n \\geq N$.\n\nIvanov proves that there is a similar situation for most pure reducible elements (see the Appendix of [@I]). ", "In particular, suppose $\\alpha$ is a nonseparating simple closed curve in $S$ preserved by a mapping class $\\phi$ that is pseudo-Anosov when restricted to $S - \\alpha$. Let $[\\mu^+_\\phi]$ and $[\\mu^-_\\phi]$ be the stable and unstable laminations for $\\phi$ in $S - \\alpha$ considered laminations on $S$, and note that $$Z\\mu^-_\\phi = \\big\\{ [s\\mu^-_\\phi + (1-s)\\alpha] \\in \\PML(S) \\, | \\, s \\in [0,1] \\big\\}.$$ If $K \\subset \\PML(S) - Z\\mu^-_\\phi $ is a compact set and $U$ a neighborhood of $[\\mu^+_\\phi]$, then there is an $N > 0$ such that for all $n \\geq N$ we have $$\\label{pong}\n\\phi^n(K) \\subset U.$$\n\nGiven a mapping class $g$ of either type above, let $\\lambda(g)$ denote the *expansion factor* of $g$, the number such that $$g(\\mu_g^+) = \\lambda(g) \\mu_g^+.$$\n\nThe construction\n================\n\nLet $\\alpha$ be a nonseparating curve fixed by a mapping class $\\phi$ that is pseudo-Anosov on $S - \\alpha$, and let $[\\mu^+_{\\phi}]$ and $[\\mu^-_{\\phi}]$ be as in the previous section.", "\n\nLet $\\mathbb{S}_\\phi \\subset \\PML(S)$ be a bicollared $(6g-8)$–dimensional sphere dividing $\\PML(S)$ into two closed balls $\\mathcal A_{\\phi}$ and $\\mathcal B_{\\phi}$ containing $Z\\mu^-_{\\phi}$ and $[\\mu^+_\\phi]$, respectively.", "\n\nAccording to , there is an $N > 0$ so that for all $n \\geq N$ we have $$\\phi^n(\\mathcal B_{\\phi}) \\subset \\mathrm{int}(\\mathcal B_{\\phi}).$$ So we choose an $n \\geq N$, let $h = \\phi^n$, $B^-_h = \\mathcal A_{\\phi}$, and $B^+_h = h(\\mathcal B_{\\phi})$.\n\nRecall H. Masur’s theorem [@Ma] that the set $$\\{([\\mu^+_\\psi],[\\mu^-_\\psi]) \\, | \\, \\psi \\in \\Mod(S) \\mbox{ pseudo-Anosov} \\}$$ is dense in $\\PML(S) \\times \\PML(S)$. So we choose a pseudo-Anosov $\\psi$ whose fixed points $[\\mu^+_\\psi]$ and $[\\mu^-_\\psi]$ lie in $\\PML(S) - (B^-_h \\cup B^+_h)$. We let $\\mathbb{S}_\\psi \\subset \\PML(S)- (B^-_h \\cup B^+_h)$ be a bicollared $(6g-8)$–sphere which bounds two balls: $\\mathcal A_\\psi \\subset \\PML(S) - (B^-_h \\cup B^+_h)$ containing $[\\mu^-_\\psi]$ and $\\mathcal B_\\psi$ containing $[\\mu^+_\\psi]$. As $\\PML(S) - (B^-_h \\cup B^+_h)$ is a neighborhood of $[\\mu^+_\\psi]$, provides an $M > 0$ such that for all $m \\geq M$, we have $\\psi^m(\\mathcal B_\\psi) \\subset \\PML(S) - (B^-_h \\cup B^+_h)$. Arguing as in [@I], we may choose $m$ so that $\\psi^mh$ is pseudo-Anosov, and we do so. ", "We let $f = \\psi^m$, $B^-_f = \\mathcal A_\\psi$, and $B^+_f = f(\\mathcal B_\\psi)$.\n\nWe now have elements $f$, $h$, and pairwise disjoint closed balls $$B^-_h,B^+_h,B^-_f,B^+_f$$ with $$h(B^-_h) = \\overline{\\PML(S) - B^+_h} \\mbox{ and } f(B^-_f) = \\overline{\\PML(S) - B^+_f}.$$ See Figure \\[schottky1\\].", "\n\nLet $G = \\langle f,h \\rangle$, set $$\\Theta = \\overline{\\PML(S) - \\left( B^-_h \\cup B^+_h \\cup B^-_f \\cup B^+_f \\right)}.$$ and let $$\\Omega = \\bigcup_{g \\in G} g \\cdot \\Theta.$$ The group $G$ acts on $\\Omega$ properly discontinuously and cocompactly with fundamental domain $\\Theta$, and the usual ping–pong argument implies that $G \\cong F_2$.\n\nA slight modification now provides the desired example.", "\n\nWe let $f_1 = fh$ and $f_2 = f$, both pseudo-Anosov by construction. ", "Of course, $G = \\langle f_1,f_2 \\rangle$, and we need only find balls $B_1^\\pm$ and $B_2^\\pm$ with $$\\label{nest}\nf_i(B_i^-) = \\overline{\\PML(S) - B_i^+} .$$ Set $B_1^- = B^-_h$ and $B_1^+ = f(B^+_h)$. The ball $B_2^-$ is constructed as a regular neighborhood of $B^-_f \\cup B^+_h \\cup \\delta$ in $\\PML(S) - (B^-_h \\cup B^+_f)$, where $\\delta$ is an arc in $\\Theta$ from $B^-_f$ to $B^+_h$. The ball $B_2^+$ is defined to be $\\overline{\\PML(S) - f(B_2^-)}$. See Figure \\[schottky2\\].", "\n\nOne can now check .", "\n\nProper discontinuity {#propersection}\n====================\n\nLet $G = \\langle h,f \\rangle$ be the group constructed in the previous section, and let $\\partial G$ be the Gromov boundary of $G$. By the work in [@MP], the limit set $$\\Lambda_G = \\overline{ \\{ [\\mu^+_g] \\in \\PML(S) \\, | \\, g \\in G \\mbox{ is pseudo-Anosov} \\}}$$ is the unique minimal closed $G$–invariant subset of $\\PML(S)$. In [@KL2] we showed that one may choose $h$ and $f$ as above so that $G$ has the following property.", "\n\n\\[kluniform\\] There exists a continuous $G$–equivariant homeomorphism $$\\mathfrak{I}{\\colon\\thinspace}\\partial G \\to \\Lambda_G.$$ Moreover, for each $x \\in \\partial G$ which is a fixed point of a conjugate $^gh$ of $h$, $\\mathfrak{I}(x)$ is the stable or unstable lamination of that conjugate $^gh$ (respecting the dynamics). ", "Otherwise $\\mathfrak{I}(x)$ is a uniquely ergodic filling lamination. ", "In particular, every element $g \\in G$ not conjugate to a power of $h$ is pseudo-Anosov.", "\n\nWe henceforth assume that $G$ satisfies Property \\[kluniform\\].", "\n\nThe domain of discontinuity is defined to be $$\\Delta_G = \\PML(S) - Z \\Lambda_G .$$ This is an open set on which $G$ acts properly discontinuously [@MP], which justifies the name.", "\n\nWe may describe the zero locus $Z \\Lambda_G$ for $G$ explicitly. ", "For each conjugate $^g h$ of $h$, we have the attracting and repelling fixed points $x^\\pm_{^g\\!h}$ in $\\partial G$. By Property \\[kluniform\\], the map $\\mathfrak{I}$ sends these to the stable and unstable laminations $$\\mathfrak{I}(x^\\pm_{^g\\!h}) = [\\mu^\\pm_{^g\\!h}] = g [\\mu^\\pm_h].$$ For any such point $g [\\mu^\\pm_h] \\in \\Lambda_G$, the set $Z g\\mu^\\pm_h = gZ\\mu^\\pm_h$ is a $1$–simplex in $Z \\Lambda_G$. Since $\\mathfrak{I}(x)$ is uniquely ergodic and filling for every other point $x \\in \\partial G$, it follows that $Z \\Lambda_G$ is the union of $\\Lambda_G$ and all of these intervals.", "\n\nThe intervals $Z\\mu^-_h$ and $Z\\mu^+_h$ intersect each other at $\\alpha$, and so the union $$\\mathbb{J}_h = Z\\mu^-_h \\cup Z\\mu^+_h$$ is an interval joining $\\mu^-_h$ to $\\mu^+_h$. All in all, we have $$\\label{descriptionZ}\nZ \\Lambda_G = \\Lambda_G \\cup \\bigcup_{g \\in G} g\\, \\mathbb{J}_h$$\n\nWe impose one further restriction on $h$ and $f$—more precisely, on the balls $B^\\pm_f$. Since the fixed points of $f$ do not meet the interval $\\mathbb{J}_h$, we may replace $f$ with a power so that the balls $B^\\pm_f$ are disjoint from this interval. ", "This implies that $$\\mathrm{int}\\, Z \\mu^+_h = Z \\mu^+_h \\cap \\bigcup_{n\\in \\mathbb Z} h^n \\Theta$$ and so $Z \\mu^+_h$ intersects the $h^n$ translates of $\\Theta$, and no other $G$–translates. ", "As $Z \\mu^-_h$ does not intersect $\\Omega$, these are the only $G$–translates of $\\Theta$ that $\\mathbb{J}_h$ intersects. ", "Write $\\Sigma^\\pm_h = \\partial B^\\pm_h$ and $\\Sigma^\\pm_f= \\partial B^\\pm_f$.\n\nWe claim that $$\\Sigma^+_f \\cap Z \\Lambda_G = \\emptyset.$$ To see this, note that if $\\Sigma^+_f$ nontrivially intersected $Z \\Lambda_G$, it would do so in some $g \\mathbb{J}_h$, by ; and then $g$ must be a power of $h$, since $\\Sigma^+_f$ lies in $\\Theta$. But $h \\mathbb{J}_h = \\mathbb{J}_h$, and so $\\Sigma^+_f$ would intersect $\\mathbb{J}_h$, contrary to our choice of $f$. The claim follows.", "\n\nNow, Theorem \\[pdexample\\] will follow from\n\n\\[pdexample2\\] The set $\\Delta_G$ is properly contained in $\\Omega$. In fact, $$\\Omega = \\PML(S) - \\left( \\Lambda_G \\cup \\bigcup_{g\\in G} g Z\\mu^-_h \\right).$$\n\nFirst note that $\\Delta_G \\neq \\Omega$ as $\\Sigma^-_h \\subset \\Theta \\subset \\Omega$ nontrivially intersects $\\mathbb{J}_h \\subset Z \\Lambda_G = \\PML(S) - \\Delta_G$.\n\nTo prove the containment, we must gather some information about the complement of $\\Omega$. Let $\\mathfrak{X} = \\PML(S) - \\Omega$.\n\nThere is a continuous $G$–equivariant map $$\\mathfrak{K}{\\colon\\thinspace}\\mathfrak{X} \\to \\partial G.$$\n\nThe spheres $\\Sigma^\\pm_h$ and $\\Sigma^\\pm_f$ are bicollared with collars $N(\\Sigma^\\pm_h)$ and $N(\\Sigma^\\pm_f)$. We assume as we may that $$h(N(\\Sigma^-_h)) = N(\\Sigma^+_h) \\mbox{ and } f(N(\\Sigma^-_f)) = N(\\Sigma^+_f)$$ and that all of the $G$–translates of these collars are pairwise disjoint.", "\n\nLet $\\mathcal G$ be the Cayley graph of $G$ and identify $\\partial G = \\partial \\mathcal G$. We define a continuous $G$–equivariant map $$\\mathfrak{K}_0{\\colon\\thinspace}\\Omega \\to \\mathcal G$$ by identifying $\\mathcal G$ with the tree dual to the hypersurface $$\\bigcup_{g \\in G} g\\big(\\Sigma^-_h\\big) \\cup \\bigcup_{g \\in G} g\\big(\\Sigma^-_f \\big)$$ in $\\Omega$ and projecting in the usual manner, see [@Sh].", "\n\nThe map $\\mathfrak{K}_0$ extends continuously to a $G$–equivariant map $$\\mathfrak{K}{\\colon\\thinspace}\\PML(S) \\to \\overline{\\mathcal G} = \\mathcal G \\cup \\partial G$$ whose restriction to $\\mathfrak{X}$ is the map we desire. ", "The extension is described concretely as follows.", "\n\nFirst note that given any point $[\\eta] \\in \\mathfrak{X}$, there is a unique sequence of elements $$x_1^{\\epsilon_1},x_2^{\\epsilon_2},x_3^{\\epsilon_3},\\ldots$$ where $x_i \\in \\{f,h\\}$ and $\\epsilon_i \\in \\{ \\pm 1\\}$ with the property that $[\\eta]$ is contained in the nested intersection $$\\bigcap_{i=1}^\\infty x_1^{\\epsilon_1} \\cdots x_i^{\\epsilon_i}(B^{\\epsilon_i}_{x_i}).$$ where $B^{\\pm1}_h = B^\\pm_h$ and $B^{\\pm1}_f =B^\\pm_f$. Identifying $\\partial G$ with the set of infinite reduced words, our map is given there by $$\\mathfrak{K}([\\eta]) = x_1^{\\epsilon_1}x_2^{\\epsilon_2}x_3^{\\epsilon_3}\\cdots.$$\n\nTo see that $\\mathfrak{K}$ is continuous, let $\\mathcal U_g \\subset \\overline{\\mathcal G}$ be the open set consisting of all infinite reduced words in $\\partial G$ with prefix $g$ together with the union of the open tails of the corresponding paths in $\\mathcal G$. Now if $g$ ends in $x_0^{\\epsilon_0}$ with $x_0 \\in \\{h,f\\}$ and $\\epsilon_0 \\in \\{\\pm 1\\}$, then $$\\mathfrak{K}^{-1}(\\mathcal U_g) = gx_0^{-\\epsilon_0}(\\mathrm{int}\\, B^{\\epsilon_0}_{x_0})$$ which is open.", "\n\n$\\mathfrak{K}$ is a one-sided inverse to $\\mathfrak{I}$. That is, $\\mathfrak{K} \\circ \\mathfrak{I} = \\mathrm{id}_{\\partial G}$.\n\nSince $\\mathfrak{X}$ is a $G$–invariant closed set, it contains $\\Lambda_G$, and so $\\mathfrak{K} \\circ \\mathfrak{I}$ is well-defined. ", "Next, suppose that $x^+_f$ is the attracting fixed point of $f$. Then $\\mathfrak{I}(x^+_f) = [\\mu^+_f]$ is the attracting fixed point in $\\PML(S)$ of $f$, and hence $\\mathfrak{K}(\\mathfrak{I}(x^+_f)) = x^+_f$. The same is true for any conjugate of $f$, and hence $\\mathfrak{K} \\circ \\mathfrak{I}$ is the identity on the set of attracting fixed points of conjugates of $f$. Being $G$–invariant, this set is dense in $\\partial G$, and so, by continuity, $\\mathfrak{K} \\circ \\mathfrak{I}$ is the identity on all of $\\partial G$.\n\nTheorem \\[pdexample2\\] follows easily from the following lemma.", "\n\n\\[fiberszero\\] For all $x \\in \\partial G$, we have $\\mathfrak{K}^{-1}(x) \\subset Z \\mathfrak{I}(x)$. In fact, if $x$ is the repelling fixed point $x^-_{^g\\!h}$ of a conjugate $^gh$ of $h$, then $\\mathfrak{K}^{-1}(x) = g Z \\mu^-_h$. Otherwise, the set $\\mathfrak{K}^{-1}(x)$ is a singleton contained in $\\Lambda_G$.\n\nBy the first statement, $\\mathfrak{X} \\subset Z \\Lambda_G$ since $$Z \\Lambda_G = \\bigcup_{x \\in \\partial G} Z \\mathfrak{I}(x).$$ So $\\Omega \\supset \\Delta_G$ as required. ", "Again, the containment is proper as $Z\\mu^+_h$ nontrivially intersects $\\Omega$.\n\nThe description of $\\Omega$ follows from the second and third statements.", "\n\nWe need the following general fact about sequences of laminations.", "\n\n\\[boundedangles\\] Suppose $\\mathfrak{S} \\subset \\ML(S)$ is a compact set, $\\{f_k\\} \\subset \\Mod(S)$ is an infinite sequence of distinct pseudo-Anosov mapping classes with $$\\mu^\\pm_{f_k} \\to \\mu^\\pm$$ in $\\ML(S)$, and that $\\{\\nu_k \\}_{k=1}^\\infty \\subset \\mathfrak{S}$ and $\\{t_k \\}_{k=1}^\\infty \\subset \\mathbb R_+$ are sequences with $$t_k f_k(\\nu_k) \\to \\eta$$ in $\\ML(S)$.\n\nIf there is an $r > 0$ such that $$i(\\nu,\\mu^\\pm) > r$$ for all $\\nu \\in \\mathfrak{S}$, then $t_k \\to 0$.\n\nNote that continuity of $i$ and compactness of $\\mathfrak{S}$ imply that there exist $K > 0$ and $R > 1$ such that for all $k \\geq K$ and all $\\nu \\in \\mathfrak{S}$ $$\\frac{1}{R} < i\\big(\\nu,\\mu^\\pm_{f_k}\\big) < R .$$\n\nBy the continuity of $i$ we have $$\\lim_{k\\to\\infty} i\\big(t_kf_k(\\nu_k),\\mu^-_{f_k}\\big) = i(\\eta,\\mu^-),$$ and so, for sufficiently large $k$, we have $$i(\\eta,\\mu^-) - 1 < i\\big(t_kf_k(\\nu_k),\\mu^-_{f_k}\\big) < i(\\eta,\\mu^-) + 1.$$ The central term of this inequality is also given by $$\\begin{aligned}\n i\\big(t_kf_k(\\nu_k),\\mu^-_{f_k}\\big) & = i\\big(t_k \\nu_k,f_k^{-1}(\\mu^-_{f_k})\\big) \\\\\n & = t_k i\\big(\\nu_k,\\lambda(f_k^{-1})\\mu^-_{f_k}\\big) \\\\\n & = t_k \\lambda(f_k)i\\big(\\nu_k,\\mu^-_{f_k}\\big)\n \\end{aligned}$$ where $\\lambda(f_k)$ is the expansion factor of $f_k$, and so, for all sufficiently large $k$, we have $$\\frac{i(\\eta,\\mu^-) - 1}{R} < t_k \\lambda(f_k) < R(i(\\eta,\\mu^-) + 1).$$ Since the $f_k$ are all distinct, and their fixed points converge in $\\PML(S)$, it follows that $\\lambda(f_k) \\to \\infty$. So $t_k \\to 0$ as required.", "\n\nFirst assume that $x \\in \\partial G$ is the fixed point of a conjugate of $h$. By the $G$–equivariance of $\\mathfrak{K}$, it suffices to consider the case of $h$ itself. ", "Then, we have $x = x^+_h$ or $x = x^-_h$. In this case, the sequences of balls nesting to $\\mathfrak{K}^{-1}(x^+_h)$ and $\\mathfrak{K}^{-1}(x^-_h)$ are given by $$\\{h^k(B^+_h)\\}_{k=1}^\\infty \\mbox{ and } \\{h^{-k}(B^-_h)\\}_{k=1}^\\infty,$$ respectively.", "\n\nFrom the discussion in Section \\[prelimsection\\], we already know that $$\\mathfrak{K}^{-1}(x^+_h) = \\bigcap_{k=1}^\\infty h^k(B^+_h) = \\{ [\\mu^+_h]\\} \\subset Z \\mathfrak{I}(x^+_h)$$ and $$\\mathfrak{K}^{-1}(x^-_h) = \\bigcap_{k=1}^\\infty h^{-k}(B^-_h) = Z\\mu^-_h = Z \\mathfrak{I}(x^-_h).$$\n\nIf $g \\in G$ is any other element not conjugate to a power of $h$, then, by Property \\[kluniform\\], $g$ is pseudo-Anosov, and the dynamical properties of pseudo-Anosov mapping classes discussed in Section \\[prelimsection\\] implies $$\\mathfrak{K}^{-1}(x^\\pm(g)) = \\{ [\\mu^\\pm(g)] \\} = Z \\mathfrak{I}(x^\\pm(g)).$$\n\nTherefore, to complete the proof of the lemma, we assume that $x \\in \\partial G$ is not a fixed point of any element of $G$.\n\nWe write $x$ as an infinite reduced word $$x = x_1^{\\epsilon_1}x_2^{\\epsilon_2}x_3^{\\epsilon_3}\\cdots.$$ Since $x$ is not the fixed point of any element of $G$, we can assume that $x_n = f$ and, say, $\\epsilon_n = +1$ for infinitely many $n$ (the case that $x_n = f$ and $\\epsilon_n = -1$ for infinitely many $n$ is similar). ", "The $G$–equivariance of $\\mathfrak{K}$ implies that we may also assume that $x_1 = f$ and $\\epsilon_1 = 1$. Let $\\{n_k\\}_{k=1}^\\infty$ be the increasing sequence of natural numbers for which $x_{n_k} = f$ and $\\epsilon_{n_k} = +1$. Finally, set $$f_k = x_1^{\\epsilon_1} x_2^{\\epsilon_2}x_3^{\\epsilon_3} \\cdots x_{n_k}^{\\epsilon_{n_k}} \\in G.$$\n\nThen, we have $\\mathfrak{K}^{-1}(x)$ expressed as the nested intersection $$\\mathfrak{K}^{-1}(x) = \\bigcap_{k=1}^\\infty f_k(B^+_f).$$ Any point $[\\eta]$ in the frontier of $\\mathfrak{K}^{-1}(x)$ is a limit of a sequence in the frontiers $$[\\eta] = \\lim_{k \\to \\infty} f_k([\\nu_k])$$ where $$[\\nu_k] \\in \\mathrm{Fr}(B^+_f) = \\Sigma^+_f.$$ We fix any such $[\\eta] \\in \\mathrm{Fr}(\\mathfrak{K}^{-1}(x))$ and such a sequence $\\{[\\nu_k]\\}$.\n\nWe pass to a further subsequence so that $\\mu^\\pm_{f_k} \\to \\mu^\\pm \\in \\ML(S)$. Since $[\\mu^\\pm_{f_k}] \\in \\Lambda_G$ for all $k$, we also have $[\\mu^\\pm] \\in \\Lambda_G$. In fact, since $f_k= x_1^{\\epsilon_1}\\cdots x_{n_k}^{\\epsilon_{n_k}}$ is cyclically reduced, the axes for $f_k$ in $\\mathcal G$ all go through the origin and limit to a geodesic $\\gamma \\subset \\mathcal G$ through ${\\bf 1}$ with positive ray ending at $x$. Therefore, $x^+_{f_k} \\to x$ as $k \\to \\infty$, and by continuity of $\\mathfrak{I}$, it follows that $$\\mathfrak{I}(x) = [\\mu^+] \\in \\Lambda_G.$$ Moreover, the negative ray of $\\gamma$ ends at some point $y \\in \\partial G$ and is described by an infinite word $$y = y_1^{\\delta_1} y_2^{\\delta_2} y_3^{\\delta_3} \\cdots$$ where $y_1^{\\delta_1} \\neq f$ since $x_1^{\\epsilon_1} =f$ and $\\gamma$ is a geodesic. ", "Therefore, again appealing to the continuity of $\\mathfrak{I}$ we see that $$\\mathfrak{I}(y) = [\\mu^-] \\in \\Lambda_G \\cap \\PML(S) - B^+_f.$$\n\nBy similar reasoning, for any $[\\mu] \\in \\Lambda_G \\cap B^+_f$, we have $$f_k([\\mu]) \\to [\\mu^+] = \\mathfrak{I}(x).$$ In fact, it follows from [@MP Lemma 2.7] that there is a $\\mu$ (a fixed point of a pseudo-Anosov in $G$) and a sequence $s_k$ tending to zero such that $$\\lim_{k \\to \\infty} s_k f_k(\\mu) = \\mu^+ \\in \\ML(S).$$\n\nWe now let $\\mathfrak{S} \\subset \\ML(S)$ be the image of $\\Sigma^+_f$ under some continuous section of $\\ML(S) \\to \\PML(S)$. Since $\\Sigma^+_f \\cap Z \\Lambda_G = \\emptyset$, there is an $r > 0$ such that $$i(\\nu,\\mu^\\pm) > r$$ for every $\\nu \\in \\mathfrak{S}$.\n\nWe take the representatives $\\nu_k$ of $[\\nu_k]$ to lie in $\\mathfrak{S}$. Then, according to Lemma \\[boundedangles\\], the sequence $t_k$ for which $$\\lim_{k\\to\\infty} t_k f_k(\\nu_k) = \\eta$$ must tend to zero. ", "So $$i(\\eta,\\mu^+) = \\lim_{k \\to \\infty} i\\big(t_k f_k(\\nu_k),s_k f_k(\\mu)\\big) = \\lim_{k \\to \\infty} t_k s_k i(\\nu_k,\\mu) = 0$$ since $s_k$ and $t_k$ tend to zero and $i(\\nu_k,\\mu)$ is uniformly bounded by compactness of $\\mathfrak{S}$. Since $\\mu^+$ is uniquely ergodic, we conclude that $[\\eta] = [\\mu^+] = \\mathfrak{I}(x)$.\n\nThis means that the frontier of $\\mathfrak{K}^{-1}(x)$ is precisely $\\{\\mathfrak{I}(x)\\}$, and hence $$\\mathfrak{K}^{-1}(x) = \\{\\mathfrak{I}(x)\\} = Z \\mathfrak{I}(x)$$ as required.", "\n\nFinal comments {#finalcomments}\n==============\n\nIf we replace $h$ with $h^{-1}$ in our construction we obtain another $G$–invariant open set $\\Omega'$ on which $G$ acts properly discontinuously and cocompactly. ", "By Lemma \\[fiberszero\\], we have descriptions $$\\Omega = \\PML(S) - \\left( \\Lambda_G \\cup \\bigcup_{g\\in G} g Z\\mu^-_h \\right)$$ and $$\\Omega' = \\PML(S) - \\left( \\Lambda_G \\cup \\bigcup_{g\\in G} g Z\\mu^+_h \\right),$$ and it follows that $$\\Omega \\cup \\Omega' = \\PML(S)- \\left(\\Lambda_G \\cup \\bigcup_{g\\in G} G \\cdot \\alpha\\right).$$ The group $G$ does not act properly discontinuously on $\\Omega \\cup \\Omega'$, and in fact, we have the following.", "\n\n\\[maximal domains\\] If $\\mathcal{U} \\subset \\PML(S)$ is any open set on which $G$ acts properly discontinuously, then $\\mathcal{U} \\subset \\Omega$ or $\\mathcal{U} \\subset \\Omega'$.\n\nLet $\\mathcal{U} \\subset \\PML(S)$ be a $G$–invariant open set. ", "We will show that if $\\mathcal{U}$ is not contained in either $\\Omega$ or $\\Omega'$, then $G$ does not act properly discontinuously on $\\mathcal{U}$.\n\nIf $\\mathcal{U} \\cap \\Lambda_G \\neq \\emptyset$, then since $G$ acts minimally on $\\Lambda_G$ and $\\mathcal{U}$ is $G$–invariant, we must have $\\Lambda_G \\subset \\mathcal{U}$. As $G$ clearly fails to act properly discontinuously on $\\mathcal{U}$ in this case, we assume that $\\mathcal{U} \\cap \\Lambda_G = \\emptyset$.\n\nSo if $\\mathcal{U}$ fails to be contained in either $\\Omega$ or $\\Omega'$, there are points $[\\eta^+] \\in \\mathcal{U} \\cap Z \\mu^+_h$ and $[\\eta^-] \\in \\mathcal{U} \\cap Z \\mu^-_h$. Moreover, $[\\eta^\\pm]$ is in the interior of $Z \\mu^\\pm_h$. Let $\\Upsilon^\\pm$ be small compact balls contained in $\\mathcal{U}$ containing $[\\eta^\\pm]$. Since $[\\eta^+] \\in \\Omega$, we may assume that $\\Upsilon^+ \\subset \\Omega$. Moreover, $G$–invariance of $\\mathcal{U}$ allows us to pick $[\\eta^+]$ and $\\Upsilon^+$ to lie in $B^-_h$.\n\nAfter passing to a subsequence, we can assume that the sequence of sets $\\{h^{-{k_j}}(\\Upsilon^+)\\}_{j=1}^\\infty$ converges in the Hausdorff topology. ", "Moreover, we have $$\\lim_{j \\to \\infty}h^{-k_j}(\\Upsilon^+) \\subset \\bigcap_{k=1}^\\infty h^{-k}(B^-_k) = Z \\mu^-_h.$$ Note that the Hausdorff limit must be connected since $\\Upsilon^+$ is. ", "This limit contains $\\alpha$ as the pointwise limit of $h^{-k}[\\eta^+]$, and $[\\mu^-_h]$ as the pointwise limit of any other point of $\\Upsilon^+$ under $h^{-k}$. Therefore, $$\\lim_{j \\to \\infty}h^{-k_j}(\\Upsilon^+) = Z \\mu^-_h.$$\n\nNow, consider the compact set $\\Upsilon = \\Upsilon^+ \\cup \\Upsilon^-$. Since $\\mathrm{int}(\\Upsilon^-)$ is a neighborhood of $[\\eta^-]$, we have $$h^{-k_j}(\\Upsilon) \\cap \\Upsilon \\supset h^{-k_j}(\\Upsilon^+) \\cap \\mathrm{int}(\\Upsilon^-) \\neq \\emptyset$$ for all sufficiently large $j$. So $G$ does not act properly discontinuously on $\\mathcal{U}$.\n\nFrom this we deduce that $\\Omega$ and $\\Omega'$ are the only maximal open sets on which $G$ acts properly discontinuously. ", "By our descriptions of $\\Omega$ and $\\Omega'$ we also have $$\\Delta_G = \\Omega \\cap \\Omega'.$$ It follows that $\\Delta_G$ can be described purely in terms of the action of $G$ on $\\PML(S)$, *without referring to geometric structures on the surface*.", "\n\nThough $\\Delta_G$ may not be a *maximal* open set on which $G$ acts nicely, it remains a *canonically defined* one, and we pose the following question.", "\n\nIf $G$ is an irreducible subgroup of $\\Mod(S)$, is $\\Delta_G$ is the intersection of all maximal open sets on which $G$ acts properly discontinuously?", "\n\n[A]{}\n\nB. Farb and L. Mosher, *Convex cocompact subgroups of mapping class groups*, Geom.", " Topol.", " [**6**]{} (2002), 91–152 (electronic).", "\n\nU. Hamenstädt, *Word hyperbolic extensions of surface groups*, Preprint, `arXiv:math.", "GT/0505244`.", "\n\nN. Ivanov, *Subgroups of Teichmüller modular groups*, Translated from the Russian by E. J. F. Primrose and revised by the author. ", "Translations of Mathematical Monographs, 115. ", "American Mathematical Society, Providence, RI, 1992. ", "xii+127 pp.", "\n\nR. Kent.", " IV and C. Leininger *Shadows of mapping class groups: capturing convex cocompactness*, to appear in GAFA.", "\n\nR. Kent.", " IV and C. Leininger *Uniform convergence in the mapping class group*, Ergodic Theory Dynamical Systems [**28**]{} (2008), 1177–1195.", "\n\nR. Kent.", " IV and C. Leininger *Subgroups of the mapping class group from the geometrical viewpoint*, In the tradition of Ahlfors–Bers IV, Contemp.", " Math., ", "432, Amer.", " Math.", " Soc., ", "Providence, RI, 2007.", "\n\nH. Masur, *Dense geodesics in moduli space*, Riemann surfaces and related topics: Proceedings of the 1978 Stony Brook Conference (State Univ.", " New York, Stony Brook, N. Y., 1978), pp.", " 417–438, Ann.", " of Math.", " Stud., ", "97, Princeton Univ.", " Press, Princeton, N. J., 1981.", "\n\nJ. McCarthy, *A “Tits-alternative” for subgroups of surface mapping class groups*, Trans.", " Amer.", " Math.", " Soc.", " [**291**]{} (1985), no. ", "2, 583–612.", "\n\nJ. McCarthy and A. Papadopoulos, *Dynamics on Thurston’s sphere of projective measured foliations*, Comment.", " Math.", " Helv.", " [**64**]{} (1989), no. ", "1, 133–166.", "\n\nL. Mosher *A hyperbolic-by-hyperbolic hyperbolic group*, Proc.", " Amer.", " Math.", " Soc.", " [**125**]{} (1997), no. ", "12, 3447–3455.", "\n\nP. Shalen *Representations of 3-manifold groups*, Handbook of geometric topology, 955–1044, North-Holland, Amsterdam, 2002.", "\n\n[^1]: The first author was supported in part by an NSF postdoctoral fellowship.", "\n\n[^2]: The second author was supported in part by NSF Grant DMS-0603881.", "\n" ]

{ "pile_set_name": "ArXiv" }

[ 0.0006629150011576712, 0.0007115988410077989, 0.013795961625874043, 0.00508013553917408, 0.0025156899355351925, 0.0007134050247259438, 0.0005951622151769698, 0.013032494112849236, 0.0005695313448086381, 0.0009203508961945772, 0.0025072693824768066, 0.0007444850052706897, 0.0015426683239638805, 0.0007261469727382064, 0.0007362064789049327, 0.0006512834224849939, 0.04214504361152649, 0.0053629446774721146, 0.0018359796376898885, 0.0010375131387263536, 0.039517227560281754, 0.00728366244584322, 0.02077685296535492, 0.15173251926898956, 0.09890206158161163, 0.0341835655272007, 0.016002696007490158, 0.009692860767245293, 0.010375880636274815, 0.0006011047516949475, 0.008282581344246864, 0.017832646146416664, 0.004230127204209566, 0.005779382772743702, 0.004615623503923416, 0.0009967762744054198, 0.0031712264753878117, 0.04193918779492378, 0.01935899257659912, 0.043656423687934875, 0.0445527583360672, 0.026163527742028236, 0.012127114459872246, 0.03525291755795479, 0.023542089387774467, 0.0005523776053451002, 0.01823645643889904, 0.02833225019276142, 0.008748886175453663, 0.01693541556596756, 0.0007639556424692273, 0.0005659908638335764, 0.054199155420064926, 0.0028602825477719307, 0.034098099917173386, 0.00956831593066454, 0.02732912451028824, 0.03495689481496811, 0.044831037521362305, 0.0009047015337273479, 0.008419424295425415, 0.007306248880922794, 0.021228158846497536, 0.005571050103753805, 0.01310777384787798, 0.0009971632389351726, 0.0008136026444844902, 0.001826258609071374, 0.0006783200660720468, 0.0022299105767160654, 0.0007122915703803301, 0.0006964316708035767, 0.0008444330887869, 0.0006100618629716337, 0.000630292110145092, 0.0006339976098388433, 0.0007217969396151602, 0.0008306000963784754, 0.0008124262094497681, 0.0008306000963784754, 0.0007777461432851851, 0.0008306000963784754, 0.0006357763195410371, 0.0007826202781870961, 0.0009710597805678844, 0.0008406097185797989, 0.0007560782833024859, 0.0007117267232388258, 0.0006407900946214795, 0.0006864329916425049, 0.0007873072754591703, 0.0007605582941323519, 0.0007981661474332213, 0.0007962085073813796, 0.0006865233299322426, 0.0033237719908356667, 0.001252227695658803, 0.0008406097185797989, 0.0007810515817254782, 0.0007446613162755966, 0.0009435770334675908, 0.0008896912331692874, 0.0008406097185797989, 0.0011114791268482804, 0.000852246186695993, 0.000887081609107554, 0.0007299584685824811, 0.001252227695658803, 0.0008406097185797989, 0.0007810515817254782, 0.0008361412910744548, 0.0009120856411755085, 0.0006179558113217354, 0.000571905227843672, 0.0006101266480982304, 0.001995444530621171 ]

[ "Robbie Nichols\n\nRobert B. (Robbie) Nichols (born November 17, 1946 – June 24, 2011) is a former professional American football Linebacker in the National Football League. ", "He attended the University of Tulsa. ", "He would play Linebacker with the Baltimore Colts in 1970 and 1971, and was a member of the Colts' Super Bowl V winning team.", "\n\nReferences\n\nExternal links\nPro-Football reference\n\nCategory:1946 births\nCategory:2011 deaths\nCategory:People from Cleveland, Oklahoma\nCategory:Baltimore Colts players\nCategory:Tulsa Golden Hurricane football players\nCategory:Players of American football from Oklahoma\nCategory:Super Bowl champions" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0010231141932308674, 0.0007892227149568498, 0.0007266948814503849, 0.0006522935000248253 ]

