article
stringlengths 77
232k
⌀ | abstract
stringlengths 212
2.72k
| section_names
stringlengths 1
1.13k
⌀ |
|---|---|---|
multiple studies have demonstrated that neural plasticity can change the structure and function of the central nervous system after structural brain damage and rehabilitation ( chen et al . , 2010 ; hosp and luft , 2011 ) .
an important mechanism is the adaptation of the anatomical and functional connectivities between brain areas .
one approach for examining connectivity between brain regions within a network involves quantifying temporal correlation in the blood oxygen level - dependent ( bold ) signal while the brain is in a resting state ( cabral et al . , 2014 ) .
multiple studies have demonstrated that resting - state functional connectivity is correlated with behavioral output in multiple domains , particularly in the motor system ( albert et al . , 2009 ) .
studies of motor impairments after stroke have demonstrated disrupted connectivity within the motor network ( golestani et al . , 2013 ; yin et al . , 2012 ) .
the strength of this disrupted connectivity has been shown to correlate with the clinical outcomes of patients ( yin et al . , 2012 ) .
the main factors responsible are the effects of structural brain damage itself ( urban et al . , 2012 ) , as well as the effects of deafferentation and deefferentation ( werhahn et al . , 2002 ) .
because most studies analyzing cortical plasticity after loss of function are conducted in patients suffering from brain damage ( e.g. , stroke ) , apportionment can be difficult .
some studies have circumvented this problem by investigating connectivity changes caused by impairment of peripheral nerves or limb amputation ( qiu et al . , 2014 ) .
however , there are no peripheral pure motor nerves , and therefore , these studies have investigated the combined effect of deafferentation and deefferentation on cortical plasticity . at this time
the palsy is a transient , unilateral deefferentation of facial muscles , typically of unknown cause ( perhaps viral ) and resolving within about 6 months .
because efferent activity to facial muscles is carried by the affected facial nerve , whereas somatosensory afference is carried by the trigeminal nerve , the palsy does not affect facial reafference . as we show
, bell 's palsy brings into play central nervous system network dynamics pertaining to a pure deefferentation that may illuminate motor systems more generally .
we hypothesize that the sensory - motor mismatch alone ( without a structural brain lesion ) is a sufficient stimulus for adaptation within the facial brain network .
particularly , we investigate whether such a sensory - motor mismatch is a sufficient stimulus for motor adaptation during rest or whether the brain will simply adapt to the current state of the ( impaired ) sensory - motor information .
we tested this hypothesis in the present study , employing functional magnetic resonance imaging ( fmri ) and connectivity analyses in the acute stage of bell 's palsy .
the study population was comprised of 30 patients with bell 's palsy ( age 40.9 16.9 years ranging from 21 to 71 , 17 male , 14 female , 15 right sided facial palsies ) , who were recruited from the neurology and otorhinolaryngology departments , and 31 age- and gender- matched healthy controls .
right- and left sided facial palsies were investigated in this study together in a balanced design ( 15 left , 15 right sided palsies ) to avoid hemispheric specific effects . only patients with idiopathic facial nerve palsies without any previous history of neurological disorder were included .
the subjects underwent magnetic resonance scans between 2 and 5 days after the onset of their symptoms .
handedness was assessed by the edinburgh inventory ( oldfield , 1971 ) , which ranges from 100 for strong left - handedness to + 100 for strong right - handedness . only right - handed ( > + 79 ) patients were included .
the study was approved by the local ethics committee , and all patients gave their written informed consent according to the declaration of helsinki .
although a variety of scoring systems for the clinical assessment of the severity of peripheral facial nerve palsy are available , the stennert grading system , which is one of the most widely applied , was selected for use in this study ( stennert et al . , 1977 ) .
the scale assesses the severity of facial palsy at rest and during voluntary facial movements .
this score ranges from 0/0 , representing normal facial function , to 4/6 , which represents gross facial asymmetry at rest ( first value ) and complete paralysis ( second value ) .
subjects were instructed to move the left or right mouth angle up , then relax their facial muscles to regain the starting position .
these motor tasks were performed with a frequency of 1 hz for 30.6 s , followed by a 30.6 s rest .
the movement effort should be equal on both sides of the face , even if it elicited marginal or no movement on the paretic side .
the paradigm during the mri measurement consisted of 10 blocks ( five times the motor task of the left and five times of the right corner of the mouth ) in a pseudo - randomized order , which were visually directed .
all examinations were performed on the same 3.0 tesla mr scanner ( trio , siemens , erlangen , germany ) to obtain echo - planar t2 * -weighted image volumes ( epi ) and transaxial t1-weighted structural images .
the patient was instructed to lie down with the eyes closed , to think of nothing in particular , and not fall asleep .
a functional image volume was composed of 44 transaxial slices , including the whole cerebrum and cerebellum ( voxel size = 3 3 3 mm , repetition time = 2.52 s , te 35 ms ) .
the motor task was performed after the resting state scan , during which 255 images ( voxel size = 3 3 3 mm , repetition time = 2.52 s , te 35 ms ) were acquired .
after functional measurement , high - resolution t1-weighted structural images ( voxel size = 1 1 1 mm ) were acquired . to make patients with right - sided palsy and their age and gender matched healthy control subject comparable to left - sided ones ,
all their images were flipped along the y - axis prior to analysis . for each subject , all images were realigned to the first volume using a six - parameter rigid - body transformation that corrected for motion artifacts .
the images were co - registered with the subject 's corresponding anatomical ( t1-weighted ) images , re - sliced to correct for acquisition delays , normalized to the montreal neurological institute ( mni ) standard brain ( evans et al . , 1993 ) to report mni coordinates , and smoothed using a 6-mm full - width - at - half - maximum gaussian kernel .
a multiple regression analysis using a general linear model was performed to obtain statistical parametric maps calculated for all three conditions ( tongue and right / left sided facial movement ) .
functional mri signal time courses were high - pass filtered ( 128 s ) and modeled as an experimental stimulus onset function , convolved by the canonical hemodynamic response function ( low - pass filter ) .
individual results were projected onto the co - registered individual high - resolution t1-weighted 3-d data set .
the anatomical localization of activations was analyzed with reference to the standard stereotaxic atlas and by visual inspection of the individual t1-weighted structural data .
the resulting statistical maps were thresholded by the family - wise error ( fwe ; p < 0.05 ) . in the present study , functional connectivity
is examined in the resting state , where temporal correlations of low frequency ( < 0.1 hz ) blood oxygenation level dependent ( bold ) fmri signal fluctuations ( biswal et al . , 1995 ; friston et al . ,
1993 ) are presumed to relate to neural activity and reflect information transfer and collaboration between brain areas ( biswal et al . , 1995 ; greicius et al . ,
2003 ) . while most studies analyzed the functional connectivity during rest in this frequency range
there are also methods to investigate the connectedness between brain areas in other frequency ranges .
particularly , the estimation of the causal influence that one brain area exerts over another ( effective connectivity ) requires higher frequencies and is usually estimated during a task or the modulation of a task .
changes in functional connectivity within the facial motor network were investigated in the resting state . to identify relevant areas of the facial motor network relevant for connectivity analysis
the point of maximum activation strength , along with its 26 neighbors , was selected from each activated region , and these were further used as regions of interest ( rois ) .
the resting state data from these identified rois were extracted , and cluster - specific time series were estimated by averaging the time series of all voxels within a cluster .
several sources of variance were then removed from the data by linear regression as follows : ( 1 ) six parameters obtained by rigid body correction of head motion , ( 2 ) the signal from a ventricular roi and ( 3 ) the signal from a region centered in the white matter .
all signal intensity time courses were bandpass filtered ( 0.01 < f < 0.1 ) to reduce the effect of low - frequency drift and high - frequency noise
the spatial locations of these rois were determined using the clusters activated during the motor task in the random effect fmri analysis .
to estimate the global connectivity , we used all combinations of connections in the rois ( fig .
1 ) . to estimate the intra - hemispheric connectivity , we used all connections between rois within one hemisphere ( fig .
these coefficients were transformed to z - scores by fisher 's r- to z - transformation .
the z - scores were entered into a paired t - test to determine whether the two groups ( healthy vs. facial palsy ) showed a significantly different functional connectivity .
in addition to global connectivity values , each chosen roi was used to determine whether the connections of this roi to all other areas were different between groups ( fig .
1 ) . given the resulting number of statistical tests , ( 16 tests ) a correction for multiple tests was necessary , and accordingly , all results were corrected by bonferroni correction and considered as significant at p < 0.05 .
during the acute state of bell 's palsy , all patients showed a unilateral loss of facial function , with stennert grades resting index for rest ranging between 0 and 4 ( mean 1.5 1.2 ) , and for voluntary facial movements ranging between 1 and 6 ( mean 3.7 1.7 ) .
the motor tasks of the paretic and non - paretic facial nerves during the acute stage of bell 's palsy evoked highly significant activations ( p < 0.01 , fdr corrected ) in all patients . the same motor task evoked similar activations in the group of healthy subjects .
the random effect group analysis of patients and healthy controls revealed significant activations in bilateral mi , bilateral lpmcv , bilateral cma , bilateral thalamus , bilateral sma , bilateral secondary somatosensory area ( sii ) , bilateral cerebellum and bilateral insula ( fig .
2 ) . the mni coordinates with standard deviations , as well as the corresponding t - values for the random effect analysis , are summarized in table 1 .
these activated clusters were further used in the following connectivity analysis . because the aim of the current study is the investigation of connectivity differences between patients with facial palsy and healthy controls , we were mainly interested in the spatial location of activated cortex areas .
we compared the spatial location of activity cluster of the eight activity clusters between controls and patients but did not find any significant differences .
we estimated the functional connectivity in the resting state between brain regions that were activated during the motor task .
the functional connectivity was estimated for all subjects and compared between both groups ( patients with facial palsy and control subjects ) by a paired t - test .
first , we tested whether there was an overall disturbed connectivity in patients compared with healthy controls .
we found a significantly reduced functional connectivity in patients compared to healthy controls ( p < 0.01 ) . to determine whether there is a difference in intra - hemispheric connectivity related to the affected side
we found a highly significant decreased functional connectivity of the right hemisphere in patients ( left facial palsy ) compared to the control group ( p < 0.01 ) .
we additionally tested whether this difference in hemispheric connectivity is also significant within the group of patients ( testing for differences between both hemispheres within the group of patients ) . within the group of patients suffering from facial palsy ,
the intra - hemispheric connectedness within the right hemisphere was significantly lower compared to the connectedness within the left hemisphere ( p < 0.01 ) .
the same test for the control group did not reveal any significant differences ( p = 0.48 ) . to investigate
which areas contribute to the measured connectivity decrease , we tested for differences between groups for each area ( averaged connectivity between one area and all other areas ) . because of the number of tests ( 16 tests ) , all results were corrected for multiple comparisons using the bonferroni correction .
we found a significantly decreased functional connectivity ( healthy vs. patients ) in the right thalamus , bilateral sii , right insula and bilateral cerebellum ( fig .
we estimated the correlation between decrease in connectivity and the clinical severity for all areas that showed a decrease in connectivity .
we found a significant correlation between the clinical severity of facial palsy and decreased connectedness for the bilateral sii and the right insula ( p < 0.05 , bonferroni corrected 18 tests ) . the other areas that showed significant decreased connectedness ( right thalamus , bilateral cerebellum ) failed to show significant correlation with the clinical score ( fig .
the current study demonstrates decreased functional connectivity in the acute stage of facial palsy in the cerebral hemisphere contralateral to the paralyzed side .
we demonstrated that connectedness was most affected in areas of sensorimotor integration , not to primary- or secondary motor areas.at first thought , one might assume that a pure deefferentation should lead to an adaptation of the motor program , and therefore plasticity should primarily affect the motor areas of the brain .
however , no altered functional connectivity was found in areas of the primary or secondary motor cortex . instead
, altered functional connectivity was found to the secondary somatosensory cortex , the insula , the thalamus and the cerebellum .
the role of each area in the context of the acute deefferentation will be briefly discussed.the insular cortex and the secondary somatosensory areas participate in higher - order processing of somatosensory input and are considered to be crucial nodes for motor - sensory integration detecting the mismatch between perceived and expected movements ( mutschler et al .
, 2009 ; lederman et al . , 2001 ; simoes and hari , 1999 ) . in particular , the sii integrates information from both hemispheres , ( disbrow et al . , 2001 ) and perceives asymmetrical facial sensory information at rest and during symmetrical facial movement efforts .
a further connectivity decrease was found in the dorsolateral thalamus , which is strongly involved in the forwarding and modulation of somatosensory information ( klingner et al .
, 2013 ; klingner et al . , 2011).the implications of the decreased functional connectivity to the bilateral cerebellum are harder to interpret due to its complex involvement in the processing of sensory and motor information . however , the cerebellum is known for its contributions to the coordination and quality of movements . for the online control of actions , anticipatory control loops
are suggested which predict the sensory feedback ( forward modeling ) due to a chosen motor program ( desmurget and grafton , 2000 ; shadmehr et al . , 2010 ) .
we suggest that the decreased connectivity to the cerebellum is due to the substantial prediction error caused by the motor - sensory mismatch .
our knowledge about the role of the involved brain areas could be extended in further studies by analyzing the effective connectivity by using fmri at higher temporal resolution or by using eeg and meg .
these methods would not only allow to estimate the causal relationship between brain areas but might also shed light on the importance of the sensory feedback as possible driving force for the adaptation during the course of bell 's palsy.our results demonstrated connectivity changes in areas responsible for sensory processing and motor - sensory integration while no alterations were found in the primary or secondary motor areas.this pattern might be due to the fact that the brain has no information on the cause of the sensory - motor mismatch and particularly no information about where a possible damage might be .
because of the brain 's inability to detect whether the efferent or afferent information transfer is impaired , we interpret the current results as the principal mechanism that the brain is using in the case of a detected sensory motor discrepancy of unknown origin . similarly reduced sensory feedback
accordingly , studies investigating cortical plasticity after long - term sensory deprivation found representational map changes in the somatosensory cortex ( merzenich et al . , 1983 ) .
however , a deafferentation ( in contrary to a deefferentation ) reduces not only information about performed movements but also information about external stimuli .
this condition is often associated with dysesthesia , which limits the comparability to a deefferentation.in clinical practice , most patients suffering from an acute bell 's palsy receive an exercise physiotherapy although there is no clear evidence for its effectiveness ( de almeida et al . , 2014 ) and also no compelling theory of how such an exercise therapy might influence the outcome after facial nerve palsy .
the results of this study indicate that the brain tries to adapt to the actual impaired state of sensorimotor mismatch without any major attempt to solve this discrepancy by modulating motor programs .
the question remains whether increased training in the acute state is helpful by activating motor programs and increasing the total amount of the remaining sensory information or whether training solidified the adaptation to this pathologic state . in a previous study of bell 's palsy ,
we found reduced functional connectivity during motor activity in the motor network ( klingner et al . , 2011 ) .
these results indicate that motor training is necessary for adaptation of the motor system , while the pure existence of a sensorimotor mismatch is not a sufficient stimulus for adaptation .
the training - associated adaptation of the motor system together with our current results ( no adaptation of the motor network at rest ) further indicates that the adaptation of brain networks is highly context sensitive .
it can therefore be hypothesized that motor training is helpful in the acute state of this disease .
this result is in line with existing studies suggesting that facial exercise therapy is effective for facial palsy for the functional outcome ( pereira et al . , 2011 ) .
if we assume that the increased amount of sensory information is important in avoiding adaptation to the impaired state of sensorimotor information , then the question becomes whether additional sensory information from other modalities is also beneficial via impeding the adaptation to the current pathologic state .
for example , one might hypothesize that mirror feedback training avoids the adaptation to the pathologic state by additional visual information . another interesting approach to overcome the sensorimotor mismatch could be a repetitive manual stimulation of the face ( e.g. , with the hands of the patient ) . with this maneuver , the brain could be supported in realizing , that no afferent but a pure efferent deficit causes the sensorimotor discrepancy .
in conclusion , we demonstrated that connections in bell 's palsy areas of sensory - motor integration were most affected , and primary- or secondary motor areas were not .
this pattern indicates that a pure deefferentation leads the brain to adapt to its current state without any major attempts to modulate the motor program .
these results suggest an important role of sensory feedback in plasticity after an acute deefferentation , but its exact role and impact have to be investigated in further studies . | cerebral plasticity includes the adaptation of anatomical and functional connections between parts of the involved brain network .
however , little is known about the network dynamics of these connectivity changes .
this study investigates the impact of a pure deefferentation , without deafferentation or brain damage , on the functional connectivity of the brain . to investigate this issue ,
functional mri was performed on 31 patients in the acute state of bell 's palsy ( idiopathic peripheral facial nerve palsy ) .
all of the patients performed a motor paradigm to identify seed regions involved in motor control .
the functional connectivity of the resting state within this network of brain regions was compared to a healthy control group .
we found decreased connectivity in patients , mainly in areas responsible for sensorimotor integration and supervision ( sii , insula , thalamus and cerebellum ) .
however , we did not find decreased connectivity in areas of the primary or secondary motor cortex . the decreased connectivity for the sii and the insula significantly correlated to the severity of the facial palsy .
our results indicate that a pure deefferentation leads the brain to adapt to the current compromised state during rest .
the motor system did not make a major attempt to solve the sensorimotor discrepancy by modulating the motor program . | Introduction
Materials and methods
Results
Discussion
Conclusion |
according to the two latest who assessments , cataract has consistently been the leading cause of world blindness , which was responsible for around 48% and 51% of blindness in 2002 and 2010 , respectively .
biological ageing plays the most crucial role in the development of cataract [ 35 ] .
china , the most populous country , has been experiencing an unprecedented ageing due to a lower birth rate and longer life expectancy .
about 15.5% of the entire chinese were aged 60 + years in 2014 , a figure much higher than the threshold for ageing society ( 10% ) .
therefore as an age - related disease , cataract requires increased and urgent attention in china [ 8 , 9 ] . besides age ,
many other related factors , such as diabetes and gender , have also been well - addressed in previous studies [ 1013 ] .
it has been demonstrated that diabetics faced 25 times greater risk of developing cataracts than the nondiabetic counterparts .
additionally , gender diversity in the prevalence of cataract has also been frequently reported and most studies showed greater prevalence among females than males .
hormonal differences between men and women may mainly contribute to such gender diversity [ 10 , 14 ] , but the reasons were still not fully understood .
ocular changes may arise during pregnancy due to the modifications of hormone , metabolism , and weight .
although most of the changes are reversible , some are occasionally permanent which may in turn cumulatively affect women 's vision at their older ages .
a study revealed that there was a significant association between parity and the risk of cataract among middle- and older age women .
however , the evidence is scant since very few studies have directly reported the link between childbearing and cataract , especially for women in their old ages . in this study , we aim to ( 1 ) test the relationship between childbearing and cataract among the older women and ( 2 ) examine whether diabetes is a mediator in this relationship .
as previously described , we conducted a large scale cross - sectional survey among 14,292 older adults aged 60 + years in xiamen , china , in 2013 .
all 38 subdistricts in xiamen were selected . in stage 2 , one - third of communities
were randomly sampled from each subdistrict and a total of 173 communities were included in the end .
the randomization of these communities was performed by computer - generated random numbers . in stage 3 , participants were conveniently selected from each community by controlling for gender and age composition .
the number of individuals to be sampled in each community was determined according to its proportion of eligible older adults .
participants ' demographic characteristics , activities of daily living , physical health , psychological health , and social support were assessed by a structural questionnaire , which was finished by a face - to - face interview . written informed consent was obtained by each participant and our study was approved by the ethical review committee of school of public health , xiamen university .
the primary outcomes in this study were whether the participants suffered from physician - diagnosed cataract and diabetes .
they were assessed by the same item : do you suffer from the following physician - diagnosed chronic diseases ? ( check all that apply ) .
only if the option was ticked , we assume the participant suffered from the corresponding chronic disease . in xiamen
, for medical screening purposes , people who were aged 60 years or older can participate in an annual physical examination for free in recent years , including blood pressure and blood glucose checks , and an ocular examination .
moreover , some self - reported chronic diseases were reported to be highly correlated with physician 's records .
therefore , the reliability of self - reported diabetes and cataract in the elderly should be potentially ensured ( see supplementary 1 for the reason in detail in supplementary material available online at http://dx.doi.org/10.1155/2015/385815 ) .
the nondiabetic cataracts in our study referred to the individuals who suffered from cataract but did not have diabetes .
the exposure of interest was childbearing status which was measured by number of children ( noc ) .
numerical response was obtained and was classified into six levels : 0 , 1 , 2 , 3 , 4 - 5 , and 6 or more .
additionally , some basic information ( gender , age , residence , education , and marital status ) , life habits ( dietary salt intake , smoking history , and alcohol drinking ) , and hypertension status were included as covariates ( see table 1 for the details of the classification of the variables ) .
we considered the hypertension status as a covariate because it has also been frequently reported to have relationship to cataract .
first , we summarized the characteristics of participants by cataract status using descriptive statistics ( mean and standard deviation for age and counts and proportions for the other categorical characteristics ) .
chi - square tests were performed to assess the relationship between cataract and all the other covariates .
second , to identify the relationships among noc , diabetes , and cataract in women , stata v 13.0 was used to perform structural equation modeling ( sem ) .
the reason we tested their relationships was due to the concern that diabetes may be a mediator in the relationship between noc and cataract .
the sem for this mediation model for the ith participant ( 1 i n ) is given by(1)logitprobabilitydi=0+1noci+i , logitprobabilityci=0+1di+2noci+3tcovariates+i , where the outcome di is diabetic status , ci is cataract status , 0 , 1 , 0 , 1 , 2 , and 3 are the regression coefficients , covariates are the nine covariates described above , and i and i are the random errors .
third , we presented the prevalence of cataract by line chart under the six levels of noc , stratified by gender and diabetes status .
fourth , logistic regressions were carried out to model the cataract status on the noc among the participants without diabetes , stratified by gender and adjusted by the nine covariates mentioned above . p
among the 14,292 participants , 14,119 had complete data on all variables mentioned above and were included in the following analyses .
descriptive statistics of characteristics stratified by gender and cataract status were presented in table 1 . among 14,119 valid participants , the prevalence of cataract was 5.01% , with an obviously higher prevalence in women than men ( 6.41% versus 3.51% ) .
the average age was significantly higher in cataract participants than in those without cataract for both men and women ( p < 0.001 ) .
an increase trend of prevalence of cataract was presented as noc grew for women and ranged from 3.10% for the childless to 9.09% for those who had six or more children .
about ten percent of participants suffered from diabetes , of whom the prevalence values of cataract were 4.48% for men and 9.26% for women , which were both higher than their nondiabetic counterparts .
approximately thirty percent of participants reported to have hypertension and 6.85% of them reported to have cataract .
significantly higher prevalence of cataract was presented in hypertensive participants than nonhypertensive groups for both men and women .
female participants who had salt - heavy diet , were illiterate , were single or widowed , and had quit drinking had significantly higher prevalence of cataract ( p < 0.05 ) .
however , for male participants , except for the hypertensive status , only smoking history was significantly associated with cataract status .
unexpectedly , men who had quit smoking presented highest prevalence , and those who smoked often showed lowest one . as descriptive results shown above , both diabetes and having more children increase the risk of cataract for older women . to test whether diabetes is a mediator in the relationship between noc and cataract , mediation analysis with sem was performed .
figure 1 presented the path diagram with estimated odds ratios ( or ) , which represented the sem models for female elderly ( equation ( 1 ) ) .
diabetic women had a statistically higher risk ( or = 1.33 ) of cataract than their nondiabetic counterparts .
those who had one or more children faced roughly 24 times higher risk of cataract than the childless women .
however , all the paths between noc and diabetes were not significant , indicating that diabetes should not be a mediator in the relationship between noc and cataract .
the details of the estimates of the sem models can be found in supplementary 2 .
the prevalence of cataract under the six levels of noc stratified by gender and diabetic status was depicted by line chart in figure 2 .
a notably increased prevalence ( solid line ) appeared as noc grew for nondiabetic older women , but it disappeared among the nondiabetic older men ( dotted line ) .
moreover , the nondiabetic females had higher prevalence of cataract than nondiabetic males at all levels of noc except among the childless participants .
at all the levels of noc , diabetic females had obvious higher prevalence of cataract than diabetic males .
the increased trend of prevalence as having more children disappeared for diabetic female and male participants .
table 2 presented the ors with corresponding 95% confidence intervals ( cis ) obtained from logistic regression models for nondiabetic participants stratified by gender .
for both nondiabetic women and men , age was a crucial risk factor for developing cataract .
the older women who had one or more children faced roughly 24 times higher risk of nondiabetic cataract than their childless counterparts ( or [ 95% ci ] = 3.88 [ 1.24 , 17.71 ] , 3.21 [ 1.04 , 14.52 ] , 4.32 [ 1.42 , 19.44 ] , 4.41 [ 1.46 , 19.74 ] , and 3.98 [ 1.28 , 18.10 ] for having 1 , 2 , 3 , 4 - 5 , and 6 or more children , resp . ) .
however , among the nondiabetic older men , the ors seemed to decrease as noc grew , although they were not statistically significant .
hypertension , salt - heavy diet , and living in a city were risk factors for women but not for men .
unexpectedly , having quit smoking was a risk factor , and being widowed was a protect factor for men only .
the findings in this study indicated that childbearing may increase the risk of nondiabetic cataract in women 's old age .
after controlling for the potential confounders , nondiabetic women who had one or more children faced roughly 24 times higher risk of cataract than the childless .
moreover , sem analysis suggested that diabetes was not a mediator in the relationship between noc and cataracts .
these results may contribute to the existing body of literature on identifying the risk factor of cataract among the older individuals .
however , some possible explanations for the childbearing effect in older women may be speculated ; these include ( 1 ) pregnancy - induced estrogen changes .
some investigators believed that estrogen played a protective role in controlling the development of cataract .
a previous study indicated that the risk of cortical cataract increased by about 5% for each one year increment in age at menarche and that the risk decreased by 11% for each five years of age
therefore , we may postulate that the increased risk of cataract for women having more children is due to a reduction in lifetime exposure to circulating estrogens induced by each pregnancy and breastfeeding .
( 2 ) postpartum obesity may be another important risk factor of cataract for women in their later life [ 23 , 24 ] .
a previous study presented that the average gestational weight gains for chinese women ( 17.3 4.9 kg , 17.4 4.4 kg , and 15.7 5.1 kg for women of low , moderate , and high prepregnancy body mass index , resp . ) were much higher than the recommended criteria ( 1316.7 kg , 1116.4 kg , and 7.114.4 kg , resp . ) .
( 3 ) various ocular changes occur during pregnancy , including decreased sensitivity of the cornea , enlarged blind spots , and bitemporal loss [ 27 , 28 ]
. the cumulative effect of those asymptomatic and subtle ocular changes may also contribute to the development of cataract for women in later life .
( 4 ) a complex of other risk factors , such as the stress for taking care of many children , may also increase the risk of cataract .
however , in either case , more physiological studies were in great need to fully elucidate the mechanism . in line with many previous studies [ 2931 ] ,
cataract was more common in women than men , with the prevalence of 6.41% versus 3.51% in the present study .
such difference is often addressed by the estrogen deficiency or biomass cooking fuels . however
the prevalence of cataract among childless women was notably lower than that among childless men ( 3.1% versus 5.1% ) .
this result may further indicate that childbearing was an important risk factor of cataract among older women .
a study has directly stated that the risk of cataract in young women ( 3545 years ) increased by an estimated 20% for each additional birth . moreover ,
older women ( 4586 years ) were observed to have 11.3% higher risk of cataract for each additional live birth in a recent cohort study . among the nondiabetic women , the prevalence of cataract grew as they had more children , but such trend disappeared among the women with diabetes . in other words , the effect of childbearing on cataract among the female older adults
cataract was the second most ocular common complication of diabetes , and the effect of diabetes on cataract should be direct and obvious .
however , the childbearing occurred at women 's younger age and its effect on age - related cataract may be cumulative and subtle . therefore the effect of childbearing on cataract is easy to be neglected or covered by other stronger risk factors .
consistent with many previous studies [ 3537 ] , our findings identified hypertension , salt - heavy diet , living in a city , and having quit smoking as risk factors for development of cataract .
salt - heavy diet has been well - addressed to be related to hypertension [ 38 , 39 ] , which may increase the risk of development of the posterior subcapsular cataracts [ 40 , 41 ] . as for smoking , it had been consistently stated to be associated with both nuclear and posterior subcapsular cataract . in this study , having quit smoking was a risk factor for older men which might be due to the smoking history in their younger age .
some investigators found that risk of cataract remains elevated for many years following smoking cessation .
unexpectedly , we found men who smoked often had obviously lower prevalence of cataract than those who never smoked ( 2.81% versus 3.61% ) .
, we further analyzed our data and found that individuals who smoked often were significantly younger than those who never smoked ( 69.45 years versus 71.78 years , p < 0.01 ) , especially among men ( 69.12 years versus 71.77 years , p < 0.01 ) .
therefore , age , the most critical risk factor of cataract , probably confounded the relationship between cataract and smoking history .
this speculation was further validated in the following regression model for men where or for smoking often was higher than never smoking ( 1.07 versus 1.00 ) , after controlling for age and other impact factors .
another possible explanation is that some related chronic diseases can prompt smoking cessation for older adults , and the current smokers may have or believe they have relatively better physician conditions .
however , this speculation can not be validated in this study due to our cross - sectional survey and limited measurements . to fully uncover the relationship between smoking and cataract , variables such as smoking pack - years , age of smoking cessation , and the reason(s ) for smoking cessation are in great need .
despite the fact that abovementioned risk factors of cataracts were well - demonstrated , limited studies have elucidated the gender - specified risk factors .
our results suggested that salt - heavy diet and hypertension were the risk factors for nondiabetic female only and on the contrary , having quit smoking was for nondiabetic male only .
the findings in the present study have uncovered the relationship between childbearing and cataract in older adults .
they may open new research challenges to detect the risk factors of senile cataract . nevertheless , some limitations should be acknowledged .
first , the chronic conditions were obtained by a self - reported question . as a result
, substantial agreement was found in a study comparing subjects ' self - reported diabetes with information from medical records .
some studies demonstrated that self - reported diabetes was > 92% reliable over time and it was a reliable proxy for medical record review .
the difference between self - reporting and true prevalence of cataract has been evaluated in supplementary 1 , and the reliability of self - reported cataract in this study may also be potentially ensured .
second , to exclude the diabetes - induced cataracts , the data of the participants with diabetes were all removed from our regression models . however , some of participants may have cataract prior to diabetes or the cataracts were not diabetes - induced , and as a result , the complete exclusion may consequently result in some bias .
nevertheless , such bias was restricted , since only 71 ( less than 1% ) female participants had both cataract and diabetes .
third , there are three primary types of age - related cataracts ( nuclear , cortical , and posterior subcapsular ) , and each may have its own somewhat varying causes [ 37 , 41 ] .
however , the types of cataracts were not asked in our survey and therefore we can not specify which type(s ) of cataract were accounted for in relation to childbearing .
this study has revealed a relationship between childbearing status and the risk of cataract among chinese elderly , and diabetes was not a mediator in this relationship . as a result
, we should pay more attention to the eyes care for the women during pregnancy and after childbirth . |
backgrounds .
ocular changes may arise during pregnancy and after childbirth , but very few studies have reported the association between childbearing and cataract among older adults . methods .
14,292 individuals aged 60 + years were recruited in xiamen , china , in 2013 .
physician - diagnosed cataract and diabetes status were assessed by a self - reported questionnaire .
childbearing status was measured by number of children ( noc ) .
structural equation modeling ( sem ) analysis was conducted to examine the relationships among noc , diabetes , and cataract .
gender - specific logistic models regressing nondiabetic cataract on noc were performed by adjusting some covariates .
results .
14,119 participants had complete data , of whom 5.01% suffered from cataract , with higher prevalence in women than men ( 6.41% versus 3.51% ) .
estimates of sem models for women suggested that both noc and diabetes were risk factors for cataract and that no correlation existed between noc and diabetes .
women who had one or more children faced roughly 24 times higher risk of nondiabetic cataract than their childless counterparts ( or [ 95% ci ] = 3.88 [ 1.24 , 17.71 ] , 3.21 [ 1.04 , 14.52 ] , 4.32 [ 1.42 , 19.44 ] , 4.41 [ 1.46 , 19.74 ] , and 3.98 [ 1.28 , 18.10 ] for having 1 , 2 , 3 , 4 - 5 , and 6 or more children , resp . ) .
conclusions .
childbearing may increase the risk of nondiabetic cataract in chinese women 's older age . | 1. Introduction
2. Methods
3. Results
4. Discussion
5. Conclusions |
cell biology is an inherently multidisciplinary science , requiring approaches from genetics , chemistry , physics , applied mathematics , and engineering .
while biochemical and genetic approaches have been successfully integrated into the field , other disciplines require more effort .
physical scientists that join the field of cell biology retain the training and language from their physical discipline , which has been specialized for specific purposes .
applied mathematicians , condensed matter physicists , and mechanical engineers all have unique perspectives on how to model complex biological phenomena ( fig .
this has led to the development of parallel theoretical and experimental approaches for modeling cell biological phenomena that are difficult to directly compare or rigorously test .
a challenge for the future is to develop a community of researchers that will integrate these diverse physical approaches to identify strengths , resolve differences , and determine the best approaches for modeling cell behaviors .
a flow chart showing examples of how various disciplines from the physical sciences ( bottom ) have optimized a variety of theoretical / modeling tools ( left ) as well as experimental techniques ( right ) that have been applied to cell biological problems .
a current challenge is to systematically have them benchmarked against each other and identify their weaknesses and strengths before using them to provide a new framework optimized for mesoscale cell biology .
one of the simplest solutions to implement is to develop a consistent and precise language to describe measurements or ideas . in my field , which centers on how mechanical forces are sensed and generated by cells , terms like mechanosensing or even
stiffness sensing are used without precision , resulting in confusion of what is known versus just thought to be true .
precision of language is essential for standardizing experimental protocols and measurements and in being able to clearly communicate conclusions and ideas .
one historical role of physical scientists in biology has been the introduction of new experimental and analytical tools .
some of these tools , such as microscopy and scattering techniques , have been developed extensively .
however , in other cases , the nature of measurements require small apparatuses that can be difficult to replicate or operate ( magnetic tweezers are a notorious example ) , making it difficult for other laboratories to build upon this knowledge . similar issues arise in analysis and methods .
it is extremely important for these methods to be used and validated by different laboratories to confirm results independently and by many individuals so that the language used to describe physical concepts and results can be made more precise .
being able to directly compare two different measurement techniques so that the same parameters can be used is essential for resolving discrepancies . even though the goal is to understand cell physiology , model testing will require physical characterization that may not immediately inform a biological process . to use an analogous example : the work in basic materials science of magnetism that needed to be performed before we could construct and build computer hard drives .
it is my hope that the cell biology community will remain interested in these advances in characterization of biological materials and systems , as they are crucial to uncovering synergies that are not currently apparent .
in the physical sciences , research has evolved so that individuals typically focus on either theory or experimentation . of course , each of these can be further subdivided into analytical theory versus computer modeling , as well as sample preparation versus characterization .
it also has led to a vigorous feedback between theoretical prediction , experimental measurement , and new materials development . to be useful , models need to be falsifiable . there is increasing evidence that many of the models used in biology are over - parameterized and , consequently , difficult ( or impossible ) to falsify .
that is , when parameters are assigned with molecular - level details , the number of parameters quickly becomes large . in these scenarios , changes in the parameter value
have little effect on the model predictions and make it difficult to verify the accuracy of the model ( for more details , see http://www.lassp.cornell.edu/sethna/sloppy/ ) .
identifying order parameters that encompass the physical quantities or metrics ( e.g. , elastic modulus , organelle transport ) that make up many of the molecular details is essential for developing models with fewer control parameters .
such order parameters will provide crucial insight into understanding regulation of the individual macromolecular machinery .
the word mechanism in cell biology typically refers to a molecular mechanism that is explored rigorously by genetic and biochemical testing .
understanding the physical mechanism requires both identification of the parameters controlling a system and then elucidation of the regulation of parameter values .
moreover , understanding how molecular interactions give rise to a single physical parameter is not straightforward , and may require years of work .
it is quite natural to apply models and approaches that we have used to engineer machines , such as the flow of decision making in electrical circuits or mechanic designs .
however , cells are working under different sets of constraints , and a future challenge of understanding cellular machines is that completely different design principles may be used . establishing a culture that encourages dynamic feedback between theory , experimentation , and
a potentially very exciting possibility is that understanding the physical mechanisms controlling biological machines will enable a completely new set of design principles that provide insight into how living cells are able to respond and adapt to highly variable environments .
this will enable understanding of how these states change during disease progression and the capability of engineering biological cells to maintain a healthy phenotype . | a major goal in cell biology is to bridge the gap in our understanding of how molecular mechanisms contribute to cell and organismal physiology .
approaches well established in the physical sciences could be instrumental in achieving this goal
. a better integration of the physical sciences with cell biology will therefore be an important step in our quest to decipher how cells work together to construct a living organism . | Developing a common community
Precision in language
Construction and validation of physical methods
Feedback between modeling and experiments |
renal cell carcinoma ( rcc ) is a widespread oncourological disease with a tendency towards a slow increase of incidence . in the recent decade ,
there has been development of numerous effective drugs targeted at different molecules that play a dominant role in rcc carcinogenesis .
understanding of rcc carcinogenesis confirms the key role of angiogenesis in maintaining the viability of renal tumours and their metastases .
we aimed to systemize numerous medicines , used to inhibit the angiogenesis in patients with advanced rcc according to their targets , and to analyze their efficacy .
there are roughly four main mechanisms of action of the targeted drugs : blockade of circulating extracellular vegf molecules.the selective blockade of tyrosine kinase receptors domains.the simultaneous blockage of the tyrosine kinase receptors domains and intracellular tyrosine kinases.the blockade of mammalian target of rapamycin ( mtor ) which is responsible for support of vital functions of cancer cells .
the selective blockade of tyrosine kinase receptors domains . the simultaneous blockage of the tyrosine kinase receptors domains and intracellular tyrosine kinases . the blockade of mammalian target of rapamycin ( mtor ) which is responsible for support of vital functions of cancer cells .
in addition to fda officially approved drugs , numerous experimental agents have been synthesized , which are currently on initial stages of clinical studies in rcc treatment .
the results of the currently used targeted drugs demonstrate perspectives of metastatic rcc conservative treatment , that are able to prolong cancer specific survival in previously doomed patients for up to 29 months .
the development of schedules for sequential treatment or combination targeted therapy remains a current challenge .
the advantages and disadvantages of neoadjuvant and adjuvant targeted therapy are currently being intensively discussed .
it is clear that after initiation of tumour growth the cancerogenesis of rcc occurs via two inseparable pathways : proliferation , enabling the raf / mek / erk kinase pathway , and the vascularisation pathway , maintaining reactions mediated by growth factors .
inducible factor1alpha ( hif1alpha ) and mammalian target of rapamycin ( mtor ) in the processes of cell proliferation and angiogenesis is indisputable .
radiation causes oxidative stress & gene mutations , thus the role of chronic exposure to low doses of ionizing radiation in rcc genesis has been proved too . to grow beyond 12 mm in diameter , the tumour requires the emergence and further development of its own blood vessels .
this complex process , managed by growth factors ( vascular endothelial growth factor ( vegf ) , platelet derived growth factor ( pdgf ) , etc . ) is known as neoangiogenesis .
under normal conditions there is a dynamic equilibrium in the body ( angiogenic balance ) between activators and inhibitors of this process of new vessel formation , neoangiogenesis .
the synthesis of activators and inhibitors of angiogenesis is managed by pro angiogenic and anti angiogenic genes . in case of a natural necessity of a vascular net ( trauma , surgeries , burns etc . ) , the pro angiogenesis genes are activated , the concentration of activators of angiogenesis increases , launching the mechanisms of new vessel formation for renewing tissues trophism . upon reaching the required effect , the anti angiogenesis genes
the process of angiogenesis is controlled by the von hippel lindau gene . in most cases of clear cell renal cancer inactivation or mutations of this gene are observed .
up to 90% of all sporadic ccrccs ( clear cell renal cell carcinomas ) demonstrate hif1alpha stabilization and tissue accumulation because of a consequence of vhl loss or its inactivation .
mammalian target of rapamycin ( mtor ) is an intracellular enzyme , activating the kinases , responsible for support of vital functions of cancer cells .
it exists in the form of two signal complexes : mtor complex 1 ( mtorc1 ) , that is involved in the intracellular synthesis of proteins and mtor complex 2 ( mtorc2 ) , that participates in the formation of the cytoskeleton ( cellular framework stabilizing the cellular cytoplasm ) .
there is activation of protein kinases c ( pkc ) and akt / pkb with the participation of mtor , thereby increasing the synthesis of biologically active proteins hif1alpha and cyclin d. the molecules of mtor are activated under the influence of tyrosine kinase receptor extracellular domain stimulation by growth factors , due to inhibition of genes , suppressing tumour growth and the direct action of oncogens .
overproduction of hif1alpha , in turn , causes overexpression of vegf and pdgf with subsequent activation of angiogenesis . due to the influence of mtor on the synthesis of hif1alpha , inhibition of mtor
an important contribution to the studies of the mechanisms of cancerogenesis was made by the studies of structure , varieties , and functions of tyrosine kinases and their receptors , the activation of which allows execution of the normal and abnormal intracellular effects of ligands .
cell forms ) confirms the key position of angiogenesis that is ruled by the hif1alpha / vegf&pdgf pathway , in sustaining the viability of the cells of this type of renal tumours and their metastases [ 4 , 10 ] .
clarification of the structure and function of all components of the mechanism behind tumour vascularisation stimulated the search for the pharmacological agents able to block the process of vascularisation on different levels .
tumour therapy employing such agents began to be referred to as targeted therapy .
we aimed to systemize numerous drugs , used to inhibit the angiogenesis in patients with rcc according to their targets and analyze their efficacy .
we propose the original scheme with four main mechanisms of action of rcc targeted therapy , which are shown in figure 1 .
targets of rcc targeted therapy . 1 , 2 , 3 , 4 the targets for the relevant groups of targeted drugs ; a extracellular environment ; b cytoplasmic membrane of an endothelial cell ; c intracellular environment ; d intracellular domain of tyrosine kinase receptors ; mtor mammalian target of rapamycin ; t tyrosine kinases ; vegf vascular endothelial growth factor molecule ; vegfr the tyrosine kinase receptor to vegf by blocking the key target molecules on these four levels , targeted drugs are able to stop new blood vessels formation as well as tumour cells proliferation and migration . as a consequence
target 1 . the first approach of rcc targeted therapy ( tt ) is blockade of circulating extracellular vegf molecules .
the mechanism of action of such agents as bevacizumab ( bev ) , aflibercept and lenalidomide is based on this principle .
the following phenomena occur due to vegf inhibition : arrest of angiogenesis;regression of vegf dependent vessels ( tumourous vessels and normal capillaries);reversal of vegf induced effects , such as : reversal of tumourous vessels;decrease in blood flow through the tumour , therefore decreased influx of oxygen and nutrients into the tumour;tumour shrinkage as a consequence .
arrest of angiogenesis ; regression of vegf dependent vessels ( tumourous vessels and normal capillaries ) ; reversal of vegf induced effects , such as : reversal of tumourous vessels;decrease in blood flow through the tumour , therefore decreased influx of oxygen and nutrients into the tumour;tumour shrinkage as a consequence .
reversal of tumourous vessels ; decrease in blood flow through the tumour , therefore decreased influx of oxygen and nutrients into the tumour ; tumour shrinkage as a consequence .
bevacizumab ( avastin , roche ) is an igg1monoclonal antibody , capable of the detection and binding of all vegf isoforms .
this results in inability of transmission of the specific signal through the transmembrane tyrosine kinase receptor , due to isolation of the circulating molecules of the receptor 's ligand .
2003 , demonstrates statistically significant increase of progression free survival ( pfs ) in a group of patients receiving the drug at a dose of 10 mg / kg i.v . once in 2 weeks , up to 4.8 months ( compared to 2.5 months in the placebo group ) . there was a low level of objective response rate ( orr ) , only in 10% of patients .
the above indices are substantially increased whenever the therapy is appended by interferon 2 ( ifn2 ) .
multicentre randomized studies of combination mrcc therapy ( bev + ifn2 ) have demonstrated the prolongation of pfs up to 10.213.5 months and increase of orr to 30% .
the above combination of drugs is a first line therapy in patients with disseminated clear cell renal cancer in europe and the u.s .
agent bevacizumab has an acceptable level of toxicity and moderate disease stabilizing activity in selected patients with metastatic rcc ( mrcc ) who have failed prior therapy by vegfr tyrosine kinases and mtor inhibitors .
the median pfs of bevacizumab therapy was 4.4 months ( 95% ci , 2.89.6 months ) , and the median os was 19.4 months ( 95% ci , 9.9nr months ) respectively . for subjects treated with prior vegf and mtor inhibitors , median
grade 3 to 4 toxicities included fatigue ( 29% ) , dehydration ( 24% ) , failure to thrive ( 10% ) , constipation ( 10% ) , and muscle weakness ( 10% ) .
aflibercept ( vegf trap , regeneron / sanofi aventis ) is a soluble protein consisting of segments of the extracellular domains of vegfr1 and vegfr2 .
after administration , aflibercept is accumulated in the extracellular medium of vascular endothelium , where it selectively binds vegf molecules in a manner similar to that of bevacizumab , thus preventing vegf from binding with the extracellular domains of the tyrosine kinase receptors and therefore stopping angiogenesis .
the clinical trials of aflibercept efficacy in the treatment of patients with different cancers including rcc are currently ongoing .the same vegf
targeted group includes lenalidomide ( revlimid , celgene corp . ) , a thalidomide derivative , which possesses anti angiogenic and immunomodulating effect . the immunomodulating action of lenalidomide is due to the impact on t cell immunity .
lenalidomide therapy in patients with mrcc , ensure the median of pfs 6 months and the median os 17 months . in another study ,
39% of patients had a stabilization of their cancer for at least three months but median os had not yet been reached at 13.5 months of follow up .
major side effects included fatigue , skin problems , and low levels of immune cells .amg 386 ( amgen inc . ) .
taking into consideration the direct influence of hif1alpha proteins on the vegf synthesis and therefore of angiogenesis activation , there is a search for the possibilities to block the hif1mechanism , thereby decreasing vegf concentrations .
the experimental drug amg 386 ( amgen inc . ) is a neutralizing polypeptide , created as a substance able to disrupt the connections of tie2 receptors with angiopoietin 1/2 , thereby arresting the pro angiogenic effects of hif1alpha and as a consequence vegf .
another hif1targeted drug , a chimeric monoclonal antibody targeted at carbonic anhydrase ix ( ca ixmn / g250 ) cell surface receptor , which is hyper expressed in rcc cells and is hif1alpha dependent .
cell mrcc , the os is 15 months . in combination therapy with wx g250 + il2 the os achieves 22 months .
the same vegf
targeted group includes lenalidomide ( revlimid , celgene corp . ) , a thalidomide derivative , which possesses anti angiogenic and immunomodulating effect . the immunomodulating action of lenalidomide is due to the impact on t cell immunity . lenalidomide therapy in patients with mrcc , ensure the median of pfs 6 months and the median os 17 months . in another study ,
39% of patients had a stabilization of their cancer for at least three months but median os had not yet been reached at 13.5 months of follow up .
major side effects included fatigue , skin problems , and low levels of immune cells .
amg 386 ( amgen inc . ) . taking into consideration the direct influence of hif1alpha proteins on the vegf synthesis and therefore of angiogenesis activation ,
there is a search for the possibilities to block the hif1mechanism , thereby decreasing vegf concentrations .
the experimental drug amg 386 ( amgen inc . ) is a neutralizing polypeptide , created as a substance able to disrupt the connections of tie2 receptors with angiopoietin 1/2 , thereby arresting the pro angiogenic effects of hif1alpha and as a consequence vegf .
another hif1targeted drug , a chimeric monoclonal antibody targeted at carbonic anhydrase ix ( ca ixmn / g250 ) cell surface receptor , which is hyper expressed in rcc cells and is hif1alpha dependent . when the drug is taken by the patients with clear
cell mrcc , the os is 15 months . in combination therapy with wx g250 + il2 the os achieves 22 months . target 2
. the second approach of targeted therapy is the selective blockade of domains of tyrosine kinase receptors : vegfr , pdgfr and epidermal growth factor 's receptor ( egfr ) .
this mechanism of action is typical for such drugs as pazopanib , erlotinib , axitinib , semaxanib , tivozanib , ramucirumab etc .
pazopanib ( votrient , gsk ) is a selective inhibitor of vegfr1;2;3 and pdgfr receptors .
administration of the drug produces tumour shrinkage ( ts ) by 30% compared to baseline . in october 2009 pazopanib was approved by fda as a first line therapy agent for clear cell mrcc . the final overall survival results of a randomized , double blind phase iii study of pazopanib in patients with advanced and/or metastatic renal cell carcinoma , demonstrate that the difference in final os between pazopanib and placebo treated patients was not statistically significant ( 22.9 vs. 20.5 months , respectively ; hazard ratio [ hr ] = 0.91 ; 95% confidence interval [ ci ] , 0.711.16 ; one sided p = 0.224 ) .
although no significant difference in os was observed , extensive crossover from placebo to pazopanib confounded the final os analysis .
hoc analyses adjusting for crossover suggest os benefit with pazopanib treatment for mrcc patients . in our opinion , such a long os in placebo treated patients ( 20.5 months ) in comparison with results of similar investigations presented in our article may be caused only by a special selection of patients .
thus , the preliminary conclusion of this study about equal survival in pazopanib & placebo groups may be a topic for discussion .
erlotinib ( tarceva , osi pharmaceutical / genentech / roche ) is a selective inhibitor of extracellular domains of epidermal growth factor receptors ( egfr ) .
axitinib ( inlyta , pfizer ) is a selective inhibitor of extracellular domains of vegfr1;2;3 ; pdgfr ; rtks ; ckit receptors .
data from the trial agile 1046 presented at the 2012 asco annual meeting demonstrated a median pfs of more than one year , and an overall response rate of 40.2% in the treatment arm of the study .
thus , axitinib was granted fda approval in january 2012 to treat advanced rcc in patients who failed to respond to prior therapy .
tivozanib ( av951 , aveo pharmaceuticals ) , an inhibitor of all three types of vegf1;2;3 receptors , initially demonstrated promising significant improvement in pfs and orr compared with sunitinib in patients who had received no prior systemic therapy for metastatic rcc .
however , in 2013 the fda has rejected a new drug application for tivozanib for the treatment of advanced rcc , recommending an additional clinical trial to address concerns over existing clinical data . at the time of the os analysis , presented at the asco genitourinary symposium ,
mortality rates were 45.4% in the tivozanib group and 39.3% in the sorafenib group , corresponding to a stratified hazard ratio of 1.245 ( 95% ci , 0.9541.624 ; p = .105 ) trending in favor of sorafenib .
the median os was 28.8 months in the tivozanib arm and 29.3 months in the sorafenib arm .
ramucirumab ( imc1121b ; imclone systems / eli lilly ) is a fully human , high affinity monoclonal antibody to the extracellular domain of vegfr2 .
patients with progressive disease or intolerance to either sorafenib , sunitinib , or both were iv administered 8 mg / kg ramucirumab biweekly and received tumour assessments every six weeks .
grade 12 headache ( 23% of patients ) , grade 13 fatigue ( 18% of patients ) and grade 1 nausea ( 13% of patients ) were the most common therapy related adverse effects .
nineteen patients ( 49% ) had stable disease that lasted for more than 5 months ; preliminary median progression
target 3 . the third approach of tt is simultaneous blockage of the domains of tyrosine kinase receptors and intracellular tyrosine kinases .
it is proved that the drug inhibits the intracellular kinases ( b raf , mutant b
raf , c raf ) and the receptors , located on the surface of cells ( kit , flt3 , ret , vegfr13 and pdgfr beta ) . in 2006
ratain m. et al . published the results of sorafenib efficacy in the therapy of patients with mrcc resistant to cytokine therapy .
after 12 weeks of therapy , tumour regression was documented in 40% of patients ; stabilization of the disease was documented in 29% of patients . by week 24 of therapy there was a longer progression free survival in the group of sorafenib compared to placebo ( 50% and 18% , respectively ) .
pfs was 23 and 6 weeks , respectively . in december 2005 , sorafenib was approved by fda and recommended as therapy for advanced rcc .
sunitinib ( sutent , pfizer ) is an inhibitor of multikinases , blocking the vegfr , pdgfr , kit , ret , csf1r and flt3 receptors . in 2008
, robert figlin have presented the final stage results of this drug studies : orr = 3947% ; pfs = 11 months ; os = 26 months . in 2006
the drug was approved by fda , as a first line therapy for clear cell mrcc .
tissue markers expression , such as ca9 , cd31 , cd34 and vegfr1/2 in the primary tumours of metastatic ccrcc patients might serve as predictors of a good response to sunitinib treatment .
orr to sunitinib is higher , and metastatic sites were few in patients with low immature blood vessel ratio ( ibvr ) .
thus , ibvr should be considered as a very useful prognostic factor to make an estimate in sunitinib treatment in patients with mrcc .
acquired resistance to sunitinib in human renal cell carcinoma cells is mediated by constitutive activation of signal transduction pathways associated with tumour cell proliferation .
the maintained phosphorylation of several types of protein kinases during the treatment with sunitinib may be involved in the acquisition of resistant phenotype in rcc cells to this agent ; therefore , it would be worthy to further investigate the significance of agents inactivating either protein kinases , such as ly294002 , as possible candidates for overcoming resistance to sunitinib in patients with rcc .
sunitinib and sorafenib can be safely given to patients with renal insufficiency , providing there is adequate monitoring of renal function . for those patients developing an increase in blood creatinine levels ,
dose modifications may be required in order to allow continuation of therapy . in 2009 ,
tim eisen presented the results of a stage ii clinical study of a novel multi
targeted drug regorafenib ( bay 734506,stivarga , bayer ) . like the above drugs ,
regorafenib is targeted at angiogenesis due to the blockade of vegfr13 , tie2 , pdgfr
beta , and cell proliferation by inhibiting the oncogenic raf , ret and c kit tyrosine kinases . by the time of presentation , 81% of patients were found to have stabilization ( 50% ) or regression ( 31% ) of the disease .
related adverse events were registered in 35% of all patients , including hand and foot skin reaction ( 33% ) , diarrhoea ( 10% ) , renal failure ( 10% ) , fatigue ( 8% ) , hypertension ( 6% ) , cardiac ischaemia or infarction ( 4% ) , hypomagnesaemia ( 2% ) , and pain in the chest or thorax ( 2% ) .
another experimental multi targeted drug cediranib ( azd 2171 ; recentin , astrazeneca ) demonstrated antitumour activity in various forms of cancer , including rcc , in preclinical studies . in a preliminary report of a single arm phase ii study of cediranib in treatment naive rcc ,
12 out of 32 evaluable patients ( 38% ) had a partial response , and 15 patients ( 47% ) had stabilization of disease , yielding a benefit rate of 85% . in a randomized , double blind phase
at 12 weeks , the investigators noted a highly significant difference in mean percentage change in tumour size between the study and control groups ( 20% vs. + 19% , p < 0.0001 ) .
of the 18 patients in the placebo arm , 14 crossed over to cediranib ; of these 14 patients , 10 had tumour reduction . in the cediranib arm ,
nintedanib ( bibf 1120 , vargatef , boehringer ingelheim ) , is a triple tyrosine kinase inhibitor of vegfr13 , pdgfr/ , and fgfr13 , as well as ret and flt3 , and demonstrated similar efficacy to sunitinib ( pfs ( median : 8.44 vs. 8.38 mo ; hazard ratio : 1.16 ; 95% ci : 0.711.89 ; p = 0.56 ) ; os ( median : 20.37 vs. 21.22 mo ; p = 0.63 ) ) .
it possessed a manageable safety profile , including a lower incidence of dermatologic adverse effects vs. sunitinib .
in addition , nintedanib was not associated with qt prolongation ( grade 3 adverse effects occurred in 47% of nintedanib treated patients and 56% of sunitinib treated ) .
temsirolimus ( torisel , wyeth pharmaceuticals ) is a specific blocker of mtorc1 .
administration of temsirolimus causes arrest of mtorc1 synthesis , decreases levels of vegf and pdgf , thereby halting angiogenesis and tumour progression .
it has been proven that the efficacy and safety of temsirolimus monotherapy is higher than in combination with ifn or bevacizumab .
pfs in monotherapy of non clear cell forms of mrcc is 3.8 months , os = 10.9 months .
the benefit of temsirolimus compared to ifn was significant in the group of patients with non clear cell histology . in this population ,
the median os was 11.6 months with temsirolimus and 4.3 months with ifn ( hr 0.49 ; 95% ci : 0.290.85 months ) ; median pfs , based on independent assessment , was 7.0 months with temsirolimus and 1.8 months with ifn ( hr 0.38 ; 95% ci : 0.230.62 months ) .
temsirolimus has been registered by fda and emea in 2007 ; this is a first line agent in therapy of non clear cell forms of mrcc and rcc with high degree of risk for disease progression .
recent investigations confirm that activation of the signal transduction pathway via mtorc2 , but not via mtorc1 , may play an important role in the acquisition of resistance to temsirolimus in rcc , through the constitutive activation of akt and mark even after treatment with temsirolimus .
everolimus ( afinitor , novartis ) is a rapamycin derivative , a drug with immunosuppressive and anti
angiogenic actions , specifically targeted at the blockage of mtorc1 . in 2008 motzer r. et al . published the results of a phase iii clinical trial of everolimus efficacy in patients with mrcc , in whom the administration of sorafenib or sunitinib failed to demonstrate clinical improvement , or there was renewal of tumour progression after prior improvement .
orr = 26% , pfs = 4.0 months as opposed to 1.9 months in the placebo group . in 2009
the drug was registered by fda and emea and recommended for the treatment of mrcc in cases of low efficacy of sorafenib and sunitinib , as well as in loss of the therapeutic effect thereof . in 2010 ,
casciano r. et al . in 2010 reported on the results of an indirect comparative efficacy study of everolimus and sorafenib in the therapy of sunitinib refractory patients .
the study included 98 patients ; 46 of these received everolimus and 52 received sorafenib . in the group of everolimus , pfs was equal to 40.8 weeks , os = 78 weeks ; in the group of sorafenib pfs = 17.7 weeks and os = 32 weeks .
everolimus is effective in the treatment of large angiomiolypomas ( aml ) in patients with subependymal giant cell astrocytoma ( sega ) associated with tuberous sclerosis complex ( tsc ) .
this treatment demonstrates efficacy in reducing aml lesion volume in patients with sega associated with tsc who also presented with aml .
aml downsizing > 50% were seen only in everolimus treated patients ( 56.5% , 78.3% , 80% ) compared with placebo treated patients ( 0% at each time point ) at week 12 , 24 , and 48 , respectively .
it may offer a pharmacological treatment option for patients with tsc and concomitant aml and sega . in 2010
asco developed the algorithm for assigning targeted drugs depending on the histological type of rcc and the risk of disease progression according to motzer r. , 1999 [ 46 , 47 ] . by generalizing the recommendations of asco and the results of recently finished and ongoing studies , which have demonstrated a positive clinical effect , modern approaches to drug therapy of rcc
the algorithm of sequential targeted drugs administration in rcc treatment moderate drug activity the research is ongoing ; bev bevacizumab ; ril recombinant interleukin ; tki tyrosine kinase inhibitors ; ct cytokine therapy in addition to the above drugs , a number of experimental agents have been synthesized , which are currently in initial stages of efficacy studies in rcc .
studies on the efficacy of osi027 and azd8055 , both novel mtor inhibitors , have been initiated .
the action of these drugs is simultaneously directed on the blockade of both mtorc1 and mtorc2 complexes .
the same mechanism of action is also appropriate to a new class of mtor inhibitors , the torkinhibs , which have been developed recently .
their specific association on the atp site of the mtor molecule allows a more comprehensive inhibition of the pathway and their superiority over rapalogs has been reported recently in a pre clinical trials .
the pre clinical trial revealed a superiority of the novel dual mtor inhibitor ink128 vs. temsirolimus and placebo , to control rcc tissue slice graft growth rate : ink128 was significantly superior to placebo in the three arms containing 20 , 12 and 9 mice , respectively ( p = 0.012 , 0.005 , 0.01 ) .
ink128 was significantly superior to temsirolimus in the first cohort ( p = 0.012 ) , superior but not significant in another cohort ( p = 0.77 ) , and not compared to temsirolimus in the third cohort .
bortezomib ( ps341 , velcade , millenium pharmaceuticals inc . ) is a highly selective reversible inhibitor of 26s proteasome , a modified boric acid . as a consequence of inhibition of the proteolytic effects of the proteasome
apoptosis factors , the molecules of inflammation mediators and the molecules of cellular adhesion , as well as cytokines that facilitate tumour growth .
the influence of the product on the course of rcc is an object of ongoing research .
the combination of bortezomib and pan deacetylase inhibitor panobinostat can induce drastic apoptosis and anable to inhibit renal cancer growth synergistically .
this combination would kill cancer cells effectively by inhibiting the degradation of oncogenic proteins and thereby inducing endoplasmic reticulum stress and ubiquitinated protein accumulation .
there is currently ongoing research concerning the efficacy of a combination of sunitinib and an autologous tumour vaccine ags003 ( argos therapeutics ) , developed from tumourous cells of an individual patient .
ags003 is a highly specific product consisting of dendritic cells , tumour antigen and cd40 , the molecule stimulating immune response . in march 2010 , theodora logan presented the results of an efficacy study of a vaccine in patients with metastatic rcc , diagnosed a few months after nephrectomies for localized rcc . given that most subjects were patients with medium or high risk of disease progression , the results obtained can be considered quite encouraging .
orr = 40% , whereas pfs in the group of ags003 was 5.6 months , compared to the known indices of pfs after application of ifn in similar cases of 5.1 months in moderate risk patients and 2.5 months in high risk patients .
the accumulated experience of using anti angiogenic drugs in rcc treatment demonstrates that neoangiogenesis and tumour progression resume on the average in 1012 months of monotherapy , in spite of continued tt . however , there is no cross resistance of tumourous cells to representatives of various groups of target drugs .
therefore the development of schedules of sequential treatment or combination tt remains a current challenge that allows an extended css in some rcc patients up to 2529 months : now there are numerous officially approved and experimental targeted drugs available . aside from survival terms , the patient 's quality of life is an important factor that influences drug choice . as noted by dr .
motzer , pazopanib and sunitinib are similarly effective in first line treatment of metastatic renal cell carcinoma . for both drugs , the median progression
an interim analysis found median overall survival was 28.4 months with pazopanib versus 29.3 months with sunitinib ( hr = 0.908 ; p = 0.275 ) .
independent review found that objective response rate was 31% with pazopanib versus 25% with sunitinib ( p = 0.032 ) . in terms of health related quality of life , 11 out of 14 domains favoured pazopanib over sunitinib .
both drugs resulted in side effects , but fatigue and skin sores , occurred with less frequency for pazopanib than with sunitinib , the researchers found .
the quality of life questionnaires were in favor of pazopanib over sunitinib , and suggested improved tolerability for pazopanib over sunitinib , dr . motzer sumarized .
thus , tolerability should be considered as an important factor influencing the choice of the targeted drug .
there are two current options for initiation of targeted therapy : before surgery or in the postoperative period .
neoadjuvant administration of tt facilitates reducton in the size of tumour and its metastases , which facilitates subsequent removal . also , in a pronounced effect of tt , a revision of planned surgical tactics is possible , with inclination towards organ sparing surgery .
such therapeutic tactics probably could produce reduction of microscopic metastatic foci and prevent intraoperative dissemination of the disease as a result of angiogenesis blockade .
neodjuvant sunitinib use in 12 patients with locally advanced or centrally located tumours for 4 weeks , followed by a washout phase of 2 weeks before nephron sparing surgery , decreased the primary tumour size with a mean reduction in maximum diameter of 21% .
patients with renal cell carcinoma and imperative indication for renal sparing options may benefit from tumour downsizing by targeted therapies . especially patients with tumours in the range of 57 cm are of interest , because a reduced size may make them eligible for ablative techniques .
smaller tumour size ( < 5 cm ) was related to more effective shrinkage , with median downsizing of 34% ( from 46% to + 11% ) . in the second group ( 57 cm )
in this group 8/22 ( 37% ) reduced into a range of 2.34.7 cm in which ablative techniques are feasible and nephron sparing surgery may benefit from the reduced size .
in tumors sized 710 cm , median downsizing was 14% ( from 39% to + 2% ) . in the group with tumours
> 10 cm median downsizing was 9% ( from 31 to + 8% ) . according to karakiewicz p.i .
, it is possible to downstage inferior vena cava thrombi with targeted drugs administration . in another retrospective study , cost n.g .
et al . , 2011 , the effect of neoadjuvant therapy on vena cava tumour thrombi was also evaluated : 12 patients received sunitinib , 9 received bevacizumab , 3 received temsirolimus , and one patient received sorafenib .
opposite to previous research , analysis revealed minimal effect on the tumour thrombus level and failed to demonstrate a significant impact on the surgical approach .
a substantial disadvantage of the above tactics is disease progression in cases of low tt efficacy with subsequent expansion of the volume of surgical intervention . in a certain number of patients adverse actions of targeted drugs ( hypertension , vomiting , diarrhoea , changes in blood rheology )
deteriorate the course of the postoperative period , complicate wound healing , and may cause haemorrhages and thromboembolism .
the research of jakub kcz et al , 2013 , demonstrates that there is no scientific proof that neoadjuvant targeted therapy may significantly reduce the stage and size of a tumour in large renal tumours . at the same time
authors consider that the removal of the tumour in disseminated disease is only justified in patients with a condition suitable for targeted adjuvant treatment .
the advantages of adjuvant tt are : reduction of cancer intoxication immediately after tumour removal , a possibility for detecting the histological type of the tumour and the degree of nuclear atypia , which allows informed selection of the relevant target drug and predicting its efficacy .
surgery and the postoperative period are not complicated by possible adverse effects of tt . however , immediate tt is impossible in the above tactics since , taking into consideration the possible adverse effects of the drugs , tt can be started only after postoperative wounds heal . currently there is no unanimous understanding concerning the timing of tt and surgical treatments for rcc .
undoubtedly , in cases when the patients present with hematuria , significant tumour intoxication and high risk for surgical complications against the background of tt , the treatment should be started with surgical intervention , followed by pharmacological therapy .
due to the enhanced immune response against the background of ags003 administration , it was logical to expect the favourable efficacy of adjuvant combination therapy using anti angiogenic drugs .
adjuvant treatment with an ags003 + sunitinib combination after nephrectomies in 22 patients with mrcc demonstrates an orr of 81% , and pfs 12.5 months .
adjuvant therapy by girentuximab in 286 patients with locally advanced rcc improved a median of 5 years disease
free survival by over 50% , compared to a placebo group ( 73.6 vs. 51.2 months ) . due to a high price in the majority of targeted drugs , it is actually a problem of cost saving treatment .
a cost minimization analysis of bevacizumab + ifn or sunitinib alone in mrcc treatment was performed , focusing on survival terms and direct medical costs only ( drugs , administration and management of adverse events ) .
the analysis compared the cost of bevacizumab ( 10 mg / kg ) plus ifn ( 9 , 6 or 3 million iu [ miu ] ) versus sunitinib ( 50 mg ) as first line therapies for advanced or metastatic clear
the efficacy profiles of bevacizumab + ifn or sunitinib alone have been shown ( indirectly ) to be similar in patients with rcc ; indeed , median pfs with either treatment is in the 10 to 11month range . assuming a pfs of 11 months for these options , bevacizumab + ifn ( 9 miu ) would be a lower cost strategy ( cost savings of 2,052 per patient ) than sunitinib . the cost advantages for bevacizumab would increase in parallel with a reduction in ifn dosing ; for example , with ifn 6 miu the corresponding cost savings would be 4,185 , and with 3 miu the cost advantage would be 6,320 per patient .
thus , bevacizumab + ifn cost saving alternative to sunitinib as the first line treatment of metastatic rcc .
thus , the results of using targeted therapy demonstrate the promising prospects of conservative treatment for metastatic rcc . under the influence of tt ,
patients previously considered to be hopelessly ill demonstrated clinically significant reversal of the disease with an improved quality of life .
a number of unresolved issues have to be conceded , such as the ability of certain tumours to adapt to tt , insignificant progress in the treatment of non clear cell rcc , and the high costs of drugs , which limits their wide application .
however , taking into consideration the substantial progress in the studies of rcc cancerogenesis , it is obvious that growth factors , their receptors , tyrosine kinases , hif , mtor as well as the processes regulated by these substances , will continue to be viewed as principal targets of pharmacological therapy for renal cell carcinoma .
the following general regularities concerning selection of targeted therapy and predicting its efficacy can be formulated : targeted therapy does not exclude surgical treatments in rcc , but rather appends them , whenever removal of the primary tumour and/or metastatic foci is feasible .
there are studies indicating the expediency of neoadjuvant and adjuvant tt.in most cases targeted drugs are effective in the treatment of clear cell mrcc . only temsirolimus and partially sorafenib / sunitinib demonstrate their efficacy in the treatment of non clear cell forms .
related adverse events are common among the patients receiving tt , with serious adverse events forcing the rejection and stoppage of targeted drug utilization.usually , after 1012 months of monotherapy , despite continued administration of vegf targeted drugs , angiogenesis and tumour progression resume .
that is why the schedules of sequential administration of anti angiogenic drugs of various directions , as well as options of combination tt are currently under development.in the era of individualized medicine , every rcc patient should be completely informed and given the option to choose a targeted drug .
tolerability is an important factor influencing the drug choice.presented scheme of rcc targeted therapy enables the classification of numerous drugs that are used in kidney cancer treatment , helps to imagine cell localization of the key targets , and contributes to further understanding the ways of angiogenesis inhibition .
targeted therapy does not exclude surgical treatments in rcc , but rather appends them , whenever removal of the primary tumour and/or metastatic foci is feasible .
targeted drugs are effective in the treatment of clear cell mrcc . only temsirolimus and partially sorafenib / sunitinib demonstrate their efficacy in the treatment of non clear cell forms .
related adverse events are common among the patients receiving tt , with serious adverse events forcing the rejection and stoppage of targeted drug utilization . usually , after 1012 months of monotherapy , despite continued administration of vegf targeted drugs , angiogenesis and tumour progression resume .
that is why the schedules of sequential administration of anti angiogenic drugs of various directions , as well as options of combination tt are currently under development . in the era of individualized medicine ,
every rcc patient should be completely informed and given the option to choose a targeted drug .
presented scheme of rcc targeted therapy enables the classification of numerous drugs that are used in kidney cancer treatment , helps to imagine cell localization of the key targets , and contributes to further understanding the ways of angiogenesis inhibition . | introductionrenal cell carcinoma ( rcc ) is a widespread oncourological disease with a tendency towards a slow increase of incidence . in the recent decade ,
there has been development of numerous effective drugs targeted at different molecules that play a dominant role in rcc carcinogenesis .
understanding of rcc carcinogenesis confirms the key role of angiogenesis in maintaining the viability of renal tumours and their metastases.material and methodswe aimed to systemize numerous medicines , used to inhibit the angiogenesis in patients with advanced rcc according to their targets , and to analyze their efficacy.resultsthere are roughly four main mechanisms of action of the targeted drugs : blockade of circulating extracellular vegf molecules.the selective blockade of tyrosine kinase receptors domains.the simultaneous blockage of the tyrosine kinase receptors domains and intracellular tyrosine kinases.the blockade of mammalian target of rapamycin ( mtor ) which is responsible for support of vital functions of cancer cells .
in addition to fda officially approved drugs , numerous experimental agents have been synthesized , which are currently on initial stages of clinical studies in rcc treatment.conclusionsthe results of the currently used targeted drugs demonstrate perspectives of metastatic rcc conservative treatment , that are able to prolong cancer specific survival in previously doomed patients for up to 29 months .
the development of schedules for sequential treatment or combination targeted therapy remains a current challenge .
the quality of life is an important factor that influences remedy choice .
the advantages and disadvantages of neoadjuvant and adjuvant targeted therapy are currently being intensively discussed . | Introduction
Material and methods
Results
Conclusions
Features and key molecules of RCC carcinogenesis
DISCUSSION
CONCLUSIONS |
null | the four processes involved in the flammability of materials are described and related to the various flame retardance mechanisms that may operate . following this
the four practical approaches used in improving flame retardance of materials are described .
each approach is illustrated with a number of typical examples of flame retardants or synthetic procedures used .
this overview of flammability , flame retardance , and flame retardants used is followed by a more detailed examination of most of the plastics manufactured in the united states during 1973 , their consumption patterns , and the primary types of flame retardants used in the flame retardance of the most used plastics .
the main types of flame retardants are illustrated with a number of typical commercial examples .
statistical data on flame retardant market size , flame retardant growth in plastics , and price ranges of common flame retardants are presented.imagesfigure 1.figure 2.figure 3.figure 4 . | Images |
together with myringotomy or tympanocentesis , tympanostomy tube insertion ( tti ) has been one of the most commonly performed otologic surgical procedures in children . when a child is unable to stay calm during minor otologic surgery , most otologic surgeons typically choose general ( intravenous or endotracheal ) anesthesia .
young children who receive general anesthesia often have bad experience such as delirium and agitation when they wake up . following sedation or general anesthesia , prolonged drowsiness , paradoxical hyperstimulation , gastrointestinal upset , and
serious hazard , such as hypoxia , may be as high as 11% in children sedated with oral chloral hydrate and 17% in children sedated with intravenous pentobarbital .
these unwanted reactions may increase the risk of anesthesia - related injury to the child and decrease the parent 's satisfaction with the care their child is receiving . during the surgery ,
the type and dosage of anesthetic drugs is decided and administered by the anesthesiologist at an operating room .
however , the type of anesthesia method is decided by the otologic surgeon in most clinical situation , before a child enters into the operating room .
even though the otologic surgeon contacts the anesthesiologist before the procedure , it is not sure what basis they can choose the anesthesia method for each individual . on what basis
the choice of best anesthesia is not simple for the patient , surgeon , and anesthesiologist because each of them has own objectives for the outcome of the operation as well as anesthesia .
otologic surgeon or anesthesiologist is faced with the task of choosing the best anesthesia method for a child having a minor otologic surgical procedure as well as his / her parent .
the factors influencing this decision are different for every patient and surgeon or anesthesiologist , limiting usefulness of standardized guideline .
types of anesthesia are classified into local , and regional ( such as caudal epidural block ) , and general anesthesia . for general anesthesia , an anesthetic drug
is administered either by inhalation through a breathing mask or endotracheal tube , or by injection through an intravenous line .
this review considers how otologic surgeon or anesthesiologist can choose the appropriate anesthesia method for a child having a minor otologic surgical procedure , balancing relative importance between objectives of the patient / parent and medical doctors .
to choose the anesthetic method for minor surgical procedure in a pediatric population , clinicians should consider more aspects than in the cases of adult patients .
the concerns about which anesthesia is appropriate for a child have been addressed in the field of dentistry . especially in the uk
, tooth extraction under general anesthesia has been a routine treatment option for young children and guidelines for the use of sedation and general anesthesia was published for safe sedation and anesthesia . for minor surgical procedures , such as tti or tooth extraction , it is important for clinicians to ensure that children receive effective pain control from the start to end of the surgical procedure . to achieve this purpose , clinicians can use a range of techniques , comprising four : behavioral / psychological techniques , local anesthesia , sedation , and general anesthesia .
most textbook stated that general anesthesia is required to children for tti through intravenous or masked inhalational anesthesia .
general anesthesia for minor surgical procedures in children can be a good option for clinicians or parents .
however , this option can be limited because of morbidity , limits of service provision and medical cost . in most countries ,
the limitation of health care service provision has increased because of many legal and ethical considerations to keep safe sedation and general anesthesia .
the increase in general anesthesia induces excessive pre - procedures assessment or consultation ; leads to the referral from a clinic to a hospital ; requires more use of health care services and medical resources ; and inevitably results in the increase of health care costs and social burdens .
if clinicians decrease the rate of general anesthesia , social or national burdens on health care costs will be lightened .
the author reported that total medical costs can be decreased 2- to 3-fold , and patient charges can be decreased 1.5- to 2-fold in south korea , when outpatient tti is performed under local anesthesia rather than general .
this suggestion was supported by reports of other country , which has different medical insurance systems from south korea .
shiley , et al . reported that average hospital charges were significantly about 4 times higher for general anesthesia in the usa .
generally , universal indications for general anesthesia can be classified in three main groups : 1 ) patients having special medical problems , 2 ) patients needing extensive surgical procedures , and 3 ) patients who do not cooperate . patients with medical problems tend to be contraindicated for general anesthesia but some patients may be risky to operate them in the usual way .
representative examples are mental problems , uncontrollable epilepsy or uncontrollable motor problems , which makes it impossible even for adult patients to collaborate the surgery .
is the minor surgical procedure in a child really included into the indication for general anesthesia ?
is all of children indicated for general anesthesia , even for the minor surgical procedure , such as tti ?
the main reason for a surgeon to prefer general anesthesia for pediatric tti is children 's uncooperation and irritability .
once a child gets the fear or phobia before the procedure starts , further surgical procedure is impossible in most cases .
this is because of a physical or mental immaturity , but not because of invasiveness of the surgical procedure itself .
actually , local anesthesia can achieve enough pain control for younger children to get minor surgical procedures , including tti .
but local infiltrative anesthesia is not suitable for children because anesthetic procedure itself hurts a child a little bit .
once after a child feel any pain or even discomfort , any further treatment will be rejected violently and any other type of control will be impossible . for local infiltrative anesthesia ,
the anticipation of receiving a shot tends to increase anxiety in children and even seeing a needle in a medical setting may make younger children cry or agitated
. contrary to adult patient who are willing to endure minor discomfort of the injection , younger children do not have the ability to do this .
therefore , local topical anesthesia , together with behavioral / psychological techniques is appropriate for younger patients .
the author usually uses a 10% xylocaine solution to get effective topical anesthesia for minor otologic surgeries at outpatient clinic . before anesthesia , the ear canal
this step is very important because the crust or ear wax hinders the anesthetic drug from contacting with the skin of the ear canal as well as tympanic membrane .
small cotton ball is then inserted into the ear canal in contact with the tympanic membrane .
after 1520 minutes , the xylocaine solution is sucked out by a microsuction and the cotton ball is removed by microforceps . during the procedure , it is important for xylocaine not to enter the middle ear cavity because it enter the perilymph of the inner ear through round window membrane , paralyzes the peripheral vestibular afferent neurons and induces unilateral vestibular loss . even though this vestibular suppressing effect disappears gradually over time , the patient suffers from severe vertigo and disequilibrium at least for several hours .
the author 's report demonstrated that tti could be performed successfully under local topical anesthesia for children aged 5 years and older .
it also showed that most children did not feel any pain at the time of myringotomy or tube insertion because author 's anesthesia method controlled pain enough .
however , some children complained excessively annoying or startling noise while middle ear effusion was sucked out and fullness sensation or vague discomfort while the tube was inserted and pressed a tympanic membrane medially . despite of deep analgesia provided by local anesthesia , clinicians should always consider the psychological aspects of pain .
even though the pain disappears , younger children may focus their attention on other feelings or noise and misperceive them as
pain . therefore , behavioral / psychological management before the procedure is needed to handle of it : clinicians and nurses should try to explain and calm down a child before the procedure starts .
these discomforts can be controlled enough by behavioral / psychological techniques and do not interrupt the completion of tti under local anesthesia . to my experience ,
the youngest child who underwent tti under local anesthesia was a 36 month - old boy .
one of them is psychological relief of children and their parent before as well as after the minor otologic surgical procedure .
local topical anesthesia can provide appropriate analgesia , which gives ideal psychological conditions to recovering children and indeed their parents . because an alert , calm , and cooperative child is less likely to interfere with postoperative dressings , postoperative workload for the parent and nurses
the other benefit is that it can be used when general anesthesia is contraindicated , considered technically difficult or associated with increased morbidity and mortality .
local anesthesia can avoid a long wait for an operation schedule as well as excessive preoperative assessment including consultations . as mentioned above
, local anesthesia can save medical resources in a hospital and reduce resultant health care costs .
minor but very real benefit of local anesthesia is that it may remain good memory of surgery and anesthesia to a child . for younger children , to be awoken in a foreign environment , surrounded by strangers may be bad experience . children who undergo early painful experiences related to tti are likely to exhibit negative behavior during postoperative follow - up .
this review suggests that minor surgical procedures such as tti can be successfully performed under local topical anesthesia in pediatric population .
compared with general anesthesia in pediatric population , local anesthesia can give psychological relief to children and their parent during the surgical procedure as well as postoperative care .
it can make the medical service providers easier for the operation schedule and allocation of medical resources .
the author hopes that the otologic surgeon chooses the anesthesia method comprehensively for children who get the minor otologic surgery .
clinicians should not blindly choose general anesthesia for the minor otologic surgical procedures merely because the patient is younger children . | the use of general ( face - mask inhalation and intravenous ) anesthesia has been the method of choice for tympanostomy tube insertion in children . however , there is no exact guideline for the choice of anesthesia method and there is no evidence to support the use of one anesthesia method over another .
clinically , the anesthesia method used to be decided by old customs and the surgeon 's blind faith that children can not bear tympanostomy tube insertion under local anesthesia .
clinicians should keep in mind that pediatric anesthesia has a potential risk . despite infrequent serious complications ,
their seriousness necessitates that sedation or general anesthesia should be done by an anesthesiologist and thus children requiring tympanostomy tube insertion should be referred to secondary or tertiary hospitals , even if they have been followed by a primary care physician for a long time .
previous evidence showed that local anesthesia is appropriate for tympanostomy tube insertion in selected children , especially in children older than 5 years are older .
proper choice of anesthesia method is helpful for both patient and medical service provider .
local anesthesia can give psychological relief to children and their parent .
it is easier for the medical service providers to schedule the operation and allocate the medical resources in their hospital .
local anesthesia can reduce individual , social , and national burdens for the health care services . | Introduction
General Anesthesia for Minor Surgical Procedure in Children
Disadvantages of General Anesthesia for Minor Surgical Procedure
Local Topical Anesthesia for Minor Surgical Procedure in Children
Advantages of Local Anesthesia for Minor Surgical Procedure in Pediatric Population
Conclusion |
stress is defined as any condition that seriously disrupts
physiological and psychological homeostasis ranging from anxiety to
posttraumatic stress disorder , and affects cognitive functions both in
animal models and in humans [ 24 ] .
the hippocampus is of special significance
in this respect because it has been shown to play a major role in regulating
stress [ 5 , 6 ] , and to be involved in some aspects of learning and memory [ 713 ] . at present , long - term potentiation ( ltp ) of synaptic
transmission in the hippocampus
is the most studied neurophysiological model
for learning and memory processes in the mammalian nervous system .
depending on the type of stress and
the procedures used , stress has been shown to have different effects on
different measures of synaptic plasticity .
there is a general agreement that
ltp in area ca1 of the hippocampus is impaired following stress [ 4 , 1418 ] .
some studies have also shown that stress impairs ltp in the dentate
gyrus ( dg ) of the hippocampus [ 16 , 19 , 20 ] , while others reported intact ltp
in the dg following stress [ 14 , 21 ] .
thus , dg ltp is considered to be less
sensitive to stress compared to ltp in ca1 .
although ltp is a widely accepted model of learning and
memory , debates continue over its validity , and controversial results regarding
its behavioral correlates are reported ( for review , see ) .
a different
level of processing that is likely to be relevant to memory formation is local
circuit activity . when examining this level of processing , the focus is on
interactions between local , mostly inhibitory gabaergic neurons and pyramidal
or granular principle cells in the hippocampus and cortex [ 24 , 25 ] .
this is
in contrast to the focus on ltp of input excitatory synapses onto principle
cells , which is responsible for transmitting information from one region to
another .
inhibitory interneurons exert a powerful control over local circuit
activity through feedforward and feedback inhibition .
modification of local
circuits can affect the computational properties of the region , and therefore
affect its involvement in behavior .
in the current study , local circuit activity and plasticity
were measured by using frequency - dependent inhibition ( fdi ) and commissural
modulation protocols , following exposure to behavioral stress .
fdi is suggested to reflect gaba - mediated inhibition by
perforant path- ( pp- ) activated interneurons onto granule cells .
increasing stimulus frequency from 0.1 hz to 1.0 hz results in the reduction of
the population spike ( ps ) of the field potential response to stimulation of the
pp . our lab has previously shown that fdi in the dg is nmda - dependent
, gaba - mediated , and that delivering theta - burst stimulation ( tbs ) to the
pp of the hippocampus induced a lasting reduction in fdi .
the dg commissural pathway is activated by stimulating the
contralateral dg at different intervals prior to pp stimulation .
stimulation of
the commissural pathway induces a biphasic , inhibitory / excitatory effect on
granule cell responsiveness to pp stimulation .
although the effect of behavioral stress on induction of
hippocampal ltp has been studied extensively , to our knowledge no research has
established the relationship between stress and local circuit activity and
plasticity .
the current study addresses this issue in order to further explore
the potential relevance of local circuit activity to learning and memory .
our
aim in this study was to characterize local circuit activity and plasticity in
the dg of the hippocampus following exposure to behavioral stress .
adult , male sprague dawley rats , weighing 240330 g , from harlan
( jerusalem , israel ) maintained five per cage on a 12-hour light / dark cycle
with water and laboratory rodent chow ad libitum .
trunk blood was collected following decapitation and
samples were centrifuged at 3000 r.m.p . for 20 minutes at 4c .
corticosterone was measured using a radioimmunoassay kit
( coat - a - count , diagnostic products corporation , los angeles , calif , usa ) .
rats were anaesthetized ( 6% chloral hydrate in 100 ml
saline ; 0.5 ml/100 g. ip ) and prepared for acute stimulation of the
perforant path and for recording of field potentials in the dentate gyrus as
described before .
rats were placed in a head holder in a
stereotaxic frame and small holes were drilled in the skull to allow the
insertion of electrodes in the brain .
a recording microelectrode ( glass , tip
diameter 25 m filled with 2 m nacl , resistance 14 m ) was placed in the dentate gyrus ( coordinates : 4 mm posterior to bregma , 2.5 mm lateral to midline ) .
a bipolar 125 m stimulating electrode was implanted in the ipsilateral
angular bundle to stimulate the perforant path ( coordinates : 8 mm posterior to bregma , 4 mm lateral to midline ) .
the
depth of the electrodes was adjusted to maximize the size of the evoked
positive - going excitatory postsynaptic potential ( epsp ) recorded in the hilus
of the dentate gyrus .
evoked responses were digitized
( 10 khz ) and analyzed using the cambridge electronic design 1401 + and its
spike2 software .
offline measurements were made of the amplitude of the ps and
the slope of the epsp using averages of 5 successive responses to a given stimulation
intensity applied at 0.1 hz .
test stimuli ( monopolar pulses , 100-microsecond duration ,
intensity adjusted to yield a ps of 3050% of the maximal pretetanus value )
were delivered at 0.1 hz .
after positioning the electrodes , the rat was left
for 20 minutes before commencing the experiment . during recording the rats were
maintained at 37 1c with a homeothermic blanket system ( harvard ) .
ltp was induced by a tbs ( 3 sets of 10 trains ,
each consisting of 10 pulses at 100 hz .
intertrain interval : 200 milliseconds ,
and the interval between each set : 1 minute , trains are delivered at 2x test
stimulus intensity ) .
ltp was measured as the difference in epsp
slope before and 60 minutes after tbs .
we defined ltp as an increase of the least 20% in the epsp slope of the
evoked potentials 60 minutes after application of tbs .
to determine fdi , 10
pulses were delivered at 0.1 hz followed by 10 pulses at 1.0 hz , as described
before .
the ps or epsp slope of the 10 responses at 0.1 hz were averaged and compared to the 10
responses at 1.0 hz in each set .
inhibition is expressed as an fdi index which was assessed by dividing the
averaged response at 1.0 hz by the averaged response at 0.1 hz . the dg commissural
pathway was activated by stimulating the contralateral dg at different
intervals prior to pp stimulation ( 15 , 30 , 80 , and 150 milliseconds ) as
described before .
stimulation of
the commissural pathway induces a biphasic inhibitory / excitatory effect on
granule cell responsiveness to pp stimulation [ 31 , 32 ] .
commissural - induced modulation is expressed by commissural
index which was evaluated as the ratio of the size of the response to pp stimulation
after commissural stimulation divided by that of the response to pp stimulation
with no priming stimulation . in order to measure tbs - induced alterations on frequency - dependent
inhibition or on commissural - induced inhibition and facilitation
, the
stimulation intensity following the induction of ltp was adjusted to yield a ps
size comparable to pre - tbs level .
apparatusthe maze employed is a four - armed
black opaque plexiglas platform , elevated 50 cm above ground .
two opposite arms are
enclosed by 40 cm high plexiglas walls on both sides and on the outer edges of the platform , that
is , closed , while the two remaining opposite arms are open , and are
surrounded only by a 1 cm high plexiglas rim , which serves as a tactile guide to animals in the open
areas .
individual rats were placed
in the central platform , faced towards different arms in randomized order .
the maze employed is a four - armed
black opaque plexiglas platform , elevated 50 cm above ground .
two opposite arms are
enclosed by 40 cm high plexiglas walls on both sides and on the outer edges of the platform , that
is , closed , while the two remaining opposite arms are open , and are
surrounded only by a 1 cm high plexiglas rim , which serves as a tactile guide to animals in the open
areas .
individual rats were placed
in the central platform , faced towards different arms in randomized order .
each
five - minute session was recorded using an overhead video camera connected to a
monitor / recorder in an adjacent observation room .
animals were placed in the
central platform and allowed to explore for five minutes .
animals were then
subjected to the acute swim stress procedure , and then allowed to rest for 90
minutes .
after the resting period animals were placed once again in the maze
for a five - minute poststress test .
animals were
scored as being in an open or closed arm only when all four paws passed over the
open / closed dividing line .
the water container used for the forced
swim procedure consists of a circular container of water ( 50 cm in diameter with a rim 75 cm high ) .
individual rats were subjected
to a single 15-minute swim session in the water container .
after this single
swim session , rats were allowed to dry in a resting cage for 30 minutes , and
then anesthetized and taken to electrophysiology .
in order to validate that
animals subjected to the acute swim stress procedure were indeed behaviorally
affected , we used the elevated plus maze test . a paired sample t - test revealed that in the poststress
session , animals spent less time in the open arms ( see figure
1(a ) , t(7 ) = 4.25 , p < .005 ) .
an independent t - test
revealed that stress was associated with a significant increase in
corticosterone levels ( see figure 1(b ) , t(13 ) = 4.29 , p <
the stimulation intensity used to elicit a baseline
response was not different between the control and stress groups ( t(25 ) = 0.93 , n.s . ) .
there was no significant difference between control and stressed rats in the
amplitude of the baseline ps ( t(25 ) = 1.44 , n.s . ) ) and fepsp slope ( t(25 ) = 0.26 , n.s . ) . upon altering the frequency of stimulation from 0.1 hz to
1.0 hz
, a marked reduction of the ps was observed in both control and stressed
rats as indicated by the fdi index ( see figure 2(a ) ) .
this
reduction was apparent prior to tbs application and 60 following it ( see figure
2(b ) , f(1,14 ) = 101.16 , p < .05 ) .
no significant differences in fdi index were
found between the two groups on both tests ( f(1,14 ) = 0.18 , n.s . )
although no main effect was observed for group under the
different conditions , the analysis of variance indicated a significant group x
test interaction ( f(1,14 ) = 6.53 , p < .05 ) .
the initial pre - tbs fdi
index of stressed rats was lower than that of controls whereas the post - tbs fdi
index was higher . altering stimulation frequency from 0.1 hz to 1.0
hz resulted
in a slight but significant reduction in the epsp slope in both groups . in
control rats ,
stimulation at 1.0 hz reduced the slope of the epsp to 0.850.05 of its size during stimulation at 0.1 hz ( t(7 ) = 11.49 , p < .
hz reduced the slope of the epsp to 0.880.02 of its size during stimulation at 0.1 hz [ t(7 ) = 3.66 , p < 0.05 ] .
there was no significant difference in epsp fdi between the two groups and , in
contrast to the ps , the application of tbs did not affect epsp fdi in either
group . in both control and
stressed rats , the response to the pp
stimulation was inhibited by priming stimulation of the commissural path at
interpulse intervals of 15 milliseconds and 30 milliseconds ( see figure 3(a ) ) .
when using the 15-millisecond interpulse interval , exposure to stress induced
significantly higher inhibition , as expressed by the small commissural index of
stressed rats compared to controls .
this increase in inhibition was apparent
before and after tbs application ( f(1,12 ) = 64.36 , p < .005 ) .
the
application of tbs did not cause any significant changes in commissural - induced
inhibition in either group ( f(1,12 ) = 0.126 , n.s ) ( see figures 3(b ) and 3(c ) ) . when priming stimulation of the commissural path at interpulse
interval of 30 milliseconds , stressed rats exhibited significantly higher
commissural - induced inhibition than control rats before and after tbs
application ( f(1,12 ) = 90.42 , p <
.001 ) , as seen in the 15-millisecond interpulse
interval . interestingly , both groups have shown a significant decrease in commissural - induced
inhibition following tbs application ( f(1,12 ) = 13.68 , p < .005 ) .
( see figures
3(b ) and 3(c ) ) . when using the 80-millisecond and 150-millisecond interpulse
intervals ,
the response to the pp stimulation was facilitated in both control
and stressed rats , as expressed by the
large commissural indexes . in both groups ,
commissural - induced facilitation was
significantly increased after tbs application ( 80 milliseconds : f(1,12 ) = 17.55 , p <
.005 ; 150 milliseconds : f(1,12 ) = 7.87 , p < .05 ) .
no differences were
found between the two groups before or after tbs application ( 80 milliseconds :
f(1,12 ) = 0.68 , n.s ; 150 milliseconds : f(1,12 ) = 0.057 , n.s ) .
sixty minutes following the application of tbs , there was a
clear potentiation of the slope of the epsp in control rats ( 38% 5.9 , t(13 ) =
6.38 , p < .001 ) and stressed rats ( 35% 9.3 , t(10 ) = 3.54 , p < .05 ) , compared
to pre - tbs levels .
the application of
tbs also resulted in an increase in ps amplitude in both groups ( control : 128%
32 , t(13 ) = 4.02 , p
< .005 ) ;
stress : 127% 38 , t(10 ) = 4.6 , p <
.05 ) .
no significant difference in ltp was found between the two
groups ( epsp - ltp : t(23 ) = 0.33 ; ps - ltp : t(23 ) = 0.93 , n.s ) ] ( see figure 4 ) .
in the present study , we have examined the effects of behavioral
stress on local circuit activity and plasticity in the dg .
we report that when
using fdi , this form of local circuit activity was reduced following the
application of tbs in both control and stressed rats . however , this reduction
in fdi plasticity was greater in the stressed rats compared to controls . when using commissural - induced modulation , inhibition was
significantly higher in stressed rats both before and after tbs at 15- and 30-millisecond
intervals . fdi results from direct afferent excitation of inhibitory
interneurons or of other cells that excite inhibitory cells [ 26 , 35 ] , and thus
provides a simple method for measuring local circuit activity mediated by
dentate interneurons .
in the present study , an attempt was made to find out
whether behavioral stress would have an effect on fdi activity and plasticity .
our results reveal that both control and stressed rats have shown a decrease in
fdi following tbs , and that differences between pre- and posttetanic levels of
fdi were not significantly different between the two groups . when examining the
differences between pre- and post - tbs levels of fdi within each group ,
a
greater difference was observed in the stressed group , which may suggest that
undergoing behavioral stress has caused an increase in fdi plasticity .
this increased plasticity is somewhat surprising since
exposure to stress is typically shown to suppress plasticity and to impair
learning [ 3640 ] .
it should be noted though that most studies
related to stress effects on plasticity focused mainly on ltp and on ca1 area
of the hippocampus .
the effects of stress on ltp in other brain regions are
less consistent [ 14 , 21 , 41 ] .
furthermore , even in ca1 , while stress may suppress ltp , it is reported
to enhance other forms of plasticity , such as ltd [ 17 , 42 ] .
stressed rats have shown a marked increase in inhibition
both before and after the application of tbs , indicating a lasting modification
in this form of local circuit activity .
this result is in agreement with other
studies that have shown that stress levels of corticosterone produce a profound
and long - lasting inhibitory influence on hippocampal cell activity [ 4347 ] .
although stress has caused a reduction in local circuit activity in
this case , no alteration in commissural local circuit plasticity was observed
after tbs application .
the fact that fdi activity was not affected by the stress
while commissural - induced modulation was significantly affected suggests that
stress may affect only a subpopulation of inhibitory interneurons .
indeed , it
has been previously suggested that interneurons in the hippocampus may be
divided into those showing no activity - dependent plasticity and those that do .
it was further suggested that activity - dependnet plasticity of this sort may
contribute to mood and anxiety disorders .
the fact that an increase in inhibitory activity was
observed in the hippocampus may imply that
deficits in cognitive functioning and flexibility might take place , as has been
suggested before for aged rats .
this does not necessarily mean that rats
that have undergone stress would show impaired learning in a specific task , but
it is possible that they would be less adaptive if required to shift to a new
coping strategy during task acquisition .
for example , stress has been shown to
cause impairment in reversal learning and induced perseveratory behavior in the
morris water maze without having a significant effect on task acquisition . in the present study ,
as indicated above , the effects of stress on dentate gyrus
ltp may depend on the exact nature of the stress experience [ 14 , 21 , 41 ] .
interestingly , although stress seemed to have caused alterations in local
circuit plasticity ( as observed in the fdi findings ) and in local circuit
activity ( as observed by the commissural modulation findings ) , it had no effect
on ltp induction .
this further supports the notion that local circuit activity
and plasticity is independent of synaptic plasticity such as ltp [ 18 , 28 ] .
the study of the effects of stress on gabaergic
neurotransmission is of special interest because it has been suggested that
gaba plays a role in the pathophysiology of mood and anxiety disorders [ 5054 ] .
the results presented here may further support the potential role
of gaba - impaired modulation of neural activity and plasticity in stress - related
disorders .
our results suggest that stressful experience may lead to
alterations in local circuit activity and plasticity . understanding the
alterations that take place in these local interneurons
may contribute to a
better understanding of their involvement in memory formation and regulation
under normal and psychopathological conditions . | studies have shown that , depending on its severity and context , stress can affect neural plasticity .
most related studies focused on synaptic plasticity and long - term potentiation ( ltp ) of principle cells
. however , evidence suggests that following high - frequency stimulation , which induces ltp in principal cells , modifications also take place at the level of complex interactions with interneurons within the dentate gyrus , that is , at the local circuit level .
so far , the possible effects of stress on local circuit activity and plasticity were not studied .
therefore , we set out to examine the possible alterations in local circuit activity and plasticity following exposure to stress .
local circuit activity and plasticity were measured by using frequency dependant inhibition ( fdi ) and commissural modulation protocols following exposure to a 15 minute - forced swim trial .
exposure to stress did not alter fdi .
the application of theta - burst stimulation ( tbs ) reduced fdi in both control and stressed rats , but this type of plasticity was greater in stressed rats .
commissural - induced inhibition was significantly higher in stressed rats both before and after applying theta - burst stimulation .
these findings indicate that the exposure to acute stress affects aspects of local circuit activity and plasticity in the dentate gyrus .
it is possible that these alterations underlie some of the behavioral consequences of the stress experience . | 1. INTRODUCTION
2. METHODS
3. RESULTS
4. DISCUSSION |
tooth movement during orthodontic treatment is accomplished by the delivery of orthodontic forces through brackets . a frictional force ( fr ) , defined as the resistant force against movement when two contacting objects are moving ,
the former is the minimum amount of force required for the initial movement of a static object , while the latter is the force required to maintain the movement of two objects at a certain velocity .
therefore , an orthodontic force that dissipates as fr should be considered during clinical treatment.2 although high frs can offset the force delivered to the teeth during orthodontic treatment and cause anchor loss and debonding of brackets , appropriate control of frs can improve the treatment effects and decrease the treatment duration .
the material constituting the brackets and archwires , surface conditions of arch wires , size of bracket slots , cross - section and torque of archwires , ligation method , interbracket distance , and salivary and intraoral conditions are factors that can affect fr.3,4,5,6,7 according to previous studies on the effects of brackets and archwires on fr , teeth move through repeated movements that cause them to tilt and become upright.8 peterson et al.9 adjusted the angulation between the bracket and archwire to 0-10 to evaluate frs .
meanwhile , thorstenson and kusy10 and kusy and whitley11 studied the critical slope angles at which frs tended to increase . after examining various combinations of archwires and brackets
, they found the critical slope angle to be approximately 3.7 , and frs increased sharply at angles larger than 3.7. furthermore , the increase in frs with an increase in the critical slope angle is affected by the physical properties of the materials of the appliances.11 the type of orthodontic wire can reportedly affect the increase in fr as well as the rate of increase , with nitinol and beta - titanium arch wires showing a higher fr than stainless steel ( ss ) archwires .
furthermore , there are reports that frs increase with an increase in the thickness of orthodontic wires and are higher with rectangular wires than with round wires.7 cacciafesta et al.12 reported that metal brackets exhibited a lower fr than ceramic or resin brackets after examining differences in frs according to bracket materials .
ceramic brackets exhibit higher frs than metal brackets , which have softer surfaces that are easily polished with archwire binding .
generally , archwires are inserted into brackets and held with elastic rings or ligature wires , but self - ligating brackets have special hinge caps , eliminating the need for ligature wires .
self - ligating brackets reportedly facilitate effective tooth movement while shortening the total treatment duration because of decreased frs.13 a decrease in frs as a result of different ligation methods can decrease the treatment duration , thus providing an advantage during the treatment of orthodontic extraction cases .
furthermore , the surfaces of self - ligating brackets are generally smooth ; therefore , they provide more comfort and allow better oral hygiene control to the patient.14 previous studies on the frs of metal self - ligating brackets have reported varying results , possibly because of different experimental conditions and limitations in mechanical reproduction.15 however , there are few comparative studies including ceramic self - ligating brackets . therefore ,
in this study , the authors evaluated and compared frs among different bracket - archwire angles and different bracket materials .
the experimental groups included passive metal self - ligating brackets ( damon3 mx ; ormco , orange , ca , usa ) , active metal self - ligating brackets ( quick ; forestadent , pforzheim , germany ) , and active ceramic self - ligating brackets ( clippy - c ; tomy , tokyo , japan ) . in the control group , conventional twin metal brackets ( micro - arch ; tomy ) were used .
all brackets were maxillary premolar brackets with 0.022 inch ( in ) slots and a -7 torque . in order to measure the fr , 0.018 round and 0.019 0.025
ten identical brackets from each group were used for measurements , and a total of 240 brackets were used according to the combinations of archwires and angles .
brackets from each group were attached to 10 customized steel blocks ( 10 10 20 mm ) .
metal primer ( reliance orthodontic products , itasca , il , usa ) was applied after microetching , and 1 min later , transbond xt primer ( 3 m unitek , monrovia , ca , usa ) was applied and light cured for 30 s. vertical and horizontal lines crossing through the center of the blocks were drawn for use as guides during bracket positioning .
the steel blocks with the attached brackets were inserted into larger rectangular blocks and fixed in place with screws such that angles of 0 , 5 , and 10 were created ( figure 1 ) .
the two blocks were positioned on the movable fixation cast of the universal testing machine ( instron 3366 ; instron corp . ,
one end of the archwire was fixed on a 150-g pendulum with a screw , while the other end was inserted into the tension load cell .
the conventional metal brackets were ligated with o - rings ( ormco , elastic rubber ligation material ) .
efforts were taken to prevent the generation of any extra torque , and the archwires and steel blocks with the attached brackets were replaced in each experiment .
measurements were obtained using a load cell of 500 n to draw 10 mm of wire at a crosshead speed of 10 mm / min using the universal testing machine .
the maximum point on the weight - displacement curve that resulted from the measurement of the maximum fr was noted as the static fr .
the kinetic fr was calculated as the mean value of 10 measurements obtained at 1-s intervals .
were replaced with new ones to rule out possible wear effects or errors from repeated use . to assess the shape of the brackets , scanning electron microscopy ( sem , hitachi-800 ; hitachi , tokyo , japan ) was used for comparison .
each bracket was measured in the 20 kv / s electron mode . the sas program ( sas inc .
standard deviations were calculated using the mean values for static and kinetic frs measured in each group , and 3-way analysis of variance ( anova ) was used to analyze the interaction effects between type of archwires , type of brackets , and bracket - archwire angles . for multiple comparisons ,
the student - newman - keuls method was used , with a significance level of 0.05 .
standard deviations were calculated using the mean values for static and kinetic frs measured in each group , and 3-way analysis of variance ( anova ) was used to analyze the interaction effects between type of archwires , type of brackets , and bracket - archwire angles . for multiple comparisons ,
the student - newman - keuls method was used , with a significance level of 0.05 .
tables 1 and 2 present the static and kinetic frs for the four types of brackets according to bracket type , bracket - archwire angulation , and wire type . the results of three - factor anova indicates that these factors had significant effects on both static and kinetic frs . the interaction effect between bracket type and bracket - archwire angulation , between bracket type and wire type , and between bracket - archwire angulation and wire type were statistically significantly for both static and kinetic frs ( p < 0.001 ) . the three - way interaction among bracket type , wire type , and bracket - archwire angulation was also statistically significant ( p < 0.001 ) .
the static fr was significantly higher with the rectangular wire than with the round wire ( p < 0.001 ) .
the damon3 mx brackets exhibited the lowest static fr at the 0 bracket - archwire angulation and a lower increase in static fr with an increase in bracket - archwire angulation than the other brackets .
kinetic frs also increased with an increase in bracket - archwire angulation and were higher with the rectangular wire than with the round wire ( p < 0.001 ) .
again , the damon3 mx brackets exhibited the lowest kinetic fr , while the micro - arch brackets exhibited the highest kinetic fr at the 0 bracket - archwire angulation .
the increase in kinetic fr with an increase in the bracket - archwire angulation was higher with the micro - arch bracket than with the experimental brackets .
comparative observations of the shape and surface properties of the brackets were made using sem ( figure 2 ) .
the overall shape of each bracket was observed under a 20 magnification , while the part of the slot where the archwire was bound was observed under a 200 magnification .
the slot of the bracket was further magnified to 2,000. the damon3 mx brackets showed a soft area at the point of binding .
the quick brackets also revealed a relatively soft surface , but its active clip appeared somewhat rougher than that of the passive brackets .
the clippy - c brackets , while having well - polished surfaces and softer rounded angles in the slot , showed more porous surfaces than the other self - ligating brackets under the 2,000 magnification .
the slot surfaces of the conventional metal brackets appeared somewhat rougher than those of the metal self - ligating brackets .
the static fr was significantly higher with the rectangular wire than with the round wire ( p < 0.001 ) .
the damon3 mx brackets exhibited the lowest static fr at the 0 bracket - archwire angulation and a lower increase in static fr with an increase in bracket - archwire angulation than the other brackets .
kinetic frs also increased with an increase in bracket - archwire angulation and were higher with the rectangular wire than with the round wire ( p < 0.001 ) .
again , the damon3 mx brackets exhibited the lowest kinetic fr , while the micro - arch brackets exhibited the highest kinetic fr at the 0 bracket - archwire angulation .
the increase in kinetic fr with an increase in the bracket - archwire angulation was higher with the micro - arch bracket than with the experimental brackets .
comparative observations of the shape and surface properties of the brackets were made using sem ( figure 2 ) .
the overall shape of each bracket was observed under a 20 magnification , while the part of the slot where the archwire was bound was observed under a 200 magnification .
the slot of the bracket was further magnified to 2,000. the damon3 mx brackets showed a soft area at the point of binding .
the quick brackets also revealed a relatively soft surface , but its active clip appeared somewhat rougher than that of the passive brackets .
the clippy - c brackets , while having well - polished surfaces and softer rounded angles in the slot , showed more porous surfaces than the other self - ligating brackets under the 2,000 magnification .
the slot surfaces of the conventional metal brackets appeared somewhat rougher than those of the metal self - ligating brackets .
it is important to obtain optimal forces during tooth movement , and an understanding of how frs work in brackets is required .
kusy and whitley11 reported that the loss of orthodontic force through fr generation ranges from 12% to 60% and that anchorage loss can result in orthodontic extraction cases .
for satisfactory tooth movement , it is important to understand the magnitude of frs developing between brackets and orthodontic wires . according to cacciafesta et al.16 ,
variables that can affect the fr include orthodontic wires , brackets , ligation method , and orthodontic appliances , among others .
orthodontic wires vary in size , shape , and material , but overall , ss wires cause the least fr .
thicker wires and rectangular wires tend to generate higher frs.7 in this experiment , only ss wires were used , and similar to the findings of garner et al.17 , frs were higher with rectangular wire than with round wire in all experimental groups .
the rate of increase in frs with an increase in the bracket - archwire angle was higher with the rectangular wire than with the round wire .
with regard to fr according to bracket type , the passive metal self - ligating brackets exhibited lower frs than the active ceramic self - ligating brackets .
with rectangular wires , the active ceramic self - ligating brackets exhibited a slightly lower fr than the active metal self - ligating brackets .
kusy and whitley11 compared the frs of various types of metal self - ligating brackets and conventional metal brackets by altering the angle between the brackets and orthodontic wires , and they reported that the passive self - ligating brackets exhibited a low fr and that the active self - ligating brackets showed varying degrees of fr . ceramic brackets exhibit a higher fr than metal brackets because orthodontic wires bind more easily with ceramic brackets , which have rough surfaces as opposed to metal brackets , which have relatively polished and softer surfaces .
although ceramic brackets are esthetically pleasing , higher frs inside the bracket slots than those in metal brackets are considered a disadvantage.18 the reason why the ceramic self - ligating brackets used in this study may have shown lower frs than the metal brackets could be polishing of the slot . with regard to frs according to the bracket - archwire angle , the rate of increase in fr was greater when the angle increased from 5 to 10 than when the angle increased from 0 to 5. furthermore , the rate of increase was greater with rectangular wires than with round wires .
pizzoni et al.15 reported that self - ligating brackets had low sliding forces at 0 and 3 , which increased proportionally with an increase in the angle to 6 , 9 , and 12. this could be because the sliding movement of teeth can be disturbed by vertical forces produced at both ends of the bracket slot as the bracket - archwire angulation increases and causes binding .
frank and nicolai19 reported that the effects of vertical forces decreased while the effects of archwire stiffness increased with an increase in the bracket - archwire angulation .
with regard to the effects of the ligation method , the passive self - ligating brackets exhibited significantly lower frs at all angles , while the conventional metal brackets that used elastic o - rings exhibited the highest fr .
with regard to active self - ligating brackets , the fr was similar in the ceramic and metal brackets when a round archwire was used , while it was lower in the ceramic brackets when a rectangular archwire was used .
in general , according to reports by previous researchers , self - ligating brackets are reportedly more effective in decreasing the fr than conventional brackets that use elastic or metal ligatures.20,21 thorstenson and kusy22 reported that passive self - ligating brackets exhibited a lower fr during sliding because the critical contact angle was large .
the fr of self - ligating brackets in all groups increased more gradually than that of the conventional brackets as the bracket - archwire angle increased .
the reason for the slightly higher fr in ceramic self - ligating brackets is that at the initial angle , ceramic causes more binding with orthodontic wires in the slot than metal .
damon3 mx brackets are passive and showed low frs at all bracket - archwire angles , with a gradual rate of increase in fr .
overall , under high magnification of an electron microscope , the corners of the bracket slots showed smooth surfaces ( figure 2a-2c ) .
the quick bracket , an active self - ligating bracket , showed well - polished surfaces overall ( figure 2d-2f ) .
the ceramic self - ligating brackets also showed well - polished corners of the slot under high magnification as well as partially exposed crystalline particles and soft surfaces due to silica coating ( figure 2g-2i ) .
the conventional metal brackets exhibited a higher overall fr ; furthermore , under sem , their slots had rougher surfaces than those of self - ligating brackets .
these rougher surfaces may be correlated with the higher frs exhibited by the conventional metal brackets ( figure 2j-2l ) . with an increase in the bracket - archwire angle ,
the ceramic self - ligating brackets exhibited lower frs than the active metal self - ligating brackets .
the ceramic self - ligating bracket clip is advantageous during sliding because it is more flexible than the active metal self - ligating bracket clip and because the contact angle is smaller because of the larger width of the ceramic bracket .
the width of the bracket also affects the contact angle formed between the bracket and orthodontic wire .
the limit value where the passive configuration of the bracket and archwire becomes the active configuration is termed the critical contact angle . with an increase in bracket width ,
moreover , the width of the bracket can affect the moment that is delivered to the tooth ; therefore , as the width of the bracket increases , a lower force is required to produce a moment and the contact angle decreases in space closure .
the clippy - c brackets exhibited the largest width of approximately 0.132 in , while the quick , micro - arch , and damon3 mx brackets exhibited widths of approximately 0.10 - 0.11 in .
the damon3 mx brackets exhibited the least width and a low fr in terms of critical contact angle .
from this perspective , the clippy - c brackets should exhibit a high fr , but it showed an fr similar to that exhibited by the quick brackets from 5 to 10 bracket - archwire angulations . considering that both brackets were active self - ligation systems , surface treatment and a round design in the slot angle area of the clippy - c brackets also helped in decreasing the fr .
the development of various types of self - ligating brackets is in progress to improve their physical and esthetic properties .
further studies on the esthetic advantages of and decreased frs in self - ligating brackets during long - term orthodontic treatment are required .
furthermore , experiments using various angles and various types of orthodontic wires using artificial saliva are considered necessary .
in this study , compared to the active metal and ceramic self - ligating brackets , the passive metal self - ligating brackets showed the lowest static and kinetic frs . however , the active ceramic self - ligating brackets showed a lower fr than the active metal self - ligating and conventional metal brackets .
the findings of sem analysis in our study suggest that self - ligating brackets can generate varying frs in vitro according to the wire size , surface characteristics , and bracket - archwire angulation . | objectivethis study aimed to compare the frictional force ( fr ) in self - ligating brackets among different bracket - archwire angles , bracket materials , and archwire types.methodspassive and active metal self - ligating brackets and active ceramic self - ligating brackets were included as experimental groups , while conventional twin metal brackets served as a control group .
all brackets were maxillary premolar brackets with 0.022 inch [ in ] slots and a -7 torque .
the orthodontic wires used included 0.018 round and 0.019 0.025 in rectangular stainless steel wires .
the fr was measured at 0 , 5 , and 10 angulations as the wire was drawn through the bracket slots after attaching brackets from each group to the universal testing machine .
static and kinetic frs were also measured.resultsthe passive self - ligating brackets generated a lower fr than all the other brackets .
static and kinetic frs generally increased with an increase in the bracket - archwire angulation , and the rectangular wire caused significantly higher static and kinetic frs than the round wire ( p < 0.001 ) .
the metal passive self - ligating brackets exhibited the lowest static fr at the 0 angulation and a lower increase in static and kinetic frs with an increase in bracket - archwire angulation than the other brackets , while the conventional twin brackets showed a greater increase than all three experimental brackets.conclusionsthe passive self - ligating brackets showed the lowest fr in this study .
self - ligating brackets can generate varying frs in vitro according to the wire size , surface characteristics , and bracket - archwire angulation . | INTRODUCTION
MATERIALS AND METHODS
Statistical analysis
RESULTS
Comparison of static FRs (
Comparison of kinetic frictional forces (
Scanning electron microscopy analysis
DISCUSSION
CONCLUSION |
ferns have often been associated with contaminated soils , particularly with mining operations ( samecka - cymerman et al .
nevertheless , these plants have received less attention than vascular plants in relation to metal tolerance and accumulation ( kachenko et al .
some fern species are important bioindicators of metalliferous soils or have the exceptional capability to hyperaccumulate some metals and have been used to decontaminate polluted sites ( kachenko et al . 2007 ; leung et al . 2007 ; zhang et al . 2012 ) . among fern species , pteridium aquilinum ( l. ) kuhn ( bracken ) is one of the world s most successful and widely dispersed species , the only terrestrial fern that dominates large tracts of land outside woodland in temperate climates ( marrs and watt 2006 ; chang et al .
the p. aquilinum common in disturbed habitats is also recognized as one of the plants most resistant to metals ( chang et al .
therefore , this fern meets the demands for a good bioindicator which could be used to enable environmental control ( markert et al .
the amount of any metal taken up by plants from contaminated soils has been suggested as being of central importance in assessing the risk of toxicity ( roy and gunjan 2010 ) .
there is extensive information on the contamination of soils and plants by single metals ; however , the combined pollution with these elements is a more common phenomenon in nature with mitigating or amplifying effects ( pivetz 2001 ; haiyan 2003 ) .
because xenobiotics like cr and ni are usually present together in polluted areas , a selection was made of model environments of granites ( usually poor in both metals ) and serpentinites typically with high concentrations of both ni and cr ( galardi et al .
it is well known that plants have a capacity to adapt to certain environmental conditions ( fernndz et al .
therefore , p. aquilinum from granite areas should accumulate significantly less cr and ni than those from serpentinite sites which live on soils with an excess of these elements .
the aim of this study was to experimentally compare the concentration of cr and ni in the rhizome and fronds of p. aquilinum from serpentinite and granite sites with supplementation of both elements separately and in combination .
the following hypotheses were investigated : ( 1 ) combined concentrations of cr and ni supplied to p. aquilinum may cause suppressing effects on the sum of both toxicities and ( 2 ) p. aquilinum from serpentinite accumulates significantly more ni and cr than the same species from granite because it is adapted to soil containing increased concentrations of these metals .
in lower silesia ( fig . 1 ) , a total of 22 sampling sites were selected , of which 11 on granites ( sites 111 ) and 11 on serpentinites ( sites 1222 ) .
soil profiles in those mountainous areas hardly accumulated organic material or developed a discernible a and b horizon because of erosion .
rock - forming minerals contain most of the nutrients required by plants for growth and development .
ground - weathered rock has been proposed as a source of slow release of the elements to be utilized by plants ( harley and gilkes 2000 ) .
at each site , five samples of the rhizome and fronds were collected randomly within a 25 m 25 m square .
each sample consisted of a mixture of three subsamples . as required by the rules set by the european heavy metal survey ( icp vegetation 2005 ) ,
topsoil samples were also taken from each square , from a depth of 0 to 5 cm .
the total number of rock , soil , and plant ( rhizome and frond ) samples was 22 5 = 110 .
1map showing study areas and sampling locations ( x ) map showing study areas and sampling locations ( x ) fresh soil samples were used for the determination of phh2o and phkcl potentiometrically ( model : hanna hi991300 , hanna instruments inc . , woonsocket ( ri ) , usa ) in a 1:2.5 soil - h2o and 1:2.5 soil - kcl ratios ( pansu and gautheyrou 2006 ) . before analysis
rhizomes were washed carefully for a few minutes and fronds for a few seconds in distilled water .
rock , soil , and plant samples were dried at 50 c to constant weight .
soil samples were homogenized with a mortar and pestle after the coarse material was removed using a 2-mm sieve .
plant samples were homogenized to a fine powder in an ika labortechnik m20 laboratory mill . dried soil and plant samples ( 300 mg of dry weight , in triplicate )
were digested with 3 ml of nitric acid ( ultra pure , 65 % ) and 2 ml of perchloric acid ( ultra pure , 70 % ) , and samples of rock powder ( 300 mg of dry weight , in triplicate ) were digested in aqua regia in a cem mars 5 microwave oven .
samples were then diluted with deionized water to a total volume of 50 ml , and the soil and plant digests were analyzed for fe , mn , and zn using faas and cd , co , cr , cu , ni , and pb using etaas with graphite furnace gf3000 ( avanta pm atomic absorption spectrophotometer from gbc scientific equipment ) .
all elements were assayed against the atomic absorption standard solution from sigma chemical co. and blanks containing the same matrix as the samples and were processed and analyzed as samples .
results of metal concentrations for the plants were calculated on a dry weight basis . the accuracy of the methods applied for the determination of the metal concentrations in plant and soil samples was checked against certified reference materials : dc73348 lgc standards of bush branches and leaves and rth 907 dutch anthropogenic soil ( wageningen evaluating programs for analytical laboratories , wepal ) ( table 1).table 1analysis of certified reference materialselementcertifiedfoundrecoverycv(mg kg)(%)bush branches and leaves dc73348 lgc cd0.140.13 0.00692.864.62 co0.390.38 0.0197.442.63 cr2.32.28 0.0699.132.63 cu5.25.05 0.1297.122.38 fe1,0201,037 23101.672.22 mn5858.33 1.5100.572.57 ni1.71.68 0.0698.823.57 pb7.16.78 0.2395.493.39 zn20.620.81 0.32101.021.54dutch anthropogenic soil rth907 cd2.182.22 0.08101.833.60 cr48.653.37 1.22109.812.29 cu121119.63 1.7598.871.46 pb318311.4 7.5397.922.42 zn714716
9.7100.281.35 co9.098.98 0.1598.791.67 fe16,60017,130 630103.193.68 mn506527 12104.152.28 ni27.926.99 1.0396.743.82 analysis of certified reference materials the toxicity of cr and ni ions on the fern ( single metals as well as their combinations ) was investigated .
cr and ni as typical elements for serpentinites but also present in polluted environments were selected . from all the sampling sites analyzed , three on granite and three on serpentinite
were chosen where the cr and ni concentration in the soil was equal to the average of all the investigated sites .
rhizomes of ferns were collected in march in a state of unfolded fronds ( zenkteler 1994 ) .
rhizomes were cleaned from soil and washed in distilled water and then placed in threefold in pots filled with general potting mix soil according to kachenko et al .
two groups of pots were established : one with granite rhizomes and second with serpentinite rhizomes .
each of them was divided into three subgroups which received cr , ni , and mixture of cr and ni , respectively .
metal salts were applied as 0 ( control ) , 50 , 100 , and 250 mg kg of dry weight of potting soil ( for each metal ) using k2cr2o7 and nicl2 .
the amounts were calculated by weight of elemental cr and ni ( kachenko et al .
the hexavalent cr(vi ) species , considered the most toxic form , was selected ( shanker et al .
metal concentrations were chosen based on the average ( ~100 mg kg ) concentration of cr and ni in serpentinite soils of the examined sites .
one lower ( 50 mg kg ) and one higher concentration ( 250 mg kg ) were added in the test series to study the mutual metal interference at other than the average concentration .
pots were arranged in a completely randomized experimental design , and there were three replicates for each treatment .
the plants were raised in a glasshouse for 20 weeks , watered daily with deionized water , and no fertilizer was applied during the experimental period ( kachenko et al .
differences among sampling sites with respect to metal concentrations in rocks , soil , rhizome , and fronds were evaluated by one - way anova on log - transformed data to obtain the normal distribution of features according to zar ( 1999 ) .
the normality of the analyzed features was checked by means of shapiro - wilk s w test , and the homogeneity of variances was checked after transformation using the brown - forsythe test .
element concentrations in experimental rhizomes and fronds from granite and serpentinite sites were compared with t test ( zar 1999 ) .
in lower silesia ( fig . 1 ) , a total of 22 sampling sites were selected , of which 11 on granites ( sites 111 ) and 11 on serpentinites ( sites 1222 ) .
soil profiles in those mountainous areas hardly accumulated organic material or developed a discernible a and b horizon because of erosion .
rock - forming minerals contain most of the nutrients required by plants for growth and development .
ground - weathered rock has been proposed as a source of slow release of the elements to be utilized by plants ( harley and gilkes 2000 ) .
at each site , five samples of the rhizome and fronds were collected randomly within a 25 m 25 m square .
each sample consisted of a mixture of three subsamples . as required by the rules set by the european heavy metal survey ( icp vegetation 2005 ) ,
topsoil samples were also taken from each square , from a depth of 0 to 5 cm .
the total number of rock , soil , and plant ( rhizome and frond ) samples was 22 5 = 110 .
1map showing study areas and sampling locations ( x ) map showing study areas and sampling locations ( x )
fresh soil samples were used for the determination of phh2o and phkcl potentiometrically ( model : hanna hi991300 , hanna instruments inc . , woonsocket ( ri ) , usa ) in a 1:2.5 soil - h2o and 1:2.5 soil - kcl ratios ( pansu and gautheyrou 2006 ) . before analysis , rocks were crushed to a fine powder .
rhizomes were washed carefully for a few minutes and fronds for a few seconds in distilled water .
rock , soil , and plant samples were dried at 50 c to constant weight .
soil samples were homogenized with a mortar and pestle after the coarse material was removed using a 2-mm sieve .
plant samples were homogenized to a fine powder in an ika labortechnik m20 laboratory mill . dried soil and plant samples ( 300 mg of dry weight , in triplicate )
were digested with 3 ml of nitric acid ( ultra pure , 65 % ) and 2 ml of perchloric acid ( ultra pure , 70 % ) , and samples of rock powder ( 300 mg of dry weight , in triplicate ) were digested in aqua regia in a cem mars 5 microwave oven .
samples were then diluted with deionized water to a total volume of 50 ml , and the soil and plant digests were analyzed for fe , mn , and zn using faas and cd , co , cr , cu , ni , and pb using etaas with graphite furnace gf3000 ( avanta pm atomic absorption spectrophotometer from gbc scientific equipment ) .
all elements were assayed against the atomic absorption standard solution from sigma chemical co. and blanks containing the same matrix as the samples and were processed and analyzed as samples .
the accuracy of the methods applied for the determination of the metal concentrations in plant and soil samples was checked against certified reference materials : dc73348 lgc standards of bush branches and leaves and rth 907 dutch anthropogenic soil ( wageningen evaluating programs for analytical laboratories , wepal ) ( table 1).table 1analysis of certified reference materialselementcertifiedfoundrecoverycv(mg kg)(%)bush branches and leaves dc73348 lgc cd0.140.13 0.00692.864.62 co0.390.38 0.0197.442.63 cr2.32.28 0.0699.132.63 cu5.25.05 0.1297.122.38 fe1,0201,037 23101.672.22 mn5858.33 1.5100.572.57 ni1.71.68 0.0698.823.57 pb7.16.78 0.2395.493.39 zn20.620.81 0.32101.021.54dutch anthropogenic soil rth907
cd2.182.22 0.08101.833.60 cr48.653.37 1.22109.812.29 cu121119.63 1.7598.871.46 pb318311.4 7.5397.922.42 zn714716 9.7100.281.35 co9.098.98 0.1598.791.67 fe16,60017,130
630103.193.68 mn506527 12104.152.28 ni27.926.99 1.0396.743.82 analysis of certified reference materials
the toxicity of cr and ni ions on the fern ( single metals as well as their combinations ) was investigated .
cr and ni as typical elements for serpentinites but also present in polluted environments were selected . from all the sampling sites analyzed , three on granite and three on serpentinite
were chosen where the cr and ni concentration in the soil was equal to the average of all the investigated sites .
rhizomes of ferns were collected in march in a state of unfolded fronds ( zenkteler 1994 ) .
rhizomes were cleaned from soil and washed in distilled water and then placed in threefold in pots filled with general potting mix soil according to kachenko et al .
two groups of pots were established : one with granite rhizomes and second with
each of them was divided into three subgroups which received cr , ni , and mixture of cr and ni , respectively .
metal salts were applied as 0 ( control ) , 50 , 100 , and 250 mg kg of dry weight of potting soil ( for each metal ) using k2cr2o7 and nicl2 . the amounts were calculated by weight of elemental cr and ni ( kachenko et al .
the hexavalent cr(vi ) species , considered the most toxic form , was selected ( shanker et al . 2005 ) .
metal concentrations were chosen based on the average ( ~100 mg kg ) concentration of cr and ni in serpentinite soils of the examined sites .
one lower ( 50 mg kg ) and one higher concentration ( 250 mg kg ) were added in the test series to study the mutual metal interference at other than the average concentration .
pots were arranged in a completely randomized experimental design , and there were three replicates for each treatment .
the plants were raised in a glasshouse for 20 weeks , watered daily with deionized water , and no fertilizer was applied during the experimental period ( kachenko et al .
differences among sampling sites with respect to metal concentrations in rocks , soil , rhizome , and fronds were evaluated by one - way anova on log - transformed data to obtain the normal distribution of features according to zar ( 1999 ) .
the normality of the analyzed features was checked by means of shapiro - wilk s w test , and the homogeneity of variances was checked after transformation using the brown - forsythe test .
element concentrations in experimental rhizomes and fronds from granite and serpentinite sites were compared with t test ( zar 1999 ) .
the ph of the examined soils may be classified as acidic , significantly lower for granite than for serpentinite ( table 3 ) .
the ph is an important factor which influences the trace element bioavailability by affecting speciation and solubility and the properties of biological surfaces ( lithner et al .
( 2005 ) , bioavailability of ni and cr increases as soil ph decreases . so a lower ph may result in a higher solubility of both metals in the examined soils .
the ranges of metal concentrations in parent rock , soil , and ferns are displayed in tables 2 , 3 and 4 .
the parent rock , soil , and fern samples differed significantly in terms of the concentrations of the elements assessed ( anova , p = 0.05 ) .
the concentrations ( table 2 ) of all the elements in granite were significantly lower than in serpentinite .
( 2007 ) that serpentine rocks are usually rich in cr , co , and ni . the concentration of co , fe , mn , and zn in granite and serpentinite and of cr and ni in serpentinite was significantly higher than in overlaying soil ( t test , p < 0.05 ) .
higher metal concentrations in parent rocks than in overlaying soil were also observed by samecka - cymerman et al .
rhizomes and fronds from ferns of serpentinite soils contained significantly higher concentrations of cd , co , cr , and ni and significantly lower concentrations of mn than those from granite soils ( table 4 ) .
thus , increased levels of metals in parent rocks and soils were reflected similarly in plants ( markert et al . 2003 ) .
table 2minimum , maximum , mean and standard deviation ( sd ) , and t test of the concentration ( mg kg ) of metals in serpentinite and granite rockserpentinitegranite
p valueminimummaximummeansdminimummaximummeansdcd0.040.30.140.090.0370.050.040.003<0.01co2036295.42.32.92.60.2<0.001cr171412232892.26.54.11.4<0.001cu2.1104.931.21.61.40.14<0.01fe28,30560,54850,95312,0347,17611,8579,4671,714<0.001mn2602,4531,304880169460313117<0.01ni6961,2739202001.53.42.40.6<0.001pb4.04115133.96.25.00.7<0.05zn269456243142353.2<0.05table 3minimum , maximum , mean and standard deviation ( sd ) , and t test of phh2o , phkcl , and the concentration ( mg kg ) of metals in soils of the serpentine and granite sitesserpentinitegranite
p valueminimummaximummeansdminimummaximummeansdphh2o
4.04.74.40.23.64.44.00.2<0.001phkcl
3.34.33.80.43.03.93.30.3<0.001cd0.090.970.350.250.020.20.090.06<0.001co2.931119.90.43.11.60.8<0.001cr4419399473.9148.13.1<0.001cu3.5137.13.13.08.75.41.8<0.05fe5,97114,2229,2032,6433,2548,6046,2071,451<0.001mn42950262274561429725<0.01ni31191101472.17.94.51.6<0.001pb2287432316743014<0.05zn18753522938188.6<0.01table 4minimum , maximum , mean and standard deviation ( sd ) , and t test of the concentration ( mg kg ) of metals in rhizome and fronds of pteridium aquilinum from the serpentinite and granite sitesserpentinitegranite
p valueminimummaximummeansdminimummaximummeansdrhizomecd0.060.500.300.140.020.170.090.04<0.001co0.823.01.60.70.070.450.260.08<0.001cr0.70116.13.41.42.51.90.32<0.001cu3.47.75.21.32.37.95.21.8>0.05fe140282205458227115452<0.01mn151024429151086727<0.01ni1129195.71.98.13.71.4<0.001pb4.431157.04.832168.0>0.05zn2042305.99.233238.0<0.01frondscd0.100.450.290.090.020.140.080.03<0.001co0.121.90.820.640.080.820.360.25<0.01cr1.23.72.60.831.22.61.70.45<0.001cu2.28.54.82.02.87.74.11.2>0.05fe60149105196613010216>0.05mn593581658561803325227<0.01ni4.6199.45.11.6113.92.4<0.001pb0.677.64.41.11.26.03.51.2<0.05zn1945287.41239247.5>0.05 minimum , maximum , mean and standard deviation ( sd ) , and t test of the concentration ( mg kg ) of metals in serpentinite and granite rock minimum , maximum , mean and standard deviation ( sd ) , and t test of phh2o , phkcl , and the concentration ( mg kg ) of metals in soils of the serpentine and granite sites minimum , maximum , mean and standard deviation ( sd ) , and t test of the concentration ( mg kg ) of metals in rhizome and fronds of pteridium aquilinum from the serpentinite and granite sites p. aquilinum sampled from serpentinite soils and those planted in the experimental pots contained significantly higher ( t test , p < 0.05 ) concentrations of cr and ni in the rhizomes . according to fargaova ( 2012 ) , the accumulation of cr was higher in roots than in upper plant parts .
the transport of ni to shoots was at least twice as high as that of cr .
also , in this investigation , the concentration of ni in fronds was at least twice as high as that of cr . according to oze et al .
( 2008 ) , serpentinite vegetation suppresses cr and ni uptake into its aboveground biomass , and both elements are preferentially immobilized or sequestered in roots rather than leaves .
this is probably a major mechanism for serpentinite vegetation to tolerate the elevated levels of metals in soils ( oze et al . 2008 ) .
( 2007 ) also report that metal translocation was limited because of absorption and retention in roots , suggesting an exclusion mechanism as part of the ferns tolerance to the metals supplied .
additionally , cr compared to ni is usually strongly bound in serpentinite soils , and the concentration of this element in roots was well below those in soils .
however , nickel concentrations in plants usually reflect those in soil ( kabata - pendias 2001 ) .
plant tissue bioaccumulation factor ( plant tissue element concentration ) / ( plant soil element concentration ) of ni for p. aquilinum from serpentinite and granite sites investigated by samecka - cymerman et al .
( 2009 ) exceeded 1 , indicating that p. aquilinum is not an ni excluder .
there was also a significant positive pearson correlation between the concentration of ni in soil and ni in p. aquilinum .
there was no difference in the concentration of ni and cr ( applied both separately or together ; all treatments ) between the serpentinite and granite p. aquilinum rhizome and fronds ( t test , p < 0.05 ) .
this is in agreement with onierz ( 2007 ) that serpentinite species frequently accumulate vast quantities of cr .
this lack of difference in cr and ni concentration may probably indicate that the phenotypic plasticity of this species is very important in the adaptation to extreme environments and probably increases the survival of p. aquilinum in contaminated sites ( ernen 2008 ; dunn and rothwell 2012).fig .
2cr or ni concentrations in rhizomes and in fronds of p. aquilinum from granite and serpentinite cultivated in experimental soils with concentrations of 50 , 100 , and 250 mg kg of cr and ni applied separately or combined .
i cr in rhizome , ii cr in fronds , iii ni in rhizome , iv ni in fronds ; a serpentinite combined , b serpentinite separate , c granite combined , d granite separate , mean , standard error , confidence interval cr or ni concentrations in rhizomes and in fronds of p. aquilinum from granite and serpentinite cultivated in experimental soils with concentrations of 50 , 100 , and 250 mg kg of cr and ni applied separately or combined .
i cr in rhizome , ii cr in fronds , iii ni in rhizome , iv ni in fronds ; a serpentinite combined , b serpentinite separate , c granite combined , d granite separate ,
mean , standard error , confidence interval there was a significant increase in the concentration of cr and ni in the experimental ferns with higher applications of both elements ; however , a sharp increase in metal accumulation was observed at concentrations higher than 100 mg kg ( fig . 2 ) .
( 2007 ) , such a phenomenon suggests breakdown in tolerance mechanisms and unrestricted metal transport .
the results of the experiment were most spectacular for the 250 mg kg level . in this concentration , rhizomes (
both granite and serpentinite ) contained significantly higher cr and ni concentrations when both metals were supplied separately ( post hoc least significant difference ( lsd ) , p < 0.05 ) ( fig . 2 ) .
however , fronds ( both granite and serpentinite ) contained significantly higher concentrations of cr and ni when both metals were supplied together ( post hoc lsd , p < 0.05 ) . according to shah et al .
( 2010 ) , ni and cr showed good correlation in both soils and plants in serpentinite areas .
( 1997 ) also suggest that the combined toxicity of both metals might be higher than the sum of the individual toxicities of each separate element .
( 2005 ) that the toxicity of some elements changes in the presence of other metals and results in different effects comparing rhizomes with stems and leaves because of changing ratios .
a cr / ni different effect in fronds and rhizomes is therefore possible for metal uptake in p. aquilinum .
thus , cr and ni uptake in the fern appears to be controlled by their mutual concentrations ( ondo et al .
( 1995 ) , the same cr - ni metal ions are listed as mitigating transfer from the soil to rhizome level and favoring transfer from the rhizome to fronds .
the explanation of differences in the joint accumulation of cr and ni on the rhizome or frond level may probably be the competitive binding of cr and ni to the rhizome cell wall ( glick 2003 ) .
the interaction between ferns and rhizosphere microorganisms or mycorrhizal symbiosis which may influence the tolerance of p. aquilinum for metals should not be neglected ( khan 2001 ) .
there is a possibility that both elements may be accumulated in the extrametrical hyphae or excluded by the symbiont ( ghre and paszkowski 2006 ) .
the differences in the cr accumulation behavior in the presence of ni and other metals in plants need further investigation .
p. aquilinum sampled from serpentinite soils and those planted in the experimental pots contained significantly higher concentrations of both elements in the rhizome than in fronds .
grown at a concentration of 250 mg kg of cr or ni in soil , fronds ( both granite and serpentinite ) contained significantly higher cr and ni concentrations when both metals were supplied together . at a concentration of 250 mg kg of cr or ni , rhizomes (
both granite and serpentinite ) contained significantly higher cr and ni concentrations when both metals were supplied separately .
to explain these differences , further investigation is needed . in experimental ferns , there was no difference in the concentration of ni and cr ( applied both separately or together ; all treatments ) between the serpentinite and granite p. aquilinum rhizome and fronds .
the exception was cr concentration in fronds which was significantly higher in serpentinite than in granite ferns .
this lack of difference may probably indicate that the phenotypic plasticity of this species is very important in the adaptation to extreme environments and probably increases the survival of this fern in contaminated sites .
the results of this investigation may be applied in the bioindication of ni and cr in anthropogenic polluted environments .
it contributes to the use of p. aquilinum in bioindication of the combined presence of cr and ni , taking into account their changing effects at different ratios in the environment .
further investigation might supply assertion which biogeochemical condition will promote efficient phytoremediation by this species . | pteridium aquilinum is a ubiquitous species considered to be one of the plants most resistant to metals .
this fern meets the demands for a good bioindicator to improve environmental control .
therefore , it was of interest to survey the accumulation of cr and ni in the rhizome and fronds of this species collected in lower silesia ( sw poland ) of serpentinite rich in cr and ni and granite poor in these metals . additionally , concentrations of cd , co , cr , cu , fe , mn , ni , pb , and zn were measured in granite and serpentinite parent rocks , soils , and in p. aquilinum ( rhizome and fronds ) .
the experiment was carried out with rhizomes of ferns from both types of soils placed in pots supplemented with 50 , 100 , and 250 mg kg1 of cr or ni or both elements together . at a concentration of 250 mg kg1 of cr ,
ni , or cr + ni , fronds ( from granite or serpentinite origin ) contained significantly higher cr and ni concentrations when both metals were supplied together . in the same concentration of 250 mg kg1 of cr ,
ni , or cr + ni , rhizomes ( from granite or serpentinite origin ) contained significantly higher cr and ni concentrations when both metals were supplied separately .
the explanation of metal differences in the joint accumulation of cr and ni on the rhizome or frond level needs further investigation .
the lack of difference in cr and ni concentration in the rhizome and fronds between experimental p. aquilinum collected from granite and serpentinite soils may probably indicate that the phenotypic plasticity of this species is very important in the adaptation to extreme environments . | Introduction
Materials and methods
Study sites and collection of samples
Plant, parent rock, and soil analysis
Experimental design
Statistical analysis
Results and discussion
Conclusions |
these radiopharmaceuticals are formulated from cyclotron - produced or generator - eluted radionuclides and should be subjected to quality control ( qc ) tests to assure their safety and efficacy before injecting to the patient .
fluorodeoxyglucose ( f-18 fdg ) , a glucose analog , is the most popular pet radiopharmaceutical .
o-15 , ga-68 , i-124 , and cu-64 , and so on are also being used for pet imaging .
however , catalysts like kryptofix ( kryptofix 2.2.2 . ) or tetrabutylammonium ( tba ) salts are required for f-18 fdg synthesis .
somatostatin peptide analogues like dotatate , dotanoc , and dotatoc have been labeled with ga for somatostatin receptor imaging .
n-13 is a short - lived pet radionuclide ( t1/2 = 10 min ) and is produced in cyclotron .
the proton irradiation of a natural water target o ( p , ) n is an efficient method .
oxo anions of nitrogen n-13 ( n-13-no3 and n-13-no2 ) are produced from radiolytic oxidation . with the use of reducing agents such as devarda 's alloy / sodium hydroxide or titanium - chloride / hydroxide ,
these oxo - anions can be converted to n-13 nh3 qc parameters of n-13 nh3 were studied by various methods .
the prepared radiopharmaceuticals are administered intravenously ; therefore , qc is mandatory , but there is no global consensus in relation to required quality attributes .
the three major standards ph.int . , ph . eur . , and usp are available for f-18 fdg .
however , there are differences in f-18fdg quality requirements among usp , ep , and int phar . in this study ,
the qc parameters of three pet radiopharmaceuticals , f-18 fdg , n-13 nh3 , and ga-68 dotatate are studied .
pet radiopharmaceuticals , thin layer chromatography ( tlc ) scanner ( ez - scan , usa ) with multimode radiation detector , ( omni - rad ) gas chromatography ( gc ) ( varian 3900 ) with flame ionization detector ( fid ) , multichannel analyzer ( captus 3000 , capintec ) , well counter , dose calibrator ( capintec crc-25pet ) , silica gel chromatography paper , ph paper ( merck ) , lal reagents from charles river laboratories india pvt . ltd .
the f-18 was produced by o ( p , n ) f reaction using 16.5 mev on - site cyclotron ( pet trace-4 , ge healthcare , milwaukee , usa ) by proton irradiation for 45 min at 40a current using o-18 enriched water . at the end of bombardment , the fluoride was transferred directly to the automatic synthesizer module ( tracer lab mxfdg , ge healthcare , milwaukee , usa ) by helium pressure .
( abx , germany ) that contained all chemicals required for the nucleophilic radiosynthesis were used .
the labeled precursor was hydrolyzed under basic medium to eliminate the protecting group and sterilized by 0.22 m millipore filter .
the f-18 fdg ( 16 ml ) was collected in a sterile glass vial and qc was performed .
ga-68 dotatate was prepared using ge-68/ga-68 generator and iqs fluidic labeling module with in - built heater , both from itg germany .
ethanol ( 30% ) was used for elution of prepared peptide ( ga-68 dotatate ) from c-18 cartridge .
eluted product was passed through a 0.22 m low protein binding filter and collected in a sterile vial .
n-13nh3 was produced by o ( p , ) n irradiation reaction using on - site cyclotron .
oxoanions of nitrogen ( n-13 no3 , and n-13 no2 ) were produced from radiolytic oxidation .
oxoanions were converted to n-13 nh3 by the use of devarda 's alloy , a reducing agent , in sodium hydroxide .
n-13 nh3 vapors were collected in normal saline in a sterilized vial after passing through 0.22 m filter . a total of 25 samples each of f-18 fdg and ga-68 dotatate and n-13 nh3 were randomly selected .
radionuclide purity was assessed by half - life of radionuclides ( t1/2 ) and was measured by two methods , well counter and formula method .
activity of test samples ( f-18 fdg , ga-68 dotatate ) after every 10 min ( a10 ) was recorded .
t1/2 was calculated from the measured values as per the formula : where , t1/2 and t are in minutes .
counts / activity of f-18 fdg sample at 10 s interval was also taken to determine the impurity of n-13 in f-18 fdg . in case of n-13 nh3
a time activity curve was plotted on semilog graph and half - life ( t1/2 ) was taken as the time at which the total activity was decayed to half . for a gamma spectrum of pet radionuclides ,
a repeat spectrum of ga-68 point source was also obtained after 24 and 48 h to determine the ge-68 breakthrough .
radiochemical purity was assessed by silica gel instant thin layer chromatography ( sg - itlc ) . a drop ( 4 - 5 l ) of test sample was placed on a sg - itlc strip ( 10 * 1 cm for f-18 fdg , 8 * 1 for ga-68dotatate and n-13 nh3 ) and air dried .
acetonitrile : water ( 95:5 , v / v ) and sodium citrate was used as mobile phase for f-18 fdg and ga-68 dotatate , respectively .
water : acetone : acetic acid ( 3:2:1 ) saturated with sodium chloride ( nacl ) was used as mobile phase for n-13-nh3 . the radioactivity profile and rf
the amount of organic solvents present in the test samples was estimated by gc using fid detector .
the temperature of detector , oven , and injector were kept constant for all pet radiopharmaceuticals .
hydrogen , air flow , and nitrogen flow rate were also kept constant for all samples .
reference standard of ethanol ( 4000 ppm ) and acetonitrile , ( 400 ppm ) and samples ( 2 - 3 l ) were injected into the gc column and an analysis report was generated .
the concentration of ethanol and acetonitrile in the sample was calculated by the following formula : where c1 and c2 are the concentration of standard and sample .
the chemical purity was calculated for f-18 fdg as kryptofix 2.2.2 ( amino polyether ) may be present in the final product of f-18 fdg .
a total of 4 - 5l of f-18 fdg test sample and the reference standard of kryptofix 2.2.2 ( 0.22 mg / ml ) were developed in the mobile phase composed of methanol : ammonia ( 9:1 , v / v ) .
the developed strips , after drying , were exposed to iodine vapors in a closed container of iodine crystals .
robertson cooked meat medium broth ( rcmb ) was used for cultivation of aerobes and anaerobes , especially pathogenic clostridia .
small inoculation was made near the bottom of the tube and incubated at 37c for 7 days .
the samples were observed every day for 7 days to observe the turbidity or bubble formation by organisms .
the widely used and accepted test for assessing the presence of bacterial endotoxin in a radiopharmaceutical preparation is limulus amebocyte lysate ( lal ) test .
the estimation of bacterial endotoxin test is based on the formation of gel clot in the presence of endotoxin .
this test was performed in randomly selected samples for each pet radiopharmaceutical ( n = 25 ) in a thermally regulated and vibration - free environment .
the permissible limit of endotoxin in injectable formulation is 175 eu / v according to usp and per mlaccording to ph .
the endotoxin concentration in positive water control ( pwc ) was 0.25 and 0.5 eu/ ml .
each sample was diluted at two different maximum valid dilutions ( mvds , i.e. , 350 and 700 times to match with the above - mentioned dilutions of endotoxin .
lal reagent water was used as negative control . after adding reagents in appropriate volume and concentration according to the protocol
, the test vials were incubated for 60 min at 37 1c and were inverted to observe the formation of gel .
a total of 25 samples each of f-18 fdg and ga-68 dotatate and n-13 nh3 were randomly selected .
radionuclide purity was assessed by half - life of radionuclides ( t1/2 ) and was measured by two methods , well counter and formula method .
the initial radioactivity ( a0 ) and activity of test samples ( f-18 fdg , ga-68 dotatate ) after every 10 min ( a10 ) was recorded .
t1/2 was calculated from the measured values as per the formula : where , t1/2 and t are in minutes .
counts / activity of f-18 fdg sample at 10 s interval was also taken to determine the impurity of n-13 in f-18 fdg . in case of n-13 nh3
a time activity curve was plotted on semilog graph and half - life ( t1/2 ) was taken as the time at which the total activity was decayed to half .
for a gamma spectrum of pet radionuclides , a point source was prepared and placed in well counter .
a repeat spectrum of ga-68 point source was also obtained after 24 and 48 h to determine the ge-68 breakthrough .
radiochemical purity was assessed by silica gel instant thin layer chromatography ( sg - itlc ) . a drop ( 4 - 5 l ) of test sample was placed on a sg - itlc strip ( 10 * 1 cm for f-18 fdg , 8 * 1 for ga-68dotatate and n-13 nh3 ) and air dried .
acetonitrile : water ( 95:5 , v / v ) and sodium citrate was used as mobile phase for f-18 fdg and ga-68 dotatate , respectively .
water : acetone : acetic acid ( 3:2:1 ) saturated with sodium chloride ( nacl ) was used as mobile phase for n-13-nh3 . the radioactivity profile and rf
the amount of organic solvents present in the test samples was estimated by gc using fid detector .
the temperature of detector , oven , and injector were kept constant for all pet radiopharmaceuticals .
hydrogen , air flow , and nitrogen flow rate were also kept constant for all samples .
reference standard of ethanol ( 4000 ppm ) and acetonitrile , ( 400 ppm ) and samples ( 2 - 3 l ) were injected into the gc column and an analysis report was generated .
the concentration of ethanol and acetonitrile in the sample was calculated by the following formula : where c1 and c2 are the concentration of standard and sample .
the chemical purity was calculated for f-18 fdg as kryptofix 2.2.2 ( amino polyether ) may be present in the final product of f-18 fdg .
the permissible limit for kryptofix 2.2.2 is 0.22 mg / ml . a total of 4 - 5l of f-18 fdg test sample and the reference standard of kryptofix 2.2.2 ( 0.22 mg / ml ) were developed in the mobile phase composed of methanol : ammonia ( 9:1 , v / v ) . the developed strips , after drying , were exposed to iodine vapors in a closed container of iodine crystals .
robertson cooked meat medium broth ( rcmb ) was used for cultivation of aerobes and anaerobes , especially pathogenic clostridia .
small inoculation was made near the bottom of the tube and incubated at 37c for 7 days .
the samples were observed every day for 7 days to observe the turbidity or bubble formation by organisms .
the widely used and accepted test for assessing the presence of bacterial endotoxin in a radiopharmaceutical preparation is limulus amebocyte lysate ( lal ) test .
the estimation of bacterial endotoxin test is based on the formation of gel clot in the presence of endotoxin .
this test was performed in randomly selected samples for each pet radiopharmaceutical ( n = 25 ) in a thermally regulated and vibration - free environment .
the permissible limit of endotoxin in injectable formulation is 175 eu / v according to usp and per mlaccording to ph .
the endotoxin concentration in positive water control ( pwc ) was 0.25 and 0.5 eu/ ml .
each sample was diluted at two different maximum valid dilutions ( mvds , i.e. , 350 and 700 times to match with the above - mentioned dilutions of endotoxin .
lal reagent water was used as negative control . after adding reagents in appropriate volume and concentration according to the protocol
, the test vials were incubated for 60 min at 37 1c and were inverted to observe the formation of gel .
the product of f-18 fdg , ga-68 dotatate , and n-13 nh3 , were clear , colorless , and free from particulate matter .
the ph of all the samples of f-18 fdg , n-13 nh3 , and ga-68 dotatate was in the range of 5.0 - 6.5 .
the half - life of radionuclide of f-18 fdg , n-13 nh3 , and ga-68 dotatate samples with graph were 110 , 10 , and 69 min , respectively [ figures 1a c ] . the calculated t1/2 ( mean ) from the measured values using the above - mentioned formula was 115.5 , 10.8 , and 67.5 min , respectively .
single peak corresponding to photon energy of 511 kev was observed in the gamma ray spectrum of f-18 fdg and n-13 nh3 [ figures 2a and b ] . in gamma ray spectra of ga-68 ,
one prominent peak corresponding to photon energy of 511 kev and a small sum peak corresponding to 1022 kev were observed [ figure 3a ] .
no peak was observed when the spectrum was recorded with ga-68 point source after 24 and 48 h [ figure 3b ] .
based on half - life measurement and gamma spectra , the radionuclide purity was almost 100% . the retardation factor ( rf ) of f-18 fdg , ga-68 dotatae , and n-13
nh3 were in the range of 0.39 - 0.48 , 0.16 - 0.23 , and 0.64 - 0.73 [ figures 4a c ] .
single peaks were observed in each sample of all three pet radiopharmaceuticals used which demonstrated the radiochemical purity more than 99%
. graphical demonstration of time - activity curve on semilogthermic graph for determination of t1/2 of ( a ) f-18 , ( b ) n-13 , and ( c ) ga-68 spectra obtained by using mca ( a ) f-18 fdg ( b ) n-13 nh3 spectra of ga-68 obtained by using mca ( a ) after elution , ( b ) 24 h after elution instant thin layer chromatograms of ( a ) fluorine-18 fluorodeoxyglucose , ( b ) ga-68 dotatate , and ( c ) n-13 nh3 the concentration of ethanol and acetonitrile of f-18 fdg sample was in the range of 20 - 1695ppm and 3 - 57 ppm , respectively [ figure 5a , b ] .
however , the concentration of ethanol in ga-68 dotatate was in the range of 294 - 1147 ppm [ figure 6a , b ] .
gc was not performed for n-13 nh3 samples as organic solvents were neither used nor formed during the synthesis of n-13 nh3 .
the violet - brown color was developed in a standard kryptofix strip when exposed to iodine vapors .
however , no color band was visible when f-18 fdg sample strips were exposed to iodine vapors [ figure 7 ] .
gas chromatograms of ( a ) ethanol and acetonitrile standard and ( b ) fluorine-18 fluorodeoxyglucosesample gas chromatograms of ( a ) ethanol standard and ( b ) ga-68 dotatate sample showing chromatograms of ( a ) kryptofix standard ( 0.22 mg / ml ) , ( b ) f-18 fdg samples , developed in methanol : ammonia ( 9:1 , v / v ) and exposed to iodine vapors ; ( c ) iodine chamber no microbial growth was observed in the samples of f-18 fdg , n-13 nh3 , and ga-68 dotatate .
gel formation was not observed in the samples of f-18 fdg , n-13 nh3 , ga-68 dotatate , and in negative water control .
however , gel was formed in pwc and positive product control at an endotoxin concentration of 0.25 and 0.50 eu / ml . all the results are summarized in table 1 .
the visual inspection per batch of in - house synthesized pet radiopharmaceutical is important and mandatory prior to use in the patient and is also a measure of process performance and validation .
presence of particulate matter in a test sample indicates possible failure at some stage of radiopharmaceutical synthesis .
this may include the failure of the purification , sterilizing filtration , and inadequate environmental control during assembly of reagents in the preinstallation stage .
however , a slight yellow color in the f-18 fdg preparation is acceptable according to ph .
a precisely measured count at two points within a 10 min interval is sufficient to determine the physical half - life of f-18 and ga-68 .
however , the counts were also taken at 10 min interval up to 2 h and half - life was calculated at which the activity / counts were reduced to half . in our tests , the gamma spectrum of a test sample demonstrated a major peak at 511 kev and a sum peak at 1022 kev .
but the presence of a 511or 1022 kev peak in the g ray spectrum is not sufficient to determine radionuclidic identity .
impurities such as n ( arising from o impurity in the o - water ) or other positron emitters may not be detected , as gamma peaks with an energy of 511 and 1022 kev sum peak are a common feature of positron emitters .
a combination of gamma spectrum and the half - life measurement provides the best assurance of the identity and purity of the radionuclide
. the measured half - life will be lower if n-13 impurity is present in fdg .
as the half - life of n-13 is only 10 min therefore , activity as a measure of counts at 2 min interval is important .
the ga-68 sample prepared for gamma spectra was kept for 48 h in order to decay all ga-68 present to a level that permits the detection of long lived ge-68 impurity .
the gamma photons resulting from the decay of ge-68 will have energy of 511 kev and a sum peak of 1022 kev may also be observed . in our study , we could not find any energy peak at 24 and 48 h. these results demonstrated that ge-68 is not present at detectable range .
the availability of nonmetallic silica based column generator eliminates the additional purification step for removal of metallic ions by cation exchange column .
only single peak was observed in tlc scans of f-18 fdg , ga-68 dotatate , and n-13 nh3 .
the rf of the principal peak corresponded with the studied radiopharmaceuticals [ table 1 ] .
radio - tlc provides an easy and reliable means to determine radiochemical identity and purity of radiopharmaceuticals .
narrow range of rf values of the principal spot in the test samples confirmed the radiochemical identity of f-18 fdg , ga-68 dotatate , and n-13 nh3 .
radioactivity was measured in a dose calibrator after calibration with an appropriate reference standard , cs-137 ( 662 kev ) .
the total radioactivity , volume ( mbq / ml or mci / ml ) and reference time of radiopharmaceuticals were specified on product vial label . on the basis of this information , radioactivity per patient was dispensed and exposure to the worker was also reduced .
the ph of f-18 fdg , ga-68 dotatate , and n-13 nh3 fall within the range , that is , 4.5 - 8.5 .
the allowed range of acceptable ph for radiopharmaceuticals is broad ; hence , ph meter was not used .
a narrow range ph strip was used and the results were within the reference ph range .
the ph check of n-13 nh3 is very important as the radio - labeled nitrates may be carried over during the reduction and distillation process .
acetonitrile / ethanol is used during synthesis for reagent preparations and conditioning of the purification cartridges .
traces of these organic solvents may potentially contaminate f-18 fdg and ga-68 dotatate and therefore should be controlled .
the permissible limit of acetonitrile is 400 ( 0.04% ) and of ethanol is 4000 ppm ( 0.4% ) .
ga-68 dotatate was eluted in ethanol , but the concentration of ethanol in random samples was within the permissible limit [ table 1 ] .
organic solvent was not used in the preparation protocol of n-13 nh3 synthesis and thus there was no requirement of gc .
no color band / spot was visualized in the chromatogram of f-18 fdg when exposed to iodine vapors after developed in methanol : ammonia ( 1:1 ) .
these results demonstrated that kryptofix was not present at detectable range in f-18 fdg samples .
kryptofix , a cyclic crown ether , acts as catalyst and binds the potassium ion to prevent the formation of f-18 kf , therefore , enhances the reactivity of ( f-18 ) ion .
kryptofix may cause apnea and convulsions ; therefore , it must be within appropriate limits ( 0.22 mg / ml ) and conformance with these limits is to be demonstrated .
currently available automatic synthesis modules have multiple removal steps to reduce the amount of kryptofix to negligible level .
we have used rcmb as it has the ability to initiate growth of bacteria from very small inocula and also maintain the viability of cultures for longer duration .
moreover , rcmb is routinely used in the department of microbiology , so there was no need for growing reference bacteria .
the gel was not formed in any of the samples indicated the absence of endotoxin in f-18 fdg , ga-68 dotatate , and n-13 nh3 test samples .
all positive controls demonstrated the gel formation even with the endotoxin concentration of 87.5eu / ml . however , negative control and samples did not show any gel formation .
f-18 fdg , ga-68 dotatate , and n-13 nh3 comply with requirements for intravenous administrations .
f-18 fdg , ga-68 dotatate , and n-13 nh3 conformed to various quality attributes of purity ; efficacy and safety in the samples included in this study and comply with all requirements for injectable radiopharmaceutical products . | purpose of the study : to study quality control parameters of routinely prepared positron emission tomography ( pet ) radiopharmaceuticals.materials and methods : three pet radiopharmaceuticals fluorine-18 fluorodeoxyglucose ( f-18 fdg ) , n-13 ammonia ( n-13 nh3 ) , and ga-68 dotatate ( n = 25 each ) , prepared by standardized protocols were used . the radionuclide purity , radiochemical purity , residual solvents , ph , endotoxins , and sterility of these radiopharmaceuticals were determined.results:the physical half - life of radionuclide in radiopharmaceuticals , determined by both graphical and formula method , demonstrated purity of radionuclides used .
ph of all pet radiopharmaceuticals used was in the range of 5 - 6.5 .
no microbial growth was observed in radiopharmaceutical preparations .
the residual solvents , chemical impurity , and pyrogens were within the permissible limits.conclusions:all three pet radiopharmaceuticals were safe for intravenous administration . | INTRODUCTION
MATERIALS AND METHODS
pH
Radionuclide purity
Gamma ray spectra
Radiochemical purity
Residual solvent
Chemical purity
Sterility
Bacterial endotoxin test
RESULTS
DISCUSSION
CONCLUSION |
alpha-1 antitrypsin ( a1at ; also known as -1 proteinase inhibitor ) is a serum glycoprotein which predominantly ( 80% ) originates from hepatocytes.1 a1at inhibits a wide variety of proteases ( eg , neutrophil elastase and proteinase-3 ) to contribute to a proteinase / antiproteinase balance.2 it is postulated that this acute phase protein participates in limiting host tissue injury by proteases at sites of inflammation;3 a proposed critical function is the prevention of lung injury associated with disruption of connective tissue by neutrophil elastase enzyme.1 a1at deficiency is an autosomal recessive genetic disorder caused by its defective production leading to both decreased activity in body tissues and deposition of excessive abnormal protein in the liver.1,2 while m is the normal allele for a1at , there are over 80 variant mutations of the gene .
the z allele results in a glutamate to lysine mutation at position 342 while the s allele produces a glutamate to valine mutation at position 264 . in individuals with ss , mz and sz genotypes , blood levels of a1at
are reduced to between 40% and 60% of normal levels ( ie , those observed among mm individuals ) . among those who do not smoke ,
this a1at concentration is almost always sufficient to protect the lungs from the effects of elastase .
however , among individuals with the zz genotype , a1at levels are usually less than 15% of normal and these deficient patients can develop lung disease at a young age .
in addition , those with the zz genotype can develop liver disease ; this is associated with impaired a1at secretion and its consequent accumulation in this specific tissue .
therefore , a1at deficient patients can present with lung disease ( eg , panacinar emphysema [ chronic obstructive pulmonary disease ] , pneumothorax , asthma , and bronchiectasis ) and liver disease ( eg , hepatitis , cirrhosis , and hepatocellular carcinoma).4 people of northern and western european ancestry are at the greatest risk for a1at deficiency and its associated diseases;5 4% carry the piz allele and between 1 in 1,500 and 1 in 2,5003,000 are zz .
in addition to siderophores and ferrireductases , microbials employ proteases to mobilize host sources of iron to support their growth and replication.6 these proteases cleave iron - transport and -storage proteins allowing utilization of the metal by the microbe.7,8 corroborating a potential interaction between metal homeostasis and proteases , elevated iron concentrations impact expression of proteases and their activities.912 animal and human investigation similarly suggests a participation of proteases in iron homeostasis.1315 the intratracheal instillation of a single dose of neutrophil elastase in an animal model increased lung iron concentrations .
iron homeostasis is disrupted among cystic fibrosis patients in whom airway elastase content and activity is excessive ; cystic fibrosis patients have elevated iron and ferritin concentrations in both the sputum and bronchoalveolar lavage .
a participation of proteases also suggests a potential involvement of anti - proteases in iron homeostasis .
a participation of a1at in the iron homeostasis of humans has been previously suggested with observations of deficient patients developing cirrhosis characterized by significant iron accumulation.16 an involvement of neutrophil elastase and a1at in disrupting iron homeostasis of the lung was supported by investigation which demonstrated a proteolytic cleavage of both iron - transport and -storage proteins with subsequent increase in nonheme tissue iron concentrations.17 finally , patients treated with antiproteases , and thus altering protease activity , can show evidence of disruptions in iron homeostasis.18 we further explored the relationship between a1at and iron homeostasis in humans by testing the postulate that its deficiency is associated with a systemic disruption in iron homeostasis .
archived plasma samples were kindly provided by the alpha-1 foundation ( miami , fl ) . these included 90 nonfasting plasma specimens from 30 mm , 30 mz , and 30 zz individuals who had been screened as family members of a patient with a1at deficiency .
institutional review board exemption was granted from the university of north carolina for analyses of these blood samples .
samples were analyzed for a1at , ferritin , iron , transferrin , and c - reactive protein ( crp ) .
a1at and crp concentrations were measured using immunoturbidimetric assay kits ( diasorin inc , stillwater , mn ) .
ferritin was quantified by also using an immunoturbidimetric assay ( kamiya biomedical company , seattle , wa ) .
transferrin concentrations were analyzed using an immunoprecipitin analysis ( incstar corporation , stillwater , mn ) .
assays were modified for use on the konelab arena 30 ( thermolab systems , espoo , finland ) .
plasma samples were hydrolyzed at 70c in 3 n hcl/10% trichloroacetic acid for 24 hours .
after centrifugation , metals in the supernatant were measured using inductively coupled plasma optical emission spectroscopy ( icpoes ; model optima 4300d ; perkin elmer , norwalk , ct ) .
differences between groups were compared using one - way analysis of variance . the post - hoc test employed was duncan s multiple range test .
archived plasma samples were kindly provided by the alpha-1 foundation ( miami , fl ) . these included 90 nonfasting plasma specimens from 30 mm , 30 mz , and 30 zz individuals who had been screened as family members of a patient with a1at deficiency .
institutional review board exemption was granted from the university of north carolina for analyses of these blood samples .
samples were analyzed for a1at , ferritin , iron , transferrin , and c - reactive protein ( crp ) .
a1at and crp concentrations were measured using immunoturbidimetric assay kits ( diasorin inc , stillwater , mn ) .
ferritin was quantified by also using an immunoturbidimetric assay ( kamiya biomedical company , seattle , wa ) .
transferrin concentrations were analyzed using an immunoprecipitin analysis ( incstar corporation , stillwater , mn ) .
assays were modified for use on the konelab arena 30 ( thermolab systems , espoo , finland ) .
plasma samples were hydrolyzed at 70c in 3 n hcl/10% trichloroacetic acid for 24 hours .
after centrifugation , metals in the supernatant were measured using inductively coupled plasma optical emission spectroscopy ( icpoes ; model optima 4300d ; perkin elmer , norwalk , ct ) .
data are expressed as mean values standard error unless otherwise specified . differences between groups were compared using one - way analysis of variance .
demographics of healthy individuals providing archived plasma samples are listed ( table 1 ) . there were differences in the gender distributions between the mm , mz , and zz cohorts and subsequently results were provided for males and females .
disparities in age and ethnicity between the cohorts were not significant . among the samples collected by the alpha-1 foundation ,
plasma levels of a1at for mz and zz individuals were approximated as 60% and 20% of those for mm individuals respectively ( figure 1a ) .
this concentration of a1at approximates those serum values reported in other study populations in which zz individual demonstrate levels 15% of mm subjects.19 there were significant differences in plasma ferritin concentrations between mm , mz , and zz cohorts ( figure 1b ) .
those with the zz genotype showed greater ferritin values relative to both mm and mz genotypes while there were no differences between mm and mz ( figure 1b ; f = 5.54 ; p = 0.02 ) . when separate analyses of variance were conducted for males and females , the ferritin concentration in the zz cohort was greater than both mm and mz for males while only greater than mm subjects for females .
plasma transferrin for mm , mz , and zz cohorts showed no significant differences between them regardless of whether all were included in the analysis or sex - specific values were considered ( figure 1c ; f = 2.97 ; p = 0.09 ) .
linear regression analysis revealed a significant ( negative ) relationship between plasma concentrations of a1at and ferritin ( figure 2a ; r = 0.26 ; p = 0.01 ) .
linear regression between a1at and transferrin levels was not significant ( figure 2b ; r = 0.18 ; p = 0.09 ) .
the linear regression between ferritin and transferrin was significant ( negative ) ( figure 2c ; r = 0.39 ; p < 0.01 ) .
plasma crp concentrations were not significantly different between mm , mz , and zz individuals ( figure 3a ) .
linear regression analysis did not show a significant association between crp and a1at ( figure 3b ; r = 0.10 ; p = 0.36 ) . regarding the relationships between crp and indices of iron homeostasis
, there was no significant association with either ferritin ( r = 0.17 ; p = 0.11 ) or transferrin ( r = 0.20 ; p = 0.06 ) .
plasma metal concentrations were significantly different between mm and zz cohorts for aluminum ( f = 3.10 ; p = 0.05 ) and iron ( f = 3.37 ; p = 0.04 ) ( figure 4a ) .
zinc also appeared to increase in the zz cohort , but this did not reach significance ( f = 0.49 ; p = 0.61 ) . aluminum and iron
were elevated in those individuals with the zz genotype relative to the mm genotype ; disparities between mm and mz were not significant .
in contrast , copper levels among those with both mz and zz genotypes were significantly lower relative to the mm cohort ( f = 4.33 ; p = 0.02 ) ( figure 4a ) .
correlations of plasma metal concentration with levels of a1at were significant only for iron ( figure 3b ; r = 0.21 ; p = 0.05 ) .
ferritin is considered the best available index to measure total body stores of iron.2022 significant differences in plasma ferritin concentrations between mm and zz individuals support an impact of a1at deficiency on iron homeostasis in humans .
similarly , plasma iron levels were increased in the zz genotype . while the mz genotype decreased a1at levels , it did not influence ferritin and iron concentrations ; this may reflect either a true lack of effect of a1at genotype on iron homeostasis or the sample number may have been insufficient to demonstrate a difference .
the significant correlations between both plasma levels of ferritin and iron with a1at also suggest a participation of this anti - protease in iron homeostasis . a relationship between a1at and ferritin
however , crp levels were not significantly different between genotypes ( mm , mz , and zz ) and there was no significant relationship between crp and ferritin suggesting the increase in ferritin levels among zz individuals was not the result of disparities in inflammatory status .
in addition , while both a1at and ferritin are positive acute phase reactants , the relationship between them in our study cohort was an inverse one ; that is , as a1at decreased , ferritin increased .
it is not possible to argue that inflammation is responsible for an increase in one index while the other is decreased .
this investigation does not address the molecular basis for a disruption in iron homeostasis in patients with a1at deficiency .
proteases are employed as a third pathway of iron acquisition by microbials ( in addition to siderophores and ferrireductases).23,24 these proteins have a capacity to cleave iron - transport and -storage proteins thus allowing utilization of the metal by the microbe.2527 reflecting potential interactions between metal availability and proteases , increased iron concentrations can impact expression and/or activity of collagenase , elastase , alkaline proteinase , and metalloproteases.9,10,12,28,29 in addition , in vitro exposure to the protease inhibitor a1at alters iron homeostasis in eukaryotic cells.3034 this serpin , which primarily inhibits neutrophil elastase , can elevate intracellular ferritin concentrations in cultured cells . in vivo exposure to protease disrupted iron homeostasis in an animal model.17 finally , among patients with a1at deficiency , iron homeostasis is disrupted.16,35,36 accordingly , one mechanism through which a1at deficiency can affect a disruption in iron homeostasis is by allowing an unrestricted activity of specific proteases which would result in increased iron availability .
this will lead to elevated tissue concentrations of iron especially in the liver and spleen , which are major cites of storage . reflecting this
this disruption in iron homeostasis associated with a1at deficiency can assist in understanding the clinical presentation of such patients .
liver tissue is one of the major sites for iron storage . with a lack of a1at
elevated liver iron is associated with hepatitis , cirrhosis , and hepatocarcinoma , which are the manifestations of disease in a1at deficiency among zz individuals .
inhaled exposures ( eg , particles ) precipitate a biological effect in the lung by disrupting the normal iron homeostasis and increasing the availability of host iron.37 subsequently , particle exposure in a1at deficient individuals is predicted to be associated with a higher incidence of disease ( eg , chronic obstructive pulmonary disease among smokers and those exposed to elevated particle levels).3840 we conclude that a1at deficiency is associated with evidence of a disruption in iron homeostasis in zz individuals with plasma ferritin and iron concentrations being elevated .
such a disruption in iron homeostasis can contribute to understanding the clinical presentation of a1at deficiency . | there is evidence that proteases and antiproteases participate in the iron homeostasis of cells and living systems .
we tested the postulate that -1 antitrypsin ( a1at ) polymorphism and the consequent deficiency of this antiprotease in humans are associated with a systemic disruption in iron homeostasis .
archived plasma samples from alpha-1 foundation ( 30 mm , 30 mz , and 30 zz individuals ) were analyzed for a1at , ferritin , transferrin , and c - reactive protein ( crp ) .
plasma samples were also assayed for metals using inductively coupled plasma atomic emission spectroscopy ( icpaes ) .
plasma levels of a1at in mz and zz individuals were approximately 60% and 20% of those for mm individuals respectively .
plasma ferritin concentrations in those with the zz genotype were greater relative to those individuals with either mm or mz genotype .
plasma transferrin for mm , mz , and zz genotypes showed no significant differences .
linear regression analysis revealed a significant ( negative ) relationship between plasma concentrations of a1at and ferritin while that between a1at and transferrin levels was not significant .
plasma crp concentrations were not significantly different between mm , mz , and zz individuals .
icpaes measurement of metals confirmed elevated plasma concentrations of nonheme iron among zz individuals .
nonheme iron concentrations correlated ( negatively ) with levels of a1at .
a1at deficiency is associated with evidence of a disruption in iron homeostasis with plasma ferritin and nonheme iron concentrations being elevated among those with the zz genotype . | Introduction
Methods
Samples from MM, MZ, and ZZ individuals
Plasma assays
Measurements of metals in plasma
Statistics
Results
Discussion |
nanohybrid resin composite , the newest resin composite restorative material , is becoming popular because it combines physical , mechanical , and esthetic properties .
it incorporates a high volume fraction of filler particles with a wide particle size distribution ( 5 - 100 nm ) .
the compressive and diametral strength , and the fracture resistance of the nanohybrid resin composite is equivalent to or higher than those of other composites ( hybrid , microhybrid , and microfilled - resin composite ) .
giomer is a relatively new innovative filler technology of resin composite as an esthetic direct restorative material for anterior and posterior teeth restoration .
similar to a traditional methacrylate - based composite , the giomer chemical composition encompasses inorganic filler particles and organic - resin matrix . in place of applying purely glass or quartz as the typical fillers ,
the giomer encompasses inorganic fillers ( ranges between 0.01 and 5 m ) that are derived from the complete or partial reaction of ion - leachable fluoroboroaluminosilicate glasses with polyalkenoic acids in water before being interfaced with the organic matrix .
this created a stable glass - ionomer phase on a glass core in which they induced an acid - base reaction between acid reactive fluoride containing glass and polycarboxylic acid in the presence of water and developed as a prereacted glass ionomer ( prg ) filler .
the pre - action can involve only the surface of the glass particles ( called surface prg ( s - prg ) ) or almost the entire particle ( termed fully prg ( f - prg ) ) .
a recent study suggested that drinking apple cider can help maintain good health as well as help one detox .
however , consumption of acidic food , fruit juices , soft drinks , coffee , tea , or wine , can result in surface damage and decrease hardness , esthetic quality , and other properties of resin composite and giomer
. there are a number of studies reporting the different surface hardness effects of beverages on resin composite and giomer , but only a few of the studies reported effects of apple cider , orange juice , coca - cola , coffee , and beer on surface hardness of nanohybrid resin composite and giomer .
in addition , the previous studies presented the continuous immersion of resin composite in the selected beverages .
however , during consumption , drink contacts only shortly with the tooth surfaces before it is washed away by saliva . this study was then designed to simulate the washing effect of saliva of an individual drinking by cyclic specimen immersion .
therefore , the objectives of this study were to compare the effects of different beverages ( apple cider , orange juice , coca - cola , coffee , and beer ) on surface hardness and surface characteristic changes of nanohybrid resin composite and giomer and to investigate the ph and titratable acidity of different beverages .