[ "Home » Art Exhibitions and the Performing Arts worth Visiting for the Things to do in Jakarta\n\n28SEP\n\nArt Exhibitions and the Performing Arts worth Visiting for the Things to do in Jakarta\n\nIf you have the love for the arts of different cultures, the city of Jakarta has some of the most favorite art galleries and the performing arts worth visiting if you’re looking for some things to do in Jakarta. ", "As a massive city, Jakarta is homed to a variety of mix cultures in terms of language, food and the arts. ", "The city attracts artists from all over Indonesia as well as internationally showcasing their own works and expertise. ", "They mostly move to the big city to start their career in Jakarta. ", "The city offers outdoor and indoor auditoriums, concert halls and theaters for both local and international events.", "\n\nOne big theater in Jakarta, Taman Ismail Marzuki offers you the art, culture and science center to showcasing a variety of cultural events and performances of Indonesian and international artists. ", "The theater itself consists of a concert hall, exhibition hall, a gallery, six performing art theaters, and cinemas. ", "Next we have the Gelora Bung Karno Stadium, named after Indonesia’s first President; the stadium is open to events mainly for soccer matches and big concerts. ", "Famous artists and bands have their world tour held here, such as Lady Gaga and Linkin Park. ", "The stadium will also be held for the next Asian Games of 2018.", "\n\nThings to do in Jakarta. ", "The Jakarta Performing Art Theater is another great place to go for cultural events. ", "Located in Central of Jakarta, this theater is in fact a historical heritance from the Dutch colonial era. ", "It was built back in 1821 where the architectural design depicting the neo-renaissance style. ", "Just South of Jakarta, another significant historical heritance from the Betawi descendants is the cultural heritage of Setu Babakan Betawi Cultural Village. ", "Betawi or Batavia is the indigenous people who maintain their cultural tradition in Jakarta. ", "Setu Babakan is also a lake used by the people for fish farming. ", "Hence, live performances are held every Sunday from 2-3 pm.", "\n\nThe National Gallery of Indonesia is another great place of museum and art gallery of contemporary and modern artists. ", "The gallery facilitates regular and temporary art exhibition, seminar hall, library and laboratory. ", "When you come in at the right day, free workshops are available for the public such as general education about Indonesian culture, getting to know more how to draw, as well as getting useful tips directly from the artists. ", "It is free for the public and open daily from 10 am to 4 pm. ", "For more information and photographs of the places listed above, please feel free to visit our website at www.indonesia.travel." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005258940509520471, 0.0005847568972967565, 0.0006216356996446848, 0.0007459372282028198, 0.0005364645039662719, 0.0005185498157516122, 0.0006653379532508552, 0.0006669870344921947, 0.0006494762492366135, 0.0007162237889133394, 0.0006014674436300993, 0.0005756468744948506, 0.0008584603783674538, 0.0006314579513855278, 0.0006703924154862761, 0.0006439145072363317, 0.0008684048661962152, 0.0006039237487129867, 0.0006965139764361084, 0.0006015242543071508, 0.0005350729334168136, 0.00066997273825109, 0.0005320991622284055 ]

[ "Association of Political Organisations of the Indonesian People\n\nAssociation of Political Organisations of the Indonesian People (Indonesian: Pemufakatan Perhimpunan-perhimpunan Politik Kebangsaan Indonesia, (abbrev: PPPKI), was one of the key anti-colonial political umbrella organizations championing for independence in Indonesia (present-day of Netherlands East Indies) during Dutch colonial rule. ", "PPPKI attempt at uniting disparate key pre-Second World War pan-Indies political reformist and nationalism movements such as Partai Sosialis Indonesia (Socialist Party of Indonesia), Budi Utomo (Great Endeavour), Partai Nasional Indonesia (Indonesian National Party), Paguyuban Pasundan, Jong Sumatranen Bond (Association of Sumatran Youth), Pemuda Kaum Betawi, and Kelompok Studi Indonesia.", "\n\nPPPKI was established on 17 December 1927 at Bandung, notably by then PNI's charismatic leader and future first President of Indonesia, Sukarno, in an attempt to unite nationalist and reformist efforts against colonial rule in the Netherlands East Indies, championing for independence. ", "However, PPPKI was conflict-ridden from the start, and key members disagreed on many policies that the umbrella organisation should undertake, most significantly the argument between radical members of PPPKI advocating non-cooperation with the colonialists, and moderate members opposing such a stance. ", "While PPPKI failed to achieve most of its intended goals, PPPKI was instrumental in the proclamation of the Sumpah Pemuda (Youth Oath) of 1928, in which nationalist symbols of Indonesia were adopted, namely, Bahasa Indonesia - a variant of Bahasa Melayu, was named the lingua franca; the presentation of \"Indonesia Raya\", the national anthem, and the red-white national flag, or Sang Saka Merah Putih, symbolising the Indonesian independence movement.", "\n\nSee also\n PPKI\n BPUPK\n\nReferences\n\nCategory:Indonesian National Awakening" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.0007271957583725452, 0.0015761498361825943, 0.0007195682846941054, 0.00099201372358948, 0.0007954562897793949, 0.0006862702430225909 ]

[ "It is all about phases: ultrafast holographic photoelectron imaging.", "\nPhotoelectron holography constitutes a powerful tool for the ultrafast imaging of matter, as it combines high electron currents with subfemtosecond resolution, and gives information about transition amplitudes and phase shifts. ", "Similarly to light holography, it uses the phase difference between the probe and the reference waves associated with qualitatively different ionization events for the reconstruction of the target and for ascertaining any changes that may occur. ", "These are major advantages over other attosecond imaging techniques, which require elaborate interferometric schemes in order to extract phase differences. ", "For that reason, ultrafast photoelectron holography has experienced a huge growth in activity, which has led to a vast, but fragmented landscape. ", "The present review is an organizational effort towards unifying this landscape. ", "This includes a historic account in which a connection with laser-induced electron diffraction (LIED) is established, a summary of the main holographic structures encountered and their underlying physical mechanisms, a broad discussion of the theoretical methods employed, and of the key challenges and future possibilities. ", "We delve deeper in our own work, and place a strong emphasis on quantum interference, and on the residual Coulomb potential." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006239087088033557, 0.0006009096978232265, 0.0005957936518825591, 0.000662186648696661, 0.000575651356484741, 0.0005568417254835367, 0.0005497731035575271, 0.000602381129283458 ]

[ "Rocky Mountain Angular\n\nThis is a group devoted to the exploration, understanding, and practical application of the AngularJS development framework. ", "We'll organize regularly scheduled meetings that dive deep into every aspect of AngularJS, it's place in the development ecosystem, and provide opportunities to learn the best way possible...by coding with our peers. ", "We welcome developers, managers, designers, and anyone else who is interested in learning more about the \"Superheroic JavaScript MVW Framework\" from Google." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0005577240372076631, 0.0005308390827849507, 0.0005357889458537102 ]

[ "**Please note that not all products available online are available in the stores. ", "The RRP against which any savings comparisons we make to the listed sale\nprice for products displayed on this website is: the supplier's recommended retail price for the product, provided that this is a price at or above which at\nleast 5% of Australian Pharmacy Transactions~ have occurred for that product within the previous 2 months; or if at least 5% of Australian Pharmacy\nTransactions~ for that product in the previous two months did not occur at or above the supplier's recommended retail price, the RRP will be the price at or\nabove which at least 5% of Australian Pharmacy Transactions~ occurred within the last 2 months. ", "All prices displayed on this website are in AUD unless\notherwise indicated. ", "Actual product or product packaging delivered may vary slightly from product image shown.", "\n\n*This product may not be right for you. ", "Always read the label, warnings and instructions for use, before purchase. ", "Vitamin and Mineral supplements should not replace a balanced diet.", "\nAlways read the label. ", "Follow directions for use. ", "If symptoms persist talk to your healthcare professional. ", "This medicine may not be right for you. ", "Read the warnings before purchase.", "\nThe Pharmacist reserves the right to not supply contrary to our professional and ethical obligation.", "\nSunscreen is only used for one element of protection." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006261396338231862, 0.0005698823370039463, 0.0006894289399497211, 0.0005773951415903866, 0.0007719032000750303, 0.0005673660198226571, 0.0006542715127579868, 0.0006157432217150927, 0.0005507410387508571, 0.0006340695545077324, 0.004486135207116604, 0.0006445858743973076, 0.0019028589595109224, 0.0005864531849510968 ]

[ "Atrophy of neurons in the prefrontal cortex (PFC) plays a key role in the pathophysiology of depression and related disorders. ", "The ability to promote both structural and functional plasticity in the PFC has been hypothesized to underlie the fast-acting antidepressant properties of the dissociative anesthetic ketamine. ", "Here, we report that, like ketamine, serotonergic psychedelics are capable of robustly increasing neuritogenesis and/or spinogenesis both in vitro and in vivo. ", "These changes in neuronal structure are accompanied by increased synapse number and function, as measured by fluorescence microscopy and electrophysiology. ", "The structural changes induced by psychedelics appear to result from stimulation of the TrkB, mTOR, and 5-HT2A signaling pathways and could possibly explain the clinical effectiveness of these compounds. ", "Our results underscore the therapeutic potential of psychedelics and, importantly, identify several lead scaffolds for medicinal chemistry efforts focused on developing plasticity-promoting compounds as safe, effective, and fast-acting treatments for depression and related disorders.", "\n\nBecause of the similarities between classical serotonergic psychedelics and ketamine in both preclinical models and clinical studies, we reasoned that their therapeutic effects might result from a shared ability to promote structural and functional neural plasticity in cortical neurons. ", "Here, we report that serotonergic psychedelics and entactogens from a variety of chemical classes (e.g., amphetamine, tryptamine, and ergoline) display plasticity-promoting properties comparable to or greater than ketamine. ", "Like ketamine, these compounds stimulate structural plasticity by activating the mammalian target of rapamycin (mTOR). ", "To classify the growing number of compounds capable of rapidly promoting induced plasticity (), we introduce the term “psychoplastogen,” from the Greek roots psych- (mind), -plast (molded), and -gen (producing). ", "Our work strengthens the growing body of literature indicating that psychoplastogens capable of promoting plasticity in the PFC might have value as fast-acting antidepressants and anxiolytics with efficacy in treatment-resistant populations and suggests that it may be possible to use classical psychedelics as lead structures for identifying safer alternatives.", "\n\nLike ketamine, serotonergic psychedelics and entactogens have demonstrated rapid and long-lasting antidepressant and anxiolytic effects in the clinic after a single dose (), including in treatment-resistant populations (). ", "In fact, there have been numerous clinical trials in the past 30 years examining the therapeutic effects of these drugs (), with 3,4-methylenedioxymethamphetamine (MDMA) recently receiving the “breakthrough therapy” designation by the Food and Drug Administration for treating PTSD. ", "Furthermore, classical psychedelics and entactogens produce antidepressant and anxiolytic responses in rodent behavioral tests, such as the forced swim test () and fear extinction learning (), paradigms for which ketamine has also been shown to be effective (). ", "Despite the promising antidepressant, anxiolytic, and anti-addictive properties of serotonergic psychedelics, their therapeutic mechanism of action remains poorly understood, and concerns about safety have severely limited their clinical usefulness.", "\n\nAntidepressive, anxiolytic, and antiaddictive effects of ayahuasca, psilocybin and lysergic acid diethylamide (LSD): a systematic review of clinical trials published in the last 25 years.", "\n\nThe safety and efficacy of +/-3,4-methylenedioxymethamphetamine-assisted psychotherapy in subjects with chronic, treatment-resistant posttraumatic stress disorder: the first randomized controlled pilot study.", "\n\nKetamine has demonstrated remarkable clinical potential as a fast-acting antidepressant (), even exhibiting efficacy in treatment-resistant populations (). ", "Additionally, it has shown promise for treating PTSD () and heroin addiction (). ", "Animal models suggest that its therapeutic effects stem from its ability to promote the growth of dendritic spines, increase the synthesis of synaptic proteins, and strengthen synaptic responses ().", "\n\nNeuropsychiatric diseases, including mood and anxiety disorders, are some of the leading causes of disability worldwide and place an enormous economic burden on society (). ", "Approximately one-third of patients will not respond to current antidepressant drugs, and those who do will usually require at least 2–4 weeks of treatment before they experience any beneficial effects (). ", "Depression, post-traumatic stress disorder (PTSD), and addiction share common neural circuitry () and have high comorbidity (). ", "A preponderance of evidence from a combination of human imaging, postmortem studies, and animal models suggests that atrophy of neurons in the prefrontal cortex (PFC) plays a key role in the pathophysiology of depression and related disorders and is precipitated and/or exacerbated by stress (). ", "These structural changes, such as the retraction of neurites, loss of dendritic spines, and elimination of synapses, can potentially be counteracted by compounds capable of promoting structural and functional neural plasticity in the PFC (), providing a general solution to treating all of these related diseases. ", "However, only a relatively small number of compounds capable of promoting plasticity in the PFC have been identified so far, each with significant drawbacks (). ", "Of these, the dissociative anesthetic ketamine has shown the most promise, revitalizing the field of molecular psychiatry in recent years.", "\n\nGlobal burden of disease attributable to mental and substance use disorders: findings from the Global Burden of Disease Study 2010.", "\n\nAs a final note, the concentration responses of most psychoplastogens had Hill slopes that deviated from 1.0 ( Figure S3 ), implying polypharmacology. ", "Because psychedelics have relatively high affinities for 5-HT2A receptors, it is likely that the effects of psychedelics are mediated primarily through 5-HT2A receptors at low concentrations and modulated by other targets at high concentrations. ", "Interestingly, the concentration response of DMT was the only one to exhibit a Hill slope greater than 1.0, indicating some form of cooperativity.", "\n\nThese initial experiments were performed using doses of psychoplastogens that produced maximal effects on structural plasticity (circa 10 μM) in combination with a 10-fold excess of ketanserin (100 μM). ", "At these concentrations, we could not rule out the possibility of other receptors contributing to the antagonistic effects of ketanserin. ", "Therefore, we treated cultured cortical neurons with a significantly lower dose of LSD (10 nM) and attempted to block its ability to promote neurite outgrowth using increasing doses of ketanserin ( Figure 6 H). ", "We found that ketanserin blocks the psychoplastogenic effects of LSD by ∼50% when treated at 10 nM. This is consistent with the fact that the binding affinities of ketanserin and LSD for the 5-HT2A receptor are roughly equivalent (low nanomolar). ", "Increasing the concentration of ketanserin to 100 nM, 10-fold higher than the concentration of LSD used in this experiment, completely prevented LSD-induced neuritogenesis. ", "At 100 nM, ketanserin is relatively selective for the 5-HT2A receptor, although, at this concentration, we cannot rule out the possible involvement of 5-HT2C, adrenergic, or histamine receptors.", "\n\nFinally, we sought to determine whether the 5-HT2A receptor played any role in the plasticity-promoting effects of DOI, DMT, and LSD because this receptor is known to be primarily responsible for the hallucinogenic effects of classical psychedelics (). ", "Furthermore, the psychoplastogenic potencies of these and related compounds correlate well with their 5-HT2A receptor affinities ( Figure S3 ) (i.e., a higher 5-HT2A binding affinity generally predicts more potent psychoplastogenic effects). ", "Control experiments demonstrated that 5-HT2A receptors were expressed on cultured rat cortical neurons at both 6 days in vitro (DIV6) and DIV19 ( Figure 6 A). ", "Next we found that co-treatment with ketanserin, a selective 5-HT2A antagonist, completely abrogated the ability of DMT, LSD, and DOI to promote both neuritogenesis and spinogenesis ( Figures 6 B–6F). ", "Ketanserin was also able to block the effects of psilocin as well as the non-classical psychedelic noribogaine and enactogen MDMA ( Figure 6 G).", "\n\n(C–E) Compound-induced increases in the AUC of the Sholl plots (C), the N max of the Sholl plots (D), and the number of dendritic branches (E) are completely blocked by ketanserin (n = 10–11 neurons, DIV6).", "\n\n(B) The effects of psychedelics on increasing dendritic arbor complexity are blocked by co-treating with ketanserin, a selective antagonist of 5-HT2A receptors, as measured by Sholl analysis of cultured cortical neurons (DIV6).", "\n\nActivation of TrkB is known to promote signaling through mTOR (), which plays a key role in structural plasticity (), the production of proteins necessary for synaptogenesis (), and the effects of ketamine (). ", "Treatment with rapamycin, an mTOR inhibitor, completely blocked psychedelic-induced neuritogenesis ( Figure 5 ), thus confirming that mTOR activation plays a role in the plasticity-promoting effects of classical serotonergic psychedelics.", "\n\n(A–D) The effects of psychedelics on dendritic arbor complexity are blocked by rapamycin, an inhibitor of mTOR, as measured by Sholl analysis of cultured cortical neurons (A) (DIV6). ", "Compound-induced increases in the AUC of the Sholl plots (B), the N max of the Sholl plots (C), and the number of dendritic branches (D) are completely blocked by rapamycin (n = 9–12 neurons).", "\n\nThe role of BDNF in both neuritogenesis and spinogenesis is well known (), and several reports suggest that psychedelics are capable of increasing levels of neurotrophic factors (). ", "Therefore, we treated cortical neurons with BDNF, DOI, and a combination of the two to see whether they had any additive or synergistic effects. ", "Dose-response studies using recombinant BDNF ( Figures 3 A–3C) revealed that a 50 ng/mL treatment increased neuritogenesis to a comparable extent as DOI (10 μM). ", "Moreover, a combination of the two did not confer any added benefit, suggesting that they operate through a related mechanism ( Figures 3 D–3F). ", "Next, we treated cortical neurons with DOI, DMT, and LSD for 24 hr before measuring BDNF gene and protein expression using droplet digital PCR (ddPCR) and ELISA, respectively. ", "Although psychedelics did not increase the expression of BDNF transcript ( Figure 3 G), they did result in a 2-fold increase in BDNF protein levels, although this effect was not statistically significant ( Figure 3 H). ", "When cortical cultures were co-treated with ANA-12 (), a selective antagonist of BDNF’s high-affinity receptor TrkB, the ability of psychedelics or BDNF to stimulate neuritogenesis and spinogenesis was completely blocked ( Figure 4 ).", "\n\n(A–D) The effects of psychedelics on dendritic arbor complexity are blocked by ANA-12, a selective inhibitor of TrkB, as measured by Sholl analysis of cultured cortical neurons (A) (DIV6). ", "Compound-induced increases in the AUC of the Sholl plots (B), the N max of the Sholl plots (C), and the number of dendritic branches (D) are completely blocked by ANA-12 (n = 8–10 neurons).", "\n\n(G and H) Cultured cortical neurons (DIV18) were treated with compounds for 24 hr, and then BDNF gene (G) and protein (H) expression was assessed via ddPCR (n = 4) and ELISA (n = 3–4), respectively.", "\n\n(D) Sholl analysis (n = 5–10 neurons) demonstrating that DOI (10 μM) increases neuritogenesis to a comparable extent as recombinant BDNF (50 ng/mL). ", "A combination of DOI (10 μM) and BDNF (50 ng/mL) did not have any additive or synergistic effects.", "\n\n(A–C) Dose response of recombinant BDNF on neuritogenesis. ", "AUC of the Sholl plots (A), N max of the Sholl plots (B), and total number of branches (C) of treated cortical neurons (n = 11–12 neurons per treatment, DIV6) indicate that the highest concentration of BDNF (50 ng/mL) is more effective at promoting neuritogenesis than lower concentrations (5.0 and 0.5 ng/mL).", "\n\nBecause the half-life of DMT is exceedingly short (∼15 min), these results confirm that structural and functional changes induced by DMT persist for hours after the compound has been cleared from the body. ", "Moreover, they demonstrate that DMT produces functional effects on pyramidal neurons of the PFC that mirror those produced by ketamine (). ", "Because the PFC is a key brain region involved in extinction learning (), and both ketamine and DMT have been shown to facilitate fear extinction (), our results suggest a link between the plasticity-promoting and behavioral effects of these drugs. ", "Because fear extinction can be enhanced by increasing levels of brain-derived neurotrophic factor (BDNF) in the PFC (), and ketamine’s behavioral effects have been shown to be BDNF-dependent (), we next sought to determine the role of BDNF signaling in the plasticity-promoting effects of classical psychedelics.", "\n\nEncouraged by our in vitro results, we next assessed the effects of a single intraperitoneal dose of DMT on spinogenesis in the PFC of adult rats using Golgi-Cox staining. ", "We chose to administer a 10 mg/kg dose of DMT for three reasons. ", "First, all available data suggested that this dose would produce hallucinogenic effects in rats with minimal safety risks (). ", "Second, we have previously shown that a 10 mg/kg dose of DMT produces positive effects in rat behavioral tests relevant to depression and PTSD (). ", "Finally, we wanted to directly compare the effects of DMT with ketamine, and seminal studies conducted byhad previously demonstrated that a 10 mg/kg dose of ketamine produced a robust increase in dendritic spine density in the PFC of rats. ", "We observed a significant increase in the density of dendritic spines on cortical pyramidal neurons 24 hr after dosing with DMT ( Figures 2 I and 2J). ", "This effect was comparable with that produced by ketamine at the same dose ( Figure 2 J). ", "Importantly, this DMT-induced increase in dendritic spine density was accompanied by functional effects. ", "Ex vivo slice recordings revealed that both the frequency and amplitude of spontaneous excitatory postsynaptic currents (EPSCs) were increased following DMT treatment ( Figures 2 K–2M). ", "Interestingly, 10 mg/kg and 1 mg/kg doses produced similar responses despite the fact that they are predicted to be hallucinogenic and subhallucinogenic, respectively ().", "\n\nThe role of 5-HT2A, 5-HT2C and mGlu2 receptors in the behavioral effects of tryptamine hallucinogens N,N-dimethyltryptamine and N,N-diisopropyltryptamine in rats and mice.", "\n\nComparison of the discriminative stimulus effects of dimethyltryptamine with different classes of psychoactive compounds in rats.", "\n\nIn addition to dendritic atrophy, loss of dendritic spines is a hallmark of depression and other neuropsychiatric disorders (), so we next assessed the effects of psychedelics on spinogenesis. ", "We treated mature rat cortical cultures for 24 hr with DOI, DMT, and LSD as representative compounds from the amphetamine, tryptamine, and ergoline classes of psychedelics, respectively. ", "All three compounds increased the number of dendritic spines per unit length, as measured by super-resolution structured illumination microscopy (SIM) ( Figures 2 A, 2B, and S6 ), with LSD nearly doubling the number of spines per 10 μm. ", "Additionally, treatment caused a shift in spine morphology, favoring immature (thin and filopodium) over more mature (mushroom) spine types ( Figure 2 C). ", "Colocalization of pre- and postsynaptic markers following treatment demonstrated that psychedelics promoted synaptogenesis by increasing the density, but not the size of synapses ( Figure 2 D–2F). ", "This increase in synapse density was accompanied by an increase in the density of VGLUT1 puncta, but not PSD-95 puncta, following compound administration ( Figures 2 G and 2H).", "\n\np < 0.05,p < 0.01,p < 0.001,p < 0.0001, as compared to vehicle control (VEH). ", "Data are represented as mean ± SEM. ", "See also Figure S6\n\n(K and L) Whole-cell voltage-clamp recordings of layer V pyramidal neurons from slices obtained 24 hr after DMT treatment (10 mg/kg and 1 mg/kg) demonstrate that DMT increases both spontaneous excitatory postsynaptic current (sEPSC) frequency (K) and amplitude (L) (n = 11–38 neurons from 3 animals).", "\n\n(D) Representative images of cortical neurons (DIV19) treated for 24 hr, demonstrating that psychedelics increase synaptogenesis (green, VGLUT1; magenta, PSD-95; yellow, MAP2). ", "White areas in the VGLUT1 + PSD-95 images indicate colocalization of pre- and postsynaptic makers and are indicated by gray arrows.", "\n\nTo assess the in vivo effects of classical psychedelics on neuritogenesis, we started treating Drosophila larvae during the first instar with LSD and DOI. ", "As observed in rodent cortical cultures, both LSD and DOI significantly increased dendritic branching of class I sensory neurons; however, they did not increase the total length of the dendritic arbors ( Figures 1 J–1L). ", "Because of the striking effects of psychedelics on the structures of immature neurons, we hypothesized that they might influence neurodevelopment. ", "To test this, we chronically treated zebrafish embryos with compounds for 6 days immediately following dechorionation and assessed gross morphological changes and behavior. ", "We did not observe any differences in head sizes between the treatment groups, nor did we detect any statistically significant differences in activity levels ( Figure S5 ). ", "Next we assessed the ability of psychedelics to promote neuritogenesis in more mature neurons by starting to treat Drosophila larvae during the late second instar. ", "Again, psychedelics increased the branching of class I neurons, although the effect was less dramatic than that observed when treatment was started during the first instar ( Figure 1 M–1O). ", "Although different developmental stages might be more or less susceptible to the effects of psychedelics, it is also possible that the smaller effect size observed after administering compounds starting at the later time point was simply the result of treating the larvae for a shorter period of time. ", "Regardless, it was quite surprising to observe compound-induced changes in neuronal structure after initiating treatment during the late second instar because class I neurons are stereotyped and typically possess relatively few higher-order branches (). ", "Moreover, our results demonstrate that psychedelics can promote changes in neuronal structure across vertebrate (rats) and invertebrate (Drosophila) species, suggesting that they act through an evolutionarily conserved mechanism.", "\n\nNotably, the anti-addictive alkaloid ibogaine () was the only psychedelic tested that had absolutely no effect ( Figure S4 ). ", "This was a surprising result because we hypothesized that ibogaine’s long-lasting anti-addictive properties might result from its psychoplastogenic properties. ", "Previous work byclearly demonstrated that ibogaine increases the expression of glial cell line-derived neurotrophic factor (GDNF) and that this plasticity-promoting protein is critical to ibogaine’s anti-addictive mechanism of action. ", "Because several reports have suggested that noribogaine, a metabolite of ibogaine, might actually be the active compound in vivo (), we decided to test its ability to promote neuritogenesis in cultured cortical neurons. ", "Gratifyingly, noribogaine robustly increased dendritic arbor complexity with an ECvalue comparable to ketamine ( Figure S3 ), providing additional evidence suggesting that it may be the active compound in vivo.", "\n\nTo establish the relative potencies and efficacies of hallucinogens and entactogens for promoting neurite outgrowth, we conducted 8-point dose-response studies ( Figure S3 ). ", "We defined 100% and 0% efficacy as the maximum number of crossings induced by ketamine (10 μM) and vehicle (0.1% DMSO), respectively. ", "We chose the 10 μM concentration of ketamine as the upper limit because this concentration of ketamine is reached in the brain following intraperitoneal administration of an antidepressant dose in rats (). ", "For consistency, we used this same concentration when testing the effects of psychedelics and entactogens, with DMT being the only exception. ", "We used a maximum 90 μM concentration of DMT in our studies to more closely mimic the brain concentration of DMT in rats treated with an antidepressant dose (). ", "In this neuritogenesis assay, ketamine’s half maximal effective concentration (EC) value was 132 nM. Surprisingly, the majority of the psychedelics and entactogens we tested exhibited significantly greater potency than ketamine, with LSD being particularly potent (EC= 0.409 nM). ", "In fact, LSD exhibited activity across 8 orders of magnitude into the low picomolar range ( Figure S3 ).", "\n\nNearly all psychedelic compounds tested were capable of robustly promoting neuritogenesis, with comparable effects being produced by tryptamines (N,N-dimethyltryptamine [DMT] and psilocin), amphetamines (2,5-dimethoxy-4-iodoamphetamine [DOI] and MDMA), and ergolines (lysergic acid diethylamide [LSD]). ", "As a positive control, we treated cells with 7,8-dihydroxyflavone (DHF), a psychoplastogen structurally dissimilar to classical psychedelics (), and found that it also increased dendritic arbor complexity ( Figure S2 ). ", "This neurite outgrowth structural phenotype seems to only be induced by select compounds because serotonin and D-amphetamine, molecules that are chemically related to classical psychedelics and entactogens, exerted minimal to no effects on neuritogenesis ( Figure S2 ).", "\n\nBecause atrophy of cortical neurons is believed to be a contributing factor to the development of mood and anxiety disorders (), we first treated cultured cortical neurons with psychedelics from a variety of structural classes ( Figures 1 A and S1 A) and measured the resulting changes in various morphological features. ", "Using Sholl analysis (), we observed that several psychedelics increased dendritic arbor complexity comparably to ketamine, as measured by the area under the curve of the Sholl plots as well as the maximum number of crossings ( Figures 1 B–1E and S1 B–S1E). ", "This increase in arbor complexity appeared to result from large changes in both the number of dendritic branches and the total length of the arbors ( Figures 1 F, 1H, S1 F, and S1H). ", "Psychedelics had a limited effect on the number of primary dendrites and did not alter the length of the longest dendrite ( Figures 1 G, 1I, S1 G, and S1I).", "\n\np < 0.05,p < 0.01,p < 0.001,p < 0.0001, as compared to vehicle control (VEH). ", "Scale bars, 30 μm. ", "Data are represented as mean ± SEM. ", "See also Figures S1–S5\n\n(M and N) Class I neurons from Drosophila larvae treated with psychedelics during the third instar display increased branching (M) but not total length of the dendritic arbor (N) (n = 3 neurons).", "\n\n(J and K) Class I neurons from Drosophila larvae treated with psychedelics during the first instar display increased branching (J) but not total length of the dendritic arbor (K) (n = 3 neurons).", "\n\n(F–I) Cortical neurons treated with psychedelics display an increase in the number of branches (F), the number of primary dendrites (G), and the total length of the dendritic arbor (H) but not the length of the longest dendrite (I).", "\n\nDiscussion\n\nJones et al. (", "2009) Jones K.A.\n\nSrivastava D.P.\n\nAllen J.A.\n\nStrachan R.T.\n\nRoth B.L.\n\nPenzes P. Rapid modulation of spine morphology by the 5-HT2A serotonin receptor through kalirin-7 signaling. ", "Marinova et al., ", "2017 Marinova Z.\n\nWalitza S.\n\nGrünblatt E. The hallucinogen 2,5-dimethoxy-4-iodoamphetamine hydrochloride activates neurotrophin receptors in a neuronal cell line and promotes neurites extension. ", "Prior to this study, two reports suggested that psychedelics might be able to produce changes in neuronal structure.demonstrated that DOI was capable of transiently increasing the size of dendritic spines on cortical neurons, but no change in spine density was observed. ", "The second study showed that DOI promoted neurite extension in a cell line of neuronal lineage (). ", "Both of these reports utilized DOI, a psychedelic of the amphetamine class. ", "Here we demonstrate that the ability to change neuronal structure is not a unique property of amphetamines like DOI because psychedelics from the ergoline, tryptamine, and iboga classes of compounds also promote structural plasticity. ", "Additionally, D-amphetamine does not increase the complexity of cortical dendritic arbors in culture, and therefore, these morphological changes cannot be simply attributed to an increase in monoamine neurotransmission.", "\n\nLepack et al., ", "2016 Lepack A.E.\n\nBang E.\n\nLee B.\n\nDwyer J.M.\n\nDuman R.S. Fast-acting antidepressants rapidly stimulate ERK signaling and BDNF release in primary neuronal cultures. ", "Castello et al., ", "2014 Castello N.A.\n\nNguyen M.H.\n\nTran J.D.\n\nCheng D.\n\nGreen K.N.\n\nLaFerla F.M. 7,8-Dihydroxyflavone, a small molecule TrkB agonist, improves spatial memory and increases thin spine density in a mouse model of Alzheimer disease-like neuronal loss. ", "Zeng et al., ", "2012 Zeng Y.\n\nLv F.\n\nLi L.\n\nYu H.\n\nDong M.\n\nFu Q. 7,8-dihydroxyflavone rescues spatial memory and synaptic plasticity in cognitively impaired aged rats. ", "Voleti et al., ", "2013 Voleti B.\n\nNavarria A.\n\nLiu R.J.\n\nBanasr M.\n\nLi N.\n\nTerwilliger R.\n\nSanacora G.\n\nEid T.\n\nAghajanian G.\n\nDuman R.S. Scopolamine rapidly increases mammalian target of rapamycin complex 1 signaling, synaptogenesis, and antidepressant behavioral responses. ", "Wacker et al., ", "2017 Wacker D.\n\nWang S.\n\nMcCorvy J.D.\n\nBetz R.M.\n\nVenkatakrishnan A.J.\n\nLevit A.\n\nLansu K.\n\nSchools Z.L.\n\nChe T.\n\nNichols D.E.\n\net al. ", "Crystal Structure of an LSD-Bound Human Serotonin Receptor. ", "The identification of psychoplastogens belonging to distinct chemical families is an important aspect of this work because it suggests that ketamine is not unique in its ability to promote structural and functional plasticity. ", "In addition to ketamine, the prototypical psychoplastogen, only a relatively small number of plasticity-promoting small molecules have been identified previously. ", "Such compounds include the N-methyl-D-aspartate (NMDA) receptor ligand GLYX-13 (i.e., rapastinel), the mGlu2/3 antagonist LY341495, the TrkB agonist 7,8-DHF, and the muscarinic receptor antagonist scopolamine (). ", "We observe that hallucinogens from four distinct structural classes (i.e., tryptamine, amphetamine, ergoline, and iboga) are also potent psychoplastogens, providing additional lead scaffolds for medicinal chemistry efforts aimed at identifying neurotherapeutics. ", "Furthermore, our cellular assays revealed that several of these compounds were more efficacious (e.g., MDMA) or more potent (e.g., LSD) than ketamine. ", "In fact, the plasticity-promoting properties of psychedelics and entactogens rivaled that of BDNF ( Figures 3 A–3C and S3 ). ", "The extreme potency of LSD in particular might be due to slow off kinetics, as recently proposed following the disclosure of the LSD-bound 5-HT2B crystal structure ().", "\n\nYang et al., ", "2018 Yang Y.\n\nCui Y.\n\nSang K.\n\nDong Y.\n\nNi Z.\n\nMa S.\n\nHu H. Ketamine blocks bursting in the lateral habenula to rapidly relieve depression. ", "Cohen and Vogel, 1972 Cohen I.\n\nVogel W.H. Determination and physiological disposition of dimethyltryptamine and diethyltryptamine in rat brain, liver and plasma. ", "Importantly, the psychoplastogenic effects of psychedelics in cortical cultures were also observed in vivo using both vertebrate and invertebrate models, demonstrating that they act through an evolutionarily conserved mechanism. ", "Furthermore, the concentrations of psychedelics utilized in our in vitro cell culture assays were consistent with those reached in the brain following systemic administration of therapeutic doses in rodents (). ", "This suggests that neuritogenesis, spinogenesis, and/or synaptogenesis assays performed using cortical cultures might have value for identifying psychoplastogens and fast-acting antidepressants. ", "It should be noted that our structural plasticity studies performed in vitro utilized neurons exposed to psychedelics for extended periods of time. ", "Because brain exposure to these compounds is often of short duration due to rapid metabolism, it will be interesting to assess the kinetics of psychedelic-induced plasticity.", "\n\nKyzar et al., ", "2017 Kyzar E.J.\n\nNichols C.D.\n\nGainetdinov R.R.\n\nNichols D.E.\n\nKalueff A.V. Psychedelic Drugs in Biomedicine. ", "Li et al., ", "2010 Li N.\n\nLee B.\n\nLiu R.J.\n\nBanasr M.\n\nDwyer J.M.\n\nIwata M.\n\nLi X.Y.\n\nAghajanian G.\n\nDuman R.S. mTOR-dependent synapse formation underlies the rapid antidepressant effects of NMDA antagonists. ", "Cameron et al., ", "2018 Cameron L.P.\n\nBenson C.J.\n\nDunlap L.E.\n\nOlson D.E. Effects of N, N-dimethyltryptamine on rat behaviors relevant to anxiety and depression. ", "Osório et al., ", "2015 Osório Fde.", "L.\n\nSanches R.F.\n\nMacedo L.R.\n\nSantos R.G.\n\nMaia-de-Oliveira J.P.\n\nWichert-Ana L.\n\nAraujo D.B.\n\nRiba J.\n\nCrippa J.A.\n\nHallak J.E. Antidepressant effects of a single dose of ayahuasca in patients with recurrent depression: a preliminary report. ", "Sanches et al., ", "2016 Sanches R.F.\n\nde Lima Osório F.\n\nDos Santos R.G.\n\nMacedo L.R.\n\nMaia-de-Oliveira J.P.\n\nWichert-Ana L.\n\nde Araujo D.B.\n\nRiba J.\n\nCrippa J.A.\n\nHallak J.E. Antidepressant effects of a single dose of ayahuasca in patients with recurrent depression: a SPECT study. ", "Santos et al., ", "2007 Santos R.G.\n\nLandeira-Fernandez J.\n\nStrassman R.J.\n\nMotta V.\n\nCruz A.P. Effects of ayahuasca on psychometric measures of anxiety, panic-like and hopelessness in Santo Daime members. ", "A key question in the field of psychedelic medicine has been whether or not psychedelics promote changes in the density of dendritic spines (). ", "Using super-resolution SIM, we clearly demonstrate that psychedelics do, in fact, increase the density of dendritic spines on cortical neurons, an effect that is not restricted to a particular structural class of compounds. ", "Using DMT, we verified that cortical neuron spine density increases in vivo and that these changes in structural plasticity are accompanied by functional effects such as increased amplitude and frequency of spontaneous EPSCs. ", "We specifically designed these experiments to mimic previous studies of ketamine () so that we might directly compare these two compounds, and, to a first approximation, they appear to be remarkably similar. ", "Not only do they both increase spine density and neuronal excitability in the cortex, they seem to have similar behavioral effects. ", "We have shown previously that, like ketamine, DMT promotes fear extinction learning and has antidepressant effects in the forced swim test (). ", "These results, coupled with the fact that ayahuasca, a DMT-containing concoction, has potent antidepressant effects in humans (), suggests that classical psychedelics and ketamine might share a related therapeutic mechanism.", "\n\nNutt et al., ", "2007 Nutt D.\n\nKing L.A.\n\nSaulsbury W.\n\nBlakemore C. Development of a rational scale to assess the harm of drugs of potential misuse. ", "Nutt et al., ", "2010 Nutt D.J.\n\nKing L.A.\n\nPhillips L.D. Independent Scientific Committee on Drugs\n\nDrug harms in the UK: a multicriteria decision analysis. ", "Majić et al., ", "2015 Majić T.\n\nSchmidt T.T.\n\nGallinat J. Peak experiences and the afterglow phenomenon: when and how do therapeutic effects of hallucinogens depend on psychedelic experiences?. ", "Moskal et al., ", "2017 Moskal J.R.\n\nBurgdorf J.S.\n\nStanton P.K.\n\nKroes R.A.\n\nDisterhoft J.F.\n\nBurch R.M.\n\nKhan M.A. The development of rapastinel (formerly GLYX-13); a rapid acting and long lasting antidepressant. ", "Yang et al., ", "2015 Yang C.\n\nShirayama Y.\n\nZhang J.C.\n\nRen Q.\n\nYao W.\n\nMa M.\n\nDong C.\n\nHashimoto K. R-ketamine: a rapid-onset and sustained antidepressant without psychotomimetic side effects. ", "Zanos et al., ", "2016 Zanos P.\n\nMoaddel R.\n\nMorris P.J.\n\nGeorgiou P.\n\nFischell J.\n\nElmer G.I.\n\nAlkondon M.\n\nYuan P.\n\nPribut H.J.\n\nSingh N.S.\n\net al. ", "NMDAR inhibition-independent antidepressant actions of ketamine metabolites. ", "Although the molecular targets of ketamine and psychedelics are different (NMDA and 5-HT2A receptors, respectively), they appear to cause similar downstream effects on structural plasticity by activating mTOR. ", "This finding is significant because ketamine is known to be addictive whereas many classical psychedelics are not (). ", "The exact mechanisms by which these compounds stimulate mTOR is still not entirely understood, but our data suggest that, at least for classical psychedelics, TrkB and 5-HT2A receptors are involved. ", "Although most classical psychedelics are not considered to be addictive, there are still significant safety concerns with their use in medicine because they cause profound perceptual disturbances and still have the potential to be abused. ", "Therefore, the identification of non-hallucinogenic analogs capable of promoting plasticity in the PFC could facilitate a paradigm shift in our approach to treating neuropsychiatric diseases. ", "Moreover, such compounds could be critical to resolving the long-standing debate in the field concerning whether the subjective effects of psychedelics are necessary for their therapeutic effects (). ", "Although our group is actively investigating the psychoplastogenic properties of non-hallucinogenic analogs of psychedelics, others have reported the therapeutic potential of safer structural and functional analogs of ketamine ().", "\n\nOur data demonstrate that classical psychedelics from several distinct chemical classes are capable of robustly promoting the growth of both neurites and dendritic spines in vitro, in vivo, and across species. ", "Importantly, our studies highlight the similarities between the effects of ketamine and those of classical serotonergic psychedelics, supporting the hypothesis that the clinical antidepressant and anxiolytic effects of these molecules might result from their ability to promote structural and functional plasticity in prefrontal cortical neurons. ", "We have demonstrated that the plasticity-promoting properties of psychedelics require TrkB, mTOR, and 5-HT2A signaling, suggesting that these key signaling hubs may serve as potential targets for the development of psychoplastogens, fast-acting antidepressants, and anxiolytics. ", "Taken together, our results suggest that psychedelics may be used as lead structures to identify next-generation neurotherapeutics with improved efficacy and safety profiles." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0008031551260501146, 0.0009779478423297405, 0.0006992131820879877, 0.0006597957108169794, 0.0005542986909858882, 0.0005594239919446409, 0.0005885173450224102, 0.0006669803406111896, 0.0007777112768962979, 0.0006790153565816581, 0.0006242524832487106, 0.0006964497151784599, 0.0006220582872629166, 0.0008373851305805147, 0.0007689276826567948, 0.000721215910743922, 0.0007726843468844891, 0.0007831465918570757, 0.004333344753831625, 0.0006046831840649247, 0.003603125223889947, 0.000726229278370738, 0.0007576419739052653, 0.0006384800071828067, 0.0008129950729198754, 0.0005382115487009287, 0.0007017125026322901, 0.0008093228098005056, 0.0008614372927695513, 0.0006821000715717673, 0.0006794613436795771, 0.000728643499314785, 0.0005648001097142696, 0.0008925237925723195, 0.0007953849853947759, 0.0007977396016940475, 0.0006964107742533088, 0.0006207976257428527, 0.0006789807230234146, 0.0006780401454307139, 0.0008231608662754297, 0.0007144759292714298, 0.0006713181501254439, 0.0006950065144337714, 0.0005878883530385792, 0.0012130753602832556, 0.0006600809283554554, 0.000758670037612319, 0.0010426521766930819, 0.0006582085625268519, 0.000717993185389787, 0.0005745906382799149, 0.0006619922933168709, 0.0006598487962037325, 0.0007011981215327978, 0.0006284266128204763, 0.0006860704161226749, 0.0006323318229988217, 0.0010638528037816286, 0.0006466332706622779, 0.0009961791802197695, 0.0007171687320806086, 0.0007358957082033157, 0.0009212492732331157, 0.0008476432412862778, 0.000789004610851407, 0.0006489874795079231, 0.0006038949359208345, 0.0010916730388998985, 0.0006524271448142827, 0.0006287142168730497, 0.0006379499100148678, 0.0006958373123779893, 0.0008337325998581946, 0.0005869930610060692, 0.0007097938796505332, 0.001112322323024273, 0.0008038231753744185, 0.0008637934224680066, 0.0007094012689776719, 0.0005896071088500321, 0.0006434433744288981, 0.0007395285065285861, 0.0006414616946130991, 0.0006678227800875902, 0.000606137269642204, 0.0006104311323724687, 0.0006282044923864305, 0.0006216780748218298, 0.000589342787861824, 0.0005875645438209176, 0.0008268999517895281, 0.0006339764804579318, 0.000569684139918536, 0.0007900937343947589, 0.0006147004314698279, 0.0005515129305422306, 0.0006191357388161123, 0.0006993134738877416, 0.001023733289912343, 0.0008787910919636488, 0.0011518514947965741, 0.0008579223067499697, 0.0006223728996701539, 0.0017220458248630166, 0.0006723515689373016, 0.0007074844907037914, 0.0005780556821264327, 0.000699845259077847, 0.0008801633957773447, 0.0006268665310926735, 0.0008155762334354222, 0.0007520362851209939, 0.0016022094059735537, 0.0006263687973842025, 0.0005804793909192085, 0.0006007627816870809, 0.0008906678995117545, 0.0006678227800875902, 0.0006592265563085675, 0.000606137269642204, 0.0006216982146725059, 0.0006232538144104183, 0.0006358639220707119, 0.0005974805681034923, 0.0007730411598458886, 0.0006782751879654825, 0.0034696434158831835, 0.0005961154820397496, 0.0009129077079705894, 0.000797423766925931, 0.0008890547906048596, 0.0008421462262049317, 0.0006656356854364276, 0.0007812086259946227, 0.0006749906460754573, 0.0010080256033688784, 0.0006723300321027637, 0.004386416636407375, 0.0006997021264396608, 0.0011512471828609705, 0.0009022850426845253, 0.0016030631959438324, 0.0006686625420115888, 0.0006902082241140306, 0.0006573506398126483, 0.0008621677407063544, 0.0010167674627155066, 0.0007393340347334743, 0.0006680313381366432, 0.0005918127135373652, 0.0006508931401185691, 0.002797971945255995, 0.0010311915539205074, 0.0005927128368057311, 0.000557115999981761, 0.0008756169700063765, 0.0005248709348961711, 0.0005807542474940419, 0.0006693596951663494, 0.0007902646320872009, 0.000663494342006743, 0.0010046742390841246, 0.0006455249385908246, 0.0008464055717922747, 0.0006798335234634578, 0.0016330609796568751, 0.0007775023113936186, 0.0006618172628805041, 0.0007417596061713994, 0.0006755911163054407, 0.001434984733350575, 0.0005743853398598731, 0.0006199573981575668, 0.0005520859849639237, 0.0005410126177594066, 0.0007727727643214166, 0.0007992514874786139, 0.0006441010627895594, 0.000801292946562171, 0.0007448295364156365, 0.000801292946562171, 0.0006846269243396819, 0.0006915302947163582, 0.0008196941926144063, 0.0006858661072328687, 0.002097162650898099, 0.0006508931401185691, 0.0012903454480692744, 0.0007223495631478727, 0.001094836974516511, 0.0010341942543163896, 0.0006381684797815979, 0.0006939799641259015, 0.0006231567240320146, 0.0008226947393268347, 0.0019926547538489103, 0.0005427894066087902, 0.0006187827093526721, 0.0006431505898945034, 0.0006538560846820474, 0.0006983185303397477, 0.0006765207508578897 ]

[ "Two cases of right ventricular ischemic injury due to massive pulmonary embolism.", "\nIn general, massive pulmonary embolism induces severe right ventricular overload, but pathological changes in the right ventricle due to pulmonary embolism is rarely seen. ", "In this report, we describe two autopsy cases of massive pulmonary embolism without pre-existing cardiopulmonary disease. ", "Both cases were accompanied by myocarditis-like changes in the right ventricle and infiltration of a number of polymorphonuclear neutrophils and mononuclear cells into the dilated right ventricular wall. ", "Transmural or subendocardial coagulation necrosis was not apparent. ", "Almost all of the mononuclear cells were immunohistochemically revealed to be CD68-positive macrophages. ", "We speculated that these findings resulted from ischemia due to massive pulmonary embolism." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.002014326862990856, 0.002962624654173851, 0.0008932744967751205, 0.009846420958638191, 0.0011273393174633384, 0.004371717572212219, 0.0007609294843859971 ]

[ " Case: 18-50390 Document: 00514721679 Page: 1 Date Filed: 11/13/2018\n\n\n\n\n IN THE UNITED STATES COURT OF APPEALS\n FOR THE FIFTH CIRCUIT\n United States Court of Appeals\n Fifth Circuit\n\n FILED\n No. ", "18-50390 November 13, 2018\n Summary Calendar\n Lyle W. Cayce\n Clerk\nUNITED STATES OF AMERICA,\n\n Plaintiff-Appellee\n\nv.\n\nROSARIO DIVINS,\n\n Defendant-Appellant\n\n\n Appeal from the United States District Court\n for the Western District of Texas\n USDC No. ", "5:08-CR-889-1\n\n\nBefore SMITH, HIGGINSON, and DUNCAN, Circuit Judges.", "\nPER CURIAM: *\n Rosario Divins, federal prisoner # 30034-280, seeks leave to proceed in\nforma pauperis (IFP) on appeal from the denial of her Federal Rule of Criminal\nProcedure 36 motion to correct a clerical error. ", "By moving to proceed IFP,\nDivins is challenging the district court’s certification decision that her appeal\nwas not taken in good faith because it is frivolous. ", "See Baugh v. Taylor, 117\n\n\n\n\n * Pursuant to 5TH CIR. ", "R. 47.5, the court has determined that this opinion should not\nbe published and is not precedent except under the limited circumstances set forth in 5TH\nCIR. ", "R. 47.5.4.", "\n\f Case: 18-50390 Document: 00514721679 Page: 2 Date Filed: 11/13/2018\n\n\n No. ", "18-50390\n\nF.3d 197, 202 (5th Cir. ", "1997). ", "Divins’s motion to file a supplemental brief is\nGRANTED.", "\n Divins does not address the district court’s reasons for denying her IFP\nmotion or her Rule 36 motion. ", "When an appellant fails to identify any error in\nthe district court’s analysis, it is the same as if the appellant had not appealed\nthat issue. ", "Brinkmann v. Dallas Cty. ", "Deputy Sheriff Abner, 813 F.2d 744, 748\n(5th Cir. ", "1987); see also FED. ", "R. APP. ", "P. 28(a)(8). ", "Thus, Divins’s motion to\nproceed IFP is DENIED, and her appeal is DISMISSED as frivolous. ", "See\nBaugh, 117 F.3d at 202 n.24; 5TH CIR. ", "R. 42.2. ", "Divins is WARNED that filing\nrepetitive or frivolous pleadings in this court could result in the imposition of\nsanctions. ", "These sanctions may include dismissal, monetary sanctions, and\nrestrictions on her ability to file pleadings in this court and any court subject\nto this court’s jurisdiction.", "\n\n\n\n\n 2\n\f" ]

{ "pile_set_name": "FreeLaw" }

[ 0.0007010761764831841, 0.0007259369012899697, 0.000657453725580126, 0.0007335973205044866, 0.0007111141458153725, 0.0006834825035184622, 0.0006590101402252913, 0.001062648487277329, 0.0006897900020703673, 0.0007813821430318058, 0.0007741957088001072, 0.0006084698252379894, 0.000741034687962383, 0.0006661509978584945, 0.000815784907899797, 0.0010011643171310425, 0.0007069719722494483, 0.0009975661523640156, 0.0007280195131897926, 0.0009149195975624025, 0.0007224224973469973, 0.0009558744495734572, 0.0011400111252442002, 0.0007011326379142702, 0.0010009023826569319 ]

[ "[Command]\nCommand=\"\n copyq:\n function modifySelectedItemData(itemData)\n {\n // TODO: Modify item data here!", "\n if (mimeText in itemData) {\n itemData[mimeText] = str(itemData[mimeText]).replace('\\\\n', ';');\n delete itemData[mimeHtml]\n }\n }\n\n var itemsData = selectedItemsData()\n for (var i in itemsData) {\n var itemData = itemsData[i]\n modifySelectedItemData(itemsData[i])\n }\n setSelectedItemsData(itemsData)\"\nIcon=\\xf016\nInMenu=true\nName=Template: Modify Selected Items\nShortcut=ctrl+shift+m\n\n" ]

{ "pile_set_name": "Github" }

[ 0.0009472416713833809, 0.0012212686706334352 ]

[ "Screening for inhibitors of chloroplast galactolipid synthesis acting in membrano and in planta.", "\nThe knowledge of the membrane lipid metabolism in photosynthetic cells is expected to benefit from the availability of inhibitors acting at the level of specific enzymes like MGD1 (E.C. 2.4.1.46) that catalyzes the synthesis of monogalactosyldiacylglycerol (MGDG) in chloroplasts. ", "MGDG is a major lipid of photosynthetic membrane, interacting with photosystems. ", "It is the precursor of digalactosyldiacylglycerol that serves as a phospholipid surrogate when plants are deprived of phosphate, and it is a source of polyunsaturated fatty acids for jasmonic acid syntheses. ", "MGD1 is activated by phosphatidic acid and thus a coupling point between phospholipid and galactolipid metabolisms. ", "Here we describe a method to screen for inhibitors of MGD1 assayed in liposomes. ", "Selected compounds can therefore reach the core of the biological membranes in which the target sits. ", "We then describe a secondary screen to evaluate the efficiency of developed compounds at the whole plant level. ", "Major issues raised by the screening of inhibitors acting on membrane proteins are discussed and can be useful for similar targets." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006533078849315643, 0.0007240790291689336, 0.0011719352332875133, 0.0015373710775747895, 0.0020626403857022524, 0.000970749300904572, 0.0005646206554956734, 0.0005238605663180351, 0.0005242834449745715 ]

[ "Etiology and management of dyslipidemia in children with chronic kidney disease and end-stage renal disease.", "\nLipids are essential components of cell membranes, contributing to cell fuel, myelin formation, subcellular organelle function, and steroid hormone synthesis. ", "Children with chronic kidney disease (CKD) and end-stage renal disease (ESRD) exhibit various co-morbidities, including dyslipidemia. ", "The prevalence of dyslipidemias in children with CKD and ESRD is high, being present in 39-65% of patients. ", "Elevated lipid levels in children without renal disease are a risk factor for cardiovascular disease (CVD), while the risk for CVD in pediatric CKD/ESRD is unclear. ", "The pathogenesis of dyslipidemia in CKD features various factors, including increased levels of triglycerides, triglyceride-rich lipoproteins, apolipoprotein C3 (ApoC-III), decreased levels of cholesterylester transfer protein and high-density lipoproteins, and aberrations in serum very low-density and intermediate-density lipoproteins. ", "If initial risk assessment indicates that a child with advanced CKD has 2 or more co-morbidities for CVD, first-line treatment should consist of non-pharmacologic management such as therapeutic lifestyle changes and dietary counseling. ", "Pharmacologic treatment of dyslipidemia may reduce the incidence of CVD in children with CKD/ESRD, but randomized trials are lacking. ", "Statins are the only class of lipid-lowering drugs currently approved by the U.S. Food and Drug Administration (FDA) for use in the pediatric population. ", "FDA-approved pediatric labeling for these drugs is based on results from placebo-controlled trial results, showing 30-50% reductions in baseline low-density lipoprotein cholesterol. ", "Although statins are generally well tolerated in adults, a spectrum of adverse events has been reported with their use in both the clinical trial and post-marketing settings." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0010391233954578638, 0.0009182184585370123, 0.02012011781334877, 0.0025585906114429235, 0.000830132863484323, 0.0009400585549883544, 0.001413572346791625, 0.001984173431992531, 0.0008038542000576854, 0.0006434831884689629, 0.0006364832515828311 ]

[ "Vikings season 4: Intrigues, dead, spoilers … Everything you need to know before the return of the series!", "\n\nAfter months of waiting, Season 4 Vikings will make his return in a few days! ", "Discover everything you need to know about the return of the series, its intrigues, its people and its spoilers.", "\n\nAn update! ", "On November 30, History will broadcast “The Outsider” , episode 11 of season 4 of Vikings, where we met the son of Ragnar in several promo videos . ", "We know that second half of the season will mark the entry into a new era for our heroes. ", "A significant leap in time was conducted and therefore many new intrigues to be proposed to us. ", "First, one involving Ragnar. ", "He will make his return to Kattegat, after years of absence, to make every effort to engage a battle against Wessex. ", "Unfortunately, only Ivar will follow in this quest. ", "A quest loaded in disillusionment, which could well lead to the presumed and expected death of Ragnar. ", "Another trip we will be proposed: that Bjorn will go to the conquest of the Mediterranean, accompanied by Floki and some of his brothers. ", "Moreover, Rollo will feel the need to reconnect with his roots Vikings. ", "Kattegat is also one of the major challenges of the next puisqu’Aslaug Lagertha episodes and will compete to have the leadership. ", "Finally, the other son will not be left behind as everyone will choose their destiny . ", "Destinies that could lead to clash! ", "To death ?", "\nPossibly! ", "We have seen in several excerpts, Sigurd is perceived as the weak link of the siblings, but it is also enamored of the young woman with whom Ubbe sharing intimate relationships. ", "Thus the possibility of a fight between brothers and fratricide can not be excluded. ", "Note that Hvitserk is the only so far not to have benefited from promotion on his character. ", "Does that mean he will die quickly? ", "Everything is possible. ", "Other deaths are expected. ", "We said there that Ragnar, but Aslaug and Rollo could also be close to the end of their stories . ", "Conversely, we have nothing to fear for Lagertha, present on the set of season 5! ", "Then she will be the new queen of Kattegat? ", "The new episodes also expected to create new characters, including Astrid, the new companion Lagertha. ", "Note that the 5 son of Ragnar should not miss to experience great love stories! ", "We are impatient ! ", "Stay tuned since after the official posters of the 4B Vikings season , promotion should continue! ", "Are you excited to attend the Vikings back?" ]

{ "pile_set_name": "Pile-CC" }

[ 0.001134407240897417, 0.001517504220828414, 0.0005917692906223238, 0.0009371917694807053, 0.000628943438641727, 0.000644211599137634, 0.0005389846628531814, 0.0013224510475993156, 0.002295735292136669, 0.0007904442609287798, 0.020511716604232788, 0.0008758631884120405, 0.0005716542364098132, 0.002963827457278967, 0.00233799172565341, 0.0011240290477871895, 0.6614207625389099, 0.0013125095283612609, 0.0006280368543229997, 0.0013820448657497764, 0.0009287838474847376, 0.5930646657943726, 0.0006375511293299496, 0.016620831564068794, 0.0008993992232717574, 0.0012207627296447754, 0.0015177058521658182, 0.0007738600834272802, 0.001033483655191958, 0.0015027590561658144, 0.0006594216683879495, 0.0012673294404521585 ]

[ "Q:\n\nCMake share library with multiple executables\n\nMy project contains several executables that share some common code. ", " I would like to put the common code in a static library that the executables can link to. ", " (The common code is pretty small and I prefer not to deal with shared libraries).", "\nThe source tree looks something like this:\n\nproject\n\nCMakeLists.txt\ncommon\n\nCMakeLists.txt\nsrc\ninclude\n\napp1\n\nsrc\nCMakeLists.txt\n\napp2\n\nsrc\nCMakeLists.txt\n\napp1 and app2 both depend on the code in common.", "\nThis common code is very application specific and will never need to be used by another project outside this directory tree. ", " For that reason I would prefer not to install the library in any sort of global location.", "\nThe top-level CMakeLists.txt file just adds the subdirectories:\nproject(toplevel)\ncmake_minimum_required(VERSION 3.1)\n\nadd_subdirectory(common)\nadd_subdirectory(app1)\nadd_subdirectory(app2)\n\nThe common library's CMakeLists.txt file creates the static library and sets include directories:\nadd_library(common STATIC common.cpp) \ntarget_include_directories(common PUBLIC \"${CMAKE_CURRENT_LIST_DIR}/include\")\n\nAnd the file for the executables looks like this:\nproject(app1)\ncmake_minimum_required(VERSION 3.1)\n\nadd_executable(${PROJECT_NAME} main.cpp)\ntarget_link_libraries(${PROJECT_NAME} common)\n\nNow for my question. ", " If I run CMake from the top level project directory, I can build app1 and app2 and they build successfully. ", " However, if I want to build a single one of these projects (by running CMake from app1, for example) instead of building from the top level directory, I get an error because common/include is not added to the header search path.", "\nI can see why this happens. ", " There is nothing in the CMakeLists.txt file for app1 or app2 that \"pulls in\" common. ", " This is only done at the top level.", "\nIs there a way around this, or is this behavior generally considered acceptable? ", " Is something about my setup sub-optimal? ", " I'm just thinking it would be nice to be able to build the projects individually instead of from the top level in the event that we start to develop more and more executables that use this common library, but perhaps this is something I shouldn't be concerned about.", "\n\nA:\n\nWhen you setup your build environment, you should put some thought into the following three topics (beside others, but for this discussion/answer I reduced it to the three I feel are relevant here):\n\nDependecies / Coupling\nDeployment\nTeams\n\n\"Strong Coupling\"\nI came to think of the add_subdirectory() command as supporting \"strong coupling\" and your current setup implicitly supports:\n\nA frequently changing common library\nA single deployment (process and timing) for all your apps\nA single team working on the complete source base \n\nAn IDE would show it all in one solution\nYou generate one build environment for everything \n\n\"Loose Coupling\"\nIf you want a more \"loose coupling\" you could make use of external scripts in other languages or the use of CMake's ExternalProject_Add() macro. ", "So if you setup the common library (maybe even including \"binary delivery\") and each app as a separate project you do support:\n\nA less often changing common library\n\nProbably with its own release cycles\n\nAn independent development/deployment cycle for each app\nA team of different developers working on each app\n\nA Mixture of Both\nSo as you can see there a lot of things to consider and CMake can give you support for all kind of approaches. ", "Considering that your project might be in the early stages, you probably go by a mixed approach (not right away de-coupling the common library):\nCMakeLists.txt\nproject(toplevel)\ncmake_minimum_required(VERSION 3.1)\n\ninclude(ExternalProject)\n\nExternalProject_Add(\n app1 \n SOURCE_DIR \"${CMAKE_CURRENT_SOURCE_DIR}/app1\"\n PREFIX app1\n INSTALL_COMMAND \"\"\n)\nExternalProject_Add(\n app2 \n SOURCE_DIR \"${CMAKE_CURRENT_SOURCE_DIR}/app2\"\n PREFIX app2\n INSTALL_COMMAND \"\"\n)\n\napp1/CMakeLists.txt\nproject(app1)\ncmake_minimum_required(VERSION 3.1)\n\nadd_subdirectory(../common common)\n\nadd_executable(${PROJECT_NAME} src/main.cpp)\ntarget_link_libraries(${PROJECT_NAME} common)\n\nThis will actually generate three build environments. ", "One directly in your binary output directory and one each in app1 and app2 sub-directories.", "\nAnd in such approaches you may want to think about common CMake toolchain files.", "\nReferences\n\nUse CMake-enabled libraries in your CMake project (II)\nCMake: How to setup Source, Library and CMakeLists.txt dependencies?", "\n\nA:\n\nYou should use project() command in subdirectories only if this subproject is intended to be built both as standalone and as a part of toplevel project. ", "This is the case for LLVM and Clang, for example: Clang can be compiled separately, but when LLVM build system detects Clang source, it includes its targets too.", "\nIn your case you don't need subprojects. ", "To compile only app1 or app2 target issue make app1/make app2 in projects build dir.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007267945911735296, 0.0006219145143404603, 0.0006021491717547178, 0.0006546323420479894, 0.0006331954500637949, 0.0006722849211655557, 0.0006626936374232173, 0.000688146217726171, 0.0006224906537681818, 0.0007532336749136448, 0.0008612772799097002, 0.000625064829364419, 0.0006420827703550458, 0.0007503722445107996, 0.0005518315592780709, 0.0005728757241740823, 0.00054281170014292, 0.0006182878278195858, 0.000669115805067122, 0.0005500192055478692, 0.0006270347512327135, 0.0006200032657943666, 0.0006648277048952878, 0.0008457094663754106, 0.000682839541696012, 0.001995444530621171 ]

[ "#!", "/bin/bash\n\nkill $(pgrep -f \"node index\");\nrm -f /home/reddit/.lounge/users/*;\nrm -rf /home/reddit/.lounge/storage;\ncd /home/reddit/lounge-autoconnect;\nyes N | node index add first-user;\nnohup npm start ./ >> thelounge.log 2>&1 &\nexit\n" ]

{ "pile_set_name": "Github" }

[ 0.01251957006752491, 0.00463437894359231 ]

[ "This invention generally relates to heat transfer systems and more particularly relates to systems for cooling LED arrays.", "\nMany applications which use infrared cameras depend on infrared light emitted from LED arrays to illuminate the subject whose image is being captured by the infrared camera. ", "Infrared cameras are often used in imaging applications associated with vehicle safety systems to determine the presence (or absence) of a passenger in one or more locations within a vehicle. ", "Infrared imaging systems are also used in automobile applications in what is known as “driver gaze systems.” ", "Driver gaze systems are systems that monitor driver eye and head movement to determine if the driver is falling asleep or otherwise becoming inattentive to his driving responsibilities.", "\nBy their nature, infrared cameras can operate at an optimal efficiency only if the light received by the camera falls within an optimum wavelength range. ", "If an infrared camera is operated outside of its optimum wavelength range, its efficiency degrades significantly. ", "For example, many infrared cameras operate optimally in a wavelength band centered around 940 nm. ", "In order to obtain the optimal performance from the infrared camera, the infrared LED array used to illuminate the subject, should have a spectral irradiance maximum centered on or about the 940 nm wavelength point. ", "Although such ideal matching between camera and LED array can be achieved in the laboratory setting, such ideal conditions cannot typically be met within a vehicle passenger compartment inasmuch as unregulated passenger compartment temperatures can vary anywhere from −40 degrees C. to 85 degrees C. and LED arrays have a significant wavelength shift vs. temperature dependence (typically about 0.25 nm/° C.). ", "When a vehicle HVAC system is operational, typical cabin temperatures vary within a much narrower range (typically 22 degrees C.+/−5 degrees C.).", "\nThe present invention takes advantage of the moderating temperatures provided by the HVAC system within the vehicle to moderate the temperature of the LED array." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.0005588657222688198, 0.0005960126291029155, 0.0005865137791261077, 0.0005723668145947158, 0.0007568460423499346, 0.000587932881899178, 0.0006120892358012497, 0.0005592128727585077, 0.0005826301057823002, 0.0005672422121278942, 0.0005892961635254323, 0.0005750401760451496 ]

[ "An Arabidopsis thaliana tubulin mutant with conditional root-skewing phenotype.", "\nLow doses of microtubule-interacting drugs cause wild-type Arabidopsis thaliana seedling roots to twist in a left-handed helical direction. ", "We here report molecular characterization of an A. thaliana tubulin mutant whose roots twist in a right-handed direction and have shallow left-handed cortical microtubule arrays when challenged with low doses of microtubule drugs. ", "In the absence of the drug, growth and development of the mutant was apparently normal. ", "In this conditional twisting mutant, Cys213 of alpha-tubulin6 was exchanged with Tyr. ", "The mutant tubulin was incorporated into the microtubule polymer with wild-type tubulins, and thus acted as a dominant-negative mutation. ", "These results suggest that compromised microtubules in wild-type and mutant roots are qualitatively distinct and affect skewing direction differently." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.001299003604799509, 0.0007750076474621892, 0.0006193623994477093, 0.0006247524870559573, 0.0010443510254845023, 0.0006955508724786341, 0.0006471314700320363 ]

[ "By David Jacobson and Ross Stein, Temblor\n\nCheck your seismic hazard rank\n\nIn the last 24 hours, there have been 15 small earthquakes within a area just northwest of Avenal, California. ", "These quakes ranged from M=1.5 to a M=3.3, registering 65 felt reports on the USGS website. ", "These earthquakes, as well as a larger cluster 4-5 days ago, are not close to any mapped surface faults. ", "In fact, the closest major fault that cuts the earth’s surface is the San Andreas, approximately 30 km (20 mi) away. ", "Because of this, we thought we’d take a look at the potential seismicity source for the earthquake clusters near Avenal.", "\n\nEast of Avenal lies a chain of upwarped folds (‘anticlines’) that mark the western margin of the San Joaquin Basin. ", "An anticline is a folded strata, resembling an arch, that is the product of compression. ", "In the case of the these folds, they are the result of ‘blind thrust faults,’faults that are active but do not cut the earth’s surface. ", "Slip on these faults have slowly pushed up and folded the overlying strata. ", "These faults accommodate several millimeters per year of contraction perpendicular to the San Andreas Fault. ", "So, the San Andreas can only take care of the strike-slip motion; what’s left over is compression acting perpendicular to the San Andreas, and this gets accommodated by the thrusts.", "\n\nAs blind thrust faults evolve, several things happen. ", "First, they can slip in large earthquakes, which struck here in the May 2, 1983 M=6.5 Coalinga, and the August 4, 1985 M=6.1 Kettleman Hills earthquakes. ", "Second, as the originally horizontal strata is folded, traps for oil are created. ", "In fact, the Coalinga Oil Field is the eighth largest in California and went into production in 1890. ", "Lastly, at the junctions between folds, “tears” can form. ", "Yesterday’s quakes appear to be on these tear faults.", "\n\nThe schematic diagram below illustrates what is likely occurring near Avenal. ", "Rather than being continuous, the blind thrusts have tears between the segments, where strike-slip quakes can occur. ", "Here, the resulting tear faults would be ‘right-lateral’ (whichever side you are on, the other sides moves to the right).", "\n\nThese small quakes are thus emblems of a hidden hazard: the potential for M~7 quakes on the blind thrust segments. ", "According to the Global Earthquake Activity Rate (GEAR) model shown in Temblor, an earthquake of magnitude M=6.50 is likely in your lifetime along much of the western margin of the valley. ", "The M=7.3 Kern County shock struck the southern end of the Great Valley in 1952.", "\n\nReferences\n\nUSGS\n\nCaltech\n\nGoran Ekstrom, Ross S. Stein, J.P. Eaton, and D. Eberhart-Phillips, Seismicity and Geometry of a 110-kim-Long Blind Thrust Fault: The 1985 Kettleman Hills, California, Earthquake, Journal of Geophysical Research, Vol. ", "97, NO. ", "B4, p. 4843-4864, April 10, 1992. – ", "Link\n\nStein, R.S. and Yeats, R.S., Hidden Earthquakes, Sci. ", "Am., ", "260, . ", "48-57, June, 1989. – ", "Link" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006035399856045842, 0.0006259692017920315, 0.0007020613411441445, 0.0010042880894616246, 0.0005269949324429035, 0.0011588764609768987, 0.0007254912052303553, 0.0009631271241232753, 0.0009604388615116477, 0.0007260884740389884, 0.000660213059745729, 0.0008105942979454994, 0.0005806144326925278, 0.0005915341316722333, 0.0006214938475750387, 0.012626131996512413, 0.021596912294626236, 0.0005968844052404165, 0.0008363129454664886, 0.0010953039163723588, 0.0009095788700506091, 0.0006205866811797023, 0.0007851689588278532, 0.0006094519048929214, 0.0008708756067790091, 0.0006617188919335604, 0.0006964078056626022, 0.001066664350219071, 0.0010853466810658574, 0.0006575490115210414, 0.0008559398702345788 ]

[ "Arch Out Loud has announced an international competition challenging designers to develop proposals for a vertical cemetery that explores the relationship between life and death within the city for the Shinjuku district of Tokyo.", "\n\nWith almost 25 percent of Tokyo’s population now aged 65 and older and a large majority over the age of 30, Arch Out Loud suggests the city needs to face the issue of burial space. ", "Currently in Tokyo, unwanted cemeteries are often constructed in front of homes in neighbourhoods that are already densely populated.", "\n\nDesigners have the freedom to vertically address the issue of space and the requirements of the brief. ", "There is no required scale for the cemetery.", "\n\nProposals should include a columbarium (a space for the storage of funeral urns) and while designers can choose how much room they allocate, efficiency will be considered by the jury.", "\n\nThere should also be reflection spaces for family and friends of the deceased to reflect. ", "The areas can be large gathering areas for many people or small personal spaces. ", "There must be two or more of these spaces in the overall proposal.", "\n\nThe competition is the second to be held by Arch Out Loud, an architectural research initiative dedicated to providing opportunities for designers to explore the current atmosphere of architectural and cultural thought. ", "Arch Out Loud’s first design competition was for the New York City Aquarium and Public Waterfront, which received 178 proposals and was won by Italian architectural firm Lissoni Architettura.", "\n\nThe objectives of the vertical cemetery competition are to:\n\nExplore the relationship between death and the current state of the discipline of architecture. ", "Look for innovative ways a cemetery can be experienced. ", "Create a solution that efficiently addresses Tokyo’s issue with space. ", "Define a relationship between two unlike environments – the cemetery and the city. ", "Examine the connection between a cemetery and the commercial and pop culture identities of Tokyo.", "\n\nThere will be 50 finalists and first place will receive US$5,000 (NZD$7,000) while three runners-up will each receive US$1,000. ", "A director’s choice award and 10 honourable mentions will also be awarded.", "\n\nThe jury includes Tom Wiscombe (founder and principal at Tom Wiscombe Architecture), Alison Killing (founder of Killing Architects and curator of the 2014 Venice Biennale, Death in Venice), Liam Young (founder of Tomorrow’s Thoughts Today), Ania Molenda (founder of Amateur Cities and curator of the 2014 Venice Biennale, Death in Venice), Masatake Shinohara (vice curator of the Japanese Pavilion at the 2016 Venice Biennale), Dongwoo Yim (principal and co-founder of Praud), Rafael Luna (principal and co-founder of Praud), Curtis Roth (Ohio State University and Akadamie Schloss Solitude), Karla Britton (head of architectural theory at Yale University), and Astrid Klein (founder and principal at Klein Dytham Architecture).", "\n\nTeams must not exceed four people. ", "For further information and registration details visit the Arch Out Loud website." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0005579564021900296, 0.000858056009747088, 0.0005898575182072818, 0.0005323188961483538, 0.000621870975010097, 0.0007084651733748615, 0.000522983493283391, 0.0006357811507768929, 0.0005741740460507572, 0.0005696486332453787, 0.0006454819231294096, 0.0005657481378875673, 0.0005790609284304082, 0.0007201260887086391, 0.0006334568024612963, 0.0006062421016395092, 0.0006134748109616339, 0.0005454494967125356, 0.0006356042576953769, 0.0006454219692386687, 0.0005660264287143946 ]