ninety - three disc - shaped specimens ( 10.0 mm in diameter and 2.0 mm in thickness ) were made from each nanohybrid resin composite and giomer using a polytetrafluoroethylene cylindrical mold .
the details of these materials are given in table 1 . a mylar strip and a glass slide
were then placed over the filled mold after which light pressure ( 20 n ) was applied . the glass slide and
the specimens were polymerized for 40 s with a light - activated polymerization unit ( elipar 2500 , 3 m espe , st paul , mn , usa ) to ensure a complete polymerization .
caulk , milford , de , usa ) . no mechanical preparation or abrasions of specimens
materials used in this study five beverages were used in this study : apple cider , orange juice , coca - cola , coffee , and beer [ table 2 ] .
the ph of each beverage was determined using a ph meter ( orion 900a , orion research , boston , ma , usa ) .
ten ph readings of the freshly prepared drinks were obtained in order to give a mean ph measurement for each beverage .
beverages used in the present study to determine titratable acidity ( buffering capacity ) , 20 ml of each beverage was added by 0.5 ml increments of 1 mol / l sodium hydroxide ( naoh ) .
the amount of naoh required to reach ph levels of 5.5 , 7.0 , and 10.0 was recorded .
the titrations for each beverage were also repeated 10 times to obtain a mean value .
ninety - three discs of each nanohybrid resin composite and giomer were divided into five groups of 18 specimens , the rest of three samples ( before immersion ) were subjected to scanning electron microscopy ( sem ) ( jsm model 5800lv , jeol , tokyo , japan ) observations .
the hardness value ( kg / mm ) of each specimen was determined using a microhardness tester ( micromet ii , buehler , lake bluff , il , usa ) with a diamond vickers indenter .
a load of 0.3 n was applied to the surface for 10 s. five indentations , equally spaced over a circle , were made on the surface of each specimen .
after that , at room temperature ( about 25c ) , the specimens were alternately immersed in 25 ml of a beverage for 5 s and in 25 ml of artificial saliva for 5 s for 10 cycles .
the same protocol was used with different beverages used in this study for 28 days consecutively . in order to maintain the original ph level of the beverages ,
the specimens immersion protocol simulated an individual eating acidic food , sour fruits , and drinks .
after the immersion sequence was completed , the specimens were rinsed with deionized water , blotted dry , and subjected to post - immersion surface microhardness testing .
the surface hardness test was carried out at the following intervals , before immersion and then subsequently at 7 , 14 , 21 , and 28 days .
gradual changes in surface microhardness were recorded at each time interval . using sem , the effect of each beverage on the surface micromorphology of the materials before and after immersion were determined .
three specimens of each restorative material from each of the five beverages at day 28 were examined .
surface microhardness values were tested for significant differences ( at = 0.05 ) using two - way analysis of variance ( anova ) with repeated measurement , tukey 's honestly significant difference ( hsd ) , and a t - test for multiple comparisons .
ninety - three disc - shaped specimens ( 10.0 mm in diameter and 2.0 mm in thickness ) were made from each nanohybrid resin composite and giomer using a polytetrafluoroethylene cylindrical mold .
the details of these materials are given in table 1 . a mylar strip and a glass slide
were then placed over the filled mold after which light pressure ( 20 n ) was applied . the glass slide and
the specimens were polymerized for 40 s with a light - activated polymerization unit ( elipar 2500 , 3 m espe , st paul , mn , usa ) to ensure a complete polymerization .
caulk , milford , de , usa ) . no mechanical preparation or abrasions of specimens
five beverages were used in this study : apple cider , orange juice , coca - cola , coffee , and beer [ table 2 ] .
the ph of each beverage was determined using a ph meter ( orion 900a , orion research , boston , ma , usa ) .
ten ph readings of the freshly prepared drinks were obtained in order to give a mean ph measurement for each beverage .
beverages used in the present study to determine titratable acidity ( buffering capacity ) , 20 ml of each beverage was added by 0.5 ml increments of 1 mol / l sodium hydroxide ( naoh ) .
the amount of naoh required to reach ph levels of 5.5 , 7.0 , and 10.0 was recorded .
the titrations for each beverage were also repeated 10 times to obtain a mean value .
ninety - three discs of each nanohybrid resin composite and giomer were divided into five groups of 18 specimens , the rest of three samples ( before immersion ) were subjected to scanning electron microscopy ( sem ) ( jsm model 5800lv , jeol , tokyo , japan ) observations .
the hardness value ( kg / mm ) of each specimen was determined using a microhardness tester ( micromet ii , buehler , lake bluff , il , usa ) with a diamond vickers indenter . a load of 0.3 n was applied to the surface for 10 s. five indentations , equally spaced over a circle , were made on the surface of each specimen .
after that , at room temperature ( about 25c ) , the specimens were alternately immersed in 25 ml of a beverage for 5 s and in 25 ml of artificial saliva for 5 s for 10 cycles .
the same protocol was used with different beverages used in this study for 28 days consecutively . in order to maintain the original ph level of the beverages ,
the specimens immersion protocol simulated an individual eating acidic food , sour fruits , and drinks .
after the immersion sequence was completed , the specimens were rinsed with deionized water , blotted dry , and subjected to post - immersion surface microhardness testing .
the surface hardness test was carried out at the following intervals , before immersion and then subsequently at 7 , 14 , 21 , and 28 days .
using sem , the effect of each beverage on the surface micromorphology of the materials before and after immersion were determined .
three specimens of each restorative material from each of the five beverages at day 28 were examined .
surface microhardness values were tested for significant differences ( at = 0.05 ) using two - way analysis of variance ( anova ) with repeated measurement , tukey 's honestly significant difference ( hsd ) , and a t - test for multiple comparisons .
the mean ph and standard deviations ( sds ) and titratable acidity of beverages with 1 mol
the microhardness values of the materials used before and after immersion are reported in table 4 . the mean ph and standard deviation ( sd ) and titratable acidity ( volume of naoh ( ml ) to bring the ph to 5.5 ,
7.0 , and 10.0 ) in beverages tested mean microhardness and standard deviations ( sds ) of materials tested immersed in different beverages at different times sem photomicrographs of the nanohybrid resin composite and giomer , before and after the 28 day of immersion period in the different beverages , are presented in figures 1 and 2 , respectively .
scanning electron microscopy ( sem ) photomicrographs of nanohybrid resin composite ( 300 ) : ( a ) before immersion ( b ) after immersion in apple cider ( c ) orange juice ( d ) coca - cola , ( d ) coffee , and ( e ) beer sem photomicrographs of giomer ( 300 ) : ( a ) before immersion ( b ) after immersion in apple cider ( c ) orange juice ( d ) coca - cola ( d ) coffee , and ( e ) beer
microhardness values of all groups decreased from the initial week of immersion until the end of the 28 days period and the greatest change in hardness shown occurred within the first 7 days .
the specimens were not exposed to any mechanical forces so any observed change in hardness would be from a chemical reaction or dissolution .
the decreasing in microhardness related to the ph and the titratable acidity of beverages as seen from sem photomicrographs . according to the sem results of this present study , both materials tested became rougher after soaking in the beverages .
beautifil ii giomer became rougher than the premise resin composite , because average filler particle size of beautifil ii is 0.8 mm and premise is 0.4 mm . after soaking in the beverages , dislodgement of filler particles resulting in beautifil
coca - cola is a popular soft drink with the lowest ph among the beverages in the present study . after immersing the specimens in the beverages ,
it has been reported that a low ph in acidic food and drink induces erosive wear in materials .
although coca - cola is the lowest tritratable acidity , but coca - cola is a carbonate beverage containing carbonic acid and phosphoric acid which promotes dissolution and easily eroded the materials .
the erosive potential of an acid drink is not exclusively dependent on its ph , is also strongly influenced by its tritratable acid content in beverages .
the ph values present only a measure of the free hydrogen ion concentration . it does not present the hydrogen ion remaining in the undissociated form .
thus , the potential degradation of acidic agents should be considered for both the ph value and titratable acidity .
apple cider has the highest tritratable acidity in this study of beverages , while orange juice as a fruit drink has higher tritratable acidity than the other three groups of beverages , thus indicating erosive potential .
it may also be possibly related to the type of acid used in beverage 's formulations .
apple cider and orange juice are composed of citric acid while coca - cola is composed of phosphoric acid and carbonic acid .
however , citric acid has been shown to be aggressive for dental hard tissues and resin - based restorative materials .
the influence of the acidity increasingly dissolves the matrix , along with any unstable glass particles in a low ph value drink .
high acidity might have a greater softening effect on the resin matrix , thus promoting the dislodgement and leaching out of filler particles and reducing the load resistance of restorative materials . in comparison to a giomer
, resin composite was found to be less affected by low ph beverages or acid solution .
therefore , premise resin composite exhibited less change in surface hardness values than beautifil ii giomer .
the results of this present study showed that microhardness decreased from the 1 week until the end of the 28 days period of immersion in coffee .
although the ph of coffee is nearly 7 , coffee is composed of water , and the effect of water uptake can degrade polymer materials . when polymer materials absorb water , coupling agents cause hydrolysis and loss of chemical bond between filler particles and the resin matrix .
filler particles dislodge from the outer surface of the material causing surface roughness and decreasing hardness . the effect upon the resin matrix and the degradation of the resin - filler interface and inorganic fillers
this may explain why premise resin composite , which contains silica / barium glass , shows hardness decrements when exposed to beverages .
factors which influenced water absorption of polymer - based materials included the types of resin . a hydrophobic resin like hydroxyethylmethacrylate absorbs more water than one like bis - gma
. filler loading may affect the water absorption of materials , with higher filler loading expecting to show a lower uptake .
the last factor which influences water absorption of polymer - based tooth - color filling materials is the presence of voids during the mixing or producing of these materials .
the result of this present study also showed that microhardness decreased from the first week until the end of the 28 days period of immersion in beer , accompanied with the data of mckinney and wu .
wine and 9% volume alcohol beverages cause significant increases in the degree of corrosion because alcohol in beverages soften polymer matrices and dislodge filler particles , resulting in a rapid decrease in microhardness . the limitations of this study included incomplete replication of the complex oral environment and disregard for the effects of temperature change . whilst further studies may examine the in vivo effects of beverages and this study could not completely replicate the complex oral environment , this study at least confirms the erosive potential of certain acidic juices , soft drink , coffee , and alcoholic beverages ; which are a potentially damaging factor that the public should be aware of .
within the limitation of this study , the following conclusions were drawn : all the beverages used significantly reduced the surface hardness of the both materials , particularly at the end of the 28 days immersion period .
immersion in coca - cola caused more surface hardness reduction over time than other beverages .
in addition , giomer showed significantly greater reduction in surface hardness than nanohybrid resin composite .
the effect of these beverages on the surface of both restorative materials also depended upon the exposure time and chemical composition of the restorative materials and beverages . | aims : to investigate the effects of five beverages ( apple cider , orange juice , coca - cola , coffee , and beer ) on microhardness and surface characteristic changes of nanohybrid resin composite and giomer.materials and methods : ninety - three specimens of each resin composite and giomer were prepared . before immersion ,
baseline data of vicker 's microhardness was recorded and surface characteristics were examined using scanning electron microscopy ( sem ) .
five groups of discs ( n = 18 ) were alternately immersed in 25 ml of each beverage for 5 s and in 25 ml of artificial saliva for 5 s for 10 cycles .
specimens were then stored in artificial saliva for 24 h. this process was repeated for 28 days .
after immersion , specimens were evaluated and data were analyzed by two - way repeated analysis of variance ( anova ) , tukey 's honestly significant difference ( hsd ) , and a t - test ( = 0.05).results : microhardness of all groups significantly decreased after being immersed in the tested beverages ( p < 0.05 ) .
sem photomicrographs presented surface degradation of all groups.conclusions:the effect of these beverages on the surface of both restorative materials also depended upon the exposure time and chemical composition of the restorative materials and beverages . | INTRODUCTION
MATERIALS AND METHODS
Specimen preparation
The pH and titratable acidity measurements
Beverage immersion and microhardness testing
Surface micromorphology analysis
Statistical analysis
RESULTS
DISCUSSION
CONCLUSION |
colorectal cancer ( crc ) is one of the most common malignancies in industrialized countries and one of the most common causes of cancer - related death.1,2 in denmark , approximately 4200 new cases of crc are diagnosed each year,3 with a 5-year survival of only 43%49%.4,5 danish crc survival is lower than in our neighboring counterparts and countries with similar health systems,6,7 probably due to higher mortality in the first year after diagnosis.5,6,8 similar to crc , denmark has lower survival for many other cancer sites.5,6,9 aiming to improve cancer control , the first national cancer plan was established in 2000.10 the main topics were expansion of the diagnostic and nonsurgical treatment capacity , as well as establishment of multidisciplinary cancer groups and implementation of clinical databases in order to monitor quality of cancer treatment . in 2005 ,
the second national cancer plan was launched11 and concerned the reduction of diagnostic and treatment delays by organizing the cancer pathways , as well as strengthening the cancer surgery by centralization and in - service training .
although these different initiatives may have the potential of improving survival in crc patients , no updated data on survival exist .
we therefore conducted the present study to monitor survival and mortality in colon and rectal cancer patients using existing data from the central and northern danish regions .
we conducted this study in the central and northern denmark regions with a combined population of 1.8 million persons .
the national health service provides tax - supported health care for all inhabitants of denmark , guaranteeing free access to general practitioners and hospitals . through the danish national registry of patients ( dnrp ) , we identified all patients who had a first - time hospitalization with colon or rectal cancer between january 1 , 1998 and december 31 , 2009 .
the dnpr includes data on personal identification number , hospital , department , surgical and diagnostic procedures , and discharge diagnoses , as defined by the international classification of diseases 10th edition ( icd-10 ) by 1993.12 the icd-10 codes used to identify colonic cancer were c1819 and rectal cancer c2021 .
since 1968 , the central office of civil registration has assigned a unique 10-digit civil registration number to all danish citizens,13 which enables unambiguous data linkage between danish registries .
the civil registration system also contains information on vital status , date of death , and residence .
we followed each patient from the date of colon or rectal cancer diagnosis until emigration , death , or june 25th 2010 , whichever came first . to visualize crude survival we constructed kaplan meier curves stratified according to periods of colon or rectal cancer diagnosis ( 19982000 , 20012003 , 20042006 , and 20072009 ) , estimating 1- and 5-year survival . in the latter periods we predicted 5-year survival using a hybrid analysis in which we included the actual survival for as long as possible and then estimated the conditional probability of surviving thereafter based on the corresponding survival experience of patients in the previous period ( ie , using a period analysis technique).14 to compare mortality over time we used cox proportional hazards regression analysis with 19982000 as a reference to estimate 1- and 5-year mortality rate ratios ( mrrs ) and the corresponding 95% confidence intervals ( cis ) adjusting for age groups ( 1564 years , 6579 years , 80 + years ) and gender .
additionally , analyses were stratified on age and gender . for the patients who underwent surgery , we likewise computed 30-day mortality rates for the four time periods .
surgery was defined as resection or first operative procedure , although the latter included resections if these were initially performed ( see appendix 1 for codes ) .
thus , a patient could enter both surgery groups in the case of an initial defunctional procedure and a resection hereafter .
we used cox proportional hazards regression analysis and estimated 30-day mrrs with 19982000 as a reference , adjusting for age and gender .
analyses were performed using sas version 9.2 ( sas institute inc , cary , nc ) .
through the danish national registry of patients ( dnrp ) , we identified all patients who had a first - time hospitalization with colon or rectal cancer between january 1 , 1998 and december 31 , 2009 .
the dnpr includes data on personal identification number , hospital , department , surgical and diagnostic procedures , and discharge diagnoses , as defined by the international classification of diseases 10th edition ( icd-10 ) by 1993.12 the icd-10 codes used to identify colonic cancer were c1819 and rectal cancer c2021 .
since 1968 , the central office of civil registration has assigned a unique 10-digit civil registration number to all danish citizens,13 which enables unambiguous data linkage between danish registries .
the civil registration system also contains information on vital status , date of death , and residence .
we followed each patient from the date of colon or rectal cancer diagnosis until emigration , death , or june 25th 2010 , whichever came first . to visualize crude survival we constructed kaplan meier curves stratified according to periods of colon or rectal cancer diagnosis ( 19982000 , 20012003 , 20042006 , and 20072009 ) , estimating 1- and 5-year survival . in the latter periods we predicted 5-year survival using a hybrid analysis in which we included the actual survival for as long as possible and then estimated the conditional probability of surviving thereafter based on the corresponding survival experience of patients in the previous period ( ie , using a period analysis technique).14 to compare mortality over time we used cox proportional hazards regression analysis with 19982000 as a reference to estimate 1- and 5-year mortality rate ratios ( mrrs ) and the corresponding 95% confidence intervals ( cis ) adjusting for age groups ( 1564 years , 6579 years , 80 + years ) and gender .
additionally , analyses were stratified on age and gender . for the patients who underwent surgery , we likewise computed 30-day mortality rates for the four time periods .
surgery was defined as resection or first operative procedure , although the latter included resections if these were initially performed ( see appendix 1 for codes ) .
thus , a patient could enter both surgery groups in the case of an initial defunctional procedure and a resection hereafter .
we used cox proportional hazards regression analysis and estimated 30-day mrrs with 19982000 as a reference , adjusting for age and gender .
analyses were performed using sas version 9.2 ( sas institute inc , cary , nc ) .
the number of colon cancer patients increased from a total of 2097 in 19982000 to 2763 in 20072009 ( table 1 ) , most pronounced among men ( table 2 ) . at the same time median age at diagnosis declined from 73 years to 72 years .
one - year overall survival improved from 65% to 70% over the study period , corresponding to an adjusted mrr of 0.83 ( 95% ci : 0.760.92 ) in 20072009 using 19982000 as a reference ( figure 1 and table 1 ) .
accordingly , the 5-year overall survival improved from 37% to predicted 43% , corresponding to a 5-year adjusted mrr of 0.84 ( 95% ci : 0.780.90 ) in 20072009 compared with 19982000 . in general , in both genders and in all age groups the survival improved . five - year survival improved particularly in men aged 1564 and 80 + as well as in women aged 80 + ( table 2 ) .
the 30-day postoperative mortality decreased during the study period ; after resection from 9% in 19982000 to 7% in 20072009 ( adjusted mrr 0.68 ( 95% ci : 0.530.87 ) ) and after the first operative procedure from 11% to 8% ( adjusted mrr 0.71 ( 95% ci : 0.570.88 ) ) ( table 3 ) . a total of 5685 patients were diagnosed with rectal cancer in the 19982009 period .
the number of rectal cancer patients increased during the four time intervals from a total of 1336 to 1554 ( table 1 ) , most pronounced among the youngest men and women ( table 2 ) . at the same time , median age at diagnosis declined from 71 years to 69 years .
the 1-year overall survival improved from 73% to 78% , corresponding to an adjusted mrr of 0.79 ( 95% ci : 0.680.91 ) in 20072009 using 19982000 as a reference ( figure 1 and table 1 ) .
accordingly , the 5-year survival improved from 39% 19982000 to the predicted 47% in 20072009 , corresponding to an adjusted mrr of 0.81 ( 95% ci : 0.730.89 ) . in general ,
improvements in survival were present in all age groups in both genders apart from 1-year survival in women aged 80 + .
men aged 80 + showed remarkable improvements in 1- and 5-year survival , whereas 5-year survival also improved notably in both genders aged 6579 ( table 4 ) .
as for colon cancer patients , the 30-day postoperative mortality decreased for rectal cancer patients over the study period . after resection ,
30-day mortality decreased from 5% in 19982000 to 3% in 20072009 ( adjusted mrr of 0.59 ( 95% ci 0.370.96 ) ) , and after the first operative procedure the 30-day mortality decreased from 7% to 4% ( adjusted mrr of 0.61 ( 95% ci 0.410.89 ) ) ( table 3 ) .
the number of colon cancer patients increased from a total of 2097 in 19982000 to 2763 in 20072009 ( table 1 ) , most pronounced among men ( table 2 ) . at the same time median age at diagnosis declined from 73 years to 72 years .
one - year overall survival improved from 65% to 70% over the study period , corresponding to an adjusted mrr of 0.83 ( 95% ci : 0.760.92 ) in 20072009 using 19982000 as a reference ( figure 1 and table 1 ) .
accordingly , the 5-year overall survival improved from 37% to predicted 43% , corresponding to a 5-year adjusted mrr of 0.84 ( 95% ci : 0.780.90 ) in 20072009 compared with 19982000 . in general , in both genders and in all age groups the survival improved . five - year survival improved particularly in men aged 1564 and 80 + as well as in women aged 80 + ( table 2 ) .
the 30-day postoperative mortality decreased during the study period ; after resection from 9% in 19982000 to 7% in 20072009 ( adjusted mrr 0.68 ( 95% ci : 0.530.87 ) ) and after the first operative procedure from 11% to 8% ( adjusted mrr 0.71 ( 95% ci : 0.570.88 ) ) ( table 3 ) .
the number of rectal cancer patients increased during the four time intervals from a total of 1336 to 1554 ( table 1 ) , most pronounced among the youngest men and women ( table 2 ) . at the same time , median age at diagnosis declined from 71 years to 69 years .
the 1-year overall survival improved from 73% to 78% , corresponding to an adjusted mrr of 0.79 ( 95% ci : 0.680.91 ) in 20072009 using 19982000 as a reference ( figure 1 and table 1 ) .
accordingly , the 5-year survival improved from 39% 19982000 to the predicted 47% in 20072009 , corresponding to an adjusted mrr of 0.81 ( 95% ci : 0.730.89 ) . in general ,
improvements in survival were present in all age groups in both genders apart from 1-year survival in women aged 80 + .
men aged 80 + showed remarkable improvements in 1- and 5-year survival , whereas 5-year survival also improved notably in both genders aged 6579 ( table 4 ) . as for colon cancer patients ,
after resection , 30-day mortality decreased from 5% in 19982000 to 3% in 20072009 ( adjusted mrr of 0.59 ( 95% ci 0.370.96 ) ) , and after the first operative procedure the 30-day mortality decreased from 7% to 4% ( adjusted mrr of 0.61 ( 95% ci 0.410.89 ) ) ( table 3 ) .
in this large population - based study we found an improved survival in both colon and rectal cancer patients .
the main strength of this study is the population - based design with a large sample size covering about 30% of the danish population and a complete hospital history .
we had complete follow - up on all patients ensured by the civil registration system .
we used the dnrp since it is continuously updated and has been demonstrated to be complete and valid.15,16 we consider overall survival as a valid outcome measurement in this study of prognostic changes over time , rather than disease - specific survival , which may be affected by bias in classifying the cause of death . such bias may be differential according to time period.17 our study also had limitations .
first , we had no data on cancer stage and thus were unable to evaluate whether the improvements in survival stemmed from better treatment or diagnosis at an earlier stage .
however , data on previous stage distribution in crc reveal no substantial change during the 20012008 period,18 thus speaking against major changes towards earlier diagnosis.19 length time and lead time biases are therefore unlikely.20 second , life expectancy has increased in the general population , particularly for men.21 therefore , our findings of improved survival being most pronounced among men aged 80 + may partly be attributable to a reduced mortality in general . still , coleman et al found that the 1-year relative survival of colorectal cancer in denmark ( ie , the ratio between observed survival and expected survival based on the background mortality ) improved from 71.7% to 77.7% in the period 19952007.6 this finding indicates that increased life expectancy in general is not solely responsible for the improved survival reported in our study .
a number of initiatives have been launched during the last decades to improve crc prognosis . in 1998
the danish colorectal cancer group first published national clinical guidelines for diagnosis and treatment of crc.22 furthermore , national cancer plans were introduced in 2000 and 2005 aiming also to improve health care organization and avoiding delay in cancer diagnostics and treatment . according to this , the surgical treatment of crc patients has generally been centralized
. however , evidence of the impact of high hospital procedure volume and high surgeon case volume on crc prognosis is inconsistent , although some reviews have shown benefits.2325 furthermore , in rectal cancer treatment , multidisciplinary teams comprising radiologists , pathologists , surgeons , and oncologists have been established .
in addition to these initiatives , refinements over time of diagnostic procedures and techniques , such as endoscopy , computerized tomography , magnetic resonance , ultrasonic scanning , and position emission tomography may also have played a role in improving crc diagnosis by facilitating earlier and more accurate diagnosis .
however , the similar stage distribution in crc in denmark in the period 2001200818 indicates that these advances may only have played a minor role .
the surgical treatment of crc has also developed over the study period , in at least three ways .
first , total mesorectal excision technique was adapted in denmark in 1996 in rectal cancer surgery .
improved survival by reduced local recurrence rate has been observed after implementation of this technique.2628 second , treatment of cancer - related acute colonic obstruction by self - expanding metallic stents has been introduced.29 this technique has the potential of converting emergent procedures into planned procedures,30 which are associated with better survival.3133 third , laparoscopic surgery is now widely implemented.29 although randomized clinical trials on colon cancer tend to show improved short - term mortality by laparoscopic procedures compared with open surgery , long - term mortality does not differ significantly , and for rectal cancer , evidence on mortality improvements by laparoscopic surgery is less clear.34,35 in addition to the potential improvements in surgical treatment , better perioperative care may also have contributed to the observed survival improvements .
furthermore , during the study period , an oxaliplatin - containing adjuvant chemotherapy regimen has been introduced in the treatment of colonic cancer3638 as well as biological monoclonal antibodies to selected patients with metastatic crc.39,40 for rectal cancer , preoperative radiotherapy with or without concomitant chemotherapy has been introduced .
however , randomized clinical trials show lower local recurrence rate , but no effect on survival.41,42 the results from our study extend those from previous population - based studies based on data from the dnrp43 and the danish cancer registry.6,7,44 compared with our nordic counterparts and countries with similar health systems , crc survival in denmark is still inferior despite the reported improvements.6,7 this underlines the need of further initiatives , although we may await effects of the national cancer plans already implemented .
in conclusion , survival after colon and rectal cancer has improved in central and northern denmark during the 1998 2009 period . | objectivethe prognosis for colon and rectal cancer has improved in denmark over the past decades but is still poor compared with that in our neighboring countries .
we conducted this population - based study to monitor recent trends in colon and rectal cancer survival in the central and northern regions of denmark.material and methodsusing the danish national registry of patients , we identified 9412 patients with an incident diagnosis of colon cancer and 5685 patients diagnosed with rectal cancer between 1998 and 2009 .
we determined survival , and used cox proportional hazard regression analysis to compare mortality over time , adjusting for age and gender . among surgically treated patients , we computed 30-day mortality and corresponding mortality rate ratios ( mrrs).resultsthe annual numbers of colon and rectal cancer increased from 1998 through 2009 . for colon cancer , 1-year survival improved from 65% to 70% , and 5-year survival improved from 37% to 43% . for rectal cancer , 1-year survival improved from 73% to 78% , and 5-year survival improved from 39% to 47% .
men aged 80 + showed most pronounced improvements .
the 1- and 5-year adjusted mrrs decreased : for colon cancer 0.83 ( 95% confidence interval ci : 0.760.92 ) and 0.84 ( 95% ci : 0.780.90 ) respectively ; for rectal cancer 0.79 ( 95% ci : 0.680.91 ) and 0.81 ( 95% ci : 0.730.89 ) respectively . the 30-day postoperative mortality after resection also declined over the study period .
compared with 19982000 the 30-day mrrs in 20072009 were 0.68 ( 95% ci : 0.530.87 ) for colon cancer and 0.59 ( 95% ci : 0.370.96 ) for rectal cancer.conclusionthe survival after colon and rectal cancer has improved in central and northern denmark during the 19982009 period , as well as the 30-day postoperative mortality . | Introduction
Material and methods
Identification of CRC patients
Survival
Statistical analysis
Results
Colon cancer
Rectal cancer
Discussion
Conclusion |
glomeruli are involved in 75 - 90% of cases , clinical correlate of which is nephrotic - range proteinuria and slow progression to chronic kidney disease .
it is seldom appreciated that extracapillary glomerulonephritis may be superimposed on amyloidosis in such cases .
a 50-year - old man presented with the complaint of swelling of feet and facial puffiness of 1 month duration accompanied by oliguria .
he was not a diabetic or hypertensive and had no significant illness in the past . on examination
respiratory system examination revealed bilateral basal crepitations . abdominal examination showed the presence of ascites without any evidence of organomegaly .
laboratory examination showed hemoglobin of 10 mg/ dl , total leukocyte count of 14.4 10/l with 76% of polymorphs in differential count .
biochemical parameters were as follows : random blood sugar 127 mg / dl , serum creatinine 1.4 mg / dl , blood urea 34 mg / dl , and serum albumin 0.9 g / dl .
urine analysis showed 3 + protein , 23 pus cells / hpf , and inactive sediments .
abdominal sonogram showed moderate ascites with bilateral pleural effusion and bilateral normal - sized kidneys .
light microscopy showed 24 glomeruli , all of which showed pale , eosinophilic , acellular , weakly periodic acid - schiff ( pas)-positive material in the mesangium and basement membrane , focally forming nodules [ figure 1 ] .
immunofluorescence showed ten viable glomeruli that were negative for igg , iga , igm , c3c , c1q , and fibrin .
immunohistochemical studies were positive for amyloid a protein in the deposits [ figure 2 ] .
a diagnosis of renal amyloid a ( aa ) amyloidosis causing secondary nephrotic syndrome was reached and the patient was put on enalapril , atorvastatin , and diuretics .
three glomeruli displaying global deposition of pale eosinophilic acellular weakly pas - positive material deposited in the mesangial region and along capillaries , obliteration of capillary lumen and patent bowmans space .
scanty amyloid material is seen in the vessel wall ( 20 , pas ) amyloid deposits are strongly positive for amyloid a protein ( a ) , and lack of light chain restriction with kappa ( b ) and lambda ( c ) light chains ( 40 , immunoperoxidase ) he returned for follow - up after 1 month with complaints of anorexia , nausea , and oliguria .
on evaluation , he had anasarca and had blood pressure of 130/80 mmhg . clinically , the patient had persisting bilateral pleural effusion and ascites .
laboratory tests were as follows : hemoglobin 6.5 g / dl , blood urea 157 mg / dl , serum albumin 1.8 g/ dl , and serum creatinine 6.5 mg / dl .
antineutrophil cytoplasmic antibody ( by immunoblot assay ) was negative and serum c3 was 93.8 mg / dl ( normal , 90180 mg / dl ) . considering the rapid deterioration of renal function and sudden drop in hemoglobin ,
fourteen viable glomeruli were seen on light microscopy , of which 30% of them showed active cellular crescents occupying circumferentially in addition to amyloid deposits [ figure 3 ] .
immunofluorescence showed eight viable glomeruli that were negative for igg , iga , igm , c3c , c1q , and fibrin .
repeat biopsy : glomerulus shows global deposition of amyloid material that is silver - negative and an active cellular crescent seen circumferentially along with fibrinous material in the crescentic area ( 40 , pasm stain ) the patient was treated with large doses of diuretics .
the patient gradually had increasing urine output and was symptomatically better at discharge , with serum creatinine improving to 3.5 mg / dl .
amyloidosis of the kidney is characterized by deposition of amyloid protein in the renal parenchyma .
patients present with heavy proteinuria and a progressive course , leading to slow decline in renal functions and end - stage renal disease .
this may be in the form of ablation of plasma cells in myeloma - associated amyloidosis , or suppression of acute phase response and treatment of underlying chronic inflammatory / infective condition in aa amyloidosis .
eprodisate is a new drug being tried in secondary amyloidosis . with all these different therapies ,
the course of the decline in renal functions can be further slowed down or even arrested .
rapid decline of renal functions is unusual and is attributed to the severe nephrotic state causing prerenal type of renal insufficiency . progressive deposition of amyloid itself has been found to be the cause in a few cases .
rapidly progressive glomerulonephritis ( rpgn ) in the background of amyloidosis is distinctly rare and has been described in anecdotal reports .
panner reported the first two cases of possible renal amyloidosis that presented as rpgn , one of whom had ra .
there are some other reports of rapidly progressive renal failure in patients with longstanding ra that demonstrated amyloidosis on renal biopsy , associated with crescentic glomerulonephritis .
crescents have been described in al amyloidosis as well . in a recent report , crosthwaite et al .
have reported one case of crescentic glomerulonephritis in a case of al amyloidosis , which is probably the first report of an association of al amyloidosis with crescents .
nagata et al . have proposed that damage to the glomerular basement membrane ( gbm ) ultrastructure by the amyloid fibrils led to crescent formation . in their series of 105 cases of renal amyloidosis studied on autopsy or biopsy , glomerular crescents were seen in 14 cases ( 13% ) .
immunohistochemical studies among these cases documented amyloid protein of aa type in 12 cases ( 85% ) .
they recorded that crescent formation was more closely associated with the site of amyloid deposition and not with the level of proteinuria , with mesangial deposition being more commonly associated with crescents .
electron microscopic studies showed areas of the gbm disruption in areas of amyloid deposition supporting their hypothesis .
leakage of fibrin - fibrinogen caused by gaps in the gbm incites inflammatory reaction and plays a crucial role in extracapillary proliferation .
it is also likely , however , that crescents may be of a different pathophysiology and the association with renal amyloid may be incidental . in another case report
, a patient with chronic inflammatory bowel disease treated with infliximab developed rapidly progressive renal failure 3 months later .
on renal biopsy , crescents and vasculitis , presumably due to infliximab , were seen in addition to aa amyloidosis . in our patient ,
we considered the crescentic transformation was either due to vasculitis in view of the sudden drop in hemoglobin and renal insufficiency or drug ( colchicine ) induced .
however , the anca profile was negative and the literature is silent with regard to colchicine associated with crescent formation . on the contrary , there are reports that suggest that colchicine is an immunomodulatory drug and downregulates inflammatory response .
the patient was treated with fresh frozen plasma in addition to ace inhibitors in an effort to alleviate the nephritic edema and third - space collections . in addition , as the renal function declines and urine output drops , the quantity of urinary protein loss comes down , which could possibly explain the improvement in serum albumin levels .
it is possible that association of crescents in a proven case of amyloidosis may be more common than previously considered .
the association may be missed as such patients may not be subjected to a repeat biopsy even when they present with rapid deterioration in renal function .
the benefits of aggressive immunosuppression with a combination of steroids and cytotoxic drugs in patients who are already protein depleted and malnourished are not well documented and may cause more harm than good .
it appears that that these patients do worse than patients with rpgn without underlying amyloidosis . however , there are isolated case reports that indicate that aggressive treatment may salvage the kidney function , at least partially .
there is one case report of rpgn associated with amyloidosis in a 53-year - old lady with ra who was successfully treated with intensive plasma exchange and immunosuppression . in this patient ,
moroni et al . , in their report of three cases of crescentic glomerulonephritis superimposed on amyloidosis , have documented partial recovery of renal functions in two patients after treatment with intravenous pulse methylprednisolone , immunosuppressive agents , and oral corticosteroids . to the best of our knowledge ,
our patient had aa amyloidosis as proven by immunohistochemical studies , but no underlying disease could be identified .
he was treated with pulse methylprednisolone along with iv cyclophosphamide , but had nephrotic - range proteinuria and moderate renal dysfunction till last follow - up . in summary ,
crescentic glomerulonephritis associated with renal amyloidosis is a rare occurrence and it is important that clinicians suspect this possibility when confronted with a case of renal amyloidosis and rapid worsening of renal functions . | renal amyloidosis is characterized by progressive deposition of extracellular material , most commonly in the glomeruli .
most often , patients present with nephrotic range proteinuria and the disease progresses gradually to renal failure . rapid worsening of renal functions is rare .
we report a case of crescentic glomerulonephritis superimposed on amyloidosis , clinically presenting as rapidly progressive renal failure , and present a review of the literature . | Introduction
Case Report
Discussion |
t1 is the longitudinal ( or spin - lattice ) relaxation time of a tissue .
t1 mapping refers to parametric maps that are generated from a series of images acquired with different t1 weighting so that each pixel can be assigned a t1 value.7 t1 maps can be displayed using color or thresholded scales to enable quantitative visual interpretation.8,9 each tissue type exhibits a characteristic range of normal t1 relaxation times at a particular field strength , deviation from which may be indicative of disease . measured myocardial t1 values are also influenced by various physiological and technical factors , including temperature , disease , age , sex , heart rate , and the pulse sequence used.1012 the modified look - locker inversion recovery ( molli ) method developed by messroghli et al13 in 2004 opened a new frontier of clinical applications for myocardial t1 mapping .
newer variants , based on inversion - recovery , saturation - recovery , or hybrid approaches , continue to emerge , enabling faster acquisition times and minimizing sources of error such as heart - rate dependency , motion , off - resonance , and partial volume effects.1420 although molli - based sequences are the most widely used and most extensively validated,11,13,20,21 the saturation - recovery single - shot acquisition sequence is a very promising novel approach demonstrating good t1 measurement accuracy in phantoms.14 this contrasts with molli techniques , which are known to underestimate t1.20,22 this is attributed in part to t223 and also more recently to the presence of a physiological but mr - invisible proton pool that , although affecting the technical accuracy of molli , may actually improve its sensitivity to disease.24 myocardial t1-mapping methods are used for native ( ie , without the use of gadolinium - based contrast agents ) and also for postcontrast t1 measurements . in combination with hematocrit levels ,
these enable the quantification of extracellular volume fraction ( ecv).25 native myocardial t1 reflects a composite signal from both the intracellular ( predominantly myocytes ) and the extracellular compartment .
gadolinium - based contrast agents shorten t1 times , and the physiological differences in redistribution after administration directly affect tissue t1.22,2629 however , isolated postcontrast t1 values are influenced by a number of factors , including native t1 , the type and dosage of gadolinium contrast used , and the postcontrast acquisition time within the contrast pharmacodynamics redistribution process .
the latter depends on numerous systemic variables , such as body fat percentage , hematocrit levels , and glomerular filtration rate.3032 therefore , currently preferred outputs for myocardial t1 quantification are native t1 and ecv.7 there is increasing interest in the study of the myocardial interstitium as a determinant of disease course and as a therapeutic target in a number of cardiac conditions .
ecv measures the extracellular space , and , in the absence of myocardial edema or other factors that could expand the interstitial space ( such as amyloid ) , expansion of the myocardial collagen volume fraction is responsible for most of the extracellular matrix expansion.7 ecv can act as a surrogate for ( but not as a direct measure of ) myocardial interstitial fibrosis.7 it is possible to quantify myocardial ecv in vivo using the equilibrium cmr technique,33 which showed good correlation with histologic collagen volume fraction.34 equilibrium cmr assumes an equilibrium steady state between the intravascular and interstitial spaces as a strict , 2-compartment model and requires a constant infusion of contrast to achieve a steady state .
this protocol may be abbreviated by using the bolus contrast technique with delayed ( 15 min ) postcontrast measurement , known as dynamic - equilibrium cmr,32 which closely approximates the steady state and is sufficient for most myocardial ecv applications.7 ecv calculation can correct for some of the variables confounding isolated postcontrast t1 values , but its accuracy also relies on the assumption that the effect of contrast is equal in the 2 compartments , which is subject to debate.35 additional confounders include incomplete dynamic equilibrium , contrast transfer into other compartments , and a faster renal clearance than exchange rate.31 the clinical utility of native t1 mapping relies on a normal range with small variability14,19,36 and high sensitivity to disease
. elevated t1 times in the myocardium have been reported in a number of commonly encountered cardiac conditions including myocardial infarction,9 myocarditis,37 hypertrophic and dilated cardiomyopathy ( dcm),38,39 cardiac amyloidosis,40 cardiac involvement in systemic diseases,4143 and diffuse fibrosis in patients with aortic stenosis.44 in particular , native myocardial t1 is prolonged by excess free water content,4547 such as that due to acute edema , inflammation , or pooling within an expanded interstitial space .
ferreira et al9 demonstrated for the first time that native t1 mapping detects acute myocardial edema in patients with tako - tsubo cardiomyopathy and regional stunning with high diagnostic accuracy compared with conventional t2w techniques .
dallarmellina et al48 found that the diagnostic performance of t1 mapping for detecting acute myocardial injury was at least as good as that of t2w cmr in patients with st elevation myocardial infarction and superior to t2w imaging in patients with non - st elevation myocardial infarction ( fig .
1 ) . for determining the area at risk after acute myocardial infarction , native t1 mapping and t2 mapping yield similar quantitative results and good agreement with microspheres in animal models.49 recently , native t1 mapping was shown to have superior sensitivity compared with t2w and lge techniques in detecting acute myocarditis ( fig .
2 ) , which may be especially useful in detecting subtle focal disease and when gadolinium - based contrast imaging is not feasible.37 furthermore , native myocardial t1 values are significantly elevated in patients with dcm and hypertrophic cardiomyopathy compared with normal controls38,50 ; t1 values are also increased in apparently normal regions without lge in both conditions .
these findings suggest that native t1 mapping provides information on myocardial tissue characteristics beyond that achieved by standard cmr techniques .
the clinical utility of native t1 mapping was also shown in patients with cardiac amyloidosis ( fig .
3 ) who have significantly elevated t1 values compared with normal subjects and patients with aortic stenosis.41 native t1 mapping may be particularly useful for identifying amyloid patients with possible or definite cardiac involvement given its high diagnostic accuracy and the difficulty in applying conventional lge in this cohort.40 increased native t1 values have been reported in patients with human immunodeficiency virus51 and patients with systemic lupus erythematosus and cardiac involvement.52 in patients with severe aortic stenosis , native t1 values are increased and correlate with the degree of biopsy - quantified collagen volume fraction.45 native myocardial t1 values may be lowered by water - protein interactions and fat or iron content and thus can also serve as a diagnostic tool in characterizing anderson - fabry disease,10 fat in cardiac masses,53 and myocardial siderosis.54 t1 mapping in acute myocardial infarction .
edema t2w images ( left column ) , acute lge images ( center ) , and shmolli t1 mapping ( right column ) are displayed .
two sets of images ( a and b ) corresponding to 2 separate patients are shown . a , a case of transmural inferior stemi . both edema ( t2w ) and
lge depict an area of increased signal intensity ; in the same region t1 mapping depicts significantly increased t1 values ( shown in red ) compared with the remote unaffected myocardium ( normal t1 values shown in green ) .
although the t2w images show only a mild increase in brightness , there is an area of increased t1 values exceeding the area of lge enhancement .
it is noteworthy that the peak troponin i level was significantly different in the 2 patients ( peak troponin i 50 mg / ml in the stemi patient vs. 7 mg / ml in the nstemi patient ) .
nstemi indicates non - st elevation myocardial infarction ; stemi , st elevation myocardial infarction ( modified from dall'armellina et al,48 figure 1 ) .
so in order to publish this adaptation , authorization must be obtained both from the owner of the copyright in the original work and from the owner of copyright in the translation or adaptation .
t1 mapping in acute myocarditis . a , dark - blood t2w imaging demonstrating increased signal intensity in the mid - lateral wall ( arrows ) .
b , bright - blood t2w imaging demonstrating increased signal intensity in the mid - lateral wall ( arrows ) .
c , shortened molli ( shmolli ) t1 map demonstrating increased t1 values ( 1100 to 1200 ms ) in the lateral wall ( arrows ) .
d , lge imaging demonstrating mid - wall enhancement in the lateral wall ( arrows ) ( modified from ferreira et al,37 figure 1 ) .
so in order to publish this adaptation , authorization must be obtained both from the owner of the copyright in the original work and from the owner of copyright in the translation or adaptation .
cmr end - diastolic frame from cine ( left panel ) , shmolli noncontrast t1 map ( middle panel ) , and lge images ( right panel ) in a normal volunteer , a cardiac amyloid patient , and an aortic stenosis patient .
note the markedly elevated myocardial t1 time in the cardiac amyloid patient ( 1170 ms , into the red range of the color scale ) compared with the normal control ( 955 ms ) and the patient with aortic stenosis and left ventricular hypertrophy ( 998 ms ) .
so in order to publish this adaptation , authorization must be obtained both from the owner of the copyright in the original work and from the owner of copyright in the translation or adaptation .
ecv may serve as a marker for myocardial fibrosis in a number of myocardial diseases.25,31,45,55 the ecv of the normal myocardium has been reported to be in the range of 24% to 28%.21,56 ecv expansion has been demonstrated in a number of cardiac conditions including myocardial infarction , myocarditis , hypertrophic cardiomyopathy and dcm , cardiac amyloidosis , diabetes , obesity , congenital heart disease with myocardial dysfunction , and other cardiac conditions characterized by diffuse myocardial fibrosis ( fig .
4).5765 the detection of interstitial myocardial fibrosis may allow early therapeutic intervention before irreversible changes occur .
examples illustrating excellent agreement between lge and ecv in cases of focal abnormalities in myocardial ecv .
precontrast t1 maps ( top row ) , postcontrast t1 maps ( second row ) , lge ( third row ) , and ecv maps ( bottom row ) for patients with : ( a ) chronic mi , ( b ) acute myocarditis , and ( c ) hcm .
so in order to publish this adaptation , authorization must be obtained both from the owner of the copyright in the original work and from the owner of copyright in the translation or adaptation .
the clinical utility of native t1 mapping relies on a normal range with small variability14,19,36 and high sensitivity to disease .
elevated t1 times in the myocardium have been reported in a number of commonly encountered cardiac conditions including myocardial infarction,9 myocarditis,37 hypertrophic and dilated cardiomyopathy ( dcm),38,39 cardiac amyloidosis,40 cardiac involvement in systemic diseases,4143 and diffuse fibrosis in patients with aortic stenosis.44 in particular , native myocardial t1 is prolonged by excess free water content,4547 such as that due to acute edema , inflammation , or pooling within an expanded interstitial space .
ferreira et al9 demonstrated for the first time that native t1 mapping detects acute myocardial edema in patients with tako - tsubo cardiomyopathy and regional stunning with high diagnostic accuracy compared with conventional t2w techniques .
dallarmellina et al48 found that the diagnostic performance of t1 mapping for detecting acute myocardial injury was at least as good as that of t2w cmr in patients with st elevation myocardial infarction and superior to t2w imaging in patients with non - st elevation myocardial infarction ( fig .
1 ) . for determining the area at risk after acute myocardial infarction , native t1 mapping and t2 mapping yield similar quantitative results and good agreement with microspheres in animal models.49 recently
, native t1 mapping was shown to have superior sensitivity compared with t2w and lge techniques in detecting acute myocarditis ( fig .
2 ) , which may be especially useful in detecting subtle focal disease and when gadolinium - based contrast imaging is not feasible.37 furthermore , native myocardial t1 values are significantly elevated in patients with dcm and hypertrophic cardiomyopathy compared with normal controls38,50 ; t1 values are also increased in apparently normal regions without lge in both conditions .
these findings suggest that native t1 mapping provides information on myocardial tissue characteristics beyond that achieved by standard cmr techniques .
the clinical utility of native t1 mapping was also shown in patients with cardiac amyloidosis ( fig .
3 ) who have significantly elevated t1 values compared with normal subjects and patients with aortic stenosis.41 native t1 mapping may be particularly useful for identifying amyloid patients with possible or definite cardiac involvement given its high diagnostic accuracy and the difficulty in applying conventional lge in this cohort.40 increased native t1 values have been reported in patients with human immunodeficiency virus51 and patients with systemic lupus erythematosus and cardiac involvement.52 in patients with severe aortic stenosis , native t1 values are increased and correlate with the degree of biopsy - quantified collagen volume fraction.45 native myocardial t1 values may be lowered by water - protein interactions and fat or iron content and thus can also serve as a diagnostic tool in characterizing anderson - fabry disease,10 fat in cardiac masses,53 and myocardial siderosis.54 t1 mapping in acute myocardial infarction .
edema t2w images ( left column ) , acute lge images ( center ) , and shmolli t1 mapping ( right column ) are displayed .
two sets of images ( a and b ) corresponding to 2 separate patients are shown . a , a case of transmural inferior stemi .
both edema ( t2w ) and lge depict an area of increased signal intensity ; in the same region t1 mapping depicts significantly increased t1 values ( shown in red ) compared with the remote unaffected myocardium ( normal t1 values shown in green ) .
although the t2w images show only a mild increase in brightness , there is an area of increased t1 values exceeding the area of lge enhancement .
it is noteworthy that the peak troponin i level was significantly different in the 2 patients ( peak troponin i 50 mg / ml in the stemi patient vs. 7 mg / ml in the nstemi patient ) .
nstemi indicates non - st elevation myocardial infarction ; stemi , st elevation myocardial infarction ( modified from dall'armellina et al,48 figure 1 ) .
so in order to publish this adaptation , authorization must be obtained both from the owner of the copyright in the original work and from the owner of copyright in the translation or adaptation .
t1 mapping in acute myocarditis . a , dark - blood t2w imaging demonstrating increased signal intensity in the mid - lateral wall ( arrows ) .
b , bright - blood t2w imaging demonstrating increased signal intensity in the mid - lateral wall ( arrows ) .
c , shortened molli ( shmolli ) t1 map demonstrating increased t1 values ( 1100 to 1200 ms ) in the lateral wall ( arrows ) .
d , lge imaging demonstrating mid - wall enhancement in the lateral wall ( arrows ) ( modified from ferreira et al,37 figure 1 ) .
so in order to publish this adaptation , authorization must be obtained both from the owner of the copyright in the original work and from the owner of copyright in the translation or adaptation .
cmr end - diastolic frame from cine ( left panel ) , shmolli noncontrast t1 map ( middle panel ) , and lge images ( right panel ) in a normal volunteer , a cardiac amyloid patient , and an aortic stenosis patient .
note the markedly elevated myocardial t1 time in the cardiac amyloid patient ( 1170 ms , into the red range of the color scale ) compared with the normal control ( 955 ms ) and the patient with aortic stenosis and left ventricular hypertrophy ( 998 ms ) .
so in order to publish this adaptation , authorization must be obtained both from the owner of the copyright in the original work and from the owner of copyright in the translation or adaptation .
ecv may serve as a marker for myocardial fibrosis in a number of myocardial diseases.25,31,45,55 the ecv of the normal myocardium has been reported to be in the range of 24% to 28%.21,56 ecv expansion has been demonstrated in a number of cardiac conditions including myocardial infarction , myocarditis , hypertrophic cardiomyopathy and dcm , cardiac amyloidosis , diabetes , obesity , congenital heart disease with myocardial dysfunction , and other cardiac conditions characterized by diffuse myocardial fibrosis ( fig .
4).5765 the detection of interstitial myocardial fibrosis may allow early therapeutic intervention before irreversible changes occur .
examples illustrating excellent agreement between lge and ecv in cases of focal abnormalities in myocardial ecv .
precontrast t1 maps ( top row ) , postcontrast t1 maps ( second row ) , lge ( third row ) , and ecv maps ( bottom row ) for patients with : ( a ) chronic mi , ( b ) acute myocarditis , and ( c ) hcm .
so in order to publish this adaptation , authorization must be obtained both from the owner of the copyright in the original work and from the owner of copyright in the translation or adaptation .
t2 ( or spin - spin ) relaxation time is the time constant governing the exponential decay of transverse magnetization . the fractional increase in t2 is substantially larger than the fractional increase in t1 when water content is increased , and this relationship was demonstrated in a canine model of acute myocardial infarction 30 years ago.46 various technical improvements since then have enabled the wide clinical use of t2w cmr for the qualitative or semiquantitative detection of myocardial edema and inflammation.66,67 however , there are a few well - recognized limitations of conventional t2w techniques,5 including the need for a normal reference region of interest , either in remote myocardium or skeletal muscle , which can lead to false - negative results when these reference areas are also affected in systemic processes.37,68,69 quantification of t2 myocardial relaxation times promises to circumvent these limitations and is achieved by collecting multiple images with different t2-weighting , providing multiple points along the t2 decay curve for fitting of an exponential signal decay model.6 initial t2-mapping techniques based on dark - blood turbo spin echo sequences were sensitive to ghosting and motion artifacts.6 recently , bright - blood t2 prep - based pulse sequences showed improved results.70 these t2-mapping techniques exhibit heart - rate dependency , sensitivity to the order of acquisition,71 and flip angle , with incomplete t1 recovery resulting in t1 weighting and errors in the t2 relaxation time measurements , although increasing the sampling interval can reduce this effect.72 currently , normal measured t2 times exhibit larger interindividual variability compared with measured t1 times70,72,73 but nevertheless have been shown to be useful in detecting disease .
t2 mapping can detect edematous myocardial territories in a variety of cardiac pathologies , including acute myocardial infarction , myocarditis , tako - tsubo cardiomyopathy , and heart transplant rejection.72,7477 verhaert et al77 assessed t2 mapping in patients with acute myocardial infarction and found that myocardial segments characterized by recent ischemic injury can be quantitatively differentiated from remote myocardium by their higher t2 value ( fig .
another study from the same group showed the usefulness of t2 mapping in suspected myocarditis or tako - tsubo cardiomyopathy , demonstrating that t2 mapping can identify myocardial involvement beyond conventional cmr techniques such as t2w and lge imaging .
t2 mapping has also been used as a noninvasive tool for cardiac transplant monitoring with promising preliminary findings in small cohorts.74 t2 maps , t2-stir , and lge images in patients with acute myocardial infarction .
a , a 53-year - old male patient admitted with st - segment elevation myocardial infarction ( stemi ) in the circumflex artery territory .
quantitative t2 in the infarct region was 72 ms compared with 56 ms in the remote myocardium .
b , a 75-year - old male patient presenting with left anterior descending artery territory stemi .
t2 of the infarct zone measured by t2 mapping was 66 ms compared with 51 ms in the remote myocardium .
c , basal short - axis slice in a 58-year - old female patient presenting with non - stemi in the right coronary artery territory .
t2 measured within the region of the infarct was 71 ms compared with 58 ms in the remote myocardium .
d , a 62-year - old male patient admitted with a stemi in the left anterior descending artery territory .
quantitative t2 of the infarcted segments was 73 ms . by t2 mapping , a rim with high signal intensity circumferential to the left ventricle
stemi indicates st - segment elevation myocardial infarction ; t2-stir , t2w short tau inversion recovery ( modified from verhaert77 ) .
so in order to publish this adaptation , authorization must be obtained both from the owner of the copyright in the original work and from the owner of copyright in the translation or adaptation .
t2 mapping can detect edematous myocardial territories in a variety of cardiac pathologies , including acute myocardial infarction , myocarditis , tako - tsubo cardiomyopathy , and heart transplant rejection.72,7477 verhaert et al77 assessed t2 mapping in patients with acute myocardial infarction and found that myocardial segments characterized by recent ischemic injury can be quantitatively differentiated from remote myocardium by their higher t2 value ( fig .
another study from the same group showed the usefulness of t2 mapping in suspected myocarditis or tako - tsubo cardiomyopathy , demonstrating that t2 mapping can identify myocardial involvement beyond conventional cmr techniques such as t2w and lge imaging .
t2 mapping has also been used as a noninvasive tool for cardiac transplant monitoring with promising preliminary findings in small cohorts.74 t2 maps , t2-stir , and lge images in patients with acute myocardial infarction .
a , a 53-year - old male patient admitted with st - segment elevation myocardial infarction ( stemi ) in the circumflex artery territory .
quantitative t2 in the infarct region was 72 ms compared with 56 ms in the remote myocardium .
b , a 75-year - old male patient presenting with left anterior descending artery territory stemi .
t2 of the infarct zone measured by t2 mapping was 66 ms compared with 51 ms in the remote myocardium .
c , basal short - axis slice in a 58-year - old female patient presenting with non - stemi in the right coronary artery territory .
t2 measured within the region of the infarct was 71 ms compared with 58 ms in the remote myocardium .
d , a 62-year - old male patient admitted with a stemi in the left anterior descending artery territory .
quantitative t2 of the infarcted segments was 73 ms . by t2 mapping , a rim with high signal intensity circumferential to the left ventricle
stemi indicates st - segment elevation myocardial infarction ; t2-stir , t2w short tau inversion recovery ( modified from verhaert77 ) .
so in order to publish this adaptation , authorization must be obtained both from the owner of the copyright in the original work and from the owner of copyright in the translation or adaptation .
t1-mapping and t2-mapping techniques have already demonstrated clinical usefulness as quantitative tissue characterization mr techniques in a variety of common cardiac conditions .
further technical improvements are expected to advance their clinical application in the detection of acute , subacute , and subclinical pathologies .
consensus within the cmr community regarding methodological issues and standardization is needed to facilitate wider clinical utility .
multicenter studies should be performed to assess not only the diagnostic value of these techniques but also their utility in therapeutic monitoring and prognostication . | cardiac magnetic resonance ( cmr ) imaging is a well - established noninvasive imaging modality in clinical cardiology .
its unsurpassed accuracy in defining cardiac morphology and function and its ability to provide tissue characterization make it well suited for the study of patients with cardiac diseases .
late gadolinium enhancement was a major advancement in the development of tissue characterization techniques , allowing the unique ability of cmr to differentiate ischemic heart disease from nonischemic cardiomyopathies .
using t2-weighted techniques , areas of edema and inflammation can be identified in the myocardium .
a new generation of myocardial mapping techniques are emerging , enabling direct quantitative assessment of myocardial tissue properties in absolute terms .
this review will summarize recent developments involving t1-mapping and t2-mapping techniques and focus on the clinical applications and future potential of these evolving cmr methodologies . | MYOCARDIAL T1 AND T1 MAPPING
Clinical Applications of T1 Mapping
MYOCARDIAL T2 AND T2 MAPPING
Clinical Applications of T2 Mapping
FUTURE DIRECTIONS |
bladder cancer is a significant cause of morbidity and mortality in the uk with ~10,000 new cases diagnosed and 5,000 deaths registered each year ( 1 ) .
the most common pathological subtype is transitional cell carcinoma ( tccu ) ( 90% of cases ) ( 2 ) with ~50% of all cases being stage ii or beyond at the time of diagnosis ( 1 ) .
standard of care for localized , muscle invasive tccu is radical cystectomy , which historically , i.e. , without modern neoadjuvant combination chemotherapy , leads to 5-year overall survival in the approximate range of 5060% ( 3 ) . a meta - analysis including 11 trials and 3,005 patients confirmed the value of preoperative cisplatin based combination chemotherapy which was shown to reduce the risk of relapsing disease and conferring a 5-year absolute overall survival advantage of 5% ( 4 ) .
a recent meta - analysis comprising 945 patients and nine clinical trials similarly demonstrated the benefits of postoperative cisplatin based combination chemotherapy ( 5 ) .
however , not all patients are eligible for curative - intent multimodal therapy , and about one in five patients present with stage iv disease ( i.e. , locally extending to other organs , to the pelvic or abdominal wall , and/or with evidence of distant metastases ) at the time of diagnosis ( 1 ) . patients with relapse following primary treatment , or with advanced disease at presentation , confer a significant challenge , and even among those fit for optimal platinum - based combination chemotherapy the median overall survival does not exceed the range of 1215 months ( 6,7 ) . the recommended first line chemotherapy for these patients are cisplatin based combinations and either mvac ( methotrexate , vinblastine , doxorubicin , and cisplatin ) or gc ( gemcitabine and cisplatin ) ( 6,7 ) although the gc regimen is often preferred due to a milder toxicity profile ( 7 ) . for patients with acceptable performance status and preserved organ functions , and where the relapse occurs later than 12 months following neoadjuvant / adjuvant cisplatin - based combination chemotherapy , change of platinum based regimen may be a feasible option ( 8) . in selected cases the addition of paclitaxel to gemcitabine and cisplatin may be considered ( 9 ) . for patients unfit for cisplatin combinations alternative although potentially less efficient combination regimens have been proposed , either with alternative platinum agents [ oxaliplatin ( 10 ) or carboplatin ( 11 ) ] or a platinum - free combination of paclitaxel and gemcitabine ( 12 ) . in patients deemed ineligible for standard cisplatin based treatment , combination treatment with split dose cisplatin and gemcitabine has reported encouraging results ( 13 ) . following failure of first line chemotherapy ,
be it early relapse following platinum based neoadjuvant / adjuvant chemotherapy , or progressive disease during palliative first - line chemotherapy , treatment options have so far been limited .
studies , mostly phase ii and retrospective series , have reported activity with taxanes and pemetrexed ( 14 ) . until recently there were no randomized studies to confirm the benefit of second line chemotherapy for patients with metastatic tccu .
vinflunine ( javlor ) , a microtubule inhibitor of the vinca - alkaloid family of anticancer agents ( 15 ) , is the first drug to obtain european medicine agency ( ema ) approval for use in tccu ( 2009 ) due to evidence of efficacy from phase ii ( 16,17 ) and phase iii trials ( 18,19 ) .
considering the multiple challenges in the second - line setting , with declining performance status due to progressive disease , persistent side effects or complications from earlier treatments , and primary or acquired chemo resistance after primary chemotherapy , the safety profile and efficacy data from the recent vinflunine reports are encouraging . in the phase iii trial ( 18,19 )
median overall survival was 6.9 months in the vinflunine plus best supportive care compared to 4.3 months in the best supportive care only population .
further empirical studies have confirmed vinflunine to be a safe and effective second line approach in spain [ n=66 ( 20 ) ] , france [ n=134 ( 21 ) ] and germany [ n=77 , hegele ( 22 ) ] with reported overall survival of 7.710.4 months .
based on the accumulating evidence , the esmo guidelines now suggest vinflunine as the recommended second - line therapy in advanced bladder cancer ( 23 ) .
vinflunine as a second line therapy is not currently recommended for uk practice , nor is it available to the nhs patients through the approved list of drugs on cancer drug fund .
it has however been made available through the free of charge program ( focp ) sponsored by pierre fabre .
here we evaluate the outcome of patients treated with vinflunine as a second line therapy in this program .
data were collected retrospectively on patients with advanced metastatic tccu diagnosed between 6th june 1999 and 20th june 2013 .
data were collected via a pre - defined crf adopted for the study and sent to local investigators for population .
all patients who received vinflunine as a second line therapy following failure of first line therapy were eligible for inclusion .
all patients received vinflunine as a second - line therapy through the free of charge program ( focp ) and received at least one dose of vinflunine .
all patients were included in the analysis , irrespective of any dose reductions or toxicities .
the dose of vinflunine was 320/280/250 mg / m every 3 weeks as per the spc .
the aim was to document the toxicity , radiological rr and os for patients treated with vinflunine in real life setting within the focp .
demographic data were collected on patient gender , age , height , weight and performance status as well as the site of the disease recurrence and their hemoglobin level at the time that the decision to prescribe vinflunine was made .
details on the type of first - line therapy were requested as was whether this was in the neo - adjuvant or adjuvant setting .
continuous data are presented as medians ( iqr ) and categorical data are expressed as frequencies of counts .
the primary outcome measure of interest is overall survival ( os ) which is measured as the time from intention to treat with vinflunine until death by any cause .
progression - free survival ( pfs ) is measured as the time from first vinflunine administration until progression or death by any cause .
objective response rate is defined using recist criteria ( version 1.1 ) and determined at each local site .
univariate analyses are carried out to assess patient demographics as prognostic factors for overall survival using cox proportional hazards models .
hazard ratios ( hr ) are presented with associated 95% confidence intervals ( ci ) .
reported toxicities are defined using ctcae ( version 4 ) and are reported based on being either grade 12 or 34 , respectively .
data are provided on 49 patients from nine contributing sites throughout the uk and ireland ( ccc 15 ; christie 5 ; cork 6 ; glasgow 9 ; st .
george 's 1 ; royal free london 2 ; royal marsden 6 ; northampton 1 ; newcastle 4 ) diagnosed with advanced metastatic tccu between 6th june 1999 and 20th june 2013 .
patient demographics are provided in table i. the patient group consists of 67% ( 33/49 ) males and have a median ( iqr ) age of 64 ( 5770 ) . as per the summary of product characteristics ( spc ) for vinflunine , patients with a 0/1 performance status ( ecog ) or a hemoglobin ( hb ) level > 10 g / dl were targeted .
thirteen patients ( 27% ) had an ecog performance status of 2 or a hemoglobin level < 10 .
two patients ( 4% ) had chronic constipation at presentation and two patients ( 4% ) had coronary artery disease .
information on first - line therapy is available for 48/49 ( 98% ) of all participating patients .
first line neo - adjuvant chemotherapy was given to 60% ( 27/48 ) and consisted of gemcitabine / cisplatin ( 74% ; 20/27 ) , gemcitabine / carboplatin ( 22% , 6/27 ) , or gemcitabine / cisplatin switched to carboplatin in view of worsening renal functions ( 4% , 1/27 ) .
in the metastatic setting patients received platinum regimens consisting of either gemcitabine / cisplatin ( 30% , 13/43 ) , gemcitabine / carboplatin ( 37% , 16/43 ) , gemcitabine / cisplatin switched to carboplatin ( 2% , 1/43 ) , or some other combination ( 30% , 13/43 ) .
following first - line therapy , patient best response rates were complete response 15% ( 7/48 ) , partial response 48% ( 23/48 ) , stable disease 17% ( 8/48 ) and progressive disease 19% ( 9/48 ) .
the overall response rate for first - line therapy was 63% ( 30/48 ) and 98% ( 43/44 ) of patients demonstrated disease progression with 77% ( 34/44 ) demonstrating bone , liver , or lung metastases .
the starting dose was 250 mg / m ( 4% , 2/49 ) , 280 mg / m ( 76% , 37/49 ) or 320 mg / m
three patients ( 6% ) had a dose escalation and 10 ( 21% ) had dose reduction .
eight patients ( 17% ) had only a single cycle , while the maximum number of cycles at the time of analysis was 18 .
toxicities are reported by sites as being either grade 1/2 or grade 3/4 hematological or non - hematological .
overall 31% ( 15/49 ) of patients reported at least one grade 3/4 adverse event .
the most common grade 3/4 toxicities are constipation reported by 8% ( 4/49 ) and asthenia / fatigue reported by 6% ( 3/49 ) of patients .
patients were followed up for a median of 9.1 months . at the time of analysis , 41 ( 84% )
1 ) give a median ( 95% confidence interval ) of 9.1 months ( 6.012.7 ) .
ecog performance measures were investigated further as a key prognostic indicator of interest ( fig .
median survival estimates of 13.1 ( 6.0 , na ) months and 7.6 ( 5.9810.5 ) months were observed for ecog performance measures of 0 and 12 , respectively .
this was not significant statistically [ hr ( 95% ci ) : 1.62 ( 0.74 , 3.55 ) ; p=0.23 ] . a total of 45 ( 92% ) of patients had disease progression at the time of analysis .
sensitivity analyses report the result only on patients who meet the spc ( ecog < 2 , hb > 10 ) . here
35 patients gave an estimated os of 9.9 months ( 7.616.4 ) with an estimated pfs of 6.0 months ( 4.812.1 ) and a partial response rate of 30% .
toxicities are reported by sites as being either grade 1/2 or grade 3/4 hematological or non - hematological .
overall 31% ( 15/49 ) of patients reported at least one grade 3/4 adverse event .
the most common grade 3/4 toxicities are constipation reported by 8% ( 4/49 ) and asthenia / fatigue reported by 6% ( 3/49 ) of patients .
patients were followed up for a median of 9.1 months . at the time of analysis , 41 ( 84% )
1 ) give a median ( 95% confidence interval ) of 9.1 months ( 6.012.7 ) .
ecog performance measures were investigated further as a key prognostic indicator of interest ( fig .
median survival estimates of 13.1 ( 6.0 , na ) months and 7.6 ( 5.9810.5 ) months were observed for ecog performance measures of 0 and 12 , respectively .
this was not significant statistically [ hr ( 95% ci ) : 1.62 ( 0.74 , 3.55 ) ; p=0.23 ] .
a total of 45 ( 92% ) of patients had disease progression at the time of analysis .
sensitivity analyses report the result only on patients who meet the spc ( ecog < 2 , hb > 10 ) . here
35 patients gave an estimated os of 9.9 months ( 7.616.4 ) with an estimated pfs of 6.0 months ( 4.812.1 ) and a partial response rate of 30% .
the prognosis for patients with advanced metastatic tccu who have progressed after first - line therapy remains dismal , and whilst previously published randomised trials and empirical evidence have favoured the use of vinflunine in this patient group , the results have not been clear enough to favour its wide spread use in the uk . as a consequence , many patients will end antitumour therapy or proceed onto palliative care once the first - line regimen has failed .
we performed a retrospective observational study in this clinical setting to assess the effects of vinflunine in terms of both efficacy and toxicity .
data on 49 patients from sites across the uk and ireland were collected and analysed .
the dose of and number of cycles were consistent with previous studies , with a median of 3.5 cycles being similar to the number recorded in the phase iii trial ( 18,19 ) .
the most common starting dose was 280 g / m ( 75% ) and the dose was relatively well tolerated with only 10 ( 29% ) patients requiring a reduction .
further to this , the present median overall survival of 9.1 months ( 6.012.7 ) is consistent with or even slightly better than the 6.9 months of the vinflunine treated arm of the bellmunt phase iii study ( 18,19 ) .
further , the present numbers compare favourably with the empirical ' real life ' results obtained from spain ( 16 ) germany ( 22 ) and france ( 21 ) which all report median survivals between 7.710.4 months in similar patient populations .
toxicity rates observed in our study also show little cause for concern with 39% ( 19/49 ) patients reporting a grade 3 + adverse event , the most common being constipation ( 4 patients ) and fatigue ( 3 patients ) .
toxicity can be further improved with the use of prophylactic laxative and oral antibiotics and should provide little concern in the prescribing of vinflunine .
further inspection of study efficacy shows that patients with a baseline ecog ps of 0 display a median os of 13.1 ( 6.0 , na ) months , while patients of ps 12 have a poorer prognosis of 7.6 ( 6.010.5 ) months .
20 reporting survival estimates of 13.2 and 6.7 months , respectively , for the same patient groups and emphasise baseline ps as a key prognostic predictor although not ruling out the potential benefits even in the ps 12 population .
this study is limited by the retrospective nature of the data collection and the lack of a randomised comparative arm against which to compare the efficacy , which ultimately open the study results to possible bias . in saying that , however , the study analysis includes patients who did not meet the spc for vinflunine as well as patients who only received a single dose .
coupled with the high rate of ecog > 0 and the distribution of metastases this suggests a patient population which is representative of general clinical practice rather than a narrowly selected clinical trial population .
recently there has been much interest in the role of immune checkpoint inhibitors in urothelial cancer with durable responses have been noted with pd1 [ e.g. , pembrolizumab ( 24 ) and pdl1 atezolizumab ( 25 ) ] .
the results of recently completed trials comparing anti - pd1/pdl1 antibodies , with standard of care chemotherapy of institution 's choice that includes vinflunine in the 2nd line setting ( nct 02256436 ) are awaited with interest . in conclusion ,
the empirical results obtained from uk and ireland practice reflect what has been observed in randomised trials of vinflunine as well as other retrospective studies throughout the european union .
the accumulating evidence puts forward vinflunine single drug therapy as an efficient , safe and reasonably tolerable second - line therapy in patients with advanced tccu . | there is no standard of care in the uk or ireland for second - line chemotherapy for patients with advanced transitional cell carcinoma ( tccu ) .
vinflunine is approved for tccu patients who have failed a platinum - based regimen , and is standard of care in europe but is not routinely available in the uk .
data were collected retrospectively on patients who received vinfluine as a second - line treatment .
the aims were to document the toxicity and efficacy in a real life setting .
data were collected on 49 patients from 9 sites across the uk and ireland [ median age , 64 ( iqr , 5770 ) years , 33 males ] .
all patients had advanced metastatic tccu .
thirteen patients had bone or liver metastases , 4 patients had ps 2 and 11 patients had hb < 10 .
median vinflunine administration was 3.5 cycles ( range 118 ) .
most common grade 34 toxicities were constipation ( 4 patients ) and fatigue ( 3 patients ) .
partial response rate was 29% ( 14 pr , 11 sd , 19 pd , 4 ne , 1 not available ) .
median os was 9.1 ( 6.0 , 12.7 ) months .
results are consistent with real life data from europe .
toxicity is further reduced with prophylactic laxative and oral antibiotics .
vinflunine is an efficient and tolerable second line treatment in advanced tccu . | Introduction
Patients and methods
Results
Toxicity
Overall survival
Disease progression
Patient response
Discussion |
acinetobacter baumannii is an aerobic , nonfermentative gram negative coccobacillus that can survive for prolonged periods in the environment and can cause nosocomial infections , ( urinary tract and wound infections ) .
extensive use of antimicrobial agents in clinical cases has contributed to the appearance of resistant a. baumannii strains .
increasing resistance to carbapenems in a. baumannii infections in the past decade is creating therapeutic challenges .
one of the characteristics of pathogenic bacteria is that they contain virulence factors ( vfs ) .
nonadhesive vfs include : diverse siderophores , such as ; yersiniabactin ( fyua ) , aerobactin ( iuta ) , invasins ( ibea ) , serum resistance ( trat ) , and colicin v production ( cvac ) .
the purposes of this work was to detect the genes codifying nonadhesive vfs , and to evaluate the frequency distribution of nonadhesive vfs in carbapenemase - producing a. baumannii isolated from clinical samples .
one - hundred four samples were isolated from patients hospitalized in three hospitals affiliated with kermanshah university of medical sciences , iran during march 2011-march 2013 .
the strains were identified as a. baumannii by conventional biochemical tests and api 20ne kit ( version 6.0 , bio - mrieux , france ) .
susceptibility to carbapenem was performed according to the standard clinical and laboratory standards institute guidelines to check their resistance to carbapenems using imipenem ( 10 g ) and meropenem ( 10 g ) ( mast , merseyside , uk ) .
escherichia coli mk1 and mk2 were used for ibea and fyua as a positive control . for vf trat , cvac and iuta
one amplified a polymerase chain reaction ( pcr ) product of each gene sent to sinaclon company for sequencing and the results were used as the positive control after nblast alignment .
bacteria were harvested from 1 ml of an overnight broth culture , suspended in 200 l of sterile water , and incubated at 100c for 10 min .
following centrifugation of the lysate , a 150 l sample of the supernatant was stored at 20c as a template dna stock .
each reaction mixture ( 15 l ) contained 2 l of dna , 0.5 mm of each primer , 1 u of taq dna polymerase ( sinaclon ) , the four deoxynucleoside triphosphates ( each at 200 m ) and 1.5 mm mgcl2 .
pcr was performed under predenaturation at 94c for 5 min , followed by 35 cycles of 94c for 45 s , at each specific annealing temperature [ table 1 ] for 30 s , and 72c for 45 s ending with a final extension step at 72c for 5 min .
the pcr product was run and visualized on 1.5% agarose gels then were stained with ethidium bromide .
primers to vfs used in the polymerase chain reaction a statistical comparison of the frequencies of nonadhesive vfs in carbapenemase - producing a. baumannii isolates was conducted by chi - squared test ( variables were analyzed by chi - square test ) .
one - hundred four samples were isolated from patients hospitalized in three hospitals affiliated with kermanshah university of medical sciences , iran during march 2011-march 2013 .
the strains were identified as a. baumannii by conventional biochemical tests and api 20ne kit ( version 6.0 , bio - mrieux , france ) . susceptibility to carbapenem
was performed according to the standard clinical and laboratory standards institute guidelines to check their resistance to carbapenems using imipenem ( 10 g ) and meropenem ( 10 g ) ( mast , merseyside , uk ) .
escherichia coli mk1 and mk2 were used for ibea and fyua as a positive control . for vf trat , cvac and iuta
one amplified a polymerase chain reaction ( pcr ) product of each gene sent to sinaclon company for sequencing and the results were used as the positive control after nblast alignment .
bacteria were harvested from 1 ml of an overnight broth culture , suspended in 200 l of sterile water , and incubated at 100c for 10 min .
following centrifugation of the lysate , a 150 l sample of the supernatant was stored at 20c as a template dna stock .
each reaction mixture ( 15 l ) contained 2 l of dna , 0.5 mm of each primer , 1 u of taq dna polymerase ( sinaclon ) , the four deoxynucleoside triphosphates ( each at 200 m ) and 1.5 mm mgcl2 .
pcr was performed under predenaturation at 94c for 5 min , followed by 35 cycles of 94c for 45 s , at each specific annealing temperature [ table 1 ] for 30 s , and 72c for 45 s ending with a final extension step at 72c for 5 min .
the pcr product was run and visualized on 1.5% agarose gels then were stained with ethidium bromide .
a statistical comparison of the frequencies of nonadhesive vfs in carbapenemase - producing a. baumannii isolates was conducted by chi - squared test ( variables were analyzed by chi - square test ) .
one - hundred four a. baumannii specimens were collected from three hospitals in kermanshah ( iran ) .
fifty isolates were resistant to imipenem and meropenem and also positive for one of the carbapenemase - encoding genes ( blaoxa-23-like , blaoxa-24-like ) ; these isolates were detected as carbapenemase - producing isolates for future analysis .
the carbapenemase resistant bacteria were isolated from 35 ( 70% ) males to 15 ( 30% ) females , and the distributions of carbapenemase - producing a. baumannii , according to age , are shown in figure 1 .
frequencies of nonadhesive vfs include : serum resistance ( trat ) , colicin v ( cvac ) , and aerobactin ( iuta ) , were ; 40 isolates ( 80% ) , 17 isolates ( 34% ) , and 8 isolates ( 16% ) , respectively .
however , the genes fyua , ibea , and pathogenicity - associated islands ( pai ) , codifying for ; yersiniabactin , invasion and pais , respectively , were not detected by means of a pcr with specific primers .
eight ( 16% ) isolates carried both trat and cvac ( p = 0.27 ) , 6 ( 12% ) isolates carried trat and iuta ( p = 0.18 ) , and 4 ( 8% ) isolates carried cvac and iuta ( p = 0.41 ) .
distribution of trat , cvac and iuta did not correlate with gender [ table 2 ] .
distribution of carbapenemase - producing acinetobacter baumannii according to the age of patients patterns of agarose gel electrophoresis showing polymerase chain reaction amplification products for the nonadhesive virulence factors genes .
( a ) lane 1 : trat ( 290 bp ) ; lane 3 : cvac ( 680 bp ) ; lane 5 : iuta ( 300 bp ) ; lane 2 , 4 , 6 : negative control .
( b ) lane 2 : fyua ( 785 bp ) ; lane 4 : ibea ( 170 bp ) ; lane 3 and 5 : negative control distribution of trat , cvac and iuta according to sex
treatment of infections with opportunistic pathogens such as a. baumannii has been a great challenge .
carbapenems are the first - line of treatment of acinetobacter infections , but nowadays resistance to them is reported . in this study , 50 isolates ( 48% ) were recognized as carbapenemase - producing phenotypes out of 104 clinical isolates of a. baumannii .
park et al . reported resistance to imipenem and meropenem , 31.7% and 34.9% respectively from 63 isolates of acinetobacter in south korea .
resistant rate to carbapenem in a. baumannii isolates investigated in this study is different compared to other studies , which may be due to geographical differences in isolates .
fifty carbapenemase - producing isolates were examined in terms of having six nonadhesive vfs including trat ( serum resistance ) , cvac ( colicin v ) , iuta ( aerobactin ) , ibea , ( invasion ) , fyua ( yersiniabactin ) and pai .
frequency of trat , cvac and iuta factors were 40 ( 80% ) , 17 ( 34% ) and 8 ( 16% ) isolates , respectively .
vfs cause infection in most gram negative pathogenic bacteria . of these , nonadhesive vfs play a key role in bacterial survival in special conditions such as in human blood and exposure to serum and poor iron environments that cause diseases . compared to other gram - negative pathogens ,
serum resistance ( trat ) is one of the nonadhesive factors investigated in this study .
studies indicate that serum resistance is the ability of the bacterial cell to resist the lytic effects of serum and to invade and survive in the human blood stream .
2012 ) studied 14 samples of acinetobacter and indicated that 7 isolates ( 50% ) had serum resistance phenotypically .
king et al . in the usa found that from 7 a. baumannii isolates , 3 isolates ( 43% ) had serum resistance phenotypically .
the results obtained from carbapenemase - producing a. baumannii isolates in this study show that genotypic frequency of trat gene is higher than in other studies .
of course , this difference could be due to phenotypic and genotypic detection techniques for these vfs .
there is also a direct relationship between serum resistance and biofilm formation , and hence they increase bacterial pathogenicity . as a result ,
considering the existence of 80% trat gene in this study , more pathogenicity is expected for these isolates .
another vf described in a. baumannii is the production of siderophores by isolates growing under iron limiting conditions .
these bacteria are capable to express high - affinity iron uptake systems composed by siderophores . in braun study , all a. baumannii strains were able to grow under iron limiting conditions , and they concluded that this bacterium produces siderophores . unlike our study , the genes iuta and fyua from iron uptake system of e. coli and yersinia sp .
. considering the frequency of iuta gene in this study , it seems that iuta siderophore unlike fyua in acinetobacters isolated from sputum / tracheal secretion , is more important vf compared to urinary isolates .
another gene that was positive in this study is cvac , which was observed in 34% of cases .
cvac , which encodes colicin v , have been proposed to confer enhanced virulence through their carriage of other specific vfs , including the aerobactin system and serum survival genes , such as trat .
carbapenemase - producing a. baumannii strains are among the most important agents of nosocomial infections in our hospital and worldwide .
three vfs of trat , cvac and iuta with frequency of 80% , 34% , and 16% , respectively , revealing a role in the pathogenesis of these isolates and also may be have the most impact on existence for long time by carbapenemase - producing a. baumannii in environment of hospital .
frequent screening for these vfs may contribute to better infection control measures and to the investigate new treatment options . | background : acinetobacter baumannii which is a gram - negative bacterium can cause several different infections .
the appearance of carbapenemase - producing a. baumannii in recent years has made the treatment process more difficult .
the identification of virulence factors ( vfs ) , such as nonadhesives in a. baumannii , helps to fight against related infections.materials and methods : a total of 104 samples from teaching hospitals in kermanshah , iran , were collected during a 24 months period ( 2011 - 2013 ) .
sample identification was first carried out by biochemical tests , and then their susceptibility to carbapenems was determined using the kirby bauer method . for confirmation of carbapenemase - producing a. baumannii , polymerase chain reaction ( pcr )
was done for carbapenemase - encoding genes .
in addition , the frequency of nonadhesive vfs in carbapenemase - producing isolates was determined by pcr.results:there were 50 isolates that were identified as carbapenemase - producing a. baumannii .
the pcr results showed ; 40 isolates ( 80% ) for trat , 17 isolates ( 34% ) for cvac , and 8 isolates ( 16% ) for iuta , and these encode serum resistance , colicin v and aerobactin , respectively .
no significant correlation was observed between these three genes.conclusions:the mechanism of a. baumannii virulence has always been in question .
the role of vfs has also been recognized in other gram - negative bacteria . according to the prevalence of trat , cvac and iuta , as nonadhesive vfs
, we can suggest that they could be the main mechanism of carbapenemase - producing a. baumannii pathogenesis . | INTRODUCTION
MATERIALS AND METHODS
Bacterial collection
Identification and antimicrobial susceptibility testing
Polymerase chain reaction
Statistical analysis
RESULTS
DISCUSSION
CONCLUSION
Financial support and sponsorship
Conflicts of interest |
the present discussion focuses on the review by oliveira and coworkers ( presented in this issue ) , and on the use of hypertonic saline resuscitation in sepsis .
early fluid resuscitation of patients with systemic inflammatory response syndrome reduces the incidence of mortality due to septic shock and sepsis .
these favorable results have led to consideration of other fluid modalities . in their review ,
oliveira and coworkers consider the use of hypertonic saline solutions in the treatment of patients with severe sepsis .
hypertonic saline has been extensively investigated in animal models with regard to its efficacy in treating hemorrhagic hypotension .
numerous clinical studies of patients with traumatic injuries have been initiated with favorable , but not definitive , results .
limited animal studies have been directed at treatment of septic shock using hypertonic solutions , and clinical studies have been exploratory at best .
following administration there was a small effect on oxygenation by increasing cardiac output and oxygen delivery .
an abstract reported by oliveira an colleagues described a randomized study of 25 stable patients with sepsis .
administration of 250 ml hypertonic saline in dextran significantly improved cardiac index and pulmonary artery occlusion pressure as compared with administration of an equivalent volume of normal saline .
although favorable , those studies of responses to hypertonic saline solutions in stable patients with sepsis are only descriptive . furthermore , administration of hypertonic saline solutions during the early stages of septic shock when the patient is not yet hyperdynamic has not been investigated .
the major benefit of hypertonic solutions is the rapid expansion of blood volume for a small volume administered .
this advantage is sustained by the addition of colloids such as dextran . in their review ,
oliveira and colleagues suggest that the major benefit of resuscitation with hypertonic solutions in models of septic shock is the restitution of blood volume and accompanying improvements in cardiovascular and hemodynamic function .
hypertonic solutions have been demonstrated to modulate the immune system . as pointed out by oliveira and coworkers , hypertonic saline
has a pronounced anti - inflammatory effect that could reduce the response to sepsis and attenuate later multiple organ failure .
recently , shi and coworkers found resuscitation with hypertonic saline to ameliorate the gut and lung injury seen following use of ringer 's lactate .
this lack of injury reduced bacterial translocation , and would presumably reduce the incidence of sepsis . comparisons between various resuscitation solutions on outcome have been controversial .
however , the work of rhee and colleagues in comparing various solutions suggests pronounced differences in immune modulation .
the question that must be addressed is whether the presently available solutions are harmful in conditions in which immune function is challenged , and are thus inappropriate to use .
rhee and coworkers showed that hypertonic solutions , especially when combined with dextran , are superior to ' standard of care ' solutions .
this leads to the conclusion that presently used solutions may be harmful because they compromise immune function and that hypertonic solutions are of benefit because they do not . in their review ,
oliveira and coworkers discuss the use of hypertonic solutions for treatment of septic shock ; however , they do not refer to the possible prophylactic benefit of early use of these solutions .
the etiology of sepsis is based on a sustained period of hypoperfusion of vital organs .
the use of hypertonic solutions as the initial fluid therapy , irrespective of the cause of hypotension or cardiac insufficiency , may be of benefit in blocking the cascade that leads to septic shock . in a study of trauma patients initially resuscitated with hypertonic saline dextran , no cases of sepsis occurred in the hypertonic saline group as compared with an incidence of 2% in the standard of care group . although interesting , this difference was not significant .
the favorable preservation of tissues and immune function that occurs following early resuscitation of the hypotensive patient with hypertonic solutions bodes well for a favorable outcome in the treatment of sepsis .
oliveira and colleagues point out the probable advantages of using hypertonic solutions in patients with sepsis .
there is a rapid and sustained expansion of plasma volume , leading to improvement in cardiovascular function , rectification of microcirculatory blood flow , and favorable modulation of immune function .
all of these factors may contribute to improved outcomes in patients with sepsis and septic shock . beyond the scope of the present commentary
is the possibility that early resuscitation with hypertonic solutions could contribute to a reduced incidence of sepsis by modulation of immune responses and reduced tissue injury .
these improvements following hypertonic saline resuscitation would have a greater impact on the subsequent course of patients admitted to the intensive care unit . at present , although the experimental data are positive and the rationale for use of hypertonic solutions in the care of patients with sepsis or septic shock is reasonable , definitive clinical studies as to the safety and efficacy in this patient population are still required .
cew is a faculty member of the university of california at davis , which holds the us patent for hypertonic saline / hyperoncotic solutions .
he holds advisory positions in companies developing these solutions and serves as a consultant to other companies . | the review by oliveira and colleagues on the subject of hypertonic saline resuscitation in sepsis ( included in the present issue ) suggests possible benefits for hypertonic saline .
there is a firm experimental basis for the actions of hypertonic saline / hyperoncotic solutions in hemorrhagic hypotension , which include expansion of blood volume , improvement in cardiac index , favorable modulation of the immune system , and improvement in survival .
these actions are presumed to be of benefit in the treatment of sepsis or septic shock . however , there are few experimental data regarding the use of these solutions , and clinical studies are descriptive
. the major impact of early administration of hypertonic solutions may be attenuation of tissue injury , sepsis , and septic shock .
early and aggressive fluid resuscitation with hypertonic solutions to clinical end - points should be investigated in patients with systemic inflammatory response syndrome , sepsis , and septic shock . | Introduction
Competing interests |
we present an unusual case of a 24 year old male who was hospitalized to undergo a dental procedure and subsequently developed a cardiac arrest 2 days following the procedure .
the patient presented with a swelling in the buccal cavity for which a biopsy was taken .
two days following the procedure , the patient suddenly presented at night with recurrent ventricular tachycardia ( vt ) and fibrillation ( vf ) , which were intractable requiring multiple dc shocks . during this period arterial blood gas analysis revealed severe metabolic acidosis .
electrocardiogram ( ecg ) revealed vt / vf [ figure 1 ] . following termination of vt ,
subsequently detailed history from the wife revealed that the patient had a heated argument with his wife , after which he was not seen in bed for 2 - 3 hours .
2 hours later , patient was found to be unresponsive and cardiac arrhythmias were noted .
electrocardiogram showing ventricular tachycardia electrocardiogram showing deep t - inversions in precordial leads following termination of the arrhythmia the circumstances led us to suspect poisoning as one of the cause for his medical condition .
patient had access to hand sanitizers which was freely available in the hospital attached to the walls .
the constituents of hand sanitizer include isopropyl alcohol ( ipa ) , glycerin and perfume .
his gastric lavage sample was analyzed by head space gas chromatography- mass spectroscopy , which revealed the presence of ipa .
patient remained hemodynamically stable for the next 9 days although his conscious level did not improve .
when it does occur in the young , it is important to consider poisoning or toxic ingestion as one of the causes .
centre of disease control endorses the use of alcohol based hand sanitizers to prevent pathogen transmission . in a few case reports , a prisoner and a hospitalized patient had consumed ethanol based sanitizer .
they underwent conservative management and recovered . a few cases with intoxication due to ipa based sanitizers have been reported.[35 ] these patients underwent aggressive hemodialysis and had an uneventful recovery . in our patient
we could reverse the toxic effects of ipa with hemodialysis but due to intractable arrhythmias patient had sustained hypoxic ischemic encephalopathy and later succumbed to sepsis .
healthcare professionals need to be aware of common toxins which are accessible to patients in the hospital setting .
we recommend to use a caution in bold letters may cause death if ingested on the label of the container .
inhalation and ingestion of ipa at high concentration leads to apnea , cns depression with subsequent coma and death .
treatment of ipa poisoning should include decontamination by activated charcoal ; supportive care is required for hypotension and respiratory depression .
this case summarizes the need to educate healthcare professionals regarding the toxic effects of commonly available sanitary products in the hospital with a protocol to manage the same when it does occur . | we present an unusual case of 24 year old male who was hospitalized for dental procedure and developed cardiac arrest 2 days after the procedure .
the patient presented with swelling of buccal cavity for which a biopsy was taken .
two days after the procedure , apparently normal patient suddenly presented at mid night with vt and vf , which were intractable requiring multiple dc shocks . during this period arterial blood gas analysis revealed severe acidosis .
the circumstances led us to suspect poisoning as one of the cause for his medical condition .
we looked for commonly available toxins .
one of the commonly available toxins is hand sanitizer which contains isopropyl alcohol , glycerin and perfume . due to prolonged cardiac arrest and
intractable arrhythmia patient had sustained hypoxic brain injury .
patient remained hemodynamically stable for next 9 days although his cns status did not improve .
patient succumbed to sepsis on 9th day .
healthcare professionals should be aware of such possibilities and treat the patients at the earliest and put a check on the easy availability of ipa based hand sanitizers . | INTRODUCTION
DISCUSSION |
null | mammalian target of rapamycin ( mtor ) signalling and macroautophagy ( henceforth autophagy ) regulate numerous pathological and physiological processes including cellular responses to altered nutrient levels . however , the mechanisms regulating mtor and autophagy remain incompletely understood .
lysosomes are dynamic intracellular organelles 1 , 2 intimately involved both in the activation of mtor complex 1 ( mtorc1 ) signalling and in degrading autophagic substrates 3 - 8 . here
we report that lysosomal positioning coordinates anabolic and catabolic responses to changes in nutrient availability by orchestrating early plasma membrane signalling events , mtorc1 signalling and autophagy .
activation of mtorc1 by nutrients correlates with its presence on peripheral lysosomes that are physically close to the upstream signalling modules , while starvation causes perinuclear clustering of lysosomes , driven by changes in intracellular ph ( phi ) .
lysosomal positioning regulates mtorc1 signalling , which , in turn , influences autophagosome formation .
lysosome positioning also influences autophagosome - lysosome fusion rates , and thus controls autophagic flux by acting both at the initiation and termination stages of the process .
our findings provide a fundamental physiological role for the dynamic state of lysosomal positioning in cells as a coordinator of mtorc1 signalling with autophagic flux . | Supplementary Material |
hepatocellular carcinoma ( hcc ) is the fifth and seventh most commonly diagnosed cancer in males and females , respectively , and the third leading cause of cancer mortality worldwide .
the incidence and mortality rates for hcc are similar because most hcc patients are diagnosed at an advanced stage , highlighting the importance of early hcc detection in the application of potentially curable treatment options .
hepatitis b virus ( hbv ) is the major risk factor for hcc and early detection of hcc through surveillance of high - risk populations improves hcc mortality .
therefore , national practice guidelines recommend regular hcc surveillance for high - risk hbv - infected persons . in korea ,
the korean association for the study of the liver and the national cancer center jointly developed guidelines for hcc screening in 2001 recommending that high - risk adults with hbv infection should undergo surveillance for hcc using ultrasonography and alpha - fetoprotein ( afp ) every 6 months . based on this recommendation ,
the korean government introduced nationwide hcc screening as a part of the organized national cancer screening program ( ncsp ) for lower income levels in 2003 .
the ncsp provides a biannual ultrasonography and afp test for males and females 40 years of age that were hepatitis b surface antigen ( hbsag)-positive , had hepatitis c infection , or liver cirrhosis . in the beginning ,
the ncsp supplied medicaid recipients and national health insurance ( nhi ) beneficiaries in the lower 30% income bracket with free hcc screening services . in 2006 , the ncsp provided participants in the lower 50% income bracket with hcc screening services free of charge .
in addition to these national hcc screening programs , ultrasonography and afp testing are performed in outpatient clinics or private health promotion centers across korea .
based on the advantages of early hcc detection , it is crucial to investigate the rate of adherence to hcc screening to understand how hcc surveillance tests are being implemented in high - risk groups in korea .
although a nationwide organized screening program has been provided in korea since 2003 , no study to date has investigated changes in adherence rates to hcc screening in practice .
this study used data from the second and fifth korea national health and nutrition examination surveys ( knhanes ) , which is a nationally representative , cross - sectional survey .
we analyzed screening rates for hcc among the hbv - infected korean population after the introduction of the nationwide hcc screening program and assessed factors related to hcc screening adherence .
this study used the second knhanes ( knhanes ii ) data collected during 2001 and fifth knhanes ( knhanes v ) data collected from 2010 to 2011 . the knhanes is a series of nationally representative , cross - sectional health and nutrition examination surveys conducted by the korean centers for disease control and prevention since 1998 .
it uses a complex , stratified , multistage probability sample representative of the korean population .
the procedures for selecting the sample and conducting the interviews and examinations have been described elsewhere .
consistent with current korea ncsp recommendations , we restricted the analysis to adults 40 years of age at the time of the interview
. there were 14,936 individuals who participated in knhanes ii and 9159 who participated in knhanes v who met the age criteria ; 3763 and 8145 , respectively , of these participants , were tested for hbsag . of these ,
176 and 285 participants in knhanes ii and v , respectively , were infected with hbv . among these populations ,
we excluded participants who reported a personal history of hcc ( n = 4 in knhanes v ) or did not answer questions on compliance to hcc screening tests ( n = 11 and 5 in knhanes ii and v , respectively ) . in the final analysis , we included 165 and 276 participants 40 years of age who were hbsag - positive from knhanes ii and v , respectively [ figure 1 ] .
all participants provided informed consent , and the protocol was approved by the institutional review board of the korea centers for disease control .
hbsag was measured using enzyme - linked immunosorbent assays in knhanes ii ( coda ; bio - rad , hercules , ca , usa ) , and an electrochemiluminescence immunoassay ( modular e-170 ; roche diagnostics , mannheim , germany ) in knhanes v. all other parameters were determined from the self - reported questionnaires .
ii , participants were asked , have you had a screening test for hcc within the last 2 years ? ; possible responses were yes , no , and do not know . in knhanes v ,
participants were asked , when was the last time you had hcc screening test ? ; possible responses were never ,
> 2 years ago , and do not know . to standardize the major outcome variable , participants who had undergone hcc screening test within the previous 2 years were considered to have undergone recent hcc screening .
participants were also asked , have you ever been diagnosed with hbv infection by a doctor or a health professional ? subjects who answered positively to this question were defined as those who were self - aware of hbv infection .
data were also collected on demographic and socioeconomic factors ( e.g. , age , gender , urbanity , marital status , education , household income , health insurance , smoking , and alcohol consumption ) relevant to hcc screening .
two categorical levels for education attainment were used based on the highest level of education achieved by the respondent : high school or higher , and less than high school .
household income was divided into four groups on the basis of monthly income quartile . with regard to health insurance
three categorical groups for alcohol amount were used : light drinking ( < 10 g / d for women , < 20 g / d for men ) , moderate drinking ( 1020 g / d for females , 2040 g / d for males ) , and heavy drinking ( 20 g / d for females , 40 g / d for males ) .
statistical analyses were performed using sas software ( version 9.3 , sas institute , cary , nc , usa ) , which incorporates sample weights and adjust the analyses for the complex sample design of the survey .
the survey sample weights , which were calculated taking into consideration the sampling rate , response rate , and age / gender proportion of the reference population ( 2000 and 2005 national census registry , respectively ) , were used in all analyses to produce estimates representative of the noninstitutionalized civilian korean population considering a complex , stratified , multistage probability sampling design . the prevalence and 95% confidence interval ( ci ) of hbv infection aged 40 years
the hcc screening rate within 2 years and 95% ci for each survey year were calculated using cross - tabulation .
differences in the proportion of participants who had hcc screening in each survey were analyzed using the chi - square test ( proc surveyfreq procedure ) . to identify risk factors for adherence to an hcc screening program ,
the crude and adjusted odds ratios ( ors ) were calculated using logistic regression ( proc surveylogistic procedure ) .
the covariates for the adjusted or calculation were household income , smoking status , awareness of hbv infection , and survey year .
this study used the second knhanes ( knhanes ii ) data collected during 2001 and fifth knhanes ( knhanes v ) data collected from 2010 to 2011 . the knhanes is a series of nationally representative , cross - sectional health and nutrition examination surveys conducted by the korean centers for disease control and prevention since 1998 .
it uses a complex , stratified , multistage probability sample representative of the korean population .
the procedures for selecting the sample and conducting the interviews and examinations have been described elsewhere .
consistent with current korea ncsp recommendations , we restricted the analysis to adults 40 years of age at the time of the interview
. there were 14,936 individuals who participated in knhanes ii and 9159 who participated in knhanes v who met the age criteria ; 3763 and 8145 , respectively , of these participants , were tested for hbsag . of these ,
176 and 285 participants in knhanes ii and v , respectively , were infected with hbv . among these populations ,
we excluded participants who reported a personal history of hcc ( n = 4 in knhanes v ) or did not answer questions on compliance to hcc screening tests ( n = 11 and 5 in knhanes ii and v , respectively ) . in the final analysis , we included 165 and 276 participants 40 years of age who were hbsag - positive from knhanes ii and v , respectively [ figure 1 ] .
all participants provided informed consent , and the protocol was approved by the institutional review board of the korea centers for disease control .
hbsag was measured using enzyme - linked immunosorbent assays in knhanes ii ( coda ; bio - rad , hercules , ca , usa ) , and an electrochemiluminescence immunoassay ( modular e-170 ; roche diagnostics , mannheim , germany ) in knhanes v. all other parameters were determined from the self - reported questionnaires .
ii , participants were asked , have you had a screening test for hcc within the last 2 years ? ; possible responses were yes , no , and do not know . in knhanes
v , participants were asked , when was the last time you had hcc screening test ? ; possible responses were never ,
> 2 years ago , and do not know . to standardize the major outcome variable , participants who had undergone hcc screening test within the previous 2 years were considered to have undergone recent hcc screening .
participants were also asked , have you ever been diagnosed with hbv infection by a doctor or a health professional ?
subjects who answered positively to this question were defined as those who were self - aware of hbv infection .
data were also collected on demographic and socioeconomic factors ( e.g. , age , gender , urbanity , marital status , education , household income , health insurance , smoking , and alcohol consumption ) relevant to hcc screening . two categorical levels for education attainment were used based on the highest level of education achieved by the respondent : high school or higher , and less than high school .
household income was divided into four groups on the basis of monthly income quartile . with regard to health insurance
three categorical groups for alcohol amount were used : light drinking ( < 10 g / d for women , < 20 g / d for men ) , moderate drinking ( 1020 g / d for females , 2040 g / d for males ) , and heavy drinking ( 20 g / d for females , 40 g / d for males ) .
statistical analyses were performed using sas software ( version 9.3 , sas institute , cary , nc , usa ) , which incorporates sample weights and adjust the analyses for the complex sample design of the survey .
the survey sample weights , which were calculated taking into consideration the sampling rate , response rate , and age / gender proportion of the reference population ( 2000 and 2005 national census registry , respectively ) , were used in all analyses to produce estimates representative of the noninstitutionalized civilian korean population considering a complex , stratified , multistage probability sampling design . the prevalence and 95% confidence interval ( ci ) of hbv infection aged 40 years
the hcc screening rate within 2 years and 95% ci for each survey year were calculated using cross - tabulation .
differences in the proportion of participants who had hcc screening in each survey were analyzed using the chi - square test ( proc surveyfreq procedure ) . to identify risk factors for adherence to an hcc screening program , the crude and adjusted odds ratios ( ors ) were calculated using logistic regression ( proc surveylogistic procedure ) .
the covariates for the adjusted or calculation were household income , smoking status , awareness of hbv infection , and survey year .
there were 165 and 276 participants 40 years of age infected with hbv in 2001 and 20102011 , respectively .
the weighted seroprevalence of hbv infection was 4.3% in 2001 , and 3.8% in 20102011 .
the baseline distribution of the study population was broadly similar between survey years , with the exception of educational attainment , household income , smoking status , and alcohol intake .
baseline characteristics of the participants 40 years of age with hepatitis b infection * based on weighted data . based on unweighted data .
p values are derived from rao - scott chi - square test ( proc surveyfreq procedure ) .
the proportion of study participants with hbv infection reporting an hcc screening test within the previous 2 years increased significantly from 17.5% in 2001 to 40.3% in 20102011 ( p < 0.0001 ) .
an increased rate of hcc screening tests from 2001 to 20102011 was also observed in the entire study population .
rate of recent hepatocellular carcinoma screening within 2 years * based on weighted data ; based on unweighted data .
p values are derived from rao - scott chi - square test ( proc surveyfreq procedure ) .
the results of the multivariable logistic regression models for factors associated with the adherence to hcc screening tests are reported in table 3 . following adjustments for household income ,
smoking status , awareness of hbv infection , survey year , and individuals in higher income quartiles were more likely to have undergone recent hcc screening ( third quartile : adjusted or = 3.03 , 95% ci : 1.277.23 ; fourth quartile : adjusted or = 2.49 , 95% ci : 1.085.73 ) .
self - awareness of hbv infection was positively related to recent hcc screening ( adjusted or = 2.74 , 95% ci : 1.405.38 ) .
survey year 20102011 was associated with a significantly higher rate of recent hcc screening ( adjusted or = 3.37 , 95% ci : 1.955.81 ) .
regression models for adherence to hepatocellular carcinoma screening * based on weighted data ; based on unweighted data . crude and
adjusted ors ( 95% cis ) were calculated using logistic regression ( proc surveylogistic procedure ) . or : odds ratio ; ci : confidence interval ; knhanes : korea national health and nutrition examination surveys .
there were 165 and 276 participants 40 years of age infected with hbv in 2001 and 20102011 , respectively .
the weighted seroprevalence of hbv infection was 4.3% in 2001 , and 3.8% in 20102011 .
the baseline distribution of the study population was broadly similar between survey years , with the exception of educational attainment , household income , smoking status , and alcohol intake .
baseline characteristics of the participants 40 years of age with hepatitis b infection * based on weighted data . based on unweighted data .
p values are derived from rao - scott chi - square test ( proc surveyfreq procedure ) .
the proportion of study participants with hbv infection reporting an hcc screening test within the previous 2 years increased significantly from 17.5% in 2001 to 40.3% in 20102011 ( p < 0.0001 ) .
an increased rate of hcc screening tests from 2001 to 20102011 was also observed in the entire study population .
rate of recent hepatocellular carcinoma screening within 2 years * based on weighted data ; based on unweighted data .
p values are derived from rao - scott chi - square test ( proc surveyfreq procedure ) .
the results of the multivariable logistic regression models for factors associated with the adherence to hcc screening tests are reported in table 3 . following adjustments for household income ,
smoking status , awareness of hbv infection , survey year , and individuals in higher income quartiles were more likely to have undergone recent hcc screening ( third quartile : adjusted or = 3.03 , 95% ci : 1.277.23 ; fourth quartile : adjusted or = 2.49 , 95% ci : 1.085.73 ) .
self - awareness of hbv infection was positively related to recent hcc screening ( adjusted or = 2.74 , 95% ci : 1.405.38 ) .
survey year 20102011 was associated with a significantly higher rate of recent hcc screening ( adjusted or = 3.37 , 95% ci : 1.955.81 ) .
regression models for adherence to hepatocellular carcinoma screening * based on weighted data ; based on unweighted data . crude and
adjusted ors ( 95% cis ) were calculated using logistic regression ( proc surveylogistic procedure ) . or : odds ratio ; ci : confidence interval ; knhanes : korea national health and nutrition examination surveys .
given the considerable burden and overall poor prognosis of hcc , early diagnosis through screening enables curative treatments , and , therefore , has the potential to reduce liver - related mortality .
it is important to investigate changes in the use of hcc screening to understand how screening is being conducted in practice following the introduction of a nationwide hcc screening program in korea .
this study revealed a significant increase in recent hcc screening from 2001 to 20102011 . in 2001 , only 17.5% of respondents had undergone hcc screening test ; however , 40.3% of hbv - infected participants had been screened for hcc within the preceding 2 years in 20102011 . this substantial increase in hcc screening
, the korean government has provided individuals at high - risk for developing hcc for free or with a 90% subsidy for hcc screening services .
however , no prominent increase in hcc screening among individuals with low household income was detected .
moreover , the participation rate of hcc screening in the low - income group remained low , even though screening services were offered free of charge by the ncsp .
hcc screening programs are different from those of other solid cancers , such as stomach , breast , cervical , or colorectal cancers , in that they target not a general population but a high - risk population .
therefore , omission from the target population might cause underuse of hcc screening tests among individuals in the low - income group . the target population for hcc screening in korea
first , the ncsp identifies the high - risk population for hcc among the lower 50% of nhi beneficiaries by screening a computerized medical claims database stored in the nhi corporation within the past 2 years .
the ncsp also analyzed serologic tests for hbsag and hcv antibody to identify the high - risk group among medicaid recipients .
therefore , individuals with hbv infection who had never undergone a health check - up might be missing from the target population group .
consequently , the opportunity to make use of free hcc screening services would have been lost in this missing population .
the lower participation rate among the low - income group may also have been due to their unawareness of hbv infection status , and lack of information regarding the nationwide cancer screening program and the benefits of hcc screening .
we also found that moderate - to - high household income , awareness of hbv infection status , and survey year were associated with increased use of recent hcc screening .
the association between household income and hcc screening in this study was similar to a previous report that participants with higher income were more likely to use hcc screening tests .
in general , individuals with higher household income are more likely to undergo screening for colorectal , gastric , breast , and cervical cancer . in addition , self - awareness of hbv infection
several reports have shown that awareness of hbv infection significantly affected participation in hcc screening programs . in this report ,
16.3% of hbv - infected participants aged 40 years were aware of their hbv infection status in 2001 .
however , the rate of infection awareness among hbv carriers 40 years of age was 21% in 20102011 , which was not significantly increased compared to that in 2001 .
these results imply that the identification of hbv - infected individuals among the general population group is important for hcc surveillance among hbv - infected persons .
therefore , to increase the low rate of hcc screening use , a national policy should encourage hbsag screening programs to identify hbv - infected persons , as well as improve patient adherence to hcc screening among hbv - infected individuals .
first , causal associations could not be examined due to the cross - sectional design .
second , this study defined recent hcc screening use as that performed within the previous 2 years to make uniform the measurement in the two survey periods .
the guidelines released jointly by the korean association for the study of the liver and the national cancer center recommended regular screening every 6 months on the basis of tumor doubling time .
therefore , the primary outcome in this study does not represent the recommended hcc screening criteria .
moreover , previous studies reported that the rate of participation in regular hcc screening ( every 6 months ) was lower compared to that of irregular or lifetime hcc screening .
nevertheless , this study that revealed relatively few participants had undergone recent hcc screening within the previous 2 years .
third , we relied on self - reported data to determine whether a subject had actually been screened and when the screening was performed .
therefore , this limitation does not seem to overstate our finding of underuse of hcc screening among the study population .
in korea , opportunistic screening is widely accessible , in addition to nationwide organized screening programs .
finally , other factors influencing hcc screening use , such as a family history of hcc , or replicative state of hbv , or other co - morbidities , were not investigated . despite these limitations , this study had several strengths .
first , it was the first to analyze changes in hcc screening rates following the implementation of organized , nationwide hcc screening programs among hbv - infected groups targeted for screening .
a substantial increase in hcc screening in hbv - infected individuals following implementation of the nationwide screening program provides lessons for government 's hcc screening policy in areas endemic for hbv .
second , we used data representative of the korean population . therefore , we could evaluate the nationwide change in the utilization of hcc screening .
third , we also identified potential factors related to underuse of screening . to improve the efficiency of national hcc screening program and
reduce socioeconomic disparities , identification of proper screening targets for active surveillance is a crucial step in hbv - endemic areas .
we anticipate that our results might bring about improvements in hcc screening of high - risk individuals . in conclusion ,
the rate of adherence to hcc screening within the past 2 years among hbv - infected korean people aged 40 years has more than doubled in 20102011 compared to 2001 . however , the hcc screening rate among the high - risk group remained suboptimal despite the implementation of a nationwide screening program .
household income and awareness of hbv infection were positively associated with hcc screening in this study population at high - risk for hcc .
these results suggest that multiple strategies , including encouragement for hbv - infected persons to attend hcc screening , as well as more efficient identification of hbv - infected subjects unaware of their infection , are urgently needed to maximize the advantages of hcc screening .
this study was supported by a research grant from the korean association for the study of the liver ( the research supporting program of the korean association for the study of the liver ) .
this study was supported by a research grant from the korean association for the study of the liver ( the research supporting program of the korean association for the study of the liver ) . | background : evaluating a change in the screening rate for hepatocellular carcinoma ( hcc ) is critical for understanding screening implementation , and whether targeted population groups are receiving proper screening .
this study examined recent nationwide changes in hcc screening use among hepatitis b virus ( hbv)-infected populations after the introduction of the korean national cancer screening program and predictors of screening adherence.methods:we analyzed 165 and 276 participants 40 years of age who were hepatitis b surface antigen - positive from 2001 ( 14,936 participants ) to 20102011 ( 9159 participants ) korea national health and nutrition examination surveys , respectively .
demographic data , socioeconomic factors , and hcc screening use were collected by means of self - reported questionnaires.results:the rate of hcc screening within the previous 2 years increased significantly from 17.5% in 2001 to 40.3% in 20102011 ( p < 0.0001 ) .
the rate of hcc screening use increased from 2001 to 20102011 in all study populations .
subjects who had a higher income status and were aware of their infection were more likely to have undergone recent hcc screening.conclusions:this study showed a substantial increase in hcc screening in high - risk hbv - infected subjects from 2001 to 20102011 . however , the hcc screening participation rate remained suboptimal despite the introduction of the nationwide screening program .
efforts should be made to identify high - risk individuals and increase attendance at hcc screening events among high - risk groups . | I
M
Study population
Data collection
Statistical analysis
R
Baseline characteristics of the participants 40 years of age with hepatitis B virus infection
Rates of recent hepatocellular carcinoma screening tests within 2 years
Factor influencing hepatocellular carcinoma screening tests among hepatitis B virus-infected participants 40 years of age
D
Financial support and sponsorship
Conflicts of interest |
iran can be divided into 11 regions with 28 provinces ( supplementary file ) , based on ethnographic , demographic , epidemiologic , and socioeconomic factors ( 18 ) .
this study was cross - sectional and was conducted during the year 2001 in iran .
it was a part of the micronutrient survey , which covered the whole country and was conducted by the ministry of health ( moh ) of iran .
the study population was households and the sampling method was unequal cluster sampling with unequal household sizes randomly selected throughout the country .
the clusters were sampled relative to the size of the urban and rural population of each province in all 11 regions .
there were 880 clusters in all 11 regions , 504 urban and 376 rural clusters .
before the study was conducted , a team of health workers in each health care center in urban and rural areas were selected .
each team was assigned to pick up at least five people for the study from each subregion .
pregnant women were informed about the study process . assigned pregnant women gave informed consent , and accepted to give blood samples and complete questionnaires .
these pregnant women were targeted in their own provinces by written invitation at the nearest health care center that belonged to their region .
if a woman was not able to go to the health care center within the due date , the survey staff would go to the woman 's house and invite her to participate in the study . as an inclusion criterion ,
it was important that the pregnant women were otherwise healthy and did not have any kind of chronic diseases such as diabetes or heart disease .
the total number of pregnant women who participated in the study was 4,368 from all regions of iran , but data on vitamin a levels were only available in 3,270 women .
a questionnaire was designed by the moh in iran to collect information about mothers on general characteristics , health status , supplements if used , number of abortions , pregnancies , and deliveries . from each participant ,
a minimum of 6.5 ml venous blood was collected and kept in dry ice and sent to an accredited district laboratory for centrifugation .
vitamin a was analyzed as retinol by using high - performance liquid chromatography ( hplc ) at the who collaborating laboratory in tehran after the samples were transported there in a cold chain vehicle .
data for 3,270 pregnant women were analyzed with spss version 17.0 ( spss inc . ,
one - way anova test was carried out to test the significant differences between the mean of vitamin a levels within groups with different age and gestational age .
one - way anova test was computed to test the significant difference of parity on vitamin a status . two - way anova test was carried out to test the impact of age and areas ( rural and urban ) on the levels of vitamin a in pregnant women .
the approval for this study was obtained from the ethics committee of the moh in iran .
data for 3,270 pregnant women were analyzed with spss version 17.0 ( spss inc . ,
one - way anova test was carried out to test the significant differences between the mean of vitamin a levels within groups with different age and gestational age .
one - way anova test was computed to test the significant difference of parity on vitamin a status . two - way anova test was carried out to test the impact of age and areas ( rural and urban ) on the levels of vitamin a in pregnant women .
the approval for this study was obtained from the ethics committee of the moh in iran .
the mean age of the participating women was 26 years , ranging from 14 to 47 years .
the number of included pregnant women in the 11 regions varied between 229 and 330 ( table 1 ) .
mean ( sd ) values of serum vitamin a ranged from 0.77 ( 0.46 ) to 1.12 ( 0.43 ) mol / l . in table 1 ,
the regional as well as national mean ( sd ) levels of vitamin a as well as prevalence rates within the categories deficient , insufficient , suboptimal , and optimal is shown .
mol / l ) are also shown . the highest mean plasma retinol level ( 1.12
mol / l [ 0.43 ] ) was found in central iran ( region 6 ) .
deficiency was mainly seen in regions 2 , 5 , 7 , 8 , and 11 .
mol / l for the whole nation is well above 20% ( 24.9% ) and should therefore be characterized as severe according to the who categories . in some parts of the country the prevalence below 0.7 mol
/ l is over 30% ( 3 , 11 ) with one region reaching the level of 45.9% ( 7 ) .
the mean ( sd ) of plasma retinol levels in pregnant women and the percentage distribution of deficient , insufficient , suboptimal , and optimal levels in fig .
1 , the percentage distribution of vitamin a status is shown for the 11 regions .
deficiency was mainly seen in regions 2 , 5 , 7 , 8 , and 11 .
the highest optimal percentage of vitamin a was in regions 2 , 4 , 6 , 9 , and 11 .
more than half of pregnant women had serum vitamin a with suboptimal level , while vitamin a deficiency was only seen in less than 7% of all pregnant women in the study , and insufficiency in 18% .
the mean ( sd ) vitamin a level in rural and urban areas were 0.98 ( 0.4 ) and 1.00 ( 0.4 ) mol / l , respectively .
vitamin a in each age group was slightly lower in rural than that in urban areas .
the difference showed that the difference of vitamin a in both areas was not statistically significant .
however , there was a statistically significant main effect of age on vitamin a level ( p=0.005 ) . using the same test , this effect size was rather small ( eta squared=0.003 ) ( fig .
2 ) . mean vitamin a in rural and urban areas at different gestational age groups .
vitamin a levels in pregnant women decreased by increasing maternal age ( anova , p=0.005 ) ( table 2 ) .
women who were less than 23 years old had higher levels of serum retinol than the older ones .
there was a weak negative but significant correlation between age and vitamin a status ( pearson correlation , r=0.047 , p=0.007 ) .
the meansd of vitamin a ( mol / l ) in pregnant women at different age groups p - value for the difference within the groups=0.008 , one - way anova test was performed .
p - value for the difference between the two defined groups=0.006 , post hoc anova test was performed .
the mean vitamin a decreased as the gestational age increased ( p=0.009 , one - way anova ) .
the mean serum retinol decreased as the gestational age increased ( p=0.009 , one - way anova ) .
meansd of vitamin a ( mol / l ) in pregnant women with different gestational age p=0.01 difference between two defined groups p=0.02 difference between two defined groups , post hoc test was performed .
there was no significant relation between parity and vitamin a status ( f=0.79 , p=0.45 ) as shown in table 4 .
meansd of vitamin a ( mol / l ) in pregnant women with different parity p=0.45 , one - way anova test was performed .
this study showed that pregnant women in 2001 in this nationally representative study from iran had a low vitamin a status since 25% of pregnant women had insufficient or deficient vitamin a levels . using the who cut - offs for national prevalence of vitamin a deficiency , iran should by this standard
be considered a country with severe vitamin a insufficiency prevalence ( < 0.7 mol / l ) in 2001 .
in contrast , reports from the north of iran , marand district , in 2002 showed that 2.1% of child - bearing women had a deficiency level of vitamin a ( < 0.7 mol / l ) but 18% had values between insufficient or suboptimal level of vitamin a ( 19 ) . prevalence of deficiency levels ( < 0.36
mol / l ) was 6.6% nation - wide and similar to the average global prevalence of maternal vitamin a deficiency in developing countries ( 7% ) ( 20 ) .
the highest prevalence of deficiency to our knowledge was reported from nepal ( 31% ) ( 21 ) , about five times higher than in iran .
china had the lowest prevalence of deficiency , only 2% in 2001 ( 21 , 22 ) .
in contrast , data from who in 2005 showed that on average 11.6% of pregnant women in europe had vitamin a deficiency , ranging from 2.6 to 20.6% over the past 15 years ( 10 ) .
maternal vitamin a deficiency was also correlated to a reduced intra - uterine growth rate and birth weight , and higher infant mortality ( 2325 ) .
the prevalence of vitamin a deficiency we found indicates a slight improvement in vitamin a status from severe to moderate deficiency during 1989 to 2001 ( 10 ) . a general severe deficiency of vitamin a in cord blood in male infants in 1989 developed into moderate deficiency in 2001 in iran ( 17 ) .
despite the improvement in prenatal health care facilities , which in the meanwhile have been organized in each province supplying multivitamin ( vitamins a+d ) supplements free of charge through the primary health care system .
supplementation of vitamin a to infants from 2 weeks of age until 2 years by moh in the past decades may be responsible for a previous finding that vitamin a deficiency and insufficiency were rare in infancy ( 18 ) .
the higher prevalence of insufficient vitamin a levels in the south of iran might be associated with lower contribution of animal and milk products to the total energy intake , being 6 and 1% , respectively , in comparison with central and north of iran , where animal and milk products contributed to about 8 and 4% , respectively , of the total energy intake ( 26 ) .
a low access in the south of iran to main sources of vitamin a ( dairy products , vegetables , and fruits ) may be related to the hot and dry climate in this region ( 27 ) .
one study in northwest of iran showed that the important sources of vitamin a in child - bearing women were nuts and green leaves , products that were not typical of other populations ( 19 ) .
vegetables and fruits provide carotenoids equivalent to more than 50% of vitamin a ( 4 ) .
moh reported that the intake to need ratio of vitamin a shows a scattered provincial distribution , from 60% in sistanbalouchestanto to 100% in east azarbayejan ( 26 ) .
this is in accordance with the consumption of the main sources of vitamin a in the south of iran , that is , sistanbalouchestan is low ranking in both urban and rural areas .
this might also be related to socioeconomic status , drought , and low production of fruits and vegetables . referring to the un food and agriculture organization ( fao ) regarding the nutritional intake in iran ( 2002 ) , the average daily intake of vitamin a was lower in villages than in towns , but insufficient in both , based on lower intake of animal products , fruits , and vegetables ( 26 ) . in this study , the level of vitamin a deficiency was almost the same in both areas .
the association between the status of vitamin a and age has been reported earlier ( 10 , 21 ) and has been related to factors such as dietary patterns and life - style that influence the nutritional status ( 28 ) .
the current study revealed that there was a significant correlation between gestational age and serum retinol .
similarly , among nepalese pregnant women , even though the prevalence of vitamin a deficiency was higher only in late pregnancy , it lead to night blindness ( 9 ) . this might be explained by an increased vitamin a - transfer to the fetus during late pregnancy .
in contrast to our finding regarding the negative association of vitamin a with age , it has been reported elsewhere that night - blind women were more likely to be teenagers ; however , the risk again increased with age among women aged above 30 ( 9 ) .
the difference could be explained by the fact that the nepalese study reported data based on whether the women had night blindness during pregnancy or not , while our study reported serum retinol levels .
in addition , we had no records of the socioeconomic status which could be an influencing factor here , as it has been shown in the previously mentioned study ( 9 ) .
one study in bangladesh showed no correlation between parity and serum retinol ( 29 ) . a limitation to our study was that investigations at the regional level in the 11 included regions did not include data on sociodemographic differences .
this study illustrates that the status of vitamin a was good in 75% of pregnant women in iran . as
the who goal is to eliminate vitamin a deficiency globally , this study shows that iran has achieved a relatively good result historically in the drive to eliminate vitamin a deficiency only in some provinces but not at the national level .
since this data does not represent the current status of vitamin a in the country , further information on vitamin a status in pregnant women are required for a strict surveillance of this important problem and to ensure that the vitamin a status continues to improve in iran .
the authors have not received any funding or benefits from industry or elsewhere to conduct this study . | backgroundvitamin a deficiency is considered as one of the public health problems among pregnant women worldwide .
population representative data on vitamin a status in pregnancy have not previously been published from iran.objectivesthe aim of this study was to publish data on vitamin a status in pregnant women in all the provinces of iran in 2001 , including urban and rural areas , and to describe the association of vitamin a status with maternal age , gestational age , and parity.designthis descriptive cross - sectional study was conducted on 3,270 healthy pregnant women from the entire country , 2,631 with gestational age 36 weeks , and 639 with gestational age > 36 weeks .
vitamin a status was determined in serum using high - performance liquid chromatography.resultretinol levels corresponding to deficiency were detected in 6.6% ( < 0.36
mol / l ) and 18% had insufficient vitamin a levels ( 0.36<0.7
mol / l ) .
suboptimal level of serum retinol was observed in 55.3% of the pregnant women ( 0.71.4 mol / l ) . only about 20% of the women had optimal values ( > 1.4
mol / l ) .
the level of serum retinol was lower in older pregnant women ( p=0.008 ) , and at higher gestational age ( p=0.009 ) .
high vitamin a levels were observed in pregnant women in the central areas of iran and the lowest values in those in the southern areas of iran.conclusionsthe vitamin a status was good in 2001 but should be closely monitored also in the future . about 25% of pregnant women had a vitamin a status diagnosed as insufficient or deficient ( < 0.7 mol / l ) .
the mean serum retinol decreased as the gestational age increased .
the clinical significance of this finding should be further investigated , followed by a careful risk group approach to supplementation during pregnancy . | Methods
Statistical analysis
Ethical approval
Results
Discussion
Conclusions
Conflict of interest and funding |
three weeks prior to this presentation , she was evaluated in the emergency room for similar complaint and was discharged after having normal blood and imaging tests including cardiac enzymes , electrocardiogram ( ekg ) , and chest x - ray .
her chest pain was described as sharp , constant , 6/10 in intensity , located in the substernal area , radiating to the back , no exacerbating factors , and improved by non - steroidal anti - inflammatory drugs ( nsaids ) .
she had no previous history of rash , prior shingles , or lower back pain .
she had a past medical history of hypertension and was taking amlodipine and metoprolol at home .
she was a chronic smoker , smoking an average of five cigarettes a day for more than 20 years , but denied any alcohol or illicit drug use .
her vital signs were significant for mildly elevated blood pressure of 160/98 mmhg with a pulse rate of 75/min . on examination , she had normal pulses , a normal heart rate , and rhythm without any murmurs or gallops .
there was no chest wall tenderness , abdominal discomfort or costovertebral angle tenderness , and pedal edema .
initial ekg showed normal sinus rhythm at 86 bpm , normal axis with no evidence of st elevation or depression ( fig .
routine blood tests were done , which showed normal values of complete blood count , basic metabolic panel , liver function tests , tsh , coagulation profile , lipid profile , and serum cardiac troponin i ( ctni ) .
other labs revealed esr 25 mm / h ( normal 020 mm / h ) , crp 6 mg / l ( normal < 5 mg / l ) , and d - dimer 1.51 mg / l ( normal < 0.5 mg / l ) .
no other significant abnormalities were noted . a list of differential diagnoses including acute myocardial infarction , acute pulmonary embolism , aortic dissection , myocarditis , pericarditis , and musculoskeletal pain was made
. acute myocardial infarction and pericarditis were ruled out with the presence of normal ekg , normal ctni , esr , and high normal crp .
ct angiogram of the chest with contrast ( cta ) was obtained , which showed a protrusion of the medial wall of the descending thoracic aorta into a thickened aortic wall indicative of a penetrating atherosclerotic ulcer with imh ( fig .
transthoracic echocardiogram ( tte ) showed normal left ventricular size , wall thickness , and systolic function ( ejection fraction
exercise stress test did not reveal any signs of myocardial ischemia . with the normal findings of cardiac workup and ct angiogram , pau with imh was diagnosed as a cause of recurrent chest pain .
ct angiogram of chest with contrast ( a ) transaxial and ( b ) coronal planes demonstrating a penetrating atherosclerotic aortic ulcer ( blue arrow ) with a mural hematoma approximately 2.3 cm in the largest transverse diameter and 1.25 cm in the largest thickness ( blue arrow ) .
as her condition did not require immediate surgical intervention , she was scheduled for outpatient follow - up and was counseled about medication compliance for anti - hypertensive and smoking cessation .
after 2 weeks , she followed up in the clinic where she stated that her chest and back pain had resolved .
her blood pressure was controlled with bp of 130/80 mmhg and also she had successfully quit smoking .
acute aortic syndrome ( aas ) is a constellation of aortic dissection , imh , and penetrating atherosclerotic disease . with recent developments in diagnostic modalities
, pau has been frequently identified over the past few years with 2.37.6% estimated prevalence in symptomatic patients with aas , but its background and actual incidence remains unknown ( 5 , 6 ) .
pau usually develops in old age , atherosclerotic disease , coronary artery disease , hypertension , hyperlipidemia , a strong smoking history , and renal disease ( 7 , 8) .
it can not be differentiated from aortic dissection by symptoms alone at initial emergency room visit , where exclusion of classic aortic dissection is crucial ( 5 , 8) .
pau can be found in the ascending and descending thoracic aorta while the latter was being more common .
pau , known as a disease of the intima , can start as a benign atherosclerotic plaque in the aorta , which can gradually progress to deep media layer associated with imh due to disruption of vasa vasorum that may be a nidus of aortic dissection ( 9 ) .
it can be associated with complications such as acute aortic dissection , aortic rupture , aortogastric fistula , and false aneurysm ( 4 , 10 , 11 ) . moreover
, the risk of aortic rupture was higher in patients with pau ( 40% ) compared with patients with type - a ( 7% ) and type - b dissections ( 3.6% ) ( 9 ) .
it is worth noting that the understanding of pau in the literature came from imaging studies rather than histopathologic findings ( 8 , 9 ) . because of its vague presentation
therefore , pau is often found while the patient is undergoing diagnostic tests to rule out other pathologies .
traditionally , pau was diagnosed by aortography ; however , since the early 1980s , cta , mri , and tte have replaced aortography to diagnose aortic pathology .
table 1 summarizes the radiologic findings of pau ( 6 , 8 , 12 , 13 ) . however , cta is the best diagnostic choice in pau ( 8) . management of pau depends on several factors including the presence of symptoms , location of ulcer , extent and size of the ulcer , and presence of imh ( 8 , 14 ) .
the presence of pau in ascending aorta with persistent symptoms , hemodynamic instability , imh , and progression of ulcer size are major predictors of adverse outcome which require early surgical intervention ( 14 ) .
radiologic findings of pau we here report the case of a 65-year - old woman with recurrent chest and back pain of unknown origin , later found to have pau with imh in the descending aorta as a cause of her chest pain .
there was a similar case reported in which a patient presenting with persistent chest pain was determined to have a pau in the descending aorta .
ct showed varying degrees of sub - adventitial hemorrhage in the thoracic aorta ; therefore , this patient underwent surgery successfully ( 15 ) .
reported a case of pau , which presented with chest and back pain of uncertain origin .
cta chest showed a pau in the ascending aorta associated with aneurysmal dilatation , which required immediate surgical intervention ( 16 ) .
the above cases highlight the importance of early detection and surgical treatment of pau to prevent adverse outcomes if ct scan findings were of concern .
interdisciplinary expert consensus from the european journal of cardio - thoracic surgery made the statement that medical treatment was indicated in patients with uncomplicated courses whereas thoracic endovascular aortic repair ( tevar ) , or surgical therapy , was considered in complicated cases including persistently symptomatic patients despite medical treatment , asymptomatic patients with large pleural effusions , imh , and large initial pau depth ( > 10 mm ) and diameter ( > 20 mm ) ( 14 ) . in asymptomatic patients who do not require surgical intervention , follow - up is recommended every 6 months for the first 3 years and every year thereafter with imaging techniques ( 14 ) .
since there was no surgical indication for our patient , she was conservatively managed with tight blood pressure control and smoking cessation .
she was symptomatically better and discharged to outpatient follow - up with further imaging studies . in conclusion
, pau is an underestimated aortic disease that can present with chest and back pain . until now
, there is no sufficient data in the literature to suggest which chest pain patient should undergo an extensive workup . individualized clinical judgment with a detailed history and thorough physical examination is a valuable tool in the evaluation of chest pain , and it is paramount to think of pau if chronic chest and back pain in elderly patients are unrelated to cardiac or musculoskeletal origin , where further diagnostic imaging might be necessary .
we mostly focus on the assessment of acute coronary syndrome and pulmonary pathologies in patients with chest pain but unfortunately we forget to consider other etiologies that may be equally dangerous
. since pau is one of the aas with a high risk of complications , we may miss this life - threatening diagnosis if we do not have a hunch and perform appropriate tests .
this work received no specific grant from any funding agency in the public , commercial , or not - for - profit sectors . | chest pain is a very common symptom and can be of cardiac or non - cardiac origin .
it accounts for approximately 5.5 million annual emergency room visits in the united states , according to 2011 cdc data .
penetrating atherosclerotic aortic ulcer ( pau ) , an uncommon condition , is also a potential cause of chest pain .
we here report the case of a 65-year - old woman who presented with atypical chest and back pain .
the pain persisted for 4 weeks necessitating two emergency room visits .
initial tests were non - significant including cardiac troponins , an electrocardiogram ( ekg ) , and a chest x - ray on her first visit . upon her second visit , she underwent a computed tomography angiogram of chest with contrast which revealed a pau with an intramural hematoma in descending aorta .
the pau was finally diagnosed with an exclusion of other chest pain causes .
she was treated non - surgically with a blood pressure control strategy and pain management . after a 2-month period of smoking cessation and following the achievement of a controlled blood pressure
, she felt well without chest pain . | Case presentation
Discussion
Conflict of interest and funding |
rapid recruitment of innate immunity cells such as polymorphonuclear neutrophils ( pmns ) is a critical component of pathogen killing and removal during infection .
as they differentiate , the cells begin to move toward the venous sinusoids prior to migration across the sinusoidal endothelium to reach the vascular lumen .
these terminally differentiated cells have a short life but nevertheless represent the most abundant leukocyte species in the circulation .
pmns are the first leukocytes to migrate from the blood to inflammatory sites [ 2 , 3 ] .
following their activation by various proinflammatory cytokines such as il-8 , tnf , or il-1 secreted by resident macrophages , pmns start rolling along the vessel wall , followed by firm arrest and transmigration through the inflammatory vascular endothelium [ 46 ] .
once in the extravascular environment , pmns interact with extracellular matrix proteins and migrate along a chemotactic gradient to reach the site of injury .
at the site of infection , pmns begin phagocytosis and killing of pathogens through production of toxic reactive oxygen species ( ros ) , secretion of lysosomal enzymes , and formation of nets ( figure 1(a ) ) [ 2 , 8 ] . activated pmns
also regulate the innate and the adaptive immune responses by secretion of various cytokines and chemokines , such as il-1 , il-6 , il-8 , tnf [ 2 , 911 ] , and lipid mediators as well .
the interaction of pmns with their environment is an indispensable determinant that tailors their functional responses , including correct timing of events leading to activation .
the mechanisms that contribute to the maintenance of pmn homeostasis under normal and inflammatory conditions are tightly regulated through integration of external signals picked up by their transmembrane receptors .
these receptors mediate intracellular signalling cascades through activation of two superfamilies of g proteins , the heterotrimeric g proteins , and the ras superfamily of small monomeric gtpases [ 13 , 14 ] .
whereas heterotrimeric g proteins directly interact with and are activated following stimulation of so - called g protein - coupled receptors ( gpcrs ) such as formyl - peptide receptors or cxcr1 chemokine receptor , small gtpases are generally activated by other regulatory proteins downstream of many transmembrane receptors ( figure 1(b ) ) .
the ras superfamily comprises more than 150 members divided into six subfamilies : ras , rho , ran , rab , rheb , and arf .
small gtpases are molecular switches that exist in an active on form when bound to guanosine - triphosphate ( gtp ) and an inactive off conformation when bound to guanosine - diphosphate ( gdp ) [ 15 , 16 ] .
the guanine nucleotide exchange factors ( gefs ) catalyze the removal of gdp and allow gtp binding to the conserved guanine nucleotide binding site of small gtpases .
the binding of gtp rigidifies small gtpases in an active conformation that interacts with specific effector proteins and engages a limited number of downstream effects .
small gtpases have low intrinsic gtpase activity and need help from gtpase activating proteins ( gaps ) to hydrolyse gtp and return to the inactive gdp - bound conformation [ 17 , 18 ] .
some gtpases of the rho and rab family are also regulated by guanine nucleotide dissociation inhibitors ( gdis ) that remove small gtpases from the membranes and sequester them in the inactive state as a cytosolic heterodimer .
small gtpases are key elements of downstream signalling pathways regulating multiple effector proteins and functional responses of cells . numerous studies , including those from our laboratory , have shown that arf proteins activate phospholipase d ( pld ) and phosphatidylinositol 4-phosphate 5-kinase ( pip5-kinase ) and regulate various pmn functions such as superoxide production , degranulation , and chemotaxis ( figure 1(b ) and table 1 ) . in this review , we will focus on the arf gtpases and their regulators in relation to pmn functional responses .
the arf family was first identified and named according to its function as a cholera toxin cofactor stimulating the adp - ribosylation of g protein g subunit .
arf gtpases are ubiquitously expressed and their sequences are highly conserved among eukaryotes . they are divided into three classes based on sequence homology .
class ii comprises arf4 and arf5 , and arf6 is the only representative of class iii [ 23 , 24 ] .
we can not overlook the fact that small g proteins sharing structural features with arfs also include arf - like ( arl ) proteins , ras - related protein 1 ( sar1 ) , and arf - related protein 1 ( arfrp1 ) . like all small gtpases , arfs are on - off molecular switches regulated by specific gaps and gefs .
in contrast to other small g proteins that undergo posttranslational modification ( prenylation or isoprenylation ) at their c - terminus , arfs share n - terminal amphipathic helix with a myristoylated n - terminal glycine residue .
gtp binding to arfs induces conformational changes in switch 1 and switch 2 regions that bind effector proteins , as well as a reorientation of the amphipathic helix that favours interaction with the membrane and insertion of the lipid tail into the phospholipid bilayer .
arfs also have different distribution in the cells , which is thought to stem from the individual protein environment .
although classes i and ii arfs are mainly localized to the er - golgi , arf1 and arf3 are released in the cytosol , whereas arf4 and arf5 can associate with the golgi and the trans - golgi network ( tgn ) in their gdp - bound state .
studies have determined that the gdp - gtp cycle of arf6 takes place at the plasma membrane and that some gtp - binding defective mutants of arf6 are trapped in endosomes [ 30 , 31 ] .
the two that have been the most studied are arf1 and arf6 ( table 1 ) .
arf1 was first reported to regulate intracellular vesicular traffic from the golgi to the endoplasmic reticulum ( er ) and between golgi cisternae , through the recruitment of clathrin and nonclathrin coats to membrane , a first step in the budding of transport vesicles [ 5052 ] .
in addition to stimulating pld , golgi - associated arfs recruit phosphatidylinositol 4-kinase and pip5-kinase to maintain the structure and the dynamics of the golgi apparatus through local synthesis of phosphatidylinositol-4-phosphate and phosphatidylinositol-4,5-bisphosphate ( ptdins(4,5)p2 ) .
arf1 and arf3 are required for the integrity of recycling endosomes but seem dispensable for the retrograde transport from endosomal compartments to the tgn .
, arf1 was shown to mediate formyl - methionyl - leucyl - phenylalanine ( fmlf ) dependent activation of pld .
studies from our laboratory have shown that the particulate agonist monosodium urate crystals , fmlf , and leukotriene b4 induce arf1 recruitment to membranes and pld activation in pmns .
a study using cytosol - depleted hl-60 cells suggested that arf1 and phosphatidylinositol transfer protein ( pitp ) restore secretory function in cytosol - depleted cells by promoting ptdins(4,5)p2 synthesis .
ptdins(4,5)p2 synthesis could also be dependent on arf1-mediated activation of pip5-kinase in hl-60 cells . in pmns
, arf1 was shown to bind to complement receptor type 1 ( cr1 ) storage vesicles and was suggested to play a role in regulation of their transport .
though activated arf1 has been shown to recruit arfaptin-1 and arfaptin-2 to golgi membranes and has been suggested to regulate golgi function in hl-60 cells , more recent studies showed that arl1 but not other arf proteins determine the association of arfaptins with and the biogenesis of secretory granules at the trans - golgi in cells [ 59 , 60 ] .
less is known about the function of arf class ii . arf4 and arf5 play roles in transport mechanisms between the endoplasmic reticulum golgi intermediate compartment ( ergic ) and the golgi .
arf4 was reported to regulate transport of ciliary cargoes , and the creb3-arf4 signalling cascade was suggested to be part of a golgi stress response to pathogens . in hela cells , arf5 was reported to regulate internalization of the 51 integrin and clathrin - mediated endocytosis of specific cargoes . though quantitative proteomics studies have identified arf4 and arf5 in pmns [ 47 , 65 ] , the functions of arf class ii in pmns have not been investigated .
arf6 , the arf gtpase most distantly related to arf1 , has been localized to the plasma membrane and endosomal compartments .
this gtpase has been implicated in different signalling pathways and in a wide diversity of cellular functions such as actin cytoskeleton remodelling , phagocytosis , endocytosis , membrane receptor recycling , and intracellular transport [ 52 , 6670 ] .
overexpression of arf6 and of its regulators in metastatic cancers suggests important roles in regulating adhesion , migration , and invasive behaviour of cancer cells [ 7173 ] .
for example , in epithelial cells , e - cadherin is targeted by arf6 to adherens junctions for maintaining barrier permeability , epithelial cell morphology , and polarity [ 74 , 75 ] . in immune cells such as macrophages ,
a spatiotemporal recruitment of arf6 to phagosomes regulates fc receptor - dependent phagocytosis [ 7679 ] .
this gtpase is also involved in endocytosis and recycling of various gpcrs [ 8082 ] such as mu - opioid and 2-adrenergic receptors , or growth factor receptors as well .
moreover , it is important to mention that arf6 plays a major role in the signalling pathway of toll - like receptor 4 ( tlr4 ) and tlr9 [ 86 , 87 ] .
the expression of arf6 in pmns and neutrophil - like cells such as differentiated hl-60 or plb-985 myeloid leukemia cells has been previously reported [ 3638 ] .
arf6 protein is four to five times more abundant in these myeloid leukemia cells when compared to human pmns . in pmns or differentiated plb-985 cells
, arf6 plays roles in the signalling pathways elicited by the chemotactic peptide fmlf [ 37 , 38 ] .
plb-985 cells , overexpressing the arf6 ( q67l ) mutant defective in gtp hydrolysis or the arf6 ( t27n ) mutant defective in gtp binding , show increased and decreased nadph oxidase activity , respectively .
silencing of arf6 in plb-985 cells also reduces fmlf - mediated production of superoxide and pld activation as well .
inhibition of superoxide production by arf6 mutants could be due to reduced pld activity since overexpression of the arf6 ( n48r ) mutant defective in pld activation also reduced fmlf - induced nadph oxidase activity in plb-985 cells .
in addition to pld , pip5-kinase was reported to be a downstream effector of arf6 [ 88 , 89 ] . in this context
, it is important to highlight that arf proteins can be depleted from hl-60 cells by permeabilization and that addition of arf6 to permeabilized cells contributes to the regulation of pdtins(4,5)p2 synthesis at the plasma membrane by directly activating pip5-kinase .
altogether , these studies suggest that remodelling of membrane phospholipids by arf6-mediated activation of pld enzymes and pip5-kinase would regulate pmn functional responses such as nadph oxidase activity , phagocytosis , and degranulation [ 9092 ] . direct demonstration of a role for arf6 in pmn phagocytosis and degranulation awaits characterization of arf6 knockout pmns .
gefs can signal from plasma membrane receptors directly to small gtpases , and in some cases gefs serve as gtpase effectors or adaptor proteins that facilitate activation of other small gtpase family members .
the human genome contains gefs that are family specific but some gefs are highly specific toward one gtpase .
the first characterized arf gefs comprise the yeast gea1p and in mammals cytohesin-2 and big1 [ 9496 ] .
although arf gefs show different substrate specificities , they share a conserved 200-amino acid region called the sec7 domain that catalyzes the exchange of nucleotides . some but not all sec7 domains are the target of the drug brefeldin a ( bfa ) .
arf gefs contain other motifs , like the pleckstrin homology ( ph ) domain involved in protein targeting to membranes through binding to polyphosphoinositides , homology downstream of sec7 ( hds ) lipid - binding domains , or sh2 and sh3 domains related to protein - protein interactions .
arf gefs are classified into six evolutionarily conserved families as follows : gbf1 , big , psd , iqsec , cytohesins , and fbxo8 . the golgi - specific bfa resistance factor 1 ( gbf1 ) and the two yeast gbf1 orthologs , gea1 and gea2 , localize in the golgi .
lipid binding to the hds1 domain immediately downstream of the sec7 domain is sufficient for targeting gbf1 to lipid droplets and golgi membranes .
gbf1 recruits the copi coat to the cis - golgi [ 99101 ] . in vitro
gbf1 has been reported to activate arf1 in response to stimulation with fmlf . upon stimulation , arf1 and gbf1
are relocalized from the golgi to the leading edge of migrating cells in a phosphatidylinositol 3-kinase- ( pi3k- ) dependent manner .
the silencing of gbf1 in hl-60 cells abrogates cell polarisation , direction sensing , and superoxide production induced by fmlf .
the big ( bfa inhibited gef ) family of arf gefs comprises big1 and big2 in mammals .
big2 has been shown to activate class i arfs ( arf1 and arf3 ) and to localize to the tgn and recycling endosomes [ 103106 ] .
big1 and big2 have redundant functions and are important determinants of arf - based membrane traffic between the tgn and late endosomes .
in addition to lipid binding , the hds1 domain of sec7 , the yeast orthologue of big2/big2 , is important to localize this arf gef to golgi membrane compartments on which arf1 has already been activated . a cascade in which gbf1-activated arf4 and arf5 regulate the recruitment of big1 and big2 to the tgn has been reported .
this study provides a mechanistic basis for the effects of a combination of arf class i and class ii knockdowns on golgi morphology .
although bfa has been reported to inhibit fmlf - mediated production of superoxide in pmns , the bfa sensitive arf gef involved in this effect , if any , has not been characterized .
the psd family of arf gefs , also known as efa6 ( exchange factor for arf6 ) , comprises four paralogs in vertebrates ( efa6a , efa6b , efa6c , and efa6d ) .
efa6 is plasma membrane - targeted through interaction with ptdins(4,5)p2 and f - actin [ 111 , 112 ] .
efa6 is involved in cytoskeletal rearrangement and clathrin - mediated endocytosis [ 112 , 113 ] .
the bfa resistant arf gefs ( brags ) or iqsec family contains three members in vertebrates .
brag1/2 were found associated to endosomes and were found to localize with arf6 at the cell periphery [ 114116 ] .
in addition to arf6 , brag2 was reported to activate arf4 and arf5 and to regulate arf5-dependent internalization of 1 integrins in the clathrin - coated pits .
other studies have shown that brag2 plays a role in cell adhesion and phagocytosis through regulation of integrin trafficking in epithelial cells and monocytes , respectively [ 117 , 118 ] .
other arf family gefs include sec12 , a type ii er membrane protein that is a specific sar1 gef , and the f - box protein 8 gene family ( fbxo8 ) .
fbxo8 might not function as a gef but as a factor that controls the intracellular levels of arf6 protein through ubiquitinylation - mediated proteasomal degradation .
the cytohesin ( cyth ) family is represented by four bfa - insensitive arf gefs in vertebrates .
the structural organization of cyths includes n - terminal coiled - coil domain involved in cyth dimerization or protein - protein interaction , the sec7 domain , and a c - terminal ph domain [ 122 , 123 ] .
the affinity of their ph domain for ptdins(4,5)p2 and phosphatidylinositol 3,4,5-trisphosphate ( ptdins(3,4,5)p3 ) is an important determinant for cyth localization and/or recruitment to the plasma membrane .
studies from our laboratory have reported the expression of cytohesin-2/arno ( cyth-2 ) and cytohesin-3 ( cyth-3 ) in undifferentiated hl-60 or plb-985 cells and a strong induction of cytohesin-1 ( cyth-1 ) expression during granulocytic differentiation [ 20 , 39 ] . in differentiated hl-60 cells ,
stimulation with fmlf induced a pi3k - independent and pi3k - dependent membrane recruitment of cyth-1 and cyth-2 , respectively .
we have previously shown that pharmacological inhibition of cyth-1 with secinh3 inhibited fmlf - mediated membrane translocation of arf6 and arf1 and activation of arf6 in pmns .
studies using secinh3 in pmns and plb-985 cells overexpressing cyth-1 or silenced for arf6 have highlighted a role for the cyth-1-arf6 signalling axis in pld activation and two major bactericidal functions , degranulation and nadph oxidase activity .
furthermore , pharmacological inhibition or silencing of cyth-1 was shown to reduce the internalization of fprl-1 ( formyl - peptide - like receptor 1 ) in fmlf activated granulocytes .
cyth-1 was initially characterized as a positive regulator of the 2 integrin lfa-1 ( lymphocyte function antigen-1 ) functions in lymphocytes [ 4042 ] . in our laboratory
, we showed that overexpression of cyth-1 in plb-985 cells increases lfa-1-dependent adhesion to endothelial cells .
in contrast , plb-985 cells silenced for cyth-1 and pmns treated with secinh3 show decreased lfa-1-dependent adhesion to endothelial cells .
further studies from our laboratory also documented that cyth-1 associates with and restrains the activation of the 2 integrin mac-1 ( macrophage antigen-1 ) , thereby having a negative impact on pmn adhesion to fibrinogen , chemotaxis , and phagocytosis .
altogether , these studies suggest that cyth-1 in pmns differentially regulates the activation of the 2 integrins lfa-1 and mac-1 .
gtpase activating proteins ( gaps ) are proteins that accelerate the intrinsic gtp hydrolysis activity of small g proteins .
the arf gaps contain a characteristic domain of about 130 amino acids , which has been shown to be the minimum unit with gap activity .
the gap domain has a zinc - finger structure that is unique to arf gaps , but similar to other gaps for the ras and rho families of small gtpases , there is a conserved arginine that is essential for the catalytic activity of the so - called arginine finger [ 125 , 126 ] . the human genome is predicted to encode thirty - one proteins containing the arf gap domain .
mammalian arf gaps are selective for one or more arfs but are not active on sar1 or arl proteins .
however , gap selectivity in vivo is likely to depend on the localization of arf gaps and arfs in cells , as well as on composition and shape of lipid bilayer membranes .
in addition to the gap domain , these proteins have a variety of other domains involved in intramolecular , protein - protein , and protein - lipid interactions .
the arf gaps have been classified into two major groups according to the domain structure .
the arfgap1-type with n - terminal gap domain includes the arfgap , smap , adap , and git protein subtypes .
the azap - type with a gap domain in a sandwich between a ph domain and the ankyrin ( ank ) repeat motif comprises asap , acap , agap , and arap subtypes .
arfgap1 contains two motifs termed amphipathic lipid packing sensor ( alps ) that allow binding to liposomes . the alps motifs for golgi localization make arfgap1 activity extremely sensitive to membrane lipid curvature [ 132 , 133 ] .
the primary function attributed to arfgap1 is regulation of copi vesicle biogenesis by stimulating the hydrolysis of gtp bound to golgi arfs [ 124 , 134 ] .
arfgap2 and arfgap3 lack the alps motif of arfgap1 but instead possess dilysine retrieval motifs that confer golgi localization through direct interaction with the copi coat [ 135137 ] .
arfgap2 and arfgap3 are key components of the copi coat lattice and coatomer - induced gap activity may be required for proper vesicle formation [ 135137 ] .
the smap subfamily comprises two members , smap1 and smap2 [ 138 , 139 ] .
smap protein structure includes a clathrin box that binds clathrin heavy chains and regulates the trafficking of clathrin - coated vesicles [ 138 , 139 ] .
smap1 was reported to be an arf6 gap regulating arf6-dependent endocytosis of transferrin and e - cadherin receptors , whereas smap2 was involved in arf1-dependent membrane trafficking between early endosomes and the tgn .
although smap1 and smap2 were initially shown to have distinct functions , the proteins were also reported to interact which each other and to regulate transferrin receptor endocytosis .
there are no reports , as of yet , on the expression of smap proteins in human pmns and in human tumor - derived myeloid cell lines .
though git proteins have no ph domain , their gap activity was reported to be stimulated by ptdins(3,4,5)p3 . git1
interacts with various gpcrs to regulate their endocytosis via the clathrin pathway in a g protein - coupled receptor kinase , -arrestin , and dynamin - dependent manner [ 145 , 146 ] .
it is worth highlighting that git proteins can form complexes with pix , a gef specific for rho gtpases rac2 and cdc42 .
git / pix complexes regulate cdc42/rac - dependent activation of p21-activated kinase 1 ( pak1 ) , a protein involved in microtubule - mediated focal adhesion disassembly .
git2 and a splice variant named git2-short have been characterized , with the expression of the latter being restricted to immune cells .
overexpression of git2-short was reported to cause redistribution of golgi protein -cop , to affect the subcellular localization of paxillin , and to reduce the levels of actin - based fibers .
git2 is expressed in human lymphocytes and/or monocytes , mature pmns , hl-60 promyelocytic leukemia cells , and the rat macrophage cell line raw264 ( figure 2 ) . in pmns obtained from git2-deficient mice ,
git2 deficiency was associated with reduced directional migration to fmlf and enhanced production of superoxide even if nadph oxidase polarization at the leading edge of migrating pmns was lost .
interestingly , the arf gef gbf1 has been suggested to control the activation of arf1 and to target p22phox and git2 to the leading edge of chemotaxing pmns .
more information on the domain structure of asaps can be found elsewhere [ 25 , 127 ] .
asap1 and asap2 have pip2-dependent gap activity and both act on arf1 and arf5 and only weakly on arf6 in vitro .
this is possibly due to intramolecular interaction between the bar and ph domains , which affects gap activity independently of the property of bar domain in mediating association of asap1 with membranes .
although asap1 and asap2 were detected in pmns using proteomic analyses , their subcellular distribution and biological functions remain open questions .
the acap family comprises three members , with acap1 and acap2 being the best characterized .
acap homologs in dictyostelium were shown to affect the actin cytoskeleton and to regulate cytokinesis [ 155 , 156 ] . however , their role in chemotaxis is still unclear [ 154156 ] .
a recent study suggested a role for acap2 in fcr - dependent phagocytosis in macrophages .
polyclonal acap1 antibodies generated in our laboratory detected a protein of about 75 kda in pmns and acap1-gfp overexpressed in rbl-2h3 cells ( figure 3 ) .
but to our knowledge , no one has yet explored the function of this arf gap in pmns .
the three members of the arap subtype have rho gap domain in addition to an arf gap domain with multiple ph domains that recognize ptdins(3,4,5)p3 [ 25 , 127 , 158 ] .
arap1 regulates endocytosis of epidermal growth factor receptor ( egfr ) [ 159 , 160 ] .
receptor internalization requires the interaction of arap1 with multiple proteins such as cin85 and its phosphorylation by src kinase [ 160 , 161 ] .
further investigation is required to assess the impact of phosphorylation and protein - protein interaction on arap1 gap activities .
arap1 also regulated the filamentous - actin ring structure size of circular dorsal ruffles in nih 3t3 cells through an arf1/5-dependent mechanism .
arap2 was shown to regulate focal adhesion dynamics using arf6 . in vitro and in vivo arap3 has been reported to be a specific arf6 gap [ 158 , 164 ] .
arap1 and arap3 were detected in neutrophils using proteomics methods [ 46 , 47 ] .
recent studies using an inducible arap3 ko mouse model suggest that this gap affects 2 integrin functions and several biological responses dependent on integrin activation such as adhesion - dependent ros formation , granule release , and chemotaxis through modulation of rhoa but not of arf6 activation [ 48 , 49 ] . in humans , 11 genes are predicted to encode for agap - type arf gaps , with agap1 and agap2 being the most studied .
agap1/2 have high gap activity toward arf1 and arf5 and weak activity towards arf6 [ 165 , 166 ] .
gap activity is stimulated by ptdins(4,5)p2 and phosphatidic acid as well [ 165 , 166 ] .
the agap2 gene encodes for three protein isoforms ; pike - l and pike - s , which are restricted to brain , whereas pike - a ( agap2 ) is more ubiquitously expressed [ 167 , 168 ] . as shown in figure 4(a ) , purified recombinant agap2 is a very potent arf1 gap .
gap activity is strongly stimulated by ptdins(3)p and ptdins(3,5)p2 , the products of pi3ks ( figure 4(b ) ) .
agap2 was reported to colocalize with ap-1 and transferrin receptors on recycling endosomes , and , together with arf1 , to regulate retrograde trafficking between early endosomes and the tgn [ 166 , 169 ] .
moreover , agap2 plays a role in the signalling pathways and regulates the recycling of 2-adrenergic receptors . during cell migration ,
agap2 was shown to promote focal adhesion disassembly through binding to and stimulation of focal adhesion kinase .
we generated polyclonal agap2 antibodies that detect a protein of about 90 kda in pmns ( figure 5(a ) ) .
the 90 kda protein recovered in 1% np-40 pmn lysates was immunoprecipitated by the agap2 antibody but not by the preimmune serum ( figure 5(b ) ) .
overall , 32 peptides covering 44% of the agap2 amino acid sequence were identified . among these peptides , two were unique to agap2 and there were no signature peptides for agap1 or pike - l ( figure 5(c ) ) . taken together , the data indicate that agap2 , but not agap1 or pike - l , was expressed in pmns .
this work is still in progress , but preliminary observations suggest that agap2 regulates phagocytosis independently of its gap activity .
the adap subfamily includes two structurally related proteins with an arf gap and two ph domains in tandem .
adap1 is a brain specific ptdins(3,4,5)p3-binding protein that functions as an arf6 gap in vivo [ 172 , 173 ] .
adap1 also serves as a scaffold in several signalling pathways through interaction with proteins such as f - actin , the kinesin family protein k1f13b , ran binding protein in microtubule organizing center , -tubulin , and pkc family members to name a few ( reviewed in ) . through interaction with components of the cytoskeleton
, adap1 has been suggested to regulate neuronal actin and vesicle transport along microtubules [ 173 , 175 ] .
adap2 is a gap selective for arf6 that regulates cortical actin formation at the plasma membrane .
adap2 is abundantly expressed in fat , heart , and skeletal muscles and was suggested to play a role in heart development .
the presence of arf proteins including arf1 , arf3 , arf5 , and arf6 has been reported in pmns and/or neutrophil - like cells .
arf1 and arf6 regulate various biological responses through stimulation of the lipid remodelling enzymes pld and pip5-kinase ( table 1 ) .
pharmacological approaches and the use of neutrophil - like cells have permitted the investigation of the role of arf6 in pmn functional responses such as nadph oxidase activity , phagocytosis , and degranulation .
cyth-1 was involved in pld and nadph oxidase activation , degranulation , and regulation of pmn adhesion through the 2 integrins mac-1 and lfa-1 .
gbf1 is part of a signalling pathway coordinating cell polarisation , direction sensing , and superoxide production in response to stimulation with chemoattractants .
there is still fragmentary information available on the biological functions of the various arf gaps expressed by pmns .
the best characterized include git2 , a negative regulator of arf1 , and arap3 , a dual arf and rho gap . whereas git2 is involved in pmn direction sensing and superoxide production , arap3 modulates 2 integrin functions and adhesion - dependent formation of ros , granule content release , and chemotaxis ( table 1 ) .
further studies on the arf gaps recently identified in human pmns ( asap1 , asap2 , acap1 , acap2 , arap1 , adap2 , and agap2 ) are required to understand the significance of these proteins in pmn biology . | polymorphonuclear neutrophils ( pmns ) are key innate immune cells that represent the first line of defence against infection .
they are the first leukocytes to migrate from the blood to injured or infected sites .
this process involves molecular mechanisms that coordinate cell polarization , delivery of receptors , and activation of integrins at the leading edge of migrating pmns . these phagocytes actively engulf microorganisms or form neutrophil extracellular traps ( nets ) to trap and kill pathogens with bactericidal compounds .
association of the nadph oxidase complex at the phagosomal membrane for production of reactive oxygen species ( ros ) and delivery of proteolytic enzymes into the phagosome initiate pathogen killing and removal .
g protein - dependent signalling pathways tightly control pmn functions . in this review , we will focus on the small monomeric gtpases of the arf family and their guanine exchange factors ( gefs ) and gtpase activating proteins ( gaps ) as components of signalling cascades regulating pmn responses .
gefs and gaps are multidomain proteins that control cellular events in time and space through interaction with other proteins and lipids inside the cells .
the number of arf gaps identified in pmns is expanding , and dissecting their functions will provide important insights into the role of these proteins in pmn physiology . | 1. Introduction
2. Arfs
3. Arf GEFs
4. Arf GAPs
5. Concluding Remarks |
the association between chronic viral infection and human malignancy is well established : papillomaviruses are involved in the pathogenesis of human cervical cancer ( dell and gaston 2001 ) , epstein - barr virus has been linked to burkitt 's lymphoma , nasopharyngeal carcinoma , post - transplant lymphoma , hodgkin 's disease , and gastric carcinoma ( thompson and kurzrock 2004 ) ; hepatitis viruses b and c are associated with hepatocellular carcinoma ( monto and wright 2001 ) , simian virus 40 has been linked to mesothelioma ( rizzo et al .
the mechanisms responsible for the malignant transformation in cases of long - lasting viral infection differ according to the particular virus and cancer and have been extensively studied .
an established association between viral infection and cancer may lead the way for development of a vaccine which could prevent both the infection as well as the malignant transformation .
incorporation of viral dna may interfere with the normal sequence of human dna bases , in a genetic manner , or cause secondary epigenetic changes such as gene promoter methylation or histone acetylation .
activation of oncogenes or silencing of tumor suppressor genes may be the result of long lasting inflammation .
these gene products enhance proliferation and inhibit apoptosis and differentiation , driving the cells towards carcinogenesis .
chromosomal instability has been established as the key mechanistic component of cancer development ( fearon and vogelstein 1990 ) .
later , it was found that crc results not only from the progressive accumulation of genetic alteration , but also from epigenetic changes ( lengauer et al .
three main pathways have been described : chromosomal instability ( cin ) , microsatellite instability ( msi ) , and cpg island methylation phenotype ( cimp ; boland and goel 2010 ) .
microsatellite instability is involved in the genesis of about 15% of crcs ( ionov et al . 1993 ; thibodeau et al .
the multiple errors in repetitive dna sequences ( microsatellites ) result from a failure of the dna mismatch repair system to edit errors made during dna replication ( carethers and boland 2003 ) .
this system is inactivated either by hypermethylation of the promoter , which silences gene transcription of hmlh1 ( epigenetic phenomenon in sporadic crc ) , or because of germ - line mutations ( herman et al .
other genes of the mismatch repair family , such as msh2 , msh6 , and pms2 may be inactivated by genetic processes , and cause lynch syndrome .
dna methylation is mediated by dna methyltransferase catalyzing the transfer of a methyl group from methyl donor s - adenosil - methyonine to 5 cytosine postponed by guanine and forming methylcytosine ( lyko et al .
the overall frequency of cpg dinucleotides is relatively low in the human genome and accounts for approximately 1% of total dna bases ( ehrlich et al .
. however , up to 60% of genes have a 5 promoter region with 0.32 kb stretches of dna called cpg island ( bird 1986 ) . the great majority of cpg dinucleotides which are not associated with cpg islands are heavily methylated ; however , cpg dinucleotides in cpg islands of promoter regions are usually unmethylated , whether or not the gene is being transcribed ( antequera and bird 1993 ) .
cancer gene genomes simultaneously show global hypomethylation , specific promoter hypermethylation of tumor suppressor genes , and hypomethylation of oncogenes ( gaudet et al .
in addition to dna methylation , common epigenetic changes in cancer include histone modification by acethylation ( jenuwein and allis 2001 ) .
some of transcription factors can not bind to dna with methylated cpg island to start transcription ( prendergast and ziff 1991 ) . additionally , methylated dna has general effect on chromatin .
mbps are part of complexes containing histone deacetylases that inactivate chromatin configuration around gene and silenced gene expression by exclusion of transcriptional factors ( nan et al .
tumors with high - frequency microsatellite instability tend to be diploid to possess a mucinous histology and to have a surrounding lymphoid reaction .
they are more prevalent in the proximal colon , have a rapid ( 23 years ) progression from adenomatous polyp to cancer , and are insensitive to 5-fluoro - uracil - based chemotherapy .
nevertheless , they are associated with longer survival than stage - matched tumors with microsatellite stability ( lothe et al . 1993 ; gryfe et al . 2000 ; halling et al . 1999 ; thibodeau et al .
deng and colleagues demonstrated that , in crc , regional hypermethylation and global hypomethylation are associated with altered chromatin conformation and histone acetylation , which have a causal correlation with msi and cin , respectively ( deng et al .
msi cancers had closed chromatin conformation and low levels of histone acetylation . gene silencing is mediated by genetic processes , such as mutation , deletion , or insertion of nucleotides or by epigenetic mechanisms such as methylation of the cpg island in a gene promoter by the enzyme dna methyltransferase .
this group of substances may decrease or increase proliferation by silencing oncogenes or tumor suppressor genes . whether cpg island hypermethylation constitutes a mechanism for mirna silencing , and
balaguer and colleagues demonstrated that epigenetic silencing of mir-137 is an early event in colorectal carcinogenesis ( balaguer et al .
some oncoviruses , including jc virus , may initiate carcinogenesis by epigenetic modification of different oncogenes .
jc virus , a small non - enveloped negatively supercoiled 5,130 bp dsdna virus , is a member of the polyomavirus family , which includes bk virus , sv40 , and , recently described , ki virus , wu virus , and mc virus ( white and khalili 2004 ; allander et al .
jcv was first isolated in 1971 from the brain of a patient ( john cunningham ) with hodgkin 's lymphoma who developed progressive multifocal encephalopathy after chemotherapy .
structurally , jcv contains only six genes which encode the t- and t - antigens , three viral capsid proteins ( vp1 - 3 ) , and an agnoprotein involved in viral assembly .
the t - ag takes up over half of the viral genome ( raj et al .
possess neutralizing antibodies to the virus , some 50% of adults shed jcv dna in the urine ( kitamura et al . 1994 ; rossi et al .
1996 ; sabath and major 2002 ) ; however , the viral genome has also been detected in tissue samples from brain , lung , spleen , liver , tonsils , and stomach to colon .
it may act by stabilizing -catenin , facilitating its entrance to the cell nucleus and starting proliferation and cancer formation .
diploid crc cell lines transfected with jcv - containing plasmids developed cin ( niv et al .
this result provided direct experimental evidence for the ability of t - ag to induce cin in the genome of colonic epithelial cells .
the association of hmlh1 promoter methylation and tumor positivity for jc virus in crc was recently documented ( goel et al .
jc virus t - ag dna sequences found in 77% of crcs were associated with promoter methylation of multiple genes ( fig . 1 ) .
hmlh1 was methylated in 25 out of 80 crc patients positive for t - ag ( 31% ) in comparison with only one out of 11 negative cases ( 9% ) .
this observation is somewhat unexpected since , in this case , suppression of dna repair by silencing hmlh1 gene should be sufficient to cause genomic instability and uncontrolled proliferation .
we confirmed this observation in a small sample of israeli patients ( niv et al .
, we looked at both jcv t - ag in the crc tissue and hmlh1 promoter methylation in different ethnic groups in israel with different incidences of crc .
we found 83.3% positivity of the tumors for jcv t - ag , which is very similar to that in previous publications ( laghi et al .
unexpectedly , we demonstrated hmlh1 promoter methylation only in jcv t - ag - positive tumors .
1working hypothesis : jc virus t - ag initiates proliferation through wnt signaling or hypermethylation of hmlh1 working hypothesis : jc virus t - ag initiates proliferation through wnt signaling or hypermethylation of hmlh1 nosho et al .
( 2009 ) , in large study that included 766 patients with sporadic colorectal cancer , investigated the correlation between expression of t - ag in tumor tissue and different molecular alterations ( msi , cimp , cin , loss of heterozygosity of different loci , braf and kras mutation , p53 , b - catenin , cyclin d1 , and cyclooxygenase-2 expression ) . in this study , jcv t - ag was demonstrated in 35% of tumors , but , in contrast to results of goel and colleagues , expression of t - ag was inversely associated with msi and cimp . in multivariate
logistic regression analysis , jcv t - ag expression was independently associated with p53 expression and cin .
( 2008 ) investigated the association between jcv t - ag expression and methylator phenotype in 50 cases of colorectal adenoma .
t - ag expression was demonstrated in 16 ( 32% ) of cases , and the proportion of positive cases increased progressively from unmethylated cases to cimp - low and cimp - high .
an association between methylation and exposure to carcinogens such as viruses has been observed before but has not led to mechanistic insights into the process ( boland et al . 2005 ; shen et al .
human papillomavirus chronic infection is associated with methylation of several genes involved in carcinogenesis such as apc , cdkn2a , pten , and others ( whiteside et al .
similarly , in nasopharyngeal carcinoma associated with epstein - barr virus ( ebv ) , hypermethylation of certain cellular promoters is attributed to the up - regulation of dna methyltransferase1 ( dnmt1 ) by the viral oncoprotein lmp1 via jnk / ap1-signaling ( niller and wolf 2009 ) . the primary molecular abnormality in ebv - associated gastric cancer is global cpg island methylation in the promoter region of many cancer - related genes ( fukayama 2010 ) .
viral latent membrane protein 2a up - regulates cellular dnmt1 through phosphorylation of stat3 and hypermethylation and silencing of the tumor suppressor gene , pten . increased dnmt1 also caused methylation of e - cadherin , hmlh1 , and thbs-1 genes , and
. demonstrated significant alteration in dna methylation patterns that affected the transcription of cellular genes ( doerfler 2009 ) .
foreign dna may cause extensive methylation in cellular genome segments even at loci remote from the site of insertion .
in addition , down - regulation of microrna by viral component can induce aberrant dna methylation by targeting dna methyltransferase 1 , as demonstrated in hepatitis b virus - related hepatocellular carcinoma , in this case , mir-152 ( huang et al .
jc virus can mediate both cin and aberrant methylation in crc . like other viruses , chronic infection with jcv
gene promoter methylation induced by jcv may be an important process in crc and the polyp - carcinoma sequence .
further research in this field is needed , looking at a possible association between hnpcc tumors and jcv , the presence of jcv in normal mucosa of cancer - free patients , association between jcv with prognosis , and survival in crc cases of cin , cimp , and msi pathways . | incorporation of viral dna may interfere with the normal sequence of human dna bases on the genetic level or cause secondary epigenetic changes such as gene promoter methylation or histone acetylation .
colorectal cancer ( crc ) is the second leading cause of cancer mortality in the usa .
chromosomal instability ( cin ) was established as the key mechanism in cancer development .
later , it was found that crc results not only from the progressive accumulation of genetic alterations but also from epigenetic changes .
jc virus ( jcv ) is a candidate etiologic factor in sporadic crc .
it may act by stabilizing -catenin , facilitating its entrance to the cell nucleus , initialing proliferation and cancer development .
diploid crc cell lines transfected with jcv - containing plasmids developed cin .
this result provides direct experimental evidence for the ability of jcv t - ag to induce cin in the genome of colonic epithelial cells .
the association of crc hmlh1 methylation and tumor positivity for jcv was recently documented . jc virus t - ag dna sequences were found in 77% of crcs and are associated with promoter methylation of multiple genes .
hmlh1 was methylated in 25 out of 80 crc patients positive for t - ag ( 31% ) in comparison with only one out of 11 t - ag negative cases ( 9% ) .
thus , jcv can mediate both cin and aberrant methylation in crc .
like other viruses , chronic infection with jcv may induce crc by different mechanisms which should be further investigated .
thus , gene promoter methylation induced by jcv may be an important process in crc and the polyp - carcinoma sequence . | Introduction
Hypermethylation in CRC
JC virus infection and hMLH1 hypermethylation in CRC
Possible mechanisms of epigenetic processes induced by chronic viral infection in cancer
Conclusion |
1 ) . most chimpanzee ascs adopt a fibroblast - like phenotype in vitro ( fig .
1 ) , consistent with previous reports of human ascs ( zuk et al . 2001 ) and with the human ascs profiled in this study ( fig .
when grown to confluence , the chimpanzee ascs migrate on top of one another and appear to exhibit lower levels of contact inhibition than the human ascs ( fig .
2 ) . decreased contact inhibition has been noted in other stem cell populations , such as embryonic stem cells ( burdon et al .
interestingly , small lipid droplets are present in some of the chimpanzee ascs but were not seen in any of the human stromal cells profiled in this study ( fig .
( a ) fluorescence image depicting the nucleus ( blue : dapi ) and the actin filaments ( red : phalloidin ) .
( c ) brightfield image depicting the nucleus ( blue : mayer s hematoxylin ) and lipid droplets ( red : oil red o ) .
the bottom panel contains brightfield images depicting the nucleus ( blue : mayer s hematoxylin ) and lipid droplets ( red : oil red o ) .
( a ) fluorescence image depicting the nucleus ( blue : dapi ) and the actin filaments ( red : phalloidin ) .
( c ) brightfield image depicting the nucleus ( blue : mayer s hematoxylin ) and lipid droplets ( red : oil red o ) .
the bottom panel contains brightfield images depicting the nucleus ( blue : mayer s hematoxylin ) and lipid droplets ( red : oil red o ) .
no lipid droplets were seen in any of the human asc lines . to uncover fundamental properties of the chimpanzee asc transcriptome , rna extracted from the confluent chimpanzee stromal cells ( figs .
approximately 48 million reads were mapped ( 94% of the total ) to the pantro3 chimpanzee genome assembly .
the highest expressed genes in chimpanzee asc overwhelmingly encode extracellular matrix ( ecm ) components ( fig .
this makes sense , as cells of the connective tissue produce , organize , and degrade the ecm . in turn
, the ecm provides organization , strength , and signaling mechanisms for cells of the connective tissue .
the dominance of ecm gene expression we observe in chimpanzee ascs is consistent with a previous study of human ascs ( katz et al .
we also observed that the 10 highest expressed genes in chimpanzee were represented within the top 14 highest expressed genes in humans ( fig .
it is not surprising that genes encoding collagen , the most abundant family of proteins in mammals and primary source of strength and structure in the ecm , represent five of the top ten highest expressed genes ( fig .
highlighted genes have fpkm 100 and the connections that contain a complete ecm - ligand and receptor pair are shown in bold .
highlighted genes have fpkm 100 and the connections that contain a complete ecm - ligand and receptor pair are shown in bold .
we next sought to determine what is unique about the collection of highest expressed chimpanzee asc genes ( fragments per kilobase of transcript per million counted reads [ fpkm ] 100 , n = 614 ) . using database for annotation , visualization and integrated discovery ( david )
receptor interaction kegg pathway as the most enriched pathway when compared with all asc - expressed genes ( p = 2.9e10 , corrected p = 4.1e8 ) and the second most when compared with all of the genes in the genome ( p = 4.4e11 , corrected p = 3.1e9 ) ( huang et al .
receptor interaction pathway is the relationship between structural proteins , including collagen , and / integrins ( fig .
integrins are responsible for mediating a physical and chemical connection between the internal asc cytoskeleton ( actin shown in fig
this connection is necessary for a variety of critical cell behaviors including proliferation , migration , adhesion , differentiation , and apoptosis ( alberts et al .
the particular / heterodimer dictates which ecm ligand(s ) the integrin interacts with ( fig .
, four complete integrin pairings were represented among the highest expressed chimpanzee genes : fibronectin-51 , fibronectin-v1 , osteopontin-v1 , and osteopontin-55 ( fig .
3a ) , binds to other ecm proteins , including collagens ( alberts et al .
2008 ) . as cells of the connective tissue , much of the structure and function of ascs
a hallmark of stem cells is pluripotency , the ability to differentiate into cell types of the three germ layers . although the ability of ascs to self - renew and differentiate into ectodermal lineages in vivo has not been definitively established ( cawthorn et al .
2012 ) , these cells can be used to investigate many different cell types in culture .
we successfully differentiated clint s ascs into mature adipocytes in vitro using a cocktail of adipocyte differentiation media .
4a ) , a marker of mature adipocytes , here visualized by oil red o staining .
although this result does not confirm pluripotency for chimpanzee ascs , it does demonstrate their ability to differentiate into mesodermal lineages .
( a ) brightfield image of adipocytes after 14 days of differentiation depicting the nucleus ( blue : mayer s hematoxylin ) and lipid droplets ( red : oil red o ) .
( b ) schematic of asc differentiation into adipocytes , modified from cawthorn et al .
( c ) relative age of cell lines in this study measured by passage number and estimated population doubling level ( epdl ) .
( a ) brightfield image of adipocytes after 14 days of differentiation depicting the nucleus ( blue : mayer s hematoxylin ) and lipid droplets ( red : oil red o ) .
( b ) schematic of asc differentiation into adipocytes , modified from cawthorn et al .
( c ) relative age of cell lines in this study measured by passage number and estimated population doubling level ( epdl ) .
ascs and preadipocytes ( a slightly more differentiated state ) are members of the white adipose tissue expansion continuum and share many of the same cell surface markers ( fig .
as mentioned earlier , clint s ascs show evidence of lipid accumulations that were not detected in the human cells we profiled ( fig .
these lipid droplets are substantially smaller then those found in clint s differentiated adipocytes ( fig .
three possibilities may explain the presence of lipid droplets in chimpanzee but not human ascs : 1 ) the chimpanzee cells are further differentiated than the human cells , 2 ) an artifact was introduced during collection prior to receipt of the cell lines , or 3 ) these lipids represent a species - specific difference in ascs . to investigate the differentiation state of these cell lines
, we examined the expression of two transcriptional regulators that mark committed preadipocytes in white adipose tissue , ppar and zfp467 ( cawthorn et al .
we found that ppar is expressed at higher level in chimpanzee ascs ( false discovery rate [ fdr]-adjusted p = 0.0316 , log2 fold change = 1.43 ) , whereas zfp467 is not expressed in either chimpanzee or human ascs .
the significantly higher expression levels of ppar in chimpanzee ascs indicates that perhaps this population of cells is more differentiated than human ascs .
it is also consistent with the small lipid droplets present in the chimpanzee ascs , as this transcription factor regulates lipid processing ( neve et al .
however , the absence of zfp467 expression in both species suggests that the story is more complicated .
we also examined a third gene , mmp3 , that encodes a metalloprotease produced by committed preadipocytes ( cawthorn et al .
this gene is expressed at much higher levels in human than chimpanzee ascs and shows the second greatest fold difference between the two species genome - wide ( fdr - adjusted p = 5e09 , log2 fold change = 7.51 ) .
based on these three incongruent expression markers for a limited selection of differentiation markers , it remains unclear where specifically the chimpanzee and human cells lie on the white adipose tissue expansion continuum ( fig .
additional information about the degree of differentiation comes from the estimated population doubling level and passage number , which act as a proxy for cell age .
these are relevant , as the length of time ascs are in culture changes their immunophenotypes ( mitchell et al .
2006 ) , increases senescence ( gruber et al . 2012 ) , and is inversely related to their pluripotency ( katz et al . 2005 ; wall et al .
no substantial species differences in passage number or estimated population doubling level distinguish the cells used in this study ( fig .
4c ) , suggesting that these factors are unlikely to account for the phenotypic difference between species . finally , a species - specific collection bias is also improbable , as the ascs were collected from at least three different institutions and harvested by different investigators . despite widely known differences in asc processing strategies ,
several groups have commented on the consistency in immunophenotype and molecular profiles of ascs across studies ( katz et al . 2005 ; gimble et al . 2007 ) .
therefore , it is unlikely that the approach employed by the scientists and veterinarians who harvested clint s cells was so radically different that they induced a phenotypic change in the asc line .
several differences have been documented in adipose tissue derived mesenchymal stem cells from humans and the nonhuman primate macaca mulatta .
( 2006 ) found that human ascs retained their adipogenic potential longer than those from macaque .
although these results do not directly speak to differences in lipid droplet formation between human and chimpanzee ascs ( no droplets were detected in any of the undifferentiated macaque ascs ) , they do demonstrate that phenotypic differences exist in ascs among primate species ( izadpanah et al .
the lipid droplet difference in ascs reported in the current study could be indicative of biological differences between humans and chimpanzee ascs ( fig .
2 ) , but without more chimpanzee adult stem cell resources , the nature of these differences remains unclear .
in order to find genes that are differentially regulated between human and chimpanzee , we next compared clint s asc transcriptome with three human asc transcriptomes .
the human asc samples yielded on average 44 million reads mapped to hg19 ( 95% of total reads ) .
based on these reads and the chimpanzee reads discussed earlier , we were able to compare 10,021 orthologous genes between species .
as expected , the three human ascs are more similar in expression to each other than any of them are to the chimpanzee asc , with the major axis in a mds plot clearly separating the species and explaining 69.12% of the distance between samples ( fig .
next , we sought to determine which genes distinguish clint s ascs from the human asc samples . at a 5% fdr ( benjamini and hochberg 1995 ) , 679 genes are expressed at significantly higher levels in chimpanzee ascs ( fig .
5b , red ) and 486 genes are expressed at significantly higher levels in human ascs ( fig .
( a ) multidimensional scaling plot of euclidean distances among the four transcriptomes investigated in this study .
( b ) ma - plot where each dot represents a gene and those that are significantly differentially expressed at a fdr - adjusted p < 0.05 are red ( up in chimpanzee ) or blue ( up in human ) . visualizing the normalized asc transcriptomes .
( a ) multidimensional scaling plot of euclidean distances among the four transcriptomes investigated in this study .
( b ) ma - plot where each dot represents a gene and those that are significantly differentially expressed at a fdr - adjusted p < 0.05 are red ( up in chimpanzee ) or blue ( up in human ) . to uncover functional differences between chimpanzee and human ascs
, we interrogated the red ( chimpanzee higher ) and blue ( human higher ) genes in figure 5b using the panther tools database ( mi et al . 2005 ) .
these standard categorical enrichments include gene ontology ( go ) biological processes , go molecular functions , and panther protein classes .
chimpanzee ascs have higher expression for genes involved in immunity ( dark red ) and protein processing ( light red ) , whereas human ascs have higher expression for genes involved in the cell cycle ( dark blue ) and dna processing ( light blue ) ( fig .
strikingly , every one of the broader highlighted categories is distributed perfectly onto either the human or chimpanzee branch ( for instance , all six cell cycle subcategories are enriched on the human branch ) .
the most significant enrichments for the chimpanzee are processes involved in the development and functioning of the immune system , which responds to potential invasive or internal threats ( fig .
a previous study also found that ascs are enriched for immune - related expression when compared with other stem cells populations ( jansen et al .
another complementary category that is enriched in the chimpanzee and significantly depauperate in humans is cytokine activity ( fig .
the chemokines , one class of cytokines , elicit homing behavior in bone marrow stem cells by sensing tissue injury and migrating to the site of damage ( shyu et al .
2006 ) . higher expression of genes involved in immunity and cytokine activity is consistent with anecdotal evidence that both captive and wild chimpanzees have faster epidermal wound healing abilities compared with humans ( hedlund et al .
these results provide a glimpse into the molecular differences underlying the human and chimpanzee condition .
the queried genes include those significantly higher in the chimpanzee ascs ( red in fig .
these were assessed against the background set of all significant asc genes in this study . shown
are the top five most significantly enriched categories for both human and chimpanzee ; italicized categories are not statistically significant for the species they are enriched in .
the sign next to the nominal p value indicates whether the category is enriched ( + ) or depauperate ( ) for the given species . ( a )
go biological process enrichments , ( b ) go molecular function enrichments , and ( c ) panther protein class enrichments .
the queried genes include those significantly higher in the chimpanzee ascs ( red in fig .
these were assessed against the background set of all significant asc genes in this study .
shown are the top five most significantly enriched categories for both human and chimpanzee ; italicized categories are not statistically significant for the species they are enriched in .
the sign next to the nominal p value indicates whether the category is enriched ( + ) or depauperate ( ) for the given species .
( a ) go biological process enrichments , ( b ) go molecular function enrichments , and ( c ) panther protein class enrichments .
recently , the national research council ( national academy of sciences , usa ) reaffirmed the important role of comparative genomic research involving chimpanzees , highlighting numerous insights that have and will likely continue to come from these data ( altevogt et al .
this report set forth two criteria for research involving chimpanzees : 1 ) the studies provide otherwise unattainable insight and 2 ) all experiments are performed on acquiescent animals in a manner that minimizes distress
the majority of comparative genomic research that would use chimpanzee adult stem cells not only meets both of these criteria but also offers the opportunity to significantly expand the number of available approaches for fruitful inquiry . moving forward
, the use of adult stem cells from chimpanzees can complement existing data on the in vivo state of an evolutionarily relevant tissue by providing access to a single cell type from that tissue , where experiments can be carried out in a controlled ex vivo setting .
combined in vivo and ex vivo comparative functional genomic analyses can provide a unique perspective with the potential to uncover novel results that would not otherwise be accessible . moving forward
, adult stem cells promise to transform comparative primate genomics . here , we profiled just one type of adult stem cell , the asc .
the primary nature of ascs makes them especially attractive for experimental and medical applications ( gimble et al .
primary cells are the closest representative of a cell type , as they have been taken directly from the living organism and have not been genetically transformed or reprogrammed .
another type of adult stem cell , the induced pluripotent stem cell ( ipsc ) , offers different advantages for comparative functional studies .
( 2012 ) recently commented on the potential of ipscs for evolutionary genomics approaches , and indeed they may be the most promising source of adult stem cells from chimpanzees . there are established methods for dedifferentiating fibroblasts into ipscs , and several companies have developed kits specifically for this purpose ( takahashi et al .
importantly , a large catalog of chimpanzee fibroblast lines is currently available : the coriell institute alone has 50 , whereas just one chimpanzee asc line exists to our knowledge .
the available chimpanzee fibroblasts are derived from both sexes , providing a window into the effects of biological variation , something the current study was unable to examine .
in addition , ipscs can be passaged many times , providing a steady supply of material .
in contrast , ascs can only be cultured for a few passages before their ability to differentiate is diminished ( wall et al .
2007 ) . obtaining the amount of cells one needs for a complete analysis with ascs
is difficult when working with the chimpanzee , an endangered animal with minimal body fat .
this limitation makes follow - up experiments a challenge when relatively large numbers of cells are needed , as in dnase - seq experiments ( shibata et al .
the toolkit of experimental manipulations available for ex vivo studies is vast and includes physiological and hormonal challenges , targeted gene knock - downs , co - culturing multiple cells , and a variety of environmental manipulations .
responses to these experiments can be assayed through numerous cellular phenotypes , including proliferation and apoptosis rates , migration ability , cell size and shape , organelle content , import and export of specific compounds , and detailed metabolic profiles .
to date , only a tiny fraction of the vast array of informative experimental manipulations and phenotypic assays that are possible using culture systems has been exploited .
6 ) include eliciting an immune response by challenging cells with immunomodulating chemokines and carrying out classic in vitro scratch migration assays .
these experiments could provide molecular insights into the presumed wound healing differences between human and chimpanzees ( hedlund et al .
fish and wildlife service ( 2012 ) as threatened in captivity and endangered in the wild , whereas the international union for conservation of nature considers them as endangered with a declining population ( oates et al .
the idea that cells can be used in this manner is becoming more widely recognized as the utility of frozen zoos is gaining credibility ( ben - nun et al . 2011 ) .
2011 ) created ipsc from two highly endangered species , the northern white rhinoceros and the drill monkey .
the authors expressed the hope that these resources could facilitate the reintroduction of genetic material into the population in the future a prospect that seems increasingly practical with the development of methods for reprogramming adult stem cells into haploid spermatogenic cells ( equizabal et al .
, a recent study found that an endangered primate population contained considerable genetic variation , which could be capitalized on for conservation efforts ( perry et al .
an important opportunity in primate comparative genomics is using adult stem cells to carry out controlled experiments aimed at investigating molecular differences between humans and our closest living relatives . in vivo approaches based on tissue samples have proved valuable and will continue to provide useful information .
however , the ability to work with cell culture systems provides opportunities for functional studies that are otherwise impossible for practical or ethical reasons .
these ex vivo approaches provide a powerful complementary set of experimental tools that will likely become an increasingly important component of primate evolutionary genomics .
adult male ascs from two different species are investigated in this study : one chimpanzee ( s008396 from the coriell institute for biomedical research ) and three humans ( ag19304 and ag20471 from the coriell institute for biomedical research and l040903 from zen - bio ) .
the stromal cells were recovered from cryofreeze in mesenpro rs medium ( invitrogen 12746 - 012 ) supplemented with 200 mm l - glutamine ( invitrogen 25030 - 081 ) and 1% penicillin - streptomycin solution ( invitrogen 15140 - 122 ) .
these cells were allowed to expand to 70% confluency and then were removed using tryple ( invitrogen 12604 - 021 ) and plated at 40,625 cells / cm in 6-well plates ( corningstar 3516 ) .
ascs were cultured for 2448 h until confluent and were then differentiated into adipocytes using zenbio s adipocyte differentiation medium ( dm-2-prf ) and adipocyte maintenance medium ( am-1-prf ) supplemented with 250 m of linoleic acid ( sigma l9530 ) following the differentiation and maintenance protocol ( zbm0001.03 ) .
stromal cells were collected at confluency and rna isolated using qiazol ( qiagen 79306 ) followed by mirneasy mini extraction kit ( qiagen 217004 ) , followed by dnase i treatment .
rna quality was verified using the agilent bioanalyzer 2100 ( minimum rin = 10 ) .
illumina truseq sbs libraries were constructed with 1 g of rna and put through cluster generation .
we used 50 bp , paired - end illumina hiseq sequencing , with all four libraries multiplexed in one lane .
sequencing took place at duke institute for genome sciences & policy s genome sequencing & analysis core resource .
the casava - trimmed reads were mapped to hg19 and pantro3 with tophat v1.4.1 using default settings ( trapnell et al .
the mapped reads were counted with htseq - count 0.5.1p1 using the settings union and strandedness ( http://www-huber.embl.de/users/anders/htseq/doc/count.html , last accessed october 18 , 2013 ) .
gene models for each species were constructed using primate exon orthology database version 2 ( http://giladlab.uchicago.edu/orthoexon/ , last accessed october 18 , 2013 ) .
these models were further filtered using the ensembl database ( http://useast.ensembl.org/index.html , last accessed october 18 , 2013 ) . to remove genes with unclear homologies , we eliminated human chimpanzee homology types one2many and many2many as well as the ribosomal families rpl , rps mrpl , and mrps .
we also removed genes where the original chromosome assignment did not match the ensembl chromosome assignment and where multiple ensembl gene ids were assigned to the same hgnc gene name ( http://www.genenames.org , last accessed october 18 , 2013 ) .
genes with less then five counts per 10 million fragments were removed from every library .
counts were normalized by estimating the tagwise dispersion , and significance was calculated used the program edger 1.6.0 ( robinson et al .
these data are available from the investigators upon request in any standard configuration ( .bam files , raw counts , normalized counts , etc . ) .
to interrogate the highly expressed chimpanzee asc genes ( fpkm 100 , n = 614 ) , we used david v6.7 kegg pathway tool ( huang et al .
both the 10,021 asc genes in this study as well as the entire genome were assessed . when comparing the chimpanzee and human transcriptomes , categorical gene enrichments were calculated with the panther tools gene expression data analysis feature using the compare gene lists function ( http://www.pantherdb.org/tools/ , last accessed october 18 , 2013 ) .
the queried genes are those expressed at a significantly higher level in the chimpanzee asc and those expressed at a significantly higher level in the human asc at an fdr - adjusted p < 0.05 .
these were assessed against the background set of all significant asc - expressed genes in this study . for the florescence imagining , 22 22 mm glass coverslips were coated with fnc mix ( athenaes ) , and cells were plated at 5,263 cells / cm in 6-well plates .
cells were cultured for 24 h , fixed for 10 min with 4% paraformaldehyde ( electron microscopy sciences ) , washed with 1 phosphate - buffered saline ( pbs ) , and stained with tritc - phalloidin ( sigma ) and dapi ( sigma ) , washed with 1 pbs and mounted on slides .
the florescence and black and white images were taken with the zeiss axio observer a1 inverted stand microscope with a zeiss hbo arc lamp and power supply using a hamamatsu orca er digital camera in the light microscopy core facility at duke university .
asc and adipocytes were stained for lipid content using the oil red o stain kit and protocol ( scytek ork-1 ) and imaged prior to confluence and on day 14 of differentiation .
the color images were taken with a leica dm irb microscope using a zeiss axiocam icc1 digital camera .
adult male ascs from two different species are investigated in this study : one chimpanzee ( s008396 from the coriell institute for biomedical research ) and three humans ( ag19304 and ag20471 from the coriell institute for biomedical research and l040903 from zen - bio ) .
the stromal cells were recovered from cryofreeze in mesenpro rs medium ( invitrogen 12746 - 012 ) supplemented with 200 mm l - glutamine ( invitrogen 25030 - 081 ) and 1% penicillin - streptomycin solution ( invitrogen 15140 - 122 ) .
these cells were allowed to expand to 70% confluency and then were removed using tryple ( invitrogen 12604 - 021 ) and plated at 40,625 cells / cm in 6-well plates ( corningstar 3516 ) .
ascs were cultured for 2448 h until confluent and were then differentiated into adipocytes using zenbio s adipocyte differentiation medium ( dm-2-prf ) and adipocyte maintenance medium ( am-1-prf ) supplemented with 250 m of linoleic acid ( sigma l9530 ) following the differentiation and maintenance protocol ( zbm0001.03 ) .
stromal cells were collected at confluency and rna isolated using qiazol ( qiagen 79306 ) followed by mirneasy mini extraction kit ( qiagen 217004 ) , followed by dnase i treatment .
rna quality was verified using the agilent bioanalyzer 2100 ( minimum rin = 10 ) .
illumina truseq sbs libraries were constructed with 1 g of rna and put through cluster generation .
we used 50 bp , paired - end illumina hiseq sequencing , with all four libraries multiplexed in one lane .
sequencing took place at duke institute for genome sciences & policy s genome sequencing & analysis core resource .
the casava - trimmed reads were mapped to hg19 and pantro3 with tophat v1.4.1 using default settings ( trapnell et al .
the mapped reads were counted with htseq - count 0.5.1p1 using the settings union and strandedness ( http://www-huber.embl.de/users/anders/htseq/doc/count.html , last accessed october 18 , 2013 ) .
gene models for each species were constructed using primate exon orthology database version 2 ( http://giladlab.uchicago.edu/orthoexon/ , last accessed october 18 , 2013 ) .
these models were further filtered using the ensembl database ( http://useast.ensembl.org/index.html , last accessed october 18 , 2013 ) . to remove genes with unclear homologies , we eliminated human chimpanzee homology types one2many and many2many as well as the ribosomal families rpl , rps mrpl , and mrps .
we also removed genes where the original chromosome assignment did not match the ensembl chromosome assignment and where multiple ensembl gene ids were assigned to the same hgnc gene name ( http://www.genenames.org , last accessed october 18 , 2013 ) .
genes with less then five counts per 10 million fragments were removed from every library .
counts were normalized by estimating the tagwise dispersion , and significance was calculated used the program edger 1.6.0 ( robinson et al .
these data are available from the investigators upon request in any standard configuration ( .bam files , raw counts , normalized counts , etc . ) . to interrogate the highly expressed chimpanzee asc genes ( fpkm 100 , n = 614 ) , we used david v6.7 kegg pathway tool ( huang et al .
both the 10,021 asc genes in this study as well as the entire genome were assessed . when comparing the chimpanzee and human transcriptomes , categorical gene enrichments were calculated with the panther tools gene expression data analysis feature using the compare gene lists function ( http://www.pantherdb.org/tools/ , last accessed october 18 , 2013 ) .
the queried genes are those expressed at a significantly higher level in the chimpanzee asc and those expressed at a significantly higher level in the human asc at an fdr - adjusted p < 0.05 . these were assessed against the background set of all significant asc - expressed genes in this study .
for the florescence imagining , 22 22 mm glass coverslips were coated with fnc mix ( athenaes ) , and cells were plated at 5,263 cells / cm in 6-well plates .
cells were cultured for 24 h , fixed for 10 min with 4% paraformaldehyde ( electron microscopy sciences ) , washed with 1 phosphate - buffered saline ( pbs ) , and stained with tritc - phalloidin ( sigma ) and dapi ( sigma ) , washed with 1 pbs and mounted on slides .
the florescence and black and white images were taken with the zeiss axio observer a1 inverted stand microscope with a zeiss hbo arc lamp and power supply using a hamamatsu orca er digital camera in the light microscopy core facility at duke university .
asc and adipocytes were stained for lipid content using the oil red o stain kit and protocol ( scytek ork-1 ) and imaged prior to confluence and on day 14 of differentiation .
the color images were taken with a leica dm irb microscope using a zeiss axiocam icc1 digital camera . | comparisons between humans and chimpanzees are essential for understanding traits unique to each species . however , linking important phenotypic differences to underlying molecular changes is often challenging .
the ability to generate , differentiate , and profile adult stem cells provides a powerful but underutilized opportunity to investigate the molecular basis for trait differences between species within specific cell types and in a controlled environment . here
, we characterize adipose stromal cells ( ascs ) from clint , the chimpanzee whose genome was first sequenced . using imaging and rna - seq , we compare the chimpanzee ascs with three comparable human cell lines .
consistent with previous studies on ascs in humans , the chimpanzee cells have fibroblast - like morphology and express genes encoding components of the extracellular matrix at high levels .
differentially expressed genes are enriched for distinct functional classes between species : immunity and protein processing are higher in chimpanzees , whereas cell cycle and dna processing are higher in humans .
although hesitant to draw definitive conclusions from these data given the limited sample size , we wish to stress the opportunities that adult stem cells offer for studying primate evolution .
in particular , adult stem cells provide a powerful means to investigate the profound disease susceptibilities unique to humans and a promising tool for conservation efforts with nonhuman primates . by allowing for experimental perturbations in relevant cell types ,
adult stem cells promise to complement classic comparative primate genomics based on in vivo sampling . | Morphological and Molecular Characterization of Chimpanzee ASCs
Chimpanzee ASC Pluripotency and Differentiation Status
Transcriptomic Differences between Chimpanzee and Human ASCs
Stem Cells Can Greatly Expand the Number of Ex Vivo Models for Comparative Primate Genomics
Materials and Methods
Culturing and Differentiating Stromal Cells
Stromal Cell Transcriptomics
Staining and Imaging |
drug - eluting stents ( des ) have not only improved clinical outcomes compared with bare metal stents ( bms ) , they have vastly enhanced our capability and confidence to tackle increasingly complex patients and lesions traditionally treated with coronary artery bypass graft surgery ( cabg ) [ 13 ] .
this has in turn increased percutaneous coronary interventional ( pci ) procedural volumes worldwide and des use in clinical and angiographic scenarios not initially tested and approved by the u.s .
food and drug administration ( fda ) , otherwise referred to as off - label use .
the result has been justifiable concerns regarding the efficacy and associated risk of des in these situations .
however , these concerns have been continually addressed by carefully collected outcomes analyses from large longitudinal registries , data from randomized controlled trials ( rcts ) , and translational research studies combined with advances in des technology .
importantly , this effort has been a result of unprecedented collaboration between regulatory bodies , industry , and the interventional community . in this review ,
the clinical outcome data of the most recently fda - approved des are critically examined , the resolute zotarolimus - eluting stent ( r - zes , medtronic , inc .
, santa rosa , ca , usa ) , and the unique features of the next iteration of the r - zes built on the integrity platform ( medtronic , inc . , santa rosa , ca , usa ) to further enhance stent flexibility and deliverability , especially in complex lesions
the integrity bms is a new iteration of the driver bms ( medtronic , inc .
, santa rosa , ca , usa ) ; the zotarolimus - eluting version is the resolute integrity stent where integrity bms replaces the driver platform in the new stent .
the integrity stent platform uses a single cobalt chromium wire to form a continuous sinusoidal pattern of crowns and struts wrapped helically around a mandrel with a 0.09 mm strut thickness and a 1.12 mm crossing profile .
this unique manufacturing technology enhances stent flexibility , deliverability , and conformability without sacrificing radial strength .
a study of stent longitudinal distortion tested seven stent platforms including the endeavor driver ( medtronic , inc .
, santa rosa , ca , usa ) , resolute integrity ( medtronic , inc . , santa rosa , ca , usa ) , liberte ( boston scientific , natick , ma , usa ) , omega promus element ( boston scientific , natick , ma , usa ) , multilink 8xience prime ( abbott vascular , santa clara , ca , usa ) , and vision xience v ( abbott vascular , santa clara , ca , usa ) .
the resolute integrity des was more resistant to longitudinal distortion in elongation tests than the omega element or driver stents , and similar to the other stents tested .
the authors note that ideally there must be a balance between stent flexibility and stiffness which has been shown to correlate with the number of connectors between hoops .
the resolute integrity and the driver platform have two connections compared with three for xience v and xience prime stents , but the unique helical single - wire design decreases the longitudinal distortion of the resolute integrity stent thus maintaining a balance between flexibility and longitudinal integrity [ 5 , 6 ] .
radial strength is primarily responsible for creating and maintaining vessel patency and studies have shown it to be an important predictor of clinical performance [ 79 ] .
in - house testing at medtronic has shown equivalence in radial strength between the driver and integrity stents .
performance of the resolute integrity stent platform was compared with five other contemporary stents deployed in an idealized vessel using finite element simulations .
percent malposition of stent struts , defined as the strut distance from the wall > 10 m was least with the resolute integrity platform at 9% and maximal with the promus element stent at 43% .
furthermore , these investigators used finite element analysis correlated with bench testing of radial strength and demonstrated similar radial strength to the promus element stent ( ~0.012 mm / n diameter reduction at given force ) and greater radial strength than the multilink vision ( ~0.16 mm / n ) or xience prime stents ( ~0.018 mm / n diameter reduction ) ( personal communication )
. the r - zes is covered with a proprietary biolinx ( medtronic , inc .
, santa rosa , ca , usa ) tripolymer , a blend of the hydrophilic c19 polymer , polyvinyl pyrrolidinone ( pvp ) and the hydrophobic c10 polymer .
the pvp component results in an overall hydrophilic polymer which enhances the biocompatibility of the stent .
there is an initial release of zotarolimus from the surface of the stent followed by extended drug elution .
nearly 85% of the zotarolimus ( dose density ~1.6 g / mm ) is released by 60 days , and completely by 180 days .
the thin strut , low profile , and continuous sinusoidal design combined with the biocompatible polymer and extended drug release is designed to maximize deliverability and efficacy of this new generation r - zes .
however , the evidence regarding its long - term safety for complex patient subsets also needs to be critically examined . this review will summarize the clinical data for the r - zes and discuss results in the context of complex real - world pci
the pubmed database was used to identify all prospective clinical trials for the r - zes and the everolimus - eluting stent ( ees ) for the past 5 years .
related presentations for the past 2 years were obtained from the transcatheter cardiovascular therapeutics , american college of cardiology , and pcronline websites .
the pubmed database was also searched for preclinical data using a zotarolimus - eluting stent , biolinx polymer , coronary stent design , and coronary stent performance search terms .
the first - in - man r - zes experience ( resolute study ) was a 139 patient , multicenter , prospective study examining 9-month in - stent late loss and target lesion revascularization ( tlr ) in stenotic de novo lesions in coronary vessels with reference vessel diameter between 2.5 and 3.5 mm in diameter and 14 mm to 27 mm in length .
the study required a 4-month angiographic and intra - vascular ultrasound ( ivus ) follow - up in the first 30 patients and a 9-month follow - up in the remainder .
complex patients with recent myocardial infarction , left ventricular ejection fraction ( lvef ) < 30% and ostial , bifurcation , heavily calcified , or left main lesions were excluded .
dual anti - platelet therapy ( dapt ) with aspirin and clopidogrel was prescribed for 6 months post - pci , and aspirin continued indefinitely thereafter .
the 9-month in - stent late lumen loss was 0.22 0.27 mm .
tlr rates at 9 months , 1 , 2 , and 4 years were 0.0% , 0.8% , 1.5% , and 2.3% , respectively . the academic research consortium ( arc)-defined definite and probable stent thrombosis ( st ) events at 4 years remained at 0.0% [ 12 , 13 ] . though this experience was restrictive and may not reflect real - world
des use , it certainly set the best - case reference of r - zes performance .
the results from the single - arm resolute us trial ( r - us ) , which included 1,402 patients with 1- or 2-vessel coronary artery disease from 116 us centers with lesions suitable for 2.254.0 mm r - zes was reported in april 2011 .
though the main analysis was performed on a prespecified group of single - lesion patients treated with 2.53.5 mm r - zes , a 241 patient cohort received the 2.25 mm r - zes or had two lesions treated .
the overall ( 2.254.0 mm ) target lesion failure ( tlf ) rate was 4.7% , and rates of cardiac death , myocardial infarction ( mi ) , and tlr were 0.7% , 1.4% , and 2.8% , respectively . the 12-month rate of st was 0.1% . the resolute all - comers ( r - ac ) trial was an international , multicenter rct including 2,292 patients with an open - label random assignment of a wide variety of unrestricted coronary lesions in a 1:1 fashion to either r - zes or ees .
there were no restrictions on the number of lesions , vessels , or number of implanted stents .
most importantly , 1,520 patients were defined as complex based on prespecified definition , with a well - balanced allocation to r - zes ( 764 patients and 1,227 lesions ) and ees ( 756 patients and 1,242 lesions ) groups .
the definition of complex patients is shown in table 1.table 1prespecified definition of complex patients in resolute all - comers trial
complex patients criteria
( presence of at least one of the following )
acute myocardial infarction within 72 hleft ventricular ejection fraction < 30%renal insufficiency or failure ( serum creatinine 140 mol / l)treatment of bifurcation coronary lesionstreatment of saphenous vein graft lesionstreatment of arterial graft lesionstreatment of in - stent restenosis lesionstreatment of unprotected left main coronary lesionstreatment of 2 coronary vesselstreatment of coronary lesions 27
mm in lengthtreatment of > 1 lesion per coronary vesseltreatment of coronary vessels with presence of thrombustreatment of coronary total occlusions prespecified definition of complex patients in resolute all - comers trial the primary 12-month noninferiority endpoint of tlf , defined as a composite of cardiac death , target vessel mi , and clinically indicated tlr , was met ( r - zes 8.2% vs. ees 8.3% , noninferiority p < 0.001 ) . the mean syntax ( boston scientific , natick , ma , usa ) score was 16.6 9.4 in the complex r - zes patients , compared with 11.2 7.9 in the simple r - zes patients .
patients with recent acute mi , diabetes mellitus ( dm ) , and lvef < 35% constituted 43.5% , 23.1% , and 3.8% of the complex patient cohort , respectively .
bifurcation , left main , saphenous vein graft , and chronic total occlusion pci were performed in 26% , 3.1% , 3.5% , and 25% of complex patients .
overall , tlf was 6.3% and 9.3% ( p = 0.015 ) at 1 year for simple and complex patients , respectively .
similarly , target vessel failure ( tvf ) in the entire study , defined as a composite of cardiac death , target - vessel mi , and clinically indicated target vessel revascularization ( tvr ) was 7.1% and 10.4% ( p = 0.009 ) at 1 year for simple and complex patients , respectively .
a patient oriented 1-year composite endpoint including all cause death , mi , and any repeat revascularization was identified as a secondary clinical endpoint and was also higher for complex patients compared with simple ( 16.1% vs. 11.6% , p = 0.004 ) . definite or probable st occurred in 2.2% of complex patients and in 1.35% of simple patients , with no difference between the r - zes and ees groups ( p value for interaction = 0.14 ) .
prespecified 2-year clinical outcomes of the r - ac trial demonstrated sustained safety and efficacy for the r - zes and ees .
the rates of tlf at 3 years were 13.1% for r - zes and 12.4% for ees ( p = 0.614 ) . additionally , the rates of definite or probable st at 3 years were also low .
rates of definite or probable very late stent thrombosis ( vlst ) were 0.5% for both stents .
dapt use was 84.4 and 83.5% at 1 year for the r - zes and ees groups , respectively ( p = 0.60 ) . the resolute international trial ( r - int ) trial enrolled an unrestricted cohort of 2,349 patients ,
two - thirds of which were complex with at least one r - zes ( 2.254.0 mm stent diameter ) .
nearly 30% of patients were diabetic and 46% presented with an acute coronary syndrome ( acs ) .
the composite primary endpoint of cardiac death and target vessel mi at 1 year was 4.3% .
the pooled resolute clinical program derived from five r - zes studies ( resolute , r - us , r - ac , r - int and resolute japan ) includes 5,130 patients .
the diabetic cohort was older with expectedly more patients with hypertension , hyperlipidemia , or prior pci . at 2 years , clinically - driven tlr was 4.7% and definite or probable st was 0.9% . in a prespecified analysis of less complex patients with dm , 2-year rates of clinically - driven tlr and definite or probable st for patients with dm ( n = 861 ) was 4.8% and 0.3% , respectively ( fig . 1 ) . in the nondiabetic cohort ( n = 1,903 )
these data indicate consistently low event rates and durable clinical outcomes in the higher - risk patients with dm .
based on these data the r - zes is the first des approved by the fda for use in patients with dm.fig .
1two - year event rates for standard - risk patients with diabetes mellitus ( n = 861 ) in the pooled resolute global clinical program st stent thrombosis , tlf target lesion failure , tlr target lesion revascularization , tvf target vessel failure , tvmi target vessel myocardial infarction two - year event rates for standard - risk patients with diabetes mellitus ( n = 861 ) in the pooled resolute global clinical program st stent thrombosis , tlf target lesion failure , tlr target lesion revascularization , tvf target vessel failure , tvmi target vessel myocardial infarction the diabetic population included 29.6% of patients with insulin - dependent dm . at 1 year , event rates were significantly higher in patients with insulin - dependent diabetes mellitus iddm compared with those without dm ( tlr 6.3% vs. 2.9% [ p <
0.001 ] ; cardiac death or mi 6.6% vs. 3.6% [ p = 0.003 ] ; st 1.5% vs. 0.7% [ p = 0.02 ] ) .
the cumulative incidence of tlf , cardiac death , target vessel mi , and tlr was similar for dm patients receiving the r - zes ( 7.8% ) and the ees ( 9.0% ) at 1 year ( p = 0.96 ) ; there was a trend to lower tlf in the non - dm patients ( r - zes 6.1% ; ees 8.3% ; [ p = 0.09 ] ) .
one year outcomes for r - zes and ees dm patients were also similar for rates of tlr , cardiac death or mi , and st . these data also indicate to the strength of the resolute pooled clinical program which was conceptualized using similar event definitions , adjudication , and data management methodology across a myriad of r - zes trials .
it is imperative that data from this large and diverse cohort of patients representing a real - world
patient population will continue to be the source of important data and guide contemporary pci practice worldwide .
stefanini et al . compared the r - zes results from the r - ac rct to other rcts with all comer patients . in the sirolimus - eluting and paclitaxel - eluting stents for coronary revascularization ( sirtax ) trial , 12-month clinically - driven tlr and definite st rate were 8.9% and 1.9% , respectively . in the limus
eluted from a durable versus erodable stent coating ( leaders ) trial , though only a fifth of the patients had angiographic follow - up , clinically - driven tlr and definite st rates were 5.5% and 2.0% at 12 months , respectively .
the randomized controlled trial of everolimus - eluting stents and paclitaxel - eluting stents for coronary revascularization in daily practice ( compare ) trial reported a 1-year clinically driven tlr of 2% and a definite st rate of 0.4% .
the results from the r - zes trials , especially r - ac , compared very favorably with other all - comer studies , while including a much more complex patient population and lesion categories .
a meta - analysis of 76 rcts with 117,762 patient - years of follow - up found considerable variations in the magnitude of long - term tvr rates ( 3961% ) by des type ( zes - r = ees > paclitaxel - eluting stent > zes > bms ) .
overall , there was no long - term increase in death with any of the des . in the r - ac trial ,
r - zes was associated with a higher definite stent thrombosis at 1 year than ees ( 1.2% vs. 0.3% ; [ p = 0.01 ] ) , while definite or probable stent thrombosis at 2 years were 1.9% and 1.0% ( p
= 0.08 ) for r - zes and ees , respectively [ 16 , 18 ] however , in the twente trial , definite or probable st rates for r - zes and ees were 0.9% and 1.2% , respectively ( p = 0.59 ) .
definite st rates were also low ( 0.58% and 0% , respectively [ p = 0.12 ] ) . comparative data of st across r - zes and ees studies is shown in fig . 2 [ 16 , 20 , 25 , 2734 ] .
it is important to note that these data are not based on direct comparisons and on studies not powered for the low frequency st event .
these data suggest a very low risk of st with r - zes and ees stents and the observed differences are caused by chance.fig .
arc definite and probable st at 12 months from 10 real - world clinical trials .
it is important to note that these data are not based on direct comparisons and on studies not powered for the low frequency st event .
arc academic research consortium , compare second - generation everolimus - eluting and paclitaxel - eluting stents in real - life practice , estrofa-2 estudio espanol sobre trombosis de stents farmacoactivos de segunda generacion-2 , isar individualizable drug - eluting stent system to abrogate restenosis , lesson 1 long - term comparison of everolimus - eluting and sirolimus - eluting stents for coronary revascularization , r - int resolute international , risico resolute italian study in all comers , st stent thrombosis stent thrombosis across resolute and everolimus - eluting stent trials . arc definite and probable st at 12 months from 10 real - world clinical trials .
it is important to note that these data are not based on direct comparisons and on studies not powered for the low frequency st event .
arc academic research consortium , compare second - generation everolimus - eluting and paclitaxel - eluting stents in real - life practice , estrofa-2 estudio espanol sobre trombosis de stents farmacoactivos de segunda generacion-2 , isar individualizable drug - eluting stent system to abrogate restenosis , lesson 1 long - term comparison of everolimus - eluting and sirolimus - eluting stents for coronary revascularization , r - int resolute international , risico resolute italian study in all comers , st stent thrombosis patti et al .
reported in a 2008 meta - analysis of nine studies comparing des with bms in dm patients , including 1,141 patients , an in - stent restenosis ( isr ) and tlr rates with bms of 41% and 27% , significantly higher than first generation des isr and tlr rates of 8% and 8% , respectively ( p < 0.0001 for both comparisons ) . in a pooled analysis of ees versus paclitaxel - eluting stent from the spirit and
compare trials , ischemia - driven tlr rates were 6.1% and 5.5% for diabetics in the paclitaxel - eluting and ees recipients , respectively ( p = 0.60 ) ; it was 6.9% and 3.6% , respectively in nondiabetics ( p < 0.0001 ) .
, tvr rates in patients with dm with sirolimus - eluting stent and ees were 10.7% and 6.7% at 18 months , respectively .
while this subgroup analysis was not powered to assess these endpoints , these data support the observation that significant strides have been made with respect to pci outcomes in diabetics with complex coronary artery disease revascularized percutaneously with r - zes .
r - zes use in complex patients and lesions is associated with durable efficacy and safety and represents another generational improvement in des technology , which will undoubtedly enhance patient outcomes post - pci . | the introduction of first - generation drug - eluting stents ( des ) was a major advance in the percutaneous treatment of coronary artery disease , with des significantly reducing the incidence of restenosis and major adverse coronary events compared with bare metal stents .
next - generation des now utilizes lower profiles , thinner struts , and other technological advances to help extend their safety and efficacy .
importantly , studies of next - generation devices have now gone beyond controlled clinical trials with selected populations to registries and studies with all - comer populations , where more diverse and complex sets of patients and lesions have been managed .
thus , a large body of evidence and comparative data about the safety and efficacy of these devices has accumulated .
the resolute zotarolimus - eluting stent ( r - zes ; medtronic inc . , santa rosa , ca , usa ) is a next - generation des that uses a novel biocompatible polymer on a cobalt alloy stent platform to extend the duration of drug elution and improve the stent s efficacy .
the integrity platform ( medtronic , inc .
, santa rosa , ca , usa ) used in the most recent iteration of the r - zes stent further enhances the flexibility and deliverability of the stent in complex lesions by incorporation of a continuous sinusoidal design . in the following review ,
the clinical data is critically examined for the r - zes and discuss its performance using comparative data currently available for next - generation des .
it is concluded that r - zes use in complex patients and lesions is associated with durable efficacy and safety and represents another generational improvement in des technology , which undoubtedly will enhance patient outcomes postpercutaneous coronary interventional . | Introduction
R-Zes
Methods
R-Zes Clinical Studies
R-Zes Results In Perspective
Conclusion |
renal trauma occurs in approximately 1 - 5% of all injuries . the kidney is considered to be the most commonly damaged organ of the urinary system with the male to female ratio being 3:1 [ 2 , 3 , 4 ] .
blunt kidney trauma ( bkt ) occurs more often than penetrating trauma , being 9 times more common .
generally , renal injuries are mild and can be managed conservatively ; although blunt kidney trauma can be life threatening and requires urgent open surgery .
kidney damage usually manifests as an urgent accident for both the urologist and the patient , which requires an immediate decision about the treatment option .
recent advances in the imaging and more precise staging of trauma , as well as in the available treatment options , have decreased the need for surgical intervention and increased the percentage of kidney preservation . during the few last decades
, numerous papers have been published that analyze the indications and advantages of minimally invasive treatment in patients with bkt .
therefore , we aimed to analyze our own experiences of selective renal artery embolization in bkt patients and compare the obtained results with other investigations on the topic .
we retrospectively analyzed the medical and technical outcomes of selective renal artery embolization ( rae ) in 20 patients with grades ii - iv blunt kidney traumas .
, we used the american association for the surgery of trauma ( aast ) classification .
iv according to aast classification;hemodynamic stability;gross hematuria that was not able to be stopped conservatively .
presence of bkt grades ii iv according to aast classification ; hemodynamic stability ; gross hematuria that was not able to be stopped conservatively .
rae sessions consisted of the following steps . at first , a catheter was inserted transfemorally into the renal artery close to the ruptured branch ( figure 1 ) .
then an angiography was performed with a 5-f cobra catheter transfemorally ( figure 2 ) .
after localization of the origin of bleeding , we moved the catheter with a steerable 0.035-inch guide wire ( cook ; cordis ) more distally to the bleeding vessel .
after that , a 3-f superselective coaxial catheter ( terumo ) was introduced coaxially into the proximity of the vessel 's rupture and an embolization was performed ( figure 3 ) .
embolization and the preparing of the active solution were performed according to generally approved principles . for embolization
, we used polyvinyl alcohol ( pva ) particles sized 250350 m ( contour ; boston scientific ) in 14 patients and gelaspon granules in 6 patients .
the particles were prepared by mixing them with contrast material , usually by adding 5 ml of contrast to the 2- to 5-ml prefilled saline . then the air was carefully removed and the syringe was gently inverted several times .
then , using a three - way stopcock attached to a smaller 1- to 5-ml syringe , the solution was further mixed .
the smaller syringe was used to inject small aliquots of the particles under careful fluoroscopic guidance keeping in mind that constant agitation and remixing of the agent is very important to prevent particle aggregation .
a higher - contrast material concentration usually results in precipitation of the particles with a higher tendency to conglomerate and form clusters .
that is why the solution tends to become more stable with time , and premixing several minutes in advance was important .
the endpoints that have to be achieved were technical and medical successes of the procedure .
technical success of the embolization session was defined as the complete and irreversible occlusion of renovascular bleedings with arterial occlusion as registered with arterial angiography at the end of the rae ( figure 4 . ) final image of arterial angiography at the end of the rae with pointing of devascularized area .
medical success was defined by the cessation of gross hematuria up to the 3 day after rae as well as the absence of : recurrent hematuria and need for erythrocyte administration;recurrent decrease of hemoglobin by more than 1.5 g / dl ( 15 g / l);necessity for angiographic reembolization or subsequent open surgery .
recurrent hematuria and need for erythrocyte administration ; recurrent decrease of hemoglobin by more than 1.5 g / dl ( 15
complications of rae also were divided into technical and medical , short term ( during first 30 days ) and long - term ( after 30 day from rae session ) . to evaluate renal function we used radioisotope renography with 131-iodine labelled sodium ortho - iodohippurate ( hippuran ) that was performed 3 , 6 and 12 months after rae session in all patients and
the following parameters were measured from renogram curves : the time interval from injection to the peak of the tracing ( tmax);the time interval from injection to the point where the curve decays to 50% of the maximum ( t1/2 ) ;
the time interval from injection to the peak of the tracing ( tmax ) ; the time interval from injection to the point where the curve decays to 50% of the maximum ( t1/2 ) ; the normal range of ( tmax ) was considered from 2.5 to 5.5 min , and the normal range of ( t1/2 ) from 8.2 to 9.9 min .the renograms were considered normal if they were within these limits and abnormal if outside .
differences in the distribution of continuous variables were described in terms of the mean standard deviation ( m sd ) and assessed for statistical significance using student 's t test . results were considered significant if the two - tailed p - value was less than 0.05 .
according to the aast classification , grade ii blunt kidney injury was registered at 2 ( 10.0% ) pts , grade iii at 11 ( 55.0% ) pts and grade iv at 7 ( 35.0% ) pts .
together with flank pain and local swelling , a gross hematuria following trauma was the leading symptom in all patients .
the sessions of embolization lasted 54.6 3.8 minutes , and the mean term of hospitalization was 9.8 1.2 days . in all patients ,
the bleeding was stopped with the embolization procedure that was registered by arterial angiography at the end of the rae session .
eighteen ( 90.0% ) patients were treated in a single interventional session with clear urine within 13 days after the procedure .
reembolization , stipulated by repeated gross hematuria in a short - term post - session period on the second and third day after rae . among our patients , the following technical complications of rae were registered : accidental embolization of unruptured arterial branches of vascularised territories as a consequence;puncture - site bleeding .
accidental embolization of unruptured arterial branches of vascularised territories as a consequence ; puncture - site bleeding .
medical complications were classified as short - term ( i.e. , registered up to the 30th day after the rae ) or delayed ( i.e. , registered after 30 day from rae performing ) .
short - term complications included : postembolization syndrome ( i.e. , back pain and fever not registered before);decrease in renal function ( defined as serum creatinine levels 130 mol / l);arterial hypertension;repeated persistent gross hematuria .
postembolization syndrome ( i.e. , back pain and fever not registered before ) ; decrease in renal function ( defined as serum creatinine levels 130
arterial hypertension ; decrease in renal function ; observed medical and technical complications of rae in our patients complications are systematized in the table 1
. medical and technical complications of rae as presented in table 1 , 15 events of rae complications were registered .
pointed events were registered in 5 ( 25% ) patients : two or more complications were often combined in each individual case .
for example , in a 35-year - old male with grade iv blunt kidney trauma , an accidental , undesirable embolization of unruptured arteria was performed during the rae session , followed by postembolization syndrome and decrease in renal function and arterial hypertension . in another 37-year - old female with grade iii blunt kidney trauma ,
one day after complete embolization , postembolization syndrome manifested ; 3 days after the rae session , persistent gross hematuria occurred , that caused reembolization accompanied with repeated puncture - site bleeding and was followed by long - term decrease in renal function . in general , our results demonstrate perspectives of minimally invasive treatment in patients with kidney injury , complicated by intensive gross hematuria .
complications that have been registered did not seriously influence postoperative management and were corrected conservatively .
table 2 presents means of tmax and t1/2 that were calculated after radioisotope renography performed in damaged kidneys at 3 , 6 and 12 months after rae sessions .
means of tmax and t1/2 in damaged kidneys calculated after radioisotope renography as it was shown in table 2 , function in damaged kidneys was preserved at the 3 month after rae sessions .
however , means of tmax and t1/2 in damaged kidneys were considered as abnormal because they differed from normal limits . after 6 and 12 months , reducing means of tmax and t1/2 were registered with a tendency towards normalizing .
the presented study aimed to analyze the efficacy and safety of selective renal artery embolization in patients with blunt kidney injuries based on own and other researchers experiences .
breyer et al . in 2008 reported about their experience of rae performed in 26 patients with acute renal hemorrhage as a consequence of kidney injury ( 10 of them
the authors noted that embolization proved effective for grade 4 blunt renal trauma for which conservative therapy failed .
accordingly to researchers , rae indications include cases of kidney injury with : persistent gross hematuria , inefficacy of conservative treatment aimed at blood pressure stabilization ; increasing perirenal hematoma , renal parenchyma ruptures , renal arterio - venous fistulas or pseudoaneurism formation . in the authors experiences , minimally invasive treatment failed in all grade 5 acute renal injuries ( 100% ) caused by external trauma .
the rae could be used successfully even in the cases of anatomically abnormal kidney injury .
molina escudero r. et al . in 2012 reported about effective use of selective embolization by means of arteriography of a branch of the right renal artery and placement of a double j stent due to urinary extravasation in the lower left horseshoe kidney pole . in 2009
lin et al . in 2013 suggested that contrast extravasation , changing of perirenal hematoma rim distance and the extent of hematoma could be considered as simple and sensitive indicators of patients with kidney trauma for minimally invasive treatment .
. however , presently there is no consensus to predict or exclude an indication of kidney angioembolization with a computed tomography ( ct ) scan .
charbit et al . in 2011 concluded that none of the ct criteria had a strong negative predictive value for the outcomes of renal embolization .
they presented their experience of the successful use of nephron sparing selective arterial cessation associated with a perirenal hematoma rim distance < 25 mm as an indication to exclude embolization . except for hemorrhage cessation ,
one more positive feature of rae is able to preserve damaged kidney function . as chatziioannou et al . in 2004
considered , super selective embolization resulted in permanent cessation of bleeding as well as preventing serious parenchymal infarction and allowed serum creatinine levels in patients to return to the pre - bleeding values .
morita et al . in 2013 suggested that the function of the injured kidney could be preserved in the majority of patients with grade iv blunt renal trauma that indicated the efficacy of embolization in such cases .
heyns & stellmacher in 2005 concluded that the reduction of kidney function occurs even after successful selective renal artery embolization in 50% of cases .
huber et al . in 2011 reported about the high percentage of re - embolization in patients with posttraumatic renal hemorrhage as well as the necessity of nephrectomy when embolisation failed .
embolization was performed in 19 out of 21 patients with posttraumatic kidney bleeding and hemoglobin decrease of more than 2 gm / dl .
the primary clinical success was observed in 12 ( 63% ) patients , including 2 cases with grade v parenchymal injury . in the cases when primary treatment failed ,
it resulted in clinical success in 4 out of 6 patients ( 67% ) with equal efficiency ( p = 1 ) .
three patients ( 16% ) who could not be sufficiently treated with transarterial embolization underwent nephrectomy . according to yanagi et al . , 2013 , in patients with type
iii renal injury classified by the japanese association for the surgery of trauma staging system , transcatheter arterial embolization could be an effective method of choice .
sixteen patients were treated successfully with transcatheter arterial embolization in the 2 hospitals , and 15 of them were classified as type iii renal injury .
thus , the authors believe that nephrectomy should be avoided in such patients because of the benefits offered by embolization [ 22 , 23 ] .
hemodynamically stable patients with a grade iv or v bri could be safely managed without operation as van der wilden gm et al . concluded in 2013 .
the authors compared treatment outcomes in 206 patients ; 52 ( 25.2% ) of them were operated on immediately , and 154 ( 74.8% ) were managed conservatively ( with the assistance of angiographic embolization for 25 patients ) . by multivariate analysis ,
the authors identified two independent predictors of non - operative treatment failure : age over 55 years and a road traffic crash as the mechanism of injury .
when both risk factors were present , non - operative treatment failure occurred for 27.3% of the patients ; when both were absent there were no conservative management failures .
the renal salvage rate was 76.2% for the entire population and 90.3% among patients selected for non - operative management .
rao et al . in 2014 concluded that superselective transcatheter renal artery embolization is a highly effective , minimally invasive therapy for the treatment of non - iatrogenic bkt iii - v grade hemorrhages . in the presented series
, there was only one patient who died of cerebral trauma 3 days after the minimally invasive treatment , although his macroscopic hematuria had disappeared at that time . in table 3
studies of rae efficacy and success rates n number of patients as presented in table 3 , rae performed in patients with bkt grades ii - v ensures high renal salvage rates ranging from 90.3 to 100% . according our data ,
thus , our presented results and the researches of numerous authors demonstrate the proved efficacy of selective renal artery embolization in hemodynamically stable bkt patients . we considered that indications to perform rae are the presence of blunt kidney trauma grades ii - iv , combined with a gross hematuria that can not be stopped conservatively .
the absolute advantage of minimally invasive treatment could be considered the preserving of damaged kidney function .
the unanswered question at the present time is the efficacy of rae in grade v kidney injuries .
, 2008 that the majority of these patients should be treated operatively because of the trauma 's high severity and emergency .
randomized prospective multicenter trials are necessary to define the real value of rae in patients with bkt ; however , keeping in mind the strict inclusion criteria , this aim is very difficult to realize .
rae is an effective , minimally invasive treatment of blunt kidney injury accompanied with gross hematuria that stopped kidney bleeding .
complications of rae were registered in 25% of our patients , two or more complications may present simultaneously in one patient . | introductionthe ren is considered as the most commonly damaged genitourinary organ . in general ,
blunt kidney traumas ( bkt ) are mild and can be managed conservatively .
we aimed to analyze our own experiences of selective renal artery embolization ( rae ) in bkt patients and compare obtained results with other reports.material and methodswe analyzed the medical and technical outcomes of rae in 20 patients with grades ii - iv blunt kidney traumas .
indications for rae were blunt kidney trauma combined with a gross hematuria that could not be stopped conservatively . for evaluating the functioning of kidneys we used radioisotope renography.resultsaccording to the american association for the surgery of trauma classification ,
grade ii blunt kidney injury was registered at 2 ( 10.0% ) pts , grade iii at 11 ( 55.0% ) pts and grade iv at 7 ( 35.0% ) pts . in all patients ,
the bleeding was stopped with the embolization procedure .
18 ( 90.0% ) patients were treated in a single interventional session and 2 ( 10.0% ) needed further intervention .
different complications were registered as 5 ( 25% ) pts : two or more complications were often combined in each individual case .
the function in damaged kidneys was preserved at the 3rd month after rae sessions.conclusionsrae is an effective , minimally invasive treatment for blunt kidney injury that ensures the cessation of gross hematuria and kidney function preserving . | INTRODUCTION
MATERIAL AND METHODS
RESULTS
DISCUSSION
CONCLUSIONS
CONFLICTS OF INTEREST |
chronic ischemic heart disease ( cihd ) is characterized as reduced blood supply to the heart muscle due to plaque building up along the inner walls of the arteries of the heart .
cihd is a major cause of morbidity and mortality in developed countries and in some of the emerging countries . although the application of medical therapy and coronary artery revascularization techniques ( e.g. , coronary artery bypass grafting [ cabg ] and percutaneous coronary intervention [ pci ] ) have improved clinical outcomes , cihd is still a leading cause of angina and congestive heart failure refractory to traditional therapies .
optimal therapies for this disease should achieve clinical improvement of cardiac function by realizing myocardial regeneration and revascularization , without severe adverse effects . therefore , stem / progenitor cells - based cell therapy has great potential due to the ability to self - renew and to differentiate into specialized cells .
since 2001 , transplantation of bone marrow - derived cells ( bmcs ) , either by intracoronary or intramyocardial route , has been tested as a therapy for myocardial infarction and other ischemic heart disease due to their multipotent , autologous origin and readily usable features .
a number of studies were launched to evaluate the effect of this therapy and some reported improved left ventricular ejection fraction ( lvef ) and exercise capacity in patients with myocardial infarction or other coronary artery diseases .
initial meta - analysis also demonstrated the safety and beneficial effects of intracoronary bmc therapy .
however , due to small sample size of the trials , the exact efficacy of bmc therapy for patients with cihd is still unclear .
in addition , previous meta - analyses also found significant heterogeneity of trials included and conflicting results [ 1113 ] .
thus , it is necessary to integrate results of the latest clinical trials to perform an updated meta - analysis .
the aim of this meta - analysis was to make an updated assessment of efficacy and safety of autologous transplantation of bmcs for patients with cihd .
this meta - analysis generally followed the preferred reporting item for systematic reviews and meta - analyses ( prisma ) guidelines .
relevant studies focusing on bmc transplantation in patients with cihd were retrieved from pubmed , ovid , embase , the cochrane library and clinicaltrials.gov from january 2000 to april 2014 . the subject terms and free - text terms used for this study were : bone marrow cell , bone marrow mononuclear cell , stem cell , stromal cell , coronary artery disease , ischemic cardiomyopathy , ischemic heart disease , heart failure , myocardial ischemia , and myocardial infarction .
introduction and reference lists of included trials were manually searched to identify additional qualified studies .
studies included for meta - analysis had to meet all of the following criteria simultaneously : ( 1 ) randomized controlled trial ( rct ) based on patients with chronic ischemic heart disease ( cihd ) ; ( 2 ) cell therapy was autologous bmcs - based ; ( 3 ) patients in the control arm received standard therapy ; and ( 4 ) follow - up was at least 3 months .
exclusion criteria were : ( 1 ) studies provided patients cell precursors mobilized by cytokines due to the additional effect of cytokine myocardium and bmcs . in this study , chid was defined as chronic coronary total occlusion , stable angina , refractory angina , myocardial ischemia , historical myocardial infarction , or patients with previous revascularization .
two authors ( cx and sz ) independently assessed eligibility of studies and extracted data from original studies .
the following information was extracted from original studies : first author , year of publication , number of patients recruited , basic information of patients ( age , sex , and nyha classification ) , clinical scenario , duration of follow - up , type and number of cells transplanted , route of delivery , and imaging modality .
the outcomes of lv function and remodeling primary endpoint - left ventricular ejection fraction ( lvef ) and secondary endpoints - net changes in left ventricular end - systolic volume ( lvesv ) , and left ventricular end - diastolic volume ( lvedv ) were extracted for further meta - analysis . for studies that reported primary or secondary endpoints measured by various imaging modalities
data on the major adverse effects were extracted for assessing the safety of bmcs transplantation for cihd patients .
the methodological quality of included studies was assessed according to the method proposed by juni et al .
the major quality components were : adequate method to generate randomized sequence , adequate method of allocation concealment , blinding of outcome assessors , loss of participant follow - up ( % ) , and all patients treated in assigned group .
revman 5.2 ( cochrane collaboration ) software was used for data analysis . to guarantee uniformity of outcomes , when multiple measurements of the change of primary and secondary endpoint from baseline to follow - up were available , 6-month data were obtained and used for further pooled analysis .
if original data did not provide the changes in mean and sd form , the estimation method recommended by the cochrane handbook for systematic reviews of interventions 16.1.3 was used ( version 5.1.0 , the cochrane collaboration , 2011 ) .
results are summarized in the form of weighted mean difference ( wmd ) with 95% confidence intervals ( cis ) .
heterogeneity between trials was assessed using chi - square test ( ) and i statistics .
if no significant clinical heterogeneity was observed , the random effects model based on mantel - haenszel method was used to make estimates .
subgroup analysis was also performed according to type of cells ( bmmncs or mcss ) , the route of cell delivery ( i m or ic ) , and above or below average lvef level ( < 35.5% or 35.5% ) .
this meta - analysis generally followed the preferred reporting item for systematic reviews and meta - analyses ( prisma ) guidelines .
relevant studies focusing on bmc transplantation in patients with cihd were retrieved from pubmed , ovid , embase , the cochrane library and clinicaltrials.gov from january 2000 to april 2014 . the subject terms and free - text terms used for this study were : bone marrow cell , bone marrow mononuclear cell , stem cell , stromal cell , coronary artery disease , ischemic cardiomyopathy , ischemic heart disease , heart failure , myocardial ischemia , and myocardial infarction .
introduction and reference lists of included trials were manually searched to identify additional qualified studies .
studies included for meta - analysis had to meet all of the following criteria simultaneously : ( 1 ) randomized controlled trial ( rct ) based on patients with chronic ischemic heart disease ( cihd ) ; ( 2 ) cell therapy was autologous bmcs - based ; ( 3 ) patients in the control arm received standard therapy ; and ( 4 ) follow - up was at least 3 months .
exclusion criteria were : ( 1 ) studies provided patients cell precursors mobilized by cytokines due to the additional effect of cytokine myocardium and bmcs . in this study , chid was defined as chronic coronary total occlusion , stable angina , refractory angina , myocardial ischemia , historical myocardial infarction , or patients with previous revascularization .
two authors ( cx and sz ) independently assessed eligibility of studies and extracted data from original studies .
the following information was extracted from original studies : first author , year of publication , number of patients recruited , basic information of patients ( age , sex , and nyha classification ) , clinical scenario , duration of follow - up , type and number of cells transplanted , route of delivery , and imaging modality .
the outcomes of lv function and remodeling primary endpoint - left ventricular ejection fraction ( lvef ) and secondary endpoints - net changes in left ventricular end - systolic volume ( lvesv ) , and left ventricular end - diastolic volume ( lvedv ) were extracted for further meta - analysis . for studies that reported primary or secondary endpoints measured by various imaging modalities
data on the major adverse effects were extracted for assessing the safety of bmcs transplantation for cihd patients .
the methodological quality of included studies was assessed according to the method proposed by juni et al .
the major quality components were : adequate method to generate randomized sequence , adequate method of allocation concealment , blinding of outcome assessors , loss of participant follow - up ( % ) , and all patients treated in assigned group .
revman 5.2 ( cochrane collaboration ) software was used for data analysis . to guarantee uniformity of outcomes , when multiple measurements of the change of primary and secondary endpoint from baseline to follow - up were available , 6-month data were obtained and used for further pooled analysis .
if original data did not provide the changes in mean and sd form , the estimation method recommended by the cochrane handbook for systematic reviews of interventions 16.1.3 was used ( version 5.1.0 , the cochrane collaboration , 2011 ) .
results are summarized in the form of weighted mean difference ( wmd ) with 95% confidence intervals ( cis ) .
heterogeneity between trials was assessed using chi - square test ( ) and i statistics .
if no significant clinical heterogeneity was observed , the random effects model based on mantel - haenszel method was used to make estimates . otherwise , descriptive analysis was performed .
subgroup analysis was also performed according to type of cells ( bmmncs or mcss ) , the route of cell delivery ( i m or ic ) , and above or below average lvef level ( < 35.5% or 35.5% ) .
initial retrieval yielded 1731 references , among which 1688 were excluded after reviewing the title and/or abstract .
the remaining 43 trials were reviewed in detail for assessing eligibility . among them , 11 were excluded due to non - rct , 3 were excluded due to use of precursors mobilized by cytokine , 3 were excluded due to use of blood - derived stem cells , and 6 were excluded because lvef data was not reported .
finally , a total of 20 trials were included for meta - analysis [ 6,9,10,1632 ] .
all of the trials had relatively small sample size , with number of patients ranging from 14 to 109 .
a total of 453 patients were included in the cell therapy groups and 322 patients were included in the control groups . all trials recruited patients with cihd , including chronic coronary total occlusion , refractory angina , ischemic heart failure , and chronic myocardial infarction .
twelve studies used pci or cabg as the control method for revascularization and 8 studies recruited patients unsuitable for revascularization .
the autologous bmcs , including both bmmncs and mcss , were delivered either directly through intramyocardial or intracoronary approach .
mean patient age in the intervention groups was 61.03.3 and in the control groups was 61.23.3 ( p=0.88 ) , suggesting adequate match .
the roughly symmetrical distribution pattern suggested there was no significant publication bias ( supplement figure 2 ) .
generally , the quality of trials included was good . according to the modified jadad score ,
there was no significant difference in patient characteristics between cell therapy and standard therapy groups .
all of the trials were randomized , but 6 studies did not report the method of generating a randomized sequence and 6 did not give concealing allocation method .
eighteen studies had both blinded patients and practitioners and 2 studies had only blinded patients .
eighteen studies had loss of follow - up rate under 15% and 2 were over this level . the primary and secondary outcome ( lvef , lvedv , and lvesv )
compared with standard treatment , bmc transplantation significantly improved lvef in patients with revascularization ( 3.35% , 95%ci 0.72% to 5.97% , p=0.01 ; i=85% ) and in patients without revascularization ( 3.05% , 95% ci 0.65% to 5.45% , p=0.01 ; i=86% ) .
lvef improvement was similar in these 2 groups ( p=0.87 ) ( figure 1 ) .
compared with control , bmc transplantation was associated with moderately decreased lvesv in patients with revascularization ( 5.88 ml , 95% ci , 12.66 ml to 0.91 ml , p=0.09 ; i=51% ) and significantly decreased in patients without revascularization ( 11.75 ml , 95% ci 17.81 ml to 5.69 ml , p=0.0001 ; i=81% ) ( figure 2 ) .
no significant difference in lvesv decrease was observed between these 2 groups ( p=0.21 ) ( figure 2 ) .
in addition , a significant trend of decreased lvedv was only observed in patients receiving only cell therapy ( 7.80 ml , 95% ci 15.31 ml to 0.29 ml , p=0.04 ; i=39% ) , but not in patients receiving combination of cell therapy and revascularization ( 7.30 , 95% ci 17.68 ml to 3.09 ml , p=0.17 ; i=57% ) .
however , the difference between these 2 groups was not significant ( p=0.94 ) ( figure 3 ) . due to significant heterogeneity observed within groups with or without revascularization ,
subgroup analysis was performed to explore whether the type of revascularization intervention ( cabg or pci ) , the type of cell delivered , and the level of baseline lvef influenced the efficacy of cell therapy .
compared with lvef improvement in intracoronary route ( 1.00% , 95% ci 0.11% to 2.10% ) , the improvement in intramyocardial delivery was significantly higher ( 4.77% , 95% ci 4.11% to 5.44% ) ( p<0.00001 ) ( table 1 ) .
however , no significant difference was observed in lvesv and lvedv ( p=0.68 and p=0.64 , respectively ) . when comparing the effect of cell type transplanted on lv function improvement , it was observed lvef improvement was significantly higher in the bmmncs group ( 4.33% , 95% ci 3.69% to 4.96% ) than in the mcss group ( 1.32% , 95% ci 0.00% to 2.65% ) ( p<0.00001 ) ( table 1 ) .
however , lvesv decrease was more evident in the mcss group ( 15.69 ml , 95% ci 17.87 ml to 13.52 ml ) than in the bmnncs group ( 8.51 ml , 95% ci 14.28 ml to 2.74 ml ) ( p=0.02 ) .
lvef increase was significantly higher in the group with higher than average lvef ( 5.11% , 95% ci 4.36% to 5.86% ) than the group with lower than average lvef ( 1.93% , 95% ci , 1.05% to 2.81% ) ( p<0.00001 ) .
changes in lvesv and lvedv were similar in these 2 groups ( p=0.23 and p=0.32 , respectively ) ( table 1 ) .
major adverse cardiovascular events reported in original studies were pooled to assess the safety of bmc transplantation ( table 2 ) .
generally , compared with control , bmc transplantation had a similar risk ratio in ventricular arrhythmia , recurrent myocardial infarction , and cerebrovascular accident as control in subgroups both with and without revascularization .
however , significantly lower risk of all - cause death was observed in the subgroup without revascularization ( rr : 0.30 , 95% ci : 0.12 to 0.77 , p=0.01 ) , but not in the subgroup with revascularization .
initial retrieval yielded 1731 references , among which 1688 were excluded after reviewing the title and/or abstract .
the remaining 43 trials were reviewed in detail for assessing eligibility . among them , 11 were excluded due to non - rct , 3 were excluded due to use of precursors mobilized by cytokine , 3 were excluded due to use of blood - derived stem cells , and 6 were excluded because lvef data was not reported .
finally , a total of 20 trials were included for meta - analysis [ 6,9,10,1632 ] .
all of the trials had relatively small sample size , with number of patients ranging from 14 to 109 .
a total of 453 patients were included in the cell therapy groups and 322 patients were included in the control groups . all trials recruited patients with cihd , including chronic coronary total occlusion , refractory angina , ischemic heart failure , and chronic myocardial infarction .
twelve studies used pci or cabg as the control method for revascularization and 8 studies recruited patients unsuitable for revascularization .
the autologous bmcs , including both bmmncs and mcss , were delivered either directly through intramyocardial or intracoronary approach .
mean patient age in the intervention groups was 61.03.3 and in the control groups was 61.23.3 ( p=0.88 ) , suggesting adequate match .
the roughly symmetrical distribution pattern suggested there was no significant publication bias ( supplement figure 2 ) .
generally , the quality of trials included was good . according to the modified jadad score ,
there was no significant difference in patient characteristics between cell therapy and standard therapy groups .
all of the trials were randomized , but 6 studies did not report the method of generating a randomized sequence and 6 did not give concealing allocation method .
eighteen studies had both blinded patients and practitioners and 2 studies had only blinded patients .
eighteen studies had loss of follow - up rate under 15% and 2 were over this level .
the primary and secondary outcome ( lvef , lvedv , and lvesv ) were pooled .
compared with standard treatment , bmc transplantation significantly improved lvef in patients with revascularization ( 3.35% , 95%ci 0.72% to 5.97% , p=0.01 ; i=85% ) and in patients without revascularization ( 3.05% , 95% ci 0.65% to 5.45% , p=0.01 ; i=86% ) .
lvef improvement was similar in these 2 groups ( p=0.87 ) ( figure 1 ) .
compared with control , bmc transplantation was associated with moderately decreased lvesv in patients with revascularization ( 5.88 ml , 95% ci , 12.66 ml to 0.91 ml , p=0.09 ; i=51% ) and significantly decreased in patients without revascularization ( 11.75 ml , 95% ci 17.81 ml to 5.69 ml , p=0.0001 ; i=81% ) ( figure 2 ) .
no significant difference in lvesv decrease was observed between these 2 groups ( p=0.21 ) ( figure 2 ) .
in addition , a significant trend of decreased lvedv was only observed in patients receiving only cell therapy ( 7.80 ml , 95% ci 15.31 ml to 0.29 ml , p=0.04 ; i=39% ) , but not in patients receiving combination of cell therapy and revascularization ( 7.30 , 95% ci 17.68 ml to 3.09 ml , p=0.17 ; i=57% ) .
however , the difference between these 2 groups was not significant ( p=0.94 ) ( figure 3 ) .
due to significant heterogeneity observed within groups with or without revascularization , subgroup analysis was performed to explore whether the type of revascularization intervention ( cabg or pci ) , the type of cell delivered , and the level of baseline lvef influenced the efficacy of cell therapy .
compared with lvef improvement in intracoronary route ( 1.00% , 95% ci 0.11% to 2.10% ) , the improvement in intramyocardial delivery was significantly higher ( 4.77% , 95% ci 4.11% to 5.44% ) ( p<0.00001 ) ( table 1 ) . however , no significant difference was observed in lvesv and lvedv ( p=0.68 and p=0.64 , respectively ) . when comparing the effect of cell type transplanted on lv function improvement , it was observed lvef improvement was significantly higher in the bmmncs group ( 4.33% , 95% ci 3.69% to 4.96% ) than in the mcss group ( 1.32% , 95% ci 0.00% to 2.65% ) ( p<0.00001 ) ( table 1 ) .
however , lvesv decrease was more evident in the mcss group ( 15.69 ml , 95% ci 17.87 ml to 13.52 ml ) than in the bmnncs group ( 8.51 ml , 95% ci 14.28 ml to 2.74 ml ) ( p=0.02 ) .
lvef increase was significantly higher in the group with higher than average lvef ( 5.11% , 95% ci 4.36% to 5.86% ) than the group with lower than average lvef ( 1.93% , 95% ci , 1.05% to 2.81% ) ( p<0.00001 ) .
changes in lvesv and lvedv were similar in these 2 groups ( p=0.23 and p=0.32 , respectively ) ( table 1 ) .
major adverse cardiovascular events reported in original studies were pooled to assess the safety of bmc transplantation ( table 2 ) . generally , compared with control ,
bmc transplantation had a similar risk ratio in ventricular arrhythmia , recurrent myocardial infarction , and cerebrovascular accident as control in subgroups both with and without revascularization .
however , significantly lower risk of all - cause death was observed in the subgroup without revascularization ( rr : 0.30 , 95% ci : 0.12 to 0.77 , p=0.01 ) , but not in the subgroup with revascularization .
for patients with cihd , the goal of cell therapy is to achieve coronary neovascularization- and myocardial regeneration - based cardiac structural and functional improvement .
although previous meta - analyses explored the therapeutic effects and adverse events of bmcs compared with standard therapy , due to significant heterogeneity , small number of original trials and inconsistency of the findings , it is quite necessary to add outcomes new trials for better understanding of bmcs therapy . to date , there is no available meta - analysis that explored the efficacy of bmcs - based cell therapy between patients with revascularizable and non - revascularizable cihd .
this meta - analysis of 20 rcts showed that autologous transplantation of bmcs was safe and effective both for patients who were candidates for revascularization with cabg / pci and those who were not .
findings of this study also indicated that for patients with no option for revascularization , single administration of bmcs could provide compatible effect in improving lv function , including increased lvef and decreased lvedv and lvesv compared with patients who received a combination of cell therapy and revascularization .
subgroup analysis found that the route of transplantation , baseline lvef , and type of cells delivered could influence the efficacy of cell therapy .
we found that i m injection was more beneficial to improve lvef compared with ic injection ( 4.77% vs. 1.00% , p<0.00001 ) .
, who found that cell therapy through i m injection was associated with better effect .
this difference might be related to the higher proportion of cells retained in the heart through i m injection than through the ic route , which was confirmed by an animal study and 1 small rct .
previous studies reported that cell therapy had better effect in patients with lower baseline lvef .
subgroup analysis of this study also found that patients with lower than average baseline lvef ( < 35.5% ) had better therapeutic outcome ( more lvef improvement ) than those with higher than average baseline ( 5.11% vs. 1.93% , p<0.00001 ) .
furthermore , this study found that transplantation of bmmncs had better effect in improving lvef than did mcss .
however , due to the small number of trials based on mcss ( n=3 ) , the reliability of this finding should be confirmed in future rcts . as to lvedv and lvesv
pooled safety assessment found that cell therapy significantly decreased all - cause death in the subgroup without revascularization .
other major adverse events were similar between cell therapy and control group in both subgroups .
the mechanisms by which bmcs contribute to cardiac repair and function improvement are still not fully understood .
a previous study observed that bmcs could differentiate to cardiomyocytes in infarcted areas of the heart .
however , this was proven to be a minor mechanism because the process of transdifferentiation occurs very rarely in this situation .
previous studies found that bmcs and bone marrow progenitor cells could secrete a series of cytokines that activate endogenous cardiac repair , such as activating resident cardiac progenitor cells and stimulating cardiomyocyte cell - cycle re - entry .
in addition , bmcs were involved in the process of neovascularization , inhibiting apoptosis of myocardial cells , and reducing inflammation through paracrine production of cytokines and growth factors .
however , how these mechanisms interact with each other and whether other mechanisms are involved is not clear .
as observed in previous meta - analyses , this study also found a considerable degree of between - study heterogeneity .
the high level of heterogeneity is closely related to patient baseline characteristics of each trial , route of transplantation , type and number of cell delivered , and methodology used to measure lv functional indicators . for example , a recent study indicated that use of low - dose mesenchymal stem cells ( approximately 2010 cells ) was associated with the best effect in lv volume and lvef increase .
however , the number of cells transplanted ranged from 10 to 10 in trials included in this meta - analysis . secondly , in subgroup analysis , few trials assessed the effect of pci and mcss , which resulted in incompatible pooled sample size and thus might impair the reliability of observed phenomenon .
thirdly , most of the trials included had short - term follow - up ( less than 1 year ) .
the medium to long - term effect of cell therapy is still not quite clear .
in conclusion , the results of this meta - analysis suggest that transplantation of bmcs is a safe and effective therapy to improve left ventricular function both for patients who were candidates for revascularization with cabg / pci and those who were not .
large clinical trials and long - term follow - up are required to confirm the benefits .
intervention ; c control ; nyha new york heart association ; lvef left ventricular ejection fraction ; n.a .
not available ; r - cihd revascularizable chronic ischemic heart disease ; i m intramyocardial ; ic intracoronary ; cabg coronary artery bypass grafting ; bmc bone marrow cell ; bmmnc bone marrow mononuclear cell ; aldhbr with a high level of aldehyde dehydrogenase activity ; mri magnetic resonance imaging ; echo echocardiography ; lvg left ventriculography . | backgroundalthough bone marrow - derived cells ( bmcs ) have shown great therapeutic potential in patients with chronic ischemic heart disease ( cihd ) , the exact efficacy and safety of bmcs therapy is still not completely defined.material/methodswe searched pubmed , ovid , embase , the cochrane library , and clinicaltrials.gov and finally identified 20 qualified trials in this meta - analysis .
assessment of efficacy was based on left ventricular ejection fraction ( lvef ) , left ventricular end - systolic volume ( lvesv ) , and left ventricular end - diastolic volume ( lvedv ) improvement , by weighted mean difference ( wmd ) with 95% confidence intervals ( cis ) .
results of all - cause death , ventricular arrhythmia , recurrent myocardial infarction , and cerebrovascular accident were pooled to assess safety .
subgroup analysis was performed by stratifying rcts into 2 subgroups of those with revascularization and without revascularization.resultsbmc transplantation significantly improved lvef in patients with revascularization ( 3.35% , 95% ci 0.72% to 5.97% , p=0.01 ; i2=85% ) and without revascularization ( 3.05% , 95% ci 0.65% to 5.45% , p=0.01 ; i2=86% ) . in patients without revascularization ,
bmc transplantation was associated with significantly decreased lvesv ( 11.75 ml , 95% ci 17.81 ml to 5.69 ml , p=0.0001 ; i2=81% ) , and lvedv ( 7.80 ml , 95% ci 15.31 ml to 0.29 ml , p=0.04 ; i2=39% ) .
subgroup analysis showed that the route of transplantation , baseline lvef , and type of cells delivered could influence the efficacy of bmc transplantation.conclusionsautologous transplantation of bmcs was safe and effective for patients who were candidates for revascularization with cabg / pci and those who were not .
however , large clinical trials and long - term follow - up are required to confirm these benefits . | Background
Material and Methods
Search strategy
Selection criteria
Data extraction
Quality assessment
Data analysis
Results
Search results
Characteristics of included studies
Quality assessment
Efficacy of BMC transplantation
Subgroup analysis
Safety of BMC transplantation
Discussion
Conclusions |
reactive oxygen species ( ros ) are generated during normal cellular metabolism , as a result of the influence of various environmental factors , as well as during pathological processes .
ros are responsible for dna , lipid and protein damage and play an important role in the development and progression of many human diseases , including cancer
. protein oxidation may result in structural changes and loss of function through peptide bond cleavage due to oxidation of the protein backbone , formation of protein
the oxidation of protein side chains occurs mainly on proline , arginine , lysine and threonine residues resulting in carbonyl formation .
carbonyl groups formed during the oxidation are chemically stable which is useful for both in terms of detection and stability during sample storage .
protein carbonyl levels are the most frequently used biomarker of protein oxidation and their accumulation has been observed with aging and in several human diseases , including cancer ( reviewed in ;) .
several methods of protein carbonyl groups detection are available , including a colorimetric assay based on derivatization of the carbonyl group with 2,4-dinitrophenylhydrazine ( dnph ) . a stable 2,4-nitrophenylhydrazone ( dnp ) product results that can be detected spectrophotometrically .
because this method is relatively time - consuming and requires higher amount of biological samples , buss et al .
the assay is reproducible and correlates well with the classical colorimetric assay . in the present study
, we investigated the association of oxidative stress , measured as the levels of protein carbonyl groups in plasma , with breast cancer risk among women who participated in the long island breast cancer study project ( libcsp ) . among controls
, we also determined the correlation of plasma protein carbonyl levels with age , average lifetime physical activity , fruit and vegetable intake , alcohol consumption , cigarette smoking , body mass index ( bmi ) and menopausal status , factors that may affect oxidative stress .
the libcsp is a population - based study investigating the associations between environmental factors and breast cancer .
briefly , eligible cases were women residing in nassau or suffolk counties , who spoke english , and were newly diagnosed with a first primary in situ or invasive breast cancer between august 1 , 1996 , and july 31 , 1997 .
population - based controls were identified using random digit dialling ( < 65 years of age ) and health care financing administration rosters ( 65 + years of age ) , and frequency matched to the expected age distribution of the cases by 5-year age group .
the main questionnaire was administered by a trained interviewer in the participant 's home and lasted approximately 2 hrs .
information was assessed on known and suspected risk factors for breast cancer , including passive and active cigarette smoking , lifetime alcohol use , menstrual and reproductive histories , hormone use , body size by decade of adult life , lifetime participation in recreational activities , prior medical history and family history of breast cancer ( http://epi.grants.cancer.gov/libcsp/projects/questionnaire.html ) .
usual dietary intake in the year prior to the interview was assessed using a modified block self - administered food frequency questionnaire , as previously described .
we also collected information on cancer treatment undergone prior to blood collection , including whether a participant had radiation and/or chemotherapy .
of the eligible participants who completed the main questionnaire ( 1508 cases and 1556 controls ) , 73% of cases and 73% of controls donated a non - fasting blood samples at the time of the interview .
the samples were donated on average within 3 months after breast cancer diagnosis , prior to the onset of chemotherapy for most case participants , but after surgery . for controls ,
blood samples , collected in ethylenediaminetetraacetic acid ( edta)-treated tubes , were shipped at room temperature for overnight delivery to columbia university for processing and storage .
the samples were aliquoted and frozen at 80c within 24 hrs of collection . in the present study
the levels of plasma protein carbonyl groups were assessed using a non - competitive elisa , essentially as described in , with some modifications .
briefly , the oxidized protein standards were prepared by incubation of bovine serum albumin ( bsa ) ( 50 mg / ml ) with 0.73 m h2o2 and 0.42 mm fe for 1 hr at 37c .
it was then diluted with native ( unoxidized ) bsa and phosphate - buffered saline ( pbs ) to give a final carbonyl content of 2.0 nmol / mg protein and protein concentration of 4 mg / ml .
total protein concentration in the plasma samples was measured using bicinchoninic acid kit ( sigma ) and the samples were diluted with pbs to a final protein concentration of 4 mg / ml . after the derivatiza - tion with dnph , the plate was coated with 200 l of sample ( 1 g ) and incubated overnight at 4c in the dark .
the plate was washed with pbs / tween ( 0.05% tween 20 in pbs ) and blocked with 0.1% bsa in pbs for 1.5 hr .
after another washing step , biotinylated primary anti - dnp antibody ( molecular probes ; diluted 1:1500 with 0.1% bsa , 0.1% tween 20 in pbs ) was added and the plate was incubated at 37c for 1 hr . another washing was followed by adding the streptavidin - biotynylated horseradish peroxidase conjugate ( amersham ; diluted 1:4000 in 0.1% bsa , 0.1% tween 20 in pbs ) and incubation at room temperature for 1 hr .
colour was developed by adding the tetram - ethyl benzidine ( tmb ) liquid substrate system ( sigma ) and the reaction was stopped with h2so4 after 1525 min incubation in the dark .
each sample was analysed in duplicate ; the interassay coefficient of variability for the repeat analysis ( n = 53 ) of a quality control sample was 17% . as a quality control ,
a pooled plasma sample was repeatedly frozen and thawed before analysis ; there was no significant difference in protein carbonyl levels with up to four freeze - thaw cycles .
we first compared the differences between 1050 cases and 1107 controls with regard to the plasma protein carbonyl levels ( nmol carbonyl / ml plasma ) .
the analysis of variance test was used for comparing case - control differences as continuous variables and the chi - square test was used for comparing case - control differences .
we also examined case - control differences using unconditional logistic regression adjusting for reference age ( date of diagnosis for cases and date of identification for controls ) .
other factors that were considered as possible confounders include those that have been associated with breast cancer and may also influence oxidative stress pathways , including average physical activity level , fruit and vegetable intake , average lifetime alcohol intake , active cigarette smoking status , bmi , menopausal status , age at menarche , age at first birth ( afb ) , parity , oral contraceptive ( oc ) use and hormone replacement therapy ( hrt ) use ( using definitions that have been previously published [ 10,1517 ] ) . only those that changed the effect estimates by more than 10% were included in the final models .
we stratified the association between plasma protein carbonyl levels and breast cancer by the same factors to examine effect modification on a multiplicative scale .
we also examined the associations with the cases restricted to those women for whom chemotherapy ( n = 827 ) or radiation therapy ( n = 831 ) had not yet been initiated by the time of the blood collection .
we then assessed whether plasma protein carbonyl levels differed by age , average physical activity level , fruit and vegetable intake , average lifetime alcohol intake , active smoking status , bmi , menopausal status , age at menarche , afb , parity , oc use and hrt use among 1107 controls first by using the analysis of variance test and second by using linear regression methods .
we used log transformation for the plasma protein carbonyl levels in the linear regression model to meet the assumption of normality .
we estimated a saturated model with all factors suspected to influence plasma protein carbonyl levels and a parsimonious model with other those variables which were statistically significantly related to the outcome .
the libcsp is a population - based study investigating the associations between environmental factors and breast cancer .
briefly , eligible cases were women residing in nassau or suffolk counties , who spoke english , and were newly diagnosed with a first primary in situ or invasive breast cancer between august 1 , 1996 , and july 31 , 1997 .
population - based controls were identified using random digit dialling ( < 65 years of age ) and health care financing administration rosters ( 65 + years of age ) , and frequency matched to the expected age distribution of the cases by 5-year age group .
the main questionnaire was administered by a trained interviewer in the participant 's home and lasted approximately 2 hrs .
information was assessed on known and suspected risk factors for breast cancer , including passive and active cigarette smoking , lifetime alcohol use , menstrual and reproductive histories , hormone use , body size by decade of adult life , lifetime participation in recreational activities , prior medical history and family history of breast cancer ( http://epi.grants.cancer.gov/libcsp/projects/questionnaire.html ) .
usual dietary intake in the year prior to the interview was assessed using a modified block self - administered food frequency questionnaire , as previously described .
we also collected information on cancer treatment undergone prior to blood collection , including whether a participant had radiation and/or chemotherapy .
of the eligible participants who completed the main questionnaire ( 1508 cases and 1556 controls ) , 73% of cases and 73% of controls donated a non - fasting blood samples at the time of the interview .
the samples were donated on average within 3 months after breast cancer diagnosis , prior to the onset of chemotherapy for most case participants , but after surgery . for controls ,
blood samples , collected in ethylenediaminetetraacetic acid ( edta)-treated tubes , were shipped at room temperature for overnight delivery to columbia university for processing and storage .
the samples were aliquoted and frozen at 80c within 24 hrs of collection . in the present study
the levels of plasma protein carbonyl groups were assessed using a non - competitive elisa , essentially as described in , with some modifications .
briefly , the oxidized protein standards were prepared by incubation of bovine serum albumin ( bsa ) ( 50 mg / ml ) with 0.73 m h2o2 and 0.42 mm fe for 1 hr at 37c .
it was then diluted with native ( unoxidized ) bsa and phosphate - buffered saline ( pbs ) to give a final carbonyl content of 2.0 nmol / mg protein and protein concentration of 4 mg / ml .
total protein concentration in the plasma samples was measured using bicinchoninic acid kit ( sigma ) and the samples were diluted with pbs to a final protein concentration of 4 mg / ml . after the derivatiza - tion with dnph , the plate was coated with 200 l of sample ( 1 g ) and incubated overnight at 4c in the dark .
the plate was washed with pbs / tween ( 0.05% tween 20 in pbs ) and blocked with 0.1% bsa in pbs for 1.5 hr .
after another washing step , biotinylated primary anti - dnp antibody ( molecular probes ; diluted 1:1500 with 0.1% bsa , 0.1% tween 20 in pbs ) was added and the plate was incubated at 37c for 1 hr . another washing was followed by adding the streptavidin - biotynylated horseradish peroxidase conjugate ( amersham ; diluted 1:4000 in 0.1% bsa , 0.1% tween 20 in pbs ) and incubation at room temperature for 1 hr .
colour was developed by adding the tetram - ethyl benzidine ( tmb ) liquid substrate system ( sigma ) and the reaction was stopped with h2so4 after 1525 min incubation in the dark .
each sample was analysed in duplicate ; the interassay coefficient of variability for the repeat analysis ( n = 53 ) of a quality control sample was 17% .
as a quality control , a pooled plasma sample was repeatedly frozen and thawed before analysis ; there was no significant difference in protein carbonyl levels with up to four freeze - thaw cycles .
we first compared the differences between 1050 cases and 1107 controls with regard to the plasma protein carbonyl levels ( nmol carbonyl / ml plasma ) .
the analysis of variance test was used for comparing case - control differences as continuous variables and the chi - square test was used for comparing case - control differences .
we also examined case - control differences using unconditional logistic regression adjusting for reference age ( date of diagnosis for cases and date of identification for controls ) .
other factors that were considered as possible confounders include those that have been associated with breast cancer and may also influence oxidative stress pathways , including average physical activity level , fruit and vegetable intake , average lifetime alcohol intake , active cigarette smoking status , bmi , menopausal status , age at menarche , age at first birth ( afb ) , parity , oral contraceptive ( oc ) use and hormone replacement therapy ( hrt ) use ( using definitions that have been previously published [ 10,1517 ] ) . only those that changed the effect estimates by more than 10%
we stratified the association between plasma protein carbonyl levels and breast cancer by the same factors to examine effect modification on a multiplicative scale .
we also examined the associations with the cases restricted to those women for whom chemotherapy ( n = 827 ) or radiation therapy ( n = 831 ) had not yet been initiated by the time of the blood collection .
we then assessed whether plasma protein carbonyl levels differed by age , average physical activity level , fruit and vegetable intake , average lifetime alcohol intake , active smoking status , bmi , menopausal status , age at menarche , afb , parity , oc use and hrt use among 1107 controls first by using the analysis of variance test and second by using linear regression methods .
we used log transformation for the plasma protein carbonyl levels in the linear regression model to meet the assumption of normality .
we estimated a saturated model with all factors suspected to influence plasma protein carbonyl levels and a parsimonious model with other those variables which were statistically significantly related to the outcome .
we observed a statistically significant trend in breast cancer risk in relation to increasing quartiles of plasma protein carbonyl levels ( multivariate - adjusted or = 1.2 , 95% ci = 0.91.5 ; or = 1.5 , 95% ci = 1.22.0 ; or = 1.6 , 95% ci = 1.22.1 for the 2 , 3 and 4 quartile relative to the lowest quartile , respectively , p for trend = 0.0001 ) ( table 1 ) .
estimates differed little between models with and without adjustment for other breast cancer risk factors . among cases
, there were no differences in plasma protein carbonyl level between those with or without chemotherapy or radiation therapy prior to blood collection .
considering plasma protein carbonyl levels categorized into other quartile groupings ( tertiles , quintiles , deciles ) yielded similar effect estimates ( data not shown ) .
thus , after removal of the 214 women who had received chemotherapy and the 209 who had received radiation therapy , results did not materially change ( or = 1.1 , 95% ci = 0.81.5 ; or = 1.7 , 95% ci = 1.22.3 ; or = 1.7 , 95% ci 1.22.3 for the 2 , 3 and 4 quartile relative to the lowest quartile , respectively , p for trend = 0.0001 ) .
we also determined whether removal of women currently on hrt impacted results but again they did not materially change ( or = 1.0 , 95% ci = 0.71.4 ; or = 1.4 , 95% ci = 1.02.0;or = 1.3 , 95% ci 0.91.8 for the 2nd , 3rd and 4th quartile relative to the lowest quartile , p for trend = 0.02 ) . removing those who received chemotherapy and radiation therapy in addition to those on hrt resulted in ors of 1.0 ( 95% ci 0.71.4 ) , 1.6 ( 95%ci 1.12.3 and 1.4 ( 95%ci 0.92.0 ) for the 2 , 3 and 4 quartile relative to the lowest quartile ( p for trend = 0.02 ) .
adjusted odds ratios and 95% confidence intervals for breast cancer associated with plasma protein carbonyl level * adjusted for age , average physical activity level , fruits and vegetables intake , average alcohol intake , active smoking status , menopausal status , bmi , ever use hrt , ever use oc , age at menarche , parity and age at first birth .
the increase in breast cancer risk by quartile of plasma protein carbonyl level was similar for younger ( < 50 years ) and older women or by fruits and vegetables consumption ( table 2 ) .
the association between plasma protein carbonyl level and breast cancer risk was more pronounced among women with higher physical activity levels ( 0.7 hrs / week for 4 quartile versus lowest quartile or = 2.0 , 95% ci = 1.43.0 ) , with higher average lifetime alcohol consumption ( 15 grams / day for 4 quartile versus lowest quartile or = 2.3 , 95% ci = 1.14.9 ) and who used hrt ( or = 2.6 , 95%ci = 1.64.4 for 4 quartile versus lowest quartile ) .
but , the multiplicative interaction terms were statistically significant only for physical activity ( p= 0.02 ) and use of hrt ( p= 0.04 ) .
breast cancer risk associated with plasma protein carbonyl level stratified by age , average physical activity level , fruits and vegetable intake , alcohol intake , cigarette smoking status , bmi , menopausal status , hrt and oc use , age of menarche and first birth and parity adjusted for age , average physical activity level , fruits and vegetables intake , average alcohol intake , active smoking status , menopausal status , bmi , ever use hrt , ever use oc , age at menarche , parity and age at first birth . to assess whether breast cancer risk is related to increased levels of markers of protein oxidation and lipid peroxidation , we compared plasma protein carbonyl levels and urinary 15f2t - isoprostane levels ( analysed in a subset of 400 cases and 401 controls in our previous study ) .
women with higher levels of plasma protein carbonyl ( median ) and higher levels of 15f2t - isoprostane ( median ) had a 1.8-fold increase in breast cancer risk ( or = 1.8 , 95% ci = 1.22.6 ) compared to women with levels below the median for both markers of oxidative stress ( table 3 ) .
breast cancer risk associated with the 15-f2t - isoprostane and plasma protein carbonyl levels in univariate analyses , among controls , plasma protein carbonyl levels significantly increased with age ( p= 0.02 , table 4 ) , and were significantly higher in post - menopausal compared to pre - menopausal women ( p= 0.01 ) and in those with age of menarche < 13 yrs ( p < 0.01 ) .
contrary to our expectations , levels were also higher with increased fruits and vegetables intake ( p= 0.04 ) .
no significant associations were found between plasma protein carbonyl levels and average physical activity level , average lifetime alcohol intake , cigarette smoking status , bmi and other reproductive variables .
mean ( and sd ) of plasma protein carbonyl levels ( continuous ) within strata of age , average physical activity level , fruits and vegetables intake , average lifetime alcohol intake , cigarette smoking status , body mass index ( bmi ) and menopausal status , ever use hrt , ever use oc , age at menarche , parity and age at first birth among controls comparing differences between mean values by category .
table 5 reports the findings from multivariate linear regression models examining the association between selected breast cancer risk factors and plasma protein carbonyl levels among controls .
higher average physical activity , higher consumption of alcohol and later age of menarche were associated with decreased plasma protein carbonyl levels . in the best - fitting model , higher fruit and vegetable intake and post - menopausal status
were associated with increased plasma protein car - bonyl levels and high alcohol consumption and later age of menarche with decreased levels .
multivariate estimates of the association among age , average physical activity level , fruit and vegetable intake , average lifetime alcohol intake , cigarette smoking status , body mass index ( bmi ) , menopausal status , ever used hrt , ever used oc , age at menarche , parity , and age at first birth and the log of plasma protein carbonyl levels among controls * adjusted for age , average physical activity level , fruits and vegetables intake , average lifetime alcohol intake , active smoking status , body mass index , menopausal status , ever use hrt , ever use oc , age at menarche , parity and age at first birth . * * best - fitting model .
protein oxidation , measured as plasma levels of protein carbonyl groups , was significantly associated with breast cancer risk in our study .
participants with the highest quartile of plasma protein carbonyl levels had a 60% increased risk of developing breast cancer compared to participants with plasma protein carbonyl levels in the lowest quartile .
several previous studies have provided evidence that protein oxidation might be associated with cancer risk . increased levels of plasma protein carbonyl groups
were observed in patients with hodgkin 's lymphoma , with bladder cancer and in children with various malignancies , but not in a small study of lung cancer . to the best of our knowledge ,
our study is the first analysis of the relationship between protein oxidation and breast cancer risk .
also , our study completes the investigation of a panel of oxidative stress markers among the participants of libcsp . according to a recent report , it is critical to simultaneously analyse several markers of oxidative stress to better understand the processes leading to the particular pathology being studied .
the process of aging is accompanied by increasing levels of oxidative damage , including protein oxidation ( reviewed in ) .
increased levels of protein carbonyls have been observed in elderly participants as compared with younger participants in some , but not all studies .
we also found increased plasma protein carbonyl levels in older women ( table 4 ) . in the multivariate analysis ,
higher physical activity was associated with decreased plasma protein carbonyl levels ( table 5 ) . in general
, physical exercise can produce an imbalance between ros and antioxidants and thus lead to oxidative stress , but the results of different studies are conflicting . decreased plasma protein carbonyl levels were found in participants after strenuous physical exercise and in sedentary participants as a result of physical exercise , but levels increased in participants in a super - marathon race .
thus , the biological meaning of our observation is not clear;how - ever , it is in agreement with other studies .
fruits and vegetables contain both antioxidant and pro - oxidant factors so their effect on oxidative stress markers may be variable .
decreased levels of various oxidative stress markers have been observed after administration of fruits and vegetables - rich food in several studies [ 3133 ] .
analysis of data from the libcsp showed that higher fruits and vegetables consumption was associated with significantly decreased breast cancer risk among postmenopausal women ( or 0.72 , 95% ci 0.530.99 for the highest quintile compared with the lowest ) with weaker associations among pre - menopausal .
contrary to this data , we observed significantly increased plasma protein carbonyl levels among participants with higher fruits and vegetables consumption ( table 4 & 5 ) .
where participants receiving a diet rich in fruits and vegetables , or a pill containing vitamins and minerals corresponding to those in the fruits and vegetables diet , had higher protein carbonyl formation at lysine residues than those on placebo .
they hypothesized that the pro - oxidant activity of vitamin c might be responsible for their findings .
three pathways of ethanol metabolism have been described and each results in free radical production leading to oxidative damage .
several studies have observed increased protein carbonyl levels among patients with chronic alcoholism [ 3638 ] suggesting that repeated exposure to high alcohol levels may be necessary to affect protein carbonyl levels .
lower levels of oxidative stress markers were reported among moderate alcohol drinkers [ 39 , 40 ] , but these studies concentrated on white and red wine drinkers .
it is probable that the presence of antioxidants in wine diminishes the negative effect of ethanol on oxidative stress markers . in the present study ,
this may reflect the type of alcoholic beverages consumed by the participants in our study ( prevalence of wines rich in antioxidants ) , as well as relatively low levels of alcohol exposure that were not sufficient to increase oxidative stress even in the group of women consuming > 30 g alcohol / day .
significantly increased levels of oxidized proteins in smokers than in non - smokers were observed with similar , but non - significant results in another study .
we found a significant increase in plasma protein carbonyl levels among former smokers compared with non - smokers ( table 5 ) .
shorter life - time exposure to estrogen as a result of late menarche may decrease oxidative stress induced by estrogen metabolism . in our previous study
, we observed an association between urinary 15-f2t - isoproprostane , a marker of lipid peroxidation , and breast cancer risk in a subset of women analysed in the present study .
the combination of elevated ( median ) plasma protein carbonyl and 15-f2t - isoproprostane levels resulted in a 1.8-fold increase in breast cancer risk compared to women with levels below the median for both markers of oxidative stress .
analysis of a combination of several oxidative stress markers may provide more relevant information about risk than any one measure .
a limitation of our study is that the blood samples were shipped at room temperature after collection and haemolysis may have contributed to additional oxidative stress .
however , all samples were handled the same way and thus , time between collection of samples and their processing can not account for the differences between cases and controls .
although extensive efforts were undertaken to obtain the samples prior to the onset of chemotherapy and radiation therapy for most case participants , all breast cancer cases had undergone surgery before blood draw .
it has been shown that surgery results in significant decrease of ros production and levels of oxidative stress markers , including protein carbonyl levels in colon and laryngeal cancer patients .
moreover , total plasma antioxidant capacity increases after a tumour removal . in our study , we observed no effect of non - surgical treatment on carbonyl level and when we restricted our analyses to case participants who had not received chemotherapy and radiation therapy prior to blood collection , our results did not change substantially . a prospective study using samples collected before diagnosis may be more useful for determining if elevated levels of protein oxidation predict breast cancer risk .
a major strength of our study is the large number of participants , which helped to ensure that the study had sufficient power .
in addition , the population - based study design ensured that cases and controls arose from the same source population . in summary , we found positive associations between plasma protein carbonyl levels and breast cancer risk in this population - based , case - control study . among controls ,
oxidized protein levels significantly increased with cigarette smoking and , unexpectedly , with higher fruit and vegetable consumption but decreased with alcohol consumption > 30 grams per day .
elevation in two oxidative stress biomarkers , urinary 15f2t - isoprostanes and oxidized protein was associated with increased breast cancer risk .
our results add additional support to the hypothesis that oxidative stress may play a role in breast cancer etiology . | abstractto study the role of oxidative stress in breast cancer risk , we analysed plasma levels of protein carbonyls in 1050 cases and 1107 controls .
we found a statistically significant trend in breast cancer risk in relation to increasing quartiles of plasma protein carbonyl levels ( or = 1.2 , 95% ci = 0.91.5 ; or = 1.5 , 95% ci = 1.22.0 ; or = 1.6 , 95% ci = 1.22.1 , for the 2nd , 3rd and 4th quartile relative to the lowest quartile , respectively , p for trend = 0.0001 ) . the increase in risk was similar for younger ( < 50 years ) and older women , more pronounced among women with higher physical activity levels ( 0.7 hrs / week for 4th quartile versus lowest quartile or = 2.0 , 95% ci = 1.43.0 ) , higher alcohol consumption ( 15 grams / day for 4th quartile versus lowest quartile or = 2.3 , 95% ci = 1.14.7 ) , and hormone replacement therapy use ( hrt , or = 2.6 , 95% ci = 1.64.4 for 4th quartile versus lowest quartile ) .
the multiplicative interaction terms were statistically significant only for physical activity and hrt .
the positive association between plasma protein carbonyl levels and breast cancer risk was also observed when the analysis was restricted to women who had not received chemotherapy or radiation therapy prior to blood collection . among controls ,
oxidized protein levels significantly increased with cigarette smoking and higher fruit and vegetable consumption , and decreased with alcohol consumption > 30 grams per day .
women with higher levels of plasma protein carbonyl and urinary 15f2t - isoprostane had an 80% increase in breast cancer risk ( or = 1.8 , 95% ci = 1.22.6 ) compared to women with levels below the median for both markers of oxidative stress . in summary ,
our results suggest that increased plasma protein carbonyl levels may be associated with breast cancer risk . | Introduction
Materials and methods
Participants
Covariate exposure assessment
Plasma protein carbonyl assay
Statistical analysis
Results
Discussion |
by the early 1990s , 75 years of research had failed to answer a most basic question about the 1918 pandemic : why was it so fatal ?
no virus from 1918 had been isolated , but all of its apparent descendants caused substantially milder human disease . moreover ,
examination of mortality data from the 1920s suggests that within a few years after 1918 , influenza epidemics had settled into a pattern of annual epidemicity associated with strain drifting and substantially lowered death rates .
did some critical viral genetic event produce a 1918 virus of remarkable pathogenicity and then other critical genetic event occur soon after the 1918 pandemic to produce an attenuated h1n1 virus ? in 1995 , a scientific team identified archival influenza autopsy materials collected in the autumn of 1918 and began the slow process of sequencing small viral rna fragments to determine the genomic structure of the causative influenza virus ( 10 ) .
these efforts have now determined the complete genomic sequence of 1 virus and partial sequences from 4 others .
the primary data from the above studies ( 1117 ) and a number of reviews covering different aspects of the 1918 pandemic have recently been published ( 1820 ) and confirm that the 1918 virus is the likely ancestor of all 4 of the human and swine h1n1 and h3n2 lineages , as well as the " extinct " h2n2 lineage .
no known mutations correlated with high pathogenicity in other human or animal influenza viruses have been found in the 1918 genome , but ongoing studies to map virulence factors are yielding interesting results . the 1918 sequence data , however , leave unanswered questions about the origin of the virus ( 19 ) and about the epidemiology of the pandemic .
before and after 1918 , most influenza pandemics developed in asia and spread from there to the rest of the world . confounding definite assignment of a geographic point of origin , the 1918 pandemic spread more or less simultaneously in 3 distinct waves during an 12-month period in 19181919 , in europe , asia , and north america ( the first wave was best described in the united states in march 1918 ) .
historical and epidemiologic data are inadequate to identify the geographic origin of the virus ( 21 ) , and recent phylogenetic analysis of the 1918 viral genome does not place the virus in any geographic context ( 19 ) .
although in 1918 influenza was not a nationally reportable disease and diagnostic criteria for influenza and pneumonia were vague , death rates from influenza and pneumonia in the united states had risen sharply in 1915 and 1916 because of a major respiratory disease epidemic beginning in december 1915 ( 22 ) .
the first pandemic influenza wave appeared in the spring of 1918 , followed in rapid succession by much more fatal second and third waves in the fall and winter of 19181919 , respectively ( figure 1 ) .
is it possible that a poorly - adapted h1n1 virus was already beginning to spread in 1915 , causing some serious illnesses but not yet sufficiently fit to initiate a pandemic ?
data consistent with this possibility were reported at the time from european military camps ( 23 ) , but a counter argument is that if a strain with a new hemagglutinin ( ha ) was causing enough illness to affect the us national death rates from pneumonia and influenza , it should have caused a pandemic sooner , and when it eventually did , in 1918 , many people should have been immune or at least partially immunoprotected . "
herald " events in 1915 , 1916 , and possibly even in early 1918 , if they occurred , would be difficult to identify .
three pandemic waves : weekly combined influenza and pneumonia mortality , united kingdom , 19181919 ( 21 ) .
the 1918 influenza pandemic had another unique feature , the simultaneous ( or nearly simultaneous ) infection of humans and swine .
the virus of the 1918 pandemic likely expressed an antigenically novel subtype to which most humans and swine were immunologically naive in 1918 ( 12,20 ) .
recently published sequence and phylogenetic analyses suggest that the genes encoding the ha and neuraminidase ( na ) surface proteins of the 1918 virus were derived from an avianlike influenza virus shortly before the start of the pandemic and that the precursor virus had not circulated widely in humans or swine in the few decades before ( 12,15,24 ) .
more recent analyses of the other gene segments of the virus also support this conclusion .
regression analyses of human and swine influenza sequences obtained from 1930 to the present place the initial circulation of the 1918 precursor virus in humans at approximately 19151918 ( 20 ) . thus , the precursor was probably not circulating widely in humans until shortly before 1918 , nor did it appear to have jumped directly from any species of bird studied to date ( 19 ) . in summary ,
historical records since the 16th century suggest that new influenza pandemics may appear at any time of year , not necessarily in the familiar annual winter patterns of interpandemic years , presumably because newly shifted influenza viruses behave differently when they find a universal or highly susceptible human population .
thereafter , confronted by the selection pressures of population immunity , these pandemic viruses begin to drift genetically and eventually settle into a pattern of annual epidemic recurrences caused by the drifted virus variants . in the 19181919 pandemic , a first or spring wave began in march 1918 and spread unevenly through the united states , europe , and
illness rates were high , but death rates in most locales were not appreciably above normal . a second or fall wave spread globally from september to november 1918 and was highly fatal .
clinical similarities led contemporary observers to conclude initially that they were observing the same disease in the successive waves . the milder forms of illness in all 3 waves were identical and typical of influenza seen in the 1889 pandemic and in prior interpandemic years . in retrospect , even the rapid progressions from uncomplicated influenza infections to fatal pneumonia , a hallmark of the 19181919 fall and winter waves , had been noted in the relatively few severe spring wave cases .
the differences between the waves thus seemed to be primarily in the much higher frequency of complicated , severe , and fatal cases in the last 2 waves .
but 3 extensive pandemic waves of influenza within 1 year , occurring in rapid succession , with only the briefest of quiescent intervals between them , was unprecedented .
the occurrence , and to some extent the severity , of recurrent annual outbreaks , are driven by viral antigenic drift , with an antigenic variant virus emerging to become dominant approximately every 2 to 3 years . without such drift , circulating human influenza viruses would presumably disappear once herd immunity had reached a critical threshold at which further virus spread was sufficiently limited .
the timing and spacing of influenza epidemics in interpandemic years have been subjects of speculation for decades .
factors believed to be responsible include partial herd immunity limiting virus spread in all but the most favorable circumstances , which include lower environmental temperatures and human nasal temperatures ( beneficial to thermolabile viruses such as influenza ) , optimal humidity , increased crowding indoors , and imperfect ventilation due to closed windows and suboptimal airflow .
however , such factors can not explain the 3 pandemic waves of 19181919 , which occurred in the spring - summer , summer - fall , and winter ( of the northern hemisphere ) , respectively .
the first 2 waves occurred at a time of year normally unfavorable to influenza virus spread .
the second wave caused simultaneous outbreaks in the northern and southern hemispheres from september to november .
furthermore , the interwave periods were so brief as to be almost undetectable in some locales . reconciling epidemiologically the steep drop in cases in the first and second waves with the sharp rises in cases of the second and third waves is difficult .
assuming even transient postinfection immunity , how could susceptible persons be too few to sustain transmission at 1 point and yet enough to start a new explosive pandemic wave a few weeks later ? could the virus have mutated profoundly and almost simultaneously around the world , in the short periods between the successive waves ?
acquiring viral drift sufficient to produce new influenza strains capable of escaping population immunity is believed to take years of global circulation , not weeks of local circulation . and
having occurred , such mutated viruses normally take months to spread around the world . at the beginning of other " off season " influenza pandemics , successive distinct waves within a year have not been reported .
the 1889 pandemic , for example , began in the late spring of 1889 and took several months to spread throughout the world , peaking in northern europe and the united states late in 1889 or early in 1890 .
the second recurrence peaked in late spring 1891 ( more than a year after the first pandemic appearance ) and the third in early 1892 ( 21 ) .
as was true for the 1918 pandemic , the second 1891 recurrence produced of the most deaths .
the 3 recurrences in 18891892 , however , were spread over > 3 years , in contrast to 19181919 , when the sequential waves seen in individual countries were typically compressed into 89 months .
what gave the 1918 virus the unprecedented ability to generate rapidly successive pandemic waves is unclear .
because the only 1918 pandemic virus samples we have yet identified are from second - wave patients ( 16 ) , nothing can yet be said about whether the first ( spring ) wave , or for that matter , the third wave , represented circulation of the same virus or variants of it .
data from 1918 suggest that persons infected in the second wave may have been protected from influenza in the third wave .
but the few data bearing on protection during the second and third waves after infection in the first wave are inconclusive and do little to resolve the question of whether the first wave was caused by the same virus or whether major genetic evolutionary events were occurring even as the pandemic exploded and progressed . only influenza rna positive human samples from before 1918 , and from all 3 waves , can answer this question .
viral sequence data now suggest that the entire 1918 virus was novel to humans in , or shortly before , 1918 , and that it thus was not a reassortant virus produced from old existing strains that acquired 1 or more new genes , such as those causing the 1957 and 1968 pandemics . on the contrary , the 1918 virus appears to be an avianlike influenza virus derived in toto from an unknown source ( 17,19 ) , as its 8 genome segments are substantially different from contemporary avian influenza genes .
influenza virus gene sequences from a number of fixed specimens of wild birds collected circa 1918 show little difference from avian viruses isolated today , indicating that avian viruses likely undergo little antigenic change in their natural hosts even over long periods ( 24,25 ) .
for example , the 1918 nucleoprotein ( np ) gene sequence is similar to that of viruses found in wild birds at the amino acid level but very divergent at the nucleotide level , which suggests considerable evolutionary distance between the sources of the 1918 np and of currently sequenced np genes in wild bird strains ( 13,19 ) .
one way of looking at the evolutionary distance of genes is to compare ratios of synonymous to nonsynonymous nucleotide substitutions .
a synonymous substitution represents a silent change , a nucleotide change in a codon that does not result in an amino acid replacement .
a nonsynonymous substitution is a nucleotide change in a codon that results in an amino acid replacement .
generally , a viral gene subjected to immunologic drift pressure or adapting to a new host exhibits a greater percentage of nonsynonymous mutations , while a virus under little selective pressure accumulates mainly synonymous changes .
since little or no selection pressure is exerted on synonymous changes , they are thought to reflect evolutionary distance .
because the 1918 gene segments have more synonymous changes from known sequences of wild bird strains than expected , they are unlikely to have emerged directly from an avian influenza virus similar to those that have been sequenced so far .
this is especially apparent when one examines the differences at 4-fold degenerate codons , the subset of synonymous changes in which , at the third codon position , any of the 4 possible nucleotides can be substituted without changing the resulting amino acid . at the same time , the 1918 sequences have too few amino acid differences from those of wild - bird strains to have spent many years adapting only in a human or swine intermediate host .
one possible explanation is that these unusual gene segments were acquired from a reservoir of influenza virus that has not yet been identified or sampled .
all of these findings beg the question : where did the 1918 virus come from ?
in contrast to the genetic makeup of the 1918 pandemic virus , the novel gene segments of the reassorted 1957 and 1968 pandemic viruses all originated in eurasian avian viruses ( 26 ) ; both human viruses arose by the same mechanism
reassortment of a eurasian wild waterfowl strain with the previously circulating human h1n1 strain . proving the hypothesis that the virus responsible for the 1918 pandemic had a markedly different origin requires samples of human influenza strains circulating before 1918 and samples of influenza strains in the wild that more closely resemble the 1918 sequences .
a series of experiments are under way to model virulence in vitro and in animal models by using viral constructs containing 1918 genes produced by reverse genetics .
influenza virus infection requires binding of the ha protein to sialic acid receptors on host cell surface .
the ha receptor - binding site configuration is different for those influenza viruses adapted to infect birds and those adapted to infect humans .
influenza virus strains adapted to birds preferentially bind sialic acid receptors with ( 23 ) linked sugars ( 2729 ) .
human - adapted influenza viruses are thought to preferentially bind receptors with ( 26 ) linkages .
the switch from this avian receptor configuration requires of the virus only 1 amino acid change ( 30 ) , and the has of all 5 sequenced 1918 viruses have this change , which suggests that it could be a critical step in human host adaptation .
a second change that greatly augments virus binding to the human receptor may also occur , but only 3 of 5 1918 ha sequences have it ( 16 ) .
this means that at least 2 h1n1 receptor - binding variants cocirculated in 1918 : 1 with high - affinity binding to the human receptor and 1 with mixed - affinity binding to both avian and human receptors .
no geographic or chronologic indication exists to suggest that one of these variants was the precursor of the other , nor are there consistent differences between the case histories or histopathologic features of the 5 patients infected with them . whether the viruses were equally transmissible in 1918 , whether they had identical patterns of replication in the respiratory tree , and whether one or both also circulated in the first and third pandemic waves , are unknown . in a series of in vivo experiments ,
recombinant influenza viruses containing between 1 and 5 gene segments of the 1918 virus have been produced .
those constructs bearing the 1918 ha and na are all highly pathogenic in mice ( 31 ) .
furthermore , expression microarray analysis performed on whole lung tissue of mice infected with the 1918 ha / na recombinant showed increased upregulation of genes involved in apoptosis , tissue injury , and oxidative damage ( 32 ) .
these findings are unexpected because the viruses with the 1918 genes had not been adapted to mice ; control experiments in which mice were infected with modern human viruses showed little disease and limited viral replication .
the lungs of animals infected with the 1918 ha / na construct showed bronchial and alveolar epithelial necrosis and a marked inflammatory infiltrate , which suggests that the 1918 ha ( and possibly the na ) contain virulence factors for mice .
the potential role of the other 1918 proteins , singularly and in combination , is also unknown .
experiments to map further the genetic basis of virulence of the 1918 virus in various animal models are planned .
these experiments may help define the viral component to the unusual pathogenicity of the 1918 virus but can not address whether specific host factors in 1918 accounted for unique influenza mortality patterns .
the curve of influenza deaths by age at death has historically , for at least 150 years , been u - shaped ( figure 2 ) , exhibiting mortality peaks in the very young and the very old , with a comparatively low frequency of deaths at all ages in between .
in contrast , age - specific death rates in the 1918 pandemic exhibited a distinct pattern that has not been documented before or since : a " w - shaped " curve , similar to the familiar u - shaped curve but with the addition of a third ( middle ) distinct peak of deaths in young adults 2040 years of age .
influenza and pneumonia death rates for those 1534 years of age in 19181919 , for example , were > 20 times higher than in previous years ( 35 ) .
overall , nearly half of the influenza - related deaths in the 1918 pandemic were in young adults 2040 years of age , a phenomenon unique to that pandemic year .
the 1918 pandemic is also unique among influenza pandemics in that absolute risk of influenza death was higher in those < 65 years of age than in those > 65 ; persons < 65 years of age accounted for > 99% of all excess influenza - related deaths in 19181919 . in comparison ,
the < 65-year age group accounted for 36% of all excess influenza - related deaths in the 1957 h2n2 pandemic and 48% in the 1968 h3n2 pandemic ( 33 ) . "
u- " and " w- " shaped combined influenza and pneumonia mortality , by age at death , per 100,000 persons in each age group , united states , 19111918 .
influenza- and pneumonia - specific death rates are plotted for the interpandemic years 19111917 ( dashed line ) and for the pandemic year 1918 ( solid line ) ( 33,34 ) .
a sharper perspective emerges when 1918 age - specific influenza morbidity rates ( 21 ) are used to adjust the w - shaped mortality curve ( figure 3 , panels , a , b , and c ) .
persons < 35 years of age in 1918 had a disproportionately high influenza incidence ( figure 3 , panel a ) . but
even after adjusting age - specific deaths by age - specific clinical attack rates ( figure 3 , panel b ) , a w - shaped curve with a case - fatality peak in young adults remains and is significantly different from u - shaped age - specific case - fatality curves typically seen in other influenza years , e.g. , 19281929 ( figure 3 , panel c ) .
also , in 1918 those 5 to 14 years of age accounted for a disproportionate number of influenza cases , but had a much lower death rate from influenza and pneumonia than other age groups . to explain this pattern
, we must look beyond properties of the virus to host and environmental factors , possibly including immunopathology ( e.g. , antibody - dependent infection enhancement associated with prior virus exposures ) and exposure to risk cofactors such as coinfecting agents , medications , and environmental agents .
influenza plus pneumonia ( p&i ) ( combined ) age - specific incidence rates per 1,000 persons per age group ( panel a ) , death rates per 1,000 persons , ill and well combined ( panel b ) , and case - fatality rates ( panel c , solid line ) , us public health service house - to - house surveys , 8 states , 1918 ( 36 ) .
a more typical curve of age - specific influenza case - fatality ( panel c , dotted line ) is taken from us public health service surveys during 19281929 ( 37 ) .
one theory that may partially explain these findings is that the 1918 virus had an intrinsically high virulence , tempered only in those patients who had been born before 1889 , e.g. , because of exposure to a then - circulating virus capable of providing partial immunoprotection against the 1918 virus strain only in persons old enough ( > 35 years ) to have been infected during that prior era ( 35 ) .
but this theory would present an additional paradox : an obscure precursor virus that left no detectable trace today would have had to have appeared and disappeared before 1889 and then reappeared more than 3 decades later .
epidemiologic data on rates of clinical influenza by age , collected between 1900 and 1918 , provide good evidence for the emergence of an antigenically novel influenza virus in 1918 ( 21 ) .
jordan showed that from 1900 to 1917 , the 5- to 15-year age group accounted for 11% of total influenza cases , while the > 65-year age group accounted for 6% of influenza cases .
but in 1918 , cases in the 5- to 15-year - old group jumped to 25% of influenza cases ( compatible with exposure to an antigenically novel virus strain ) , while the > 65 age group only accounted for 0.6% of the influenza cases , findings consistent with previously acquired protective immunity caused by an identical or closely related viral protein to which older persons had once been exposed .
persons > 75 years had lower influenza and pneumonia case - fatality rates than they had during the prepandemic period of 19111917 .
at the other end of the age spectrum ( figure 2 ) , a high proportion of deaths in infancy and early childhood in 1918 mimics the age pattern , if not the mortality rate , of other influenza pandemics .
in its disease course and pathologic features , the 1918 pandemic was different in degree , but not in kind , from previous and subsequent pandemics . despite the extraordinary number of global deaths , most influenza cases in 1918 ( > 95% in most locales in industrialized nations ) were mild and essentially indistinguishable from influenza cases today .
furthermore , laboratory experiments with recombinant influenza viruses containing genes from the 1918 virus suggest that the 1918 and 1918-like viruses would be as sensitive as other typical virus strains to the food and drug administration approved antiinfluenza drugs rimantadine and oseltamivir . however , some characteristics of the 1918 pandemic appear unique : most notably , death rates were 520 times higher than expected . clinically and pathologically , these high death rates appear to be the result of several factors , including a higher proportion of severe and complicated infections of the respiratory tract , rather than involvement of organ systems outside the normal range of the influenza virus . also , the deaths were concentrated in an unusually young age group .
finally , in 1918 , 3 separate recurrences of influenza followed each other with unusual rapidity , resulting in 3 explosive pandemic waves within a year 's time ( figure 1 ) .
each of these unique characteristics may reflect genetic features of the 1918 virus , but understanding them will also require examination of host and environmental factors . until we can ascertain which of these factors gave rise to the mortality patterns observed and learn more about the formation of the pandemic , predictions are only educated guesses .
we can only conclude that since it happened once , analogous conditions could lead to an equally devastating pandemic .
like the 1918 virus , h5n1 is an avian virus ( 39 ) , though a distantly related one .
the evolutionary path that led to pandemic emergence in 1918 is entirely unknown , but it appears to be different in many respects from the current situation with h5n1 .
there are no historical data , either in 1918 or in any other pandemic , for establishing that a pandemic " precursor " virus caused a highly pathogenic outbreak in domestic poultry , and no highly pathogenic avian influenza ( hpai ) virus , including h5n1 and a number of others , has ever been known to cause a major human epidemic , let alone a pandemic .
while data bearing on influenza virus human cell adaptation ( e.g. , receptor binding ) are beginning to be understood at the molecular level , the basis for viral adaptation to efficient human - to - human spread , the chief prerequisite for pandemic emergence , is unknown for any influenza virus .
the 1918 virus acquired this trait , but we do not know how , and we currently have no way of knowing whether h5n1 viruses are now in a parallel process of acquiring human - to - human transmissibility . despite an explosion of data on the 1918 virus during the past decade , we are not much closer to understanding pandemic emergence in 2006 than we were in understanding the risk of h1n1 " swine flu " emergence in 1976 .
even with modern antiviral and antibacterial drugs , vaccines , and prevention knowledge , the return of a pandemic virus equivalent in pathogenicity to the virus of 1918 would likely kill > 100 million people worldwide . a pandemic virus with the ( alleged ) pathogenic potential of some recent h5n1 outbreaks
could cause substantially more deaths . whether because of viral , host or environmental factors , the 1918 virus causing the first or spring ' wave was not associated with the exceptional pathogenicity of the second ( fall ) and third ( winter ) waves .
identification of an influenza rna - positive case from the first wave could point to a genetic basis for virulence by allowing differences in viral sequences to be highlighted .
identification of pre-1918 human influenza rna samples would help us understand the timing of emergence of the 1918 virus .
surveillance and genomic sequencing of large numbers of animal influenza viruses will help us understand the genetic basis of host adaptation and the extent of the natural reservoir of influenza viruses .
understanding influenza pandemics in general requires understanding the 1918 pandemic in all its historical , epidemiologic , and biologic aspects . | the " spanish " influenza pandemic of 19181919 , which caused 50 million deaths worldwide , remains an ominous warning to public health .
many questions about its origins , its unusual epidemiologic features , and the basis of its pathogenicity remain unanswered
. the public health implications of the pandemic therefore remain in doubt even as we now grapple with the feared emergence of a pandemic caused by h5n1 or other virus .
however , new information about the 1918 virus is emerging , for example , sequencing of the entire genome from archival autopsy tissues .
but , the viral genome alone is unlikely to provide answers to some critical questions .
understanding the 1918 pandemic and its implications for future pandemics requires careful experimentation and in - depth historical analysis . | Trying To Understand What Happened
When and Where Did the 1918 Influenza Pandemic Arise?
Were the 3 Waves in 19181919 Caused by the Same Virus? If So, How and Why?
What Was the Animal Host Origin of the Pandemic Virus?
What Was the Biological Basis for 1918 Pandemic Virus Pathogenicity?
Why Did the 1918 Virus Kill So Many Healthy Young Adults?
Could a 1918-like Pandemic Appear Again? If So, What Could We Do About It? |
galantamine is a long acting , selective and reversible acetylcholinesterase inhibitor that has been a licensed treatment for alzheimer s disease ( ad ) in the usa , across europe and into asia since 2000 .
the main source of the pharmaceutical product galantamine ( galan / t / amine ) has been the alkaloid galanthamine ( galan / th / amine ) extracted from plants .
galanthamine occurs in several species of the amaryllidaceae family , including galanthus nivalis , leucojum aestivum , lycoris radiate , and narcissus ( daffodil ) spp .
however , with the exception of narcissus spp , the source plants are wild flowers not suitable for agricultural exploitation due to limitations in either resources or research , and consequently supplies have been limited .
opportunities for producing synthetic galantamine have been explored [ 2 , 3 ] , but this has not proved to be a viable alternative .
there is a long - established relationship between the exposure of plants to stress and the production of a vast array of secondary compounds , a proportion of which have medical or other commercial values . in many instances ,
secondary metabolites are implicated in plant stress amelioration and so tend to increase during exposure to stresses [ 47 ] .
for example , lycoris aurea plants exposed to nitrogen stress ( no added n ) show markedly increased levels of the compound in the leaves . to date , however , there has been no attempt to evoke similar stress - induced responses under commercial growing conditions .
upland areas within the uk and northern europe are characterized by poor growing conditions brought about by a combination of low temperatures , high rainfall , exposure to wind , thin soils , and a shortage of major nutrients . consequently agricultural production in these areas
is generally limited to grassland - based ruminant systems that are currently heavily reliant upon government support payments to be economically viable .
however , it has been reported that n. pseudonarcissus grown at altitude may yield higher concentrations of galantamine compared to bulbs grown under lowland conditions . thus growing narcissus spp .
for galanthamine production in marginal areas could impose sufficient stress to increase galanthamine synthesis and so offer a novel solution to the issue of constrained galantamine supplies .
this approach would simultaneously increase the economic resilience and social sustainability of less favored rural areas .
legislative constraints surrounding plowing of long - term grassland ( the land cover accounting for by far the greatest proportion of upland farms ) limit options for traditional cropping however . furthermore , to date it has been the bulbs of narcissus plants that have been used as material for extraction of galanthamine , again requiring soil disturbance .
our proof - of - principle study tested the feasibility of an innovative dual - cropping approach to producing plant - derived galanthamine based on integrating n. pseudonarcissus growing into existing marginal pasture and harvesting green above - ground vegetative plant materials rather than bulbs . by cultivating the crop in marginal growing conditions ,
we seek to exploit the previously observed increase in endogenous galanthamine biosynthesis of n. pseudonarcissus grown under such conditions but also to enhance biosynthesis further through the imposition of interspecies competition with forage grassland plants .
such an approach could offer a win - win - win scenario whereby i ) ad patients have increased access to a proven treatment , ii ) environmental impacts are minimized , and iii ) traditional farming systems within marginal areas are maintained , with their economic viability increased .
lines of n. pseudonarcissus cv . carlton ( size < 10 ; grampian growers , montrose , uk ) were sown into pasture at each of four different sites at the pwllpeiran upland research centre , wales from 253 m a.s.l . to 430 m a.s.l .
at each site bulbs , were planted at three different intervals : 5 cm , 10 cm , and 15 cm apart .
each line of n. pseudonarcissus was 8 m long , and lines were spaced 1 m apart .
planting lines were created using a single bolt - on tooth ( 15 cm10 cm wide ) on the front bucket of a mini - digger ( 8026 cts ; jcb ltd , rocester , staffordshire , uk ) .
bulbs were planted at the prescribed densities by hand , with the tops of the bulb the treatment distance apart .
a 500 g soil sample was collected for each site by bulking 10 soil cores collected at random between the lines of n. pseudonarcissus .
sampling of the n. pseudonarcissus biomass was undertaken when the majority of flowers at a site reached the
gooseneck growth stage , i.e. , were bent downwards to an angle of approximately 45 but were unopened .
the number of n. pseudonarcissus plants growing was counted along a 6 m length in the center of each line .
the corresponding growth was then harvested to a height of 3 cm using grass shears .
the material cut from each line was weighed to determine fresh matter ( fm ) weight .
fifteen leaves and 15 flower stems were then selected from each bag at random for length measurements . to determine dry matter ( dm ) content ,
a sub - sample was taken from each bag and oven dried to constant weight at 60c .
a separate sub - sample of approximately 100 g was taken for subsequent analysis to determine alkaloid concentrations .
leaf sections of approximately 100 mg fm were homogenized in 500 l of methanol adjusted to ph 8 with 25% of ammonia added , and then a further 500 l methanol added .
the samples were left for at least 5 h and then centrifuged at 13,000 r.p.m . for 1 min .
the dry extract was dissolved in 500 l mobile phase a ( see below ) prior to analysis by high - performance liquid chromatography .
a betasil c18 column ( 1504.6 mm ; particle size 5 m ) was used ( fisher scientific uk ltd , loughborough , uk ) .
analyses were conducted with ultra - violet monitoring at 298 nm using a gradient method . the mobile phase consisting of 0.1% trifluoroacetic acid in pure water ( mobile phase a ) and acetonitrile
( mobile phase b ) was filtered through a membrane filter , degassed for 4 min before use and pumped to the column at the rate of 1 ml min .
the data were collected and analyzed using the chrom quest 5.0 hplc database program ( thermo fisher scientific , cramlington , uk ) .
data were analyzed using general analysis of variance with altitude and planting distance as treatment effects ( genstat ( 16th edition ) ; vsn international ltd , hemel hempstead , uk ) . in this context ,
altitude was used as a collective term for the combination of factors relating to soil characteristics , climatic conditions , and exposure , which potentially influence the degree of environmental stress experienced .
lines of n. pseudonarcissus cv . carlton ( size < 10 ; grampian growers , montrose , uk ) were sown into pasture at each of four different sites at the pwllpeiran upland research centre , wales from 253 m a.s.l . to 430 m a.s.l .
at each site bulbs , were planted at three different intervals : 5 cm , 10 cm , and 15 cm apart .
each line of n. pseudonarcissus was 8 m long , and lines were spaced 1 m apart .
planting lines were created using a single bolt - on tooth ( 15 cm10 cm wide ) on the front bucket of a mini - digger ( 8026 cts ; jcb ltd , rocester , staffordshire , uk ) .
bulbs were planted at the prescribed densities by hand , with the tops of the bulb the treatment distance apart .
a 500 g soil sample was collected for each site by bulking 10 soil cores collected at random between the lines of n. pseudonarcissus .
sampling of the n. pseudonarcissus biomass was undertaken when the majority of flowers at a site reached the
gooseneck growth stage , i.e. , were bent downwards to an angle of approximately 45 but were unopened .
the number of n. pseudonarcissus plants growing was counted along a 6 m length in the center of each line .
the corresponding growth was then harvested to a height of 3 cm using grass shears .
the material cut from each line was weighed to determine fresh matter ( fm ) weight .
fifteen leaves and 15 flower stems were then selected from each bag at random for length measurements . to determine dry matter ( dm ) content ,
a sub - sample was taken from each bag and oven dried to constant weight at 60c .
a separate sub - sample of approximately 100 g was taken for subsequent analysis to determine alkaloid concentrations .
leaf sections of approximately 100 mg fm were homogenized in 500 l of methanol adjusted to ph 8 with 25% of ammonia added , and then a further 500 l methanol added .
the samples were left for at least 5 h and then centrifuged at 13,000 r.p.m .
the dry extract was dissolved in 500 l mobile phase a ( see below ) prior to analysis by high - performance liquid chromatography . a betasil c18 column ( 1504.6 mm ; particle size 5 m )
analyses were conducted with ultra - violet monitoring at 298 nm using a gradient method . the mobile phase consisting of 0.1% trifluoroacetic acid in pure water ( mobile phase a ) and acetonitrile ( mobile phase b )
was filtered through a membrane filter , degassed for 4 min before use and pumped to the column at the rate of 1 ml min .
the data were collected and analyzed using the chrom quest 5.0 hplc database program ( thermo fisher scientific , cramlington , uk ) .
data were analyzed using general analysis of variance with altitude and planting distance as treatment effects ( genstat ( 16th edition ) ; vsn international ltd , hemel hempstead , uk ) . in this context ,
altitude was used as a collective term for the combination of factors relating to soil characteristics , climatic conditions , and exposure , which potentially influence the degree of environmental stress experienced .
soil nutrient status across the four sites was variable ( table 1 ) . in terms of the key minerals ,
the concentrations recorded equate to moderate or high indices for potassium and magnesium , but low or very low indices for phosphorus .
the plant counts prior to harvest showed over 80% of the bulbs had successfully established ( table 2 ) , demonstrating that planting under long - term pasture on comparatively poor soils is feasible .
planting distance inevitably had a significant effect on the biomass of herbage harvested ( table 2 ) , but we found no effect of altitude on total dm yield or dm yield per bulb planted .
between - altitude differences in leaf and stem length followed a similar pattern to fm yield .
it has been shown that the concentration of galanthamine in n. pseudonarcissus can vary between different varieties .
the variety carlton is considered to have potential as a commercial source of galantamine due to relatively high concentrations of galanthamine in the bulbs , a large bulb size , and good availability of large volumes of planting stock .
galanthamine concentrations in n. pseudonarcissus leaves have been found to be steady until flowering , before decreasing .
although higher concentrations of alkaloids could potentially be obtained from leaves at an earlier growth stage than the gooseneck stage , we judged that the total amount of biomass , and thus total yield of galanthamine , would not be so high .
the galanthamine concentrations achieved during the current experiment were substantially higher than those recorded during the earlier study focused on bulbs , and higher than concentrations previously reported for above - ground n. pseudonarcissus biomass .
these findings are in keeping with the imposition of greater plant - plant competition when growing in grassland eliciting a greater stress response , but further research is required to verify this relationship . by cutting green material , there is potential for a single planting of bulbs to deliver harvests over multiple years
these results concur with those from an earlier study which found the concentration of galanthamine in other narcissus cultivars to be unaffected by planting depth and density , bulb size , or flower bud removal .
thus , overall , the results suggest that higher planting densities which would favor biomass yield would maximize galanthamine yield , although monitoring over multiple harvest years would be beneficial to determine whether further nutrient depletion from already poor quality soils becomes a factor over time . in summary , this study has verified the feasibility of establishing n. pseudonarcissus under permanent pasture in upland areas as a means of producing plant - derived galanthamine .
further research is now required to verify the commercial viability of this supply route and develop management guidelines that maximize galanthamine yield . | many secondary plant compounds are synthesized in response to stressed growing conditions .
we tested the feasibility of exploiting this feature in a novel strategy for the commercial production of the plant alkaloid galanthamine .
experimental lines of narcissus pseudonarcissus were established under marginal upland permanent pasture at four different sites . over 80% of bulbs successfully established at each site .
there was no effect of altitude or planting density on galanthamine concentrations within vegetative tissues , which were higher than anticipated .
the results confirm that planting n. pseudonarcissus under grass competition in upland areas could offer a novel and sustainable source of plant - derived galanthamine . | INTRODUCTION
MATERIALS AND METHODS
Experimental design and plot preparation
Measurements
Alkaloid analysis
Data analysis
RESULTS AND DISCUSSION |
in the light of developing the level of health care services in the world , taking care of elderly people in general has taken great deal of emphasis since the second half of 20th century .
due to surplus of oil revenues , gcc countries have witnessed during the last four decades a rapid economic , social and cultural transformational movement which produced comprehensive and developmental programs in all aspects .
it is quite notable that the economic growth in gcc countries was parallel with health , social , educational and cultural growth reflected in the concepts dealing with most needy groups of society such as children , handicapped and elders .
small and the large family in the united arab emirates ( uae ) society have always been the safe haven to all its members from children to elderly stage . since the uae society pays a special tribute to elderly people being the men of yesterday and wise men of today , the elderly people have occupied a special place in social services policies implemented by uae government since its establishment in 1971 .
the purpose of this paper is to overview the current services of elderly people especially those with handicapping conditions in uae society .
analysis of social , economical and cultural background is taken into consideration when providing appropriate suggestions and recommendations to enhance and promote elderly programs . | introductionin the light of developing the level of health care services in the world , taking care of elderly people in general has taken great deal of emphasis since the second half of 20th century.contextdue to surplus of oil revenues , gcc countries have witnessed during the last four decades a rapid economic , social and cultural transformational movement which produced comprehensive and developmental programs in all aspects .
it is quite notable that the economic growth in gcc countries was parallel with health , social , educational and cultural growth reflected in the concepts dealing with most needy groups of society such as children , handicapped and elders .
small and the large family in the united arab emirates ( uae ) society have always been the safe haven to all its members from children to elderly stage . since the uae society pays a special tribute to elderly people being the men of yesterday and wise men of today , the elderly people have occupied a special place in social services policies implemented by uae government since its establishment in 1971.aimsthe purpose of this paper is to overview the current services of elderly people especially those with handicapping conditions in uae society .
analysis of social , economical and cultural background is taken into consideration when providing appropriate suggestions and recommendations to enhance and promote elderly programs . | Introduction
Context
Aims |
anemia is a major comorbidity of chronic kidney disease ( ckd ) and in patients with end stage renal disease ( esrd ) on renal replacement therapy .
untreated dialysis patients were often symptomatic and dependent on blood transfusions with their innate morbidity until the advent of erythropoietin stimulating agents ( esa ) , which transformed anemia management in this population .
esa effectively increase hemoglobin and improve quality of life in patients on dialysis.1 currently , while effective , the cost burden of esa is enormous .
it is estimated that medicare costs in the us for esa are approximately two billion us dollars per year .
additionally , recent reports have shown that esa are associated with strokes at high hemoglobin levels.2 while esa address the deficiency in innate erythropoietin production , numerous other factors contribute to anemia as well as resistance to these agents in patients on dialysis .
inflammation , iron deficiency , chronic infections , bone marrow failure , and hyperparathyroidism are among these factors .
it is likely due to inhibition of dna synthesis , thought to be caused by the
methylfolate trap , or alternatively , the formate starvation hypothesis.2 while intuitively , the diagnosis of b12 deficiency should be confirmed by serum b12 levels , this turns out to be neither sensitive nor specific for b12 deficiency .
serum homocysteine levels have superior sensitivity and specifity to serum b12 levels , but elevated methylmalonic acid ( mma ) levels have been shown to be the most sensitive and specific marker in the general population.3,4 the diagnosis can be confirmed with a peripheral smear showing hypersegmented neutrophils in addition to macrocytosis .
in addition , foods that are high in b12 typically contain high concentrations of electrolytes harmful to dialysis patients , limiting them to low b12 foods .
furthermore , b12 is a classic middle size molecule , which is cleared well with modern high flux dialyzers , providing an additional reason for hemodialysis ( hd ) patients to be b12 deficient . in dialysis patients , b12 deficiency presents a diagnostic challenge .
b12 levels , homocysteine , and mma have not been studied as markers of b12 deficiency in this population . while studies have suggested that serum mma levels are increased in ckd,6 esrd and uremia , it is not known whether this is a result of b12 deficiency , or an independent effect of uremia.7,8 although mma levels are elevated in patients with renal insufficiency,9 levels are presumed not to exceed 800 nmol / l as a consequence of renal insufficiency.6 similarly ,
low serum b12 and high homocysteine levels with a subsequent reversal after b12 therapy have been reported in hd patients , but again , these levels have not been validated as a diagnostic tool in this population .
in addition there have been reports of erythropoietin resistance secondary to vitamin b12 deficiency which reversed after supplementation.10,11 in this study , our goals were to determine the incidence of vitamin b12 deficiency in hd patients .
in addition we investigated the effect of b12 supplementation on erythropoietin alpha requirements and on quality of life in b12 deficient patients .
the study was approved by the hospital institutional board review of staten island university hospital , ( staten island , ny , usa ) and all patients provided written informed consent prior to enrolling in the study . in a single center dialysis unit , 132 out of 171 esrd patients ( age 1880 ) who were on maintenance hemodialysis for at least 6 months consented and were screened for vitamin b12 deficiency .
three months prior to treatment , the mean monthly epo dose was 82,067 47,906 and post treatment , the mean epo usage was 65,495 39,691 .
each patient had a thorough review of his or her past medical history and current medications .
inclusion criteria included hd duration of at least 6 months , age greater than 18 years , and the ability to provide written informed consent .
exclusion criteria included factors known to affect vitamin b12 stores , including : a history of hematological cancer , methotrexate use , alcohol ingestion of more than two drinks per day , vegetarian diet , previous gastric surgery , inflammatory bowel disease , pernicious anemia , recent blood transfusion , or patients receiving b12 supplementation .
all laboratory values were drawn prior to the first hd session of the week and prior to initiation of hd . those with an mma level greater than 800
nmol / l had smears of their peripheral blood examined to assess for characteristic findings that are consistent with vitamin b12 deficiency , and the patients with levels less than 800 nmol / l were excluded .
peripheral blood smears were examined by trained hematologists for the presence of oval macrocytic red blood cells ( ie , mean corpuscular volume > 100 ml ) or the presence of hypersegmented neutrophils ( > 5 percent of neutrophils with 5 lobes or 1 neutrophil with 6 lobes ) as the marker for b12 deficiency . of
the patients screened , 60 were confirmed to be vitamin b12 deficient by smear and high mma levels , three refused treatment , leaving 57 enrolled in the study .
the enrolled patients were treated with 1000 mcg of intramuscular vitamin b12 weekly for the first month and then monthly for 3 consecutive months .
all injections were given in the deltoid muscle prior to the initiation of the hemodialysis session .
all patients underwent adjustment of erythropoietin alpha dosing by the treating nephrologist on a bi - weekly basis based on the hemoglobin / hematocrit concentration , as was done for all patients in the unit .
other parameters for esa resistance were addressed which included : iron stores , elevated parathyroid hormone levels , inflammation or infection , and thyroid function .
enrolled patients were asked to complete a kdqol-36 ( kidney disease quality of life instrument adopted for quality of life assessment for patients with kidney disease ) prior to vitamin b12 therapy and were asked to complete the same questionnaire post treatment .
the questionnaire was used to assess if vitamin b12 therapy improved any aspects in quality of life . following therapy , serum b12 , mma levels , percent iron saturation , pararthyroid levels , and peripheral blood smears
vitamin b12 was analyzed on the chemiluminescent immunoassay system ( immulite , johnson and johnson , new brunswick , nj , usa ) and the mma levels on gc - ms analyzer ( dxi , beckman coulter life science , indianapolis , in , usa ) .
the mean age of the 57 subjects who received vitamin b12 therapy was 63.43 14.6 years .
of those , 33 ( 58.9% ) were females and 23 ( 41.1% ) were males ( table 1 ) .
the mean prestudy hemoglobin level was 11.39 g / dl 1.28 g / dl ( range from 8.5 g / dl to 14.2 g / dl ) and the mean poststudy hemoglobin level was 11.48 g / dl 1.11 g / dl ( 8.8 g / dl to 13.5 g / dl ) which was not statistically different .
table 1 shows the mean pre- and post - kdqol-36 results , along with the corresponding mean absolute difference and p - values using the wilcoxon signed - rank test .
of the 22 items , only social function significantly increased from baseline ( 56.7 29.1 ) to post - treatment ( 67.50 24.91 ) ; the mean difference ( 10.8 19.4 ) was statistically significantly different from zero ( p = 0.047 ) . although some of the item scores increased or decreased qualitatively , these changes were not statistically significant .
the definitive diagnosis of vitamin b12 deficiency in our study was based on characteristic findings on peripheral blood smear .
low serum vitamin b12 concentration ( vitamin b12 < 180 mg / ml ) alone was observed in 0.76% ( 1/132 ) of the total patients . using serum mma levels ( .800 mg / dl ) as a marker
however , peripheral smears indicated that 58.25% ( 60/103 ) of the patients had characteristic findings of vitamin b12 deficiency in the population where mma was elevated . prior to treatment
there was no relationship between mma and blood smears , where only 58.25% of patients had mma levels > 800 .
we found that 63.5% ( 33/52 ) were b12-deficient using mma values as the criterion , while 31% ( 16/52 ) were b12-deficient by the smear criterion after therapy .
there was no agreement between the two tests ( p < 0.0011 ) ( table 2 ) .
in the b12-treated group , the average decrease in mean erythropoietin alpha dose from 3 months prior to treatment compared to 3 months after treatment was 16,572 units 41,902 units per month .
this mean change was statistically significantly different from zero , p = 0.0082 by the wilcoxon signed - rank test ( figure 1 ) .
several categories on the quality of life questionnaires were assessed for change before and after treatment . while several categories were compared , only social function was found to be significantly different , p = 0.047 .
anemia continues to be one of the significant factors affecting the esrd population ; it is common and has a substantial effect on morbidity and mortality . in addition
, it places a significant economic burden ; the cost to medicare for esa alone is estimated at two billion us dollars per year .
the prevalence of vitamin b12 deficiency in this population has not been determined in the past and is likely due to the lack of adequate and interpretable tests.8 the gold standard , bone marrow biopsy , is very invasive , and no other tests have been examined in this population where serum biomarkers can vary so greatly from that of the general population . in our study ,
a serum vitamin b12 level was not specific for vitamin b12 deficiency , as even patients with very high levels were found to be deficient .
there were too few patients with low levels to determine sensitivity . in the general population ,
it has been reported to be elevated , but presumed not to exceed levels greater than 800 nmol / l.6 in our data , a high mma level was not specific for b12 deficiency , and since we did not check peripheral smears on patients whose mma levels were low , we are unable to draw conclusions about sensitivity .
we used peripheral blood smears as our gold standard for deficiency and we found the prevalence in our population to be 58% .
all the patients who were treated did experience a drop in mma levels measured after treatment , likely further signifying that b12 stores improved .
there are numerous factors that can influence anemia and erythropoietin alpha dosing , including vitamin supplementation.10 in our study we were able to determine that the addition of vitamin b12 may help in lowering the overall erythropoietin alpha requirements in hd patients independent of other factors .
we were able to determine that a short duration of vitamin b12 supplementation was able to reduce the cumulative monthly erythropoietin alpha requirement by 16,572 units 41,902 units which was significantly different from the group not treated ( p = 0.014 ) .
further , we noticed that at a certain period after cessation of the vitamin b12 dosing , the patients who were confirmed to be vitamin b12 deficient began to require more erythropoietin alpha .
the effect of vitamin b12 is likely to be short lived in this population . in addition to restricted food products allowable in our population , vitamin b12 is actively removed by hemodialysis with high flux membranes .
in addition , we had several patients ( 16/52 ) who were confirmed to continue to be vitamin b12 deficient by smear criterion .
this is felt to be a result of the limited time frame of the study , and we would expect those patients to improve with continued supplementation as body stores are more fully repleted .
this indicates that the decrease in erythropoietin alpha , was truly a decrease in the erythropoietin alpha requirement .
patients on dialysis suffer from numerous factors that impact upon their daily life and overall function .
we administered the kdqol-36 questionnaire to our patients to determine if there is any benefit on their overall daily life with supplementation of vitamin b12 and lower erythropoietin alpha dosing .
the only significant improvement we observed was in social function ( p = 0.047 ) .
while the decrease in erythropoietin alpha dose would not be expected to affect the quality of social function , this may be due to other salutary effects of vitamin b12 repletion in a deficient population .
further , the limited time frame may have influenced the lack of impact upon quality of life and function .
our study showed a reduction in erythropoietin alpha dosing with b12 in the patients we determined to be deficient .
importantly , there were no side effects or toxicities associated with the vitamin b12 injections aside from local site pain .
while this was only a short pilot study , longer treatment might improve anemia , esa sensitivity and overall quality of life in patients on hd .
while further research is needed , we believe our study indicates that vitamin b12 deficiency needs to be addressed in the hd population and particularly those requiring high doses of esa . | backgroundvitamin b12 deficiency may have deleterious effects on end stage renal disease ( esrd ) patients on maintenance hemodialysis , and may increase erythropoietin stimulating agent ( esa ) resistance , yet little is known about its prevalence in this population.methodsserum vitamin b12 and methylmalonic acid ( mma ) levels were drawn from esrd patients prior to hemodialysis .
all patients with mma levels greater than 800 nmol / l had peripheral smears evaluated for b12 deficiency . those with confirmatory smears were considered to be deficient and received intramuscular vitamin b12 injections for 4 months .
post - treatment mma levels and smears were obtained .
erythropoietin dosages were monitored throughout the treatment period.resultsthere was a 58% ( 60/103 ) prevalence of vitamin b12 deficiency as defined by a positive mma level and a positive blood smear .
out of 52 patients with positive smears , 36 ( 69.2% ) were negative on repeat analysis after b12 treatment .
mean epogen ( epo ) dosages significantly decreased by 16,572 41,902 units per month from baseline to the post - b12 t reatment period ( p = 0.0082 , wilcoxon signed - rank test ) .
three months prior to treatment , the mean monthly epo dose was 82,067 47,906 and post , the mean epo usage was 65,495 39,691 .
post treatment hemoglobin levels were not significantly different from baseline.conclusionvitamin b12 supplementation was associated with a decrease in the mean dose of esa administration while maintaining a stable hemoglobin level . maintaining serum vitamin b12 levels
improves functionality , and may allow a decrease in the use of esa s , avoiding their toxicities and significant costs . | Introduction
Study design
Results
Discussion
Conclusion |
invitations to speak at major meetings are prized by scientists because they provide visibility and the ability to present their work efficiently to an audience of peers .
speaking invitations are used by faculty promotion and tenure committees as evidence of external recognition and thus can be critical to academic and professional advancement .
studies have shown that women s participation at meetings is often underrepresented relative to their numbers ( 1 , 2 ) .
in fact , women lag in a variety of academic areas despite increases in the percentage of women scientists ( 36 ) .
given the importance of oral presentations at scientific meetings and academic advancement , a colleague and i recently analyzed the role of convener gender in symposia in two meetings from 2011 to 2013 and noted that the presence of at least one female convener was associated with a marked increase in female speaker participation and a reduction in the probability that the session was all male ( 7 ) .
this communication describes the effect of making that information known to the american society for microbiology ( asm ) general meeting ( gm ) program committee in the years 2014 and 2015 and discusses interventions that were associated with achieving gender parity in 2015 ( fig . 1 ) .
panel a shows the percentages of female speakers for five consecutive asm gms in the years 2011 to 2015 .
panel b shows a plot of the percentage of session convener teams with a least one female convener versus the percentage of women speakers with the year next to the data point .
panel c shows the percentages of female speakers in sessions organized by all - male conveners and those organized by teams with at least one female convener .
panel d shows the percentages of all - male sessions among sessions organized by all - male convener teams and teams with at least one female convener .
data for the years 2011 to 2013 were published previously ( 7 ) and are shown here for comparison with those for the years 2014 and 2015 .
the asm gm is planned by a program committee that meets in washington , dc , in the summer before the meeting .
the committee is composed of scientists who represent the wide breadth of subdisciplines that participate in the gm , ranging from microbial pathogenesis to microbial ecology and basic microbial physiology and genetics .
the format for the organization of the gm has not been changed since the meeting was reorganized in 2011 ( 8) , and the process was described in detail in a prior publication ( 7 ) .
basically , the program committee designs symposia and assigns shepherds who are members of the committee , who in turn choose conveners who select the speakers .
hence , the convener team has great latitude in speaker selection , with the shepherds overseeing the process and occasionally providing input into session content . in the summer of 2013 , the results of the gm gender participation analysis for the years 2011 to 2013 , subsequently published in mbio ( 7 ) , were available and were presented to the program committee planning the 2014 meeting in washington , dc .
two points were made : ( i ) that female speakers were underrepresented relative to the participation of females in the meeting , with too many all - male sessions , and ( ii ) that the presence of at least one female convener was associated with a 72% increase in female participation in those sessions and a 70% reduction in the likelihood of an all - male session .
the simple intervention of presenting the data from prior meetings was associated with an increase in convener teams comprising at least one woman and an increase in female speaker participation at the 2014 meeting to 43% from an average of 29.6% for the prior 3 years but had no effect on the number of all - male sessions ( fig . 1 ) .
in the summer of 2014 , the gender statistics from the 2014 meeting ( which had occurred 1 month earlier ) were again presented to the program committee planning the 2015 meeting , together with an analysis of trends in recent years . however , on that occasion , the committee was also instructed verbally to do better with regard to gender balance and to avoid all - male sessions , except under extraordinary circumstances .
the powerpoint slide used to instruct the committee during the presentation is shown in fig .
2 . the 2015 asm gm essentially achieved gender equity among speakers , with 48.5% being women . as a result of the increases in the percentage of women speaking in the 2014 and 2015 meetings ,
approximately 100 more women presented in those two meetings than the number expected on the basis of the 2011 to 2013 meeting averages .
first , the percentage of all - male speaker sessions was reduced tremendously , and second , the gender difference among conveners disappeared , such that all - male convener teams were equally as likely to invite female speakers as those that included a female convener ( fig . 1 ) .
a positive correlation between the presence of at least one woman on the convener team and the percentage of women speakers was observed when the data from the five meetings were combined ( fig . 1 ) .
these results establish that it is possible to achieve gender equity among speakers in a major scientific meeting in a reasonably short time frame .
although increases in female speaker participation followed two interventions with the program committee involving first the presentation of gender statistics and second a verbal plea to do better with gender balance , i caution that this report merely establishes an association between these interventions and increased female participation and remind the reader that association is not causation .
although it is conceivable that the increase in female participation was a result of the inclusion of more topics where female scientists were better represented , i do not think this explains the data since the overall mix of scientific topics at the asm gm is fairly constant year after year .
another possibility is that women have more women in their scientific networks and that their presence in convener teams resulted in more suggestions for women speakers . in this regard ,
the establishment of networks can contribute to success for women in science ( 9 ) .
it is likely that making the committee aware of the gender statistics influenced their decisions , increasing the number of female conveners and potentially encouraging shepherds to be more proactive in enhancing female participation in their assigned sessions . particularly noteworthy
was the observation that the difference in female speakers associated with convener teams that included at least one female convener disappeared in 2015 .
one explanation for this effect may be that all - male convener teams responded to the data presented to the committee and published previously ( 7 ) and decided to actively recruit more female speakers .
alternatively , it is possible that all - male teams felt that they were under increased scrutiny and increased their selection of women speakers . whatever the explanation , the outcome resulted in significantly increased numbers of women speakers . among asm members ,
women now constitute the majority of the students and postdocs ( 7 ) and therefore represent the future of the society .
thus , it is important to convey the message to the next generation that in this field there is no glass ceiling with regard to gender . since selection as
a speaker is an important form of recognition that can carry tangible benefits with regard to career development , the achievement of gender equity at the asm gm will , i hope , convey the message that both genders are welcomed into the accomplished ranks of the society . in this regard ,
all - male sessions are potentially problematic , as they could be interpreted as indicative of areas with poor gender balance that are perhaps not as welcoming to women .
the near eradication of all - male sessions at the 2015 asm gm shows that it is possible to effect change in this type of session format and thus avoid any subtle negative messages to female scientists in training and younger faculty members .
our results suggest three strategies that may be used to increase the participation of women in meetings where better gender balance is needed and desired .
first , obtaining gender data from prior meetings and presenting them to the program committee can increase awareness of inequities in gender balance .
second , the increased representation of women among those who select speakers was associated with increased female speaker participation .
third , direct instruction to the committee can help focus the group on reducing inequities in gender balance . | abstractin 2015 , the american society for microbiology ( asm ) general meeting essentially achieved gender equity , with 48.5% of the oral presentations being given by women .
the mechanisms associated with increased female participation were ( i ) making the program committee aware of gender statistics , ( ii ) increasing female representation among session convener teams , and ( iii ) direct instruction to try to avoid all - male sessions .
the experience with the asm general meeting shows that it is possible to increase the participation of female speakers in a relatively short time and suggests concrete steps that may be taken to achieve this at other meetings . | Observation |
the experimental setup was based on a broadband
oscillator ( venteon pulse one ) delivering pulses of 5.5 fs duration ,
800 nm central wavelength , and 250 pj pulse energy at a repetition
rate of 80 mhz .
double - chirped mirrors and a pair of glass wedges
were used for dispersion compensation to achieve the optimal pulse
duration on the sample .
the pulse was sent through a properly calibrated ,
compact michelson interferometer with a piezo mirror enabling a range
of delays between 250 fs and + 250 fs in steps of 67 as .
the
beam was then focused by a 20 cm focal length achromat lens onto the
sample surface at an angle of 65 to the surface normal .
the
resulting focal spot dimensions were approximately 50 100 m on the sample .
after the interferometer , a flip mirror could
send the beam to a separate arm for pulse characterization . in this
separate pulse characterization arm ,
the beam passed through a window
identical to the entrance window of the peem chamber and was focused
by an identical lens into a thin bbo crystal for second harmonic generation .
by measuring the second harmonic spectrum as a function of glass thickness
in the beam , the pulse could be completely characterized using the
d - scan technique . to obtain the
experimental near - field autocorrelation trace ,
the images were first
drift compensated using an automatic hot - spot tracking routine .
then ,
the intensity in the area of the spot was measured from each image
and a background intensity measured from a featureless area was subtracted .
the resulting near - field autocorrelation trace was subjected to a
narrow gaussian smoothing filter ( = 60 as ) .
the samples
consisted of polyol - synthesized rice - shaped ag nanoparticles that were drop - cast from ethanol solution onto
substrates of ito on glass .
the samples were directly transferred
into a ultrahigh vacuum chamber with a base pressure of 10 mbar .
after the peem measurements , the samples were studied in a
scanning electron microscope ( hitachi su8010 ) .
finite - difference
time - domain modeling was performed using the commercial software fdtd
solutions from lumerical .
the ag nanoparticles were modeled as ellipsoidal
particles with a dielectric function taken from literature , lying on a fused silica substrate . a staircase - type
mesh with a minimum element size of 2.5
the calculations
were performed with a broadband modulated gaussian total field scattered
field plane wave source .
the excitation spectral range was set to
match the actual laser spectrum covered by the experiment .
frequency - dependent
quantities , such as absorption cross - section and field patterns , were
obtained through fourier transform and normalization by the excitation . | the local enhancement of few - cycle
laser pulses by plasmonic nanostructures opens up for spatiotemporal
control of optical interactions on a nanometer and few - femtosecond
scale .
however , spatially resolved characterization of few - cycle plasmon
dynamics poses a major challenge due to the extreme length and time
scales involved . in this letter
, we experimentally demonstrate local
variations in the dynamics during the few strongest cycles of plasmon - enhanced
fields within individual rice - shaped silver nanoparticles .
this was
done using 5.5 fs laser pulses in an interferometric time - resolved
photoemission electron microscopy setup .
the experiments are supported
by finite - difference time - domain simulations of similar silver structures .
the observed differences in the field dynamics across a single particle
do not reflect differences in plasmon resonance frequency or dephasing
time .
they instead arise from a combination of retardation effects
and the coherent superposition between multiple plasmon modes of the
particle , inherent to a few - cycle pulse excitation .
the ability to
detect and predict local variations in the few - femtosecond time evolution
of multimode coherent plasmon excitations in rationally synthesized
nanoparticles can be used in the tailoring of nanostructures for ultrafast
and nonlinear plasmonics . | Methods |
in february 2013 , a 70-year - old man sought care at the university of amsterdam department of dermatology for a neuropathic ulcer on his left foot .
it was determined that he had a neuropathic ulcer , a complication of nerve damage caused by leprosy , for which he was treated successfully .
he was a native of suriname , where he lived until he moved to the netherlands 1977 .
he had multiple instances of treatment for skin infections , beginning with a diagnosis of leprosy ( hansen disease , caused by the mycobacterium m. leprae ) when he was 10 years of age .
, he moved to groningen , the netherlands , and clofazimine was added to his treatment for leprosy for 6 months . in february 1982 , he moved to amsterdam and sought routine follow - up care for leprosy at the university of amsterdam department of dermatology , and quiescent borderline lepromatous leprosy was diagnosed .
he was treated during february 1982february 1983 with a triple therapy consisting of rifampin , dapsone , and clofazimine . in 1984
, the man traveled to paramaribo and coronie in suriname , where he stayed for 4 weeks during the spring season . during that time
, he fished in creeks . in december 1984 , he sought treatment again at the university of amsterdam department of dermatology for a painful red swelling on the dorsal side of the right wrist after he had scratched it on a rough wall 5 weeks earlier , in mid - november .
beginning in february 1985 , the patient had signs of infection of the wound , including conspicuous edematous swelling of the hand .
however , during april 26may 11 , 1985 , the patient experienced recurrent infection with abscess formation .
a biopsy was taken , and an acid - fast bacilli ( afb ) smear and culture for nontuberculous mycobacteria were done .
the histopathology report indicated scarring dermis and mixed cell infiltrate , leucocytoclastic vasculitis , fibrinoid changes , and some diffusely spread histiocytes .
on june 3 , partly dry wounds , 1 deep ulcer , fistula formation , and spontaneous drainage of another lesion were documented .
the wound was cultured , and amoxicillin and clavulinic acid 4 times daily for 3 weeks was prescribed ; after that time , the patient s treatment for related conditions consisted of local wound care .
after 6 weeks incubation , the mycobacterial culture was positive at 30c but negative at 37c and 45c . in august , ulcers were still present , and multiple nodules at the underarm and an enlarged lymph node at the elbow were palpable .
, the isolate was sent to the institute of tropical medicine of antwerp and was identified as m. ulcerans itm 842 according to phenotypic characteristics ( 3 ) .
the isolate was further analyzed by several genotypic methods ( 36 ) . by april 7 , 1986 ,
phenotypic characteristics of isolates from suriname and french guiana are identical , whereas isolates originating in africa , australia , and asia have different phenotypic characteristics ( 3 ) .
variable - number tandem - repeat genotypic analysis had been shown to discriminate the suriname isolate from french guiana isolates and from mycolactone - producing m. marinum ( 4,5 ) .
results confirmed that this isolate was different from m. ulcerans isolates from other geographic origins , albeit closely related to m. ulcerans strains from french guiana by genetic characteristics ( 4,5 ) .
the incubation period of primary bu is estimated to be 23 months , but latency of the disease can span years .
persons who were in an area to which bu is endemic months to years earlier can manifest bu in a traumatized body site ( 6,7 ) .
co - infections with leprosy and bu have been described , but rarely ( 8) . during 19521977 ,
the patient was treated with dapsone monotherapy . additionally , he received clofazimine for 6 months upon his arrival in the netherlands .
subsequently , during february 1982february 1983 , he was treated with a triple therapy consisting of rifampin , dapsone , and clofazimine .
treatment of bu patients with dapsone has not been properly evaluated in humans ( 9 ) , and clofazimine is not indicated in the treatment of patients with bu ( 10 ) ; however , rifampin is highly bactericidal against this organism ( 11 ) .
if the patient was infected with m. ulcerans before his arrival in the netherlands in 1977 , it is unlikely that the dapsone and clofazimine that he received for treatment of leprosy could have controlled the infection . whether or not he had been infected with m. ulcerans when he first arrived in the netherlands , treatment for 1 year with rifampin and dapsone before he returned to suriname for 4 weeks in 1984 would have been expected to have killed any m. ulcerans .
thus , the most likely hypothesis is that he acquired bu infection during the 4 weeks he spent in suriname in 1984 , and that the scratch obtained against a rough wall in november 1984 in the netherlands reactivated a latent infection .
it is unlikely that the rough wall was contaminated by m. ulcerans , because bu is not considered prevalent in europe .
there are many similarities between this case and that reported by lindo and daniels ( 7 ) .
both patients manifested symptoms of bu after having left a disease - endemic area , and in both patients , the lesion developed at the site of a trauma that occurred in a non disease - endemic country .
correct laboratory confirmation remains essential to confirm the discovery of new foci of bu , and the use of genetic mapping can provide additional information about the geographical location in which patients were infected . the importance of laboratory confirmation of bu has been emphasized by the world health organization s manual for the laboratory diagnosis of bu ( 12).the study of imported cases , and in particular this case from suriname , has enabled us to acquire more knowledge regarding latency and reactivation of the disease , and the existence of new foci . as in the report by meyers
et al ( 13 ) , this case report emphasizes the role of trauma to the skin in the delayed manifestation of this disease caused by m. ulcerans . reports from european countries , canada , america , and australia describe travelers visiting friends or relatives in bu - endemic countries who manifested bu upon return to a non disease - endemic area ( 14,15 ) .
thus , bu may be diagnosed in patients late , or not diagnosed , in non disease - endemic countries , where health care professionals are usually not familiar with the condition or its causal organism .
the clinician s consideration of the patient s recent travel history and awareness of cutaneous and bone lesions of bu are needed for accurate testing , diagnosis , and treatment of the patient . | we report buruli ulcer in a man in the netherlands .
phenotyping of samples indicate the buruli pathogen was acquired in suriname and activated by trauma on return to the netherlands .
awareness of this disease by clinicians in non
buruli ulcer
endemic areas is critical for identification . | The Case-Patient
Conclusions |
solid waste management encompasses a wide range of activities , including collecting garbage , collecting and sorting recyclable materials and collecting and processing of commercial and industrial waste .
risks occur at every step in the process , from the point of the collection at homes , during transportation and at the sites of recycling or disposal .
municipal solid waste ( msw ) workers are at risk for a variety of occupational diseases as a result of daily exposure to work - related hazards . in many developing countries ,
msw is collected manually , and collection of household waste is also a job which requires repeated heavy physical activity .
the socioeconomic status of waste workers is low and their working conditions are unfavorable . for waste collectors , the risk of disease resulting from exposure to various work hazards is high . as well as the risk of fatal and nonfatal occupational accidents .
musculoskeletal problems are also common among waste collectors and in this work group nonfatal injuries are mainly musculoskeletal . musculoskeletal disorders ( msds ) are an important public health problem in both developed and developing countries , with substantial impact on the quality of life as well as a substantial economic burden in compensation costs , lost wages , and productivity .
msds contribute to absenteeism , increased work restriction , transfer to other jobs , or disability more than any other group of diseases with a considerable economic toll on the individual , the organization , and the society as a whole .
moreover , msds are the most expensive form of work disability . as far as india is concerned , msd is one of the major occupational health problems .
estimates have shown that msd contributes to about 40% of all costs toward the treatment of work - related injuries .
workplace activities such as heavy lifting , manual handling , prolonged sitting and standing , bending , and other repetitive tasks are known as risk factors for msds . in india , like many developing countries
, msw is collected manually , and a collection of household waste is also a job , which requires repeated heavy physical activity such as lifting , carrying , pulling , and pushing .
although msds represent a significant occupational issue for msw workers worldwide , there is a dearth of evidence found from the literature review . in developing countries like india
, there has been little study on the health and incidence of msds among solid waste workers .
most of the reviewed studies suffer from limitations related to poor exposure assessment and lack of information on relevant confounders .
considering this fact and focusing on the indian context , this study was aimed to determine the prevalence of musculoskeletal symptoms in varied groups of msw workers and its predictors in chennai city , india .
the present cross - sectional study was carried out among msw workers of chennai , which is capital city of the tamil nadu , a southern indian state .
chennai is the fifth largest city and fourth most populous metropolitan area in the country and 31 largest urban area in the world having a population of 4.7 million .
every day , 4500 mt of garbage is collected and removed from the city , with a per capita generation per day of about 700 g. door to door collection of garbage is prescribed in all zones .
the sample for this study was selected randomly from the employee roster of the municipal registry , chennai city . using probability proportionate to sample
, three zones of chennai were identified for the desired sample size of 220 workers ( collectors , transporters , segregators and disposers , and rag pickers ) , for the study purpose .
permission was obtained from the project manager of private companies handling solid waste operations in chennai city under the chennai municipal corporation .
a pretested validated questionnaire through pilot testing has been used to collect the data on demographic and occupational history .
anthropometric measurements were done using the standardized scale , for assessing the physical status . a globally validated tool called nordic musculoskeletal questionnaire used to collect the information on musculoskeletal pain .
the study proposal was approved by the university institutional ethics committee ( reference : csp/13/jan/26/17 of sri ramachandra university , chennai , india ) prior to the data collection .
a written informed consent was obtained from all of the participants who were willing to be involved in the study , before administering the questionnaire .
the descriptive analysis in the form of the mean with standard deviation or percentage was conducted for demographic variables and occupational information .
t - test and chi - square tests were used for comparison and are shown with p values , considering the level of significance at p < 0.05 .
data analysis was performed using r software ( 3.0.1 version , university of auckland , new zealand ) .
the mean age , height , weight , and body mass index ( bmi ) of all msws were 36.9 10.1 years , 160 9.7 cm , 57.1 11.7 kg , and 22.2 3.8 , respectively .
the total years of work experience was found to be 12.1 7.5 years , and all were working for 8 h in a single shift .
this study population contains 59.5% male and 40.56% female with 105 ( 48% ) being young adults ( < 35 years ) .
more than one - third ( 39% ) of the sample have no formal education , whereas only 14% went to high school or more .
approximately 65% of waste workers had < 5 years of experience , whereas 75% were found to be unskilled in waste management .
it has been found that , 24.5% participants were smokers and 20.5% were alcoholics in this study .
but around 40% of waste workers were habituated to paan , or gutka , or any form of tobacco chewing the anthropometric measurement indicates that 63% workers had normal bmi ( 18.524.9 kg / m ) , whereas only 21% were obese or overweight . of all workers ,
it describes the differences between the subgroups of msws for all demographic and occupational history variables . except for personal habits , employment duration , and msd pain , all other variables found to be statistically significant among sub groups .
descriptive statistics of msws with groups figure 1 demonstrates the prevalence of musculoskeletal pain among all themsw workers .
their period prevalence was asked for the past year , and the point prevalence was asked for the last 7 days concerning pain in any body part , which was self - reported by the participants .
the period prevalence , that is , last 12 months , any body region pain was reported as 70% , whereas point prevalence , that is , last 7 days any body region found to be 91.8%.among all the body parts , knee pain was found to be the highest ( point = 84.5% , period = 60% ) followed by shoulder joint ( point = 74.5% , period = 38.6% ) .
low back pain and wrist joint were next to above as the manual handling involves these two majorly .
other peripheral joints such as elbow , hip , and ankle were in negligible proportion .
prevalence of musculoskeletal disorders among municipal solid wastes the logistic regression model as shown in table 2 , that age increases the chance of getting msds as odds increases from odds ratio ( or ) = 2.75 ( 2535 years ) to or = 7.56 ( > 45 years ) . the odds of females having msds is 2.53 times that of males , within the study population .
however , it loses its significance in the model as adjusted or is found to be 0.77 .
it is obvious that those who have less education ( or = 6.73 ) and lower wealth quintile ( or = 4.01 ) are at greater chance for msds as they are mostly poor ; and lack knowledge of using an ideal posture while working .
personal habits such as smoking ( or = 1.26 ) or tobacco chewing ( or = 1.01 ) were found to have some effect of msds development .
we suspect that obese or overweight people would have a greater chance of msds as the level of physical activity decreases among them .
this study found that as the bmi increases ( or = 2.73 ) , the occurrence of msds also increases from 1.27 to 2.73 times . among all sub - categories , the rag pickers ( or = 2.64 )
were found to be the most vulnerable group to develop msds , followed by disposers ( or = 1.05 ) .
this study has generated the baseline msd profile of the msw workers working under the private agencies in chennai city . this study has presented a 100% of response rate , and this is superior to previous questionnaire studies on this topic such as 70% in hussain and 80% in smith et al . in this group of msw workers ,
most of them reported knee complaint in one or more parts of the body in the last 12 months .
previous studies using the nordic questionnaire in a variety of jobs have reported 1 year prevalence rates of musculoskeletal symptoms .
the results of the present study showed that a high percentage of musculoskeletal complaints ( 90.8% ) were detected among msw collectors , and the knee ( 84.5% ) was the most frequently affected body region .
high prevalence of msds among waste collectors was reported also in studies of brazil , denmark , taiwan , usa , and the netherlands .
the independent risk factors for musculoskeletal symptoms among msw collectors were the duration of employment ; lifting , pulling ; pushing / carrying loads > 20/kg , and walking for long periods of time .
the differences in the distribution of musculoskeletal complaints in between different types of msw collectors were statistically not significant but shown higher in the rag pickers group . in egypt , collectors suffer from msds because of the large volume of waste they have to pack manually .
the illiterate collectors may be unaware of the proper safety techniques during waste collection . in palestine
, 45.7% of surveyed waste collectors have suffered from backache , 34.1% of waste collectors have suffered from twisted ankle , 22.1% have suffered from muscle tear , and 8.7% have suffered from joint pain .
these findings differ from the current study ; as in india several municipalities are transforming waste collection management services from a public - private partnerships model and they engage temporary workers informally ; as in the current study larger population have < 5 years of work experience . in nigeria
, 171 workers representing 61.3% of the sampled solid waste collectors had suffered from musculoskeletal injuries on the job .
solid waste collectors in port harcourt municipality suffered from musculoskeletal injuries because of the large volume of waste they have to pack manually in contrast to the use of hydraulic lifts . in iran , the prevalence of musculoskeletal symptoms , among msw workers in tehran , in low back , knees , shoulders , upper back , and neck were 45% , 29% , 24% , 23% , and 22% , respectively .
the risk of disease increased with increasing years of work as a solid waste worker and smoking .
whereas the current study indicates that illiterate , adult female workers have higher odds for development of msds
. habits such as smoking or alcoholic have less influence on msds status ; on the other hand , a local tobacco chewing , that is , paan / gutka was found to be a contributing factor for msd pain .
lower wealth quintiles population of msws were found to exhibit higher odds for the msds ( or = 4.01 ) . in many developing countries ,
msw is collected manually and collection of household waste is also a job , which requires repeated heavy physical activity such as lifting , carrying , pulling , and pushing .
this study also suggests that msw workers were mostly engaged in manual handling tasks for waste collection .
though the workers were found to be highly experienced , they have little knowledge about health hazards at their workplace ; an integrated screening of workplace hazards and awareness might help to prevent further development of msds among this high risk group .
the nonwork - related risk factors have not been studied explored extensively in this study as well as the musculoskeletal pain was self - reported not the medical diagnosis or confirmatory msds .
this is a single - center study that included a small number of msw collectors ; because of which , the results can not be generalized to the total population of msw collectors .
the higher percentage of musculoskeletal symptoms among msw workers could be attributed to the long duration of employment , the low job control , and the nature of their job , which is physically demanding and involves lifting , pulling , pushing heavy loads , and frequent bending and twisting activities , and walking for long distances in their task profile .
also the less educated ( illiterate or having less than primary education ) collectors seem to be less aware of the potential hazards and health impacts related to the collection methods .
the unfavorable working conditions of msw collectors could be ameliorated through engineering , medical , and legislative measures as well as a proper workplace health promotion model intervention . as education was found to be highly significant in contributing a factor of msds
, an integrated health education consisting of ergonomics and healthy work habits needs to be incorporated in a prehealth screening program .
in addition , a routine workplace health promotion model needs to be activated for the welfare of these undermarginalized population . | background : waste management is a necessary activity around the world , but involves a variety of health hazards . in a developing country like india ,
municipal solid waste is collected manually requiring heavy physical activity . among all occupational health issues ,
musculoskeletal problems are common among waste collectors in the form of nonfatal injuries because of the presence of such risk factors ( lifting , carrying , pulling , and pushing ) .
we have thus conducted this study to evaluate musculoskeletal disorders ( msds ) among municipal solid waste ( msw ) workers.methodology:a cross - sectional study using probability proportionate to size sampling , recruited 220 msw workers from the chennai municipal corporation , india for this study .
a pretested validated questionnaire has been used to collect data on demographic and occupational history and information on musculoskeletal pain .
data analysis was performed using r software ( 3.0.1 version).results:70% of the participants reported that they had been troubled with musculoskeletal pain in one or more of the 9 defined body regions during the last 12 months , whereas 91.8% had pain during the last 7 days .
higher prevalence of symptoms in knees , shoulders , and lower back was found to be 84.5% , 74.5% , and 50.9% respectively .
female illiterate workers with lower socioeconomic status were found to have higher odds for msds . similarly , higher body mass index having no physical activity increases the chance of odds having msds.conclusion:the higher percentage of musculoskeletal symptoms among msw workers could be attributed to the long duration of employment , the low job control , and the nature of their job , which is physically demanding .
a workplace of health promotion model integration can minimize the reported high prevalence , and a prospective cohort study could be recommended further . | Introduction
Methodology
Results
Discussion
Limitations
Conclusion
Financial support and sponsorship
Conflicts of interest |
diagnostic tests assist the physician in assuring an appropriate treatment of the symptoms and as also the disease from which a patient is suffering . in vitro diagnostic tests are widely used in the practice of modern medicine .
nonsteroidal anti - inflammatory drugs ( nsaids ) are amongst the most frequently used drugs for the treatment of a variety of symptoms and diseases .
therefore , it is unsurprising that adverse reactions to nsaids arise in some patients .
the diagnosis of nsaid - triggered , or exacerbated symptoms and diseases , is usually based on medical history or provocative challenge testing [ 18 ] . in some cases the latter
is precluded on ethical grounds ( e.g. , pregnancy , children of young age ) , anatomical alterations ( e.g. , massive nasal polyposis ) , missing compliance of the patient ( e.g. , asthmatic experiences and therefore fear of life threatening symptoms ) , unavailability of specific technical and/or medical equipment ( e.g. , measurement of respiratory function , appropriate emergency unit ) , or inadequately trained staff [ 7 , 8 ] .
several approaches attempted to diagnose and confirm nsaid - triggered symptoms and related diseases by in vitro diagnostic tools during the last 110 years .
some of them were discarded , others are under investigation . in vitro tests , and the results derived when they are used , frequently play a vital role in the overall diagnostic process . to ensure that each reader has the same basic knowledge , we will describe some rudimentary background information on terminology , suggested pathomechanism , test theory and test performance before discussing the in vitro test for diagnosis of nsaid - triggered symptoms and underlying diseases in more detail . to some extent
there is a known discrepancy of medical history and clinical symptoms upon exposure to nsaids , that is , that the provocation test shows negative outcome , whereas patients ' history documented positive reaction .
this may require an additional ( in vitro ) diagnosis to support the physician 's decision for an appropriate treatment of the patient .
unfortunately , any diagnostic procedure , clinically and in vitro , is hampered by one or more inherent as well as exogenous factors .
while some of them are known , most remain unknown , leading to some uncertainty of the test outcome . the nomenclature for nsaid - triggered hypersensitivity reaction in medical literature might be confusing because of the diverse terms employed over last decades and the multiple clinical manifestations in humans . a list of terms used is given in table 1 , making no claim to be complete .
supporting the communication we consider the proposed terminology of report of the nomenclature review committee of the world allergy organisation , dating from 2003 .
this nomenclature is independent of the target organ or patient age group , but is based on the mechanisms that initiate and mediate reactions on our current knowledge , assuming that as knowledge about basic causes and mechanisms improves , the nomenclature will need further review . in this context hypersensitivity
describes objectively reproducible symptoms or signs initiated by exposure to a defined stimulus at a dose tolerated by normal persons .
the terminology aspirin - exacerbated respiratory disease ( aerd ) characterises physical reactions , underlying respiratory diseases , and inhibitors of cyclooxygenase ( cox ) and refers to the clinical syndrome of chronic rhinosinusitis ( crs ) , nasal polyposis , bronchoconstriction in asthmatics , and/or eosinophil inflammation in the upper and lower airways following the ingestion of nsaids blocking the cox-1 enzyme .
an assignment of aerd in the context of adverse drug reactions ( adr ) and drug hypersensitivity is given in figure 1 .
aspirin or aspirin - like drugs . aspirin , the trade name of acetylsalicylic acid ( asa ) , patented in 1899 by bayer ag in germany and in 1900 in the usa , was thereafter successfully marketed all over the world and still remains one of the world 's safest , least expensive , and most frequently used drug . in vivo absorption of salicylate and acetylsalicylic acid varies greatly from one individual to another but is reasonably constant within the same individual .
bound and unbound salicylate shows no differences in aspirin - tolerant and aspirin - intolerant patients , and the rate of deacetylation in serum is the same for aspirin - intolerant patients and normal controls [ 3 , 13 ] .
the pharmacological hallmark of acetylsalicylic acid and other nsaids is the blocking of cox - enzymes causing reduction and/or loss of prostaglandin ( pg ) production as demonstrated in 1971 by ferreira and colleagues , smith and willis , and vane .
meanwhile there are several other nsaids known to inhibit the three known cox - isoenzymes , depending on their selectivity ( an overview is given in table 2 , for review see ) .
the characterisation of nsaid - triggered airway diseases , aerd , was first published by widal et al . in 1922 describing the symptoms , and was annotated by the eponym
as it was written in french it was not until samter and beers popularised this syndrome 35 years later and the syndrome was annotated
severe cutaneous and systemic adverse reactions upon ingestion of aspirin was first documented in 1902 by hirschberg , shortly after the market launch of aspirin .
nearly 90 years ago it was proposed that aspirin activates rather than inhibits peripheral chemoreceptors causing bronchoreactivity , increases blood flow , vascular permeability in skin and permeability of various membranes , bronchoconstriction , secretion of mucous glands , and alters in aspirin - intolerant patients .
although nsaids , and aspirin in particular , are beneficial for their indicated use for most patients , these drugs account for 2125% of all adverse drug reactions .
nsaids are well - known elicitors of upper and lower airway diseases and symptoms of other organs of adults as well as of children [ 5 , 6 , 8 , 21 ]
.
symptom - based diagnosis of aerd is usually performed by medical history , which is confirmed by in vivo provocation tests . for this purpose , oral , nasal , bronchial , or intravenous challenges with nsaids blocking the cox-1 enzyme
are performed followed by measuring of nasal or pulmonary function [ 49 , 12 , 22 ] .
the most common causes of adverse drug reactions are acetylsalicylic acid ( ~80% ) , ibuprofen ( 41% ) , and pyrazolones ( ~9% ) , but also nonselective cox-2 inhibitors are implicated .
medication , usage , and availability are most likely to be responsible for regional differences concerning published prevalence of adverse reactions to single nsaids . therefore , the prevalence of aspirin hypersensitivity in the general population ranges from 0.6 to 2.5% and is up to ~30% in asthmatics also suffering from chronic nasal polyposis .
the risk of severe adverse effects caused by challenge tests , ethical reasons , and/or other contraindications ( see above ) make an in vitro diagnostic test for aerd desirable [ 7 , 8 ] .
in vitro diagnosis of aerd
is discussed in literature with some controversy , most likely based on insufficient and in part contradicting data of earlier and recent publications , as well as by former papers mentioning the unavailability of or inability to establish in vitro tests [ 4 , 9 ] .
however , the underlying concepts pertaining to diagnostic tests in general , and to their use for diagnosis of a diseases in particular , are often less familiar , and perhaps less well understood . the current concepts point to the pathways of lipids
( exemplified by eicosanoids ) and other molecules related to them ( e.g. , cytokines , growth factors , cell surface markers , second messengers of cell signalling , enzymes and receptors ) .