[ "Courtesy of FX Networks; HBO; ABC\n\nGreat TV came in many shapes and sizes in 2015, and my top 10 of the year reflects at least some of that diversity. ", "From a network comedy to a premium cable late-night show to a streaming animated half-hour to a slew of golden age dramas, the list runs the gamut. ", "An impressive six series here premiered in 2014, with several making big creative leaps in their second seasons. ", "And then there are the two venerable shows that had triumphant conclusions. ", "When I sketched out my top 10, I knew what the first five shows would be, and I knew I wanted what ended up occupying the sixth and seventh slots to be somewhere on the list as well. ", "But the last three slots involved hair-pulling — and many of the shows that will appear on my \"Second 10\" list missed the first cut by the slimmest of margins.", "\n\nLet's get down to business …" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0005565294995903969, 0.000925675849430263, 0.0005419966182671487, 0.000618495570961386, 0.0005929289618507028, 0.0015866901958361268, 0.0011290288530290127 ]

[ "York Regional Police are warning the public after con artists showed up at a victim’s Markham home to perpetrate a tax collection scam Tuesday.", "\n\nAccording to police, the victim, who lives in the Steeles Ave. ", "E. and Don Mills Rd. ", "area, received a phone call from scammers claiming to be with the Canadian Revenue Agency (CRA) who told her that she owed $58,000 in overdue taxes. ", "The victim thought the call was suspicious and hung up.", "\n\nShortly after, the victim received another call from a number that showed up as York Regional Police on her caller ID, and was told that she would be arrested if she didn’t pay the overdue taxes immediately.", "\n\nThe victim hung up again, but a short time later, a black SUV showed up at her home and two people knocked on her door. ", "The victim hid inside her home until they left, then called police.", "\n\nAlthough police have seen increased reports of tax collection scams done over the phone by people claiming to be with CRA or various police services, this is the first report of ripoff artists actually showing up at someone’s residence, Const. ", "Laura Nicolle said.", "\n\nYork police does not engage in tax collection or arrest people in relation to overdue taxes. ", "Nicolle said anyone approached by someone claiming to be a police officer has the right to ask for a badge and proof of identity.", "\n\n“As soon as someone is aggressive with you, that’s a big red flag,” she said.", "\n\nPolice are investigating the incident and are asking anyone who may have seen the black SUV or who has experienced a similar incident to contact the Major Fraud Unit at 1-866-876-5423, ext. ", "6612.", "\n\nRead more about:" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.012024241499602795, 0.0008669779635965824, 0.0009185225935652852, 0.0022286938037723303, 0.0013163704425096512, 0.0009506878559477627, 0.03448878973722458, 0.0029174210503697395, 0.002712085610255599, 0.000895065488293767, 0.0011745558585971594, 0.0007435816805809736, 0.020265808328986168, 0.0012622554786503315, 0.0010542158270254731, 0.0006089882226660848 ]

[ "The present invention relates generally to integrated circuit clocking, and more specifically, to distributing a clock throughout an integrated circuit system.", "\nAn issue facing the integrated circuit industry today is the problem of distributing clock signals throughout integrated circuit systems and integrated xe2x80x9ccircuit dies with minimal clock delay variation and jitter. ", "One source of clock xe2x80x9d; xe2x80x9cvariation and jitter is noise in the power supply to the inverters that drive thexe2x80x9d; and clock signal throughout the integrated circuit. ", "Currently, the amount of clock delay variation and jitter due to power supply noise is dealt with by lowering the maximum chip operating frequency to provide a higher margin for clock delay variation and jitter. ", "Stated another way, because of the clock delay variation and jitter, the maximum operating frequency of the integrated circuit is reduced. ", "Thus, by lowering the amount of clock delay variation and jitter, the maximum operating frequency of the integrated circuit can be increased.", "\nIn a conventional clock distribution network, a series of inverters are used, increasing in size, to drive the capacitance of the clock load starting at the clock generator circuit. ", "One example of such a clock distribution network is described in U.S. Pat. ", "No. ", "6,037,822 to Rao et al. ", "and assigned to the same assignee as the present invention. ", "In the \"\"822 patent, inverters are used to drive a clock signal through an xe2x80x9cH-treexe2x80x9d clock distribution system. ", "Typically, the inverters are connected directly to the power supply of the integrated circuit. ", "Noise in the power supply affects the performance of the inverters and results in clock variation and jitter at the peripheral boundaries of the clock distribution network. ", "This tends to lower the maximum chip operating frequency. ", "Specifically, as seen in FIG. ", "1, a power supply Vcc 101 powers an inverter 103. ", "The inverter 103 is one of many inverters that form the clock distribution network. ", "As seen in FIG. ", "1, the power supply 101 is connected directly to the inverter 103. ", "It has been found that this direct connection of the power supply to the inverter 103 results in clock delay variation and jitter, if there is noise on the power supply." ]

{ "pile_set_name": "USPTO Backgrounds" }

[ 0.000600022089201957, 0.000821944500785321, 0.0009948877850547433, 0.000769864593166858, 0.000596530910115689, 0.0006283374386839569, 0.0007060731295496225, 0.0006277029751800001, 0.0013785817427560687, 0.0006912429817020893, 0.0006673548487015069, 0.0009291276801377535, 0.0006768983439542353, 0.000938223849516362, 0.0007126890704967082, 0.0006042602472007275, 0.0009741802932694554, 0.0010568122379481792, 0.0006292338948696852, 0.0007148500881157815, 0.000791519065387547 ]

[ "Sorcerer King continues to get polished up. ", "I suspect it’s the most polished game we’ve ever made as we’ve had so much extra time to work on it.", "\n\nSo what’s been happening?", "\n\nOriginally, we were going to release Sorcerer King in April. ", "But we talked to our friends at other studios and realized that the Age of Wonders expansion and Pillars of Eternity were coming out during the same month. ", "That’s a lot of fantasy in a short amount of time. ", "With Galactic Civilizations coming out in May and E3 in June, we decided that July would be a good date.", "\n\nAs a result, the team has just kept working on Sorcerer King throughout all that time with the game getting increasingly fun and polished as a result.", "\n\nWhat have you done with that extra time?", "\n\nAsked someone. ", "I dunno who. ", "Someone. ", "You there. ", "The one reading this. ", "You asked right?", "\n\nAnyway…\n\nWhen GalCiv III got released we learned a lot. ", "For one thing, we learned that the initial impression is made in the first 6 minutes of play through. ", "If you’re a game developer, make note of that time. ", "that’s 360 seconds from the time they get to the main menu to the time they’ve largely decided whether they think the game is “good” or not.", "\n\nA big part of that time is making sure the game has a coherent narrative. ", "You have to explain to the player, immediately, what the game is about. ", "And I can tell you, Asynchronous 4X doesn’t cut it.", "\n\nNow, you guys and us know we have a fun game. ", "But we have certain aspects of the game that have been a challenge. ", "So let’s talk about that.", "\n\nFantasy Star Control\n\nSorcerer King is, in essence, fantasy Star Control at its root. ", "You have a main bad guy who has already conquered everyone who is about to do some very bad stuff. ", "You are the heroic leader trying to assemble a ragtag force to go deal with the main bad guy while along the way picking up allies.", "\n\nThere’s a big problem with this idea: Replayability. ", "Sorcerer King has been trapped half-way between Star Control and a sandbox 4X.\n\nWhile Sorcerer King has a pretty good campaign, it’s no where near as involved as what’s in Star Control. ", "On the other hand, while Star Control doesn’t have a lot of replayability, it could live on its amazing story-driven campaign while Sorcerer King has been trying to have a much shorter (maybe 30 hour) campaign with the main meat of the game being the sandbox.", "\n\nThe problem with the sandbox, however, is that you can only beat the Sorcerer King so many times before you’ve “played the game” to its conclusion.", "\n\nHow do you solve a problem like Mirdoth?", "\n\nSo to succinctly recap:\n\nSorcerer King was envisioned as a sort of fantasy Star Control except where the maps are randomly generated each time. ", "The player builds up a force, makes alliances and goes and confronts the main bad guy.", "\n\nThe strength of this is that the game is extremely fun the first several times you play. ", "But eventually, you’ve played it.", "\n\nHow we’re addressing this\n\nIn an open sandbox game like Galactic Civilizations III or Civilization V, the solution is that every game is totally different. ", "You have no idea, at the start, who are going to be your friends and enemies. ", "You have no idea what resources you will be bargaining or how the placement of other civilizations will affect your game.", "\n\nSorcerer King, by contrast, isn’t an open sandbox. ", "That’s because the Sorcerer King, by design, is a lot more powerful than the player up until the end (assuming you survive).", "\n\nSo how do you make such a game as replayable as say Galactic Civilizations?", "\n\nHere’s how:\n\nYou create additional victory conditions\n\nYou turn those minor civilizations into actual rivals\n\nYou make sure that each sovereign you choose is really different\n\nAdditional Victory Conditions\n\nOriginally the only way to win was to confront and defeat the Sorcerer King in his fortress. ", "However, we are going to add additional victory conditions including:\n\nVictory: The Tower of Sorcery (you build a tower and begin racing the Sorcerer King to gather enough magical might to throw throw him down (this is actually what happened in the book)\n\nVictory: Alliance. ", "Gain the trust of all your rivals and you win. ", "Easier said than done of course (easier on small maps with 1 opponent).", "\n\nRivals\n\nSo the once minor factions are now full-blown Rivals who you can pick and choose in the game setup and give a difficulty level. ", "If you conquer their city, they will start producing their specific unit for your use (you don’t have to manage conquered cities).", "\n\nThey now will try to found new cities as well and will go to war with each other.", "\n\nYou can trade and negotiate with them (though it’s not like the Trade screen but rather an RPG-like trade system instead – conversational).", "\n\nUnique Sovereigns\n\nFrom here on out, only Galor is the son of Relias. ", "The others each have their own backstory and the way you interact with the world and with the Sorcerer King depends on which sovereign you have.", "\n\nThis is great news. ", "I've liked the premise of SK, but you hit the target on the dilemma. ", "And for a $40 game to have such a (relatively) short win condition, adding in more replayability will be key.", "\n\nHonestly, if you could create a game variant/mod that converted SK into Legendary Heroes (in some form), that would blow the replayability up by a thousand. ", "I love the polish and art of SK and wish it was in FE/LH. ", "I know it's much more complicated to disable/enable stuff for it to act like LH because of the Doomsday Counter, role of triggers, etc., ", "but if you had the ability to enter a more sandbox mode than just a semi-randomized/customized campaign there would be a lot of love. ", "And I could see it unlocking a bunch of DLC, too.", "\n\nLove it that what probably started as a mod has turned into fully supported, polished, and well-crafted software. (", "see what I did at the end there? ", "crafting?)", "\n\nWhen do you all think you'll have a \"release candidate\" for Sorcerer King? ", "The changes here, while not insignificant, don't seem like they're too hard to implement at this point, considering how polished everything is. ", "When do you think we'll see them?", "\n\nHonestly, I think Sorcerer King has the potential to be your best game. ", "Ever. ", "Not kidding. ", "It's very polished, very fun, and with some replayability issues addressed, deeper than you'd expect with a pretty easy entry barrier.", "\n\nWill we see the rivals war with the SK on their own? ", "When they battle each other, if one wins, what happens to the losers units?", "\n\nAre you all shooting for mid-July?", "\n\nKeep up the good work, guys! ", "The finish line is in sight! ", "You have the potential for a real winner here...\n\nGreat ideas,and i love the changes that are coming.", "Some things that i would love to see\n\n-Minor factions that are now full-rivals maybe can be playable by us as a different starting option-race???", "\n\n-Some heroes and sovereigns need buffing,especially mages\n\n-Better city sieges(they seem lackluster right now)\n\nThis is your best game in the fantasy setting.", "There is huge potential right here.", "I know that i can't wait for the release date to come,but i would prefer to take your time and deliver when you are ready\n\nWhen GalCiv III got released we learned a lot. ", "For one thing, we learned that the initial impression is made in the first 6 minutes of play through.", "\n\nI hope you also learnt GCIII fails in providing good impression in those minutes.", "\n\nYou have to explain to the player, immediately, what the game is about. ", "And I can tell you, Asynchronous 4X doesn’t cut it.", "\n\nI see no reason why it does not. ", "Starting cinematic + first turn give player full understaing of what is going on.", "\n\nWhile Sorcerer King has a pretty good campaign\n\nHow do we know it does?", "\n\nSorcerer King, by contrast, isn’t an open sandbox. ", "That’s because the Sorcerer King, by design, is a lot more powerful than the player up until the end\n\nI don't get it. ", "What exactly \"closes\" the sandbox in SK?", "\n\nYou create additional victory conditions\n\nYou turn those minor civilizations into actual rivals\n\nYou make sure that each sovereign you choose is really different\n\nI have better idea: make existing systems work, instead of wasting time on developing new ones, with no guarantees it helps.", "\n\nWhat means make work?", "\n\nMake resources work. ", "Right now there is only one resource: horsemetal. ", "Yes, horsemetal. ", "There is no reason to use one without other, and crystal resource is just useless. ", "Game system have 3 resources. ", "Make them valuable and make player adapt to their apperiance on the map.", "\n\nMake crafting work. ", "First of, make it not be a chore. ", "Don't give player lots of high level items from battles. ", "make player make hard choices on what enchant material to use. ", "The same applies to receipts of items. ", "This way player will have to craft and enchant differently each game.", "\n\nMake SK fortersses work. ", "Right now it just occupies space. ", "SK's units comes up from garrisons (round \"altars\"). ", "And those just spawn in front of your capital! ", "Make fortresses more valueable to SK and more threatening to player. ", "And random maps will provide different positional play each game.", "\n\nMake dozens little things work! ", "Like Peregan has falcon. ", "Falcon is useless in battle, but may be it is good scout? ", "Nope, its view range is non existing! ", "Make him a good scout and player will have an interesting choices of not producing a scout, but use hero skillpoint to aquire superior in mobility scout!", "\n\nI provide all these criticisms not becouse I'm a jerk (tough possibly being one), but becouse this game have a huge potential, but it seems development is being derailed from polishing things which are already there. ", "Which is exactly what is expected for game two months from release.", "\n\nI can understands why other people might like the idea of the other minor factions acting like players, so I can understand the appeal of it to some extent. ", "But I like the minor factions the way they are now thanks very much. ", "I Likew the idea of me facing off against a much more poerful foe with some assistance from the minor factions. ", "Otherwise it would really feel like Age of Wonders etc with one very big guy on the block as the rest of us squabble. ", "Dont sacrifice uniqueness for what others may like.", "\n\nHowever if others want the choice, give it to them. ", "Set it as a option.", "\n\nThe problem with the sandbox, however, is that you can only beat the Sorcerer King so many times before you’ve “played the game” to its conclusion.", "\n\nI dont see this as a problem. \"", "AI-War\" has been a very successful game with lots of expansions and it, at its core, is just a \"build up to take out the big bad computer while not pissing it off too much till you do.\" ", "People LIKE that sort of game. ", "It's. ", "again, unique. ", "Don;t bland out the game when you have a good idea and selling point.", "\n\nHow can you make a game like SK replayable many times?There has to be choices that define the experience.", "Let's have a look at them.", "\n\n-Sovereigns.", "Are they all the same or do they offer different playstyle(some of them need balance tweaks).", "\n\n-Sovereign skills.", "When you reach big time level with tinkerer let's say for example you have to choose between 2 skills that are his specialization.3 recipes for legendary weapons,or recipes for 2 legendary armors and 1 ring with big resistances.", "Mage sovereign must choose between unlocking 3 attack type spells,or some support ones that are very powerful.", "\n\n-City building.", "Each sovereign has to choose 3 times between 2 buildings.", "One in start,one in middle,one in the end-game.", "For example if i pick the mage i have to choose between a college of magic that gives me more mana per turn and +1 attack on all mage units and a halls of wisdom that unlocks 3 more spells that are powerful.", "Only one building can be constructed.", "Another example.", "Do i build the grand cathedral that let's me produce high paladins or do i build altar of light that produces angels?The last example provides also some unit diversity.", "\n\n-Units.", "Our stack of doom is pretty standard right now.", "I should be able to go full ranged,or full melee and be viable,or something ranged with a bit of support with auras and spells.", "We need more unit diversity.", "If i choose to go with a ranged team do i pick archers type 1 or do i go with archer type 2.Each has his benefits.", "Archer type 1 is full attack,archer type 2 has some support-defend skills and lower damage output.", "Same thing for melee.", "Viable options so i can try different things.", "\n\n-Outposts should also provide a tactical option.", "Upgrade them to give us a bit of defense and movement or big attack bonus,or give a teleportation skill with certain sovereigns(cooldown and some restrictions needed in this so it;s not completely broken).", "\n\nMaster of magic is considered till today the best in it's kind for one reason.", "It gives you options,and very different strategies that can carry you through the end.", "Viable strategies,different strategies,different playstyle.", "I know it is a different game from SK but still it is a very good example of why it was so good.", "I know my suggestions are very vague,but i would like you to see them as examples of different options and how you can implement them in the game.", "A game doesn't need just options.", "It needs them to be viable.", "If they are not it becomes just bloated like many today games and loses it's simplicity and tightness.", "Do i need 30 options in a game that doesn't matter or do i need a game that has only 10 options but each one is viable and differentiates my playstyle?You have a real gem right here.", "\n\nPs.", "Sorry for my big post again.", "It isn't well written or maybe well explained.", "My suggestions are just a small example of how you can diversity in the game.", "I am sure other guys may have much better ones." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006248938734643161, 0.0006327393930405378, 0.0007087988196872175, 0.0006069575902074575, 0.0005409179721027613, 0.0007328469073399901, 0.0005628815270029008, 0.0005836452473886311, 0.0007331723463721573, 0.0009391288040205836, 0.00100786576513201, 0.0012229838175699115, 0.0013249313924461603, 0.0007273718365468085, 0.0007534375763498247, 0.0006846686592325568, 0.0005603896570391953, 0.0005990369827486575, 0.0007322210003621876, 0.0005934583605267107, 0.0006565211224369705, 0.0031864994671195745, 0.0010781381279230118, 0.0005701960762962699, 0.0005782212829217315, 0.0007057993207126856, 0.03293497860431671, 0.013541343621909618, 0.0007558240322396159, 0.0007932913140393794, 0.000745405734051019, 0.0012459001736715436, 0.0024238128680735826, 0.0006023494643159211, 0.0012494160328060389, 0.0006661189254373312, 0.0006206979160197079, 0.000634341558907181, 0.02227133698761463, 0.0008261954062618315, 0.0012061076704412699, 0.0011090904008597136, 0.0007232683710753918, 0.0008252063416875899, 0.0006854244275018573, 0.003062918782234192, 0.0005813210154883564, 0.0008985131862573326, 0.0013299316633492708, 0.3678489327430725, 0.0006371893687173724, 0.0010801644530147314, 0.0006939998711459339, 0.0006128285313025117, 0.000691869470756501, 0.0007424048963002861, 0.01328620221465826, 0.0006144957151263952, 0.0006381800631061196, 0.0006013218662701547, 0.0023983342107385397, 0.0006756557850167155, 0.0006809016922488809, 0.0006683943211100996, 0.0006582217756658792, 0.0005778774502687156, 0.0007354999543167651, 0.0006561023183166981, 0.003299212548881769, 0.0018407439347356558, 0.0005466658039949834, 0.017924034968018532, 0.05554604530334473, 0.0008328250842168927, 0.0011738172033801675, 0.0014127297326922417, 0.0006933477125130594, 0.0006726582651026547, 0.0008484428399242461, 0.0006063795881345868, 0.0005766447284258902, 0.0005603896570391953, 0.0021169984247535467, 0.0006565211224369705, 0.0031864994671195745, 0.0007277156691998243, 0.0006881429580971599, 0.0006463643512688577, 0.0012061076704412699, 0.0007162364781834185, 0.0008578099659644067, 0.0007400865433737636, 0.0007596647483296692, 0.0006933103431947529, 0.0021372397895902395, 0.014880402013659477, 0.01498092245310545, 0.0007852912531234324, 0.0006812915089540184, 0.0006535037537105381, 0.0024112688843160868, 0.0009167350362986326, 0.0006668983842246234, 0.000622208637651056, 0.0006639218772761524, 0.004213398788124323, 0.0006646490073762834, 0.0006735665956512094, 0.22892923653125763, 0.0017987756291404366, 0.0006298189400695264, 0.0015227985568344593, 0.0023006543051451445, 0.0038295576814562082, 0.0007745794137008488, 0.0007162207621149719, 0.02398095838725567, 0.0006441858131438494, 0.0005383164971135557, 0.0005410399753600359, 0.003932229243218899, 0.004518166184425354, 0.0012264117831364274, 0.0005802125670015812, 0.0007392832776531577, 0.0012459001736715436, 0.0008712585549801588, 0.09346166998147964, 0.0007953509339131415, 0.0009271000744774938, 0.0007105210679583251, 0.008653081953525543, 0.0007945740944705904, 0.0005963165895082057, 0.0006943292682990432, 0.0006723948172293603, 0.0006146291852928698, 0.0023764478974044323, 0.0007882861536927521, 0.0006581277120858431, 0.0006135125295259058, 0.0008410796872340143, 0.00074882892658934, 0.0006076199933886528, 0.0007212571799755096, 0.0008655223064124584, 0.0006563281058333814, 0.0024476151447743177, 0.0005866901483386755, 0.000611630268394947, 0.0006410026689991355, 0.0009415990207344294, 0.0006989233661442995, 0.0005634212866425514, 0.0005438653170131147, 0.0009185864473693073, 0.000700632983352989, 0.0006331178592517972, 0.0005806874833069742, 0.0007515465840697289, 0.0005150730139575899, 0.0007646005833521485, 0.0006110115209594369, 0.0014438425423577428, 0.0009183489019051194, 0.0009656924521550536, 0.0008563925512135029, 0.0006580546032637358, 0.0005924702272750437, 0.0005601771408692002 ]

[ "[Investigation of modes of hantavirus infection transmission from rodents to humans].", "\nHemorrhagic fever with renal syndrome (HFRS) is a focal zoonosis of viral etiology that appears in many countries of the world. ", "Investigation demonstrated that for epidemic of HFRS is necessary to have intensity of epizootic process. ", "The increased number of mice-like rodents in enzootic foci of HFRS is the most important factor. ", "This investigation pointed out to high risk of direct contact with rodents secrets, from visible urine and feces traces of rodents that are present in large number of patients, in 422 patients or 69.29%. ", "Results of this investigation demonstrate that Hantavirus infection can be spread by infectious droplets as in areas with increased number of rodents. ", "In this manner 65 persons got HFRS in investigated period or 10.67%. ", "The food, if it is exposed to the rodent contamination can be a way of transmitting infection and HFRS. ", "This investigation determined this way of transmitting infection in 64 persons or 10.50%. ", "As a possible way to transmit the infection with drinking water contaminated by rodents excretes 40 patients got the disease or 6.58% out of total number." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0005840075318701565, 0.0012378029059618711, 0.0006040777079761028, 0.0007607025327160954, 0.0006683659157715738, 0.0006297088111750782, 0.0010106011759489775, 0.0016242354176938534, 0.0007183757261373103, 0.0012671701842918992 ]

[ "Q:\n\nWhen is a static variable in Visual Basic created?", "\n\nLet's say I have a static variable in a function:\nPrivate Sub SomeFunction()\n Static staticVar As String = _myField.", "Value\nEnd Sub\n\nWhen, exactly, is the value from _myField assigned to staticVar? ", "Upon the first call to the function? ", "Instantiation of the enclosing class?", "\n\nA:\n\nThe CLR has no support for this construct so the VB.NET compiler emulates it.", "\nCreation first. ", " The variable is lifted to a private field of the class with an unspeakable name that ensures no name collisions can occur. ", " It will be an instance field if the variable is inside an instance method of the class. ", " So will be created when an object of the class is created with the new operator. ", " It will be a Shared field if the method is Shared or is part of a Module. ", " So will be created in the loader heap by the jitter.", "\nAssignment next, the much more involved operation. ", " The language rule is that assignment occurs when code execution lands on the Dim statement for the first time. ", " The term first time is a loaded one. ", " There's an enormous amount of code generated by the compiler inside the method to ensure this is guaranteed. ", " The kind of problems that need to be addressed are threading, recursion and exceptions.", "\nThe compiler creates another hidden helper field of type StaticLocalInitFlag at the same scope as the hidden variable field to keep track of initialization state for the variable. ", " The first part of the injected code is a call to Monitor.", "Enter() to deal with threading. ", " Same thing as SyncLock. ", " The StaticLocalInitFlag serves as the locking object, note how it is a class and not just a Boolean.", "\nNext, Try and Finally statements guard against exceptions. ", " Inside the Try statement, the value of StaticLocalInitFlag.", "State is checked for 0. ", " This protects against recursion on the same thread. ", " State is then set to 2 to indicate that initialization code is running. ", " Followed by the assignment. ", " Next, State is checked again to see if it is still 2. ", " If it is not then something went drastically wrong and an IncompleteInitialization exception is thrown.", "\nThe Finally block then sets the State to 1 to indicate that the variable is initialized. ", " Followed by a call to Monitor.", "Leave().", "\nLots of code, 96 bytes of IL for just a simple variable. ", " Use Static only if you don't worry about the cost.", "\n\nA:\n\nA Static variable is instantiated when it is assigned, obviously.", "\nWhen that line is run, not before, not after.", "\nPut a breakpoint on it and you'll see.", "\nStatic just means that the value will persist between calls.", "\nShared class/module members are instantiated the first time the class is accessed, before any Shared constructor and before the call, whether that is to the class constructor or some Shared method/property. ", "I think this may be the origin of your confusion. ", "Static local variables, like local statics in c# are not instantiated in this way.", "\n\nInteresting information from Tim Schmelter, it appears the value is maintained internally using a hidden Shared class level variable that is instantiated like other Shared class level variables but always with the default value.", "\nThe effect observed by you the developer is unchanged, apart from some instantiation delay when the class is accessed. ", "This delay should be undetectable in practice.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007273718365468085, 0.0007556133205071092, 0.0007133084582164884, 0.0006578019238077104, 0.0008756775059737265, 0.0006931448588147759, 0.0006569026154465973, 0.0006272944738157094, 0.0006681255181320012, 0.0007750179502181709, 0.0005972608341835439, 0.005475193727761507, 0.0006017877603881061, 0.0007147489232011139, 0.0006540953763760626, 0.0005587858613580465, 0.0006903581670485437, 0.0006511658430099487, 0.0006598689360544086, 0.0007209238829091191, 0.0007064833189360797, 0.002121496945619583, 0.0007416712469421327, 0.0007944729877635837, 0.0007540739607065916, 0.0007047010585665703, 0.0006136151496320963, 0.0006720101227983832, 0.0006116011063568294, 0.0006555744330398738, 0.0011011090828105807, 0.0007713641389273107, 0.0013962493976578116, 0.000624489679466933, 0.0010493630543351173, 0.0006502517499029636, 0.0007464560912922025, 0.0006689464789815247, 0.0006472088280133903, 0.0006718339864164591, 0.0007149993325583637, 0.000716693582944572, 0.0007560213562101126, 0.000552778656128794, 0.0006211157306097448, 0.001995444530621171 ]

[ "Before L. Ron Hubbard founded Scientology, he wrote what he considered his masterpiece. ", "Hubbard claimed the novella, titled Excalibur or sometimes Dark Sword, was so good that its early readers went insane or killed themselves.", "\n\nIn actuality, little evidence of the sword-titled book exists, leading commentators to speculate that Hubbard (famous for his tall tales) never wrote it. ", "But 33 years after Hubbard’s death, Scientology has a new sword death problem. ", "People with swords or very large knives keep getting involved in killings at Scientology centers.", "\n\nIt happened again on Wednesday.", "\n\nAn unidentified man parked a white Bentley outside the front doors of the Church of Scientology in Inglewood, California on Wednesday afternoon and entered the center with a samurai sword, where he started “acting crazy,” one witness told KTLA.", "\n\nTwo police officers arrived on the scene and opened fire on the man, striking him in the head. ", "He later died in the hospital. ", "Details of the killing are sparse.", "\n\nBut the death wasn’t even the only samurai sword-related Scientology slaying within a dozen miles.", "\n\nIn November 2008, 48-year-old Mario Majorski entered Scientology’s famous Hollywood “Celebrity Center,” some 12 miles north of Inglewood. ", "Brandishing a samurai sword in each hand, Majorski attempted to attack people inside the center until a security guard shot and killed him.", "\n\nMajorski had a complicated history with the controversial group, a trajectory shared by other former members. ", "He’d been a Scientologist in the early 1990s, the group told media at the time. ", "While involved in Scientology, Majorski took up the group’s aggressive stance against critics. ", "In 1993, he attempted to sue a UCLA professor who criticized Scientology. ", "One of his attorneys in the case was longtime Scientology lawyer Kendrick Moxon, court records show.", "\n\nThe case was dismissed for lack of standing. ", "But Moxon’s involvement ties the suit to a decades-long pattern of aggressive legal action against Scientology’s critics.", "\n\nScientology has been the subject of skepticism before it technically even existed as a religion. ", "Hubbard, originally a science-fiction author, began claiming otherworldly enlightenment after a supposed near-death experience in a dentist’s office in 1938. ", "His alleged brush with the afterlife inspired him to write Excalibur, the title of which references the legendary sword King Arthur pulled from a stone. ", "A gifted self-promoter, if not a particularly gifted writer, Hubbard boasted about the book for decades without ever publishing it. (", "He claimed early readers had lost their minds or died.) ", "Instead, he reworked some of the supposed book’s themes into Dianetics, a pseudoscientific self-help book that became a national sensation in the 1950s, despite debunkings by medical professionals.", "\n\nThat criticism continued when Hubbard made Dianetics the foundational text in the religion of Scientology, which preaches that humans are actually just bodies occupied by ancient, soul-like beings called “thetans” which, with the right amount of pricey Scientology training, can work miracles and exercise supernatural powers.", "\n\nThe church has been accused of financially exploiting and physically abusing members in prison-like conditions aboard ships and inside Scientology buildings, allegations the group denies. ", "After one early denial, in 1968, the church began targeting critic Paulette Cooper, suing her at least 19 times over a book she wrote on Scientology. ", "The organization also planned an elaborate harassment campaign against Cooper, which was revealed in documents seized by FBI agents in a 1977 raid over Scientologists’ infiltration of more than 100 government agencies. (", "Eleven high-level church officials, including Hubbard’s wife, were convicted in the conspiracy to infiltrate the government and sanitize records about the church and Hubbard.)", "\n\nMoxon, the lawyer who represented Majorski in his suit against the UCLA professor, was named an “unindicted co-conspirator” in the infiltration conspiracy case, and was not charged. ", "But Majorski did not stay with the group. ", "He left sometime in the ’90s, Scientology officials say, and was accused of a series of attacks with obscure weapons. ", "In 2007, he allegedly tried to attack a judge with a sharpened railroad spike, and in 2008 used an ax handle to threaten an AAA representative who helped him when his car was stranded.", "\n\nDuring those years of estrangement from Scientology, Majorski sent the church threatening faxes and phone calls, the group’s representatives said.", "\n\nScientology suffered a third stabbing incident this past January, when a 16-year-old carried a nine-inch knife into a Sydney, Australia center. ", "The teenager was believed to have attended the church with his mother, who was undergoing one of Scientology’s “purification ceremonies.” ", "He allegedly became involved in a domestic dispute inside the building.", "\n\nWhen Scientology staff tried to eject the teen from the building, he allegedly drew the knife on them, injuring one and killing another.", "\n\nScientology blamed its critics for the murder. ", "In a letter to the A+E television network, which aired an award-winning expose of the church, Scientology accused network executives of having “blood on your hands.”", "\n\n“Week after week, month after month, and now year after year, this series has poisoned the airwaves in an avowed effort to create hatred against the Scientology religion and Scientologists,” the email read. “", "Now, somebody is dead. ", "You paid for the hate that caused his murder.”" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006616482278332114, 0.04342835396528244, 0.0006737351068295538, 0.02259126491844654, 0.001788754714652896, 0.0006953752017579973, 0.0016682461136952043, 0.1443209946155548, 0.008993172086775303, 0.0007177878869697452, 0.014375896193087101, 0.001080886460840702, 0.11442204564809799, 0.000637830060441047, 0.0006269161240197718, 0.0009768439922481775, 0.006180931348353624, 0.0006138599710538983, 0.0007492961594834924, 0.0009356893133372068, 0.001096653752028942, 0.0006882786983624101, 0.0009174777660518885, 0.0005793054588139057, 0.004641059320420027, 0.0008782800287008286, 0.0017795973690226674, 0.0022497065365314484, 0.0013203235575929284, 0.0007318659336306155, 0.0007973405881784856, 0.000758664624299854, 0.0007827354711480439, 0.0010136232012882829, 0.0015878787962719798, 0.0014938703970983624, 0.007970518432557583, 0.00124364101793617, 0.0007395925931632519, 0.06879129260778427, 0.005007641389966011, 0.0554281547665596, 0.005183913744986057, 0.07271167635917664, 0.16776731610298157 ]

[ "Garrett Lindholm\n\nGarrett Lindholm (born August 10, 1988) is an American football placekicker who is currently a free agent. ", "He played for Tarleton State in college. ", "He is best known for kicking a 64-yard field goal to send Tarleton to overtime against Texas A&M–Kingsville in his senior season.", "\n\nProfessional career\n\nEarly career\nLindholm signed with the Atlanta Falcons in 2013, but was released in July. ", "Lindholm was claimed off waivers by the Indianapolis Colts, where he played in 3 preseason games mostly as a kickoff specialist. ", "He was released priors to the Colts 3rd preseason game.", "\n\nMilwaukee Mustangs\nIn 2011, Lindholm was assigned to the Milwaukee Mustangs of the Arena Football League (AFL).", "\n\nSt. Louis Rams\nLindholm played the 2012 preseason with the St. Louis Rams. ", "Lindholm received an opportunity to kick for the Rams, but was competing with Greg Zuerlein who was drafted, and eventually won the job. ", "Lindholm was released following the Rams' 3rd preseason game.", "\n\nArizona Rattlers\nIn 2013, Lindholm was assigned to the Arizona Rattlers. ", "Lindholm lead the AFL in Field Goals made (7), and was the league leader in points (179). ", "Lindholm was named the AFL's Kicker of the Year following the conclusion of the regular season. ", "His longest made field goal was from 47 yards. ", "His efforts helped the Rattlers capture their second consecutive ArenaBowl Championship.", "\n\nSan Antonio Talons\nOn January 30, 2014, Lindholm was assigned to the San Antonio Talons.", "\n\nNew Orleans VooDoo\nOn March 26, 2015, Lindholm was assigned to the New Orleans VooDoo. ", "When the VooDoo ceased operations August 9, 2015, Lindholm became a free agent.", "\n\nOrlando Predators\nOn August 12, 2015, Lindholm was assigned to the Orlando Predators.", "\n\nLos Angeles KISS\nOn August 6, 2016, Lindholm was assigned to the Los Angeles KISS.", "\n\nReferences\n\nExternal links\nNFL bio\nTarleton State bio\n\nCategory:1988 births\nCategory:Living people\nCategory:Tarleton State Texans football players\nCategory:Milwaukee Mustangs (2009–12) players\nCategory:Arizona Rattlers players\nCategory:San Antonio Talons players\nCategory:New Orleans VooDoo players\nCategory:Orlando Predators players\nCategory:Los Angeles Kiss players\nCategory:American football placekickers\nCategory:People from Pflugerville, Texas" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.004888775292783976, 0.0007633162313140929, 0.0036595489364117384, 0.0006411401554942131, 0.0006778001552447677, 0.000628726789727807, 0.000737794442102313, 0.0009312831680290401, 0.001138002728112042, 0.0006700206431560218, 0.0007685114978812635, 0.000998369650915265, 0.0008193455287255347, 0.0008939015679061413, 0.0018019333947449923, 0.0008763552759774029, 0.0006334416684694588, 0.0013244823785498738, 0.0008208838989958167, 0.0006231935112737119, 0.0006521632894873619 ]