, a shorthand nomenclature of eicosanoids was given in 1987 by smith and willis ) are oxygenated metabolites of the ( 5z , 8z , 11z , 14z)-5,8,11,14-eicosatetraenoic acid , widely known as arachidonic acid ( aa ) .
arachidonic acid is the main source of the eicosanoid cascade in humans involving more than 50 enzymes generating a multiplicity of eicosanoids [ 25 , 26 ] .
concerning nsaid - triggered hypersensitivity and aerd , we selected and focused on the cox- and 5-lipoxygenase ( 5lo- ) pathway .
both pathways are intimately linked to aerd and their implication is well documented ( see subsequent literature ) . beside these pathways and their metabolites , others such as those of cytokines , growth factors , or second messengers of signal transduction
however , it is beyond the scope of this paper to cover all of them in known detail .
via the cox - pathway prostanoids ( i.e. , prostaglandins ( pg ) , thromboxane ( tx ) )
the cox - pathway is blocked by nasids [ 1416 , 27 ] by acetylating the cox enzyme and by causing inhibition of the conversion of arachidonic acid to pg .
cox-1 is constitutively expressed in most tissues and cells and is involved in cellular housekeeping functions .
cox-2 is induced by inflammatory stimuli such as cytokines , growth factors , immunoglobulins , or bacterial toxins .
putative cox-3 mrna is present in several tissues , including that from humans , but functional protein was still not found in humans .
cox-3 is switched on later in inflammation and is suggested for biosynthesis of endogenous anti - inflammatory mediators .
all cox isoenzymes are modified by nsaids with different efficacy ( for review see [ 17 , 27 , 29 ] ) .
there were no differences in the total number of cells stained for cox-1 and cox-2 irrespective of whether tolerant or intolerant to nsaids .
the number and percentage of mast cells , however , that express cox-2 was significantly increased in patients intolerant to nsaids .
furthermore , the expression of cox-2 in epithelial and submucosal cellular was increased in asthmatics . additionally ,
the expression of cox-2 was downregulated in polypous tissue as well as in bronchial muscular cells from patients with aerd [ 31 , 32 ] .
pge2 acts on at least four different seven - transmembrane - domain g - protein - coupled receptor subtypes , nominated ep1 to ep4 .
binding on the ep2 or ep4 causes bronchodilatative effects , whereas binding to ep1/ep3 causes opposite effects .
focusing on the 5lo - pathway , lta4 is generated from aa , which is further metabolised by the ltc4-synthase forming ltc4 , containing three amino acid groups , which is actively exported in the extracellular space .
an overexpression of the promotor of the ltc4-synthase gene was observed in some patients with aerd .
these metabolites have been named in 1960 by brocklehurst as slow - reacting substances of anaphylaxis ( srs - a ) and were identified in 1982 by hammarstrom and samuelsson introducing the term leukotrienes for their occurrence in leukocytes and the characteristic chemical structure of conserved three conjugated double bonds ( see figure 2 ) .
these lt are characterised by a short half - life compared to other lipid mediators and are collectively named peptidoleukotrienes ( plt ) based on their integral part of amino acids [ 35 , 36 ] .
the discovery of the 5-lo pathway caused an enormous interest in this area , largely displacing the classic prostaglandins .
plt are potent vaso- and bronchoconstrictors and have several other biological activities , including an ability to increase vascular permeability or to produce negative ionotropic effects in cardiac contractions [ 37 , 38 ] .
the plt unfold their potential by currently three known seven - transmembrane - domain g - protein - coupled receptor types , named cyslt1 and cyslt2 .
a third dual orphan receptor gpr17 binds uracil nucleotides and plt [ 39 , 40 ] . increased expression of cyslt1 and cyslt2 receptors is correlated to aerd [ 4143 ] .
the chemotactic metabolite ltb4 , also generated from lta4 but formed by a separate enzymatic pathway , is 100-fold less potent concerning bronchoconstriction and acts on a separate ltb4 receptor [ 38 , 44 ] .
other lipid mediators are lipoxins ( lx ) . lxa4 is known to inhibit ltc4 response and is decreased in patients with aerd [ 45 , 46 ] .
further pathogenetic aspects in aerd are extensively reviewed by palikhe et al . in this journal .
attempting to condense the findings outlined above , a complex eicosanoid - protein interaction network has been discovered over the past decades , comprising lipid - derived mediators , second messengers , cytokines , receptors , enzymes , and activation of genes .
the enzymes and receptors of the eicosanoid cascade are found to be quite ubiquitous but also feature differences regarding distribution and expression in tissue and cells in normal circumstances as well as in patients with aerd .
the cox - pathway can be attributed to the control of proliferative states , the 5lo - pathway to wound healing and tissue repair .
both pathways are embedded in other metabolic pathways , for example , the network of cytokines and neuropeptides , which in turn are also interconnected .
gene expression and variability differs between aerd and nsaid - tolerant individuals with peculiarities with respect to ethnic background .
some of these elements may directly interact with intracellular effectors to trigger multiple signalling cascades , while others act extracellularly .
these components control and modulate cell migration , growth , proliferation , and activity of tissues and organs , which will result in differentiated reactions , unveiling symptoms like crs , nasal polyposis , or asthma .
we will mention some of the known pathogenic mechanisms , elaborated in respect to aerd and to their supposed relevance to aerd , but limited to in vitro diagnosis of aerd and nsaid - triggered hypersensitivity . since the first description of adverse reactions to aspirin in airways , it is common knowledge that aerd is triggered by nsaids [ 39 , 1113 , 21 , 22 , 30 , 43 , 46 , 47 , 4952 ] .
eicosanoids comprises a complex network of lipids essentially involved in the pathomechanisms of nsaid - triggered hypersensitivity or aerd .
nsaid hypersensitivity is characterised by an imbalance of eicosanoid synthesis ( i.e. , pge2 and plt ) prior to as well as after exposure to aspirin .
this was initially documented in 1999 as a result of analysing cultured peripheral blood cells as well as nasal mucosa of the same patients .
the concept of the imbalance of eicosanoid synthesis was taken up and approved recently by a theoretical study and supported by former studies .
the genetic as well as functional modifications may be reasonable [ 33 , 4143 , 4651 ] but details are not fully understood , as expression of cox-2 is enhanced in macrophages but no differences of cox-1 or cox-2 expression in patients with aerd and nsaid - tolerant individuals is found .
the reduced levels of pge2 in aerd might be one initial factor for a diminished endogenous inhibition of the housekeeping function of pge2 , when activating the ep2 or ep4 receptor .
these receptor types initiate the production of cyclic adenosine monophosphate ( camp ) , a second messenger , after binding of pge2 .
the synthesis of plt is reduced by a camp - dependent intracellular signal transduction mechanism [ 11 , 48 , 52 ] .
the reduced basal synthesis of housekeeping and induced pge2 [ 11 , 4952 ] , as well as the postulated and validated overexpression of ltc4-synthase and cyslt receptors [ 4143 ] give rational arguments to explain at least in part the shift toward an elevated basal synthesis of plt .
this pge2-plt shift will be further elevated upon exposure to nsaids , but also by other agents initiating the eicosanoid cascade ( e.g. , cytokines like interleukine-1 , or bacterial antigens ) .
thus , the reduced housekeeping / induced pge2 most likely accounts for reduced production of camp , which is induced upon coupling of pge2 on ep2 or ep4 receptors , but can be induced by other signal transduction pathways .
thus , the diminished availability of the housekeeping ( basal ) and induced pge2 will cause a reduced generation of suppressive acting endogenous camp upon exposure to cox - inhibiting agents . in this context ,
pge2 , plt , nsaids , camp , and other factors ( e.g. , bacterial toxins , availability of arachidonic acid , cytokines , and others ) will most likely contribute in a highly complex manner to the multifactorial exacerbation of nsaid - triggered symptoms and diseases .
since the latter half of the 1980s enzyme immunoassay ( eia ) tests are widely used to screen and diagnose a multitude of diseases .
results are mostly classified by a binary outcome as positive ( reactive ) or negative ( nonreactive ) , based on the protocols provided by the test manufacture and evaluation in the laboratory .
the classification is the result of an ordered sequence of several steps , which had been initiated via the testing procedure .
, we will assume that the laboratory performing the test will maintain the complex process of the measurement system , and that the distribution of the results of disease - free and diseased individuals are normally distributed ( see figure 4 ) .
many ( currently and probably in perpetuity ) unknown factors alter these distributions causing overlap to some extent . regardless of where the test outcome threshold is situated on the measurement scale
, some disease - free individuals and diseased ( i.e. , aerd ) will be incorrectly classified as negative ( known as false - negative , dark shaded area left - hand side of figure 4 ) or positive ( known as false - positive , grey area right - hand side of figure 4 ) , respectively .
because any diagnostic test procedure has a single outcome threshold , moving the threshold to the right will reduce the false - positive results of disease - free individuals , but automatically will increase the false - negative error rate of the diseased individuals . similarly , adjusting the threshold to the left will reduce the false - negative error rate , but automatically increases the false - positive error rate ( i.e. , classifying disease - free individuals as patients with aerd ) . only changing the distribution of test results in one or both groups would simultaneously reduce the rates of both types of diagnostic test errors ( i.e. , false - positive and false - negative results ) . unfortunately , in realty this will not be practicable , due to
the complex pathomechanisms underlying aerd , and the composition of the groups investigated like age , sex , medication , mentioned symptoms , interindividual variability of symptoms and syndromes , and our limited knowledge and understanding of the plus - minus clearly defined disease .
the terms sensitivity ( se ) , specificity ( se ) , and posttest probabilities in this concern refer to probability of an ( in vitro ) diagnostic test outcome , not to the equality of reagent or chemicals .
tests with a high sensitivity will correctly identify virtually all patients with nsaid - triggered hypersensitivity with a high probability ; tests with high specificity identify all disease - free individuals correctly with a high probability .
this becomes obvious when referring to figure 4 : sensitivity and specificity correspond to the area under the probability curve ( i.e. , the distribution ) of patients with nsaid - triggered hypersensitivity ( sensitivity of the test , on the right ) and disease - free individuals ( specificity of the test , on the left ) .
unfortunately , inadequacies in the pathological and clinical symptoms or comorbid components and symptom stage , including age and sex distribution of disease - free individuals as well as patients with disease were described ~30 years ago and continued to hamper any diagnostic test . what physicians are really interested in knowing is the extent to which a positive or negative test result accurately predicts the true status of the patient , that is , disease - free or patient with , for example , aerd .
this is commonly referred to as the posttest probability of a disease ( e.g. , aerd ) , or predictive value of a positive test result ( ppv ) . in case of
a negative test result the posttest probability of being disease - free , that is , the predictive value of a negative test result ( npv ) is of interest .
these values depend on not only the sensitivity and specificity , but also on the pretest probability ( or prevalence ) of the disease ( e.g. , aerd ) .
the mathematical algorithm connecting the three probabilities sensitivity , specificity , and prevalence is known as bayes ' theorem ( originally published 1763 by r. price after the death of the english clergyman thomas bayes ) .
it might be easier to grasp the sense of this relationship more directly than looking on the mathematical algorithm : the prevalence of aerd is arguable in respect to the supposed prevalence of 1.2 to 2.8% of a population [ 5 , 8 , 20 ] .
however , as outlined before , there is some uncertainty concerning the prevalence ( i.e. , the pretest probability ) of aerd due to the impossibility of diagnosing this syndrome by an absolute unfailing method .
this marks a further limitation for precisely defining the outcome of an in vitro test by mathematical characteristics .
the probability term likelihood ratio , introduced in 1968 by lustedt and popularised in the 1980s by sacket et al .
is a ratio of the two probabilities sensitivity and 1-specificity , describing the relative probability of a positive diagnostic test result in diseased individuals compared to disease - free individuals which can be calculated [ 56 , 57 ] . for ruling - in a disease
the likelihood ratio should be at least 1 , preferably much higher ( graphically this represents the area on the right site of the test threshold of figure 4 ) . in case of ruling out a disease ,
these values should ideally be much smaller than one . as easily deduced from the above - mentioned aspects ,
the definition of an optimal threshold is not only a question of statistics but rather depends on how the test result will be used
. for screening purpose the threshold will be relatively low , resulting in higher false - positive outcomes .
the low threshold also covers the risk that a patient with a potential nsaid - triggered hypersensitivity but without obvious symptoms would undergo life - threatening reactions upon exposure to nsaids , would not be detected .
thus , the low threshold uncovers those patients with currently mild nsaid - triggered hypersensitivity for appropriate treatment before the disease worsens in the future .
the latter is visualised , in part , by figure 5 , sketching schematically the course of nsaid - triggered hypersensitivity : the symptoms and underlying disease(s ) do not relate in a uniform fashion , rather a pattern of exacerbation and remission is more like an exponentially growing sinus line .
this pattern will be superimposed on the residual changes of the underlying disease and is a further challenge of in vivo and in vitro diagnosis of aerd .
the change in knowledge and concepts concerning the pathogenic mechanisms of aerd reflects the diversity of in vitro diagnostic approaches developed during the last century .
the signt examines serum or plasma collected from patients suffering from aerd and other manifestations of nsaid - triggered symptoms .
the samples are filled into tubes coated with nsaids , including derivatives , or with nsaids / derivatives coupled to a carrier . after an incubation and washing step an anti - ige or anti - igg antibody labelled with a tracer ( e.g. , fluorochrome or chromogen finally converted by an enzyme ) is added .
resulting values of the measurement will identify diseased patients if the value exceeds a predefined threshold ( cutoff ) . underlying
this approach was the observation , that adverse reactions to nasids displayed symptoms such as allergic reactions ( the term allergy was introduced in1906 by von pique as immunoglobulin mediated type of reaction ) .
numerous attempts at detecting an antibody directed against aspirin , derivatives thereof ( e.g. , anti - aspiryl antibodies ) , or to any other supposed nsaids failed to demonstrate an unequivocal antibody . even though antibodies were detected in 1940 by butler et al . and zhu and colleagues , or propyphenazone - specific antibodies by the group of ferreira , or were suspected by the group of settipane .
. also serum level of ige in aspirin - intolerant patients did not differ from non - atopic population .
nevertheless , these investigations contributed some substantial insights to our current understanding of aerd and to other nsaid - triggered symptoms as nonimmunologically mediated diseases .
thus , a signt for the detection of antibodies directed to any nsaid could not be established and is not available for in vitro diagnosis of aerd .
the hrt examines urine samples from patients exposed to nsaids or supernatants of cell culture medium of peripheral blood cells ( pbls ) incubated in vitro with varying concentrations of different nsaids .
the first approach ( analysing urinary samples ) would not be classified as an in vitro test as it affords an in vivo provocation / exposure of the patient .
there are some essential drawbacks , arguing why this procedure ( in vivo challenge ) might not be suitable in some cases ( because of , for example , ethical reasons , age , compliance , technical ; see section 1 ) .
using pbls for measurement of histamine release has to be designated as an in vitro diagnostic test .
the known bronchoconstrictive effect of histamine stimulated the attempt to look for an altered histamine release in patients with aerd .
early investigations demonstrated elevated urinary excretion of a histamine metabolite and elevated plasma histamine levels .
these measurements were , however , not confirmed in nasal lavage upon provocation [ 67 , 68 ] .
preincubation of leucocytes with aspirin failed to alter spontaneous or calcium ionophore - induced histamine release in patients with aerd [ 69 , 70 ] .
this was confirmed for bronchial lavage and for leucocytes by our study performed in vivo as well as in vitro exposure [ 49 , 50 ] .
okuda and colleagues reported elevated histamine release induced by platelet - activating factor from leukocytes of patients with aerd , hosemann and colleagues measured lower histamine content in polypous tissue of patients with aerd than in analgesic - tolerant patients , and the group of stevensson reported elevated plasma histamine levels in only three of seventeen patients .
the low efficiency of histamine release by in vitro stimulation according to the cast - protocol ( see cast ) was also affirmed by a more recent study . even though the hrt was promising , as it depicts a pathomechanistic element of aerd , and it might be suitable to confirm aerd / nsaid sensitivity in specifically selected patients ( e.g. , with an underlying allergic comorbidity ) , it is not suggested for routine in vitro diagnosis of patients with aerd taking into consideration all data currently available .
the ltt ( synonyms are lymphocyte proliferation test or lymphocyte stimulation test ) examines the activity of lymphocytes , notably of t - lymphocytes selected from pbls upon exposure to varying nsaids at different concentrations .
most widely used for quantifying the proliferation is the measurement of h - thymidin uptake by dividing cells from samples of anticoagulated blood .
the relevance of the ltt as model system for analysing patients with hypersensitivity to aspirin was discussed more than 40 decades ago [ 7680 ] .
some nsaids do inhibit others from enhancing the proliferation , but this was not seen consistently [ 8185 ] .
a later study demonstrated an enhanced proliferation of normal lymphocytes , but a diminished h - thymidin uptake by lymphocytes from patients with aerd .
but the inconsistency of results , and the more indirect relation of detecting lymphocyte proliferation to our current pathomechanistic understanding of aerd , often implicated unclear results .
these findings questioned the clinical relevance of the ltt for the detection of adverse reaction to nsaids .
therefore , the ltt is actually not referred to be a suitable tool for in vitro diagnosis for patients with aerd .
the platelets are exposed to varying concentrations of those nsaids which are of interest , for a defined time as validated by the performing laboratory .
around 25 years ago it was suggested that platelets might have a pivotal role in aerd [ 8893 ] .
in a subsequent study , a group led by picado detected no differences in any indices of platelet function studied between aspirin - tolerant and patients with aerd despite a slightly elevated aspirin - triggered pgf2 release .
these results are somehow unexpected , as platelets are known to be potent producer of eicosanoids . despite this approach and the implication of the platelet behaviour in nsaid - triggered symptoms ,
upon addition of a predefined concentration of asa in vitro , samples are analysed using a radio - immunosorbent assay .
this approach was introduced in 1991 by willilams and colleagues and demonstrated no changes in pge2 or pgd2 but lower plasma level of pgf2 in patients with aerd before addition of aspirin , and elevated levels of pgf2 after addition of aspirin , when compared to aspirin - tolerant asthmatics .
this confirmed the hypothesis of an nsiad - triggered alteration of prostanoid metabolism and altered serum protein binding capacities in patients with aerd .
regrettably , there are no further publications documenting the routine use of this promising approach .
the supernatant is analysed using specific enzyme immunoassays for two cytokines , mcp-3 and rantes .
it was proposed that patients with aerd are characterised more likely by a chronic rather than an acute overproduction of mcp-3 and rantes .
the mnlt increased our pathomechanistic understanding of aerd , but an in vivo provocation step is presupposed .
hence , this approach does not meet the criteria of an in vitro test . even though , the mnlt would be suitable to confirm aerd .
the condensate is stored until analysis using an enzyme immunoassays specific for 8-isoprostanes , ltb4 , and pge2 .
this study was presented in 2002 by the group of barnes , demonstrating elevated 8-isoprostanes and plt ( in ~50% of aspirin - intolerant asthmatics ) , no reduced pge2 and unchanged ltb4 in exhaled breath condensate of patients with aerd exposed to nsaids .
these outcomes are in line with other studies also highlighting the implication of leukotrienes and prostanoids regarding diseases of the upper and lower airways [ 33 , 49 , 52 , 99103 ] .
a very recent study extended the analysis of eicosanoids in exhaled breath condensate using gas chromatography / mass spectrometry and high - performance liquid chromatography / mass spectrometry . before lysine aspirin challenge
the amount of 5- and 15-hete was higher in aspirin - intolerant asthmatics than in aspirin - tolerant asthmatics .
the approach of the ebcet depicts some of our recent knowledge on pathomechanisms concerning patients with aerd .
the ebcet , however , might become of some diagnostic value and would confirm aerd .
the cast examines cytokine - primed enriched basophilic granulocytes separated by density - gradient sedimentation from edta - anticoagulated venous pbls .
cells are incubated for 15 up to 40 minutes with varying concentrations of variable nsaids in combination with complement factor 5a , or anti - ige as positive control or vehicle .
reaction is stopped by freezing ; supernatants are analysed by an enzyme immunoassay specified for cysteinyl - leukotrienes .
values from nsaid - stimulated samples have to exceed a predefined threshold ( cutoff ) of cysteinyl - leukotrienes ( = plt ) released from a control sample to reveal a positive test outcome .
the cast , introduced in 1993 by de weck detects a biomarker with high relevance in aerd .
a sensitivity of 41 to 82% and a specificity of 82 to 100% were published .
these variances are a consequence of method , as well as other details ( e.g. , sample preparation , selection of nsaid , duration of exposure , inclusion / exclusion criteria , age , sex , and number of patients / controls ) [ 8 , 73 , 107110 ] .
costimulation with complement factor 5a was claimed by the group of weber to improve sensitivity ; they investigated patients with various underlying diseases .
nevertheless , the cast was successfully established for diagnosis of allergies . according to a more recent study
, the cast uncovers a pathway which was different from the classical ige - mediated pathway .
cast uses doses of asa for in vitro stimulation causing nonspecific basophile activation , and thereby eliminates the usefulness of a cell based diagnostic test for aerd .
therefore , it was suggested that the cast would have low value in diagnosing aerd and other diseases [ 108 , 110 ] .
the bat , also named fast ( flow - cytometric allergen stimulation test ) , examines basophilic granulocytes separated from edta - anticoagulated venous pbls .
cells are incubated with varying concentrations of different nsaids for up to 40 minutes . thereafter
, basophilic granulocytes are double - marked with antibodies directed to ige and cd63 ( or cd203 ) .
the number of positively stained basophiles is measured using a fluorescence activated flow cytometer combined with appropriate software .
a positive test outcome is defined by a laboratory - defined threshold ( cutoff ) of positively stained basophiles .
cd63 is a cell surface glycoprotein that mediates signal transduction events that play a role in the regulation of cell development , ( platelet ) activation , growth and motility .
cd203 represents a transmembrane ecto - nucleotide pyrophosphatase / phospho - diesterase - i enzyme ( e - npp ) , which cleaves phosphodiesters and phosphosulfate bonds .
the last decade follow - up studies were initiated to improve and ensure the technical procedures , thereby using the term bat [ 112115 ] .
the bat depicts an altered appearance of granulocytes , which are known to be implicated in aerd .
variable values of sensitivity ( ~1064% ) and specificity ( ~75100% ) were published depending on the protocols used ( e.g. , sample preparation , selection of nsaid , duration of exposure , inclusion / exclusion criteria , age , sex , and number of patients / controls ) . the clinical use of the bat is controversially discussed [ 112115 ] , pointing to inherent factors influencing the opportunities and limitations of an in vitro diagnostic test .
the flow - cast uses two techniques , the cast ( enzyme immunoassay ) and bat ( flow cytometric assays ) .
the outcomes of both tests are combined . as reviewed in 2005 by the group of de weck ,
combination of bat with cast elevated sensitivity ( to ~73% ) but reduced specificity ( to 71% ) .
it was proposed that in case of a negative result , a nsaid hypersensitivity can not be excluded and a provocation challenge remains necessary if clinically indicated .
this approach demonstrates the usefulness of combining diagnostic procedures as mentioned in the introduction part , but demonstrates also the drawbacks as explained . from a practical point of view , performing both tests makes great demands on laboratory equipment as well as manpower , and therefore impacts on cost - effectiveness .
the release of 15-hydroxyeicosatetraenoic acid ( 15-hete ) is analysed using an enzyme immunoassay specific for 15-hete .
values exceeding a predefined amount threshold line ( cutoff , ~6% exceeding basal release ) identify patients with aerd . the report by kowalski and colleagues in 2005 concluded that the aspirin - triggered release of 15-hete from pbls does , to some extent , mimic the reactions observed in vivo .
15-hete was detected in epithelial cells of nasal polypous tissue as well as in pbls from patients with aerd , but not in asthmatics without nsaid hypersensitivity [ 31 , 119 , 120 ] . already in 1991 the group of picado demonstrated the in vivo evidence of elevated release of 15-hete in nasal secretions of allergic patients .
it was demonstrated , that a pge1 analogue ( misoprostol ) inhibited the aspirin - triggered 15-hete release .
a recent study investigating eight asa - intolerant patients confirmed the elevated level of 15-hete .
the aspitest depicts a pathomechanistic link to aerd and obviously confirms the clinical finding in patients with aerd .
hitherto , there are only few promising publications and future studies will have to prove to which extent the aspitest will be applicable for routine use for in vitro diagnosis of aerd and related diseases .
pbls are diluted in an appropriate buffer before exposure to asa , neuropeptides , and arachidonic acid .
the resulting individualised dynamic eicosanoid pattern is classified in values ranging from 0.0 to 3.0 .
this outcome is then more roughly classified as normal ( 0.0 to 0.5 ) , mild ( < 0.5 ) , moderate ( < 1.5 ) , and severe ( < 2.5 to 3.0 ) ; these values also represent a probability of severity of the symptoms .
this approach was introduced in 1999 by schfer and colleagues and thereafter improved by integrating the growing knowledge of pathomechanistic concepts [ 11 , 4952 , 122 ] .
the fet depicts two biomarkers which are intimately involved in aerd and nsaid - triggered symptoms / diseases .
first studies demonstrated the confirmation of clinically diagnosed aerd prior to , during provocation , and after successful treatment [ 123 , 124 ] .
subsequent studies demonstrated the differentiation of non - airway - related but nsaid - triggered diseases [ 11 , 125127 ] .
others applied the fet for monitoring medical treatment in patients with aerd [ 128 , 129 ] or characterisation of pathophysiological aspects .
values for sensitivity and specificity varied depending on the underlying disease ( airways : 96 and 89% , skin : 96 and 97% , gastrointestinal tract : 6498 and 8289% , resp . ) .
the fet provides context - dependent cell - based confirmative as well as prospective information .
this approach confirms aerd , but also differentiates and/or characterises underlying diseases of closely related symptoms ; in addition , depending on the intended diagnostic challenge ( as exemplified in figures 6(a ) and 6(b ) ) .
the fet differentiates obviously different symptoms of nsaid - triggered hypersensitivity of varying underlying disease .
future studies will have to demonstrate whether the fet , in addition to confirming or differentiating aerd , might provide some prognostic value in nsaid - triggered diseases .
during the last decades our knowledge concerning the pathogenic mechanisms , the terminology of nsaid - triggered symptoms and nsaid - exacerbated diseases ( e.g. , aerd ) and the technical possibilities have continuously improved .
this facilitated the development of new approaches for in vitro diagnosis , starting from no in vitro tests available 110 years ago to twelve in vitro tests developed during the last decades .
some characteristics and suggestions for intended use of the in vitro tests discussed are summarised in table 3 .
our understanding of aerd and nsaid hypersensitivity moved form an immunoglobulin - triggered pathomechanism , diagnosed in the serum , to a multiplexed highly interconnected ( eicosanoid ) imbalance based on pathogenic understanding , diagnosing parameters from cell cultures , for example , genes , enzymes , mediators ( lipids , cytokines , ph , and others ) , receptors , and others .
a schematically simplified pictogram of the cox- and 5-lo pathway referred to for in vitro diagnosis is given in figure 2 .
the complexity of interacting parameters accounts for the initial situation where nsaids ( see table 2 ) start to act . if there is an imbalance of several metabolic and/or genetic parameters , the block of the cox pathway by nsaids will cause an exacerbation of one or more of prestage(s ) of symptoms of a disease . diagnosing the balance and imbalance of the eicosanoid cascade might be fundamental for diagnosing and treating nsaid - triggered diseases ( see figures 1 and 3 ) .
these approaches might be hampered by high individual variability of underlying diseases , genetics , enzymatic / cellular function / activity , and by inclusion and exclusion criteria during sample collection for in vitro diagnosis .
the ( in vitro ) test outcome has to be carefully interpreted by an appropriately trained physician and researcher concerning terminology , inclusion , and exclusion criteria , test theory , and last but not least , the most recent hypothesis and models of pathogenic mechanisms .
all in vitro tests , currently available , consider our current pathogenic and clinical understanding of aerd .
but the intended use by the clinician or researcher will also account for the selection of the most appropriate in vitro diagnostic procedure ( e.g. , screening purpose , confirmation of a clinical diagnosis , individual risk assessment , proof of , prognostic probability , and/or differentiation of symptomatic appearance , monitoring of treatment , effect of single drugs , and many more ) .
considering the limitations of clinical diagnosis of aerd ( see above ) , the provocation
test is yet designated as gold standard in clinical diagnosis , but is usually restricted to confirm acute physical reactions of hyper reactive lower airways and requires the necessity for patients ' provocation . but this gold standard will fail if aerd is still not thoroughly distinctive , a prognostic goal has to be considered , or provocation is precluded .
the relevance of the diagnostic test outcome and its interpretation will improve if the users of an in vitro diagnostic procedure consider all information provided . in this concern ,
functional cellular in vitro approaches mimic some of the complex in vivo processes seen in patients with aerd .
the imbalance of eicosanoids might be a rational decision - making model for in vitro diagnosis of aerd as well as nsaid - triggered hypersensitivity .
future research will demonstrate whether and which functional in vitro approach will prove to be the gold standard of in vitro diagnosis of aerd to support treatment of patients with aerd and related diseases . | aspirin - exacerbated respiratory disease ( aerd ) refers to chronic rhinosinusitis , nasal polyposis , bronchoconstriction , and/or eosinophilic inflammation in asthmatics following the exposure to nonsteroidal anti - inflammatory drugs ( nsaids ) .
a key pathogenic mechanism associated with aerd is the imbalance of eicosanoid metabolism focusing on prostanoid and leukotriene pathways in airway mucosa as well as blood cells .
genetic and functional metabolic studies on vital and non - vital cells pointed to the variability and the crucial role of lipid mediators in disease susceptibility and their response to medication .
eicosanoids , exemplified by prostaglandin e2 ( pge2 ) and peptidoleukotrienes ( plt ) , are potential metabolic biomarkers contributing to the aerd phenotype . also other mediators are implicated in the progress of aerd .
considering the various pathogenic mechanisms of aerd , a multitude of metabolic and genetic markers is suggested to be implicated and were introduced as potential biomarkers for in vitro diagnosis during the past decades .
deduced from an eicosanoid - related pathogenic mechanism , functional tests balancing pge2 and plt as well as other eicosanoids from preferentially vital leukocytes demonstrated their applicability for in vitro diagnosis of aerd . | 1. Introduction
2. Concept of Pathogenic Mechanisms
3. Theoretical Consideration of
4.
5. Conclusions |
mesenchymal stem cells ( mscs ) have been receiving considerable attention in bone
regeneration , both for tissue engineering or cellular therapy .
these cells are capable
of self - renewal or differentiation into multi - lineage cells , including osteoblasts and
condroblasts , under the appropriate conditions .
mscs have been isolated from different
tissues , such as bone marrow , dental pulp , fat , and gingiva .
adipose - derived stem cells ( ascs )
represent one interesting cellular option for clinical applications since these cells
are available in large amounts , are easily accessible and isolated , and they demonstrate
a fast attachment and proliferation in culture .
bone morphogenetic proteins ( bmps ) belong to the transforming growth factor
( tgf - b ) superfamily and were identified by their ability to induce bone formation at
ectopic sites .
in particular , bmp-2 ,
bmp-4 , and bmp-7 have been associated with bone development .
bmp-2 has been used for treatment of bone defects in
orthopedic , spine , and maxillofacial surgeries .
interestingly , it was
observed during the fracture repair that an increase of bmp-4 and bmp-7 occurs in
response to the presence of bmp-2 ,
and it was suggested that bmp-4 and bmp-7 might be able to substitute each other during
bone healing , as has been shown in other tissues where these bmps are
co - expressed .
therefore , the
co - expression of a panel of bmps exert strong synergy , meaning that combination of
certain bmps may be more efficacious than single bmp to stimulate osteogenic
differentiation , and different bmps may act at different nodal points of
osteogenesis . besides the exogenous bmps , it is important to consider
the possibility and the effects of biologically active endogenous bmps expressed by
human mscs .
( 2009 )
observed that bone marrow - derived stem cells promoted osteogenesis by endogenous bmp-2 ,
bmp-4 , and bmp-6 .
classical signaling pathway for bmps begins with the binding of bmp to a dimeric complex
of transmembrane serine - threonine kinase receptors , the type i and type ii receptors .
type i receptors include bmp receptors ( bmprs ) -ia , -ib , and activin receptor type 1
( actr1 ) , while type ii receptors include bmpr - ii , actr2 , and -2b , which are
constitutively active kinases .
these bmprs subtypes have different bmp affinities and
form receptor complexes prior to or after bmp binding , which is thought to regulate bmp
signaling ( smad - dependent versus smad - independent ) .
heteromeric receptor complexes
comprising type i and ii receptors lead to ligand - induced phosphorylation of type i
receptors . following the activation of this receptor , receptor kinases phosphorylate the
transcription factors smad1 , 5 or 8 that subsequently form heteromeric complexes with
smad4 and activate the expression of target genes in the nucleus .
reports have shown that
mitogen - activated protein kinase ( mapk ) and phosphatidylinositol 3-kinase ( pi-3k ) activity are
critical switches for osteogenic differentiation , indicating that other pathways , other
than the smad pathway , regulate the mesenchymal stem cells differentiation after bmp
exposure .
the most usual supplementation for in vitro osteogenic differentiation
includes ascorbate , -glycerophosphate , and dexamethasone .
differently , some reports have
demonstrated that in vitro and in vivo treatments of
ascs with bmp-2 had no consistent effect on osteogenic differentiation .
therefore , this study evaluated the effect of a recombinant bmp-2 as
well as the endogenous bmp-4 and bmp-7 in the osteogenic differentiation of
adipose - derived stem cells ( ascs ) in medium supplemented with ascorbate and
-glycerophosphate .
antibiotics / antifungic agentes were purchased from cultilab ( so paulo , sp ,
brazil ) .
ascorbate , -glycerophosphate , bmp-2 ( recombinant human bmp-2 ) ,
eosin , paraformaldehyde , -nitrophenol phosphate ( npp ) , and silver
nitrate were obtained from sigma - adrich ( st . louis , mo , usa ) . -modified
eagle 's minimal essential medium ( mem modified ) and dulbecco 's modified
eagle 's medium ( dmem ) were from nutricell ( so paulo , sp , brazil ) . fetal
bovine serum , superscript iii , and trizol were
purchased from invitrogen ( carlsbad , ca , usa ) .
kit calcium assay was from bioassay
systems ( hayward , ca , usa ) .
antibodies anti -bmp4 ( mab1049 ) , -bmp7 ( mab4350 ) ,
- actin ( 04 - 1116 ) , -smad1 ( 05 - 1459 ) , -phosphorylated smad1/5/8 ( ab3848 ) ,
-smad4 ( 04 - 1033 ) , anti - rabbit , anti - goat and anti - mouse peroxidase - conjugated
antibodies , and immobilon - p membranes were obtained from millipore ( danvers , ma ,
usa ) .
enhanced chemiluminescence pierce ecl was from thermo scientific ( rockford , il ,
usa ) .
step one detection system and sybr green
pcr master mix were purchased from applied biosystems ( carlsbad , ca , usa ) .
568/10 for human osteoblasts ) and with the
understanding and written consent of the voluntaries , human lipoaspirate tissues from
three healthy patients ( average age 21 ) , with normal body mass indexes , non - smokers ,
and not taking any medication , were processed to isolate the ascs , as described by
zuk , et al .
the ascs were
sub - cultured and used at passage 3 , according to the following groups : asc+om :
osteogenic medium ( om ) ( dmem supplemented with 250 m ascorbate and 10 mm
-glycerophosphate ) ; ascs+om+bmp2 : om with 50 ng / ml bmp-2 .
mc3t3-e1
pre - osteoblasts subclone 4 ( american type culture collection , manassas , va , usa ,
2593 ) were used as the positive control for the determination of the
alkaline phosphatase activity , the evaluation of matrix mineralization , and for the
western blotting assays .
mc3t3-e1 cells were cultured according to the
recommendations in mem modified with 50 g / ml ascorbate and 10 mm
-glycerophosphate .
human
osteoblast explant cultures were
obtained from three patients through biopsies of cortical - porous bone tissue from the
mandible , using dental implant drills .
culture media were supplemented with 10% ( v / v ) fetal bovine serum and 1%
( v / v ) antibiotic/ antifungic .
mc3t3-e1 and ascs ( 9.4x10 cells / well in 24-well plates ) were cultivated
for 7 , 14 , 21 , and 28 days .
trizol was used for total protein
extraction , and the concentrations were determined according to the lowry 's
method .
alp activity was
determined by releasing r - nitrophenol ( np ) from r - nitrophenol phosphate
( npp ) . concisely , 0.5 ml of diethanolamine buffer ( 1.02 m , ph 9.8 , 0.6 mm
magnesium chloride ) and 0.5 ml of npp were incubated for 2 min at
37c .
afterward , 0.1 ml of the extracted protein was added and incubated at
37c . following 30 min , 1 ml of 3 n
absorbances were measured ( infinite m200 , tecan , salzburg , grdig , austria ) at
405 nm , and the alp activity was calculated from a np standard curve and all
values were normalized against the total protein concentration .
mc3t3-e1 and ascs ( 2x10 cells / well on a 96-well plates ) were cultivated
for 21 days .
cells were fixed for 1 h with 3% ( v / v ) aqueous paraformaldehyde and
stained with 1% ( w / v ) silver nitrate under light exposure for 1h , and counterstained
with eosin .
mc3t3-e1 and ascs ( 2x10 cells / well on 96-well plates ) were cultivated for
5 , 12 , 23 , and 32 days , for the calcium quantification at the extracellular matrix .
cells were harvested in 200 l of 0.1 n hcl at 4c for 4 h and
centrifuged at 10,000 x g for 5 min .
mc3t3-e1 and ascs ( 9.4x10 cells / well on 24 well - plates ) were cultivated
for 7 , 14 , 21 , and 28 days .
for the western blotting experiments , 5 g of denatured protein
were loaded onto an sds / polyacrylamide gel .
proteins were transferred to immobilon - p
membranes , which were incubated overnight with anti -smad1 ( 1:500 ) , -phosphorylated
smad1/5/8 ( 1:500 ) , -smad4 ( 1:1000 ) , -bmp4 ( 1:500 ) , -bmp7 ( 2 g / ml ) , or
- actin ( 1:2000 ) antibodies .
after incubation with each corresponding
secondary antibody , the enhanced chemiluminescence pierce ecl substrate was used for
detection , according to the manufacturer 's protocol .
human osteoblasts and ascs ( 9.4x10 cells / well ) were cultured for 1 , 7 ,
14 , 21 , and 28 days on 24-well plates .
total rna was isolated with
trizol reagent , and cdna transcriptions were performed using
oligo ( dt ) primers and superscript iii .
step one
detection system and sybr green pcr master mix were used for the
qpcr .
the comparative threshold cycle ( ct ) method was used in order to quantify
changes in the smad1 , bmpr-2 , osteonectin , and osteocalcin gene expression between
the control ( human osteoblasts ) and treated ascs .
the fold difference between the
control and treatments was calculated according to 2-ct , where ct=(ct control ) -
( ct treatment ) and ct=(ct target gene ) - ( ct internal control , ribosomal 18 s ) .
primer
reverse 5'-3 ' gccctgttactgccattattgtt ; smad1 mrna expression : primer forward
gggactgcctcatgtcatttact .
the results of the alp activity and calcium quantification in all groups
were compared through non - parametric one - way analysis of variance ( anova ) followed by
the student newman - keuls ( snk ) post hoc test .
results of mrna
relative expression in all groups were compared through the student 's t
test .
statistical analyses were performed comparing all treatments for each
time period separately using the graphpad prism 4 software ( graph pad software inc ,
san diego , ca , usa ) at a 95% confidence interval .
antibiotics / antifungic agentes were purchased from cultilab ( so paulo , sp ,
brazil ) .
ascorbate , -glycerophosphate , bmp-2 ( recombinant human bmp-2 ) ,
eosin , paraformaldehyde , -nitrophenol phosphate ( npp ) , and silver
nitrate were obtained from sigma - adrich ( st . louis , mo , usa ) . -modified
eagle 's minimal essential medium ( mem modified ) and dulbecco 's modified
eagle 's medium ( dmem ) were from nutricell ( so paulo , sp , brazil ) . fetal
bovine serum , superscript iii , and trizol were
purchased from invitrogen ( carlsbad , ca , usa ) .
kit calcium assay was from bioassay
systems ( hayward , ca , usa ) .
antibodies anti -bmp4 ( mab1049 ) , -bmp7 ( mab4350 ) ,
- actin ( 04 - 1116 ) , -smad1 ( 05 - 1459 ) , -phosphorylated smad1/5/8 ( ab3848 ) ,
-smad4 ( 04 - 1033 ) , anti - rabbit , anti - goat and anti - mouse peroxidase - conjugated
antibodies , and immobilon - p membranes were obtained from millipore ( danvers , ma ,
usa ) .
enhanced chemiluminescence pierce ecl was from thermo scientific ( rockford , il ,
usa ) .
step one detection system and sybr green
pcr master mix were purchased from applied biosystems ( carlsbad , ca , usa ) .
568/10 for human osteoblasts ) and with the
understanding and written consent of the voluntaries , human lipoaspirate tissues from
three healthy patients ( average age 21 ) , with normal body mass indexes , non - smokers ,
and not taking any medication , were processed to isolate the ascs , as described by
zuk , et al .
the ascs were
sub - cultured and used at passage 3 , according to the following groups : asc+om :
osteogenic medium ( om ) ( dmem supplemented with 250 m ascorbate and 10 mm
-glycerophosphate ) ; ascs+om+bmp2 : om with 50 ng / ml bmp-2 .
mc3t3-e1
pre - osteoblasts subclone 4 ( american type culture collection , manassas , va , usa ,
2593 ) were used as the positive control for the determination of the
alkaline phosphatase activity , the evaluation of matrix mineralization , and for the
western blotting assays .
mc3t3-e1 cells were cultured according to the
recommendations in mem modified with 50 g / ml ascorbate and 10 mm
-glycerophosphate .
human
osteoblast explant cultures were
obtained from three patients through biopsies of cortical - porous bone tissue from the
mandible , using dental implant drills .
culture media were supplemented with 10% ( v / v ) fetal bovine serum and 1%
( v / v ) antibiotic/ antifungic .
mc3t3-e1 and ascs ( 9.4x10 cells / well in 24-well plates ) were cultivated
for 7 , 14 , 21 , and 28 days .
trizol was used for total protein
extraction , and the concentrations were determined according to the lowry 's
method .
alp activity was
determined by releasing r - nitrophenol ( np ) from r - nitrophenol phosphate
( npp ) .
concisely , 0.5 ml of diethanolamine buffer ( 1.02 m , ph 9.8 , 0.6 mm
magnesium chloride ) and 0.5 ml of npp were incubated for 2 min at
37c . afterward , 0.1 ml of the extracted protein was added and incubated at
37c .
following 30 min , 1 ml of 3 n naoh was used to stop the reaction .
absorbances were measured ( infinite m200 , tecan , salzburg , grdig , austria ) at
405 nm , and the alp activity was calculated from a np standard curve and all
values were normalized against the total protein concentration .
mc3t3-e1 and ascs ( 2x10 cells / well on a 96-well plates ) were cultivated
for 21 days .
cells were fixed for 1 h with 3% ( v / v ) aqueous paraformaldehyde and
stained with 1% ( w / v ) silver nitrate under light exposure for 1h , and counterstained
with eosin .
mc3t3-e1 and ascs ( 2x10 cells / well on 96-well plates ) were cultivated for
5 , 12 , 23 , and 32 days , for the calcium quantification at the extracellular matrix .
cells were harvested in 200 l of 0.1 n hcl at 4c for 4 h and
centrifuged at 10,000 x g for 5 min .
mc3t3-e1 and ascs ( 9.4x10 cells / well on 24 well - plates ) were cultivated
for 7 , 14 , 21 , and 28 days . following cells lysis ,
the protein quantification was
performed . for the western blotting experiments , 5 g of denatured protein
proteins were transferred to immobilon - p
membranes , which were incubated overnight with anti -smad1 ( 1:500 ) , -phosphorylated
smad1/5/8 ( 1:500 ) , -smad4 ( 1:1000 ) , -bmp4 ( 1:500 ) , -bmp7 ( 2 g / ml ) , or
- actin ( 1:2000 ) antibodies .
after incubation with each corresponding
secondary antibody , the enhanced chemiluminescence pierce ecl substrate was used for
detection , according to the manufacturer 's protocol .
human osteoblasts and ascs ( 9.4x10 cells / well ) were cultured for 1 , 7 ,
14 , 21 , and 28 days on 24-well plates .
total rna was isolated with
trizol reagent , and cdna transcriptions were performed using
oligo ( dt ) primers and superscript iii .
step one
detection system and sybr green pcr master mix were used for the
qpcr .
the comparative threshold cycle ( ct ) method was used in order to quantify
changes in the smad1 , bmpr-2 , osteonectin , and osteocalcin gene expression between
the control ( human osteoblasts ) and treated ascs . the fold difference between the
control and treatments
was calculated according to 2-ct , where ct=(ct control ) -
( ct treatment ) and ct=(ct target gene ) - ( ct internal control , ribosomal 18 s ) .
primer
reverse 5'-3 ' gccctgttactgccattattgtt ; smad1 mrna expression : primer forward
gggactgcctcatgtcatttact .
primer reverse
aactcgtcacagtccggattg ; osteonectin mrna expression : primer forward
cgggtgaagaagatccatgag . primer reverse ctgccagtgtacagggaagatg .
the results of the alp activity and calcium quantification in all groups
were compared through non - parametric one - way analysis of variance ( anova ) followed by
the student newman - keuls ( snk ) post hoc test .
results of mrna
relative expression in all groups were compared through the student 's t
test .
statistical analyses were performed comparing all treatments for each
time period separately using the graphpad prism 4 software ( graph pad software inc ,
san diego , ca , usa ) at a 95% confidence interval .
ascs+om and asc+om+bmp2 demonstrated similar alp activities , and mc3t3-e1 cells
( positive control ) showed the highest activity ( r=0.0004 ) at day 7 .
ascs+om+bmp2
up - regulated the alp activity compared to acs+om and mc3t3-e1 at day 14
( =0.00379 ) . at day 21 , ascs+om+bmp2 and mc3t3-e1 demonstrated the highest
activities ( r=0.0087 ) .
there was no statistically significant difference among the
groups at day 28 ( >0.05 ) ( figure 1 ) .
different letters refer to statistical significant differences ( anova / snk ,
<0.05 ) von kossa staining demonstrated that all groups presented phosphate at the
extracellular matrix at day 21 ( figure 2a - c ) .
adipose - derived
stem cells ( ascs ) with osteogenic medium ( om ) .
bar=500 m ; b ) ascs with om
supplemented with bmp-2 ; c ) mc3t3-e1 cells ( positive control ) ; d ) calcium
quantification at days 12 , 23 , and 32 .
different letters refer to statistical
significant differences ( anova / snk , <0.05 ) at day 5 , calcium deposition was not observed at the extracellular matrix . at day 12 ,
mc3t3-e1 demonstrated the highest calcium amount ( r<0.0001 ) , ascs+om and
ascs+om+bmp2 showed similar results .
there was no statistically significant
difference among the groups ( r>0.05 ) at days 23 and 32 ( figure 2d ) .
ascs+om+bmp2 expressed more smad1 when compared to mc3t3-e1 and ascs+om at day 7 . at
days 14 and 21 , all groups demonstrated similar smad1 expressions .
ascs+om
demonstrated the lowest expression at day 28 ( figure
3 ) .
protein expression evaluated by
western blotting , at days 7 , 14 , 21 , and 28 only mc3t3-e1 expressed phosphorylated smad1/5/8 at day 7 .
all groups demonstrated
similar expression of these proteins at day 14 . at day 21 , ascs+om+bmp2 expressed
more than ascs+om , while mc3t3-e1 stopped these expressions .
all groups had no
expression of these phosphorylated proteins at day 28 ( figure 3 ) .
ascs+om showed the highest smad4 expression at day 7 . at day 14 , mc3t3-e1
demonstrated the highest expression followed by ascs+om+bmp2 and then by ascs+om .
mc3t3-e1 demonstrated the highest level of smad4 at day 21 , followed by ascs+om and
then by ascs+om+bmp2 . at day 28
, mc3t3-e1 showed the highest expression , while
ascs+om and ascs+om+bmp2 demonstrated similar levels of smad4 ( figure 3 ) .
ascs+om
demonstrated the highest bmp-4 expression followed by ascs+om+bmp2 and then mc3t3-e1
at day 21 .
figure 3 did not show differences
between ascs+om and ascs+om+bmp2 groups at day 28 , while mc3t3-e1 demonstrated a weak
expression .
bmp-7 expressions were smaller than the other groups at day 28
( figure 3 ) .
figure 4a shows that bmpr - ii relative mrna
expressions were similar for ascs+om and ascs+om+bmp2 ( >0.05 ) at days 1 ,
7 , 14 , and 21 . at day 28
a ) bmpr - ii mrna expression ; b ) smad1 mrna expression ;
c ) osteocalcin mrna relative expression ; d ) osteonectin mrna expression .
different letters refer to statistical significant differences ( t test ,
<0.05 ) ascs+om+bmp2 showed the highest levels of smad1 relative mrna expression at days 1
( <0.0001 ) , 7 ( =0.0002 ) , and 21 ( =0.0008 ) .
ascs+om
demonstrated the highest expressions at days 14 ( =0.0014 ) and 28
( =0.0003 ) ( figure 4b ) .
osteocalcin and osteonectin relative mrna expressions were similar for all groups for
all time periods ( >0.05 ) ( figure 4c
and 4d ) .
ascs+om and asc+om+bmp2 demonstrated similar alp activities , and mc3t3-e1 cells
( positive control ) showed the highest activity ( r=0.0004 ) at day 7 .
ascs+om+bmp2
up - regulated the alp activity compared to acs+om and mc3t3-e1 at day 14
( =0.00379 ) . at day 21 , ascs+om+bmp2 and mc3t3-e1 demonstrated the highest
activities ( r=0.0087 ) .
there was no statistically significant difference among the
groups at day 28 ( >0.05 ) ( figure 1 ) .
von kossa staining demonstrated that all groups presented phosphate at the
extracellular matrix at day 21 ( figure 2a - c ) .
adipose - derived
stem cells ( ascs ) with osteogenic medium ( om ) .
bar=500 m ; b ) ascs with om
supplemented with bmp-2 ; c ) mc3t3-e1 cells ( positive control ) ; d ) calcium
quantification at days 12 , 23 , and 32 .
different letters refer to statistical
significant differences ( anova / snk , <0.05 ) at day 5 , calcium deposition was not observed at the extracellular matrix . at day 12 ,
mc3t3-e1 demonstrated the highest calcium amount ( r<0.0001 ) , ascs+om and
ascs+om+bmp2 showed similar results .
there was no statistically significant
difference among the groups ( r>0.05 ) at days 23 and 32 ( figure 2d ) .
ascs+om+bmp2 expressed more smad1 when compared to mc3t3-e1 and ascs+om at day 7 . at
days 14 and 21 , all groups demonstrated similar smad1 expressions .
ascs+om
demonstrated the lowest expression at day 28 ( figure
3 ) .
protein expression evaluated by
western blotting , at days 7 , 14 , 21 , and 28 only mc3t3-e1 expressed phosphorylated smad1/5/8 at day 7 .
all groups demonstrated
similar expression of these proteins at day 14 . at day 21 , ascs+om+bmp2 expressed
more than ascs+om , while mc3t3-e1 stopped these expressions .
all groups had no
expression of these phosphorylated proteins at day 28 ( figure 3 ) .
ascs+om showed the highest smad4 expression at day 7 . at day 14 , mc3t3-e1
demonstrated the highest expression followed by ascs+om+bmp2 and then by ascs+om .
mc3t3-e1 demonstrated the highest level of smad4 at day 21 , followed by ascs+om and
then by ascs+om+bmp2 . at day 28
, mc3t3-e1 showed the highest expression , while
ascs+om and ascs+om+bmp2 demonstrated similar levels of smad4 ( figure 3 ) .
ascs+om
demonstrated the highest bmp-4 expression followed by ascs+om+bmp2 and then mc3t3-e1
at day 21 .
figure 3 did not show differences
between ascs+om and ascs+om+bmp2 groups at day 28 , while mc3t3-e1 demonstrated a weak
expression .
ascs+om bmp-7 expressions were smaller than the other groups at day 28
( figure 3 ) .
figure 4a shows that bmpr - ii relative mrna
expressions were similar for ascs+om and ascs+om+bmp2 ( >0.05 ) at days 1 ,
7 , 14 , and 21 . at day 28
a ) bmpr - ii mrna expression ; b ) smad1 mrna expression ;
c ) osteocalcin mrna relative expression ; d ) osteonectin mrna expression .
different letters refer to statistical significant differences ( t test ,
<0.05 ) ascs+om+bmp2 showed the highest levels of smad1 relative mrna expression at days 1
( <0.0001 ) , 7 ( =0.0002 ) , and 21 ( =0.0008 ) .
ascs+om
demonstrated the highest expressions at days 14 ( =0.0014 ) and 28
( =0.0003 ) ( figure 4b ) .
osteocalcin and osteonectin relative mrna expressions were similar for all groups for
all time periods ( >0.05 ) ( figure 4c
and 4d ) .
bmp-2 is considered a potent local factor that promotes bone formation and has been used as an osteogenic
supplementation .
this report evaluated the effects of bmp-2 associated with
ascorbate and -glycerophosphate to induce osteogenic differentiation of human
ascs during the entire in vitro osteogenic process ( day 1 to 32 ) , and
the effects of endogenous bmp-4 and bmp-7 in this process .
herein , efforts were made to
study osteogenic markers , such as alp activity , smads , bmpr - ii , osteonectin ,
osteocalcin , and calcium deposition , as discussed below .
an enzymatic hydrolysis activity of alp is necessary to initiate biological
mineralization by hydrolyzing -glycerophosphate , which serves as an additional
source of phosphate ions .
some
proteins are involved in the extracellular matrix deposition and mineralization during
bone formation , such as osteonectin and osteocalcin .
osteonectin is an intermediate
phase glycoprotein that binds calcium and type i collagen with a high affinity .
osteocalcin is produced exclusively in bone , dentin , and cementum and it represents
approximately 20% of non - collagenous proteins .
finally , a functional assay of terminally differentiated
osteoblasts is the extracellular matrix mineralization , which can be evaluated by the
calcium quantification .
in general , we observed that the supplementation with bmp-2 did not increase the levels
of osteogenic markers in the initial , intermediate , or final phases of human ascs
differentiation .
our results demonstrated that these cells expressed endogenous bmp-4
and bmp-7 , and we were encouraged to suggest that these endogenous bmps were
biologically active due to the observed induction of alp activity , upregulation of
osteogenic genes ( osteocalcin and osteonectin ) , and increase of calcium deposition in
cells treated without bmp-2 .
( 2009 ) observed that human bone marrow - derived
mesenchymal cells were able to express endogenous bmp-4 , but not bmp-7 .
herein , the peak of alp activity , which indicates the initial phase of extracellular
matrix mineralization , occurred at day 7 . at that stage , ascs treated in the presence or
absence of bmp-2 demonstrated similar results , suggesting that bmp-2 supplementation did
not improve the initial phase of osteogenic differentiation , in accordance with song , et
al .
( 2007 ) ( human bone
marrow - derived stem cells ) and differing from wang , et al .
it is important
to appreciate that explanations made with bmps in human cells can be extrapolated to the
human system with more precision .
the presence of bmp-2 in medium supplementation did not up - regulate the bmpr - ii mrna
expression , similarly to that found by wang , et al . (
we also observed a similar expression of osteocalcin and
osteonectin mrna relative expression for ascs treated with or without bmp-2 .
( 2011 ) demonstrated that
induction of ascs with om containing bmp-2 for 7 days significantly augmented expression
of osteopontin and osteocalcin , and decreased alp and osteonectin gene expressions .
however , when the exposure time to bmp-2 was increased to either 21 or 28 days ( the
terminal differentiation stages of ascs ) any changes to the gene expression ,
attributable to bmp-2 was lost .
( 2006 ) observed similar osteonectin expression in mouse ascs
cultures using control medium and osteogenic medium with bmp-2 .
complementary , our
results demonstrated that ascs treated with or without exogenous bmp-2 showed similar
calcium deposition at the extracellular matrix , as found by song , et al .
conversely , beloti and
rosa ( 2005 ) demonstrated that
osteoblast differentiation of human bone marrow cells did not occur only in the presence
of ascorbate and -glycerophosphate .
( 2010 ) observed that the addition of
bmp-2 or bmp-6 to dexamethasone , ascorbic acid , and -glycerophosphate did not
enhance osteogenic differentiation of human periodontal ligament cells , since they
observed that neither of the bmps induced in vitro mineralization ,
despite the increase of alp activity .
bmp-2 supplementation led to the highest levels of smad1 relative mrna expression at
days 1 , 7 , and 21 , the highest expression of smad1 at day 7 , and the highest expression
of smad4 at day 14 .
( 2009 ) demonstrated that the treatment of osteoblast - like cells with bmp-4 increases
smad1/5 phosphorylation .
( 2001 ) also observed that the bmp-4 activation in c2c12 mouse muscle myoblast cell line
occurs via the smad pathway .
( 2009 ) demonstrated that
osteogenesis by endogenous bmp-4 and bmp-6 was independent of smad activation and
dependent on phosphatidylinositol 3-kinase ( pi-3k ) activation in marrow - derived stem
cells .
therefore , bmp-4 activation has been related to pathways dependent or independent
of smads .
these different findings may be due to the different lineage cell type ,
species , and culture conditions .
( 2011 ) did not observe any significant changes in smad1/5/8
phosphorylation levels upon bmp-2 induction .
additionally , these authors observed that
the removal of dexamethasone from the bmp-2 did not significantly change the
mineralization capacity of ascs from that measured when samples were induced with bmp-2
and om containing dexamethasone .
such a finding would suggest that the lack of effect of
bmp-2 was not due to any interference by the presence of dexamethasone .
despite that the presence of bmp-2 in the osteogenic supplementation led to the highest
expression of smads , this protein did not increase the alp activity at the peak of this
enzyme , the expression of osteonectin and osteocalcin mrna , or the calcium deposition at
the extracellular matrix , an indicator of osteoblast final maturation .
( 2003 ) observed that
ascs cultured with bmp-2 demonstrated more alp and matrix calcification than the
positive osteoblast control . considering that both treatments ( ascs+om and ascs+om+bmp2 )
led to similar effects in osteogenic differentiation , the effects of exogenous bmp-2
could be counterbalanced by the highest expression of endogenous bmp-4 and bmp-7 .
herein , probably endogenous bmp-4 and bmp-7 pathways were independent of smad
activation , corroborating seib , et al .
there are a number of possible explanations for the reasons
that ascs had demonstrated similar osteogenic differentiation in the presence or absence
of bmp-2 , including the maturation of osteogenic progenitors during culture , emergence
of a dominant cell type or spontaneous differentiation of mscs into the
osteoblasts .
although a combination of these factors could be
responsible for the results herein , endogenous bmps production could be a critical
factor in any of these scenarios .
moreover , the
supplementation of ascs with bmp-2 did not increase the level of osteogenic markers in
the initial ( alp activity ) , intermediate ( osteonectin and osteocalcin ) , or final
( calcium deposition ) phases suggesting that the exogenous addition of bmp-2 did not
improve the in vitro osteogenesis process of human ascs .
the authors would like to thank to cnpq / mct and capes / mec ( brazil ) for their research
fellowships .
william f. zambuzzi ( universidade do grande rio ) for gently
providing the mc3t3-e1 cells .
the authors would also like to thank msc lucas barcelos
oliveira for his proficient editorial assistance .
this work was partially supported
by mct / sebrae/ finep ( grant number 23080.039510/2007 - 12 ) . | bone morphogenetic protein type 2 ( bmp-2 ) is a potent local factor , which promotes
bone formation and has been used as an osteogenic supplement for mesenchymal stem
cells.objectivesthis study evaluated the effect of a recombinant bmp-2 as well as the endogenous
bmp-4 and bmp-7 in the osteogenic differentiation of adipose - derived stem cells
( ascs ) in medium supplemented with ascorbate and -glycerophosphate .
material and methodshuman ascs were treated with osteogenic medium in the presence ( ascs+om+bmp-2 ) or
absence ( ascs+om ) of bmp-2 .
the alkaline phosphatase ( alp ) activity was determined
and the extracellular matrix mineralization was evaluated by von kossa staining
and calcium quantification .
the expressions of bmp-4 , bmp-7 , smad1 , smad4 , and
phosphorylated smad1/5/8 were analyzed by western blotting .
relative mrna
expressions of smad1 , bmp receptor type ii ( bmpr - ii ) , osteonectin , and osteocalcin
were evaluated by qpcr .
results : ascs+om demonstrated the highest expression of
bmp-4 and bmp-7 at days 21 and 7 , respectively , the highest levels of bmpr - ii mrna
expression at day 28 , and the highest levels of smad1 mrna at days 14 and 28 .
ascs+om+bmp-2 demonstrated the highest levels of smad1 mrna expression at days 1 ,
7 , and 21 , the highest expression of smad1 at day 7 , the highest expression of
smad4 at day 14 , the highest alp activity at days 14 and 21 , and expression of
phosphorylated smad1/5/8 at day 7 .
ascs+om and ascs+om+bmp2 showed similar alp
activity at days 7 and 28 , similar osteonectin and osteocalcin mrna expression at
all time periods , and similar calcium depositions at all time periods .
conclusionswe concluded that human ascs expressed endogenous bmp-4 and bmp-7 .
moreover , the
supplementation of ascs with bmp-2 did not increase the level of osteogenic
markers in the initial ( alp activity ) , intermediate ( osteonectin and osteocalcin ) ,
or final ( calcium deposition ) phases , suggesting that the exogenous addition of
bmp-2 did not improve the in vitro osteogenesis process of human
ascs . | INTRODUCTION
MATERIALS AND METHODS
Reagents
Isolation and culture of human adipose-derived stem cells
Determination of alkaline phosphatase activity
Evaluation of matrix mineralization
Western blotting
qPCR
Statistical analysis
RESULTS
BMP-2 improved the alkaline phosphatase activity
BMP-2 did not improve the calcium at the extracellular matrix
Expression of osteoblast-related proteins
Relative expression of osteoblast-related mRNA
DISCUSSION
CONCLUSIONS
ACKNOWLEDGEMENTS |
sinus node dysfunction with prolonged pauses is a rare finding in children unless they have had prior congenital heart surgery .
abrupt termination of a supraventricular tachycardia ( svt ) or pacing can be associated with sinus pauses due to overdrive suppression of the sinus node . however , such pauses are rarely seen in children despite the common prevalence of paroxysmal supraventricular tachycardia ( psvt ) perhaps because of the relative healthy state of the sinus node .
we describe a case of long sinus pauses in a teenager with an asymptomatic ectopic atrial tachycardia .
treatment with radiofrequency catheter ablation of the underlying tachyarrhythmia led to resolution of the sinus pauses .
an asymptomatic 14 year old boy was referred for evaluation of an irregular heart rhythm noted during a routine checkup .
a standard 12lead electrocardiogram revealed short runs of an atrial tachycardia ( fig . 1 ) .
an ambulatory 24 hour holter monitor done to assess the frequency and behavior of the tachycardia showed frequent sinus pauses ( fig .
2 ) with a longest pause around 5 s. the pauses were mostly ( but not always ) associated with termination of the svt .
because of the concerns of the long sinus pauses and because we felt that pharmacologic therapy could lead to worsening of the pauses , he was taken up for catheter ablation . at the ablation procedure
, he was found to have an ectopic atrial tachycardia arising within the right atrial appendage .
the ectopic focus was mapped with three dimension electro anatomical mapping ( carto , biosense webster ) , and successfully ablated .
post ablation , he showed no sinus pauses with atrial burst pacing ( normal corrected snrt ) and holter monitor done one week later showed normal sinus rhythm with no pauses , and no sinus bradycardia ( lowest heart rate was 42 ) .
sinus node dysfunction with long sinus pauses is rare in children with an otherwise normal heart .
while sinus pauses due to overdrive suppression of the sinus node in the context of atrial fibrillation is described in adults , it has not been reported in children , .
adult reports have shown that ablation of the atrial fibrillation can lead to resolution of the sinus pauses , . however , it is unclear whether this also applies to children .
we decided to defer pacemaker therapy and instead opted for management of the tachyarrhythmia with catheter ablation .
ablation was preferred over medication because of potential concerns that an antiarrhythmic medication could lead to worsening of the bradycardia .
decision making was influenced by the fact that the patient was asymptomatic , with a normal cardiac structure and function on echocardiogram . while pacemaker placement would have been a permanent or semi - permanent intervention , ablation was preferred since it is a one - time procedure .
sinus pauses can occur in young patients with paroxysmal svt . based on this case ,
we recommend that initial treatment should be directed towards the svt and not to the bradyarrhythmia . | sinus pauses in the setting of supraventricular tachycardia is rare in children .
we describe an asymptomatic teen with irregular heart rate detected during an incidental exam who was found to have short runs of a slow ectopic atrial tachycardia on electrocardiogram and prolonged sinus pauses on routine ambulatory ecg .
successful catheter ablation of the ectopic atrial tachycardia led to resolution of the sinus pauses . | Introduction
Case report
Discussion
Conclusion
Author disclosures |
the quantification of this public health problem and the benefits of its regulation , however , has been the subject of debates .
such impact assessments usually rely on extrapolations of data from various fields with partly unknown uncertainties , as it is rather rare to base the assessment on direct interventional observations .
a few ' intervention studies ' , however , have been published , underlying the notion that air pollution causes morbidity and mortality , and that improvements in air quality consequently lead to direct health benefits [ 5 - 8 ] .
so far , impact assessments have mostly focused on mortality in adults and a few measures of morbidity .
the impact assessment guidelines of who , however , emphasized the need for a broader assessment of the overal public health relevance . the update of the global burden of disease project of who , which quantified and ranked the health impact of 20 main risk factors , also included outdoor air pollution , again with a strong focus on mortality .
the burden of combustion - related urban air pollution in developed countries was estimated to exceed the impact of other considered environmental factors . in their study ,
ezatti and colleagues estimated worldwide mortality due to urban outdoor air pollution for children under five years of age but did not provide disaggregated effects for infants .
we now estimated the burden of outdoor air pollution on infant mortality in selected areas of the u.s .
, where air pollution levels and infant mortality rates are relatively low and causes of infant deaths prevalent in developing countries are rare . to compare the underlying outcome frequencies and air quality aspects , we used only one u.s .
however , evidence is increasing for associations of outdoor air pollution with infant mortality and other adverse pregnancy outcomes [ 15 - 17 ] .
we applied the risk assessment methods of a european study , which was adapted from others .
the method calculates attributable cases by using background rates of infant mortality ( death register data ) , to which the epidemiological exposure - response function is applied .
this procedure leads to the number of attributable cases per unit of ambient air pollution concentration .
we used particulate matter < 10 m in diameter ( pm10 ) as a surrogate of air pollution mix .
it is possible that the independent effects of other components ( e.g. ozone or co ) of air pollution may not be fully captured .
we used the exposure - response function from the only currently available cohort study in the u.s
. conducted by woodruff and colleagues based on approximately 4 million infants born between 198991 in 86 metropolitan areas .
exposure was defined as the mean outdoor pm10 levels for the first two months of life .
the authors controlled for some individual risk factors for infant mortality ( i.e. maternal education , maternal ethnicity , parental marital status , maternal smoking during pregnancy ) and other potential confounders ( i.e. infant 's month and year of birth , average temperature during first 2 months of life ) , and found that postneonatal mortality from all causes ( excluding violent death ) increased by 4% ( 95% confidence interval [ ci ] 27% ) for every 10 g / mpm10 . sudden infant death syndrome ( sids ) and respiratory disease mortality in infants with normal birth weight increased by 12% ( 95% ci 717% ) and 20% ( 95% ci 636% ) for every 10 g / mpm10 , respectively ( table 1 , column 1 ) .
more recently , lipfert and colleagues reanalyzed these results , mostly confirming the pm10 associations ; however , differences in study design and modeling did not allow including results from both of these studies in our risk assessment .
metropolitan counties , 199597 * from woodruff and colleagues 1997 * * we estimate cases attributable to pm10 only above a reference level of 12.0 g / m3 * * * equivalent for new u.s .
pm2.5 standard ; the observed mean level was used if below 25.0 g / mpm10 * * * * sids deaths are defined by the international classification of diseases , revision 9 ( icd9 ) code 798.0 . * * * * * respiratory deaths are defined by icd9 codes 460519 .
we applied the outcome - specific exposure - response functions from woodruff and colleagues to 25 counties in 23 u.s .
metropolitan areas with a population of approximately 40 million people and 700,000 infants born between 199597 who survived the neonatal period ( alabama : jackson ; california : fresno , los angeles , sacramento , san diego , san francisico ; colorado : denver ; connecticut : hartford ; illinois : cook ; maryland : baltimore ; michigan : wayne ; missouri : st .
louis ; new york : bronx , kings , new york ; pennsylvania : philadelphia ; texas : el paso , harris , dallas ; oklahoma : oklahoma , tulsa ; rhode island : providence ; utah : salt lake city ; washington : king ; wisconsin : milwaukee ) .
criteria for the selection of counties were 1 ) that they were geographically distributed over the united states , 2 ) a population size above 500,000 and 3 ) availability of data on post - neonatal infant mortality and air pollution levels .
we obtained annual mean outdoor pm10 levels for the years 199597 from the environmental protection agency ( epa ) air monitoring data and mortality rates for infants aged 112 months for the years 199597 from the national center for health statistics .
we did not quantify attributable cases for pm10 levels below 12.0 g / mto avoid extrapolation beyond the lowest exposure level observed in woodruff and colleagues .
attributable mortality was calculated by county and then averaged across all counties . in another step we estimated the death burden of all counties that reached the new u.s .
standard for particulate matter < 2.5 m in diameter ( pm2.5 ) of 15 g / m(assuming an equivalent of 25 g / mpm10 ) .
the mean pm10 level during 199597 was 28.4 g / m(county range : 18.0 g / mto 44.8 g / m .
fourteen of 25 counties had a 199597 mean pm10 level above 25 g / m . across counties ,
all cause mean postneonatal infant mortality rates ranged from 130 to 352 per 100,000 . based on the risk assessment ,
postneonatal infant mortality rates and proportions attributable to pm10 air pollution are shown in table 1 .
the estimated proportion of all cause mortality , sids ( normal birth weight ) and respiratory disease mortality ( normal birth weight ) attributable to pm10 above the reference level was 6% ( 95% ci 311% ) , 16% ( 95% ci 923% ) and 24% ( 95% ci 744% ) , respectively . this estimate might be a reasonbable approximation of the attributable proportion across all metroplolitan areas of the u.s .. the expected number of infant deaths per year in the selected areas was 106 ( 95% ci 53185 ) , 79 ( 95% ci 46111 ) and 15 ( 95% ci 527 ) , repectively . for all outcomes ,
only a quarter of the burden was due to mean exposures above the new u.s .
pm2.5 standard of 15 g / m(equivalent to 25 g / mpm10 ) , whereas three quarters of the burden were due to pm10 levels between 12 g / mpm10 ( our reference level ) and 25 g / mpm10 .
our risk assessment suggests that outdoor air pollution above a reference level of 12.0 g / mpm10 contributes in a substantial way to postneonatal infant mortality .
the estimated attributable proportions were particularly high for postneonatal mortality from sids and respiratory disease in infants born with a normal birth weight .
the estimated contribution between the reference level and the new pm2.5 standard of 15 g / m(equivalent to 25 g / mpm10 ) revealed that the majority of the estimated burden would remain even if all counties would comply to the new pm2.5 standard .
the results emphasize the need to address the diseases burden on a local and national level rather then at the global scale since risk factors that are rare in the u.s .
environmental health risk assessments suffer from inherent limitations related to uncertainties of the assumptions made .
given the advantage of the cohort approach and the potential limitations of geographic extrapolation , we relied on only one single albeit large u.s . study . in a previous risk assessment
, we used the only two cohort studies available at the time for adult mortality .
selection criteria defined in the previous assessment , including adequate study design and published pm10 levels , were met .
a growing number of studies conducted in different countries using different study designs are showing effects of air pollution on infant mortality [ 24 - 27 ] and mortality in children under five years of age . using previously reported methods
, we were able to convert effects from all these studies except one to relative risks per g / mpm10 .
effects ranged from 1.07 ( 95% ci 1.021.15 ) ( , 3 day lag model ) to 1.12 ( 95% ci 1.041.20 ) ( , 3 day moving average model ) for all cause infant mortality , 1.08 ( 95% ci 1.011.15 ) to 1.09 ( 95% ci 1.031.14 ) for postneonatal respiratory mortality , and 1.01 ( 95% ci 1.001.02 ) to 1.02 ( 95% ci 1.011.02 ) for mortality in children under five years of age .
studies for a metaanalytic estimate because we believe that considerable differences in study regions do not allow transferring results
. however , the effects found in these studies support the conclusion that the associations observed by woodruff and colleagues reflect true effects of pollution , and are not just a result of uncontrolled confounding .
other recent studies have focused on the impact of air pollution on fetal growth , preterm birth , birth weight [ 33 - 39 ] , and other pregnancy outcomes such as smaller head circumference at birth and cardiac malformations .
wilhelm and ritz recently concluded from their research that compounds of motor vehicle exhaust may effect fetal development , potentially resulting in increased vulnerability of the respiratory and cardiovascular systems during infancy and childhood .
intrauterine growth retardation and low birth weight ( lbw ) have been linked to respiratory health later in life and intrauterine growth retardation may lead to increased susceptibility to air pollution exposure and other environmental factors .
furthermore , recent studies have shown growing evidence that ambient air pollution is associated with decreasing heart rate variability in adults .
the hypothezised underlying effect on the autonomic nervous system may also play a role in the genesis of sids .
there is clearly a need for further research to determine the impact of air pollution exposure on fetal development during pregnancy and to fill the gap of knowledge between our understanding of the underlying mechanisms and the observed associations of air pollution and mortality in infants .
we believe that the accumulating evidence justifies a risk assessment based on the assumption that ambient air pollution with pm used as a surrogate for the mixture causes infant deaths .
lipfert and colleagues recently have questioned this assumption when they reanalyzed the association between air pollution and infant mortality using partly the same data as woodruff and colleagues , because they observed unstable and partly inverse associations for some pollutants ( albeit not for pm10 ) .
however , exposure was assigned on an annual base rather than accounting for the month of birth , and the stepwise multi - pollutant regression models used for the study is prone to artifacts .
although we did not use the same metropolitan areas as woodruff and colleagues , the size and extent of their study increased our confidence that the results are generalizable to other u.s .
populations . also , our results did not change considerably when we excluded counties in california , new york and oklahoma that were not part of the original study . however , woodruff and colleagues were not able to control for risk factors such as limited prenatal care or maternal age at delivery that may modify the effect estimates used in our assessment . in a more recent evaluation , woodruff and colleagues
have shown that mothers from different ethnic groups than caucasian were more likely to be exposed to high pollution levels and to have preterm delivery suggesting additional risk of residing in areas with poor air quality among infants at already increased risk of poor health .
potential interactions with other county - specific factors , e.g. social deprivation , have been shown to be related to unknown factors that modify the effect of air pollution on mortality in adults .
exposure - response functions may be larger in such areas , with unpredictable influence on the overall impact . in our assessment ,
the total attributable risk based on population - weighting was higher than average across counties ( 7% , 95% ci 412% vs. 6% , 95% ci 311% ) , indicating that lack of control for risk factors in the original study may have resulted in an underestimate of the total effect .
in addition , excluding infants with lbw may have resulted in increased social class homogeneity because low social class is a determinant of lbw , probably adding to an underestimate of the total effect estimated in our assessment .
it is , however , reassuring that the sum of the cause - specific attributable cases ( 14.0 ) closely corresponded to attributable cases based on the total mortality ( 14.7 ) estimate ( table 1 ) .
consistent with the underlying epidemiologic study , our assessment was based on fixed site monitors . for pm2.5 and pm10
, current evidence suggests a high correlation between ambient and indoor concentrations from outdoor origin ; thus , imprecision in exposure may be of minor concern for our assessment .
the choice of the exposure reference level is a large influence on the derived attributable cases .
our assessment considered only the burden of concentrations higher then 12 g / m(i.e . the lowest observed level in the original study of woodruff and colleagues ) .
however , studies in adults give no evidence for a no - effect threshold even in time - series data with lowest concentrations being below 12 g / m .
assuming an exposure reference level of 7.5 g / mas used in other studies ( e.g. ) would result in an approximately 2025% higher burden attributed to air pollution then the number of annual air pollution attributable cases for all cause infant mortality would increase from 106 ( 95% ci 53185 ) to 132 ( 95% ci 66 to 232 ) if 7.5 g / mwas taken as the exposure reference level .
we emphasize , however , that the shape of the risk function is less well defined in the lowest concentrations .
time - series mortality studies conducted with adults give no indication of a threshold of no effect , but this aspect has not been exploited for infant mortality .
thus , the burden derived for levels above 7.5 g / mcarries larger uncertainties than the one shown in our main results , where cases attributed to ambient levels below 12 g / mare ignored .
we also acknolwedge that the differentiation between an additive versus a multiplicative risk function has not been made in the woodruff study nor in our risk assessment .
however , given the very small relative risks and the application to only a limited range of exposure , this uncertainty is not of major concern .
because it is generally not possible to assign effects of ambient air pollution to specific single pollutants , we considered pm as a surrogate measure of a more complex mixture .
part of the association between mortality and pm may be explained by the correlation of pm with other ambient air pollutants , and the estimated mortality may not be exclusively attributed to pm10 .
this uncertainty needs to be taken into account in the assessment of benefits of policies that target single pollutants rather than the mixture . in case of mortality among adults
, it may be preferable to convert the risk functions into estimates of the years of life lost . for infants , we chose attributable cases as a preferred outcome .
first , the measure can be directly derived from the published data , which did not measure life years lost .
second , some deaths may occurr among susceptible infants who may not have survived otherwise , a feature that has been called ' harvesting ' in studies conducted with adults .
although premature death of highly frail subjects plays only a minor role in short - term effects of air pollution among adults , the issue has not been addressed yet for infants , thus the uncertainty regarding time lost is particularly large .
third , the question arises whether attributable cases are preventable , given improved air quality .
quasi - experimental studies suggest fast short - term health benefits of clean air interventions for morbidity in children or mortality in adults , but no data on infant mortality are available . as competing risks
may become relevant after removal of one risk factor , the preventable fraction may be smaller .
although loss of life expectancy may be substantial among infant deaths , these are rare events in the developed world .
therefore , infant mortality due to air pollution can have only a minor effect on life expectancy in the u.s .
evidence for a causal effect of air pollution on morbidity and mortality is strong for adults , and evidence is building that air pollution has an effect on infants and young children and a potential impact during the fetal period .
our estimates are based on the best currently available information , leaving considerable uncertainty about the size of the true effect of particulate matter on infant mortality .
however , given that the whole population is exposed , we conclude that air pollution - related infant mortality is a major public health problem . this outcome should be considered in future public health risk assessment and management and included in epa 's assessment of the benefits of the u.s .
ci : confidence interval epa : environmental protection agency lbw : low birth weight pm10 : particulate matter < 10 m in diameter pm2.5 : particulate matter < 2.5 m in diameter sids : sudden infant death syndrome who : world health organization
rk contributed to methods development , performed the analysis , reviewed the literature and wrote the manuscript . | backgroundthe impact of outdoor air pollution on infant mortality has not been quantified.methodsbased on exposure - response functions from a u.s .
cohort study , we assessed the attributable risk of postneonatal infant mortality in 23 u.s .
metropolitan areas related to particulate matter < 10 m in diameter ( pm10 ) as a surrogate of total air pollution.resultsthe estimated proportion of all cause mortality , sudden infant death syndrome ( normal birth weight infants only ) and respiratory disease mortality ( normal birth weight ) attributable to pm10 above a chosen reference value of 12.0 g / m3 pm10 was 6% ( 95% confidence interval 311% ) , 16% ( 95% confidence interval 923% ) and 24% ( 95% confidence interval 744% ) , respectively . the expected number of infant deaths per year in the selected areas was 106 ( 95% confidence interval 53185 ) , 79 ( 95% confidence interval 46111 ) and 15 ( 95% confidence interval 527 ) , respectively .
approximately 75% of cases were from areas where the current levels are at or below the new u.s .
pm2.5 standard of 15 g / m3 ( equivalent to 25 g / m3 pm10 ) . in a country where infant mortality rates and air pollution levels are relatively low , ambient air pollution as measured by particulate matter contributes to a substantial fraction of infant death , especially for those due to sudden infant death syndrome and respiratory disease .
even if all counties would comply to the new pm2.5 standard , the majority of the estimated burden would remain.conclusiongiven the inherent limitations of risk assessments , further studies are needed to support and quantify the relationship between infant mortality and air pollution . | Introduction
Methods
Results
Discussion
Conclusions
List of abbrevations used
Competing interests
Authors' contributions |
the statistical model proposed in for one probe set in multiple oligonucleotide arrays has the form it states that the perfect match ( pm)/mismatch ( mm ) difference in array i , probe j of this probe set is the product of model - based expression index ( mbei ) in array i ( i ) and probe - sensitivity index of probe j ( j ) plus random error .
fitting the model , we can identify cross - hybridizing probes ( j with large standard error ( se ) , which are excluded during iterative fitting ) and arrays with image contamination at this probe set ( i with large se ) , as well as single outliers ( image spikes ) which are replaced by the fitted values . in effect the estimated expression index i is a weighted average of pm / mm differences : with larger weights given to probes with larger .
the image of outliers ( array and single outliers ) identified through model - fitting can be used to assess the quality of an experiment and to identify unexpected problems such as a misaligned corner of a dat file .
we have investigated several important properties of the model , including the reliability and stability of the fitted parameters mbei ( ) and probe sensitivity indexes ( ) , the performance of mbei compared to the commonly used average difference ( ad ) , and how the availability of se facilitates downstream comparative and clustering analysis .
in practice , in an array experiment , a researcher hybridizes tissue or cell line samples , corresponding to different treatments or conditions , to a batch of arrays . ideally , the probe - sensitivity index ( ) should be independent of the tissue type .
this condition , however , may not hold for those probes that have cross - hybridization affinity to non - target genes . nevertheless , assuming that a non - target gene cross - hybridizes only to a few probes of a probe set , and its expression levels across arrays do not correlate with the target gene , the iterative probe - excluding procedure in may be able to exclude cross - hybridizing probes , regardless of the tissue type hybridized .
in addition , the relative probe - sensitivity indexes of the good probes called by the model are likely to be similar across sets of arrays hybridizing to different tissue samples .
we apply the model ( equation 1 ) independently to six sets of hu6800 arrays ( 21 leukemia , lymphoma and mantle cell samples , 20 prostate cancer cell lines , 17 brain tumor samples , 55 cancer cell lines , 58 brain samples , and 55 lung tumor samples ) .
figure 1a shows the values fitted for probe set 6457 ( used in figure 1 and 2 of ) in the six array sets .
the patterns resemble each other greatly , showing that the probe - sensitivity index is an inherent property of these non - cross - hybridizing probes and can be consistently identified from different sets of arrays .
it is noteworthy that the probe 11 in array set 5 is likely to be cross - hybridizing , making its relative strength ( here mm is consistently larger than pm and this leads to a negative ) dissimilar to the probe 11 in other array sets .
the model identifies this probe as a ' probe - outlier ' only for array set 5 and excludes it when calculating mbei ( 0 ) for array set 5 .
values estimated for probe sets ( a ) 6457 , ( b ) 1248 , and ( c ) 6571 in six array sets ( shown in panels 16 from left to right for each probe set ) . values ( constrained to have sum square equal to number of probes used in each array set ) are on the y - axis , and probe pairs are labeled 1 to 20 on the x - axis .
the title of each panel ( for example , p = 0 ) indicates the proportion of arrays ' present ' for the target gene in the array set .
they are stratified by average lower presence proportion in two array sets ( the presence proportion of a probe set is the proportion of arrays in an array set where the target gene is called ' present ' by genechip 's algorithm ) .
the average is taken over c(6 , 2 ) = 15 pairwise comparison of two array sets for each probe set , and the correlation is calculated using probes that are not identified as an outlier in both array sets .
the range of the average lower presence proportion for the six boxplots are : ( 0 , 0.17 ) , ( 0.17 , 0.34 ) , ( 0.34 , 0.51 ) , ( 0.51 , 0.68 ) , ( 0.68 , 0.85 ) , ( 0.85 , 1 ) .
the title of each boxplot is the number of probe sets classified into this boxplot .
eleven probe sets with too few non - outlier probes to calculate correlations for all 15 comparisons are not included in the boxplots .
the average lower presence proportion and average pairwise correlation for probe sets in figure 1 are ( a ) 1 , 0.95 ; ( b ) , 0.93 , 0.94 ; and ( c ) 0 , 0.86 . in figure 1a , b the target gene is present in most samples of all array sets . for a probe set
whose target gene is mostly absent throughout samples ( figure 1c ) , many probes are identified as probe - outliers because of their negative indexes . here
, we can not obtain correct probe - sensitivity indexes because of the absence of the target gene .
nevertheless , the pm - mm values for these probes are random fluctuations around zero , leading to a correct expression index close to zero .
if the target gene becomes available for a future array set , the correct probe - sensitivity indexes will be recovered and these probes will be used for expression calculation . occasionally , a responsive probe set may give rise to very different estimates in two array sets . in figure 1b , probes 8 and 13 have different relative responses in array set 1 and 4 , leading to different probe - response patterns .
this might be due to the possibility that the probes in this probe set are differentially cross - hybridized in different array sets , or that the same probe in different batches of arrays may systematically behave differently .
identification and flagging such probe sets is desirable and essential if we want to compare arrays hybridized to different tissue samples .
figure 2 shows the boxplots of average pairwise correlations of values between two array sets , stratified by average lower presence proportion in the two sets . in general , when a gene is present in many samples of two array sets , the patterns estimated from the two sets are very similar .
the target gene 's presence in many arrays of an array set allows the probe - sensitivity index to be estimated accurately . from figure 1 of
, one can see that some mm probes may respond poorly to the changes in the expression level of the target gene .
this phenomenon raised questions on the efficiency of using mm probes , and led some investigators to design custom arrays that use pm probes exclusively ( r. abagyan and yingyao zhou , personal communication ; b.r .
conklin , personal communication ) , and others to calculate fold changes using only pm probes ( f. naef , personal communication ) .
this design greatly increases the number of genes that can be studied on one array . to investigate the relative performance of pm / mm versus pm - only designs
, we exploited the model to estimate gene expression levels using only pm probes , and compared it to the mbei using both pm and mm probes .
the full intensity model ( equation 1 of ) specifies the relationship of pm probe responses and expression level : where vj is the baseline response of probe pair j due to nonspecific hybridization , and ' j is the sensitivity of pm probe of the probe pair j. the parameter estimates can be obtained by iteratively fitting i and vj,'j , regarding the other set as known .
the mm probe responses have a similar form as equation 2 except for different probe - sensitivity indexes .
we fit a pm - only and an mm - only model to obtain expression values of all 20-probe probe sets using array set 1 . for comparison
, we also used half of the probe pairs ( by alternatively picking one out of every two probes ) in a 20-probe probe set to fit to the difference model ( equation 1 ) . for each probe set , these three sets of expression values were compared with the expression values of the original difference model using 20 probes , in terms of correlation of s obtained by two methods across the 21 arrays .
we assumed the 20-probe difference model provides the most accurate expression estimates . if , for a probe set , a simplified model ( pm - only , mm - only or 10-probe difference model ) performs reasonably well , we expect its estimates to correlate with that from the 20-probe difference model .
figure 3 shows the histogram and figure 4 the boxplot of correlations of s estimated from the 20-probe difference model and s estimated from the 10-probe difference model ( a ) , the 20-probe pm - only model ( b ) and the 20-probe mm - only model ( c ) . for probe sets with high presence proportion , both the 10-probe difference model and the pm - only model correlate well with the 20-probe difference model .
we note that this comparison is intrinsically biased in favor of the 10-probe difference model because the ' truth ' is constructed from pm - mm differences .
histogram of correlations between model - based expression values estimated using the 20-probe difference model and those estimated using different models .
( a ) 10-probe difference model ; ( b ) 20-probe pm - only model ; ( c ) 20-probe mm - only model .
boxplot of correlations between values estimated using the 20-probe difference model and s estimated using different models , stratified by presence proportion .
( a ) 10-probe difference model ; ( b ) 20-probe pm - only model ; and ( c ) 20-probe mm - only model .
the number of presence calls for a probe set in the 21 arrays and the subpopulation size for the six boxplots are : 03 , 4,385 ; 47 , 693 ; 811 , 413 ; 1215 , 488 ; 1619 , 497 ; and 2021 , 323 .
this comparison corroborates the basic notion of the technology : the pm probes hybridize more strongly to the target signals than mm probes and contain most of the information .
we stress that , whereas the above analysis illustrates the applicability of model - based analysis to pm - only arrays , the assessment presented here is only tentative because of the limited information provided by the hu6800 arrays on the comparisons .
definitive comparisons of the efficiency of the designs must await the availability of data from pm - only arrays .
each pair consists of two arrays hybridizing to samples replicated at total mrna level ( the total mrna sample is split and then amplified and labeled separately , and hybridized to two different arrays ) .
the differences between the expression values of the two replicate arrays in a pair are due to the variation introduced in experimental steps after the split , the array manufacturing difference and analytical methods such as normalization and expression calculation .
this difference provides a lower bound of biological variation that can be detected between two independently amplified samples , and serves as a good statistic for comparing different analytical methods .
for comparison , we also used the method in to calculate ads for all probe sets and plot them in figure 5b ( ad is based on normalized probe values , see methods and materials section for the normalization method . also note that genechip software excludes probes
whose pm / mm difference is outside three standard deviations ( sds ) of all probe differences in either of the two arrays in the comparison ; here , as we are comparing multiple arrays at the same time , when calculating ads a probe is excluded if its difference is an outlier in the above sense in any of the arrays , until a minimum of five probes is reached , where all five probes will be used ) .
both the mbei and the ad method yielded some expression values differing by more than a factor of two , especially for genes at low expression level .
this might be explained by the relatively larger amplification variation for weakly expressed genes , given a constant success rate of amplifying a sequence by a certain fold .
log ( base 10 ) expression indexes of a pair of replicate arrays ( array 1 and 2 of array set 5 ) for different statistical methods .
only 6,695 ( a ) and 4,696 ( b ) probe sets with positive values in both arrays are used .
the center line is y = x , and the flanking lines indicate the difference of a factor of two .
researchers often use ' log ratio ' between expression values of a gene in two arrays as the criterion for identifying differentially expressed genes . between duplicate arrays , we expect these log ratios of expression values based on a good expression index ( ad or mbei ) to be close to zero .
thus for every probe set we calculated its average absolute log ( base 10 ) ratio of 29 pairs of duplicates as a statistic to compare the variation in expression levels between duplicates using the ad or the mbei method .
the average absolute log ratio distribution of the mbei method is significantly lower than that of the ad method when expression level is low ( and thus probe sets have a low proportion of detections of the target gene across arrays ) .
as expression level becomes higher ( when the target gene of a probe set is detected in more arrays ) , the ad method shows a rapid improvement in performance , approaching the level of the mbei method .
the same boxplots ( figure 7 ) for another set of 60 human u95a arrays consisting of 30 replicate pairs conveys similar information .
these results suggest that the mbei method is able to extend the reliable detection limit of expression to a lower mrna concentration .
boxplots of average absolute log ( base 10 ) ratios between replicate arrays stratified by presence proportion for different statistical methods .
( a ) mbei method ; ( b ) ad method . the number of presence calls for a probe set in the 58 arrays for the six boxplots are : 09 , 1019 , 2029 , 3039 , 4049 , 5058 .
the title of each boxplot is the number of probe sets used for the boxplot .
log ratios are not calculated for negative expression values or expression values identified as ' array - outliers ' by the mbei method in either array of a replicate pair , and are not used to calculate the average .
744 probe sets are not included as their average absolute log ratios can not be calculated for all the 29 pairs using either method .
similar plots as in figure 6 for another set of 30 pairs of duplicated human u95a arrays .
( a ) mbei method ; ( b ) ad method.the number of presence calls for a probe set in the 60 arrays for the six boxplots are : 09 , 1019 , 2029 , 3039 , 4049 , 5060 .
the title of each boxplot is the number of probe sets used for the boxplot . after obtaining expression indexes using ad or mbei
, fold changes can be calculated between two arrays for every gene and used to identify differentially expressed genes .
usually , low or negative expressions are truncated to a small number before calculating fold changes , and genechip also cautions against using fold changes when the baseline expression is absent .
the availability of ses for the model - based expression indexes allows us to obtain confidence intervals for fold changes .
suppose where 1 and 2 are the real expression levels in the sample , and 1 and 2 are the model - based estimates of expression levels .
we substitute the model - based ses for 1 and 2 letting r = 1/2 be the real fold change , then inference on r can be based on the quantity it can be shown that q has a distribution with 1 degree of freedom irrespective of the values of 1 and 2 . thus q is a pivotal quantity involving r. we can use q to construct fixed - level tests and to invert them to obtain confidence intervals ( ci ) for fold changes .
table 1 presents the estimated expression indexes ( with ses ) in two arrays and the 90% confidence intervals of the fold changes for 14 genes .
although all genes have similar estimated fold changes , the confidence intervals are very different .
for example , gene 1 has fold change 2.47 and a tight confidence interval ( 2.06 , 3.02 ) .
in contrast , gene 11 has a similar fold change of 2.48 but a much wider confidence interval ( 0.96 , 18.18 ) .
thus the fold change around 2.5 for gene 11 is not as trustworthy as that for gene 1 .
further examination reveals that this is due to the large ses relative to the expression indexes for gene 11 .
this agrees with the intuition that when one or both expression levels are close to zero for one gene , the fold change can not be estimated with much accuracy .
in addition , when image contamination results in unreliable expression values with large ses , the fold changes calculated using these expression value are attached with wide cis . in this manner , the measurement accuracy of expression values propagates to the estimation of fold changes . using expression levels and associated ses to determine confidence intervals of fold changes in practice , we find it useful to sort genes by the lower confidence bound ( ' lower cb ' in table 1 ) , which is a conservative estimate of the fold change .
when an expression index is negative ( as a result of taking pm / mm differences ) , we do not calculate the confidence intervals .
in such a case , it is more helpful to filter genes by presence calls .
cluster analysis is a popular method for analyzing the data of a series of microarrays [ 6 , 7 ] .
if two genes are co - regulated at the transcription level , their expression values across samples are likely to be correlated . clustering algorithms use these correlations ( or monotone transformation of correlations ) to cluster co - regulated genes together
the correlation based on the estimated expression levels may , however , be different from that based on the real but unobserved expression levels .
also , the commonly used hierarchical clustering algorithm is an irreversible process : once two genes or nodes are merged , they will stay together , even if later on there is good reason to adjust previous clustering .
a global way of using se in hierarchical clustering is to resample or bootstrap the whole ' gene by sample ' data matrix and redo the clustering , then investigate the overall properties emerging from this repertoire of clustering trees . in bittner et al . , the data matrix coming from cdna microarray experiments is resampled using the estimated variation derived from the median sd of log ratios for a gene across samples .
as we now have ses for all data points , we can resample each expression value from a normal distribution with mean equal to the estimated expression value and sd equal to the attached se .
figure 8a shows a hierarchical clustering tree of 225 selected genes with presence proportion > 0.5 and coefficient of variation ( sd / mean ) > 0.7 across the 20 samples in array set 2 . in trying to interpret this tree
, we may be interested in the gene cluster colored in blue and the reliability of the gene members belonging to this cluster .
the whole data matrix is resampled , and the clustering is performed again ( figure 8b ) .
we notice that some blue genes ( genes in the original cluster are colored blue ) are clustered with other non - blue genes , and some non - blue genes are mixed into the main body of the blue genes . after each resampling
, we identify a cluster that contains more than 80% of all the blue genes , but as few non - blue genes as possible ( measured as a percentage of all genes in this cluster ) .
this cluster is considered to be the cluster that corresponds to the original one in figure 8a . in figure 8b the root node of the ' corresponding cluster '
is marked with small horizontal line intersecting the vertical line ( representing the range of the cluster ) on the right of the clustering picture .
then , for each of all the 225 genes , if it belongs to this ' corresponding cluster ' , we increase its ' in - cluster ' count by 1 .
after resampling 30 times , the in - cluster counts are indicated in gray - scale on the left side of the original clustering ( figure 8c ) , with black representing 30 and white representing zero . a high ' in - cluster
' count indicates a gene ' remains ' in the original cluster in most of the resampled clustering trees .
gene clustering ( a ) 225 filtered genes are clustered based on their expression profiles across 20 samples .
each gene 's expression values are standardized to have mean 0 and sd 1 across 20 samples .
although the original ' blue ' genes are scattered to various places , we can still determine where the original cluster is , using the criteria described in the text .
( c ) after resampling 30 times , the reliability of the genes belonging to the original cluster is indicated by the vertical gray - scale bar on the left of the blue - red picture .
we can see from figure 8c that most genes in the original cluster are reliable members , whereas a few genes at the bottom of the cluster are not ( in fact they are merged into the original cluster last ) .
interestingly , some genes originally not in the original cluster group with the ' corresponding clusters ' during resampling many times and have gray ' in - cluster ' marks .
these genes may be related to the original cluster in some way . in summary , this method can help us to distinguish reliable and unreliable gene members of a cluster , as well as draw our attention to related genes originally clustered somewhere else because of the accidental nature of hierarchical clustering .
in practice , in an array experiment , a researcher hybridizes tissue or cell line samples , corresponding to different treatments or conditions , to a batch of arrays . ideally , the probe - sensitivity index ( ) should be independent of the tissue type .
this condition , however , may not hold for those probes that have cross - hybridization affinity to non - target genes . nevertheless , assuming that a non - target gene cross - hybridizes only to a few probes of a probe set , and its expression levels across arrays do not correlate with the target gene , the iterative probe - excluding procedure in may be able to exclude cross - hybridizing probes , regardless of the tissue type hybridized .
in addition , the relative probe - sensitivity indexes of the good probes called by the model are likely to be similar across sets of arrays hybridizing to different tissue samples .
we apply the model ( equation 1 ) independently to six sets of hu6800 arrays ( 21 leukemia , lymphoma and mantle cell samples , 20 prostate cancer cell lines , 17 brain tumor samples , 55 cancer cell lines , 58 brain samples , and 55 lung tumor samples ) .
figure 1a shows the values fitted for probe set 6457 ( used in figure 1 and 2 of ) in the six array sets .
the patterns resemble each other greatly , showing that the probe - sensitivity index is an inherent property of these non - cross - hybridizing probes and can be consistently identified from different sets of arrays .
it is noteworthy that the probe 11 in array set 5 is likely to be cross - hybridizing , making its relative strength ( here mm is consistently larger than pm and this leads to a negative ) dissimilar to the probe 11 in other array sets .
the model identifies this probe as a ' probe - outlier ' only for array set 5 and excludes it when calculating mbei ( 0 ) for array set 5 .
values estimated for probe sets ( a ) 6457 , ( b ) 1248 , and ( c ) 6571 in six array sets ( shown in panels 16 from left to right for each probe set ) . values ( constrained to have sum square equal to number of probes used in each array set ) are on the y - axis , and probe pairs are labeled 1 to 20 on the x - axis .
the title of each panel ( for example , p = 0 ) indicates the proportion of arrays ' present ' for the target gene in the array set .
they are stratified by average lower presence proportion in two array sets ( the presence proportion of a probe set is the proportion of arrays in an array set where the target gene is called ' present ' by genechip 's algorithm ) .
the average is taken over c(6 , 2 ) = 15 pairwise comparison of two array sets for each probe set , and the correlation is calculated using probes that are not identified as an outlier in both array sets .
the range of the average lower presence proportion for the six boxplots are : ( 0 , 0.17 ) , ( 0.17 , 0.34 ) , ( 0.34 , 0.51 ) , ( 0.51 , 0.68 ) , ( 0.68 , 0.85 ) , ( 0.85 , 1 ) .
the title of each boxplot is the number of probe sets classified into this boxplot .
eleven probe sets with too few non - outlier probes to calculate correlations for all 15 comparisons are not included in the boxplots .
the average lower presence proportion and average pairwise correlation for probe sets in figure 1 are ( a ) 1 , 0.95 ; ( b ) , 0.93 , 0.94 ; and ( c ) 0 , 0.86 . in figure 1a , b the target gene is present in most samples of all array sets . for a probe set
whose target gene is mostly absent throughout samples ( figure 1c ) , many probes are identified as probe - outliers because of their negative indexes . here
, we can not obtain correct probe - sensitivity indexes because of the absence of the target gene .
nevertheless , the pm - mm values for these probes are random fluctuations around zero , leading to a correct expression index close to zero .
if the target gene becomes available for a future array set , the correct probe - sensitivity indexes will be recovered and these probes will be used for expression calculation . occasionally , a responsive probe set may give rise to very different estimates in two array sets . in figure 1b , probes 8 and 13 have different relative responses in array set 1 and 4 , leading to different probe - response patterns .
this might be due to the possibility that the probes in this probe set are differentially cross - hybridized in different array sets , or that the same probe in different batches of arrays may systematically behave differently .
identification and flagging such probe sets is desirable and essential if we want to compare arrays hybridized to different tissue samples .
figure 2 shows the boxplots of average pairwise correlations of values between two array sets , stratified by average lower presence proportion in the two sets . in general , when a gene is present in many samples of two array sets , the patterns estimated from the two sets are very similar .
the target gene 's presence in many arrays of an array set allows the probe - sensitivity index to be estimated accurately .
from figure 1 of , one can see that some mm probes may respond poorly to the changes in the expression level of the target gene .
this phenomenon raised questions on the efficiency of using mm probes , and led some investigators to design custom arrays that use pm probes exclusively ( r. abagyan and yingyao zhou , personal communication ; b.r .
conklin , personal communication ) , and others to calculate fold changes using only pm probes ( f. naef , personal communication ) .
this design greatly increases the number of genes that can be studied on one array . to investigate the relative performance of pm / mm versus pm - only designs
, we exploited the model to estimate gene expression levels using only pm probes , and compared it to the mbei using both pm and mm probes .
the full intensity model ( equation 1 of ) specifies the relationship of pm probe responses and expression level : where vj is the baseline response of probe pair j due to nonspecific hybridization , and ' j is the sensitivity of pm probe of the probe pair j. the parameter estimates can be obtained by iteratively fitting i and vj,'j , regarding the other set as known . the same outlier exclusion procedure in is applied .
the mm probe responses have a similar form as equation 2 except for different probe - sensitivity indexes .
we fit a pm - only and an mm - only model to obtain expression values of all 20-probe probe sets using array set 1 . for comparison
, we also used half of the probe pairs ( by alternatively picking one out of every two probes ) in a 20-probe probe set to fit to the difference model ( equation 1 ) . for each probe set , these three sets of expression values were compared with the expression values of the original difference model using 20 probes , in terms of correlation of s obtained by two methods across the 21 arrays .
if , for a probe set , a simplified model ( pm - only , mm - only or 10-probe difference model ) performs reasonably well , we expect its estimates to correlate with that from the 20-probe difference model .
figure 3 shows the histogram and figure 4 the boxplot of correlations of s estimated from the 20-probe difference model and s estimated from the 10-probe difference model ( a ) , the 20-probe pm - only model ( b ) and the 20-probe mm - only model ( c ) . for probe sets with high presence proportion ,
both the 10-probe difference model and the pm - only model correlate well with the 20-probe difference model .
the mm - only model yields noticeably lower correlations , however . we note that this comparison is intrinsically biased in favor of the 10-probe difference model because the ' truth ' is constructed from pm - mm differences .
histogram of correlations between model - based expression values estimated using the 20-probe difference model and those estimated using different models .
( a ) 10-probe difference model ; ( b ) 20-probe pm - only model ; ( c ) 20-probe mm - only model .
boxplot of correlations between values estimated using the 20-probe difference model and s estimated using different models , stratified by presence proportion .
( a ) 10-probe difference model ; ( b ) 20-probe pm - only model ; and ( c ) 20-probe mm - only model . the number of presence calls for a probe set in the 21 arrays and the subpopulation size for the six boxplots are : 03 , 4,385 ; 47 , 693 ; 811 , 413 ; 1215 , 488 ; 1619 , 497 ; and 2021 , 323 .
this comparison corroborates the basic notion of the technology : the pm probes hybridize more strongly to the target signals than mm probes and contain most of the information .
we stress that , whereas the above analysis illustrates the applicability of model - based analysis to pm - only arrays , the assessment presented here is only tentative because of the limited information provided by the hu6800 arrays on the comparisons .
definitive comparisons of the efficiency of the designs must await the availability of data from pm - only arrays .
each pair consists of two arrays hybridizing to samples replicated at total mrna level ( the total mrna sample is split and then amplified and labeled separately , and hybridized to two different arrays ) .
the differences between the expression values of the two replicate arrays in a pair are due to the variation introduced in experimental steps after the split , the array manufacturing difference and analytical methods such as normalization and expression calculation .
this difference provides a lower bound of biological variation that can be detected between two independently amplified samples , and serves as a good statistic for comparing different analytical methods .
for comparison , we also used the method in to calculate ads for all probe sets and plot them in figure 5b ( ad is based on normalized probe values , see methods and materials section for the normalization method . also note that genechip software excludes probes
whose pm / mm difference is outside three standard deviations ( sds ) of all probe differences in either of the two arrays in the comparison ; here , as we are comparing multiple arrays at the same time , when calculating ads a probe is excluded if its difference is an outlier in the above sense in any of the arrays , until a minimum of five probes is reached , where all five probes will be used ) .
both the mbei and the ad method yielded some expression values differing by more than a factor of two , especially for genes at low expression level .
this might be explained by the relatively larger amplification variation for weakly expressed genes , given a constant success rate of amplifying a sequence by a certain fold .
log ( base 10 ) expression indexes of a pair of replicate arrays ( array 1 and 2 of array set 5 ) for different statistical methods .
( a ) mbei method ; ( b ) ad method . only 6,695 ( a ) and 4,696 ( b ) probe sets with positive values in both arrays are used .
the center line is y = x , and the flanking lines indicate the difference of a factor of two .
researchers often use ' log ratio ' between expression values of a gene in two arrays as the criterion for identifying differentially expressed genes . between duplicate arrays
, we expect these log ratios of expression values based on a good expression index ( ad or mbei ) to be close to zero . thus for every probe set we calculated its average absolute log ( base 10 ) ratio of 29 pairs of duplicates as a statistic to compare the variation in expression levels between duplicates using the ad or the mbei method .
the average absolute log ratio distribution of the mbei method is significantly lower than that of the ad method when expression level is low ( and thus probe sets have a low proportion of detections of the target gene across arrays ) .
as expression level becomes higher ( when the target gene of a probe set is detected in more arrays ) , the ad method shows a rapid improvement in performance , approaching the level of the mbei method .
the same boxplots ( figure 7 ) for another set of 60 human u95a arrays consisting of 30 replicate pairs conveys similar information .
these results suggest that the mbei method is able to extend the reliable detection limit of expression to a lower mrna concentration .
boxplots of average absolute log ( base 10 ) ratios between replicate arrays stratified by presence proportion for different statistical methods .
( a ) mbei method ; ( b ) ad method . the number of presence calls for a probe set in the 58 arrays for the six boxplots are : 09 , 1019 , 2029 , 3039 , 4049 , 5058 .
the title of each boxplot is the number of probe sets used for the boxplot .
log ratios are not calculated for negative expression values or expression values identified as ' array - outliers ' by the mbei method in either array of a replicate pair , and are not used to calculate the average .
744 probe sets are not included as their average absolute log ratios can not be calculated for all the 29 pairs using either method .
similar plots as in figure 6 for another set of 30 pairs of duplicated human u95a arrays .
( a ) mbei method ; ( b ) ad method.the number of presence calls for a probe set in the 60 arrays for the six boxplots are : 09 , 1019 , 2029 , 3039 , 4049 , 5060 .
the title of each boxplot is the number of probe sets used for the boxplot .
after obtaining expression indexes using ad or mbei , fold changes can be calculated between two arrays for every gene and used to identify differentially expressed genes .
usually , low or negative expressions are truncated to a small number before calculating fold changes , and genechip also cautions against using fold changes when the baseline expression is absent .
the availability of ses for the model - based expression indexes allows us to obtain confidence intervals for fold changes .
suppose where 1 and 2 are the real expression levels in the sample , and 1 and 2 are the model - based estimates of expression levels .
we substitute the model - based ses for 1 and 2 letting r = 1/2 be the real fold change , then inference on r can be based on the quantity it can be shown that q has a distribution with 1 degree of freedom irrespective of the values of 1 and 2 . thus q is a pivotal quantity involving r. we can use q to construct fixed - level tests and to invert them to obtain confidence intervals ( ci ) for fold changes .
table 1 presents the estimated expression indexes ( with ses ) in two arrays and the 90% confidence intervals of the fold changes for 14 genes .
although all genes have similar estimated fold changes , the confidence intervals are very different .
for example , gene 1 has fold change 2.47 and a tight confidence interval ( 2.06 , 3.02 ) .
in contrast , gene 11 has a similar fold change of 2.48 but a much wider confidence interval ( 0.96 , 18.18 ) .
thus the fold change around 2.5 for gene 11 is not as trustworthy as that for gene 1 .
further examination reveals that this is due to the large ses relative to the expression indexes for gene 11 .
this agrees with the intuition that when one or both expression levels are close to zero for one gene , the fold change can not be estimated with much accuracy .
in addition , when image contamination results in unreliable expression values with large ses , the fold changes calculated using these expression value are attached with wide cis . in this manner , the measurement accuracy of expression values propagates to the estimation of fold changes . using expression levels and associated ses to determine confidence intervals of fold changes in practice
, we find it useful to sort genes by the lower confidence bound ( ' lower cb ' in table 1 ) , which is a conservative estimate of the fold change .
when an expression index is negative ( as a result of taking pm / mm differences ) , we do not calculate the confidence intervals .
in such a case , it is more helpful to filter genes by presence calls .
cluster analysis is a popular method for analyzing the data of a series of microarrays [ 6 , 7 ] . if two genes are co - regulated at the transcription level , their expression values across samples are likely to be correlated . clustering algorithms use these correlations ( or monotone transformation of correlations ) to cluster co - regulated genes together .
the correlation based on the estimated expression levels may , however , be different from that based on the real but unobserved expression levels .
also , the commonly used hierarchical clustering algorithm is an irreversible process : once two genes or nodes are merged , they will stay together , even if later on there is good reason to adjust previous clustering .
thus there is a need to assess the reliability of clusters . a global way of using se in hierarchical clustering is to resample or bootstrap the whole ' gene by sample ' data matrix and redo the clustering
in bittner et al . , the data matrix coming from cdna microarray experiments is resampled using the estimated variation derived from the median sd of log ratios for a gene across samples .
as we now have ses for all data points , we can resample each expression value from a normal distribution with mean equal to the estimated expression value and sd equal to the attached se .
figure 8a shows a hierarchical clustering tree of 225 selected genes with presence proportion > 0.5 and coefficient of variation ( sd / mean ) > 0.7 across the 20 samples in array set 2 . in trying to interpret this tree
, we may be interested in the gene cluster colored in blue and the reliability of the gene members belonging to this cluster .
the whole data matrix is resampled , and the clustering is performed again ( figure 8b ) .
we notice that some blue genes ( genes in the original cluster are colored blue ) are clustered with other non - blue genes , and some non - blue genes are mixed into the main body of the blue genes . after each resampling
, we identify a cluster that contains more than 80% of all the blue genes , but as few non - blue genes as possible ( measured as a percentage of all genes in this cluster ) .
this cluster is considered to be the cluster that corresponds to the original one in figure 8a . in figure 8b the root node of the ' corresponding cluster '
is marked with small horizontal line intersecting the vertical line ( representing the range of the cluster ) on the right of the clustering picture .
then , for each of all the 225 genes , if it belongs to this ' corresponding cluster ' , we increase its ' in - cluster ' count by 1 .
after resampling 30 times , the in - cluster counts are indicated in gray - scale on the left side of the original clustering ( figure 8c ) , with black representing 30 and white representing zero . a high ' in - cluster
' count indicates a gene ' remains ' in the original cluster in most of the resampled clustering trees .
gene clustering ( a ) 225 filtered genes are clustered based on their expression profiles across 20 samples .
each gene 's expression values are standardized to have mean 0 and sd 1 across 20 samples .
although the original ' blue ' genes are scattered to various places , we can still determine where the original cluster is , using the criteria described in the text .
( c ) after resampling 30 times , the reliability of the genes belonging to the original cluster is indicated by the vertical gray - scale bar on the left of the blue - red picture .
we can see from figure 8c that most genes in the original cluster are reliable members , whereas a few genes at the bottom of the cluster are not ( in fact they are merged into the original cluster last ) .
interestingly , some genes originally not in the original cluster group with the ' corresponding clusters ' during resampling many times and have gray ' in - cluster ' marks .
these genes may be related to the original cluster in some way . in summary , this method can help us to distinguish reliable and unreliable gene members of a cluster , as well as draw our attention to related genes originally clustered somewhere else because of the accidental nature of hierarchical clustering .
we have developed a software package dna - chip analyzer ( dchip ) to perform invariant - set normalization ( see below ) , calculation of mbei , computation of confidence intervals of fold changes , and hierarchical clustering with resampling .
our experience is that more than 10 arrays are appropriate for model training , outlier detection and mbei calculation .
researchers with fewer than 10 arrays may seek arrays of the same chip type and hybridizing to similar tissue samples , and combine them in a single dchip analysis session .
we are exploring model - based meta - analysis of many arrays of the same chip type but hybridizing to a heterogeneous set of tissues samples , and will present such analysis in future work .
as array images usually have different overall image brightness ( figure 9a ) , especially when they are generated at different times and places , proper normalization is required before comparing the expression levels of genes between arrays .
model - based expression computation requires normalized probe - level data ( from affymetrix 's dat or cel files ) . for a group of arrays
, we normalize all arrays ( except the baseline array ) to a common baseline array having the median overall brightness ( as measured by the median cel intensity in an array ) .
( a ) the cel intensities ( see text ) of a pair of replicate arrays ( array 11 and 12 in array set 5 ) are plotted against each other .
the baseline array 11 ( shown on the y - axis ) is not as bright as array 12 ( shown on the x - axis ) .
the smoothing spline ( green curve ) deviates from the diagonal line y = x ( blue curve ) , indicating the need for normalization .
( b ) the same plot as ( a ) with superimposed circles representing the invariant set , on the basis of which a piecewise linear normalization relationship is determined ( black dotted line , whose y - coordinate is the normalized value of array 12 ) .
the normalization curve is close to the smoothing spline curve in ( a ) as the two arrays are replicated arrays and all probes should be invariant .
( c ) after normalization ( y - axis is the baseline array 11 , and x - axis the normalized value of array 12 ) , the scatterplot centers around the diagonal line and the array 12 is adjusted to have the similar overall brightness as array 11 .
( d ) the q - q plot of probe intensities of array 11 and normalized array 12 shows the probes in the two sets have almost the same distribution .
a normalization relation can be understood as a curve in the scatterplot of two arrays with the baseline array drawn on the y - axis and the array to be normalized on the x - axis .
a straight line running through the origin is a multiplicative normalization method ( genechip 's scaling method ) , and a smoothing spline through the scatterplot can also be used ( figure 9a , also see ) .
we should base the normalization only on probe values that belong to non - differentially expressed genes , but generally we do not know which genes are non - differentially expressed ( control or housekeeping genes may also be variable across arrays ) .
nevertheless , we expect that a probe of a non - differentially expressed gene in two arrays to have similar intensity ranks ( ranks are calculated in two arrays separately ) .
we use an iterative procedure to identify a set of probes ( called the invariant set ) , which presumably consists of points from non - differentially expressed genes ( figure 9b ) . specifically , we start with points of all pm probes ( about 140,000 for hu6800 array ) .
if a point 's proportion rank difference ( prd , absolute rank difference in two arrays divided by n = 140,000 ) is small enough , it is kept for the new set . here
the threshold of being small is prd < 0.003 when a points 's average intensity ranks in the two arrays is small and prd < 0.007 when it is large , accounting for fewer points at high - intensity range ; and the threshold is interpolated in between .
we chose these parameters empirically to make the selected points in the invariant set thin enough to naturally determine a normalization relation . in this way
we may obtain a new set of 10,000 points , and the same procedure is applied to the new set iteratively , until the number of points in the new set does not decrease anymore . a piecewise linear running median line
figure 10 shows another pair of arrays where the normalization relationship is non - linear .
similar plots as in figure 9 for arrays hybridized to two different samples ( array 24 and 36 of array set 5 ) .
( a ) cel intensities ; ( b ) same plot as in ( a ) with superimposed circles representing the invariant set ; ( c ) after renormalization ; ( d ) q - q plot of normalized probe intensities .
note that the smoothing spline in ( a ) is affected by several points at the lower - right corner , which might belong to differentially expressed genes .
the invariant set , on the other hand , does not include these points when determining the normalization curve , leading to a different normalization relationship at the high end .
we have developed a software package dna - chip analyzer ( dchip ) to perform invariant - set normalization ( see below ) , calculation of mbei , computation of confidence intervals of fold changes , and hierarchical clustering with resampling .
our experience is that more than 10 arrays are appropriate for model training , outlier detection and mbei calculation .
researchers with fewer than 10 arrays may seek arrays of the same chip type and hybridizing to similar tissue samples , and combine them in a single dchip analysis session .
we are exploring model - based meta - analysis of many arrays of the same chip type but hybridizing to a heterogeneous set of tissues samples , and will present such analysis in future work .
as array images usually have different overall image brightness ( figure 9a ) , especially when they are generated at different times and places , proper normalization is required before comparing the expression levels of genes between arrays .
model - based expression computation requires normalized probe - level data ( from affymetrix 's dat or cel files ) . for a group of arrays ,
we normalize all arrays ( except the baseline array ) to a common baseline array having the median overall brightness ( as measured by the median cel intensity in an array ) .
( a ) the cel intensities ( see text ) of a pair of replicate arrays ( array 11 and 12 in array set 5 ) are plotted against each other .
the baseline array 11 ( shown on the y - axis ) is not as bright as array 12 ( shown on the x - axis ) .
the smoothing spline ( green curve ) deviates from the diagonal line y = x ( blue curve ) , indicating the need for normalization .
( b ) the same plot as ( a ) with superimposed circles representing the invariant set , on the basis of which a piecewise linear normalization relationship is determined ( black dotted line , whose y - coordinate is the normalized value of array 12 ) .
the normalization curve is close to the smoothing spline curve in ( a ) as the two arrays are replicated arrays and all probes should be invariant .
( c ) after normalization ( y - axis is the baseline array 11 , and x - axis the normalized value of array 12 ) , the scatterplot centers around the diagonal line and the array 12 is adjusted to have the similar overall brightness as array 11 .
( d ) the q - q plot of probe intensities of array 11 and normalized array 12 shows the probes in the two sets have almost the same distribution .
a normalization relation can be understood as a curve in the scatterplot of two arrays with the baseline array drawn on the y - axis and the array to be normalized on the x - axis .
a straight line running through the origin is a multiplicative normalization method ( genechip 's scaling method ) , and a smoothing spline through the scatterplot can also be used ( figure 9a , also see ) .
we should base the normalization only on probe values that belong to non - differentially expressed genes , but generally we do not know which genes are non - differentially expressed ( control or housekeeping genes may also be variable across arrays ) .
nevertheless , we expect that a probe of a non - differentially expressed gene in two arrays to have similar intensity ranks ( ranks are calculated in two arrays separately ) .
we use an iterative procedure to identify a set of probes ( called the invariant set ) , which presumably consists of points from non - differentially expressed genes ( figure 9b ) . specifically , we start with points of all pm probes ( about 140,000 for hu6800 array ) .
if a point 's proportion rank difference ( prd , absolute rank difference in two arrays divided by n = 140,000 ) is small enough , it is kept for the new set . here
the threshold of being small is prd < 0.003 when a points 's average intensity ranks in the two arrays is small and prd < 0.007 when it is large , accounting for fewer points at high - intensity range ; and the threshold is interpolated in between .
we chose these parameters empirically to make the selected points in the invariant set thin enough to naturally determine a normalization relation . in this way
we may obtain a new set of 10,000 points , and the same procedure is applied to the new set iteratively , until the number of points in the new set does not decrease anymore . a piecewise linear running median line
figure 10 shows another pair of arrays where the normalization relationship is non - linear .
similar plots as in figure 9 for arrays hybridized to two different samples ( array 24 and 36 of array set 5 ) .
( a ) cel intensities ; ( b ) same plot as in ( a ) with superimposed circles representing the invariant set ; ( c ) after renormalization ; ( d ) q - q plot of normalized probe intensities .
note that the smoothing spline in ( a ) is affected by several points at the lower - right corner , which might belong to differentially expressed genes .
the invariant set , on the other hand , does not include these points when determining the normalization curve , leading to a different normalization relationship at the high end .
we thank sven de vos , dan tang , nik brown , stan nelson , jae k. lee , yaron hakak , john walker and arindam bhattacharjee for providing data , and the editor and referees who provided valuable suggestions .
this work is supported in part by nih grant 1 ro1 hg02341 - 01 and nsf grant dbi-9904701 . | backgrounda model - based analysis of oligonucleotide expression arrays we developed previously uses a probe - sensitivity index to capture the response characteristic of a specific probe pair and calculates model - based expression indexes ( mbei ) .
mbei has standard error attached to it as a measure of accuracy .
here we investigate the stability of the probe - sensitivity index across different tissue types , the reproducibility of results in replicate experiments , and the use of mbei in perfect match ( pm)-only arrays.resultsprobe-sensitivity indexes are stable across tissue types . the target gene 's presence in many arrays of an array set allows the probe - sensitivity index to be estimated accurately .
we extended the model to obtain expression values for pm - only arrays , and found that the 20-probe pm - only model is comparable to the 10-probe pm / mm difference model , in terms of the expression correlations with the original 20-probe pm / mm difference model .
mbei method is able to extend the reliable detection limit of expression to a lower mrna concentration .
the standard errors of mbei can be used to construct confidence intervals of fold changes , and the lower confidence bound of fold change is a better ranking statistic for filtering genes .
we can assign reliability indexes for genes in a specific cluster of interest in hierarchical clustering by resampling clustering trees .
a software dchip implementing many of these analysis methods is made available.conclusionsthe model - based approach reduces the variability of low expression estimates , and provides a natural method of calculating expression values for pm - only arrays .
the standard errors attached to expression values can be used to assess the reliability of downstream analysis . | Background
Results and discussion
Probe-sensitivity indexes are stable across tissue types
Model-based analysis for PM-only arrays
MBEI reduces variability for low expression estimates
Confidence interval for fold change
Standard errors help to assess clustering results
Methods and materials
Software
Normalization of arrays based on an 'invariant set'
Acknowledgements |
we evaluated rates of sustained virologic response 12 weeks after the end of treatment ( svr12 ) , adverse events , and graded laboratory abnormalities in black versus nonblack subjects in the phase 3 ion program .
the ion1 , ion2 , and ion3 clinical trials evaluated the safety and efficacy of 8 , 12 , and 24 weeks of the fixeddose combination of ledipasvir and sofosbuvir with or without ribavirin for treatment of genotype1 chronic hcv .
there was no upper limit to age or body mass index ( bmi ) , and the primary endpoint was svr12 for all trials .
the ion1 trial was a phase 3 openlabel study involving 865 ( 16% cirrhotic ) previously untreated patients with chronic hcv . in the ion1 trial , patients were randomly assigned to four arms in a 1:1:1:1 ratio to receive ledipasvir / sofosbuvir in a fixeddose combination tablet once daily for 12 weeks ( with or without ribavirin ) or for 24 weeks ( with or without ribavirin).12
the ion2 clinical trial was structured similarly to the ion1 trial ; however , it was a phase 3 , randomized openlabel study involving 440 patients ( 20% cirrhotic ) infected with hcv genotype 1 who had not had a sustained virologic response after treatment with peginterferon and ribavirin , with or without a protease inhibitor.13 similar to the ion1 trial , patients in the ion2 trial were randomly assigned to receive ledipasvir and sofosbuvir in a oncedaily , fixeddose combination tablet for 12 or 24 weeks with or without ribavirin .
given the high svr12 rates seen at 12 weeks for the ion1 and ion2 trials , the ion3 trial was devised to evaluate svr after 8 weeks of treatment.14 ion3 was an openlabel study with random assignment of 647 previously untreated patients with hcv genotype 1 infection without cirrhosis to receive the combination of ledipasvir and sofosbuvir with or without ribavirin for 8 weeks or ledipasvir / sofosbuvir for 12 weeks . using pooled data from the ion trials , we performed an integrated ad hoc analysis to evaluate the efficacy and safety of ledipasvir / sofosbuvir with or without ribavirin in black versus nonblack patients .
descriptive summaries were provided by race ( black or nonblack ) for the key demographics and baseline characteristics , including age , sex , bmi , il28b genotype , and so forth .
the svr12 rate and the twosided 95% exact confidence interval ( clopperpearson method ) were calculated by race ( black or nonblack ) and for each subgroup defined by prior hcv treatment experience ( treatmentnave or treatmentexperienced ) , cirrhosis status ( cirrhotic versus noncirrhotic ) , and baseline hcv rna ( < 6 or 6 million iu / ml ) .
safety data were analyzed by the number and percent of black versus nonblack patients experiencing adverse events .
of the 1952 patients randomized and treated in the ion studies , 308 ( 16% ) selfreported their race as black .
of the remaining 1644 patients in these studies , three declined to report race , leaving 1641 nonblack patients for comparison in this analysis .
overall , approximately one quarter of the patients had a bmi 30 kg / m ; this proportion was considerably higher among black patients than it was among nonblack patients ( 41% versus 23% ) .
overall , 12% of patients , but only 7% of blacks , had compensated cirrhosis . as expected , more blacks had noncc il28b genotypes than nonblacks ( 90% versus 73% ) . the mean alanine aminotransferase level for blacks ( 61
u / l ) was lower than that of nonblacks ( 77 u / l ) . among the ion study participants ,
similar proportions of black and nonblack patients were treatmentexperienced and had hcv rna 800,000 iu / ml . abbreviations : alt , alanine aminotransferase ; bmi , body mass index ; egfr , estimated glomerular filtration rate ; hcv , hepatitis c virus .
overall , 95% of black patients ( 95% confidence interval [ ci ] , 92%97% ) and 97% of nonblack patients ( 95% ci , 96%98% ) achieved svr12 ( fig .
table 2 shows svr12 rates in black versus nonblack patients by treatment history , cirrhosis status , regimen , and combined regimen and baseline viral load .
although these subgroups were not powered for formal comparisons , some general observations may be made . among treatmentnave patients without cirrhosis who received 8 weeks of ledipasvir / sofosbuvir with and without ribavirin ,
the rate of svr12 was 90% among blacks versus 94% among nonblacks . in most , but not all , subgroups of those receiving 8 weeks of treatment ,
there are similar differences , with slightly more nonblack patients achieving svr12 than black patients .
the largest difference was between black and nonblack patients with a high viral load at baseline ( hcv rna 6,000,000 ) not receiving ribavirin ( 83% versus 92% ) .
svr12 by baseline factors , treatment history , and regimen patients who did not disclose their race or who were missing cirrhosis status were excluded from the analysis .
abbreviations : ci , confidence interval ; hcv , hepatitis c virus ; ldv , ledipasvir ; rbv , ribavirin ; sof , sofosbuvir ; svr12 , sustained virologic response at 12 weeks after the end of therapy .
overall , 10 black patients ( 3% ) relapsed compared with 26 nonblack patients ( 2% ) , but among patients receiving 8 weeks of treatment , there was a substantial numerical difference : 9% of black patients relapsed versus 4% of nonblack patients . one black patient , a 63yearold man with hcv genotype 1b who was in the 24week ledipasvir / sofosbuvir group of ion1 , had virologic breakthrough at week 8 of treatment .
this patient had undetectable plasma concentrations of ledipasvir and the circulating metabolite of sofosbuvir at weeks 8 and 10 , suggesting nonadherence to the study treatment .
four of these 11 patients had ns5a or ns5b resistanceassociated variants ( ravs ) at baseline , and nine had y93h or q30 ns5a ravs at the time of relapse .
characteristics of black patients with virologic failure abbreviations : f , female ; hcv , hepatitis c virus ; ldv , ledipasvir ; m , male ; pi , protease inhibitor ; rav , resistanceassociated variant ; rbv , ribavirin ; sof , sofosbuvir .
table 4 shows svr12 and virologic failure rates in black and nonblack patients by presence or absence of baseline ns5a ravs .
both black and nonblack patients with baseline ns5a ravs at baseline had rates of svr12 that were numerically lower and rates of virologic failure that were numerically higher than patients without baseline ravs , but the difference was not large ( between 4 and 7 percentage points ) .
black patients with and without ns5a ravs had slightly lower rates of svr12 and higher rates of virologic failure than corresponding groups of nonblack patients , but again the numeric differences were slight ( between 2 and 5 percentage points ) .
virologic outcomes in black and nonblack patients by presence or absence of baseline ns5a ravs for patients for whom sequencing data were available .
differences in response and relapse by race are less evident among patients receiving 12 and 24 weeks of treatment .
overall , rates of svr12 among treatmentnave and treatmentexperienced patients , as well as those with and without cirrhosis , are similarly high in black and nonblack cohorts .
94% for nonblacks , and in patients receiving a 24week regimen , svr12 rates were 100% for nonblacks and 97% for blacks ( table 2 ) .
no racebased differences were evident by cirrhosis status in patients receiving 12 weeks of treatment .
both black and nonblack patients with cirrhosis had an svr12 rate of 92% , which was lower than the rate in patients without cirrhosis , but black and nonblack patients without cirrhosis had similar rates of svr12 ( 99% versus 97% ) . in patients receiving 24 weeks of treatment , however , a lower proportion of black patients with cirrhosis had svr12 ( 90% ) than nonblack patients with cirrhosis ( 100% ) , however , there were only 10 black patients with cirrhosis in this group .
the efficacy of ledipasvir / sofosbuvir did not appear to be greatly affected by the presence of ribavirin in black or nonblack patients .
the four analysis groups of patients receiving 12 weeks of treatment black patients receiving ribavirin , black patients not receiving ribavirin , nonblack patients receiving ribavirin , and nonblack patients not receiving ribavirin all had very similar svr12 rates within the range of 96%99% . among patients receiving 24 weeks of treatment , one group
black patients not receiving ribavirin had an svr12 rate that was substantially lower ( 92% ) than that of the other groups ( 99%100% ) . for a safety analysis , we pooled patients by race ( black versus nonblack ) and drug combination ( ledipasvir / sofosbuvir versus ledipasvir / sofosbuvir plus ribavirin ) .
the most common adverse events in all groups were fatigue , headache , nausea , and insomnia ( table 5 ) . dose modification or interruption
was required in 13% of black patients and 14% of nonblack patients receiving ledipasvir / sofosbuvir plus ribavirin compared with < 1% of black and nonblack patients receiving ledipasvir / sofosbuvir alone . in general , a numerically larger percentage of black patients receiving ledipasvir / sofosbuvir plus ribavirin had safety events than black patients receiving ledipasvir / sofosbuvir alone .
the same was true for nonblack patients ; more nonblack patients receiving ledipasvir / sofosbuvir plus ribavirin experienced safety events than those receiving ledipasvir / sofosbuvir alone .
overall safety by race events occurring in at least 10% of patients in any treatment group .
of the 1952 patients randomized and treated in the ion studies , 308 ( 16% ) selfreported their race as black .
of the remaining 1644 patients in these studies , three declined to report race , leaving 1641 nonblack patients for comparison in this analysis .
overall , approximately one quarter of the patients had a bmi 30 kg / m ; this proportion was considerably higher among black patients than it was among nonblack patients ( 41% versus 23% ) .
overall , 12% of patients , but only 7% of blacks , had compensated cirrhosis . as expected , more blacks had noncc il28b genotypes than nonblacks ( 90% versus 73% ) . the mean alanine aminotransferase level for blacks ( 61
u / l ) was lower than that of nonblacks ( 77 u / l ) . among the ion study participants ,
similar proportions of black and nonblack patients were treatmentexperienced and had hcv rna 800,000 iu / ml . abbreviations : alt , alanine aminotransferase ; bmi , body mass index ; egfr , estimated glomerular filtration rate ; hcv , hepatitis c virus .
overall , 95% of black patients ( 95% confidence interval [ ci ] , 92%97% ) and 97% of nonblack patients ( 95% ci , 96%98% ) achieved svr12 ( fig .
table 2 shows svr12 rates in black versus nonblack patients by treatment history , cirrhosis status , regimen , and combined regimen and baseline viral load .
although these subgroups were not powered for formal comparisons , some general observations may be made . among treatmentnave patients without cirrhosis who received 8 weeks of ledipasvir / sofosbuvir with and without ribavirin ,
in most , but not all , subgroups of those receiving 8 weeks of treatment , there are similar differences , with slightly more nonblack patients achieving svr12 than black patients .
the largest difference was between black and nonblack patients with a high viral load at baseline ( hcv rna 6,000,000 ) not receiving ribavirin ( 83% versus 92% ) .
svr12 by baseline factors , treatment history , and regimen patients who did not disclose their race or who were missing cirrhosis status were excluded from the analysis .
abbreviations : ci , confidence interval ; hcv , hepatitis c virus ; ldv , ledipasvir ; rbv , ribavirin ; sof , sofosbuvir ; svr12 , sustained virologic response at 12 weeks after the end of therapy .
overall , 10 black patients ( 3% ) relapsed compared with 26 nonblack patients ( 2% ) , but among patients receiving 8 weeks of treatment , there was a substantial numerical difference : 9% of black patients relapsed versus 4% of nonblack patients .
one black patient , a 63yearold man with hcv genotype 1b who was in the 24week ledipasvir / sofosbuvir group of ion1 , had virologic breakthrough at week 8 of treatment .
this patient had undetectable plasma concentrations of ledipasvir and the circulating metabolite of sofosbuvir at weeks 8 and 10 , suggesting nonadherence to the study treatment .
four of these 11 patients had ns5a or ns5b resistanceassociated variants ( ravs ) at baseline , and nine had y93h or q30 ns5a ravs at the time of relapse .
characteristics of black patients with virologic failure abbreviations : f , female ; hcv , hepatitis c virus ; ldv , ledipasvir ; m , male ; pi , protease inhibitor ; rav , resistanceassociated variant ; rbv , ribavirin ; sof , sofosbuvir . table 4 shows svr12 and virologic failure rates in black and nonblack patients by presence or absence of baseline ns5a ravs .
both black and nonblack patients with baseline ns5a ravs at baseline had rates of svr12 that were numerically lower and rates of virologic failure that were numerically higher than patients without baseline ravs , but the difference was not large ( between 4 and 7 percentage points ) .
black patients with and without ns5a ravs had slightly lower rates of svr12 and higher rates of virologic failure than corresponding groups of nonblack patients , but again the numeric differences were slight ( between 2 and 5 percentage points ) .
virologic outcomes in black and nonblack patients by presence or absence of baseline ns5a ravs for patients for whom sequencing data were available .
differences in response and relapse by race are less evident among patients receiving 12 and 24 weeks of treatment .
overall , rates of svr12 among treatmentnave and treatmentexperienced patients , as well as those with and without cirrhosis , are similarly high in black and nonblack cohorts .
94% for nonblacks , and in patients receiving a 24week regimen , svr12 rates were 100% for nonblacks and
, no racebased differences were evident by cirrhosis status in patients receiving 12 weeks of treatment .
both black and nonblack patients with cirrhosis had an svr12 rate of 92% , which was lower than the rate in patients without cirrhosis , but black and nonblack patients without cirrhosis had similar rates of svr12 ( 99% versus 97% ) . in patients receiving 24 weeks of treatment ,
however , a lower proportion of black patients with cirrhosis had svr12 ( 90% ) than nonblack patients with cirrhosis ( 100% ) , however , there were only 10 black patients with cirrhosis in this group .
the efficacy of ledipasvir / sofosbuvir did not appear to be greatly affected by the presence of ribavirin in black or nonblack patients .
the four analysis groups of patients receiving 12 weeks of treatment black patients receiving ribavirin , black patients not receiving ribavirin , nonblack patients receiving ribavirin , and nonblack patients not receiving ribavirin all had very similar svr12 rates within the range of 96%99% . among patients receiving 24 weeks of treatment , one group
black patients not receiving ribavirin had an svr12 rate that was substantially lower ( 92% ) than that of the other groups ( 99%100% ) .
for a safety analysis , we pooled patients by race ( black versus nonblack ) and drug combination ( ledipasvir / sofosbuvir versus ledipasvir / sofosbuvir plus ribavirin ) .
the most common adverse events in all groups were fatigue , headache , nausea , and insomnia ( table 5 ) .
dose modification or interruption was required in 13% of black patients and 14% of nonblack patients receiving ledipasvir / sofosbuvir plus ribavirin compared with < 1% of black and nonblack patients receiving ledipasvir / sofosbuvir alone . in general , a numerically larger percentage of black patients receiving ledipasvir / sofosbuvir plus ribavirin had safety events than black patients receiving ledipasvir / sofosbuvir alone .
the same was true for nonblack patients ; more nonblack patients receiving ledipasvir / sofosbuvir plus ribavirin experienced safety events than those receiving ledipasvir / sofosbuvir alone . for both dose combinations , fewer black patients than nonblack patients had safety events .
overall safety by race events occurring in at least 10% of patients in any treatment group .
in this analysis of data from the ion phase 3 clinical trials evaluating the fixeddose combination of ledipasvir / sofosbuvir with and without ribavirin in treatmentnave and previously treated patients with genotype 1 hcv , we found that black patients had rates of svr12 similar to those in nonblack patients , regardless of treatment history , treatment duration , or cirrhosis status . among the 308 patients who selfidentified as black , svr12 rates were high ( 90% ) even among those with compensated cirrhosis and those who had previously failed previous treatment , including treatment with a protease inhibitor and peginterferon / ribavirin .
the addition of ribavirin did not appear to increase svr12 rates but led to higher rates of adverse events .
the factor that appeared to be most strongly associated with response was treatment duration ; the rate of relapse among black patients in the 8week treatment arms of ion3 was 8.6% compared with 1.5% among blacks receiving 12 weeks of treatment and 1.1% among blacks receiving 24 weeks of treatment .
even so , this result likely understates the difference in response by treatment duration , given that the 8week group enrolled only treatmentnave patients without cirrhosis , whereas the groups receiving 12 and 24 weeks of treatment included previously treated patients and those with cirrhosis .
if patients receiving the clearly suboptimal duration of 8 weeks are omitted from the analysis , there are not enough patients with virologic failure ( n = 3 ) to make any generalizations concerning factors predictive of treatment success or failure . given the known safety profile of ribavirin
, higher rates of adverse events in patients receiving ribavirin than in those receiving sofosbuvirledipasvir alone were expected .
this pattern was evident in comparing black patients who did and did not receive ribavirin and nonblack patients who did and did not receive ribavirin .
what was unexpected was that black patients receiving ledipasvir / sofosbuvir and those receiving ledipasvir / sofosbuvir plus ribavirin had consistently lower rates of most adverse events than nonblack patients ( table 4 ) .
the reason for these differences is not known but may be partly explained by the fact that a slightly higher percentage of black patients than nonblack patients received 8 weeks of treatment ( 26% versus 21% ) and a lower percentage of black patients had cirrhosis ( 7% versus 12% ) .
one might have expected , however , that these differences would have been offset by the higher mean age and bmi among black patients .
our analysis is limited by the retrospective framework and need to combine the black population across all three of the ion studies for these comparisons .
overall , the ion1 , 2 , and 3 studies achieved a relatively good level of diversity with black patients representing 16% of the study population .
however , even with 300 patients , we lose the necessary means to achieve reliable results when attempting to look at subgroups , such as when examining compensated cirrhosis in blacks ( only 38 patients ) . therefore , although the ion1 , 2 , and 3 studies when combined achieved a relatively diverse population for analysis , the overall population was still too small to perform the nuanced analyses required to definitively show efficacy and safety in diverse populations .
a lack of participation of minorities in clinical trials is a major barrier to identifying treatment regimens for diverse populations .
blacks are disproportionally affected by hcv and represent the majority of patients treated for hcv within certain communities across the united states , yet they are severely underrepresented in hcv clinical trials . given the known historical differences in svr based on race , the black population within clinical trials must be increased .
a recent report of data from the ion4 study looking at the fixeddose combination of ledipasvir and sofosbuvir for treating hcv in coinfected patients highlights the need for these types of analyses.15 here , among individuals coinfected with hcv and hiv , the overall svr12 rate was 96% .
similar svr rates were achieved for treatmentnave and treatmentexperienced participants ( 95% and 97% , respectively ) , and for subjects with and without cirrhosis ( 94% and 96% , respectively).15 however , black patients had lower svr12 rates than nonblack patients ( 90% [ 95% ci , 83%95% ] versus 99% [ 95% ci , 97%100% ] ; p < 0.001 ) .
all 10 patients who experienced virologic relapse in this trial were black . in a multivariate analysis ,
population pharmacokinetics of ledipasvir was the same when comparing black versus nonblack race , efavirenz versus nonefavirenz antiretroviral regimens , and svr versus relapse .
this is the first study of directacting antivirals to suggest a lower svr in black patients .
this finding needs to be confirmed in other studies , which will only be achieved if future trials are powered with respect to population diversity to address this question.15
this is an exciting time in the treatment of viral hepatitis .
we are now identifying alloral , well tolerated , safe , and efficacious treatments for hcv .
future work within this field of hepatology will need to ensure that these regimens are safe and efficacious in all populations affected by hcv .
the ion4 study is an example of the kind of potentially surprising results that can be obtained when a clinical trial includes an appropriate population of underrepresented minorities .
whether the ion4 findings are an aberration , unique to that trial , or strictly relevant to coinfected populations is unclear ; only further studies of diverse populations can settle these questions .
here , we show that an all oral interferonfree regimen has great potential because of its equal efficacy and safety in an underrepresented population . due to the relatively small population ,
however , it is important that future studies confirm these findings using study populations that have a larger minority population . | black patients chronically infected with genotype 1 hepatitis c virus ( hcv ) have historically had lower rates of response to interferonbased treatment than patients of other races . in the phase 3 ion program ,
the singletablet regimen of the ns5a inhibitor ledipasvir and ns5b nucleotide polymerase inhibitor sofosbuvir was shown to be safe and highly effective in the general population .
the aim of this study was to evaluate the safety and efficacy of ledipasvir / sofosbuvir in black patients using data from the three openlabel ion clinical trials , which evaluated the safety and efficacy of 8 , 12 , and 24 weeks of ledipasvir / sofosbuvir with or without ribavirin for the treatment of treatmentnave and treatmentexperienced patients with genotype 1 hcv , including those with compensated cirrhosis .
the primary endpoint was sustained virologic response at 12 weeks after the end of therapy ( svr12 ) . for our analysis
, rates of svr12 , treatmentemergent adverse events , and graded laboratory abnormalities were analyzed in black versus nonblack patients . of the 1949 patients evaluated ,
308 ( 16% ) were black . on average , black patients were older , had higher body mass index , were more likely to be il28b noncc , and had a lower serum alanine aminotransferase at baseline than nonblack patients .
overall , 95% of black and 97% of nonblack patients achieved svr12 .
the rate of relapse was 3% in black patients as compared with 2% in nonblack patients .
the most common adverse events included fatigue , headache , nausea , and insomnia .
the majority of adverse events occurred more frequently in the ribavirincontaining arms of the studies .
no differences were observed in overall safety by race .
conclusion : a oncedaily dosage of ledipasvir / sofosbuvir was similarly effective in black and nonblack patients with genotype 1 hcv infection .
the addition of ribavirin did not appear to increase svr12 but was associated with higher rates of adverse events .
( hepatology 2016;63:437444 ) | Patients and Methods
Results
Demographics
Efficacy
Safety
Discussion |
we conducted real - time pcr analyses targeting the msp2 gene on genomic ( g ) dna of 12,606 i. scapularis ticks collected across canada ( technical appendix 1 ) .
169 ( 1.3% ) ticks were pcr - positive ( table 1 ) . there were significant differences ( 5 = 129.7 , p<0.001 ) in the proportions of ticks infected with a. phagocytophilum among geographic regions ; with a greater proportion of pcr - positive ticks in manitoba than in ontario , quebec , and the atlantic provinces . * data from these provinces were not included in the statistical analyses because sample sizes ( 20072010 ) were < 100 ticks .
we developed pcr - based assays to distinguish the ap - ha strain from the ap - variant 1 strain of a. phagocytophilum based on dna sequence comparisons of the 16s rrna gene of each strain ( technical appendix 1 ) over a much larger region ( 875 bp ) than in previous studies ( 1,3 ) .
in addition to the 2 nucleotide differences described previously ( 1,3 ) , a third difference ( at position 536 ) was detected in the aligned sequences ( technical appendix 2 ) .
this nucleotide alteration in the dna sequence of the ap - variant 1 strain was associated with a restriction site for the endonuclease kpn2i ( t / ccgga ) that was absent in the sequence of the ap - ha strain .
two pcr - rflp assays ( technical appendix 1 ) , developed at different laboratories , were designed on the basis of this sequence difference and tested on 22 amplicons derived from a. phagocytophilum infected ticks collected in minnesota , usa
eighteen amplicons remained undigested ( i.e. , a single band of 920 bp ) , and 3 amplicons had 2 bands ( 360 and 550 bp ) , representing the expected patterns for the ap - ha strain and ap - variant 1 strain , respectively ( figure 1 ) .
these results were confirmed on the basis of comparisons of the dna sequences of representative samples . the rflp pattern of 1 amplicon , derived from the gdna of a female tick from itasca state park , minnesota , consisted of 3 bands ( 360 , 550 and 920 bp ) ( technical appendix 2 ) , suggesting a mixture of the 2 strains .
additional analyses of another 125 amplicons from a. phagocytophilum - infected ticks revealed that 79 ( 63% ) had rflp patterns consistent with the ap - variant 1 strain , and 46 ( 37% ) had rflp patterns of the ap - ha strain .
the dna sequences of a subset of these samples ( n = 58 ) showed 100% agreement between rflp pattern and strain type of a. phagocytophilum ( i.e. , 24 of the ap - ha strain and 34 of the ap - variant 1 strain ) .
restriction fragment length polymorphism patterns of 16s dna for 7 anaplasma phagocytophilum pcr positive ixodes scapularis ticks .
all amplicons were produced by semi - nested pcr and digested with the restriction enzyme kpn2i .
we also designed a custom taqman snp genotyping assay ( https://www.lifetechnologies.com/order/custom-genomic-products/tools/genotyping ) to differentiate the two a. phagocytophilum strains on the basis of a nucleotide difference at the 5 end of the 16s rrna gene sequence ( technical appendix 1 ) .
the snp assay clearly discriminated between ticks infected with the ap - ha and/or ap - variant 1 strains ( figure 2 ) .
of the 142 amplicons tested by this assay , 82 ( 58% ) contained the ap - variant 1 strain , 59 ( 42% ) contained the ap - ha strain , and 1 contained a mixture of both strains , which was in 100% agreement with the results of the rflp analyses and dna sequencing .
the results of the snp analyses also revealed a significant difference ( 2 = 40.48 , p<0.001 ) in the proportions of i. scapularis ticks infected with the ap - ha strain among geographic regions ( table 2 ) . a smaller proportion of ticks from central provinces were infected with the ap - ha strain when compared with those from the prairie and atlantic provinces .
allelic discrimination plot for the anaplasma single nucleotide polymorphism assay based on the 16s rna gene .
blue circles represent samples that contain the ap - ha strain ; green circles represent samples that contain the ap - variant 1 strain .
includes 13 ticks listed in table 1 and an additional 11 a. phagocytophilum infected ticks collected by drag sampling at 2 sites in ontario .
a small proportion ( 1.3% ) of i. scapularis ticks collected in canada were infected with a. phagocytophilum .
the prevalence of a. phagocytophilum-infected ticks differed among geographic regions , but the potential significance of this finding needs to be explored further . although knowledge of the prevalence of a. phagocytophilum infected i. scapularis ticks provides some information for determining the public health risks for hga , the prevalence of the ap - ha strain of a. phagocytophilum in blacklegged ticks should be considered for risk assessment , since the ap - ha strain , and not the ap - variant 1 strain , is most often associated with clinical cases of hga ( 4 ) . for the current study
, 3 pcr - based assays were developed to distinguish the ap - ha strain from the ap - variant 1 strain .
each of the 3 assays detected the presence of both strains in the gdna of a female tick .
mixed infections of both strains in i. scapularis ticks have been reported ( 4 ) , but appear to be uncommon .
results of these assays also were 100% concordant with the results of 2 rflp assays ( developed at different laboratories ) that were tested on the same gdna samples .
similarly , there was total concordance in the identifications of the a. phagocytophilum strains present within 125 infected ticks collected across canada by using the seminested pcr - rflp assay and the taqman snp genotyping assay .
the results of these analyses revealed significant differences in the proportion of blacklegged ticks infected with the ap - ha strain among geographic regions ( p<0.001 ) .
the public health implications of these findings need to be examined in more detail , using the molecular assays developed in this study .
the taqman snp genotyping assay is ideal for clinical and epidemiologic use where it may be essential to distinguish between the 2 strains of a. phagocytophilum in i. scapularis to assess the potential risk for human infection .
however , in a clinical setting , it remains to be established how this assay would be incorporated into or supplement the current diagnostic approach for detecting a. phagocytophilum infections in humans .
this test is less technically demanding and takes less time to perform than nested / seminested pcr - rflps and dna sequencing analyses . moreover , this method eliminates the need for postamplification manipulations and technical problems that are sometimes associated with rflp analyses of amplicons produced by nested pcr ( 14,15 ) .
nonetheless , given the 100% concordance in the results of the different analytical methods , the pcr - rflp assays provide a reliable and cost - effective approach for distinguishing the ap - ha strain from the ap - variant 1 strain of a. phagocytophilum .
the pcr - rflp assays will be particularly useful in research laboratories that lack the capacity to conduct real - time pcrs providing an independent and relatively inexpensive method to confirm the results of the snp assay .
samples , dna extraction and prevalence of a. phagocytophilum in i. scapularis genetic test results for a. phagocytophilum | we developed pcr - based assays to distinguish a human pathogenic strain of anaplasma phagocytophilum , ap - ha , from ap - variant 1 , a strain not associated with human infection .
the assays were validated on a. phagocytophilum - infected blacklegged ticks ( ixodes scapularis ) collected in canada .
the relative prevalence of these 2 strains in i. scapularis ticks differed among geographic regions . | The Study
Conclusions
None |
end - stage liver cirrhosis ( eslc ) is a fatal clinical condition and frequently accompanied with mental alteration , ascites , jaundice , coagulopathy , and persistent deterioration of liver function .
once a complication of eslc develops , the 5-year survival rate decreased to low than 20% , and patients should be recommended to take liver transplantation ( lt ) .
advances in transplantation have improved long - term survival rates to more than 70% at 5 years after lt . in the case of life - threatening hepatic failure and donation severe shortage ,
abo - incompatible lt ( abo - i lt ) has been suggested as an optimal option for rescuing life .
recently , some parameters from blood were identified as promising markers for prognosis of patients with diverse diseases . among them ,
the elevated preoperative neutrophil - lymphocyte ratio ( nlr ) is a useful predictor for overall survival rates in colorectal cancer , hepatocellular carcinoma ( hcc ) , or nontumoros diseases . in addition , the patients characterized by thrombocytopenia and declining platelet counts were associated with an ominous prognosis .
demonstrated that the restoration of posttransplant absolute lymphocyte count can be a novel prognostic factor for the recurrence of hepatitis c and hcc .
given this , the study was designed to determine the effect of presurgery blood parameters on outcomes of patients with eslc after abo - i lt .
a total of 84 eslc patients undergoing abo - i lt from the first affiliated hospital , zhejiang university school of medicine between january , 2004 , and december , 2011 , were enrolled in our study .
the ab blood type recipients and o blood type donors were excluded from the study .
the cutoff of neutrophil , lymphocyte count , and platelet were acquired according to their median , respectively .
patients with preoperative sepsis , autoimmune hepatitis , hcc , steroids administration before lt , illicit drug abuse , and loss to follow - up were excluded from our study .
all lt were performed following obtaining informed consent from all patients , and this study was approved by the ethical review board of the first affiliated hospital of the medical school of zhejiang university ( no .
the improved strategy in our center for reducing anti - abo antibodies consisted of rituximab , basiliximab , and intravenous immunoglobulin ( ivig ) .
rare abo - i lt patients received splenectomy were due to the serious hypersplenism which commonly diagnosed by stubborn decreasing of white blood cell , lymphocyte , platelet , and neutrophil .
our immunosuppression protocol following abo - i lt adopted a standard protocol of quadruple regimen consisted of basiliximab , methylprednisolone , tacrolimus , and mycophenolate mofetil ( mmf ) .
the median serum tacrolimus concentration was 8.9 4.3 ng / ml in the high - nlr group , and 9.2 6.5 in the normal nlr group presenting no significant difference between two groups .
our immunosuppression protocol following abo - i lt adopted an standard protocol of quadruple regimen .
methylprednisolone ( initially 1000 mg then tapered and withdraw at 1 month ) , tacrolimus ( initially plasma target level : 1012 ng / ml and titrated down to 810 ng / ml ) , and mmf ( 500 mg twice daily ) were administered for maintaining the immunosuppressive effect after surgery .
furthermore , piperacillin - tazobactam , fluconazole , and ganciclovir were adopted postoperatively as an anti - infection strategy .
patients with hepatitis b virus were intravenously injected with lamivudine and hepatitis b immunoglobulin to prevent the recurrence of hepatitis b after lt .
the quantitative and qualitative variables were presented as mean with standard deviation and frequency , respectively .
fisher 's exact test , independent sample t - test , and pearson 's test were performed to evaluate the differences in the clinicopathologic factors of abo - i lt patients with high and normal nlrs .
the kaplan meier method and cox proportional hazard model analysis were used to determine the risk factors for poorer prognosis .
the patient characteristics were valued using univariate analysis first , and then risk factors with p < 0.1 were selected and entered into cox proportional hazard model analysis to estimate their hazard ratio . the software program sas version 9.1 ( sas institute inc .
, cary , nc , usa ) was used for analyzing data , and statistical significance was adopted at p < 0.05 .
a total of 84 eslc patients undergoing abo - i lt from the first affiliated hospital , zhejiang university school of medicine between january , 2004 , and december , 2011 , were enrolled in our study .
the ab blood type recipients and o blood type donors were excluded from the study .
the cutoff of neutrophil , lymphocyte count , and platelet were acquired according to their median , respectively .
patients with preoperative sepsis , autoimmune hepatitis , hcc , steroids administration before lt , illicit drug abuse , and loss to follow - up were excluded from our study .
all lt were performed following obtaining informed consent from all patients , and this study was approved by the ethical review board of the first affiliated hospital of the medical school of zhejiang university ( no .
the improved strategy in our center for reducing anti - abo antibodies consisted of rituximab , basiliximab , and intravenous immunoglobulin ( ivig ) .
rare abo - i lt patients received splenectomy were due to the serious hypersplenism which commonly diagnosed by stubborn decreasing of white blood cell , lymphocyte , platelet , and neutrophil .
our immunosuppression protocol following abo - i lt adopted a standard protocol of quadruple regimen consisted of basiliximab , methylprednisolone , tacrolimus , and mycophenolate mofetil ( mmf ) .
the median serum tacrolimus concentration was 8.9 4.3 ng / ml in the high - nlr group , and 9.2 6.5 in the normal nlr group presenting no significant difference between two groups .
our immunosuppression protocol following abo - i lt adopted an standard protocol of quadruple regimen .
methylprednisolone ( initially 1000 mg then tapered and withdraw at 1 month ) , tacrolimus ( initially plasma target level : 1012 ng / ml and titrated down to 810 ng / ml ) , and mmf ( 500 mg twice daily ) were administered for maintaining the immunosuppressive effect after surgery .
furthermore , piperacillin - tazobactam , fluconazole , and ganciclovir were adopted postoperatively as an anti - infection strategy .
patients with hepatitis b virus were intravenously injected with lamivudine and hepatitis b immunoglobulin to prevent the recurrence of hepatitis b after lt .
the quantitative and qualitative variables were presented as mean with standard deviation and frequency , respectively .
fisher 's exact test , independent sample t - test , and pearson 's test were performed to evaluate the differences in the clinicopathologic factors of abo - i lt patients with high and normal nlrs .
the kaplan meier method and cox proportional hazard model analysis were used to determine the risk factors for poorer prognosis .
the patient characteristics were valued using univariate analysis first , and then risk factors with p < 0.1 were selected and entered into cox proportional hazard model analysis to estimate their hazard ratio .
, cary , nc , usa ) was used for analyzing data , and statistical significance was adopted at p < 0.05 .
of the 84 adult recipients who underwent emergency abo - i lt for alf at our hospital , 13 ( 15.5% ) were excluded ( seven recipients had steroids administration before lt , three were loss to follow - up , two were autoimmune hepatitis , and one had drug abuse ) .
the study populations consisted of 47 males and 24 females and the median age at diagnosis was 47.9 years .
of 71 patients , 13 ( 18.3% ) received preoperative artificial liver support , three ( 4.2% ) underwent splenectomy along with lt [ table 1 ] .
the blood type combinations between donors and recipients included the following pairings : a to b , o ; ab to a , b , o ; b to a , o ; whereas ab blood type recipients and o blood type donors were excluded from the study [ table 2 ] .
patient demographics and clinical characteristics blood type combinations between donors and recipients the median follow - up period was 41.2 months and the courses of death during study period included multiple organ failure / sepsis , cerebral hemorrhage , antibody - mediated rejection ( amr ) , neurological complications , and gradual graft failure . among them , sepsis was the main death factor [ figure 1a ] .
of 14 dead patients were due to sepsis , 11 ( 78.6% ) with high nlr and three with normal nlr .
the 1- , 3- , and 5-year overall survival rates of the study population were 78.8% , 68.0% , and 68.0% , respectively .
( a ) suggested that sepsis was the main course of death , specially , in the high neutrophil - lymphocyte ratio group ( p = 0.025 ) , ( b ) the infection complications was more in the high neutrophil - lymphocyte ratio group than in the normal group but presented no statistical significance ( p = 0.056 ) the abnormal renal function was defined by high creatinine ( > 133
we found that the patients with high serum creatinine were respectively 26 in the high - nlr group and seven in the normal nlr group , but lt receptors with pretransplant high serum creatinine did not presented poorer prognosis including survival outcomes and complications .
of all factors , only high nlr had remarkable effect on survival outcomes after abo - i lt and related results were presented in table 3 .
the 1- , 3- , and 5-year overall survival were 94.9% , 80.0% and 80.0% in the normal nlr group respectively , and 59.4% , 55,4% and 55.4% in patients with up - regulated nlr respectively [ p = 0.001 , figure 2a ] .
we also analyzed the effect of elevated nlr on complications and found none correlation between them [ figure 1b ] .
univariate and multivariate analysis of factors affecting overall survival after abo - incompatible liver transplantation kaplan
meier chart comparing both overall survivals for patients classified according to the neutrophil - lymphocyte ratio ( a ) , neutrophil count ( b ) , and lymphocyte count ( c ) preoperatively .
the curves presented different survival rates of patients with abo - incompatible liver transplantation with different preoperative neutrophil - lymphocyte ratio or neutrophil count , but bot with different lymphocyte count the median counts of neutrophil and lymphocyte were significantly different between the elevated nlr group and the normal nlr group ( p < 0.001 , p = 0.003 respectively ) .
the 1- , 3- and 5-year recipient survival rates were 61.8% , 58.5% and 58.5% , respectively , in the high neutrophil group , and 94.6% , 74.8% and 74.8% , respectively in the low - neutrophil group [ p = 0.016 , figure 2b ] .
however , we found that the 1- , 3- and 5-year overall survival rates were 77.4% , 59.7% and 59.7% in the lymphopenia group , respectively , and 79.9% , 77.1% and 77.1% in the normal - lymphocyte group , respectively [ p = 0.504 , figure 2c ] .
in addition , we further divided patients into a death group and a survival group and found that there were a significant difference in nlr and neutrophil count whereas not in lymphocyte count and white blood cell [ figure 3 ] .
these results suggested that the high - neutrophil count was the main cause for high nlr inducing poorer recipient survival .
in addition , high neutrophil and high nlr presented p < 0.1 in univariate analysis ; these factors were further selected and entered into cox proportional hazard model analysis to estimate their hazard ratio , and only high nlr remains statistical significance [ table 3 ] .
the difference of pretreatment neutrophil - lymphocyte ratio ( a ) , neutrophil count ( b ) , lymphocyte count ( c ) and white blood cell ( d ) , between the survival and death groups in the retrospective cohort .
there were a significant difference in neutrophil - lymphocyte ratio and neutrophil count , whereas not in lymphocyte count and white blood cell
of the 84 adult recipients who underwent emergency abo - i lt for alf at our hospital , 13 ( 15.5% ) were excluded ( seven recipients had steroids administration before lt , three were loss to follow - up , two were autoimmune hepatitis , and one had drug abuse ) .
the study populations consisted of 47 males and 24 females and the median age at diagnosis was 47.9 years .
of 71 patients , 13 ( 18.3% ) received preoperative artificial liver support , three ( 4.2% ) underwent splenectomy along with lt [ table 1 ] .
the blood type combinations between donors and recipients included the following pairings : a to b , o ; ab to a , b , o ; b to a , o ; whereas ab blood type recipients and o blood type donors were excluded from the study [ table 2 ] .
patient demographics and clinical characteristics blood type combinations between donors and recipients the median follow - up period was 41.2 months and the courses of death during study period included multiple organ failure / sepsis , cerebral hemorrhage , antibody - mediated rejection ( amr ) , neurological complications , and gradual graft failure . among them , sepsis was the main death factor [ figure 1a ] .
of 14 dead patients were due to sepsis , 11 ( 78.6% ) with high nlr and three with normal nlr .
the 1- , 3- , and 5-year overall survival rates of the study population were 78.8% , 68.0% , and 68.0% , respectively .
( a ) suggested that sepsis was the main course of death , specially , in the high neutrophil - lymphocyte ratio group ( p = 0.025 ) , ( b ) the infection complications was more in the high neutrophil - lymphocyte ratio group than in the normal group but presented no statistical significance ( p = 0.056 )
the abnormal renal function was defined by high creatinine ( > 133 mol / l ) .
we found that the patients with high serum creatinine were respectively 26 in the high - nlr group and seven in the normal nlr group , but lt receptors with pretransplant high serum creatinine did not presented poorer prognosis including survival outcomes and complications .
of all factors , only high nlr had remarkable effect on survival outcomes after abo - i lt and related results were presented in table 3 .
the 1- , 3- , and 5-year overall survival were 94.9% , 80.0% and 80.0% in the normal nlr group respectively , and 59.4% , 55,4% and 55.4% in patients with up - regulated nlr respectively [ p = 0.001 , figure 2a ] .
we also analyzed the effect of elevated nlr on complications and found none correlation between them [ figure 1b ] .
univariate and multivariate analysis of factors affecting overall survival after abo - incompatible liver transplantation kaplan meier chart comparing both overall survivals for patients classified according to the neutrophil - lymphocyte ratio ( a ) , neutrophil count ( b ) , and lymphocyte count ( c ) preoperatively .
the curves presented different survival rates of patients with abo - incompatible liver transplantation with different preoperative neutrophil - lymphocyte ratio or neutrophil count , but bot with different lymphocyte count
the median counts of neutrophil and lymphocyte were significantly different between the elevated nlr group and the normal nlr group ( p < 0.001 , p = 0.003 respectively ) .
the 1- , 3- and 5-year recipient survival rates were 61.8% , 58.5% and 58.5% , respectively , in the high neutrophil group , and 94.6% , 74.8% and 74.8% , respectively in the low - neutrophil group [ p = 0.016 , figure 2b ] .
however , we found that the 1- , 3- and 5-year overall survival rates were 77.4% , 59.7% and 59.7% in the lymphopenia group , respectively , and 79.9% , 77.1% and 77.1% in the normal - lymphocyte group , respectively [ p = 0.504 , figure 2c ] .
in addition , we further divided patients into a death group and a survival group and found that there were a significant difference in nlr and neutrophil count whereas not in lymphocyte count and white blood cell [ figure 3 ] .
these results suggested that the high - neutrophil count was the main cause for high nlr inducing poorer recipient survival .
in addition , high neutrophil and high nlr presented p < 0.1 in univariate analysis ; these factors were further selected and entered into cox proportional hazard model analysis to estimate their hazard ratio , and only high nlr remains statistical significance [ table 3 ] .
the difference of pretreatment neutrophil - lymphocyte ratio ( a ) , neutrophil count ( b ) , lymphocyte count ( c ) and white blood cell ( d ) , between the survival and death groups in the retrospective cohort .
there were a significant difference in neutrophil - lymphocyte ratio and neutrophil count , whereas not in lymphocyte count and white blood cell
to date , most of the researchers payed attention to preexisting anti - abo antibody titer that neglects other potential predictors .
moreover , egawa et al . found the preoperative high anti - abo igm did not have any significance in predicting the frequency of amr and 5-year survival rate following abo - i lt .
recently , several studies reported that nlr could predict the long - term outcomes of patients with hcc after lt and even was selected to challenge the milan criteria as a precise predictive marker .
nlr was a miniature of systemic inflammation and easily calculated by routine examine of peripheral blood samples .
our results presented that elevated nlr was significantly associated with poorer both overall survival and graft survival , in our study population .
the reactive neutrophilia and lymphocytopenia were a physiological response to the immune system to a variety of stressful events , so the high preoperative nlr not only showed the presence of immune dysfunction but also the severity of affliction .
the immune dysfunction of patients with eslc undoubtedly promoted postsurgery infection . besides , in high - nlr group , patients presented more serious lymphocytopenia that increases the susceptibility to infection .
furthermore , the sepsis rather than amr was the crucial cause of patients death after abo - i lt in the study and a previously reported literature , which suggested that the increased postoperative infection diseases are the mechanism underlying high nlr influencing survival outcomes of abo - i lt , and the carefully perioperative management for preventing infection is very important . although the accurate mechanism underlying nlr influencing survival outcomes in various diseases was not clear , our data still provided some hint .
we found that high nrl group presented a higher model for end - stage liver disease ( meld ) score comparing with the normal nlr group . in the previously published literature , lt patients with higher meld
score presented poorer survival outcomes , but the cutoff of high meld score was extraordinary different in the different lt cohort . in our previously published data , we found meld score 28 was an independent risk factor . therefore , we added the analysis of meld score 28 predicting prognosis of abo - i lt recipients .
we found that abo - i lt recipients with meld score 28 presented a significant trend of poorer graft survival outcomes ( p = 0.047 , less than meld score 25.7 ) .
in addition , by the cox proportional hazard model analysis , we defined that high meld score could not interfere in nlr as a predictor for abo - i lt recipients .
the combination of plasma exchange pe , graft local infusion ( gli ) , splenectomy , rituximab , and ivig is a standard protocol of reducing anti - abo antibody titer and the incidence of amr .
raut et al . reported that preoperative rituximab could effectively prevented amr irrespective of splenectomy , and not any immunological benefit was obtained due to splenectomy during the initial 8 weeks .
ikegami et al . indicated that the new protocol using pe , rituxamab , and ivig without gli in four cases after abo - i living donor lt seemed to be a safe treatment because gli leaded to various catheter - associated complications .