[ "Kimberley Nordic Fall Training Camp. ", "Sept. 28-30th.", "\n\nTime to kick-start the fall season with a multi-day camp that will include some roller skiing, ski striding, circuit training, team bonding, and piles of FUN! ", "Join us in Kimberley for some great training, fun outdoor activities and sports-related lectures from our special guests.", "\n\nLocation: Kimberley, BC, at the Kimberley Nordic Club (KNC). ", "The lodge will remain open all weekend. ", "You can tent or set up a trailer in the stadium area or parking lot. ", "No water or electrical hook-ups available. ", "Note, bears can be in the area. ", "Some activities will start from the lodge, but roller skiing will mainly occur on the Rails to Trails, requiring transport/car-pooling to the trails. ", "Some parent volunteers will be needed.", "\n\nAthletes: This camp is open to skiers aged 8-80, but will focus on the ages of 9-14, and 15-18. ", "Based on the Long Term Athlete Development model, athletes in the Learn to Train, Train to Train and Learn to Compete stages of development will benefit most from this camp. ", "The camp is also open to any interested Masters athletes. ", "Parents: If your athlete is 12 years of age and younger, you are required to sleep on site with your athlete or find another adult to help supervise. ", "Local athletes are encouraged to stay on site for the duration of the camp. ", "Please leave electronic devices away for the weekend! (", "You’ll have so much fun that you won’t miss them!)", "\n\nCoaches: Tim Wintoniw and many other great coaches.", "\n\nParents: We are looking for volunteers in varying capacities: • Group Sweeps in runs, ski striding, roller skiing; lead or assist in games and team building activities; dinner prep and clean up on Saturday; clean up after the camp. • ", "Parent coaches/coaches please come and learn alongside other coaches. ", "We would like to have an opportunity for you to learn and develop as well in a mentorship setting. • ", "If you are on our volunteer coach list, we will cover the cost for your Saturday evening meal. ", "Contact Tim Wintoniw to be placed on this list.", "\n\nRegistration & Cost: The focus for this camp is FUN, as well as time to bond with your teammates. ", "Athletes are expected to demonstrate respectful, supportive and inclusive behaviour at all times. ", "Coaches and/or chaperones will supervise athletes during the daytime activities. ", "Parents and/or chaperones will be responsible for all meal times other than Saturday dinner, as well as evening/night time supervision. ", "Registration and payment is on zone4 at hhps://zone4.ca, and the deadline to register is September 24th. ", "For registration inquiries, please contact Timwintoniw@gmail.com.", "\n\nCost for the camp is $60 for athletes of all ages. ", "The fee includes rental of the lodge, snacks and electrolyte drinks on all days for the athletes, dinner on Saturday night, and the cost for our 2 guest lecturers on Friday and Saturday evenings. ", "For parents/guests not registered for the camp, dinner tickets will be available through zone4.ca at $20 per person. ", "Please bring your own dishes and cutlery. ", "Everyone will be responsible for all of their own breakfasts and lunches, as well as dinner on Friday night. ", "Teck will be awarding athletic T-Shirts to participants aged 16 and under. ", "This camp has a full participation policy. ", "This means that participants are expected to arrive when the camp starts on Sept 28th and stay until the camp ends on September 30th unless you have made prior arrangements with Tim Wintoniw.", "\n\nTentative Training and Activity Times:\n\nFriday: 3:30pm – arrive at the KNC and set up your tents/check-in with the coaches 4:00pm – 6:00pm – fun team-bonding activity followed by trail run\n\nSunday: 9:30am – 13:00pm – Older athletes with classic RS - long classic roller skiing from TaTa Creek to KNC Lodge (Tim, and other coaches to provide support and feedback on technique), older athletes without classic RS – long run around the mountain; younger athletes will have an intro to Orienteering followed by an orienteering competition on the Nordic Trails (Eileen Charles to lead this, and aided by other coaches). ", "12:30pm – lunch and clean-up prior to departure.", "\n\nWhat to Bring:\n\n***Please have all items well marked with first and last name and club***\n\n• B.C. Care Card/Medical number\n\n• Personal hygiene items (toothbrush, toothpaste, deodorant, etc.)", "\n\n• Sunscreen and lip balm with sun block\n\n• Sunglasses\n\n• Towels (suggest bringing one for indoor and one for outdoor use)\n\n• Rain Jacket and Pants.", "\n\n• Training clothes for very hot through to cold, wet and miserable weather\n\n*You will not be allowed to participate in roller ski sessions if you do not have them. ", "Please refrain from bringing any electronic devices for the duration of the camp - there is no Internet access at the campground. ", "Electronic games, videos, etc. ", "will not be permitted during the camp." ]

{ "pile_set_name": "Pile-CC" }

[ 0.0006485360790975392, 0.0007968859863467515, 0.0012621610658243299, 0.0005319543997757137, 0.0005780151695944369, 0.0006546049262396991, 0.0016100154025480151, 0.0006856991094537079, 0.0010396596044301987, 0.0005819433135911822, 0.0005738249747082591, 0.0007080680225044489, 0.0005727307870984077, 0.0005349956918507814, 0.004179774317890406, 0.0005273079732432961, 0.0006867523770779371, 0.0010103089734911919, 0.0005973447696305811, 0.0006116346339695156, 0.0005205324268899858, 0.0005000259843654931, 0.0011705484939739108, 0.000975951028522104, 0.0005665465141646564, 0.000526470597833395, 0.0005899837706238031, 0.0006744141574017704, 0.0005571114597842097, 0.0006247019045986235, 0.0009154719300568104, 0.0005893452907912433, 0.0006010846700519323, 0.0011185772018507123, 0.0008214002591557801, 0.01587499864399433, 0.0005963134462945163, 0.0006244643591344357, 0.0005613741232082248, 0.0006976171280257404, 0.0007603206322528422, 0.0006509738159365952, 0.0038036287296563387, 0.0005753770819865167, 0.0006506029167212546, 0.0007113526808097959 ]

[ "Influence of substrate tissue type on larval growth in Calliphora augur and Lucilia cuprina (Diptera: Calliphoridae).", "\nThe size of fly larvae is an important variable in the use of these insects to estimate postmortem interval. ", "Furthermore, the nutritional intake of larvae is likely to vary subject to the part of a corpse on which they are feeding. ", "A study was therefore conducted to investigate the effect of type of food substrate on larval growth in two species of forensically important Australian blowflies. ", "After collection on sheep's liver in the laboratory, different groups of larvae of Lucilia cuprina (Wiedemann) and Calliphora augur (Fabricius) were grown on sheep's liver, meat, and brains, and their body lengths compared. ", "Results indicated that the development of larvae fed sheep's liver was adversely affected compared with larvae fed meat and brain; they moulted later, reached maximum length more slowly and sometimes produced significantly smaller pupae. ", "These findings, similar to those of another recent study, have obvious implications for postmortem interval determinations. ", "Estimates may be considerably skewed if the site of collection of larvae at a death scene contains tissue types different to those used in reference experiments. ", "We therefore recommend caution in forensic analyses that interpret crime scene data using developmental studies performed with a single type of larval food substrate." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0006349291652441025, 0.0005777342594228685, 0.0008797604241408408, 0.0007406061631627381, 0.00101348792668432, 0.0035462677478790283, 0.0006120792822912335, 0.0005981127615086734, 0.000542190857231617 ]

[ "\n\nWindows \"Next\" hate is nothing new - Suraj-Sun\nhttp://www.neowin.net/news/windows-next-hate-is-nothing-new\n\n======\nbackwardsx\nI never understood people's love for Windows XP. ", "It maybe started to get good\nafter a few service packs but I found it to be unstable and prone to slowing\ndown after a short while of use even into SP2.", "\n\nWhatever initial criticisms of XP that had come out were probably justified\n(It definitely was and still is an ugly operating system). ", "I don't agree with\nthe author's point that people automatically hate whatever windows version\ncome next. ", "It just seems that way because we haven't had a good windows since\n98.", "\n\nThe only reason why windows 7 actually turned out to be a decent operating\nsystem is because it needed to be, the competition(OSX, linux) was gaining\nground under XP primarily because of how bad it was. ", "Sure I imagine that the\nage of XP had something to do with it but I remember installing linux back in\n2004/2005 after one to many blue screens with XP and not looking back until\nwindows 7.", "\n\n------\nSlipperySlope\nEssentially ...\n\n\"Does this mean that everyone is going to drop Windows 7 in favor of 8?", "\nProbably not; chances are that a ton of businesses and consumers will still be\nrunning it when Windows 9 (or even 10) comes out. ", "But that’s not necessarily\nbecause they hate it, it’s just the way people adopt new OSes – with new\nhardware.\"", "\n\n... So will companies and consumers upgrade to laptops with touch screens?", "\n\n" ]

{ "pile_set_name": "HackerNews" }

[ 0.005435548722743988, 0.0005734474980272353, 0.0008011008612811565, 0.0014644453767687082, 0.0008301347843371332, 0.0011025896528735757, 0.0006252055172808468, 0.0009243895183317363, 0.0006368563626892865, 0.0010634991340339184, 0.0008632125100120902, 0.001995444530621171 ]

[ "Flow cytometry description of a novel CD3-/CD7+ intraepithelial lymphocyte subset in human duodenal biopsies: potential diagnostic value in coeliac disease.", "\nIntraepithelial lymphocytes (IEL) represent a heterogeneous cellular compartment of unknown functions and controversial ontogeny. ", "Previous observations in humans indicate that the majority of IEL subsets express the CD3 complex associated with either the alphabeta or the gammadelta T-cell receptor components, and describe the characteristic increase of CD3+TCRgammadelta+ IEL in coeliac disease. ", "In the present work, we analyze the surface antigen expression of intraepithelial lymphocytes isolated from duodenal biopsies of control subjects and coeliac disease patients. ", "We describe a CD3-CD7 + IEL subset frequently found in control subjects (41.41+/-21.8), with the following features: 1) most of these cells are CD45R0+ CD103+ and CD44- CD28- CD5-; 2) a significant percentage express CD56 (44.7%+/-21.3), CD2 (55.1%+/-16.2), and CD94 (16.2%+/-7.3). ", "Furthermore, they are CD122+ and CD25-; 3) this CD3- IEL subset exhibit an activated phenotype expressing higher levels of CD69, CD103, and CD38 than the CD3+ subset. ", "Interestingly, this CD3- subset is drastically reduced in CD patients (2.2+/-2.9 in active disease, 6.3+/-4.6 in treated patients versus 41.4+/-21.8 in control subjects). ", "The imbalanced ratio \"increased TCRgammadelta versus decreased CD3- CD7+\" is a permanent finding in CD patients following clinical and histological remission. ", "This parameter might provide helpful diagnostic information (easily obtained by 3-color FCM from diagnostic biopsies), and suggest a potential implication in the pathogenesis of coeliac disease." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.0014175571268424392, 0.0006973631680011749, 0.0007810005336068571, 0.0006777187809348106, 0.0006359450635500252, 0.000918777659535408, 0.0006591216078959405, 0.0006336808437481523, 0.0005917862290516496 ]

[ "Q:\n\nmysql - query inside a query\n\nHow is it possible to do the following :\n(i am using mysql - phpmyadmin )\nthis query returns a table name :\nSelect table_name from Table1 where id = 1\n\nI want to use it inside another query , like :\nselect val from (Select table_name from Table1 where id = 1)\n\nbut this sure does not work, and since phpmyadmin does not support calling stored procedures, could there be any possible solution for this ?", "\n\nA:\n\nYou cannot really do it in a single SQL statement.", "\nYou are trying to use data (field value) as metadata (table name), and SQL does not allow this.", "\nYou could break it in two statements or write dynamic SQL in a stored procedure. ", "Note that not all client layers support returning resultsets from stored procedures.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0006434711976908147, 0.0007776283309794962, 0.0006730240420438349, 0.0006932217511348426, 0.0006622078362852335, 0.001995444530621171 ]

[ "Outcome of preterm infants who suffered neonatal apnoeic attacks.", "\nThirty infants of less than 31 weeks post-menstrual age were monitored for apnoea using routine medical equipment and intermittent 24-h pneumocardiograms. ", "These infants were examined again between 16 and 36 months of age. ", "Full physical and ophthalmological examinations were carried out as well as audiometry and assessment using the Griffiths mental developmental scales. ", "Twenty-five of these infants had suffered apnoeic attacks and two of these infants had an abnormal developmental quotient. ", "Neither sensorineural deafness of retinopathy of prematurity were detected in the children who suffered apnoeic episodes. ", "The poor prognosis which has been associated with neonatal apnoea may not apply to those infants without other serious neonatal problem." ]

{ "pile_set_name": "PubMed Abstracts" }

[ 0.005479940213263035, 0.0012487992644309998, 0.0007559921941719949, 0.00066709378734231, 0.0020683095790445805, 0.013266819529235363, 0.009139008820056915 ]

[ "using UnityEngine.", "PostProcessing;\n\nnamespace UnityEditor.", "PostProcessing\n{\n using Settings = GrainModel.", "Settings;\n\n [PostProcessingModelEditor(typeof(GrainModel))]\n public class GrainModelEditor : PostProcessingModelEditor\n {\n SerializedProperty m_Colored;\n SerializedProperty m_Intensity;\n SerializedProperty m_Size;\n SerializedProperty m_LuminanceContribution;\n\n public override void OnEnable()\n {\n m_Colored = FindSetting((Settings x) => x.colored);\n m_Intensity = FindSetting((Settings x) => x.intensity);\n m_Size = FindSetting((Settings x) => x.size);\n m_LuminanceContribution = FindSetting((Settings x) => x.luminanceContribution);\n }\n\n public override void OnInspectorGUI()\n {\n EditorGUILayout.", "PropertyField(m_Intensity);\n EditorGUILayout.", "PropertyField(m_LuminanceContribution);\n EditorGUILayout.", "PropertyField(m_Size);\n EditorGUILayout.", "PropertyField(m_Colored);\n }\n }\n}\n" ]

{ "pile_set_name": "Github" }

[ 0.0007824852364137769, 0.0007337567512877285, 0.0006650662980973721, 0.0008018692606128752, 0.0006705201230943203, 0.0006717097712680697, 0.000688448955770582, 0.0007719035493209958 ]

[ "Impressive New South Wales debutant Jack Bird is confident he can step into a starting role in the halves in Game Three in Sydney on June 13 but doesn't want to wear the No.7 jersey.", "\n\nA shoulder injury looks almost certain to rule Blues halfback Adam Reynolds out of the third game of the 2016 Holden State of Origin Series, the Rabbitohs No.7 to have scans to determine the extent of the injury when he returns to Sydney on Thursday.", "\n\nIn the immediate aftermath of his side's 26-16 loss at Suncorp Stadium on Wednesday night Blues coach Laurie Daley was quite certain that Reynolds would not be fit to play at ANZ Stadium in three weeks' time, the search for a halves partner for James Maloney likely to start with his Cronulla teammate.", "\n\nAs well as being club teammates Maloney and Bird were the starting halves for Country Origin in their loss to City Origin in Tamworth last month but Bird said after his Origin debut that he would feel more comfortable playing at five-eighth if selected.", "\n\n\"I had No.7 [for Country]; I prefer five-eighth. ", "I think they just mixed the jersey numbers up,\" said Bird, who moved to the halves when Reynolds left the field 16 minutes from full-time.", "\n\n\"I haven't really played halfback, I'm probably more of a five-eighth.", "\n\n\"They're pretty much the same position these days but the matter of it in my head thinking 'halfback'... I'd try and play a different role that I'm not used to and that's where things get mixed up.", "\n\n\"If I had a week of training at it maybe I could pull something off but I'm not too sure.\"", "\n\nThe 21-year-old said that the experience of Origin was as fast and as crazy as he had expected but there was little doubt after the game that Bird had stamped himself as a player of Origin credentials who will become a mainstay of this Blues team.", "\n\nIn addition to sharing a surname Blues teammate Greg Bird sees similarities in the young Shark and has no doubt that he could tread a similar path by moving into the halves early in his Origin career.", "\n\n\"Yeah he's probably very similar to me really,\" said Bird following his 18th appearance for New South Wales.", "\n\n\"Came off the bench in game one [of his Origin career] and he's every chance with the injury that 'Reyno' picked up to maybe slip into a starting five-eighth role and that's exactly what I did.", "\n\n\"You never know what could be with that kid. ", "He plays with intensity, he plays off the cuff, he plays what's in front of him and that's the sort of footballer that you need in State of Origin.", "\n\n\"The players that play what's in front of them are the players that capitalise on opportunities.\"", "\n\nBird, who also played halfback for Country in 2015, has played 22 of his 36 NRL games to date at five-eighth and believes having Maloney alongside him would allow him to make a smooth transition if Reynolds doesn't recover in time.", "\n\n\"I'm not too sure how bad the injury is but hopefully he has a speedy recovery and hopefully we can have him back for Game Three,\" said Bird.", "\n\n\"There are a lot of good five-eighths out there that are wanting this position. ", "If I got chucked in at five-eighth... I haven't played it in a while but I think I can do it; there would be a lot of pressure on me.", "\n\n\"Jimmy tends to lead the team around. ", "He does it pretty well at club footy and does it here as well.", "\n\n\"It would help me a lot if Jimmy was there but that's up to 'Loz' (Daley).", "\n\n\"He probably won't go that way to be honest but we'll just have to wait and see.\"" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006730760214850307, 0.0009899126598611474, 0.0008750198758207262, 0.0007899683550931513, 0.0006729682208970189, 0.000583532324526459, 0.001592625747434795, 0.0006086076027713716, 0.000548507203347981, 0.0009326772415079176, 0.0005807688576169312, 0.0005901597905904055, 0.0008048517629504204, 0.003789487760514021, 0.0015237318584695458, 0.0007090849103406072, 0.0007645072182640433, 0.0007917133625596762, 0.001477734767831862, 0.0008048847084864974, 0.0005926975281909108, 0.0006534990970976651, 0.0006184283411130309, 0.0005764724919572473 ]

[ "FC Naters\n\nFC Naters is a Swiss football club from the town of Naters in Canton Valais. ", "The team currently plays in Liga 1., ", "the third highest tier in the Swiss football pyramid.", "\n\nHistory\n\nFC Naters was founded in 1958 and played their first game on 16 June 1958. ", "In 1961 the club rose to the 3. ", "Liga (fifth tier) for the first time in their history. ", "At the end of the 1969/70 season the club rose to the 2. ", "Liga and in 1971 narrowly missed out on promotion to the 1. ", "Liga. ", "At the end of the 1978/79 season the club were relegated and so returned to the 3. ", "Liga.", "\n\nThe team currently plays in Liga 1., ", "the third highest tier in the Swiss football pyramid where they have played since 1996.", "\n\nStadium\n\nThe club play their home games at Sportanlage Stapfen. ", "The capacity is 3,000. ", "The stadium was opened in 1997.", "\n\nCurrent squad\n\nExternal links\nOfficial Website \nSoccerway.com profile \nFootball.ch profile \n\nNaters\nCategory:Association football clubs established in 1958\nCategory:1958 establishments in Switzerland" ]

{ "pile_set_name": "Wikipedia (en)" }

[ 0.001162939821369946, 0.0006568975513800979, 0.0011212719837203622, 0.0007338071009144187, 0.0008485523867420852, 0.0006350066396407783, 0.0009323867270722985, 0.0009763574344106019, 0.0008291833801195025, 0.0008709070389159024, 0.0008291833801195025, 0.0006568975513800979, 0.0009459065622650087, 0.0014919369714334607, 0.0016565716359764338, 0.0007183822453953326, 0.000661649217363447 ]

[ "Q:\n\nAndroid webview cant to load daily motion website fully\n\nI am trying to build a apps which will be able to youtube and dailymotion ...\nyoutube is ok but dailymotion is not load fully,it load's only menu bar with click restricted(no touch allowed)...How will i solve it,any idea please...\nMy sample code for loading WebView is here \n webView.setWebViewClient(new myWebViewClient());\n webView.setWebChromeClient(new myWebChromeClient());\n webView.getSettings().setJavaScriptEnabled(true);\n webView.getSettings().setAppCacheEnabled(true);\n webView.getSettings().setBuiltInZoomControls(true);\n webView.getSettings().setSaveFormData(true);\n webView.getSettings().setPluginState(WebSettings.", "PluginState.", "ON);\n webView.loadUrl(\"http://www.dailymotion.com\");\n\noutput window:\n\nA:\n\nI have gotten a solution that can solve this problem..i have given my code here if would be beneficial..\nwebView.setWebViewClient(new myWebViewClient());\n webView.setWebChromeClient(new myWebChromeClient());\n webView.getSettings().setJavaScriptEnabled(true);\n webView.getSettings().setAppCacheEnabled(true);\n webView.getSettings().setBuiltInZoomControls(true);\n webView.getSettings().setSaveFormData(true);\n webView.getSettings().setPluginState(WebSettings.", "PluginState.", "ON);\n\nwebView.getSettings().setDomStorageEnabled(true); \n webView.loadUrl(\"http://www.dailymotion.com\");\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0015523030888289213, 0.0008467758307233453, 0.0014078376116231084, 0.0008467758307233453, 0.0007943105883896351 ]

[ "There are 332,432,401 people in the United States of America. ", "If everyone in the U.S. lined up single file, the line would stretch around the Earth almost 7 times. ", "That's a lot of people.", "\n\nThe U.S. Census Bureau statistics tell us that there are at least 151,671 different last names and 5,163 different first names in common use in the United States. ", "Some names are more common than others.", "\n\nThere are 48,067 people named John Smith in the United States. ", "There are 1,045 people named James Bond, 110 people named Harry Potter , 468 people named George Bush, and 34 people named Emily Dickinson. ", "However, Johnny Cash (35 people) songs aside there are, statistically speaking, very few boys named Sue.", "\n\nWhat about you? ", "How many people share your name? ", "Enter it and find out how many of you there are.", "\n\nQ: Why have the number of people with my name changed?", "\n\nAs part of our constant attempt to keep this site fresh, we've updated our data with recently released last name information from the 2000 Census. ", "In many cases the number of people with a particular name changed significantly, but the new data is more recent, more precise, and includes almost twice as many last names. ", "Read more here.", "\n\nSee our new site!", "\n\nApocaLuck.com\n\n\n\nA confused computer system accidentally triggers nuclear apocalypse in the US; will your city be destroyed, or will it be lucky? ", "Plug in your city or zip code at Apocaluck, and find out if your city would survive a nuclear apocalypse.", "\n\n\n\n" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0005751700373366475, 0.0006728339358232915, 0.000733979104552418, 0.0005721864872612059, 0.000578312436118722, 0.000672888767439872, 0.0008349115960299969, 0.0009050717344507575, 0.0011349563719704747, 0.0008516004309058189, 0.001058934605680406, 0.000731628155335784, 0.0005363886011764407, 0.000565214257221669, 0.0006314730271697044, 0.0009334521018899977, 0.024173790588974953, 0.2025720179080963, 0.001995444530621171 ]

[ "Q:\n\nDevise forms no longer clickable after new controller added\n\nI had previously installed and configured devise and it worked fine. ", "Forms worked fine. ", "I then added a new StaticPages controller:\nrails g controller StaticPages index landing about contribute\n\nI set my routes.rb:\nRails.application.routes.draw do\n\n devise_for :users\n\n resources :cards\n\n root 'static_pages#index'\n get 'static_pages/landing' => 'static_pages#landing'\n get 'static_pages/about' => 'static_pages#about'\n get 'static_pages/contribute' => 'static_pages#contribute'\n\n unauthenticated do\n root to: 'static_pages#landing', :as => 'unauthenticated'\n end\n\nend\n\nAfter this the users/sign_in page for devise rendered, but the forms were not clickable. ", "I click on them and they do not highlight nor allow text to be entered. ", "I can however tab through the form to enter credentials and press enter to sign in. ", "Why do the forms no longer work?", "\nHere is the sign in form:\n<body id=\"sign-in\">\n <div class=\"wrapper-center\">\n <div class=\"container-form\">\n <div class=\"container-fields\">\n <h2 class=\"light-text\">Sign in</h2>\n <%= form_for(resource, as: resource_name, url: session_path(resource_name)) do |f| %>\n <div class=\"field\">\n <%= f.email_field :email, autofocus: true, placeholder: \"Email\" %>\n </div>\n\n <div class=\"field\">\n <%= f.password_field :password, autocomplete: \"off\", placeholder: \"Password\" %>\n </div>\n\n <% if devise_mapping.rememberable? -%", ">\n <div class=\"field remember-me\">\n <div class=\"checkbox\">\n <%= f.check_box :remember_me %>\n </div>\n <div class=\"checkbox-label\">\n <%= f.label :remember_me %>\n </div>\n </div>\n <% end -%>\n\n <div class=\"actions\">\n <%= f.submit \"Sign in\" %>\n </div>\n <% end %>\n </div>\n </div>\n <div class=\"devise-links\">\n <%= render \"devise/shared/links\" %>\n </div>\n </div>\n</body>\n\nA:\n\nWithout further code, it's difficult to diagnose, however, this may have something to do with it:\n<body id=\"sign-in\">\n\nWhy are you including a <body> tag in your views? ", "\nWhen you have a Rails app, you have two \"levels\" of views - the layout and the view.", "\nThe layout is the wrapper for the whole page; is where you'd put <body> tags. ", "The view is the specific code for that particular page. ", "\nThus, I'd expect to see something like the following:\n#app/views/layouts/application.html.erb\n....\n<body>\n <%= yield %>\n\n#app/views/devise/sessions/new.html.erb\n<div class=\"container-form\">\n <div class=\"container-fields\">\n <%= form_for ... %>\n\nAgain, I can only presume you've included <body> in your view. ", "I don't have any other reference.", "\n--\nThe idea that you have an HTML issue would be congruent with your issue actually - it's the interaction with your form which is an issue, not the submission. ", "\nIf you had a problem with Rails, you'd not be able to sign in. ", "Therefore, it's likely an issue with the way the form is rendered, which is HTML & CSS.", "\n\nAs an aside, you should also look up about adding non-restful routes (for your static pages):\n#config/routes.rb\nresources :static_pages, only: :index do\n %i(landing about contribute).each do |option|\n get :option, on: :collection\n end\nend\n\nAnother suggestion would be to keep those \"static\" pages in your application controller:\n#config/routes.rb\n%w(landing about contribute).each do |option|\n get option, to: \"application##{option}\"\nend\n\n... you'd back that up with the respective methods in your ApplicationController:\n#app/controllers/application_controller.rb\nclass ApplicationController < ActionController::Base\n def landing\n ...\nend\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0007140586385503411, 0.0006568262469954789, 0.0006732238689437509, 0.0007067776168696582, 0.0005565939354710281, 0.0008406905690208077, 0.0007850321126170456, 0.001121492707170546, 0.0005863967235200107, 0.0007831036346033216, 0.000593220058362931, 0.000614045187830925, 0.0006298690568655729, 0.000646760337986052, 0.0007879748591221869, 0.0006072639371268451, 0.0006409238558262587 ]