, respectively reported that amr was highly associated with postoperative rebound elevation of isoagglutinin titer , and high - dose ivig was very effective . in this study , all of the voluntary donor livers come from the accidentally dead people , so we were not sure the blood type pairs of lt before the operation .
the two reasons urged us to make an emerge abo - i lt without pe .
all patients were administered the improved protocol , and there were only two episodes of amr presented in the study .
the low incidence of amr provided a possibility for rituximab totally substituting for pe and highlighted the role of high - dose ivig and subsequent quadruple immunosuppressive scheme involving steroids in treatment and/or prophylaxis of severe amr .
the small sample size is a limitation in this study , the larger sample size and the further investigation for the effect of high nlr and the improved protocol on long - term survival outcomes are needed in future study .
we found that high nlr was the independent risk factor for poorer overall survival after abo - i lt , which might be selected as an index for rearranging the abo - i lt candidates list .
the high neutrophil count rather than lymphopenia contributed to the effect of elevated nlr on postoperative survival outcomes .
this work was supported by national s and t major project ( no . 2012zx10002 - 017 ) , national natural science foundation of china ( 81373160 , 81302074 ) and nsfc for innovative research group ( 81121002 ) and national natural science foundation of zhejiang province ( lq13h160004 ) , scientific plan of medicine care in zhejiang province ( 20147283 ) .
2012zx10002 - 017 ) , national natural science foundation of china ( 81373160 , 81302074 ) and nsfc for innovative research group ( 81121002 ) and national natural science foundation of zhejiang province ( lq13h160004 ) , scientific plan of medicine care in zhejiang province ( 20147283 ) .
shz and lz contributed in the conception of the work , bl and lg , zhzh conducted the study , revised the draft , and others fished the data collection and analysis . | background : the study was designed to assess the role of preoperative neutrophil , lymphocyte , and neutrophil - lymphocyte ratio ( nlr ) in predicting survival outcomes of abo - incompatible liver transplantation ( lt).materials and methods : we retrospectively collected the demographic and clinical characteristics of 71 patients with end - stage liver cirrhosis following abo - incompatible lt in this study .
kaplan
meier survival analysis and cox multiple factors regression analysis were performed to determine the independent risk factors from preoperative blood parameters for poor prognosis.results:the 1- , 3- , and 5-year overall survival were 94.9% , 80.0% , and 80.0% in the normal nlr group , respectively , and 59.4% , 55,4% , and 55.4% in patients with up - regulated nlr , respectively ( p = 0.001 ) .
furthermore , no significant difference was observed on post - lt complications between normal nlr and high - nlr groups .
the high nlr was identified as the only independent prognostic risk factor for recipient survival ( p = 0.015 , 95% confidence interval = 3.573 [ 1.2849.943]).conclusion : the preoperative high nlr could be considered as a convenient and available indicator for selecting abo - incompatible lt candidates . | INTRODUCTION
MATERIALS AND METHODS
Patients and blood parameters collection
Management for patients following liver transplantation
Statistical analysis
RESULTS
Patient demographics and outcomes
Correlation between blood parameters and outcomes after ABO-incompatible liver transplantation
The role of neutrophil and lymphocyte in neutrophil-lymphocyte ratio
DISCUSSION
CONCLUSION
Financial support and sponsorship
Conflicts of interest
AUTHORS CONTRIBUTION |
ec - ic , extracranial - intracranial imax , internal maxillary artery mca , middle cerebral artery sc - ic , subcranial - intracranial sta , superficial temporal artery
we recently treated 4 patients with sc - ic bypass who required cerebral bypasses to effectively treat various cerebrovascular pathologies . the decision to treat the patient with a bypass and the feasibility of the sc - ic bypass
was made in a multidisciplinary fashion by the neurovascular , neuroradiology , and cranial base teams .
our multidisciplinary team performed cadaveric dissection to better assess the subcranial approach for exposure of the imax in the infratemporal fossa . in this dissection ,
subsequently , a lateral rectangle craniectomy of the temporal fossa floor was created up to a point that was 2 mm lateral to a virtual line connecting the foramen rotundum and foramen ovale ( figures 1 - 4 ) .
the deep temporal arteries on the medial aspect of the temporalis muscle were then identified and followed to the imax .
drawing of an elevated skin flap and temporalis , after osteotomy ; the line indicates the craniotomy site .
the red area indicates the contemplated craniectomy of the middle cranial fossa floor to unroof the infratemporal fossa .
the corridor craniectomy will reach a line 2 mm lateral to the virtual line between the foramen ovale and foramen rotundum . a right - sided cadaveric dissection demonstrates an orbitozygomatic osteotomy and frontotemporal craniotomy .
the craniectomy ( thick red arrow ) is done up to the virtual line 2 mm lateral to v2 and v3 entering foramen rotundum and foramen ovale , respectively ( thin arrows ) .
the internal maxillary artery is dissected in the infratemporal fossa ( large gray arrow ) .
zygomatic osteotomy ( with or without orbital osteotomy ) was used followed by frontotemporal craniotomy and subsequently temporal fossa craniectomy reaching its medial border designated by the same virtual line connecting the foramen rotundum and foramen ovale ( figures 4 and 5 ) .
we use computed tomography angiography based neuronavigation and micro doppler probe ( mizuho inc .
tokyo , japan ) . to identify the imax artery in the pterygoid muscles ( figures 6 and 7 ) .
anatomically , the deep temporal arteries in the medial aspect of the temporalis muscle were followed proximally to allow definitive identification of the imax artery .
the first patient 's proximal anastomosis was performed in an end - to - side fashion , whereas the proximal anastomoses in the subsequent 3 patients were end to end ( figures 8 - 10 ) .
the end - to - end anastomoses were technically less demanding than the end to side .
in the 3 end - to - end cases , reversed subcutaneous brachiocephalic veins were used rather than the radial artery .
this vessel was consistently an excellent diameter match with the donor imax . in our experience ,
the brachiocephalic vein was consistently reliably free of valves and had a paucity of branches .
intraoperative flow measurements using the charbel microflow probe ( transonic systems inc . , ithaca , new york ) was performed in all patients .
intraoperative angiography and indocyanine green videoangiography were obtained to evaluate bypass patency in all patients .
all patients also underwent postoperative angiography to further assess the flow within the bypass and to further treat the aneurysms with endovascular techniques , as deemed necessary . left side intraoperative craniectomy of the middle cranial fossa floor , similar in view to the cadaveric dissection shown in figure 4 .
a screen shot from the stryker neuronavigation system ( stryker instruments , kalamazoo , michigan ) shows the localization of the internal maxillary artery ( red arrows ) . a left - sided intraoperative image of the internal maxillary artery ( blue arrow ) dissected in the infratemporal fossa .
drawing of the donor internal maxillary artery and the recipient m3 in the opened sylvian fissure .
drawing of the proximal end - to - end anastomosis and a permanent clip on the distal internal maxillary artery and distal end - to - side anastomosis to the m3 .
zygomatic osteotomy ( with or without orbital osteotomy ) was used followed by frontotemporal craniotomy and subsequently temporal fossa craniectomy reaching its medial border designated by the same virtual line connecting the foramen rotundum and foramen ovale ( figures 4 and 5 ) .
we use computed tomography angiography based neuronavigation and micro doppler probe ( mizuho inc .
tokyo , japan ) . to identify the imax artery in the pterygoid muscles ( figures 6 and 7 ) .
anatomically , the deep temporal arteries in the medial aspect of the temporalis muscle were followed proximally to allow definitive identification of the imax artery .
the first patient 's proximal anastomosis was performed in an end - to - side fashion , whereas the proximal anastomoses in the subsequent 3 patients were end to end ( figures 8 - 10 ) .
the end - to - end anastomoses were technically less demanding than the end to side .
in the 3 end - to - end cases , reversed subcutaneous brachiocephalic veins were used rather than the radial artery .
this vessel was consistently an excellent diameter match with the donor imax . in our experience ,
the brachiocephalic vein was consistently reliably free of valves and had a paucity of branches .
intraoperative angiography and indocyanine green videoangiography were obtained to evaluate bypass patency in all patients .
all patients also underwent postoperative angiography to further assess the flow within the bypass and to further treat the aneurysms with endovascular techniques , as deemed necessary . left side intraoperative craniectomy of the middle cranial fossa floor , similar in view to the cadaveric dissection shown in figure 4 .
a screen shot from the stryker neuronavigation system ( stryker instruments , kalamazoo , michigan ) shows the localization of the internal maxillary artery ( red arrows ) . a left - sided intraoperative image of the internal maxillary artery ( blue arrow ) dissected in the infratemporal fossa .
drawing of the donor internal maxillary artery and the recipient m3 in the opened sylvian fissure .
drawing of the proximal end - to - end anastomosis and a permanent clip on the distal internal maxillary artery and distal end - to - side anastomosis to the m3 .
one case was a flow augmentation bypass for a hypoperfused hemisphere in a patient with neurofibromatosis type 2 who underwent cervical surgery for resection of a cervical neurofibroma that resulted in occlusion of the internal carotid artery .
this patient also had a very small - caliber superficial temporal artery ( sta ) .
two patients have a diagnosis of a giant mca aneurysm not amendable to endovascular treatment or direct microsurgical clipping ( figures 11 and 12 ) .
one of these patients had undergone a previous craniotomy in which the ipsilateral sta had been sacrificed .
this patient experienced major recanalization of her aneurysm after endovascular coiling and presented with severe brain edema .
subsequent to sc - ic bypass , the distal m1 segment was clipped , and the patient was subsequently treated by trapping of her proximal m1 segment using coil embolization . a , computed tomography angiography of a patient with enlarging serpentine m2 aneurysm .
b , magnetic resonance angiography demonstrates the thrombosed aneurysm and the flow into the aneurysm .
patient had had a previous frontotemporal craniotomy for meningioma and had no superficial temporal artery . in the first patient ,
the imax was identified in the infratemporal fossa by neuronavigation coupled with micro doppler confirmation ( figure 6 ) . in the subsequent patients , anatomic landmarks formed by the virtual line between the foramen rotundum and foramen ovale ( which marks the medial border of the craniectomy ) , as well as the deep temporalis arteries that lead to the imax ,
the position of the imax was then confirmed by micro doppler . in our last case ,
intraoperative flow measurements , in the graft , using the charbel flow probe ( transonic systems inc ) , ranged from 20 to 60 ml / min . in the cases of end - to - end anastomosis ( figure 13 )
retrograde filling of distal imax territory by external carotid artery collaterals was demonstrated on all postoperative angiograms . a left - sided intraoperative image of the proximal end - to - end anastomosis of the internal maxillary artery ( imax ) and the vein graft ( orange arrow ) .
postoperative angiography demonstrated good filling of the graft with robust distal flow in all cases ( figures 14 and 15 ) .
this plan allows early flow demand to be placed on the transplanted graft with real - time angiographic flow assessment before aneurysm deconstruction .
in addition , by eliminating surgical exposure of the aneurysm , less surgical dissection is required , limiting surgical morbidity to the construction of the bypass itself .
the last case underwent distal microsurgical m1 segment sacrifice with the residual aneurysm coiled and completely occluded postoperatively .
retrograde filling was demonstrated from the sc - ic anastomosis into the m1 segment up to the clip , allowing flow into the lateral lenticulostriate arteries arising from this portion of the m1 segment .
a , an internal carotid artery injection demonstrates complete occlusion ( no distal flow ) of the aneurysm by coil mass .
b , an external carotid artery injection demonstrates a patent bypass that fills the middle cerebral artery territory .
anteroposterior ( a ) and lateral ( b ) projections of a common carotid artery injection demonstrate a patent bypass and filling of the entire hemisphere .
one of the aneurysm patients in our series experienced postoperative swelling of the hemisphere after aneurysm embolization and underwent decompressive craniectomy .
one case was a flow augmentation bypass for a hypoperfused hemisphere in a patient with neurofibromatosis type 2 who underwent cervical surgery for resection of a cervical neurofibroma that resulted in occlusion of the internal carotid artery .
this patient also had a very small - caliber superficial temporal artery ( sta ) .
two patients have a diagnosis of a giant mca aneurysm not amendable to endovascular treatment or direct microsurgical clipping ( figures 11 and 12 ) .
one of these patients had undergone a previous craniotomy in which the ipsilateral sta had been sacrificed .
this patient experienced major recanalization of her aneurysm after endovascular coiling and presented with severe brain edema .
subsequent to sc - ic bypass , the distal m1 segment was clipped , and the patient was subsequently treated by trapping of her proximal m1 segment using coil embolization . a , computed tomography angiography of a patient with enlarging serpentine m2 aneurysm .
b , magnetic resonance angiography demonstrates the thrombosed aneurysm and the flow into the aneurysm .
patient had had a previous frontotemporal craniotomy for meningioma and had no superficial temporal artery .
in the first patient , the imax was identified in the infratemporal fossa by neuronavigation coupled with micro doppler confirmation ( figure 6 ) . in the subsequent patients , anatomic landmarks formed by the virtual line between the foramen rotundum and foramen ovale ( which marks the medial border of the craniectomy ) , as well as the deep temporalis arteries that lead to the imax ,
the position of the imax was then confirmed by micro doppler . in our last case ,
intraoperative flow measurements , in the graft , using the charbel flow probe ( transonic systems inc ) , ranged from 20 to 60 ml / min . in the cases of end - to - end anastomosis ( figure 13 )
retrograde filling of distal imax territory by external carotid artery collaterals was demonstrated on all postoperative angiograms . a left - sided intraoperative image of the proximal end - to - end anastomosis of the internal maxillary artery ( imax ) and the vein graft ( orange arrow ) .
all patients tolerated the imax sc - ic bypass well . postoperative angiography demonstrated good filling of the graft with robust distal flow in all cases ( figures 14 and 15 ) .
this plan allows early flow demand to be placed on the transplanted graft with real - time angiographic flow assessment before aneurysm deconstruction .
in addition , by eliminating surgical exposure of the aneurysm , less surgical dissection is required , limiting surgical morbidity to the construction of the bypass itself .
the last case underwent distal microsurgical m1 segment sacrifice with the residual aneurysm coiled and completely occluded postoperatively .
retrograde filling was demonstrated from the sc - ic anastomosis into the m1 segment up to the clip , allowing flow into the lateral lenticulostriate arteries arising from this portion of the m1 segment .
a , an internal carotid artery injection demonstrates complete occlusion ( no distal flow ) of the aneurysm by coil mass .
b , an external carotid artery injection demonstrates a patent bypass that fills the middle cerebral artery territory .
anteroposterior ( a ) and lateral ( b ) projections of a common carotid artery injection demonstrate a patent bypass and filling of the entire hemisphere .
one of the aneurysm patients in our series experienced postoperative swelling of the hemisphere after aneurysm embolization and underwent decompressive craniectomy .
cerebral bypass has been used for many years for the treatment of cranial base tumors and giant aneurysms as well as for flow augmentation into hypoperfused cerebral hemispheres.1 - 4,10 the 2 basic modalities of bypass are either ec - ic bypass or ic - ic ( in situ ) bypass.11 - 13 the most common ec - ic bypass is the sta - mca bypass . in cases in which the target of the bypass is flow replacement ,
a higher flow bypass graft is often required.14,15 in these cases , the cervical carotid artery is typically used as the donor site , using either a saphenous vein or radial artery as a graft vessel , which is then anastomosed to an appropriate recipient mca branch.1,2,14,16 this technique typically requires a graft in excess of 20 cm , which can be prone to kinking and subcutaneous compression .
these grafts need to be safely tunneled from the neck to the cranial insertion site ; alternatively , a long skin incision from the craniotomy site down to the cervical carotid is required . additionally , the 2 operative fields are not well visualized through a single operative microscopic view
. the surgeon must move from neck to cranial exposure when performing the 2 anastomoses , and any graft complication is therefore managed with only a partial view of the totality of the graft length .
imax - mca ( sc - ic ) bypass as a high - flow ec - ic bypass option has been described in both cadaveric studies6 - 9,17 and clinical microsurgical practice.5 this bypass option is efficacious in cases that require high flow where the use of the cervical carotid as a donor is contraindicated ( ie , after neck surgery or in the setting of occlusion of the common carotid artery ) . the imax - mca bypass technique and the important modifications that we propose carry a number of distinct advantages over the conventional ec - ic bypass in which the cervical carotid artery is used as a donor .
first , the sc - ic graft is significantly shorter ( 7 - 9 cm ) than the typical length required when using the cervical carotid artery as a proximal anastomosis site .
although bypass length has not been described as a prognostic factor for bypass longevity , longer grafts are theoretically more prone to mechanical disruption such as kinking and compression .
short graft length permits the use of a brachiocephalic rather than a saphenous vein , and graft size can then be tailored more effectively to recipient size .
the brachiocephalic vein has few , if any , valves , which improves overall donor quality .
additionally , potential upper extremity arterial complications that can be associated with radial artery are then avoided.1,18,19 an additional benefit of the sc - ic bypass technique is that the entire intracranial graft both the proximal and distal anastomoses is visualized within the same microsurgical field ( figures 16 and 17 ) .
this allows for immediate inspection of the graft , the proximal anastomosis site , and the distal anastomosis site simultaneously and thus improves the safety and efficiency of the operation .
a postoperative computed tomography 3-dimensional reconstruction of the cranium ( from a second patient ) that demonstrates the vein graft bypassing through the floor of the middle cranial fossa .
note the craniectomy at the base of the middle cranial fossa overlying the infratemporal fossa .
the final result demonstrates the vein graft ( blue arrow ) emerging from the infratemporal fossa ( black arrow ) into the sylvian fissure ( green arrow ) in the same operative field .
our modification of the previously described imax bypass technique , in which the imax was identified through a small middle cranial fossa floor window , represents a distinct technical improvement.5 this original technique is highly demanding , requiring drilling in the anterior aspect of the floor of the middle cranial fossa and the subsequent end - to - side anastomosis through this small , constricted middle cranial fossa craniectomy . precise localization and manipulation of the imax through this small window
our sc - ic technique modification used either a zygomatic osteotomy or orbitozygomatic osteotomy followed by a lateral rectangular craniectomy of the middle fossa .
this modification allowed the imax to be reliably anatomically identified over a considerable length of 15 to 20 mm . in cadaver dissections , we localized the imax just anterior and parallel to the line between the foramen rotundum and foramen ovale .
this experience allowed us to execute the craniectomy in situ up to this same line and then readily identify the vessel within the infratemporal fossa ; this exposure then allowed for the performance of the anastomosis in an end - to - end fashion , ultimately , we found that the completion of proximal anastomosis could be performed in a straightforward manner , with wide exposure and illumination of the imax in the infratemporal fossa . there was no need for retractors throughout the procedure .
the imax - mca ( sc - ic ) bypass is safe and effective and has a number of advantages over the conventional ec - ic bypass using the cervical carotid .
these advantages include ( 1 ) shorter graft length , ( 2 ) avoidance of a cervical carotid artery dissection and its attendant complications , ( 3 ) a microsurgical view of the entirety of the intracranial graft and both the proximal and distal anastomoses within the same field , ( 4 ) minimization of the risk of graft kinking and compression , ( 5 ) the ability to use a subcutaneous vein with easier graft sizing rather than the radial artery with its known risks , and ( 6 ) the use of a lateral temporal fossa rectangular craniectomy technique combined with a zygomatic osteotomy .
this craniectomy was found to significantly improve the previously described anastomotic technique by allowing the imax to be reliably identified , accessed , and then used as a proximal blood flow source without the need for significant drilling .
we believe that this technique should be considered as a first choice for an ec - ic bypass in which the sta is either unavailable or inadequate relative to the flow required .
we strongly advocate preparatory cadaveric dissection by the multidisciplinary team before microsurgical in vivo sc - ic bypass using the imax .
the authors have no personal financial or institutional interest in any of the drugs , materials , or devices described in this article .
the authors have no personal financial or institutional interest in any of the drugs , materials , or devices described in this article .
this is an interesting small technical case series with nice illustrations . for the open vascular subspecialist
, it highlights an important nuance to a newer option for an extracranial - intracranial bypass , the internal maxillary middle cerebral artery ( imax - mca ) bypass . although the overall technique is not novel and the patient number is small , the authors demonstrate the feasibility of , and rationale for , using this modification . as originally described , the imax - mca bypass provides access to the donor artery through only a small opening in the middle fossa floor , which presents technical challenges .
the nuance provided allows for better exposure and control of the donor artery and for end - to - end as well as end - to - side anastomosis .
slick alternative to more traditional methods , indications for using it are probably very limited .
when available , the superficial temporal artery ( sta ) is a technically easier bypass that does not require a separate graft harvest and can be used even for high - flow indications .
i have advocated double - barrel sta - mca bypass whenever feasible , and when both branches are used ( one for the superior division and one for the inferior division ) , flows approaching 100 ml / min are possible in patients with robust arteries .
intracranial - intracranial bypass is also emerging as an attractive option in many cases and shares the benefits of short graft length and the lack of a cervical incision with the currently described technique .
microvascular anastomosis , in whatever form it takes , remains an important skill for cranial neurosurgeons and should continue to be taught to our trainees . in the laboratory ,
synthetic kits , turkey wings , and rats are good models for early experience , and although a high level of trust is required , i have found that senior residents can safely participate in bypass surgery in the operating room . | background : internal maxillary artery ( imax)middle cerebral artery ( mca ) bypass has been recently described as an alternative to cervical extracranial - intracranial bypass .
this technique uses a keyhole
craniectomy in the temporal fossa that requires a technically challenging end - to - side anastomosis.objective:to describe a lateral subtemporal craniectomy of the middle cranial fossa floor to facilitate wide exposure of the imax to facilitate bypass.methods:orbitozygomatic osteotomy is used followed by frontotemporal craniotomy and subsequently laterotemporal fossa craniectomy , reaching its medial border at a virtual line connecting the foramen rotundum and foramen ovale .
the imax was identified by using established anatomic landmarks , neuronavigation , and micro doppler probe ( mizuho inc .
tokyo , japan ) . additionally , we studied the approach in a cadaveric specimen in preparation for microsurgical bypass.results:there were 4 cases in which the technique was used .
one bypass was performed for flow augmentation in a hypoperfused hemisphere .
the other 3 were performed as part of treatment paradigms for giant middle cerebral artery aneurysms .
vein grafts were used in all patients . the proximal anastomosis was performed in an end - to - side fashion in 1 patient and end - to - end in 3 patients .
intraoperative graft flow measured with the transonic flow probe ranged from 20 to 60 ml / min .
postoperative angiography demonstrated good filling of the graft with robust distal flow in all cases .
all patients tolerated the procedure well.conclusion:imax to middle cerebral artery subcranial - intracranial bypass is safe and efficacious .
the laterotemporal fossa craniectomy technique resulted in reliable identification and wide exposure of the imax , facilitating the proximal anastomosis.abbreviations:ec-ic , extracranial - intracranialimax , internal maxillary arterymca , middle cerebral arterysc - ic , subcranial - intracranialsta , superficial temporal artery | ABBREVIATIONS:
METHODS
Intraoperative Technique
RESULTS
Patients
Anastomoses
Outcome
DISCUSSION
CONCLUSION
Disclosure
COMMENT |
this group is selective for cyclic guanosine monophosphate - specific phosphodiesterase ( pde ) type 5 present in corpora cavernosa .
these agents differ in their degree of selectivity in inhibiting pde isoenzymes , in their pharmacokinetic profiles , in their drug - food interactions , and in their adverse effects .
, these agents have been shown to possess antioxidative or oxidative stress - protective properties . , ciprofloxacin is a fluoroquinolone antibiotic that possesses strong activity against gram - negative bacteria .
ciprofloxacin is commonly used for the treatment of a number of infections such as acute uncomplicated cystitis , urinary tract infections , acute sinusitis , and chronic bacterial prostatitis .
the mechanism of antibacterial action of quinolone , including ciprofloxacin , involves interfering with replication and transcription of dna via inhibiting bacterial dna gyrase / topoisomerase ii and dna topoisomerase iv , and further preventing dna of bacteria from unwinding and duplicating .
thus , complexes of quinolone - enzyme - dna are formed , leading to the production of cellular poisons and cell death .
microbiologic studies of various bacteria ascertain the presence of the guanosine monophosphate - pde system in bacteria , which could represent a possible pharmacologic target for sildenafil and similar agents in bacteria .
moreover , a previous study showed that coadministration of ciprofloxacin and clarithromycin significantly increased sildenafil bioavailability in human beings .
this could point to a possible interaction with antibiotic agents that are commonly administrated concomitantly with these agents .
we evaluated , for the first time , the possible interaction among members of the pdei group and ciprofloxacin .
the results of our study could be of clinical significance due to the common use of pdeis , especially , sildenafil , when antibiotics are used for treatment of urinary tract infection .
ciprofloxacin used in this study was donated by al - hikma pharmaceuticals ( amman , jordan ) .
vardenafil and tadalafil were obtained from orchid chemical supplies ltd ( hangzhou , china ) .
antibacterial activity of ciprofloxacin and/or pdei combinations were evaluated against different reference bacteria , including escherichia coli attc 35218 , staphylococcus aureus attc29213 , pseudomonas aeruginosa attc 9027 , staphylococcus epidermidis attc 12228 , acinetobacter baumannii attc 17978 , proteus mirabilis attc 12459 , and klebsiella pneumoniae attc 13883 .
the organisms were stored at 70c in trypticase - soy broth and 20% glycerol ( bbl microbiology systems , cockeysville , maryland ) .
antibiotic solutions were prepared on the day of use according to the manufacturer s recommendations .
serial 2-fold dilutions were added to molten bbl muller - hinton gold ii agar ( bbl microbiology systems ) .
after slight cooling and drying of the plates , a steers replicator was used to place aliquots containing approximately 5 10 cfu per drop for 4 test strains .
the plates were incubated at 37c and read 24 hours later . in experiments where 0.1 g / ml ciprofloxacin was combined with pdei
results ( ie , the mean of 3 independent experiments ) were recorded by measuring the zones of growth inhibition surrounding the antibiotic - containing discs .
the breakpoints indicated in the tables of the clinical and laboratory standards institute guidelines were used to determine susceptibility and resistance .
briefly , drugs were serially diluted and added to 96-well plates that were prepared by dispensing into each well 100 l of an appropriate medium ( bbl muller - hinton gold ii agar ; bbl microbiology systems ) and 20 l inoculum ( containing about 5 10 cfu ) .
mic is defined as the lowest concentration at which no growth , a faint haze , or fewer than 3 discrete colonies was detected .
the effect of pdeis on antigyrase activity of ciprofloxacin was examined using the e coli dna gyrase cleavage assay as described by the manufacturer ( inspirals , norwich , united kingdom ) . in brief ,
dna gyrase was incubated with 0.5 g supercoiled pbr322 in a reaction volume at 37c for 1 hour in the presence of 0.1 g / ml ciprofloxacin and/or different pdeis ( 100 m ) .
sds and proteinase k ( 0.2% and 0.1 g / ml final concentrations , respectively ) were added before a further incubation at 37c for 30 minutes .
about 10 l reaction mixture was electrophoresized using 1% agarose and bands were visualized using ethidium bromide .
analysis was performed using graphpad prism software ( version 4.0 , graphpad software , la jolla , california ) .
one - way anova followed by tukey s posttest were used to determine if there was any statistically significant difference .
ciprofloxacin used in this study was donated by al - hikma pharmaceuticals ( amman , jordan ) .
vardenafil and tadalafil were obtained from orchid chemical supplies ltd ( hangzhou , china ) .
antibacterial activity of ciprofloxacin and/or pdei combinations were evaluated against different reference bacteria , including escherichia coli attc 35218 , staphylococcus aureus attc29213 , pseudomonas aeruginosa attc 9027 , staphylococcus epidermidis attc 12228 , acinetobacter baumannii attc 17978 , proteus mirabilis attc 12459 , and klebsiella pneumoniae attc 13883 .
the organisms were stored at 70c in trypticase - soy broth and 20% glycerol ( bbl microbiology systems , cockeysville , maryland ) .
antibiotic solutions were prepared on the day of use according to the manufacturer s recommendations .
serial 2-fold dilutions were added to molten bbl muller - hinton gold ii agar ( bbl microbiology systems ) .
after slight cooling and drying of the plates , a steers replicator was used to place aliquots containing approximately 5 10 cfu per drop for 4 test strains .
the plates were incubated at 37c and read 24 hours later . in experiments where 0.1 g / ml ciprofloxacin was combined with pdei
results ( ie , the mean of 3 independent experiments ) were recorded by measuring the zones of growth inhibition surrounding the antibiotic - containing discs .
the breakpoints indicated in the tables of the clinical and laboratory standards institute guidelines were used to determine susceptibility and resistance .
briefly , drugs were serially diluted and added to 96-well plates that were prepared by dispensing into each well 100 l of an appropriate medium ( bbl muller - hinton gold ii agar ; bbl microbiology systems ) and 20 l inoculum ( containing about 5 10 cfu ) .
mic is defined as the lowest concentration at which no growth , a faint haze , or fewer than 3 discrete colonies was detected .
the effect of pdeis on antigyrase activity of ciprofloxacin was examined using the e coli dna gyrase cleavage assay as described by the manufacturer ( inspirals , norwich , united kingdom ) . in brief ,
dna gyrase was incubated with 0.5 g supercoiled pbr322 in a reaction volume at 37c for 1 hour in the presence of 0.1 g / ml ciprofloxacin and/or different pdeis ( 100 m ) .
sds and proteinase k ( 0.2% and 0.1 g / ml final concentrations , respectively ) were added before a further incubation at 37c for 30 minutes .
about 10 l reaction mixture was electrophoresized using 1% agarose and bands were visualized using ethidium bromide .
analysis was performed using graphpad prism software ( version 4.0 , graphpad software , la jolla , california ) .
one - way anova followed by tukey s posttest were used to determine if there was any statistically significant difference .
we investigated the possible attenuating effect of a pdei on the antibacterial activity of ciprofloxacin against various species of reference bacteria , namely , e coli , staphylococcus aureus , pseudomonas aeruginosa , staphylococcus epidermidis , a baumannii , proteus mirabilis , and k pneumoniae .
inhibition zones suggested in the clinical and laboratory standards institute guidelines were considered representative of bacterial susceptibility to the compounds .
table i shows that ciprofloxacin possessed significant antibacterial activity against the reference bacteria that were tested , except for a baumannii and k pneumonia , which showed a zone of inhibition in the intermediate and resistant ranges .
when reference strains were treated with a combination of ciprofloxacin with sildenafil , tadalafil , or vardenafil , the zones of inhibition of the combination were significantly lower than those of ciprofloxacin alone for all tested bacterial strains ( table i ) .
next , the mics of ciprofloxacin alone and the combination of ciprofloxacin with sildenafil , tadalafil , or vardenafil were measured for all tested strains . as shown in table ii , pretreatment of various reference bacteria cells with
this is indicated by significantly higher mic values ( table ii ) for the combination of any of the pdeis ( sildenafil , vardenafil , or tadalafil ) and ciprofloxacin compared with ciprofloxacin alone . to examine the mechanism by which pdeis interfere with the action of ciprofloxacin , the in vitro e coli dna gyrase cleavage assay was used .
however , treatment with pdei drugs had no effect on ciprofloxacin - induced inhibition of e coli gyrase activity ( figure 1 ) .
moreover , pdei drugs alone did not affect e coli gyrase activity ( data not shown ) .
our study showed , for the first time , the inhibition of the antibacterial activity of ciprofloxacin when bacteria are pretreated with any of the pdeis .
these results were generated using wide panel of standard bacterial strains and they could be of importance when ciprofloxacin is used on top of pdeis to treat bacterial infections in older men .
our results show the efficacy of ciprofloxacin on variety of bacterial strains , including e coli , s aureus , pseudomonas aeruginosa , s epidermidis , and proteus mirabilis . in accordance ,
previous studies have shown the susceptibility of these bacterial strains to ciprofloxacin . , we and others have previously demonstrated the crucial role of reactive oxygen species in the antibacterial action of ciprofloxacin on bacterial species , including pseudomonas aeruginosa , e coli , and s aureus .
, , , on the other hand , common scavengers of reactive oxygen species , including vitamin c and vitamin , were shown to attenuate the antibacterial activity of ciprofloxacin .
additionally , it was shown that ciprofloxacin induces reactive oxygen species production when it works against bacterial strains such as e coli , enterococcus faecalis , and s aureus .
for example , increased levels of intracellular superoxide were reported in ciprofloxacin - sensitive microorganisms compared with the resistant ones .
it was also shown that ascorbic acid or glutathione application attenuated the antibacterial activity of ciprofloxacin against escherichia coli , which was dependent on superoxide anions and hydrogen peroxide scavenging .
our present results indicate that combining ciprofloxacin with a pdei results in inhibition of the antibacterial activity of ciprofloxacin against a panel of reference bacterial strains . to our knowledge , this is the first report of such effect or drug - drug interaction .
this could point out that concurrent use of ciprofloxacin with any of the pdeis we tested might oppose the antibacterial activity of this antibiotic .
therefore , pdei use might need to be closely monitored in patients who are receiving ciprofloxacin .
quinolones exert their bactericidal actions through the inhibition of dna gyrase , bacterial type ii topoisomorase . , yet multiple other effects were related to quinolones , such as inhibiting the growth of other types of cells , , , , via interference with cell cycles , reducing cell size , inhibiting de novo synthesis of pyrimidine , and interfering with mitochondrial enzymes that are involved in energy metabolism and oxidative stress .
however , these agents were shown to possess other effects , such as being antioxidative or oxidative stress protective , , being immunomodulatory , having anti - inflammatory properties , and altering energy metabolism and mitochondrial biogenesis .
given the importance of reactive oxygen species , energy metabolism , and mitochondrial functions for the antibacterial action of ciprofloxacin , , , , it is possible that these mechanisms play a role in the observed inhibition of the antibacterial activity of ciprofloxacin by pdei family members .
the results showed an absence of effect for pdei drugs on the gyrase inhibitory action of ciprofloxacin .
thus , it is unlikely that pdei interacts directly with ciprofloxacin and prevents its antigyrase activity .
future studies are needed to indicate the exact mechanism by which pdeis interfere with the action of ciprofloxacin .
the concentration of pdeis used in this study was generally lower than that in human plasma as judged from the pharmacokinetic profile of each pdei .
, , however , taking into consideration the fraction of each pdei that is eliminated in the urine
our study shows the concept of the possible drug - drug interaction between pdei family members and ciprofloxacin .
future work should focus on a range of relevant concentrations to further characterize the effect observed in our study .
the antibacterial action of ciprofloxacin is inhibited when combined with a pdei , including sildenafil , tadalafil , or vardenafil .
this observation is significant because ciprofloxacin is a commonly used antibiotic with huge therapeutic value .
the authors have indicated that they have no conflicts of interest regarding the content of this article | backgroundciprofloxacin is a commonly used antibiotic for urinary tract infection that interacts with bacterial topoisomerases leading to oxidative radicals generation and bacterial cell death .
phosphodiesterase inhibitors ( pdeis ) , on the other hand , are commonly used drugs for the management of erectile dysfunction .
the group includes agents such as sildenafil , vardenafil , and tadalafil.objectiveswe investigated whether pdei could interfere with the antibacterial activity of ciprofloxacin.methodspdeis were tested in several reference bacteria , including escherichia coli , staphylococcus aureus , pseudomonas aeruginosa , staphylococcus epidermidis , acinetobacter baumannii , proteus mirabilis , and klebsiella pneumoniae utilizing a standard disc diffusion method and measuring both zones of inhibition and mic.resultsresults from both assays indicated that ciprofloxacin demonstrates potent activity against the tested reference bacteria .
additionally , when bacteria were treated with a combination of ciprofloxacin and sildenafil , tadalafil , or vardenafil , the zones of the combination inhibition were significantly reduced , whereas the mic values were significantly greater than those of ciprofloxacin alone for all tested bacterial strains . in an attempt to examine the mechanism by which pdeis interfere with the action of ciprofloxacin , we utilized the in vitro e coli dna gyrase cleavage assay .
the results showed that pdei drugs had no effect on ciprofloxacin s inhibition of e coli gyrase activity.conclusionspretreatment of various reference bacterial cells with pdeis largely inhibited the antibacterial activity of ciprofloxacin . | Introduction
Materials and Methods
Chemicals
Microbial culture and growth conditions
Antimicrobial susceptibility test
Determination of MIC
E coli
Statistical analysis
Results
Discussion
Conclusions
Conflicts of Interest |
it was reported that there were 8,284 new cases of lung cancer in korea diagnosed in 2001 ( 1 ) , and the incidence and the number of lung cancer deaths continue to increase . since the overall 5-yr survival for patient with lung cancer is < 15% ( 2 ) , the future line in both the prevention of new disease by reducing the prevalence of tobacco use , and being able to accurately identify early stage disease will be amenable to curative therapy .
( 3 ) described the cellular progression of bronchial tissue from atypical metaplasia to dysplasia to carcinoma in situ ( cis ) and invasive carcinoma .
it has also been shown that the identification and treatment of these pre - invasive lesions in other organs , such as the cervix and colon , can lead to significant improvement in cancer related mortality ( 4 , 5 ) .
unfortunately , early detection has not been shown to improve survival in lung cancer patients , and physicians usually do not recommend screening for lung cancer , such as sputum cytology , chest radiology or bronchoscopy .
recent advances in screening include the use of ultra - fast ct , serum biomarkers , and sputum dna , however their role remains to be defined ( 6 , 7 ) .
bronchoscopy for the detection of early lung cancer may be helpful for two reasons : first , carcinogenesis is slow process evolving over years ( 3 ) .
secondly , about 50 - 60% of all lung cancer , especially squamous cell carcinoma , develops in the central airways .
these cancers can be detected by bronchoscopy , but are generally roentgenographically occult ( 8) . the main problem for conventional bronchoscopy is its low sensitivity and specificity for detection of early malignant cancer ( 9 ) .
pre - invasive lesions usually are small and only some cell layer thick ( 10 ) .
their endoscopic signs therefore are very subtle and can be missed even by experienced bronchoscopists . to improve the sensitivity and specificity of conventional endoscopy ,
autofluorescence bronchoscopy ( afb ) is an emerging endoscopic tool that can identify pre - cancerous lesions in the central tracheobronchial tree , predominantly squamous cell carcinoma .
there are four available systems of afb around the world , but the two most widely used systems are lung imaging fluorescence endoscopic device ( life ) and d - light / afb system .
there was only one report ( 12 ) of using life , but no report with d - light / afb system in korea .
the aim of this study was to compare the utility of d - light / afb versus the standard white light bronchoscopy ( wlb ) in the detection of pre - cancerous lesions .
the study was done during 15 november 2001 to 31 august 2002 in kosin university gospel hospital , busan , korea .
the criteria for enrollment were as follows : 1 ) patients with known or suspected bronchogenic cancer who scheduled for bronchoscopy as a part of standard diagnostic workup , 2 ) follow - up patients who were completely treated with surgery or radiotherapy , 3 ) positive cytological findings , and 4 ) smokers older than 40 yr and/or evidence of chronic obstractive pulmonary disease .
the exclusion criteria were suspected lung infection , in state of cancer treatment , pregnancy , bleeding disorders , and known reaction to topical lidocaine .
bronchoscopy was performed with local anesthesia with or without sedation using d - light / afb ( karl storz , tuttlingen , germany ) and the standard white light bronchoscopy ( wlb : bf-1t200 , olympus , tokyo , japan ) .
d - light / afb system can be used without the application of a photosensitive drug such as ala .
1 ) , while malignant abnormal tissues appearing as red / brown areas against a normal gray / blue background . fig .
2 shows the abnormal florescence and white light bronchoscopic findings of a 74 yr old male patient with cis in left upper lobe bronchus .
he was positive in sputum cytology , but he showed roentgenographically occult chest radiography finding .
details of d - light / afb systems have been reported elsewhere ( 13 ) .
the investigation was done first with white light mode , and then switching to blue light mode for the detection of the specific autofluorescence .
additionally , in almost all patients random biopsies were taken from normally appearing bronchial tissue ( 2 point classification system used ; normal and abnormal finding ) .
the duty pathologist without knowledge of clinical findings evaluated biopsy slides first , and then one lung pathologist who was blinded to the previous results reviewed all .
all biopsies were classified into one of eight groups as follows : normal , hyperplasia , metaplasia , mild atypia , moderate atypia , severe atypia , carcinoma in situ ( cis ) , and invasive carcinoma .
intraepithelial neoplasia was defined as lesions that were graded as moderate / severe dysplasia or cis .
thus the sensitivity was defined as the percentage ( visually suspicious and histologically positive / total number of histologically positive ) , and specificity also by the similar way .
positive predictive values and negative predictive values were also calculated for both wlb and afb in a similar manner .
the relative sensitivity , or the ratio of sensitivity of wlb+afb as compared with wlb alone was calculated to evaluate the contribution of the fluorescence examination to detect neoplastic lesions .
for the per lesion analysis , each biopsy specimen was evaluated and considered positive if the final diagnosis was positive .
there were 113 patients ( male 106 , female 7 ) with median age of 62 yr ( range 40 - 80 ) .
almost all patients ( 86.9% ) were current or ex - smokers with mean pack - years of 44.6 ( table 1 ) .
a total of 364 biopsy specimens were obtained . of these , 81 were not valuable ; inflammation in 63 and inadequate specimens in 18 .
the final pathologic diagnoses of the specimens were as follows : normal in 96 ; hyperplasia in 69 ; metaplasia in 32 ; mild dysplasia in 13 , moderate dysplasia in 6 , severe dysplasia in 4 ; cis in 6 ; invasive carcinoma in 57 ( table 2 ) . thus , 73 biopsy specimens ( 25.7% ) were graded as moderate dysplasia or worse ; this was then used as the standard to determine the relative sensitivity in intraepithelial neoplasia of the bronchoscopic procedure . on the lesion - by - lesion analysis , wlb alone detected severe dysplasia 2 among 4 , cis 2 among 6 , but moderate dysplasia could not be found .
in addition of afb , we missed only 1 moderate dysplasia ( table 3 ) .
the sensitivity of wlb was 30.6% , adjunctive afb to wlb 79.2% , the specificity of wlb 92% , adjunctive afb to wlb 70% in hyperplasia or worse lesions .
the sensitivity of wlb was 30.6% , wlb+afb 79.2% , the specificity of wlb 92% , wlb+afb 70% in moderate dysplasia or worse lesions .
the relative sensitivity of adjunctive afb to wlb vs. wlb alone was 2.6 in hyperplasia or worse and 1.5 in moderate dysplasia or worse lesions ( table 4 ) .
the addition of the afb identified 15 sites . therefore , the relative sensitivity of wlb+afb vs. wlb alone for intraepithelial lesions was 3.2 .
the specificity of adjunctive afb and wlb alone were 0.5 and 0.91 , respectively ( table 5 ) .
the fluorescent system is based on the different fluorescence emissions of normal tissue and tumor tissue , either spontaneously as autofluorescence ( af ) light or as drug induced fluorescence by selective accumulation of exogenous applied photosensitizer in the tumor tissue . when a surface is illuminated by light , the light
additionally , light also causes the tissue to fluoresce , however this af can not be seen during conventional wlb as the intensity of fluorescence is very low , and is overwhelmed by the reflected and back - scattered light .
tissue af revealed the underlying biochemical changes occurring in the cells , specifically the electronic structure of absorption chromophores .
the normal airway fluoresces green when exposed to light in the violet - blue spectrum ( 400 - 450 nm ) , and as sub - mucosal disease progresses from normal , to metaplasia , to dysplasia , to cis , there is a progressive loss of the green af , causing a red - brown appearance of the airway wall .
this results from reductions in certain chromophores , increasing thickness of the epithelium , as well as an increase in angiogenesis that develops with more advanced disease ( 15 ) .
as intraepithelial neoplastic lesions are only a few cell layers thick , the surface mucosa typically appears relatively normal during wlb .
lam et al . ( 17 ) introduced fluorescence bronchoscopy that is effective without the use of protoporphyrins for the purpose of localizing endobronchial lesions of moderate dysplasia or more malignant tissue .
they initially used a 100 mw helium - cadmium laser to illuminate the airways with blue light ( 442 nm ) .
lam 's group found that the red / green ratios from areas with moderate dysplasia , severe dysplasia and cis were significantly higher than those from normal areas ( 18 ) .
the system of karl - storz system is based on a modified xenon light source . on a filter in the ocular of the bronchoscope and an optional integrating camera ,
. there has been one study ( 19 ) comparing life and d - light system .
the examination time was significantly shorter with the d - light system , which may be explained by the more comfortable handling and the direct switch between white light and af imaging . when compared to the other studies , the relative sensitivity of 3.2 finding rate in the intraepithelial lesion is similar .
we gained 3.2-folds sensitivity in detecting pre - cancerous lesions by addition of afb , but lost 0.55-folds decrease in specificity .
the relative sensitivity of 1.5 in moderate dysplasia or worse lesions was also similar to the other report ( 20 ) .
that study was a large study with 1,173 patients ( 916 men ) of mean age 58.7 yr using d - light system .
overall pre - invasive lesions ( moderate to severe dysplasia , and cis ) were detected in 3.9% of the patients .
the biopsy based sensitivity of wlb alone and wlb+afb for detecting intraepithelial lesion was 57.9% compared with 82.3% ( 1.42-fold increase ) .
the corresponding specificity was 62.1% compared with 58.4% ( 0.94-fold decrease ) . in an initial study of afb , lam et al .
found a sensitivity of 48% for wlb , and sensitivity of 73% for afb , a 50% improvement ( 17 ) .
published data in more than 1,400 patients suggest that wlb alone detects on average only 40% of high - grade dysplasia and cis , whereas afb increased the detection rate up to 88% ( 21 ) .
the variation in results of both wlb and afb can be explained by the quality of conventional wlb as well as the reproducibility of the bronchoscopic and pathologic interpretation ( 22 ) .
the latter problem will hopefully be addressed by utilizing a standardized classification of pre - invasive lung cancer developed by the who ( 14 ) .
they investigated the additional yield afb had on wlb in 39 current or former smokers , and found no significant increase in the detection of squamous cell metaplasia or dysplasia .
a possible explanation for this is the fact that the prevalence of advanced disease was low in the population studied .
the majority of patients were former smokers who had stopped smoking for median of 8 yr prior to the study .
this contrasts to the studies where afb has shown to be beneficial , in that enrolled patients had known or suspected lung cancer , and therefore a higher prevalence of advanced dysplasia / cis ( 18 ) .
it appears that the increased sensitivity is associated with decreased specificity , resulting in many false - positive biopsies . aside from the cost of the autofluorescence unit , the major downside to afb is the lack of specificity .
the specificity of afb has been found to be low , with up to one third of area of abnormal fluorescence being found to be false positives ( 24 ) .
this results in a greater number of abnormal lesions being identified at the time of bronchoscopy , prolonging the procedure in order to biopsy the negative lesions , and added time and expense for the pathologist , who is required to examine all of the obtained tissue ( 25 ) .
there are many trials to increase the specificity . quantitative fluorescence imaging or combined fluorescence - reflectance imaging
however it has been suggested that up to 50% of biopsies obtained from these areas carry molecular genetic lesions associated with malignancy , despite their normal histological appearance ( 26 ) . in conclusion ,
the adjunctive afb to the standard wlb increased the detection rate of the localized pre - invasive lesions .
our findings do not support the general use of afb as a screening tool for lung cancer , but suggest that it may be of use in certain groups . | autofluorescence bronchoscopy ( afb ) is one of the newly developed diagnostic tools to detect the pre - cancerous lesions in the bronchial tissue .
the utility of d - light / afb in the detection of pre - cancerous lesions was compared to the standard white light bronchoscopy ( wlb ) . in 113 patients ( male 106 , female 7 ) , who visited hospital for evaluation of lung cancer , wlb and afb were done and 364 biopsy specimens were obtained from november 2001 to august 2002 .
the bronchoscopic findings on wlb and afb were compared to the pathological findings .
the pathologic diagnoses of the specimens were as follows : normal in 96 ; hyperplasia in 69 ; metaplasia in 32 ; mild dysplasia in 13 , moderate dysplasia in 6 , severe dysplasia in 4 ; carcinoma in situ in 6 ; invasive carcinoma in 57 .
the relative sensitivity of adjunctive afb to wlb vs. wlb alone was 1.5 in moderate dysplasia or worse lesions , and 3.2 in intraepithelial neoplasia .
the specificity of adjunctive afb and wlb alone were 0.91 and 0.5 , respectively .
the adjunctive afb to the standard wlb increased the detection rate of the localized pre - invasive lesions .
however , there was high rate of false positive in afb . | INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION |
tuberculosis ( tb ) is one of the top 10 causes of illness , death , and disability world - wide and is the leading cause of death from a curable infectious disease .
it is estimated that approximately one - third of the world 's population is infected with the mycobacterium tuberculosis ( hereafter called latent tb ) , with 8.8 million new cases during 2005 alone .
the annual number of new active tb cases is expected to increase to 9 - 10 million in the year 2010 .
smear - positive tb , the most infectious form of the disease accounts for about 46% of these new cases .
world - wide , about 10% of those with latent tb are expected to develop active tb disease .
nutritional status is one of the most important determinants of resistance to infection , and it is well - established that nutritional deficiency is associated with impaired immune functions . although malnutrition limits cell mediated immunity and increases susceptibility to infection , infection can lead to nutritional stress and weight loss , thereby weakening immune function , and nutritional status .
vitamin a plays a central role in the growth and function of t and b cells , antibody responses , and maintenance of mucosal epithelia .
low blood levels of vitamin a are associated with accelerated disease progression and increased mortality in human immunodeficiency virus - infected adults .
it has been known that vitamin a is excreted in the urine in patients with fever , and this has been confirmed in subjects with acute infections , including pneumonia .
zinc is important for enzymes of all six classes as well as transcription and replication factors .
zinc has been shown to be essential in vitamin a metabolism because it is required to mobilize vitamin a from the liver .
zinc deficiency may contribute to vitamin a deficiency even in the presence of adequate hepatic reserves of the vitamin .
zinc deficiency also affects host defence in a variety of ways and it results in decreased phagocytosis and leads to a reduced number of circulating t cells and reduced tuberculin ( purified protein derivative ) reactivity , at least in animals .
the objective of the present study was to determine the association of the serum zinc level with vitamin a level in active pulmonary tb cases .
this was a cross - sectional study in which cases were out - patients with active pulmonary tb patients ( new sputum smear positive ) attended the directly observed treatment short - course center in the department of pulmonary medicine , king george 's medical university , uttar pradesh , lucknow .
selection of cases was based on the following criteria : age 18 - 55 years ; at least two sputum specimens positive for acid - fast bacilli by microscopy ; and the clinical and the radiographic abnormalities consistent with pulmonary tb .
exclusion criteria for cases were as follows : previous anti - tb treatment , pregnancy , lactation , use of corticosteroids or supplements containing vitamin a or zinc during the previous month , moderate to severe injury or surgery during the last month , and diseases such as abnormal liver function as measured by elevated serum levels of aspartate amino transferase and alanine amino transferase , diabetes mellitus as measured by elevated fasting blood glucose levels , neoplasm as determined by the clinical examination , chronic renal failure as determined by elevated serum levels of urea and creatinine , and the congestive heart failure .
2 ml blood were kept in ethylene diamine tetra acetic acid vial to determine hemoglobin ( hb ) , white blood cell ( wbc ) count , erythrocyte sedimentation rate ( esr ) , and remain in the venipuncture . in the laboratory ,
hb concentration and wbcs were measured directly using an automatic analyzer ( sysmex microdilutor f-800 , kobe , japan ) .
serum retinol was measured using the retinol binding protein ( human ) enzyme - linked immunosorbent assay kit ( cat .
the study was approved by the institutional ethics committee of king george 's medical university , uttar pradesh , lucknow , india .
the unpaired t - test is used to compare the differences in vitamin a levels between male / female and married / unmarried patients .
the one - way analysis of variance is used to compare the vitamin a levels among different age groups . the 95% confidence interval ( ci ) of means
the pearson correlation analysis is carried out to find out the correlation between vitamin a levels and serum zinc , hb , serum albumin , wbc , and esr .
the multivariate linear regression is being carried out to assess the effect of serum zinc level to adjust confounding factors such as age , sex , and body mass index ( bmi ) of the patients on vitamin a levels .
the p < 0.05 is being considered as significant . all the analysis is being carried out by using the spss 15.0 version .
this was a cross - sectional study in which cases were out - patients with active pulmonary tb patients ( new sputum smear positive ) attended the directly observed treatment short - course center in the department of pulmonary medicine , king george 's medical university , uttar pradesh , lucknow .
selection of cases was based on the following criteria : age 18 - 55 years ; at least two sputum specimens positive for acid - fast bacilli by microscopy ; and the clinical and the radiographic abnormalities consistent with pulmonary tb .
exclusion criteria for cases were as follows : previous anti - tb treatment , pregnancy , lactation , use of corticosteroids or supplements containing vitamin a or zinc during the previous month , moderate to severe injury or surgery during the last month , and diseases such as abnormal liver function as measured by elevated serum levels of aspartate amino transferase and alanine amino transferase , diabetes mellitus as measured by elevated fasting blood glucose levels , neoplasm as determined by the clinical examination , chronic renal failure as determined by elevated serum levels of urea and creatinine , and the congestive heart failure .
2 ml blood were kept in ethylene diamine tetra acetic acid vial to determine hemoglobin ( hb ) , white blood cell ( wbc ) count , erythrocyte sedimentation rate ( esr ) , and remain in the venipuncture . in the laboratory ,
hb concentration and wbcs were measured directly using an automatic analyzer ( sysmex microdilutor f-800 , kobe , japan ) .
serum retinol was measured using the retinol binding protein ( human ) enzyme - linked immunosorbent assay kit ( cat .
the study was approved by the institutional ethics committee of king george 's medical university , uttar pradesh , lucknow , india .
the unpaired t - test is used to compare the differences in vitamin a levels between male / female and married / unmarried patients .
the one - way analysis of variance is used to compare the vitamin a levels among different age groups . the 95% confidence interval ( ci ) of means
the pearson correlation analysis is carried out to find out the correlation between vitamin a levels and serum zinc , hb , serum albumin , wbc , and esr .
the multivariate linear regression is being carried out to assess the effect of serum zinc level to adjust confounding factors such as age , sex , and body mass index ( bmi ) of the patients on vitamin a levels .
a total of 208 patients of tb were studied to determine the serum zinc levels and its association with vitamin a levels .
the mean age of the patients was 30.56 ( 11.38 ) years with range 18 - 55 years .
more than half ( 54.3% ) of the patients were males and 63% of the patients were married .
mol / l and 0.77 ( 0.22 ) mol / l respectively . however , hb , wbc , esr , and serum albumin were 10.02 ( 1.33 ) g / dl , 10076.01 ( 1822.67 ) cell / mm , 14.50 ( 2.95 ) mm / h and 3.40 ( 0.32 ) g / dl respectively .
background characteristics of the patients there was a strong correlation between serum zinc and vitamin a levels ( r = 0.86 , p < 0.01 ) [ figure 1 ] .
hb ( r = 0.61 , p < 0.01 ) and serum albumin levels ( r = 0.87 , p < 0.01 ) were also strongly correlated with the vitamin a levels ; however ,
wbc ( r = 0.60 , p < 0.01 ) and esr ( r = 0.79 , p < 0.01 ) were negatively correlated with the vitamin a levels [ table 2 ] .
scatter plot of vitamin a ( mol / l ) and zinc ( mol / l ) levels ( a strong correlation was found between serum zinc and serum vitamin a level ( r = 0.86 , p < 0.01 ) correlation between vitamin a level with zinc and biochemical parameters table 3 shows the effect of background characteristics of patients on vitamin a levels .
the vitamin a levels was insignificantly ( p > 0.05 ) higher in the age group of 31 - 40 years of patients ( 0.80 0.27 mol / l , 95% ci = 0.71 - 0.90 ) as compared to below 20 years ( 0.79 0.23 , 95% ci = 0.69 - 9.00 ) , above 50 years ( 0.78 0.27 , 95% ci = 0.65 - 0.91 ) , 20 - 30 years ( 0.76 0.20 , 95% ci = 0.72 - 0.79 ) and 41 - 50 years ( 0.74 0.19 , 95% ci = 0.66 - 0.82 ) . the vitamin a levels were significantly ( p = 0.001 ) higher in male ( 0.82 0.23 , 95% ci = 0.77 - 0.86 ) patients as compared to females ( 0.71 0.20 , 95% ci = 0.67 - 0.75 ) .
there were no significant differences ( p > 0.05 ) in the levels of vitamin a between married and unmarried patients .
vitamin a levels by background characteristics of the patients table 4 presents the results of multivariate linear regression analysis determining the effect of serum zinc levels on vitamin a adjusted for age , sex , and bmi of the patients .
the adjusted regression coefficient for the serum zinc level remained same as in unadjusted analysis , which was 1.35 ( p < 0.0001 ) indicating that there was no confounding effect of age , sex , and bmi of the patients in the level of vitamin a. effect of serum zinc levels on vitamin a levels adjusted for age , sex , and bmi of the patients
zinc deficiency affects the host defenses in a variety of ways and it results in decreased phagocytosis and leads to a reduced number of circulating t - cells and reduced tuberculin reactivity , at least in animals . in vitro cellular killing by macrophages was found to be reduced during zinc deficiency and rapidly restored after zinc supplementation .
zinc supplementation has a beneficial effect on vitamin a metabolism , which has an important role in tb .
an adequate supply of zinc may also limit free radical membrane damage during inflammation . in the present study ,
a total of 208 tb patients were assessed for their status of zinc level and its association with vitamin a level .
the serum zinc and vitamin a levels among the patients were 9.60 ( 0.86 ) mol / l and 0.77 ( 0.22 ) mol / l respectively .
however , hb , wbc , esr and serum albumin were 10.02 ( 1.33 ) g / dl , 10076.01 ( 1822.67 ) cell / mm , 14.50 ( 2.95 ) mm / h and 3.40 ( 0.32 ) g / dl respectively .
concentration of vitamin a was found lower in tb patients than controls ; however , in an indian study , the low vitamin a levels observed in tb patients returned to normal at the end of anti - tuberculosis treatment without vitamin a supplementation .
the lack of a reliable biological marker for zinc deficiency may mask the real role of this trace element in the genesis of vitamin a deficiency in the studied subjects , whereas , it occurs in other micronutrients , due to a strict homeostatic control , serum zinc levels can be found within normal limits even in individuals with the low body stores of this element ; however , despite these limitations , serum zinc levels are still the most widely used biomarker for zinc status of the organism since other biomarkers also showed limitations in addition to present major technical difficulties in its execution . in our study
, there was strong correlation between serum zinc and vitamin a levels ( r = 0.86 , p < 0.01 ) .
coutsoudis et al . have also reported a positive correlation between vitamin a and serum zinc levels . in our study , hb ( r = 0.61 , p < 0.01 ) and
serum albumin levels ( r = 0.87 , p < 0.01 ) were strongly correlated with the vitamin a levels .
however , wbc ( r = 0.60 , p < 0.01 ) and esr ( r = 0.79 , p < 0.01 ) were negatively correlated with the vitamin a levels .
to best of our knowledge , none of the study was found to correlate these micronutrients with vitamin a ; hence comparison with existing literature could not be made . in our study , the vitamin a levels were not significantly different among the different age groups .
however , this was significantly ( p = 0.001 ) higher in male ( 0.82 0.23 , 95% ci = 0.77 - 0.86 ) patients as compared to female ( 0.71 0.20 , 95% ci = 0.67 - 0.75 ) .
a study on pre - school children reported no significant difference in vitamin a between male and female .
this difference might be due to that they studied on pre - school children while our study was on adult pulmonary tb patients .
there were no significant differences ( p > 0.05 ) in the levels of vitamin a between marital statuses of the patients .
the multivariate linear regression analysis determining the effect of serum zinc levels on vitamin a adjusted for age , sex , and bmi of the patients indicated that the adjusted regression coefficient for serum zinc level remained same as in unadjusted analysis , which was 1.35 , indicating that there was no confounding effect of age , sex , and bmi of the patients in the level of vitamin a. the results of this study also raise the possibility that zinc deficiency may indirectly influence the metabolism of other nutrients in men via reduction of the levels of circulating proteins .
one example , already extensively investigated in animals and to a lesser degree in men , is the role of zinc deficiency on vitamin a metabolism , mainly through its effect on retinol binding protein .
a variety of other nutrients , which rely on transport proteins , such as iron and transferrin , may have their metabolism altered by severe zinc deficiency with decreased nutrients being transported for organ utilization .
thus on the basis of the above findings it could be concluded that nutritional status of the patients is an important determinant to resistance against infections .
the zinc deficiency may indirectly influence the metabolism of vitamin a via reduction of the levels of circulating proteins .
hence , it is advisable that zinc supplementation along with vitamin a may be helpful in attaining disease condition . | introduction : one - third of the total human population is infected with the mycobacterium tuberculosis . this bacterium causes illness in up to 9 million people annually and is responsible for three deaths every minute world-wide.objective:to determine the association of serum zinc level with vitamin a level in active pulmonary tuberculosis ( tb ) cases.materials and methods : it was a cross - sectional study of 208 active pulmonary tb patients aged 18 - 55 years .
blood samples were obtained from these patients to determine the serum zinc and serum retinol levels.results:the mean age of the patients was 30.56 ( 11.38 ) years ranging from 18 years to 55 years .
more than half ( 54.3% ) of the patients were males and 63% were married .
body mass index of the patients was 18.40 3.10 .
the serum zinc and vitamin a levels among the patients were 9.60 ( 0.86 )
mol / l and 0.77 ( 0.22 ) mol / l respectively .
however , haemoglobin , white blood cell , erythrocyte sedimentation rate , and serum albumin were 10.02 ( 1.33 ) g / dl , 10076.01 ( 1822.67 ) cell / mm3 , 14.50 ( 2.95 ) mm / h and 3.40 ( 0.32 ) g / dl respectively
. there was a strong correlation between serum zinc and vitamin a levels ( r = 0.86 , p < 0.01 ) .
vitamin a levels were not significantly different among the different age groups ; however , this was significantly ( p = 0.001 ) higher in male ( 0.82 0.23 , 95% confidence interval [ ci ] = 0.77 - 0.86 ) patients as compared to females ( 0.71 0.20 , 95% ci = 0.67 - 0.75).conclusion : zinc deficiency may indirectly influence the metabolism of vitamin a via reduction of the levels of circulating proteins . | INTRODUCTION
MATERIALS AND METHODS
Study design and subjects
Collection of blood samples
Biochemical analysis
Ethical considerations
Statistical analysis
RESULTS
DISCUSSION
CONCLUSION |
the prediction of in vivo toxicity based on in vitro measurements
is a challenging task , which is in
the center of active development of modern computational toxicology .
the topcoder data science competition platform in collaboration
with environment protection agency ( epa ) organized the toxcast challenge
in 2014 .
lel is defined as the lowest dose that
shows adverse effects in these animal toxicity tests .
the lel is then
conservatively adjusted in different ways by regulators to derive
a value that can be used by the agency to set exposure limits that
are expected to be tolerated by majority of the population .
the total toxcast challenge included five
consecutive subchallenges ,
which were executed over a seven month period and attracted 432 registrants
from 32 countries .
the first subchallenge was to identify software
libraries and/or methods to describe the chemical structure of various
compounds .
the second subchallenge was about identification of a specific
combination of in vitro assays , which could be used
to predict the in vivo systemic lel .
the third subchallenge
was executed privately and was entitled predictive capability
tests .
it had a goal to build a prediction model ( algorithm )
using data from high - throughput in vitro assays ,
chemical properties , and chemical structural descriptors to quantitatively
predict a chemical s systemic lel .
the final fifth subchallenge was about the documentation
of the results of the models . in this study , we present the
results of the rank - i model for the
prediction challenge . according to the challenge rules , the participants
were strictly forbidden to use any data other than the data that were
provided in this competition .
this was done in order to offer equal
conditions to all participants as well as to better evaluate the performance
of models developed using in vitro measurements .
indeed
, the use of any information outside of the data provided within
the challenge , e.g. , information about toxicological chemical pathways ,
could potentially bias the comparison of algorithms .
the summary of
this prediction challenge was published by the epa . since september 2015
, this information has been available
from the web archives and included as supporting information ( see section epa
toxcast lelpredictor marathon match results summary ) to this
study .
this article analyzes the steps that were taken to develop
the
rank - i submission model by participant novserj
the supporting information also contains an extended
technical description , which was submitted to topcoder as part of
the contest .
data , rank - i model , and model predictions
are available at http://ochem.eu/article/68104 .
we believe
that this article will be interesting to both participants and organizers
of the challenge and will help them to better understand and interpret
the results of the challenge .
moreover , the model
reported in this study has the highest prediction ability for lel
end point as validated by the challenge organizers and thus can be
of potential value for people working on the risk assessment of chemical
compounds .
the in vitro measurements provided within the scope of the challenge included
a battery of more than 700 biochemical and cell - based in vitro assays to identify what proteins , pathways , and
cellular processes these chemicals interact with and at what concentration
they interact . the total
data set used during the challenge incorporated 1,854 molecules .
the
experimental lel values were provided for 483 compounds that were
used as the training set .
the test set included lel values for 143
chemicals , which were kept secret and were split into provisional
( 63 ) and final scoring ( 80 ) sets . during the challenge ,
topcoder participants
could submit predictions and receive the statistical results for the
provisional set .
the 80 compounds from the final scoring
set were used only once to rate the final model submissions .
the challenge organizers did not reveal information about the compounds ,
which were used as the test sets .
after the challenge , the experimental
values for 143 compounds from the test set were kindly released by
the topcoder organizers to the authors of the article .
the detailed description of the rank - i submission is provided in supporting information ( see technical
description section ) .
ten different descriptor packages
implemented in the public platform ochem were used individually to create ten models for the resulting consensus .
four descriptor packages , e - state , qnpr , isida fragmentor , and gsfrag , were based on the 2d representations
of the chemical structures .
the other six packages , inductive , chemaxon , adriana , mera / mersy , cdk , and dragon descriptors ,
were calculated using 3d representations of the chemical structures .
exactly the same procedure was used for all
models , and thus , the same number of descriptors and molecules were
utilized to develop each model with different machine learning methods . the selected descriptors count for each model after the
unsupervised filtering
ad is the applicability
domain of
the model as defined by ochem ( see also
ref ( 20 ) ) .
the model
used in the challenge
was developed with associative neural networks ( asnn ) .
it can be considered in a simplified
way as a combination of k - nearest neighbor ( knn ) method applied in
the space of ensemble predictions .
the models developed with the asnn
were top - ranked in several benchmarking studies and that is why this method was selected for the epa challenge .
the default parameters for the asnn algorithm , as optimized during
previous studies and provided on the ochem web site were used .
they
included 64 neural networks in ensemble , 3 neurons in a hidden layer
trained by the supersab algorithm .
in addition to asnn , we also analyzed knn , support vector machines
( as implemented in libsvm ) , and partial least squares methods . as with the asnn method , the default
parameters of these algorithms as provided on the ochem site were
used .
the unbiased estimation of the
models performance is critically important for selection and
decision making for development of models .
two protocols , cross - validation ,
and bagging are frequently used to estimate validation accuracy for
the training set .
it uses n 1 subsets as the training set and predicts the remaining
chunk of the data .
bootstrap aggregation ( bagging ) is another
powerful approach to develop and validate models developed by leo
breiman .
it is based on the aggregation
of models , each one of which is developed with its own training set
( bag in the terminology of breiman ) .
each bag is formed
by random sampling with replacement from the initial training set
and has the same size as the initial set .
the molecules ( on average
37% ) , which do not participate in the respective training set , are
called out - of - the - bag .
the predictions for these molecules
are used to evaluate the predictive power of models .
, there were several theoretical
developments to identify
the most significant descriptors for neural networks .
some of these methods calculate the sensitivity ( importance ) of
input parameters according to derivatives of neural network weights
with respect to the error function , while
others provide such estimations based on the analysis of the magnitudes
of the neural network weights . for this
study
, we used a method from the second group , which provided the
best results in our previous studies .
the sensitivity si of a neuron i was calculated as1where wij were weights connecting neuron i and j , maxa was taken over all weights
ending at
the neuron j having sensitivity sj , and summation was taken over all weights
connecting the neuron i with the upper layer neurons .
the sensitivity calculations were performed recursively starting from
the last layer neuron , which had sensitivity of 1 .
the pruning
procedure started once neural network training was completed . on each
step ,
the least significant descriptors with smallest si were eliminated , and the models were
retrained with the decreased set of descriptors .
the sets of descriptors ,
which calculated the minimal errors , were considered as the optimal
ones . in order to avoid overfitting and overtraining ,
the neural networks were trained using the efficient partitioning
algorithm , which uses the early stopping
procedure . the root mean square error ( rmse )
metric
the challenge organizers used the following scoring
function1ato rank the models . as a result , models with
lower rmse got a higher score and higher rank among the others . in
addition to rmse , the organizers also reported pearson correlation
coefficients and auc defined as percentage of pairs where
predicted1 < predicted2 among those where ground_truth1 <
the workflow for the model
development used in the challenge ( see
technical description in the supporting information ) was based on our previous expertise to develop
recently published models .
final statistical results for
the top - ranking models are summarized in table 2 .
below , we provide a detailed analysis of
the steps , which were used to develop the model .
prediction accuracy for the out - of - the - bag
samples .
confidence intervals
were estimated
using the subsets , which were sampled from the training set , and each
had the same size as the respective test set ( see for more details
ref ( 23 ) ) .
best model based on the in vitro assay descriptors developed using the libsvm method
( see also table s1 ) .
model based on molecular weight
( mw ) and number of carbon atoms ( nc ) developed using the same approach
as the above in vitro model .
there were 37 molecules , including
11 molecules from the training set , for which descriptor generation
failed for different packages .
cdk descriptor package does not support
inorganic elements such as [ sn ] , [ hg ] , [ b ] , and [ as ] .
the failed molecules
either included unsupported atoms for cdk or some groups , e.g. , [ n3 + ] .
several other molecules , e.g. , rifampicin , -cyclodextrin , milbemectin ,
emamectin benzoate , etc . were large chemical structures and failed
either due to time - out or structure conversion problems . according
to the challenge rules ,
as a simple
solution , we used an average value of all training set molecules ,
loglel = 3.2602 log(m ) , as the predicted values for the failed
molecules the challenge organizers offered a provisional set of n = 63 compounds for the purpose of model analysis and selection .
however , we decided to skip the testing on this set for the following
considerations .
thus , an attempt to rely on the models performance
for this set by , e.g. , submission of multiple predictions and selection
of a
best model using it , could contribute a higher
uncertainty and result in the selection of a nonoptimal model for
the final set .
indeed , the final model rmse was 0.88
0.04 for n = 472 training set molecules .
the provisional
set was not available ,
and thus , we were unable to calculate the confidence intervals for
it .
we estimated the intervals by random sampling of n = 63 molecules from the training set , for each of which we calculated
the intervals .
thus , selecting the best model based on
the performance for the provisional test set is about twice as uncertain
compared to selecting based on the training set .
therefore , instead
of relying on the accuracy of models for the provisional test set ,
a strategy to rely on the estimated validated results for the training
set is more reliable .
an even better strategy could be to select a
model based on the combined accuracies of the provisional and training
sets , but such an analysis was not implemented .
the confidence
intervals for n = 80 molecules
were about the same as that for n = 63 molecules .
the wide confidence intervals for both provisional and final test
sets might have contributed to the fluctuations of ranks of challenge
models for both sets .
for example , the top final scoring model was
only ranked # 8 for the provisional submission , while the fourth model
was ranked # 27 .
vice versa , the models ranked top # 1 and # 4 for provisional
submissions were ranked as # 9 and # 34 ( out of 47 participants ) for
the final test set .
thus , indeed , the
provisional ranking score was not strongly predictive of the final
one : provisional and final models ranks were correlated only
with correlation coefficient r = 0.76 .
the
rmse of the eight top - ranked final models were in the range
1.12 to 1.16 and thus were within the confidence intervals of the
winning model .
thus , statistically speaking , these models had the
same performance , and their differences in performance were due to
chance .
the model
submitted to the topcoder challenge was a consensus of the bagging
models developed with the asnn method . in this section
, we briefly
describe the considerations that were used to develop and select this
model for the challenge .
below , we compare the performance
of different methods , which are described in the methods section . bagging vs cross - validation
table s1 in supporting information demonstrates
that models developed using bagging had consistently smaller validation
rmses as compared to the cross - validation results .
comparison of different machine
learning methods ( table s1 ) shows that
combinations of machine learning methods
and descriptors provided quite similar performances with rmse ranging
from 0.9 to 1.2 log units .
considering that 95% confidence intervals
of rmse were 0.4 log units , the majority of these models were
not significantly different .
the highest rmse = 1.2 ( i.e. , the lowest performance ) was
calculated using the pls method for mera / mersy descriptors . actually ,
the failure of this method was due to several outlying molecules that
had predictions far beyond the range of the training set values
. they
may be due to the sparseness of descriptors used to develop models
and insufficient number of data points used to fit the coefficients
in pls .
if we limited the predicted values for all compounds to the
range of the training set values , the results of pls models became
similar to those of other methods .
it is interesting that the
model developed using in vitro assay measurements
consistently provided the lowest accuracy compared
to the other descriptors . considering
that models developed with different descriptor sets had approximately
similar performance , we decided to build our consensus models using
a simple average of individual models . for each machine learning approach ,
since the
individual models were calculated using the bagging approach , the
developed consensus models were also validated using the same protocol .
the model based on the asnn method calculated the lowest rmse error
compared to consensus models developed using other machine learning
approaches .
the exclusion of the model based on in vitro descriptors did not change the accuracy of the asnn consensus model .
the model based on a combination of both in silico and in vitro descriptors requires both sets of
descriptors .
this limits its application to compounds for which in vitro measurements are present , while the model based
exclusively on in silico descriptors can be applied
to any new compounds . therefore , we decided to submit the model developed
using only in silico descriptors to the challenge .
first , we
found that the models developed on the training set have large validation
rmse and that the provisional set statistics had a limited value for
model selection .
therefore , we followed the model development steps ,
which were successful in our previous studies .
did the complexity of the final
model ( a consensus of several individual
models , each of which uses a different descriptor set and is a bootstrap
aggregation of multiple neural network submodels ) add any value , or
could we get some similar results using a simpler approach ? in order
to answer this question , we developed models using just two descriptors :
molecular weight and number of carbon atoms using linear regression .
the rmse of this model on the training set was 1.0 0.04 log
unit .
the use of the same descriptors for the bagging approach decreased
rmse to 0.97 0.04 log unit for the libsvm method ( table 2 ) .
interestingly ,
the best model calculated based on the in vitro assay
measurements had exactly the same accuracy ( rmse = 0.97 0.04 ) .
the topcoder organizers
kindly released information about the experimental values for the n = 143 test set molecules .
it allowed us to provide an
additional analysis of the results for this set and to better evaluate
the influence of the in vitro descriptors on the
prediction accuracy .
the model developed using in vitro descriptors ( see table 2 ) had higher rmse = 1.24 for the test set
as compared to that
of the consensus model , rmse = 1.08 , based on in silico descriptors .
the extension of the consensus model by inclusion of
the model based on in vitro descriptors increased
the rmse of the new consensus model to 1.10 log units .
we also explored
whether extension of in silico descriptors with in vitro descriptors can provide better prediction accuracy .
for this study , we developed models using combinations of each descriptor
set with in vitro descriptors .
the rmse of the models
developed with in silico + in vitro sets were changed
in the range of 0.02 to 0.01 log units compared to rmses of
models calculated using only in silico descriptors .
the rmse of the consensus model based on in silico + in vitro sets was 1.09 , i.e. , 0.01 log units higher compared to that of the
model based only on in silico descriptors .
the rmse calculated for the test
set was significantly higher than that for the training set compounds
( table 2 ) .
an analysis
of extended functional groups ( efg ) was
done to identify whether both sets contained chemically different
compounds .
the efg consists of 583 manually curated functional groups ,
which provide comprehensive coverage of heterocyclic compounds and
are relevant for medicinal chemistry .
the setcompare tool was used to determine statistically significantly
overrepresented chemical groups in training and in test sets using
hypergeometric distribution .
it was found that hydroxy compounds ,
amines , saturated six - membered heterocycles containing one heteroatom ,
etc .
, were overrepresented in the test set , while pnictogens , thiophosphoric
acid esters , halogen derivatives , etc . were overrepresented in the
training set .
thus , the chemical diversity
of molecules in both sets may have contributed to the observed differences
in the rmses for the training and test sets .
the
efg and setcompare tools were also used to analyze which chemical
features contributed to predictions with high errors .
a difference
of 1.5 log units between predicted and experimental values was used
to identify n = 62 compounds with high prediction
errors .
most of these compounds had extreme lel values , i.e. , either
low or high values , and only 7 compounds ( 10% ) were within [ 2 ,
4 ] log(m ) interval as compared to 420 ( 75% ) of compounds that
were within this region for the remaining group .
thus , the model had
difficulties in predicting highly toxic and nontoxic compounds . according to the topcoder rules
,
the submitted results were scored using predictions for all test set
compounds . however , of course , some of the compounds from the test
set could be outside of the applicability domain ( ad ) and have lower
prediction accuracy .
ochem uses standard deviation of the predictions
of models , which contribute to the consensus model , as distance to
the model ( abbreviated as std - cons ) .
std - cons
was found as the best definition of the distance to the model .
ochem defines ad of a model as the value of std - cons that covers
95% predictions from the training set . in the previous benchmarking
study of 12 definitions of distances to the model applied to 11 models ,
we found that std - cons provided the best separation of molecules with
large and low prediction errors notwithstanding the used model .
therefore , we concluded that ad of models is
determined by the composition of the training set of molecules rather
than by the used descriptors or machine learning methods . in the current
study ,
seven compounds from the test set were outside of the ad of
the consensus model .
the consensus model as well as individual submodels
calculated significantly higher rmses , which were in the range of
2.1 to 2.7 log units , for these seven compounds ( table 1 ) .
this result supports the
previous conclusions about the universal nature of the ad of models
and good discriminating power of std - cons distance to the model .
it
also indicates that taking into consideration the ad of the models
is important to avoid predictions with high errors .
it is interesting
that four out of seven compounds had lel < 3 , while other three
compounds had lel > 5.5 .
thus , the used ad has identified compounds
that had experimental toxicity values in the ranges that are difficult
to predict .
the final consensus model was based on 10 submodels , which were
developed with n = 4036 descriptors ( table 3 ) .
these descriptors were selected
from the initial set following the unsupervised filtering procedure .
we explored whether the performance of this model can be further improved
by using a supervised descriptor selection procedure based on neural
network pruning of the least sensitive descriptors .
the application
of this procedure decreased the numbers of descriptors in 5 to 100-fold
( table 3 ) .
models developed
using these descriptors had on average lower training set rmses as
compared to those based on descriptors selected by the unsupervised
filtering , while the opposite result was calculated for the test set
rmses ( table 3 ) .
thus ,
selection of descriptors optimal for the training set introduced variable
selection bias .
indeed , during supervised
selection of descriptors we evaluated the performance of models for
the training set molecules multiple times .
this resulted in selection
of descriptors with improved fit for this set but at the same time
decreased the prediction accuracy for test set compounds , which have
different chemical diversities .
the neural networks are very efficient
methods to work with high - dimensional data and can be also efficiently used without a need of supervised variable
selection .
rmse is the root mean squared error
calculated for the training ( n = 483 ) and full test
set ( n = 143 ) .
the final consensus model was based on 10 submodels , which were
developed with n = 4036 descriptors ( table 3 ) .
these descriptors were selected
from the initial set following the unsupervised filtering procedure .
we explored whether the performance of this model can be further improved
by using a supervised descriptor selection procedure based on neural
network pruning of the least sensitive descriptors .
the application
of this procedure decreased the numbers of descriptors in 5 to 100-fold
( table 3 ) .
models developed
using these descriptors had on average lower training set rmses as
compared to those based on descriptors selected by the unsupervised
filtering , while the opposite result was calculated for the test set
rmses ( table 3 ) .
thus ,
selection of descriptors optimal for the training set introduced variable
selection bias .
indeed , during supervised
selection of descriptors we evaluated the performance of models for
the training set molecules multiple times .
this resulted in selection
of descriptors with improved fit for this set but at the same time
decreased the prediction accuracy for test set compounds , which have
different chemical diversities .
the neural networks are very efficient
methods to work with high - dimensional data and can be also efficiently used without a need of supervised variable
selection .
rmse is the root mean squared error
calculated for the training ( n = 483 ) and full test
set ( n = 143 ) .
in this study , we highlighted the steps used
to develop the rank - i
submission for the epa toxcast challenge , which was organized by the
topcoder community .
we have shown how to consider limitations of the
training and test data sets and that following occam s
razor principle helps to provide a top - entry to the challenge .
a similar consensus
approach was used to achieve the overall best balanced accuracy for
12 end points for another toxcast challenge organized by nih .
the consensus modeling
was also successfully used in the cerapp project to identify potential
endocrine disruptors .
it is rather
surprising that the rank - i model did not involve the in vitro descriptors .
the lel
is defined as lowest effect level dose across multiple animal studies .
this can contribute to considerable differences in the determined
quantitative toxicity thresholds due to interspecies variations as
well as differences in the experimental protocols .
these factors could
contribute to the biological noise of the measured values and make
their prediction a difficult task .
the relatively
weak performance of this model and all others in the challenge can
also point out the limitation of the brute - force machine learning
approach to this problem .
the in vitro assay data
may need to be treated as more than just a table of numbers , and one
will need to incorporate biological knowledge into the structure of
the model .
indeed , pharmacokinetic and pharmacodynamics properties
of the analyzed molecules could be essential for their toxicity .
thus ,
we can expect that the use of systems biology methods can contribute
to more accurate predictions of the lel .
it should be mentioned that
the use of external data was explicitly forbidden for the purpose
of the toxcast challenge .
we can not exclude the possibility that some of the
currently used in vitro assays could be insufficient
for the analyzed end
point .
for example , if toxicity is caused by metabolites of the analyzed
compound the in vitro assays ignoring metabolic activation
may not correctly report toxicity .
currently , it is not clear whether
such problems frequently occur , but recent studies suggest that taking
into consideration the metabolic activation was an important factor
for prioritization of potentially emerging contaminants .
of course , the same problem can also contribute
to difficulties with prediction of toxicity based on in silico descriptors . which of these factors contributed to the low
accuracy of the model ?
such analysis is beyond the scope of the article
and will hopefully be answered in the future with new computational
studies by the scientific community .
importantly , the public availability
of the test set compounds released in this article will help other
users to develop and benchmark new approaches to predict lel and benchmark
their results against the rank i model of the toxcast challenge .
moreover ,
since the model is publicly available and does not use in
vitro descriptors , it can be used to predict the lel of new
compounds in prospective studies and can be benchmarked using new
measurements , which may be available in the future .
we believe publishing
models online in a usable and reproducible manner will become an integral
part of future computational chemistry . in summary , we have described the protocol for developing
the rank - i
model of the epa toxcast challenge . the model is based only on in silico descriptors , and we were not able to increase
its prediction ability using in vitro measurements
in a postmarathon study presented in this article .
the relatively
low accuracy of this model indicates high complexity of the lel and
suggests that pure brute - force machine - learning approaches may not
be sufficient to accurately predict such a complex biological end
point .
possibly , systems biology approaches can help to develop better
models for the prediction of lel using the available in vitro measurements . at the same time
, we can not exclude the possibility
that the currently used in vitro assays may not be
sufficient to correctly characterize this end point .
the developed
model and used data are publicly available at http://ochem.eu/article/68104 and can be used by interested users to answer these questions as
well as to benchmark new ideas , methods , or approaches . | the
toxcast epa challenge was managed by topcoder in spring 2014 .
the goal of the challenge was to develop a model to predict the lowest
effect level ( lel ) concentration based on in vitro measurements and calculated in silico descriptors .
this article summarizes the computational steps used to develop the
rank - i model , which calculated the lowest prediction error for the
secret test data set of the challenge .
the model was developed using
the publicly available online chemical database and modeling environment
( ochem ) , and it is freely available at http://ochem.eu/article/68104 .
surprisingly , this model does not use any in vitro measurements .
the logic of the decision steps used to develop the
model and the reason to skip inclusion of in vitro measurements is described .
we also show that inclusion of in vitro assays would not improve the accuracy of the model . | Introduction
Data
Methods
Results
Development of Models Using Descriptors Optimized with Pruning
Discussion |
the interest in whey - protein supplement ( wps ) increased with consumer 's sensibility concerning health benefits , since the immunomodulatory role of wps has already been amply demonstrated [ 1 , 2 ] . the whey protein ( wp )
constitutes 20% of the total protein content of bovine milk and includes alpha - lactalbumin ( -la ) , beta - lactoglobulin ( -lg ) , bovine serum albumin ( bsa ) , lactoferrin ( ltf ) , immunoglobulins ( ig ) , and growth factors to tissues .
they are associated with the prebiotic effect , promoting tissue restoration , maintenance of intestinal integrity , destruction of pathogens , and elimination of toxins .
highly digestible and quickly absorbed by the body , the wps are widely used in situations of metabolic stress .
whey - protein concentrates ( wpcs ) and whey - protein isolates ( wpis ) usually contain a cysteine concentration at least four times higher than other high - quality proteins , and it produces an improvement in immune response .
crohn 's disease ( cd ) is a complex chronic inflammatory disease , with periods of exacerbation , which affects the gastrointestinal tract , and may also involve the musculoskeletal system , skin , and eyes .
it is important to consider that although the cd may affect any portion of the digestive tract , in most cases it occurs more frequently in the small intestine .
the ileum and cecum are affected in 40% of cases , the small intestine in 30% , and colon in 25% . with this large percentage of presentation in the small intestine
the deregulation of the immune system associated with the intestinal mucosa leads to chronic inflammation , which leads to the destruction of intestinal epithelium and severe functional abnormalities , with loss of absorptive capacity and excessive secretion of electrolytes and intestinal fluids .
thus , cd individuals may show nutritional changes ranging from deficiency of trace elements to severe malnutrition .
several types of diets and supplements are able to modulate the immune system functions , and their bioactive components have been proposed to form the basis of functional immunomodulatory food product .
human and bovine milk contains the transforming growth factor ( tgf- ) , multifunctional polypeptide with an important role in the development of tolerance and prevention of autoimmunity . despite the valuable functional and nutritional properties , it is important to note that wp has little or no flavour .
however , some compounds in whey are susceptible to chemical reactions , for example , lipid oxidation forming unpleasant aromas and flavours in the product [ 13 , 14 ] . today
, consumers increasingly expect to obtain pleasure from food and require sensory characteristics , for example , aroma , flavour , texture , and , along with these sensory characteristics , maintaining or improving their health and welfare . therefore , for cd patients ( who often require specific nutritional support ) to be encouraged to undertake the process of continuous alimentary supplementation , it is necessary to study the acceptability of the product , so that researchers and industries can adapt to the sensory quality of the product as expected by patients . thus , the objective of this study was to evaluate the acceptability of an alimentary supplement of whey - protein concentrate ( wpc ) and tgf- , unavailable commercially , by patients with crohn 's disease .
it is the first time that a study about the acceptability of this supplement by cd patients is done . in this study
the supplement used was donated by an industry of cheese and whey products from california ( usa ) .
the supplement was constituted by whey - protein concentrate ( wpc ) with the addition of tgf- in the exogenous shape , but in amounts not reported by the company , since it is a supplement not marketed yet .
the humidity , total solids , ash , and protein were established based on the methods of aoac .
total lipids were determined according to bligh and dyer and total carbohydrates were estimated by difference , subtracting the sum of the values obtained in other measurements of 100% .
the water protein solubility ( % ) was determined according to the method of morr and foegeding .
total amino acids in the supplement were determined by reversed phase liquid chromatography , after acid hydrolysis ( 24 h ) , plus 20% of hcl phenol , followed by derivatisation with phenylisothiocyanate .
fifty - four individuals ( 24 male and 30 female ) who had cd and aged from 18 to 62 years ( median age of 37 years ) were invited to participate in this study .
it was conducted in the gastrocentro ( centre for diagnosis of digestive tract diseases ) , university of campinas ( unicamp ) , brazil .
the patients with cd performed the acceptance test of the supplement in a single session for the three attributes : aroma , flavour , and viscosity , according to the following criteria : ( a ) patients of both genders ; ( b ) attending outpatient department regularly .
this study was approved by the local ethics committee under protocol 304/2007 , and all individuals signed an informed consent form before the sensory evaluation .
the patients conducted an acceptance test assessing the supplement in inflammatory intestinal disease outpatient clinic at gastrocentro ( unicamp ) .
such test was previously prepared by diluting 15 g of the product in 100 ml of filtered water at room temperature .
the test was performed in individual booths and during the morning from 9 : 00 to 11 : 00 h. the cd patients assessed in a single session the acceptance of the product concerning the attributes : aroma , flavor , and viscosity by using nine - point facial hedonic scale in the extreme left and extreme right , under the term terrible and the term great , as shown in figure 1 [ 19 , 20 ] . to evaluate the acceptance results , the items of hedonic facial scale were converted into numerical values .
thus , the term terrible was converted into the number 1 , the term very bad was converted into the number 2 , the term bad into the number 3 , and so on , until the term great , that was converted to number 9 in the scale . for aroma and flavour ,
the patients were also asked to quote the aromatic notes and flavours perceived in the supplement sample and to assess the product purchase intention .
the physicochemical data were assessed by calculating the average , standard deviation , and tukey 's test , by using the software spss 15.1 for windows .
sensory analysis data were assessed by calculating average , and perceived percentage of quotes for aroma and flavours , processed in the microsoft excel 2002 .
table 1 shows the supplement chemical composition used in this study . in its composition , the supplement had high protein value and low carbohydrate content . due to the high content of essential amino acids , especially the branched chain ones , the supplement also showed high nutritional value , as noted in table 2 .
these values are above average when compared to those from other protein sources , for example , casein , soybean , egg , rice , beans , chicken , and so forth , providing supplement with important nutritional properties .
it may contribute to maintain the nutritional status for cd patients , who often require special nutritional support .
due to the wpc amino acids profile , this protein is used to formulate several specialty products , for example , infantile formulas , and for the performance of muscle metabolism , due to the high content of essential amino acids branched chain , for example , leucine and isoleucine .
these characteristics are hugely important for cd patients , due to hypermetabolism and progressive loss of lean mass , with the clinical evolution of the disease .
the results indicated that the supplement has good solubility in a wide ph range ( table 3 ) , which is quite advantageous , since it may be used to formulate various foods , for example , fermented beverages , ice creams , and so forth .
thus , it increases the possibilities for consumption of this supplement with high nutritional value . according to the acceptance averages for aroma , flavour , and viscosity obtained for the cd patients ,
it was observed that the assessment of the supplement in general was between the terms maybe good or maybe bad and just a little good
46.3% of values were in the region of product rejection ( values from 1 to 4 or between the words
by contrast , 25.9% of the assessed individuals classified the supplement as maybe good or maybe bad and 28% of patients assessed the supplement between just a little good and great ( values between 6 and 9 on the scale ) ( figure 2 ) .
in fact , the supplement aroma was characterised by presenting the unpleasant aroma notes in percentage of responses , such as soybean / grain ( 31% ) , sour milk ( 17% ) , and cooked food ( 9% ) .
it was observed that a small proportion of quotes were associated with pleasant aromas , for example , sweet / vanilla ( 17% ) . concerning the flavour , the frequency of responses was quite similar to the aroma :
additionally , the flavour was mainly associated with soybean / grain flavour ( 34% of respondents ) , sour milk ( 16% of respondents ) , sweet / vanilla ( 13% ) , and milk powder ( 9% ) ( table 5 ) . for viscosity
, the acceptance was a little better ; nearly 40% liked the sample viscosity against 33% who did not like it .
in general , it was observed that roughly 30% of individuals liked the supplement concerning all attributes assessed . by contrast ,
half of them did not like it and the other , from 20% to 25% , classified it as maybe good or maybe bad .
it indicates that the product needs to be improved , especially its aroma and flavour . on the other hand ,
the acceptance was not as bad as the supplement was evaluated only dissolved in water , maybe if the supplement was added to fruit juice or milk drink could have a better acceptance by the patients .
the aroma and flavour of grain / soybean , sour milk , bitter , cheese , cooked food , all noticed by individuals , can be from lipid oxidation or maillard reaction ( or both ) , as some studies have shown .
these reactions contribute to the formation of off - flavours and to the loss of pleasant aromas / flavours of whey - protein concentrate , thus limiting its use .
isolated and identified 43 volatile from wpc , among them several aldehydes , ketones , and hydrocarbons . according to the authors , several of them can contribute to the aromas and flavours perceived in wpc , for example , 2-heptanone , 2-nonanone , 1-octen-3-ol , and volatiles associated with aromas of cardboard , metal , and mould , respectively .
the formation of volatiles during production and storage of wpc is difficult to control , considering all the reactions that may occur . to obtain a wpc with milder
aroma / flavour would be necessary to standardise the conditions for processing and storage of wpc , and thus obtain a supplement with better sensory quality . despite the low acceptance of the product , 28% of patients indicated that they probably would buy the supplement , and
by contrast , 19% of patients indicated that they perhaps would or would not buy the supplement , 22% said they probably would not buy the product , and 9% of them definitely would not buy .
several studies have demonstrated that complete nutrition with protein supplements improves nutritional status of patients , intestinal inflammation , and , often , recovery of intestinal mucosa .
paradoxically , the treatment using only corticosteroids presents limited effects on the mucosa . in children affected by cd , complete nutrition plays a fundamental role in the increase of their growth , since the additional nutrient provision is coupled with improvement in intestinal inflammation . in cd - acute adults ,
the complete nutrition is greatly effective in relieving the disease and in the nutritional status of individuals , and it can be used together to other therapies to control cd .
therefore , studies assessing and developing oral solutions that are better accepted by patients are very important .
the supplement presented as a good protein source and high content of essential amino acids providing important nutritional properties that can contribute to maintain the nutritional status for cd patients , who often require special nutritional support .
although the supplement was not well accepted for aroma , flavour , and viscosity by most patients , almost 30% of individuals liked the supplement concerning all attributes assessed .
the results indicated that the supplement provided important nutritional properties for patients with cd ; however , for a large number of patients to be encouraged to start the supplementation process , it is essential to improve the sensory quality of the product . in order to do so , additional research is necessary to prevent the formation of volatiles , which cause off - flavours in wpc , associated in the present study with soybean / grain , sour milk , cooked food , vomit , and other undesirable aromas and flavours . | the objective of this study was to evaluate the acceptability of an alimentary supplement of bovine whey - protein concentrate ( wpc ) and tgf- , unavailable commercially , by patients with crohn 's disease ( cd ) and determine the chemical composition , solubility , and total amino acids content .
the supplement was diluted in water , and an acceptance test was done to evaluate the aroma , flavour , and viscosity of the product using facial hedonic scale ( nine - point scale ) , applied on 54 cd patients .
the supplement composition indicated 73.3% protein , 10.5% fat , 2.2% ash , 6.3% water , and 7.7% carbohydrate .
the supplement is presented as a good protein source and high content of essential amino acids .
the average acceptance for all the attributes was between 5.0 and 6.0 , and the flavour was mainly associated with soybean / grain , sour milk , and sweet / vanilla flavour .
the results indicated that the supplement provided important nutritional properties for cd patients ; however , for a large number of individuals to be encouraged to perform supplementation , it is essential to improve the sensory quality of the product . in order to do so
, additional research is necessary to prevent the formation of volatiles which cause off - flavours or to mask undesirable aromas / flavours found in it . | 1. Introduction
2. Material and Methods
3. Results and Discussion
4. Conclusion |
+ 1 prfa prf event that results in a shift of the ribosome forward one nucleotide into next adjacent reading - frame on the mrna3-oxo - c6-hsln-(3-oxohexanoyl)-l - homoserine lactone;antiactivationa form of transcriptional repression that is dependent on protein - level inhibition of a transcriptional activatorc proteinscontrol proteinsicesintegrative and conjugative elementsicemlsymthe integrative and conjugative symbiosis island of mesorhizobium loti strain r7amgemobile genetic elementsorfopen reading frameprfprogrammed ribosomal frameshiftqsquorom sensingrmrestriction modification a prf event that results in a shift of the ribosome forward one nucleotide into next adjacent reading - frame on the mrna n-(3-oxohexanoyl)-l - homoserine lactone ; a form of transcriptional repression that is dependent on protein - level inhibition of a transcriptional activator integrative and conjugative elements the integrative and conjugative symbiosis island of mesorhizobium loti strain r7a mobile genetic elements programmed ribosomal frameshift restriction modification
mobile genetic elements ( mge ) frequently harbor genes that contribute to the evolutionary success of their host organisms .
the genetic cargo carried by mge can increase metabolic capacity , confer resistance to antimicrobials or arm bacteria with weapons with which to attack other organisms . in some cases
mge encode entire suites of genes that facilitate adaptation to a new habitat or lifestyle .
the symbiosis island icemlsym of mesorhizobium loti is a 502-kb integrative and conjugative element ( ice ) that carries a diverse array of genes involved in nitrogen fixation , plant signaling , effector protein secretion and metabolism .
naturally - occurring non - symbiotic mesorhizobia that receive icemlsym via conjugation gain the ability to become endosymbionts of the pasture legume lotus corniculatus . converted mesorhizobia are able to communicate interactively with plants and form an intracellular infection within plant root cells , where they differentiate into bacteroids that fix atmospheric nitrogen into ammonia . thus in this example , horizontal gene transfer results in the single - step evolution of an entire developmental and metabolic reprogramming of an organism
. horizontal transfer of icemlsym was first identified in situ following investigation of rhizobial populations that arose under a l. corniculatus stand following inoculation with a single m. loti strain in new zealand .
the field - site soil was devoid of indigenous rhizobia able to nodulate the host .
a diverse variety of native mesorhizobial recipients of icemlsym were identified and over time the exconjugants supplanted the original inoculant strain in nodules , directly demonstrating that these hybrid offspring produced from horizontal gene transfer were more competitive in this environment than their parents .
a similar scenario was subsequently documented in australian soils but , interestingly , the exconjugants were frequently inefficient nitrogen - fixers despite also being competitive in soil and nodule environments .
while the factors leading to the competitive success of these hybrid mesorhizobia are probably multifactorial , it is clear that icemlsym and related ices have expedited evolution by facilitating genetic reassortment of the pan - genome .
mge can directly benefit their hosts in the short term and indirectly increase collective bacterial evolvability in the longer term but , because mge ultimately promote their dissemination at the expense of the host , the fitness costs associated with mobility may present a direct fitness burden to the donor bacterium .
conjugation systems , as well as occupying dna real - estate , impart significant energy demands on hosts during conjugation .
these demands undoubtedly place active donors at a disadvantage compared to hosts lacking ices or those carrying ices that have lost mobility . since there is no guarantee that horizontal transfer will result in the evolution of superior offspring , fitness deficits at the level of the host bacterium are also detrimental to the long - term survival of the ice through vertical descent within its current host . additionally , the unilateral transfer of dna to a potentially non - isogenic competitor seemingly has no benefit to the bacterial donor and can ( and does for mesorhizobial ices ) result in the original ice host losing its niche to its partially - related offspring .
evolutionary models of plasmid persistence predict that plasmid mobility should eventually be lost regardless of the beneficial cargo the plasmid may carry , unless the rate of conjugation and generation of successful offspring overcome the selection for loss of mobility .
this prediction likely also applies to ices and other mge and , assuming current presumptions of the selective forces shaping mge evolution are correct , it would seem that successful extant mge must have evolved mechanisms to mitigate these risks and avoid selection for loss of their mobility . unlike plasmids , ices exhibit a clear partition between their stay - at - home and
the integration of ices within the host genome affords ices the stability of replication and segregation provided by the host chromosome and , furthermore , likely reduces the fitness cost of dna maintenance compared to an extrachromosomal existence .
however , ices must excise from the host chromosome through site - specific recombination prior to conjugative transfer to form a circularized ice capable of rolling - circle replication and conjugation . for most documented ices , excision and
transfer is a rare event . in wild - type laboratory populations of m. loti strain r7a , icemlsym
is only observed in the excised state in 0.066% of cells and only 3 in 10,000,000 cells act as donors .
nevertheless , genetic augmentation of the icemlsym transfer regulation system can induce excision and stable replication of icemlsym in 100% of cells , with a resulting 1000-fold increase in conjugative transfer . these increased excision and transfer frequencies
are achieved through derepression of the icemlsym - encoded quorum - sensing ( qs ) system ( fig . 1 )
, which when activated establishes a positive autoinduction circuit leading to expression of the excisionase protein rdfs ( fig . 2 ) .
in the vast majority of cells , icemlsym remains stably integrated within the host chromosome .
in this state , cells produce negligible 3-oxo - c6-hsl and are unresponsive to large amounts of exogenous 3-oxo - c6-hsl .
however in a minority of cells in the population , icemlsym is excised and able to replicate extrachromosomally in a relaxase - dependent manner . in this state ,
the qs autoinduction circuit is activated by minute amounts of 3-oxo - c6-hsl and is stimulated to produce 1000x more 3-oxo - c6-hsl than when in the integrated qs - off state .
the model implies that qs / excision - on cells and qs / excision - off cells behave as 2 discrete populations .
the diagram illustrates the genetic and molecular factors involved in activation ( in green ) and repression ( in red ) of qs and excision of icemlsym .
trar activates transcription from the trai1 and trai2-msi172-msi171 promoters , further inducing 3-oxo - c6-hsl production . in a minority of translation events of msi172 ( 413% ) ,
an in - frame stop codon in msi172 is bypassed through ribosomal frameshifting and the msi172-msi171 open reading frames ( orfs ) are translated into a single polypeptide , producing the transcriptional activator fsea .
fsea activates transcription of rdfs , which encodes the icemlsym recombination directionality factor ( excisionase ) , which stimulates excision of icemlsym . in most cells
qsem is able to bind both trar-3-oxo - c6-hsl and the msi172-encoded n - terminal portion of fsea and inhibit the transcriptional activation functions of both proteins .
the transcription of qsem is controlled by the dna - binding protein qsec , which positively autoregulates its own expression and represses expression of qsem through differential binding of 2 operator sites located between qsem and qsec .
population - level model of icemlsym excision and quorum sensing . in the vast majority of cells ,
, cells produce negligible 3-oxo - c6-hsl and are unresponsive to large amounts of exogenous 3-oxo - c6-hsl .
however in a minority of cells in the population , icemlsym is excised and able to replicate extrachromosomally in a relaxase - dependent manner . in this state ,
the qs autoinduction circuit is activated by minute amounts of 3-oxo - c6-hsl and is stimulated to produce 1000x more 3-oxo - c6-hsl than when in the integrated qs - off state .
the model implies that qs / excision - on cells and qs / excision - off cells behave as 2 discrete populations .
the diagram illustrates the genetic and molecular factors involved in activation ( in green ) and repression ( in red ) of qs and excision of icemlsym .
trar activates transcription from the trai1 and trai2-msi172-msi171 promoters , further inducing 3-oxo - c6-hsl production . in a minority of translation events of msi172 ( 413% ) ,
an in - frame stop codon in msi172 is bypassed through ribosomal frameshifting and the msi172-msi171 open reading frames ( orfs ) are translated into a single polypeptide , producing the transcriptional activator fsea .
fsea activates transcription of rdfs , which encodes the icemlsym recombination directionality factor ( excisionase ) , which stimulates excision of icemlsym . in most cells
qsem is able to bind both trar-3-oxo - c6-hsl and the msi172-encoded n - terminal portion of fsea and inhibit the transcriptional activation functions of both proteins .
the transcription of qsem is controlled by the dna - binding protein qsec , which positively autoregulates its own expression and represses expression of qsem through differential binding of 2 operator sites located between qsem and qsec .
the original concept of an integrative and conjugative element presumed that ices excised only transiently prior to transfer , before returning to an integrated state in the same cell .
it is now clear that several ices are able to replicate extrachromosomally and remain stable in this state through cell division .
maintenance of icemlsym as an extrachromosomal element is dependent on the conjugative relaxase gene rlxs , indicating that icemlsym replicates via relaxase - dependent rolling - circle replication in this state .
the phenomenon of relaxase - dependent replication of ices has subsequently been documented for ices in bacillus subtilis ( icebs1 ) and providencia rettgeri ( ice r391 ) .
icebs1 utilizes several host- and ice - encoded proteins for extrachromosomal replication , including the conjugative relaxase nick .
ice r391 , as well as exhibiting relaxase - dependent replication , is also stabilized through cell division by partitioning proteins when it is in the excised state . thus the consensus from these studies is that while ices spend most of their existence stably integrated within the host chromosome , they have also evolved the ability to exist as extrachromosomal elements that have an increased propensity for conjugative transfer .
the concept of bacterial differentiation into mating bodies that carry excised ice capable of conjugative transfer has been proposed for iceclc of pseudomonas knackmussii b13 .
a low percentage ( 35% ) of b13 cells in laboratory populations enter a slow - growing state in which iceclc is excised .
this concept of differentiation of ice - carrying bacteria into cell subpopulations that are either switched on or off for excision and conjugative transfer is consistent with the inducible and stable extrachromosomal replication exhibited by icemlsym , icebs1 and ice r391 .
since ices are able to exist stably as extrachromosomal elements , it seems unlikely that ice excision occurs transiently in all cells .
instead the vast majority of cells in ice - carrying populations never participate in excision or conjugative transfer , while a minority of cells in the population carry stably excised ices and are the donors in horizontal transfer events .
this population heterogeneity likely allows ices to ameliorate the fitness costs associated with their mobility , as the vast majority of ice - carrying cells in a population likely never experience any costs other than those of maintaining the ice dna itself .
similar phenotypic bet - hedging phenomena are observed for the induction of competence and sporulation in bacillus subtilis in response to changing metabolic conditions .
bet - hedging behavior is often underpinned at the molecular level by autoinduction circuits and layered antagonistic repression systems that together facilitate stochastic establishment of transcriptional and phenotypic bistability .
the excision regulation system of icemlsym involves a qs autoinduction system that is able to induce excision in all m. loti cells . until recently however ,
the extent of the negative regulation that prevents this activation in the majority of cells in the bacterial population was not fully appreciated .
icemlsym encodes a cluster of regulatory genes that control both the induction of excision and the expression of an n - acyl - homoserine - lactone - dependent qs system .
trar is a top - level regulator homologous to trar of the agrobacterium tumefaciens ti plasmid .
trar is activated in the presence of the diffusible signaling molecule n-(3-oxohexanoyl)-l - homoserine lactone ( 3-oxo - c6-hsl ) .
trar activates transcription from 2 promoters , one of which initiates transcription upstream of the 3-oxo - c6-hsl synthase gene trai1 , thus completing the paradigmal luxri - family qs - autoinduction loop .
expression of msi172 and msi171 is essential for expression of rdfs , the product of which stimulates the integrase ints to catalyze excision of icemlsym . as mentioned previously , despite this positive autoinduction circuit , excision is only observed in a minority of cells and 3-oxo - c6-hsl production is almost undetectable in wild - type populations .
repression of the autoinduction loop can be relieved through ectopic expression of trar , which induces excision in 100% of cells and copious ahl production , but not by the addition of exogenous 3-oxo - c6-hsl .
this indicates that there is a fine balance between positive and negative regulatory components of this excision - regulating switch , but once the balance is tipped by increased trar , cells are firmly set to the on ' position .
several qs circuits have evolved negative regulatory components that inhibit qs activation and prevent spontaneous autoinduction triggered by biological noise in transcription and signal - molecule production . like the qs system of the agrobacterium ti plasmid ,
icemlsym encodes an antiactivator ' protein , qsem , which binds and inhibits activity of the qs transcriptional activator trar .
qsem shows no primary amino - acid sequence similarity to previously characterized antiactivator proteins , consistent with the observation that several unrelated qs antiactivators have independently evolved in association with luxri - type systems . using bacterial 2-hybrid assays , ahl bioassays and transcriptional fusion assays
, we demonstrated that qsem binds icemlsym - encoded trar in a 3-oxo - c6-hsl - dependent manner and prevents activation of qs and expression of msi172 and msi171 .
strains deleted for qsem exhibit a phenotype identical to strains ectopically expressing trar , that is , 3-oxo - c6-hsl production is massively upregulated , and icemlsym is excised in 60100% of cells , and transfer frequency is increased 1000-fold . through binding and inactivating trar ,
qsem likely dampens the effects of biological noise that might spuriously stimulate activation of qs ; more importantly though , it appears to totally prevent the activation of qs in the vast majority of cells in the bacterial population .
expression of qs and icemlsym excision require either that trar expression is increased or that qsem expression is repressed ; the balance between these 2 components is at the heart of the switch between the integrated and excised state .
the expression of qsem is controlled by the quorum - sensing and excision control protein qsec , a dna - binding protein that autoinduces qsec expression and represses qsem expression through differential binding to 2 operator sites located between the divergently oriented qsem and qsec promoters .
mutation of qsec prevents the activation of qs , even in the presence of ectopically expressed trar , due to derepression of qsem transcription .
qsec and its operator sites strongly resemble the control ( c ) proteins and operator sites of type ii restriction modification ( rm ) systems . additionally , homologues of qsec are found adjacent to tram genes on several agrobacterium and rhizobial plasmids .
this suggests that these c proteins provide a mode of regulatory control that is well - suited for regulation of restriction modification , quorum sensing and plasmid and ice mobility .
the c proteins of rm cassettes are critical for the lag between methylase and endonuclease expression following entry of the rm cassette into a nave host , and for delicately adjusting the differential expression of these proteins during replication .
c proteins , through a mix of positive and negative autoregulation , enable rm systems to adjust gene expression in response to changing c - protein concentration and operator copy number .
we suspect that , analogous to methylase gene expression on rm cassettes , qsem is strongly expressed following arrival in a new host and in actively replicating cells , but is stochastically repressed in a sub - population of slow - growing or non - dividing cells . in this repressed state , providing that 3-oxo - c6-hsl concentration is able to accumulate to enable activation of trar ( which may be as little as a few molecules per cell ) , the qs autoinduction circuit is established , msi172 and msi171 are expressed and excision is activated .
once the switch has flipped , autoinduction of qsec expression largely prevents further qsem expression and qsem repression may be further augmented through transcriptional interference from the convergently transcribed trai2-msi172-msi171 operon . in a recent investigation
, we found that the functional protein product of the msi172 and msi171 genes is a transcriptional activator fsea , which is translated as a single polypeptide through a programmed ribosomal frameshift ( prf ) .
fsea directly and strongly activates the rdfs promoter , connecting qs with the activation of excision .
a prf site exists near the 3 end of the msi172 gene , and encodes a slippery sequence uuuc that facilitates a + 1 shift of the trna from the uuu codon to the uuc codon , placing the ribosome in the msi171 reading frame and joining the polypeptide sequences encoded by the msi172 and msi171 open reading frames ( orfs ) . despite fsea
having no structurally defined relatives , fsea homologues ( duf2283 ) are widespread in the proteobacteria and appear to be encoded on numerous putative ices , both as single - orf and prf - containing 2-orf variants .
the prf site of msi172 contains several features common to other + 1 prf sites , such as the slippery codon sequence and a conserved upstream guanine - rich region .
the prf event appears to occur at a rate of between 4 and 13% of translation events , estimated from the detection of frameshifted protein products in escherichia coli and through fusion of the prf site to the -galactosidase gene , expressed in m. loti .
activation of the rdfs promoter by msi172-msi171 is only 0.8% of that induced by expression of a fused fsea gene .
thus the prf site of msi172 markedly reduces the potential activation of the rdfs promoter by qs , but induced rdfs expression remains high enough that when trar is active , excision is stimulated in 100% of cells .
overexpression of rdfs causes growth inhibition in the presence or absence of icemlsym and thus the prf site may have evolved to reduce the deleterious effects of rdfs overexpression .
the inhibition observed when rdfs is strongly expressed suggests that , as for p. knackmussii iceclc , donors of icemlsym may differentiate into a slow - growing transfer competent state .
however , given that m. loti cells active for qs and excision do not appear to exhibit growth inhibition , the inhibition may be a side - effect of rdfs expression above levels that occur naturally and not a conserved feature of mating - body differentiation .
the 413% translation of fsea may be adequate to provide the sustained expression of rdfs required for maintenance of icemlsym in the extrachromosomal state when qs is activated , but not high enough to induce growth inhibition or loss of icemlsym .
in addition to reducing the deleterious effect of rdfs overexpression , the msi172 prf site may have evolved to dampen biological noise stemming from spurious msi172-msi171 transcription . at a molecular level ,
observed population - level ranges in gene expression are not analog , but rather the average of a series of discrete events . promoter strength or promoter activation largely reflects the frequency at which transcription is initiated .
biological noise at the level of transcription can result in stochastic expression from even a weak or unactivated promoter , and once this transcript is produced , only post - transcriptional regulation can abate the translation of proteins encoded by it .
it has been proposed that qs circuits may not be able to avoid random autoinduction without the presence of negative regulatory components , which is consistent with the unbridled qs activation in m. loti in the absence of qsem .
spurious expression of a transcript encoding genetically fused msi172 and msi171 genes ( no prf site ) would likely result in sporadic expression of rdfs and excision of icemlsym .
untimely and unregulated excision of icemlsym could place both the ice and the host bacterium at a competitive disadvantage that could lead to selection for loss of icemlsym , or at least loss of icemlsym mobility .
we propose that the prf site and fsea have together evolved to provide an appropriate level of expression of rdfs when the qs switch is activated , but negligible production of fsea in the absence of qs .
as we recently reported , qsem is additionally able to bind the msi172-encoded n - terminal portion of fsea and directly prevent transcriptional activation of the rdfs promoter by fsea . to our knowledge
the additional inhibition of fsea by qsem illustrates that icemlsym has evolved extraordinarily robust safeguards to prevent expression of rdfs , and activation of excision , in the face of biological noise .
it is not yet clear how qsem achieves binding and inhibition of two distinct transcriptional activator proteins .
qsem shows weak amino - acid similarity to the msi171-encoded duf2283 domain of fsea , suggesting their genes may have a common ancestor .
numerous ices that carry homologues of fsea lack qsem homologues , suggesting that duf2283-domain proteins may have primarily evolved as transcriptional regulators rather than antiactivators .
one possibility is that qsem arose from a duplication of an ancestral fsea gene that then lost its msi172-like region and evolved antagonistic activity against its fsea - like paralogue .
interestingly , qsem and fsea are present on numerous ices that lack recognizable qs genes , further supporting the notion that the antagonistic relationship between qsem and fsea evolved prior to the ability of qsem to bind and inhibit trar .
these findings , considered together with the identification of several other independently - evolved qs antiactivators , suggest that antagonistic factors that repress qs have evolved frequently during evolution .
together the components of the icemlsym excision regulation system likely shield most cells from the potentially deleterious expression of its mobility genes and govern the proportion of cells in a population that enter into the transfer - competent state .
it is likely that factors that favor the differentiation of ice - carrying cells to become transfer - competent are the same factors that favor the evolutionary outcomes of horizontal gene - transfer events .
further understanding of the mechanistic factors that stimulate ices to enter into the excised , transfer - competent state , will undoubtedly shed light on the environmental factors that have favored horizontal gene transfer in situ .
horizontal gene - transfer events are of critical concern for the spread of antimicrobial resistance and virulence determinants and yet our understandings of the circumstances that lead to these low - frequency events are still relatively rudimentary .
furthermore , tools could be derived from the exquisite repression systems inbuilt within mges for use in the creation of synthetic circuitry .
the emerging field of synthetic biology has brought with it the promise of creating living organisms that might replace everything from electronic circuitry to molecular sensors and even biochemists !
these switches often utilize quorum - sensing components and simple dna - binding regulators similar to those described here . however a major stumbling block in the creation of synthetic biological circuits is their inherent variability and sensitivity to biological noise . in commentary on factors inhibiting the progress of the synthetic biology field , 3 of the five hard truths for synthetic biology
we argue that mge have faced similar issues with noise throughout their lengthy evolutionary history and that elements like icemlsym have evolved very elegant solutions that await exploitation .
this work was funded by a university of otago ( uoo ) research grant and a dean 's bequest consumables grant from the otago school of medical sciences .
jpr acknowledges the uoo division of health sciences for a career development postdoctoral fellowship and curtin university faculty of health sciences for funding of work contributed at curtin university by himself and students . | mobile genetic elements run an evolutionary gauntlet to maintain their mobility in the face of selection against their selfish dissemination but , paradoxically , they can accelerate the adaptability of bacteria through the gene - transfer events that they facilitate .
these temporally conflicting evolutionary forces have shaped exquisite regulation systems that silence mobility and maximize the competitive fitness of the host bacterium , but maintain the ability of the element to deliver itself to a new host should the opportunity arise .
here we review the excision regulation system of the mesorhizobium loti symbiosis island icemlsymr7a , a 502-kb integrative and conjugative element ( ice ) capable of converting non - symbiotic mesorhizobia into plant symbionts .
icemlsymr7a excision is activated by quorum sensing , however , both quorum sensing and excision are strongly repressed in the vast majority of cells by dual - target antiactivation and programmed ribosomal - frameshifting mechanisms .
we examine these recently discovered regulatory features under the light of natural selection and discuss common themes that can be drawn from recent developments in ice biology . | Abbreviations
None
Disclosure of Potential Conflicts of Interest
Acknowledgments
Funding |
a 30-year - old male presented to chonnam national university hospital complaining of pitting edema of both lower extremities .
laboratory studies were as follows : blood urea nitrogen , 24.7 mg / dl ; serum creatinine , 1.4 mg / dl ; and c - reactive protein , 3.5 mg / dl .
one week later , the follow - up serum creatinine level had increased from 1.4 mg / dl to 3.0 mg / dl .
the renal ultrasound showed a resistive index ( ri index ) of 0.53 and hypoechoic fluid collection in the pelvic cavity and around the transplanted kidney .
follow - up renal ultrasound showed hydronephrosis of the transplanted kidney ( fig . 1 ) and pelvic cavity fluid collection , which was confirmed by abdominal computed tomography ( fig .
the scan showed focal tracer accumulation in the pelvic area , and there was evidence of abnormal leakage from the transplanted kidney and ureter ( fig .
to distinguish between lymphocele and urinoma , we conducted sono - guided percutaneous drainage of the fluid collected in the pelvic cavity ( fig .
the chemistry of the peritoneal fluid was more equivalent to the serum values than to the urinary values ( table 1 ) .
the common etiologies of perirenal fluid collections occurring after kidney transplantation include urinomas , hematomas , abscesses , and lymphoceles.1 examination of the aspirate fluid is an essential method for specifying the kind of perirenal and pelvic cavity fluid collection .
analysis of fluid composition is also helpful in identifying urine leakage , because higher creatinine and potassium concentrations and lower sodium concentrations are detected in urine than in lymphocele fluid.2,3 indeed , urine fistulae may be responsible for perirenal collection , particularly early after surgery , through ureteral or bladder leaks .
perirenal hematomas occur during the postoperative period or after traumatism and are easily diagnosed by examining the fluid composition .
abscesses are also easily identified by aspirate white blood cell composition and bacterial cultures.1 the cause of lymphocele formation is unclear , but it is believed to result from transection of the lymphatic vessels accompanying the external iliac vessels during transplantation surgery and subsequent lymph accumulation in a nonepithelialized cavity in the extra - peritoneal plane adjacent to the transplanted kidney.4 the therapeutic options for lymphoceles occurring after kidney transplantation include simple aspiration under imaging control drainage with or without sclerotherapy and more invasive options of laparoscopic or open surgery to fenestrate the lymphocele into the peritoneal cavity . however , treatment decisions seem to be center - dependent.5 our patient underwent simple aspiration and antibiotic treatments . his serum creatinine level decreased to within the normal range , and the hydronephrosis was resolved . because treatments of lymphocele and urinoma differ , it is important to clarify the cause of the perirenal fluid collection after kidney transplantation .
in addition , early detection of transplantation - associated complications is expected to preserve renal function in patients with kidney transplantation . in summary , we have presented a case of perirenal and pelvic cavity fluid collection after kidney transplantation .
this case suggests that physicians should remember how to differentiate lymphocele and urinoma in postobstructive nephropathy in patients who have received a kidney transplant . | a 30-year - old male presented with pitting edema .
he had received a kidney transplantation 3 months previously .
his serum creatinine level was increased , and a renal ultrasound showed hypoechoic fluid collection in the perirenal space and pelvic cavity .
we conducted sono - guided percutaneous drainage of the fluid collected in the pelvic cavity .
the chemistry of the peritoneal fluid was more equivalent to serum chemistry values than to urinary values .
simple aspiration and treatment with antibiotics were performed .
we have presented a case of lymphocele after kidney transplantation .
this case suggests that physicians should remember how to differentiate the pelvic cavity fluid collection in patients who have received a kidney transplant . | THE CASE: WHAT IS THE CAUSE OF IMPAIRED RENAL FUNCTION?
THE DIAGNOSIS: LYMPHOCELE AFTER KIDNEY TRANSPLANTATION |
lifestyle and health - related behaviors are strongly associated with morbidity and mortality in many chronic diseases worldwide .
major factors include diet , physical activity , smoking , body mass index ( bmi ) , and alcohol consumption [ 35 ] .
for example , university students experience significant changes in their diet due to busy class schedules and extracurricular activities , as well as the abundance of opportunities for eating out and drinking alcohol . in addition , excessive interest in appearance and poor health literacy even lead some to develop a habit of skipping meals . moreover , according to previous research , although most university campuses provide physical environments that promote physical activities , more than 54.8% of university students do not participate in sufficient physical activity and 25.8% do not participate in any physical activity at all .
these unhealthy behaviors have been reported to cause diseases such as obesity , cancer , cardiovascular disease , cerebrovascular disease , and osteoporosis . in south korea ,
the incidence of osteoporosis in young women and the prevalence of obese young adults have increased sharply over the last decade .
young adulthood is a transitional period that bridges adolescence and adulthood , and the lifestyle of a person during this period not only reflects their past lifestyle , but may also predict their future lifestyle in adulthood and beyond .
failure to recognize the unhealthy lifestyles of young adults may therefore limit the success of childhood health promotion programs .
first line interventions for health promotion in young adults tend to target diet and physical activity [ 1416 ]
. however , only a few studies have investigated the effects of programs promoting healthy eating habits that also include physical activity . moreover ,
most relevant studies on the effects of a diet or physical activity program were long - term studies lasting more than 8 weeks .
however , in a preliminary study on the need for a health promotion program targeting young adults , we found that most respondents expected to experience a remarkable change after participating in a short - term intensive experience program .
short - term programs have been shown to improve skeletal muscle strength , insulin sensitivity and serum lipids , as well as aid weight loss and changes in body composition .
for example , a previous study reported that a 14-day diet and exercise intervention decreased body mass index ( bmi ) , insulin sensitivity , triglycerides ( tg ) and total cholesterol ( tc ) in 21 overweight or obese children .
similarly , a 6-day yoga and diet change program conducted in 47 obese adults reduced bmi , waist and hip circumference , fat - free mass and hand - grip strength .
therefore , this study was conducted to assess the impact of an intensive 10-day health promotion program combining healthy diet and physical activity on body composition , physical fitness , and biochemical parameters of young adults .
as college - based researchers often find it easier to recruit on campus , university students were chosen as participants of this health promotion study for young adults .
the selection criteria were ( 1 ) no physical and/or psychological disease before study commencement and ( 2 ) no history of participation in any health promotion programs .
each group required 17 subjects to detect an effect size of 0.80 with a power of 0.70 at a 0.05 level of significance .
this number was based on a previous study , which suggested 10% of the project sample size ( 10 to 30 participants ) to be appropriate for the pilot study . despite male students being eligible for inclusion , they were reluctant to participate in the program
. therefore , 34 female undergraduate students enrolled in the study , and were randomly assigned to the intervention group or the control group ( 17 in each group ) .
subjects family names were arranged according to the korean alphabet , and then research randomization 4.0 , a randomized computer program , was used to perform the randomization .
however , 3 students dropped out before the baseline examination because of scheduling conflicts and one dropped out before the follow - up examination because of a health condition ( figure 1 ) .
finally , 30 participants ( 16 in the intervention group and 14 in the control group ) were included in this study .
this study was approved by the ethical committee of sahmyook university and complied with the ethical standards of the declaration of helsinki .
the intensive 10-day health promotion program combining diet and physical activity ( 10-rhpdp ) was designed and conducted by experts , professors , and researchers of nutrition , exercise , and lifestyle .
all participants followed a planned 24-hour schedule during the program . after getting up at 6:00 a.m. and having breakfast
, participants listened to health - related lectures on nutrition , exercise , and health for 3 hours in the morning and 1 hour after lunch for a total of 24 hours over the 10-day period . to ensure the long - lasting effects of the program , healthy diet , exercise , massage practice ,
in addition , participants exercised for a total of 23 hours over the 10-day period , which included taking a light walk for 1 hour every morning , and undertaking aerobic , flexibility , and strength exercises for 2 hours in the afternoon . before lunch , participants engaged in healthy cooking sessions for a total of 8 hours over the 10-day period . after dinner , participants listened to a lecture on massage theory and practiced for a total of 16 hours over the course of the program .
all participants had to drink water frequently throughout the day ( a daily total of 1.5 l of water ) and go to bed after the 10:00 p.m. roll call ( no later than 10:30 p.m. ) . with regard to the exercise program , participants ran 45 km a day at the track for aerobic exercise .
they were instructed , encouraged , and supervised to run for 1 km at a low speed at which conversation was possible , for 23 km at a speed at which conversation was slightly uncomfortable , and for the last 1 km at the individual s maximum speed .
after finishing the aerobic exercise , all the participants moved to an indoor gym and performed 10 different flexibility exercises and 6 different core exercises , maintaining each pose for 30 seconds and resting for 15 seconds between poses . in total , 3 sets of these exercises were performed over approximately 40 minutes .
food was consumed at a scheduled time and place , and a vegetarian diet planned by a nutritionist was available for consumption in unlimited amounts .
the diet comprised a variety of fruits and vegetables , whole grains , dairy products , eggs and legumes .
participants assigned to the intervention group lived and engaged in activities as a group according to a 24-hour schedule . dietary intake and physical activity outside the predetermined schedule were impossible because of strict supervision by the experiment assistants .
participants assigned to the control group spent 10 days consuming their normal diets and refraining from any formal exercise , as per their usual custom .
all subjects attended a baseline assessment at sahmyook university prior to study commencement . a 12-hour fasting blood sample ( approximately 10 ml )
weight ( kg ) , bmi , body fat ( percent ) , and muscle mass ( kg ) were measured with a bioelectrical impedance analysis instrument ( biospace co. , seoul , south korea ) after resting for approximately 20 minutes . to assess physical fitness , muscle strength ( grip and leg and back extension ) , flexibility ( sit and reach , shoulder ) , balance ( single - leg standing ) , and cardiorespiratory capacity ( 12-minute run ) were measured using a grip dynamometer ( ds total sports , incheon , south korea ) , dynamometer ( takei scientific instruments co. , tokyo , japan ) , and sit and reach box ( ds total sports , incheon , south korea ) .
serum levels of tg , tc , high - density lipoprotein cholesterol ( hdl - c ) , low - density lipoprotein cholesterol ( ldl - c ) were measured using the enzymatic colorimetric assay method ( model ; p , roche co , mannheim , germany ) .
glucose levels were measured with enzymatic kinetic assays ( hexokinase ) ( model ; p , roche co , mannheim , germany ) .
insulin levels were measured with electrochemiluminescence immunoassays ( eclia ) ( model ; e , roche co , mannheim , germany ) .
homeostasis model assessment of insulin resistance index ( homa - ir ) , the index value of the indicator representing the insulin resistance , was calculated using the following formula : homa - ir=[fasting plasma insulin ( iu / ml ) fasting plasma glucose ( mmol / l ) ] .
statistical analysis was performed using the ibm spss program for windows version 20.0 ( ibm corp .
, armonk , ny , usa ) . all data are expressed as mean standard deviation . the mann
whitney u test for intergroup comparisons and wilcoxon signed - rank test for intragroup comparisons were used .
as college - based researchers often find it easier to recruit on campus , university students were chosen as participants of this health promotion study for young adults .
the selection criteria were ( 1 ) no physical and/or psychological disease before study commencement and ( 2 ) no history of participation in any health promotion programs .
each group required 17 subjects to detect an effect size of 0.80 with a power of 0.70 at a 0.05 level of significance .
this number was based on a previous study , which suggested 10% of the project sample size ( 10 to 30 participants ) to be appropriate for the pilot study . despite male students being eligible for inclusion , they were reluctant to participate in the program
. therefore , 34 female undergraduate students enrolled in the study , and were randomly assigned to the intervention group or the control group ( 17 in each group ) .
subjects family names were arranged according to the korean alphabet , and then research randomization 4.0 , a randomized computer program , was used to perform the randomization .
however , 3 students dropped out before the baseline examination because of scheduling conflicts and one dropped out before the follow - up examination because of a health condition ( figure 1 ) .
finally , 30 participants ( 16 in the intervention group and 14 in the control group ) were included in this study .
this study was approved by the ethical committee of sahmyook university and complied with the ethical standards of the declaration of helsinki .
the intensive 10-day health promotion program combining diet and physical activity ( 10-rhpdp ) was designed and conducted by experts , professors , and researchers of nutrition , exercise , and lifestyle .
all participants followed a planned 24-hour schedule during the program . after getting up at 6:00 a.m. and having breakfast
, participants listened to health - related lectures on nutrition , exercise , and health for 3 hours in the morning and 1 hour after lunch for a total of 24 hours over the 10-day period . to ensure the long - lasting effects of the program , healthy diet , exercise , massage practice ,
in addition , participants exercised for a total of 23 hours over the 10-day period , which included taking a light walk for 1 hour every morning , and undertaking aerobic , flexibility , and strength exercises for 2 hours in the afternoon . before lunch , participants engaged in healthy cooking sessions for a total of 8 hours over the 10-day period . after dinner , participants listened to a lecture on massage theory and practiced for a total of 16 hours over the course of the program .
all participants had to drink water frequently throughout the day ( a daily total of 1.5 l of water ) and go to bed after the 10:00 p.m. roll call ( no later than 10:30 p.m. ) . with regard to the exercise program , participants ran 45 km a day at the track for aerobic exercise .
they were instructed , encouraged , and supervised to run for 1 km at a low speed at which conversation was possible , for 23 km at a speed at which conversation was slightly uncomfortable , and for the last 1 km at the individual s maximum speed .
after finishing the aerobic exercise , all the participants moved to an indoor gym and performed 10 different flexibility exercises and 6 different core exercises , maintaining each pose for 30 seconds and resting for 15 seconds between poses . in total , 3 sets of these exercises were performed over approximately 40 minutes .
food was consumed at a scheduled time and place , and a vegetarian diet planned by a nutritionist was available for consumption in unlimited amounts .
the diet comprised a variety of fruits and vegetables , whole grains , dairy products , eggs and legumes .
participants assigned to the intervention group lived and engaged in activities as a group according to a 24-hour schedule .
dietary intake and physical activity outside the predetermined schedule were impossible because of strict supervision by the experiment assistants .
participants assigned to the control group spent 10 days consuming their normal diets and refraining from any formal exercise , as per their usual custom .
all subjects attended a baseline assessment at sahmyook university prior to study commencement . a 12-hour fasting blood sample ( approximately 10 ml )
weight ( kg ) , bmi , body fat ( percent ) , and muscle mass ( kg ) were measured with a bioelectrical impedance analysis instrument ( biospace co. , seoul , south korea ) after resting for approximately 20 minutes . to assess physical fitness , muscle strength ( grip and leg and back extension ) , flexibility ( sit and reach , shoulder ) , balance ( single - leg standing ) , and cardiorespiratory capacity ( 12-minute run )
were measured using a grip dynamometer ( ds total sports , incheon , south korea ) , dynamometer ( takei scientific instruments co. , tokyo , japan ) , and sit and reach box ( ds total sports , incheon , south korea ) .
serum levels of tg , tc , high - density lipoprotein cholesterol ( hdl - c ) , low - density lipoprotein cholesterol ( ldl - c ) were measured using the enzymatic colorimetric assay method ( model ; p , roche co , mannheim , germany ) .
glucose levels were measured with enzymatic kinetic assays ( hexokinase ) ( model ; p , roche co , mannheim , germany ) .
insulin levels were measured with electrochemiluminescence immunoassays ( eclia ) ( model ; e , roche co , mannheim , germany ) .
homeostasis model assessment of insulin resistance index ( homa - ir ) , the index value of the indicator representing the insulin resistance , was calculated using the following formula : homa - ir=[fasting plasma insulin ( iu / ml ) fasting plasma glucose ( mmol / l ) ] .
statistical analysis was performed using the ibm spss program for windows version 20.0 ( ibm corp . ,
whitney u test for intergroup comparisons and wilcoxon signed - rank test for intragroup comparisons were used .
the mean age of the subjects was 20.01.1 years , the mean height was 161.75.1 cm , and the mean weight was 56.28.7 kg . before the intervention , there were no statistically significant differences in any variables between the intervention and control groups , thus ensuring homogeneity between the groups ( table 2 ) .
body weight and bmi decreased significantly in the intervention group compared with that in the control group ( p<0.001 ) .
there were no statistically significant differences in fat - free mass , muscle mass , skeletal muscle mass , fat mass , or body fat percentage between the 2 groups ( table 3 ) . back and leg strength , bilateral grip strength , waist flexibility , bilateral shoulder flexibility , balance , and cardiorespiratory endurance increased significantly in the intervention group compared to that in the control group ( p<0.01 to p<0.001 ) ( table 4 ) .
tg , tc , ldl - c , glucose levels and homa - ir decreased significantly in the intervention group compared to those in the control group ( p<0.05 to p<0.001 ) , but there were no statistically significant differences for hdl - c and insulin .
the mean age of the subjects was 20.01.1 years , the mean height was 161.75.1 cm , and the mean weight was 56.28.7 kg . before the intervention , there were no statistically significant differences in any variables between the intervention and control groups , thus ensuring homogeneity between the groups ( table 2 ) .
body weight and bmi decreased significantly in the intervention group compared with that in the control group ( p<0.001 ) .
there were no statistically significant differences in fat - free mass , muscle mass , skeletal muscle mass , fat mass , or body fat percentage between the 2 groups ( table 3 ) .
back and leg strength , bilateral grip strength , waist flexibility , bilateral shoulder flexibility , balance , and cardiorespiratory endurance increased significantly in the intervention group compared to that in the control group ( p<0.01 to p<0.001 ) ( table 4 ) .
tg , tc , ldl - c , glucose levels and homa - ir decreased significantly in the intervention group compared to those in the control group ( p<0.05 to p<0.001 ) , but there were no statistically significant differences for hdl - c and insulin .
this study was performed to determine the effects of the 10-rhpdp on body composition , physical fitness , and blood factors of young adults .
the program was effective in reducing weight and bmi , and in increasing back muscle strength , leg muscle strength , grip strength , waist and shoulder flexibility , balance , and cardiorespiratory endurance of young adult females aged 1822 years .
few studies worldwide have investigated the effects of a short - term intensive health promotion program that combines diet and physical activity in healthy young adults .
therefore , direct comparison of study results is difficult . a study performed in adults aged 1850 years , however , reported a decrease in body weight and total fat mass after the implementation of a program combining a hypocaloric diet and exercise training . in a study of women aged 1950 years
, a program combining a 15002000 calories / day diet , 3060 minutes / day of moderate - intensity physical activity , and behavioral modification consultations was found to reduce bmi and body fat percentage . in another study
investigating the effects of diet and exercise , alone or combined , on weight and body composition in obese menopausal women , there was a statistically significant weight loss in the low - fat diet and moderate - intensity aerobic exercise groups , but the greatest change was observed in the group where a combination of both interventions was applied . a randomized controlled trial conducted by christensen et al .
designed a workplace intervention to achieve an energy deficit of 1200 kcal / day including strengthening exercise ( 15 minutes / hour ) , aerobic fitness ( 2 hours / week ) , and cognitive behavioral training ( 1 hour / week ) .
this resulted in a reduction in weight , bmi , and body fat percentage , and increased back muscle strength and hand grip strength .
similarly , rigamonti et al . reported that a 3-week multidisciplinary body weight reduction program combining an energy - restricted diet , 90 min / daily aerobic physical activity , psychological counseling , and nutritional education , improved bmi and percent fat mass in 7 obese male adolescents .
these results provide important evidence on the benefit of a health promotion program for healthy young adults , as well as the feasibility of adhering to the program for at least 10 days for overweight or obese young adults . as with the previous studies ,
the findings of this study suggest that undergoing a short - term lifestyle program can enhance the physique and physical fitness of healthy adults .
therefore , to achieve successful health promotion , it is important to help participants recognize the importance of a healthy lifestyle by providing training on healthy eating habits and adequate physical activity .
it is believed that encouraging young adults to participate in a health program , albeit a short - term one , is important .
although the control group in this study had spent 10 days maintaining their normal lifestyle , there was a decrease in leg strength after 10 days .
this could be because the participants may have been unmotivated to perform the leg strength measurements .
in addition , the korean culture views demonstrations of physical strength as unfeminine , which may have contributed to the subjects reluctance to engage in the assessment .
another important finding was the discovery that the 10-rhpdp was effective in reducing serum lipid and glucose levels as well as insulin resistance in our subjects .
the program also increased hdl - c and reduced insulin levels , although these findings were not statistically significant .
a study investigating the effects of diet and physical activity in young adults aged 1835 years showed similar results
jakicic et al . reported that a 6-month diet and physical activity program decreased participants tc , tg , and glucose levels and increased their fitness levels .
although other studies demonstrated biochemical parameters levels comparable to those found in our study , they varied widely with respect to duration , size , population , and types of diet and exercise interventions used .
besnier et al . demonstrated a reduction in insulin levels and homa - ir after individualized exercise training combined with a fruit- and vegetable - rich diet in overweight or obese women , and otten et al . reported improved glycemic control and homa - ir after a paleolithic diet with 1 hour of supervised exercise ( aerobic exercise and resistance training ) 3 times per week among 32 patients with type 2 diabetes .
similarly , brekke et al . showed that tc , ldl - c , and insulin levels were decreased and hdl - c levels increased after a 12-week behavior modification intervention with diet and exercise among overweight and obese lactating women .
. found that tg , tc , and ldl - c levels were reduced but hdl - c levels were not significantly changed by diet and aerobic exercise intervention in 6 studies , which may help explain the improvements seen in this study .
thus , the 10-rhpdp may be efficacious in improving the glycemic control and blood lipid levels of young adults . finally , combining diet and physical activity interventions can reduce the risk of developing multiple lifestyle diseases such as obesity , diabetes , hypertension , and cardiovascular diseases in young adults .
there were no statistically significant changes , however , in fat - free mass , muscle mass , skeletal muscle mass , fat mass , or body fat percentage
. this may be because ( 1 ) most of the results of the variables fell within the normal ranges , ( 2 ) it is difficult to produce a change during a 10-day period , or ( 3 ) the subjects had vegetarian diets that did not provide sufficient protein .
this study was the first randomized pilot trial of a short - term lifestyle modification program in healthy south korean young adults .
the aim of the study was to improve several health - related parameters by combining diet and physical activity interventions .
experts , professors , and researchers of nutrition , exercise , and lifestyle designed and facilitated the program .
additionally , compared with previous trials that took place over a longer period and took a less intensive approach ( including biweekly or triweekly meetings ) , this study used an intensive program over a short period of time , which is likely the reason for the high compliance among our study participants however , the study had several limitations .
second , all of the participants were females , as it was difficult to recruit male participants for the diet intervention .
therefore , the possibility that the effect of the 10-rhpdp may differ according to sex can not be excluded .
third , the study only targeted the students of a single university ; therefore , generalization of the results should be done carefully . in the future
, further research should be conducted with a larger sample size . despite the study s limitations
, its findings suggest that the 10-rhpdp can improve not only the physique and physical fitness , but also the glycemic control and blood lipid levels of young adults .
the results of this study showed that an intensive 10-day health promotion program improved weight , bmi , muscle strength , muscle flexibility , balance , cardiorespiratory endurance , homa - ir , and tg , tc , ldl - c , and glucose levels in a group of young women .
it is easy to administer and may be an effective way to improve body composition , physical fitness , glycemic control , and blood lipid levels in this population . | backgrounda lifestyle characterized by poor eating habits and physical inactivity is a risk factor for multiple lifestyle diseases in young adults .
this study assessed the effects of implementing an intensive 10-day health promotion program combining diet and physical activities on body composition , physical fitness , and biochemical parameters of young adults.material/methodsin this randomized pilot study , 30 female undergraduate students were randomly allocated to an intervention and a control group . the health promotion program consisted of unlimited amounts of vegetarian food ; aerobic , flexibility , and strength exercises ( 3 hours / day ) ; lectures on health ( 3 hours / day ) ; massage practice ( 2 hours / day ) ; and healthy cooking practice ( 1 hour / day ) .
the effects of the intervention were analyzed using the mann - whitney u test and the wilcoxon signed - rank test.resultsthe intensive 10-day health promotion program significantly reduced body weight , body mass index , triglyceride , total cholesterol , low - density lipoprotein cholesterol , blood glucose , and the homeostasis model assessment of insulin resistance . at the same time , participants demonstrated increased back muscle , leg muscle , and grip strength ; waist and shoulder flexibility ; balance ; and cardiorespiratory endurance.conclusionsthe intensive 10-day health promotion program is a viable intervention for improving body composition , physical fitness , glycemic control , and blood lipid levels in young adults . | Background
Material and Methods
Participants
The intensive 10-day health promotion program
Data collection and outcome measurement
Statistical analysis
Results
Demographic and clinical characteristics at baseline
Body composition
Physical fitness
Blood factors
Discussion
Conclusions |
the case under discussion highlights the importance of vascular access monitoring and surveillance to prevent failure .
blood loss through avf can be from aneurysms , stenosis and subsequent rupture , infection , trauma , suicide and , use of anticoagulants and antiplatelet drugs .
common causes of blood loss through the av fistula in esrd patients are also reviewed in the discussion part .
a 57-year - old caucasian man with a past medical history of benign essential hypertension , dyslipidemia , coronary artery disease status post1 coronary artery bypass grafting , systolic congestive heart failure secondary to ischemic cardiomyopathy , type 1 diabetes mellitus with associated complications of diabetic retinopathy , neuropathy and nephropathy , h / o ischemic stroke , human immunodeficiency virus ( hiv ) positivity since 1992 , and end - stage renal disease on hemodialysis through a right arm brachiocephalic av fistula ( avf ) created approximately five years ago presented to the emergency room ( er ) with bleeding from his avf .
he started having problems with this av fistula almost a year previously when he underwent an av fistulogram due to decreased dialysis clearance .
the fistulogram identified two areas of venous stenosis and an aneurysmal dilatation in the proximal portion of the outflow vein .
successful angioplasty of the two sequential stenoses was performed with establishment of good fistula flow .
five months after this procedure , prolonged fistula bleeding after a routine dialysis led to another av fistulogram which demonstrated a recurrent stenosis of the outflow tract in the cephalic vein .
no significant dialysis access issues were observed until two weeks before the current presentation when dialysis nurses observed aneurysmal dilatation of his av fistula and recurrent prolonged bleeding from the cannulation site . vascular surgery appointment was scheduled and pending .
his home medications included aspirin 81 mg , clopidogrel 75 mg , lamivudine , atazanavir , lanthanum carbonate , carvedilol , amlodipine , valsartan , levothyroxine , insulin aspart , and lantus . of note
he was on a combination of both antiplatelets for the last 4 years . on the day of presentation ,
about 30 minutes after his dialysis treatment ended , he called a friend and complained of bleeding from his avf .
the patient was coherent and conscious but complaining of generalized weakness , fatigue , and shortness of breath .
upon arrival in the er , his blood pressure was 117/98 mmhg , pulse 79 , and regular , respiratory rate 18 , temperature 98.6 f , spo2 92% on room air .
he was pale and there was an area of aneurysmal dilatation of the right avf with a pinpoint area of bleeding which had largely stopped with pressure .
a short arm cast was on the right wrist ( wrist fracture had occurred three weeks earlier ) .
there were no obvious signs and symptoms of infection of the avf and no recent antibiotic use .
initial labs were remarkable for hgb 6.7 gm / dl and hct of 21.8% . of note ,
the patient was transfused 5 units of packed red blood cells with appropriate response in hemoglobin .
a new left arm basilic vein transposition avf was created along with ligation of the right brachiocephalic avf .
three months later , the right brachiocephalic fistula was removed by vascular surgery ; intraoperatively a pseudoaneurysm and thrombosis of the av fisula were observed .
the centers for medicare and medicaid services interpretive guidance update requires every dialysis facility to have an ongoing program for vascular access monitoring and surveillance for early detection of failure and to allow timely referral of patients for intervention .
physical examination can be used as a monitoring tool to exclude low flows associated with impending vascular access failures .
there are 3 components to the access examination : inspection ( look ) , palpation ( touch ) , and auscultation ( listen ) .
a fistula that does not at least partially collapse with arm elevation is likely to have an outflow stenosis .
strictures can be palpated and the intensity and character of the bruits can suggest the location of stenosis .
observance of changes in adequacy or in pressures measured during dialysis , difficulties in cannulation , or in achieving hemostasis may also be used as monitoring tools [ 14 ] .
surveillance strategies include device - based methods such as access flow measurements , direct or derived static venous pressure ratios , and duplex ultrasound , and so forth
the best available evidence indicates that fistula surveillance does not prolong fistula life and there is limited evidence that surveillance may reduce fistula thrombosis .
serial monitoring of aneurysms may give the opportunity to potentially prevent rupture by timely intervention .
evidence of periodic monitoring and surveillance of the vascular access should be documented on the dialysis treatment record , progress notes , or on a separate log .
a member of the facility staff must review the vascular access monitoring / surveillance documentation to identify adverse trends and take action if indicated .
our patient probably would have benefited from early vascular surgical intervention before an episode of life threatening hemorrhage .
he was on both aspirin and clopidogrel although the current evidence suggests that the combined use of aspirin and clopidogrel does not offer greater benefit for stroke prevention than either agent alone but does substantially increase the risk of bleeding complications .
thus , it is likely that the antiplatelet agents contributed to his bleeding and stopping the dual antiplatelet therapy should have been considered when aneurysmal dilation of the fistula was initially noticed .
the most common sources of acute access blood loss in hemodialysis patients are shown in table 1 .
aneurysms usually occur in long - lasting arteriovenous fistulas and form in areas of repeated needle puncture sites . repeated needle punctures of the arterialized veins over time result in destruction of the venous wall and replacement by scar tissue causing loss of elasticity .
there is also an increased risk of bleeding each time after insertion and removal of dialysis needles .
this is because the vessel wall is thinned in an aneurysm and is easily injured and prone to bleeding and rupture .
cannulation should not be continued along any type of aneurysm , particularly in patients for whom the skin layer within the aneurysm is thin and prone to infection , a sign of impending perforation .
long - standing high blood flow rates through an av fistula results in shear forces that cause damage to the elastic fibers of the internal elastic lamina . the high flow rates and the resulting shear forces from repeated dialysis treatments
limit time for healing , thereby causing destruction of the venous wall and aneurysm formation .
false aneurysms are hematomas located outside the vessel wall , formed due to a leaking hole in the artery and are most often due to iatrogenic trauma , primarily repeated needle punctures .
infection of a false aneurysm increases the risk of rupture and bleeding as the vessel wall is already thin .
risk for bleeding and hematoma formation is greatest in the early stages of use of a fistula and greater in brachiobasilic fistulae than fistulae at the wrist or elbow .
venous aneurysms occur when repeated trauma to the venous wall is coupled with complete stenosis .
the increased venous resistance leads to progressive enlargement of the venous aneurysm , thus increasing the risk of rupture .
true aneurysms are fusiform , develop slowly over several years , and lie beneath intact , nonulcerated skin making them less prone to infection and rupture . on the contrary ,
pseudoaneurysms are usually saccular with thinning of overlying skin and develop over a short period of time , making them more prone to rupture and infection .
aneurysms are at risk for rupture if they are large and rapidly expanding , if there is thinning of overlying skin exposing the underlying fistula and if there are signs of local infection [ 15 , 16 ] .
the occurrence of large aneurysms , in addition to threatening the function of the avf , may ultimately rupture with catastrophic sequelae .
however surgical options to repair such large aneurysms are limited and often involve loss of the avf .
endovascular procedures such as angioplasty and stenting have been increasingly used to treat vascular access dysfunction and to prolong the life of an avf .
the basic underlying mechanism of venous stenosis is neointimal hyperplasia due to cytokine production , cellular proliferation , and microvessel formation .
this is triggered by high intraluminal pressure , turbulent blood flow , vascular calcification , endothelial injury , and increased levels of fibronectin [ 20 , 21 ] .
development of stenosis of av fistula is also influenced by venous capacitance , surgical technique , and the site of the av fistula . in hemodialysis patients ,
a native av fistula is the vascular access of choice owing to its superior patency and low complication rates .
venous stenosis per se does not lead to blood loss but can be complicated by aneurysm formation with subsequent rupture and blood loss .
aneurysms are observed within the first postanastomotic venous segment in the presence of a hemodynamically relevant stenosis in the juxta - anastomotic position the therapy of choice is a new av anastomosis using a healthy venous segment located a few centimeters more proximally , but as close to the former anastomosis as possible , to preserve the maximum area for cannulation .
vascular access site infection is considered to be the most challenging complication and the major cause of morbidity and mortality among chronic hemodialysis patients .
infection rate is highest with temporary central vein catheter followed by tunneled central vein catheter and prosthetic av grafts and is least with primary av fistulas [ 2327 ] .
common factors associated with increased avf and av graft infection include prior episode of bacteremia , immunosuppression , poor personal hygiene , poor aseptic techniques during cannulation , repeated cannulations , defects in neointimal lining , nasal staphylococcus aureus carriage , diabetes mellitus , uremia , and age of fistula [ 22 , 28 ] .
blood loss due to infections of av fistulas results from vessel wall weakening leading to aneurysm formation and rupture .
utilization of antibacterial soap followed by either 70% alcohol or 10% povidone iodine has been shown to reduce the risk of infections from needle cannulations .
a study showed a slightly greater incidence of av fistula infections with the button hole technique for cannulation when compared with the rope ladder technique . recognizing and correcting the modifiable risk factors for
infection will help minimize the incidence of av fistula infection and thereby decrease the risk of access blood loss due to aneurysm rupture
first cannulation should be carried out by nurses who have great expertise [ 11 , 30 ] .
to reduce the bleeding time after needle withdrawal , all superficial av fistulas should be cannulated at an angle of 25 degrees .
there are 3 different cannulation techniques which include rope ladder , button hole , and area puncture . in the rope ladder technique ,
puncture sites are spread along the length of the vascular access , starting distally , and proceeding proximally .
the button hole technique consists of puncturing the same site , in the same direction and at the same angle and depth .
the initial few punctures are made using a sharp needle and once a tract is formed , blunt needles are used .
this technique is associated with more complications such as aneurysm formation , thinning of the skin at puncture sites , increased risk of bleeding along the needles , and longer bleeding time after needle withdrawal .
a standard part of patient teaching should be on managing interdialytic bleeding that includes compression with a clean cloth and calling the dialysis facility for instructions .
they should also be instructed to go to the emergency room or call 911 for a more severe , uncontrollable bleed .
all patients should be taught to compress a bleeding access , wash skin over access with soap and water daily and before dialysis , and also recognize signs and symptoms of infection .
all patients should know to avoid carrying heavy items draped over the access arm , avoid wearing occlusive clothing , wear protective clothing over the exposed fistula vein if working around machinery or sharp tools .
platelet biochemical abnormalities in adp and serotonin compounds along with thromboxane a2 leading to defective platelet aggregation may contribute to increased bleeding tendencies in dialysis patients [ 32 , 33 ] .
factor 8 and von willebrand factor alteration may also play a crucial role as can anemia by leading to defective platelet aggregation as demonstrated by in vitro studies [ 35 , 36 ] .
hemodialysis improves these hemostatic complications but use of heparin during dialysis may be a contributory factor to increased bleeding tendencies from dialysis access sites including petechial hemorrhages , blood blisters , ecchymosis , and hematoma .
it is unusual for acute access blood loss to occur due to an underlying coagulopathy though theoretically it may prolong bleeding from any other reason .
antiplatelet agents , such as dipyridamole and low - dose aspirin with or without sulfinpyrazone , aspirin plus clopidogrel , have been studied in an effort to decrease graft thrombosis but conflicting evidence exists in this regard and no real recommendations exist for the use of antiplatelet agents to prevent graft thrombosis [ 37 , 38 ] . in one clinical trial , role of aspirin plus clopidogrel versus double placebos was studied in preventing graft thrombosis , but the study was stopped because of a markedly increased risk of bleeding among those receiving active therapy ( hazard ratio of 1.98 , 95% ci 1.193.28 ) . at study end , dual antiplatelet therapy was not associated with a significant benefit in preventing thrombosis .
similarly , administration of warfarin does not increase graft survival and is associated with significant bleeding .
the incidence and prevalence of depression among dialysis patients is unknown but estimates vary from 20 to 50 percent . approximately one - fourth of dialysis patients are depressed at some point in time . furthermore ,
risk factors for suicide include male gender , a preexistent psychiatric diagnosis , and addiction to drugs or alcohol [ 4345 ] .
in summary , patients with esrd may lose blood from the av fistula due to a variety of reasons .
aneurysms should be considered a risk factor for acute vascular access bleeding in chronic dialysis patients and should never be cannulated .
if assessed to be at risk for rupture , a workup for associated access infection should be considered and a surgical consult for aneurysm repair initiated .
patient education is important to avoid complications of access bleeding ; patients should be taught simple techniques like putting direct pressure to minimize bleeding while seeking acute medical care .
our patient should have applied direct pressure to his av fistula and called for emergency services , thus potentially reducing the duration of his hospitalization . | little has been written about acute blood loss from hemodialysis vascular access .
we describe a 57-year - old caucasian male with an approximately 7 gm / dl drop in hemoglobin due to bleeding from a ruptured aneurysm in his right brachiocephalic arteriovenous fistula ( avf ) .
there was no evidence of fistula infection .
the patient was successfully managed by blood transfusions and insertion of a tunneled dialysis catheter for dialysis access .
later , the fistula was ligated and a new fistula was constructed in the opposite arm .
aneurysm should be considered in cases of acute vascular access bleeding in chronic dialysis patients . | 1. Introduction
2. Case
3. Discussion
4. Conclusion |
both kinetochore microtubules ( mts [ kmts ] ) and nonkmts in mitotic and meiotic bipolar spindles of higher eukaryotes exhibit poleward translocation or flux ( rogers et al . , 2005 ) .
most kmts normally extend the full length of the kinetochore fiber from their plus end attachment sites at kinetochores to minus end anchorage sites at spindle poles ( mcdonald et al . , 1992 ) .
in animal cells , the flux of kmts is coupled to minus end depolymerization at spindle poles .
this poleward flux of kmts can account for 20100% of chromosome to pole movement depending on cell type ( rogers et al . , 2005 ) .
several studies have reported that eg5 ( kinesin 5 ) is responsible for the sliding component of flux for both nonkmts and kmts ( miyamoto et al . , 2004 ; shirasu - hiza et al . , 2004 ; goshima et al . , 2005 ) .
this plus end directed kinesin cross - links antiparallel mts and slides them toward their minus ends .
because the plus ends of nonkmts overlap with each other and with kmts in the central region of a bipolar spindle , eg5 is an ideal candidate for the role of flux driver .
forces could be applied to kmts by interaction with eg5 or through lateral cross - links to adjacent fluxing nonkmts to the same pole ( margolis and wilson , 1981 ; maddox et al . , 2003 ; mitchison et al . , 2004 ; goshima et al . , 2005 ) .
( 2005 ) proposed a mechanistic model in which sliding forces generated by eg5 drive poleward mt flux and activate mt minus end depolymerization at poles .
a salient feature of this model is that pole - associated mt depolymerases ( e.g. , kinesin 13 ) sense sliding forces to regulate the depolymerization rate and spindle length . in agreement with this model
, the inhibition of klp10a ( kinesin 13 in drosophila melanogaster ) did not affect the sliding component of flux but blocked depolymerization at the poles , resulting in highly elongated metaphase spindles ( rogers et al .
egg extract spindles , perturbation of the normal localization of kif2a ( kinesin 13 ) by the disruption of dynein / dynactin blocks mt minus end disassembly at poles , but antiparallel mt sliding continues ( gaetz and kapoor , 2004 ) . here , we test whether eg5 is the dominant mechanism of kmt poleward flux in mammalian ptk1 cells using specific inhibitors of eg5 .
we assay flux in monopolar spindles that lack antiparallel mts and test two polar complex proteins for their possible role in poleward flux .
an important aspect of our studies is the use of quantitative fluorescent speckle microscopy ( fsm [ qfsm ] ) and fluorescence photoactivation techniques combined with two - color spinning disk confocal imaging to obtain much more accurate measurements for kmt poleward flux than achieved in previous studies on the roles of kinesin 5 and 13 for all spindle mts ( miaymoto et al . , 2004 ; shirasu - hiza et al . , 2004 ;
kinetochores in mammalian cultured cells exhibit directional instability ( rieder and salmon , 1998 ) , although the character of movement is usually somewhat different for individual bioriented chromosomes at the spindle equator .
those chromosomes that are positioned near the spindle axis oscillate regularly between phases of poleward and antipoleward movement .
in contrast , chromosomes aligned at the periphery of the metaphase plate show little , if any , oscillation ( khodjakov and rieder , 1996 ; cimini et al . , 2004 ) .
we found by kymograph analysis that flux rates of kmts were not significantly different for kinetochore fibers attached to oscillating and stationary chromosomes ( fig .
although we consistently detected new speckles entering the kinetochore fiber as kmts polymerized during antipoleward movement and detected the disappearance of speckles near the kinetochore as kmts depolymerized during poleward movement ( fig .
1 ) . the mean tension for stationary kinetochores as measured by the distance between sister kinetochores ( 2.6 0.2 m ; n = 30 time points for each of seven kinetochores ) was typically higher than the mean tension for oscillating sisters ( 2.36 0.52 m ;
n = 30 time points for each of six kinetochores ; centromere rest length was 1.3 0.25 m in cells lacking mts ) .
thus , the higher tensions developed at kinetochores as they stretched their centromeres during poleward movement for oscillating kinetochores had no detectable effect on the rate of kmt poleward flux in ptk1 cells , unlike what has been proposed in meiotic xenopus egg extract spindles and crane fly spermatocytes ( maddox et al .
( a ) single frame from combined time - lapse sequence of tubulin ( green ) and cenp - f labeling of kinetochores and poles ( red ; video 1 , available at http://www.jcb.org/cgi/content/full/jcb.200601075/dc1 ) .
a fast fourier transform filter set at high pass with a 20% cutoff in metamorph v4.5 was performed on the entire image sequence to help visualize fluorescent speckles above background .
black box denotes the region containing a mt kinetochore fiber , and its attached pole and kinetochore are shown in b. white box denotes the region shown in c. ( b ) montage of cropped region from the interior of the spindle containing a kinetochore fiber and its attached pole and kinetochore .
each frame is 20 s apart ; entire montage is 10 min from left to right .
dotted lines follow the position of two speckles from frame to frame whose slopes indicate the rate of flux ( 0.6 and 0.7 m / min , respectively ) .
open arrow denotes the time point at which the kinetochore is moving away from the pole and a new fluorescent speckle has incorporated into the kinetochore fiber .
closed arrow denotes the time point at which the kinetochore is moving poleward and chewing up a fluorescent speckle .
the slopes of the dotted lines indicate a rate of speckle flux of 0.62 and 0.54 m / min .
( d ) single frame of fluorescently labeled cenp - f localized at the kinetochores and poles ( same spindle as in a ) .
dotted lines show the location of the kymograph lines shown in e and g. ( e ) kymograph of sister kinetochores in the interior of the spindle .
( f and h ) kinetochore position ( color ) and pole position ( gray ) over time .
( i ) single frame of a time - lapse sequence showing a spindle imaged in fsm .
( j ) frame in i overlaid with tracks of computer - detected speckle movement ( color - coding according to the histogram in k ) .
( k ) distribution of individual speckle velocities in j. number of speckles tracked is 111 ; mean velocity is 0.70 0.22 m / min .
bars , 10 m . to improve the accuracy and statistical significance of our kmt flux measurements , we used qfsm ( danuser and waterman - storer , 2003 ) .
qfsm involves computer - vision methods to automatically detect and track speckles along kinetochore fibers ( fig .
c ; available at http://www.jcb.org/cgi/content/full/jcb.200601075/dc1 ; yang , g. , a. matov , and g. danuser .
proceedings of the institute of electrical and electronics engineers international conference on computer vision and pattern recognition .
this method yielded a mean kmt poleward flux velocity in bipolar spindles of 0.65 0.08 m / min ( n = 1,428 tracks ; supplemental material ) .
the variation of speckle velocities within a spindle was larger ( sd = 0.26 m / min ; fig .
this indicates that mt flux involves significant heterogeneity that is possibly associated with spatially and temporally varying contributions of multiple force - generation mechanisms .
1 j ) , precluding the identification of the various sources of flux from heterogeneity analysis alone .
kinetochore fibers are composed of 25 kmts and 25 nonkmts in ptk1 cells ( mcewen et al . , 1998 ) .
the half - life of kmts has been estimated to be 5 min at metaphase , whereas the half - life of nonkmts is much shorter ( 0.2 min ) because of the high dynamic instability of nonkmt plus ends and their rapid growth ( 11 m / min ) and shortening ( 20 m / min ) velocities ( zhai et al . , 1995 ; tirnauer et al . ,
the width of a kinetochore fiber ( < 0.4 m ) is not much larger than the resolution limit of the light microscope ( 0.25 m ) . as a result ,
fluorescent speckles seen at a specific site in images of kinetochore fibers contain fluorophores from adjacent nonkmts that produce fluctuation in speckle intensity that could potentially confuse automated tracking ( supplemental material ) .
tracking the movement of fluorescent marks on kmts produced by photoactivation is less sensitive to signal instability caused by nonkmt turnover .
fluorescence from nonkmts rapidly disappears after photoactivation ( supplemental material and video 2 , available at http://www.jcb.org/cgi/content/full/jcb.200601075/dc1 ) , leaving fluorescent marks on the more stable kmts in higher contrast ( mitchison , 1989 ) .
we applied fluorescence photomarking methods to ptk1 cells expressing photoactivatable ( pa ) gfp ( pa - gfp ) fused to -tubulin .
pa - gfp tubulin within spindle fibers was photoactivated by a 0.1-s pulse from a 408-nm laser focused by a cylindrical lens into a pseudo - gaussian line profile with a 1.4-m width at half - maximum intensity .
the persistent marks on kinetochore fibers in metaphase cells were seen to move poleward at a constant velocity with a mean of 0.62 0.26 m / min ( video 2 ) , which is similar to our qfsm measurements and earlier studies ( mitchison , 1989 ; zhai et al . ,
1995 ) . as reported previously ( mitchison , 1989 ; zhai et al . , 1995 ; waters et al . ,
1996 ) , the width of the mark along the fibers appeared relatively constant until it reached the ends of the kinetochore fibers at the pole , where it shortened at the velocity of poleward flux ( video 2 ) .
we simulated mark movements along the 57-m length of kinetochore fibers in metaphase spindles using the velocity distributions obtained by qfsm ( fig .
these simulations produced movements of photoactivated marks that closely approximated the experimental data and indicated that the heterogeneity of speckle velocities does not detectably widen the mark over its short travel to the pole ( supplemental material and video 3 ) .
to determine whether kmt poleward flux in ptk1 cells depends on the activity of kinesin 5 , we used several specific small - molecule inhibitors .
monastrol ( miyamoto et al . , 2004 ) , hr22c16-e1 ( hotha et al . , 2003 ) , and s - trityl - l - cysteine ( debonis et al . , 2004 ) were used at concentrations reported to substantially inhibit flux in xenopus egg extract spindles ( 100200 m monastrol ) or induce monopolar spindles in mammalian cultured cells ( 10 m hr22c16-e1 and 2 m s - trityl - l - cysteine ) .
both qfsm and photoactivation approaches revealed that the inhibition of eg5 in bipolar metaphase spindles did not abrogate kmt poleward flux , although the rate decreased by 25% ( to 0.5 0.27 m / min ; fig . 2 and see fig .
5 a , supplemental material , and videos 4 and 5 ; available at http://www.jcb.org/cgi/content/full/jcb.200601075/dc1 ) .
spindle length and the character of chromosome movement also remained normal upon kinesin 5 inhibition ( mean sister kinetochore distance = 2.16 0.23 m ; either kinetochores with 2030 time points each ; p = 0.2 , which is not significantly different from the control ) .
thus , eg5 is responsible for only a minor contribution to kmt poleward flux during metaphase in ptk1 cells .
this differs substantially from reports of kmt poleward flux and spindle length regulation in drosophila s2 cells ( goshima et al . ,
2005 ) and mt flux in meiosis ii xenopus egg extract spindles ( miyamoto et al . , 2004 ; shirasu - hiza et al . ,
( a ) single frame of fsm time - lapse sequence of the spindle in a ptk1 cell treated with monastrol ( video 4 , available at http://www.jcb.org/cgi/content/full/jcb.200601075/dc1 ) .
( b ) image in a overlaid with computer - tracked speckle trajectories ( color - coding according to histogram in c ) .
( c ) distribution of individual speckle velocities in b. number of speckles tracked is 77 ; mean velocity is 0.61 0.30 m / min .
( d ) phase - contrast image of a ptk1 cell expressing pa - gfp tubulin that was treated with monastrol .
( e ) time series of fluorescence images showing photoactivated fluorescent mark of gfp - tubulin ( video 5 ) .
time in minutes / seconds is given in the bottom right corner of each image .
although eg5 is thought to be the molecule responsible for antiparallel mt sliding , it is conceivable that other molecular motors can contribute to this mechanism .
therefore , we analyzed kmt poleward flux in monopolar spindles that do not have overlapping mts of opposite orientation .
the addition of kinesin 5 inhibitors before nuclear envelope breakdown results in the formation of monopolar spindles with unseparated centrosomes ( kapoor et al . , 2000 ) . plus ends of mts in the monopolar spindles are uniformly oriented away from the pole , as evident from time - lapse recordings of ptk1 cells expressing the gfp form of the + tip protein eb1 ( fig . 3 a and video 7 , available at http://www.jcb.org/cgi/content/full/jcb.200601075/dc1 ; tirnauer et al . , 2002 ) .
chromosomes attach to monopolar spindles via either one ( monotelic ) or both sister kinetochores ( syntelic ) and oscillate toward and away from the pole in a normal fashion ( video 6 ; tirnauer et al . , 2002 ) .
( a ) ptk1 cell expressing gfp - eb1 treated with 200 m monastrol ( video 7 , available at http://www.jcb.org/cgi/content/full/jcb.200601075/dc1 ) .
image 2 was subtracted from image 1 in metamorph software to show the direction of eb1 movement .
white mark exterior to black mark shows that mt plus ends are oriented away from the pole .
( b ) fsm frame of a ptk1 cell treated with 100 m monastrol ( video 6 ) .
( c ) frame in b overlaid with computer - tracked speckle trajectories ( color - coding according to the histogram in d ) .
( d ) distribution of individual speckle velocities in c. the number of speckles tracked is 176 ; mean velocity is 0.57 0.24 m / min .
( e ) phase image of monopolar spindle in a ptk1 cell expressing pa - gfp
( f ) time series of fluorescence images showing the photoactivated fluorescent mark of gfp - tubulin ( video 8) .
time in minutes / seconds is given in the bottom right corner of each image .
the rate of kmt poleward flux in monopole spindles measured by qfsm was 0.56 0.1 m / min ( n = 7 cells ; 792 tracks ; fig .
we also measured flux in monopoles using photoactivation of a bar of fluorescence across a monopolar spindle in between the chromosomes and the pole ( fig .
much as in bipolar spindles , photoactivated marks disappeared quickly for nonkmt fibers and persisted for fibers containing kmts .
then , the width of the mark decreased at the rate of flux ( fig .
photoactivation measurements yielded a velocity of poleward flux of 0.44 0.26 m / min ( n = 13 cells ; 17 tracks ; see fig . 5 a and supplemental material ) .
thus , when eg5 is inhibited , the velocity of flux is similar between monopolar and bipolar spindles .
this , in turn , implies that most of kmt poleward flux in mammalian spindles is not based on the sliding of antiparallel mts .
( 2005 ) reported that mt poleward flux in bipolar mitotic spindles is inhibited by sirna depletion of the depolymerase kif2a in human u2os cells .
these cells were also depleted of another depolymerase , mitotic centromere - associated kinesin , which alone did not block flux . in this study
in ptk1 cells , we found that kif2a was concentrated at the polar minus ends of kinetochore fibers from late prometaphase through anaphase , and it also localized to centromeres throughout mitosis and to centrosomes during interphase and mitosis ( fig .
microinjection of antibodies to either human or xenopus kif2a into prophase or prometaphase cells had no effect on the progression of chromosome alignment or segregation as assayed by live cell imaging ( unpublished data ) .
because sirna for kif2a is currently not possible in ptk1 , we attempted to alter kif2a localization at spindle poles by microinjecting a recombinant protein fragment ( p150_cc1 ) of the nh2-terminal coil - coiled domain of the p150 subunit of dynactin .
p150_cc1 disrupts dynein / dynactin , induces spindle lengthening , and has been shown to greatly diminish kif2a localization to spindle poles in xenopus egg extract spindles ( gaetz and kapoor , 2004 ) . in ptk1 cells , p150_cc1
microinjection altered spindle morphology , causing centrosomes to become disconnected from the ends of the spindle and minus ends of kinetochore fibers to become less focused ( fig . 4 and fig . s2 ) . nevertheless , poleward flux continued in both bipolar ( 0.70 0.08 m / min ; video 9 ) and monopolar spindles , and kif2a remained most concentrated at the minus ends of the kinetochore fibers ( fig .
4 ) . in addition , most sister chromosomes continued to oscillate as assessed by themovement of dark bars ( absence of fluorescence ) between growing and shortening sister kinetochore fiber pairs ( video 9 ) .
these results indicate that kif2a is an integral part of a complex of proteins that concentrates at the minus ends of individual , fluxing kinetochore fibers even when the minus ends of the fibers are not attached to the centrosome and are not focused together .
( b ) cells injected with p150_cc1 and rhodamine - tubulin were then fixed and stained for kif2a .
( c ) cells treated with 200 m monastrol and injected with p150_cc1 and tubulin showing the localization of kif2a ( c ) and tubulin ( c ) in the monopolar spindle .
images are the addition of two planes of a z series in which each pole is most in focus .
asterisks denote the position of the centrosome as found in other planes of the z series .
our results reveal that neither eg5 nor antiparallel mts are required for the majority of kmt poleward flux in ptk1 cells .
the velocity of flux in ptk1 cells is slow relative to flux in drosophila embryo and xenopus egg extract spindles , and there is little ( goshima et al . , 2005 ) to no ( mitchison et al . , 2004 )
these results suggest that mechanisms responsible for flux contribute differently in different systems ( e.g. , mammals vs. lower animals ) .
although polar ejection forces on chromosome arms push nonkmts poleward , they pull kinetochores and their kmts away from the pole ( rieder and salmon , 1998 ) . as a result
, polar ejection forces can not be the source of force that produce a constant rate of kmt poleward flux in monopolar spindles , particularly during kinetochore poleward movement when kinetochores pull strongly on their kmts in a direction opposite to flux . instead
, our data indicate that in ptk1 cells , the dominant mechanism of kmt poleward flux is a poleward pulling - in mechanism coupled to minus end depolymerization ( fig .
5 b ; margolis and wilson , 1981 ; sawin and mitchison , 1991 ; waters et al . , 1996 ;
however , the mechanism of dynamic attachment and pulling force generation at a depolymerizing end is not well understood .
it might involve sleeve mechanisms as envisioned by hill ( 1985 ) , rings of dash / dam proteins like those discovered in budding yeast , anchorage proteins like numa , and pulling forces generated by inside - out peeling of tubulin protofilaments at depolymerizing ends promoted by the atpase activity of depolymerases like kif2a ( salmon , 2005 ) .
our p150_cc1 data suggest that a kind of self - feeding mechanism is working in which both the depolymerase and pulling activity are in the same complex that remains at minus ends of k fibers and does not require anchorage to the centrosome or focused pole .
flux and depolymerization rates may depend critically on load , as proposed by goshima et al .
directed kinesin motor attached to the complex of proteins at the minus ends of kinetochore fibers may be critical for driving poleward flux ( sawin and mitchison , 1991 ) as well as reducing the load on the depolymerization mechanism ( thresher mechanism ) .
sensitivity of the minus end depolymerization mechanism to load would also explain how kinesin 5driven sliding forces in bipolar ptk1 spindles produce a 25% increase in the poleward flux rate of kmts .
( a ) bar graph comparing the flux rate in control , kinesin 5inhibited bipoles , and monopoles using qfsm ( black bars ) and photoactivation ( white bars ) .