[ "\"Tonight on Undercover Boss...\" \"Hi, how's it going?\" \"", "John Fuller, president and CEO of Coffee Bean Tea Leaf...\" \"This is what I did before.\" \"", "Goes undercover for the second time.\" \" ", "Hello, family.\" \" ", "It's quite disturbing.\" \"", "This former Johnny Rockets CEO...\" \"Looks like a little miniskirt on you.\" \"", "Is ordering up a double shot of Undercover Boss.\" \"", "Toss it and start over.\" \"", "You got to try to remember their order.\" \" ", "Oh, crap.\" \" ", "I have a few more other things.\" \"", "I know.\" \"", "Sorry for taking so long.\" \" ", "While undercover...\" \" Man, it's small in here.\" \"", "He'll meet the people who keep this company brewing.\" \"", "Hey, Coffee Bean, we're giving you free drinks today!\" \"", "All right, people!\" \"", "Free drinks!\" \"", "Thank you for choosing Coffee Bean Tea Leaf.\" \"", "My name is Mick.\" \"", "How are you?\" \"", "And what will happen when one employee thinks she knows his true identity?\" \"", "Find out next on Undercover Boss.\" \"", "Headquartered in Los Angeles, California,\" \"The Coffee Bean Tea Leaf is one of the largest coffee chains in the world.\" \"", "Can I do a regular Iced Americano?\" \"", "With more than 1,000 locations, 15,000 employees, and bringing in $500 million in annual revenue, this company sells high-quality hot and cold beverages around the globe.\" \"", "Brewing up this coffee giant's strong future is one man.\" \"", "I'm John Fuller, president and CEO of The Coffee Bean Tea Leaf.\" \"", "I first appeared on Undercover Boss as president and CEO of Johnny Rockets.\" \"", "♪ Let's go down to Johnny Rockets ♪\" \"The first time I went undercover, it was an awesome experience.\" \"", "Here you go, Tom.\" \"", "You want to take this?\" \"", "Sure, absolutely.\" \"", "Here you go.\" \"", "If it's frozen, you're gonna throw it in the blender.\" \"", "I really was able to empathize with the employees and just see the passion and actually how difficult their job really is.\" \"", "Let me know if this is any good.\" \"", "And it's hard, you know.\" \"", "You stand on your feet all day.\" \"", "But the best part about it was what I learned.\" \"", "And this isn't on the menu, right?\" \"", "No, it's not.\" \"", "We submitted some ideas to corporate.\" \" ", "Did you ever hear back?\" \" ", "No.\" \"", "I learned so much that I'd be a fool not to take advantage of this again.\" \"", "Hi, how's it going?\" \"", "I was with Johnny Rockets for 7 1/2 years.\" \"", "I left the company a little over a year ago and joined The Coffee Bean Tea Leaf.\" \"", "The Coffee Bean Tea Leaf started in 1963 by a guy named Herbert Hyman.\" \"", "Mr. Hyman would travel around the world to places like Colombia,\" \"Costa Rica, Indonesia, and he would notice that the quality of the beans that he was getting in his coffee was something that was missing here in Southern California, and so he opened up a store in Brentwood in 1963.\" \"", "We have about 1,100 stores now in 30 countries and 14 states in the U.S.\" \"Coffee Bean Tea Leaf was the first of the premium coffee and tea retailers, but since then, there's been a ton of successful companies that everyone's heard of, from Starbucks to Peet's.\" \"", "What differentiates us from the competitors is that we are not as corporate as they are, so we're still able to have the approachability of the neighborhood coffee store.\" \"", "I think that's a competitive advantage for us.\" \"", "The Coffee Bean Tea Leaf is best known for the Ice Blended.\" \"", "It's a drink that was created almost 30 years ago and has been stolen by every other competitor out there.\" \"", "Large Caramel Ice Blended with fudge.\" \"", "I'm just still waiting for the day when Starbucks actually says that they stole this idea from us.\" \"", "Their Frappuccino is our Ice Blended.\" \"", "So a lot has changed since the last time I was undercover, when I was a divorced father, two girls, and had a man cave.\" \"", "Not only do I have a new job and I now live in Burbank.\" \"", "I also got married five years ago, so my whole life is completely different.\" \"", "Thank God I don't have braces anymore.\" \" ", "That's a start.\" \" ", "Yeah, yeah.\" \" ", "You were brace face back then.\" \" ", "So little.\" \"", "And then, McKenna, you hadn't had your growth spurt yet.\" \"", "I was just...\" \"I was tiny.\" \"", "I was so small.\" \"", "It's amazing what can happen in five years.\" \"", "I know the disguise needs to be a lot more radical than it was on the first time I did this.\" \"", "First time, I had a couple people recognize me.\" \"", "You look like the CEO of Johnny Rockets.\" \"", "How you doing?\" \" ", "I'm fine.\" \" ", "Good.\" \"", "This is what I did before.\" \"", "You think we can make it where\" \" no one will recognize me?\" \" ", "Yeah.\" \"", "How long does this take?\" \" ", "Around four hours.\" \" ", "Oh, my gosh.\" \"", "The Coffee Bean Tea Leaf has been around for over 50 years, and so if we're gonna see another 50 years, we've got to really kick-start the growth above and beyond where we're at today.\" \"", "The best way to do that, though, is to make certain the stores we have today are operating as efficiently as possible.\" \"", "One of the best ways to try to get the feel for that is by going undercover and experiencing it firsthand.\" \"", "I'll be going undercover as Mick from Phoenix, Arizona.\" \"", "My employees will think they're on a different reality show.\" \"", "They will have no idea it's really Undercover Boss.\" \"", "You use Facebook more than I do.\" \"", "Hello, family.\" \"", "No!\" \"", "Oh, my God.\" \"", "When I first went undercover,\" \"I was a newly appointed CEO of a company.\" \"", "That undercover experience allowed me to learn things at a much faster pace.\" \"", "Or like this?\" \"", "It's quite disturbing.\" \"", "So being relatively new here,\" \"I'm kind of going into this with an open mind and knowing I'm gonna learn a lot of things\" \"I never thought I would have.\" \"", "Bye, guys.\" \" ", "Be careful out there, Dad.\" \" ", "Bye.\" \"", "Today I'm in Downey, California, and I'm gonna get a chance to work with the shift supervisor.\" \"", "In order for our brand to be successful, we kind of have to have the next line of general managers getting groomed and ready to assume new responsibilities as we add new stores.\" \"", "The shift supervisor is where we get most of these people from.\" \"", "Hi, I'm here for Deanna.\" \"", "Yeah, that would be me.\" \"", "Today I'm hoping to see how ready they are for that next step in their career.\" \" ", "My name is Deanna.\" \" ", "Okay.\" \"", "I am the shift supervisor, and I oversee everything when the manager's not here.\" \"", "First thing we're gonna do is, we're gonna put\" \" an apron on you.\" \" ", "Okay.\" \" ", "It's a little short, but...\" \" It's all right.\" \" ", "Do you mind tying it for me?\" \" ", "It kind of looks like a little miniskirt on you, but it's okay.\" \"", "It's all right.\" \"", "All right.\" \"", "Okay, so we're gonna do super basic.\" \" ", "Okay?\" \" ", "Okay.\" \"", "We're just gonna make, like, a Vanilla Latte.\" \" ", "Okay.\" \" ", "I'm gonna show you how to do it, and then you're gonna do it.\" \" ", "Okay.\" \" ", "They only can be in here for three minutes, 'cause we don't want the customers waiting.\" \"", "These are all little cheat sheets that we have.\" \"", "So, like, if we do forget, all we have to do is look this up.\" \"", "Just steam your milk first.\" \"", "You're gonna put this under here like this.\" \"", "You want to hear it wisp.\" \"", "Psss.\" \" ", "All right.\" \" ", "Keeps it nice and frothy.\" \"", "So the temperature's, like, at 100.\" \"", "Too cold.\" \"", "One, two.\" \" ", "All right.\" \" ", "Right here.\" \"", "30 pounds of pressure.\" \"", "Bam.\" \"", "Push this button.\" \"", "The shot's only good for 18 seconds to 26 seconds.\" \"", "They expire at 30.\" \"", "This is a Vanilla Latte.\" \"", "So it has one shot of espresso.\" \" ", "Okay.\" \" ", "This is small.\" \"", "Vanilla powder.\" \"", "And mix.\" \"", "And pour it.\" \"", "Okay, done.\" \"", "All right.\" \"", "Like, right now, this is gonna be a real order coming in.\" \"", "Like the Vanilla Latte that I showed you...\" \" Yep.\" \" ", "Except this is gonna be in a larger cup with an extra shot.\" \" ", "There you go.\" \" ", "Okay.\" \"", "So it's the same old thing here.\" \"", "Wait, that's not on there right.\" \"", "Yeah, put it on there right.\" \"", "Okay.\" \"", "And just the 12-ounce...\" \"or 16-ounce?\" \"", "No, it'll be in the large one, so it'll be the large one.\" \"", "There you go.\" \"", "Now mix her up.\" \"", "Yeah.\" \"", "Try not to touch all that, because that's going in...\" \"You don't want to touch all that.\" \"", "Sorry it took so long.\" \"", "Have a good evening.\" \"", "Hey, look.\" \"", "our board's getting full.\" \"", "Oh, boy.\" \"", "So right now, we're gonna make a large chai.\" \"", "Oh, three...\" \"three shots, okay.\" \"", "Remember, you need to, like, put the pedal to the metal.\" \"", "Let's go.\" \"", "They are probably packing up their car and their kids and leaving.\" \"", "Time's ticking, buddy.\" \" ", "Here you go.\" \" ", "Thank you.\" \" ", "Have a good evening.\" \" ", "You got it, buddy?\" \" ", "Okay, regular...\" \" Whoa, wait.\" \"", "Whoa, whoa.\" \"", "Remember, these are only good for 30 seconds.\" \" ", "Toss it and start over.\" \" ", "Ugh.\" \"", "So it's gonna be with soy milk.\" \"", "Are you sure this is the right one?\" \"", "Yeah.\" \"", "Others are waiting, like, 20 minutes.\" \" ", "So I whisk it now?\" \"", "Yes?\" \" ", "Yes, start whisking.\" \"", "So just add whip to it.\" \"", "Yeah, the whipped cream is somewhere around here, I'm sure.\" \"", "Apologize.\" \"", "Sorry.\" \"", "First day.\" \"", "Mick has people waiting.\" \"", "I had to give out gift cards to apologize because he was crumbling.\" \" ", "I'm just making your shots.\" \" ", "Thank you.\" \"", "I'm trying to get you caught up here, buddy.\" \"", "Yeah, it's a little too sweet.\" \"", "All right.\" \"", "You can get another one.\" \"", "Since you're a little bit behind here,\" \"I'm gonna find something else for you to do.\" \" ", "Okay, please.\" \" ", "Go ahead and go in the back.\" \"", "And then I'll help you out in about a...\" \"Give me a...\" \"let me get caught up here.\" \"", "Making coffee and tea the right way is so much harder than making hamburgers at Johnny Rockets.\" \"", "So this is our inventory sheet.\" \"", "You're gonna look on the paper.\" \"", "Okay, so this right here are powders.\" \"", "This is where we keep our powder.\" \"", "You just look on the side of the box, and it'll tell you... vanilla.\" \"", "Okay.\" \"", "Oh, that's helpful.\" \"", "I want you to count them all.\" \" ", "So you have two boxes...\" \" Okay.\" \"", "And then how many bags are in this one?\" \"", "So start counting up the powders.\" \"", "And you have to be exact because I won't know what to order.\" \"", "Okay.\" \"", "French vanilla.\" \"", "They should put these things in order.\" \"", "All right, Deanna, I do have a quick question,\" \" if you don't mind.\" \" ", "Yeah, sure.\" \"", "It's a little confusing for me.\" \"", "So this is hot chocolate, and I don't see hot chocolate on here.\" \"", "Even though it says \"hot chocolate\" on it,\" \" it's just chocolate.\" \" ", "Oh, okay.\" \"", "So...\" \"That's what we make hot chocolate with, which we also make our mocha...\" \"Okay, so it's just chocolate, then.\" \" ", "Just chocolate.\" \" ", "Okay.\" \"", "All right.\" \"", "Our inventory process to me seems somewhat archaic.\" \"", "What frustrates me is, the words on the box don't match the words on the form.\" \"", "So help me find Colombia light on there, then, if you could.\" \"", "Right there.\" \"", "That is Colombia light.\" \"", "See, it doesn't say \"light,\" though.\" \" ", "It won't say \"light.\"\" \" ", "So how would I know?\" \"", "As a CEO, I've always tried to make things as simple as possible.\" \"", "The way we do our inventory, though, is far from simple, and I'm gonna look into that and see if we can be better at that.\" \"", "How long have you worked here?\" \" ", "I've worked here for 15 years.\" \" ", "Okay, no wonder.\" \"", "Okay, so that...\" \"so it's not like...\" \"Yeah, so week one, you knew how to do this?\" \" ", "No.\" \" ", "Or week ten?\" \"", "No, I walked into The Coffee Bean, and I just said, \"Look, I've never had a job.\" \"\"", "I don't know too much.\" \"\"", "I had a bad drug habit a long time ago, and I need some help to get on my feet\"\"\" \"I feel like Coffee Bean kind of turned my whole life around.\" \" ", "Ah.\" \" ", "That's... where it all began is right... 15 years...\" \"Really, so someone gave you a chance and then...\" \"Somebody gave me a chance.\" \"", "I mean, I dropped out of school at tenth grade, so I don't really have too much education.\" \" ", "Uh-huh.\" \" ", "So this is it for me.\" \"", "Have you gone back?\" \"", "Can you go back and get your...\" \" I could.\" \" ", "Yeah.\" \" ", "But I don't want to.\" \" ", "How come?\" \"", "'Cause I'd rather put all my energy into my kids.\" \"", "I'd rather them go off to college.\" \"", "I have to do everything for them now, 'cause I was sick for a long time and I took nine months off.\" \"", "What's your Si... is it...\" \"Do you mind if I ask?\" \"", "No, I still have liver cancer.\" \" ", "Oh, my gosh.\" \" ", "I mean, I'm still sick.\" \"", "But I was also taking care of my dad\" \" that has colon cancer.\" \" ", "Oh, my gosh.\" \"", "So it was two of us being sick at the same time, but I had to.\" \" ", "Mm-hmm.\" \" ", "But I had to take the time off 'cause I was just too sick to work.\" \" ", "He passed away in May.\" \" Oh, sorry.\" \"", "But I took care of him till the last day.\" \"", "I think the best thing is, I get up in the morning, it's time to go to work.\" \"", "And I'm doing something positive.\" \"", "I'm gonna make somebody's day, so that turns around and makes my day.\" \"", "If I make one customer happy, good.\" \"", "Deanna's a fighter.\" \"", "She's got heart.\" \"", "And to have the strength to come do what she does ever day despite all the things she's dealing with is absolutely amazing.\" \"", "She's a great shift supervisor and someone who can continue to grow and advance in our system.\" \"", "So let's go out to the front.\" \" ", "All right, let's do it.\" \" ", "Okay.\" \"", "Coming up...\" \"Don't forget to add the powder in there.\" \"", "Oh, crap, thank you.\" \"", "Mick freezes up on the job.\" \"", "Man, I'm making a mess for you.\" \"", "Ahh!\" \"", "They're already out here waiting.\" \"", "They're thinking you're slow already.\" \"", "And later...\" \"Sammy.\" \"", "The boss faces an employee with suspicions about his true identity.\" \"", "Welcome to The Coffee Bean TeaLeaf.\" \"", "So today I'm here in Henderson, Nevada, right on the outskirts of Las Vegas, and I get to work with the general manager for special events.\" \"", "As CEO, I'm always aware of brand awareness and opportunities to take advantage of that.\" \"", "One of the best ways is by going into communities and taking part in special events.\" \"", "So you go... on the very back is all of our locations.\" \"", "You go to any one you want and test us out.\" \"", "Still being relatively new to the company,\" \"I'm really interested to see how successful this coffee truck can be at this event 'cause I think there's gonna be tremendous opportunities going forward to do more of this.\" \"", "Hey, is there a Chris back here?\" \" ", "Hey, how's it going?\" \" ", "Hey.\" \"", "Mick.\" \"", "How you doing, man?\" \"", "Chris.\" \"", "Nice to meet you.\" \"", "You want to come on in?\" \" ", "Sure, let's do it.\" \" ", "Hey.\" \" ", "I'm ready.\" \" ", "Oh, you're ready to go?\" \"", "What are you gonna teach me?\" \"", "We're gonna do some marketing today.\" \"", "I'm a special events manager.\" \"", "We have 15 locations in Las Vegas, Nevada, but a lot of people don't even know who The Coffee Bean are.\" \"", "I don't know.\" \"", "Have you ever heard of us?\" \" ", "I have.\" \"", "Yeah.\" \"", "Yeah.\" \" ", "Okay, well, good, see?\" \"", "That's one up on a lot of other people.\" \"", "So what we do at the truck is, we do a lot of nonprofit organizations.\" \"", "We do events like this to get our name out where you're giving 'em drinks and things like that.\" \"", "That's free.\" \"", "Once everybody tries us, they never go back to any other coffee shop.\" \"", "When Mick first walked up to my truck,\" \"I was like, \"Whoa, is this guy gonna fit into my truck?\"\" \"", "I couldn't believe how big he was.\" \"", "He looks like, you know, a retired professional football player.\" \" ", "Man, it's small in here.\" \" ", "Yeah, that's what I said.\" \" ", "Are you gonna fit?\" \" ", "It's crowded\" \"All right, so what we're gonna do, we're gonna do four drinks.\" \" ", "Vanilla Blendeds...\" \" Okay.\" \" ", "With coffee or without coffee.\" \" ", "All right.\" \"", "Or the Mocha Blended, with coffee or without coffee.\" \" ", "Okay, sweet.\" \" ", "So grab a cup.\" \" ", "All right, I can do this.\" \" ", "Fill that up with ice.\" \"", "And we're gonna do a coffee one, so we're gonna do half milk, half espresso extract.\" \"", "Oh, I did too much.\" \" ", "That's okay.\" \" ", "All right.\" \"", "A little extra flavor never hurt.\" \"", "Okay, next, we're gonna grab our coffee extract.\" \" ", "And fill it to the top?\" \" ", "No, to the line.\" \"", "That goes into the blender.\" \"", "Now I'll let you pick.\" \"", "You want to try the vanilla or the chocolate?\" \" ", "Oh, we got to go chocolate.\" \" ", "Well, there you go.\" \"", "Yeah, that's good.\" \" ", "Keep that closed.\" \" ", "Okay.\" \"", "As that's going,\" \"I got my lids and such over here.\" \" ", "Dude, you sweat a lot in here.\" \" ", "Oh, yeah.\" \" ", "And then...\" \" Top off.\" \"", "Into the cup.\" \"", "Oh.\" \"", "Sorry.\" \"", "Man, I'm making a mess for you.\" \"", "That's okay.\" \"", "Hey, it happens.\" \"", "That's what towels are for?\" \"", "That's what towels are for, and I tell people, when you're not making a mess you're not having any fun.\" \" ", "Oh, okay.\" \"", "Good to know.\" \" ", "See how it snaps on?\" \"", "All right, are we doing some whipped cream with it?\" \"", "And some whipped cream.\" \"", "You hand the drink out with the straw.\" \" ", "Perfect.\" \" ", "And also I have some location cards and that's good for one free drink.\" \"", "It works out 'cause we have a store which is right across the street, so, A, if you like us so much, go hit them up right across the street.\" \" ", "Okay.\" \" ", "How are we doing today?\" \" ", "Hi.\" \" ", "How's it going?\" \"", "We're gonna have some pure vanillas and pure chocolates coming up here in a second.\" \"", "He's making... we're making 'em right now.\" \"", "Don't forget to add the powder in there.\" \"", "Oh, crap.\" \"", "Thank you.\" \"", "Are you having fun out here?\" \" ", "Yeah.\" \" ", "Yeah, good, good.\" \"", "All right.\" \"", "And the extra cups are right here.\" \"", "Yup.\" \"", "You're having a little trouble with the lids.\" \"", "These lids are gonna drive me crazy.\" \"", "You don't want to hand out drinks that are... you know.\" \"", "Looking like crap?\" \"", "Well, you know, stuff on the side.\" \"", "Yeah, I know.\" \"", "Oh, they're already out here waiting.\" \"", "They're thinking you're slow already.\" \"", "I know.\" \"", "I just want them to be happy.\" \"", "Mick was having a hard time.\" \"", "I think he was a little nervous.\" \"", "He wanted to do well.\" \"", "I think the biggest thing Mick was struggling with was, he was spilling it everywhere, and he's a big guy, so his hands is like two of my hands trying to, you know, pick up a cup.\" \"", "Ah, I knew that was gonna happen.\" \"", "I tried to rush, and I don't like rushing.\" \"", "All of The Coffee Bean locations.\" \"", "Come by and check us out.\" \" ", "The line's getting long.\" \" ", "Get 'em all hyped up.\" \"", "Hey, Coffee Bean, we're giving you some free drinks today!\" \" ", "Get 'em all hyped up.\" \" ", "You want me doing that?\" \"", "I want you doing that.\" \"", "Get loud.\" \"", "I ain't scared of you.\" \"", "All right, people!\" \"", "Coffee Bean Tea Leaf, free drinks!\" \"", "Get over here!\" \"", "Come and visit.\" \"", "Now that it's standing up, we're gonna have it pop out for you guys.\" \"", "Chris' energy around the guests was perfect.\" \"", "I mean, it's that right passion, that right energy.\" \"", "Test us out.\" \" ", "Can I get it?\" \" ", "Yeah, there you go.\" \"", "He knew how to keep 'em happy, motivated.\" \"", "He had great interaction with them.\" \"", "That's so important;\" \"that's what I look for in people that work in our stores.\" \"", "Here's two, and then I got one more left.\" \"", "Whoever yells loudest,\" \"\"I love Coffee Bean TeaLeaf,\"getsit.\" \"", "I love Coffee Bean Tea Leaf!\" \"", "All right, you win.\" \"", "You did it.\" \"", "Yeah!\" \"", "So how did you decide to do this?\" \"", "Originally when I first moved to Las Vegas,\" \"I was working for a toy store.\" \"", "You know, I was talking to my boss, and he was like,\" \"\"You know, I'm bringing this new coffee concept to Nevada.\" \"", "I think you would fit perfect for what I'm doing\"\"\" \"How'd you meet him?\" \" ", "He came into the toy store.\" \" ", "Oh, really?\" \"", "Okay, so he liked your personality and all that?\" \"", "Yeah, yeah.\" \"", "So I was their original employee that Coffee Bean hired, so I've been around since everything, since day one.\" \" ", "Okay, that's cool.\" \" ", "And we moved up.\" \"", "15 years later, I've been here.\" \"", "I'm still doing it, I'm gonna keep doing it.\" \"", "Ah.\" \"", "So you like it?\" \"", "You think you'll stay out here\" \" for a long time?\" \" ", "Oh, I love Vegas.\" \"", "You know, I grew up with my dad in New York, and I lived out there for about 19 years.\" \"", "So I said, \"You know what?\" \"", "I spent 19 years with my dad\"\"\" \" Yeah?\" \" \"", "Let me move to Vegas and spend some time with my mom\"\"\" \"My oldest sister lives in Jersey, and then the other four are out here in Vegas.\" \" ", "So do you miss New York?\" \" ", "I miss it a little bit.\" \"", "But, you know, I go back in the holidays to visit my family, so that's always nice.\" \"", "What about, like, the sports teams and all that?\" \"", "Well, I'm coming up on 38 years old.\" \" ", "Okay.\" \" ", "In my life,\" \"I've never seen a professional NFL game.\" \"", "This past Christmas, I went to New York, me and my dad, and we got to watch the Buffalo Bills\" \" play the Dallas Cowboys.\" \" ", "Oh, how cool is that?\" \"", "I thought that was the best thing.\" \"", "Family's important, and that's what I'm about.\" \"", "Man, I like it.\" \"", "Like, you have a better, truer sense of yourself than most people.\" \"", "The streets of New York, you learn quick.\" \"", "Yeah, it's a good School of Hard Knocks, yeah.\" \"", "Our franchise here in Las Vegas has done a lot of things right, but certainly one of the things they did right was to hire a guy like Chris.\" \"", "I am impressed with his ability to interact with the people, and Chris showed me that a truck's a great idea.\" \"", "Again, being involved in the community,\" \"I think, is so important, and what a great way to do it, so I really want to think about how to get more trucks in activation.\" \" ", "Thanks for coming.\" \" ", "All right, man.\" \"", "Hey, hey.\" \"", "Next event.\" \"", "So you're off to the next gig?\" \"", "My next event.\" \"", "We keep it rocking all day.\" \"", "Today I'm here in Riverside, California, and today I will be working with the general manager.\" \"", "Enjoy.\" \"", "As I continue to grow the business, one of the areas of focus is having more drive-throughs.\" \"", "When you commit to having drive-throughs, speed of service is a critical element of that, and that's one of the things I really want to monitor today.\" \"", "There a Tatiana here?\" \" ", "Yes.\" \" ", "Hi, I'm Mick.\" \" ", "Hi, how are you?\" \" ", "Nice to meet you.\" \" ", "How are you?\" \" ", "Nice to meet you too.\" \"", "I hear you're gonna be the one teaching me stuff.\" \"", "Oh, absolutely.\" \"", "So, Mick, I'm the GM here.\" \"", "I'm over every aspect of this business.\" \"", "What do you want me to do?\" \"", "Well, today I'm gonna be teaching you the drive-through.\" \" ", "Are you ready to learn?\" \" ", "Cool.\" \"", "Yes, let's do it.\" \" ", "All right, come on back.\" \" ", "All right.\" \"", "You're gonna get your own headphone.\" \"", "Now, the drive-through here is 85% of our business.\" \" ", "85%?\" \" ", "We have to be fast.\" \"", "We have to be efficient.\" \"", "Want to make sure we're friendly, but we want to make sure we're giving genuine service.\" \" ", "Got it.\" \" ", "So this is our spiel.\" \" ", "Oh, got it.\" \"", "Right.\" \" ", "So I'm gonna do it.\" \"", "And then I'm gonna have you do it and let you go on your own.\" \"", "Got it.\" \"", "Thank you for choosing Riverside Plaza Coffee Bean.\" \"", "This is Tatiana.\" \"", "How can I help you today?\" \"", "Can I get a regular Ice Blended, half hazelnut, half white chocolate?\" \"", "Okay, your total's gonna be $5.89 at the window.\" \" ", "Thank you.\" \" ", "Thank you.\" \"", "Did you see that?\" \"", "That was quick.\" \"", "And then someone else...\" \"After you do that, someone else around here...\" \"They already started working on it.\" \" ", "Okay, that's great.\" \" ", "Okay?\" \"", "Okay, so the next one's yours.\" \"", "Okay.\" \"", "Hi.\" \"", "Good morning.\" \"", "Thank you for choosing\" \"The Coffee Bean Tea Leaf Riverside Plaza.\" \"", "My name is Mick.\" \"", "How's your day going?\" \"", "Uh, I'm not sure it's working.\" \" ", "Now.\" \" ", "Thank you for choosing\" \"The Coffee Bean Tea Leaf Riverside Plaza.\" \"", "My name is Mick.\" \"", "How's your day going?\" \" ", "Medium pumpkin latte.\" \" ", "Your total is $4.69.\" \"", "Thank you.\" \"", "We'll see you at the window.\" \" ", "Thank you.\" \" ", "Okay.\" \"", "Don't worry about rushing through it.\" \"", "Okay.\" \"", "Good morning.\" \"", "Thank you for choosing\" \"The Coffee Bean Tea Leaf Riverside Plaza.\" \"", "My name is, uh, Mick.\" \"", "How's your day going?\" \"", "I want...\" \"I want to put my name down here 'cause I can see me saying,\" \"\"My name is Tawny,\" and I would feel ridiculous.\" \"", "You requested a large sugar-free macchiato.\" \"", "You got to be full of energy, because remember, whatever you're giving off, that's what they're picking up off of you.\" \"", "Hi, good morning.\" \"", "Thank you for choosing\" \"The Coffee Bean Tea Leaf Riverside Plaza.\" \"", "Does it sound like I'm reading it?\" \"", "A little bit.\" \"", "A little bit robotic.\" \"", "I'll do a Blended Thai Tea, regular.\" \"", "Blended Chai Tea, regular.\" \"", "Wait, did you say \"Thai\" or \"chai\"?\" \" ", "Chai.\" \" ", "Uh, Thai, please.\" \"", "Okay, chai.\" \"", "Okay, I want you to pace yourself.\" \"", "Okay.\" \"", "It's Iced Caramel, you said?\" \"", "Yes.\" \"", "Uh, and then I repeat the order?\" \"", "Do I ask that on every single one, cream, sugar, whip... or do we wait and let them ask?\" \" ", "Anything else?\" \" ", "No, that would be it.\" \"", "Thank you and we'll see you at the window.\" \"", "Well, Mick, you're gonna be putting these orders in...\" \" Throwing me in the pool?\" \" ", "On your own now.\" \"", "And then I'll be right over here checking on other stuff.\" \" ", "Okay, great.\" \" ", "Okay?\" \"", "Hi, good afternoon.\" \"", "Thank you...\" \"Hi, good afternoon.\" \"", "Thank you for choosing\" \"Coffee Bean Tea Leaf Riverside Plaza.\" \"", "My name is Mick.\" \"", "How are you?\" \"", "The way Tatiana looks at me,\" \"I'm really concerned she knows who I am.\" \"", "Sammy.\" \"", "I don't want to go in and assume my cover's blown, but I see her talking to the staff.\" \"", "I just don't feel comfortable right now.\" \"", "Welcome to The Coffee Bean TeaLeafRiversidePlaza.\" \"", "It's one thing if Tatiana suspects it's me, but if she starts telling everyone and other locations find out,\" \"I've got to stop this immediately.\" \"", "I got to come up with something fast.\" \"", "I see her talking to the staff, whispering.\" \"", "I kind of feel like she's looking at me weird.\" \"", "I wouldn't be surprised if she knows that this is a disguise.\" \"", "I got to fix this immediately.\" \"", "So we're gonna do a little bit more order...\" \"Well, actually, I was gonna\" \" ask you something.\" \" ", "Yes?\" \"", "Can we go talk for just two minutes?\" \" ", "Outside of here?\" \" ", "Yes.\" \"", "So we can get someone to cover for you?\" \"", "Yes.\" \"", "So, um, do you think I'm somebody else, by chance?\" \"", "'Cause I kind of heard you talking...\" \" Okay, okay.\" \" ", "I heard you talking to people...\" \"You did... you do favor our CEO a little bit.\" \"", "Okay, well, I am John Fuller.\" \"", "I'm sorry for trying to trick you, so it's actually Undercover Boss.\" \"", "I did not know that part.\" \"", "Oh, you didn't?\" \"", "Well, now you do.\" \" ", "No, I didn't.\" \" ", "Well, being the boss, one of the reasons I did this is to go undercover so I can learn and be better as a CEO.\" \"", "I want you to.\" \"", "Okay, so now that you know who I am, if you could be me for a day or a week or a month, what would you do different?\" \"", "I do have a ton of ideas.\" \"", "I really think that I would make sure that our team feel like we're taking care of them.\" \" ", "Uh-huh.\" \" ", "If they don't feel like we care as a company, they're not gonna give us the best them.\" \" ", "Right.\" \" ", "You know, I ran\" \" the Newport Beach location.\" \" ", "Okay.\" \"", "And I kept the same team in there all that time.\" \"", "How long have you been at this location?\" \"", "For just a couple months.\" \"", "So why'd you come here?\" \"", "To get close to home because I've been commuting for ten years.\" \"", "You know, I put 240,000 miles on my car.\" \" ", "Oh, my gosh.\" \" ", "And I was running up a $1,300 toll road bill every year.\" \"", "All right, and how close do you live to here?\" \"", "To here, I live eight miles away.\" \"", "But they just said,\" \"\"We're gonna just put you out here,\" \"\"and then when we open up something, we're gonna put you in there,\"\" \"so they're moving me to Fontana somewhere.\" \"", "How far away is Fontana from here?\" \"", "It's about 22 to 25 miles.\" \"", "But I have to get close to home.\" \"", "You know, things have got kind of critical toward these last couple of years because my husband has renal failure.\" \" ", "Oh, jeez.\" \" ", "But his kidneys actually failed 'cause he was prescribed the wrong medication.\" \"", "So I was working in Newport Beach, and I got a call from my daughter.\" \"", "She's like, \"Daddy's getting rushed to the hospital, so come,\" so I ran out of my store.\" \"", "You know, he could have literally died.\" \"", "But thank God he didn't.\" \" ", "Right.\" \" ", "But that did, like, change the whole dynamic of our life, you know.\" \"", "That's when I made up in my mind,\" \" I have to get close to home.\" \" ", "Right.\" \"", "Tatiana shared with me that her family life really changed about a year ago.\" \"", "Here's someone who has all the reasons in the world to relocate, and we should be right on that immediately.\" \"", "The fact that our company is so slow to act on it and see if we can find her a better home is really disappointing to me.\" \"", "For me to get what I need to gain from this undercover experience...\" \" Right.\" \" ", "It's super important that you protect my secrecy and my identity.\" \"", "Oh, yeah, we'll get it under wraps.\" \"", "Well, thank you for talking to me.\" \" ", "Thank you.\" \" ", "Want to go back in?\" \" ", "Yes.\" \" ", "All right.\" \"", "When I went undercover at Johnny Rockets, one of my biggest takeaways was that taking care of our people is the most important thing you could possibly do.\" \"", "Good afternoon, okay?\" \"", "Hi.\" \"", "Good afternoon.\" \"", "Thank you...\" \"In my role as CEO,\" \"I'm trying to change the culture in a place where people are the first priority, and things like I hear about today from Tatiana makes it seem like people are not the first priority.\" \"", "Certainly that's one of the things\" \"I want to change immediately.\" \"", "That was 100% better.\" \"", "You did really good, okay?\" \"", "Yeah.\" \"", "Today I'm gonna be working with a team member in San Diego, California.\" \"", "Our San Diego market does not perform as well as others, but this specific location does pretty well.\" \"", "Hi, is Jacob here?\" \"", "And I want to see why that is.\" \" ", "Mick.\" \"", "How you doing?\" \" ", "Nice to meet you, Nick.\" \"", "We're gonna teach you how to run\" \" our register today.\" \" ", "Awesome.\" \"", "We have four different screens.\" \"", "We have hot drinks, cold drinks...\" \" All right.\" \" ", "Food, and retail products.\" \" ", "Okay.\" \" ", "We have three main options.\" \"", "A small, regular, and large drink.\" \"", "Single or double shot of espresso unless the customer asks differently.\" \"", "So we got some people coming up right now.\" \"", "How you guys doing today?\" \"", "I'm in training, so sorry if I go slow.\" \"", "You know what?\" \"", "I'll just have espresso...\" \"like, a macchiato.\" \"", "Ask him if he wants a single or a double.\" \" ", "You want a single or a double?\" \" ", "Single.\" \" ", "Single?\" \" ", "Single shot.\" \" ", "Okay, and macchiato?\" \" ", "Uh-huh.\" \"", "Your total is $4.68, so go ahead and slide right there.\" \"", "There you go.\" \" ", "Thanks.\" \" ", "Thank you.\" \"", "For this order, you're doing this on your own.\" \" ", "I'm stepping back.\" \" ", "All right.\" \"", "Hi, we're getting...\" \"This is one of the items we're getting.\" \" ", "Okay, so...\" \" Scan that.\" \"", "Is there a scanner?\" \"", "Sorry.\" \"", "How is this supposed to go?\" \" ", "Go to bottled drinks.\" \" ", "What's that?\" \" ", "Bottled drinks.\" \" ", "Oh, crap.\" \"", "All right.\" \"", "I have a few more other things.\" \"", "Let me know when you're ready.\" \"", "I know.\" \"", "Sorry for taking so long.\" \"", "Mick, when he was on the register, he was really fumbling about.\" \"", "So back to cold drinks.\" \" ", "It's a hot drink.\" \" ", "Oh, hot drink.\" \"", "That's why I can't find it.\" \"", "He seemed to get caught in his own words too much that he forgot what he was doing.\" \"", "We want to make sure we're going\" \" and going and going.\" \" ", "Okay, yeah.\" \" ", "Hi.\" \" ", "Retail product.\" \" ", "Uh...\" \" Other way.\" \"", "Up.\" \"", "I'm just gonna start hitting a bunch of buttons and see what happens.\" \"", "You got to try to remember their order.\" \"", "Okay.\" \"", "All right, thanks for taking it easy on me.\" \"", "Imagine if you were in here and you were waiting for ten minutes.\" \"", "For me, I'd... when walking out,\" \"I'd go, \"Wow, that was a long wait.\"\" \" ", "Right.\" \" ", "You can get coffee anywhere.\" \"", "So we want to really make sure that this is a place they want to come back to.\" \" ", "Yeah.\" \" ", "So here we have this thing right here for making our coffee.\" \"", "We have to brew these once every hour.\" \"", "And then we also have all of our teas.\" \" ", "We only have bag teas.\" \" ", "Oh, you do?\" \"", "And we only do one size for our hot teas.\" \"", "If I was a tea drinker and I came here and I was really looking for tea...\" \" Yeah?\" \" ", "And it says\" \"Coffee Bean Tea Leaf, I would think that they would have something more traditional.\" \"", "Really underrepresented in the tea world.\" \"", "Seems like that's a ton of choices, still.\" \"", "In the world of tea, there is hundreds of thousands of types of tea.\" \"", "You're kidding me.\" \"", "Each teas come from a different plant, a different fermentation.\" \"", "You have a loose leaf tea.\" \"", "What that is, is a proportional scoop per cup.\" \"", "Like, here, we only bag teas.\" \"", "Can't really do anything for a small or large other than recommend another tea bag.\" \"", "You want us to add more water?\" \"", "Right.\" \"", "Do you get people asking you about it?\" \"", "Yep.\" \"", "Coffee Bean doesn't really focus on...\" \"They really leave out the tea aspect of The Coffee Bean Tea Leaf.\" \"", "Jacob kind of said some interesting things about tea, and I know, as a system, we're about 15% of our sales are tea, but I've underestimated, I think, how tea is such a huge area of growth potential for us,\" \"and so I'm really gonna focus in on growing our tea business.\" \"", "We got four teas on our list.\" \"", "We have Pacific Coast, Tropical Passion,\" \"Orchard Peach, and Swedish Berries.\" \"", "So we had somebody label these tea pitchers for us.\" \"", "What this has is the name of the tea.\" \"", "This is all used for iced tea.\" \"", "Oh, ice... okay.\" \"", "So these are our teas right here.\" \"", "Black tea, since it's so strong and thick, it really has to take that five minutes to fully diffuse in the water.\" \"", "Herbal infusion will be at seven minutes just because it's mixed with fruits, pieces of plants, while a green tea, it's a lighter tea, it's easier to diffuse, so it's gonna take three minutes to get ready.\" \"", "So let's go ahead and get our Swedish Berries started.\" \" ", "Okay, so...\" \" That is a herbal infusion tea, so how long do you think that's gonna go for?\" \" ", "Seven minutes.\" \" ", "Yep.\" \" ", "Just drop it in?\" \" ", "Yep, go ahead.\" \" ", "All right.\" \" ", "That's seven minutes.\" \"", "We're done with that one for now.\" \"", "That one's gonna brew on its own.\" \"", "We can start filling up these other ones.\" \"", "So we got a green, Orchard Peach, and how long does green tea brew for?\" \" ", "Three minutes.\" \" ", "Three minutes, so you want to go ahead and prepare this.\" \"", "All right.\" \"", "Uh...\" \"Start?\" \"", "No, wait.\" \"", "No, just go ahead and hit the minute.\" \"", "Add the minutes I want on there?\" \" ", "Yep.\" \" ", "Oh, wait.\" \"", "That says minutes, but...\" \"That's three minutes, right?\" \"", "Yep, that is three minutes.\" \"", "Okay, we're gonna do two of these?\" \" ", "Yep.\" \"", "Go ahead.\" \" ", "Yeah.\" \" ", "And that's our teas.\" \" ", "Okay.\" \"", "Done.\" \"", "Should I stir that up?\" \"", "No, we just pull 'em out.\" \"", "Just pull it out.\" \"", "You got to be fast about it, though, because while you're doing that, the tea's still brewing, and if you wait too long, then that tea's gonna be overbrewed and it can taste different.\" \"", "Mick needs to move a little bit faster.\" \"", "If he's not ready to serve up the tea, the whole batch might go bad.\" \" ", "Did you grow up here?\" \" ", "No, I'm not from here.\" \" ", "Where'd you grow up?\" \" ", "Born in Indiana.\" \"", "And your family... does any of them live out here?\" \"", "None of them live out here.\" \"", "Most of them are in Indiana and Michigan.\" \"", "So you don't have family at home, huh?\" \"", "Nope, no family here.\" \"", "Where do you live around here?\" \"", "Do you live close by, or...\" \"No, I live on the other side of San Diego.\" \"", "It takes me about an hour to get here in the mornings.\" \" ", "Really?\" \" ", "I take the buses.\" \" ", "You do?\" \"", "Okay.\" \" ", "Yep.\" \"", "Right now, I don't have a permanent address.\" \"", "I'm sleeping on some guy's living room floor for $550 a month.\" \"", "$550 a month?\" \"", "To sleep on a floor?\" \"", "But, you know, it's better than finding a park to sleep in every night.\" \"", "I've been homeless too.\" \"", "It's hard, and...\" \"Really?\" \"", "Where, out here or in...\" \"Yeah, out here.\" \"", "I mean, I've had sprinklers.\" \"", "I've had a cop tell me to go.\" \" ", "Yeah.\" \" ", "It gets tiring.\" \" ", "I was very tired.\" \" ", "Yeah.\" \"", "Yeah.\" \"", "And that has long-lasting effects.\" \"", "So you can't, like, rent a room from other people for that amount?\" \"", "I probably could, but the problem is,\" \"I don't have a computer, so it's harder to find it.\" \"", "At the same time, I'm always working, so I don't have the time to go and track stuff down.\" \"", "With two jobs, you really have to weigh what you need against what you have.\" \"", "For me, I'm getting offered another dollar at Buffalo Wild Wings if I'd be open just one more day a week.\" \" ", "Really?\" \" ", "Promised 28 hours.\" \"", "And that... you know, it's probably gonna interfere with Coffee Bean Tea Leaf.\" \"", "I need at least a full-time equivalent.\" \"", "I'm gonna keep working hard until I get where I need to be.\" \" ", "And sometimes that's...\" \" What do you want to be?\" \"", "Do you know?\" \"", "Do you know what that looks like yet?\" \"", "Yeah, I would love to be a linguistics professor.\" \" ", "Really?\" \" ", "I can speak four languages.\" \"", "Which ones?\" \"", "English, Spanish, Portuguese, and American Sign Language.\" \"", "Wow.\" \"", "Working with people like Jacob, it takes me back to six years ago when I went undercover for the first time, and this just is exactly the reason\" \"I wanted to do this again, and with that kind of drive and intelligence and passion and commitment to doing the job right,\" \"I can see why this location is one of our best performers in San Diego.\" \" ", "Now, that one tastes right.\" \" ", "Really?\" \"", "I nailed it?\" \" ", "That one tastes good.\" \"", "Mm-hmm.\" \" ", "Cheers.\" \"", "Coming up...\" \" How you doing?\" \" ", "Hi.\" \"", "The boss reveals his true identity to his employees.\" \" ", "I'm Mick.\" \" ", "Okay.\" \" ", "But my name's not Mick either.\" \" ", "Oh, my God.\" \"", "How will they react?\" \"", "You're on Undercover Boss.\" \"", "Are you serious?\" \"", "I'm really glad I undertook this journey one more time.\" \"", "Still being relatively new to the company, of course I have all kinds of ideas of what I want to do, but innovation isn't always about new products.\" \"", "It's about new ways to take care of your people, and I've relearned that again every day this week.\" \" ", "How you doing?\" \" ", "Hi.\" \"", "Do I look a little different?\" \" ", "Very.\" \" ", "Yeah?\" \" ", "Very different.\" \" ", "And how was Mick?\" \"", "Um, very messy.\" \"", "He did come in a little shaggy.\" \"", "I think I've seen you somewhere before.\" \" ", "Really?\" \"", "Have we met?\" \" ", "I don't know.\" \"", "I think so.\" \"", "Maybe.\" \" ", "So I'm Mick.\" \" ", "Okay.\" \"", "But my name's not Mick either.\" \" ", "What?\" \" ", "My real name is John Fuller.\" \"", "I'm our president and CEO of The Coffee Bean Tea Leaf.\" \" ", "Oh, wow.\" \" ", "Oh, my God.\" \"", "So you're on Undercover Boss.\" \"", "Are you serious?\" \"", "You caught me off guard for that one.\" \"", "Oh, my God.\" \"", "I feel embarrassed.\" \"", "Don't be embarrassed.\" \"", "Deanna, I learned some things.\" \"", "That inventory sheet drove me crazy.\" \"", "So help me find Colombia light on there, then, if you could.\" \"", "Right here.\" \"", "That is Colombia light.\" \"", "See, it doesn't say \"light,\" though.\" \" ", "It won't say \"light.\"\" \" ", "So how would I know?\" \"", "So if we automated it and made it more kind of today's technology, do you think that would help?\" \"", "Oh, absolutely.\" \"", "Absolutely.\" \"", "So, um, you've had some health issues.\" \"", "Yeah.\" \"", "I know you're under so much pressure with what you've had to deal with.\" \"", "Well, I'm a single parent, you know, so it's a little difficult, you know?\" \"", "One of the things we want to do so that you can create a different path for yourself and also try to create a good, happy environment for your kids is, we want to give you $20,000 to help get you started with that.\" \" ", "Are you serious?\" \" ", "Absolutely.\" \"", "That would...\" \"That could pay off everything.\" \"", "I can see... when you were telling me you dropped out in the tenth grade,\" \"I could hear the pain in your voice.\" \" ", "It's embarrassing.\" \" ", "And I don't want you to have to have that anymore.\" \"", "What I would like to see you do for yourself is get your high school diploma, and we will fund whatever it takes to go online to take care of getting that done, and I'm gonna have a graduation present\" \"waiting for you of $10,000 once you complete your courses.\" \"", "It's so embarrassing, but I thank you.\" \"", "I tell my children, you know, go to school.\" \"", "Education is everything.\" \"", "In order to help you with that, we're gonna set aside $40,000 in a college fund,\" \"$20,000 for each kid, so that can help them on their way.\" \"", "That would help them both so much.\" \"", "I really thank you.\" \"", "I feel like a huge weight has been lifted off me.\" \"", "I don't feel like I'm drowning.\" \"", "Having my kids both get to go to college, it's a gift that I never thought\" \"I'd be able to give 'em.\" \"", "Thank you.\" \"", "Coffee Bean saved my life twice.\" \"", "Chris, you know, we're much more than just giving away coffee.\" \"", "You made it an experience.\" \"", "You know, I left you alone in the truck.\" \"", "I was like, \"He's gonna make a total mess in there and\"...\" \"And I did.\" \"", "You're having a little trouble with the lids.\" \"", "Swear to God, these lids are gonna drive me crazy.\" \"", "You don't want to hand out drinks that are... you know.\" \"", "Looking like crap?\" \"", "In order for The Coffee Bean Tea Leaf to be more successful, I want to get more trucks out in the community, and I'd like to ask you to be part of a task force here in the home office to help us become great at this,\" \"and I'd want to pay you $5,000 if you agree to help us.\" \"", "That sounds good to me.\" \"", "I appreciate it.\" \" ", "Thank you very much.\" \" ", "Yeah.\" \"", "One of the things that is so touching was hearing how you went to your first NFL game with your father.\" \"", "You mentioned how important family is to you.\" \"", "You have your mom here.\" \"", "You have your brothers and sisters here.\" \"", "It would be my pleasure to give you and your family six tickets to an upcoming Rams game.\" \"", "We're gonna send a car for you on the day before the game.\" \"", "We'll put you up in a nice hotel, take you out to a nice dinner, and then the next day, you go to the game together as a family.\" \"", "That's great.\" \"", "Thank you very...\" \"thank you very much for that.\" \" ", "Wow.\" \" ", "Sure.\" \"", "This is gonna be a great trip for everybody, so I really appreciate it.\" \"", "Thank you so much.\" \"", "It's a great feeling.\" \"", "All my hard work gets noticed, so it shows other employees that stuff like this can happen and if you work hard, you do a great job that good things happen.\" \"", "My future looks brighter in The Coffee Bean Tea Leaf.\" \"", "Tatiana, you're the greatest.\" \"", "You were willing to be open and honest with me, which is rare for me, so I appreciate it.\" \"", "I hope that was okay.\" \" ", "It was fantastic.\" \" ", "Okay.\" \"", "I want to make sure that our team feel like we're taking care of them.\" \" ", "Uh-huh.\" \" ", "If they don't feel like we care as a company, they're not gonna give us the best them.\" \"", "I'm personally taking this on to make certain that we relook at how we recognize, reward, promote, educate, all things that have to do with how we treat people to make certain that we're a place that everyone can be proud of.\" \"", "Yeah, and make 'em feel good about what they're doing.\" \"", "Well, one of the things I want to do for you because of your loyalty is, you said you wanted to move stores.\" \"", "Yeah.\" \"", "Where did you want to move to?\" \"", "Downtown Riverside.\" \"", "If I switched you there immediately, would you like that?\" \" ", "Uh, yes.\" \" ", "Okay, done.\" \"", "For sure?\" \" ", "For sure.\" \" ", "Okay.\" \"", "One other thing I want to do for you, if we were able to...\" \"acted on this sooner, at a minimum, you would have saved\" \"$1,300 a year in toll road fees, so I want to give you $2,600 to at least offset the last...\" \" Are you serious?\" \" ", "I'm POS... yes.\" \"", "Oh, my God.\" \"", "Thank you so much.\" \"", "So tell me about your car.\" \"", "My car, Hercules, is a '06 Dodge Charger.\" \"", "He has 235,000 miles.\" \"", "What I'd like to do for you, since of all the things you've done for us, is, we would like to get you a new car, make sure that you can get there.\" \"", "Oh, John, for real?\" \"", "Serious?\" \"", "Oh, my God.\" \"", "I need that so bad.\" \"", "Thank you so much.\" \"", "This has changed my life.\" \"", "I still don't understand how I'm even here.\" \"", "Like, how did this happen?\" \"", "I've just...\" \"I'm just thankful.\" \"", "John is my guardian angel and hero today.\" \"", "He saved the day for me.\" \"", "Jacob, you care about what you do, and just how you talked about tea, it was such an... like, a romanticized experience for you.\" \"", "It wasn't just a product off the shelf.\" \"", "In the world of tea, there is hundreds of thousands of types of tea.\" \"", "You're kidding me.\" \"", "Each teas come from a different plant, a different fermentation.\" \"", "You mentioned to me that we don't have enough variety in the way we could do tea, so I think you have some ideas that might be able to help us grow our share of tea as far as sales.\" \"", "I want to send you on an all-expenses-paid trip to Sri Lanka...\" \" Really?\" \" ", "To one of our tea farms.\" \"", "And you're gonna learn so much from this trip, and I want you to come back even smarter about tea than you are today, 'cause I think we can learn some things from you.\" \"", "That's... that's amazing.\" \"", "Thank you very much.\" \"", "I've always wanted to travel the world.\" \"", "I always thought that would be something really cool.\" \"", "It's one of the reasons why I love languages and culture so much.\" \"", "And going to see an actual tea farm, that's really cool.\" \"", "You shared with me your goals of being a...\" \" Linguistics professor.\" \" ", "If you allow me,\" \"I'd love to be your personal mentor and maybe help you as you try to navigate through colleges.\" \"", "That... that sounds amazing.\" \"", "You mentioned you don't have a computer.\" \" ", "Yeah.\" \" ", "And so by the time you go home today, you're gonna have a computer.\" \"", "I... what?\" \"", "Yeah, you're gonna get a laptop.\" \"", "Th... thanks.\" \"", "Another thing I would like to do for you, Jacob,\" \"I want to offer you a full-time job here at The Coffee Bean Tea Leaf.\" \"", "Okay.\" \"", "One second.\" \"", "Um...\" \"You're serious about that?\" \" ", "Yes, I am.\" \" ", "Okay.\" \"", "What we're gonna do for you as long as you work for Coffee Bean, over the next year, we will provide for you a fully furnished apartment with very close proximity to your current location.\" \"", "Okay.\" \"", "I don't know if I mentioned it or not, but I was homeless for a while, and right now is...\" \"So I'm paying $550 to sleep on somebody's floor, so that, like... that's...\" \"That sounds like... that sounds like the deal of a lifetime to me.\" \"", "Wow.\" \"", "I never really thought that I was anyone important;\" \"I thought I was just there to get the job done and go home, and then the CEO does something like this.\" \"", "I don't know how I can be more grateful.\" \" ", "Thank you very much.\" \" ", "All right.\" \"", "Getting a full-time job and getting a place to live...\" \"Oh, my God.\" \"", "I'm gonna have a bed.\" \"", "There's so much stress that's gonna be taken off my shoulders.\" \"", "This is definitely going to change my life.\" \"", ".srt Extracted and Resynced by Dan4Jem, AD.MMXVII.I\"" ]