( b ) model of spindle components contributing to poleward flux in bipolar and monopolar ptk1 cells . finally , we found little change in the length of bipolar spindles when eg5 was inhibited , a result typical for mitotic mammalian spindles in late prometaphase or metaphase ( kapoor et al . , 2000 ) . unlike meiosis ii spindles in xenopus egg extracts , other factors such as astral or polar ejection forces
may play a much more significant role in determining metaphase spindle length than eg5 sliding forces .
ptk1 cells were maintained in ham 's f-12 medium ( sigma - aldrich ) and were complemented with 10% fbs , antibiotics , and antimycotic ( cimini et al . , 2004 ) .
a ptk1 cell line stably expressing pa - gfp fused to -tubulin was created by selecting cells transfected with a vector that was made by removing -tubulin with bamhi and xhoi from the gfp - tubulin vector ( clontech laboratories , inc . ) and ligating it into ppa - gfp - c1 ( gift of g. patterson and j. lippincott - schwartz , national institute of child health and human development , bethesda , md ; patterson and lippincott - schwartz , 2002 ) .
tubulin ptk1 cells were selected with 1 mg / ml geneticin and maintained in ham 's f-12 as ptk1 cells except they were sometimes complemented with 15% fbs to promote the growth and health of cells .
a ptk1 cell line stably expressing gfp - eb1 was a gift of j. tirnauer ( university of connecticut health center , farmington , ct ) and was maintained in ham 's f-12 with 0.25 mg / ml geneticin .
for live cell imaging , all cells were incubated in leibovitz 's l-15 ( invitrogen ) complemented with 10% fbs , antibiotics , antimycotic , 7 mm hepes , 4.5 g / l glucose , and 0.45 u / ml oxyrase ( oxyrase ) .
ptk1 cells were coinjected with low levels of x - rhodamine labeled tubulin to fluorescently speckle mts ( waterman - storer et al . , 1998 ) and alexafluor488-labeled antibodies to cenp - f protein ( gift of d. cleveland [ university of california , san diego , san diego , ca ] and t. tafari [ national institute of environmental health sciences , research triangle park , nc ] ) to label kinetochores and spindle poles ( cimini et al . , 2004 ) .
microinjection was performed at room temperature to prevent tubulin polymerization inside the microneedle . for dynein
/ dynactin inhibition experiments , 0.2 g / ml p150_cc1 recombinant protein ( needle concentration ; gift of j. gaetz and t. kapoor , the rockefeller university , new york , ny ) was coinjected with rhodamine - labeled tubulin ( to designate which cells were injected for the immunofluorescence of kif2a or for speckle labeling of mts in live cell imaging experiments to measure flux rates ) .
some cells were injected with tubulin alone and fixed and stained for kif2a ( human antibody to kif2a was a gift of d. compton , dartmouth medical school , hanover , nh ; xenopus antibody to kif2a was a gift of r. ohi , harvard medical school , boston , ma ) to ensure that rhodamine - tubulin injection was not altering kif2a localization .
tubulin and antibody or p150_cc1 were diluted into tubulin injection buffer ( 50 mm k - glutamate and 0.5 mm mgcl2 , ph 7.0 , with koh ) and coinjected into prophase and/or early prometaphase cells .
digital images were collected with a cooled ccd camera ( orca er ; hamamatsu ) coupled to a yokogawa spinning disk confocal unit ( csu10 ; perkinelmer ) , which was attached to an inverted microscope ( te300 ; nikon [ cimini et al . , 2004 ] ) with a 100 1.4 na plan - apochromatic differential interference contrast objective .
stage temperature was maintained at 35c using an air curtain incubator ( asi 400 ; nevtek ) .
near simultaneous fluorescence images were acquired at 488 and 568 nm at a single focal plane every 520 s. for photoactivation , a 408-nm laser ( 56ics323 ; melles griot ) was focused by a cylindrical lens into a pseudo - gaussian line profile with a 1.4-m width at half - maximum intensity .
images were collected before and after a 0.1-s photoactivation through a 100 1.4 na plan - apochromatic phase objective to track chromosome and spindle location ( phase contrast ) and the photoactivated bar ( 488-nm fluorescence and 1-s exposure ) .
each frame of the fsm image sequence was aligned to the previous frame in the sequence using a correlation - maximization algorithm ( pratt , 2001 ) .
speckle detection was then performed on the aligned images as previously described ( ponti et al . , 2003 ) .
speckle tracking was formulated as a modified optimal bipartite graph linear assignment problem and was solved using the jonker - volgenant algorithm ( yang , g. , a. matov , and g. danuser .
proceedings of the institute of electrical and electronics engineers international conference on computer vision and pattern recognition .
when computing flux rates in a specific region , only those tracks that were contained completely within that region were considered .
software for image alignment , speckle detection , speckle tracking , and statistical analysis of tracking results was developed using matlab ( mathworks ) and c++ .
for photoactivation image analysis , the distance between the photoactivated mark and the closest pole was tracked and measured over the time course of the video using metamorph software ( molecular devices ) .
a graph of distance versus time was plotted , and the slope of the best - fit line was determined to be the flux rate for that mark .
online supplemental material includes methods for fluorescent speckle detection and tracking , a simulation of photoactivation , and additional analysis of flux velocity distributions in monastrol - treated cells .
s1 shows an example of speckle tracking ( a c ) and a cumulative velocity histogram comparison ( d ) .
s2 shows the localization of kif2a and the effects of p150_cc1 injection in ptk1 cells .
1 ( a c ) . video 2 shows a photoactivated mark of tubulin fluorescence moving to the pole in a control spindle .
3 . video 9 is a time lapse of p150_cc1 plus a rhodamine - tubulin
ptk1 cells were maintained in ham 's f-12 medium ( sigma - aldrich ) and were complemented with 10% fbs , antibiotics , and antimycotic ( cimini et al . , 2004 ) .
a ptk1 cell line stably expressing pa - gfp fused to -tubulin was created by selecting cells transfected with a vector that was made by removing -tubulin with bamhi and xhoi from the gfp - tubulin vector ( clontech laboratories , inc . ) and ligating it into ppa - gfp - c1 ( gift of g. patterson and j. lippincott - schwartz , national institute of child health and human development , bethesda , md ; patterson and lippincott - schwartz , 2002 ) .
tubulin ptk1 cells were selected with 1 mg / ml geneticin and maintained in ham 's f-12 as ptk1 cells except they were sometimes complemented with 15% fbs to promote the growth and health of cells .
a ptk1 cell line stably expressing gfp - eb1 was a gift of j. tirnauer ( university of connecticut health center , farmington , ct ) and was maintained in ham 's f-12 with 0.25 mg / ml geneticin .
for live cell imaging , all cells were incubated in leibovitz 's l-15 ( invitrogen ) complemented with 10% fbs , antibiotics , antimycotic , 7 mm hepes , 4.5 g / l glucose , and 0.45 u / ml oxyrase ( oxyrase ) .
ptk1 cells were coinjected with low levels of x - rhodamine labeled tubulin to fluorescently speckle mts ( waterman - storer et al . , 1998 ) and alexafluor488-labeled antibodies to cenp - f protein ( gift of d. cleveland [ university of california , san diego , san diego , ca ] and t. tafari [ national institute of environmental health sciences , research triangle park , nc ] ) to label kinetochores and spindle poles ( cimini et al . , 2004 ) .
microinjection was performed at room temperature to prevent tubulin polymerization inside the microneedle . for dynein
/ dynactin inhibition experiments , 0.2 g / ml p150_cc1 recombinant protein ( needle concentration ; gift of j. gaetz and t. kapoor , the rockefeller university , new york , ny ) was coinjected with rhodamine - labeled tubulin ( to designate which cells were injected for the immunofluorescence of kif2a or for speckle labeling of mts in live cell imaging experiments to measure flux rates ) .
some cells were injected with tubulin alone and fixed and stained for kif2a ( human antibody to kif2a was a gift of d. compton , dartmouth medical school , hanover , nh ; xenopus antibody to kif2a was a gift of r. ohi , harvard medical school , boston , ma ) to ensure that rhodamine - tubulin injection was not altering kif2a localization .
tubulin and antibody or p150_cc1 were diluted into tubulin injection buffer ( 50 mm k - glutamate and 0.5 mm mgcl2 , ph 7.0 , with koh ) and coinjected into prophase and/or early prometaphase cells .
digital images were collected with a cooled ccd camera ( orca er ; hamamatsu ) coupled to a yokogawa spinning disk confocal unit ( csu10 ; perkinelmer ) , which was attached to an inverted microscope ( te300 ; nikon [ cimini et al . ,
2004 ] ) with a 100 1.4 na plan - apochromatic differential interference contrast objective .
stage temperature was maintained at 35c using an air curtain incubator ( asi 400 ; nevtek ) .
near simultaneous fluorescence images were acquired at 488 and 568 nm at a single focal plane every 520 s. for photoactivation , a 408-nm laser ( 56ics323 ; melles griot ) was focused by a cylindrical lens into a pseudo - gaussian line profile with a 1.4-m width at half - maximum intensity .
images were collected before and after a 0.1-s photoactivation through a 100 1.4 na plan - apochromatic phase objective to track chromosome and spindle location ( phase contrast ) and the photoactivated bar ( 488-nm fluorescence and 1-s exposure ) .
each frame of the fsm image sequence was aligned to the previous frame in the sequence using a correlation - maximization algorithm ( pratt , 2001 ) .
speckle detection was then performed on the aligned images as previously described ( ponti et al . , 2003 ) .
speckle tracking was formulated as a modified optimal bipartite graph linear assignment problem and was solved using the jonker - volgenant algorithm ( yang , g. , a. matov , and g. danuser .
proceedings of the institute of electrical and electronics engineers international conference on computer vision and pattern recognition .
when computing flux rates in a specific region , only those tracks that were contained completely within that region were considered .
software for image alignment , speckle detection , speckle tracking , and statistical analysis of tracking results was developed using matlab ( mathworks ) and c++ .
for photoactivation image analysis , the distance between the photoactivated mark and the closest pole was tracked and measured over the time course of the video using metamorph software ( molecular devices ) .
a graph of distance versus time was plotted , and the slope of the best - fit line was determined to be the flux rate for that mark .
online supplemental material includes methods for fluorescent speckle detection and tracking , a simulation of photoactivation , and additional analysis of flux velocity distributions in monastrol - treated cells .
s1 shows an example of speckle tracking ( a c ) and a cumulative velocity histogram comparison ( d ) .
s2 shows the localization of kif2a and the effects of p150_cc1 injection in ptk1 cells .
1 ( a c ) . video 2 shows a photoactivated mark of tubulin fluorescence moving to the pole in a control spindle .
videos 4 and 5 correspond to fig . 2 , and videos 68 correspond to fig .
3 . video 9 is a time lapse of p150_cc1 plus a rhodamine - tubulin | forces in the spindle that align and segregate chromosomes produce a steady poleward flux of kinetochore microtubules ( mts [ kmts ] ) in higher eukaryotes . in several nonmammalian systems ,
flux is driven by the tetrameric kinesin eg5 ( kinesin 5 ) , which slides antiparallel mts toward their minus ends .
however , we find that the inhibition of kinesin 5 in mammalian cultured cells ( ptk1 ) results in only minor reduction in the rate of kmt flux from 0.7 to 0.5 m / min , the same rate measured in monopolar spindles that lack antiparallel mts .
these data reveal that the majority of poleward flux of kmts in these cells is not driven by eg5 .
instead , we favor a polar pulling - in mechanism in which a depolymerase localized at kinetochore fiber minus ends makes a major contribution to poleward flux .
one candidate , kif2a ( kinesin 13 ) , was detected at minus ends of fluxing kinetochore fibers .
kif2a remains associated with the ends of k fibers upon disruption of the spindle by dynein / dynactin inhibition , and these k fibers flux . | Introduction
Results and discussion
Materials and methods
Cell culture
Microinjection and microscopy
Speckle tracking and data analysis
Online supplemental material
Supplementary Material |
a 2-year - old boy presented to us with a reddish fleshy mass protruding from the inner side of the left eye for 8 months .
he underwent an incisional biopsy at a local dispensary 2 months ago , following which there was an increase in the size of mass , spontaneous bleeding episodes , and epiphora .
he was a diagnosed patient of classical lamellar ichthyosis and was using skin emollients . on local examination ,
a 15 mm 12 mm , strawberry - like polypoidal mass was observed in the left caruncular region [ fig .
the inferior fornix revealed multiple , gelatinous , frond - like lesions originating from both forniceal and tarsal conjunctiva , along its entire length [ fig .
the child was not cooperative for superior bulbar , palpebral , and forniceal conjunctival examination .
( a ) left eye shows reddish , strawberry - like mass in the caruncular region .
the inferior orbital sulcus appears full with blood stained matting of temporal eyelashes indicating spontaneous bleeding episodes .
( b ) on inferior conjunctival examination , florid growth of similar lesions is observed along whole length of tarsal conjunctiva with an old blood clot present medially .
( c ) inferior sulcus pressure reveals massive involvement of forniceal conjunctiva with similar lesions .
multiple pinhead - sized hemorrhages are seen on the surface a clinical diagnosis of diffuse , multifocal cp was made , and topical fortified eye drops of inf-2b ( injection zavinex , zydus cadila , india ) was started qid ( 1 million iu/1 ml ) .
the child was kept under regular weekly follow - up for 6 weeks , but there was no mass reduction .
however , the mass vascularity and spontaneous bleeding episodes reduced markedly after the topical treatment . in view of no reduction in mass size , a near - total surgical excision of the papillomas with cryo application at each site ( 2 freeze - thaw - freeze
intraoperatively , similar lesions were noted at the superior tarsal and forniceal conjunctiva [ fig .
the gelatinous exophytic masses were excised with westcott scissors , keeping its blades flush with the conjunctival surface .
after cryo application , total 1 ml ( 3 million iu ) of inf-2b was injected subconjunctivally at multiple sites [ fig . 2c and d ] .
( a ) intraoperative double eversion of upper eyelid revealed multiple foci of similar gelatinous lesions over medial tarsal and forniceal conjunctiva .
( c ) after near - total excision with westcott scissors , application of cryo ( 2 freeze - thaw - freeze cycles ) is being demonstrated .
( d ) subconjunctival injection of interferon-2b being administered at multiple foci after the cryotherapy the histopathology of excised mass revealed multiple pedunculated papillomatous figures with central core of fibrovascular tissue covered by nonkeratinizing epithelium . there was no cellular atypia , and nuclear - cytoplasmic ratio was normal , ruling out any evidence of malignancy .
postoperatively , topical 0.5% moxifloxacin ( qid ) and 1% carboxymethyl cellulose ( 2 hourly ) were prescribed along with topical fortified inf-2b ( 1 iu / ml qid ) eye drops . in the 1 postoperative week , the child had mild eyelid edema and nasal subconjunctival hemorrhage [ fig .
3a and b ] . topical steroid ointment ( hs ) was prescribed for 1 week to reduce cryotherapy - induced inflammation .
at 14-month follow - up , the child is symptom - free ( no epiphora and spontaneous bleeding episodes ) , and there are no signs of local recurrence [ fig .
( a ) early postoperative period shows diffuse medial subconjunctival blood staining with no evidence of residual papillomas over inferior conjunctiva and caruncle .
( b ) superior tarsal conjunctiva is free from the papillomas with few subconjunctival hematoma spots .
one small pinpoint hemorrhage presents temporal to plica semilunaris ( resolved in 1 week ) .
( d ) at 14-month follow - up , no recurrence of mass and the tumor epicenter appears normal .
the infs are naturally produced glycoprotein molecules in our body secondary to viral infections and tumors .
of late , these molecules have been employed with significant success in various human diseases , including cp , an uncommon ophthalmological condition . in children , due to the diffuse , multicentric nature , and inferior fornix predilection , the topical fortified inf-2b eye drops has a potential role .
this drug has shown satisfactory results in primary and recurrent cp cases . in the past , many drugs such as oral cimetidine , 5-fluorouracil , mitomycin - c , local inf-2b ( topical or injection ) , and long - acting pegifn-2b have been used in the management of primary and recurrent cp .
all these therapeutic agents mainly played the role of an adjunct to the surgical intervention than isolated therapeutic agents .
no - touch technique , excisional biopsy cryotherapy , is the surgery of choice .
surgical debulking not only provides instant relief but also reduces the viral load which is rather a difficult job for a short - acting , fortified drug such as inf-2b .
hence , it is a good option in management armamentarium of surgeon handling recurrent cases . even after these treatment modalities ,
have described specific clinical tumor details which might be helpful in monitoring the treatment response , for example , tumor epicenter location ( clockwise and quadrant wise ) , basal dimensions and thickness ( in millimeters ) , configuration , pigmentation , and vascularity ( intrinsic and feeder vessels ) . on pubmed search with keywords - ichthyosis and cp , only single case report in literature is available from year 1988 though no association has been established . in our patient with classical lamellar ichthyosis and unilateral recurrent cp , the topical inf-2b eye
drops mildly reduced the tumor vascularity which probably eliminated spontaneous bleeding but did not show any regression in tumor size .
cp showed remission after near - total surgical excision and cryotherapy along with local subconjunctival injection of inf-2b .
we postulate that the postoperative topical inf-2b eye drops prevent the dislodged viruses to establish and form a nidus at other conjunctival sites , which might lead to multifocal recurrences specifically in pediatric cp . | a 2-year - old boy presented with a recurrent strawberry - like reddish mass arising from the left caruncular region for 8 months . an incisional biopsy was performed elsewhere 2 months earlier , followed by an increase in size of mass , significant epiphora , and intermittent bleeding . on examination ,
exuberant exophytic gelatinous mass with multifocal origin was observed arising from inferior forniceal conjunctiva and caruncle .
clinical differential of multifocal conjunctival papilloma was kept , and topical interferon alfa-2b
( inf-2b ) was started .
no clinical reduction in mass or symptomatology was observed over 6 weeks .
excision biopsy with cryotherapy and subconjunctival injection of inf-2b was performed over all foci .
conjunctival papilloma was confirmed on histopathology , and topical inf-2b was continued in postoperative period for 3 months . at 14 months of follow - up , no recurrence , epiphora , or bleeding was noticed .
we advocate a possible role of local inf therapy in managing and preventing recurrences of conjunctival papillomatosis . | Case Report
Discussion
Financial support and sponsorship
Conflicts of interest |
femoral artery pseudoaneurysm following by cardiac catheterization is a serious groin complication requiring careful assessment and prompt intervention .
risk of femoral artery pseudoaneurysm is estimated at 0.6 to 17 following diagnostic and interventional procedures .
the clinical usage of bedside ultrasonography as part of the physical examination by attending emergency physicians has increased significantly over recent years .
bedside emergency department ultrasonography provides the clinician with critical information noninvasively , rapidly determining various anatomical structures .
we presented the case of a femoral artery pseudoaneurysm detected by the bedside emergency department ultrasonography secondary to angiographic catheterization .
a 51-year - old woman presented to the emergency department ( ed ) with a 2-day history of right groin pain , discoloration and swelling of the inguinal area .
six days before presentation , diagnostic angiographic catheterization was performed in her right femoral area . on physical examination ,
emergency department ultrasonography ( us ) performed at the bedside revealed a pulsating anechoic lesion communicating with the superficial femoral artery by using a 10-mhz linear probe ( fig . 1 ) .
doppler examination of the patient showed a 31 26-mm pseudoaneurysm in direct continuity with the right femoral artery ( fig .
she was surgically treated and discharged from the hospital fully recovered 10 days later .
2a and b : duplex doppler us image depicts a 31 26-mm pseudoaneurysm ( psa ) with bidirectional flow within the neck pseudoaneurysm of the superficial femoral artery .
there is an anechoic lesion communicating with the right superficial femoral artery a and b : duplex doppler us image depicts a 31 26-mm pseudoaneurysm ( psa ) with bidirectional flow within the neck
a painful mass in the femoral area should heighten the clinician s index of suspicion for a possible pseudoaneurysm .
differential diagnoses of pseudoaneurysm include abscess and hematoma formation , cyst , malignant mesenchymal tumor and lymphadenopathy , which may be the landmark of sexually transmitted infections such as lymphogranuloma venereum , gonorrhea or cancers such as lymphoma .
the diagnosis of a femoral pseudoaneurysm may be performed with invasive and noninvasive methods : color doppler us , ct angiography , magnetic resonance angiography and conventional angiography .
all of these conditions may be evaluated with bedside ed us . using b - mode imaging
, a pseudoaneurysm will usually appear as an anechoic lesion communicating with the femoral artery in the femoral area ; this mode is useful for measuring pseudoaneurysm size and compression of adjacent structures .
other advantages of ed us examination are that it is a simple , rapid , inexpensive and useful method for evaluating pseudoaneurysyms .
duplex ultrasound is the diagnostic test of choice and demonstrates a high velocity jet through a defect in the arterial wall on color flow imaging .
, us examination may be a valuable tool in the ed to perform the differential diagnosis of a superficial femoral pseudoaneurysm . | backgroundfemoral artery pseudoaneurysm following by cardiac catheterization is a serious groin complication requiring careful assessment and prompt intervention.aimsrisk of femoral artery pseudoaneurysm is estimated at 0.6 to 17 following diagnostic and interventional procedures.methodsthe clinical usage of bedside ultrasonography as part of the physical examination by attending emergency physicians has increased significantly over recent years.resultsbedside emergency department ultrasonography provides the clinician with critical information noninvasively , rapidly determining various anatomical structures.conclusionswe presented the case of a femoral artery pseudoaneurysm detected by the bedside emergency department ultrasonography secondary to angiographic catheterization . | Background
Aims
Methods
Results
Conclusions
Case report
Discussion |
hashimoto 's thyroiditis ( chronic autoimmune thyroiditis ) is the most common cause of hypothyroidism in the united states . with a 510 times preference over men ,
ht is an autoimmune disorder and is characterized by the presence of antithyroperoxidase ( anti - tpo ) antibodies .
a mixed population of lymphocytes , sometimes represented in the form of crushed lymphocytes and lymphoglandular bodies ( cytoplasmic debris ) together with the presence of hurthle cells , is characteristic cytological feature of hashimoto 's thyroiditis ( ht ) . till date ,
nowhere in the literature , a case of ht with four lobed thyroid gland has been reported , making our case an interesting and rare one .
a 40-year - old married woman came to the out - patient clinic of our institute with chief complaints of a progressively increasing swelling on the anterior aspect of the neck since last 9 months .
there was no history of any dysphagia , dyspnea , stridor , hoarseness of voice , fever or loss of weight .
on examination of the neck , there was a diffuse swelling on the anterior aspect of neck , nontender , firm , freely mobile horizontally but restricted mobility longitudinally .
ultrasonography of neck demonstrated thyromegaly with hypoechoic thyroid parenchyma and increased vascularity on color doppler imaging .
fine - needle aspiration cytology ( fnac ) of the swelling was advised which revealed features suspicious of follicular neoplasm .
contrast - enhanced computed tomography ( cect ) neck revealed diffuse enlargement of thyroid with lobulated appearance of both lobes and isthmus .
there was evidence of minimal tracheal compromise at isthmus level . however , there was no cect evidence of cervical lymphadenopathy .
serum levels of t3 , t4 , and tsh were 1.16 ng / ml ( n=0.82.0 ng / ml ) ; 6.5 milligram ( mg)/deciliter ( n=4.511.5 mg / dl ) , and 4.7 miu / l ( n=0.54.70 miu / l ) , respectively .
the patient was taken for surgery and intraoperatively , we found an unusual anatomy of thyroid gland consisting of four lobes .
the additional two lobes were on the antero - medial aspect of enlarged right and left main thyroid lobes and were completely separated from each other .
the gland was firm and was adherent posteriorly to trachea . due to the nonavailability of frozen section biopsy facility ,
histopathology of each of the four lobes showed hurthle cell changes with lymphocytic background , features suggestive of ht [ figure 2 ] .
thyroidectomy specimen showing four lobed thyroid gland with extra lobes ( 3 and 4 ) antero - medial to main ( 1 and 2 ) thyroid lobes histopathology of the thyroid specimen showing hurthle cell changes ( pink cells ) with lymphocytic background
ht is the most prevalent cause of subclinical or overt hypothyroidism in areas with sufficient iodine intake .
it has a peak incidence between the ages of 30 and 50 , and other autoimmune disorders may coexist with ht .
ht can present clinically as painless , firm diffuse goiter often accompanied by hypothyroidism and autoantibodies .
the clinical diagnosis is confirmed by low serum t4 levels , high thyroid - stimulating hormone levels , and the presence of autoantibodies to thyroglobulin and thyroid peroxidase .
it is not rare for patients with ht to have neither symptoms nor physical signs . in our case
also , the patient was asymptomatic and t3/t4 levels were within normal range with a slight increase in tsh levels ( subclinical hypothyroidism ) . if only clinical and serum findings were used to diagnose ht , the diagnosis would be missed in at least half of patients . since fnac was suspicious of follicular neoplasm , tests for autoantibodies to thyroglobulin and thyroid peroxidase were not performed in our case .
the sensitivity and specificity improve dramatically by combining ultrasound evaluation with clinical and serological assessments .
the most accurate method of diagnosing ht , however , remains biopsy and histologic study .
on sonography the gland is often diffusely enlarged , and the parenchyma is coarsened , hypoechoic , and often hypervascular .
a micronodular pattern on ultrasound is highly diagnostic of ht with a positive predictive value of 95% .
they are hypoechoic as a result of lymphocyte infiltration and have an echogenic rim . on color doppler , the thyroid parenchyma can vary from slightly hypervascular to markedly hypervascular .
in addition to the diffuse form , ht may form discrete nodules within a diffusely altered parenchyma or within a sonographically normal thyroid parenchyma ( nodular ht ) .
ours was a diffuse form of ht with two extra thyroid lobes completely separated from main lobes with increased vascularity .
such distorted anatomy of thyroid gland in a patient of ht has never been reported in the literature till date .
if we consider it as an anomaly of thyroid gland , again no literature has mentioned such an anomaly till date .
histopathology in ht shows infiltration of the thyroid by t and b cells that are reactive to thyroid antigens .
the cytotoxic t cells are largely responsible for the destruction of the thyroid parenchyma , leading to initial thyrotoxicosis followed by hypothyroidism . typical histopathologic appearance of ht includes lymphocyte aggregates with germinal centers , small thyroid follicles with sparse colloid , oxyphilic changes of epithelial cells , presence of hurthle cells and variable fibrosis . in our case , histopathology from all the four lobes showed hurthle cell changes with lymphocytic background , features suggestive of ht . | hashimoto 's thyroiditis ( ht ) , an autoimmune disorder , is the most prevalent cause of subclinical or overt hypothyroidism in areas with sufficient iodine intake .
the gland is often diffusely enlarged , and the parenchyma is coarsened , hypoechoic , and often hypervascular on ultrasonograpy .
histopathologic appearance of ht includes lymphocyte aggregates with germinal centers , small thyroid follicles , presence of hurthle cells , and variable fibrosis .
we present a case of a 40-year - old female with suspected follicular neoplasm on fine - needle aspiration cytology of neck swelling .
intraoperatively , thyroid gland was found having four lobes separated from each other .
total thyroidectomy was done and histopathology from all four lobes revealed ht .
at present , there is no literature to support the fact that such distorted thyroid anatomy may be due to the underlying disease .
if we consider it as thyroid gland anomaly , no such anomaly has been mentioned in the literature till date . | Introduction
Case Report
Discussion |
the broad range of medical images and image processing technologies , representing the integration of computer technology in presurgical planning and surgical procedures are often applied in urology .
such systems can be seen as a combination of several procedures and tools developed in order to overcome the drawbacks of invasive surgery and helps the surgeon 's orientation inside the three dimensional ( 3d ) anatomy during surgery .
partial nephrectomy ( pn ) has gained more importance in the treatment of patients with small renal masses [ 2 , 3 , 4 ] and it can be performed for selected tumors with a maximum diameter of 7 cm [ 510 ] . moreover ,
the benefits of pn are well established and include , above all , a decreased risk of long term renal insufficiency and consequently a positive impact on the quality of life [ 11 , 12 , 13 ] .
the knowledge about kidney arteries branching is very important for safe performance of varies urological procedures .
an invasive arteriography allows obtaining precise but two dimensional image ( and ) angio ct can follow the renal arteries only up to their second branches .
there is lack of strategies which enable imaging of the whole renal arterial pathway in presurgical planning .
therefore we proposed the novel self developed approach for analyzing and improving the understanding of anatomical relationships between kidney endocasts of intrarenal arteries .
examples of such structures are the blood vessel system , the airway tree of a lung , bronchial tree , nerve tissues , a lymphatic system , and the retinal vascular network , for example [ 1417 ] .
simulation studies have been frequently used to gain a better understanding of both diagnostic and therapeutic aspects of blood flow . by applying the strategy proposed in this work it is possible to generate an optimized arterial tree model tree in three dimensions .
additionally , these computerized image analysis techniques can then be applied to compute the desired features of the arterial system that are usually associated with function or pathology , and can be used in presurgical planning .
the work presents the methodology of renal arterial trees analysis that consists of the following steps .
then , the endocast is processed ( transformed ) to a numeric form using high resolution computed tomography . to perform this type of analysis ,
a pre processing step is usually required : the arteries are traced and extracted from the image , using manual or automated procedures .
additionally , the series of intersections is analyzed using our self developed image processing procedures in a matlab environment to find the contours in the ct scans , which defined the boundary of each artery .
first , the structure outline needs to be traced and segmented from the rest of the tissue or background in the image .
the arterial network is modeled as a branching tree of nonintersecting , rigid cylindrical tubes .
starting at the main renal artery ( root segment ) , the tree successively bifurcates down to the last level , where the model tree is truncated in the form of terminal segments .
the geometry of the tree is characterized by the cartesian coordinates of the endpoint of each segment together with its actual ( outer ) radius .
the three dimensional model of arterial systems is converted for further analysis to a graph tree constituting typical and convenient data structure .
in particular , we focus on structures modeled by directed rooted trees , defined as directed acyclic graphs in which there exists only one path between any two nodes .
each node has one or no parents , while the node at the top of the tree that has no parents is identified as the root of the tree . when the nodes of the tree are assigned labels , then the tree is referred to as a labeled rooted tree . in this paper
we consider tree like structures that represent the renal arterial system . in the proposed tree
finally , the full information about parameters of the renal arterial system is evaluated and preserved , i.e. diameters and lengths of individual branches and coordinates of the nodes .
further , a statistical analysis of the renal arterial tree was realized by a matlab software specifically designed for three dimensional quantitative evaluation of arterial pathways .
our experimental results demonstrate the effectiveness of the proposed method in automatically characterizing tree like structures in kidney images .
these methods can potentially provide insight to the relationship between branching topology and function or pathology .
in the work we applied the elaborated methodology and tools in evaluation of the selected , typical renal arterial system . the created data structure in the tree form was studied using software tools of descriptive statistics .
the analyses mainly relied on exploration of the branch lengths , diameters , and volume distributions throughout the tree , and its location in the space .
first the endocast was imaged using a high resolution ct and processed by various specialized procedures to form the 3d connected tubes ( figure 1 ) .
further such image was converted to the form of tree data structure ( figure 2 ) , in which the information about coordinates ( x , y and z ) of the nodes and also branch lengths and diameters was stored .
the volume of the convex hull circumscribed on the analyzed arterial tree was about 53.5 cm , while the number of analyzed branches in the presented endocast was 181 with 14 bifurcation levels .
the mean diameter of the artery in the tree root amounted to 4.58 mm , while the length
the number of branches was highest ( n = 32 ) at the 9th bifurcation level ( figure 3 ) .
plot , the detailed descriptive statistic of the branch lengths and areas at respective bifurcation levels ( the smallest observation , lower quartile , arithmetic mean , median , upper quartile , largest observation ) . it may be noticed that the mean length of the arterial branch on each bifurcation level was constant and amounted to approx .
this conclusion did not regard the second or third level , in which the length was even 18 mm .
there was also noticed a relevant dispersion of the branched areas ( rsd up to 80% at the 6 and 7 levels of the arterial tree ) .
arterial system after high resolution ct and image volume rendering processing ( the subtrees were marked with different colours ) .
distribution of arterial branches ( n = 181 ) at respective bifurcation levels . averaged segment length at respective bifurcation levels .
solid squares indicate the mean length of all vessel segments at a certain bifurcation level ; vertical bars
minimum and maximum values ; rectangles lower and upper quartiles ; horizontal line median . averaged segment area at respective bifurcation levels .
it was observed ( figure 6 ) that the sum of areas of each level increased to the 67 bifurcation and further decreased ( the number of branches of each level was lower ) .
the reason of such situation may be explained by the decreasing blood pressure and flow speed .
the highest sum of areas and volumes of the arteries was observed on the 6 level ( 55 mm , 320 mm ) .
summary evaluation of the arteries at respective bifurcation levels : a ) sum of the artery areas and b ) sum of the artery volumes .
the number of terminal branches increases up to 9 level where there are 19 terminal branches .
the mean length of terminal arteries was 7.17 mm ( changing in the range from 1 mm to 15 mm ) with standard deviation 3.67 mm .
the mean radius was 0.46 mm ( area was changing in the range from 0.5 \to 1.5 , only one 2.3 mm ) with standard deviation 0.09 mm .
also , a detailed analysis of the four main sub trees ( renal arterial segments ) was done ( figure 1 ) .
localization of the nodes in the renal space at the 6 and 7 bifurcation levels is presented in figure 8 .
for each sub tree the following parameters were evaluated and relationships between them were observed .
these were : number of branches , volume of convex hull circumscribed on each sub tree , diameter and area of the artery in the sub
the calculated values of these parameters are presented in table 1 . in the presented endocast
each sub tree consisted of 37 ( 21% ) , 78 ( 44% ) , 36 ( 20% ) , and 27 ( 15% ) branches with volume of convex hull circumscribed on each segment of 4.28 , 24.47 , 3.07 and 2.68 cm , respectively .
localization of the nodes ( only x and y coordinates from ct image ) including bifurcation for the main four sub trees : a ) 6th level and b ) 7th level .
statistics of the main four sub trees of the arterial system we found a statistically significant correlation between all pairs of considered parameters .
the value of the correlation coefficient in each case was greater than 0.89 and often was close to 0.99 .
it is very important that the main sub tree artery diameter is correlated with the number of branches ( r = 0.89 ) , volume of convex hull circumscribed on each sub tree ( r = 0.95 ) , the total length ( r = 0.93 ) , the volume of the arteries in each sub tree ( r = 0.95 ) , and the number of terminal segments ( r = 0.91 ) . additionally , after conducting calculations and analyses with novel software tools , it may be concluded that the individual artery segments occupy a separate space in the kidney volume . a similar correlation is observed when the tree was divided into more sub trees .
the anatomical relationship between the intrarenal arteries and kidney parenchyma was studied in xix century with the beginning of kidney surgery .
analyzing kidney vessel endocasts , hyrtl first discovered that the renal arterial system was divided into anterior and posterior part by the renal collecting system . in 1901 , broedel described the branching of the renal artery in a tree like pattern .
in the same study , the avascular plane between the sub tree of the renal artery was discovered . in xx century
, graves , analyzing kidney endocasts , introduced a constant pattern of intrarenal artery arrangement , which divides the kidney cortex into specific anatomical segments . the same anatomical segments are described in our study with the application of modern statistical tools .
the 3d statistical analyses provide data that can verify the previous descriptions of renal artery trees for practical implications during kidney surgery and can be applied in the preoperative planing .
our observations confirmed that the kidney can be divided into segments with a separate arterial vascularization . the presented description of the methodology and the statistical analyses results , which enabled evaluation of the arterial system of the selected kidney , are a part of the project in which the greater set of objects will be tested .
the verification of previous observations will contribute to our knowledge of the renal arterial system with in critical in precise nephrong sparing surgery procedure . | introductionthe broad range of medical images and image processing technologies are applied in urology .
the aim was to propose methodology to assess three dimensional ( 3d ) arrangement of renal arterial tree and to build a statistical model for analyzing the layout of arteries in the sections of the kidney.methodsthe series of kidney ct slices are analyzed using image processing procedures and further the 3d model of arterial systems is converted to a graph tree which includes information about features of the renal arterial system.resultsthe selected endocast was transformed to the form of the 3d connected tubes , further to the tree data structure and next analyzed .
the information about 3d coordinates of the nodes , also branch length and diameter were stored .
renal arterial system of the considered kidney possessed 181 branches with 14 bifurcation levels .
the number of branches was highest at the 9th bifurcation level .
the mean length of the arterial branch on each bifurcation level was constant ( 6 mm ) .
the branch diameters rapidly decreased after each bifurcation .
the number of terminal branches increases up to 9th level where there are 19 terminal branches .
the mean length of terminal arteries was 7.17 mm while the mean radius 0.46 mm .
a statistically significant correlation between parameters that described sub
trees was noticed . it was observed that the individual artery segments occupy a separate space in the kidney volume.conclusionsthe methodology has the potential to assist in presurgical planning based on branching patterns of the renal arterial system and corresponding pathology . | INTRODUCTION
METHODS
RESULTS
DISCUSSION
CONCLUSIONS |
glioblastoma ( gb ) is the most common and aggressive primary malignant tumor of the brain in adults in the usa .
more than 10,000 new cases of gb are diagnosed each year , and 50,000 patients have gb . from 1995 to 2007 , overall survival in the usa was 35% for 1 year and < 5% for 5 years .
treatment of gb imposes an economic burden ; patients with malignant brain tumors have been shown to accrue healthcare costs that are 20-fold greater than those of people without cancer .
standard of care for newly diagnosed patients is resection followed by a combination of radiation and temozolomide therapy . aggressive therapy in newly diagnosed patients has improved median overall survival [ 5,711 ] , but recurrence is common in almost all patients and the prognosis remains poor .
after first - line therapy of recurrent disease , standard of care is not well defined and is often patient - dependent , and options are limited [ 1214 ] .
hence , efforts are needed to define effective strategies to treat gb , particularly during recurrence . in this retrospective study
, we explore real - world treatment patterns and outcomes for gb to better understand gb treatment paradigms in the usa . in patients with
newly diagnosed gb who had received first- and second - line therapies , we wanted to describe demographics and clinical characteristics at the diagnosis , treatment patterns ( including specific agents used in lines of therapy , duration of therapy , and disease progression by line of therapy ) , incremental improvement in survival since initiation of second - line therapy , prognostic markers and symptoms , and gb - related use of healthcare resources .
better understanding of these patient characteristics and treatment outcomes may help clarify the potential contributions of new treatments for gb .
this was a retrospective , observational study in which oncologists contributed de - identified information from patient charts in clinical practice through an online data - collection form during december 2012 .
each physician had at least one gb - diagnosed adult patient who had received second - line systemic therapy . to ensure that patients were selected randomly ,
oncologists were asked to pull the chart for the first patient with a surname beginning with the designated letter .
if none of the patients whose surname began with the designated letter met the criteria for the study , oncologists continued to the next letter of the alphabet .
physicians could contribute up to five patient charts ; collection of 500 charts was intended .
patients were 18 years of age with a diagnosis of primary or secondary gb confirmed by biopsy on or after 1 january 2010 and no later than 31 december 2012 . collection of patient data was restricted to those who received first - line therapy and second - line systemic therapy and who had information collected for 3 months after initiation of second - line systemic therapy or until death .
adjuvant therapy using temozolomide after radiation therapy in combination with temozolomide was considered to be part of first - line therapy .
patients with malignant primary tumors other than glioma or astrocytoma were excluded . for the characteristics of physicians and patients , frequencies and percentages
mean , standard deviation ( sd ) , and median values were reported for continuous variables .
median time from initiation of second - line therapy to discontinuation because of disease progression or death ( accounting for censoring ) was estimated by kaplan meier analyses .
time from end of first - line to initiation of second - line therapy was described by univariate analyses ( mean , median , sd ) .
this was a retrospective , observational study in which oncologists contributed de - identified information from patient charts in clinical practice through an online data - collection form during december 2012 .
each physician had at least one gb - diagnosed adult patient who had received second - line systemic therapy . to ensure that patients were selected randomly ,
oncologists were asked to pull the chart for the first patient with a surname beginning with the designated letter .
if none of the patients whose surname began with the designated letter met the criteria for the study , oncologists continued to the next letter of the alphabet .
physicians could contribute up to five patient charts ; collection of 500 charts was intended .
patients were 18 years of age with a diagnosis of primary or secondary gb confirmed by biopsy on or after 1 january 2010 and no later than 31 december 2012 . collection of patient data was restricted to those who received first - line therapy and second - line systemic therapy and who had information collected for 3 months after initiation of second - line systemic therapy or until death .
adjuvant therapy using temozolomide after radiation therapy in combination with temozolomide was considered to be part of first - line therapy .
for the characteristics of physicians and patients , frequencies and percentages were reported for categorical variables .
mean , standard deviation ( sd ) , and median values were reported for continuous variables .
median time from initiation of second - line therapy to discontinuation because of disease progression or death ( accounting for censoring ) was estimated by kaplan meier analyses .
time from end of first - line to initiation of second - line therapy was described by univariate analyses ( mean , median , sd ) .
160 physicians with a mean ( sd ) of 20.2 ( 32.6 ) patients with gb per physician contributed to a study sample of 503 patient charts ( mean [ sd ] 3.1 [ 1.8 ] patient charts per physician ) .
physicians had a mean ( sd ) of 13.8 ( 6.7 ) years of practice .
113 ( 70.6% ) physicians specialized in general oncology and 47 ( 29.4% ) in neuro - oncology .
practices were located in the northeastern ( 33.1% ; n=53 ) , southern ( 29.4% ; n=47 ) , western ( 20.0% ; n=32 ) , and midwestern ( 17.5% ; n=28 ) regions of the usa . 75 ( 46.9% )
physicians were affiliated with teaching hospitals , and 34 ( 21.3% ) were affiliated with comprehensive cancer centers designated by the national cancer institute ( nci ) .
practice settings were : office - based separate from hospitals or foundations ( 52.5% ; 84 physicians ) , office - based owned by hospitals or foundations ( 26.3% ; n=42 ) , hospitals ( 12.5% ; n=20 ) , community settings ( 8.8% ; n=14 ) .
overall mean patient age at the diagnosis of gb was 58.4 years ( table 1 ) .
the mean charlson comorbidity index at the diagnosis ( which excluded malignancies ) was 0.65 .
hypertension was present in 32.4% of patients , depression in 13.1% , anxiety in 11.5% , and diabetes mellitus without chronic complications in 9.3% . almost all tumors ( 97.8% ) were primary gb ; 40.2% were parietal , and 29.2% were frontal .
fewer than 25% of patients were assessed for each prognostic biomarker . the o6 methylguanine dna
methyltransferase promoter was assessed in 22.5% of all patients , of whom 47.8% ( n=54 ) tested positive . the epidermal growth factor receptor ( egfr ) or egfr variant iii
was assessed in 16.3% , of whom 42.7% ( n=35 ) tested positive , and the isocitrate dehydrogenase 1 mutation was assessed in 9.7% , of whom 36.7% ( n=18 ) tested positive .
there was a mean ( sd ) of 434 ( 230 ) days of post - diagnosis follow - up .
primary surgery after the diagnosis included biopsy ( 28.2% ) and resection ( 68% ) ; 87.1% of resections ( n=298 ) excluded carmustine implants .
subsequent surgeries were conducted in 4.4% of patients ( n=22 ) , and a maximum of three surgical procedures after primary surgery occurred after the diagnosis of gb . by design , all patients received first- and second - line therapies , and of those who received active second - line therapy , only 12 ( 2.4% ) received third - line therapy . during first- and second - line therapies ,
the most common agents used for first - line treatment were temozolomide ( p.o . ;
83.9% of patients overall ) , bevacizumab ( 15.3% ) , and temozolomide ( i.v .
; 8.9% ) , and the most common second - line agents were bevacizumab ( 79.5% ) , irinotecan ( 22.5% ) , and temozolomide ( p.o . ; 5.8% ) . during first - line systemic therapy ,
patients most commonly received temozolomide ( p.o . or i.v . ) as monotherapy ( 76.5% ) or in combination with bevacizumab ( 9.9% ) ( table 2 ) .
radiographic evidence ( 43.1% ) was used to assess the response to first - line therapy more frequently than clinical assessment ( 12.9% ) , though radiographic and clinical assessments were reported for 43.9% of patients .
radiographic response in first - line patients was most often assessed using mcdonald criteria ( 77.8% ) .
partial response was the most common best response to first - line therapy in 40.8% of patients ( table 3 ) .
disease progression was the most frequently reported reason for ending first - line therapy ( 57.3% of patients who ended first - line therapy ) . during second - line therapy ,
patients most commonly received bevacizumab as monotherapy ( 58.1% ) , bevacizumab irinotecan combination therapy ( 16.3% ) , or irinotecan monotherapy ( 5.8% ) . of those physicians who prescribed bevacizumab during second - line treatment , 47.5%
were affiliated with a teaching hospital , and 21% were affiliated with an nci - designated comprehensive cancer center .
radiographic evidence was reportedly used to assess response in 41.4% of patients , whereas clinical assessment was used in 19.1% , and radiographic and clinical assessments were used in 39.5% . as in first - line therapy ,
stable response was the most common best response to second - line therapy ( 38.4% of patients ) ( table 3 ) .
median duration of second - line therapy was 130 days , median time to disease progression was 113 days , and median duration of survival was 153 days . the most frequently reported reason for ending second - line therapy was disease progression ( 28.6% ) .
sequencing of therapies in first- and second - line treatments is shown in table 2 .
63.9% during second - line therapy received bevacizumab only , and 18.2% received a bevacizumab irinotecan combination .
of those who received temozolomide and bevacizumab as first - line therapy ( 9.9% , n=50 ) , 76% received bevacizumab again in the second - line setting , most commonly as monotherapy ( 60% , n=30 ) . during first- and second - line therapies , disease- or treatment - related headaches
were reported in 65.8% of patients , neurologic / neurocognitive deficiency in 37.0% , disability in 20.1% , seizures in 20.1% , and pain in 18.9% ( figure 1 ) . during first - line treatment , most symptoms were disease - related rather than treatment - related as reported by the physician . for example , of those with physician - reported symptoms , 89.7% ( n=297 ) of headaches , 86.6% ( n=161 ) of neurologic deficits , and 96.0% ( n=97 ) of seizures were attributed to gb .
disease - related symptoms were also more common than treatment - related symptoms during second - line therapy . among the three most common symptoms ,
90.7% ( n=311 ) of headaches , 94.6% ( n=175 ) of neurologic deficits , and 95.9% ( n=117 ) of disability were attributed to gb rather than second - line therapy .
overall , the resources for supportive care used frequently during first- and second - line therapies were corticosteroids ( 83.0% of patients overall , 78.8% during first - line therapy and 62.6% during second - line therapy ) , anti - epileptics ( 50.7% , 45.8% , and 41.5% ) , narcotic opioids ( 48.9% , 45.3% , and ( 41.4% ) , proton pump inhibitors ( 47.6% , 45.2% , and 40.0% ) , and anti - depressants ( 26.4% , 21.1% , and 23.9% ) ( table 4 ) .
mean ( sd ) total dose of radiation was 50.5 ( 13.6 ) gy among patients who received radiation during first- or second - line treatments . during first - line treatment , 84.9% received radiation with a mean ( sd ) total dose of 50.8 ( 12.5 ) gy . during second - line treatment , 5.0% received radiation with a mean ( sd ) total dose of 40.2 ( 15.3 ) gy .
mri , ct , and pet were used by 85.3% , 45.5% , and 13.7% during first - line therapy and 79.5% , 32.4% , and 10.3% during second - line therapy , respectively .
inpatient hospitalizations were reported in 13.0% of patients ( 10.0% during first- and 5.0% during second - line therapies ) .
mean ( sd ) number of inpatient hospitalizations was 1.3 ( 0.7 ) per patient with a hospitalization ( 1.1 [ 0.3 ] for first- and 1.2 [ 0.4 ] for second - line therapies ) . the most frequently reported reasons for inpatient hospitalizations were gb - related treatment ( 43.3% of patients ) and management of gb symptoms ( 40.0% ) .
the emergency room was used by 44.3% ( 30.6% during first- and 27.7% during second - line therapies ) . in patients who had undergone a visit to the emergency room ,
the mean ( sd ) number of visits was 2.1 ( 1.6 ) ( 1.2 [ 0.7 ] for first- and 1.8 [ 1.3 ] for second - line therapies ) .
the most frequently reported reason for use of the emergency room was management of gb symptoms ( 52.9% ) .
160 physicians with a mean ( sd ) of 20.2 ( 32.6 ) patients with gb per physician contributed to a study sample of 503 patient charts ( mean [ sd ] 3.1 [ 1.8 ] patient charts per physician ) .
physicians had a mean ( sd ) of 13.8 ( 6.7 ) years of practice .
113 ( 70.6% ) physicians specialized in general oncology and 47 ( 29.4% ) in neuro - oncology .
practices were located in the northeastern ( 33.1% ; n=53 ) , southern ( 29.4% ; n=47 ) , western ( 20.0% ; n=32 ) , and midwestern ( 17.5% ; n=28 ) regions of the usa . 75 ( 46.9% )
physicians were affiliated with teaching hospitals , and 34 ( 21.3% ) were affiliated with comprehensive cancer centers designated by the national cancer institute ( nci ) .
practice settings were : office - based separate from hospitals or foundations ( 52.5% ; 84 physicians ) , office - based owned by hospitals or foundations ( 26.3% ; n=42 ) , hospitals ( 12.5% ; n=20 ) , community settings ( 8.8% ; n=14 ) .
overall mean patient age at the diagnosis of gb was 58.4 years ( table 1 ) .
the mean charlson comorbidity index at the diagnosis ( which excluded malignancies ) was 0.65 .
hypertension was present in 32.4% of patients , depression in 13.1% , anxiety in 11.5% , and diabetes mellitus without chronic complications in 9.3% .
almost all tumors ( 97.8% ) were primary gb ; 40.2% were parietal , and 29.2% were frontal .
fewer than 25% of patients were assessed for each prognostic biomarker . the o6 methylguanine dna
methyltransferase promoter was assessed in 22.5% of all patients , of whom 47.8% ( n=54 ) tested positive .
the epidermal growth factor receptor ( egfr ) or egfr variant iii was assessed in 16.3% , of whom 42.7% ( n=35 ) tested positive , and the isocitrate dehydrogenase 1 mutation was assessed in 9.7% , of whom 36.7% ( n=18 ) tested positive .
there was a mean ( sd ) of 434 ( 230 ) days of post - diagnosis follow - up .
primary surgery after the diagnosis included biopsy ( 28.2% ) and resection ( 68% ) ; 87.1% of resections ( n=298 ) excluded carmustine implants .
subsequent surgeries were conducted in 4.4% of patients ( n=22 ) , and a maximum of three surgical procedures after primary surgery occurred after the diagnosis of gb . by design , all patients received first- and second - line therapies , and of those who received active second - line therapy , only 12 ( 2.4% ) received third - line therapy . during first- and second - line therapies ,
the most common agents used for first - line treatment were temozolomide ( p.o . ;
83.9% of patients overall ) , bevacizumab ( 15.3% ) , and temozolomide ( i.v . ; 8.9% ) , and the most common second - line agents were bevacizumab ( 79.5% ) , irinotecan ( 22.5% ) , and temozolomide ( p.o . ; 5.8% ) .
during first - line systemic therapy , patients most commonly received temozolomide ( p.o . or i.v . ) as monotherapy ( 76.5% ) or in combination with bevacizumab ( 9.9% ) ( table 2 ) .
radiographic evidence ( 43.1% ) was used to assess the response to first - line therapy more frequently than clinical assessment ( 12.9% ) , though radiographic and clinical assessments were reported for 43.9% of patients .
radiographic response in first - line patients was most often assessed using mcdonald criteria ( 77.8% ) .
partial response was the most common best response to first - line therapy in 40.8% of patients ( table 3 ) .
disease progression was the most frequently reported reason for ending first - line therapy ( 57.3% of patients who ended first - line therapy ) .
during second - line therapy , patients most commonly received bevacizumab as monotherapy ( 58.1% ) , bevacizumab irinotecan combination therapy ( 16.3% ) , or irinotecan monotherapy ( 5.8% ) . of those physicians who prescribed bevacizumab during second - line treatment , 47.5%
were affiliated with a teaching hospital , and 21% were affiliated with an nci - designated comprehensive cancer center .
radiographic evidence was reportedly used to assess response in 41.4% of patients , whereas clinical assessment was used in 19.1% , and radiographic and clinical assessments were used in 39.5% . as in first - line therapy ,
stable response was the most common best response to second - line therapy ( 38.4% of patients ) ( table 3 ) .
median duration of second - line therapy was 130 days , median time to disease progression was 113 days , and median duration of survival was 153 days .
the most frequently reported reason for ending second - line therapy was disease progression ( 28.6% ) .
sequencing of therapies in first- and second - line treatments is shown in table 2 .
patients most commonly received temozolomide ( p.o . or i.v . ) monotherapy during first - line therapy ( n=385 ) . of these ,
63.9% during second - line therapy received bevacizumab only , and 18.2% received a bevacizumab irinotecan combination .
of those who received temozolomide and bevacizumab as first - line therapy ( 9.9% , n=50 ) , 76% received bevacizumab again in the second - line setting , most commonly as monotherapy ( 60% , n=30 ) .
during first- and second - line therapies , disease- or treatment - related headaches were reported in 65.8% of patients , neurologic / neurocognitive deficiency in 37.0% , disability in 20.1% , seizures in 20.1% , and pain in 18.9% ( figure 1 ) . during first - line treatment , most symptoms were disease - related rather than treatment - related as reported by the physician .
for example , of those with physician - reported symptoms , 89.7% ( n=297 ) of headaches , 86.6% ( n=161 ) of neurologic deficits , and 96.0% ( n=97 ) of seizures were attributed to gb .
disease - related symptoms were also more common than treatment - related symptoms during second - line therapy . among the three most common symptoms ,
90.7% ( n=311 ) of headaches , 94.6% ( n=175 ) of neurologic deficits , and 95.9% ( n=117 ) of disability were attributed to gb rather than second - line therapy .
overall , the resources for supportive care used frequently during first- and second - line therapies were corticosteroids ( 83.0% of patients overall , 78.8% during first - line therapy and 62.6% during second - line therapy ) , anti - epileptics ( 50.7% , 45.8% , and 41.5% ) , narcotic opioids ( 48.9% , 45.3% , and ( 41.4% ) , proton pump inhibitors ( 47.6% , 45.2% , and 40.0% ) , and anti - depressants ( 26.4% , 21.1% , and 23.9% ) ( table 4 ) .
mean ( sd ) total dose of radiation was 50.5 ( 13.6 ) gy among patients who received radiation during first- or second - line treatments . during first - line treatment
, 84.9% received radiation with a mean ( sd ) total dose of 50.8 ( 12.5 ) gy . during second - line treatment
, 5.0% received radiation with a mean ( sd ) total dose of 40.2 ( 15.3 ) gy .
mri , ct , and pet were used by 85.3% , 45.5% , and 13.7% during first - line therapy and 79.5% , 32.4% , and 10.3% during second - line therapy , respectively .
inpatient hospitalizations were reported in 13.0% of patients ( 10.0% during first- and 5.0% during second - line therapies ) .
mean ( sd ) number of inpatient hospitalizations was 1.3 ( 0.7 ) per patient with a hospitalization ( 1.1 [ 0.3 ] for first- and 1.2 [ 0.4 ] for second - line therapies ) . the most frequently reported reasons for inpatient hospitalizations were gb - related treatment ( 43.3% of patients ) and management of gb symptoms ( 40.0% ) .
the emergency room was used by 44.3% ( 30.6% during first- and 27.7% during second - line therapies ) . in patients who had undergone a visit to the emergency room ,
the mean ( sd ) number of visits was 2.1 ( 1.6 ) ( 1.2 [ 0.7 ] for first- and 1.8 [ 1.3 ] for second - line therapies ) .
the most frequently reported reason for use of the emergency room was management of gb symptoms ( 52.9% ) .
in patients with gb , the prognosis is poor and the likelihood of disease recurrence is high .
incremental improvements in therapy have resulted in prolonged survival , but the treatment of gb is not curative . to better understand real - world application of the paradigms of gb treatment in the usa , we described treatment patterns and outcomes in this retrospective chart - abstraction study .
national comprehensive cancer network ( nccn ) clinical practice guidelines in oncology recommend tumor resection followed by radiation and/or temozolomide chemotherapy as first - line treatment , which is the standard of care .
monotherapy ( 76.5% ) or temolozamide bevacizumab combination therapy ( 9.9% ) as first - line therapy .
this strategy was consistent with nccn guidelines and the literature [ 2,1720 ] . in a large population - based study using data on commercial claims ,
temozolomide was administered as first - line therapy in 40% of patients after surgery . in that study ,
median survival ( 529 days ) was higher in patients receiving neither temozolomide nor radiation therapy compared with temozolomide monotherapy ( 331 days ) .
the authors postulated that the high median survival of patients with neither treatment may suggest lower - grade tumors for which standard - of - care therapy ( radiation therapy with or without temozolomide ) did not seem warranted .
inclusion of bevacizumab in combination with temozolomide as first - line therapy in the present analyses may suggest increasing use of bevacizumab [ 2225 ] . in the present analyses , few patients ( < 5% ) were enrolled in clinical trials , thereby highlighting a possible trend in the use of bevacizumab for routine care . for recurrent disease , according to the nccn , reoperation should be considered first , followed by chemotherapeutic options beginning with bevacizumab ( bevacizumab with / without other chemotherapy , temozolomide , nitrosourea or combination procarbazine / lomustine / vincristine , cyclophosphamide , or platinum - based regimens ) . for only a subset of patients with recurrent disease , reoperation or repeat irradiation
thus , recommendations for second - line therapy do not represent a definitive standard of care for recurrent disease and have largely been absent in treatment paradigms , thereby highlighting a pressing unmet treatment need [ 1214 ] .
an important finding of these analyses is the use of bevacizumab in gb treatment , particularly during second - line systemic therapy ( 58.1% of patients received bevacizumab monotherapy in this setting ) .
the us food and drug administration ( fda ) provided accelerated approval of bevacizumab as a single agent for patients with gb whose disease progressed after previous first - line therapy but not in newly diagnosed patients .
since the approval of bevacizumab for gb treatment , few studies have described the specific use of bevacizumab for gb treatment outside of clinical trials .
our study confirms the common use of bevacizumab for second - line systemic therapy , suggesting a pattern of second - line treatment for gb in routine care consistent with the indicated use for bevacizumab .
treatment patterns , patient populations , and outcomes may differ depending on the site of care .
thus , it is noteworthy that approximately half of the physicians who prescribed bevacizumab during second - line treatment were affiliated with facilities that included teaching hospitals , whereas a lower percentage of physicians who prescribed bevacizumab were affiliated with nci - designated comprehensive cancer centers .
some evidence suggests that the use of bevacizumab for the treatment of progressive gb may be associated with prolonged survival .
analyses of the survival of gb patients who died before and after approval of bevacizumab by the us fda demonstrated that median survival of patients with gb improved after bevacizumab approval .
median survival for patients who died before bevacizumab approval in 2006 and 2008 was 8 months and 7 months , respectively , and median survival for patients who died after bevacizumab approval in 2010 was 9 months .
incremental advances have been observed in overall survival , but improvements have not been seen across all demographics .
improvement has been observed in patients who received the recommended multidisciplinary treatment of complete resection followed by postoperative radiation therapy .
however , evidence suggests that not all patients receive recommended treatment , which may depend on patient factors and geographic distribution of oncology services . in a study of adult patients in the usa in the surveillance , epidemiology , and
end results database , postoperative radiation therapy was less likely in older and unmarried patients , and more likely in patients in higher - income geographic areas or those with a high prevalence of radiation centers . in another study ,
radiation therapy was less likely in patients with higher age ; lower annual income ; unmarried status ; subtotal resection / biopsy ; and african american , asian american , or hispanic race . however , overall survival improved for patients who received radiation therapy .
it has been shown that a six - week delay in radiation therapy reduces median survival by 11 weeks . in the present study ,
94.8% of patients received radiation therapy after a diagnosis of gb . in the glioma outcomes project (
go project ) , which assessed patients treated in academic and community practices , only 54% of patients received chemotherapy .
resource use consistent between the go project and the present study included mri ( 92% use in go project , 85% in the present study ) and corticosteroid use ( 99% and 83% , respectively ) .
use of anti - epileptic medication was more frequent in the go project ( 88% vs 51% ) , and use of anti - depressant medication was more frequent in the present study ( 26% vs 8% in go project ) .
assessment of the frequency of inpatient hospitalizations and emergency - room visits , each 0.2 admissions per month , was consistent with that of the present study , which had 1.3 and 2.1 admissions per patient with a hospitalization or visit to an emergency room , respectively .
symptoms of headaches , neurologic deficit , seizures , disability , and pain were consistent with the literature [ 3438 ] .
some preoperative factors , such as cognitive , language , and motor deficits , have been found to be associated with a poorer prognosis .
extent of physician participation was low ( 19% ) , which could limit the generalizability of the information .
information obtained from randomly selected physicians may have been different from that obtained from physicians who did not participate , thereby potentially limiting the generalization of study results . completeness and accuracy of patient information
was dependent upon the medical history available to the physician and accuracy of the information transferred by the physician from the patient chart .
due to exclusion of patients censored in the first 3 months after initiation of second - line therapy , survival from initiation of second - line treatment was potentially underestimated , and time to progression and duration of second - line treatment might have been biased .
patients who did not progress to second - line therapy were excluded from the study , thereby limiting generalization of these results to a smaller patient population with gb .
symptomatic burden and survival represent a pressing unmet need for advanced therapies and therapeutic strategies for patients with gb , particularly during disease recurrence . in this observational study , most patients with gb received temozolomide during first - line therapy and bevacizumab ( as monotherapy or in combination with other agents ) during second - line therapy .
use of supportive care appeared to be higher in first - line therapy than in second - line therapy with the exception of anti - depressants , growth factors , and stimulants .
these analyses suggest potential trends in the treatment of patients with gb in the usa and may aid in the design of future studies to help define effective treatment options for gb . | background : glioblastoma ( gb ) treatment remains challenging because of recurrence and poorly defined treatment options after first - line therapy . to better understand real - world application of treatment paradigms and their impact on outcomes ,
we describe patterns of treatment , outcomes , and use of cancer - related healthcare resource for glioblastoma in the usa.methods:a retrospective , online chart - abstraction study was conducted ; each participating oncologist contributed 5 charts .
patients were 18 years with biopsy - confirmed primary or secondary newly diagnosed gb on or after 1 january 2010 , had received first- and second - line therapies , and had information collected for 3 months after initiation of second - line therapy or until death .
assessments were descriptive and included kaplan meier analyses from initiation to end of second - line therapy , disease progression , or death.results:one hundred sixty physicians contributed information on 503 patient charts . during first - line therapy ,
patients most commonly underwent temozolomide monotherapy ( 76.5% ) . during second - line therapy ,
patients most commonly underwent bevacizumab monotherapy ( 58.1% ) .
median duration of second - line therapy was 130 days ; median time to disease progression was 113 days .
median survival was 153 days .
use of supportive care was observed to be numerically higher in first- compared with second - line therapy except for anti - depressants , growth factors , and stimulants .
frequently used resources included corticosteroids ( 78.8% of patients in first - line and 62.6% in second - line therapies ) , anti - epileptics ( 45.8% and 41.5% ) and narcotic opioids ( 45.3% and 41.4%).conclusions : most gb patients received temozolomide during first - line therapy and bevacizumab monotherapy or combination therapy during second - line therapy .
use of supportive care appeared to be higher in first- compared with second - line therapy for some agents . | Introduction
Methods
Study design
Statistical analyses
Results
Physician characteristics
Patient characteristics
Prognostic biomarkers
Systemic therapy for GB
First-line systemic therapy
Second-line systemic therapy
Sequencing of therapy
Symptoms
Cancer-related use of healthcare resources
Discussion
Conclusions |
the hepatitis c virus ( hcv ) is a small , single - stranded , enveloped rna virus of the flaviviridae family , and can induce hepatitis c and hepatocellular carcinoma ( hcc ) and lymphomas in humans ( 1 ) .
globally , around 130150 million people have chronic hepatitis c infection ( 2 ) . as in the general population ,
the prevalence of hcv among dialysis patients varies worldwide , ranging from as low as 1% to as high as over 70% .
oyake et al . measured aortic stiffness in 94 dialysis patients prospectively observing that hcv viremia was per se associated with high pulse - wave velocimeter measurements ( 3 ) .
they suggested that hcv plays an atherogenic role through the aggravation of individual components of the metabolic syndrome ( insulin resistance , abdominal obesity , dyslipidemia , arterial hypertension , and hyperglycemia ) ( 3 , 4 ) . the precise mechanisms which connect hcv infection , chronic liver disease , and atherogenesis are still not fully understood ,
however , it is not unreasonable to assume that hcv may increase atherogenesis through a number of direct and indirect biological mechanisms ( 5 ) .
this study was done on 80 patients with chronic renal failure undergoing haemodialysis in 2016 .
the patients were divided into four groups : a control group with hcv negative by pcr ( 20 patients ) , and three hcv positive groups according to viral load by pcr : low , moderate and high viremia .
inclusion criteria were normal serum calcium ( 8.510.5 mg / dl ) , phosphorus : 5mg / dl , pth 250 pg / ml , hb :
all patients underwent thorough history taking and a clinical examination , routine laboratory investigations , kidney function tests , and serum electrolytes .
viral rna isolation was performed according to manufacturer s instructions ( qiaamp viral rna mini kit # 52904 qiagen ) . in data collection ,
the assessment of parathormone level was also performed , as well as transthoracic echocardiography and calculation of left ventricular mass index ( lvmi ) .
we performed left ventricular mass index calculation : lvmi was determined by devereux s formula ( 1 , 3 , 4 ) . ultrasonographic studies on common carotid arteries were performed using a 7.5 mhz high resolution probe .
imt was defined as a low - level echoic grey band that does not project into arterial lumen , and was measured during end diastole as the distance from leading edge of the second echogenic line of the far walls of the initial tract of the internal carotid artery on both sides .
finally , data were analyzed by statistical analysis system ( version 6.03 ) using descriptive statistics , chi square , t - test , mann - whitney u test , anova , and spearman rank correlation coefficient .
demographic features of different studied groups and the etiology of renal failure are presented in tables 1 and 2 .
the study showed no significant difference in the etiology of renal failure in different case and control groups ( p<0.09 ) ( table 2 ) . the biochemical profile in different studied groups
are also shown in table 3 . in our study , we noticed a significant increase in lvm index in hemodialysis patients with high and moderate viremia compared to low viremia ( p<0.001 ) and to control group ( p<0.001 ) ( table 4 ) . also , a significant increase in end diastolic diameter in high and moderate viremia in comparison to low viremia and the control group ( p<0.001 ) were seen .
end systolic diameter in the high viremia group significantly differs in comparison to the low , moderate viremia and the control group ( p<0.001 ) ( table 4 ) . also , interventricular septal thickness ( p<0.002 ) and posterior wall thickness ( p<0.002 ) significantly increase in moderate viremia versus low viremia and control group
. however , our data showed no significant difference in carotid intimal thickness between the studied groups .
the most significant causes of mortality in patients with eskd are cardiovascular complications , such as coronary artery disease , heart failure , left ventricular hypertrophy and arrhythmia . other well - known risk factors , such as diabetes mellitus , hypertension and dyslipidemia are prevalent in eskd , yet they are not sufficient to explain the high prevalence of cardiovascular mortality , hence searching for other hidden risk factors to explain this high prevalence is of an utmost importance . a study by omura et al .
showed that at 12 months , mice that were transgenic for the hcv - core gene , developed ventricular dilatation , cardiac dysfunction , and myocardial fibrosis , comparable to the pathological presence seen in human dilated cardiomyopathy .
although hcv can cause a number of phenotypically dissimilar cardiomyopathies , mild inflammation with mononuclear cell infiltration has also been identified with hcv infection in humans .
however , no lymphocytic infiltration was encountered in these hcv - core transgenic mice . moreover , although typical characteristics of human hypertrophic cardiomyopathy are cardiomyocyte hypertrophy and disarray of the myofibers , the wall thickness of the hcv - core mice was not increased they also discovered enhancement of the expression of atrial and brain natriuretic polypeptides , and that activator protein-1 ( ap-1 )
was activated in the heart , although , there was no activation of nuclear factor-b ( nf-b ) .
according to the authors , the activation of myocardial ap-1 by hcv - core is a vital route toward cardiomyopathic changes , although whether blocking this pathway changes the disease phenotype , has not been shown .
while in transgenic mice of hcv core protein , ap-1 is activated , ( 7 ) the latter affects the activation of ap-1 in human macrophages .
moreover , hcv core protein constrains ap-1 , and stimulates c - jun n - terminal kinase ( jnk ) , extracellular signal - regulated kinase ( erk ) , and p38 mitogen - activated protein ( map ) kinase .
the study found no changes in nf-b even though hcv core protein is known to activate nf-b,21 .
consequently , more studies are required to clarify the molecular pathogenetic changes experienced in hcv - core transgenic mice ( 8 , 9 ) .
the majority of patients develop chronic hepatitis and in later years , hepatic failure , liver cirrhosis or hepatocellular carcinoma . in the majority of patients with hcv heart disease , they develop chronic inflammation of the myocardium and , subsequently ,
however , proliferative stimuli which is induced by hcv infection , can encourage myocyte hypertrophy and hypertrophic cardiomyopathy since myocytes do not replicate ( 10 ) .
perplexing data have reported either normal or increased imt , or normal or increased prevalence of carotid artery plaques in patients with a clinical diagnosis of hcv infection compared to general population . keeping in mind the potential association between hcv infection and atherosclerotic disease
, studies have highlighted that hcv seropositivity was an independent predictor of increased coronary atherosclerosis .
a study found that g1 chc patients had higher imt compared to general population novel finding is the independent association of the presence of carotid plaques with severe hepatic fibrosis , after adjustment for age .
similarly , it was also found an independent association of imt with low platelet count , an expression of more advanced fibrosis ( 11 , 12 ) . during a previous study
, it was discovered that compared to the general population , g1 chc patients had higher imt .
the finding shows the independent association of the presence of carotid plaques with severe hepatic fibrosis , following modifications for age .
similarly , an expression of more advanced fibrosis also found an independent association of imt with low platelet count , ( 11 , 12 ) .
studies showed the presence of genomic and antigenomic hcv rna strands within carotid plaque tissues in hcv+ve patients .
also , the proinflammatory and profibrogenic environment prompting fibrogenesis in the liver of hcv - infected patients could also be systemically activated , enhancing the development of atherosclerotic lesions , explaining the higher prevalence of carotid plaques in this subgroup of chc patients .
furthermore , the profibrogenic and proinflammatory environment that prompts fibrogenesis in the liver of hcv - infected patients could also be systemically stimulated , increasing the progress of atherosclerotic lesions , which could account for the greater frequency of carotid plaques in this subgroup of chc patients .
patients with chronic hepatitis c had more hypertension , higher glycosylated hemoglobin level and a higher prevalence of metabolic syndrome .
patients with chronic hepatitis c had increased hs - crp ( high - sensitivity c - reactive protein ) , sicam-1 ( soluble intercellular adhesion molecule-1 ) , svcam-1 ( soluble vascular cell adhesion molecule-1 ) , and soluble e - selectin ( 11 , 12 ) . however
our results show no direct association between viral load and atherosclerosis , probably due to the fluctuating levels of viremia in hcv infection , also , studies found lower levels of tpai-1 ( tissue - type plasminogen activator inhibitor-1 ) , mmp9 ( matrix metallopeptidase9 ) , and mpo ( myeloperoxidase ) than their comparisons . also , those with chronic hepatitis c had less dyslipidemia ( including lower low - density lipoprotein and cholesterol / high - density lipoprotein ratio ) .
in agreement with our data , caliskan et al . , stated that hepatitis c virus infection in hemodialysis patients is not associated with insulin resistance , inflammation and atherosclerosis .
since hemodialysis patients had a large number of cardiovascular risk factors , the effect of hcv infection could not be obvious ( 7 ) . aside from renal disease patients , overall 364,712 individuals who underwent investigation for any potential association between hcv infection and cardiovascular disorders in 31 studies
have been reviewed in a systematic review , 6 out of 31 reviewed studies involving a cumulative population of 81,035 ( 22.2% ) subjects , reported a negative association between hcv infection and cardiovascular disorders .
there were 2 prospective studies , both in favor of a significant relation between hcv infection and cardiovascular disease ( 13 ) .
our study showed that hcv have a significant effect on the development of cardiovascular diseases in the general population , and in renal disease patients on the structural level .
there is not enough data available on the impact of hcv infection on development of atherosclerosis in the aorta in the general population , the only available studies are on kidney disease patients .
prospective cohort studies with more controlled conditions are needed to determine the amplitude of the problem . | introductioncardiovascular complications are the most important cause of mortality in patients with eskd , such as coronary artery disease , left ventricular hypertrophy , heart failure and arrhythmia .
other well - known risk factors , such as diabetes mellitus , hypertension and dyslipidemia are prevalent in eskd , yet they are not sufficient enough to explain the high prevalence of cardiovascular mortality , hence searching for other hidden risk factors to explain this high prevalence is of an utmost importance . the aim of this study was to identify the exact mechanisms connecting hcv infection , chronic liver disease , and atherogenesis.methodsthis case control study was done on 80 patients with chronic renal failure undergoing haemodialysis at sheikh zayed specialized hospital in giza , egypt in 2016 .
the participants were divided into four groups : a control group with hcv negative by pcr ( 20 patients ) , and three hcv positive groups according to viral load by pcr : low , moderate and high viremia .
inclusion criteria were normal serum calcium ( 8.510.5 mg / dl ) , phosphorus 5mg / dl , pth250 pg / ml , hb 1012 g / dl , and duration of dialysis less than two years .
data were analyzed using chi square , t - test , mann - whitney u test , anova , and spearman rank correlation coefficient.resultsthe study showed significant increase in lvm index in hemodialysis patients with high and moderate viremia compared to low viremia ( p<0.001 ) and to control group ( p<0.001 ) . also , significant increase in end diastolic diameter in high and moderate viremia ( p<0.001 ) , significant difference in end systolic diameter in the high viremia group ( p<0.001 ) , significant increase in the interventricular septal thickness ( p<0.002 ) and posterior wall thickness ( p<0.002 ) among moderate viremia were determined.conclusionhcv has a significant effect on the development of cardiovascular diseases in the general population , and in renal disease patients on the structural level . | 1. Introduction
2. Material and Methods
3. Results
4. Discussion
5. Conclusions |
galvanic vestibular stimulation ( gvs ) can be applied to induce the feeling of directional
virtual head motion by stimulating the vestibular organs electrically1 .
the mechanisms underlying this response are not yet
understood , although the response is commonly attributed to altered otolith output , and
based on animal studies , it seems reasonable to assume that vestibular afferents from the
otoliths and semicircular canals are similarly affected by gvs2 .
when such a stimulation transmits a signal from the anode and
cathode to the vestibular system , postural sway towards the anode occurs3 .
event - related potentials ( erps ) are voltage fluctuations that are associated in time with
some physical or mental occurrence4 .
erps
are ideal candidates for such end due to their sensitivity to cognitive processes and their
high temporal resolution .
abundant research has documented these old / new differences in
erps , but the effects of the decision criteria ( or the resulting response bias ) on the erps
recorded during the execution of recognition memory tasks have rarely been investigated5 .
lee et al.6 reported , however , that the latencies of n100 and p300 were
shortened and that their amplitudes increased in both the fp1 and fp2 areas after
transcranial direct current stimulation ( tdcs ) applications .
the p300 wave occurs only if
the subject is actively engaged in the task of detecting the targets7 .
attention may also interact with an earlier , apparently
exogenous , negative waveform , n18 .
it was reported recently that gvs had a positive influence on improving short - term
memory9 , 10 and movement - related cortical potential11 , but studies on the effects of erps related to the
cognitive function after gvs application have rarely been reported .
the present study was
conducted to examine the effects of gvs on erps in relation to a cognitive function .
the subjects of this study were 40 normal females in their 20s who had the general
characteristics listed in table 1table 1.general characteristics of the subjectsgvs group ( n=20)sham group ( n=20)age ( yrs)20.6 0.820.8 0.9height ( cm)162.8 5.0160.9 5.6weight ( kg)57.4 8.154.0 7.1 . approval for this experiment was obtained from the research ethics committee
of kwangju women s university .
the subjects were randomly divided into two groups , each
consisting of 20 women ( the gvs and sham groups ) .
the
participants were asked to assume a comfortable sitting position and to close their eyes .
before attaching a disposable adhesive electrodes ( hrtc32 , hurev , south korea ) ,
the
attachment areas were washed with an alcohol swab ; electrodes were attached in both mastoid
processes .
the anode was applied to the right mastoid process , and the cathode was applied
to the left the left .
the pulse duration was 300 ms , and the interpulse duration was 700 ms
( triangular waveform ) .
the intensity was set at 90% of the patient s sensory threshold , and
gvs was applied was 10 minutes .
after attaching the electrodes onto the same areas as in the gvs
group , the subjects in the sham group were ordered to assume a comfortable sitting position
and to close their eyes .
the equipment to examine used erps was an lxe5208 electroencephalograph ( eeg ; laxtha ,
daejeon , south korea ) .
the study participants were told not to move or talk except while
carrying out the visual stimulation tasks , which were carried out by the study participants
in a comfortable sitting position . before the measurement of the erps , the electrode
attachment areas were washed with alcohol swabs to eliminate debris so that the impedance of
the scalp would be under 5 . in the attachment areas for the eeg , an ag / agci electrode was
attached to the fp1 , fp2 , fz , cz , p3 , p4 , pz , and oz areas using the international 1020
system , the ground electrode was applied to the left mastoid process , and the reference
electrode was applied to the right mastoid process .
the sampling rate was set to 256 hz , and
eeg signals were low - pass - filtered to 50 hz . the task used for the experiment involved being
presented with 40 target stimulations ( matching images of words and pictures , such as the
word smell and a picture of a rose ) and 160 nontarget stimulations ( non - matching images of
words and pictures , such as the word sit and a picture of a saxophone ) using an oddball
paradigm , with a total of 200 target stimulations and the target stimulations being randomly
given for 2 sec . n100 and
p300 components of the erps were analyzed using telescan 2.95
( laxtha , daejeon , south korea ) .
n100 are defined as the largest negative - going peaks within a
specific latency window : 100150 ms .
p300 are defined as the largest positive - going peaks
within a specific latency window : 300500 ms .
data analysis was conducted using spss version
17.0 . repeated - measures anova was conducted to determine the differences between the time
changes in each group with regard to the measured items .
the n100 latency showed significant differences in interaction effects between time and
group only in the f3 ( f1,40=7.992 ; p=0.007 ) , f4 ( f1,40=4.581 ;
p=0.039 ) , fz ( f1,40=5.535 ; p=0.024 ) , and pz ( f1,40=7.641 ; p=0.009 )
areas ( table 2table 2.changes in erp latency ( unit : ms)areagroupn100p300prepostprepostfp1gvs119.5 13.3124.2 21.5340.0 37.6301.8 40.5sham122.9 13.5123.0 14.2324.4 39.2343.4 41.9fp2gvs117.4 14.5120.1 18.4337.9 40.7312.7 36.5sham170.9 13.6154.6 17.6322.5 27.7327.5 44.2f3gvs127.7 14.6117.3 12.8345.6 40.0332.1 45.0sham123.6 15.1122.8 17.9325.0 29.1324.0 33.3f4gvs121.9 13.2118.6 12.5327.7 37.5321.8 41.7sham122.9 12.9122.9 12.0336.5 40.0319.0 43.7fzgvs123.8 12.5116.9 12.9340.0 33.8306.3 29.8sham121.1 15.3123.7 15.3322.5 43.8314.3 43.7czgvs123.6 16.3130.0 19.2337.2 39.6323.8 32.8sham124.7 15.7123.1 15.0317.2 39.1324.5 40.2pzgvs144.3 39.7125.4 15.2337.7 38.4312.3 34.8sham125.6 17.9133.2 14.1336.7 35.2321.3 43.1ozgvs139.6 43.9127.8 16.4327.3 32.4305.3 30.5sham139.5 22.4137.2 30.0307.8 35.1308.2 37.5mean sd .
the n100 latency showed significant differences in interaction effects
between time and group only in the f3 ( f1,40=7.992 ; p=0.007 ) , f4
( f1,40=4.581 ; p=0.039 ) , fz ( f1,40=5.535 ; p=0.024 ) , and pz
( f1,40=7.641 ; p=0.009 ) areas , and the p300 latency showed significant
differences in interaction effects between time and group only in the fp1
( f1,40=21.446 ; p=0.000 ) and fp2 ( f1,40=5.251 ; p=0.028 )
areas . ) , while the p300 latency showed significant differences in interaction effects
between time and group only in the fp1 ( f1,40=21.446 ; p=0.000 ) and fp2
( f1,40=5.251 ; p=0.028 ) areas .
the n100 latency showed significant differences in interaction effects
between time and group only in the f3 ( f1,40=7.992 ; p=0.007 ) , f4
( f1,40=4.581 ; p=0.039 ) , fz ( f1,40=5.535 ; p=0.024 ) , and pz
( f1,40=7.641 ; p=0.009 ) areas , and the p300 latency showed significant
differences in interaction effects between time and group only in the fp1
( f1,40=21.446 ; p=0.000 ) and fp2 ( f1,40=5.251 ; p=0.028 )
areas .
the n100 amplitude showed significant differences in interaction effects between time and
group only in the fp2 ( f1,40=6.972 ; p=0.012 ) , fz ( f1,40=10.854 ;
p=0.002 ) , and pz ( f1,40=9.798 ; p=0.003 ) areas ( table 3table 3.changes in erp amplitude ( unit : v)areagroupn100p300prepostprepostfp1gvs2.29 1.221.70 0.692.30 0.822.70 1.11sham2.04 1.221.52 0.782.33 0.962.19 0.83fp2gvs1.94 1.031.38 0.632.19 1.042.67 1.07sham1.57 1.131.78 1.541.66 0.751.90 0.72f3gvs1.60 0.621.17 0.601.73 0.851.96 0.76sham1.48 1.531.22 0.681.44 0.731.72 0.67f4gvs1.37 0.640.90 0.471.67 0.551.88 0.78sham1.48 1.441.43 1.101.33 0.611.41 0.58fzgvs1.38 0.570.91 0.391.32 0.491.69 0.75sham1.34 1.101.60 1.111.17 0.511.38 0.48czgvs1.27 0.530.97 0.381.23 0.431.52 0.73sham1.32 1.541.10 0.871.12 0.461.22 0.57pzgvs1.45 0.631.09 0.631.30 0.891.79 0.73sham1.93 1.922.63 1.981.35 0.421.40 0.48ozgvs1.51 0.471.14 0.631.36 0.371.69 0.53sham1.55 0.801.18 0.781.35 0.491.41 0.51mean sd .
the n100 amplitude showed significant differences in interaction effects
between time and group only in the fp2 ( f1,40=6.972 ; p=0.012 ) , fz
( f1,40=10.854 ; p=0.002 ) , and pz ( f1,40=9.798 ; p=0.003 ) areas ,
and the p300 amplitude showed significant differences in interaction effects between
time and group only in the fp1 ( f1,40=6.775 ; p=0.013 ) and pz
( f1,40=8.324 ; p=0.006 ) areas . ) , while the p300 amplitude showed significant differences in interaction
effects between time and group only in the fp1 ( f1,40=6.775 ; p=0.013 ) and pz
( f1,40=8.324 ; p=0.006 ) areas .
the n100 amplitude showed significant differences in interaction effects
between time and group only in the fp2 ( f1,40=6.972 ; p=0.012 ) , fz
( f1,40=10.854 ; p=0.002 ) , and pz ( f1,40=9.798 ; p=0.003 ) areas ,
and the p300 amplitude showed significant differences in interaction effects between
time and group only in the fp1 ( f1,40=6.775 ; p=0.013 ) and pz
( f1,40=8.324 ; p=0.006 ) areas .
the n100 amplitude increased in the fp2 , fz , and pz areas after gvs stimulation , and the
n100 latency was faster in the f3 , f4 , fz , and pz areas .
the n100 component of the erp was
recorded at the occipital , parietal , central , and frontal lobes12 .
the n100 amplitude increased in the reaction time task
and the rapid response of reaction13 and
also affected the optional attention in task performance14 .
park15 reported
that the n100 latency decreased and that its amplitude increased in the fz , pz , p4 , and oz
areas after gvs application .
therefore , it was found in this study that the n100 latency
decreased and that its amplitude increased in the fz and pz areas , as in the preceding
studies , and that this was because gvs improved the optional attention in the task
performance and helped improve the decision - making ability in matching .
the p300 latency was faster in the fp1 and fp2 areas after gvs application , and the p300
amplitude increased in the fp1 and pz areas .
the p300 components were found to play a
significant role in identifying the depth of cognitive information processing , and the p300
amplitude tended to increase immediately after an experimental task , whereas the latency
decreased at that time16 .
p300
alterations obviously reflect only minor cognitive changes during normal aging17 , but park15 reported that p300 had a shorter latency and a larger amplitude
after gvs application in normal adults .
park15 suggested that gvs may affect the cognitive decision for judging
the reaction to a target stimulation after receiving the stimulation .
the prefrontal
association cortex functions include goal - oriented behavior and self - awareness , and the
parietotemporal association cortex functions include sensory integration , problem solving ,
understanding language , and comprehension of spatial relationships18 .
this study has limitations related to its use of only
women in their 20s with normal cognitive function . in this study ,
n100 activation was found in the prefrontal , frontal , and parietal areas of
the cerebral cortex after gvs application , whereas p300 activation was mainly found in the
prefrontal and parietal areas of the cerebral cortex after gvs application .
these results
suggest that gvs may play a positive role in the n100 and p300 components of the erps of the
cerebral cortex related to decision - making in matching words with images . | [ purpose ] the purpose of this study was to examine the effects of galvanic vestibular
stimulation on event - related potentials .
[ subjects and methods ] forty normal female adult
subjects were randomly distributed to a galvanic vestibular stimulation application group
( 20 subjects ) and sham group ( 20 subjects ) . for galvanic vestibular stimulation
application ,
a positive electrode was applied to the right mastoid process , and a negative
electrode was applied to the left mastoid process ; simulation was applied for 10 minutes .
a test was conducted on the n100 and p300 components of the event - related potentials
before and after galvanic vestibular stimulation .
[ results ] the n100 latency showed
statistically significant differences in interaction effects between time and group in the
f3 , f4 , fz , and pz areas .
the p300 latency showed the same results in the fp1 and fp2
areas , the n100 amplitude showed the same results in the fp2 , fz , and pz areas ; and the
p300 amplitude showed the same results in the pz area .
[ conclusion ] these results suggest
that galvanic vestibular stimulation may play a positive role in the n100 and p300
components of the event - related potentials of the cerebral cortex related to
decision - making in matching words with images . | INTRODUCTION
SUBJECTS AND METHODS
RESULTS
DISCUSSION |
in this study , somatic cell cloned embryos were successfully produced on the basis of
a previous report . briefly
, femoral
fibroblasts of an 11-year - old holstein dairy cow from koiwai farm were used as donor
cells for somatic cell cloned embryos .
two cloned holstein cows , cody 1 and cody
2 , were derived from femoral fibroblasts of the donor holstein cow with the somatic
cell cloning technique .
birth weights ( bw ) and other after - birth data of the
offspring of cody 2 and of cody 2 are shown in the pedigree charts ( fig .
birth weights ( bw ) and other after - birth data of the somatic cell cloned
holstein cow ( cody 2 ) and the offspring are shown in the pedigree
charts .
* holstein cow derived from multiple ovulations for cody 2 and
embryo transfer . * * holstein cow and calf derived from artificial
insemination ( ai ) for cody 2 . ) .
co1 was born after
multiple ovulation treatments on cody 2 and embryo transfer into recipient cows ,
whereas co2 was born through artificial insemination ( ai ) of cody 2 .
growth performance of the two somatic cell cloned
heifers did not differ from that of other cattle born within the same month , with no
specific apparent clinical abnormalities .
birth weights ( bw ) and other after - birth data of the somatic cell cloned
holstein cow ( cody 2 ) and the offspring are shown in the pedigree
charts .
* holstein cow derived from multiple ovulations for cody 2 and
embryo transfer . *
* holstein cow and calf derived from artificial
insemination ( ai ) for cody 2 .
the second generation offspring of the somatic cell clone heifers calved
successfully , with co1 producing a male japanese black crossbred calf in the first
parturition and then producing a female holstein calf via ai in the second
parturition .
reproduction and milk production data were collected from the donor cow ( first sixth
lactation ) , cody 2 ( first third lactation ) , co1 and co2 ( first second lactation ) .
milking cows from koiwai farm ( 563 cows with a mean parity of 2.6 ) were used as the
control group .
the primipara age of the month and calving intervals ( days ) were
collected as reproduction data .
the calving intervals ( days ) of the donor holstein
cow ( first sixth lactation period ) and the control group were 523 days and 427 days ,
respectively .
the reproduction performance was particularly reduced in the two
somatic cell cloned holstein heifers . for milk productivity , data for the lactation curve and transitions of monthly milk
compositions during the first lactation ( fig .
1 ) were collected on the basis of the dairy herd performance test every
month .
the milk yield ( kg ) over 305 days and milk composition rates ( fat , protein
and snf ) for each lactation period were measured ( table 1 ) .
the mean milk yield and milk composition rates ( fat , protein and snf ) of the
donor holstein cow from the first to sixth lactation periods were 11,015 kg and
3.5% , 3.2% and 8.7% , respectively , whereas they were 8,128 kg and 3.7% , 3.3% and
8.9% , respectively , for the control group . | abstract this study examined two female offspring of a somatic cell cloned holstein cow
that had reproduction problems and milk production performance issues .
the two
offspring heifers , which showed healthy appearances and normal reproductive
characteristics , calved on two separate occasions .
the mean milk yields of the
heifers in the first lactation period were 9,037 kg and 7,228 kg .
the relative
mean milk yields of these cows were 111.2% and 88.9% , respectively , when
compared with that of the control group .
no particular clinical abnormalities
were revealed in milk yields and milk composition rate [ e.g. , fat , protein and
solids - not - fat ( snf ) ] , and reproductive characteristics of the offspring of the
somatic cell cloned holstein cow suggested that the cloned offspring had normal
milk production . | Methods |
instrumented - indentation testing ( also known as nanoindentation ) has been used to investigate the mechanical properties of biological tissues such as bone [ 13 ] , dentin and enamel . in the literature , there is no single protocol to measure the material properties of mineralized tissues by instrumented indentation [ 6 , 7 ] .
results cited in the literature have been achieved using a variety of control mechanisms , force application rates , termination criteria , and analyses [ 2 , 5 , 8 , 9 ] . to what extent
while such questions remain unanswered , our ability to compare and interpret results from different studies is hindered .
therefore , the primary purpose of this work was to determine the sensitivity of indentation results to test method in order to increase the value of results reported by us and others . rather than examining every permutation of indentation method and bone type , we examined two identifiable extremes in indentation method ( quasi - static and harmonic ) for each of two extremes in bone mineralization ( young and old osteons ) .
we hypothesized no significant differences in properties as a function of indentation method but significant difference in properties as a function of mineralization .
if this hypothesis is upheld , we may conclude that it is valid to compare micron scale properties measured by most indentation methods that are commonly used today .
the organ level material properties of bone are heterogenous and depend upon age anatomical location , species and bone activity .
to span the identifiable extremes of variation in mineralization that can be apparent in bone we examined bone sections that were administered intravital bone labels .
this allowed us to distinguish newly forming , younger , incompletely mineralized labeled osteons with older , more completely mineralized unlabeled osteons , a strategy we have used successfully in the past .
indentation test methods may be broadly classified as quasi - static ( qs ) or harmonic ( csm ) , the primary difference being the means by which contact stiffness , s , is determined .
a qs method involves monotonically pressing the indenter into the test surface , holding for a dwell time , and then withdrawing the indenter .
( note : this cycle may be controlled based on either force or displacement . ) pressing the indenter into the test surface causes both elastic and plastic deformation but as the indenter is withdrawn , the material recovers elastically . for time - independent materials
the contact stiffness is determined as the relationship between force reduction and recovered displacement at the onset of withdrawal .
a csm method also involves pressing the indenter into the test surface , dwelling , and withdrawal , but superimposed upon the pressing part of the test cycle is a small oscillation in force of amplitude fo .
the amplitude of the force oscillation is controlled so that the amplitude of the resulting displacement oscillation , zo , maintains a constant value of just a few nanometers .
( as the size of the contact increases the amplitude of the force oscillation must increase in order to maintain constant amplitude for the displacement oscillation . ) generally , oscillation frequencies from 1300 hz may be used , but when testing biological materials , frequencies above 45 hz are rarely used . with a csm method ,
contact stiffness is determined continuously during the pressing part of the test cycle from the amplitude ratio , fo / zo .
this technique is described in detail elsewhere . to summarize , with a qs method ,
the contact stiffness is determined as the slope of the unloading curve ; with a csm method , the contact stiffness is determined continuously during loading from the amplitude ratio of a superimposed oscillation . the acronym
it should be noted that both the qs and csm methods may be implemented in a single indentation test , because the oscillation required for the csm method is so small that it does not interfere with the quasi - static cycle .
when both methods are implemented in a single test , the csm method is used to continuously measure contact stiffness during loading , and the qs method is used to determine a single value of contact stiffness from the unloading force - displacement data . for materials which do not manifest time - dependent
elasticity ( viscoelasticity ) , these two different techniques for measuring contact stiffness yield the same measure of indentation modulus .
this is true for most ceramic and glassy materials , but the extent to which this is true for bone has yet to be demonstrated .
once the contact stiffness , s , has been determined by either method , the analyses for calculating indentation modulus ( i m ) and indentation hardness ( h ) are the same . however , because the qs method yields only one value of s , it can yield only one value of i m and h at the maximum penetration depth , whereas the csm method yields a continuous measure of i m and h as a function of surface penetration ( or applied force ) .
regardless of how s is determined , calculations of i m and h proceed as follows .
the depth over which the test material makes contact with the indenter , hc , is calculated as :
( 1)hc = h0.75ps ,
where h is the indenter displacement as measured from the point of initial contact , p is the applied force , and s is the contact stiffness .
the contact depth , hc , is less than the total depth , h , because the material around the indenter deflects downward elastically . for a berkovich indenter ,
the contact area , a , is calculated as
( 2)a ~ 24.56hc2 .
this expression for a is approximate because the real expression is slightly different for every physical diamond .
the exact form of the expression for a is determined by indenting a material with known modulus .
the reduced modulus , er , includes bidirectional displacements in both the indenter and the test sample , and is calculated as
( 3)er=2sa .
and the indentation elastic modulus ( i m ) of the sample is calculated from the reduced modulus as
( 4)ime=(12)[1er1i2ei]1 ,
where is the poisson 's ratio of the test sample , and i and ei are the poisson 's ratio and elastic modulus of the indenter , respectively . if the indenter is diamond , then i and ei are 0.07 and 1140 gpa , respectively . although the calculation of i m requires knowing the poisson 's ratio of the sample ( ) , the sensitivity is weak .
sensitivity analysis reveals that a generous uncertainty of 40% in the poisson 's ratio manifests as only a 5% uncertainty in i m .
for all the results reported in this work , a value of 0.3 was used for . finally , indentation hardness ( h ) is calculated as
louis , mo ) bone labels ( 5 mg / kg body weight ) were administered intravenously to five skeletally mature ( 1 - 2 years ) male beagle dogs .
the labels were given two weeks apart , that is , 17 days and 3 days prior to euthansia .
the femurs were harvested immediately after euthanasia and frozen in saline soaked gauze at 20c for a brief storage period .
two ~3 mm mid femoral bone slices were obtained from each dog . the method for sample preparation and osteon identification and localization
briefly , just prior to mechanical testing , the femurs were thawed and approximately 3 mm thick bone slices were obtained from the mid - diaphyseal region of the femur on a band saw .
the femoral cross sections were examined under an epifluorescent microscope ( olympus bx 51 , tokyo , japan ) to confirm the presence of labeled osteons in that bone slice being examined . among the labeled osteons we chose those that were approximately half way or greater in their bone formation cycle .
the selected femoral bone surfaces were then lightly polished [ 2 , 8 ] , and care was taken to prevent overpolishing of the specimens [ 16 , 17 ] .
this is very important in this study and thus we describe the standard polishing procedure used in our laboratory .
the bone block was glued into a well of a custom - made polycarbonate specimen holder .
the sectioned specimens were wet - polished on a rotary wheel ( ecomet , buehler , lake bluff , il ) at 120 rpm with 2,400 grit sic papers .
additional polishing was done on a napless cloth ( op - chem , struers a / s , rodovre , denmark ) with diluted 0.3 m and 0.05 m alumina oxide pastes ( micropolish c alpha alumina , buehler , lake bluff , il ) .
the polishing was restricted to the minimum time to allow for examination of the detailed morphological features ( e.g. , lamellae , cement lines ) of the cortical bone ; after polishing , surface roughness was less than 30 nm .
next , we identified and mapped the coordinates of the labeled and unlabeled osteons under an epifluorescent microscope .
this was essential as labeled osteons can not be identified under the optics of the indenter system .
multiple perpendicular lines ( figure 1 ) were scribed into the surface of the polished bone specimen with a surgical blade . the exact location ( x
, y coordinates ) of the central haversian canal of the labeled osteon relative to two orthogonal scribe lines was measured in microns using a linear microscope eyepiece of the epifluorescent microscope .
in addition , photomicrographs aided in documenting the unique cross sectional morphology of each labeled osteon site and its neighboring osteons and other structures such as blood vessels . after the bone slice was mounted in the indenter ( nano indenter xp , agilent technologies , inc . , oak ridge , tn ) , the photographic map produced from the epifluorescent microscope was referenced .
a specific labeled osteon was located using the intersection of nearest two perpendicular lines from the osteon ( figure 1 ) .
the indenter optics were moved to the intersection of the two perpendicular lines and x , y coordinates to the center of the labeled osteon in microns were entered into the software .
the sample was then translated to present the desired test location to the indenter optics .
the photographic map confirmed the specific osteon of interest and a neighboring unlabeled osteon ( figure 2 ) .
the above described procedure was repeated to locate additional labeled and unlabeled osteons on the bone slice ( figure 2 ) .
each location was flagged into the computer with one set of coordinates for each labeled osteon .
after all osteons that we desired to examine were located , we then programmed the software to place indents on the bone of the osteons .
the indents were located approximately half the distance between the reversal cement line and the central canal for all the osteons .
this is because each osteon does not have the same dimension in each cross section and osteons were sampled at different times during their formation phase .
after identification of all the labeled and unlabeled osteons the hydration system was turned on .
a hydration fluid containing a mixture of distilled water and 0.5 mg / ml of gentamicin sulphate ( sigma chemical company , st .
a total of 147 osteons ( labeled = 35 ; unlabeled = 112 ) were measured .
proper functioning of the indentation tester was verified by testing fused silica prior to testing bone .
some tests ( < 5% ) did not commence due to inability of the machine to detect contact , and occasionally , the target depth was exceeded ( e.g. , greater than 530 nm ) and such tests were eliminated .
a total of 610 indents were made on the 35 labeled osteons and 112 nonlabeled osteons .
quasi - static method ( qs)each indentation test comprised the following segments .(0)the indenter approaches the test surface until contact is sensed.(1)the indenter is pressed into contact with the test material at a rate of 10 nm / sec to a peak depth of 500 nm.(2)the force on the indenter is held constant for a dwell time of 30 seconds.(3)the indenter is withdrawn from the sample completely , and the sample is moved into position for the next test.a single value of contact stiffness is calculated from the slope of the unloading curve as explained in the introduction . i m and h are calculated from this single value of s.
each indentation test comprised the following segments .(0)the indenter approaches the test surface until contact is sensed.(1)the indenter is pressed into contact with the test material at a rate of 10 nm / sec to a peak depth of 500 nm.(2)the force on the indenter is held constant for a dwell time of 30 seconds.(3)the indenter is withdrawn from the sample completely , and the sample is moved into position for the next test.a single value of contact stiffness is calculated from the slope of the unloading curve as explained in the introduction .
i m and h are calculated from this single value of s. the indenter approaches the test surface until contact is sensed . the indenter is pressed into contact with the test material at a rate of 10 nm / sec to a peak depth of 500 nm .
the force on the indenter is held constant for a dwell time of 30 seconds .
the indenter is withdrawn from the sample completely , and the sample is moved into position for the next test .
harmonic method ( csm)superimposed upon the quasi - static loading segment ( 1 ) was a small oscillating force at 45 hz .
the amplitude of the oscillating force , fo , was continuously adjusted in order to maintain the amplitude of the resulting displacement oscillation at zo = 2 nm .
i m and h were calculated using this continuous measure of s. for the purpose of comparing with qs results , csm results for i m and h were taken at the maximum displacement of 500 nm .
superimposed upon the quasi - static loading segment ( 1 ) was a small oscillating force at 45 hz .
the amplitude of the oscillating force , fo , was continuously adjusted in order to maintain the amplitude of the resulting displacement oscillation at zo = 2 nm .
i m and h were calculated using this continuous measure of s. for the purpose of comparing with qs results , csm results for i m and h were taken at the maximum displacement of 500 nm .
the independent variables were osteonal type ( labeled , unlabeled ) or the method ( qs , csm ) . the repeated factor was dog .
data for depth analyses for the csm method were analyzed by a repeated measures , factorial analyses of variance with depth and type of osteon ( labeled , unlabeled ) as two factors and dog as the repeated factor .
the mean ( sd ) of i m ( figure 3 ) and h ( figure 4 ) for labeled osteons obtained by the two indentation methods were as follows : qs i m = 15.3 gpa ( 3.85 ) versus csm i m = 14.7 gpa ( 3.58 ) ; p = .52 , and qs h = .387 gpa ( .171 ) versus csm h = .422 gpa ( .146 ) ; p = .32 .
the mean ( sd ) of i m ( figure 3 ) and h ( figure 4 ) for unlabeled osteons were as follows : qs i m = 21.5 gpa ( 2.80 ) versus csm i m = 20.6 gpa ( 2.53 ) ; p = .054 , and qs h = .639 gpa ( .117 ) versus csm h = .700 gpa ( .120 ) ; p = .017 .
no difference in i m existed between the two methods for either type of bone , but statistically significant differences were found for h between methods for unlabeled osteons .
csm hardness values were 9% and 8% higher then qs hardness values for unlabeled and labeled osteons , respectively . anova showed significant
the csm method allows the determination of properties as a function of depth . however , there was no statistically significant difference for the i m with depth ( p = .06 ) and there was no ( p = .21 ) depth / type of osteon interaction ( figure 5 ) . with the csm method ,
i m ( sd ) for the labeled osteons increased from 13.2 ( 3.9 ) gpa at 100 nm to 14.76 ( 4.12 ) gpa at 500 nm depth ( figure 5 ) .
however , i m ( sd ) for the unlabeled osteons only increased from 20.51 ( 5.5 ) gpa at 100 nm to 20.57 ( 3.5 ) gpa at 500 nm .
although the primary focus of this study was test method , we have confirmed previous data which showed i m and h of unlabeled osteons to be greater than labeled osteons by approximately 30% . since the primary focus of this study was determining the sensitivity of measured properties to test method , it was critical that the qs and csm methods be implemented together in a single test . implementing the methods
simultaneously eliminated variables of test condition that can influence results , including tip wear , temperature , test site , and degree of tissue degradation .
for example , if all the qs tests were performed in one batch , and all the csm tests were performed in a later batch , and different results were obtained ( for like materials ) from the two batches , questions would remain as to whether the differences were due to variations in test method ( qs or csm ) or test condition . by eliminating variables of test condition
, we are able to attribute any observed property differences ( for like materials ) to test method and fundamental material behavior . although we found statistically significant differences in the properties of labeled and unlabeled bone , we found no significant difference in the i m by method . from this observation
, we deduce that at the resolution of testing , bone tissue does not exhibit significant viscoelastic behavior , that is , the elastic strain response to stress occurs instantaneously .
this conclusion , though far - reaching , is warranted by the breadth of this study .
the labeled and unlabeled osteons represent identifiable low and high degrees of mineralization in bone , respectively .
the fact that the qs and csm methods yielded statistically equal measures of i m for osteons at opposite ends of the identifiable spectrum of mineralization causes us to include various levels of physiologic mineralization of bone in this conclusion .
the qs method quantifies long - time ( 10 seconds ) response , and the csm method quantifies short - time ( 0.022 second ) response . the fact that these two methods yielded no statistically significant difference in i m causes us to include all physiologically interesting frequencies in this conclusion .
bone may well be viscoelastic at an organ level [ 1921 ] . at an organ level , blood vessels , lacunae , fluid - filled channels / canaliculi , and the larger volume of collagen matrix
however , dynamic testing of a whole femur from a 65-year - old female subject revealed only slight viscoelasticity ; the loss modulus was about 5% of the young 's modulus , and the young 's modulus was nearly independent of frequency .
we should expect even less viscoelasticity at the scale of the test within the individual osteons .
thus , our conclusion is not so surprising , as the imprint diameter of a 500-nm indentation test is approximately 4 - 5 microns .
the conclusion that bone tissue does not demonstrate significant viscoelasticity at this scale is relevant , because a frequent critique to testing bone by indentation is that analytic models for interpreting indentation data might not properly account for viscoelastic behavior .
whether or not such a critique is generally valid , the present study reveals that it is irrelevant for bone tissue at the scale of testing undertaken in this study . at this point , it is important to note that our tests were conducted under moist conditions for the entire test period , by means of a custom hydration system [ 12 , 23 ] .
we believed that it was important to conduct tests in this way so as not to artificially mitigate viscoelasticity .
although the two test methods yielded no significant difference in i m , the two test methods did yield slightly but significantly different measures of h for the unlabeled ( old ) osteons . for the unlabeled osteons ,
the h obtained by the csm method was 9% greater than that obtained by the qs method .
( although the same trend was observed for the labeled osteons , the difference was not quite large enough to be considered statistically significant . )
logistically , this can be explained by the fact that during the 30-second hold segment ( 2 ) , the indenter penetration continued to increase , even while the force on the indenter was held constant .
hardness ( h ) is calculated as load divided by area ( p / a ) .
the csm value of h was obtained immediately prior to the hold segment , while the qs value of h was obtained after the hold segment . over the course of the hold segment , applied load ( p ) remained constant , but the contact area increased , so the qs method returned a lower value of hardness .
but what is the underlying cause of this relaxation ? because we provide evidence suggesting the lack of significant viscoelasticity , we must conclude that it is due to viscoplasticity .
the plastic ( or nonrecoverable ) strain response to stress does not occur instantaneously , but rather , over a period of time .
in other words , bone tissue does creep , and this tendency is potentially greater in older bone .
our findings are in agreement with another indentation study of osteonal bone , in which authors found that the dominant time - dependent deformation mechanism for bone was viscoplasticity .
our protocol has been to make indents to a maximum depth of 500 nm , as this mitigates the consequences of surfaces roughness , which is 30 nm or less .
however , the csm method returns properties as a continuous function of indentation depth . for the labeled osteons , the value of i m at 500 nm was 6% higher than the value measured at 100 nm
; however , this difference is not large enough to be statistically significant and may have biologic implications . for the unlabeled osteons
, there was no perceptible trend in i m with depth ; values measured at 100 nm were equal to those measured at 500 nm .
this lack of depth dependence causes us to conclude that architectural features of bone as small as ~1 micron wide could be tested with indentations as small as 100 nm .
therefore , we may conclude that virtually any indentation method commonly used today will return the same value for i m for the same material under the same test conditions .
however , because bone tissue at this scale does exhibit viscoplasticity , hardness measurements will be sensitive to test method .
hardness measurements should be compared only if they have been determined by the same method .
bone at the scale of testing described in this study , does not exhibit significant viscoelastic behavior . at this scale of testing ,
i m values determined by different test methods are comparable , so long as test conditions are similar .
h values should not be directly compared unless they have been measured by the same method .
determining the material properties of biologic tissues such as bone , enamel , dentin and cementum is challenging . in this paper
we present data and compare two techniques for testing the material properties at the scale of individual osteons .
such spatially resolved testing may eventually allow us to understand the relationship between structure and function of organic and inorganic phases of mineralized tissues . | the purpose of the study was to compare quasi - static ( qs ) and harmonic ( csm ) methods of indentation testing .
bone sections were obtained from mid - femoral diaphyses of dogs which received a pair of calcein labels . labeled ( n = 35 ) and unlabeled ( n = 112 ) osteons were identified .
indentation modulus ( i m ) and hardness ( h ) for the csm method were collected during the entire loading cycle to peak depth , while i m and h for qs method were calculated at a peak depth of 500 nm .
results : the mean ( sd ) of the i m and h for labeled osteons were as follows : qs i m = 15.3 gpa ( 3.85 ) versus csm i m = 14.7 gpa ( 3.58 ) ; p = .52 and qs h = .39 gpa ( .171 ) versus csm h = .42 gpa ( .146 ) ; p = .32 .
the mean ( sd ) of the i m and h for unlabeled osteons were as follows : qs i m = 21.5 gpa ( 2.80 ) versus csm i m = 20.6 gpa ( 2.53 ) ; p = .054 and qs h = .64 gpa ( .117 ) versus csm h = .70 gpa ( .120 ) ; p = .017 .
there was no difference in i m and h for the two methods , except for h of the unlabeled osteons .
in addition , for the csm method , i m at 100 nm , 200 nm , 300 nm , 400 nm and 500 nm were not statistically significant different ( p = .06 ) .
bone is viscoelastic at an organ level .
however , this component of its behavior was not detected at the length scale examined . | 1. Introduction
2. Materials and Methods
3. Results
4. Discussion
5. Conclusion |
the extent to which hcv infection is associated with sexual exposure has been debated extensively . the 2008 egyptian demographic and health survey estimated that 15% of people aged 1559 years in egypt have anti - hcv antibodies and 10% have chronic hcv infection .
however , this high figure is related to past transmission events and is not representative of the hcv transmission occurring in egypt . sexual transmission of hcv may contribute to the total burden of infection in egypt .
the objectives of this study were to detect the risk for sexual transmission of hcv infection from chronically infected subjects to their long - term monogamous heterosexual partners ( 50 spouses ) and to identify various sexual practices associated with that risk .
spouses were carefully selected to exclude risk factors and participants were hbv ( hbsag , hbcab , and hbsab ) and hiv antibody negative .
all participants were tested for liver enzymes , hcv specific antibodies ( ortho clinical diagnostics , new jersey , usa ) , and hcv rna assay with real - time pcr using qiagen extraction kit and brilliant hcv qrt - pcr for stratagene 's mx3000p .
five spouses showed evidence of hcv infection , two were positive for hcv antibody alone ( 4% ) and three were positive for hcv antibody and hcv pcr ( 6% ) .
no association was found between the hcv infection status and various selected risk factors such as sex , age , duration of marriage , frequency of sexual intercourse , history of sexually transmitted diseases , and other risk factors for hcv .
the only association detected was the age category where both positivity of hcv antibody and hcv pcr were associated with the older age category ( > 60 y ) .
as regards the direction of transmission , an insignificant difference between male and female spouses of chronic hcv-4 infected patients was detected . in this
study the prevalence of hcv in the heterosexual spoused is 10% which may seem to be lower than the general population .
however , our patient population was carefully selected so that sexual intercourse would be the major risk factor .
one possible explanation is that a higher cell - mediated immune response against hcv in repeatedly exposed sexual partners would partially protect them against infection .
the detection of hcv - specific cellular immune responses in seronegative sexual partners of hcv patients has been documented [ 2 , 3 ] .
an important limitation is failure to analyze the sequence of nucleotides of the hcv genome .
the detection of homology in the nucleotide sequences would have been a strong evidence of a common source of infection but it would not clarify the direction of the infection , nor the responsible risk factors . the major limitation of our study may be the relatively small number of participants .
our study results raise the possibility that hcv is sexually transmitted between spouses in egypt .
this confirms the need to screen all people in the so - called high risk groups for hcv infection .
due to the ongoing high incidence of hcv in egypt , further research is needed to identify the exact routes of transmission and the associated risk factors so that preventive measures can be instituted . | we screened for evidence of hcv infection in healthy heterologous monogamous spouses of chronic hcv patients and studied the relation with various risk factors .
a cross - sectional study of fifty healthy monogamous heterosexual spouses of hcv - positive index cases was carried out .
all participants were hbv and hiv negative .
the association with various risk factors was studied .
five spouses ( 10% ) showed evidence of hcv infection .
two partners were positive for hcv antibody alone ( 4% ) and 3 for antibody and hcv pcr ( 6% ) .
no association was found between hcv infection and various sociodemographic parameters with the exception of older age categories .
intraspousal transmission of hcv may be an important source of spread of hcv infection .
the reservoir of hcv - infected individuals in egypt is sizable , and sexual transmission of hcv may contribute to the total burden of infection in egypt . | 1. Introduction
2. Conclusion |
the tryptophan ( trp ) degradation pathways can be divided into four pathways as follows : serotonin , kynurenine , glutarate , and niacin pathways ( fig .
many biologically important compounds such as serotonin , melatonin , kynurenine , kynurenic acid ( ka ) , quinolinic acid ( qa ) , and niacin are synthesized from trp . of these pathways , we are interested in the conversion pathway of trp to niacin .
this is because a deficiency of trp and a metabolic disorder of trp is pellagra , which is cured by administration of niacin .
we have previously reported that the conversion percentage of niacin from trp is around 2% in molar ratio , the rate - limiting enzyme is quinolinic acid phosphoribosyltransferase ( qprt ) , and this pathway mainly exists in the liver , while nonhepatic tissues are not associated with this conversion pathway.120 however , our recent findings21,22 have revealed that the latter is incorrect . the urine total amount of nicotinamide ( nam ) and its catabolites , such as n - methylnicotinamide ( mna ) , n - methyl-2-pyridone-5-carboxamide ( 2-py ) , and n - methyl-4-pyridone-3-carboxamide ( 4-py ) , reflects the formation of niacin - active compounds .
we investigated the relationships between the urine total amount of nam and its catabolites and other urine trp catabolites such as anthranilic acid , ka , xanthurenic acid ( xa ) , 3-hydroxyanthranilic acid ( 3-ha ) , and qa.120,23 we found a significant correlation between the urine total amount of nam and its catabolites and urine qa .
next , we examined the enzyme that controls the formation of niacin from trp in the liver.25,1012,15,16,18,19,23 the relationship between tryptophan 2,3-dioxygenase ( tdo ) and urine nam and its catabolites was not significant .
the relationship between 3-hydroxyanthranilic acid 3,4-dioxygenase ( 3-hado ) and urine total amount of nam and its catabolites was significant ( p = 0.040 ) .
the relationship between qprt and urine nam and its catabolites was not significant . from these results
, we concluded that the enzyme that governs the biosynthesis of nam from trp is 3-hado .
more than 90% of the trp intake is said to be metabolized by the trp - kynurenine - glutarate pathway ( fig .
1 ) in the liver.21,24,25 2-amino-3-carboxymuconate-6-semialde - hyde ( acms ) is a very unstable compound ; therefore , it non - enzymatically cyclizes to form qa .
qa then enters the nicotinamide adenine dinucleotide ( nad ) pathway . the nad metabolism in the liver
qa is converted to nicotinic acid mononucleotide ( namn ) , nicotinic acid adenine dinucleotide ( naad ) , and then to nad .
also , in the liver , nam is converted to nicotinamide mononucleotide ( nmn ) and nad .
when excessive nam is present in the body , it is catabolized to form mna , 2-py , and 4-py , which are eliminated into the urine .
the activity of kynurenine 3-monooxygenase and kynureninase in nonhepatic tissues is weak compared with that of the liver enzymes .
therefore , some parts of kynurenine and 3-hydroxykynurenine ( 3-hk ) are converted to side intermediates such as ka and xa .
furthermore , 3-ha is an end product , because 3-hado does not exist in nonhepatic tissues.21 namely , trp is not a precursor of nad in nonhepatic tissues . te nad biosynthetic pathway in nonhepatic tissues
is shown in figure 4 . in nonhepatic tissues , nam is only a precursor of nad .
nam generated from trp in the liver is transported to nonhepatic tissues via the blood .
thus , surplus nam in nonhepatic tissues returns back to the liver where it is catabolized .
the organ correlation with trp metabolism in wild - type ( wt ) mice is summarized in figure 5 .
the first enzyme in liver trp degradation is tdo . a small amount of trp is also degraded in nonhepatic tissues . in this case , the first enzyme is ido .
we investigated the distribution of the enzymes involved in the trp niacin metabolism.21,26,27 we found that 3-hado was only in the liver , and not in nonhepatic tissues.21 therefore , 3-ha is an end product of the trp degradation pathway in nonhepatic tissues .
also , a certain amount of 3-ha is taken up by the liver , and 3-ha is used as a niacin precursor . in nonhepatic tissues , nad is synthesized only from nam .
the upper metabolites in the trp niacin pathway such as 3-ha , ka , and xa are detected in the urine .
the lower metabolites in the trp niacin pathway such as qa , mna , 2-py , and 4-py are detected in the urine .
the urine total amount of nicotinamide ( nam ) and its catabolites , such as n - methylnicotinamide ( mna ) , n - methyl-2-pyridone-5-carboxamide ( 2-py ) , and n - methyl-4-pyridone-3-carboxamide ( 4-py ) , reflects the formation of niacin - active compounds .
we investigated the relationships between the urine total amount of nam and its catabolites and other urine trp catabolites such as anthranilic acid , ka , xanthurenic acid ( xa ) , 3-hydroxyanthranilic acid ( 3-ha ) , and qa.120,23 we found a significant correlation between the urine total amount of nam and its catabolites and urine qa .
next , we examined the enzyme that controls the formation of niacin from trp in the liver.25,1012,15,16,18,19,23 the relationship between tryptophan 2,3-dioxygenase ( tdo ) and urine nam and its catabolites was not significant .
the relationship between 3-hydroxyanthranilic acid 3,4-dioxygenase ( 3-hado ) and urine total amount of nam and its catabolites was significant ( p = 0.040 ) .
the relationship between qprt and urine nam and its catabolites was not significant . from these results
, we concluded that the enzyme that governs the biosynthesis of nam from trp is 3-hado .
more than 90% of the trp intake is said to be metabolized by the trp - kynurenine - glutarate pathway ( fig .
1 ) in the liver.21,24,25 2-amino-3-carboxymuconate-6-semialde - hyde ( acms ) is a very unstable compound ; therefore , it non - enzymatically cyclizes to form qa .
qa then enters the nicotinamide adenine dinucleotide ( nad ) pathway . the nad metabolism in the liver
qa is converted to nicotinic acid mononucleotide ( namn ) , nicotinic acid adenine dinucleotide ( naad ) , and then to nad .
also , in the liver , nam is converted to nicotinamide mononucleotide ( nmn ) and nad . when excessive nam is present in the body , it is catabolized to form mna , 2-py , and 4-py , which are eliminated into the urine .
the activity of kynurenine 3-monooxygenase and kynureninase in nonhepatic tissues is weak compared with that of the liver enzymes .
therefore , some parts of kynurenine and 3-hydroxykynurenine ( 3-hk ) are converted to side intermediates such as ka and xa .
furthermore , 3-ha is an end product , because 3-hado does not exist in nonhepatic tissues.21 namely , trp is not a precursor of nad in nonhepatic tissues . te nad biosynthetic pathway in nonhepatic tissues
is shown in figure 4 . in nonhepatic tissues , nam is only a precursor of nad .
nam generated from trp in the liver is transported to nonhepatic tissues via the blood .
thus , surplus nam in nonhepatic tissues returns back to the liver where it is catabolized .
the organ correlation with trp metabolism in wild - type ( wt ) mice is summarized in figure 5 .
a small amount of trp is also degraded in nonhepatic tissues . in this case , the first enzyme is ido .
niacin metabolism.21,26,27 we found that 3-hado was only in the liver , and not in nonhepatic tissues.21 therefore , 3-ha is an end product of the trp degradation pathway in nonhepatic tissues .
also , a certain amount of 3-ha is taken up by the liver , and 3-ha is used as a niacin precursor . in nonhepatic tissues , nad is synthesized only from nam .
the upper metabolites in the trp niacin pathway such as 3-ha , ka , and xa are detected in the urine .
the lower metabolites in the trp niacin pathway such as qa , mna , 2-py , and 4-py are detected in the urine .
we found that mice can biosynthesize the necessary amount of niacin from trp by catalysis of ido ( exists in non - hepatic tissues ) even in the absence of tdo ( mainly exists in the liver).21 a retardation of body weight gain was not observed in tryptophan 2,3-dioxygenase knockout ( tdo - ko ) mice .
namely , we found that the necessary amount of nam was synthesized from trp by ido , which exists in nonhepatic tissues .
in nonhepatic tissues , 3-hado does not exist.21 consequently , 3-ha is sent out to the blood stream and some of it is then taken and metabolized into nam in the liver , which is then distributed to nonhepatic tissues by the blood stream .
we obtained interesting findings in the experiment with tdo - ko mice ( table 1 ) .
the urinary excretion amounts of the upper intermediates of the trp niacin pathway such as kynurenine , ka , xa , and 3-ha were higher in the tdo - ko mice than in the wt mice . on the other hand ,
the amounts of the lower intermediates such as qa , nam , mna , 2-py , and 4-py were lower in the tdo - ko mice than in the wt mice .
these findings indicate that the urinary excretion amounts of the upper metabolites reflect the conversion ability of trp to 3-ha in nonhepatic tissues , but do not reflect that ability in the liver .
the conversion ability of nam from trp was very low in tdo - ko mice , because tdo was absent .
table 2 shows the relative niacin conversion activity from exogenous trp , kynurenine , 3-hk , and 3-ha.2830 each compound was orally fed to niacin - deficient animals .
these findings indicate that liver cells can incorporate trp and 3-ha , but can not incorporate kynurenine and 3-hk . from these findings
, we summarized the trp to nam metabolism in tdo - ko mice ( fig .
3-hado does not exist in nonhepatic tissues.21 hence , 3-ha in non - hepatic tissues , which is synthesized from trp by ido , is sent out to the blood stream , and some of the 3-ha is then taken up by the liver , where the 3-ha is metabolized into nam . the synthesized nam is distributed to nonhepatic tissues via the blood stream , and then , the nam is converted to nad .
we found that mice can biosynthesize the necessary amount of niacin from trp by catalysis of ido ( exists in non - hepatic tissues ) even in the absence of tdo ( mainly exists in the liver).21 a retardation of body weight gain was not observed in tryptophan 2,3-dioxygenase knockout ( tdo - ko ) mice .
namely , we found that the necessary amount of nam was synthesized from trp by ido , which exists in nonhepatic tissues .
in nonhepatic tissues , 3-hado does not exist.21 consequently , 3-ha is sent out to the blood stream and some of it is then taken and metabolized into nam in the liver , which is then distributed to nonhepatic tissues by the blood stream .
we obtained interesting findings in the experiment with tdo - ko mice ( table 1 ) .
the urinary excretion amounts of the upper intermediates of the trp niacin pathway such as kynurenine , ka , xa , and 3-ha were higher in the tdo - ko mice than in the wt mice . on the other hand ,
the amounts of the lower intermediates such as qa , nam , mna , 2-py , and 4-py were lower in the tdo - ko mice than in the wt mice .
these findings indicate that the urinary excretion amounts of the upper metabolites reflect the conversion ability of trp to 3-ha in nonhepatic tissues , but do not reflect that ability in the liver .
the conversion ability of nam from trp was very low in tdo - ko mice , because tdo was absent .
table 2 shows the relative niacin conversion activity from exogenous trp , kynurenine , 3-hk , and 3-ha.2830 each compound was orally fed to niacin - deficient animals .
these findings indicate that liver cells can incorporate trp and 3-ha , but can not incorporate kynurenine and 3-hk . from these findings
, we summarized the trp to nam metabolism in tdo - ko mice ( fig .
3-hado does not exist in nonhepatic tissues.21 hence , 3-ha in non - hepatic tissues , which is synthesized from trp by ido , is sent out to the blood stream , and some of the 3-ha is then taken up by the liver , where the 3-ha is metabolized into nam . the synthesized nam is distributed to nonhepatic tissues via the blood stream , and then , the nam is converted to nad .
true niacin - deficient animals can not be created using nutritional techniques , because the vitamin niacin can be synthesized from trp.22 we wanted to establish a truly niacin - deficient model animal using a protocol that does not involve manipulating the dietary trp .
we generated mice that do not have the qprt gene.21 the body weight of qprt - ko mice decreased when they were fed a diet without preformed niacin ; however , it did not decrease when they were fed a diet with preformed niacin .
qprt activity was not affected by the kind of diet , ie , with or without preformed niacin .
its activity was 1.0 mol / hour / g of liver in wt mice , 0.5 mol / hour / g of liver in hetero type mice , and 0 mol / hour / g of liver in qprt - ko mice .
the excretion amount percentage of qa was around 6% of the intake of dietary trp .
the urine qa was almost the same between the groups of wt and hetero mice .
this was unexpected , because we thought that qprt is the rate - limiting enzyme of the conversion pathway of trp to nam .
the trp to nam conversion percentages in wt and hetero mice were 1.4% and 1.2% , respectively .
this finding also indicates that qprt is not the limiting enzyme in the trp to nam conversion .
the degradation pathway of trp in qprt - ko mice , which does not have qprt , is shown in figure 7 .
therefore , the vitamin niacin is an essential nutrient for qprt - ko mice . in conclusion , these findings21,22 show that the limiting factors in the conversion of trp to niacin are based on the amounts of 3-ha and the conversion ability of 3-hado in the liver .
the formation of qa is catalyzed by 3-hado , whose activity is much higher than that of other enzymes involved in the trp degradation pathway . thus , generally speaking
nevertheless , our findings suggest that the limiting step may be the conversion reaction of 3-ha to qa .
the supply of 3-ha from nonhepatic tissues to the liver may have an important role .
we thought that the supply of 3-ha was significantly smaller in nonhepatic tissues than in the liver , but it turned out to be much higher than expected .
thus , ido in nonhepatic tissues plays an important role in the supply of 3-ha .
further studies on organ organ relationships are required to elucidate the entire trp metabolism . | the aim of this article is to report the organ - specific correlation with tryptophan ( trp ) metabolism obtained by analyses of tryptophan 2,3-dioxygenase knockout ( tdo - ko ) and quinolinic acid phosphoribosyltransferase knockout ( qprt - ko ) mice models .
we found that tdo - ko mice could biosynthesize the necessary amount of nicotinamide ( nam ) from trp , resulting in the production of key intermediate , 3-hydroxyanthranilic acid .
upstream metabolites , such as kynurenic acid and xanthurenic acid , in the urine were originated from nonhepatic tissues , and not from the liver . in qprt - ko mice ,
the trp to quinolinic acid conversion ratio was 6% ; this value was higher than expected .
furthermore , we found that qprt activity in hetero mice was half of that in wild - type ( wt ) mice .
urine quinolinic acid levels remain unchanged in both hetero and wt mice , and the conversion ratio of trp to nam was also unaffected .
collectively , these findings show that qprt was not the rate - limiting enzyme in the conversion . in conclusion ,
the limiting factors in the conversion of trp to nam are the substrate amounts of 3-hydroxyanthranilic acid and activity of 3-hydroxyanthranilic acid 3,4-dioxygenase in the liver . | Introduction
An enzyme that governs the biosynthesis of niacin from Trp
Organ correlation with Trp metabolism in wild-type mice
TDO-KO Mice
The necessary amount of niacin can be synthesized only by IDO
Side-intermediates of the Trpniacin pathway originate from nonhepatic tissues
QPRT-KO Mice
Future Directions |
glucotoxicity is one of the major factors involved in progressive deterioration of beta - cell function and mass in type 2 diabetes mellitus ( t2 dm ) .
beta - cell function can be improved and leaded to temporary remission in newly diagnosed t2 dm treated with short - term intensive insulin therapy [ 1 , 2 ] .
about 68% of patients with a mean duration of 5.9 6.6 years of established t2 dm may achieve fasting glucose < 7.0 mmol / l from antidiabetic therapy as well .
short - term intensive insulin treatment even improves fibrinolytic profile and vibratory sensation in patients with t2 dm . therefore , patients with long - term , poorly controlled t2 dm , perioperative hyperglycemia , and diabetic patients suffering from acute coronary events may all be good candidates for short - term , intensive insulin therapy .
there are three forms of intensive insulin therapy : multiple daily injection ( mdi ) ; continuous subcutaneous insulin infusion ( csii ) ; continuous intravenous insulin infusion . in the context of intensive diabetes management ,
insulin pumps provide precise insulin delivery throughout the day and improve the accuracy of bolus dose calculations to closely follow the physiologic patterns of secretion observed in patients without diabetes . in this way , improved glycemic control with less frequent and severe hypoglycemic episodes can be achieved .
therefore , csii may be the best current therapeutic option for patients with diabetes requiring multiple daily injections
. however , not all patients needing insulin intensive therapy have access to insulin pump therapy due to limitations including high expense , high daily use charges , inadequate medical resources , and restrictive health insurance policies .
recently , the development of new insulin preparations that mimic the normal mealtime bursts of insulin such as aspart insulin and lispro insulin and the availability of new insulin preparations that simulate endogenous basal insulin more precisely such as glargine and detemir may facilitate the ability to achieve long - term control over blood glucose in patients with t2 dm .
currently , it is not known whether mdi regimens based on new long - acting insulin analogs such as glargine and detemir may replace the need for csii [ 9 , 10 ] . in t2 dm , csii and mdi
produce similar glycemic control , but there have been a paucity of studies comparing glargine and detemir based mdi with insulin pump therapy .
although it is possible that csii may be beneficial in selected patient groups with t2 dm , further study is required to elucidate this hypothesis .
the present two - center prospective study was designed to compare the efficacy and safety of three short - term , intensive insulin therapy procedures : csii with fasting insulin analog aspart , glargine based mdi , and detemir based mdi in patients with established t2 dm of a duration exceeding five years but poorly controlled by oral antidiabetic drugs ( oad ) or conventional insulin therapy .
length of time to achieve glucose goals , total daily insulin doses , per kg body weight daily insulin doses , daily basal insulin doses , per kg body weight daily basal insulin doses , daily blood glucose fluctuations , and hypoglycemic and nocturnal hypoglycemia episodes in each group were assessed in order to compare the three treatments .
all t2 dm patients ( n = 119 ; 48 male , 71 female ) were hospitalized between october , 2010 , to october , 2011 , in the department of internal medicine , the affiliated hospital of medical college , qingdao university , qingdao , china , and the department of endocrinology at fujian provincial hospital , fuzhou , china .
exclusion criteria included patients with acute complications , renal dysfunction ( defined by serum creatinine 136
mol / l in males or 124 mol / l in females or creatinine clearance < 60 ml / min ) , hepatic dysfunction ( transaminases > 2.5 upper limit of normal serum alanine and aspartate aminotransferase levels ) , proliferative retinopathy , acute or chronic infection , malignancy and pregnancy .
prior to randomization , patient demographic characteristics ( mean standard deviation ( sd ) ) were as follows : age 61.1 8.9 years , diabetes duration 10.37 4.14 years , body weight 68.58 10.34 kg , body mass index ( bmi ) 25.07 2.83 kg / m , glycosylated hemoglobin ( hba1c ) 9.56 1.58% , and initial
all recruited patients participated in diabetes education programs during hospitalization and gave written informed consent before treatment .
enrolled subjects were randomly assigned into three groups : csii ( group a ) ; glargine - based mdi ( group b ) ; detemir - based mdi ( group c ) . during insulin
patients in group a were treated with aspart ( novo nordisk , bagsvaerd , denmark ) using medtronic ( northridge , ca ) insulin pumps .
patients in group b were treated with aspart ( novo nordisk , bagsvaerd , denmark ) before each meal and glargine ( lantus , aventis pharma , frankfurt , germany ) at bedtime .
patients in group c were treated with aspart ( novo nordisk , bagsvaerd , denmark ) before each meal and detemir ( novo nordisk , bagsvaerd , denmark ) at bedtime .
starting doses were determined based on a total daily dose of 0.30.4 iu / kg / day , with 50% provided as bolus ( premeal ) insulin and 50% provided as basal insulin . in group
a , initial basal dose was divided into the following six periods of the day : the period from 00:00 to 03:00 hours , 03:00 to 09:00 hours , 09:00 to 12:00 hours , 12:00 to 16:00 hours , 16:00 to 20:00 hours , and 20:00 to 24:00 hours .
blood glucose was monitored by a stable blood glucose monitoring device from roche ( accu - chek performa , germany ) .
blood glucose was measured from finger - stick blood samples five times a day ( fasting , two hours after breakfast , two hours after lunch , two hours after supper and at 3:00 a.m. ) .
premeal insulin doses were adjusted according to two hour postprandial glucose levels to achieve the target of 11.0 mmol / l . if the subject achieved two consecutive days at goal , length of time needed to achieve target , total daily insulin doses , daily basal insulin doses , blood glucose fluctuations , and hypoglycemia episodes were calculated .
hypoglycemic episodes were classified as severe hypoglycemia when patients were not able to treat the episode themselves and blood glucose was 3.9
mmol / l , symptomatic hypoglycemia when patients were able to treat the episode and blood glucose was 3.9
mmol / l , and relative hypoglycemia when patients with symptoms of hypoglycemia but blood glucose was either > 3.9
hypoglycemic episodes were also evaluated as all events ( all episodes occurring over a 24-hour period ) and nocturnal events ( episodes occurring between 11 pm and 6 am ) .
all statistical analyses were performed with commercial software ( spss , version 17.0 for windows , spss , inc . ,
daily blood glucose fluctuations were expressed as the ratio of the arithmetic square root of the sum of the square of differences between each time period blood glucose value and the daily mean blood glucose to daily mean blood glucose .
frequencies of hypoglycemia and nocturnal hypoglycemia were calculated by total daily hypoglycemia episodes and total nocturnal hypoglycemia episodes divided by the sum of the period of time to arrive at target in each group . a value of p < 0.05 was considered as statistically significant .
there were no clinically relevant differences in demographic characteristics between subjects in the three treatment groups ( table 1 ) .
patients in the csii group reached glycemic goals in about four days ( 4.2 1.34 days ) while patients in glargine- or detemir - based mdi groups achieved glycemic goals in about seven days ( 7.48 2.51 days and 6.85 2.28 days , respectively , p < 0.05 for a versus b or c ; p > 0.05 for b versus c ) . at the time glycemic goals were reached , total daily insulin dose and the dose per kg body weight in group a ( 40.25 5.90 iu , 0.60 0.11
iu / kg / day ) were significantly less than those in group b ( 49.35 8.90 iu , 0.74 0.14 iu / kg / day ) and group c ( 49.21 9.35 iu , 0.72 0.17 iu / kg / day , p < 0.05 for a versus b or c ; p > 0.05 for b versus c ) ( table 2 ) .
total daily basal insulin doses and the dose per kg body weight in group a ( 20.09 3.28 iu , 0.30 0.05 iu / kg / day ) were significantly less than those in group b ( 22.70 4.91 iu , 0.34 0.07 iu / kg / day ) and group c ( 23.51 3.99 iu , 0.34 0.07
iu / kg / day , p < 0.05 for a versus b or c ; p > 0.05 for b versus c ) , as well ( table 3 ) . at each time period ,
blood glucose levels and mean blood glucose levels were significantly lower than random blood glucose levels before intensive insulin therapy in each group ( p < 0.05 ) ; however , at the time glycemic goals were reached , no statistical differences in fasting blood glucose levels among the three groups were detected ( 6.03 0.47
mmol / l , 5.98 0.72 mmol / l , and 6.17 0.53 mmol / l , resp . , p > 0.05 ) ( table 4 ) .
additionally , no statistically significant differences in two - hour after breakfast blood glucose levels ( 8.77 1.23 mmol / l , 8.63 1.46 mmol / l , and 8.95 1.22 mmol / l , resp . ) , two - hour after lunch blood glucose levels ( 9.04 0.94 mmol / l , 9.52 1.60 mmol / l , and 9.01 1.35 mmol / l , resp . ) , two - hour after supper blood glucose levels ( 8.21 0.20
( 6.14 0.63 mmol / l , 6.13 0.87 mmol / l , and 5.85 0.65 mmol / l , resp . ) among the three groups ( all p > 0.05 ) ( table 4 ) were found .
daily blood glucose fluctuations in group a , however , ( 0.19 0.03 ) were significantly less than those in group b ( 0.24 0.04 ) and group c ( 0.22 0.04 , p < 0.05 for a versus b or c ; p > 0.05 for b versus c ) ( table 4 ) .
no severe hypoglycemic episodes were reported in any treatment group , and there were no statistically significant differences in hypoglycemic and nocturnal hypoglycemia episodes among the three groups ( group a ( 0.10 times / person day and 0.03 times / person day ) , group b ( 0.07 times / person day and 0.02 times / person day ) , and group c ( 0.05 times / person day and 0.02 times / person day ) , p > 0.05 ; table 5 ) .
fast - acting insulin analogues ( lispro and aspart insulin ) are characterized by amino acid substitutions in the c - terminal portion of -chain and a fast absorption rate from the subcutaneous tissue .
csii of aspart with insulin pumps could mimic physiological insulin secretion at different periods throughout the day with faster onset and offset than subcutaneous regular insulin , allowing both prandial and corrective boluses , therefore reproducing a more physiological pattern of insulin secretion and improvements in the overall 24-hour glycemic profile .
results from the present study investigating patients with established t2 dm ( duration > five years ) demonstrated that patients in the csii group reached glycemic goals in a significantly shorter period of time than patients in either the glargine- or detemir - based mdi groups .
total daily insulin doses and the doses per kg body weight in group a were significantly less than those in groups b and c. the total daily basal insulin doses and the dose per kg body weight in group a were significantly less than those in groups b and c as well .
daily blood glucose fluctuations in group a were significantly less than those in groups b and c. these results suggest that fast - acting insulin analogue - based csii remains the gold standard effective mode of intensive insulin therapy in t2 dm .
unfortunately , insulin pumps are limited by high expense and complex injection protocols which increase the potential for patient errors and noncompliance .
the development of fast - acting insulin analogues and long - acting insulin analogues suitable for once - daily administration may help overcome these challenges .
data generated in the present study suggest that glargine- or detemir - based mdi can reach glycemic goals in approximately seven days ( glargine , 7.48 2.51 days versus detemir , 6.85 2.28 days , p > 0.05 )
. therefore , glargine- or detemir - based mdi may be effective and reasonable alternatives to insulin pump therapy , especially in nondiabetes specialist wards or basic hospital settings where insulin pumps are not readily available .
the two basal insulin analogues , glargine and detemir , developed by adjusting the isoelectric point and adding a fatty acid residue , respectively , have a protracted duration of action and a relatively smooth profile .
both analogues have a longer duration of action , less of a peak of activity , and a reduced variability with repeated injections . however , there is sufficient evidence to demonstrate that these two long - acting insulin analogs are different in both their pharmacokinetic and pharmacodynamic profiles .
furthermore , the relative merit of the two analogs when compared to each other has been a matter of some controversy .
the present study found no significant differences in the time to achieve target , daily total and basal insulin doses , daily per body weight unit total and basal insulin doses between groups b and c ( p > 0.05 ) suggesting that the efficacy of detemir and glargine may be comparable in subjects with t2 dm when combined with aspart in a basal - bolus regimen .
devries et al . reported that goal - titrated , twice - daily , basal insulin tended to increase insulin doses disproportionately with regard to improvement in glycemic control .
several studies have reported that detemir was often injected twicedaily at a higher dose than glargine ( injected once - daily at a lower dose ) to achieve the same level of glycemic control [ 16 , 17 ] . however , other studies conducted by diabetologists reported oncedaily dosing with detemir and glargine was comparable in t2 dm subjects [ 18 , 19 ] .
results of most clamp studies show that duration of action with both analogues is dose dependent , and in the clinically relevant range of 0.350.8 u / kg , it is close to 24 hours in people with t2 dm .
in fact , both analogues seem to be very similar with regard to the mean shape of their pharmacodynamic profile and duration of action . these findings in experimental glucose clamp studies are consistent with observations in clinical trials and support routine once - daily use with either analogue , in particular in people with t2 dm [ 14 , 20 ] , and are further confirmed by the results of the present study .
glucose variability , such as intraday glucose fluctuations , contributes to oxidative stress , which has been linked to the pathogenesis of the long - term complications of diabetes [ 21 , 22 ] and avoiding glucose fluctuations in diabetic patients seems to be an emerging therapeutic challenge .
the results of the present study demonstrate that daily blood glucose fluctuations were significantly narrower in aspart - based csii than in glargine- or detemir - based mdi ( 0.19 0.03 , 0.24 0.04 , and 0.22 0.04 , resp . ;
p < 0.05 for a versus b or c ; p > 0.05 for b versus c ) .
these results are in accord with the general theory that basal insulin substitution with csii provides less variable glucose levels than with long - acting insulin analogs in patients with diabetes .
several studies have reported that detemir shows less within - subject variability in its metabolic effects than glargine [ 14 , 20 , 2528 ] .
however , we found no difference in daily blood fluctuations between glargine- and detemir - based mdi in accord with the study of t2 dm patients by tone et al . .
hypoglycemia is one of the main limiting factors for patients with diabetes requiring insulin in achieving tight glycemic control and reduced rates of complications .
nocturnal hypoglycemia may be the most common type of hypoglycemia in individuals with diabetes using insulin and is particularly worrisome because it often goes undetected and may lead to unconsciousness and even death in severe cases .
the results of the present study found no significant differences in hypoglycemic and nocturnal hypoglycemia episodes among the three groups ( p > 0.05 ) suggesting that the safety of either glargine- or detemir - based mdi may be comparable in subjects with t2 dm when compared with aspart - based csii therapy . from the data generated in the present study
, it would seem that fast - acting analog - based csii could achieve good blood glucose control with fewer insulin doses over shorter periods of time compared with glargine- or detemir - based mdi which remains the most effective mode of intensive insulin therapy in poorly controlled t2 dm . however , if local medical conditions and individual factors do not allow the use of insulin pumps , once daily glargine or detemir at bedtime combined with a fast - acting insulin analogue at meals should be an effective and reasonable alternative . |
aims . to examine the potential differences between multiple daily injection ( mdi ) regimens based on new long - acting insulin analogues ( glargine or detemir ) plus prandial insulin aspart and continuous subcutaneous insulin aspart infusion ( csii ) in patients with poorly controlled type 2 diabetes
. methods . patients ( n = 119 ) with poorly controlled type 2 diabetes of a duration exceeding five years
were randomly assigned into three groups : group a treated with csii using insulin aspart ; group b treated with glargine - based mdi and group c treated with detemir - based mdi
. results .
good glycemic control was achieved by patients in group a in a significantly shorter duration than patients in groups b and c. total daily insulin , basal insulin dose and dose per kg body weight in group a were significantly less than those in groups b and c. daily blood glucose fluctuation in group a was significantly less than that in groups b and c. there were no differences between groups b and c. conclusions .
aspart - based csii may achieve good blood glucose control with less insulin doses over a shorter period compared with glargine or detemir - based mdi .
no differences between glargine- and detemir - based mdi were detected in poorly controlled subjects with type 2 diabetes . | 1. Introduction
2. Research Design and Methods
3. Study Procedures
4. Statistical Analyses
5. Results
6. Discussion |
brain death ( bd ) in the popular belief is that someone 's brain stops functioning , even though their heart may be kept beating using a machine .
thus , the concept of bd is closely linked to the birth of modern intensive care medicine .
after brain function had ceased , the somatic function being sustained by mechanical ventilation for a long time .
so in many countries , the law provides that treatment can be legitimately removed from a patient who was diagnosed bd , and the donation of organs for transplantation can start . in this regard ,
a definition of irreversible coma was presented for death by an ad hoc committee of the harvard medical school . then in 1976 , guidance on the diagnosis of brain (
stem ) death was published by the united kingdom conference of medical royal colleges and their faculties . in 1979 ,
a memorandum stated that bd equated with the death of the whole person by this commission . in 1995 , the american academy of neurology ( aan ) issued guidelines on the diagnosis of bd in order to standardize its practice parameters . this guidance was the basis for the development of the statutes of death in each state in the united states and formed the basis of bd definitions in other countries .
the latest criterion in the united states is the update of the 1995 aan guideline on determining of bd , which was published in 2010 . despite the general consensus on the concept of bd , its definition still varies widely between countries . in china ,
, a draft of the determination of bd in adults was published in national medical journal of china . in 2009 ,
the revised draft was published in chinese journal of cerebrovascular disease . in 2013 ,
criteria and practical guidance for the determination of bd in adults ( bqcc version ) was published in chinese medical journal .
the 2009 version of bd criteria is completely the same as the 2013 version . in this study
, we observed the application of the chinese criteria of bd in a neurological intensive care unit ( neuro icu ) . at the same time , we compare generally accepted bd criteria for diagnosis between china and the united states in order to know its diagnostic effectiveness .
from january 1 , 2012 , we began to evaluate patients in the neuro icu of beijing tiantan hospital , who were applied for bd diagnosis .
the evaluations of bd were done by several neurologists who worked in the neuro icu .
we used two criteria for bd diagnosis that were criteria of the united states and chinese criteria . in summary ,
the criteria of the united states consist of four steps : ( 1 ) prerequisites : definite and irreversible coma whose cause should be excluded drug , hypothermia , alcohol , and other laboratory abnormal values ; ( 2 ) examination : absence of brainstem reflexes ; ( 3 ) the apnea test result is positive ; and ( 4 ) ancillary tests can be used when uncertain about the clinical examination or when the apnea test can not be performed .
the criteria in china also consist of four steps : ( 1 ) the clinical examination confirm the bd diagnose , including deep coma , absence of brainstem reflexes and no spontaneous ( spont ) respiration ; ( 2 ) confirmatory tests should fulfill two of the three which include transcranial doppler ( tcd ) , electroencephalogram ( eeg ) , and somatosensory evoked potential ( sep ) ; ( 3 ) the apnea test is positive ; and ( 4 ) a repeat determination should be done 12 h later after the 1 time .
if patients were in a coma and ventilated by nonautonomy breathing mode , they would be applied for the evaluation for bd and enrolled in this study .
first of all , the cause of coma should be known and excluded drug , hypothermia , and alcohol .
they should have normal body temperature and blood pressure ( bp ) , no acidosis .
the brainstem reflexes included corneal reflexes , pupillary reflexes , oculocephalic reflexes , oculovestibular reflexes , and cough reflexes .
no matter what the test result was , confirmatory tests were done continuously which were sep , eeg , and tcd .
if the results of tests for patients all fulfilled the criteria of bd , a repeat determination should be done 12 h later .
ventilator should be adjusted to provide normocarbia ( paco2 3445 mmhg ) and hyperoxia ( pao2 200 mmhg ) .
if respiratory movements are absent in 10 min and paco2 is 60 mmhg or 20 mmhg over a baseline , apnea can be confirmed . the determination of bd in confirmatory tests as follows : ( 1 ) short - latency sep of median nerve shows that bilateral n9 and ( or ) n13 exist , while p14 , n18 , and n20 are absent ; ( 2 ) eeg shows electrical silence ; and ( 3 ) tcd sonography shows that the blood flows of intracranial anterior and posterior circulation demonstrate reverberating flow , small systolic spike , or absence of blood flow signal .
the reactions of the physicians and families were recorded which meaning believes or unbelieves and the changes of treatment or not .
the chinese criteria of bd diagnoses have been officially published in the national journals which represent the legal status of this evaluation . at the same time , each steps of the evaluation have been already used in the clinical for years .
however , we informed the patients families about the bd evaluation and obtained their consent before evaluations .
the age , time , and money were expressed as a mean standard deviations ( sd ) .
paired t - test was used to assess the statistical significance of changes in time and money .
all statistical analyses were used spss 19.0 software ( spss inc . , chicago , il , usa ) .
from january 1 , 2012 to october 8 , 2013 , there were 37 patients which were applied for bd evaluation in the neuro icu of beijing tiantan hospital , who were a coma , being ventilated and no spont breathing .
they were 21 males , 16 females , with a mean age of 58.86 12.54 years ( ranging from 37 years to 96 years ) .
all patients were definite coma and excluded of diseases due to drug , hypothermia , and alcohol .
the cause of coma were known as subarachnoid hemorrhage ( sah , 18 patients , 48.6% ) , intracerebral hemorrhage ( ich , 8 patients , 21.6% ) , cerebral ischemia ( ci , 9 patients , 24.3% ) , brain stem tumor ( 1 patients , 2.7% ) , and intracranial infection ( 1 patients , 2.7% ) .
features of the study population bd : brain death ; sah : subarachnoid hemorrhage ; ich : intracerebral hemorrhage ; ci : cerebral ischemia ; sd : standard deviation . before the clinical examination , all patients had normal body temperature ( core temperature > 36c ) and bp ( systolic bp 100 mmhg ) except 1 patient who had low bp .
although 33 patients needed to do apnea tests , only 25 patients did the tests because others could not provide normocarbia ( paco2 3445 mmhg ) and hyperoxia ( pao2 200 mmhg ) .
the mean paco2 after 10 min stopping ventilators was 73.89 11.51 mmhg ( range 60.1098.50 mmhg ) . there were 2 patients who seemed to be recovered in spont breathing .
when the ventilator mode changed to spont mode , patients could remain spont breathing by machine .
all the 2 patients repeated the apnea tests and got the positive results ( paco2 61.6 mmhg and 77.6 mmhg , respectively ) .
confirmatory tests were completed differently because it was only necessary to have 2 positive results of the 3 tests for bd diagnosis .
one patient who had decompressive craniotomy ( dc ) did not complete eeg because there were no places for the electrodes .
twenty - five patients had positive results of eeg , and the positive rate was 100% .
the positive rate of sep was the same as eeg ( 16 patients , 100% ) .
the each part of evaluation results of bd in 37 patients , % ( n / n ) in chinese criteria , repeated tests should be done 12 h after the first evaluation .
complete means the finishing rate of the test in all patients who had done the test .
positive means the positive rate of the test in all patients who had completed the test .
tcd : transcranial doppler ; eeg : electroencephalogram ; sep : somatosensory evoked potential ; bd : brain death .
as we know the evaluation of bd contains several steps , we followed the program one by one .
as we have described above in detail , in all 37 patients , 1 patient was excluded because of low bp .
in all 33 patients , we need to complete one or more tests including the apnea test , tcd , eeg , and sep . the highest selection rate of the test was tcd , and the rate was 89.2% . while the completed rates were higher in eeg and sep than the other two test ( 96.2% , 94.1% , 90.9% , and 80.0% ) .
thirty - three patients were diagnosed bd by criteria of the united states . according to the standards of the united states ,
only 9 patients were diagnosed bd by chinese criteria . as we showed in table 3 , 23 patients had two positive results of ancillary tests
. there were 14 patients who had positive results of apnea test at the same time .
two of them were chose to give up treatments after their families knowing about the bd diagnosis .
that might be the reasons why the diagnose rate were such low in chinese criteria .
the bd diagnostic procedures and positive cases in two criteria , n the positive rate of chinese criteria for bd was 24.3% and the criteria of the united states were 89.2% .
the use of time and money in the usa criteria was obviously fewer than that in chinese criteria ( p = 0.000 ) [ table 4 ] .
compare of the criteria of the united states and china in the practice * p = 0.000 , there were a significant differential between two groups .
but when we did the apnea test again , we confirmed that they were bd . some doctors doubted if the criteria of the united states is right .
the families of patients all believed the bd diagnosis while 8 patients families could not believe that bd was equal to real death .
the mean time was 2.69 2.42 days ( range 110 days ) [ table 4 ] .
in china , the diagnosis of bd and donation of organs are under development . although the chinese criteria were published in the authoritative magazine since 2009 , those were not used widely in the intensive care unit ( icu ) .
are the chinese criteria for bd so difficulty ? can we just use the usa criteria ? in order to answer the above questions , we compared the bd evaluations between criteria of china and the united states in a sequential series of patients in neuro icu of beijing tiantan hospital .
as a neurologist , he or she knew exactly what the irreversible coma was and how to make judgments to the cause of the coma . also , they could do brainstem reflexes accurately
. the pupillary , corneal , and cough reflexes were often tested , and doctors were skilled in checking them .
it should be noted that patient should have normal body temperature ( core temperature > 36c ) and bp ( systolic bp 100 mmhg ) .
one patient did not do the bd evaluation because he could not reach the levels .
as we see , there were 4 patients had blood flow in the middle cerebral artery .
that meant you can not exclude bd even after blood flow found in tcd . and
. the brain condition could not complete tcd which included the poor temporal windows and craniotomy . in 33 patients who planned to have cd ,
eeg to determinate bd had some difficulties because the examination was done in the icu . the environment exits
too many electric inferences . when the sensitivity is increased to 2 v , it will take much time to get rid of inferences .
an apnea test is mandated by law or recommended by professional guidance in many countries .
in fact , the apnea test had some danger that 5 patients were suspended because they became unstable or desaturases in the test .
but the complete rate was 80% that reflected most patients can afford the apnea test .
when the ventilator mode changed to spont , patients could remain spont breathing by machine .
all the 2 patients repeated the apnea tests and got the positive results ( paco2 61.6 mmhg , and 77.6 mmhg , respectively ) .
repeated assessments were chosen in many countries , presumably to minimize the risk of diagnostic errors .
this is contrary to bd criteria of the united states which stipulate that only a single examination is required . in chinese criteria
although the repeat tests increased accuracy , they prolonged the time of diagnoses . in our study , 5 patients did not wait for 12 h for another determination of bd .
we compared the determination of bd in china with that in the united states . in all 37 patients , more patients
were confirmed bd by criteria of the united states than the chinese criteria ( 89.2% vs. 24.3% ) . if the apnea test was positive , the patient can be diagnosed bd . as we showed in table 3 ,
all of the above reasons make the diagnosis of bd by criteria of the united states more quickly , cheaper , and high diagnostic rate . the mean use of time in criteria of the united states was 52.27 min ( < 1 h )
the mean use of time in chinese criteria was 990 min ( 16 h and 30 min ) .
the use of time and money in criteria of the united states was obviously fewer than that in chinese criteria ( p = 0.000 ) . after comparing with criteria of the united states
, can we draw the conclusion that chinese criterion is poorer than criterion of the united states ?
the second reason is that the organ donation is rare in the neuro icu . in our study , there were no cases of organ donation .
the advantage of bd diagnosis is that the families and hospitals can stop unnecessary treatment . yet
, there were also some families who could not believe that bd was equal to real death .
they asked for continuous active treatments . in our study , some patients lived on ventilators for 10 days .
if a patient can not complete apnea test , some ancillary test can be performed to determinate bd . in our study and other studies in china
when the confirmatory tests of these patients are all according with bd , we can not exclude the diagnosis of bd .
although we need accuracy , can these patients be confirmed bd ? or we can use 3 confirmatory tests to take the place of apnea test .
the secondary thing is about the number of confirmatory tests . in order to be more accuracy ,
the bd diagnosis will be difficult to finish in time when organ donations increase in the future . if patients have apnea test , and one confirmatory test can confirm bd , it will be more convenience than now . there are some limitations in our study .
the subjects in the study were most of the patients with cerebrovascular diseases since beijing tiantan hospital is good at the treatment of cerebrovascular diseases .
the subjects we observed were sah , ich , and ci , who were older in age .
we are not sure whether our results can apply to the brain trauma and other neurological diseases . in conclusion
, we observed the application of chinese criteria of bd in 37 patients from neuro icu .
we found that bd evaluations in chinese criteria were safety and feasible . a neurologist could fulfill the tests .
compared with the bd criteria of the united states , chinese criteria were stricter , lower positive rate , more cost in money and time , and more reliable by families and doctors .
each of the two criteria has both advantages and disadvantages . with the more experiences we have in the future | background : criteria for determining brain death ( bd ) vary between china and the united states .
we reported the results of an investigation designed to compare procedures to determine bd in two countries.methods:the latest criteria in the united states were published in 2010 .
the latest criteria in china were published in 2009 .
we used these two types of bd criteria to evaluate patients who were considered to be bd .
the time , cost , and accuracy of the diagnosis were compared.results:from january 1 , 2012 to october 8 , 2013 , there were 37 patients which were applied for bd evaluation in the neurological intensive care unit of beijing tiantan hospital .
the cause of coma were known as subarachnoid hemorrhage ( 18 patients , 48.6% ) , intracerebral hemorrhage ( 8 patients , 21.6% ) , cerebral ischemia ( 9 patients , 24.3% ) , brain stem tumor ( 1 patient , 2.7% ) , and intracranial infection ( 1 patient , 2.7% ) . the clinical examinations were done for all of the patients except 1 patient who had low blood pressure .
three patients had brainstem reflexes that were excluded from bd .
twenty - five patients had apnea tests , and 20 tests were completed that were all positive .
confirmatory tests were completed differently : transcranial doppler ( 30 patients , positive rate 86.7% ) , electroencephalogram ( 25 patients , positive rate 100% ) , and somatosensory evoked potential ( 16 patients , positive rate 100% ) .
thirty - three patients were diagnosed bd by criteria of the united states .
only 9 patients were diagnosed bd by chinese criteria .
the use of time and money in the usa criteria was obviously fewer than those in chinese criteria ( p = 0.000).conclusion : compared with bd criteria of the united states , chinese criteria were stricter , lower positive rate , more cost in money and time , and more reliable by families and doctors . | I
M
Statistical analysis
R
D
Financial support and sponsorship
Conflicts of interest |
cementoblastoma is a relatively uncommon benign odontogenic neoplasm of the jaws and was first described by dewey in 1927 .
the benign cementoblastoma is recognized in the world health organization 's ( who 's ) classification ( 1971 ) of periapical odontogenic tumors as one of the four types of cementum - producing disorders .
the other three are periapical cemental dysplasia , cementifying fibroma , and gigantiform familial cementoma.[57 ] the who defines benign cementoblastoma as a neoplasm characterized by the formation of sheets of cementum- like tissue containing a large number of reversal lines and a lack of mineralization at the periphery of the mass or in the more active growth area .
the who has classified benign cementoblastoma and cementifying fibroma as the only true cemental neoplasm .
the most commonly affected tooth is mandibular first molar.[61113 ] however , other teeth involved have included mandibular second and third molars , mandibular bicuspids and maxillary bicuspids , and first , second and third molars .
true cementoblastoma can be associated with deciduous molars , although this is an uncommon occurrence .
lesions generally are discovered in patients younger than 30 years of age , often on a routine radiograph although the range has been 1072 years .
symptoms may be totally absent or when they do occur , they tend to be minor .
radiographically , cementoblastoma typically consists of well - defined radiopacity with a cortical border and then a well - defined radiolucent band just inside the cortical border .
the outline of the affected root is generally obliterated because of the resorption of the root and fusion of the mass to the tooth .
most teeth affected by the cementoblastoma respond normally to the vitality tests during early stages of the lesion , but necrotic pulp can occur with this entity , usually in later stages .
a 55-year - old female reported to the department of oral and maxillofacial surgery , with complaints of swelling in the right mandibular angle since 1 year and pus discharge in the same region since 2 months .
history revealed that the patient had mild swelling with respect to the right mandibular angle since 6 years which underwent a sudden increase in size since a year .
no history of fever , paresthesia , and numbness of the lower lip was reported .
an extraoral examination revealed facial asymmetry due to the presence of diffuse swelling and draining sinus with respect to the inferior border of the right mandibular angle .
a hard mass was palpable beneath the buccal mucosa and also on the lingual mucosa with respect to the mandibular angle .
provisional diagnosis of cementoblastoma , cement - ossifying fibroma , and complex odontoma was made .
a panoramic radiograph revealed a dense radiopaque mass surrounded by a well - defined radiolucent band with respect to the mandibular angle .
the outline of the roots of the third molar was obliterated and the radiopaque mass seemed to be attached to the roots of third molar [ figures 15 ] .
axial view of lesion on ct scan three dimensional view of lesion on ct scan a ct examination of the mandible revealed a large expansile radiopaque mass measuring 22 cm in size .
the patient was treated for the copd first by the physician and simultaneously the patient was put on antibiotics to eradicate the infection from the lesion .
after the patient was medically fit , the lesion was surgically excised along with the tooth and the sinus lining was excised .
histopathologically , the tumor consisted of a calcified mass fused with the roots of third molar with a resultant obliteration of the periodontal ligament .
the tumor comprised sheets of calcified tissue with multiple reversal lines and prominent cementoblasts and multinucleated cementoclasts .
the peripheral columns showed characteristic radiating columns of the cementum perpendicular to the surface of the lesion .
the cementoblastoma or true cementoma is a slow - growing , benign odontogenic tumor arising from ectomesenchyme .
although statistical data suggest that benign cementoblastomas are uncommon , many believe that they occur more often than published account indicates .
cementoblastomas have an unlimited growth potential and endodontic therapy does not eliminate or arrest them .
. lesions commonly occur in the younger age group with people less than 30 years of age .
more than 50% of the lesions occur under 20 years of age and the lesion is located in the mandible in more than 70% of cases ( with a predominant location at the first molar and second premolar ) .
the expansion of the cortical plates of the bone is the typical feature of cementoblastoma .
the internal structure of the mass may possess a mixed radiolucent radiopaque quality with a radiating pattern .
a radiolucent band around the benign cementoblastoma is usually better defined and more uniform than with cemental dysplasia .
periapical cemental dysplasia is small in size and shows a progressive change in radiographs from radiolucent to mixed to radiopaque over time .
the cementoblastoma is distinguished from the osteoblastoma by its location in an intimate association with the tooth root .
the odontome is usually not fused with the tooth root and appears as a more heterogenous radiopacity .
hypercementosis is a small lesion and does not associate with pain or jaw swelling . due to benign but a locally aggressive nature of the lesion , the treatment of choice is a complete removal of the lesion along with the associated tooth .
a more conservative approach to retain the associated tooth and removal of the lesion using a surgical endodontic technique has been reported .
it can be used for small lesions in strategic teeth in which the lesion can be excised without injuring adjacent teeth and if a sufficient crown - to - root ratio remains after apicoectomy .
recurrence after the excision is rare ; if it recurs , it is because of an inadequate excision of the lesion . | cementoblastoma is a relatively uncommon , benign odontogenic neoplasm of jaws .
mandible is affected more than the maxilla .
the lesions are generally diagnosed on a routine radiograph .
the localized expansion of cortical plates is observed .
radiographically , it consists of well - defined radiopacity with a radiolucent band . here is a case report of a female aged 55 years having swelling in the right mandibular angle with an extraoral draining sinus .
a panoramic radiograph shows a dense radiopaque mass along the roots of the third molar surrounded by a radiolucent band .
surgical excision was carried out and a histopathological examination was carried out which was suggestive of cementoblastoma . | I
C
D |
radiofrequency ablation of the accessory pathway ( ap ) is the usual treatment of symptomatic ventricular pre - excitation syndrome ( wolff parkinson white syndrome ) and of asymptomatic pre - excitation syndrome with signs of malignancy at electrophysiological study , .
therefore electrophysiological study ( eps ) is recommended to evaluate the pre - excitation syndrome - related risk , , , .
it is well - known that ventricular fibrillation may be the first event of the pre - excitation syndrome .
ventricular fibrillation was the first manifestation in 8 of 15 patients ( 53% ) in the study of timmermans et al . , but aborted sudden death was rare and seen in 2.2% of this population of 690 patients referred for a wolff parkinson white syndrome .
the risk was reported as lower in a personal study ; 6 of 645 patients ( 0.9% ) were resuscitated from a ventricular fibrillation .
male gender , young age , sport , septal accessory pathway ( ap ) , short ap refractory period , atrial fibrillation ( af ) were reported as risk factors of sudden death in pre - excitation syndrome .
other indications for ap ablation were the occurrence of spontaneous av re - entrant tachycardia .
but , ablation of atrioventricular ap is not always simple either associated with a risk of failure mainly in the case of right lateral location or associated with complications as the risk of complete av block in the case of anteroseptal ( as ) or parahisian location , .
the purpose of the study was to evaluate the prevalence of ap location according to the age of patient with a pre - excitation syndrome , the clinical data and the prognosis of these patients .
the population included 994 consecutive patients referred to our center between 1990 and august 2015 for overt pre - excitation and indication for electrophysiological study ( eps ) .
patients underwent examination for various reasons : a ) 414 patients ( 41.6% ) had a known history of paroxysmal reciprocal tachycardia ; b ) 31 patients ( 3.1% ) presented with a well - tolerated af ; c ) 359 patients ( 36% ) in whom asymptomatic pre - excitation was discovered during a systematic assessment prior to anesthesia , before obtaining a sporting license , prior to employment in certain at - risk occupations , or during an ecg in the preventive medicine department or in presence of congenital heart disease ; d ) 114 patients ( 11.5% ) presented with unexplained syncope without documentation of any arrhythmia event ; e ) 76 patients ( 7.6% ) presented a poorly - tolerated tachycardia , defined as a documented life - threatening hemodynamically non - tolerated arrhythmia , with collapsus or syncope and requiring emergency treatment ( ventricular fibrillation in 7 patients , rapid and poorly - tolerated af conducted over the accessory pathway in 68 patients rapid and poorly - tolerated reentrant tachycardia in one patient ) .
the retrospective study of patients ' files was approved by the commission nationale informatique et liberts ( cnil ) , in keeping with french law for single - center usual care observational studies . prior to eps and ablation ,
informed consent was obtained for clinical purposes from all patients and in the case of children , from children and their parents .
the protocol included systematic non - invasive ( 24 h holter monitoring and exercise testing ) and invasive studies .
eps was performed systematically generally by transesophageal route in asymptomatic patients or patients with undocumented tachycardia , or by conventional intracardiac method .
1 reports the number of patients studied only by esophageal route ( the most frequent ) , only intracardiac route or by both routes .
briefly , incremental atrial pacing was performed until the highest rate conducted 1/1 through the ap and/or atrioventricular node .
programmed atrial stimulation at a basic cycle length of 600 and 400 ms with the respective introduction of one and two extra - stimuli was performed . for the measurement of the ap effective refractory period ( ap erp ) , one atrial extra - stimulus was delivered after 7 paced atrial stimuli at a cycle length of 400 ms from 390 ms until the ap refractory pathway or the atrial effective refractory period with 10-msec decrements .
the disappearance of the pre - excitation pattern was indicated upon reaching the ap erp .
when a fast af conducted over ap was induced with this method , the protocol was halted ; in the absence of induction of tachycardia conducted over ap at a rate higher than 240 bpm , isoproterenol ( 0.021 g min ) was infused to increase sinus rate to at least 130 bpm after which the pacing protocol was repeated .
pre - excitation was characterized by the following data : ap location was determined with the 12-lead ecg recorded in maximal pre - excitation according to classical data , , , , , , , , , , , .
the location is easy and reliable for left ap and right or left posteroseptal location .
it is more difficult to differentiate with certainty a right lateral or a parahisian ap ( errors in 25% of cases ) .
nodo - ventricular ap is diagnosed by the absence of modification of preexcited qrs and a progressive increase of av interval when premature extrastimuli are used .
the exact location of ap was determined by intracardiac route by the determination of the site where atrioventricular conduction was the shortest in bipolar and unipolar recording in 494 patients .
other mapping criteria used for the location were the earliest ventricular activation , the recording of ap potential , and the successful ablation site when decision of ablation was made .
the presence of a his bundle potential near this site in a patient without criteria of malignancy were contraindications of ablation for our group in the past ( before 2010 ) .
sustained af or reciprocating tachycardia was defined as a tachycardia lasting longer than 1 min .
conduction over the ap was evaluated by the maximal rate conducted over ap either in tachycardia or during atrial pacing .
pre - excitation syndrome was considered as malignant and at risk of sudden death when the following association was observed : the shortest rr interval between pre - excited beats was less than 250 ms in the control state or less or equal to 200 ms after isoproterenol infusion during induced sustained af .
eps was considered as negative if no tachycardia was induced and a long refractory period of accessory pathway ( 250 ms in control state and > 200 ms after isoproterenol ) was noted , .
when ablation was indicated , ablation was performed by the same senior operator with different assisting clinical fellows .
ap ablation was made with a 7f deflectable catheter with a 4 mm electrode by searching the site where atrioventricular conduction was the shortest in bipolar and unipolar recording .
after investigations , asymptomatic patients in whom there were no electrophysiological criteria for malignancy were not treated and ablation was not indicated .
ablation of ap was proposed in symptomatic patients or asymptomatic patients with detection of a potentially malignant form of the disease .
antiarrhythmic therapy with beta - blocker and/or flecainide was the preferred mode of treatment in small children , in patients with an anteroseptal ap and in patients who refused ablation .
patients were followed during 5.1 5 years patients in whom ablation was performed had a clinical visit and a standard - ecg systematic one month after ablation . in those who remained symptomatic despite a normal ecg , 24 h holter monitoring was systematic and generally a transesophageal electrophysiological study was performed . in patients
in whom ablation was not performed , telephonic interviews with the patient and the medical referent were performed .
data were expressed as means standard deviation ( sd ) or proportions , as appropriate .
categorical variables were compared using the chi - square test and continuous variables with the unpaired t test .
univariable logistic regression was used with the following dependent variables , age , gender , ap location , history of poorly - tolerated tachycardia and hemodynamically poorly - tolerated tachycardia occurrence during follow - up , malignant form at electrophysiological study .
variables associated with the considered outcome with a p value < 0.10 in univariable analysis were entered in the multivariable models .
all statistical analyses were performed using the spss package for windows ( version 20 , spss inc , chicago , illinois ) .
the population included 994 consecutive patients referred to our center between 1990 and august 2015 for overt pre - excitation and indication for electrophysiological study ( eps ) .
patients underwent examination for various reasons : a ) 414 patients ( 41.6% ) had a known history of paroxysmal reciprocal tachycardia ; b ) 31 patients ( 3.1% ) presented with a well - tolerated af ; c ) 359 patients ( 36% ) in whom asymptomatic pre - excitation was discovered during a systematic assessment prior to anesthesia , before obtaining a sporting license , prior to employment in certain at - risk occupations , or during an ecg in the preventive medicine department or in presence of congenital heart disease ; d ) 114 patients ( 11.5% ) presented with unexplained syncope without documentation of any arrhythmia event ; e ) 76 patients ( 7.6% ) presented a poorly - tolerated tachycardia , defined as a documented life - threatening hemodynamically non - tolerated arrhythmia , with collapsus or syncope and requiring emergency treatment ( ventricular fibrillation in 7 patients , rapid and poorly - tolerated af conducted over the accessory pathway in 68 patients rapid and poorly - tolerated reentrant tachycardia in one patient ) .
the retrospective study of patients ' files was approved by the commission nationale informatique et liberts ( cnil ) , in keeping with french law for single - center usual care observational studies . prior to eps and ablation ,
informed consent was obtained for clinical purposes from all patients and in the case of children , from children and their parents .
the protocol included systematic non - invasive ( 24 h holter monitoring and exercise testing ) and invasive studies .
eps was performed systematically generally by transesophageal route in asymptomatic patients or patients with undocumented tachycardia , or by conventional intracardiac method .
1 reports the number of patients studied only by esophageal route ( the most frequent ) , only intracardiac route or by both routes .
briefly , incremental atrial pacing was performed until the highest rate conducted 1/1 through the ap and/or atrioventricular node .
programmed atrial stimulation at a basic cycle length of 600 and 400 ms with the respective introduction of one and two extra - stimuli was performed . for the measurement of the ap effective refractory period ( ap erp ) , one atrial extra - stimulus was delivered after 7 paced atrial stimuli at a cycle length of 400 ms from 390 ms until the ap refractory pathway or the atrial effective refractory period with 10-msec decrements .
the disappearance of the pre - excitation pattern was indicated upon reaching the ap erp .
when a fast af conducted over ap was induced with this method , the protocol was halted ; in the absence of induction of tachycardia conducted over ap at a rate higher than 240 bpm , isoproterenol ( 0.021 g min ) was infused to increase sinus rate to at least 130 bpm after which the pacing protocol was repeated .
pre - excitation was characterized by the following data : ap location was determined with the 12-lead ecg recorded in maximal pre - excitation according to classical data , , , , , , , , , , , .
the location is easy and reliable for left ap and right or left posteroseptal location .
it is more difficult to differentiate with certainty a right lateral or a parahisian ap ( errors in 25% of cases ) .
nodo - ventricular ap is diagnosed by the absence of modification of preexcited qrs and a progressive increase of av interval when premature extrastimuli are used .
the exact location of ap was determined by intracardiac route by the determination of the site where atrioventricular conduction was the shortest in bipolar and unipolar recording in 494 patients .
other mapping criteria used for the location were the earliest ventricular activation , the recording of ap potential , and the successful ablation site when decision of ablation was made .
the presence of a his bundle potential near this site in a patient without criteria of malignancy were contraindications of ablation for our group in the past ( before 2010 ) .
sustained af or reciprocating tachycardia was defined as a tachycardia lasting longer than 1 min .
conduction over the ap was evaluated by the maximal rate conducted over ap either in tachycardia or during atrial pacing .
pre - excitation syndrome was considered as malignant and at risk of sudden death when the following association was observed : the shortest rr interval between pre - excited beats was less than 250 ms in the control state or less or equal to 200 ms after isoproterenol infusion during induced sustained af .
eps was considered as negative if no tachycardia was induced and a long refractory period of accessory pathway ( 250 ms in control state and > 200 ms after isoproterenol ) was noted , .
when ablation was indicated , ablation was performed by the same senior operator with different assisting clinical fellows .
ap ablation was made with a 7f deflectable catheter with a 4 mm electrode by searching the site where atrioventricular conduction was the shortest in bipolar and unipolar recording .
after investigations , asymptomatic patients in whom there were no electrophysiological criteria for malignancy were not treated and ablation was not indicated .
ablation of ap was proposed in symptomatic patients or asymptomatic patients with detection of a potentially malignant form of the disease .
antiarrhythmic therapy with beta - blocker and/or flecainide was the preferred mode of treatment in small children , in patients with an anteroseptal ap and in patients who refused ablation .
patients were followed during 5.1 5 years patients in whom ablation was performed had a clinical visit and a standard - ecg systematic one month after ablation . in those who remained symptomatic despite a normal ecg , 24 h holter monitoring was systematic and generally a transesophageal electrophysiological study was performed . in patients
in whom ablation was not performed , telephonic interviews with the patient and the medical referent were performed .
data were expressed as means standard deviation ( sd ) or proportions , as appropriate .
categorical variables were compared using the chi - square test and continuous variables with the unpaired t test .
univariable logistic regression was used with the following dependent variables , age , gender , ap location , history of poorly - tolerated tachycardia and hemodynamically poorly - tolerated tachycardia occurrence during follow - up , malignant form at electrophysiological study .
variables associated with the considered outcome with a p value < 0.10 in univariable analysis were entered in the multivariable models .
all statistical analyses were performed using the spss package for windows ( version 20 , spss inc , chicago , illinois ) .
1general data on the location of ap in total population : general data on the location of ap in total population : as ap location was identified in 94 patients aged 657 years .
remaining patients had a different location , right or left posteroseptal ( ps ) location in 459 patients , left lateral ( ll ) location in 359 patients and or nodo - ventricular ( nv ) ap in 22 patients . in 8 patients ,
2 locations were identified ; one of them had right ps location associated with as ap .
three patients had associated ps ap and right lateral ap ; they were classified with right lateral location .
three patients had a ll and ps ap and another patient had a ll ap and a nv ap ; they were classified as ll location . in 2 patients only studied by esophageal route the differentiation of as and rl was not possible and patients were classified with as location . therefore , 96 patients were classified as having as ap location , 54 as having rl ap location , 459 as having ps ap location , 363 as having ll ap location and 22 as having a nv ap.2clinical data according to ap location ( table 1 ) : clinical data according to ap location ( table 1 ) : patients with as ap or rl ap were younger than patients with another ap location ( 25 13 , 25.5 14 vs 33.2 17.5 for ps ap , p < 0.001 , 36.6 16.7 for llap , p < 0.0001 ) .
the incidence by range of age was significantly higher among patients with nv , as and rl ap location before 20 years than after 19 years compared to patients with ps and ll ap location .
the statistical differences for as ap were 0.006 for ps ap and < 0.0001 for ll ap .
the statistical differences for rl ap were 0.03 for ps ap and < 0.00001 for ll ap .
the differences continuously increased with age ( table 2 ) . after 59 years as ap , rl ap or nv ap were exceptional .
male gender was significantly more frequent in patients with rl ap ( 76.5% ) ( p 0.03 ) than in all other locations .
the indications for eps differed according ap location but only for ll ap and nv ap location ; patients with ll or nv ap were less frequently asymptomatic than patients with another ap location : the differences were highly significant for ll ap ( 0.0006 compared to as ap , < 0.0001 for rl ap and < 0.0001 for ps ap ) .
poorly - tolerated arrhythmias were more frequent in patients with ll ap than in patients with another location ( p 0.009 for as ap , 0.0037 for rl ap and < 0.0001 for ps ap ) .
patients with rl ap have less frequently spontaneous reentrant tachycardia than patients with ll ap ( p 0.004).3electrophysiological data according to ap location ( table 1 ) : electrophysiological data according to ap location ( table 1 ) : maximal rate conducted over ap was significantly slower in basal state in patients with as ap than in patients with another ap location , except with rl ap location . statistical data for as ap were 0.002 compared to ps location , < 0.001 compared to ll ap and 0.04 between rl ap and ll ap .
after isoproterenol , maximal rate conducted over ap was significantly slower for as and rl ap compared to ps and ll ap ( 0.03 for ps ap compared to as ap , 0.044 for ps ap compared to rl ap ; < 0.0002 for ll ap compared to as ap , 0.02 for ll ap compared to rl ap ) .
atrio - ventricular reentrant tachycardia ( avrt ) was more frequently induced in patients with ll ap ( 67% ) than in patients with all other ap locations ( 0.002 compared to rl ap , 0.004 compared to as ap , < 0.0001 compared to ps ap ) .
the induction of af was less frequent in patients with as ap and ps ap than in patients with ll ap ( 0.005 between as ap and ll ap , 0.0001 between ps ap and ll ap ) .
the number of potentially malignant forms at eps was more frequent in patients with ll ap than in patients with as ap ( 0.002 ) or patients with ps ap ( 0.001 ) and differences were not significant with patients with rl ap.4data of patients in whom intracardiac electrophysiological study was performed in view of ap ablation ( table 3 ) : data of patients in whom intracardiac electrophysiological study was performed in view of ap ablation ( table 3 ) : intracardiac study was indicated in 494 of 994 patients ( 49.7% ) with a pre - excitation syndrome for spontaneous paroxysmal reciprocal tachycardia in 277 patients ( 56% ) , for well - tolerated af in 19 patients ( 3.9% ) , for pathological esophageal study in 84 asymptomatic patients ( induced avrt in 30 patients , induced in af with a rapid conduction over ap 44 patients , short ap erp in 10 athletes ) ; 35 patients ( 8.3% ) had pre - excitation syndrome - related syncope at esophageal study ( induced avrt 30 , induced antidromic tachycardia 1 , induced af with a rapid conduction over ap 4 ) ; 65 patients ( 13.2% ) had a spontaneous poorly - tolerated tachycardia ; in 13 patients the initial exploration was performed directly by intracardiac route at the demand of the patient .
the details of patients studied by intracardiac study are detailed in fig . 1 .
patients with as ap or rl ap were still younger than patients with another ap location ( 25 13 , 25 12 vs 33 17 for ps ap , p < 0.002 , 36.5 16 , for ll ap p < 0.0001 ) .
male gender was significantly more frequent in patients with rl ap than in all other locations ( 87% ) ( p 0.01 for ll and ps location , 0.02 for as ap ) fig . 2 . the indications for eps did not differ except for spontaneous avrt more frequent in patients with as ap than in patients with rl ap and for spontaneous af more frequent in patients with rl ap compared to patients with as ap or ps ap .
spontaneous malignant form was more frequent in patients with ll ap than in patients with as ap ( p 0.04 ) and in patients with ps ap ( < 0.0001 ) .
electrophysiological data according to ap location were also similar to the data of whole population ( table 3 ) .
the maximal rate conducted over ap was significantly slower in basal state in patients with as ap than in patients with another ap location , except with rl ap location .
the statistical data for as ap were 0.001 compared to ps location and 0.0005 compared to ll ap .
after isoproterenol maximal rate conducted over ap was significantly slower for as and rl ap compared to ps and ll ap ( 0.0065 for ps ap compared to as ap , 0.0065 for ps ap compared to rl ap ; 0.01 for ll ap compared to as ap , 0.004 for ll ap compared to rl ap ) .
the induction of avrt was more frequent in patients with ll ap ( 67% ) than with all other ap locations that did not differ for this induction ( p < 0.0001 for rl ap , 0.023 for as ap , < 0.0001 for ps ap ) .
the induction of af was less frequent in patients with ps ap than in patients with rl ap ( 0.013 ) and in patients with ll ap ( 0.005 ) .
the number of potentially malignant forms at eps was more frequent in patients with ll ap than in patients with as ap ( p 0.02 ) and patients with ps ap ( 0.006).5follow - up patients were followed from 2 months to 20 years ( mean 5.1 5 years ) .
ablation was indicated as frequently in patients with as , rl , ps and ll ap . however the success of ablation was significantly higher in patients with ll ap compared to as ap ( < 0.0001 ) or rl ap ( 0.008 ) and in patients with ps ap compared to patients with as ap ( < 0.0001 ) or rl ap ( 0.02 ) : ablation was successful in 403 patients . in 12 patients ablation was not performed because his potential recording was very near of ap in 11 patients with as ap and in one patient with a rl ap because conduction over ap was poor and tachycardia was not induced .
reappearance of ap was noted in 35 patients ( 14 patients with ll ap ( 7% ) , 11 with ps ap ( 5.3% ) , 3 with a rl ap ( 13% ) ( ns ) and 7 with as ap ( 14.5% ) ( 0.02 compared to ll ap and ps ap ) ) .
ablation failed in 43 patients ( 7 with ll ap ( 3.4% ) , 22 with ps ap ( 10.5% ) , 6 with as ap ( 12.5% ) ( 0.01 compared to ll ap ) , 4 with rl ap ( 17% ) .
one complete av occurred in a patient with as ap but this patient was seen at the beginning of the ablation technique . among the 591 patients with failure of ablation ( n = 91 ) or not treated by ap ablation ( n = 500 ) a spontaneous poorly - tolerated arrhythmia occurred in 9 patients : 3 patients with a ll ap developed this event ; one patient only had initially reentrant tachycardia , one patient was asymptomatic and one had initially a well - tolerated af .
six patients with a ps ap developed a spontaneous poorly - tolerated arrhythmia ; 4 had initially reentrant tachycardia and 2 were asymptomatic .
a second eps was performed in 123 patients between 6 and 9 years later ( mean 7.9 4 ) .
the reasons were various : in 10 patients initially studied for unexplained syncope , 2 had still syncope , 4 had symptoms of tachycardia , 3 were asymptomatic and one presented af . in 62 patients with initially reentrant tachycardia ,
9 were asymptomatic , 3 had syncope , 3 had af , 2 had a spontaneous malignant form and 45 had still symptoms of tachycardia . in 42 initially asymptomatic patients , 5 had syncope , 2 had af , 2 had a spontaneous malignant form , 10 had symptoms of tachycardia and 23 patients remained asymptomatic .
ap has lost the anterograde conduction properties in 9 of 40 patients with a ll ap ( 22.5% ) , 10 of 49 patients with a ps ap ( 20.4% ) , 8 of 20 patients with as ap ( 40% ) and 6 of 13 patients with rl ap ( 46% ) .
the differences were not significant.6multivariate analysis : multivariate analysis : age , ll ap location and ps ap location were independent factors of the occurrence of a spontaneous poorly - tolerated arrhythmia ( table 4 ) . spontaneous poorly - tolerated arrhythmia and ll ap location were independent factors to find signs of malignancy at electrophysiological study ( table 4 ) .
patients with as ap or rl ap are younger than patients with another ap location .
they had a slower maximal heart rate conducted over ap than patients with another ap location .
spontaneous malignant form and malignant form identified by electrophysiological study were more frequent in patients with ll ap than in patients with another ap location . during the follow - up in untreated patients , spontaneous poorly - tolerated arrhythmia only occurred in patients with ll or ps ap .
therefore in the case of difficult or failed ap ablation of young patients with as or rl ap , it is recommended to wait a spontaneous disappearance of ap except in patients with signs of malignancy .
data on patients with nv ap were not analyzed because these patients were too rare to obtain significant differences .
we could provide hypothesis , even if speculative , for these results and these different features of aps according to their location .
left - sided aps have higher rates of induced af because of their higher conduction rates ; but older age of these patients could be the cause of favoring af vulnerability with consequently that left aps represent more malignant substrates ?
several studies reported the data of electrocardiographic characteristics according to their localization , , , , , .
haghjoo compared the data of 120 patients with as , midseptal and ps ap and reported that midseptal aps were characterized by faster orthodromic tachycardia , whereas posteroseptal aps had a higher inducibility of atrial fibrillation .
several data differ from previously reported data probably because the old group studies were of small number .
for example , arya reported that conduction properties of accessory pathways ( aps ) are independent of location and conduction mode ( except in patients with multiple , mahaim , and slowly conducting aps ) .
patients with right - sided aps showed higher rates of atrial fibrillation and longer arrhythmia cycle length due to slower anterograde conduction over the atrioventricular node during atrioventricular reentrant tachycardia .
some of our data were similar to data of de chillou and al in 1992 .
the authors reported that location of the accessory av pathway was associated with specific electrophysiologic characteristics .
as in our study later age at onset of symptoms in the left free wall versus other ap locations and later age at the time of eps in the left free wall ap location were reported .
orthodromic reentrant tachycardia was induced less frequently in the right free wall than in other locations and inducibility of af was greater in anteroseptal ( 62% ) than in right free wall ( 21% ) , left free wall ( 44% ) and posteroseptal ( 36% ) locations ( p = 0.01 ) . in the present study induction of avrt was only more frequent in patients with ll ap than in other ap locations and af was rarely induced in patients with as ap ( 17% ) . in a small group of 45 patients , kentsch reported that antegrade effective refractory periods of septally located accessory pathways were significantly longer than of pathways located in the free wall of the ventricles .
luria in a small group of 24 patients with inducible antidromic tachycardia reported a significantly longer anterograde conduction time through the ap and retrograde atrioventricular nodal conduction time in patients with paraseptal versus lateral pathways . in the literature , complications of rf ap ablations were not rare and mainly reported for as location , , , , , , , despite a trend for an actual lower risk , , , . in the study of shaffer in children ,
inadvertent atrioventricular block was related to the ablation anatomic site : ( 2.7% ) anteroseptal , ( 10.4% ) midseptal , and ( 1.0% ) right posteroseptal sites ( p = 0.0007 for anteroseptal , p = 0.0001 for midseptal , and p = 0.17 for right posteroseptal versus left septal sites ) .
moreover , in the present study , the prevalence of unsuccessful ablation was higher in patients with as ap or rl ap without real negative prognosis value for the follow - up .
even there was no statistical difference , but more than 20% ( from 20 to 45% ) of these patients demonstrated loss of antegrade ap conduction with time and this data should be noted in patients with ablation at risk of complications or in patients with few symptoms refusing ablation .
only 494 of 994 patients had the confirmation of exact ap location by intracardiac study .
as noted previously ecg in maximal pre - excitation can not always differentiate anteroseptal and right lateral ap ( errors in 25% of cases ) . however , clinical and electrophysiological data of these 2 locations were similar ( younger age and slower anterograde conduction over ap ) .
the discrepancies only concerned spontaneous symptoms of the whole population studied for a pre - excitation syndrome compared to data obtained at the time of ablation .
they are explained by the fact that asymptomatic patients frequently did not require invasive studies .
esophageal eps is sufficient to evaluate the prognosis of patients with a pre - excitation syndrome .
patients who require ablation are more symptomatic or have more induced arrhythmias or malignant forms .
katsouras ( 18 ) report the ecg data of ap 's located at left atrioventricular ring , right atrioventricular ring , left lateral / left anterolateral , left posterior / left posterolateral , left posteroseptal , right midseptal , right posteroseptal , right posterior / right posterolateral , right lateral / right anterolateral and right anterior / right anteroseptal .
the author did not find specific criteria for the many locations frequently often close to each other .
for example the successful ablation of a ps ap may require applications of radiofrequency energy at right and left posteroseptal site .
the ep features of this ap are compatible with fasciculo - ventricular aps which are known to have a bystander / innocent role and do not require ablation .
nodo - ventricular aps might be associated with pre - excitation change depending on their take - off level from the av node , and they may also participate in reentrant tachycardias requiring ablation .
the rationale for the classification of 10 patients with multiple or unknown location and the exclusion of statistical analysis is debatable .
caution should be taken when analyzing other cohorts of patients with different races , demographical and genetic characteristics .
other limitation is that a part of patients were included in the very early era of catheter ablation ( since 1990 ) .
as and rl ap location in pre - excitation syndrome was more frequent in young patients .
absence of poorly - tolerated arrhythmias during follow - up and higher risk of ablation failure in these young patients should be taken into account for preventive indications of ap ablation or in children with few symptoms .
apaccessory pathwayafatrial fibrillationasanteroseptalavrtatrioventricular reentrant tachycardiaepselectrophysiological studyerpeffective refractory periodllleft lateralnvnodo - ventricularpsposteroseptalrlright lateral atrioventricular reentrant tachycardia electrophysiological study effective refractory period | backgroundaccessory pathway ( ap ) ablation is not always easy .
our purpose was to assess the age - related prevalence of ap location , electrophysiological and prognostic data according to this location.methodselectrophysiologic study ( eps ) was performed in 994 patients for a pre - excitation syndrome .
ap location was determined on a 12 lead ecg during atrial pacing at maximal preexcitation and confirmed at intracardiac eps in 494 patients.resultsap location was classified as anteroseptal ( as)(96 ) , right lateral ( rl)(54 ) , posteroseptal ( ps)(459 ) , left lateral ( ll)(363 ) , nodoventricular ( nv)(22).patients with asap or rlap were younger than patients with another ap location .
poorly - tolerated arrhythmias were more frequent in patients with llap than in other patients ( 0.009 for asap , 0.0037 for rlap , < 0.0001 for psap).maximal rate conducted over ap was significantly slower in patients with asap and rlap than in other patients .
malignant forms at eps were more frequent in patients with llap than in patients with asap ( 0.002 ) or psap ( 0.001).similar data were noted when ap location was confirmed at intracardiac eps . among untreated patients ,
poorly - tolerated arrhythmia occurred in patients with llap ( 3 ) or psap ( 6 ) .
failures of ablation were more frequent for as or rl ap than for ll or ps ap.conclusionsas and rlap location in pre - excitation syndrome was more frequent in young patients .
maximal rate conducted over ap was lower than in other locations .
absence of poorly - tolerated arrhythmias during follow - up and higher risk of ablation failure should be taken into account for indications of ap ablation in children with few symptoms . | Introduction
Material and methods
Population of study
Protocol
Statistical analysis
Results
Discussion
Conclusions
Disclosure
Abbreviations |
primary dysmenorrhoea , in absence of a diagnosable pelvic disease and secondary dysmenorrhoea , results from pathologic pelvic problems like endometriosis and inflammatory diseases .
pain starts either before or concurrently with onset of menstruation and lasts for 12 - 72 hours .
although primary dysmenorrhoea is not life threatening and does not lead to individuals defect , it highly affects the daily life among the young women .
it is reported that 1% of the women at reproductive age do not go to work for 1 - 3 days in a month as a result of acute dysmenorrhoea , school girl absenteeism is estimated to be 14% due to painful contractions , and those who attend their work face a severe reduction in their efficiency .
this fact is of great importance from socioeconomic view and is supposed to be the main reason for waste of time at work and school . for instance , in usa , where women are accounted for 42% of total manpower , the burden is estimated to be 600 million work hours .
in contrast , dysmenorrhoea can cause psychological and mental problems in some women and leads to their social isolation and lack of their active participation in the society .
existence of pain , as a serious health problem , is considered important and should be relived due to ethical reasons and the reduction effect on psychological and physiological status promotion .
evidences show that prostaglandin f2 , which is secreted from endometrium , is responsible for dysmenorrhoea and uterine contractions stimulation .
uterine is sensitive to prostaglandin f2 in all women either with dysmenorrhoea or without , but the difference in its amount of production in dysmenorrhoea group is significant . due to lack of a unique treatment method for dysmenorrhoea and individuals various responses to the treatment different treatment methods including medication , acupuncture , skin electrical stimulation , surgery , and prescription of various vitamins and mineral have been suggested .
these medications have some side effects such as nausea , digestive system dysfunction , diarrhea , and sometimes fatigue . in addition ,
consumption of these medications is forbidden among those with peptic ulcer , or aspirin - sensitive asthmatic patients . another suggested method is physical activity , which has been noticed as a nonmedicational method .
physical activity can help venous return through muscular contraction that leads to an increase in production of prostaglandins and other substances and finally prevents their collection in the pelvis .
reduction of dysmenorrhoea in women who play sport may be resulted from the effect of hormonal changes on endometrium or increase of endorphins .
bouyancy reduces the imposed pressure to cardiovascular system so that floating in water up to neck , imposes the pressure to the lower limbs , facilitates venous return , and diminishes the load to cardiovascular system through hydrostatic pressure .
heart rate drops by 5 - 8 pulses in resting position so that the exercises , done in water accompanied at a specific maximum heart rate , have less pulse increase ( 10 - 12 pulses ) compared with the same exercises done out of water .
hydrostatic resistance also improves muscular endurance and power if aquatic exercises are designed based on scientific principles and personal characteristics and differences .
aquatic exercises have been vastly recommended to various age groups due their lower weight bearing .
barabosa studied the effect of aquatic exercises in a pool with temperature of 28 - 30c in healthy individuals and concluded that water temperature as well as doing exercises in deep part of the pool and using assistive tools ( for more buoyancy and doing power exercises with weights in water ) are of great importance .
the above study indicates aquatic exercises as an important therapeutic program for some diseases based on various researches .
numerous studies have emphasized on the association between dysmenorrhoea and regular sport activities in recent years .
showed that the needed rest time for pregnancy low back pain was reduced in water .
a comparison on 390 healthy pregnant women who exercised once a week in two separate groups of aquatic and land exercise showed that aquatic exercise during pregnancy reduced pelvic pain and low back pain leading to fewer sick leaves in this group compared with the land exercise group . in another study titled the effect of a set of isometric exercise on dysmenorrhoea
, it was concluded that isometric exercises reduced length and severity of dysmenorrhoea as well as consumption of medication among girls .
investigated the effect of a set of pilates exercises on primary dysmenorrhoea and observed a significant reduction in intensity and length of pain in pilates group after intervention .
aquatic exercise can be effective on individuals pain reduction and improvement of quality of life through empowerment of muscles and decreased pressure on the joints .
with regard to the specifications of the water , and as the effect of aquatic exercises among various exercises on primary dysmenorrhoea has not been already investigated , this study aimed to define the effect of a 12 week aquatic exercise on primary dysmenorrhoea among nonathlete girls in direction of women 's health and ability promotion .
this is a pretest posttest quasi experimental action clinical trial with control group conducted during 2010 - 2011 .
study population comprised all female nonathlete students aged 18 - 25 years in sama school of najafabad azad university and private shahid ashrafi esfahani university .
inclusion criteria were existence of primary dysmenorrhoea in most of menstruation cycles , personal desire to use a method to relieve pain , regular menstruation cycles in each 24 - 35 days , onset of pain prior to or concurrent with bleeding lasting for 12 - 72 hours , 26 > body mass index ( bmi)>19 , and being single and nonathletic .
exclusion criteria were pelvic pain during reproductive age ( having no pelvic infection or being involved in pain not related to dysmenorrhoea ) , history of a diagnosed endometriosis in immediate relatives , history of chronic diseases such as diabetes , hypertension , cardiovascular and pulmonary diseases , history of professional sport ( playing sports for 1 hour or more a day or 7 days or more a week ) and being employed .
diagnosis of primary dysmenorrhoea and the entrance of the subjects to the study was conducted based on primary dysmenorrhoea evaluation form , checking the positive answers ( yes ) to the first five questions and responding negative ( no ) to four questions out of five in the second five questions .
then , based on the above evaluation form , 40 subjects were randomly selected and assigned to a group of aquatic exercise ( n = 20 ) and control ( n = 20 ) .
the questionnaires had been already numbered and the subjects were classified based on even or odd numbers . since in the present study , it was tried to measure dysmenorrhoea , which is a subjective issue , objectively as much as possible , severity of subjects dysmenorrhoea was investigated by present pain intensity ( ppi ) and visual analogue scale ( vas ) indexes of mcgill standard pain questionnaire , which is a precise and valid tool to measure phenomenon of pain objectively .
reliability and validity of this questionnaire have been calculated by valiani et al . in 2009
mcgill standard questionnaire was given to the subjects in both groups ( as a pretest ) after menstruation to determine dysmenorrhoea signs .
it included a vas with a 5 cm ruler scored zero ( no pain ) at one end and 5 ( intolerable pain ) at the other end .
subjects ppi was measured by selecting an option from 0 to 4 ( no pain , mild pain , suffering pain , and killing pain ) .
then , the researcher obtained subjects informed written consent and give them nutritional instructions including tips on salt intake , cereals , vegetables , etc .
( some nutrient are effective on decrease or increase of pain ) to make the conditions identical for both groups .
in the next step , physical exercises for the subjects were precisely and regularly conducted between two menstruations with the attendance of the researcher in the study group for three straight cycles . at the beginning of the exercises
then , the aquatic exercises were conducted for one hour , three sessions a week in the pool . in the first week , aquatic exercises were conducted in shallow part of the pool and in other weeks in the 3-meter deep part with temperature of 28 - 30c . meanwhile , control group had no aquatic exercise at this time interval . at the end of menstruation cycle ,
the questionnaires were collected and next posttest questionnaires ( for the following months ) were given to both groups .
these exercises were educated to strengthen pelvic area muscles in order to modify blood stasis in pelvic veins and facilitate quicker blood circulation .
the aquatic exercises included 10 minutes of warming up in form of walking and running in water , 40 - 45 minutes of aerobic , endurance , flexibility , power , coordination , speed and agility in addition to other specific exercises for abdominal and pelvic muscles and thighs .
heart rate was measured by a polar pulse watch among the subjects . at the end of exercises
descriptive and analytic statistical tests were used to analyze the data through spss version 16 .
mean and standard deviation ( sd ) were adopted in descriptive statistics , one way analysis of variance ( anova ) to compare the variable in two independent groups and anova repeated observations was adopted to compare each group before and after intervention .
subjects mean age and sd in aquatic exercises and control groups were 20.25 ( 2.02 ) and 20.50 ( 1.79 ) years , subjects mean age and sd of the first menstruation were 12.58 ( 1.72 ) and 12.30 ( 1.92 ) , and mean bmi and sd were 20.72 ( 1.80 ) and 20.33 ( 2.44 ) , respectively .
one way anova showed no significant difference in mean age ( p = 0.85 , f = 0.16 ) , mean age of the first menstruation ( p = 0.61 , f = 0.49 ) , and bmi ( p = 0.83 , f = 0.18 ) in both groups before intervention . mean pain intensity , measured with scale of ppi , showed no significant difference before intervention in two groups of aquatic exercises and control ( p = 0.21 ) , and after intervention in the first menstruation than before intervention ( p = 0.48 ) , but showed a significant difference in the second and the third periods of menstruation , respectively ( p = 0.05 ) and ( p < 0.001 ) [ table 1 ] .
table 2 presents mean pain intensity of dysmenorrhoea measured by vas showed no significant difference before intervention in two groups ( p = 0.057 ) , but after intervention , it showed a significant difference in all three periods of menstruation than before intervention ( p = 0.03 ) ( p 0.001 ) .
as seen in table 3 , mean length of pain showed no significant difference before intervention ( p = 0.907 ) and after intervention in the first and second periods of menstruation than before intervention ( p = 0.52 ) ( p = 0.58 ) , but it showed a significant difference in the third period of menstruation ( p = 0.002 ) .
the results of the present study showed that pain intensity and length were reduced after 2 months of aquatic exercises in the experimental group ( through 8 weeks of aquatic exercises ) so that if physical exercise continued , dysmenorrhoea would decrease constantly .
comparison of subjects mean dysmenorrhoea pain intensity measured by ppi scale in two groups before and after intervention in each period of menstruation comparison of subjects mean dysmenorrhoea pain intensity measured by vas scale in two groups before and after intervention in each period of menstruation comparison of subjects dysmenorrhoea pain length in two groups before and after intervention in each
period of menstruation long - term effect of these exercises should be investigated by further studies .
in the present study , positive effect of 12 week aquatic exercises on nonathletic girls dysmenorrhoea was observed , which is consistent with the findings of some previous studies investigating the positive effect of exercises on primary dysmenorrhoea .
soltani in her study titled effect of a period of isometric exercises on primary dysmenorrhoea showed that these exercises could reduce low back pain and abdominal discomfort .
shahrjerdi investigated the effect of 2-month stretching exercises on primary dysmenorrhoea and concluded that these exercises reduced pain intensity and length and consumption of sedatives among school girls .
rakhshaee in her investigation on the effect of three yoga postures ( cobra cat and fish ) on primary dysmenorrhoea concluded that these exercises reduced pain intensity and length in study group .
dysmenorrhoea is possibly made due to an increase in uterine muscles contractions under influence of sympathetic system .
stress has potentiality to increase sympathetic system activity and can enhance dysmenorrhoea through increase of sympathetic system stimulation . in a study titled stress and dysmenorrhoea ,
wang et al . concluded that there was a significant association between stress and dysmenorrhoea .
they also reported that dysmenorrhoea increases among the women at higher ages and argued that sport can diminish sympathetic system stimulation and help improvement of dysmenorrhoea signs . with regard to the obtained results by vas , aquatic exercises reduce dysmenorrhoea in the first 4 weeks of the exercise .
the reason for this difference is that vas is a quantitative scale while ppi is qualitative .
the obtained results are in line with those of researches investigating the positive effect of stretching exercises on dysmenorrhoea .
rasoolzade et al . investigated the effect of relaxation on primary dysmenorrhoea and concluded that muscular relaxation can reduce dysmenorrhoea . in another study on the effect of 6-week flexibility exercises on dysmenorrhoea ,
the researchers concluded that dysmenorrhoea signs reduced after 6 weeks of flexibility exercises . some of the pilates exercises including active stretching and isometric exercises , pelvic muscles empowerment , and mental and physical relaxation can be helpful in reduction of stress . in the present study , it was shown that pain intensity and length in aquatic exercises group was decreased after 2 months of exercises and if the exercises continued , dysmenorrhoea would be reduced constantly .
kardavani investigated the effect of aquatic exercises on lumbar herniated disc pain and concluded that aquatic exercises improved pain in these patients .
in another study , the effect of 8-month aquatic exercises in warm water in the patients with fibromualgia was investigated and their physical function ( aerobic capacity , balance , muscular tone ) was improved .
reported the effect of 8-week swimming , as an aerobic sport , on reduction of physical and psychological premenstruation signs .
kanda in her study on comparison of lower limb muscles activity during walking in water and walking on land showed that aquatic exercises can stimulate flexor and extensor muscles of hip further .
she indicated the difference between walking in water and on land is due to the fact that walking in water is one of the major aquatic exercises .
it is clear that in water with lower gravity power and hydrostatic resistance as well as lower load on joints and muscle , muscles , tendons , and ligaments can be easily strengthened .
physiologic responses of the body to floating in warm water are quite similar to those to local heat , but with less concentration .
physical properties of combination of water and heat , is the reason for most of general physiologic responses affecting various systems in the body .
therefore , aquatic exercise with regard to their potential environment for activities , compared with land exercises , can be helpful for stress and pain reduction . in the present study , pain intensity and length in the study group
was reduced through 8-week aquatic exercises and if the exercises continued , dysmenorrhoea would be diminished constantly .
overall , the findings suggest that aquatic exercise in patients with primary dysmenorrhea can reduce the symptoms . since the primary dysmenorrhea can have a negative impact on women 's employment centers , can be an affordable way to make a positive impact on other aspects of women 's health is also proposed . | background : primary dysmenorrhoea without any specific pelvic disease is one of the common complaints in women`s medicine .
the general purpose of this research is to define the effects of 12-week aquatic exercises on nonathletic girls primary dysmenorrhoea.materials and methods : this quasi - experimental was conducted on 40 nonathletic girls aged 18 - 25 years .
data gathering tools were : evaluation form of primary dysmenorrhoea and the pain evaluation tool based on the mcgill standard pain questionnaire completed before and after the intervention in 3 months ( first , second , and third run ) .
then , 20 subjects were assigned to aquatic exercise group and the other 20 to control group .
the subjects in experimental group did aquatic exercise for three sessions a week for 60 minutes for 12 weeks between two menstruations .
kruskal wallis and one way analysis of variance ( anova ) tests were used to analyze the data.results:the results of this research indicated that severity and duration of pain decreased after 12 weeks of aquatic exercises .
comparison of the two groups showed a significant difference in pain intensity based on visual analogue scale ( vas ) scale after these exercises ( first , second , and third runs ) .
present pain intensity ( ppi ) scale after these exercises ( second and third runs ) showed a significant difference .
comparison of the two groups showed a significant difference in length of pain after these exercises ( third run).conclusions : totally , the findings of the present study showed that 12-week regular aquatic exercises are effective on decrease of the severity of the symptoms of primary dysmenorrhoea . | I
M
R
D
C |
eyelid tumors are uncommon and represent 5 - 10% of all skin cancers . basal cell carcinoma ( bcc )
is the most common histological type representing 90% of all cases followed by squamous cell carcinoma ( scc ) , and less frequently by sebaceous cell carcinoma ( sbcc ) , merkel cell tumor and melanoma .
the most common localization are the lower eyelid ( 50 - 60% ) and medial canthus ( 25 - 30% ) .
basal cell carcinoma are slow growing tumors with a metastatic rate ranging from 0.003 to 0.5% but they can be locally invasive infiltrating the lid margin or the lachrymal glands producing functional disability [ 2 , 3 ] .
squamous cell carcinoma are more aggressive than bcc : about 5% are metastatic and in these patients 5-year survival rate is only 25 - 40% .
many treatment approaches are available : surgery , radiotherapy , cryotherapy , curettage , electrodissection , photodynamic therapy , and laser ablation .
surgery is considered the gold standard therapy , and the treatment aims are definitive tumor control and preservation of the functional structures [ 6 , 7 , 8 ] .
radiotherapy is also a good alternative if preservation of functional structures is not possible with surgery .
brachytherapy ( bt ) might be a better therapeutic option due to intrinsic advantages , including high radiation dose concentration into the tumor and rapid dose fall - off at target periphery with optimal sparing of normal tissues in these sensitive structures in shorter treatment time . despite the potential interest about the bt in the treatment of these tumors , randomized controlled trials , systematic reviews and/or metanalyses are lacking in literature .
therefore , the aim of this review was to systematically evaluate the available literature on local control and functional cosmetic outcome after bt of non melanoma skin cancer ( nmsc ) of eyelids .
a systematic search strategy of the bibliographic data - bases pubmed , scopus , and cochrane library from the earliest possible date through october 13 , 2015 was performed [ 9 , 10 , 11 ] .
the search strategy was based on the following terms : ( eyelid neoplasms[mesh terms ] or ( eyelid[all fields ] and neoplasms[all fields ] ) or
eyelid neoplasms[all fields ] or ( eyelid[all fields ] and cancer[all fields ] ) or
[ all fields ] ) and ( brachytherapy[mesh terms ] or brachytherapy[all fields ] ) . to avoid missing relevant studies we chose this strategy with high sensitivity but low specificity .
type of studies : we included human studies of any design ( randomized , prospective , retrospective studies ) and case series with exception of case reports .
types of participants : studies reporting on patients with a diagnosis of non melanoma skin cancer of eyelid based on histological evaluation were included .
type of interventions : eligible intervention included bt in nmsc of eyelid independently of technique , dose , dose rate , and treatment setting ( curative or adjuvant ) .
the secondary outcomes were acute - late toxicity and functional cosmetic results independently of used scales .
two independent authors ( rf , gm ) screened citations at the abstract level to identify potentially relevant studies and case series .
potentially eligible citations were retrieved for full - text review , with disagreements resolved by a third author ( agm ) .
we obtained the following information from each report : author identification , year of publication , medical center , study design characteristics , study population , bt technique , delivered dose , total treatment time , local control , toxicity , and functional cosmetic outcome . in the studies where
overall treatment time was not reported it was calculated based on dose rate and total dose .
scottish intercollegiate guidelines network ( sign ) criteria was used to classify the quality of evidence .
type of studies : we included human studies of any design ( randomized , prospective , retrospective studies ) and case series with exception of case reports .
types of participants : studies reporting on patients with a diagnosis of non melanoma skin cancer of eyelid based on histological evaluation were included .
type of interventions : eligible intervention included bt in nmsc of eyelid independently of technique , dose , dose rate , and treatment setting ( curative or adjuvant ) .
the secondary outcomes were acute - late toxicity and functional cosmetic results independently of used scales .
two independent authors ( rf , gm ) screened citations at the abstract level to identify potentially relevant studies and case series .
potentially eligible citations were retrieved for full - text review , with disagreements resolved by a third author ( agm ) .
we obtained the following information from each report : author identification , year of publication , medical center , study design characteristics , study population , bt technique , delivered dose , total treatment time , local control , toxicity , and functional cosmetic outcome . in the studies where
overall treatment time was not reported it was calculated based on dose rate and total dose .
scottish intercollegiate guidelines network ( sign ) criteria was used to classify the quality of evidence .
through a process of screening the title and the abstract , 9 articles were identified [ 13 , 14 , 15 , 16 , 17 , 18 , 19 , 20 , 21 ] .
after full text , review of 3 articles on skin cancer bt were excluded because eyelid tumors data were not reported separately [ 16 , 17 , 18 ] .
the characteristics of these studies included in the review are summarized in table 1 [ 13 , 14 , 15 , 19 , 20 , 21 ] .
no randomized controlled trials or case control studies were founded . of the selected studies , 1 was prospective while the others were retrospective reports [ 13 , 15 , 19 , 20 , 21 ] .
because of high risk of confusion or bias , all studies were classified to provide a level of evidence graded as 3 according to sign classification .
flow chart of systematic search and review process summary of studies where brachytherapy was used in non melanoma skin cancer of eyelid scc squamous cell carcinoma , bcc basal cell carcinoma , sbcc sebaceous cell carcinoma , hdr high - dose - rate , ldr low - dose - rate , mcc merkel cell carcinoma , pni perineural invasion summary of outcome of 5 studies included in our review
nr not reported , lc local control in 1 patient was not possible to evaluated functional and cosmetic outcome in all studies , interstitial bt with ir source was the used technique . both low - dose - rate ( ldr ) in 3 studies [ 13 , 14 , 19 ] and high - dose - rate ( hdr ) in the other 3 studies [ 15 , 20 , 21 ] were used .
the overall treatment time did not exceed 1 week [ 13 , 14 , 15 , 19 , 20 , 21 ] . in the ldr group ,
biopsy was performed in 131 lesions and the results were : 85% bcc , 14.5% scc , and 0.5% adenocarcinoma .
tumor size was < 2 cm in 79.5% of cases , and 2 - 5 cm in 20% . according to histotype ,
the delivered dose was 60 gy for bcc and 70 gy for scc , with a dose rate ranging from 65 to 90 cgy / h .
reported the results of 60 patients , 51 patients with primary unresected carcinoma , 5 patients with local recurrence , and 4 patients treated with postoperative bt .
mean delivered dose was 65 gy ( range 51 - 70 gy ) with dose rate ranging from 50 to 60 cgy / h . with a mean follow - up of 92 months ,
local failure rate was 3.3% in previously untreated lesions ( 2 patients with t2 carcinoma ) .
conill et al . reported the results of 24 tumors involving the eyelid tarsal structure treated with curettage and bt .
the delivered dose was 40 gy with a mean dose rate 73 cgy / h .
the reported local control rate was 91.6% . in the hdr group , two institution were in india [ 15 , 20 ] and one in portugal . in india ,
the most common eyelid tumors are scc and sbcc , which are considered to be more aggressive .
forty five nmsc of eyelid were included and treated with different total dose and fractionation [ 15 , 20 , 21 ] .
reported the results of 20 patients with different histotype ( 50% scc , 40% sbcc and 10% bcc ) .
overall , 5-year local control rate was 75.6% ( scc : 90% ; sbcc : 57.1% ; bcc : 50% ) .
the median tumor size was 11 mm but 3 patients were t4 . delivered dose ranged from 21 gy in 7 fractions to 35 gy in 10 fractions ( twice daily fractionation with 6 - 8 hours gap ) .
no local recurrences were reported but two patients had nodal recurrence 6 months after interstitial bt .
the last study reported the results of 17 patients , where bt was delivered in different setting ( curative : 2 patients , postoperative : 12 patients , salvage after surgery : 3 patients ) .
the median total dose was 42.75 gy ( range : 32 - 50 gy ) with a median of 10 fractions ( range : 9 - 11 fractions ) , twice daily fractionation with 6 hours gap .
four studies did not use eye shield [ 13 , 14 , 15 , 19 ] .
one study used a shield conformer from dental prosthesis material and the other one a lead shielding covered with paraffin to prevent additional dose to healthy tissues of the eye .
edematous reaction , lid erythema , and conjunctivitis were the most common acute toxicity reported , ranging from 12% to 100% of cases [ 14 , 15 , 19 , 20 , 21 ] .
radiodermatitis g1 , g2 , and g3 were reported in one study ( 52% , 12% , and 12% , respectively ) .
also g1 keratitis were reported in 21.7% of cases and some patients required local therapy or systemic therapy .
one study reported hematoma after needle insertion in 46% of patients but was resolved without therapy . in another study , 6 - 8 weeks after the implant , persistent edematous ( 29.6% ) and conjunctival reaction ( 12% ) were observed .
epilation of the treated area was the most common late toxicity reported ranging 65 - 100% [ 13 , 14 , 15 , 21 ] .
pigmentation was reported in four studies ranging from 10% to 47% [ 13 , 15 , 20 , 21 ] and lid fibrosis in two studies ranging from 15% to 18% [ 15 , 21 ] .
other late toxicities reported less frequently were : lacrimal duct stenosis ( range 6.7 - 9.5% ) [ 13 , 19 ] , eyelid fissure impairment ( 5.5 - 12% ) [ 13 , 21 ] , epiphora ( range 5 - 25% ) [ 13 , 19 , 20 ] , unilateral cataract ( 3.3% ) , ectropion ( range 4.4 - 14.2% ) [ 13 , 20 ] , entropion ( 23% ) , conjunctivitis ( 42% ) , keratoconjuctivitis secca ( 46% ) , eyelid malocclusion ( 46% ) , edema ( 18% ) , fibrosis ( 18% ) , pruritus ( 46% ) , hyperlacrimation ( 18% ) , and small corneal ulcer ( 0.6% ) .
recurrent lesions and larger volumes were associated with worse outcomes [ 13 , 21 ] .
functional and cosmetic outcome were reported according to the physicians or patients judgement , cosmesis after interstitial brachytherapy ( caib ) scale or not specified [ 14 , 15 ] . only in one study was cosmesis graded and documented using a 6 domain objective scoring criteria ( depigmentation of skin , eyelid dysfunction like ectropion or entropion , dry eye , keratitis , cataract , and glaucoma ) .
functional and cosmetic outcomes were reported in 5 studies and graded as optimal to good / excellent in 68.3 - 100% , respectively [ 14 , 15 , 19 , 20 , 21 ] .
both low - dose - rate ( ldr ) in 3 studies [ 13 , 14 , 19 ] and high - dose - rate ( hdr ) in the other 3 studies [ 15 , 20 , 21 ] were used .
the overall treatment time did not exceed 1 week [ 13 , 14 , 15 , 19 , 20 , 21 ] . in the ldr group ,
biopsy was performed in 131 lesions and the results were : 85% bcc , 14.5% scc , and 0.5% adenocarcinoma .
tumor size was < 2 cm in 79.5% of cases , and 2 - 5 cm in 20% . according to histotype ,
the delivered dose was 60 gy for bcc and 70 gy for scc , with a dose rate ranging from 65 to 90 cgy / h .
reported the results of 60 patients , 51 patients with primary unresected carcinoma , 5 patients with local recurrence , and 4 patients treated with postoperative bt .
mean delivered dose was 65 gy ( range 51 - 70 gy ) with dose rate ranging from 50 to 60 cgy / h . with a mean follow - up of 92 months ,
local failure rate was 3.3% in previously untreated lesions ( 2 patients with t2 carcinoma ) .
conill et al . reported the results of 24 tumors involving the eyelid tarsal structure treated with curettage and bt .
the delivered dose was 40 gy with a mean dose rate 73 cgy / h .
the reported local control rate was 91.6% . in the hdr group , two institution were in india [ 15 , 20 ] and one in portugal . in india ,
the most common eyelid tumors are scc and sbcc , which are considered to be more aggressive .
forty five nmsc of eyelid were included and treated with different total dose and fractionation [ 15 , 20 , 21 ] .
reported the results of 20 patients with different histotype ( 50% scc , 40% sbcc and 10% bcc ) .
overall , 5-year local control rate was 75.6% ( scc : 90% ; sbcc : 57.1% ; bcc : 50% ) .
the median tumor size was 11 mm but 3 patients were t4 . delivered dose ranged from 21 gy in 7 fractions to 35 gy in 10 fractions ( twice daily fractionation with 6 - 8 hours gap ) . no local recurrences were reported but two patients had nodal recurrence 6 months after interstitial bt .
the last study reported the results of 17 patients , where bt was delivered in different setting ( curative : 2 patients , postoperative : 12 patients , salvage after surgery : 3 patients ) .
the median total dose was 42.75 gy ( range : 32 - 50 gy ) with a median of 10 fractions ( range : 9 - 11 fractions ) , twice daily fractionation with 6 hours gap .
four studies did not use eye shield [ 13 , 14 , 15 , 19 ] .
one study used a shield conformer from dental prosthesis material and the other one a lead shielding covered with paraffin to prevent additional dose to healthy tissues of the eye .
edematous reaction , lid erythema , and conjunctivitis were the most common acute toxicity reported , ranging from 12% to 100% of cases [ 14 , 15 , 19 , 20 , 21 ] .
radiodermatitis g1 , g2 , and g3 were reported in one study ( 52% , 12% , and 12% , respectively ) .
also g1 keratitis were reported in 21.7% of cases and some patients required local therapy or systemic therapy .
one study reported hematoma after needle insertion in 46% of patients but was resolved without therapy . in another study , 6 - 8 weeks after the implant , persistent edematous ( 29.6% ) and conjunctival reaction ( 12% ) were observed .
epilation of the treated area was the most common late toxicity reported ranging 65 - 100% [ 13 , 14 , 15 , 21 ] .
pigmentation was reported in four studies ranging from 10% to 47% [ 13 , 15 , 20 , 21 ] and lid fibrosis in two studies ranging from 15% to 18% [ 15 , 21 ] .
other late toxicities reported less frequently were : lacrimal duct stenosis ( range 6.7 - 9.5% ) [ 13 , 19 ] , eyelid fissure impairment ( 5.5 - 12% ) [ 13 , 21 ] , epiphora ( range 5 - 25% ) [ 13 , 19 , 20 ] , unilateral cataract ( 3.3% ) , ectropion ( range 4.4 - 14.2% ) [ 13 , 20 ] , entropion ( 23% ) , conjunctivitis ( 42% ) , keratoconjuctivitis secca ( 46% ) , eyelid malocclusion ( 46% ) , edema ( 18% ) , fibrosis ( 18% ) , pruritus ( 46% ) , hyperlacrimation ( 18% ) , and small corneal ulcer ( 0.6% ) .
recurrent lesions and larger volumes were associated with worse outcomes [ 13 , 21 ] .
functional and cosmetic outcome were reported according to the physicians or patients judgement , cosmesis after interstitial brachytherapy ( caib ) scale or not specified [ 14 , 15 ] . only in one study was cosmesis graded and documented using a 6 domain objective scoring criteria ( depigmentation of skin , eyelid dysfunction like ectropion or entropion , dry eye , keratitis , cataract , and glaucoma ) .
functional and cosmetic outcomes were reported in 5 studies and graded as optimal to good / excellent in 68.3 - 100% , respectively [ 14 , 15 , 19 , 20 , 21 ] .
the aims of treatment is definitive tumor control with functional preservation of anatomical structures [ 6 , 7 , 8 ] .
radiotherapy is an effective alternative in patients where surgery might be associated with functional or cosmetic deficits or in patients unfit because of comorbidities .
the only randomized trial comparing radiotherapy versus surgery in patients with bcc of the face was published by avril et al . in 1997 .
basal cell carcinoma of eyelid represented 19% of surgery group and 20% of radiotherapy group .
interstitial bt was performed with ir - wires afterloaded with a dose of 65 - 70 gy delivered over a period of 5 - 7 days .
superficial contact therapy ( 50 kv ) was delivered in two sessions , each delivering 18 - 20 gy with a 2-week interval .
basal cell carcinoma of less than 2 cm in the largest diameter were treated with this technique .
conventional radiotherapy ( 85 - 250 kv ) was delivered with 60 gy total dose in treatment fractions ranging from 2 to 4 gy . in the radiotherapy group ,
55% were treated with interstitial bt , 33% with contact therapy , and 12% with conventional radiotherapy .
the 4-year actuarial failure rate was 7.5% in the radiotherapy group compared with 0.7% in the surgery group .
however , no analysis of outcomes according the treatment site or radiotherapy technique was performed .
only few studies are available in literature regarding the use of bt in eyelid nmsc . in all studies ,
the patients population was very heterogeneous in terms of histology , treatment aim ( curative or adjuvant ) , dose rate ( ldr and hdr ) , total dose , and follow up time [ 13 , 14 , 15 , 19 , 20 , 21 ] .
the level of evidence was low ( 3 in all studies according to sign criteria ) .
it is difficult to make a comparison because in 5/6 studies , lc was reported in terms of crude rate .
therefore , these results are probably influenced by the follow - up length [ 13 , 14 , 19 , 20 , 21 ] .
the only study reporting actuarial lc is the one of azad et al . and
this difference may explain the lower results . among the authors reporting the crude rate , conill et al .
had slightly lower results ( lc : 91.6% ) compared to the others ( 94.1 - 100% ) [ 13 , 20 , 21 ] .
this might indicate that the use of curettage ( performed by conill ) did not produces benefits in terms of disease control .
it should also be noted that conill , among the studies based on ldr [ 13 , 14 , 19 ] , is the one with the lowest total delivered dose .
only 4 studies reported the used acute toxicity score [ 14 , 19 , 20 ] .
edema was reported in three studies [ 13 , 14 , 15 ] with variable incidence ( 29.6 - 100% ) [ 13 , 14 ] .
conjunctival erythema or conjunctivitis was reported in 3 studies [ 13 , 14 , 19 ] and in the other two studies the site of erythema was not specified ( skin ?
daly et al . reported the lowest incidence of edema and conjunctival erythema ( 29.6% and 12% , respectively ) .
it is not clear whether it is a real difference or if the authors reported only the most obvious cases .
other toxicities were reported in individual studies , 21.7% of keratites and 29% of epiphora .
therefore , due to inhomogeneous and non - standardized reporting of acute toxicity , the identification of potential predictors of short term side - effects between the different studies results was difficult .
only 3 studies reported the used late toxicity score [ 14 , 20 , 21 ] .
epilation was reported in 4 studies [ 13 , 14 , 15 , 21 ] ranging from 65 to 100% .
the lowest value was reported by mareco et al . where a correlation between v100 ( volume of the tissue that receives 100% of the prescription dose ) and v150 ( volume of the tissue that receives 150% of the prescription dose ) , and epilation was observed .
v100 2 cm and v150 1 cm were associated with higher epilation frequency .
epiphora was reported in 2 studies with the same incidence ( 5% ) [ 15 , 19 ] as well as lacrimal duct stenosis , which was reported in 2 studies with a similar incidence ( 6.7 - 9.5% ) [ 13 , 19 ] .
pigmentation changes was reported in 4 studies [ 13 , 15 , 20 , 21 ] ( incidence 10 - 47% ) and impairment of eyelid fissure in 2 studies ( incidence 5.5 - 12% ) [ 13 , 21 ] .
, again v150 1 cm seemed to be correlated with the frequency of late toxicities .
ectropion was reported in 2 studies ( 5 - 14.2% ) [ 19 , 20 ] and 1 study reported the eversion of the lower lid in 4.4% of patients .
other late toxicities reported in individual studies were unilateral cataract , entropion , conjunctivitis , keratoconjunctivitis sicca , eyelid malocclusion , hyperlacrimation , and small corneal ulcer with incidences of 3.3% , 23% , 42% , 46% , 46% , 18% , and 0.6% , respectively .
cosmetic outcome was reported in 5 studies [ 14 , 15 , 19 , 20 , 21 ] .
it should be noted that in this trial the prescribed dose was the highest between the analyzed trials .
recurrent lesions [ 13 , 21 ] and higher volumes receiving the prescribed dose were associated with worst cosmetic outcomes .
the aims of treatment is definitive tumor control with functional preservation of anatomical structures [ 6 , 7 , 8 ] .
radiotherapy is an effective alternative in patients where surgery might be associated with functional or cosmetic deficits or in patients unfit because of comorbidities .
the only randomized trial comparing radiotherapy versus surgery in patients with bcc of the face was published by avril et al . in 1997 .
basal cell carcinoma of eyelid represented 19% of surgery group and 20% of radiotherapy group .
interstitial bt was performed with ir - wires afterloaded with a dose of 65 - 70 gy delivered over a period of 5 - 7 days .
superficial contact therapy ( 50 kv ) was delivered in two sessions , each delivering 18 - 20 gy with a 2-week interval .
basal cell carcinoma of less than 2 cm in the largest diameter were treated with this technique .
conventional radiotherapy ( 85 - 250 kv ) was delivered with 60 gy total dose in treatment fractions ranging from 2 to 4 gy . in the radiotherapy group ,
55% were treated with interstitial bt , 33% with contact therapy , and 12% with conventional radiotherapy .
the 4-year actuarial failure rate was 7.5% in the radiotherapy group compared with 0.7% in the surgery group .
however , no analysis of outcomes according the treatment site or radiotherapy technique was performed .
only few studies are available in literature regarding the use of bt in eyelid nmsc . in all studies ,
the patients population was very heterogeneous in terms of histology , treatment aim ( curative or adjuvant ) , dose rate ( ldr and hdr ) , total dose , and follow up time [ 13 , 14 , 15 , 19 , 20 , 21 ] .
the level of evidence was low ( 3 in all studies according to sign criteria ) .
it is difficult to make a comparison because in 5/6 studies , lc was reported in terms of crude rate .
therefore , these results are probably influenced by the follow - up length [ 13 , 14 , 19 , 20 , 21 ] .
the only study reporting actuarial lc is the one of azad et al . and
this difference may explain the lower results . among the authors reporting the crude rate , conill et al .
had slightly lower results ( lc : 91.6% ) compared to the others ( 94.1 - 100% ) [ 13 , 20 , 21 ] .
this might indicate that the use of curettage ( performed by conill ) did not produces benefits in terms of disease control .
it should also be noted that conill , among the studies based on ldr [ 13 , 14 , 19 ] , is the one with the lowest total delivered dose .
only 4 studies reported the used acute toxicity score [ 14 , 19 , 20 ] .
edema was reported in three studies [ 13 , 14 , 15 ] with variable incidence ( 29.6 - 100% ) [ 13 , 14 ] .
conjunctival erythema or conjunctivitis was reported in 3 studies [ 13 , 14 , 19 ] and in the other two studies the site of erythema was not specified ( skin ?
daly et al . reported the lowest incidence of edema and conjunctival erythema ( 29.6% and 12% , respectively ) .
it is not clear whether it is a real difference or if the authors reported only the most obvious cases .
other toxicities were reported in individual studies , 21.7% of keratites and 29% of epiphora .
therefore , due to inhomogeneous and non - standardized reporting of acute toxicity , the identification of potential predictors of short term side - effects between the different studies results was difficult .
only 3 studies reported the used late toxicity score [ 14 , 20 , 21 ] .
epilation was reported in 4 studies [ 13 , 14 , 15 , 21 ] ranging from 65 to 100% .
the lowest value was reported by mareco et al . where a correlation between v100 ( volume of the tissue that receives 100% of the prescription dose ) and v150 ( volume of the tissue that receives 150% of the prescription dose ) , and epilation was observed .
v100 2 cm and v150 1 cm were associated with higher epilation frequency .
epiphora was reported in 2 studies with the same incidence ( 5% ) [ 15 , 19 ] as well as lacrimal duct stenosis , which was reported in 2 studies with a similar incidence ( 6.7 - 9.5% ) [ 13 , 19 ] .
pigmentation changes was reported in 4 studies [ 13 , 15 , 20 , 21 ] ( incidence 10 - 47% ) and impairment of eyelid fissure in 2 studies ( incidence 5.5 - 12% ) [ 13 , 21 ] .
, again v150 1 cm seemed to be correlated with the frequency of late toxicities .
ectropion was reported in 2 studies ( 5 - 14.2% ) [ 19 , 20 ] and 1 study reported the eversion of the lower lid in 4.4% of patients .
other late toxicities reported in individual studies were unilateral cataract , entropion , conjunctivitis , keratoconjunctivitis sicca , eyelid malocclusion , hyperlacrimation , and small corneal ulcer with incidences of 3.3% , 23% , 42% , 46% , 46% , 18% , and 0.6% , respectively .
cosmetic outcome was reported in 5 studies [ 14 , 15 , 19 , 20 , 21 ] .
it should be noted that in this trial the prescribed dose was the highest between the analyzed trials .
recurrent lesions [ 13 , 21 ] and higher volumes receiving the prescribed dose were associated with worst cosmetic outcomes .
it is difficult to make a comparison because in 5/6 studies , lc was reported in terms of crude rate .
therefore , these results are probably influenced by the follow - up length [ 13 , 14 , 19 , 20 , 21 ] .
the only study reporting actuarial lc is the one of azad et al . and
this difference may explain the lower results . among the authors reporting the crude rate , conill et al .
had slightly lower results ( lc : 91.6% ) compared to the others ( 94.1 - 100% ) [ 13 , 20 , 21 ] .
this might indicate that the use of curettage ( performed by conill ) did not produces benefits in terms of disease control .
it should also be noted that conill , among the studies based on ldr [ 13 , 14 , 19 ] , is the one with the lowest total delivered dose .
only 4 studies reported the used acute toxicity score [ 14 , 19 , 20 ] .
edema was reported in three studies [ 13 , 14 , 15 ] with variable incidence ( 29.6 - 100% ) [ 13 , 14 ] .
conjunctival erythema or conjunctivitis was reported in 3 studies [ 13 , 14 , 19 ] and in the other two studies the site of erythema was not specified ( skin ?
daly et al . reported the lowest incidence of edema and conjunctival erythema ( 29.6% and 12% , respectively ) .
it is not clear whether it is a real difference or if the authors reported only the most obvious cases .
other toxicities were reported in individual studies , 21.7% of keratites and 29% of epiphora .
therefore , due to inhomogeneous and non - standardized reporting of acute toxicity , the identification of potential predictors of short term side - effects between the different studies results was difficult .
only 3 studies reported the used late toxicity score [ 14 , 20 , 21 ] .
epilation was reported in 4 studies [ 13 , 14 , 15 , 21 ] ranging from 65 to 100% .
the lowest value was reported by mareco et al . where a correlation between v100 ( volume of the tissue that receives 100% of the prescription dose ) and v150 ( volume of the tissue that receives 150% of the prescription dose ) , and epilation was observed .
v100 2 cm and v150 1 cm were associated with higher epilation frequency .
epiphora was reported in 2 studies with the same incidence ( 5% ) [ 15 , 19 ] as well as lacrimal duct stenosis , which was reported in 2 studies with a similar incidence ( 6.7 - 9.5% ) [ 13 , 19 ] .
pigmentation changes was reported in 4 studies [ 13 , 15 , 20 , 21 ] ( incidence 10 - 47% ) and impairment of eyelid fissure in 2 studies ( incidence 5.5 - 12% ) [ 13 , 21 ] .
, again v150 1 cm seemed to be correlated with the frequency of late toxicities .
ectropion was reported in 2 studies ( 5 - 14.2% ) [ 19 , 20 ] and 1 study reported the eversion of the lower lid in 4.4% of patients .
other late toxicities reported in individual studies were unilateral cataract , entropion , conjunctivitis , keratoconjunctivitis sicca , eyelid malocclusion , hyperlacrimation , and small corneal ulcer with incidences of 3.3% , 23% , 42% , 46% , 46% , 18% , and 0.6% , respectively .
cosmetic outcome was reported in 5 studies [ 14 , 15 , 19 , 20 , 21 ] .
it should be noted that in this trial the prescribed dose was the highest between the analyzed trials .
recurrent lesions [ 13 , 21 ] and higher volumes receiving the prescribed dose were associated with worst cosmetic outcomes .
in conclusion , evidences from studies comparing the results of bt with other treatments are lacking in literature . furthermore , due to low evidence of the published studies it is challenging to draw any meaningful conclusions about factors correlated with tumor control and toxicity based on available data . some scattered evidence seem to suggest that the association with curettage is not beneficial and that the use of lower doses is associated with a higher incidence of local failure .
moreover , the use of higher doses and higher volumes receiving the prescribed dose seems to be associated with a worse cosmetic outcome while prolonged treatment would produce less late effects at least from the point of view of epilation .
finally , we can conclude that bt in small tumor size ( t 3.5 cm ) or in postoperative treatment of high risk patients ( positive or close margin , perineural invasion ) resulted in high local control rates ( median : 95.2% ) with acceptable - good functional cosmetic outcome ( median : 100% ) , mainly based on retrospective studies [ 13 , 14 , 15 , 19 , 20 , 21 ] .
therefore , prospective controlled trials evaluating not only local control but also functional cosmetic outcome with validated scale are justified . | purposenon melanoma skin cancers ( nmsc ) of eyelid are uncommon .
many treatments approach are available with surgery being considered as the gold standard .
radiotherapy is an effective alternative in patients unfit for surgery .
brachytherapy ( bt ) might be a better therapeutic option due high radiation dose concentration to the tumor and rapid dose fall - off resulting in normal tissues sparing .
the aim of this review is to evaluate local control , toxicity , and functional cosmetic outcome of bt in nmsc of eyelid.material and methodsa systematic search of the bibliographic databases pubmed , scopus , and cochrane library from the earliest possible date through october 2015 was performed .
only studies published in english were included.resultssix articles fulfilled the selection criteria and were included in our review . due to high risk of bias ,
all studies were classified to provide a low level of evidence ( according to scottish intercollegiate guidelines network classification ) .
no randomized controlled trials or case control studies were founded .
brachytherapy was well tolerated with acceptable toxicity and high local control rates ( median : 95.2% ) .
functional and cosmetic outcome were reported in five study as acceptable good functional - cosmetic outcome ( median : 100%).conclusionsto date , few evidences are available on the role of bt in eyelid nmsc , and they show satisfactory results in terms of local control and functional cosmetic outcome . therefore , prospective controlled trials are justified . | Purpose
Material and methods
Criteria for considering studies to be included in this review
Study selection and quality assessment
Results
Treatment characteristics and local control
Acute-late toxicity and functional cosmetic outcome
Discussion
Treatment of eyelid cancer
Comparisons between analyzed studies
Local control
Acute toxicity
Late toxicity
Cosmetic outcome
Conclusions
Disclosure |
trans 5-o - caffeoylquinic acid ( 1 ) , quercetin-3-o - rutinoside ( 2 ) , luteolin-5-o - rutinoside ( 3 ) and luteolin-7-o - rutinoside ( 4 ) were separated from the plant material , its purity was checked by hplc and structure elucidated by ms spectral data .
water was purified by a milli - q system from millipore ( milford , usa ) .
analyses were performed on agilent 1200 chromatograph equipped with a diode array detector and mass detector in series ( agilent technologies , waldbronn , germany ) .
a phenomenex luna -c18 , 4.6150 mm , particle size 5 m with suitable guard column was employed for the separation . the binary mobile phase consisted of solvents a as 0.1% formic acid in water and solvents b as acetonitrile .
the gradient elution started with 10% b and changed to 75% b in 20 min , then reached 95% b in 27 min .
after each run the chromatographic system was set to 10% b in 4 min and equilibrated for 4 min .
the flow rate was 1.0 ml / min and injection volume was 5 l . separation of trans and cis isomer of 5-o - caffeoylquinic acid was attempted by using a zorbax sb phenyl , 4.6100 mm , particle size 1.8 m with suitable guard column .
the binary mobile phase consisted of solvents a as 0.1% formic acid in water and solvents b as acetonitrile .
the isocratic elution started with 20% b and 80% a. the flow rate was 0.8 ml / min and injection volume was 5 l .
spectral data for all peaks were recorded in the range of 200 - 400 nm .
the mass detector was an ion trap spectrometer ( agilent lc / msd trap xct ) equipped with an electrospray ionization interface and controlled by lcmsd software .
the ionization conditions were adjusted at 300 and 3.5 kv for capillary temperature and voltage , respectively .
the nebulizer pressure was 40 psi and the nitrogen flow rate was 8 l / min .
collision - induced fragmentation experiments were performed in the ion trap using helium as a collision gas , with voltage cycles from 0.3 up to 2 v. all mass spectrometry data were recorded in negative ion mode .
the screening was performed in full scan covering the range from m / z 100 up to 1000 ; multiple reaction monitoring ( mrm ) mode .
the flowers of nerium indicum were collected from the surroundings of vellore , in november 2013 , and identified at the department of chemistry , thiruvallur university . the plant material was air dried , smashed into powder and stored in a desiccator .
the flowers of nerium indicum ( 50 g ) were extracted 3 times with meoh under reflux for 3 h. evaporation of the solvent under reduced pressure provided the meoh extract ( 5.1 g ) .
to separate the compound , preparative liquid chromatography was done using acetonitrile - formic acid - water as mobile phase and the octadecylsilane as a stationary phase .
the flowers of nerium indicum were collected from the surroundings of vellore , in november 2013 , and identified at the department of chemistry , thiruvallur university . the plant material was air dried , smashed into powder and stored in a desiccator .
the flowers of nerium indicum ( 50 g ) were extracted 3 times with meoh under reflux for 3 h. evaporation of the solvent under reduced pressure provided the meoh extract ( 5.1 g ) . to separate the compound ,
preparative liquid chromatography was done using acetonitrile - formic acid - water as mobile phase and the octadecylsilane as a stationary phase .
a method coupling hplc with diode - array detector ( dad ) and electrospray ionization mass spectrometry with an ion trap analyzer was optimized for the separation and identification of phenolic acid in the extract of nerium indicum flowers .
different mobile phase compositions were screened to obtain chromatograms with good resolution within an acceptable time of analysis .
formic acid , as solvent a , and acetonitrile , as solvent b , were chosen for the gradient elution .
especially the formic acid and acetonitrile are volatile and thus compatible with lc / ms system .
formic acid ( lower ph values ) ensures better sample separation but shortens the hplc column lifetime and affects esi ionization .
compound 1 ( trans 5-o - caffeoylquinic acid ) with tr of 5.5 min , compound 2 ( quercetin-3-o- rutinoside ) with tr of 7.4 min , compound 3 ( luteolin-5-o - rutinoside ) with tr of 7.9 min and compound 4 ( luteolin-7-o - rutinoside ) with tr of 8.1 min .
* dad1 , sig=325.00 , 4.00 ref = off , ext of 2210nif.d compound 1 observed as a [ m - h ] - ion peak at m / z 353 in the esi mass spectrum ( fig .
2 ) and based on literature data compound 1 was confirmed as a 5-o - caffeoyl quinic acid . by using zorbax sb phenyl column
able to separate cis and trans isomer of 5-o - caffeoyl quinic acid ( fig .
3 ) gave an [ m - h]-ion peak at m / z 353 in the esi mass spectrum ( fig .
uv spectra also suggest that trans isomer is more absorption value compared to cis isomer ( fig .
mass spectral value of compound 2 showed a quasi - molecular ion [ m - h ] - at m / z 609 , compared with literature data compound 2 was identified as a quercetin-3-o - rutinoside ( fig .
tic / ms chromatogram of crude methanolic extract of nerium indicum flowers from hplc-(- ) esi - ms .
m / z value of 353.0 with tr of 5.5 min , m / z value of 609.3 with tr of 7.4 min , m / z value of 593.3 with tr of 7.9 min and m / z value of 593.3 with tr of 8.1 min .
hplc - dad chromatogram of cis and trans isomer of 5-o - caffeoyl quinic acid .
cis isomer with tr of 1.4 min and trans isomer with tr of 2.2 min .
tic / ms chromatogram of cis and trans isomer of 5-o - caffeoyl quinic acid from hplc-(- ) esi - ms .
cis isomer with m / z value of 362.9 and trans isomer with m / z value of 363.0 .
cis isomer with absorption maximum at 216 and 328 nm similarly trans isomer with absorption maximum at 220 , 242 and 326 nm .
esi - ms of compound 3 , 4 showed a quasi - molecular ion [ m - h ] - at m / z 593 , both are same mass value only position is different and based on literature data compounds 3 and 4 identified as luteolin-5-o - rutinoside and luteolin-7-o - rutinoside ( fig .
2 ) . based on the above data two phenolic acids , trans 5-o - caffeoylquinic acid and cis 5-o - caffeoylquinic acid ( fig . 6 ) .
three flavonoid glycosides , quercetin-3-o - rutinoside , luteolin-5-o - rutinoside and luteolin-7-o - rutinoside ( fig .
a. quercetin-3-o - rutinoside , b. luteolin-5-o - rutinoside , c. luteolin- 7-o - rutinoside . | four major compounds were separated and identified from the methanol extracts of nerium indicum flowers ( arali ) using hplc and mass spectral data . through mass data ,
the chemical structures were elucidated as : trans5-o - caffeoylquinic acid ( 1 ) , quercetin-3-o- rutinoside ( 2 ) , luteolin-5-o - rutinoside ( 3 ) and luteolin-7-o - rutinoside ( 4 ) .
in addition , the cis isomers of 5-o - caffeoylquinic acid in nerium indicum flowers were confirmed by mass , hplc and uv .
the structures of these compounds confirmed with the help of liquid chromatography mass spectrometry . | MATERIALS AND METHODS
Plant material:
Extraction and isolation:
RESULTS AND DISCUSSION |
clinical use of aminoglycoside antibiotics is complicated by ototoxicity , a condition characterized by damage to cochlear hair cells , cochlear spiral ganglion cells , and the auditory center .
understanding the molecular events behind the ototoxicity of aminoglycoside antibiotics and developing novel , non - toxic treatments are of great clinical importance .
neurotrophin-3 ( nt-3 ) , a member of the neurotrophin family , is widely expressed in the inner ear and auditory center .
nt-3 has been reported to play an important role in the structural and functional regulation of the nervous system .
specifically , nt-3 is essential for the development , survival , growth , and differentiation of auditory epithelial cells and neurons ; nt-3 also plays an important role in neuronal repair after injury and in the plasticity of remnant neurons .
additionally , it has also been shown that nt-3 expression can protect the inner ear and mitigate hearing loss through various mechanisms .
thus , increasing the local expression of nt-3 in auditory nerve cells may represent a promising approach to protecting against ototoxicity .
acupuncture , a traditional chinese therapy , has been found to yield beneficial effects on deafness and to promote hearing recovery .
, most studies examining this issue have focused on the effects of acupuncture on the inner ear and cochlear spiral ganglion [ 810 ] . to the best of our knowledge
, it has not been reported whether the auditory benefits of acupuncture involve the auditory nuclei .
therefore , in the present study , we aimed to assess the preventive effect of acupuncture on gentamicin - induced hearing impairment by measuring auditory brainstem responses ( abrs ) before and after treatment .
in addition , we sought to determine whether the underlying protective mechanism may involve nt-3 in the cochlear and inferior colliculus nuclei .
a total of 24 healthy sprague - dawley rats ( 250350 g ) with normal reflection of the auricle were provided by the animal laboratory of xian jiaotong university .
all rats were housed in an air - conditioned room with a 12-h light / dark cycle and provided free access to standard rodent chow diet and water .
after acclimation for 1 week , rats were randomly divided into the following 4 groups : control group , gentamicin group , neitinggong group , and tinggong group .
for 14 consecutive days , control group rats received an intraperitoneal injection of saline each morning ( 2.5 ml / kg ) , while rats in the other groups received an intraperitoneal injection of gentamicin ( 100 mg / kg tianjin pharmaceuticals group co. , ltd . ) each morning .
starting on the first day of intraperitoneal injection , rats in the neitinggong and tinggong groups also underwent acupuncture at the neitinggong or tinggong acupoints , respectively , once every 2 days for 20 days .
the neitinggong and tinggong acupoints are located in the middle ear and adjacent to the antilobium , respectively . for rats in the neitinggong group , filiform needles ( 0.35100 mm )
were acupunctured around the umbo of the tympanic membrane using an electric auriscope , at a depth of about 2 mm , which was adjacent to the promontory of the tympanum . for rats in the tinggong group , filiform needles ( 0.3535 mm )
were inserted ~4 mm subcutaneously , then manipulated by the reinforcing - reducing method every 10 min for 30 s each time .
for both the neitinggong and tinggong groups , the needles were removed 30 min after application .
all rats were anesthetized by intraperitoneal injection with a 10% ( w / v ) chloral hydrate solution ( 0.3 ml per 100 g body mass ; shanghai mingbo biological technology co. , ltd ) every afternoon prior to testing the abr .
abr was determined using brainstem - evoked potentiometer detection ( denmark ics chartr ep ) .
the potentiometer was set to generate a stimulatory clicking sound every 100 s ( 15-ms scanning time , 1003000-hz filtering range , and 1024 overlaps ) .
electrodes were made from 0.3550 mm platinum acupuncture needles and were inserted subcutaneously at the vertex ( active ) and ventrolaterally to the right ( reference ) and left ( ground ) ears .
recording electrodes were placed at the intersections of the cranial sagittal midline and connected with the external auditory canal , reference electrodes were placed in retroauricular subcutaneous tissue , and grounding electrodes were placed in the nasion .
abrs were averaged by the computer and displayed on the screen on a fixed scale .
the threshold was obtained by first reducing the sound pressure level ( spl ) in 10-db steps , then fine tuning the level in 5-db steps up and down to identify the lowest level at which an abr pattern could be recognized .
the minimal spl intensity able to induce wave iii of the abr waveform was considered to be the abr threshold .
after the experiment , rats were anesthetized by a 10% chloral hydrate solution , and then secured on an animal operating table .
a perfusion cannula was inserted into the aorta through which 250 ml of saline solution was perfused quickly , followed by 2000 ml of phosphate - buffered saline perfused slowly over 12 h. rats were killed rapidly by decapitation and the bilateral cochlear nucleus and inferior colliculus were removed . after paraffin embedding , antigen retrieval , and blocking
, sections were incubated overnight at 4c with a rabbit anti - rat nt3 antibody ( boster biological technology , china ) . after washing with pbs
, the sections were incubated with a biotinylated secondary antibody ( boster biological technology , china ) for 30 min at room temperature .
sections were washed thoroughly , mounted onto gelatin - coated slides , dehydrated , and cover - slipped before being examined under a microscope operated in the bright field mode .
images ( 40 magnification ) from 5 non - overlapping horizons were taken for each slice .
the average optical density value was measured by image - pro plus ( version 6.0 ) .
one - way analysis of variance ( anova ) was used for statistical analysis ( spss17.0 software ) .
a total of 24 healthy sprague - dawley rats ( 250350 g ) with normal reflection of the auricle were provided by the animal laboratory of xian jiaotong university .
all rats were housed in an air - conditioned room with a 12-h light / dark cycle and provided free access to standard rodent chow diet and water .
after acclimation for 1 week , rats were randomly divided into the following 4 groups : control group , gentamicin group , neitinggong group , and tinggong group .
for 14 consecutive days , control group rats received an intraperitoneal injection of saline each morning ( 2.5 ml / kg ) , while rats in the other groups received an intraperitoneal injection of gentamicin ( 100 mg / kg tianjin pharmaceuticals group co. , ltd . ) each morning .
starting on the first day of intraperitoneal injection , rats in the neitinggong and tinggong groups also underwent acupuncture at the neitinggong or tinggong acupoints , respectively , once every 2 days for 20 days .
the neitinggong and tinggong acupoints are located in the middle ear and adjacent to the antilobium , respectively . for rats in the neitinggong group , filiform needles ( 0.35100 mm )
were acupunctured around the umbo of the tympanic membrane using an electric auriscope , at a depth of about 2 mm , which was adjacent to the promontory of the tympanum . for rats in the tinggong group , filiform needles ( 0.3535 mm )
were inserted ~4 mm subcutaneously , then manipulated by the reinforcing - reducing method every 10 min for 30 s each time .
for both the neitinggong and tinggong groups , the needles were removed 30 min after application .
all rats were anesthetized by intraperitoneal injection with a 10% ( w / v ) chloral hydrate solution ( 0.3 ml per 100 g body mass ; shanghai mingbo biological technology co. , ltd ) every afternoon prior to testing the abr .
abr was determined using brainstem - evoked potentiometer detection ( denmark ics chartr ep ) .
the potentiometer was set to generate a stimulatory clicking sound every 100 s ( 15-ms scanning time , 1003000-hz filtering range , and 1024 overlaps ) .
electrodes were made from 0.3550 mm platinum acupuncture needles and were inserted subcutaneously at the vertex ( active ) and ventrolaterally to the right ( reference ) and left ( ground ) ears .
recording electrodes were placed at the intersections of the cranial sagittal midline and connected with the external auditory canal , reference electrodes were placed in retroauricular subcutaneous tissue , and grounding electrodes were placed in the nasion .
abrs were averaged by the computer and displayed on the screen on a fixed scale .
the threshold was obtained by first reducing the sound pressure level ( spl ) in 10-db steps , then fine tuning the level in 5-db steps up and down to identify the lowest level at which an abr pattern could be recognized . the minimal spl intensity able to induce wave iii of the abr waveform
after the experiment , rats were anesthetized by a 10% chloral hydrate solution , and then secured on an animal operating table .
a perfusion cannula was inserted into the aorta through which 250 ml of saline solution was perfused quickly , followed by 2000 ml of phosphate - buffered saline perfused slowly over 12 h. rats were killed rapidly by decapitation and the bilateral cochlear nucleus and inferior colliculus were removed . after paraffin embedding , antigen retrieval , and blocking , sections were incubated overnight at 4c with a rabbit anti - rat nt3 antibody ( boster biological technology , china ) . after washing with pbs
, the sections were incubated with a biotinylated secondary antibody ( boster biological technology , china ) for 30 min at room temperature .
sections were washed thoroughly , mounted onto gelatin - coated slides , dehydrated , and cover - slipped before being examined under a microscope operated in the bright field mode .
images ( 40 magnification ) from 5 non - overlapping horizons were taken for each slice .
the average optical density value was measured by image - pro plus ( version 6.0 ) .
one - way analysis of variance ( anova ) was used for statistical analysis ( spss17.0 software ) .
there was no significant difference in the general condition of the rats in the control group before versus after the experiments , and their body weights increased steadily .
in contrast , rats in the other 3 groups exhibited behaviors characteristic of poor health , such as decreased spontaneous activity , loss of appetite , shaggy hair , and arrested weight gain . these rats also exhibited an absence of the auricle reflex to differing extents . under the otoendoscope ,
we observed small tympanic membrane perforations around the handle of malleus in rats from the neitinggong group ; these perforations were partially healed , and did not exhibit discharge or infection .
the integrity of tympanic membranes in rats from the other experimental groups was not affected . as shown in table 1 , on day 14 ,
the average abr threshold values in rats from the gentamicin , neitinggong , and tinggong groups were significantly increased compared to those of the control group , indicating that their hearing had been impaired . compared with the values for the gentamicin group , the average threshold abr values for the neitinggong and tinggong groups appeared to be slightly , though not significantly , decreased . on day 20 ,
the average threshold abr value for the gentamicin group was significantly higher than that of the control group .
the average threshold abr values for the neitinggong and tinggong groups were significantly decreased compared with that of the gentamicin group . as shown in figure 1 , nt-3 immunopositivity ( yellow )
nt-3 expression in the cochlear nucleus did not differ significantly among the groups ( table 2 , p>0.05 ) . as shown in figure 2 ,
nt-3 was also observed in the cytoplasm of cells in the inferior colliculus . as shown in figure 2 and table 2 , the expression of nt-3 in the inferior colliculus
was significantly decreased by gentamicin treatment ( p<0.01 ) , compared with that in the control group . of note , expression of nt-3 in the inferior colliculus in the neitinggong and tinggong groups
was significantly higher than that in the gentamicin group ( p<0.01 ) , showing a restoration trend toward physiological levels .
these results indicate that acupuncture at the neitinggong or tinggong acupoints suppressed the inhibitory effect of gentamicin on nt-3 expression in the inferior colliculus ( p<0.01 ) .
there was no significant difference in the general condition of the rats in the control group before versus after the experiments , and their body weights increased steadily .
in contrast , rats in the other 3 groups exhibited behaviors characteristic of poor health , such as decreased spontaneous activity , loss of appetite , shaggy hair , and arrested weight gain . these rats also exhibited an absence of the auricle reflex to differing extents . under the otoendoscope ,
we observed small tympanic membrane perforations around the handle of malleus in rats from the neitinggong group ; these perforations were partially healed , and did not exhibit discharge or infection .
the integrity of tympanic membranes in rats from the other experimental groups was not affected .
as shown in table 1 , on day 14 , the average abr threshold values in rats from the gentamicin , neitinggong , and tinggong groups were significantly increased compared to those of the control group , indicating that their hearing had been impaired .
compared with the values for the gentamicin group , the average threshold abr values for the neitinggong and tinggong groups appeared to be slightly , though not significantly , decreased . on day 20 ,
the average threshold abr value for the gentamicin group was significantly higher than that of the control group .
the average threshold abr values for the neitinggong and tinggong groups were significantly decreased compared with that of the gentamicin group .
as shown in figure 1 , nt-3 immunopositivity ( yellow ) was readily observed in the cytoplasm of cells in the cochlear nucleus area .
nt-3 expression in the cochlear nucleus did not differ significantly among the groups ( table 2 , p>0.05 ) .
as shown in figure 2 , nt-3 was also observed in the cytoplasm of cells in the inferior colliculus . as shown in figure 2 and table 2 , the expression of nt-3 in the inferior colliculus
was significantly decreased by gentamicin treatment ( p<0.01 ) , compared with that in the control group . of note , expression of nt-3 in the inferior colliculus in the neitinggong and tinggong groups
was significantly higher than that in the gentamicin group ( p<0.01 ) , showing a restoration trend toward physiological levels .
these results indicate that acupuncture at the neitinggong or tinggong acupoints suppressed the inhibitory effect of gentamicin on nt-3 expression in the inferior colliculus ( p<0.01 ) .
specifically , on day 20 the average threshold abr values of rats treated with neitinggong or tinggong acupuncture were much lower than that of the gentamicin group .
these results are consistent with the prior observation of ma et al . that neitinggong acupuncture attenuated gentamicin - induced ototoxicity .
previous results from clinical trials and animal experiments have demonstrated that acupuncture can improve inner ear microcirculation and the hemorheology index , release blood vessel contraction of the inner ear , promote the regeneration and repair of hair cells , and influence brainstem response , all of which may contribute to the attenuation of sensorineural deafness [ 9,1316 ] .
together , these data suggest that acupuncture may serve as a promising treatment of auditory impairment induced by various factors . regarding the mechanism by which acupuncture may counter gentamicin - induced ototoxicity , there are several possible mechanisms to consider .
first , previous studies have shown that acupuncture can protect against hair cell damage directly by improving inner ear microcirculation and energy metabolism , stabilizing the mitochondria and lysosomes , scavenging oxygen free radicals , preventing inner ear lesions , increasing afferent signals , reducing the damage to the inferior colliculus nucleus , and inducing neuroplastic changes .
second , acupuncture could stimulate the auditory center directly to produce nt-3 , which exerts neurotrophic effects on the inferior colliculus nucleus neurons .
third , acupuncture could produce these effects indirectly , perhaps by improving renal blood flow and glomerular filtration , thereby alleviating renal pathological damage , which in turn could promote the excretion of gentamicin . in this work we found that acupuncture directed at the neitinggong or tinggong acupuncture site increased nt-3 expression selectively in the inferior colliculus nucleus in rats .
for example , chen et al . found that nt-3 expression in the spared l6 dorsal root ganglion ( drg ) in cats that received electro - acupuncture was markedly higher than that of other groups .
evaluated the effect of electro - acupuncture in cats subjected to dorsal rhizotomy , and found that nt-3-positive neurons were increased in lamina ii on the acupunctured side .
several studies have shown altered nt-3 expression levels in the auditory center after hearing damage .
stem auditory nuclei after unilateral cochlear ablation , and found that nt-3 levels were depressed by 2244% on day 3 , elevated transiently by 28124% on day 7 , and then returned to normal levels by day 60 . in mice injected with gentamicin for 15 days , li et al . and song found that the nt-3 expression in the cochlea , the cochlear nucleus , and the inferior colliculus nucleus was significantly decreased .
however , in the mice that received early treatment with herbal compounds for reinforcing kidneys , activating blood , and arousing consciousness ( hcraa ) , hearing was obviously improved and the expression of nt-3 was elevated . in the present study , we found that the expression of nt-3 in the inferior colliculus nucleus was decreased significantly in the gentamicin group , which may be partially explained by direct transport of gentamicin to the inferior colliculus nucleus through blood circulation where it caused hyposecretion of nt-3 . in the present study , nt-3 expression in the cochlear nucleus
this observation could be due to some nt-3 in the cochlear nucleus coming from the cochlea through axonal transport , which may mask reductions in nt-3 expression in the cochlear nucleus .
alternatively , it could be due to expression of nt-3 being related to an increase in synaptic plasticity , given that cochlear injuries may influence nt-3 expression through regulation of synaptic plasticity in auditory nuclei .
these results suggest that acupuncture is a simple and effective way to increase nt-3 expression in auditory nuclei , maintain auditory neuron survival , and promote the repair of hearing loss . however , the kinetics of nt-3 expression in auditory brain stem nuclei are not clear .
further studies are needed that focus on the dynamics of nt-3 expression in different parts of the auditory nerve nuclei and under different conditions , such as acupuncture treatment alone ( as a positive group ) .
such experiments would provide more direct evidence for the efficacy of acupuncture treatment for hearing loss and pave the way for elucidating the mechanism of the protective effects of acupuncture .
in this study , acupuncture at the neitinggong or tinggong acupoints was shown to cure sensorineural deafness caused by gentamicin in rats .
acupuncture therapy increased the expression of nt-3 in the inferior colliculus nucleus , which plays a key role in maintaining the integrity of the hearing pathway and mediates , partially , the benefits of acupuncture on auditory repair .
increasing nt-3 expression in the inferior colliculus nucleus may represent a new strategy for preserving auditory capabilities . | backgroundthe aim of this study was to investigate the protective effects of acupuncture against gentamicin - induced ototoxicity and explore the possible protective role of neurotrophin-3 ( nt-3).material / methodstwenty - four rats were divided randomly into 4 groups : control group , gentamicin group , neitinggong group , and tinggong group .
rats in the gentamicin , neitinggong , and tinggong groups received intraperitoneal injection of gentamicin ( 100 mg / kg ) for 14 consecutive days .
rats in the neitinggong and tinggong groups further received acupuncture at neitinggong or tinggong acupoints once every 2 days for 20 days .
rats in the control group received intraperitoneal injection of saline .
auditory brainstem response ( abr ) was tested in all rats on the day before treatment ( day 0 ) , and again on day 14 and day 20 to determine the average threshold value of abr for each treatment group .
the expression of nt-3 in the cochlear nucleus and the inferior colliculus nucleus were detected by immunohistochemical staining.resultsthe average threshold value of abr was significantly higher in the gentamicin group as compared with that of the control group on day 14 ( p<0.05 ) . on day 20 , the average threshold values of abr in the neitinggong and tinggong groups were significantly lower than that of the gentamicin group ( p<0.05 ) .
no statistically significant differences in nt-3 expression in the cochlear nucleus were observed among the groups ( p>0.05 ) .
however , the expression of nt-3 in the inferior colliculus nucleus in both the neitinggong and tinggong groups was significantly higher than that of the gentamicin group ( p<0.01).conclusionsa decrease in nt-3 expression in the inferior colliculus nucleus may contribute to gentamicin - induced ototoxicity in rats .
acupuncture at neitinggong or tinggong acupoints effectively improved hearing , which was attributed partially to the rescue of nt-3 expression in the inferior colliculus nucleus . therefore , preserving nt-3 expression in the auditory system may be a viable strategy to counteract gentamicin - induced ototoxicity . | Background
Material and Methods
Animals
Auditory brainstem response (ABR)
Immunohistochemistry
Data analysis
Results
General condition of rats
Average threshold value of ABR in rats
Expression of NT-3 in the cochlear nucleus
Expression of NT-3 in the inferior colliculus
Discussion
Conclusions |
null | we use micropatterning
and strain engineering to encapsulate single
living mammalian cells into transparent tubular architectures consisting
of three - dimensional ( 3d ) rolled - up nanomembranes . by using optical
microscopy
, we demonstrate that these structures are suitable for
the scrutiny of cellular dynamics within confined 3d - microenvironments .
we show that spatial confinement of mitotic mammalian cells inside
tubular architectures can perturb metaphase plate formation , delay
mitotic progression , and cause chromosomal instability in both a transformed
and nontransformed human cell line .
these findings could provide important
clues into how spatial constraints dictate cellular behavior and function . | Supplementary Material |
the study was conducted at the mata seca state park ( mssp ) , located in the middle so francisco valley in the manga municipality , northern minas gerais state , brazil ( 144836145659 s and 435512440412 w ; fig .
the mssp was created in 2000 and has a total area of 15,466.44 ha consisting predominantly of deciduous forest ( madeira et al . 2009 ) .
climate in this region is classified as semi - arid according to the kppen system , with an average temperature of 24.4c and average annual rainfall between 242 and 848 mm .
the dry season extends from may to october , in which 9095% of tree species shed their leaves ( pezzini et al .
maps indicating ( a ) plot distribution , ( b ) location of the study area in brazil and ( c ) shape of the mata seca state park .
sampling sites at mata seca state park , southeastern brazil .
maps indicating ( a ) plot distribution , ( b ) location of the study area in brazil and ( c ) shape of the mata seca state park .
dung beetles were collected in the beginning , middle , and end of the wet season in december , february , and april of 20092010 ( fig .
the consistent rains start in october , we consider our first sampling ( december ) as the beginning of the rainy season .
we believe that the biotic and abiotic conditions are maintained in the first months of the rainy season due to abundant rainfall during this period ( pezzini et al .
2016 ) presenting vegetation in advanced stages of secondary succession ( over 20 years ) were selected , with plots located at least 0.2 km apart ( fig .
1 ) . to ensure the absence of vegetation structure effects on dung beetle communities we used the database from a prior study to calculate the richness and abundance of plants per plot ( madeira et al .
2009 ) . in each sample period , four traps were placed at the extremes of each plot .
2.precipitation ( mm ) during july/2009 to june/2010 , data from mocambinho meteorological station , 15 km from mata seca state park ; and sampling periods ( december 2009 , february 2010 , and april 2010 ) indicated by gray bars .
precipitation ( mm ) during july/2009 to june/2010 , data from mocambinho meteorological station , 15 km from mata seca state park ; and sampling periods ( december 2009 , february 2010 , and april 2010 ) indicated by gray bars .
dung beetles were collected using pitfall - type traps consisting of plastic containers ( 14 cm in diameter 11 cm in deep ) buried with openings flush with the ground .
traps contained 250 ml of liquid detergent , water and salt solution to kill and preserve the beetles .
the pitfalls remained in the field for 48 h. subsequently the beetles were collected , sorted , and identified to the lowest taxonomic level using keys ( vaz de melo et al .
2011 ) and with the help of the taxonomist fernando vaz - de - melo .
the species were deposited in the collection of fernando vaz - de - melo at the federal university of mato grosso , mato grosso state , brazil .
each plot was considered a sample unit for the calculation of -diversity ( richness of species in a plot ) and dung beetle abundance .
-diversity among plots was calculated by = period/plot ( whittaker 1972 ) , where period is the total number of species per sample period ( december , february , april ) , and plot is the average species richness of the four sampling points ( pitfall traps ) within a plot .
only for -diversity calculation , the -diversity was considered as the average of species richness between traps within a plot . using this approach ,
mathematically independent values of and allow comparisons of values between sample periods with different values of -diversity ( chao et al . 2012 ) .
we used generalized mixed linear models ( glmers ; lme4 package in r ) to test whether dung beetle -diversity and abundance were affected by sample period , assuming temporal pseudoreplication .
we used linear mixed models ( lmer ) for analysis of -diversity among sample periods .
plant richness and abundance were added to the models to test for effects of vegetation structure on dung beetles . in this approach , collection period ,
plant richness and abundance were used as explanatory variables , all nested within plot ( random effect ) , which were sampled temporally ( bates et al .
significance was estimated with an anova between the complete ( h1 ) and the null model ( h0 ) . the akaike information criterion ( aic )
was used to rank the models , since it represents the uncertainty of the model , a lower value of the aic represents the more parsimonious model . when significant differences were observed between sample periods ,
the data were submitted to contrast analysis by aggregating levels ( crawley , 2013 ) .
if the level of aggregation was not significant and did not alter the deviance explained by the null model , the levels were pooled together ( contrast analyses ) .
the decomposition of was performed using the srensen ( sr ) and simpson ( sim ) dissimilarity indices ( baselga 2010 ) .
sim shows only species replacement , or turnover , and does not consider variation in species richness .
the difference between these indices indicates the total loss of species due to nestedness ( nes ) , such that ( nes = sr
the study was conducted at the mata seca state park ( mssp ) , located in the middle so francisco valley in the manga municipality , northern minas gerais state , brazil ( 144836145659 s and 435512440412 w ; fig .
the mssp was created in 2000 and has a total area of 15,466.44 ha consisting predominantly of deciduous forest ( madeira et al . 2009 ) .
climate in this region is classified as semi - arid according to the kppen system , with an average temperature of 24.4c and average annual rainfall between 242 and 848 mm .
the dry season extends from may to october , in which 9095% of tree species shed their leaves ( pezzini et al .
maps indicating ( a ) plot distribution , ( b ) location of the study area in brazil and ( c ) shape of the mata seca state park .
sampling sites at mata seca state park , southeastern brazil .
maps indicating ( a ) plot distribution , ( b ) location of the study area in brazil and ( c ) shape of the mata seca state park .
dung beetles were collected in the beginning , middle , and end of the wet season in december , february , and april of 20092010 ( fig .
the consistent rains start in october , we consider our first sampling ( december ) as the beginning of the rainy season .
we believe that the biotic and abiotic conditions are maintained in the first months of the rainy season due to abundant rainfall during this period ( pezzini et al .
2016 ) presenting vegetation in advanced stages of secondary succession ( over 20 years ) were selected , with plots located at least 0.2 km apart ( fig .
1 ) . to ensure the absence of vegetation structure effects on dung beetle communities we used the database from a prior study to calculate the richness and abundance of plants per plot ( madeira et al .
2009 ) . in each sample period , four traps were placed at the extremes of each plot .
2.precipitation ( mm ) during july/2009 to june/2010 , data from mocambinho meteorological station , 15 km from mata seca state park ; and sampling periods ( december 2009 , february 2010 , and april 2010 ) indicated by gray bars .
precipitation ( mm ) during july/2009 to june/2010 , data from mocambinho meteorological station , 15 km from mata seca state park ; and sampling periods ( december 2009 , february 2010 , and april 2010 ) indicated by gray bars .
dung beetles were collected using pitfall - type traps consisting of plastic containers ( 14 cm in diameter 11 cm in deep ) buried with openings flush with the ground .
traps contained 250 ml of liquid detergent , water and salt solution to kill and preserve the beetles .
the pitfalls remained in the field for 48 h. subsequently the beetles were collected , sorted , and identified to the lowest taxonomic level using keys ( vaz de melo et al .
2011 ) and with the help of the taxonomist fernando vaz - de - melo .
the species were deposited in the collection of fernando vaz - de - melo at the federal university of mato grosso , mato grosso state , brazil .
each plot was considered a sample unit for the calculation of -diversity ( richness of species in a plot ) and dung beetle abundance .
-diversity among plots was calculated by = period/plot ( whittaker 1972 ) , where period is the total number of species per sample period ( december , february , april ) , and plot is the average species richness of the four sampling points ( pitfall traps ) within a plot . only for -diversity calculation ,
the -diversity was considered as the average of species richness between traps within a plot . using this approach , mathematically independent values of and
allow comparisons of values between sample periods with different values of -diversity ( chao et al . 2012 ) .
we used generalized mixed linear models ( glmers ; lme4 package in r ) to test whether dung beetle -diversity and abundance were affected by sample period , assuming temporal pseudoreplication .
we used linear mixed models ( lmer ) for analysis of -diversity among sample periods .
plant richness and abundance were added to the models to test for effects of vegetation structure on dung beetles . in this approach , collection period ,
plant richness and abundance were used as explanatory variables , all nested within plot ( random effect ) , which were sampled temporally ( bates et al .
significance was estimated with an anova between the complete ( h1 ) and the null model ( h0 ) .
the akaike information criterion ( aic ) was used to rank the models , since it represents the uncertainty of the model , a lower value of the aic represents the more parsimonious model . when significant differences were observed between sample periods ,
the data were submitted to contrast analysis by aggregating levels ( crawley , 2013 ) .
if the level of aggregation was not significant and did not alter the deviance explained by the null model , the levels were pooled together ( contrast analyses ) .
the decomposition of was performed using the srensen ( sr ) and simpson ( sim ) dissimilarity indices ( baselga 2010 ) .
sim shows only species replacement , or turnover , and does not consider variation in species richness .
the difference between these indices indicates the total loss of species due to nestedness ( nes ) , such that ( nes = sr sim ) .
we collected a total of 2,018 dung beetles across 39 species , distributed among 15 genera .
the december collection had the highest species richness , with 34 species ( 1,706 individuals ) .
february and april collections yielded 15 and 16 species ( 143 and 169 individuals , respectively ) .
six species were shared among all sample periods , and no species was sampled only in february .
hirculus , and deltochilum verruciferum were the most abundant species , representing together > 61% of the samples .
table 1.abundances of scarabaeinae species sampled in the beginning , middle and end of the wet season ( december 2009 , february , and april 2010 ) in a tdf at the mata seca state park , minas gerais , braziltaxondecemberfebruaryaprilagamopus unguicularisharold , 18832200atheucus aff .
piluliformes5212canthon callybaeusblachard , 1846710canthon carbonariusharold , 1868300canthon histrioservile , 18284682453canthon lituratusgermar , 1813810canthon obscurielusschimidt , 1922500canthon sp1012canthon unicolorblanchard , 1846001coprophanaeus pertyiolsufieff , 1924100coprophanaeus cyanescensolsoufieff , 19242113deltochilum aff .
calcaratunbates , 187041171deltochilum enceladuskolbe , 18933020deltochilum pseudoicarusblathasar , 1939110deltochilum sp137260deltochilum verruciferumfelshe , 1911174449diabroctis mimaslinnaeus , 1758900dichotomius aff .
cuprinusfelche , 1901300dichotomius bosblanchard , 18461500dichotomius carbonariusmannerheim , 18296300dichotomius geminatusarrow , 1913011dichotomius glaucusharold , 18691400dichotomius nisusoliver , 1789002dichotomius puncticolisluederwaldt , 19353102eurysternnus caribaeusherbst , 1789600genieridium cryptopsarrow , 19131200ontherus appendiculatusmannerheim,18291130ontherus aztecaharold , 18692100ontherus dentatusluederwaldt , 1930008ontherus digitatusharold , 18683310onthophagus aff .
hirculusmannerheim , 18293851968trichillum externepunctatumborre,1880500uroxix bahianusboucomont , 192766010zoonocropi smachadoivaz - de - melo , 20072800total1706143169 abundances of scarabaeinae species sampled in the beginning , middle and end of the wet season ( december 2009 , february , and april 2010 ) in a tdf at the mata seca state park , minas gerais , brazil we found no effects of plant species richness and abundance on the dung beetle community ( - and -diversity , and abundance ) ( table 2 ) .
scarabaeinae -diversity and abundance were higher in december , and did not differ between february and april ( tables 2 , fig .
3a and b ) , while -diversity among plots was lowest in december ( table 2 ; fig .
3.dung beetles -diversity ( a ) , abundance ( b ) , and -diversity ( c ) ( mean se ) along a rainy season at the mata seca state park , southeastern brazil .
table 2.results of the models ( glmer and lmer ) , showing temporal variation in -diversity , abundance and -diversity of dung beetles in a tdfresponse variablesexplanatory variablesaic ( h1)aic ( h0)pdung beetle -diversityplant richness135.68133.990.579 plant abundance134.0131.990.981
month169.48180.20<0.001significance was estimated with an anova between the complete ( h1 ) and the null model ( h0 ) .
the aic represents the uncertainty of the model , thus a low value of the aic represents the more parsimonious model .
dung beetles -diversity ( a ) , abundance ( b ) , and -diversity ( c ) ( mean se ) along a rainy season at the mata seca state park , southeastern brazil .
results of the models ( glmer and lmer ) , showing temporal variation in -diversity , abundance and -diversity of dung beetles in a tdf significance was estimated with an anova between the complete ( h1 ) and the null model ( h0 ) .
the aic represents the uncertainty of the model , thus a low value of the aic represents the more parsimonious model .
the decomposition of -diversity revealed that the relative importance of nestedness and species turnover varies between pairs of sample periods .
nestedness was the main process between december and february , while turnover was more important between february and april ( table 3 ) . between december and april ,
the two processes were equally important for structuring dung beetle communities ( table 3 ) .
table 3.results from decomposition of dung beetle -diversity in the beginning , middle and end of wet season ( december 2009 , february , and april 2010 ) in a tdf at the mata seca state park , minas gerais , brazilparameterperiodsimnessrspecies presencedecember february0.133 ( 28.4%)0.336 ( 71.6%)0.469december april0.312 ( 55.9%)0.248 ( 44.3%)0.56february april0.466 ( 96.5%)0.017 ( 3.5%)0.483 results from decomposition of dung beetle -diversity in the beginning , middle and end of wet season ( december 2009 , february , and april 2010 ) in a tdf at the mata seca state park , minas gerais , brazil
dung beetle communities changed dramatically throughout the wet season , and the importance of nestedness and species turnover varies between pairs of sample periods as the main process of temporal -diversity .
individuals sampled at the beginning of the wet season accounted for nearly 85% of the total number collected .
species richness showed a similar pattern ; out of 39 species , > 90% were sampled in the beginning of the wet season .
andersen ( 2005 ) found similar results for dung beetle abundance in a tdf in mexico , with more than twice as many individuals found at the beginning of the wet season compared with the middle .
of the 34 species sampled at the beginning of the wet season , 32 either had reduced abundances or were not sampled in later periods .
these results indicate a peak adult emergence of the vast majority of species at the beginning of the wet season .
hence our study contradicts the hypothesis raised by andersen ( 2008 ) , which suggests that the dung beetles are likely to experience drastic fluctuations in abundance , with different peaks during different periods .
lack of rainfall , high solar radiation , and low humidity are typical of tdfs for at least 3 months during the dry season ( murphy and lugo 1986 ) .
these conditions affect the availability of resources and limit reproduction and survival of many animals , including dung beetles , which synchronize their life cycle to tolerate these adversities ( andersen 2005 , neves et al .
for example , the guinean savannas in africa have two wet seasons , so dung beetles have two peaks in emergence during the year ( cambefort 2014a ) .
many species weather unfavorable environmental conditions ( i.e. , during droughts ) in diapause ( hibernation ) or in larval stages in the soil ( doube 2014 ) .
the adults emerge with the onset of the rains , and immediately concentrate efforts on accumulation of resources for making nests , reproduction , and subsequent oviposition ( cambefort 2014a ) .
we found the greatest within - plot -diversity in the middle and end of the wet season . in the middle and end of the wet season
only 1347% of the collected species were present in individual plots , compared with 4774% of species per plot at the beginning of the wet season . with the emergence of most species of dung beetles due to improved abiotic conditions and the increased availability of resources
the community becomes more homogeneous at the beginning of the wet season . as the season advances , higher resource scarcity limits population size , which likely results in a smaller foraging range , increasing -diversity .
decomposition of -diversity demonstrated that the dung beetle community sampled in the middle of the wet season is indeed a subset of the species present at the beginning of the wet season . at the end of wet season turnover and nestedness were equally important , due to some species that were exclusively found in this period .
these results reinforce the pattern of peak adult emergence found in most dung beetle species at the start of the wet season , since the community changes little ( i.e. , in terms of species composition ) throughout the season .
the high turnover value between the beginning and end of the wet season was due to only five species not sampled at the beginning , which only represented 8% of the total individuals at the end of the wet season .
our results demonstrate a peak in adult emergence for most dung beetle species at the beginning of the wet season .
additionally , most species present in the middle and end of the wet season were also sampled at the beginning , whereas only a few species with few individuals were absent in the beginning .
these results suggest strong synchronism between the life cycle of these organisms and the seasonality of environmental conditions throughout the year , where the onset of the rains determines adult emergence in most species in the tdf studied . | dung beetle community dynamics are determined by regional rainfall patterns . however ,
little is known about the temporal dynamics of these communities in tropical dry forests ( tdfs ) .
this study was designed to test the following predictions : 1 ) peak diversity of dung beetle species occurs early in the wet season , with a decrease in diversity ( and ) and abundance throughout the season ; 2 ) nestedness is the primary process determining -diversity , with species sampled in the middle and the end of the wet season representing subsets of the early wet season community .
dung beetles were collected in a tdf in the northern minas gerais state , brazil over three sampling events ( december 2009 , february and april 2010 ) .
we sampled 2,018 dung beetles belonging to 39 species and distributed among 15 genera .
scarabaeinae -diversity and abundance were highest in december and equivalent between february and april , while -diversity among plots increased along the wet season .
the importance of nestedness and species turnover varies between pairs of sample periods as the main process of temporal -diversity .
most species collected in the middle and end of the wet season were found in greater abundance in early wet season .
thus , the dung beetle community becomes more homogeneous at the beginning of the wet season , and as the season advances , higher resource scarcity limits population size , which likely results in a smaller foraging range , increasing -diversity .
our results demonstrate high synchronism between the dung beetle life cycle and seasonality of environmental conditions throughout the wet season in a tdf , where the onset of rains determines adult emergence for most species . | Material and Methods
Study Area
Dung Beetle Sampling
Data Analysis
Results
Discussion
Conclusions |
a dysfunction of the dopaminergic reward , or motivation , system has been postulated in patients with schizophrenia .
evidence of a dopamine hypothesis in schizophrenia has been primarily provided by studies of the effects of antipsychotics .
furthermore , positron emission tomography ( pet ) and single - photon emission computed tomography ( spect ) studies have revealed dysfunction of the striatal dopaminergic system , noting an increase in the presynaptic synthesis of dopamine in patients with schizophrenia .
a hyper dopaminergic state within the ventral striatum in patients with schizophrenia may be associated with enhanced ideas and thoughts in the context of delusions .
a hypodopaminergic state may be related to an amotivational syndrome characterized by apathy , anhedonia , and other negative symptoms . in the hypodopaminergic state ,
however , the administration of antipsychotics has to be taken into account , because antipsychotics may affect motivational salience .
the main problem in this regard is the blockade of dopamine d2 receptors , especially by typical neuroleptics , also known as first - generation antipsychotics ( fgas ) .
this results in clinical depression in 20% to 40% of patients taking fgas , which block d2 receptors . in terms of secondary negative symptomatology , such blockade results in loss of drive , energy , and motivation ; apathy , anhedonia , and patient noncompliance .
the advantage of the new atypical neuroleptics , also called second - generation antipsychotics ( sgas ) , is that they only partially block the d2 receptors in the ventral striatum ( especially clozapine . ) . particularly with regard to the heteroreceptor mechanism involving antagonism of the presynaptic serotonin 5-hydroxytryptamine ( 5-ht2 ) receptor , the administration of sgas results in a sufficient and permanent flow of dopamine within the ventral striatum , thus maintaining affectivity and drive .
the function of the reward system can be visualized with functional magnetic resonance imaging ( fmri ) ; for this purpose , knutson et al developed the monetary incentive delay ( mid ) task .
this is a simple monetary - gain game that requires subjects to respond to a sequence of geometric shapes that are projected onto the screen of the mri scanner during fmri measurement .
this game ( figure 1 ) consists of two runs of 72 trials each , at the beginning of which a geometric shape informs the volunteer about the following : that money can be gained ( indicated by a circle ) , that loss of money can be avoided ( square ) , or that it is a neutral trial ( triangle ) with no monetary consequence .
after these cues have been given , a delay phase follows during which the volunteer waits for the appearance of a target .
the task is to press a button with the thumb when the briefly presented target is visible . immediately after this
, success or failure is indicated , and the cumulative total of money won is shown .
the chance of winning is set to 66% by means of an adaption mechanism , so that the volunteer anticipates the receipt of monetary gain on appearance of a reward - indicating cue .
it is well - known that the occurrence of the dopaminergic signal is to be expected during the anticipation phase .
the game was administered while subjects underwent scanning with a 1.5-tesla scanner ( magnetom vision , siemens ) with an echo - planar imaging ( epi)-sequence ( repetition time [ tr]=1.9 s , echo time [ te]=40 ms , flip angle=90 , voxel size=4x4x3.3 mm ) .
data were analyzed with spm2 ( statistical parameter mapping software version 2 ; http://www.fil.ion.ucl.ac.uk/spm ) . using the normalized preprocessed data ( slice timing , motion correction , spatial normalization , and spatial smoothing with 8-mm full width at half maximum [ fwhm ] )
, we developed single models according to the general linear model for each volunteer , by defining the different gain , loss , and neutral cues as single conditions .
using random effects analysis , we examined the contrast between anticipation of gain and neutral consequence ( for detailed descriptions , see refs 5 and 6 ) .
a few years ago , we examined the influence of fgas and sgas on the reward system in patients with schizophrenia .
three groups were tested : a group of 10 schizophrenic patients who received an fga ( 4 received flupenthixol 124 mg ; 4 , haloperidol 105 mg ; and 2 , fluphenazine 12 + 4 mg ) , a group of 10 schizophrenic patients who were treated with an sga ( 4 received risperidone 51 mg ; 4 , olanzapine 196 mg ; 1 , aripiprazole 30 mg ; and 1 , amisulpride 300 mg ) and a group of 10 healthy control subjects . there were no significant differences between the three groups for age , gender , and total weight gain .
there were no significant differences in psychopathology in both patient groups ( total positive and negative syndrome scale [ panss ] score in patients taking an fga , 70.1120.37 ; those taking an sga , 64.44 + 22.59 ) . in the healthy control subjects ,
we observed activation for the contrast between gain anticipation versus neutral consequence at both sides of the ventral striatum ( left : [ x y z ] = [ -21 5 -3 ] , t=9.53 ; right : [ x y z ] = [ 12 2 -10 ] , t=4.25 ) . whereas no activation in response to reward - indicating stimuli was observed in the schizophrenic patients taking an fga ,
activation was seen in the patients taking an sga , in the right ventral striatum ( [ x y z ] = [ 12 12 -1 ] , t=3.58 ) ( figure 2 ) . in group comparisons
, there was a significant difference between the healthy subjects and the schizophrenic patients taking an fga ( [ x y z ] = [ -21 9 -3 ] , t=3.39 ) , but there was no difference between healthy subjects and patients taking an sga .
the reduction in activation in response to reward- indicating stimuli was inversely correlated with the severity of negative symptomatology ( spearman 's r = -0.67 , p<0.05 ) in the group of patients being treated with an fga , as well as in the group of nonmedicated schizophrenic patients .
as cross - sectional studies are not sufficient to evaluate the effects of antipsychotic medication on ventral striatum activation during the mid task , further studies using a longitudinal design have been carried out in which schizophrenic patients were treated with an fga ( such as haloperidol , flupenthixol , or fluphenazine ) for at least 2 weeks , and then with an sga ( such as risperidone , olanzapine , or aripiprazole ) for another 2 weeks . in such studies , after 2 weeks of the respective treatments , the patients were examined by fmri while carrying out the mid task .
they were then compared with healthy subjects , who were examined twice by fmri at similar time intervals . in a study of changes associated with a switch to olanzapine
, 10 schizophrenic patients treated with an fga ( 4 received haloperidol : 10.8 + 4.3 mg / d ; 5 , flupenthixol 7.0 + 5.1 mg / d ; 1 , fluphenazine 15 mg / d ) were first examined by fmri while performing the mid task and were afterwards switched to olanzapine ( 18.57.5 mg / d ) .
the mean treatment period was 17.8 days ( 15 .0 ) for fgas and 20.2 days ( 6.7 ) for olanzapine .
the repeat examination by fmri after olanzapine treatment was carried out 31.717.3 days after the first fmri examination ( which followed fga treatment ) .
ten healthy subjects were also examined twice , the repeat examination performed 32.715.5 days after the first fmri , in order to control for a potential time effect . in anticipation of monetary gain , healthy subjects showed a significant activation of the ventral striatum ( left : [ x y z ] = [ -18 6 -9 ] , t=3.87 ; right : [ x y z ] = [ 18 6 -3 ] , t=4.70 ) , whereas schizophrenic patients treated with an fga did not show any activity ( figure 3 ) . however , after switching to olanzapine treatment , activation of the ventral striatum was observed on the right side ( [ x y z ] = [ 15 6 -12 ] , t4.36 ) . in the healthy control subjects , activation of the ventral striatum , due to the anticipation of a reward , remained quite stable over time . presumably due to secondary negative symptomatology in the schizophrenic patients ,
there was a significant correlation between the activation of the ventral striatum and the panss negative score ( r=-0.721 , p=0.019 ) , though only after treatment with an fga . in a pilot study ( gj et al , unpublished data , 2015 ) investigating the change in activation associated with a switch from treatment with an fga to an sga , 8 male schizophrenic patients under treatment with either haloperidol or flupentixol ( fgas ) at baseline ,
the average age of these patients was 3513 years ; the healthy controls were aged 33.612.5 years . at baseline ,
fmri scans carried out during performance of the mid task in fga - treated schizophrenic patients showed a significantly lower activation of the ventral striatum than healthy controls ( t - values 2.5 to 3.0 , t=0.03 to 0.04 , corrected for ventral striatum region of interest false discovery rate [ roi fdr ] ) . after changing the medication to the sga risperidone , fmri scans carried out nearly 2 months after the baseline scans in order to minimize any residual fga effects , known to be long - acting showed a visible increase in activity over that seen under fga treatment on both sides of the ventral striatum for gain anticipation ( left : t=3.6 , p=0.04 corrected for roi ; right : t=3.6 , p=0.02 corrected for roi ) .
this implies a possible regeneration of the dopaminergic reward system in the ventral striatum after the change to an sga . in another study ,
switching from an fga to the sga aripiprazole , also resulted in increased activation of the ventral striatum ( t=2.17 , p<0.05 ) .
dysfunction within the dopaminergic reward system can be explored in schizophrenic patients , with or without treatment by fgas and sgas , by fmri during performance of the mid task .
schizophrenic patients have been shown to have less activation of the ventral striatum , a core region of the reward system , than healthy controls ; the severity of the ( primary ) negative symptomatology is associated with reduced activation of the ventral striatum .
the findings about the effects of fgas in the cross - sectional and switch - longitudinal studies can be interpreted as expressions of the secondary fga - induced negative symptoms caused by a flattening of ventral striatal dopaminergic tone , symptoms that were not present , or that disappeared , after switching to an sga .
the findings of the two study types about the influence of fgas and sgas on the reward system may be summarized as follows : ( i ) patients with schizophrenia treated with fgas , but not with sgas , had less activity in the ventral striatum than healthy controls and ( ii ) the severity of the negative symptomatology correlated with the reduction in activity in the ventral striatum in patients treated with fgas the better effectiveness of sgas on negative symptomatology , shown in clinical studies , potentially correlates with lower impairment of the reward system .
sgas , for example , risperidone or olanzapine , cause relatively low blockade of the striatal dopamine d2 receptors and are not bound so tightly to these receptors .
moreover , they interact with other transmitter systems , such as the serotonergic system ( through effects on the 5-ht2a receptor ) .
secondly , the exact mechanism of the dopaminergic reward dysfunction can not be clarified by fmri .
the application of multimodal methods with a combination of dopamine - pet and fmri could possibly explain which mechanisms cause the dysfunction of the reward system in patients with schizophrenia . in order to compare fgas and sgas ,
therefore , the results discussed here require replication in a better and longer longitudinal study in patients in which treatment with fgas is then switched to treatment with sgas .
alternatively , a controlled before - and - after study of patients receiving no treatment and then receiving a specific antipsychotic monotherapy would also help to elucidate the relationship between different antipsychotic treatments and the mesolimbic dopaminergic reward system in schizophrenia . to this end
, one study has compared 23 antipsychotic - naive patients before and after a 6-week treatment with amisulpride . similarly to our findings , patients without any medication showed clear attenuation of brain fmri activation during reward anticipation in the ventral striatum during the mid task , with activation normalized after a 6-week treatment with an sga . | the mesolimbic dopaminergic reward system is responsible for the negative affective symptomatology of schizophrenia , which may be related to a low dopamine tonus within the ventral striatum .
the monetary incentive delay ( mid ) task can be used to study the response of the ventral striatum to incentive stimuli .
we show that activation of the ventral striatum is low in patients with schizophrenia , and that this low activation is related to primary and secondary negative symptoms induced by neuroleptics , also known as antipsychotics . switching from first-(typical ) to second - generation ( atypical )
antipsychotics increased activation of the ventral striatum due to less blocking of dopamine d2 receptors .
this and similar studies show that functional magnetic resonance imaging ( fmri ) tasks are suitable to investigate important aspects of antipsychotic mechanisms . | The mesolimbic dopaminergic reward system in schizophrenia
The monetary incentive delay task in functional magnetic resonance imaging
First-versus second-generation antipsychotics: a cross-sectional study
Switch from first- to second-generation antipsychotics: reactivation of the ventral striatum in patients with schizophrenia in longitudinal studies
Conclusions |
since its initial development approximately two decades ago , optical coherence tomography ( oct ) has become an indispensable tool in ophthalmic imaging . although it was initially designed to image the posterior segment and retina [ 2 , 3 ] , oct 's capability to generate cross - sectional images of internal biological structures without contacting the ocular surface
anterior segment oct technology has been improved a great deal since izatt et al .
first reported using oct to image the anterior segment of the eye in 1994 . of the many uses that have come out of those improvements ,
one of the most commonly cited is the evaluation of the anterior chamber angle for narrow - angle glaucoma .
there are currently two types of oct instruments used for imaging the anterior segment : time domain ( td ) and the more recently developed fourier domain ( fd ) .
relying on the mechanical movement of the reference mirror to produce each axial scan ( a - scan ) , td - oct samples the range of depth being imaged one point at a time .
in contrast , fd - oct also known as spectral - domain ( sd ) oct , spectral oct , high - definition ( hd ) oct , and frequency - domain oct does not rely on the mechanical movement of a reference mirror : the reflections from the entire depth range being imaged are sampled simultaneously .
the interference between the sample and reference beams is detected as a spectral interferogram , which undergoes fourier transform to produce axial scans ( a - scans ) .
therefore , fd - oct instruments can provide scan speeds 10100 times faster than td - oct instruments .
the faster speeds minimize the effect of eye movements during imaging and allow higher - definition imaging due to denser axial scans in the same transverse scan length .
the scanning speed of fd - oct also facilitates the registration and averaging of sequential frames .
this frame averaging makes it possible to both increase the signal - to - noise ratio of an image and sharpen the anatomic features contained therein ( figures 1 , 2 , 3 , 4 , 5 , and 6 ) .
anterior segment oct systems can also be differentiated by the central wavelengths they utilize for scans .
current oct instruments commonly use 840 nm , 1050 nm , or 1310 nm wavelength light .
the use of longer wavelength light to image the anterior chamber angle does have advantages .
1310 nm and 1050 nm lights show lower scattering and signal loss in turbid media [ 11 , 12 ] , permitting much better penetration through the limbus and sclera than is possible using shorter wavelengths .
this increased penetration allows 1310 nm wavelength oct to accurately measure gross angle morphology and visualize angle structures such as the iris root and scleral spur [ 1315 ] . as a result ,
past studies used 1310 nm oct systems and developed quantitative angle parameters using scleral spur as the anatomical landmark [ 1619 ] .
the axial resolutions of the earlier oct systems used in the abovementioned studies were limited to 1520 m and did not allow reliable identification of smaller angle structures such as the trabecular meshwork and schwalbe 's line .
newer oct systems capable of producing axial resolutions of 15 m are now available [ 20 , 21 ] .
this marked increase in resolution is due to the combination of broader bandwidth and shorter wavelength .
the 840 nm fd - oct systems discussed in this paper had an axial resolution of 5 m and were able to visualize details of the anterior segment that could not be resolved with previous oct systems [ 14 , 16 ] .
these details include the schwalbe 's line , schlemm 's canal , trabecular meshwork , and aqueous collector veins ( figures 16 ) . as an example
, we used both the 840 nm rtvue fd - oct ( optovue , inc .
fremont , ca , usa ) and the 1310 nm visante td - oct ( carl zeiss meditec , inc .
; dublin , ca ) to image the same anterior chamber angle location of a normal volunteer .
the 1310 nm visante oct had better penetration than the rtvue and could visualize both scleral spur and angle recess .
the device 's resolution , however , prevented visualization of fine anatomical structures such as schwalbe 's line , schlemm 's canal , and trabecular meshwork .
by contrast , the higher resolution 840 nm rtvue oct image showed schwalbe 's line , trabecular meshwork , schlemm 's canal , and scleral spur ( figure 1 ) , but provided limited visualization of the angle recess .
in summary , the visante provided a wider field of view and better penetration , but with lower resolution , while the rtvue provided higher - resolution information on a narrower portion of the anterior chamber .
reported similar observations in a 2009 study comparing the results of anterior segment imaging with the rtvue and the visante .
the study examined 54 eyes and compared measurements of central corneal thickness ( cct ) , trabecular - iris area ( tisa ) , angle opening distance at the scleral spur ( aod - ss ) , and anterior segment morphology . upon comparing the mean values of the cct , tisa , and aod - ss measurements obtained using the rtvue with those obtained using the visante , wylegaa et al . found no statistically significant difference between the measurements .
there was , however , a difference in the amount of anatomic detail contained in the images .
the study found that the rtvue images showed structures , such as bowman 's layer and schlemm 's canal , which could not be visualized with the visante .
schwalbe 's line represents the termination of descemet 's membrane and is approximately 500750 m anterior to the scleral spur .
the distance between schwalbe 's line and the scleral spur represents the trabecular meshwork and the aqueous humor filtration distance .
schwalbe 's line was proposed as an anatomical landmark because it could be consistently identified in 840 nm fd - oct images .
several research groups recommended measuring angle opening distance at the schwalbe 's line ( aod - sl ) for quantitative angle assessment [ 2325 ] .
further , aod - sl has demonstrated good repeatability and strong correlation with gonioscopic grading .
each participant underwent dark - room gonioscopy , and the angle was graded in four quadrants ( superior , inferior , nasal , and temporal ) using the modified shaffer grading system .
oct imaging was performed on the nasal and temporal quadrants of each eye using the cirrus hd - oct model 4000 ( software version 3.0 , carl zeiss meditec , dublin , ca , usa ) . an external fixation light was used to guide each patient 's fixation to the side of the oct instrument during imaging .
the aod - sl measurements showed consistent interobserver and intraobserver reliability with intraclass correlation coefficients of 0.979 and 0.988 , respectively .
there was also strong correlation between aod - sl measurements and gonioscopic grading , with a spearman correlation coefficient of 0.709 .
the occludable angle aod - sl measurements ranged from 94 m to 172 m , and the nonoccludable angle aod - sl measurements ranged from 286 m to 347 m . although cheung et al.did not report a diagnostic cutoff for occludable angle , based on these results one could be estimated at approximately 230 m . in a similar study , qin et al .
recruited 35 glaucoma patients from the doheny eye institute at the university of southern california , los angeles , california , usa .
each subject underwent dark - room gonioscopic examination and a modified shaffer grade was recorded for each of four quadrants .
angle scans were performed under standardized dim illumination conditions ( 6.6 foot candles ) using the rtvue fd - oct ( optovue , inc . ,
qin et al . also reported good repeatability for aod - sl measurements with intraobserver coefficients of variation ranging from 9.8% to 12.0% and interobserver coefficients of variation ranging from 10.1% to 13.3% .
spearman 's rho analysis showed strong correlation between aod - sl measurements and gonioscopic grading with correlation coefficients of 0.80 for nasal angles and 0.81 for temporal angles .
the occludable angle aod - sl measurements ranged from 0 m to 350 m , and the nonoccludable angle measurements ranged from 192 m to 922 m .
qin et al . determined a diagnostic cutoff value for occludable angle of 290 m by performing receiver operating characteristic ( roc ) analyses .
pre- and post - operative angle imaging with fd - oct is useful for documenting and evaluating surgery outcomes .
for example , using fd - oct to image the angle both before and after laser peripheral iridotomy made it possible to document the resulting angle morphological changes ( figure 5 ) .
this technology was also used to evaluate filtering blebs and demonstrate subconjunctival filtration after trabeculotomy , and to confirm the excision of trabecular tissue after trabectome treatment ( figure 6 ) .
oct is also used to examine iridotrabecular contact as a peripheral anterior synechia after penetrating keratoplasty .
high - resolution 840 nm fd - oct is capable of providing angle images with fine anatomical structures .
studies showed that the schwalbe 's line could be identified in over 95% of fd - oct angle scans .
in addition , measurements of the angle opening distance at the schwalbe 's line were shown to have good repeatability and strong correlation with gonioscopic assessments .
quantitative angle measurements using schwalbe 's line as the anatomical landmark may help clinicians to better assess and manage narrow - angle glaucoma . based on gonioscopic correlation , studies so far indicate the aod - sl diagnostic cutoff for occludable angle is between 230 m and 290 m
. therefore , measurement of angle opening distance with fd - oct may be useful in the assessment of angle closure risk .
after filtration surgery , fd - oct is also a useful tool for postsurgical evaluation of angle structures . | new advances in anterior segment optical coherence tomography ( oct ) technology development allow visualizing the anterior chamber angle of the eye with high speed and high resolution .
fourier - domain ( fd ) oct instruments working at 840 nm can reliably identify fine angle structures such as the schwalbe 's line .
this paper demonstrates quantitative angle assessment with 840 nm fd - oct and provides diagnostic cutoff values for occludable angle detection .
this is useful for angle closure glaucoma diagnosis and management .
moreover , 840 nm fd - oct is a useful tool for postsurgical evaluation in glaucoma patients . | 1. Introduction
2. Anterior Segment OCT
3. Schwalbe's Line-Based Quantitative Angle Assessment with High-Resolution FD-OCT
4. Postoperative Angle Imaging with FD-OCT
5. Conclusion |
osteosarcoma ( os ) , characterized by the production of osteoid material by malignant osteoblastic cells , is a primary malignant bone tumor deriving from primitive bone - forming mesenchymal cells .
overall , the treatment strategies are preoperative chemotherapy and surgical resection followed by postoperative chemotherapy and adjuvant therapy for several years .
the 5-year survival rates for patients with localized osteosarcoma have dramatically improved from less than 15% in the 1950s to greater than 60% since the 1980s . despite advances in diagnostic and treatment regiments , progress since
one of the reasons could be the presence of mutated oncogenes , which confer drug resistance of the cancer cell .
currently , the diagnosis of os is generally dependent on a comprehensive examination including clinical symptoms , imaging , laboratory examinations , biopsy , and immunohistochemistry .
clinically , os was always diagnosed at the middle or even at a late stage .
therefore , the long - term survival rate of os has not been improved in the past 20 years .
the histological examination of the biopsy specimens is still preferred by many orthopedic oncologists for the diagnosis of os . despite its invasive procedure , the accuracy of diagnosis may vary among different sample collection and different observers , making the clinical prediction questionable .
thus , we have focused our attention on the development of a noninvasive method for the early diagnosis of osteosarcoma .
many studies have identified that antigenic changes in cells can be recognized by the immune system of patients .
some early studies demonstrated the presence of serum autoantibodies to a panel of known tumor associated antigen ( taa ) in various human cancers .
the study indicated that autoantibody reactivity to individual taa rarely exceeded 20% in the cancer patient populations compared with normal human sera ( nhs ) which are usually less than 5% .
it is conceivable that specific autoantibody profiles can be identified with help for discriminating autoantibody reactivity between cancer patients and control individuals and distinguishing between some types of cancer .
so far , only a few studies have been performed in the field of using autoantibodies as diagnostic markers in osteosarcoma .
several different approaches based on mass spectrometry ( ms ) have been applied in the search for cancer biomarkers .
direct analysis of serum samples using ms is becoming more popular due to its high - throughput nature and increased sensitivity .
one of these proteomic approaches , surface - enhanced laser desorption / ionization - time - of - flight mass spectrometry ( seldi - tof - ms ) , is a rapid and sensitive proteomic technique to identify biomarkers in various forms of cancers [ 7 , 8 ] .
this technology has been effectively used in the validation of serum antigens for early - stage detection of various cancers , such as prostate , ovarian , and breast cancers .
therefore , exploitation of seldi - tof - ms for screening biomarkers in os is applicable .
the searching database tool , empirical proteomic ontology knowledge base ( epo - kb ) , including tens of thousands of mass to charge ratio ( m / z ) protein function , was used to identify proteins characterized from seldi - tof - ms . using seldi - tof - ms combined with epo - kb makes it possible to directly separate and identify the proteins from human osteosarcoma sera .
the major aim of this study using seldi - tof - ms combined with epo - kb is to identify serum markers from human osteosarcoma sera as potential os - associated markers for early diagnosis of os .
sera from 25 chinese patients , han ethnic ( fourteen males and eleven females , mean age 19.3 years , and range 250 ) , with high - grade os were collected at the time of diagnosis before biopsy and chemotherapy were analyzed .
all samples were provided by luoyang orthopedic - traumatological hospital and luoyang institute of orthopedic and traumatology between jan .
we randomly collected 26 human serum samples from normal age - matched donors in the same hospital as a normal control and 16 samples from osteochondroma ( oc ) ( nine males and six females , mean age 16.8 years , and range 448 years , chinese patients , han ethnic ) as benign tumor control .
all blood samples ( 5 ml from each patient or normal person ) were collected in edta - containing tubes at room temperature and immediately centrifuged at 1000 rpm for 10 min . the serum supernatant was collected and divided into aliquots and stored at 80c .
the study was approved by the ethics committee of luoyang orthopedic - traumatological hospital and luoyang institute of orthopedic and traumatology .
serum samples were diluted to a certain concentration and immediately centrifuged ( 20,000 rpm ) for 10 min at 4c .
twenty microliters of each serum was denatured by adding 40 ml of u9 buffer containing 9 mol / l uric acid , 2% chaps ( ph 9.0 ) , and 50 mmol / l tris - hcl ( ph 9.0 ) and shaken for 20 min at 4c .
twenty microliters of the denatured samples were fractionated by 240 l of u1 buffer and shaken for 30 min .
each chip was added with bluestone ( 50 l , 100 mmol / l ) and shaken ( 200 rpm ) for 5 min at room temperature , and the bluestone solution was immediately poured out . after being washed using ionized water for 5 times
, the chip was added with 50 l of cm low stringency buffer ( 0.1 m sodium acetate , ph 4.0 ) , shaken ( 200 rpm ) for 5 min .
then , each chip was added with 150 l of standard buffer containing 100 mol / l sodium phosphate and 500 mmol / l sodium chloride ( ph 7.0 ) and incubated on the oscillator for 5 min at room temperature , and the buffer solution was removed .
this process was repeated one more time . each serum sample ( 50 l )
was randomly assigned to a spot on each protein - chip array and incubated on the oscillator for 60 min at 4c .
the samples were denatured by 150 l of standard buffer , washed and oscillated for 3 times each for 5 min , and quickly washed with 1 mmol / l hepes ( ph 7.0 ) .
chip eam ( sinapinic acid ( spa ) ) was added with 100 mmol / l acetonitrile ( 75 l ) and trifluoroacetic acid ( tfa ) ( 75 l ) .
the reagents such as uric acid , acetonitrile , tfa , and spa were purchased from sigma .
the pbsiic and imac3-cu were calibrated externally by using the all - in - one peptide and protein ii molecular mass standards ( ciphergen biosystems ) .
each sample was analyzed in duplicate to minimize the effects of intra - assay variation .
proteomic profiles on the protein - chip arrays were detected by a protein biology system ( model pbsiic ) .
statistical signification peaks were recorded by x-s and identified by using parametric t - test with p value of 0.001 with biomarker wizard and biomarker pattern system software .
the diagnostic accuracy was measured by external leave - one - out cross - validation , which is one of the feature selection steps .
sixty - seven serum samples were assayed by seldi - tof - ms . from a total of 67 serum samples ,
25 serum samples are from os patients compared with the control group of 42 serum samples ( 16 from osteochondroma and 26 from normal human serum ) .
one protein peak at 3954 da was overexpressed and another one at 6438 da ( table 1 ) .
the mass spectrum shows the comparison of three serum samples from patients with os and oc as well as a serum from a normal individual ( figures 1 and 2 ) . in order to take a marked contrast
, we apply the biomarker pattern software to analyze protein differences in the template group to m / z , respectively , 3954 da and 6438 da proteins composed of two different diagnostic classification tree models ( figure 3 ) .
the 67 samples were repeated sampling in the learning mode , and the diagnostic sensitivity was 98.51% and specificity was 98.51% , while , in test mode , the diagnostic sensitivity was 98.51% , and specificity was 100.00% .
it was verified by leave - one - out and 3-fold cross - validation that correct grouping rate was 100% ( 67/67 ) , good response rate was 100% ( 25/25 ) , and specificity was 100% ( 42/42 ) .
we searched the m / z of 3954 da and 6438 da in the first classification tree models and got related results in the epo - kb database .
the relevant information of 6438 da protein was retrieved ; however , the 3954 da protein needs further identification ( http://www.expasy.org/cgi-bin/prosite-search-ac?pdoc50099 and http://us.expasy.org/prosite/ps50324 ) .
it is serine rich protein sequences involved in cell signal transduction and carcinogenesis . in some microtubule plus end tracking proteins , there are some basic amino acid serine rich sequences .
these basic amino acids serine rich sequences are often mediated by the microtubule plus end tracking proteins with microtubules and eb protein and the role of other proteins .
protein peak of m / z at 6438 da in the b - cell lymphoma is highly expressed and , in the low expression of t cell lymphoma , it is closely related to the human immune system regulation .
seldi - tof - ms is a relatively new proteomic technology that has impacted many areas of biological research [ 13 , 14 ] .
the high - throughput nature of this technology allows the processing of many samples simultaneously in a relatively short period of time .
it requires only small amounts of samples for profiling , which makes it particularly suitable for clinical or translational studies .
seldi - tof - ms has been successfully applied in identifying early detection biomarkers in multiple cancers , including ovarian , prostate , and breast cancers .
however , seldi - tof - ms technology is not widely used in bone oncology to identify biomarkers and perform molecular classification , partly due to the limited sample size when compared to other cancers .
the current study shows that patients with os and oc and normal individuals can be distinguished from each other by the special proteins with different m / z characters screened by seldi - tof - ms .
the results showed three samples determined by the difference of the following standards ( m3954 0.396 ( normal ) , m6438 1.329 ( os ) , and m6438 > 1.329 ( oc ) ) .
it was verified by leave - one - out and 3-fold cross - validation that correct grouping rate was 100% ( 67/67 ) , which proved that the results is reliable .
the diagnosis of os generally depended on a comprehensive way including clinical symptoms , signs , image , laboratory examinations , biopsy , immunohistochemistry , and other methods .
the surgical biopsy is also the terminal way for final diagnosis , which is an invasive procedure and has risks of enhancing tumor dissemination and metastases .
if we can perform specific markers with high sensitivity and specificity using blood specimens from the patients , it will be more convenient and noninvasive to the patients at the initial diagnosis .
these specific markers combined with x - ray exam could be used to monitor os development in coordination with chemotherapy or radiography . and
the present study has found the m / z of 3954 da and 6438 da proteins in the classification tree models and gotten 6438 da in the epo - kb database , which is a serine rich protein sequences involved in cell signal transduction and carcinogenesis .
these basic amino acids serine rich sequences are often mediated by the microtubule plus end tracking proteins with microtubules and eb protein and the role of other proteins .
since protein peak of m / z at 6438 da showed high expression in the b - cell lymphoma and low expression in t - cell lymphoma , it is closely related to the human immune system regulation .
we thought that the 6438 da protein identified by seldi - tof - ms may potentially be used for early detection , diagnosis , therapeutically monitoring , and prognosis of os .
in addition , randomized clinical trials are required to investigate its effect ( or lack thereof ) .
seldi - tof - ms technology is still more constraining in clinical research , because the only result we can get is m / z , rather than the molecular weight .
after finding the different proteins by seldi - tof - ms , further studies with chromatography , two - dimensional electrophoresis , spectroscopy , and other techniques need to be performed to identify these proteins immensely .
however , these laboratory approaches could not be used for large - scale screening of biomarkers in clinical application .
additionally , its wide acceptance is still in question due to some concerns regarding reproducibility and reduced sensitivity at high molecular weight range .
these findings suggest that the m / z of 3954 da and 6438 da proteins could potentially be biomarkers for early diagnosis of osteosarcoma
. it would be interesting and important to conduct other independent studies in large populations for comparison .
future functional studies are warranted to verify these findings and to improve our understanding of the underling molecular mechanism of genetic contribution to os carcinogenesis . | osteosarcoma ( os ) is the most common malignant bone tumor . to identify os - related specific proteins for early diagnosis of os , a novel approach , surface - enhanced laser desorption / ionization - time - of - flight mass spectrometry ( seldi - tof - ms ) to serum samples from 25 os patients , 16 osteochondroma , and 26 age - matched normal human volunteers as controls , was performed .
two proteins showed a significantly different expression in os serum samples from control groups .
proteomic profiles and external leave - one - out cross - validation analysis showed that the correct rate of allocation , the sensitivity , and the specificity of diagnosis were 100% .
these two proteins were further identified by searching the epo - kb database , and one of the proteins identified as serine rich region profile is involved in various cellular signaling cascades and tumor genesis .
the presence of these two proteins in os patients but absence from premalignant and normal human controls implied that they can be potential biomarkers for early diagnosis of os . | 1. Introduction
2. Materials and Methods
3. Results
4. Discussion |
there are standards for content used in the creation of these checklists as well as formatting .
more recent studies have shown that specific formatting changes to the college of american pathologists ( cap ) cancer protocols significantly improve the completeness of the report , the clerical error rate ( as measured by amendments ) of synoptic reports is associated with the number of required data elements ( rdes ) , and specific formats of the report itself are associated with user preference and speed of data extraction by users .
synoptic report format as well as specific required elements within the synoptic report for all primary resections of specific diagnoses but has no requirement concerning how that synoptic report is generated . written paper protocols and an electronic product that works through a pathologist 's laboratory information system ( electronic cancer checklist [ ecc ] ) are available from cap .
nevertheless , data concerning the impact of these different methods of generating a synoptic report on the quality of the synoptic report are limited .
in addition , tools have been developed to create structured data for registries and other interested parties from these synoptic reports .
this structured data consists of having the data elements as discrete elements in a true database ( i.e. , sql , etc . , ) which most commonly is achieved by creating a data file ( i.e. , comma separated value , tab delimited , or excel file for examples ) with discrete data elements rather than a free text narrative text file such as word ( most surgical pathology reports ) .
synoptic reporting can be implemented with different features ranging from simply including a table within the free text narrative report to fully structured reporting with binding to other databases including snomed and other databases .
however , data comparing the completeness or accuracy of the subsequently extracted and created structured database for any implementation of synoptic reporting is quite limited . to assess this ,
we compared four different types of synoptic report generating methods , including a web - based method , across a wide range of different quality measures .
from 2004 to 2016 , four different methods were used to generate synoptic reports in our hospital , [ table 1 ] .
all reports were dictated by the pathologists , typed by secretaries , and subsequently edited by the pathologists before sign out .
initially , pathologists used the checklists directly from the cap website ( cap format protocol ) .
next , these checklists were edited as detailed previously ( removal of all optional elements , numbering all elements , and consistent formatting ) ( edited cap protocol ) .
subsequently , word - based macros were made for the secretaries that included all rde headers and into which the secretaries only had to type the response for each header .
finally , a web - based product was made and placed on our hospital system intranet [ figure 1 ] .
this consisted of a web page connected to a json file that contained all the elements required by cap for creating a synoptic report .
this product listed all rde headers and allowed the pathologists or secretary to simply select from a list of the most common responses or free text a response if the desired response was not there . in all cases ,
the pathologist dictated the response to select from looking at the website , and the secretary subsequently went through the website and selected the items .
the website then generated a rich text formatted table - based synoptic report that was then cut and pasted directly into our surgical pathology report ( powerpath ) [ figure 2 ] .
performance of four different synoptic report generating methods screen shot of the web based protocol for colon carcinoma screen shot of the synoptic report generated by the web based protocol for colon carcinoma the web page was designed by two of the authors ( mar , sar ) so that only required ( by either cap or our clinicians ) data elements were included .
each question had to be answered , and the pathologists could only select one answer ( no multi - answer questions ) , although he or she was allowed to free text anything they like if they could not find the response they wished for , and not applicable was the appropriate response in some cases .
the default response for each question was a flag that read you missed this item that the report automatically generated if any item was missing from the report . in this way , if a pathologist skipped an item , the secretary could leave this text in place and still generate a report , and the pathologist could see and fix this response during the editing phase . there were also notes reminding the pathologists which ancillary studies needed to be ordered when associated with an rde in the synoptic report .
these notes appeared on the web page that the pathologists used to create the synoptic report but did not appear on the final synoptic report itself .
for the purposes of this study , we tracked how often the pathologist ordered kras studies on all colon carcinoma cases that were either stage t4 or n1 ( as per the desires of our clinicians ) before and after sign out as a measure of whether they remembered to order this ancillary study or had to go back and order it later .
finally , at the beginning of each rde in the report , the web page placed a pipe | specifically designed to improve free text extraction [ figure 3 ] . as a result , all rdes could be easily searched for using a free text search because they all began with the pipe
multiline responses had no effect on this since the information was in a rich text format table that placed all information related to the data element before any information related to the response .
example of a report used to test the speed and accuracy of information retrieval containing the embedded flag ( pipe ) all cases with a tumor summary were reviewed by the tumor registry for completeness .
data on completeness were collected by the staff of the tumor registry and reported back to the pathologists on a monthly basis .
the definition of completeness was all items listed as required by the cap during the appropriate time period . as those requirements changed over time , so did the definition of completeness .
however , during this study , all methods were updated in a timely manner , and hence that there were no incomplete cases identified because of a new requirement that was not listed in the method .
however , during the 1 month of the web - based report , a single data item ( specimen integrity ) was left off the web - based protocol for endometrium . as a result ,
this omission was subsequently fixed , and this was not included in our results for completeness for the web - based option since the pathologists did correctly include all items that were actually included in the web - based protocol during this time .
only amendments that related to the tumor summary and were not based on additional clinical or pathologic information were included .
specifically , we were trying to track clerical errors such as spelling mistakes and features that did not match that were supposed to ( i.e. , the stage did not match the reported extent ) .
structured data were extracted from the synoptic report section of all surgical pathology reports using free text searches and regular expressions . before the inclusion of the pipe
| items were identified using a set of standard regular expression searches looking for the text of the rde . only breast carcinoma cases were extracted since the search required the use of specific headers to identify information . with the use of the pipe
, searches were based on identifying the pipes and the corresponding colons ( : ) and all synoptic reports were included since the data were extracted regardless of which headers were included .
the data were subsequently collected in tab delimited ( txt ) file , and these results reviewed and compared .
numeric data were extracted from these strings in a subset of cases , but this conversion was not included as part of the definition of a complete report .
successful data extraction consisted of the inclusion of the correct data item and response in the txt file based on manual comparison with the original report . to test whether our embedded flag affected the end users ability to quickly and accurately extract information from a surgical pathology report ,
specifically , the participant is shown a specific phrase that may or may not be in a synoptic report .
when the user presses enter the synoptic report appears on the screen , and the timer starts .
the user then examines the report to determine if the phrase is or is not present .
if it is present the user types the number 2 , if it is not they type 1 , and then press enter . the timer stops when enter is pressed .
the program automatically records the time and whether the answer was correct , and this data are then transferred to a comma - separated values ( csvs ) file for further analysis .
we constructed our synoptic report for this test from an invasive breast carcinoma using the tumor protocol from cap .
all elements were identical except for changes in the reporting of focality , nipple involvement , skin involvement , and lymphovascular invasion .
the formats were tested in a quiz that contained 32 total questions half of which had the pipe on the left side of the report [ figure 3 ] and half of which did not [ figure 4 ] .
all questions were presented in random order . at the end of the quiz , each participant was asked whether they felt the pipe interfered with their reading of the report .
example of a report used to test the speed and accuracy of information retrieval without the embedded flag ( pipe ) twenty - six participants completed the quiz .
they were all nonpathologists and included , six cancer registrars , 15 medical personnel ( 4 md , 11 non - mds ) , and five nonmedical personnel ( administrative assistants , other professionals ) .
we specifically excluded pathologists from this testing , since we wanted to measure the performance of a user other than a pathologist . to allow comparison between these uses , times were normalized to the mean of the standard format for each user . as a result , the normalized time for the format without the pipe was the control with a normalized time of one , and the time for the pipe format was in comparison with that time .
the results for these are reported as mean standard deviation ( no units since they are normalized ) .
statistical analysis was performed using a fisher 's exact test for categorical data and a student 's t - test for continuous data .
use of the printed tumor protocols directly from the cap website had the lowest completeness ( 84% ) and highest amendment ( 1.8% ) rates .
reformatting these protocols was associated with higher completeness ( 94% , p < 0.001 ) and reduced amendment ( 1% , p = 0.20 ) rates .
extraction failed most often due to the headers for the presence of ductal carcinoma in situ ( dcis ) and the margin status of dcis not being consistently unique ( as copied from the cap protocol directly , since the fact that one of the elements is related to margin status is located well away from the actual line for dcis ) .
word - based macros improved completeness ( 98% vs. 94% , p < 0.001 ) but not amendment rates ( 1.5% ) .
in contrast , a web - based product with a reminder flag when items were missing , an embedded flag for data extraction , and a reminder to order kras when appropriate resulted in improved completeness ( 100% , p = 0.005 ) , amendment rates ( 0.3% , p = 0.03 ) , kras ordering before sign out ( 100% , p = 0.23 ) , and structured data extraction ( 100% p < 0.001 ) .
the contents of the data extraction was compared to that of the original report on a subset of cases ( 100 ) and found to be 100% accurate .
there were a total of 832 responses for the quiz , half with the pipe and half without .
the speed with which readers were able to answer the questions was not significantly different with the pipe than without it ( 0.98 + 0.66 vs. 1.00 + 0.49 , p = 0.65 ) , and both formats were 100% accurate ( p = 1.00 ) .
all readers agreed that after initially being shown the pipe , they ignored it when answering the questions in the test .
the results of this study consist of a range of quality performance measures comparing a variety of different methods to generate synoptic reports .
the goal of these quality performance measures is to ensure that a complete and accurate report is generated that can easily be converted into a structured data file and does not interfere with the ability of the reader to accurately and rapidly extract information from the report .
first , consistent formatting of the checklists makes it easier to generate a complete report .
the completeness rates for all of the methods examined except the cap format protocols , all of which have a consistent format , are well above 90% , which is a level of performance most studies have failed to achieve .
second , selection of responses from a list rather than free text typing reduces errors ( amendments ) .
third , reminders or warning flags to identify missing items or additional studies that need to be performed improves the completeness of the report , and when these reminders are appropriately designed may reduce the need for force functions to ensure completeness .
finally , embedding a flag into the synoptic report within the surgical pathology report itself made free text extraction of data elements from the surgical pathology report into a structured data file easy and highly accurate without impacting the reader 's ability to extract information from the report .
, it appeared that the secretaries were not sure what to do when a pathologist skipped an item in the macro in their dictation . in some cases
, they assumed that it was skipped on purpose and deleted that entry from the report .
additional training may be of value in further improving the completeness of reports with the use of macros .
however , there was no reduction in the amendment rate with the use of word macros . on review
, we noted that the majority of amendments were in the response rather than the header part of the report , and these macros did not change how this section of the report was created ; secretaries still had to type in the response even when using a macro .
in contrast , the web - based option reduced the number of responses that had to be typed , and this may have led to a reduction in the amendment rate . while it is possible to create drop - down boxes in word that might have the same result , we were unable to make these compatible with our current laboratory information system .
in contrast , the web - based protocol was associated with a very high level of accuracy and completeness , including completeness of ordering additional studies , a measure that has rarely been examined in previous studies .
first is that it was simply easier for both the pathologists and secretaries to use than other methods ( improved usability ) .
for both the pathologists and secretaries , the web - based method is setup with very simple rules so that each question must be answered and always requires a single response .
there is very little thinking involved concerning optional questions or multiple select items that may distract the user from the task at hand .
in addition , when reading from a computer ( typically but not exclusively internet explorer in this study ) the browser scrolled through the questions in a much more uniform and consistent fashion than microsoft word scrolled through word - based templates . in a word , the checklist often scrolled either too slowly or jumped from page to page , making it more likely for the pathologist to miss an item , and possibly distracting them from dictating the correct response . for the secretaries ,
there was significantly less free text entry , and it was more difficult for them to delete an item , and the flag made it clear that they were supposed to flag a missing item rather than simply delete it .
in addition , unlike word macros , it was also possible to embed instructions and reminders for the pathologists in the website without these appearing on the subsequent report .
our data clearly show that these reminders improved the consistent ordering of appropriate ancillary studies , without the need for force functions .
this study shows that a structured data file ( structured data ) can be extracted from free text synoptic reports and used to create a structured data set in a conventional database , but the success depends on the way those reports are structured .
structured data is a broad and generic term , and there are many types of structured data not all of which may be of value in creating a structured data file or data in a true database system .
indeed , a synoptic report is required by the cap to have data in a particular structure ( structured data ) composed of data arranged in a tabular form , but this structure is of very little value for extracting a structured data file ( i.e. , csv , txt , excel files ) for entering into a true database which is really what most authors mean when they say structured data ( although limited data suggest that this structure likely improves the speed with which readers can extract information ) .
the success of our free text searches was highly dependent on embedding an alternative structure into the synoptic report ( beyond that stipulated by the cap ) in the surgical pathology report itself , although this structured data are not the same as a data file .
when we did not embed this structure ( straight free text searching using regular expressions ) , the algorithm to extract the data was complex and completely type specific since we had to search on the specific headers themselves . as a result
, we were only able to develop an algorithm that worked for one tumor site ( breast ) , and this method was only modestly reliable .
in contrast , with our embedded structure of pipes , a single simple algorithm allowed extraction of 100% of data from all tumor sites .
thus , we believe that embedding an appropriate structure into the synoptic report can significantly improve the success of extracting a structured data file from that report using free text searches . we have also shown that the embedded structure that is used in the synoptic report does not interfere with the reader 's ability to extract information .
in addition , the structure that we employ ( pipes | ) to extract a structured data file using text - based searches is not dependent on the tabular format that is required by the cap .
one could easily list one or more items on a line , or even embed these pipes within narrative text , and still our system would be able to extract the data into a structured data file .
we believe it can also easily be extended to data within an addendum , for example , ancillary studies that may take some time to come back .
in addition , any cases with amendments can be re - extracted and a corrected structured data file created .
while other methods may be able to re - extract data from an amended report where the synoptic report itself is edited and fixed , most other report methods can only extract data from the synoptic report area , and can not extract any data from other areas of the report ( addendums , amendments where the new information is in a separate amended area , etc . ) .
finally , as we have shown the use of a pipe as we describe is in no way limited to the website we use , and any interested laboratory could use this technique regardless of how their synoptic reports are generated . while we compared the performance of four different methods in this study ,
cap also offers the ecc product through a variety of different laboratory information system vendors , but this product was not available to us to compare .
we would imagine that in some ways the performance of this product would be similar to that of our web - based product .
since the ecc typically contains a force function to ensure that all elements are included , one would expect the reports that are generated to be complete by necessity .
in addition , the ecc by design generates a structured data report from the case just as our web - based product does .
however , since our method ensures completeness and allowed extraction of virtually 100% of the data , it would appear difficult for the ecc to show an advantage in either of these two features
. nevertheless , there are important differences between the web - based product we used in this study and the ecc . stylistically , the two programs are very different .
the web page is designed to only include required questions ( including questions required by our clinicians ) so all questions must be answered and all question are single question , single answer questions . as such it is as simple a synoptic report as we can make and requires as few clicks as possible on the part of the pathologist .
in addition , we allow free text answers to every single question ( although the majority of responses were not free text ) allowing the user a very wide range of answers .
the downside to this is that the final report may include more questions that are not applicable than other types of programs do , though there is some evidence that this may , in fact , make the reports easier to read .
it contains single answer questions , multi - answer questions , conditional questions all of which are multi - question answers ( the user needs to answer more than one question to answer a single question that appears in the report ) and optional questions and answers . as such there are fewer not applicable responses in the final report , but it takes more questions and more clicks on the part of the pathologist to create it . in addition , the responses to some questions are restricted to specific types ( distances must be a number , regardless of the complexity of a particular case ) . as such if a pathologist is uncomfortable answering a question in the way that the program is structured , the only real choice is to state that the answer can not be determined .
additional testing of different formats to determine which ones are preferred by the end users may be appropriate .
perhaps more importantly , the ecc generates its structured data at the time the data is entered , whereas our web based product extracts this data from the report itself after it is signed out . as a result while we can be sure that the data we extract exactly matches the data in the final surgical pathology report ( and we have confirmed this in a subset of our cases ) , the ecc may not always be able to do this ( since the surgical report may be altered after the structured data is extracted ) , depending on the exact design used by an individual vendor .
the cap laboratory accreditation program already has standards to ensure the accuracy of all electronic interfaces .
whether confirming the accuracy of the data that is extracted by these programs might be an appropriate topic for standards in this program might be worth considering .
in addition , the ecc can only generate data from the synoptic report itself , and it can not extract data from addendums or any other field of the report . the only way to extract this data for any purpose ( research , tumor registries , etc .
however , we already know that error rates as measured by amendments are associated with the number of rdes in a synoptic report .
we also know that the amount of text in the report is associated with the speed with which readers of the report can extract information .
thus , this practice may be both reducing the accuracy of the synoptic report and its utility to convey information to the clinician .
in contrast , our web - based product can extract data from any section of the report , including notes , addendums , or even the gross , as long as our embedded structure is present . as a result , it is possible to have multiple synoptic reports within a single surgical pathology report , each designed for the needs of a different set of users . on the other hand , the ecc may have additional functionality that our website may not yet offer .
it is possible that the ecc in addition to extracting the data provides additional tools to allow that data to be linked to other data sets such as snomed codes .
the use of our website led to the timely ordering of the most appropriate ancillary studies every time before the cases was signed out .
in addition , while not the subject of our study , during this study the ancillary studies that our clinicians wanted for a number of different tumors changed several times as they responded to the very rapidly changing world of precision medicine . given this rapid pace of change
, it is becoming harder and harder for pathologists and the laboratories that they work in to ensure that the most up to date and appropriate tests are being ordered in every case .
we have found the ability to embed notes reminding the pathologists about which tests to order in which situation invaluable to the success of our practice .
since the website was designed so that changes could easily be made to accommodate these differences in practice , we were able to make these changes for all pathologists in all sites in a matter of minutes from a single source , without going through our laboratory information system vendor and without having to make changes to multiple different source documents that pathologists and secretaries were using .
such flexibility may be of value as pathologists try to keep pace with the rapidly evolving field of precision medicine .
first , we used the opinion of the people in the tumor registry as a gold standard for completeness .
in a few cases , there were disagreements about whether the report was complete or not .
furthermore , this study takes place in a busy community hospital with general pathologists . it may be possible that different results could be obtained by specialists or in practices that are less busy . perhaps most importantly
, we can not exclude that at least some of the improvement in performance is related to increasing use and experience over time and not entirely related to the methods used for synoptic report generation .
however , the sudden improvement in performance with the web - based product to essentially perfect performance after over a decade of creating synoptic reports by other methods without such success would suggest that increased practice and experience are unlikely to be the sole cause of this improvement in performance .
completeness , amendment rates , ancillary test ordering rates , and data extraction rates vary significantly with the method used to construct the synoptic report .
our web - based protocol appears to be very competitive with most other synoptic report generating methods . | context : the college of american pathologists ( cap ) requires synoptic reporting of all tumor excisions.objective:to compare the performance of different methods of generating synoptic reports.methods:completeness , amendment rates , rate of timely ordering of ancillary studies ( kras in t4/n1 colon carcinoma ) , and structured data file extraction were compared for four different synoptic report generating methods.results:use of the printed tumor protocols directly from the cap website had the lowest completeness ( 84% ) and highest amendment ( 1.8% ) rates .
reformatting these protocols was associated with higher completeness ( 94% , p < 0.001 ) and reduced amendment ( 1% , p = 0.20 ) rates .
extraction into a structured data file was successful 93% of the time .
word - based macros improved completeness ( 98% vs. 94% , p < 0.001 ) but not amendment rates ( 1.5% ) .
kras was ordered before sign out 89% of the time .
in contrast , a web - based product with a reminder flag when items were missing , an embedded flag for data extraction , and a reminder to order kras when appropriate resulted in improved completeness ( 100% , p = 0.005 ) , amendment rates ( 0.3% , p = 0.03 ) , kras ordering before sign out ( 100% , p = 0.23 ) , and structured data extraction ( 100% , p <
0.001 ) without reducing the speed ( p = 0.34 ) or accuracy ( p = 1.00 ) of data extraction by the reader.conclusion:completeness , amendment rates , ancillary test ordering rates , and data extraction rates vary significantly with the method used to construct the synoptic report .
a web - based method compares favorably with all other methods examined and does not reduce reader usability . | I
M
R
D
C
Financial support and sponsorship
Conflicts of interest |
salivary gland disease which include xerostomia , cysts and sjogren 's syndrome - like condition with persistent glandular enlargement and secretory hypofunction have been reported in hiv - infected individuals.[13 ] hiv - salivary gland disease ( sgd ) includes lymphoepithelial lesions and cysts involving the salivary gland tissue and/or intra - glandular lymph nodes , sjogren 's syndrome - like condition and diffuse infiltrative cd8 lymphocytosis syndrome ( dils ) . the introduction of highly active antiretroviral therapy ( haart ) which includes a combination of antiretroviral drugs in the treatment of hiv infected has led to a significant decrease in oral manifestations.[57 ] however , adverse effects like xerostomia and an increase in salivary gland disease have been reported with haart .
the present study was done to ascertain and compare between haart and non - haart patients , the occurrence of salivary gland disease , unstimulated salivary flow rates and stimulated salivary flow rates ( usfr and ssfr ) and their relationship to cd4 count and the perception of xerostomia .
the study was carried out on 100 confirmed hiv seropositive patients attending ragas - yrg care , chennai , india .
the patients were divided into two groups , haart group comprising 50 patients initiated on haart .
the patients were on a combination of two nucleotide reverse transcriptase inhibitors and one non - nucleotide reverse transcriptase inhibitor .
after the baseline ( 0 ) examination , they were followed - up in the consecutive 3 , 6 , and 9 month . at the baseline visit ,
subsequently , 44 , 35 , and 20 patients were followed - up at 3 , 6 , and 9 months respectively as patients were lost to follow - up . during each visit , clinical oral examination , collection of unstimulated and stimulated
multi - item xerostomia inventory comprising a set of 19 questions was used to assess salivary gland function during each visit .
the spitting method proposed by navazesh et al . , was used for the collection of unstimulated saliva .
stimulated saliva was collected by applying 2% citric acid on the dorsolateral surface and tip of the tongue every 30 seconds and the patient was asked to spit saliva into a sterile graduated container .
this was done for 10 min and the total volume of saliva was recorded and expressed in ml / min .
fifty patients not on haart ( with age and cd4 count matched as closely as possible with those in the haart group ) comprised the non - haart group .
data entry , database management , and all statistical analysis were performed with the aid of the statistical package for the social sciences ( spss version 10.05 ) software .
student t - test was carried out to compare the mean differences in normally distributed data .
mann - whitney u test was applied to assess the statistical differences between the groups of patients when the data were non - normal .
anova ( one - way ) test was used to compare the mean unstimulated salivary flow rate and stimulated salivary flow rate within the haart group at 0 , 3 , 6 , and 9 months .
data entry , database management , and all statistical analysis were performed with the aid of the statistical package for the social sciences ( spss version 10.05 ) software .
student t - test was carried out to compare the mean differences in normally distributed data .
mann - whitney u test was applied to assess the statistical differences between the groups of patients when the data were non - normal .
anova ( one - way ) test was used to compare the mean unstimulated salivary flow rate and stimulated salivary flow rate within the haart group at 0 , 3 , 6 , and 9 months .
the study population comprised 100 hiv seropositives , 50 in the haart group and 50 in the non - haart group .
there were 76 males ( haart group = 36 , non haart group = 40 ) and 24 females ( haart group = 14 , non - haart group = 10 ) .
the mean age in the haart group was 34 6.3 ( males = 35.1 5.9 ; females = 30.7 6.5 ) .
the mean age in non - haart group was 35.2 7.6 ( males = 36.3 7.5 ; females = 30.7 6.2 ) [ table 1 ] .
the mean cd4 count in haart and non - haart groups were 255 110 and 200 90 respectively .
forty one patients had a cd4 count 200 ( haart group = 36% and non - haart group = 46% ) and 59 had a cd4 count > 200 ( haart group = 64% and non - haart group = 46% ) [ table 2 ] .
when the salivary flow rates between the two groups were compared , the mean unstimulated salivary flow rate in haart group at baseline was 0.61 0.18 and in the non - haart group was 0.65 0.29 . [ table 3 ; figure 1 ] .
the mean stimulated salivary flow rate in haart group at baseline and non - haart groups was 1.24 0.50 and 1.37 0.53 respectively .
the mean unstimulated salivary flow rate in the haart group at baseline ( 0 ) , 3 , 6 , and 9 months was 0.61 0.18 , 0.62 0.27 , 0.69 0.25 , and 0.68 0.27 respectively [ table 4 ; figure 1 ] .
the mean stimulated salivary flow rate at baseline was 1.24 0.50 at 3 months 1.57 0.51 , at 6 months 1.49 0.73 , and at 9 months 1.23 0.57 ( p = 0.02 ) [ table 4 ; figure 2 ] .
age and gender distribution cd4 count in the study population mean unstimulated and stimulated salivary flow rates in highly active antiretroviral therapy ( at baseline ) and non - haart groups mean and 95% confidence interval for mean unstimulated salivary flow rate in highly active antiretroviral therapy at baseline ( 0 ) , 3 , 6 , and 9 months and non - haart groups mean and 95% confidence interval for mean stimulated salivary flow rate in highly active antiretroviral therapy at baseline ( 0 ) , 3 , 6 , and 9 months and non - haart groups mean unstimulated and stimulated salivary flow rates in highly active antiretroviral therapy group at baseline ( 0 ) 3 , 6 , 9 months the mean unstimulated salivary flow rate in haart patients with a cd4 count 200 at baseline ( 0 ) was 0.56 0.13 ml / min , whereas in patients with a cd4 count > 200 , the mean unstimulated salivary flow rate was 0.64 0.1 ml / min . at 3 months , the mean unstimulated salivary flow rate in patients with a cd4 count
200 was 0.61 0.27 ml / min and 0.63 0.27 ml / min in patients with a cd4 count > 200 .
the mean unstimulated salivary flow rate in patients with a cd4 200 at 6 months and 9 months was 0.86 0.38 ml / min and 0.68 0.28 ml / min respectively , whereas in patients with a cd4 > 200 , the mean un - stimulated salivary flow rate was 0.66 0.23 ml / min at 6 months and 0.68 0.28 ml / min at 9 months .
the mean stimulated salivary flow rate in haart patients with a cd4 count 200 at baseline ( 0 ) was 1.06 0.26 ml / min and those with a cd4 count > 200 had a mean stimulated salivary flow rate of 1.34 0.59 ml / min . at 3 months , the mean stimulated salivary flow rate in patients with a cd4 200 and cd4 > 200 was 1.54 0.49 ml / min and 1.6 0.54 ml / min respectively .
the mean stimulated salivary flow rate at 6 months in patients with a cd4 200 was 2.25 0.98 ml / min and in those with a cd4 count > 200 was 1.39 0.64 ml / min ( p = 0.02 ) . at 9 months
, the mean stimulated salivary flow rate in haart patients with a cd4 count 200 was 1.15 0.19 ml / min and 1.25 0.64 ml / min in those with a cd4 count > 200 [ table 5 ; figure 3 ] .
mean salivary flow rates in highly active antiretroviral therapy patients with cd4200 and cd4>200 at baseline ( 0 ) , 3 , 6 , 9 months mean salivary flow rates in highly active antiretroviral therapy group with cd4200 and cd4>200 at baseline ( 0 ) , 3 , 6 , and 9 months the mean unstimulated salivary flow rate in non - haart patients with a cd4 count 200 was 0.60 0.26 ml / min and 0.69 0.31 ml / min in patients with a cd4 count > 200 .
in patients with a cd4 count 200 , the mean stimulated salivary flow rate was 1.24 0.40 ml / min and in patients with a cd4 > 200 , the mean stimulated salivary flow rate was 1.48 0.6 ml / min [ table 6 ; figure 4 ] .
mean salivary flow rates in non.highly active antiretroviral therapy patients with cd4200 and cd4>200 mean salivary flow rates in non - highly active antiretroviral therapy group with cd4200 and cd4>200 the results of the subjective symptoms of dry mouth perceived by haart and non - haart patients are listed in [ table 7 ] .
subjective symptoms of dry mouth perceived by highly active antiretroviral therapy and non - haart patients ( % of patients who gave a positive response )
xerostomia with a sjogren 's syndrome - like condition with persistent glandular enlargement and secretory hypofunction have been reported .
hiv - sgd includes lymphoepithelial lesions and cysts involving the salivary gland tissue and/or intra - glandular lymph nodes , sjogren 's syndrome - like condition , and dils . in the present study , the mean usfr and ssfr in haart and non - haart
groups were compared . the spitting method , proposed by navazesh , was used for collecting saliva as it is an inexpensive , simple , and an easily reproducible procedure .
there was no significant difference in the salivary flow rates between the two groups at baseline .
when the mean unstimulated salivary flow rate in haart group at baseline ( 0 ) , 3 , 6 , and 9 months was compared , there was no statistically significant difference .
the mean stimulated salivary flow rate increased from baseline to 3 months and this increase was statistically significant ( p = 0.02 ) .
this is in contrast to that reported by navazesh et al . , who identified haart as a significant risk factor for low unstimulated ( 0.1 ml / min ) and low stimulated ( 0.7 ml / min ) salivary flow rate .
in the present study , neither the haart nor non - haart patients had an unstimulated salivary flow rate 0.1 ml / min and a stimulated salivary flow rate 0.7 ml / min .
and patton et al . , observed an increase in hiv salivary gland disease following haart and attributed this increase to lympho - proliferative reactivation stimulated by haart .
this was not seen in this study . in hiv salivary gland disease , the infiltrate is composed predominantly of lymphocytes of the cd8 ( suppressor ) subtype .
the increased numbers of circulating cd8 t - cells that infiltrate salivary glands in hiv infection is designated dils .
the increase in mean stimulated salivary flow rate observed in patients on haart during follow up may be attributed to the immune reconstitution following haart , which probably reduces the cd8 lymphocytosis in salivary glands . to ascertain
if immune suppression influences salivary flow rate , the mean usfr and ssfr in haart and non - haart patients with a cd4 200 and cd4 > 200 were compared .
the mean usfr and ssfr in non - haart patients with a cd4 200 and cd4 > 200 were not statistically significant . in the haart group at baseline ( 0 ) ,
patients with cd4 200 had a lower mean stimulated salivary flow rate when compared with patients with cd4 > 200 ( p = 0.07 ) .
in their study on 733 hiv - positive and at risk hiv - negative women observed that hiv - positive women with a cd4 200 had a higher prevalence of zero unstimulated saliva , suggesting that immunosuppression affects salivary gland function . in yet another study , mulligan et al .
, found that hiv - positive women had higher rates of salivary gland tenderness and absence of saliva on palpation that was significantly associated with a low cd4 count . in the haart group at 6 months ,
patients with cd4 count 200 had a higher mean stimulated salivary flow rate when compared with patients with cd4 > 200 and this was statistically significant ( p = 0.02 ) . since there were only four patients with cd4 200 out of the 35 patients followed - up at 6 months , these results will have to be confirmed with larger samples .
antiretroviral drugs like didanosine , zidovudine , lamivudine , and protease inhibitors ( indinavir , nelfinavir , ritonavir and saquinavir ) have been reported to cause xerostomia . in this study xerostomia
was evaluated using a multi - item " inventory comprising a set of 19 questions proposed by thomson et al
. a greater number of patients in the non - haart group perceived dryness of lips when compared with haart patients at baseline and this was statistically significant ( p = 0.02 ) . out of the 19 questions , only 3 questions does your mouth feel dry ? ( p = 0.00 ) , do you get up in the night to drink water ? ( p = 0.00 ) , and
( p = 0.01 ) were statistically significant in the haart group at baseline ( 0 ) , 3 , 6 , and 9 months . in the haart group ,
the percentage of patients who perceived xerostomia at 3 , 6 , and 9 months was less than the percentage of patients who perceived xerostomia at baseline ( 0 ) .
this correlates with the increase in mean stimulated salivary flow rate observed from baseline to 3 months which was maintained at 6 months and 9 months . in this study population haart
sreebny et al . , classified usfr that were 0.1 ml / min as abnormal , between 0.11 ml / min and 0.2 ml / min as low normal , and greater than 0.2 ml / min as normal . in their study , subjects who complained of dry mouth had usfr 0.1 ml / min and hence they concluded that the subjective feeling of xerostomia is usually associated with a marked decrease in the rate of whole saliva . in the present study ,
the haart and non - haart patients had low normal to normal salivary flow rates .
fox suggested that dry mouth symptoms are not reliable indicators of diminished salivary flow rates .
narhi et al . , stated that not all patients who complain of dry mouth have salivary gland hypo - function .
although some of the haart and non - haart patients perceived xerostomia , their salivary flow rates were normal in the present study . in the present study
, there was no difference in the salivary flow rates ( unstimulated and stimulated ) between the two groups .
in the haart group , there was an increase in the mean stimulated salivary flow rate from baseline ( 0 ) to 3 months and this increase was maintained at 6 months and 9 months . as the salivary flow rates were within normal limits , the xerostomia questionnaire did not reveal any difference between the two groups . since many patients were lost to follow up in the haart group in the present study , a long - term follow - up study with a larger sample is required for conclusive evidence on salivary flow rates | aims : to ascertain and compare between highly active antiretroviral therapy ( haart ) and non - haart patients , the stimulated salivary flow rates and unstimulated salivary flow rates ( usfr and ssfr ) and to correlate the salivary flow rates with immune suppression.materials and methods : one hundred human - immuno deficiency virus seropositive patients attending ragas - yrg care were examined and divided into two groups , a haart group ( patients on combination antiretroviral therapy ) comprising 50 patients and a non - haart group comprising 50 patients .
the haart group was followed every 3 months after the baseline visit ( 0 ) for a period of 9 months , during which a clinical oral examination and collection of unstimulated and stimulated saliva was done .
their salivary gland function was assessed using a xerostomia inventory during each visit .
the study on non - haart group was cross-sectional.statistical analysis : statistical analysis were performed with the aid of the statistical package for the social sciences ( spss version 10.05 ) software.results:there was no significant difference in mean ssfr and usfr between the two groups at baseline . in the haart group ,
the mean stimulated salivary flow rate increased from baseline to 3 months ( p = 0.02 ) , with the increase being maintained at 6 months and 9 months . when salivary flow rates were correlated with cluster of differentiation , cd4 counts , patients in the haart group with a cd4 200 at 6 months visit had a higher mean stimulated salivary flow rate when compared with patients with cd4 200 ( p = 0.02 ) .
the xerostomia inventory did not reveal any significant difference between the two groups and haart was not significantly associated with xerostomia.conclusion:in our study haart was neither associated with xerostomia nor a reduction in salivary flow rate and immune suppression was not a significant factor for decreasing the salivary flow rate . | INTRODUCTION
MATERIALS AND METHODS
Statistical analysis
RESULTS
DISCUSSION |
while india has achieved the goal of elimination of leprosy as a public health problem , defined as < 1 case per 10,000 population , at the national level in december 2005 , leprosy still persists in certain high endemic districts .
a total of 125,785 new cases were detected during the year 201415 , which gives annual new case detection rate of 9.73 per 100,000 population .
a total of 88,833 cases are recorded as on april 1 , 2015 , giving a prevalence rate of 0.69 per 10,000 population . due to the decreasing prevalence of leprosy , the clinical suspicion for diagnosing the same has reduced .
we report an unusual presentation of multibacillary leprosy which was diagnosed on slit skin smear examination from the lesion .
a 21-year - old man , working as a priest , presented with a history of generalized raised nodular lesions for 2 years .
the patient was apparently asymptomatic 2 years back when he started developing reddish raised small lesions over the right knee .
the lesions gradually increased in size and then ruptured with blood - stained purulent discharge .
similar lesions gradually developed over other sites such as left knee , both elbows , and ears .
other symptoms , such as joint pain , swelling of joints , or fever , were absent .
this biopsy report was suggestive of fungal infection ; hence , the patient was treated with itraconazole and amoxicillin - clavulanic acid but without any relief .
no acid - fast bacilli ( afb ) staining was done . on clinical examination ,
multiple erythematous nodules and plaques of varying sizes ranging from 3 mm to 3 cm in diameter were seen on bilateral ear pinna and bony prominences of the extremities , i.e. , elbows , knees , malleoli , and dorsal aspect of bilateral feet [ figure 1 ] .
nodular lesions on the right leg the blood parameters were within normal limits . slit skin smears and biopsy from multiple lesions were collected and processed for bacterial and fungal culture since a provisional diagnosis of subcutaneous mycoses was considered .
. a bacterial index of 4 + ( 10 afb per oil immersion field ) was recorded .
histopathological examination of skin biopsy showed an unremarkable epidermis with underlying dermis showing a diffuse polymorphous inflammatory infiltrate coexisting with foamy histiocytes , neutrophils , plasma cells , and lymphocytes , extending from dermis to subcutis [ figure 3 ] .
standard nerve stimulation test was done which showed evidence of mild axonal sensory mononeuritis multiplex in bilateral upper limbs and axonal sensory polyneuropathy affecting bilateral lower limbs with bilateral greater auricular , ulnar , common peroneal nerves showing thickening .
acid - fast bacilli in large numbers , grouped together in cigar - bundle appearance . stained with modified ziehl
neelsen staining , 100 dermis showing diffuse polymorphous inflammatory infiltrate with foamy histiocytes , neutrophils , plasma cells , and lymphocytes ; stained with h and e , 100 fite - faraco stain demonstrating acid - fast bacilli , 100 based on zn stain results and histopathological report , the patient was considered as a case of lepromatous leprosy and started on multidrug therapy ( mdt ) .
two months after commencement of mdt , the patient showed improvement with reduction of the nodular lesions .
on clinical examination , multiple erythematous nodules and plaques of varying sizes ranging from 3 mm to 3 cm in diameter were seen on bilateral ear pinna and bony prominences of the extremities , i.e. , elbows , knees , malleoli , and dorsal aspect of bilateral feet [ figure 1 ] .
. slit skin smears and biopsy from multiple lesions were collected and processed for bacterial and fungal culture since a provisional diagnosis of subcutaneous mycoses was considered .