{ "pile_set_name": "OpenSubtitles" }

[ 0.0006558760069310665, 0.0006544726202264428, 0.0006560282199643552, 0.0006348995375446975, 0.0006241578957997262, 0.01691284403204918, 0.0007261677528731525, 0.004313104320317507, 0.0006515904096886516, 0.9510061144828796, 0.0006165348459035158, 0.0007598193478770554, 0.0006487935897894204, 0.0007951667066663504, 0.0005578643758781254, 0.0009358305833302438, 0.0008463538833893836, 0.0008076325175352395, 0.0005379741196520627, 0.004535553976893425, 0.001141029759310186, 0.0010612104088068008, 0.0006934184348210692, 0.0005982675356790423, 0.0008261583861894906, 0.0005614332621917129, 0.0006985338404774666, 0.0006045936024747789, 0.0005762697546742857, 0.0006137695745564997, 0.001054096850566566, 0.0009738903027027845, 0.0006194001762196422, 0.0008036802755668759, 0.08325900137424469, 0.0005442576366476715, 0.0006022513844072819, 0.000940092490054667, 0.08373864740133286, 0.000583115906920284, 0.0007751782541163266, 0.0007660379633307457, 0.0005533200455829501, 0.0010327509371563792, 0.0008441177778877318, 0.008574886247515678, 0.0006353686330839992, 0.0006502284668385983, 0.0005901929689571261, 0.0005778683698736131, 0.0005837017670273781, 0.00060706224758178, 0.0005607614875771105, 0.0005811431910842657, 0.0005734551232308149, 0.000926113803870976, 0.008860887959599495, 0.0007000469486229122, 0.0030048300977796316, 0.001035388675518334, 0.0010922414949163795, 0.000634374562650919, 0.0007187561714090407, 0.0007209081668406725, 0.0006819612463004887, 0.24369053542613983, 0.0037570877466350794, 0.004371570888906717, 0.0050868084654212, 0.0015038799028843641, 0.0005678185261785984, 0.0005821870872750878, 0.0005725414375774562, 0.01009497418999672, 0.0008337588515132666, 0.000666065898258239, 0.0006345449946820736, 0.0007601510151289403, 0.0007421866757795215, 0.0007149261073209345, 0.0008951741619966924, 0.0006666073459200561, 0.0025887214578688145, 0.0005506927263922989, 0.000539819651748985, 0.0005232337862253189, 0.0006307740695774555, 0.0007117110653780401, 0.0006298225489445031, 0.0010570860467851162, 0.0006348995375446975, 0.002537983702495694, 0.001456051249988377, 0.0005662075127474964, 0.0005432107718661427, 0.0009643041412346065, 0.0006241578957997262, 0.000594358192756772, 0.0008077063248492777, 0.001029575360007584, 0.0010483075166121125, 0.000593487755395472, 0.0005589549546130002, 0.00058155128499493, 0.0006773726781830192, 0.0007343114702962339, 0.0005571292713284492, 0.0007407109369523823, 0.0006919825682416558, 0.0006108754896558821, 0.005884975660592318, 0.0006919825682416558, 0.0006485305493697524, 0.0007863205391913652, 0.0010371532989665866, 0.000639640842564404, 0.0006731597241014242, 0.0006718199583701789, 0.0007502299267798662, 0.0006919825682416558, 0.0007865580846555531, 0.0006919825682416558, 0.0015710913576185703, 0.0006919825682416558, 0.0009127807570621371, 0.016814861446619034, 0.0006472680834122002, 0.0015236992621794343, 0.0015618718462064862, 0.00078159588156268, 0.0009048997308127582, 0.0006731597241014242, 0.008693942800164223, 0.0006486167549155653, 0.013043047860264778, 0.0007770264055579901, 0.0006731597241014242, 0.0007556946948170662, 0.0010616527870297432, 0.0014678479637950659, 0.0032321035396307707, 0.0006613623700104654, 0.0006609792471863329, 0.0008233265252783895, 0.0051352339796721935, 0.0006919825682416558, 0.0007887298706918955, 0.0006807508761994541, 0.0007028894615359604, 0.0010990818263962865, 0.0006725752609781921, 0.0006731597241014242, 0.0008029068703763187, 0.000915969314519316, 0.0007367784273810685, 0.0006970787653699517, 0.0006919825682416558, 0.000712973705958575, 0.000772976316511631, 0.000652988557703793, 0.0006919825682416558, 0.0007794697303324938, 0.0006845130701549351, 0.0006970787653699517, 0.001354364794678986, 0.0007149261073209345, 0.03337975963950157, 0.0006572958664037287, 0.0006048335926607251, 0.0007794555858708918, 0.000672240974381566, 0.001082813716493547, 0.00239120633341372, 0.0017609416972845793, 0.002980866702273488, 0.0008637221762910485, 0.0060692522674798965, 0.0011111519997939467, 0.0008036802755668759, 0.0005571157089434564, 0.0006048335926607251, 0.0010962886735796928, 0.0008339615305885673, 0.0006828060722909868, 0.0005936453235335648, 0.004313104320317507, 0.0012827934697270393, 0.0008430526359006763, 0.0007724888855591416, 0.0007149261073209345, 0.0006308630690909922, 0.0010431271512061357, 0.0007158492226153612, 0.010801530443131924, 0.009443753398954868, 0.0006051692180335522, 0.0006239152862690389, 0.0007211306947283447, 0.0007070373394526541, 0.001088040298782289, 0.00789699237793684, 0.01769247278571129, 0.0005571157089434564, 0.000990314525552094, 0.0006634203600697219, 0.0006731597241014242, 0.0008908118470571935, 0.006895111408084631, 0.0005919906543567777, 0.03567714989185333, 0.0006828021723777056, 0.0017567554023116827, 0.0006633789162151515, 0.0008442275575362146, 0.0009663108503445983, 0.001630674465559423, 0.0026720056775957346, 0.0006919825682416558, 0.0006771496264263988, 0.001224268926307559, 0.0011073858477175236, 0.0016778981080278754, 0.0009389789775013924, 0.0009202982764691114, 0.0006919825682416558, 0.0007064543315209448, 0.0005804039537906647, 0.0006460342556238174, 0.0006504199700430036, 0.000628882902674377, 0.000672275316901505, 0.0006718964432366192, 0.0007272973307408392, 0.0008413721807301044, 0.0008340306230820715, 0.0006919825682416558, 0.0006731597241014242, 0.0005641254829242826, 0.003906955011188984, 0.0005832929164171219, 0.0006798059330321848, 0.0007082748343236744, 0.0006331963813863695, 0.0006752737099304795, 0.0008115263772197068, 0.0005740634514950216, 0.0005522507126443088, 0.0007697138353250921, 0.0005789477727375925, 0.0007963336538523436, 0.0007765711634419858, 0.0008441177778877318, 0.0007513070595450699, 0.0009658855851739645, 0.0006765562575310469, 0.0008924935245886445, 0.0009727191063575447, 0.0006516966386698186, 0.0008363930392079055, 0.0007686408353038132, 0.0008473819470964372, 0.001275662099942565, 0.017681818455457687, 0.0007149261073209345, 0.0009417224209755659, 0.0009552303235977888, 0.001590328523889184, 0.04596298933029175, 0.0011177617125213146, 0.0009333235211670399, 0.02670060656964779, 0.0025887214578688145, 0.0031750949565321207, 0.15014587342739105, 0.0025887214578688145, 0.0013141731033101678, 0.0007788604707457125, 0.0015204374212771654, 0.0008438450749963522, 0.0007361906464211643, 0.0006017449777573347, 0.000566238013561815, 0.0034526274539530277, 0.0005517922108992934, 0.0047953445464372635, 0.0006564210634678602, 0.0006510879611596465, 0.0006091577233746648, 0.0036294576711952686, 0.0006810620543546975, 0.0006919825682416558, 0.0007902114884927869, 0.8778076171875, 0.0067570884712040424, 0.0010690800845623016, 0.0013813896803185344, 0.0013909016270190477, 0.058799296617507935, 0.0008185870246961713, 0.0022712021600455046, 0.0006142529891803861, 0.000561424414627254, 0.0005376946646720171, 0.0005118605913594365, 0.011629490181803703, 0.001217044540680945, 0.0005152192898094654, 0.00178168760612607, 0.0006408780463971198, 0.000756401102989912, 0.012634605169296265, 0.0010081058135256171, 0.0012512797256931663, 0.0005736147286370397, 0.0014370176941156387, 0.0006394607480615377, 0.000756401102989912, 0.0006650418508797884, 0.0008732586284168065, 0.001471980707719922, 0.0006340028485283256, 0.0006217563059180975, 0.0005592000670731068, 0.0007662306888960302, 0.0008041675318963826, 0.0006848439224995673, 0.0007149261073209345, 0.0007149261073209345, 0.0006163233192637563, 0.0006786960875615478, 0.000603544875048101, 0.0008409545407630503, 0.0006248188437893987, 0.0007562274113297462, 0.04841834679245949, 0.02915111556649208, 0.0008022819529287517, 0.0006943322368897498, 0.0006850155768916011, 0.041913196444511414, 0.0007305729668587446, 0.0007211712654680014, 0.0006897985585965216, 0.0006731597241014242, 0.0006678142235614359, 0.000787378114182502, 0.0022568441927433014, 0.0006273916224017739, 0.0013016805751249194, 0.0015104961348697543, 0.0010541389929130673, 0.0006403496372513473, 0.0006731597241014242, 0.0007217522361315787, 0.0005932632484473288, 0.0007521517109125853, 0.0008303879876621068, 0.0022118210326880217, 0.0008071404881775379, 0.0008494273060932755, 0.0010335762053728104, 0.0006663595559075475, 0.0006040169973857701, 0.004334690514951944, 0.0006919825682416558, 0.0006923532928340137, 0.6008769869804382, 0.0007153162732720375, 0.028316998854279518, 0.0009533414267934859, 0.0010676204692572355, 0.0007211306947283447, 0.0010690800845623016, 0.0006403496372513473, 0.0007570122834295034, 0.000896525802090764, 0.0013474462321028113, 0.0007272973307408392, 0.0006053555407561362, 0.0006569123361259699, 0.0008117375546135008, 0.0008302262285724282, 0.0017479738453403115, 0.0007317410781979561, 0.0007174278143793344, 0.0011700218310579658, 0.0006919825682416558, 0.0007537779747508466, 0.000731741776689887, 0.0006877685082145035, 0.0006718506338074803, 0.0016690363408997655, 0.0007285886094905436, 0.9510061144828796, 0.0005571157089434564, 0.0009179893531836569, 0.0007149261073209345, 0.0005817405763082206, 0.0006731597241014242, 0.0006678082281723619, 0.000634844764135778, 0.0009496372076682746, 0.06356538832187653, 0.0027380967512726784, 0.9265080690383911, 0.0006770935142412782, 0.0006784707074984908, 0.001130384742282331, 0.058799296617507935, 0.0007598193478770554, 0.0005950297927483916, 0.004287438467144966, 0.000669553002808243, 0.0006227457779459655, 0.0027770795859396458, 0.0006931389216333628, 0.0011795902391895652, 0.0005939637194387615, 0.0006614323356188834, 0.0007953462773002684, 0.0010221335105597973, 0.0007962210802361369, 0.0010221335105597973, 0.0013569302391260862, 0.0007901403587311506, 0.01788444072008133, 0.01931210421025753, 0.0008463538833893836, 0.000683614460285753, 0.26040634512901306, 0.0011560925049707294, 0.0008865069830790162, 0.0006059062434360385, 0.0006212637526914477, 0.0007355409907177091, 0.0008145851898007095, 0.0006521906470879912, 0.0006605230155400932, 0.0005971805658191442, 0.000560654909349978, 0.0006971326074562967, 0.002018596976995468, 0.000587297196034342, 0.0007729001226834953, 0.0014224449405446649, 0.0011334820883348584, 0.0007086438126862049, 0.0005990414647385478, 0.0007943605887703598, 0.0005845089326612651, 0.0011949394829571247, 0.0007700275164097548, 0.0009100578026846051, 0.0006819612463004887, 0.0006667563575319946, 0.0006076371064409614, 0.0006635910831391811, 0.0006116133299656212, 0.0007594338967464864, 0.0009727191063575447, 0.000950739486142993, 0.0008160387515090406, 0.0006207973347045481, 0.0006565636722370982, 0.0007861129706725478, 0.0008972017094492912, 0.004310790915042162, 0.0010629172902554274, 0.0007106091361492872, 0.0005988240009173751, 0.0006258212961256504, 0.001445332309231162, 0.0006919825682416558, 0.0007350514642894268, 0.0007618882227689028, 0.0007042072829790413, 0.000573200173676014, 0.0006074468838050961, 0.0006710740854032338, 0.0008354002493433654, 0.0007077327463775873, 0.0005725337541662157, 0.0005723927170038223, 0.0005297124735079706, 0.0005376439075917006, 0.0005531149217858911, 0.0006746362196281552, 0.0007310364162549376, 0.000628062873147428, 0.0028381445445120335, 0.0006446252227760851, 0.0005715559236705303, 0.0005835006013512611, 0.0006373928626999259, 0.0005668913945555687, 0.0005822406383231282, 0.0006892968667671084, 0.0006974356365390122, 0.0012112787226215005, 0.000758669339120388, 0.0005736147286370397, 0.001141029759310186, 0.0005586679326370358, 0.0014244321500882506, 0.0006985571817494929, 0.001282710931263864, 0.0006433710223063827, 0.0010264075826853514, 0.002589697949588299, 0.0010025707306340337, 0.0006526470533572137, 0.0006419203709810972, 0.0048828148283064365, 0.0006731597241014242, 0.6182876825332642, 0.0009846363682299852, 0.0008124351734295487, 0.000957655196543783, 0.0006486489437520504, 0.0005590342916548252, 0.0007104607648216188, 0.0027390536852180958, 0.0006978990859352052, 0.0006859576678834856, 0.0007642839918844402, 0.17206226289272308, 0.0007104607648216188, 0.0005400944501161575, 0.0007010630797594786, 0.0007595446077175438, 0.0009931703098118305, 0.007214496377855539, 0.0005571157089434564, 0.0005571157089434564, 0.0007677960093133152, 0.0006917870487086475, 0.0007005068473517895, 0.0005840141675435007, 0.0007502299267798662, 0.0009648821433074772, 0.0006919825682416558, 0.000731741776689887, 0.0006110169924795628, 0.0005238495650701225, 0.004535553976893425, 0.0007210758049041033, 0.0007159204687923193, 0.0008438692311756313, 0.0005238495650701225, 0.004535553976893425, 0.0007210758049041033, 0.0007762911263853312, 0.00134647311642766, 0.0005571157089434564, 0.0006945900386199355, 0.0005571157089434564, 0.0006919825682416558, 0.0007316916016861796, 0.0006919825682416558, 0.0006110169924795628, 0.0005238495650701225, 0.002169468905776739, 0.0007210758049041033, 0.06156298518180847, 0.0025135965552181005, 0.0036455243825912476, 0.0005949688493274152, 0.0005238495650701225, 0.0007127739954739809, 0.0007303808815777302, 0.0008185324259102345, 0.0006426640902645886, 0.0007021413184702396, 0.0007173864869400859, 0.0009747174335643649, 0.0006067707436159253, 0.0007961213123053312, 0.13718172907829285, 0.0006919825682416558, 0.0006963371415622532, 0.0006974356365390122, 0.0006133263232186437, 0.0011555165983736515, 0.0007634909125044942, 0.0007849108660593629, 0.0005443792906589806, 0.03423190861940384, 0.038106758147478104, 0.000643414503429085, 0.0006525895441882312, 0.0007502299267798662, 0.0005845613195560873, 0.000560894375666976, 0.0005287920357659459, 0.004535553976893425, 0.001141029759310186, 0.0006177995237521827, 0.0010451717535033822, 0.0008706157677806914, 0.0006387940375134349, 0.0006190575659275055, 0.0007041543140076101, 0.0006265625124797225, 0.0005746084498241544, 0.0013923508813604712, 0.0007073665619827807, 0.0006518417503684759, 0.000715266854967922, 0.0007158492226153612, 0.000632641080301255, 0.0009283831459470093, 0.0006974356365390122, 0.005897545255720615, 0.0006974356365390122, 0.0006654038443230093, 0.0007034929585643113, 0.0008361429208889604, 0.0006510745733976364, 0.0009334752103313804, 0.0007022360223345459, 0.0010172872571274638, 0.0012202075449749827, 0.0008280155598185956, 0.0006737267831340432, 0.0013522969093173742, 0.000755363900680095, 0.0005816033808514476, 0.0005734846345148981, 0.0007686408353038132, 0.0022526164539158344, 0.0006859576678834856, 0.0006244738469831645, 0.0006919825682416558, 0.0005884632118977606, 0.0008585304021835327, 0.0005923045100644231, 0.0008723189239390194, 0.0006426527397707105, 0.001162914326414466, 0.0025887214578688145, 0.0006432379013858736, 0.002162450458854437, 0.000744155899155885, 0.0045281522907316685, 0.0009411066421307623, 0.0006479716976173222, 0.0007957568159326911, 0.017164960503578186, 0.0007652219501323998, 0.0014984837034717202, 0.0006275916821323335, 0.01553323119878769, 0.18402232229709625, 0.0007438729517161846, 0.0006859576678834856, 0.0007529164431616664, 0.0006358977989293635, 0.0006859576678834856, 0.000564533460419625, 0.0006711521418765187, 0.0006565930671058595, 0.0005954703083261847, 0.0006491508102044463, 0.0005843554972670972, 0.0005262498161755502, 0.0005571157089434564, 0.002265032147988677, 0.0006974356365390122, 0.0006731597241014242, 0.0006168254767544568, 0.0005965454038232565, 0.000731741776689887, 0.0006023035966791213, 0.0005559977144002914, 0.0006371320341713727, 0.0006426331237889826, 0.0005740112392231822, 0.0007149261073209345, 0.0005631230305880308, 0.0006105254287831485, 0.0007566718268208206, 0.0006397133693099022, 0.012634605169296265, 0.0008337588515132666, 0.0007035616436041892, 0.013151531107723713, 0.001612632884643972, 0.0006166920647956431, 0.0007494082092307508, 0.000614698335994035, 0.0006919825682416558, 0.0006103587220422924, 0.0007974667241796851, 0.0027142702601850033, 0.0006008907803334296, 0.0007328887586481869, 0.0007125875563360751, 0.000998054863885045, 0.010603529401123524, 0.001509474590420723, 0.0033102778252214193, 0.0008619040600024164, 0.001416716375388205, 0.0010793168330565095, 0.0007197788800112903, 0.0007686408353038132, 0.0013854963472113013, 0.0006970787653699517, 0.0005748633993789554, 0.0005571157089434564, 0.0023756215814501047, 0.00131656089797616, 0.0006731597241014242, 0.0006448295898735523, 0.0007719546556472778, 0.0007566360873170197, 0.0007211306947283447, 0.0007766285561956465, 0.00078528345329687, 0.000806340656708926, 0.0006118938326835632, 0.9510061144828796, 0.0006731597241014242, 0.0006165348459035158, 0.0007082728552632034, 0.0007598193478770554, 0.0006487935897894204, 0.02344481647014618, 0.002972705289721489, 0.0008147259941324592, 0.0008781575015746057, 0.000705512473359704, 0.0010958611965179443, 0.0007019905024208128, 0.0006706971907988191, 0.000731741776689887, 0.0006416573305614293, 0.0008033461053855717, 0.0016410695388913155, 0.0006624337402172387, 0.0006515904096886516, 0.0006919825682416558, 0.000568352930713445, 0.0007707649492658675, 0.0006816321983933449, 0.0006859576678834856, 0.0007238438702188432, 0.0006464173784479499, 0.0007149261073209345, 0.0006148091051727533, 0.0007046735263429582, 0.0006350910989567637, 0.0008436650387011468, 0.0010677095269784331, 0.0008518224349245429, 0.00078194634988904, 0.0005419155349954963, 0.0006273390026763082, 0.0006226439727470279, 0.0006240939837880433, 0.0028909260872751474, 0.0006302428664639592, 0.0009988690726459026, 0.0006334510399028659, 0.0031651004683226347, 0.0006565943476743996, 0.0012097348226234317, 0.0006859576678834856, 0.0008234676788561046, 0.0015557173173874617, 0.000647314649540931, 0.0005454354104585946, 0.0007587517611682415, 0.0005739606567658484, 0.0005667344084940851, 0.0006050849915482104, 0.0006083197076804936, 0.0013888274552300572, 0.0007009115070104599, 0.0008259746246039867, 0.0005394390318542719, 0.0009006194886751473, 0.0006925757043063641, 0.0007447301759384573, 0.0015557173173874617, 0.0007092521991580725, 0.0013749839272350073, 0.0006731597241014242, 0.0007894975715316832, 0.000653001363389194, 0.0014643073081970215, 0.0006686899578198791, 0.0006336491205729544, 0.0007083001546561718, 0.0005999602726660669, 0.0006731597241014242, 0.0007601763936690986, 0.0007898896583355963, 0.0009770096512511373, 0.0007894400623627007, 0.0015557173173874617, 0.0008327619289048016, 0.0008235527784563601, 0.0008917442173697054, 0.0006878308486193419, 0.0015557173173874617, 0.001816426869481802, 0.0007149261073209345, 0.000770275539252907, 0.0006919825682416558, 0.00078396569006145, 0.001044043223373592, 0.0023676720447838306, 0.0012269282015040517, 0.0006836691172793508, 0.0021515919361263514, 0.011388472281396389, 0.016893746331334114, 0.001023132586851716, 0.02075948938727379, 0.0006700291996821761, 0.007246972993016243, 0.03397180140018463, 0.0005813182215206325, 0.024414774030447006, 0.0008594380342401564, 0.0010249946499243379, 0.001866792794317007, 0.0006817175890319049, 0.0008307232055813074, 0.001808769186027348, 0.0011016257340088487, 0.0006919825682416558, 0.0015557173173874617, 0.0007155310013331473, 0.003449126612395048, 0.000797238782979548, 0.0080906106159091, 0.001955424202606082, 0.000707956322003156, 0.0009661709191277623, 0.0009486489580012858, 0.001983709866181016, 0.0009544446947984397, 0.0007149261073209345, 0.001216179458424449, 0.0007691947394050658, 0.0007149261073209345, 0.0007149261073209345, 0.000596659432630986, 0.0012763870181515813, 0.0007438835455104709, 0.0005524552543647587, 0.0006620926433242857, 0.000533853133674711, 0.0008307232055813074, 0.0006162369973026216, 0.000837861152831465, 0.0006145694642327726, 0.0006945648929104209, 0.0008849970763549209, 0.000916653370950371, 0.0007928205886855721, 0.0007165351416915655, 0.0008307232055813074, 0.0006008547497913241, 0.0010364396730437875, 0.0006180792115628719, 0.0007749850628897548, 0.0005249987589195371, 0.0006035761907696724, 0.0008307232055813074, 0.001004657126031816, 0.0006369389593601227, 0.0007788604707457125, 0.000544087786693126, 0.0008116973331198096, 0.000731741776689887, 0.0006849891506135464, 0.005495781544595957, 0.0006919825682416558, 0.0013019435573369265, 0.001456051249988377, 0.0008210497326217592, 0.0019690636545419693, 0.003828944405540824, 0.0005414036568254232, 0.00056713807862252, 0.0007591430330649018, 0.0008337588515132666, 0.000731741776689887, 0.0008261954062618315, 0.0008841967792250216, 0.0007833876879885793, 0.0007247625035233796, 0.002470878418534994, 0.0009137066081166267, 0.0008316957973875105, 0.0005943060386925936, 0.0008307232055813074, 0.0006910141673870385, 0.0007662306888960302, 0.0006662783562205732, 0.0006905648042447865, 0.0064850798808038235, 0.0006919825682416558, 0.0013019435573369265, 0.0009256881894543767, 0.0007008857792243361, 0.0005970157799310982, 0.0006938540027476847, 0.001456051249988377, 0.0010712883668020368, 0.003828944405540824, 0.0014560242416337132, 0.001456051249988377, 0.000710442487616092, 0.0018690313445404172, 0.0006197908660396934, 0.00888664647936821, 0.0005832929164171219, 0.0007556946948170662, 0.0007082748343236744, 0.0006331963813863695, 0.0006752737099304795, 0.0008115263772197068, 0.0005976113025099039, 0.0006985571817494929, 0.000684893224388361, 0.0036407853476703167, 0.0007149261073209345, 0.0006639254279434681, 0.0007311698282137513, 0.0007364068296737969, 0.003828944405540824, 0.000684893224388361, 0.007734074257314205, 0.10702139139175415, 0.0016882738564163446, 0.0016931761056184769, 0.011228475719690323, 0.0006200664793141186, 0.024055909365415573, 0.0015482052695006132, 0.0006230114959180355, 0.0006045091431587934, 0.0005370780127122998, 0.0010512748267501593, 0.0009782667038962245, 0.0009505207999609411, 0.0005571157089434564, 0.0010206734295934439, 0.0009654440218582749, 0.0006090927636250854, 0.02454233355820179, 0.018164120614528656, 0.0009496372076682746, 0.40613627433776855, 0.0027380967512726784, 0.9265080690383911, 0.0006007170304656029, 0.0005600287113338709, 0.0005628212238661945, 0.0005376014159992337, 0.0007149261073209345, 0.001852450892329216, 0.000565810187254101, 0.48044005036354065, 0.0016998150385916233, 0.0019581031519919634, 0.006324811838567257, 0.0015876718098297715, 0.0005957593093626201, 0.0005483271670527756, 0.0007749850628897548, 0.0006624902598559856, 0.0005166914779692888, 0.0005390940932556987, 0.0005656396970152855, 0.0006346774753183126, 0.0005427596624940634, 0.024060726165771484, 0.0005317511386238039, 0.0005837645730935037, 0.000579757324885577, 0.0006919825682416558, 0.0005778917693533003, 0.0007686408353038132, 0.0022526164539158344, 0.0005628644139505923, 0.0005640889285132289, 0.0007107987185008824, 0.0007149261073209345, 0.0008231930551119149, 0.0006739075761288404, 0.0007321840384975076, 0.0006774059147574008, 0.0006725752609781921, 0.0007024512160569429, 0.0006316331564448774, 0.0006919825682416558, 0.0006515876739285886, 0.0008727358654141426, 0.001456051249988377, 0.0005390940932556987, 0.001028037047944963, 0.0015233097365126014, 0.0008336837636306882, 0.008679586462676525, 0.0011094321962445974, 0.0011947853490710258, 0.001456051249988377, 0.004311358090490103, 0.0005390940932556987, 0.0007783362525515258, 0.0008079835097305477, 0.0007158952648751438, 0.0006371799972839653, 0.0007458484033122659, 0.0007130471058189869, 0.0030351413879543543, 0.0007340602460317314, 0.0006240939837880433, 0.0028909260872751474, 0.0006302428664639592, 0.0005557789118029177, 0.005099460016936064, 0.0007224634173326194, 0.0022176173515617847, 0.0006290702149271965, 0.0005376014159992337, 0.0006197284674271941, 0.000550238648429513, 0.0006977437296882272, 0.0006082164472900331, 0.0007027424871921539, 0.0006635094759985805, 0.0005772606236860156, 0.0008938598330132663, 0.0007149261073209345, 0.0018867799080908298, 0.001451827702112496, 0.0015701312804594636, 0.0006415649550035596, 0.0006023954483680427, 0.0006919825682416558, 0.0006643880624324083, 0.0007361759198829532, 0.0007020054617896676, 0.0006919825682416558, 0.000657716067507863, 0.0006919825682416558, 0.0011471266625449061, 0.0007749850628897548, 0.0006987053202465177, 0.000586184614803642, 0.0005376014159992337, 0.0006731597241014242, 0.018905332311987877, 0.00756525294855237, 0.0061360676772892475, 0.0009798173559829593, 0.0009766154689714313 ]

[ "<!", "doctype html>\n<html>\n <title>npm-install</title>\n <meta http-equiv=\"content-type\" value=\"text/html;utf-8\">\n <link rel=\"stylesheet\" type=\"text/css\" href=\"../../static/style.css\">\n\n <body>\n <div id=\"wrapper\">\n<h1><a href=\"../cli/npm-install.html\">npm-install</a></h1> <p>Install a package</p>\n\n<h2 id=\"SYNOPSIS\">SYNOPSIS</h2>\n\n<pre><code>npm install (with no args in a package dir)\nnpm install &lt;tarball file&gt;\nnpm install &lt;tarball url&gt;\nnpm install &lt;folder&gt;\nnpm install &lt;name&gt; [--save|--save-dev|--save-optional]\nnpm install &lt;name&gt;@&lt;tag&gt;\nnpm install &lt;name&gt;@&lt;version&gt;\nnpm install &lt;name&gt;@&lt;version range&gt;\nnpm i (with any of the previous argument usage)</code></pre>\n\n<h2 id=\"DESCRIPTION\">DESCRIPTION</h2>\n\n<p>This command installs a package, and any packages that it depends on. ", "If the\npackage has a shrinkwrap file, the installation of dependencies will be driven\nby that. ", "See <a href=\"../cli/npm-shrinkwrap.html\">npm-shrinkwrap(1)</a>.</p>\n\n<p>A <code>package</code> is:</p>\n\n<ul><li>a) a folder containing a program described by a package.json file</li><li>b) a gzipped tarball containing (a)</li><li>c) a url that resolves to (b)</li><li>d) a <code>&lt;name&gt;@&lt;version&gt;</code> that is published on the registry with (c)</li><li>e) a <code>&lt;name&gt;@&lt;tag&gt;</code> that points to (d)</li><li>f) a <code>&lt;name&gt;</code> that has a &quot;latest&quot; tag satisfying (e)</li><li>g) a <code>&lt;git remote url&gt;</code> that resolves to (b)</li></ul>\n\n<p>Even if you never publish your package, you can still get a lot of\nbenefits of using npm if you just want to write a node program (a), and\nperhaps if you also want to be able to easily install it elsewhere\nafter packing it up into a tarball (b).</p>\n\n<ul><li><p><code>npm install</code> (in package directory, no arguments):</p><p>Install the dependencies in the local node_modules folder.</p><p>In global mode (ie, with <code>-g</code> or <code>--global</code> appended to the command),\nit installs the current package context (ie, the current working\ndirectory) as a global package.</p><p>By default, <code>npm install</code> will install all modules listed as\ndependencies. ", "With the <code>--production</code> flag,\nnpm will not install modules listed in <code>devDependencies</code>.</p></li><li><p><code>npm install &lt;folder&gt;</code>:</p><p>Install a package that is sitting in a folder on the filesystem.</p></li><li><p><code>npm install &lt;tarball file&gt;</code>:</p><p>Install a package that is sitting on the filesystem. ", " Note: if you just want\nto link a dev directory into your npm root, you can do this more easily by\nusing <code>npm link</code>.</p><p>Example:</p><pre><code> npm install ./package.tgz</code></pre></li><li><p><code>npm install &lt;tarball url&gt;</code>:</p><p>Fetch the tarball url, and then install it. ", " In order to distinguish between\nthis and other options, the argument must start with &quot;http://&quot; or &quot;https://&quot;</p><p>Example:</p><pre><code> npm install https://github.com/indexzero/forever/tarball/v0.5.6</code></pre></li><li><p><code>npm install &lt;name&gt; [--save|--save-dev|--save-optional]</code>:</p><p>Do a <code>&lt;name&gt;@&lt;tag&gt;</code> install, where <code>&lt;tag&gt;</code> is the &quot;tag&quot; config. (", "See\n<code><a href=\"../misc/npm-config.html\">npm-config(7)</a></code>.)</p><p>In most cases, this will install the latest version\nof the module published on npm.</p><p>Example:</p><p> npm install sax</p><p><code>npm install</code> takes 3 exclusive, optional flags which save or update\nthe package version in your main package.json:</p><ul><li><p><code>--save</code>: Package will appear in your <code>dependencies</code>.</p></li><li><p><code>--save-dev</code>: Package will appear in your <code>devDependencies</code>.</p></li><li><p><code>--save-optional</code>: Package will appear in your <code>optionalDependencies</code>.</p><p>Examples:</p><p> npm install sax --save\n npm install node-tap --save-dev\n npm install dtrace-provider --save-optional</p><p><strong>Note</strong>: If there is a file or folder named <code>&lt;name&gt;</code> in the current\nworking directory, then it will try to install that, and only try to\nfetch the package by name if it is not valid.</p></li></ul></li><li><p><code>npm install &lt;name&gt;@&lt;tag&gt;</code>:</p><p>Install the version of the package that is referenced by the specified tag.", "\nIf the tag does not exist in the registry data for that package, then this\nwill fail.</p><p>Example:</p><pre><code> npm install sax@latest</code></pre></li><li><p><code>npm install &lt;name&gt;@&lt;version&gt;</code>:</p><p>Install the specified version of the package. ", " This will fail if the version\nhas not been published to the registry.</p><p>Example:</p><pre><code> npm install sax@0.1.1</code></pre></li><li><p><code>npm install &lt;name&gt;@&lt;version range&gt;</code>:</p><p>Install a version of the package matching the specified version range. ", " This\nwill follow the same rules for resolving dependencies described in <code><a href=\"../files/package.json.html\">package.json(5)</a></code>.</p><p>Note that most version ranges must be put in quotes so that your shell will\ntreat it as a single argument.</p><p>Example:</p><p> npm install sax@&quot;&gt;=0.1.0 &lt;0.2.0&quot;</p></li><li><p><code>npm install &lt;git remote url&gt;</code>:</p><p>Install a package by cloning a git remote url. ", " The format of the git\nurl is:</p><p> &lt;protocol&gt;://[&lt;user&gt;@]&lt;hostname&gt;&lt;separator&gt;&lt;path&gt;[#&lt;commit-ish&gt;]</p><p><code>&lt;protocol&gt;</code> is one of <code>git</code>, <code>git+ssh</code>, <code>git+http</code>, or\n<code>git+https</code>. ", " If no <code>&lt;commit-ish&gt;</code> is specified, then <code>master</code> is\nused.</p><p>Examples:</p><pre><code> git+ssh://git@github.com:isaacs/npm.git#v1.0.27\n git+https://isaacs@github.com/isaacs/npm.git\n git://github.com/isaacs/npm.git#v1.0.27</code></pre></li></ul>\n\n<p>You may combine multiple arguments, and even multiple types of arguments.", "\nFor example:</p>\n\n<pre><code>npm install sax@&quot;&gt;=0.1.0 &lt;0.2.0&quot; bench supervisor</code></pre>\n\n<p>The <code>--tag</code> argument will apply to all of the specified install targets. ", "If a\ntag with the given name exists, the tagged version is preferred over newer\nversions.</p>\n\n<p>The <code>--force</code> argument will force npm to fetch remote resources even if a\nlocal copy exists on disk.</p>\n\n<pre><code>npm install sax --force</code></pre>\n\n<p>The <code>--global</code> argument will cause npm to install the package globally\nrather than locally. ", " See <code><a href=\"../files/npm-folders.html\">npm-folders(5)</a></code>.</p>\n\n<p>The <code>--link</code> argument will cause npm to link global installs into the\nlocal space in some cases.</p>\n\n<p>The <code>--no-bin-links</code> argument will prevent npm from creating symlinks for\nany binaries the package might contain.</p>\n\n<p>The <code>--no-optional</code> argument will prevent optional dependencies from\nbeing installed.</p>\n\n<p>The <code>--no-shrinkwrap</code> argument, which will ignore an available\nshrinkwrap file and use the package.json instead.</p>\n\n<p>The <code>--nodedir=/path/to/node/source</code> argument will allow npm to find the\nnode source code so that npm can compile native modules.</p>\n\n<p>See <code><a href=\"../misc/npm-config.html\">npm-config(7)</a></code>. ", " Many of the configuration params have some\neffect on installation, since that&#39;s most of what npm does.</p>\n\n<h2 id=\"ALGORITHM\">ALGORITHM</h2>\n\n<p>To install a package, npm uses the following algorithm:</p>\n\n<pre><code>install(where, what, family, ancestors)\nfetch what, unpack to &lt;where&gt;/node_modules/&lt;what&gt;\nfor each dep in what.dependencies\n resolve dep to precise version\nfor each dep@version in what.dependencies\n not in &lt;where&gt;/node_modules/&lt;what&gt;/node_modules/*\n and not in &lt;family&gt;\n add precise version deps to &lt;family&gt;\n install(&lt;where&gt;/node_modules/&lt;what&gt;, dep, family)</code></pre>\n\n<p>For this <code>package{dep}</code> structure: <code>A{B,C}, B{C}, C{D}</code>,\nthis algorithm produces:</p>\n\n<pre><code>A\n+-- B\n`-- C\n `-- D</code></pre>\n\n<p>That is, the dependency from B to C is satisfied by the fact that A\nalready caused C to be installed at a higher level.</p>\n\n<p>See <a href=\"../files/npm-folders.html\">npm-folders(5)</a> for a more detailed description of the specific\nfolder structures that npm creates.</p>\n\n<h3 id=\"Limitations-of-npm-s-Install-Algorithm\">Limitations of npm&#39;s Install Algorithm</h3>\n\n<p>There are some very rare and pathological edge-cases where a cycle can\ncause npm to try to install a never-ending tree of packages. ", " Here is\nthe simplest case:</p>\n\n<pre><code>A -&gt; B -&gt; A&#39; -&gt; B&#39; -&gt; A -&gt; B -&gt; A&#39; -&gt; B&#39; -&gt; A -&gt; ...</code></pre>\n\n<p>where <code>A</code> is some version of a package, and <code>A&#39;</code> is a different version\nof the same package. ", " Because <code>B</code> depends on a different version of <code>A</code>\nthan the one that is already in the tree, it must install a separate\ncopy. ", " The same is true of <code>A&#39;</code>, which must install <code>B&#39;</code>. ", " Because <code>B&#39;</code>\ndepends on the original version of <code>A</code>, which has been overridden, the\ncycle falls into infinite regress.</p>\n\n<p>To avoid this situation, npm flat-out refuses to install any\n<code>name@version</code> that is already present anywhere in the tree of package\nfolder ancestors. ", " A more correct, but more complex, solution would be\nto symlink the existing version into the new location. ", " If this ever\naffects a real use-case, it will be investigated.</p>\n\n<h2 id=\"SEE-ALSO\">SEE ALSO</h2>\n\n<ul><li><a href=\"../files/npm-folders.html\">npm-folders(5)</a></li><li><a href=\"../cli/npm-update.html\">npm-update(1)</a></li><li><a href=\"../cli/npm-link.html\">npm-link(1)</a></li><li><a href=\"../cli/npm-rebuild.html\">npm-rebuild(1)</a></li><li><a href=\"../misc/npm-scripts.html\">npm-scripts(7)</a></li><li><a href=\"../cli/npm-build.html\">npm-build(1)</a></li><li><a href=\"../cli/npm-config.html\">npm-config(1)</a></li><li><a href=\"../misc/npm-config.html\">npm-config(7)</a></li><li><a href=\"../files/npmrc.html\">npmrc(5)</a></li><li><a href=\"../misc/npm-registry.html\">npm-registry(7)</a></li><li><a href=\"../files/npm-folders.html\">npm-folders(5)</a></li><li><a href=\"../cli/npm-tag.html\">npm-tag(1)</a></li><li><a href=\"../cli/npm-rm.html\">npm-rm(1)</a></li><li><a href=\"../cli/npm-shrinkwrap.html\">npm-shrinkwrap(1)</a></li></ul>\n</div>\n<p id=\"footer\">npm-install &mdash; npm@1.3.24</p>\n<script>\n;(function () {\nvar wrapper = document.getElementById(\"wrapper\")\nvar els = Array.prototype.slice.call(wrapper.getElementsByTagName(\"*\"), 0)\n .filter(function (el) {\n return el.parentNode === wrapper\n && el.tagName.match(/H[1-6]/)\n && el.id\n })\nvar l = 2\n , toc = document.createElement(\"ul\")\ntoc.innerHTML = els.map(function (el) {\n var i = el.tagName.charAt(1)\n , out = \"\"\n while (i > l) {\n out += \"<ul>\"\n l ++\n }\n while (i < l) {\n out += \"</ul>\"\n l --\n }\n out += \"<li><a href='#\" + el.id + \"'>\" +\n ( el.innerText || el.text || el.innerHTML)\n + \"</a>\"\n return out\n}).join(\"\\n\")\ntoc.id = \"toc\"\ndocument.body.appendChild(toc)\n})()\n</script>\n" ]

{ "pile_set_name": "Github" }

[ 0.006595523562282324, 0.0009980415925383568, 0.0007296996773220599, 0.001213975832797587, 0.0009694157051853836, 0.0009760462562553585, 0.0013041830388829112, 0.0012695584446191788, 0.0008964292355813086, 0.0010661071864888072, 0.0009285993874073029, 0.0011405282421037555, 0.00099141092505306, 0.0009178908658213913, 0.0007778676808811724, 0.0009600080084055662, 0.000846876238938421, 0.0010653837816789746, 0.0006657404010184109, 0.0008024428971111774, 0.0007399109308607876, 0.0006318435771390796, 0.0012944975169375539 ]

[ "From the November 2007 Issue of Car and Driver\n\nIn 1976, using mostly third gear, Brock Yates drove a Corvette 1138 miles along the Alaska Highway, nearly all of it gravel and mud. ", "It wasn't easy. ", "Back then, Corvettes were primitive and enjoyed all the build quality of Chinese gardening equipment. ", "Before Yates set out, a GM engineer confessed to him, \"Let's face it, the Corvette is three feet too long and 800 pounds too heavy....the seats are awful and the rear suspension does weird things. ", "But within the next two years, you're going to see a serious effort to make the car better.\"", "\n\nIt took longer than two years, but somewhere along the fiberglass path of its evolution, the Corvette became not only one of the world's finest sports cars but also, well, a real car.", "\n\nThirty-one years after Yates's expedition, we likewise vowed to nose a Vette into the northernmost neck of Canada's woods. ", "Thing is, the Alaska Highway is nowadays not only paved but also clogged with tourists eating Ritz crackers inside sparkling quarter-million-dollar Prevosts towing Hummer H3s. ", "There exists, however, a little-known gravel detour off Yates's route that pokes due north. ", "In '76, Yates called his story \"Northwest Passage,\" and now we were proposing to drive almost to the real Northwest Passage (see map). ", "The road is called the Dempster Highway, and it runs through Canada's Yukon and Northwest territories, never entering the U.S. It's as rough, lumpy, unpredictable, perverse, and unfinished as Yates's 1976 L48.", "\n\nBrock called his car the Yukon Corvette. ", "We would call ours the Dempster Corvette. ", "Brock traveled with then art director Jim Williams. ", "I would travel with current art director Jeff Dworin. ", "Brock's car was plucked right out of the Corvette Group's engineering fleet in Milford, Michigan, and sported a plexiglass roof. ", "So would ours. ", "Brock's Corvette churned out a thundering 180 horsepower.", "\n\nScrew that.", "\n\nTo their credit, the Corvette guys immediately grasped the alluringly goofy notion of a Yukon redux and selected a famous car for the undertaking—the 61st C6 to emerge from the Bowling Green factory, built in 2005 as a \"manufacturing validation build.\" ", "It was originally fitted with a four-speed automatic and a 400-horse LS2 and served a brutal existence as a suspension-development vehicle—known in the vernacular as a mule. ", "Other drivelines came and went until 2006, when the car was fitted with a six-speed automatic and the current 430-horse LS3, in which guise it was used to calibrate the latest C6.5's traction- and stability-control systems.", "\n\nThroughout its life, our Corvette turned untold laps at Virginia International Raceway, Homestead-Miami Speedway, Moroso Motorsports Park, and Roebling Road Raceway, and then endured a European swing, laying down Goodyear rubber at the Nürburgring, the Ring's Nordschleife, Spa-Francorchamps, and on the autobahn. ", "Behind its wheel sat a slew of talented drivers, including pro racer Ron Fellows, the only name our Canadian onlookers recognized. ", "No one knew the car's true mileage. ", "With each new driveline, its odometer was zeroed.", "\n\nOnce this C6's jet-setting life concluded, it endured further abuse during cold-weather testing in Michigan's Upper Peninsula, then was parked for indecent periods within GM's climatic wind tunnel, where it was alternately frozen and baked. ", "At which point, alas, the Precision Red C6—a prototype that, like all mules, could not be sold—had a date with the crusher.", "\n\nThat's when we came along, promising to give the old girl one last fling, an adventure sure to inflict the sort of pits and pockmarks that would alarm even Manuel Noriega. ", "GM's engineers had grown fond of ol' Number 61, and if we managed to nurse it up and down the Dempster intact, they vowed to induct it into the National Corvette Museum in Bowling Green. ", "Like a dog unexpectedly adopted from the pound, our C6 narrowly escaped euthanasia.", "\n\nView Photos JEFFREY DWORIN\n\nWhen the car arrived, we made a few modifications. ", "We raised the ride height 0.75 inch; fabricated a roof rack to hold one spare front tire and two five-gallon jugs of premium unleaded; created plexiglass stone deflectors for the windshield; installed a brush guard that might or might not survive a tête-à-tête with a caribou; fitted a bra; mounted a pair of zillion-candlepower auxiliary lights that, by law, must be blazing full time on the Dempster, even during 23 hours of daily sunlight; and painted the wheels black to camouflage the hideous scars they were about to incur. ", "But the stock Goodyear Eagle F1s—18 inches fore, 19 inches aft—stayed put. ", "No pansy M+S-rated rubber for us, because, well, we like a challenge and no one would give us a free set. ", "Via DHL, we did ship a spare rear tire to the Yukon, where we could collect it prior to our Dempster diving. ", "We never saw that tire again. ", "Ever.", "\n\nNot knowing what we intended for this Corvette, civilian enthusiasts were outraged that we'd so casually defaced an American icon. ", "The luggage rack, they told us, was particularly loathsome. ", "We pointed to the Nürburgring sticker on the rear hatch, but they weren't appeased. ", "A gas-station attendant in Watson Lake, Yukon Territory, snarled, \"What's that supposed to be?\"", "\n\nI wasn't sure what he meant. \"", "It's a Corvette,\" I said, thinking maybe he'd never seen one, which was true of a dozen or so Yukonners we'd already met.", "\n\n\"No,\" he said. \"", "What I mean is, you think you're goin' off-road with that?\" ", "Then he spit on the floor behind the cash register.", "\n\n\"I live in Michigan,\" I said, trying to prove I wasn't a city slicker. \"", "I've been off-roading a lot. ", "We're going up the Dempster.\"", "\n\n\"Got news for you, pal,\" he replied. \"", "First, you ain't in Michigan anymore, eh? ", "Second, that whatchamacallit ain't goin' up no Dempster, 'less it's on the back of a flatbed.\"", "\n\nIn the Yukon, we were cheechakos, the Chilkoot word for greenhorns. ", "Or it might mean cheesecake. ", "Either way, that's what we were.", "\n\nLike our Corvette, the Dempster proved to be an admirable feat of engineering. ", "The C6's odometer logged 484 miles from Dawson City (one-time residence to writers Jack London, Robert Service, and Pierre Berton) to Inuvik, the highway's northern terminus in the Northwest Territories. ", "That's 968 miles up and back, every inch an NVH engineer's worst nightmare. ", "The Dempster perches atop permafrost, so the gravel surface had to be four to eight feet thick. ", "Without that insulation, the permafrost would melt, and the road, as it sank, would turn into something closely resembling gray tapioca. ", "Along the Dempster, the frost doesn't just heave. ", "It pukes.", "\n\nConstruction began in 1959, when politicians called it the Road to Resources. ", "Locals joked that it was more like the Road to Remorses, and isolated construction workers called it the Road to Divorces. ", "The highway was opened to the public in 1979. ", "It was Canada's first all-weather byway across the Arctic, intended to service limitless oil and mineral fields that turned out to be not so limitless. ", "The road roughly follows a hunting trail devised eons ago by the local Gwitchin Indians and thus should have been called the Gwitchin Highway. ", "Instead, it was named after Sgt. ", "W.J.D. Dempster, who earned hero status for attempting to rescue four fellow RCMP officers, who, in 1911, had the bad luck to simultaneously freeze and starve to death about three-quarters of the way up the trail. ", "In Inuvik, which cleverly means \"place of people,\" the mercury has been known to dip to minus-70 degrees Fahrenheit. ", "Our Corvette's winter-proofing didn't extend that far.", "\n\nThe Dempster spans two mountain ranges, the Arctic Circle, the Continental Divide (which it crosses three times), and the Peel and Mackenzie rivers, both of which must be forded via ferries cutting through five-foot waves whose temperature rarely surpasses 40 degrees. ", "You think Minnesota is the land of \"10,000 Lakes\"? ", "The Mackenzie Delta is exceeded in size in the Western Hemisphere only by the Mississippi and Amazon deltas, and it encompasses 25,000 lakes.", "\n\nThe vegetation is mostly taiga forest, comprising stunted subalpine firs and skinny black spruces, although in many sections the tallest and oldest \"trees\" are willow and berry bushes. ", "Where the permafrost has gone to goo, the trees lean at comical angles. ", "The locals call them \"drunken forests.\" ", "Beyond Inuvik, a town only 60 miles shy of the Arctic Ocean, there's just tundra—no trees at all, although there's still plenty of drunkenness.", "\n\nThe Dempster is also a highway for caribous, grizzly bears, Dall sheep, mountain goats, moose, wolves, wolverines, lynxes, several varieties of foxes, arctic hares, and 160 species of birds, among them willow ptarmigans, whose first response to the danger posed by an onrushing red Corvette was to sit down in a huff.", "\n\nPtarmigan: \"Listen, no kidding, you get one foot closer, and I will sit. ", "I'm warning you. ", "Don't tempt me. ", "I swear I'll do it, and then you'll be sorry.\" ", "And then they'd sit.", "\n\nThe road is 24 feet wide, except where swirling creeks have eroded it to half that width, and it alternates between loose gravel, dense shale, clay, impacted flint, chert, granite, and slushlike mud offering all the grip of an Exxon oil spill on the 405 freeway. ", "It's the immovable flint and chert, poking skyward like individual daggers, that slice tires as if they were ripe tomatoes. ", "Those spooky portions of the road—which I began to call the \"white sharks\" because they were chalky white and murderously serrated—must be traversed at 20 mph. ", "Or less. ", "Doesn't matter whether you're in a Corvette or a Land Cruiser. ", "You slow to a crawl. ", "Dempster veterans warn that if you lose a tire and are down to no spares, you turn back. ", "We were carrying one spare—a front—and were told it might send the traction control into an electronic snit if we had to mount it on the rear. ", "We couldn't afford to annoy the traction control, which was assisting our forward progress about three times per minute, especially in the eight-inch gravel windrows that the graders kept leaving behind and that dislocated the Corvette's bra and bent its chin spoiler completely back on itself at least six times.", "\n\n\n\nView Photos JEFFREY DWORIN\n\nThere's more to driving a Corvette on the Dempster than meets the eye. ", "That's because your eyes aren't scanning the scenic wonders all around but instead are focused on erratics (lone boulders that have worked their way to the surface and, once launched into a fiberglass wheel well, sound like bazooka blasts); lateral drainage ruts capable of bending alloy wheels; blinding dust; fine pebbles that could easily double for precision ball bearings; half-ton Bullwinkles standing inert mid-road; and an infinite number of potholes filled with water. ", "Some were an inch deep, some were deep enough to harbor a small school of barracuda. ", "No way to tell, so we had to steer around every one of them. ", "Like a sprint-car driver, I found myself seeking out the wettest and darkest patches of road, which were reliably the smoothest. ", "On those sections, I could sometimes rocket up to 40 mph, thus making use of maybe 35 of the 430 horses on tap. ", "It was the only time I've been in a Corvette and was positive I wasn't going to get a speeding ticket.", "\n\nOncoming traffic was sparse and reliably polite. ", "Dempster protocol insists you slow to avoid flinging stones at cars traveling the opposite direction, a courtesy underscored by a sign that warns, \"NO MEDICAL SERVICES NEXT 734 KM.\" ", "Not far from that, however, was a sign that seemed to encourage recklessness. ", "It said, \"AVALANCHE AREA, DO NOT STOP.\" ", "I put the hammer down, wantonly blasting up to 43 mph.", "\n\nAlong the Dempster, the landscape is exactly as it was 10,000 years ago, which is even before Yates's Corvette was built. ", "No structures, nothing rearranged to suit developers, no signs of human molestation save the occasional shredded tire. ", "Strangely, glaciers never touched this region. ", "Its topography was shaped entirely by water, wind, frost, and gravity. ", "In many places, it looks like northern Scotland.", "\n\nHalfway along the Dempster's length are two buildings where—not by choice—every motorist must stop. ", "It's an outpost called Eagle Plains, perched not on a plain but atop a narrow 2360-foot-high ridge. ", "This establishment bills itself as \"an oasis in the wilderness.\" ", "The wilderness part is true. ", "But Eagle Plains is otherwise a filthy gas station adjoining 32 dingy corrugated-metal motel rooms that smell like the two dogs that live in the cafeteria and the saloon at the end of the hall. ", "Eagle Plains's lone nod to culture is a hand-carved bar with a plaque that boasts, \"Constructed in Whitehorse in 1930 and in continuous use ever since.\" ", "For good reason.", "\n\nWith nothing to do after eating Eagle Plains's \"Arctic Burgers,\" Dworin and I sauntered outside to watch a helicopter take off into a pelting, 43-degree rainstorm. ", "It achieved an altitude of 50 feet, yawed to the right, dipped dramatically at the nose, then veered directly at us before making a hard belly-flop of a landing a few feet from a tandem-tanker fuel truck.", "\n\n\"Why didn't you run?\" ", "Dworin asked.", "\n\n\"I was hoping you'd run first,\" I said.", "\n\nOur hotel in Inuvik (population 3481) at the northern tip of the Dempster smelled far better and was surgically clean. ", "It did, however, lack one amenity: electricity. ", "In the morning, there was frost on the Corvette's glass—this in mid-August—so we ate more jerky and headed south.", "\n\nAt one point on the return leg, I was driving tentatively in the oncoming lane to avoid gravel so deep and loose that it threatened to swamp the Corvette. ", "As I rounded a corner, I was alarmed to see an 18-wheeler charging toward us. ", "Without hesitation and without slowing, the trucker deftly moved into the deep gravel, giving me a little wave as we passed, both of us humping along in the other's legal lane—a generous gesture you'd not likely enjoy on more southerly roads. ", "As Yates put it 31 years ago, the truckers \"operate with the kind of intelligent abandon that comes with the knowledge that they will pay for their own mistakes.\"", "\n\nIn the end, incredibly, the Corvette emerged from the Dempster a festival of filth but mechanically unfazed, rolling proudly into Dawson City in time for Jell-O wrestling at a local bar, in time for a gay-pride parade featuring \"dykes on bikes,\" and in time for a sidewalk-performing border collie named Becca who held sticks on her nose, tossed them into the air, then caught them on the rebound.", "\n\n\n\nView Photos JEFFREY DWORIN\n\nOur fiberglass boulevardier performed an even slicker trick. ", "It suffered no flat tires—either a divine miracle or a fortuitous side effect of its OE run-flats, whose sidewalls are stiff enough to be used in bridge construction. ", "We did crack the windshield and broke the bulbs in the front turn signals. ", "Along the doorsills, flying stones had blasted portions of the paint right down to bare 'glass. ", "And the shocks felt a little rubbery, although they held their own during the 4000-mile trek back to Ann Arbor.", "\n\nOur fiberglass boulevardier performed an even slicker trick. ", "It suffered no flat tires—either a divine miracle or a fortuitous side effect of its OE run-flats, whose sidewalls are stiff enough to be used in bridge construction. ", "We did crack the windshield and broke the bulbs in the front turn signals. ", "Along the doorsills, flying stones had blasted portions of the paint right down to bare 'glass. ", "And the shocks felt a little rubbery, although they held their own during the 4000-mile trek back to Ann Arbor.", "\n\nOur only headache was 20 or so pounds of mud that had accumulated in the inner wheels. ", "It was as hard as concrete and had created the sort of imbalance you'd expect of Gary Busey during Oktoberfest. ", "Twenty-five bucks spent at a manual carwash pretty much cured the wobbles, although that particular outfit's drains might never be the same.", "\n\nThis content is created and maintained by a third party, and imported onto this page to help users provide their email addresses. ", "You may be able to find more information about this and similar content at piano.io" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0006470140069723129, 0.001198610058054328, 0.0007258654222823679, 0.0025480494368821383, 0.0006105859065428376, 0.0006685048574581742, 0.0034747598692774773, 0.02247791923582554, 0.0006775702931918204, 0.000617322395555675, 0.0007219207473099232, 0.001056831912137568, 0.001743387896567583, 0.000641494698356837, 0.0005771483411081135, 0.0007001243648119271, 0.001355871558189392, 0.0029139413964003325, 0.8673619031906128, 0.0006066776695661247, 0.0011655743001028895, 0.0006687434506602585, 0.0006066270871087909, 0.000992274610325694, 0.0008749615517444909, 0.001473420881666243, 0.0006868256605230272, 0.0022847207728773355, 0.0024363757111132145, 0.0006141139310784638, 0.0013902003411203623, 0.0005830833688378334, 0.0011053523048758507, 0.0012262365780770779, 0.005007871892303228, 0.0006688031135126948, 0.0009396685054525733, 0.003299212548881769, 0.0008454383350908756, 0.010933944024145603, 0.0009244071552529931, 0.0006079773884266615, 0.000640439335256815, 0.0006285353447310627, 0.0008688771049492061, 0.0011547704925760627, 0.433355450630188, 0.0016710779163986444, 0.001015156856738031, 0.0015272748423740268, 0.0007794481352902949, 0.003576556919142604, 0.004691095091402531, 0.003990490455180407, 0.0007265962776727974, 0.0008540521375834942, 0.0006704319384880364, 0.0006354146753437817, 0.08041541278362274, 0.001311893342062831, 0.0018069304060190916, 0.001499584293924272, 0.9527435898780823, 0.0005695120780728757, 0.0014125198358669877, 0.0005668814410455525, 0.0007041891803964972, 0.0007144194096326828, 0.0006425446481443942, 0.05923984944820404, 0.0007714086095802486, 0.0007391896215267479, 0.000612676958553493, 0.0013935633469372988, 0.0005918079405091703, 0.0009542247280478477, 0.0013480648631229997, 0.005732972174882889, 0.0011578458361327648, 0.010881476104259491, 0.002848071279004216, 0.08478187769651413, 0.1640394628047943, 0.003207150613889098, 0.0011315548326820135, 0.0008140013087540865, 0.014751291833817959, 0.0025757341645658016, 0.0009866501204669476, 0.01254877820611, 0.4282154142856598, 0.007777135353535414, 0.0010305920150130987, 0.0011800099164247513, 0.0008382309461012483, 0.0008402633829973638, 0.0024718139320611954, 0.0006956708966754377, 0.0015572402626276016, 0.0005864006234332919, 0.0007297167321667075, 0.0008643384207971394, 0.001449116156436503, 0.0011017696233466268, 0.0008532237261533737, 0.0012235210742801428, 0.0006327170412987471, 0.0008219577721320093, 0.0006704070256091654, 0.0006086200592108071, 0.0006530953105539083, 0.001170656061731279, 0.0006885516340844333, 0.0006140375626273453, 0.0006989000830799341, 0.10299950838088989, 0.0005795103497803211, 0.0007096470217220485, 0.002307263435795903, 0.0010657254606485367, 0.0066561028361320496, 0.0012326240539550781, 0.005739613436162472, 0.0007630530162714422, 0.0006745170103386045, 0.012226155027747154, 0.0009857052937150002, 0.0014878616202622652, 0.0010215718066319823, 0.004541817121207714, 0.010109174996614456, 0.0010673535289242864, 0.0009166241507045925, 0.0008580052526667714, 0.0007720061694271863, 0.0006854684907011688, 0.001083933049812913, 0.0009166241507045925, 0.0008580052526667714, 0.0007720061694271863, 0.0006854684907011688, 0.00597955659031868, 0.0012176022864878178, 0.0009764498099684715, 0.0006096833967603743, 0.000534687249455601 ]

[ "As a software services company, we understand how important customer service is when working with clients. ", "I'm happy to see Aspose shares this value with us. ", "Aspose.", "Cells is an excellent tool, has a significant speed advantage over VBA.Paul Katz | Intersoft, USA" ]

{ "pile_set_name": "OpenWebText2" }

[ 0.0005651574465446174, 0.0005179145373404026, 0.0006988794193603098, 0.000587746559176594 ]

[ "Pages\n\nScarred Heart - (a special pre-valentine story)\n\nFebruary 01, 2008\n\nThe more hurt and pain you have gone through life, the stronger and more beautiful your heart will become.....\n\nOne day a young man was standing in the middle of the town proclaiming that he had the most beautiful heart in the whole valley. ", "A large crowd gathered and they all admired his heart for it was perfect. ", "There was not a mark or a flaw in it. ", "Yes, they all agreed it truly was the most beautiful heart they had ever seen. ", "The young man was very proud and boasted more loudly about his beautiful heart.", "\n\nSuddenly, an old man appeared at the front of the crowd and said, \"Why your heart is not nearly as beautiful as mine.\" ", "The crowd and the young man looked at the old man's heart. ", "It was beating strongly, but full of scars, it had places where pieces had been removed and other pieces put in, but they didn't fit quite right and there were several jagged edges. ", "In fact, in some places there were deep gouges where whole pieces missing.", "\n\nThe people stared. ", "How can he say his heart is more beautiful?? ", "they thought. ", "The young man looked at the old man's heart and saw its state and laughed. \"", "You must be joking,\" he said. \"", "Compare your heart with mine, mine is perfect and yours is a mess of scars and tears.\"", "\n\n\"Yes,\" said the old man, \"Yours is perfect looking but I would never trade with you. ", "You see, every scar represents a person to whom I have given my love - I tear out a piece of my heart and give it to them, and often they give me a piece of their heart which fits into the empty place in my heart, but because the pieces aren't exact, I have some rough edges, which I cherish, because they remind me of the love we shared. ", "Sometimes I have given pieces of my heart away, and the other person hasn't returned a piece of his heart to me. ", "These are the empty gouges - giving love is taking a chance. ", "Although these gouges are painful, they stay open, reminding me of the love I have for these people too, and I hope someday they may return and fill the space I have waiting. ", "So now do you see what true beauty is?\"", "\n\nThe young man stood silently with tears running down his cheeks. ", "He walked up to the old man, reached into his perfect young and beautiful heart, and ripped a piece out. ", "He offered it to the old man with trembling hands.", "\n\nThe old man took his offering, placed it in his heart and then took a piece from his old scarred heart and placed it in the wound in the young man's heart. ", "It fit, but not perfectly, as there were some jagged edges.", "\n\nThe young man looked at his heart, not perfect anymore but more beautiful than ever, since love from the old man's heart flowed into his.", "\n\n*************\n\nI wanna address this story to a very dear friend of mine who had been battling against the toughest test of time. ", "Please be strong...take courage and keep holding on to your faith. ", "Everyone loves you!", "\n\n7\ncomments\n\nThanks for visiting my blog and leaving a comment. ", "You couldn't find a Shoutbox cuz I don't have one yet.", "What a great story you posted! ", "As an old man with a heart that isn't perfect, I understand it completely :)Have a great weekend!" ]

{ "pile_set_name": "Pile-CC" }

[ 0.00643117306753993, 0.0005672959960065782, 0.0008835091139189899, 0.0005717828753404319, 0.0005252405535429716, 0.002506095916032791, 0.0008258757879957557, 0.0006047555361874402, 0.0012945332564413548, 0.0006979134050197899, 0.000686700688675046, 0.0007365787751041353, 0.0006689120782539248, 0.001123377587646246, 0.20212823152542114, 0.0039411382749676704, 0.0015387762105092406, 0.000769547768868506, 0.028370553627610207, 0.0009220567299053073, 0.000909402035176754, 0.007726890500634909, 0.004414929077029228, 0.0006765787838958204, 0.0007877533789724112, 0.0006268934812396765, 0.0007775797275826335, 0.0012134832795709372, 0.0005620867596007884, 0.001432226155884564, 0.0005610531661659479, 0.003848756430670619, 0.0010553272441029549, 0.0046707079745829105 ]

[ "Q:\n\nHow to override erb with liquid?", "\n\nI've added a theming directory to my app as described here, using prepend_view_path. ", "It works as expected. ", "I can now add a view structure in my app under app/themes/my_theme/views\nNow, I want to be able to override erb templates by dropping in a \n.liquid file, which will render right off the controller action.", "\nFor example, I want to override app/views/pages/home.html.erb:\n<h1><%= t 'it_works' %></h1>\n\n...with app/themes/my_theme/views/pages/home.liquid\n<h1>It works with {{ \"liquid\" }}</h1>\n\nI don't want to have to specify an array of view paths (upkeep would be awful), but just add .liquid as a layer to the templating engine. ", "Maybe, however, have a blacklist of protected views that cannot be overridden (such as app/views/admin/*)\n\nA:\n\nDo you have a liquid template handler? ", "Otherwise Rails won't know what you want to do with .liquid files. ", "See this blog post: http://royvandermeij.com/blog/2011/09/21/create-a-liquid-handler-for-rails-3-dot-1/\nFor your second question: not using a theme for app/views/admin/* you should make sure you have an AdminController that does not prepend_view_path.", "\n\n" ]

{ "pile_set_name": "StackExchange" }

[ 0.0008300751214846969, 0.0006270260782912374, 0.0006306965369731188, 0.0005665297503583133, 0.0007029500557109714, 0.0007414952269755304, 0.0007674598600715399, 0.0006482098251581192, 0.001995444530621171 ]

[ "Image copyright Instagram Image caption Ms Gay was hit during an exchange of fire between two cars\n\nFormer world champion sprinter Tyson Gay's 15-year-old daughter has been killed in a shooting in the US state of Kentucky, police say.", "\n\nPolice in Lexington said Trinity Gay was hit in the neck during an exchange of fire between two vehicles in a restaurant car park.", "\n\nShe was taken to hospital where she later died, local media reported.", "\n\nMr Gay, who is from Lexington, confirmed her death to local TV station Lex 18.", "\n\n\"She didn't make it. ", "I'm so confused. ", "She was just here last week for fall break. ", "It's so crazy. ", "I have no idea what happened,\" Lex18 quoted him as saying.", "\n\nImage copyright AFP/getty Image caption Mr Gay represented the US at the Rio Olympics\n\nMr Gay is the US 100m record holder and is the joint second-fastest 100m runner of all time, behind Usain Bolt.", "\n\nThe US track and field athletics team tweeted its condolences, sending \"thoughts and prayers\" to Mr Gay and his loved ones \"as they mourn the tragic & senseless loss of his daughter, Trinity\".", "\n\nMr Gay's daughter was also an athlete and competed for Lafayette High School, where she was studying.", "\n\n\"Our hearts are broken this morning over the loss of Trinity to this tragic and senseless act of violence,\" Fayette County School Superintendent Manny Caulk told the Lexington Herald-Leader newspaper.", "\n\n\"A life of such potential cut so tragically short,\" tweeted Julian Tackett, commissioner of the Kentucky High School Athletics Association.", "\n\nOther athletes also tweeted their condolences.", "\n\nImage copyright @B1GHomie\n\nImage copyright @LaurynCwilliams\n\nImage copyright @AtoBoldon\n\nPolice have launched a murder investigation into the shooting, which happened at about 0400 local time (0800 GMT) outside the Cook Out restaurant in the city, Lexington police said in a statement.", "\n\nWitnesses reported an exchange of gunfire between two vehicles, a grey Dodge Charger and a dark-coloured sports car with tinted windows.", "\n\nMs Gay - who is not thought to have been in any of the vehicles - was taken to University of Kentucky hospital in a private car.", "\n\nOfficers located the Dodge Charger and detained two people for questioning but were still searching for the other vehicle, police said.", "\n\nTyson Gay was part of the US 100m relay team at the Rio Olympics.", "\n\nIn 2013 he tested positive for a banned substance and was banned from competition for a year." ]

{ "pile_set_name": "OpenWebText2" }

[ 0.032550148665905, 0.0539240725338459, 0.010608543641865253, 0.20923975110054016, 0.0012589481193572283, 0.0007832007249817252, 0.000721787684597075, 0.06911676377058029, 0.0006522107869386673, 0.08740724623203278, 0.0055838534608483315, 0.0437767393887043, 0.0007421396439895034, 0.000889876508153975, 0.0006471746019087732, 0.0007507702684961259, 0.0006689073052257299, 0.0392049215734005, 0.0006867913180030882, 0.25432902574539185, 0.0009804313303902745 ]