. slit skin smear received for detection of mycobacterium leprae was stained by modified ziehl
examination of stained smear revealed characteristic afb in large numbers [ figure 2 ] . a bacterial index of 4 + ( 10 afb per oil immersion field ) was recorded .
histopathological examination of skin biopsy showed an unremarkable epidermis with underlying dermis showing a diffuse polymorphous inflammatory infiltrate coexisting with foamy histiocytes , neutrophils , plasma cells , and lymphocytes , extending from dermis to subcutis [ figure 3 ] .
standard nerve stimulation test was done which showed evidence of mild axonal sensory mononeuritis multiplex in bilateral upper limbs and axonal sensory polyneuropathy affecting bilateral lower limbs with bilateral greater auricular , ulnar , common peroneal nerves showing thickening .
acid - fast bacilli in large numbers , grouped together in cigar - bundle appearance . stained with modified ziehl
neelsen staining , 100 dermis showing diffuse polymorphous inflammatory infiltrate with foamy histiocytes , neutrophils , plasma cells , and lymphocytes ; stained with h and e , 100 fite - faraco stain demonstrating acid - fast bacilli , 100 based on zn stain results and histopathological report , the patient was considered as a case of lepromatous leprosy and started on multidrug therapy ( mdt ) .
two months after commencement of mdt , the patient showed improvement with reduction of the nodular lesions .
recent reports from india indicate that leprosy continues to be transmitted within the community despite advances in multidrug therapy . continued findings of childhood leprosy cases ranging from 9.6% ( 2015 ) to 11.43% ( 2009 ) corroborate this theory as persistently high childhood proportion signifies ongoing transmission in general population .
leprosy presents as a wide spectrum of clinical manifestations , varying from polar tuberculoid to polar lepromatous disease .
variable clinical presentations of leprosy , depending on an increasing bacterial load and loss of m. leprae - specific cellular immunity , make it difficult to arrive at an accurate diagnosis , thereby emphasizing the need for appropriate investigations in every suspect case .
mild symptoms in early stages of leprosy may be overlooked by the patient leading to a delay in seeking medical attention .
lack of clinical suspicion and appropriate investigation on the part of the health care professional may lead to a missed diagnosis and further delay in instituting appropriate therapy .
given that the patient exhibited nodular lesions and lack of sensory loss , he was misdiagnosed as a case of subcutaneous fungal infection at the primary point of therapy .
the specimen obtained from the patient did not show any fungal element on microscopy and culture and there was no response to empiric antifungal therapy which helped to rule out fungal etiology .
leprosy should therefore be considered as a differential diagnosis for atypically presenting skin lesions not improving on empiric treatment . with histopathological examination ,
leprosy presents as granulomatous inflammation that may mimic other granulomatous diseases including tuberculosis , sarcoidosis , leishmaniasis , and subcutaneous fungal infections .
special stains such as fite faraco stain have an added advantage in demonstrating m. leprae in histopathogical examination but may show negative results in tuberculoid leprosy cases where the lesions are paucibacillary in nature .
this is a rare case of lepromatous leprosy presenting as nodular lesions without obvious sensory loss . in the current scenario ,
when the disease is considered as eliminated in india and patients coming with typical signs have become a rarity , a high index of clinical suspicion is necessary so as to not miss out on cases with atypical presentation .
however , slit skin smear from selective sites , which is a relatively minor procedure , should always be done in suspected leprosy cases . | despite india achieving the goal of elimination of leprosy as a public health problem , leprosy is still being transmitted in india . however , due to decreased clinical suspicion of leprosy and atypical case presentations , such cases may be not be diagnosed .
we present a case report of an unusual presentation of multibacillary leprosy which presented as nodular lesions .
this case report indicates that atypical presentations of leprosy may be missed out by primary care physicians . | INTRODUCTION
CASE REPORT
In our hospital
Laboratory investigations
DISCUSSION
Financial support and sponsorship
Conflicts of interest |
coronary artery disease ( cad ) is one of the leading causes of death in all countries .
it also significantly affects rates of disability ( 1 ) . in the past few decades , advances in diagnostic as well as therapeutic methods
nevertheless , half of the deaths in industrial countries and 25% of the deaths in developing countries are attributed to cad .
it is also estimated that cad will surpass infectious diseases and turn into the single leading cause of mortality and disability in the world by 2020 ( 2 ) .
globally , the chance of developing cad is 2.2 times greater in men than in women ( 3 ) , which has been attributed to the role of endogenous estrogens in cardiovascular fitness(46 ) .
there are also hypotheses linking androgen deficiency to an increased risk of cad , an intriguing theory given the prevalence of late onset hypogonadism : 30% in men ( 7 ) .
therefore , a large number of studies have evaluated the role of androgens in cardiovascular diseases , with conflicting findings .
for example , some studies have indicated that the serum levels of androgens can be used as predictors of all - cause and cardiovascular mortality ( 811 ) , while others have failed to observe any significant relationships between the serum levels of androgens and cardiovascular disease ( 12,13 ) .
the effects of androgen therapy in males with andropause have also been evaluated in a number of studies .
similar contradictory findings were observed . some of the studies have indicated a therapeutic role of oral testosterone for cardiovascular disease status(1416 ) , but this has not been supported by other studies ( 17,18 ) .
considering the existing controversy in the literature , and lack of comprehensive hormonal tests in the previous works , the present study sought to evaluate the relationship between serum levels of androgens and cad in a sample of iranian male population .
male individuals admitted to tehran heart center and sina hospital , tehran , iran from june 2011 to august 2012 were categorized into cad and control groups based on the following criteria .
individuals with positive coronary angiograms were assigned to the cad group , while those who had normal angiograms and admitted to the abovementioned centers for reasons other than cad were assigned to the control group .
patients who were taking hormonal medications , such as flutamide , or those who required dialysis due to renal failure were excluded from the study .
in addition , patients in the control group who had a history of heart attack or ccu admission were also excluded .
the study was approved by the ethical committee of tehran university of medical sciences , tehran , iran .
baseline demographic data , including age , marital status , job , weight , height , a history of smoking , diabetes , and a history of hyper - tension were recorded in the data collection sheet .
afterwards , patients were assessed for their serum levels of total testosterone , free testosterone , estradiol , dehydroepiandrosterone sulfate ( dhea - s ) , and sex hormones binding globulin ( shbg ) in samples taken between 7:00 and 11:00 a.m. albeit almost all samplings were done between 8:00 and 8:30 a.m due to both hospital protocols .
equilibrium dialysis was used to measure free testosterone , while total testosterone and dhea - s were measured by radioimmunoassay ( ria ) .
shbg and estradiol were measured by the electrochemical immunosensor method and uric acid and cholesterol were measured by colorimetry method .
it is noteworthy that all of the samples were tested in a single central laboratory .
finally , the clinical vessel score was determined for each patient based on a 03 scale , and was defined as the number of vessels whose luminal diameter was obstructed by more than 50% , with a gensini score also used(19 ) .
analysis of the collected date was carried out using spss software version 18 ( chicago , il , usa ) .
we used the chi - square test to compare the frequency of patients with diabetes and hypertension between the two groups .
anova test was used to compare the mean values of the measured parameters between cad and control groups .
we also used logistic regression analysis to explore the possible relationships between the parameters and cad .
two hundred patients were in the cad group and 135 individuals were in the control group . in the cad group , 69 had single - vessel disease , 49 had two - vessel disease , and 82 had three - vessel disease .
table 1 presents the comparison between the individuals in the two groups in terms of age , bmi , cholesterol level , uric acid level , presence of diabetes and hypertension . according to the results of chi - square and anova tests ,
statistically significant differences were observed between the individuals in the two groups with respect to age ( p<0.0001 ) , diabetes ( p<0.0001 ) , and a history of hypertension ( p=0.018 ) .
table 2 presents the serum levels of total testosterone , free testosterone , dhea - s , estradiol , and shbg in both cad and control groups .
baseline characteristics of the individuals in cad and control groups positive history of hypertension the serum levels of androgens in both cad and control groups dehydroepiandrosterone sulfate , sex hormones binding globulin as shown in the table , the serum levels of free testosterone ( anova p=0.048 ) and dhea - s ( anova p<0.0001 ) were significantly higher in the control group than in the cad group ; however , the serum level of shbg was higher in the cad group than in the control group ( anova p=0.007 ) .
results of the logistic regression analysis performed to assess the relationship between the parameters are presented in table 3 . only age ( p=0.042 ) and diabetes ( p=0.003 ) indicated significant relationships with cad .
results of the logistic regression analysis indicating the relationship between the parameters positive history of hypertension,/ dehydroepiandrosterone sulfate , sex hormones binding globulin
the present study was conducted aiming to assess the relationship between serum levels of androgens and cad in patients admitted to tehran heart center and sina hospital .
patients with positive coronary angiograms were included in the case group and participants with normal angiograms were included as the control group ; however , we had to exclude patients with a history of heart attack or ccu admission .
this was done primarily to eliminate the dilution effect in the control group and to increase the power of study .
results from the present study indicate significant differences in the serum levels of androgens between cad and control groups .
for example , the levels of free testosterone and dhea - s were significantly lower in the cad group than in the control group , whereas that of shbg was higher in the cad group than in the control group .
significant differences were also observed between the two groups with respect to age , diabetes , and a history of hypertension .
previous studies have shown that some of the abovementioned baseline characteristics , i.e. age , diabetes , and a history of hypertension , have been known to influence the serum levels of androgens ( 2022 ) , suggesting that the serum levels of androgens might have been affected by these parameters ; and the reverse has also been considered ( 23 ) .
therefore , we performed logistic regression analysis taking into consideration all of these parameters to explore the potential relationships among them .
results indicated that cad was only associated with age and diabetes . in the case of androgenic hormone levels , no significant independent relationship with cad was observed .
androgenic hormone levels were shown to have influences on the evolution of atherosclerosis through different mechanisms ( 24,25 ) . a vast majority of cross - sectional studies have found no association between cad and serum levels of androgens .
for example , in a recent study , the androgenic hormone levels , i.e. free testosterone , total testosterone , and dhea , were found to be similar in both cad and control groups ( 12 ) .
however , other studies have shown conflicting findings ( 26,27 ) . in a cross - sectional study
, the authors found that levels of dhea - s , total testosterone , free testosterone and shbg were significantly lower and the levels of estradiol and follicle - stimulating hormone ( fsh ) were significantly higher in the cad group than in the control group ; therefore , they concluded that the androgenic hormone levels could be used as predictors of cad development in men ( 26 ) .
results from prospective studies on the association between the level of androgenic hormones and cad are also somewhat controversial ; some have found significant relationships between the serum levels of androgens and cad ( 28,29 ) , while others have failed to distinguish any significant association between the two ( 30 ) . the major limitation of the present study was posed by its design , i.e. a cross - sectional study design .
another possible source of error derives from our use of a single blood sample in each patient to measure hormone levels , which are known to fluctuate .
the major strength of the present study is our analysis of a broad range of androgenic hormones , i.e. total testosterone , free testosterone , dhea - s , estradiol , and shbg .
some of these hormone levels , though potentially important , have not been measured in previous studies .
we can conclude that although the serum levels of some of the androgens were significantly different between the two groups , no independent association was found between androgenic hormone levels and the risk of cad .
rather , these significant differences were possibly due to the effects of age and diabetes on the serum levels of androgens .
ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc . ) have been completely observed by the authors . | background : the aim of the study was to evaluate the relationship between the serum levels of androgens and coronary artery disease ( cad ) in an iranian population.methods:male individuals admitted to tehran heart center and sina hospital , tehran , iran from 20112012 were categorized into cad and control groups based on selective coronary angiography .
baseline demographic data , including age , bmi , diabetes , and a history of hypertension were recorded .
patients were also assessed for their serum levels of total testosterone , free testosterone , estradiol , dehydroepi and rosterone sulfate ( dhea - s ) , and sex hormone binding globulin ( shbg ) .
data analysis was carried out chi - square and anova tests as well as logistic regression analysis.results:two hundred patients were in the cad group and 135 individuals in control group . in the cad group , 69 had single - vessel disease , 49 had two - vessel diseases , and 82 had three - vessel diseases .
statistically significant differences were observed between the individuals in the two groups with respect to age ( p<0.0001 ) , diabetes ( p<0.0001 ) , and a history of hypertension ( p=0.018 ) .
the serum levels of free testosterone ( p=0.048 ) and dhea - s ( p<0.0001 ) were significantly higher in the control group than in the cad group ; however , the serum level of shbg was higher in the cad group than in the control group ( p=0.007 ) .
results of the logistic regression analysis indicated that only age ( p=0.042 ) and diabetes ( p=0.003 ) had significant relationships with cad.conclusion:although the serum levels of some of the androgens were significantly different between the two groups , no association was found between androgenic hormone levels and the risk of cad , due mainly to the effect of age and diabetes . | Introduction
Methods
Results
Discussion
Conclusion
Ethical considerations |
nerve cell survival depends on the balance between the formation and degradation of cellular proteins and damaged organelles .
the ubiquitin - proteasome system and autophagy pathway are the two major mechanisms for maintaining this balance .
the ubiquitin - proteasome system is an important route for the degradation of short - lived proteins whereas autophagy is responsible for the degradation of long - lived proteins and damaged organelles ( pan et al . , 2008 ) .
the activation of autophagy has been observed in many diseases such as cardiovascular disease ( martinet et al . , 2007 ) , cerebral hemorrhage ( hu et al . , 2011 ) , pancreatic cancer ( grasso et al . , 2012 ) and
neurodegenerative disease such as alzheimer 's disease and parkinson 's disease ( shacka et al . , 2008 ) .
there are three types of autophagy : macroautophagy , microautophagy , and chaperone - mediated autophagy ( rubinsztein et al . , 2005 ;
macroautophagy occurs through autophagosomes , double - membrane - bound vesicles that fuse with lysosomes which subsequently degrade proteins .
microautophagy is the engulfment of cytoplasmic cargo directly by the lysosomal membrane through the processes of invagination , protrusion , and separation .
chaperone - mediated autophagy transports unfolded proteins via lysosomal chaperonin heat - shock constitutive protein 70 ( hsc70 ) and lysosomal membrane-2a ( lamp-2a ) , a lysosomal membrane receptor ( periyasamy - thandavan et al . , 2009 ) .
two major therapeutic strategies are currently being used to treat cerebral ischemia ( gabryel et al . , 2012 ) .
however , these drugs have a narrow therapeutic window of 3 hours , and could lead to hemorrhagic complications .
but , most neuroprotective agents show poor efficacy or severe toxicity / side effects and thus new therapeutic agents for the treatment of ischemic stroke need to be developed .
recent studies show that macroautophagy is activated in cerebral ischemia and indicate that autophagic induction might serve as a new therapeutic target for stroke ( wen et al . , 2008
the relationship between autophagy and cerebral ischemia is unclear ; one report suggests activation of autophagy protects neurons from death ( carloni et al . , 2008 ) , whereas another indicates it has a more destructive role ( koike et al . , 2008 ) .
in this review , we introduce macroautophagy ( herein referred to as autophagy ) , and focus on its potential role and possible signaling pathways in cerebral ischemia .
autophagy plays an important physiological role in the process of cellular growth and differentiation ( gabryel et al . , 2012 ) and is extremely important in maintaining cellular homeostasis which requires the continual turnover of nonfunctional proteins and organelles .
the process of autophagy consists of several sequential steps ( klionsky and ohsumi , 1999 ; mizushima , 2007 ; he and klionsky , 2009 ) : ( 1 ) sequestration . a unique membrane , called an isolation membrane , sequesters cytoplasmic constituents including organelles to form an autophagosome . ( 2 ) transportation .
both the inner membrane and the materials contained within the autophagosome are degraded by lysosomal hydrolases .
autophagy depends on the interaction of different complexes that are composed of several different autophagy - related ( atg ) proteins .
the complexes include ( 1 ) two ubiquitin - like conjugation systems , atg12-atg5 and atg8/lc3-pe ( microtubule - associated protein 1a/1b - light chain 3 -phosphatidylethanolamine ) conjugate systems ( klionsky and emr , 2000 ; suzuki et al . , 2005 ; periyasamy - thandavan et al . , 2009 ) ; ( 2 ) a phosphatidylinositol 3-kinase ( pi3k ) complex ; ( 3 ) the atg1/unc-51-like kinase ( ulk ) complexes ; ( 4 ) matg9 ; and ( 5 ) the atg2-atg18 complexes ( longatti and tooze , 2009 ; chen and klionsky , 2011 ; mizushima et al . , 2011 ) .
stroke is the third most common cause of death worldwide and the major cause of adult neurological disability .
it can be caused by a number of different disorders and results in temporary or permanent disruption of blood supply to the brain .
approximately 80% of stroke cases are due to primary cerebral ischemia resulting in infarction , whilst 20% are attributed to cerebral hemorrhage ( markus , 2012 ) .
when blood flow to the brain is interrupted , cells undergo a series of molecular events which include excitotoxicity , mitochondrial dysfunction , acidotoxicity , ionic imbalance , oxidative stress and inflammation .
these molecular events can lead to cell death and irreversible tissue injury ( ouyang and giffard , 2012 ) .
there is no doubt that neurons have a vital role in the nervous system and so it is particularly important to protect them from insult and death in cerebral ischemia .
there are two morphological types of cell death following cerebral ischemia , necrosis and apoptosis ( puyal and clarke , 2009 ) .
morphological characteristics of necrosis include vacuolation of the cytoplasm , breakdown of the plasma membrane and an induction of inflammation around the dying cell by release of cellular contents and proinflammatory molecules ( edinger and thompson , 2004 ) .
apoptosis is also termed type i programmed cell death ( type i pcd ) ( shintani and klionsky , 2004 ) and is characterized by nuclear condensation and fragmentation , cleavage of chromosomal dna into internucleosomal fragments and the formation of apoptotic bodies , which are removed by phagocytosis without the breakdown of the plasma membrane ( edinger and thompson , 2004 ) .
recently , studies have identified that aside from necrosis and apoptosis , a third type of cell death that occurs during ischemic stroke , autophagy ( adhami et al . , 2006 ; rami et al . , 2008 ) which can also be termed type ii pcd ( ouyang et al . , 2012 ) .
the correlation between apoptosis , autophagy and necrosis and their pathologic processes in ischemic stroke is not clear .
some studies have shown that neurons at the core of ischemia tend to undergo necrosis , while neurons in the penumbra ( surrounding region ) are subjected to apoptosis ( sabri et al . , 2013 ) . however ,
some in vivo experiments indicate that both apoptosis and autophagy are activated in the ischemic penumbra ( pamenter et al . , 2012 ) .
terminal deoxynucleotidyl transferase - mediated dutp - biotin in situ nick end labeling ( tunel ) and propidium iodide ( pi ) are used as markers of apoptosis and necrosis , respectively ( unal cevik and dalkara , 2003 ) . according to a study by balduini et al .
( 2012 ) , autophagy - positive neurons that were also tunel - positive were mainly found in superficial layers of the cerebral cortex 24 hours after hypoxia - ischemia , with only scattered necrotic cells observed in the same area .
they also reported that after ischemia , necrotic cells ( pi - positive ) were mainly detected in the hippocampus and the deep layers of the cerebral cortex , and most cells in the superficial layers of the cortex were pi - positive ( necrotic ) at later time points ( 4872 hours after hypoxia - ischemia ) .
when 3-methyladenine ( 3-ma ) and wortmannin , two type iii pi3k inhibitors ) , were used to inhibit autophagy in a model of neonatal hypoxia - ischemia , activation of the autophagic pathway was significantly reduced and there was a switch from apoptosis to necrosis in cell death .
in contrast , it could be observed that necrotic cell death and brain injury were reduced when rapamycin , the inhibitor of the mammalian target of rapamycin ( mtor ) , was administered to increase autophagy ( balduini et al . , 2009 ) .
for example , bcl2l11 ( also known as bim ) , a bh3-only protein , is considered a novel molecular link between autophagy and apoptosis .
bcl2l11 recruits beclin-1 , the homologue of yeast atg6 , to microtubules by bridging beclin-1 and dynein light chain 1 ( dynll1 , also known as lc8 ) , and it can inhibit autophagy and promote apoptosis ( luo and rubinsztein , 2013 ) . in summary ,
the crosstalk among the three types of cell death , especially between autophagy and apoptosis , is very complex and not understood .
autophagy is the process by which a membrane engulfs organelles and cytosolic macromolecules to form an autophagosome , with the engulfed materials being delivered to the lysosome for degradation ( yoshimori , 2007 ) .
autophagy was not observed in the brain of mice that had been deprived of food for 48 hours and it is thought that brain nutrients could be compensated from other organs under conditions of starvation ( mizushima et al . , 2004 ) .
second , localization of autophagosomes and lysosomes is different ; autophagosomes are located throughout the cytoplasm but lysosomes are mainly located in the juxtanuclear cytoplasm of the cell body in the neuron . to form autolysosomes ,
autophagosomes which are formed in dendrites and synaptic terminal regions need be transported to lysosomes in the cell body .
this means that when dendrites or axons are damaged , autophagosomes that have formed in dendrites and synaptic terminal regions can not fuse with lysosomes to degrade sequestrated material ( komatsu et al . , 2007 ) .
basal autophagy is considered a housekeeping process in neurons ( mizushima and komatsu , 2011 ) , whereas induced autophagy may be a promising neuroprotective strategy in neurodegenerative diseases .
induction of autophagy may serve to rid neurons of aberrant protein aggregates a common hallmark of neurodegenerative diseases .
many studies have suggested that either the absence of autophagy or inadequate autophagy may be an underlying cause of neurodegenerative diseases ( puyal et al . , 2012 ) . although currently there is no unified theory as to the role autophagy plays in cerebral ischemia , based on studies over past few years , the following five viewpoints ischemia have emerged .
( 2010 ) suggested that in neonatal hypoxia - ischemia , autophagy may be part of an integrated pro - survival signaling complex that includes pi3k - akt - mtor . when either autophagy or pi3k - akt - mtor pathways were interrupted , cells underwent necrotic cell death .
( 2012 ) reported that neuronal survival was promoted during cerebral ischemia when autophagy was induced by nicotinamide phosphoribosyltransferase ( nampt , also known as visfatin ) , which is the rate - limiting enzyme in mammalian nad biosynthesis and regulates the tsc2-mtor - s6k1 signaling pathway .
these studies suggest that autophagy may be a potential target for post - ischemic neuronal protection .
mice deficient in atg7 , the gene essential for autophagy induction , showed nearly complete protection from both hypoxia - ischemia - induced caspase-3 activation and neuronal death , indicating autophagy is essential in triggering neuronal death after hypoxia - ischemia injury ( koike et al . , 2008 ) .
wen et al . ( 2008 ) confirmed autophagy was activated in a permanent middle cerebral artery occlusion ( mcao ) model . in their paper , the infarct volume , brain edema and motor deficits could be significantly reduced by administration of 3-ma ( an autophagy inhibitor ) .
the neuroprotective effects of 3-ma were associated with an inhibition of ischemia - induced upregulation of lc3-ii , a marker of active autophagosomes and autophagolysosomes .
moreover , it was observed that the inhibition of autophagy , either by direct inhibitor 3-ma or by indirect inhibitor 2me2 ( an inhibitor of hypoxia inducible factor-1 ; hif-1 ) might prevent pyramidal neuron death after ischemia in the study of xin et al .
( 3 ) the degree of autophagy determines the fate of cells in cerebral ischemia .
kang and avery ( 2008 ) proposed that levels of autophagy were critical for the survival or death of cells : physiological levels of autophagy promote survival , whereas insufficient or excessive levels of autophagy promote death .
this hypothesis was confirmed in an oxygen and glucose deprivation model that observed dual roles of the autophagy inhibitor 3-ma in different stages of re - oxygenation ( shi et al . , 2012 ) .
twenty - four hours prior to reperfusion , 3-ma triggered a high rate of neuronal death .
it is possible that prolonged oxygen and glucose deprivation / reperfusion triggers excessive autophagy , switching its role from protection to deterioration .
( 4 ) after cerebral ischemia , the time at which autophagy is induced determines its role .
autophagy could play a protective role in ischemic preconditioning but have a different effect once ischemia / reperfusion has occurred ( ravikumar et al . , 2010 ) .
infarct volume , brain edema and motor deficits induced by permanent focal ischemia were significantly reduced after ischemic preconditioning treatment .
3-ma suppressed neuroprotection induced by ischemic preconditioning , while rapamycin reduced infarct volume , brain edema and motor deficits induced by permanent focal ischemia ( sheng et al .
( 2011 ) in which 3-ma administrated through intracerebroventricular injection before hyperbaric oxygen preconditioning , attenuated the neuroprotection of hyperbaric oxygen preconditioning against cerebral ischemia .
in contrast , pretreatment with rapamycin mimicked the neuroprotective effect of hyperbaric oxygen preconditioning ( yan et al . , 2011 ) .
( 2008 , 2010 ) also showed that when 3-ma and rapamycin were injected 20 minutes before hypoxia - ischemia , 3-ma inhibited autophagy , significantly reduced beclin-1 expression and caused neuronal death , while rapamycin increased autophagy and decreased brain injury .
in addition , 3-ma administrated by intracerebroventricular injections strongly reduced the lesion volume ( by 46% ) even when given 4 hours after the beginning of the ischemia ( puyal et al . , 2009 ) .
( 2012 ) found that rapamycin applied at the onset of reperfusion might attenuate the neuroprotective effects of ischemic postconditioning .
conversely , 3-ma administered before reperfusion significantly reduced infarct size and abolished the increase of brain water content after ischemia .
targeting autophagy either pre- or post - treatment has different results and this may reflect the different effects of autophagy at early and late stages ( he et al . , 2012 ) .
the time of intervention could be related to the degree of autophagy at different stages of ischemia and further studies are necessary to confirm this .
a common feature of many neurodegenerative diseases is the accumulation of an abnormally large number of autophagic vacuoles ( autophagosomes and autolysosomes ) or the frequent appearance of irregularly shaped autophagic vacuoles .
enhanced autophagosome formation seems to be reflected by increased density of autophagic vacuoles , but these increased autophagic vacuoles may also imply impaired autolysosomal degradation ( komatsu et al . , 2007 ) .
( 2008 ) also observed a dramatic up - regulation of beclin-1 and lc3 in rats after cerebral ischemia .
recently , however , it has been hypothesized that the increase in proteins may reflect a failure in lysosomal function leading to an accumulation of autophagosomes , or an improvement in the activity of autophagy ( xu et al . , 2012 ) .
2010 ) found that accumulation of lc3-ii was observed in sham - operated rats after treatment with lysosomal inhibitor - chloriquine , but the further change of lc3-ii levels in post - ischemic brain tissues was not observed .
the results indicated that accumulation of autophagy - associated protein following ischemia could be the result of failure of the autophagy pathway .
puyal and clarke ( 2009 ) demonstrated that lysosomal activity detected by lamp-1 and cathepsin d was increased in neurons with punctate lc3 expression in neonatal focal cerebral ischemia model .
the deficiency of acid phosphatase activity in the lysosome could lead to the increase of autophagosomes and autolysosomes .
further studies are required to verify whether the activity of autophagy is enhanced in cerebral ischemia .
mammalian target of rapamycin ( mtor ) is a 289 kda serine / threonine protein kinase that regulates transcription , cytoskeleton organization , cell growth and cell survival . by binding to different co - factors ,
mtor can form two distinct protein complexes , mtorc1 ( mtor complex 1 ) and mtorc2 ( mtor complex 2 ) ( jung et al . , 2010 ) .
the classification of mtorc1 and mtorc2 are based on their components and sensitivity to rapamycin .
recent studies suggest that the pi3k / akt / mtor pathway could regulate acute nervous system injury in cerebral hypoxia - ischemia ( chong et al . , 2012 ) .
class i pi3k plays an important role in the pi3k - akt - mtor pathway .
pi3k phosphorylates and activates akt which in turn phosphorylates and inactivates tuberous sclerosis complex ( tsc ) 1/2 .
inactivated tsc1/2 increases the activation of rheb which is part of the ras family gtp - binding protein , and mtor is subsequently activated .
beclin-1 , a component of the class iii pi3k , is essential for the initial steps of autophagy and could also induce autophagy via the interaction with other components of the class iii pi3k pathway in cerebral ischemia ( xingyong et al . , 2013 ) .
peroxisome proliferator - activated receptor- ( ppar- ) , a member of nuclear hormone receptor superfamily , is a ligand - activated transcription factor .
ppar- activation antagonizes beclin-1-mediated autophagy via upregulation of bcl-2/bcl - xl which interact with beclin-1 in cerebral ischemia / reperfusion ( xu et al . , 2013 ) .
amp - activated protein kinase ( ampk ) is a serine / threonine protein kinase and consists of three subunits : a catalytic -subunit and regulatory and -subunits .
the most studied is the catalytic -subunit which contains a threonine phosphorylation site that when phosphorylated , activates ampk .. amp which binds to sites located on the -subunit can enhance the phosphorylation of ampk by lkb1 , and ampk activation could subsequently inhibit the activity of mtor to induce autophagy ( poels et al . , 2009 ; li and mccullough , 2010 ) .
nuclear factor kappa b ( nf-b ) is a transcription factor that regulates expression of multiple genes ( chen et al . , 2011 ) .
recent experiments have demonstrated that the knockout of p50 ( nf-b1 ) enhanced autophagy by repression of mtor in cerebral ischemic mice ( li et al . , 2013 ) .
nf-b - dependent p53 signal transduction pathway is also associated with autophagy and apoptosis in the rat hippocampus after cerebral ischemia / reperfusion insult ( cui et al . , 2013 ) .
mitogen - activated protein kinases ( mapks ) include extracellular signal - related kinase ( erk ) , jun nh2 terminal kinase ( jnk ) and p38 ( lien et al . , 2013 ) .
mapk is one upstream regulator of mtorc1 and autophagy could also be induced via mapk - mtor signaling pathway in cerebral ischemia / reperfusion ( wang et al . , 2013 ) .
hypoxia - inducible factor 1 ( hif-1 ) is a key transcriptional factor that is activated in response to hypoxia during cerebral ischemia ( althaus et al . , 2006 ) .
hif-1 is composed of a constitutively expressed hif-1 subunit and an inducibly expressed hif-1 subunit . since ubiquitination is inhibited under hypoxic conditions , hif-1 can accumulate and dimerize with hif-1. this dimer activates transcription of a number of downstream hypoxia - responsive genes , including vascular endothelial growth factor ( vegf ) , erythropoietin ( epo ) , glucose transporter 1 , and glycolytic enzymes ( xin et al . , 2011 ) .
bcl-2 and adenovirus e1b 19 kda interacting proteins 3 ( bnip3 ) with a single bcl-2 homology 3 ( bh3 ) domain is a subfamily of bcl-2 family proteins and also serves as an important target gene of hif-1 ( cho et al . , 2012 ) .
bnip3 can compete with beclin-1 for binding to bcl-2 and beclin-1 is released to trigger autophagy ( he and klionsky , 2009 ; glick et al . , 2010 ) .
bnip3 also binds and inhibits rheb , an upstream activator of mtor , so it could activate autophagy by inhibiting mtor activity .
however , these models still require additional genetic testing in vivo ( zhang and ney , 2011 ) .
the induced p53 stabilization by up - regulation of hif-1 also plays an important role in post - ischemic autophagy activation ( xin et al . , 2011 ) .
autophagic cell death is activated in the nervous system in response to oxidative stress ( kubota et al . , 2010 ) .
oxidative stress can occur in cerebral ischemia and could increase reactive oxygen species such as superoxide , hydroxyl radical and hydrogen peroxide .
recent studies have reported that selenium provides neuroprotection through preserving mitochondrial function , decreasing reactive oxygen species production and reducing autophagy ( mehta et al . , 2012 ) .
autophagy can also be induced under conditions of excitotoxicity which can also occur in cerebral ischemia ( puyal et al . , 2012 ) .
although excitotoxic glutamate blocks autophagic flux , it could also induce autophagy in hippocampal neurons ( kulbe et al . , 2014 ) .
sustained elevations of ca in the mitochondrial matrix are a major feature of the intracellular cascade of lethal events during cerebral ischemia .
recently , it was reported that endoplasmic reticulum stress is one of the effects of excitotoxicity ( ouyang and giffard , 2012 ) . when endoplasmic reticula were exposed to toxic levels of excitatory neurotransmitters ,
ca was released via the activation of both ryanodine receptors and ip3r , leading to mitochondrial ca overload and activation of apoptosis . during endoplasmic reticulum stress ,
the signaling pathways mentioned above and their relationship to cerebral ischemia and auto phagy are shown in figure 1 .
the figure shows the many different signaling pathways involved in the activation of autophagy during cerebral ischemia . when activated , akt and nf-b activate mtor to inhibit autophagy in cerebral ischemia .
however , the activation of ampk could inhibit the activity of mtor and induce autophagy .
excitotoxicity could induce autophagy by er stress and block autophagic flux by glutamate in cerebral ischemia .
autophagy could also be induced through ros and inhibited through ppar-. ppar- : peroxisome proliferator - activated receptor- ; amp : adenosine 5-monophosphate ; pi3k : phosphatidylinositol 3-ki - nase ; ros : reactive oxygen species ; hif-1 : hypoxia inducible factor 1 ; bcl-2 : b cell lymphoma / leukmia-2 ; bcl - xl : b - cell lymphoma - extra large ; ampk : amp - activated protein kinase ; ampk : amp - activated protein kinase ; akt / pkb : protein kinase b ; nf-b : nuclear factor kappa b ; er : endoplasmic reticulum ; bnip3 : bcl-2 and adenovirus e1b 19 kda interacting proteins 3 ; mtor : mammalian target of rapamycin .
although autophagy has no unified role in cerebral ischemia , increasing evidence supports the notion that autophagy is a double - edged sword .
we believe that the degree of autophagy is critical to its role ( neuroprotective or deteriorative ) in ischemic stroke .
physiological levels of autophagy are favorable to neuronal survival , but excessive or inadequate levels could be harmful and cause injury
. the mechanisms of autophagy underlying cerebral ischemia and whether autophagy activity is really enhanced in cerebral ischemia should be further investigated .
it is also important to study the time point at which autophagy inhibitors and activators should be administered .
( 2010 ) have used green fluorescent protein ( gfp)-fused lc3 transgenic mice to detect autophagy in vivo and this could be helpful in monitoring autophagic processes in live stroke patients as well as clarifying the detailed roles of autophagy in the ischemic brain . the idea that the time point of autophagy induction determines the fate of neurons during cerebral ischemia provides a new treatment strategy for ischemic stroke patients . | evidence suggests that autophagy may be a new therapeutic target for stroke , but whether activation of autophagy increases or decreases the rate of neuronal death is still under debate .
this review summarizes the potential role and possible signaling pathway of autophagy in neuronal survival after cerebral ischemia and proposes that autophagy has dual effects . | Introduction
The process of autophagy and its functional complexes
Apoptosis, necrosis and autophagy in cerebral ischemia
Autophagy in cerebral ischemia
Possible autophagy signaling pathways in cerebral ischemia
Conclusions |
it is frequently used in immunocompromised patients with human immunodeficiency virus ( hiv ) or a history of organ or stem cell transplantation .
anterior uveitis and hypopyon are well - recognized and frequently reported complications of rifabutin treatment ; however , posterior involvement is relatively rare [ 1 , 2 ] . here , we describe a case of rifabutin - associated panuveitis in a young patient with a history of acute myeloid leukemia .
a 17-year - old eritrean girl presented with a 5-day history of redness , tearing , and photophobia which started in her right eye ( od ) and then involved her left ( os ) .
she recalled similar , but less severe symptoms over the 2 months prior to presentation .
she was treated with chemotherapy and received an allogeneic hematopoietic stem cell transplant 6 months after diagnosis .
she developed graft - versus - host - disease ( gvhd ) of the gastrointestinal tract , lungs , and skin with mild ocular surface involvement , but these issues were stable at the time of presentation to the eye clinic .
on initial examination , pinhole visual acuity was 20/32 in each eye ( ou ) , and intraocular pressures were 14 mmhg ou .
the anterior chambers had 3 + and 4 + cells ( od and os , respectively ) , and bilateral moderate vitritis was noted .
the left eye also had a hypopyon ( less than 1 mm ) and posterior synechiae of the iris ( fig . 1 ) .
both eyes were treated with topical prednisolone acetate 1% every hour and cyclopentolate twice daily . due to the concern for recurrent leukemia or infection
, aqueous humor was obtained from the left eye ; cytology was negative for malignant cells , and cultures were negative .
laboratory testing was negative or within normal limits for rpr , syphilis igg , hepatitis b and c , angiotensin - converting enzyme , lysozyme , ana , anti - dsdna , rheumatoid factor , and hla - b27 .
1anterior segment photograph of the left eye showing a small hypopyon and visible vitreous debris ( posterior synechiae were broken by dilation ) anterior segment photograph of the left eye showing a small hypopyon and visible vitreous debris ( posterior synechiae were broken by dilation ) topical corticosteroids were tapered to every 2 hours ou .
ten days later , the patient developed recurrent bilateral anterior uveitis and vitritis with a hypopyon os .
fluorescein angiography ( fa ) showed diffuse retinal vascular leakage and late staining of the optic nerves in both eyes ( fig .
a more detailed review of her medications and medical history revealed she was on rifabutin for recurrent mac .
nearly 2 years before she developed uveitis , she had completed a 9-month course of ethambutol , clarithromycin , and rifabutin for mac cultured from a lung biopsy . during the same period , she was on systemic immunosuppressive medications ( mycophenolate mofetil , cyclosporine , and prednisone ) for gvhd .
eight months before presenting with hypopyon uveitis , ethambutol , clarithromycin , and rifabutin were restarted for recurrent mac .
rifabutin dosing was twice as high ( 300 mg every monday , wednesday , and friday ) , and she was no longer on systemic immunosuppressive agents .
after rifabutin - associated uveitis was diagnosed , her medication was switched from rifabutin to moxifloxacin .
topical corticosteroids were continued at the same frequency ( every 2 hours ) , and the hypopyon resolved 5 days later . in the first 2 weeks of follow - up , the macular edema initially worsened , os > od , but over time , the thickening gradually returned to normal ( fig . 3 ) .
on fluorescein angiography , the diffuse retinal leakage had improved at 5 weeks and had resolved after 4 months on a slow topical corticosteroid taper ( fig .
2fluorescein angiography montages of the right and left eyes : a , b baseline ( prior to discontinuation of rifabutin ) .
3cirrus oct of the left eye : cystoid macular edema present 9 days ( a ) after stopping rifabutin that resolved 1 month later ( b ) fluorescein angiography montages of the right and left eyes : a , b baseline ( prior to discontinuation of rifabutin ) .
e , f four months after stopping rifabutin cirrus oct of the left eye : cystoid macular edema present 9 days ( a ) after stopping rifabutin that resolved 1 month later ( b )
anterior uveitis and hypopyon are the most frequent manifestations of rifabutin - associated uveitis ; however , severe cases may develop dense vitritis with large yellow - white opacities or panuveitis resembling endophthalmitis [ 3 , 4 ] . despite the strong association with rifabutin ,
infectious , autoimmune and neoplastic etiologies should still be investigated depending on the clinical situation .
examination of aqueous humor and/or vitreous via culture , cytology , or polymerase chain reaction can help rule out infection or malignancy .
although mild to moderate vitritis frequently develops in rifabutin - associated uveitis , posterior involvement is less frequent [ 57 ] .
similar to the previous cases , our patient presented with uveitis several months after the start of rifabutin and responded quickly to topical corticosteroids and discontinuation of rifabutin .
of the four cases described by skolik , only one patient had diffuse vasculitis on fa ; the others had mild peripheral vasculitis or perivascular sheathing .
of note , the patient with diffuse fa changes was immunocompetent , whereas the other patients had acquired immunodeficiency disease syndrome ( aids ) and cd4 counts less than 100 cells / mm .
in each of the single case reports by arevalo and vaudaux , the rifabutin - associated uveitis was unilateral and the posterior findings were focal .
arevalo s patient had aids and a cd4 count of 3 cells / mm ; a focal area of sclerosed retinal vessels was noted after intraocular injections of vancomycin and gentamicin for presumed endophthalmitis . in the case from vaudaux ,
the patient had been treated with systemic prednisone for chronic obstructive pulmonary disease 4 months prior to developing uveitis , but was otherwise immunocompetent .
the fa and ocular coherence tomography ( oct ) confirmed unilateral cystoid macular edema . in our immunocompetent patient ,
the vasculitis was notable for its diffuse and bilateral nature and slow resolution after the discontinuation of rifabutin .
rifabutin - associated uveitis was initially described in hiv - positive patients , but it may also occur in patients who are immunocompetent . only a few pediatric cases have been reported ; however , due to the possible association with low body weight , weight - based dosing has been suggested as a strategy to prevent uveitic complications .
our patient weighed 42.5 kg , and uveitis developed after the rifabutin was restarted at twice the initial dose .
it is unclear whether the lack of systemic immunomodulatory medications influenced the onset of uveitis during the second course of rifabutin since patients have developed rifabutin uveitis while iatrogenically immunosuppressed after transplantation .
perhaps an intact immune system predisposed our patient to develop more extensive retinal vasculitic changes .
we describe a case of rifabutin - associated hypopyon uveitis in a young immunocompetent patient with an unusual degree of diffuse bilateral retinal vasculitis .
while the anterior chamber and vitreous inflammation disappeared rapidly after discontinuation of rifabutin , resolution of the retinal vasculitis took several months .
fluorescein angiography helped assess the extent and severity of uveitis as well as guide the topical corticosteroid taper .
this article is distributed under the terms of the creative commons attribution license which permits any use , distribution , and reproduction in any medium , provided the original author(s ) and the source are credited . | purposethis study reports a case of bilateral rifabutin - associated uveitis in a child with a history of acute myeloid leukemia.methodswe utilized a clinical case description and brief discussion.resultsa 17-year - old girl presented with acute bilateral anterior uveitis , a hypopyon in the left eye , and moderate bilateral vitritis .
she had a history of acute myeloid leukemia status post - allogeneic hematopoietic stem cell transplant 5 years earlier .
she was receiving rifabutin for a biopsy - proven mycobacterium avium complex pulmonary infection .
work up for infectious and neoplastic etiologies was negative .
the uveitis initially responded to topical corticosteroids , but recurred when the drops were tapered .
fluorescein angiography demonstrated diffuse vasculitis of small retinal vessels and cystoid macular edema .
after rifabutin was discontinued , the uveitis and vasculitis slowly resolved.conclusionfluorescein angiography demonstrated widespread retinal vasculitis which is a rare manifestation of rifabutin - associated uveitis . | Introduction
Case report
Discussion
Conclusion
Open Access |
congenital muscular dystrophy type 1a ( mdc1a ) was first described in 1994 as a variant form of classic congenital muscular dystrophy ( cmd)1 ) .
mdc1a is an autosomal recessive disorder , and patients show absent merosin ( laminin 2 ) on skeletal muscle biopsy . a mutation in the laminin 2 ( lama2 ) gene , located on 6q22 - 23 ,
most patients with mdc1a show absent merosin in muscle immunohistochemistry studies , however , there have been some reports of cases of mdc1a with residual merosin expression3,4,5 ) .
mdc1a is very rare in asian countries . comparing with studies conducted in western countries2,3 ) ,
only a few cases without merosin expression have been reported in the asian population6,7,8 ) . here
the patient was born at 38 weeks of gestation with a birth weight of 3,500 gm .
she was a second child , with one 4-year - old brother with no medical problems .
she was healthy at birth , but her parents noticed that she had a delayed motor milestone at the age of 4 months as indicated by her inability to fully control her head .
she was brought to severance children 's hospital for the first time at the age of 4 months and was hypotonic at that time .
she was fully examined for muscular disease at the age of 6 months , at which time she could not yet control her head . however the bayley scales of infant development for language and cognitive development were normal .
her serum creatine kinase ( ck ) level was elevated to 2,184 iu / l ( 0 - 50 norm ) and her serum aldolase level was also high at 31.6 sigma u / ml ( 0 - 7.6 norm ) . in a nerve conduction study ,
brain magnetic resonance imaging ( mri ) performed at the age of 6 months showed excessive t2 hyper - intensity at the peritrigone and external capsule ( fig .
1 ) . repeated brain mri at the age of 8 months showed progression of dysmyelination .
hematoxylin and eosin staining showed marked muscle fiber size variation , increased endomysial fibrosis , many endomysial inflammatory cell infiltrations , and many necrotic and regenerative muscle fibers ( fig .
modified gomori trichrome staining did not show ragged red fibers , nemaline bodies , or rimmed vacuoles .
immunohistochemical staining was performed using antibodies against the c - terminal of dystrophin , rod domain of dystrophin , n - terminal of dystrophin , -sarcoglycan , -sarcoglycan , -sarcoglycan , -sarcoglycan , dysferlin , -dystroglycan , caveolin 3 , and laminin 2 . staining against laminin 2
3 ) . to confirm mutation in the lama2 gene , we performed direct sequencing of exons 14 , 25 , 26 , and 27 , all of which are known as common sites of mutation .
typical clinical features of mdc1a or merosin deficient congenital muscular dystrophy include severe floppiness at birth , elevated serum ck , delayed motor milestones , white matter changes as seen on brain mri , and normal intelligence2 ) .
however , merosin - positive cmd generally presents with less severe clinical features and without any abnormalities on brain mri2,5 ) .
initially , mdc1a was thought to be a homogenous disease ; however , case reports of atypical phenotypes and some cases showing only partially reduced merosin expression contributed to classifying the disease as a heterogeneous group3,5 ) .
there have been mdc1a patients who show late - onset weakness , mental retardation , seizures , subclinical cardiac involvement , or neuronal migration defects9 ) . in particular , cases with residual merosin expression
have more variable phenotypes than cases with absolute merosin deficiency . according to previous reports , patients with residual merosin tend to have milder phenotypes3,5 ) . with regards to ambulation
, a previous study showed that eight out of 12 patients with residual merosin achieved independent ambulation , whereas , out of four patients with absent merosin , none could walk independently5 ) .
another study presented similar results : five out of 13 patients with residual merosin and two out of 33 patients with absent merosin could walk independently3 ) . in our case ,
the onset of symptoms was 4 months after birth , rather than during the neonatal period . usually , merosin deficient patients present with symptoms within 7 days of birth , while patients with residual merosin have a later onset of symptoms .
the other symptoms of this patient , such as hypotonia , normal intelligence , elevated serum ck , and the absence of seizures , are typical presentations of mdc1a patients . at present
, she is 14 months old , and can sit without support but can not get into a sitting position .
we estimate that she has about a 50% probability of walking independently later in her life .
however , the patient 's site of lesion is in the external capsule , which is an unusual area for this disease .
a study of 25 brazilian patients with mdc1a reported that bilateral white matter involvement in the parietal , frontal , and temporal regions was frequent , and brain stem , cerebellum , and internal and external capsules were also affected in a minority of cases10 ) .
however , there were no correlations with sites of white matter abnormalities and clinical status or merosin status . to confirm mutation of the lama2 gene , we sequenced exons 14 , 25 , 26 , and 27 .
this technique , while able to screen for point mutations in above 4 exons , is limited in its ability to detect large deletions or insertions or point mutations in the other sites .
we did not further evaluate other possible mutations in the lama2 gene because of her parents ' refusal . according to a previous report
, a majority of mutations in the residual merosin group are splice site mutations , and frameshift mutations are less frequent3 ) .
this patient may have mutations in her lama2 gene , although we could not confirm the specific mutations because of incomplete study .
mdc1a is very rare in asia , and the cases reported thus far are typically those without merosin , and have mostly been severe forms of mdc1a . in our study , the patient showed a typical phenotype of mdc1a , including features such as hypotonia , elevated serum ck , delayed motor development , and t2 hyperintensity on brain mri .
however , immunohistochemical staining of the muscle fibers showed partially decreased merosin levels and some atypical findings , such as a somewhat later age of disease onset and involvement of the external capsule . from our experience ,
performing immunohistochemical staining to assay the extent of merosin expression is an important procedure , and may be helpful in predicting the clinical course of the disease . | congenital muscular dystrophy type 1a ( mdc1a ) is an autosomal recessive disorder characterized by hypotonia , elevated serum creatine kinase level , delayed motor milestones , white matter changes observed by brain magnetic resonance imaging , and normal intelligence .
a mutation in the laminin 2 ( lama2 ) gene , located at 6q22 - 23 , is a genetic cause of mdc1a .
patients have merosin ( laminin 2)-deficient skeletal muscles . however , the degree of merosin expression ranges from total absence to partial reduction .
patients with residual merosin expression have more variable and milder phenotypes than those with absolute merosin deficiency .
we observed a korean girl with mdc1a with residual merosin expression .
clinical presentation of this patient was typical except for late onset of the disease and external capsule involvement .
immunohistochemical staining of muscle fibers including merosin , is important to evaluate patients with hypotonia , delayed motor development , and abnormal white matter changes . | Introduction
Case report
Discussion |
however
none of them are considered of excellent performance to accurately determine what is
ingested for all age groups . even in studies based on a " gold
standard " method as food weighing , there can be deviations in the estimation of some
items .
the r24h is among the most widely used instruments for assessing the accuracy of
selfreport measures .
it is considered a fast and financially accessible tool that can
reflect the individual 's diet when applied repetitively .
this repetitive evaluation is important because
deviations can be found in the estimates produced by self - report measures .
studies involving parents of children or adults showed that the estimates of food intake
are considerably underestimated for the unhealthy foods and overestimated for the
healthy ones .
moreover , estimates for children and adolescents can be
affected by the recall bias .
they have problems in correlating the frequency of food
intake and the time of ingestion , and sometimes they also tend to remember just the
preferred foods . children and adolescents frequently have difficulties in reporting the size of the
consumed portion .
this fact is often associated with cognitive constraints , a little
explored subject in the literature .
it is known that in children 7 - 8 years of age , there is an increased ability to
participate in evaluations such as diet recall without the help of parents .
these difficulties in associating items of diet with time are
reported as an information overload , since many times the child does not have a clear
memory of past events .
thus , it is necessary to reconstruct the events by making
inferences from what they usually ingest .
this inference many times is n't what the child
ingested , but can portray a usual diet . on the other hand ,
the period of adolescence is characterized by
intense changes of physical , psychological and social context , and cognitive ability and
level of emotional maturity may be variable in this period .
most of the studies for validating food frequency questionnaires are concerned about
investigating the nutritional composition of the diet and the intake amount of calories
and nutrients ( macro or micro ) .
however , fast
and specific tools for estimating food behaviors , such as the frequency of carbohydrate
intake with and without sugar , are scarce .
this frequency is the main etiologic factor for dental
caries , a chronic disease
considered a serious public health problem .
thus the objective of this study was to compare estimates of food behavior related to
oral health produced by a self - report measure and dietary recalls of 24 hours .
a cross - sectional study was conducted among adolescents attending public schools in
piracicaba ( 0.7 ppm f in tap water ) , 157 km from the capital of so paulo - brazil , with
an area of 1,377 km and a population of 364,571 people .
the study was approved by the research ethics committee of public
health school - usp ( protocol no .
the study population was selected from the representative sample of 483 adolescents that
participated in the study " determinant factors of the risk of obesity in adolescents
from public schools of piracicaba : cross - sectional study as a first step in a cohort
study " supported by fapesp ( so paulo research foundation ) , process no .
nutritionists trained under the supervision of the department of nutrition from the
public health school at the university of so paulo applied three 24 hours dietary
recalls ( r24h ) .
the dietary recalls were administered at nonconsecutive days to cover
a day in the weekend , setting up 15-day intervals between them .
the self - report instrument had
three questions for each one of the eleven food items .
the questions were about food
intake related to oral health , as well as frequency and the time of the day in which
the food was ingested .
finally , we compared this instrument to the dietary recalls
( r24h ) . the tools ( self - report measure and r24h )
were tested in a pilot study and adjusted
accordingly before being used in the feld .
the nutritionists used utensils such
as cups , plates , and spoons to apply r24h . to examine the food behavior related to oral health in the past 15 days , the eleven
investigated items were ice cream , fruits , chocolate , soft drinks , vegetables , juices
with added sugar , biscuits ( with and without filling ) , greens , chocolate milk , and
sweets ( chewing gum , candy ) .
these items were selected based on the results of a
previous study on food intake conducted in piracicaba - sp , using data related to the intake average obtained
from two 24-hour recalls ( r24h ) applied in 93 adolescents .
the food items were chosen
taking into account the content of sucrose , the frequency of consumption and the
number of adolescents who reported the food intake .
data from food frequency were collected in six categories : 1 to 3 times in the last
15 days ; 4 to 6 times in the last 15 days ; 1 time a day ; 2 times a day ; 3 times a
day ; 4 or more times a day .
time of the day related to the food ingestion was
registered according to three categories : at mealtime ( breakfast , lunch or dinner ) ,
at another moment ( mid - morning or mid - afternoon or evening before bedtime ) or both .
items such as vegetables , greens and fruits were included based on questionnaires
from who ( 2010 ) and cdc about diet , due to the importance these foods in relation to
oral health - related behavior .
the measures of body weight and height of the adolescents were performed using a
digital scale with a capacity of 150 kg , sensitivity of 100 grams ( tanita , solar
digital scale hs 302 , tokyo , japan ) , and a portable estadiometer ( seca bodymeter 208 ,
hamburg , germany ) .
the estadiometer was placed in one of the walls of the research site and the
measurement used was the distance between the highest part of the head and the soles
of the feet , in upright position .
the volunteer was positioned so that the head was
aligned with the frankfurt plane ( imaginary line from the external auditory canal
until the lower orbit of the eye ) . to weigh the volunteers ,
the
volunteer was asked to look straight ahead while the weight was recorded by the
researcher .
brazilian economic classification
based on schooling level of the household head and the presence of household goods
and appliances in the house was used .
the families were categorized in eight economic
classes : a1 , a2 , b1 , b2 , c1 , c2 , d and e. the data from r24h were converted into energy and nutrients by the software dietwin
and the average consumption ( kcal ) was estimated .
moreover , they were separated in 11
food items : ice cream , fruits , chocolate , soft drink , greens , juices with added
sugar , biscuits ( with and without filling ) , vegetables , chocolate milk , sweets
( chewing gum , candy ) to allow the comparison with the issues of the self - report
instrument .
the data about the ingested item , intake frequency and the time of the
food intake were checked in the r24h and the self - report measure .
we performed the data checking to ensure their reliability , examining 20 chips
randomly , and errors of data transcription were not found .
chi - square and student 's t test were used to compare the characteristics between the
sub - sample and the reference population .
the correspondence between the responses in the individual level was verified by
simple agreement and kappa statistics when the response categories showed balance ,
and the difference between the highest and lowest value reached no more than 20% of
the respondents .
the responses on the intake frequency obtained through self - report
instrument were grouped into three categories : " one or more times a day " ; " up to 3
times over the past 15 days " ; " 4 to 6 times in the last 15 days " .
we could thus have
a better visualization of categories of frequency and could keep the category " one or
more times a day " apart .
the wilcoxon test was used to analyze the differences in average consumption
estimated by r24h and the self - report measure .
the chi - square of mcnemar test was
used to compare the differences in the percentage of respondents according to the
category " one or more times a day " and the intake moment ( only at mealtime or in
another moment ) .
assuming type 1 error equal to 5% and type 2 error equal to 20% , a
sample of 85 or more participants would be needed to detect an effect size
corresponding to 0.3 between the average daily intakes .
the same sample size would be
appropriated to detect a ratio between 1.8 and 2.2 between two proportions since the
relative frequency of discordant pairs ranged from 0.5 to 0.9 .
nutritionists trained under the supervision of the department of nutrition from the
public health school at the university of so paulo applied three 24 hours dietary
recalls ( r24h ) .
the dietary recalls were administered at nonconsecutive days to cover
a day in the weekend , setting up 15-day intervals between them .
the self - report instrument had
three questions for each one of the eleven food items .
the questions were about food
intake related to oral health , as well as frequency and the time of the day in which
the food was ingested .
the tools ( self - report measure and r24h ) were tested in a pilot study and adjusted
accordingly before being used in the feld .
the nutritionists used utensils such
as cups , plates , and spoons to apply r24h .
to examine the food behavior related to oral health in the past 15 days , the eleven
investigated items were ice cream , fruits , chocolate , soft drinks , vegetables , juices
with added sugar , biscuits ( with and without filling ) , greens , chocolate milk , and
sweets ( chewing gum , candy ) .
these items were selected based on the results of a
previous study on food intake conducted in piracicaba - sp , using data related to the intake average obtained
from two 24-hour recalls ( r24h ) applied in 93 adolescents .
the food items were chosen
taking into account the content of sucrose , the frequency of consumption and the
number of adolescents who reported the food intake .
data from food frequency were collected in six categories : 1 to 3 times in the last
15 days ; 4 to 6 times in the last 15 days ; 1 time a day ; 2 times a day ; 3 times a
day ; 4 or more times a day .
time of the day related to the food ingestion was
registered according to three categories : at mealtime ( breakfast , lunch or dinner ) ,
at another moment ( mid - morning or mid - afternoon or evening before bedtime ) or both .
items such as vegetables , greens and fruits were included based on questionnaires
from who ( 2010 ) and cdc about diet , due to the importance these foods in relation to
oral health - related behavior .
the measures of body weight and height of the adolescents were performed using a
digital scale with a capacity of 150 kg , sensitivity of 100 grams ( tanita , solar
digital scale hs 302 , tokyo , japan ) , and a portable estadiometer ( seca bodymeter 208 ,
hamburg , germany ) .
the estadiometer was placed in one of the walls of the research site and the
measurement used was the distance between the highest part of the head and the soles
of the feet , in upright position .
the volunteer was positioned so that the head was
aligned with the frankfurt plane ( imaginary line from the external auditory canal
until the lower orbit of the eye ) . to weigh the volunteers ,
the
volunteer was asked to look straight ahead while the weight was recorded by the
researcher .
brazilian economic classification
based on schooling level of the household head and the presence of household goods
and appliances in the house was used .
the families were categorized in eight economic
classes : a1 , a2 , b1 , b2 , c1 , c2 , d and e.
the data from r24h were converted into energy and nutrients by the software dietwin
and the average consumption ( kcal ) was estimated .
moreover , they were separated in 11
food items : ice cream , fruits , chocolate , soft drink , greens , juices with added
sugar , biscuits ( with and without filling ) , vegetables , chocolate milk , sweets
( chewing gum , candy ) to allow the comparison with the issues of the self - report
instrument .
the data about the ingested item , intake frequency and the time of the
food intake were checked in the r24h and the self - report measure .
we performed the data checking to ensure their reliability , examining 20 chips
randomly , and errors of data transcription were not found .
chi - square and student 's t test were used to compare the characteristics between the
sub - sample and the reference population .
the correspondence between the responses in the individual level was verified by
simple agreement and kappa statistics when the response categories showed balance ,
and the difference between the highest and lowest value reached no more than 20% of
the respondents .
the responses on the intake frequency obtained through self - report
instrument were grouped into three categories : " one or more times a day " ; " up to 3
times over the past 15 days " ; " 4 to 6 times in the last 15 days " .
we could thus have
a better visualization of categories of frequency and could keep the category " one or
more times a day " apart .
the wilcoxon test was used to analyze the differences in average consumption
estimated by r24h and the self - report measure .
the chi - square of mcnemar test was
used to compare the differences in the percentage of respondents according to the
category " one or more times a day " and the intake moment ( only at mealtime or in
another moment ) .
assuming type 1 error equal to 5% and type 2 error equal to 20% , a
sample of 85 or more participants would be needed to detect an effect size
corresponding to 0.3 between the average daily intakes .
the same sample size would be
appropriated to detect a ratio between 1.8 and 2.2 between two proportions since the
relative frequency of discordant pairs ranged from 0.5 to 0.9 .
in this study , 87 of the 92 selected adolescents completed all phases of the research .
among these adolescents ,
39.2% were male and the mean age was 13.4 years old
( sd=0.7 ) .
regarding socioeconomic level , 4.6% were class a2 , 24.1% were b1 , 43.7% were b2 , and
27.6% were c1 .
according to table 1 , there were
no statistically significant differences between the characteristics of the adolescents
included in the study and the participants of the representative sample from the city .
the samples did not differ statistically by gender , body mass index ( bmi ) and
socioeconomic level .
characteristics of sample and subsample according to gender , body mass index
( bmi ) , consumption of sweets , sugar and soft drinks .
piracicaba , brazil , 2011 notes : data sample ( 2007 ) and subsample ( 2011 ) sd = standard deviation the average energy intake in the 3 dietary recalls ( r24h ) in kcal was 2021.95 ( 671.64 ) ,
and the maximum and minimum values were respectively 4612.71 and 633.72 .
the volunteers
had a mean weight of 54.67 kg , height of 1.60 m and bmi equal to 21.28 kg / m ;
21 were overweight and 7 were considered obese according to the who values .
the self - report instrument used was composed of 33 questions , 27 on the consumption of
sweet products ( containing sugar ) interspersed with 6 items related to consumption of
fruits , greens and vegetables .
the mean values obtained through the self - report instrument were always higher than
those reported by the r24h , with statistically significant differences for most items
( wilcoxon p<0.05 ) , except ice cream , vegetables and biscuits without filling ( table 2 ) .
there were no differences between boys
and girls when the analysis was stratified by gender ( data not shown ) .
mean , median , and standard deviation ( sd ) of daily intake ( grams ) assessed by
three r24hs and a self - report measure ( srm ) , in 87 adolescents attending public
schools in piracicaba , brazil , 2011 wilcoxon test ( p<0.05 ) the higher spearman 's correlations were found for the items ice cream ( rs=0.35 , p=0.00 ) ,
soft drink ( rs=0.39 , p=0.00 ) and chocolate milk ( rs=0 , 38 , p=0.00 ) , positioning them on
the edge between a weak and moderate correlation . for fruits ( rs=0.23 , p=0.03 ) , biscuits
without filling ( rs=0.15 , p=0.15 ) , and sweets / candy / gum ( rs=0.25 , p=0.02 ) , the observed
values showed a weak correlation . for other items ,
the percentage of adolescents who reported intake frequency " one or more times daily "
was higher than the value obtained through r24h for all food items , except soft drinks
( table 3 ) . regarding the time of intake ( only
at the mealtime or at another time ) , there was no statistically significant difference
for the items greens , juice with added sugar , vegetables , chocolate milk , biscuits
without filling and sweets ( chewing gum , candy ) . for four of the five remaining items ,
namely ice cream , fruits , chocolate , soft drink and biscuits with filling , significant
differences were observed leading to an overestimation of the intake in other times
( table 3 ) .
percentage of adolescents according to their intake frequency over the past 15
days and time of the day of intake , both assessed by r24hs and self - report measure
( srm ) .
piracicaba , brazil , 2011 statistical test not applied at the individual level , the kappa statistic was applied only for soft drinks ( 0.27 ) and
sweets/ candy / gum ( 0.15 ) , with level of agreement rated as " considerable " and " mild "
consecutively .
higher values of crude agreement between instruments , individually , were for the items
biscuits without filling ( 75.9% ) , ice cream ( 72.4% ) , chocolate ( 57.5% ) and soft drinks
( 56.3% ) ( figure 1 ) .
percentage of agreement ( % ) related to the responses obtained through the r24h and
by the self - report measure ( srm ) according to the intake frequency and type of
food , piracicaba , 2011 , brazil in relation to the time of sugary food intake , the r24h showed that soft drinks and
sweets are consumed in other times besides the main meals , reaching 77.0% of agreement
between the instruments ( figure 2 ) .
percentage of responses of crude agreement ( % ) and kappa test comparing the r24h
and the self - report measure ( srm ) , according to the time of the day and type of
food ingested , piracicaba , 2011 , brazil the kappa test was only possible to apply for the soft drink and the value was
considered " mild " ( 0.10 ) .
sugars have an evidenced etiologic role in to tooth decay , not only by the amount of the
sugar ingested , but mainly by the frequency of intake .
thus , the instruments aiming to measure this consumption
are important to deepen understanding of the relationship between food behavior and
dental caries in a context of multiple sources of fluoride .
therefore , comparing estimates of dietary behavior related to oral health among
adolescents produced by a self - report instrument and by 24 hour recalls is important to
verify the reliability of these instruments . in the present study ,
we assessed the degree
of crude agreement of responses , the average intake estimates , and the percentage
distribution of participants according to the frequency of food intake in the last 15
days and the time of consumption .
the measurement of the degree of agreement between the values produced by both tools was
made in relation to the categories of consumption frequency and time of intake ( only at
mealtime and at another moment ) .
values of crude agreement equal or higher than 70% regarding the time of ingestion were
observed for four food items . in relation to the intake frequency , this agreement level
was noticed only for two items , which may indicate that adolescents have more readiness
to describe the moment of food intake than its frequency in the last 15 days .
the degree of correlation between the average daily intakes was estimated as weak for
the most studied foods .
only items as ice cream ( rs=0.35 , p=0.00 ) , soft drink ( rs=0.39 ,
p=0.00 ) and chocolate milk ( rs=0.38 , p=0.00 ) presented weak to moderate correlation
suggesting that the deviations are not homogeneous or subject to a linear
correction .
the proportion of adolescents who reported intake frequency " one or more times daily "
for a particular food was higher than the estimate obtained by reference measure for all
items , except for the soft drink , which displayed equivalent consumption .
the
implication is that the estimates provided by the self - report measure should be used
with caution .
according to the reference method , the percentage of adolescents who reported intake
frequency " one or more times a day " for fruits , greens and vegetables was always lower
than the value estimated by self - report measure .
the results suggest that adolescents , before a self - report instrument , tend to report a
degree of exposure to the food items larger than actually experience in their daily
lives . regarding the moment of ingestion , no tendency for overestimating
for some items whose estimates differed , it was observed that
the most frequent category changed from mealtime to other times outside the main meal .
this occurred for the items ice cream , fruits , chocolate , soft drink , and biscuits with
filling , which may suggest that in the face to face interview , a feature of reference
method , adolescents tend to underestimate the consumption of these products outside the
period of the mealtime . in this case
, the self - report measure might be a useful tool
considering that different behaviors in relation to the expected standard are less
reported in a face to face interview .
deviations in the estimation of food behavior are highlighted by several researchers .
some of them have argued that teenagers tend to remember only the preferred foods and do
not possess the time dimension completely formed .
there is a reasonable increase from individuals 7 - 8 years to 12 years of age in the
ability of children to participate in dietary recalls , but only for the food consumed in
the immediate past , corresponding to the last 24 hours .
parental involvement may be important to provide details about the types and amounts of
food consumed , as children have not completed their cognitive development .
however , the
help of the parents is not a solution to all difficulties of assessing the diet of the
children , particularly if the study is concerned about evaluating what is consumed
between main meals , in the period when the kids are at school or in other places out of
their parents ' sight . in the case of adolescents , additional difficulties associated with patterns of
irregular diet , including eating out of the house , and concern with self - image can
contribute to a greater or lesser lack of accuracy in reporting habitual diet .
in recent years , changes have been
observed in the social context of eating with a shift from a pattern based on family
meal to a pattern based on more irregular and solitary eating .
this not only increases
the frequency of consumption but also confuses the function of the foods .
items that
traditionally were part of the main meal and did not pose a risk to the oral health have
become a threat , as the introduction of the snacks in other moments during the
day .
some authors have emphasized that adolescents do not have cognitive maturity for
decision - making .
they would be influenced by emotional factors , because some factors of
configural stimuli are still being formed in the adolescence .
thus , to ask
for a teen to answer an instrument that assesses food consumption in the last 15 days
may require a mental and cognitive effort beyond his / her ability , leading to errors in
the estimation of food consumption .
it is important to point out that the discrepancies in this study were found in a sample
size relatively too small to detect differences between the estimates produced by
different measurement instruments .
the characteristics of volunteers who formed the
present investigation did not differ from the representative sample of adolescents who
participated in the previous study in the same county .
in addition to demographic
characteristics , the composition according to body mass and exposure to sugary products ,
both by frequency and by the amount ingested , were equivalent .
while this represents a
strong aspect of the study , a limitation is that it was not possible to ensure a more
balanced frequency for some food items , which would have allowed the application of
kappa test .
food items that composed the instrument were selected based on a previous
study , which was conducted with participants of similar age enrolled in the same
city .
nevertheless , for two items investigated by the reference
method , none was consumed by adolescents at least once a day . in spite of indicators related to group analysis have showed better application when
compared to individual analysis indicators since the kappa test could not be applied to
all food groups , from a clinical point of view , the results suggest that the utilization
of self - report instrument can lead to an overestimation of individual exposure compared
to r24h . to minimize recall bias , one might make use of food weighing as the " gold standard " .
the present study used kitchen
utensils , glasses and cups to help the adolescents remember the consumed amount in the
previous day , making sure to apply the 24-hour recall at least one day after the
weekend , since the diet might vary in this period .
the method was applied by trained nutritionists .
to apply the self - report instrument ,
the adolescents were divided in small groups ,
distant from each other in individual portfolio , always with the presence of the
researcher responsible to aid in case of any doubt .
there was considerable variability in the degree of concordance between the instruments ,
at the individual level , depending on the type of food .
the response of the adolescents
led to an overestimating of daily intake for 8 out of 11 food items measured by the
self - report instrument .
the percentage of adolescents that reported the intake frequency
" one or more time daily " was higher than the estimate obtained through r24h for all food
items , excepting soft drinks .
further studies are needed to develop a self - report measure
particularly for items in which there was an overestimation . | objectiveto compare estimates of food behavior related to oral health obtained through a
self - report measure and 24 hour dietary recalls ( r24h).methodwe applied three r24h and one self - report measure in 87 adolescents .
the estimates
for eleven food items were compared at individual and group levels.resultsno significant differences in mean values were found for ice cream , vegetables and
biscuits without filling . for the remaining items , the values reported by the
adolescents were higher than the values estimated by r24h .
the percentage of
adolescents who reported intake frequency of 1 or more times/ day was higher than
the value obtained through r24h for all food items except soft drinks .
the highest
values of crude agreement between the instruments , individually , were found in the
biscuits without filling ( 75.9% ) and ice cream ( 72.4%).conclusionthe results suggest that adolescents tend to report a degree of exposure to the
food items larger than what they actually experience in their daily lives . | INTRODUCTION
MATERIAL AND METHODS
Measurement of food behavior
Instruments
Food items
Weight and height
Socioeconomic data
Data analysis
RESULTS
DISCUSSION
CONCLUSION |
access to medical care is sometimes very difficult to be reached from people living in rural and underserved areas .
the implementation of systems support different telehealth technologies as well as on evidence - based medicine .
a fundamental change in the management and delivery of healthcare , by leveraging telehealth applications and solutions , is crucial to get the most cost - effective and efficient use out of available healthcare resources .
it is therefore crucial to develop a general information exchanged e - medical system to enable its users to perform online and offline medical consultations .
this means by consultation of additional medical experts , medical diagnosis can be stated more precisely , and certified . during the medical diagnosis , image analysis techniques combined with doctor 's opinions could be useful for final medical decisions .
telehealth is the exchange of health information and the provision of health care services through electronic information and communications technology , where participants are separated by geographic , time , social and cultural barriers .
it represents a wide range of variables including clinical application , characteristics of the information being transmitted , temporal relationships of data transfer , and the organizational context . in quality assessment studies on information systems effectiveness , data quality ,
the iso and standards and issues related to the quality of medical care exist already . over the past years
simulation refers to the artificial generation , representation , and interaction of a complex - real - world process . in the medical area
the trainee has the ability to realistically learn a number of skills without the physical presence of a real patient .
the benefits are availability and evaluation of different medical cases ; clinical human performance and mastering complex or even critical situations offers a safe study environment in absence of the physical patient , especially in cases where the distance is a crucial parameter for the diagnosis and treatment . because there is a close relation between telemedicine and medical imaging , it is essential to develop e - medical systems appropriate to provide information for the anatomical structure of the human body . moreover the online - mode gives the opportunity to communicate over far distances with a given partner in real time . in this case
both partners look at the same image material and through text messages ( chat window ) and transfer mouse actions to the remote pc , where they can discuss interactively over a medical case . methods for providing that kind of information are based on segmentation techniques .
methods for performing segmentations vary widely depending on the specific application , imaging modality , and other factors like treatment ( e.g. , cancer treatment , image - guided surgery , and invasive techniques ) or diagnostic imaging [ 24 ] . in this work we will present segmentation techniques that improve the time and interaction one needs to define one or more structures .
this methodology involves interpolation methods for the volume definition ( manual and semiautomatic ) and methods for the semiautomatic organ shape extraction .
once an accurate segmentation is obtained , this information may be used by the doctors to compare the volume and morphology characteristics of each region against known anatomical norms , other regions in the same image set , and corresponding regions in related image sets .
telemedicine , and recently e - health , are the names of telecommunication tools , which are able to improve the equitable access to healthcare .
the ability of telemedicine to facilitate medical care , irrespective of distance and availability of medical specialists on site , makes it attractive to the healthcare sector .
telemedicine promises to enhance continued on - the - job medical training of doctors , nurses , and other healthcare practitioners in rural areas , and this perspective is extremely useful for all developing countries .
telemedicine is defined as the practice of medicine at a distance , where a messenger carrying over a medical advice from a distant expert to the bed of a patient .
the physicians and health care organizations are therefore able to guarantee high - quality care , without the patient having to travel and being carried over long distances .
effectiveness of the telemedical systems could be seen especially in demanding diagnostics ( cancer disease ) where distance is an important factor in patient treatment ( radiotherapy ) .
radiotherapy is one of the most effective forms of cancer treatment , undergone by roughly a third of all cancer patients .
once cancer has been diagnosed , patients generally have three fundamental treatment alternatives : surgery , radiotherapy , or chemotherapy .
none of these options is particularly comfortable , and they each have positive and negative aspects .
radiotherapy is the only choice in certain cases , such as fast - growing tumors , in the postoperative treatment of breast or lung cancer , some prostate types and many others , where radiotherapy is often used to prevent the regrowth of malignant tissue .
the scope is on the one hand the virtualization of the complete treatment planning procedure ( to deal with the digital patient data rather than the real patient ) , on the other hand to make the virtual patient available on different sites than those of its physical location and therefore allow telematics cooperation of radiooncology centers .
the first fact will mainly increase efficiency of personnel and accuracy ( quality ) of treatment , while the second will mainly reduce costs by allowing virtual sharing of extremely expensive devices as well as remote expert assistance / service . although system demonstration will be based on a worldwide commercially available radiotherapy planning system which will extend its efficiency by adding telematics components , mainly based on generally available networks ( internet , isdn , phone lines ) .
the main efforts will be entirely focused on developing the innovative telematics tasks and implementing these on existing professional and commercially available technology .
due to the availability of telematics components expensive devices such as ct ( computed tomography ) scanners will become virtually available to hospitals without such devices physically present .
in addition , remote experts can generate the treatment plan of a patient and/or validate plans of their colleagues on - line ( consultation conference ) or off - line ( desktop system ) .
powell iii states that telemedicine programs can help patients in remote areas being cared at their duty station , when they might otherwise have traveled for care . as a result
there is an increase in appropriateness of consultation request , improved access to care , enhanced provider education , and higher customer satisfaction .
to generate views from different anatomical structures contained in ct data sets or to perform treatment planning techniques , it is essential ( 1 ) to extract the corresponding data from the image and ( 2 ) to accurately define the target volumes as well as the organs at risk for the treatment outcome ; both methods can be done via segmentation process .
the first fact will mainly increase efficiency of personnel and accuracy ( quality ) of treatment , while the second will mainly reduce costs by allowing virtual sharing of extremely expensive devices as well as remote expert assistance / service .
the main efforts will be entirely focused on developing the innovative telematics tasks and implementing these on existing professional and commercially available technology . in order to make possible the data transference ,
aim of the platform is the collaboration between doctors and/or citizens located in countries with different health care systems , different technology infrastructure , and different needs , in order to enhance the quality of health care services and the equal access to the health care systems . through the platform
will be possible the efficient handling of patients with chronic diseases , the early response to emergency incidents , and the reduction of human lives losses . based on the system platform users are able to perform online and offline medical consultations .
in addition to the given possibilities telemedical systems offer the following features : ( 1 ) sending and receiving of multimedia messages with text , image material , and audiomessages , over internet , isdn and analog phone line in offline and online mode .
( 2 ) graphical and textual annotations and pictograms can be added to the images .
( 3 ) in the online mode interactive communication via usage of a chat window , mouse , exchanged images , and a consolidated screen view is possible .
support of the operation in a telemedicine center and consultation clients through a client - server database all image of the patient and message - information will be stored constantly .
the principle of the online teleconsultations is to bring two geographically distanced doctors together in an online session . during that session
, both doctors will have the same view on the images and can communicate through additional communication features like chat , annotations , and so forth . in that way , expert knowledge and advice is provided to doctors in rural and crisis situation areas , or simply to any doctor in the field , who needs help in diagnosing a clinical case and do not want or is not able to send the patient to the expert physically ( figure 1 ) .
extended examples of telemedical systems are described and illustrated in [ 6 , 7 ] .
these systems have the ability to generate 2d and 3d images using only the original ct data of the patient .
multiplanar reconstructions ( mpr ) can be generated in real time in the orthogonal , coronal , and sagittal directions , and any oblique direction .
the 3d reconstructed images are a must in ct - sim systems in order to simulate the patient anatomy and the images generated from the real simulator or the treatment machine .
the first layout contains four windows and the displayed images are the beam 's eye view ( bev ) , the observer 's eye view ( oev ) and the room view ( rm ) , together with the axial slices .
the second layout is composed again of four windows , containing the three orthogonal slice directions and the oev .
this layout is ideal for navigation through the ct volume , for volume delineation and to observe complex radiation field arrangements .
this layout has six windows emphasizing the size of the bev image , since the physicians feel comfortable working with this image . in both rendering views , oev and bev
the important rtp imaging is the dynamic x - ray image on the simulator monitor , which is generated from the viewpoint of the beam source , called beam 's eye view ( bev ) image , see the bev view direction in figure 5 . in the system the corresponding window , called the bev window , displays the interactive drr images . through the bev window
, the physicians can investigate the patient anatomy in the drr image as they observe it on the simulator monitor .
observer 's eye view ( oev ) window visualizes the patient from the room 's eye view , which is the same view as the physicians observe the patient in the simulator room , see the oev view direction in figure 5 .
as we explained before , all of the images in both bev and oev windows are generated with the patient ct scan by the direct volume rendering ( figure 2 ) .
the system can use large amounts of data , from 40 up to 300 slices , in order to produce high - quality anatomical images .
it enables reading of ct data , acquired not only with a single slice ct scanner ( such as a siemens somatom plus 4 ) , but also multislice data ranges , acquired in this study with four slices ( somatom volume zoom ) .
it can be connected via network directly to any ct scanner that supports dicom protocol .
the system allows the adaptation to any linac configuration through a machine configuration module that is designed according to the international standard for radiotherapy equipment ( iec 1217 ) .
this configuration involves limitation on movements of the mechanical component and description of the component 's dimensions ( e.g. , multileaf collimator , or mlc ) . instead of the presence of the physical patient 's body ,
a virtual patient 's body as well as the vs machine is displayed , which is called the simulator window . through the simulator window
, the physicians can investigate the movements of the machine as they observe it through the lead glass in their simulator operation room ; see the sim view direction in figure 3 .
the effect of the radiotherapy treatment is based on the precise delivery of high irradiation dose on the tumor site without damaging the surrounding healthy tissues .
therefore patient positioning , target volume definition , and irradiation field placement are very critical steps while planning the irradiation process
. one of the significant technological advances in radiotherapy in the past 20 years is the implementation of ct or virtual simulators ( vs ) , in the clinical routine .
first proposed the concept , often termed ct - sim to distinguish it from sim - ct where a simulator is modified for ct use and by the late 1990s several designs and clinical assessments of ct virtual simulators have been reported [ 815 ] . using vs ,
the clinical routine is modified accordingly ( figure 4 ) [ 16 , 17 ] .
transfer ct data to vs. the physician defines the tumour volume and the organs at risk and she / he will place the necessary fields relative to the tumour volume .
the simulation plan and the ct data are transferred via dicom ( digital image and communication in medicine ) server to the tps for dose calculation and final treatment plan optimization . verify patient position on linac before irradiation .
perform treatment on the treatment machine ( linear accelerator or linac ) . during the images ' transferring in teleradiology important factor for effective diagnosis
volume rendering is the technique according to which a scalar field of data with discrete values , volume data , is selectively sampled in order to generation a useful image in relation to the sampled values .
a volume data set is typically a set of discrete samples of one or more physical properties in a limited object space .
a volume data set is typically a set of discrete samples of one or more physical properties in a limited object space , v(x ) , x rn , in which { x } is a set of sampling points ; n is the dimension of the sampling space , usually n = 3 , that is , 3d volume data ; v represents the sampling values , it can be a single - valued or multivalued function . according to the distribution of sampling points ( i.e.
, the structure of x ) , volume data sets are classified into structured and unstructured data sets . in medical imaging , volume data is usually a structured data set , typically organised as a stack of slices ; v can be single valued ( e.g. , the ct hounsfield value ) or multivalued ( e.g. , density , t1 , t2 in mri ) .
the resulting data structure is an orthogonal 3d array of voxels , each representing a sampling value .
the rendering methods which are proposed in this work are based on the work of .
( 1 ) transparent mode : digitally reconstructed radiographies ( drr ) with general energy exponential equation :
( 1)i(s)=i0exp(dk(t)dt ) ,
where k is the attenuation coefficient and is the wavelength in distance d ; ( 2 ) surface reconstruction mode : isovalue , gradient and semitransparent with general energy form :
( 2)i(s)=dc(t)(t)t(t)dt ,
where c(t ) is the shading intensity at point t , is the opacity , and t(t ) is the accumulated transparency from 0 to point t in distance d. drr images generated from ct digital volumes are often called using the term digitally reconstructed radiographs ( drrs ) ( figure 5 ) . to reconstruct a drr
each voxel acquired using ct has a value that is called the hounsfield unit upon the name of the father ct .
the hu can be estimated using the following formula ( 3 ) :
( 3)hu=(water)water1000 ,
where , water are the attenuation coefficient of the material for the specific voxel and the water , respectively .
when on the above equation one replaces the m = water , then will receive a huwater = 0 .
the hounsfield units have no upper limit but usually for medical scanners a range between 1024 to + 3071 is provided . apparently 4096 different hu values are provided and therefore to illustrate the complete range of the hu on a volume 12-bit voxels are required .
probably the most common methods for reconstructing surfaces directly from voxels are the gradient surface and isosurface model .
this rendering model is widely used in almost all medical data sets to render the surface detected by the gradient operator .
levoy presented this concept , which is effectively used in most medical imaging applications for the last decade .
depending on the data set size and on the size of the resulting 3d image , which influence the number of rays , a 3d view image can be calculated almost in real time ( 0.8 sec to 2.3 sec ) . before applying any visualization routine the beam and block polygon
are rotated and translated so as to achieve the appropriate orientation relative to the ct data .
the common visualization of beam , block polygons , and the ct data is achieved using a 3d scan - line conversion algorithm .
for the 3d visualization of the polygon , the depth value of the point plane is compared with the depth information of the surface z - buffer that is calculated by the volume - rendering pipeline .
if the depth value of the point plane is closer to the spectator than the calculated surface position , then the original pixel value is mixed with the point plane color value ( figure 6 ) . if zv(i , j ) is the function during the volume rendering process .
if one compares the current edge z - depth zp(i , j ) with the value of the image z - buffer then could make the following two assumptions .
if zp(i , j ) < zv(i , j ) then the current polygon edge is behind the volume and is hidden from the viewer . in this case
no value for the light mask is accumulated . if zp(i , j ) > zv(i , j ) then the current polygon edge is in the front of the volume and is visible from the viewer . in this case
accurate segmentation is required for volume determination , 3d rendering , radiation therapy , and surgery planning .
traditionally , image segmentation denotes the technique of extraction of image entities or structures ( regions or objects ) , so that the outlines of these structures will coincide as accurately as possible with the physical 2d object outlines [ 22 , 23 ] .
an object region is a set of image pixels , which are similar with respect to a homogeneity criterion such as texture .
a problem that occurs is that images either over - estimated , with objects divided into parts or images are incorrectly segmented , with or without more objects segmented as one object .
we will present an effective semiautomatic method , based on the boundary tracking technique , which improves the time when one or more structures are in use .
the implemented algorithms can segment within a few seconds the complete volume of specific organs , for example , lungs , skin , and spine .
the only interaction of the user is to select the starting point in the region of interest and the algorithm will track the object boundaries in 3 dimensions . the segmentation process might involve complicate structures and in this case usually only an expert can perform the task of the identification manually on a slice - by - slice base .
humans can perform this task using complex analysis of shape , intensity , position , texture , and proximity to surrounding structures .
of course , all these features are differently qualified depending on the experience of the user . to perform a similar procedure automatically using a computer since today
in other cases where simpler anatomical regions with a very distinguishable shape must be identified an algorithm can perform this task .
currently there are only dedicated algorithms for different regions of the human body . to generate a
complete , with a general meaning of the term , segmentation application numerous tools and algorithms must be combined .
image segmentation approaches may be performed in one of three ways : ( 1 ) completely manual : an operator with proper training draws the required boundaries manually , using a mouse or other pointing devices .
this requires expert knowledge of the operator and skills in drawing boundaries with available tools .
it will pose a serious problem when the size of data sets grows , ( 2 ) fully automatic : the current available techniques , such as thresholding or region growing are not sophisticated and robust enough for our application .
the use of these techniques is therefore restricted to simple boundaries and requires high image quality , and ( 3 ) semiautomated : this method uses boundary finding results generated by sophisticated automatic algorithms as initial guess , and then allows an operator to edit the required boundaries manually .
this method still requires expert knowledge of the operator , but reduces the time and effort needed .
the differences in these types of interaction are the amount of time and effort required , as well as the amount of training required by an operator .
even automated segmentation methods typically require some interaction for specifying initial parameters that can significantly affect performance .
linear interpolation is one of the simplest methods where linear interpolation between contours is the first approach used to provide an acceleration tool for the manual contouring .
the mechanism of the linear interpolation is applied when between the key contours at least one slice exists . to perform the linear interpolation
we create triangles between the contour points of the key contours as described in sakas . for this operation
the interpolated contour points are created after calculating the intersection of each triangle side with the intermediate slice ( figure 7 ) .
after the definition of the organ boundaries for a given 2d shape , a surface reconstruction of the 3d data defining anatomical structures must be defined .
linear interpolation between key slices is a very common approach used in rtp process to accelerate target volume definition . to overcome the problem with local discontinuities when
one contour every time is considered , a linear interpolation technique based on surface rendering is applied using information from the triangulation of the 3d shape .
surface rendering is a process in which apparent surfaces are produced from the data volume and an image of the extracted surfaces is suitably visualized .
surface contours are modelled with bidimensional primitives , as triangles or polygons , in order to represent a 3d object .
the basic idea is to extract a surface from the 3d data volume as a collection of adjacent polygons and to visualize the extracted surface by appropriate algorithms .
the triangulation approach is described as in figure 7 : contours defined on two adjacent slices are divided into the same number of equiangular sectors .
the points corresponding to sector neighbours are connected by obtaining a series of triangles that will define the surface .
the marching - cube algorithm works on a 3d mask that defines the object of interest obtained by a threshold - based or a more complex segmentation algorithm ( figure 8) .
semiautomatic segmentations methods combine the benefit of bath manual and automatic segmentation techniques . by supplying initial information about the region of interest ,
any remaining errors introduced by automatic segmentation methods may be corrected by manual editing . in this work , a boundary tracking algorithm [ 2630 ] was implemented for the segmentation part .
boundary tracking technique ( bt ) is a segmentation method that given one point along a region 's boundary follows the boundary around the region until it returns to the original point . assuming a constant boundary
, this allows for considerable variation within the region without any effect on the segmentation .
the advantage of the approach is that no assumptions are needed to be made a priori about the boundary shape , which may vary from a straight line too much more complex shapes which are difficult to parameterize .
first let us assume that the image with regions is either binary or that regions have been labeled using a specific threshold ( white for the organ of interest , black for the background ) .
the algorithm traces the edges with detail providing high accuracy to the description of the contour shape ( figure 9(a ) ) .
image - smoothing techniques are used in image processing to reduce noise . usually in medical imaging
the noise is distributed statistically and it exists in high frequencies ; therefore , it can be stated that image smoothing filters are low - pass filters .
the drawback of applying a smoothing filter is the simultaneous reduction of useful information , mainly detail features , which also exist in high frequencies .
the basis for the filtering operation is the convolution operator , where a k k matrix known as the kernel or mask is introduced by a general form :
( 4)wij=[w11w12 w1kw21w22 w2k wk1wk2 wkk],fij=[f11f12 f1kf21f22 f2k fk1fk2 fkk ] ,
where f is the original image . the convolution process is defined by g = w f. the convolution filter with the mask can also be used to find contours inside an image ; especially in volumetric and surface processing .
it is the first step of contouring detection , where the kernel isolates the part of the image where edges appeared ( large steps , rapidly changes ) .
after segmenting the regions of interest , a 3 3 sobel edge detection operator ( figure 9(b ) ) is used to improve the appearance of the contours . in the analysis of the objects in images
it is essential that we can distinguish between the objects of interest and the rest .
the techniques that are used to find the objects of interest are usually referred to as segmentation techniques segmenting the foreground from background .
image thresholding is a technique for converting a grayscale or color image to a binary image based upon a threshold value .
if a pixel in the image has intensity less than the threshold value , the corresponding pixel in the resultant image is set to white . otherwise , if the pixel is greater than or equal to the threshold intensity , the resulting pixel is set to black . for that purpose ,
a low - pass filter was used based on the rectangular window or box function based on the rule :
( 5)i(i , j)={1,if i(i , j)tobject,0,otherwisebackground ,
where i(i , j ) is image matrix and t is the appropriate threshold .
object or background which , due to its dichotomous nature , can be represented as a boolean variable 1 or 0 .
while there is no universal procedure for threshold selection that is guaranteed to work on all images , there are a variety of alternatives . for this case
a histogram - derived threshold was chosen based on the image histogram combined with hounsfield unit tissue values . to overcome the problem with the increasingly high number of points , that are reconstructing the contour , a point decimation algorithm ( or sequence sampling algorithm )
was used to reduce the number of points without loss of their general presentation . if a sequence of numbers was given , s = { s1 , s2 , s3 , ,
si1,si , si+1 , , sn } , then the main idea is to construct another sequence s * , where k%-values would be removed from the original sequence . summarizing the above procedures , the pseudocode for the segmentation technique is presented in algorithm 1 .
the main drawback of the method is that it is a binary approach and hence is very sensitive to gray value variations .
if the threshold value is not selected properly then the system will fail to detect the appropriate organ shape .
most of the inaccuracies of the segmentation method require the user intervention to optimize the result . to overcome the limitation
we calculate a secondary opacity volume from the original ct data based on the well - known approach from , that is very often used to visualize surfaces from scalar volume data in volume rendering . for the lungs segmentation
, two regions would be investigated : ( a ) concave and ( b ) convex . for the convex regions
the algorithm requires an initial point to start the tracing of the edge of the object under investigation .
the initial point travels to the vertical or horizontal direction until the edge of the investigated object is reached .
then the algorithm will start to exam the surrounding pixel of that edge and check whether they belong to the current edge or not .
for the concave regions a different approach was achieved implementing a two moving position methods based on where the starting point appears : ( i ) outside point and ( ii ) inside point .
the algorithm uses a constant threshold selection with levels 20 to 70 hounsfield values .
outside pointconsidering the case where the object is concave and a starting point was given , extended experiments indicate false segmentation alarms , when the starting point remains at the same position for all the slices ; to overcome this , a region growing technique ( grey color ) was applied to find the first white region inside the organ ; a region growing approach ( green color ) was used , to avoid undesired results in case the point position was moved at the edge of the region .
considering the case where the object is concave and a starting point
was given , extended experiments indicate false segmentation alarms , when the starting point remains at the same position for all the slices ; to overcome this , a region growing technique ( grey color ) was applied to find the first white region inside the organ ; a region growing approach ( green color ) was used , to avoid undesired results in case the point position was moved at the edge of the region .
the region - growing ( rg ) algorithm is used very often in the region - based segmentation techniques and has been successfully incorporated into several medical imaging applications for the extraction of organ volumes . in this work
we follow a simple design principle since the region boundaries that must be detected have low complexity and high contrast differences with the surrounding tissues .
the rg algorithm is initiated with a seed voxel selected manually , which is known to be a part of the voxel of interest , room air or skin surface .
if the difference in grey level is between the voxel under investigation and its six adjacent voxels are less than a given threshold , then the current voxel is merged with the growing region .
this process is repeated recursively to grow the object until not more voxels can be found .
the starting point changes and the boundary tracking technique continue as before ( figure 10 ) .
inside pointconsider now the case where the starting point is inside the lung region and close to the area of high tissue ( small white spots ) . in this case using the original method , the tracking technique probably will spot ( for some slices ) the white areas avoiding the bigger lung region .
extended experimental results suggest that these regions have maximum area close to 6 cm : if the object is smaller than 6 cm then it is removed and the process continues until a larger region corresponds to the overall lung area is found . with this restriction
consider now the case where the starting point is inside the lung region and close to the area of high tissue ( small white spots ) . in this case using the original method , the tracking technique probably will spot ( for some slices ) the white areas avoiding the bigger lung region .
extended experimental results suggest that these regions have maximum area close to 6 cm : if the object is smaller than 6 cm then it is removed and the process continues until a larger region corresponds to the overall lung area is found . with this restriction
the method avoids to segment areas that are meaningless ( figure 11 ) . for visualizing volumetric medical data , sequences of 2d images
are piled up to recreate the three - dimensional structure ( figure 12(a ) ) .
usually , in this step linear interpolation of adjacent slices is needed for the generation of new slices ( figure 12(b ) ) , since one of the problems resulting from image acquisition is the space between slices .
this problem occurs because the sampling interval between slices is normally greater than the generated image resolution , and then the volume voxels are not cubic .
after interpolation this size distortion is corrected , so that the visualization algorithm could generate correct proportion projections . assuming a simple 1d example of sampling points linear interpolation offers first - degree connectivity among the sampling points , passing a straight line through every two consecutive points of the input signal . in the spatial domain , linear interpolation ( ln ) is equivalent to convolving the sampled data with the following interpolation kernel ( 6 ) :
( 6)h(x)={1|x|,when 0|x|1,0,when 1|x| .
the above interpolation kernel corresponds to a reasonably good low - pass filter in the frequency domain . in practice
we can define the linear interpolation between two points p0 , p1 in one dimension as follows ( 7 ) :
( 7)px=(1x)p0+xp1px = p0+x(p1p0 ) .
in two dimensions the interpolation scheme will involve four data points ' p00 , p01 , p10 , and p11 .
the interpolation can be formulated using the following formula ( 8) :
( 8)pxy=(1x)(1y)p00+(1x)yp01 + x(1y)p10+xyp11 .
this interpolation method is known as bilinear interpolation and is commonly applied on image interpolation for example , when magnifying raster images . in volumetric data
linear interpolation is known as tri - linear interpolation and estimates the value of the result voxel considering the neighbourhood of eight ( 8) voxels ( p000 , p001 , p011 , p010 , p100 , p110 , p101 , and p111 ) ( figure 13 ) with estimation formula for pxyz ( 9 ) :
( 9)pxyz=(1x)(1y)(1z)p000+x(1y)(1z)p100 + xy(1z)p111+(1x)y(1z)p010 + ( 1x)(1y)zp001+x(1y)zp101 + ( 1x)yzp011+xyzp111.figure 14 illustrates different 2d and 3d reconstruction examples of segmented structures .
figure 15 illustrates examples where volume segmentation techniques and bean object reconstruction using z - buffer methodology are applied . to assess the effectiveness of the methods and its sensitivity , the following measures are considered : ( 1 ) area of a contour in cm , ( 2 ) periphery of a contour in cm , ( 3 ) computational time in sec and ( 4 ) number of points for the contours drawing .
table 1 illustrates the performance of the segmentation methods for various slices using the manual , the proposed method , and the proposed method after the point decimation process .
target volume and critical structure definition is a complex and time - consuming process in radiotherapy : although the complexity varies for different anatomical sites . in ct - sim and plan evaluation ,
the physicists and radiation oncologists interact closely to subjectively identify the plan most appropriate for the individual patient . in order to reduce the investment of time and effort by the radiation oncology staff ,
these systems thus allow the user to draw contours around the tumour as target [ ptv ] and around normal tissues and organs of interest on a slice - by - slice basis .
this provides at the same time , a cross - reference to planar images . organs with large differences in their radiation dose distributions can be segmented semiautomatically . in terms of user effort
the only action required from the user is the selection of a starting point for the algorithm on the original axial slices .
performance analysis of the system is taking place where the experiments are performed on a double processor ( 2xpentium iii 450 mhz ) pc with physical memory 512 mb .
for each view we performed time measurements for several rendering image sizes using different data resolution .
the goal of this experiment is to examine the volume rendering interactivity as well as to prove the effectiveness of the system for large amount of data .
a comparison for the system memory relative to different amount of data is presented in figure 17 .
important is that a pc with 512 mb physical memory can manipulate up to 300 slices with a rendering speed for transparent mode between 1.2 and 1.8 seconds and for the surface mode between 0.6 and 0.9 seconds .
accuracy of the system is very important for the system implementation especially for the investigation of ( 1 ) ct volume data orientation and ( 2 ) treatment parameters , including table translation , gantry , collimator , and table rotation , reference point placement , beam , and block size . commonly slices thickness between 3 mm to 5 mm and total number of slices maximum to 120 slices are used to implement segmentation analysis or radiotherapy treatment planning dose
. a cubic phantom of size 120 120 mm was initially used to exam the accuracy of the system . inside the phantom spheres of diameter 2 mm
the total number of produced slices was 120 , in square ct matrices of 512 512 pixels .
the accuracy of the routines automatic field and block adaptation is related to the resolution of the bev image ( figure 18 ) . in most cases
the bev image has the size of 256 256 up to 400 400 .
ct - sim is a technological advance that has already been tested in our clinical environment with demonstrable advantages particularly for complicated field arrangements .
the new , innovative virtual simulator system is a very useful additional tool for the radiation oncologist and makes the requirement for a conventional x - ray simulator redundant .
a significant advantage of the software is that it can run on portable computers such as laptops .
the system can be integrated immediately into the clinical environment via a direct interface to the ct scanner .
combination of different diagnostic ( e.g. , mr and pet ) and radiotherapy ( e.g. , mv portal detectors ) imaging modalities will make the ct - sim an even more effective tool in radiotherapy .
this technology could be combined with telemetrically techniques for the improvements of health services telemedicine applications are largely image - based .
the main purpose of this work is to represent an efficient interactive , easy - to - use medical system that provides modules for online and offline collaboration of medical doctors together with software products .
moreover new improvements for the system starts to be implemented based on telemedical applications ( this work is under development ) where an online mode gives the opportunity to communicate over far distances with a given partner in real time . in this case
both partners look at the same image material and through text messages ( chat window ) and transferred mouse actions to the remote pc , they can discuss interactively over a medical case .
the system combines low price , low weight , mobility , and a wide range of nonradiating examinations . as a result
the proposed platform reduces the disparity in the level of medical services , between the main centers and the less assisted areas , contributing to improvement of the quality of life . | telehealth is the exchange of health information and the provision of health care services through electronic information and communications technology , where participants are separated by geographic , time , social and cultural barriers .
the shift of telemedicine from desktop platforms to wireless and mobile technologies is likely to have a significant impact on healthcare in the future .
it is therefore crucial to develop a general information exchange e - medical system to enables its users to perform online and offline medical consultations through diagnosis . during the medical diagnosis
, image analysis techniques combined with doctor 's opinions could be useful for final medical decisions .
quantitative analysis of digital images requires detection and segmentation of the borders of the object of interest . in medical images ,
segmentation has traditionally been done by human experts .
even with the aid of image processing software ( computer - assisted segmentation tools ) , manual segmentation of 2d and 3d ct images is tedious , time - consuming , and thus impractical , especially in cases where a large number of objects must be specified .
substantial computational and storage requirements become especially acute when object orientation and scale have to be considered .
therefore automated or semi - automated segmentation techniques are essential if these software applications are ever to gain widespread clinical use .
the main purpose of this work is to analyze segmentation techniques for the definition of anatomical structures under telemedical systems . | 1. Introduction
2. Motivation
3. Telemedical Platform
4. Radiotherapy Treatment Planning (RTP)
5. Segmentation Techniques
6. Volume Definition
7. Conclusions |
in 1971 , fontan and baudet first described a palliative surgery for patients with tricuspid atresia .
it revolutionised the management of patients with complex congenital heart disease characterized by a single functional ventricle .
we describe the anaesthetic management of a 12 year - old girl who had fontan physiology and right hemiparesis , for botox injections , managed under general anaesthesia .
a 12 year - old girl weighing 41 kg was posted for botox ( botulinum ) injections and casting for spasticity of the right upper limb .
she gave history of having some heart disease since birth for which multiple operations had been done .
on going through her past medical records , it was found that she was born with complex congenital heart disease , having dextro - transposition of great arteries , double outlet right ventricle , pulmonary stenosis , and a large ventricular septal defect .
she underwent a right subclavian to right pulmonary artery shunt shortly after birth , a glenn operation at 4 months of age , and an extracardiac fontan operation ( total cavopulmonary conduit ) at 5 years of age .
computed tomography ( ct ) brain showed left middle cerebral artery ( mca ) thrombosis due to which she had developed right hemiparesis .
the hemiparesis improved gradually and she developed spasticity of the right upper and lower limbs .
she had developed pedal edema a few months earlier , due to an element of protein losing enteropathy , which was treated with diuretics and high protein diet .
she gave history of no cardiovascular ( cvs ) complaints at the time of admission , and was regular in her studies and daily activities .
she was on treatment with tablet warfarin 5 mg and tablet furosemide 20 mg once a day . on examination , she was conscious , oriented , well nourished .
she was afebrile , pulse was 82 beats / minute and regular , blood pressure was 102/66 mm hg .
investigations revealed haemoglobin of 11.2g / dl , total and differential white blood cell counts were normal .
renal function tests , serum electrolytes , liver function tests including serum proteins were within normal limits .
echo showed patent functioning cavopulmonary shunts , mild ventricular systolic dysfunction , no thrombi / vegetations .
she was advised to withhold warfarin and switch over to a low - molecular weight ( lmw ) heparin 5 days prior to surgery .
infective endocarditis prophylaxis was given with iv ceftriaxone 1 g 1 hour prior to the procedure .
it was decided to give general anaesthesia since the patient was very apprehensive and insisted on it .
patient was taken to the operation theatre , monitors were attached ( ecg , pulse oximeter , capnograph , non - invasive blood pressure monitor ) .
an infusion of lactated ringer 's solution was started and she was preloaded with around 200ml .
preoxygenation was done for 5 minutes and anaesthesia was induced with iv fentanyl 80 mcg and propofol 80 mg iv slowly and maintained with sevoflurane 0.6 - 0.8% in 50% nitrous oxide in oxygen , on spontaneous ventilation with intermittent assist .
patient received 300ml ringer 's lactate intraoperatively , and the procedure lasted 30minutes . at the end of surgery ,
once awake , responding to oral commands and stable , patient was shifted to the recovery room for monitoring .
she was shifted to the ward after an hour and had an uneventful post operative period .
prior to the development of the fontan procedure , pulmonary blood flow in patients with single ventricle and pulmonary stenosis was surgically augmented by means of systemic to pulmonary artery shunts .
these shunts improved life expectancy remarkably in the short term , but survival past the second decade remained unusual . in 1971 , fontan and baudet , and in 1973 , kreutzer et al .
it involved diverting systemic venous blood from the right atrium to the pulmonary arteries , thus bypassing the right ventricle .
it was then used for treating a number of complex congenital heart lesions with a single effective ventricle . in fontan physiology , systemic venous blood from the great veins
oxygenated blood then drains into the left atrium and then into the single ventricle that empties into the systemic circulation .
the difference between central venous pressure and systemic ventricular end - diastolic pressure ( termed the transpulmonary gradient ) is the primary force promoting pulmonary blood flow and , more importantly , cardiac output .
since intravascular volume is the main determinant of central venous pressure , hypovolemia is poorly tolerated .
thus , the main determinants of the fontan circulation are systemic venous pressure and volume , pulmonary vascular resistance , cardiac rhythm and left ventricular function . a disturbance in any of these compromises the cardiac output
. complications in post - fontan surgery patients include arrythmias , thromboembolism , protein losing enteropathy , and ventricular dysfunction .
propofol , with its transient systemic vasodilatation , is usually less problematic , as long as normovolemia is maintained.etomidate , with its cardiostable property would be the best drug for induction is these patients .
hypercarbia , hypoxia , inadequate analgesia , and acidosis should be avoided as they will lead to an increase in pulmonary vascular resistance , decreased pulmonary blood flow and thus decreased cardiac output . for short procedures ,
controlled mechanical ventilation leads to increase in intrathoracic pressure which decreases venous return , in turn causing decreases pulmonary blood flow , and hence , decreases cardiac output .
epidural anaesthesia has been successfully employed in such patients.[1012 ] postoperatively , good analgesia has to be ensured . for more painful surgeries , continuous catheter techniques , epidural analgesia and patient controlled analgesia
normovolemia needs to be maintained , and hypercarbia , hypoxia and acidosis should be avoided . | fontan procedure is a palliative surgery done for patients born with single ventricle physiology .
an understanding of the hemodynamic alterations in such a patient is important for successful perioperative management .
we have discussed the anaesthetic considerations in a 12 year - old girl with complex congenital heart disease ultimately palliated by a fontan operation , who was posted for botox injections for upper limb spasticity under general anaesthesia . | INTRODUCTION
CASE REPORT
DISCUSSION
CONCLUSION |
obesity is one of the most serious and urgent public health problems in western societies because of its metabolic and cardiovascular complications that negatively impact on life expectancy . equally alarming
is the increase of morbid obesity ( bmi 40 kg / m ) that quadrupled over the last decade , whereas extreme obesity ( bmi > 50 kg / m ) increased fivefold .
bariatric surgery , also known as metabolic surgery , has emerged as a highly effective and long - lasting treatment in patients with morbid obesity and in those with bmi 35
kg / m in the presence of type 2 diabetes ( t2 dm ) and other comorbidities .
there is extensive evidence that bariatric procedures , including biliopancreatic diversion ( bpd ) , gastric bypass ( gbp ) , and gastric banding , can successfully control most of the obesity - related comorbidities , such as hypertension , dyslipidemia , and t2 dm .
the rate of success is higher with the predominantly malabsorptive and mixed malabsorptive - restrictive procedures than purely restrictive operations .
laparoscopic sleeve gastrectomy ( lsg ) is emerging as a new promising therapy for the treatment of morbid obesity .
this procedure , originally conceived as a first stage for achieving weight loss in superobese patients before performing gbp or bpd , has revealed to be effective on its own and a potential competitor with these operations . in fact , lsg has the advantage to be less invasive than gbp and bdp , and not inferior in terms of sustained weight loss , as demonstrated in some preliminary studies .
few studies have examined the effects of lsg on glucose control and comorbidities in obese t2 dm patients , and limited information is available on the long - term efficacy of this procedure [ 79 ] .
therefore , in the present study we assessed the medium - term ( 915 months ) effects of lsg on body weight and glucose homeostasis in severely obese t2 dm subjects not adequately controlled with medical therapy .
in addition , we evaluated the impact of lsg on other pathological conditions linked to obesity , that is , hypertension and dyslipidemia .
the study was conducted at the department of surgery , s. giovanni bosco hospital , naples and at the department of clinical and experimental medicine , federico ii university , naples .
a total of 25 obese t2 dm subjects ( 10 m/15 f , age 45 9 years , bmi 48 8 kg / m , m sd ) underwent lsg surgery .
all patients were examined by a multidisciplinary and integrated medical team consisting of a diabetologist , a bariatric surgeon , a psychiatrist , and a dietician .
the inclusion criteria were as follows : age 3565 years , bmi 35 kg / m , duration of diabetes > 1 year .
exclusion criteria were age < 35 years or > 65 years , bmi < 35 kg / m , fasting c - peptide level < 1 ng / ml , endocrine obesity , a history of medical problems such as mental impairment , drug or alcohol addiction , recent major vascular event and excessive surgical risks due to debilitating diseases that considerably impair life expectancy according to perioperative bariatric guidelines .
all patients underwent complete evaluation before and at 3 and 915 months after surgery including anthropometric / clinical parameters and laboratory tests .
insulin - resistance was evaluated by the homeostasis model assessment of insulin resistance ( homa - ir ) index using a standard formula : fasting insulin ( u / l ) fasting glucose ( mmol / l ) divided by 22.5 .
the first step consists in opening the gastrocolic ligament attached to the stomach , usually starting 1012 cm from the pylorus toward the lower pole of the spleen .
then the gastric greater curvature is freed up to the cardiooesophageal junction close to stomach sparing the gastroepiploic vessels .
meticulous dissection is performed at the angle of his with full mobilization of the gastric fundus .
the mobilization of the stomach continues dissecting the greater gastric curve toward the antrum up to 35 cm from the pylorus . at this time
a 40-fr orogastric tube is inserted direct toward the pylorus , proximal to the lesser curvature of the stomach .
then , the stomach is resected with linear staplers parallel to orogastric tube along the lesser curve starting 35 cm far from pylorus .
the orogastric bougie is replaced by a nasogastric tube that is positioned in the distal stomach to perform a methylene blue test .
the transection line is inspected to search blue positivity . in case of negative test , the resected stomach is removed by left midabdominal trocar usually without prolonging incision .
remission of t2 dm was defined as fasting plasma glucose below 126 mg / dl and hba1c below 6.5% in the absence of hypoglycemic treatment .
remission of hypertension was defined as blood pressure below 140/90 mmhg in the absence of antihypertensive treatment ; remission of dyslipidemia was defined as fasting plasma ldl - cholesterol below 100 mg / dl and/or fasting plasma triglycerides below 190 mg / dl in the absence of pharmacological therapy .
anova with repeated measures was used to detect changes over time of the anthropometric and biochemical variables .
paired student 's t - tests were used to compare data before and after surgery .
all statistical analyses were performed using spss version 13.0 ( spss inc . , chicago , il ) .
all patients had a duration of t2 dm > 1 year ( 3 2 years ) , and most of them ( 68% ) were in poor glycaemic control , as evidenced by hba1c > 7% .
two patients were on diet , twenty - one patients took oral hypoglycemic agents , and two were on combined therapy ( oral agents plus insulin ) .
twenty - one ( 84% ) patients were on antihypertensive therapy , and fourteen ( 56% ) patients received hypolipidemic drugs .
mean bmi decreased from the basal value of 48 8 kg / m to 39 8 kg / m ( p < .001 ) at 3 months and to 34 6 kg / m ( p < .001 ) 915 months after surgery .
percent excess weight was 81 42% at 3 months and 61 33% ) at 915 months compared to basal value ( 122 39% ; p < .001 for both ) . fasting
plasma glucose significantly decreased to 87 19 mg / dl 3 months after lsg and remained within the normal range at 915 months in all patients but one .
mean hba1c reached 5.9 0.6% at 3 months and remained unchanged at 915 months ( 5.8 0.7% ) ( p < .03 ) .
fasting plasma insulin declined significantly by 6887% following the intervention ( p < .005 ) . as a consequence homa - ir dramatically decreased by 86% ( p < .008 ) 3 months after surgery and remained stable thereafter ( 91% , p < .04 ) .
following surgery , all patients discontinued their hypoglycemic medications , and a full remission of t2 dm was achieved in 24 out of 25 patients .
eighteen patients discontinued antihypertensive drugs , and 12 patients discontinued hypolipidemic drugs at 3 months .
a major perioperative complication occurred in one patient who was admitted to intensive care unit for acute renal failure due to severe dehydration .
our study shows that lsg is effective in producing a significant and sustained weight loss and improving glucose homeostasis in severely obese t2 dm patients .
in fact , after 915 months from surgery all patients but one achieved a good glycemic control with discontinuation of hypoglycaemic treatment .
this finding is in line with previous studies demonstrating that diabetes resolution occurs in 6680% of patients undergoing lsg [ 711 ] .
although the mechanisms underlying t2 dm remission following lsg has yet to be fully determined , some human studies have reported favourable changes in insulin sensitivity [ 12 , 13 ] . in our patients , insulin resistance evaluated by homa index
decreased by 80% thus confirming previous data by abbatini et al . who demonstrated a near - normalization of insulin resistance measured by euglycemic clamp in patients treated with lsg .
the improvement in insulin sensitivity is primarily due to weight loss , reduction in inflammatory mediators , and decreased calorie intake although the contribution of weight independent mechanisms seems very likely .
potential mechanisms include enhanced stimulation of gastrointestinal hormones secondary to rearrangement of gastrointestinal anatomy . for malabsorptive / mixed procedures ( rygb and bdp )
relevant and rapid changes in the enterohormonal axis have been demonstrated , consisting of complete recovery of meal - stimulated response of glp-1 and gip .
these modifications , evident already a few days after surgery , may explain the rapid improvement of glucose homeostasis before substantial weight loss has occurred [ 14 , 15 ] .
the long - term evaluation of these patients has also shown that the recovery of incretin response is maintained over time , probably contributing to the recovery of beta - cell function .
regarding lsg , recent studies have shown that this procedure is associated with a marked reduction of ghrelin secretion , an orexigenic peptide produced by the gastric fundus involved in mealtime hunger regulation .
ghrelin is also known to exert several diabetogenic effects ( increase in growth hormone , cortisol , and epinephrine ) ; therefore its suppression could contribute to improved glucose homeostasis .
interestingly , we observed an increased meal - stimulated glp-1 and gip response in our patients at 3 weeks postoperatively , which may have concurred to amelioration of glucose metabolism ( unpublished observations ) .
none of the patients studied presented any sign of nutritional deficiencies at 915-month follow - up , confirming that lsg is a safe procedure in terms of nutritional status at odds with malabsorptive or mixed surgical procedures which often lead to multiple nutritional consequences due to the bypass of duodenum and jejunum . in conclusion , lsg induces stable weight loss and resolution of t2 dm diabetes and other obesity - associated comorbidities in a large majority of patients .
controlled long - term comparisons between different bariatric interventions are needed to establish the optimal procedure in relation to patients ' characteristics . | this study was undertaken to assess medium - term effects of laparoscopic sleeve gastrectomy ( lsg ) on body weight and glucose homeostasis in severely obese type 2 diabetic ( t2 dm ) subjects .
twenty - five obese t2 dm subjects ( 10 m/15 f , age 45 9 years , bmi 48 8 kg / m2 , m sd ) underwent evaluation of anthropometric / clinical parameters and glucose homeostasis before , 3 and 915 months after lsg . mean bmi decreased from 48 8 kg / m2 to 40 9 kg / m2 ( p < .001 ) at 3 months and 34 6 kg / m2 ( p <
.001 ) at 915 months after surgery . remission of t2 dm ( fasting plasma glucose < 126 mg / dl and hba1c < 6.5% in the absence of hypoglycemic treatment ) occurred in all patients but one . there was a remarkable reduction in the percentage of patients requiring antihypertensive and hypolipidemic drugs .
our study shows that lsg is effective in producing a significant and sustained weight loss and improving glucose homeostasis in severely obese t2 dm patients . | 1. Introduction
2. Methods
3. Results
4. Discussion |
similar results were obtained by ryan et al11 who diagnosed delirium in 17.6%19.6% ( depending on the method used ) of general hospital adult inpatients , with prevalence as high as 34.8% in patients older than 80 years .
multicomponent nonpharmacological interventions may reduce delirium incidents among elderly inpatients by up to 44%.12,13 as expected , discontinuation of certain medication reduced the incidence of delirium in elderly living in long - term care facilities.14 the 2015 american geriatrics society ( ags ) beers criteria recommend that elderly at high risk of delirium avoid medications such as anticholinergics , benzodiazepines , corticosteroids , h2-receptor antagonists , meperidine , and sedative hypnotics because of their potential to induce or worsen symptoms of delirium.15 knowledge of risk factors is essential for delirium prevention : dementia ; cognitive impairment ; prior delirium incident ; presence of functional , visual , or hearing impairment ; comorbidity or severe illness ; depression ; prior transient cerebral ischemia or stroke ; alcohol misuse ; and age 75 years are considered predisposing factors , while polypharmacy ; treatment with psychoactive drugs , sedatives , or hypnotics ; use of physical restraints ; use of bladder catheters ; presence of metabolic disorders ; infections ; surgeries ; trauma or urgent admission ; and coma are considered precipitating factors.5 however , risk factors for delirium may differ between treatment centers .
comprehensive geriatric assessment ( cga ) may be useful in predicting incidents of delirium.16 we performed an observational , prospective study to analyze the factors predictive of delirium in patients admitted to the geriatric ward , including cga results .
predictive models of delirium may be useful for identification of high - risk patients for proactive implementation of delirium preventive strategies and for determination of clinical trial eligibility .
delirium risk stratification may also be suitable for documenting estimates of hospital course and help propagate a better understanding of potential hospitalization outcomes for the patient and patient s family.5
this prospective observational study was performed in the department of geriatrics at university hospital no 7 sum uppersilesian medical center in katowice , poland , a subacute geriatric ward at a multiprofile university hospital .
all reported tests were performed according to clinical indications , and no test was performed in case of refusal by the patient or care giver .
no procedure exceeded beyond the scope of standard care in the ward . in 2013 ,
program was initiated by unit staff and approved by hospital management for use in the ward .
in addition to commonly accepted delirium prophylaxis strategies,6,17 this program added confusion assessment method ( cam),18 delirium - o - meter,19 and richmond agitation - sedation scale20 as additional delirium prevention methods .
implementation of the program was preceded by geriatrician - led staff training . primary analysis consisted of 788 consecutive patients aged 79.57.6 years
( xsd ) within a range of 60 to 100 years , among them 66% were women and 34% were men .
participants were admitted to the department of geriatrics at university hospital no 7 sum uppersilesian medical center in katowice , poland , an acute geriatric ward at a multiprofile university hospital , between june 2013 and june 2014 .
we excluded 113 patients who had been treated with antipsychotic medications because of behavioral disorders before admission and/or presented with signs of delirium on admission ( five subjects ) .
final analysis consisted of 675 patients aged 79.27.7 years
( xsd ) within a range of 60 to 100 years , among them 443 ( 66% ) were women and 232 ( 34% ) were men .
gca was performed for all the patients , including a structured interview , physical examination , geriatric functional assessment , blood sampling , electrocardiogram ( ecg ) , abdominal ultrasound , and chest x - ray .
mini - mental state examination ( mmse)21 was used to assess global cognitive performance and geriatric depression scale - short form ( gds - sf)22 to identify depression .
barthel index of activities of daily living ( barthel index)23 and lawton instrumental activities of daily living scale ( iadl)24 were used to determine functional status .
mmse scores range from 0 to 30 , barthel index scores from 0 to 100 , and iadl scores from 9 to 27 ; higher scores indicate better functional state .
gds - sf scores range from 0 to 15 with higher scores indicating higher depression probability . to assess risk of falls , a modified get up and go
cam is the most widely used instrument for identification of delirium , which has been validated in high - quality studies.5 the cam algorithm includes four criteria : acute onset and fluctuating course , inattention , disorganized thinking , and altered level of consciousness .
confirmation of the diagnosis requires the presence of both the first and the second criteria and of either the third or the fourth criterion .
the 12-item behavioral observation scale consists of the following categories : sustained attention , shifting attention , orientation , consciousness , apathy , hypokinesia or psychomotor retardation , incoherence , fluctuating functioning , restlessness , delusions , hallucinations , and anxiety or fear .
the scale scores from + 4 ( combative ) to -5 ( unarousable ) .
dementia was diagnosed according to recommendations from the national institute on aging - alzheimer s association.26 pain intensity ( pi ) was assessed with the visual analog scale27,28 scored from 0 to 10 , or with doloplus-2 scale29,30 based on the behavioral observational method and scored from 0 to 30 points ( with a higher score indicating more severe pain ) in patients who were unable to report pi because of cognitive impairment . to harmonize both scales , for further analysis ,
doloplus-2 values were divided by a factor of 3 , and pi was scored from 0 to 10 in each patient . a body mass index ( bmi )
data were collected by three research nurses and entered into forms prepared for research purposes .
chi - square test , v - square test , and fisher s exact test were used for categorical variables and nonparametric mann
whitney u - test for quantitative variables to compare patients who developed delirium during hospitalization with those who did not .
multivariate analysis with backward elimination included variables that yielded p - values of 0.1 or lower in the initial univariate analysis .
the kaplan meier method was used to estimate probability of delirium - free hospitalization in subgroups of patients with respect to selected variables , while differences between these subgroups were assessed with the wilcoxon gehan statistic .
the study protocol was registered with the bioethical committee of the medical university of silesia in katowice . in a statement ,
the committee wrote the study is characterized by record review and in the context of law is not a medical experiment and does not require assessment by the bioethical committee
( letter knw/0022/kb/79/i/13 ) . based on this decision , written informed consent was not required of our study nor was separate patient consent required for our statistical analysis or research , since patient data are not disclosed outside internal hospital ward staff .
this prospective observational study was performed in the department of geriatrics at university hospital no 7 sum uppersilesian medical center in katowice , poland , a subacute geriatric ward at a multiprofile university hospital .
all reported tests were performed according to clinical indications , and no test was performed in case of refusal by the patient or care giver .
no procedure exceeded beyond the scope of standard care in the ward . in 2013 ,
program was initiated by unit staff and approved by hospital management for use in the ward .
in addition to commonly accepted delirium prophylaxis strategies,6,17 this program added confusion assessment method ( cam),18 delirium - o - meter,19 and richmond agitation - sedation scale20 as additional delirium prevention methods .
primary analysis consisted of 788 consecutive patients aged 79.57.6 years
( xsd ) within a range of 60 to 100 years , among them 66% were women and 34% were men .
participants were admitted to the department of geriatrics at university hospital no 7 sum uppersilesian medical center in katowice , poland , an acute geriatric ward at a multiprofile university hospital , between june 2013 and june 2014 .
we excluded 113 patients who had been treated with antipsychotic medications because of behavioral disorders before admission and/or presented with signs of delirium on admission ( five subjects ) .
final analysis consisted of 675 patients aged 79.27.7 years
( xsd ) within a range of 60 to 100 years , among them 443 ( 66% ) were women and 232 ( 34% ) were men .
gca was performed for all the patients , including a structured interview , physical examination , geriatric functional assessment , blood sampling , electrocardiogram ( ecg ) , abdominal ultrasound , and chest x - ray .
mini - mental state examination ( mmse)21 was used to assess global cognitive performance and geriatric depression scale - short form ( gds - sf)22 to identify depression .
barthel index of activities of daily living ( barthel index)23 and lawton instrumental activities of daily living scale ( iadl)24 were used to determine functional status .
mmse scores range from 0 to 30 , barthel index scores from 0 to 100 , and iadl scores from 9 to 27 ; higher scores indicate better functional state .
gds - sf scores range from 0 to 15 with higher scores indicating higher depression probability . to assess risk of falls , a modified get up and go
cam is the most widely used instrument for identification of delirium , which has been validated in high - quality studies.5 the cam algorithm includes four criteria : acute onset and fluctuating course , inattention , disorganized thinking , and altered level of consciousness .
confirmation of the diagnosis requires the presence of both the first and the second criteria and of either the third or the fourth criterion .
the 12-item behavioral observation scale consists of the following categories : sustained attention , shifting attention , orientation , consciousness , apathy , hypokinesia or psychomotor retardation , incoherence , fluctuating functioning , restlessness , delusions , hallucinations , and anxiety or fear .
the scale scores from + 4 ( combative ) to -5 ( unarousable ) .
dementia was diagnosed according to recommendations from the national institute on aging - alzheimer s association.26 pain intensity ( pi ) was assessed with the visual analog scale27,28 scored from 0 to 10 , or with doloplus-2 scale29,30 based on the behavioral observational method and scored from 0 to 30 points ( with a higher score indicating more severe pain ) in patients who were unable to report pi because of cognitive impairment . to harmonize both scales , for further analysis ,
doloplus-2 values were divided by a factor of 3 , and pi was scored from 0 to 10 in each patient . a body mass index ( bmi ) was calculated in all the subjects .
data were collected by three research nurses and entered into forms prepared for research purposes .
. chi - square test , v - square test , and fisher s exact test were used for categorical variables and nonparametric mann
whitney u - test for quantitative variables to compare patients who developed delirium during hospitalization with those who did not .
multivariate analysis with backward elimination included variables that yielded p - values of 0.1 or lower in the initial univariate analysis .
the kaplan meier method was used to estimate probability of delirium - free hospitalization in subgroups of patients with respect to selected variables , while differences between these subgroups were assessed with the wilcoxon gehan statistic .
the study protocol was registered with the bioethical committee of the medical university of silesia in katowice . in a statement ,
the committee wrote the study is characterized by record review and in the context of law is not a medical experiment and does not require assessment by the bioethical committee
( letter knw/0022/kb/79/i/13 ) . based on this decision , written informed consent was not required of our study nor was separate patient consent required for our statistical analysis or research , since patient data are not disclosed outside internal hospital ward staff .
symptoms suggestive of delirium were reported , but not documented , by 2.79% of the 788 study participants before admission to the geriatric ward .
delirium developed in 35 out of the 675 patients ( 5.2% ) who had not been previously treated with neuroleptics ( figure 1 ) .
approximately , 42.8% of the 675 patients were treated with diuretics , 41% with beta blockers , 30.4% with angiotensin converting enzyme inhibitors ( aceis ) , 29.6% with statins , 25% with proton - pump inhibitors , 23.9% with antidiabetic medications , 17.2% with aspirin , 16.6% with pain relievers , 9% with antidepressants , 8.4% with thyroxine , 5.6% with corticosteroids , and 5% with l - dopa .
compared to the control group , patients who developed delirium were characterized by greater age and increased prevalence of dementia ; congestive heart disease ; peripheral artery disease ; pressure ulcers ; urinary incontinence ; permanent or prolonged bladder catheterization ; delirium and fall incidents ; behavioural disorders ; lower mmse , barthel index , and lawton iadl scores ; higher white blood cell counts and c - reactive protein levels ; lower serum total protein and albumin levels ( table 1 ) . according to the wilcoxon
gehan test , individuals with mmse scores > 18 points had higher probability of delirium - free hospitalization ( p<0.001 ) similar to those with barthel index scores > 55 points ( p<0.001 ) , lawton iadl scores > 16 points ( p<0.001 ) , and patients without bladder catheterization ( p<0.001 ) ( figure 2 ) .
< 9.7 g / l ( p<0.002 ) , c - reactive protein serum concentration <33 mg / l ( p<0.001 ) , serum total protein concentration > 64
multivariate logistic regression analysis included eleven quantitative variables and 30 categorical variables that yielded p - values of 0.1 or lower in the initial univariate analysis .
five factors associated with the development of inpatient delirium were included in the final multivariate logistic regression analysis : transfer between hospital wards ( odds ratio [ or ] = 2.78 ; confidence interval [ ci ] = 1.545.01 ; p=0.001 ) , preexisting dementia ( or = 2.29 ; ci = 1.443.65 ; p<0.001 ) , previous delirium incidents ( or = 2.23 ; ci = 1.473.38 ; p<0.001 ) , previous fall incidents ( or = 1.76 ; ci = 1.172.64 ; p=0.006 ) , and use of proton - pump inhibitors ( or = 1.67 ; ci = 1.112.53 ; p=0.014 ) .
development of delirium is a major nosocomial complication of the hospitalized elderly patients.7,31 prevention of this condition is a major priority for hospitalized elderly patients.32 predictive models of inpatient delirium incidents may be useful for geriatric admission guidelines .
unfortunately , the pathophysiology of delirium is poorly understood and this disorder is frequently unrecognized or overlooked.5 delirium is often characterized by fluctuating psychological symptom progression that is difficult to assess subjectively . complicating assessment further , various subtypes of delirium33,34 have been defined .
preexisting dementia is the leading risk factor for development of delirium in geriatric inpatients , and distinguishing between these in the clinical setting may be difficult , even for experienced clinicians.35 numerous factors may affect delirium , among them are psychoactive agents , especially antipsychotic medications used to treat behavioral and psychological disorders associated with psychogeriatric syndromes.3639 none of the 788 study participants had documented delirium incidents before admission to the geriatric ward .
however , 113 patients were undergoing treatment with antipsychotic medication , and it is likely that a portion of these patients were receiving treatment for delirium . since antipsychotics may hinder the recognition of delirium , we excluded patients treated with antipsychotic medications ( 14.3% of all patients admitted to the ward during the observation period )
. consequently , the number of patients who developed delirium during hospitalization may not reflect the total incidence of this syndrome .
prevalence of delirium at admission to the geriatric ward was assessed in other studies at 12%,40 18.5%,16 and 25%,41 while incidence during hospitalization was 6.6%,42 11.8%,16 and 13.3%.43 similarly , we identified multiple factors associated with increased risk of the development of delirium , some of which have not been previously reported : greater age , dementia , congestive heart disease , peripheral artery disease , pressure ulcers , urinary incontinence , permanent or prolonged bladder catheterization , history of delirium episodes , behavioral disorders , history of falls , functional dependence , increased markers of inflammation , and decreased serum total protein and albumin level .
multivariate logistic regression analysis allowed identification of factors predictive of inpatient delirium development , specific for the geriatric ward .
multivariate logistic regression model consisted of five independent variables in relation to the risk of development of delirium : transfer between hospital wards , preexisting diagnosis of dementia , previous delirium incidents , previous fall incidents , and use of proton - pump inhibitors .
it may be assumed that patient transfers from other hospital wards are associated with delirium risk factors such as poor general health , increased prevalence of major geriatric syndromes , subsequent change of surroundings , and prolonged hospitalization.7,31 dementia , previous delirium , and fall incidents are well - recognized factors associated with delirium.1 a pathophysiologic mechanism for the association between proton - pump inhibitors ( ppis ) and development of delirium remains elusive .
ppis are used frequently in the geriatric inpatient setting , often for prolonged periods of time and are not necessarily taken according to indications.44 increasing evidence suggests that ppis may trigger potentially serious complications.45 some case reports suggest that omeprazole may induce delirium.46,47 use of ppis was associated with increased mortality adjusted for age , sex , comorbidity , delirium , and use of aspirin and ssris in patients of acute geriatric wards and nursing homes.48 in elderly patients discharged from acute care medical wards , high - dose ppi therapy is associated with increased 1-year mortality.49 most of our study group patients treated with ppis prior to admission had used these drugs for unspecified periods of time .
treatment was continued at the ward until indications for further treatment or treatment cessation could be determined .
the 2015 ags beers criteria recommend the avoidance of ppi therapy beyond 8 weeks without justification due to the increased risk of clostridium difficile infection , bone loss , and fractures.15 we observed that proton - pump inhibitors may increase the risk of delirium in hospitalized geriatric unit patients .
however , we were unable to determine the mechanism behind the ppi and geriatric mortality association .
prolonged use of ppis is associated with increased risk of infections ( c. difficile,50 salmonellosis,51 community - acquired pneumonia52 ) , vitamin b12 deficiency,53,54 and hypomagnesemia.45,55 infection is a recognized precipitating factor for delirium.5 delirium - free hospitalization probability was diminished in patients with increased inflammatory markers ( figure 3 ) .
poor vitamin b12 status increases risk of cognitive decline.56 some observations suggest that hypomagnesemia may be a factor precipitating delirium.57,58 ppis , especially omeprazole , affect pharmacokinetics of other drugs , among them benzodiazepines and antidepessants,59 increasing risk of adverse effects .
brain barrier and block the vacuolar - type atpase proton pumps leading to decreased degradation of amyloid beta.60,61 a recent study by akter et al62 indicates that even a short course of ppis may impair cognitive functions in young healthy volunteers .
the concept of microbiome gut brain axis is also intriguing.63 ppis significantly influence enteric microbiota,64,65 and there exists increasing evidence that gut - microbiota signaling to brain by means of neural , endocrine , immune , and humoral links may influence brain function.66 some observations suggest possible association between gut - microbiota and anxiety or depressive syndromes.67,68 thus , the pathophysiology of the relationship between ppi therapy and the risk of delirium may be complex .
we were unable to confirm the observation of goldberg et al31 that an increased number of room transfers was associated with increased incidence of delirium .
transfer between hospital wards , preexisting dementia , previous delirium incidents , previous fall incidents , and use of proton - pump inhibitors are predictive of delirium incidents in the geriatric inpatient setting . | backgrounddelirium remains a major nosocomial complication of hospitalized elderly .
predictive models for delirium may be useful for identification of high - risk patients for implementation of preventive strategies.objectiveevaluate specific factors for development of delirium in a geriatric ward setting.methodsprospective cross - sectional study comprised 675 consecutive patients aged 79.27.7 years ( 66% women and 34% men ) , admitted to the subacute geriatric ward of a multiprofile university hospital after exclusion of 113 patients treated with antipsychotic medication because of behavioral disorders before admission . comprehensive geriatric assessments including a structured interview , physical examination , geriatric functional assessment , blood sampling , ecg , abdominal ultrasound , chest x - ray , confusion assessment method for diagnosis of delirium , delirium - o - meter to assess delirium severity , richmond agitation - sedation scale to assess sedation or agitation , visual analog scale and doloplus-2 scale to assess pain level were performed.resultsmultivariate logistic regression analysis revealed five independent factors associated with development of delirium in geriatric inpatients : transfer between hospital wards ( odds ratio [ or ] = 2.78 ; confidence interval [ ci ] = 1.545.01 ; p=0.001 ) , preexisting dementia ( or = 2.29 ; ci = 1.443.65 ; p<0.001 ) , previous delirium incidents ( or = 2.23 ; ci = 1.473.38 ; p<0.001 ) , previous fall incidents ( or = 1.76 ; ci = 1.172.64 ; p=0.006 ) , and use of proton - pump inhibitors ( or = 1.67 ; ci = 1.112.53 ; p=0.014).conclusiontransfer between hospital wards , preexisting dementia , previous delirium incidents , previous fall incidents , and use of proton - pump inhibitors are predictive of development of delirium in the geriatric inpatient setting . | Introduction
Methods
Design
Participants
Measurements
Data collection
Statistical analysis
Ethics
Results
Discussion
Conclusion |
the prevalence of gallstones in the united states is approximately 6% in men and 9% in women .
older age , female sex , and obesity are a few risk factors for gallstones .
usually gallstones do not cause any symptoms throughout the lives of most of the people harbouring them .
these stones are called incidental gallstones and they are identified when imaging studies are done for different reasons ( e.g. , evaluation of abdominal pain , pelvic disease , and abnormal liver function tests [ lft ] ) . if the person becomes symptomatic due to stones , the condition is called gallstone disease .
uncomplicated gallstone disease refers to a state associated with biliary colic in the absence of any complications .
while the majority of patients with incidental gallstones will not develop symptoms attributable to the gallstones , approximately 1525% will become symptomatic during 1015 years of follow - up , but their initial symptoms are typically not severe . patients who develop symptoms initially report biliary colic rather than symptoms associated with the complications of gallstone disease . since the mortality rate related to incidental gallstone disease is remarkably lower than that associated with treatment , prophylactic cholecystectomy is not indicated in asymptomatic patients .
once symptoms develop , they tend to recur and thereby increasing the risk for the complications of the gallstone disease . therefore , cholecystectomy must not be delayed after the development of biliary symptoms .
elective nonsurgical treatment of gallstones is advised in all symptomatic patients who are poor candidates for surgery .
an estimated 750,000 laparoscopic cholecystectomies ( lc ) are performed annually in the united states ( approximately 90% of all cholecystectomies ) .
the overall serious complication rate still remains higher than that seen in open cholecystectomy , despite increasing experience with the procedure over the last so many years .
laparoscopy in the present time is done by 3-port , 4-port , or single - port technique , though it may also be performed through an open upper right abdominal incision . as the laparoscopic approach does not require the cutting of the rectus abdominis muscle , it is associated with less postoperative pain and good cosmetic effect .
a short hospital stay resulting in reduced days off work are additional advantages over open cholecystectomy . in an lc operation ,
serious complications that occur with lc include bile leaks , bile duct injury , bleeding , and bowel injury at times .
one of the complications of cholecystectomy is the migration of surgical clips into the common bile duct ( cbd ) , albeit very rare .
secondary stones , which are the commonest , form in the gallbladder and then migrate into the cbd .
stasis plays an important role in the formation of bile duct stones and can be due to stricture or other causes of obstruction like foreign bodies
. the migrated surgical clip could be one of the foreign bodies providing the nidus for the bile duct stones .
migration of surgical clips is a well - known phenomenon ever since their use in surgery .
migration of the surgical clip into the cbd as a cause of biliary stone was first recognised in 1979 after open cholecystectomy .
both of these complications ( migration of surgical clips and retained cbd stones ) can be missed easily .
presenting symptoms of both of these complications could be acute or recurrent cholangitis over a variable period of time .
a 38-year - old lady presented with repeated episodes of jaundice . jaundice used to be mild and fluctuating in nature lasting for 56 days according to her history .
upper right quadrant abdominal pain lasting for less than 6 h accompanied the jaundice . each episode was associated with mild pruritus all over the body .
she also developed nausea and vomiting for the past few days when she decided to seek medical attention .
there was no past history of abdominal pain , fever , or jaundice before lc .
ultrasonography ( usg ) done just before lc showed non - dilated cbd with normal lft .
she was found to have a temperature of 39.2c with associated tachycardia ( hr 130/min ) .
laboratory indices were as follows : wbc 12,100/ml , alt 112 u / l ( normal up to 41 ) , ast 169 u / l ( normal up to 40 ) , alp 671 u / l ( normal up to 130 ) , and total bilirubin 9.6 mg / dl ( normal up to 1.2 ) .
u / l ( normal up to 96 ) and serum lipase was 28 u / l ( normal up to 51 ) .
a small amount of contrast was injected in the cbd , which demonstrated multiple filling defects in the lower cbd with 2 linear metallic densities in one of the defects ( fig 1 ) .
wide papillotomy was done and a few stones , including the one encasing 2 metallic surgical clips , were removed by a dormia basket ( fig 2 ) . pain and fever disappeared after the procedure with progressive normalisation of lft .
most of the stones form de novo , while a few can form due to direct complications of surgery .
suture materials or metallic clips can migrate into the cbd where they act as a nidus for stone formation .
the first case of surgical clip migration after lc was reported in 1992 . in spite of the very large number of lc performed worldwide , less than 100 cases of surgical clip migration
the median time of clip migration is usually 2 years , but it can vary from 11 days to 20 years , while the median number of migrated clip is 1 ( range 16 ) . the exact sequence of events leading to clip migration is poorly understood . a possible initial event could be cystic duct stump necrosis
. this can be due to pressure exerted from intra - abdominal organ movements , ischemia , or infective complications .
in due course of time , the whole clip eventually falls away into the cbd as the stone becomes larger in size .
clip migration causing duodenal ulcer or emboli has also been reported [ 8 , 9 ] .
the clinical presentation of stones formed due to clip migration is similar to non - iatrogenic stones .
application of a minimum number of clips with proper placement away from the cystic duct and cbd junction or use of absorbable clips could probably prevent the incidence of clip migration .
this case also highlights another important issue of retained cbd stones after cholecystectomy because there were multiple stones in the cbd apart from the one formed over the migrated clips .
unexpected retained cbd stone after cholecystectomy is a rare but recognised complication with a reported incidence of about 0.52.3% [ 10 , 11 ] .
the frequency of asymptomatic cbd stones in those undergoing cholecystectomy is around 10% in the literature .
abdominal usg and lft , could still miss retained cbd stones in many cases , like the present one .
therefore , the use of on - table cholangiogram or intra - operative laparoscopic ultrasound to reduce the incidence of retained cbd stones could be the better option , but no conclusive evidence exists to date [ 13 , 14 ] .
they should be considered in the differential diagnosis of recurrent cholangitis in post - cholecystectomy cases . | laparoscopic cholecystectomy ( lc ) is currently the treatment of choice for symptomatic gallstones .
associated complications include bile duct injury , retained common bile duct ( cbd ) stones , and migration of surgical clips .
clip migration into the cbd can present with recurrent cholangitis over a period of time
. retained cbd stones can be another cause of recurrent cholangitis .
a case of two surgical clips migrating into the common bile duct with few retained stones following lc is reported here .
the patient had repeated episodes of fever , pain at epigastrium , jaundice , and pruritus 3 months after lc .
liver function tests revealed features of obstructive jaundice .
ultrasonography of the abdomen showed dilated cbd with few stones . in view of acute cholangitis ,
an urgent endoscopic retrograde cholangiopancreatography was done , which demonstrated few filling defects and 2 linear metallic densities in the cbd .
a few retained stones along with 2 surgical clips were removed successfully from the cbd by endoscopic retrograde cholangiopancreatography after papillotomy using a dormia basket . the patient improved dramatically following the procedure . | Introduction
Case Report
Discussion
Conclusion
Statement of Ethics
Disclosure Statement |
silver island films were prepared by vacuum deposition of 7 nm silver onto glass coverslips .
directly before use , films were annealed for 1 min at 300 c under argon .
the sers substrates were immediately immersed in fresh 2 mm ethanolic thiol solutions for 1518 h. to alter the pntp ( fluka , technical grade ) surface concentration , the ratio between pntp and thiophenol ( merck , for synthesis ) was adjusted to keep the total thiol concentration constant .
xray photoelectron spectroscopy measurements indicated no large deviation in thiol ratio once adsorbed onto the silver island film .
sers spectra were measured through a 5 objective ( na 0.12 ) at 532 nm excitation with a power density of 610 w cm by using a renishaw invia raman microscope .
data processing was done with matlab 2013a and the baselinecorrected peak integration performed by using trapezoidal numerical integration .
normalization of the total sers intensity was performed on the basis of the total sers intensity between 1020 and 1625 cm .
a zeroorder savitzky golay filter of 7 pixels was used to smooth the timedependent peak areas . the nonlinearmodelfitting function in mathematica 9.0
the sum of residuals and squares was calculated separately for both reactant and product , then added , to calculate r
. | abstractheterogeneous catalysis is a surface phenomenon . yet , though the catalysis itself takes place on surfaces , the reactants and products rapidly take the form of another physical state , as either a liquid or a gas .
catalytic reactions within a selfassembled monolayer are confined within two dimensions , as the molecules involved do not leave the surface .
surfaceenhanced raman spectroscopy is an ideal technique to probe these selfassembled monolayers as it gives molecular information in a measured volume limited to the surface .
we show how surfaceenhanced raman spectroscopy can be used to determine the reaction kinetics of a twodimensional reaction . as a proof of principle , we study the photocatalytic reduction of pnitrothiophenol .
a study of the reaction rate and dilution effects leads to the conclusion that a dimerization must take place as one of the reaction steps . | Experimental Section |
adults use handbags or
shoulder bags , which places a load on one hand or one shoulder , respectively1 .
overly heavy bags , inadequate carrying methods , and bag locations
distribute the weight inappropriately , which can cause abnormal posture and consequent
muscle pain and spinal disorders3 .
however , as people are accustomed to carrying bags , they are inclined to neglect problems
that are caused by the weight of the bags and how they are carried on the body . if the bag
is viewed as a piece of baggage with a certain weight , the effects of its location or weight
should be considered .
in particular , as the transport of baggage and the action of walking
are correlated , the effects of transporting a bag on walking should be taken into account .
walking is a complex exercise pattern formed by the effect of neuromuscular , biomechanical ,
and kinesiological changes that take place over a long period , starting at birth .
when the
head , neck , and trunk are aligned normally , the resulting stability and appropriate range of
motion ( rom ) allow alternative movements4 .
in normal walking , the center of pressure ( cop ) shifts in a regular and symmetric manner ,
according to whether the direction is up , down , left , or right , and the extremities move in
harmony accordingly5 .
the weight ,
location , and method of carrying a bag cause the physical response of maintaining balance
when the location of the weight line changes .
moreover , in moving forward , the body uses an
adaptation mechanism in order to rearrange the body segments in an abnormal posture6 .
in addition , a long - term increase in fatigue can create problems with
weight distribution and is a direct cause of disorders and diseases7 .
in korea , studies have been undertaken to resolve problems caused by methods of carrying
bags and to suggest correct carrying methods .
however , most studies have focused on either
elementary school students8 , 9 or bags10,11,12 .
therefore , the present study was performed to analyze gait changes in healthy women
according to their bag - carrying habits and methods , and thereby provide information to help
maintain correct posture .
the study 's subjects were 34 women in their 30s who resided in s city and were using the
region 's cultural center .
those with orthopedic disorders , neurosurgical disorders ,
functional or anatomical differences in lower limb lengths , or visual impairment were
excluded from the sample .
the research period was from august 1 to september 30 , 2011 . based
on the declaration of helsinki ,
therefore , the inclusion criteria specified right - handed
participants . of the 34 subjects , 18 ( 21.4 6.5 yrs , 158.3 4.4 cm , 51.1 6.7 kg ) had the
habit of carrying bags on their right side , and 16 had the habit of carrying bags on their
left side ( 20.3 6.5 yrs , 159.4 6.3 cm , 52.4 5.7 kg ) . the handbag used in this study had a wide rectangular shape ( 33 23 16 cm ) , which korean
women favor . as a single - strap bag ,
a previous study14 suggested that a bag 's appropriate weight
should be a maximum 10% of its carrier 's weight .
given this , after measuring the average
weight of the subjects , a sandbag was inserted into the handbag .
thus , a sandbag weighing 4.6 kg was inserted in the handbag , which
weighted 600 g. adults mainly use handbags that are either carried over the shoulder or held in the hand .
hence , the subjects were instructed to carry the bag in four ways : in the left hand , over
the left shoulder , in the right hand , and over the right shoulder .
when the subjects carried
the handbag over the shoulder , they were instructed to adjust the handbag 's length at the
level of the iliac crest in the flank6 . a
gait analyzer
( walk way mg-1000 , anima co. , japan ) was used to measure the gaits . before the
experiment , in order to prevent unnatural movements , the subjects were instructed to do
light stretching .
they then did walking exercises three times on the gait analyzer in order
to produce natural motions . during the measurements , the subjects wore a comfortable
tracksuit and socks without shoes .
they were instructed to begin on the right foot . in order
to measure their natural gait while carrying the bags , the participants walked for about
three minutes before the measurement procedure , looking forward and naturally swinging both
arms . once in each posture , they walked four times , with a 3-minute break between each
posture . spss 12.0 was used to process the statistical data on habits and methods of carrying the
handbag .
an independent samples t - test was conducted to identify gait differences according to
handbag - carrying habits .
a one - way anova was performed to identify gait differences
according to handbag - carrying methods .
the results of the analysis of the relation between handbag - carrying habits and methods ,
showed no interaction . with regard to gait differences according to handbag - carrying habits ,
statistically significant differences were exhibited in stride length , step length , step
width , gait angle , and time ( p<0.01 ) .
no
statistically significant changes were exhibited in the stance , swing , and double stance
phases ( table 1 ) .
subjects with the habit of
carrying bags on their right side revealed relatively larger strides and step lengths ,
whereas their step widths and gait angles were relatively smaller . therefore , distance
variables related to walking distance exhibited differences according to handbag - carrying
habits .
the variable of time was found to be shorter in subjects with the habit of carrying
bags on their right side , which resulted in an overall faster gait velocity . as a result , in
terms of the temporal gait variables ,
only certain variables exhibited differences according
to handbag - carrying habits . in terms of gait differences according to handbag - carrying methods , the variables of stride
length , step length , step width , gait angle , toe - out angle , time , stance phase , swing phase ,
and double stance phase showed no statistically significant differences .
this suggested that
no differences occurred in both temporal and spatial gait variables according to
handbag - carrying methods ( table 1 ) .
the purpose of this study was to provide information about maintaining correct posture
while carrying a handbag by identifying appropriate bag - carrying habits and methods .
the
methods of carrying a handbag in the hand or over the shoulder were both revealed to have no
effects on gait velocity or other gait components .
park 's study15 showed that the pattern of either carrying or holding bags
did not influence plantar foot pressure , and no differences in plantar foot pressure were
exhibited between backpacks and shoulder bags3 .
the results of that study are in agreement with the present study 's
findings that bag - carrying methods do not influence temporal and spatial gait variables . in the present study , compared with subjects that habitually carried bags on their left
side , subjects that usually carried bags on their right side exhibited longer stride and
step lengths and narrower step widths and gait angles . because increased stride and step
lengths led to narrower step widths and gait angles , subjects that habitually carried bags
on their right side were likely to have higher levels of stable gait .
the toe - out angle is
related to the degree of internal and external rotations of the lower extremities during the
stance phase16 .
consequently , carrying a
bag with an appropriate weight was revealed to have no influence on the toe - out angle . according to an1 , asymmetric bag loads
in addition , an increase in the
load applied to one foot during the stance phase decreases step width and increases cadence .
kim et al . reported that when subjects walked without a bag , step lengths were found to be
longest17 , whereas the longest bag
length resulted in the shortest step length .
asymmetric
loads vary according to bag - carrying methods , causing instability and relocation of the cop .
in response , a mechanism for posture adaptation is activated to maintain physical balance ,
which subsequently results in posture changes in the trunk and extremities .
when people walk
while carrying a heavy bag over a shoulder or in a hand , the foot on the same side has a
larger ground reaction force than the opposite foot , thereby increasing asymmetry .
moreover ,
during walking , this foot requires larger muscular strength , propulsive force , and energy
consumption18 .
constant exposure to
such asymmetrical loads can also cause physical problems that lead to inadequate posture .
a
previous study found that in cases of carrying a bag with a strap on one side and carrying a
sports bag designed to be carried on one side , the elevation of the shoulder that supported
the strap and the trunk lateral rotation on the opposite side increased2 . in the present study ,
the right - handed subjects who habitually carried bags on their right
side had fast gait velocities .
thus , future studies should identify gait changes in subjects while they carry a bag in
their dominant hand . in conclusion , this study found that when the bag 's weight was
appropriate ( maximum 10% of its carrier 's weight ) , the effects of the carrying method were
insignificant .
in other words , only bag - carrying habits had significant effects on gaits .
therefore , it may be necessary for people to be aware of the negative effects on posture
caused by their bag - carrying habits . | [ purpose ] the purpose of this study was to provide information to help maintain correct
posture by identifying gait changes caused by the habits and methods of carrying bags .
[ method ] the subjects were 34 healthy right - handed women . among them , 18 subjects had the
habit of carrying bags on their right side , and 16 subjects had the habit of carrying bags
on their left side .
the subjects were instructed to walk while carrying a bag , which
weighted approximately 10% of the subjects ' average weight , in four different ways ;
holding it in the left hand , carrying it over the left shoulder , holding it in the right
hand , and carrying it over the right shoulder .
the subjects ' gaits were measured using a
gait analyzer . [ results ] subjects who habitually carried bags on their right exhibited
changes in gait variables related to walking distance .
in addition , their gait velocities
were relatively faster .
on the other hand , differences in temporal and spatial gait
variables were not exhibited when the bag was carried using the four methods .
[ conclusion ]
when the weight of a bag is appropriate , bag - carrying habits had significant effects on
gaits .
therefore , people who carry bags should avoid the habit of carrying them on only
one side . | INTRODUCTION
SUBJECTS AND METHODS
RESULTS
DISCUSSION |
non - communicable diseases ( ncds ) have undoubtedly become a major challenge in the pacific islands , which account for around 70% of all deaths in the region , including a high percentage of premature deaths ( before the age of 60 ) .
the republic of palau bears a high burden of ncds , as well as other pacific island countries and territories . according to the data released by the ministry of health in 2011 , cardiovascular disease ( 24.3% ) , cancer ( 21.4% ) , chronic respiratory diseases ( 12.7% ) , and diabetes ( 9.8% ) are the leading four causes of death in the country .
palau is a micronesian island country , located east of the philippines , west of the federated states of micronesia ( fsm ) and northeast of indonesia .
it is classified as an upper middle income country by the world bank and has relatively high living standards in comparison with other island countries in the region . according to the latest national population and housing census conducted in 2005 ,
the total population is about 20,000 , of which 73% are of palauan descent and foreign nationals comprise the rest .
filipinos , estimated at 16% to roughly 20% of the total population , are the largest group of the foreign residents , and most of them are migrant workers from the philippines after the 1990s , with a relatively young age distribution compared to local palauans .
being aware of the seriousness of the burden of ncds , the president of republic of palau signed an executive order declaring a state of health emergency on ncds in 2011 .
however , the authorities did not have valid population baseline data of key indicators for ncds to establish evidence - based strategies for controlling ncds .
although several previous population - based surveys were conducted in palau , none of them could provide complete information , including behavioral and biological risk factor of ncds .
for example , the palau health survey in 1991 or the palau community health assessment in 2003 did not include blood tests , and the behavioral risk factor surveillance system ( brfss ) in 2010 and 2012 did not include either physical or biochemical measurements .
the ministry of health , therefore , collaborated with the world health organization ( who ) to start the who stepwise approach to risk factor surveillance ( steps ) in late 2011 , which would be the first comprehensive national survey for ncd risk factors in palau .
this paper aims to perform an initial analysis before looking further into associations among various factors on the population representative dataset , and describe the prevalence of each major common risk factor for ncds .
a population - based survey for ncd risk factors , referred to as palau ncd steps survey , was started in september 2011 by adopting the who steps instrument , and the data collection was completed in june 2013 .
based on the 2009 household survey , two - stage cluster random sampling was designed to cover the entire 16 states of palau .
firstly , 75 enumeration areas ( eas ) were selected using probability proportional to size ( pps ) as the primary sampling units , followed by randomly selecting 2,807 households from them as the secondary sampling units .
one resident aged 25 to 64 years within each of the households was recruited for the survey using the kish method , which provides for random selection of one individual from a household . the required sample size to detect statistically significant differences between eight sex - age groups
were calculated as 2,807 individuals , within a margin of error of 5% and an anticipated 80% response rate .
as detailed below , there are three component parts , called " steps " , of the survey instrument , i.e. behavioral , physical and biochemical measurements .
( 1 ) apart from questions for basic demographic information , a structured questionnaire was used to assess four common behavioral risk factors of ncds by face - to - face interviews .
participants were asked about personal dietary habits , particularly fruit and vegetable intakes , as well as tobacco use , alcohol consumption and physical activity in their daily lives .
( 2 ) the second step consisted of measurements of height , weight , waist and hip circumferences , and resting blood pressure .
the anthropometric measurements were taken in light indoor clothing , and without shoes or other heavy accessories .
waist circumference was measured at the midpoint between the lowest rib and the iliac crest .
blood pressure in the sitting position was measured three times in the upper arm , using an electronic sphygmomanometer ( omron hem-7200 ) .
three measurements of blood pressure were taken for each participant in the survey , and the arithmetic mean of the second and third readings were used . ( 3 ) biochemical blood tests were performed in the morning after roughly 10 to 12 hours of fasting .
fresh capillary whole blood samples were drawn from the fingertip , followed by biochemical tests on portable devices , namely accu - chek performa system ( roche diagnostics , north america ) for fasting blood glucose and accutrend plus system ( roche diagnostics , north america ) for blood levels of total cholesterol and triglycerides .
data were entered by using the epidata software and categorized into different groups for the analysis based on well - defined criteria .
body mass index ( bmi ) is defined as the weight in kilograms divided by the square of the height in meters . as the current who classification ,
cutoff points of 18.5 , 25 and 30 kg / m were used to define underweight , normal weight , overweight and obesity .
hypertension was defined as having a systolic blood pressure 140 mmhg , a diastolic blood pressure 90 mmhg , or currently being on antihypertensive medication .
people with systolic blood pressure 160 mmhg or diastolic blood pressure 100 mmhg were grouped as stage 2 hypertension , by applying the criteria of the seventh report of the joint national committee on prevention , detection , evaluation , and treatment of high blood pressure ( jnc 7 ) . according to the recommendations by the who and american diabetes association ( ada ) , values of fasting blood glucose 126 mg / dl or those on diabetic treatment were categorized as diabetic .
two values for the upper limit of normal fasting blood glucose were used : 110 mg / dl by the who or 100 mg / dl by the ada criteria .
the levels of blood lipids were classified as follows : normal ( < 150 mg / dl ) , borderline - high ( 150199 mg / dl ) and high ( 200 mg / dl ) for triglycerides , and desirable ( < 200 mg / dl ) , borderline - high ( 200239 mg / dl ) and high ( 240 mg / dl ) for total cholesterol . to test the differences among ethnic groups on each categorical data ,
we conducted all aforementioned data analyses using the statistical software , ibm spss statistics for windows , version 22.0 ( ibm corp , armonk , ny , usa ) . the survey proposal was reviewed and approved by the who and institutional review board of the ministry of health , republic of palau prior to implementation ( july , 2010 ) .
written informed consent was obtained from all of the participants after adequate explanations of the objectives and procedures of the project .
data analysis of this study is also included in a joint research project between palau and japan , which was designed to investigate ncd risk factors among the younger adults aged 18 to 24 years .
the relevant research project was approved by the bioethics review committee of nagoya university school of medicine ( july , 2012 ) .
from the selected 2,807 households ( 71% of the total households nationwide ) , 2 , 212 individuals participated in this survey and completed all of the three steps giving a response rate of 79% .
valid data of 2,184 individuals were finally selected for the analyses in this study , excluding those who were not within the target age range of 2564 years , who did not give a clear answer of sex , and women who were pregnant at the moment of the survey .
about 75% of the subjects were palauans and 19% were filipinos , the main foreign population in the country .
the mean age of the palauan participants was 46.6 years ( standard deviation , 10.2 ) , while the mean age of the filipinos was 42.4 years ( standard deviation , 9.5 ) .
table 1 shows the characteristics of participants by gender and age group , and table 2 shows that by ethnic background .
characteristics of participants aged 2564 years in palau ncd steps survey 20112013 , valid % usd indicates united states dollar characteristics of participants by ethnic background , valid % ( age standardized % ) based on the age distribution of the whole population from 2005 census of population and housing usd indicates united states dollar a quarter of male participants were current cigarette smokers , but female smokers were less than 10% .
betel nut with tobacco chewing was a common practice among palauans , as 58% of men and 69% of women had the habit . in the total participants , 60% of men and 58% of women reported current use of any kind of tobacco products , including smoking and chewing .
infrequent fruit intake , namely one day or less per week , occurred in 44% of men and 32% of women .
as for infrequent vegetable intake ( 1 day / week ) , it was observed in 15% and 9% of men and women , respectively .
most of palauan males ( 84% ) and females ( 86% ) were overweight or obese ( bmi 25 kg / m ) , with the mean bmi being 30.8 kg / m and 31.3 kg / m in males and females , respectively .
filipino residents also had a high prevalence of overweight or obesity , i.e. 52% in males and 40% in females , and the mean bmi was 25.4 kg / m in males and 24.5 kg / m in females .
as for percentage of obesity alone ( bmi 30 kg / m ) , it is much higher among palauan residents ( 51% in males and 55% in females ) than that among filipinos ( 9% in males and 10% in females ) .
approximately 8% of males and 14% of females among the total adult subjects reported that they had taken antihypertensive medication during the past two weeks .
including those who were on medication , more than half of palauan males ( 60% ) and females ( 54% ) were considered hypertensive , followed by 46% of males and 34% of females in the filipino population .
moreover , 20% of the total participants were stage 2 hypertensive ( 160/100 mmhg ) .
the prevalence is higher in the older age group , e.g. 29% of males and 35% of females were diabetic among the oldest age group of 5564 years . borderline - high or high levels of triglycerides
were found in 48% of men and 41% of women in the total subjects , whereas borderline - high or high levels of total cholesterol including those on medication were observed among 16% of men and 20% of women .
this is the first comprehensive population based survey on risk factors of ncds among adults in palau , which included physical and biochemical measurements .
the results revealed a high percentage on each of the major risk factors , especially tobacco use , overweight or obesity , hypertension , and raised blood glucose .
findings of this survey confirmed that cigarette smoking was more prevalent among men than women in palau ( 25% vs. 10% : p < 0.001 ) .
the prevalence was almost the same as that reported in the palau community health assessment , a national household survey in 2003 , indicating that smoking rate of adults had hovered during the past decade in this country . compared with the other pacific island countries , the prevalence of smoking in palau was not high .
for instance , it was much lower than the findings from a previous survey carried out in the adjacent micronesian country , federated states of micronesia ( fsm ) , in which 42% of men and 32% of women were reported as current smokers .
however , cigarette smoking solely can hardly illustrate the fact of tobacco use in palau .
chewing betel nut with tobacco , smokeless tobacco , is a broadly acceptable practice within all sectors of the population in palau . according to the results , palauan adults , especially women ,
had an extremely high proportion of betel nut with tobacco chewing , which was not commonly observed in other ethnic groups living in this country .
although the neighboring country , fsm , has the same tradition of betel nut chewing , the percentage of smokeless tobacco users was significantly lower in comparison to palau , namely 22% in men and 3% in women .
as regards the gender difference in betel nut and tobacco chewing , cambodia is the other country in the who western pacific region which reported women had a significantly higher prevalence than men .
three reasons for the use of chewing tobacco and betel nut among cambodian women were suggested in a previous study : ( 1 ) as an addictive stimulant , ( 2 ) as part of a female rite of passage into adulthood and reproductive age , and ( 3 ) as a remedy to relieve pregnancy - related symptoms .
however , the reasons for the high prevalence of chewing betel nut with tobacco among palauan women are still not clear .
based on the findings in this survey , the palauan government may have to develop gender- and ethnic - specific tobacco control measures for the population .
more than half of adult population in each of the pacific island countries are observed to be overweight or obese ( bmi 25 kg / m ) , with the exception of papua new guinea .
likewise , about three in four participants were considered as overweight or obesity in this survey . with regard to the difference by ethnic background ,
more than half of palauan adults were obese ( bmi 30 kg / m ) , whereas the proportions of obesity in both filipino men and women were less than 10% . even after adjusting for age ,
palauans have a higher obesity prevalence than filipinos either in men or in women ( p < 0.001 for both ) . since most of the filipinos living in palau are migrant workers engaged in physical labors and having lower income levels than palauans .
( see table 2 ) . considering the socio - economic background , lower prevalence of obesity among filipinos than among palauans might be attributable to the differences in dietary habits , physical activities , working conditions , etc . in comparison with the data reported from the palau health survey in 1991 ,
the mean bmi of adults aged 3564 years had increased from roughly 27.6 to 29.6 kg / m for men and 29.6 to 30.1 kg / m for women over the past two decades .
dietary patterns and lifestyle changes with the economic growth in palau might explain the increased bmi .
subsequent analyses or further studies are required to investigate the factors contributing to overweight or obesity in the population .
this survey revealed an alarmingly high prevalence of hypertension in palau , of which more than half of the adults had a raised blood pressure , particularly among ethnic palauans . even the youngest age group ( 2534 years ) demonstrated a high percentage of hypertension ( 36% in men and 25% in women ) .
however , the proportion of participants who were on antihypertensive medication was relatively low ( 8% in men and 14% in women ) . as hypertension rarely causes symptoms in the early stages , those who have undiagnosed hypertension or ignore self - management of blood pressure
should be targeted first in ncd control policies . among published data of who steps surveys for pacific island countries and territories , palau has the highest prevalence of hypertension in both sexes ( 55% in men and 49% in women ) , even though the prevalence of obesity is not noticeably high compared to the others .
factors might contribute to this result , such as salt intakes , need to be investigated further .
palau was the only country in oceania which did not have any available data concerning the population prevalence of raised blood glucose prior to the present survey , despite the fact that pacific island countries have some of the highest rates of diabetes in the world .
this survey showed that more than 20% of the participants had diabetic level hyperglycemia , and more than 60% of the participants had ada - defined impaired fasting glycemia ( ifg ) or diabetes ( 100 mg / dl ) .
it is known that diabetes , if untreated for years , causes serious complications such as diabetic retinopathy , nephropathy , and neuropathy , as well as ischemic cardiac diseases .
urgent actions are needed to screen and control blood glucose of the population in palau .
although the evidence of health impacts of the given risk factors has been identified around the world , a limited number of those studies were conducted in the pacific islands . as of today
, most of the countries and territories in the pacific region have accessible data of the key ncd risk factors for their population , such as those from the who steps surveys .
all of these data could be potentially used for further studies to investigate local characteristics of ncds for the islanders .
in addition , comparisons across the island countries have also become possible , because of the standardized methodology used for the data collection .
we could not obtain valid variables on fruit and vegetable intakes by servings , standard amounts of alcohol consumption , and quantity of physical activity due to inappropriate methods of the interviews . regarding blood tests ,
capillary whole blood samples were applied to the dry chemistry method . although the device has been calibrated for plasma automatically
, the results might not correspond to those done by venous plasma samples at the laboratory , the standard method for measuring and reporting glucose concentrations in blood .
accordingly , the criteria of appropriate cutoffs might be different from those we adopted in this article . in conclusion , this survey has provided useful baseline epidemiological data on the major ncd risk factors , with very high prevalence on both behavioral and biological risk factors . on the basis of this survey
, policymakers could develop more effective and efficient ncd prevention or control strategies for the public .
the authors wish to thank staff members of the bureau of public health , ministry of health , republic of palau for the data collection .
appreciation is also given to the regional office for the western pacific , who for the full financial and technical support during the survey .
the content is solely the responsibility of the authors and does not necessarily represent the official views of the palauan government or the who .
data analysis of this paper is part of a joint research project between palau and japan , supported by the health and labour sciences research grants for research on global health issues ( h24-chikyukibo - ippan-004 ) to a.a . from the ministry of health , labour and welfare , government of japan . | abstractpalau , similar to other pacific island countries , is currently highly burdened with non - communicable diseases ( ncds ) .
the who steps was launched in 2011 to comprehensively survey indicators for ncds in the country .
this paper aims to describe the prevalence of key ncd risk factors assessed by the survey . the who instrument , including behavioral , physical and biochemical measurements ,
was adopted to the nationwide survey for all residents aged 25 to 64 years .
a cluster - based sampling method was performed to obtain a national representative data .
valid data from 2,184 individuals were selected for the analyses , of which 75% were palauans and 19% were filipinos .
prevalence of current cigarette smoking was 25% in men and 10% in women .
betel nut chewing with tobacco was prevalent particularly among palauans ( 58% in men , 69% in women ) compared to the other ethnic groups . in terms of all types of tobacco use , 60% of men and 58% of women were current users .
overweight or obesity was very common among palauans ( 84% in men , 86% in women ) as well as filipinos ( 52% in men , 40% in women ) .
hypertension was found in 55% of men and 49% of women , with the stage 2 hypertension being 21% and 19% , respectively .
the prevalence of diabetic level hyperglycemia was more than 20% .
raised total cholesterol was detected in 16% of men and 20% of women .
this survey revealed an alarmingly high prevalence of ncd risk factors , especially tobacco use , obesity , hypertension and raised blood glucose .
the data would be useful baseline information to develop effective ncd strategies in palau . | INTRODUCTION
METHODS
RESULTS
DISCUSSION
ACKNOWLEDGMENTS
CONFLICTS OF INTEREST |
cardiovascular disease , type 2 diabetes and obesity are common diseases with major impact on morbidity and mortality in adulthood [ 14 ] . multiple epidemiological studies , of which many have been published in the european journal of epidemiology , identified various risk factors in childhood and adulthood for these diseases [ 535 ] .
the developmental origins of health and disease hypothesis postulates that adverse fetal exposures lead to permanent fetal adaptations in structure , physiology and metabolism .
these adaptations might be beneficial for short term fetal survival , but may lead to fetal growth retardation and cardiovascular and metabolic diseases in adulthood .
strong support for this hypothesis comes from many epidemiological studies showing that low birth weight is associated with increased risks of cardiovascular disease , type 2 diabetes and obesity [ 3741 ] .
however , the effect estimates for the associations between low birth weight and diseases in later life seem to be small and underlying causal mechanisms are unknown [ 3841 ] .
since the same birth weight might be the result of various fetal exposures and growth patterns , low birth weight is unlikely to be the causal factor per se leading to of cardiovascular disease , diabetes and obesity .
maternal smoking is one of the most important modifiable adverse risk factors for low birth weight in western countries , and might be involved in the underlying mechanisms . in this review ,
we discuss epidemiological studies focused on the associations of maternal smoking during pregnancy with fetal growth and cardiovascular and metabolic disease in the offspring , the potential role of fetal smoke exposure in the mechanisms underlying the associations between low birth weight and diseases in later life , and challenges for future epidemiological studies .
although the negative effects of smoking during pregnancy on fetal growth are well known , the prevalence of smoking during pregnancy is still high . in western countries ,
maternal smoking is one of the most important modifiable risk factors for low birth weight in western countries .
the effects of maternal smoking during pregnancy on fetal outcomes seem to be dose and trimester dependent [ 42 , 43 ] .
it has been suggested that smoking during first trimester only and quitting thereafter , does not lead to increased risks of neonatal complications [ 42 , 43 ] .
recently , it has been shown that first trimester fetal growth , as measured by crown - rump length , is also affected by maternal smoking . the biological mechanisms by which maternal smoking during pregnancy influences fetal growth are not fully known .
nicotine is an important teratogen and it induces vasoconstriction which leads to reduced placental blood flow and oxygen deprivation in the fetus .
fetal vasoconstriction and impaired blood flow may lead to suboptimal hemodynamic stimulus for placental and fetal vascular development [ 47 , 48 ] .
other toxins from maternal smoking also lead to reduced placental and fetal perfusion [ 4851 ] .
some studies suggest that nicotine directly influences cell proliferation and differentiation , hereby affecting neural cell survival and the development of fetal neurotransmitter systems .
another teratogenic element in smoking is carbon monoxide , which is rapidly absorbed in the blood where it binds to haemoglobin and forms carboxyhaemoglobin which results in hypoxia , and might be teratogenic and fetotoxic .
animal studies show a direct negative effect of prenatal carbon monoxide exposure on cardiac maturation .
reduced placental 11--hsd2 enzyme activity , needed for the metabolism of cortisol into the inactive cortisone , may lead to fetal growth restriction .
other constituents , including additives present in cigarettes , have shown to be teratogenic or fetotoxic in animals , but their effect on the human fetus are largely unknown .
although , the association of maternal smoking with low birth weight is well known , not much is known about the effects of maternal smoking on fetal organ function and development [ 5461 ] . among the offspring of mothers who continued smoking during pregnancy ,
the estimated fetal weight and birth weight were most severely affected in those with the highest umbilical artery resistance , suggesting that the effect of maternal smoking during pregnancy on fetal growth is at least partly mediated by placental and fetal circulatory adaptations .
third trimester umbilical artery resistance indices seem also to be associated with a reduced aortic root diameter in postnatal life .
these findings may suggest that increased arterial resistance in response to fetal smoke exposure affects the left atrium and aortic root development in postnatal life .
the persistence of the increased arterial resistance during life may predispose a person to the development of critical hypertension , left ventricular hypertrophy and cardiovascular disease in adulthood .
smoking less than five cigarettes per day was associated with larger fetal combined kidney volume , whereas smoking more cigarettes leads to smaller fetal kidneys . thus far , epidemiological studies on the associations of maternal smoking during pregnancy on other fetal cardiac structures and metabolic profiles are lacking .
accumulating body of evidence suggests that maternal smoking during pregnancy also affects the development of risks factors for cardiovascular disease and type 2 diabetes in the offspring .
several studies have shown that blood pressure is higher among children of mothers who smoked during pregnancy [ 6569 ] .
it has been suggested that quitting smoking during early pregnancy prevent the adverse effects on the offspring blood pressure [ 66 , 71 ] .
assessed the associations of both maternal and paternal smoking during pregnancy on blood pressure in the offspring , and observed similar effect estimates for both maternal and paternal smoking .
if maternal smoking would program the fetal cardiovascular system due to direct fetal exposure , stronger effect estimates would be observed for maternal than for paternal smoking .
their finding may therefore suggest that rather than direct intra uterine effects , general environmental mechanisms might be involved in the underlying mechanisms .
thus far , the study with the longest follow up has been performed in the united kingdom .
demonstrated that maternal smoking during pregnancy was associated with higher blood pressure in adults aged 45 years .
the increase in blood pressure in childhood may predispose to development of hypertension and cardiovascular disease in later life .
the association between smoking during pregnancy and elevated childhood blood pressure indicates that there might be an increase in peripheral vascular resistance which leads to decreased blood flow and oxygen delivery . one study with a small number of children showed that on the first postnatal day there is indeed less tissue oxygenation in children exposed to smoking in utero .
a long term follow - up study showed that fetal smoke exposure is associated with an increased rise in total cholesterol levels and appears to lead to an adverse lipoprotein profile .
it has to be noticed that this effect was restricted to the offspring in the highest body mass index tertile .
fetal smoke exposure may also negatively affect the vascular wall and eventually lead to atherosclerosis .
recent studies in animals and young children support the hypothesis that maternal smoking during pregnancy negatively affects the lipid profile in childhood [ 76 , 77 ] .
several studies have been published showing associations of maternal smoking with obesity in later life .
it has been suggested that maternal smoking during pregnancy is associated with an increase in body weight from childhood until adulthood [ 72 , 7882 ] .
fetal tobacco exposure is associated with an increase in body mass index and waist circumference in adulthood .
a systematic review showed that smoking exposure in utero appears to increase the rate of overweight already in childhood . a study on body fat composition in infancy showed no association between maternal smoking and subcutaneous fat mass in early childhood .
recently , it has been shown that children of mothers who smoke only in first trimester of pregnancy , do not have a higher risk of overweight , suggesting that the second half of pregnancy is the critical time period . in the same study
, it has been shown that paternal smoking was not associated with obesity in the offspring , suggesting direct intra uterine effects .
no extensive research has been performed on the associations of maternal smoking during pregnancy with type 2 diabetes or impaired glucose tolerance in the offspring .
however , recent animal studies suggest that fetal smoking exposure might cause metabolic changes which lead to type 2 diabetes [ 85 , 86 ] . in summary ,
an accumulating body of evidence suggest that fetal smoke exposure is associated with risk factors for cardiovascular disease , type 2 diabetes and obesity .
thus far , results seem to be inconsistent and not much is known about the mechanisms underlying these associations .
based on the above mentioned findings , we hypothesise that fetal smoke exposure might be involved in the mechanisms underlying the associations between low birth weight and cardiovascular disease , obesity and type 2 diabetes ( fig . 1).fig .
current studies showing associations of maternal smoking during pregnancy with risk factors for cardiovascular disease , type 2 diabetes and obesity do still have some major limitations . as in any observational study ,
besides fetal smoking exposure , there are several related maternal factors of influence on pregnancy outcomes [ 8792 ] .
recently , it was concluded from meta - analyses and a systematic review that heavy alcohol consumption during pregnancy increases the risks of low birth weight , preterm birth and small for gestational age .
it has been suggested that fish consumption and high caffeine intake during pregnancy does not significantly affect birth weight [ 93 , 94 ] .
however , job circumstances during pregnancy might cause adverse effects , and exposure to pesticides is associated with decreased birth weight .
study designs accounting for potential confounders on the effect of maternal smoking on postnatal outcome are needed .
for example , studies which look at effects of paternal smoking among non - smoking mothers and studies which look at the effects of siblings exposed and non - exposed to maternal smoking [ 69 , 84 ] when these possible confounders will be taken into account , it might be able to identify the specific intra uterine or general environmental effects of fetal smoke exposure [ 96109 ] .
also , for the outcomes , more detailed measurements of cardiovascular properties , such as pulse wave velocity , endothelial function , lipid spectrums and glucose responses might lead to better insight in the underlying vascular and metabolic mechanisms .
measurements of body composition by dual x energy absorptiometry , or magnetic resonance imaging ( mri ) will provide information about body growth and composition in children who had been exposed to maternal smoking during pregnancy .
mri studies also enable studies on liver steathosis , visceral fat and thoracal fat [ 114116 ] .
this is one mechanism by which adverse fetal environment might increase the risk of disease in later life .
a study of dna methylation in buccal cells showed significant alterations in children with in utero smoke exposure .
it was concluded that there is an inverse dose response relationship between dna methylation in cord serum and serum cotinine levels . in conclusion
, fetal smoke exposure might be involved in the mechanisms underlying the associations between low birth weight and cardiovascular disease , obesity and type 2 diabetes .
well designed epidemiological studies , which take account for potential confounders are needed , and focus on specific underlying mechanisms are needed . | many epidemiological studies showed associations of low birth weight with cardiovascular disease , type 2 diabetes and obesity .
the associations seem to be consistent and stronger among subjects with a postnatal catch up growth .
it has been suggested that developmental changes in response to adverse fetal exposures might lead to changes in the fetal anatomy and physiology .
these adaptations may be beneficial for short term , but may lead to common diseases in adulthood .
maternal smoking during pregnancy is one of the most important adverse fetal exposures in western countries , and is known to be associated with a 150200 g lower birth weight .
an accumulating body of evidence suggests that maternal smoking during pregnancy might be involved in pathways leading to both low birth weight and common diseases , including cardiovascular disease , type 2 diabetes and obesity , in adulthood . in this review ,
we discuss epidemiological studies focused on the associations of maternal smoking with fetal growth and development and cardiovascular and metabolic disease in later life .
we also discuss potential biological mechanisms , and challenges for future epidemiological studies . | Introduction
Maternal smoking during pregnancy and fetal development
Maternal smoking and risk factors for cardiovascular disease and type 2 diabetes in adulthood
Hypothesis
Perspectives for future research |
blood samples were obtained from 66 of the 67 factory workers , including the administrative employees . serologic testing was carried out at 2 time points ( december 2006 and december 2007 ) by using a commercial elisa ( serion , wrzburg , germany ) based on plates coated with purified anthrax protective antigen ( pa ) ( technical appendix ) .
the first year , 3 workers had immunoglobulin ( ig ) g titers above the threshold recommended by the manufacturer for vaccine protection ( > 15 iu / ml ) , and titers for another worker were considered borderline ( 1015 iu / ml ) .
all 4 workers had positive results by western blot or dot blot analysis with pure recombinant anthrax pa and lethal factor ( lf ) .
the second round of testing gave similar results , except for 3 additional borderline cases which could also be confirmed by western blot / dot blot analysis ( table ) .
lymphocyte proliferation assays were performed concurrently by using fresh , heparinized , whole blood samples to evaluate the cell - mediated immunity of the workers ( 9 ) .
this technique measures the ability of lymphocytes placed in short - term tissue culture to undergo clonal proliferation when stimulated in vitro by a foreign antigen .
cell proliferation was determined by measuring the incorporation of h - thymidine into chromosomal dna .
the release of interferon - gamma ( ifn- ) in the course of lymphocyte stimulation was also measured to assess antigen - specific , cell - mediated reactivity .
the antigens used here were pure recombinant pa and lf , along with positive control ( concanavalin a ) and negative control ( phosphate buffer ) stimulants .
of these 2 cultures , 1 reacted with pa and lf , and 1 reacted with pa only . when added together , pa and lf suppressed the proliferative effect of the individual antigens , consecutive to the probable cytotoxicity induced by the 2 assembled antigens ( porin + toxin ) .
the lymphocyte cultures found to be responsive to pure anthrax antigens originated from workers who had little circulating anti - pa igg ( < 15 iu / ml ) , as tested by elisa ( figure 2 ) . however , their serum tested positive by western blot analysis ( table ) .
moreover , supernatants of pa - stimulated lymphocyte cultures derived from the blood of these workers with positive results by determining counts per minute , were confirmed by ifn- release assay . * pa , protective antigen ; lt , lymphocyte ; ag , antigen ; lf , lethal factor ; cona , concanavalin a. performed on serum samples according to the manufacturer s instructions and thresholds ( serion , wrzburg , germany ) . note : 1 worker who tested positive at year 1 was not enrolled at year 2 , and 3 workers tested negative at year 1 seroconverted to borderline at year 2 .
conducted only on serum samples found positive or borderline by anti - pa elisa together with negative controls ( n = 25 ) .
dot blots were spotted with 1,000 , 100 , 10 , and 1 ng of each purified pa and lf ag purchased from quadratech ltd .
western blot antigens consisted in supernatant proteins derived from the culture of a reference b. anthracis strain .
assayed on blood samples from year 2 as described earlier ( 9 ) by using a proliferative index threshold set to 3 the index of a negative control stimulant ( phosphate buffer ) . stimulating ag was used at a final concentration of 4 mg / ml ( pa , lf , cona ) .
lymphocyte cultures found activatable by pa were confirmed by quantifying ifn- release by elisa , according to the manufacturer s instructions ( pierce , rockford , il , usa ) .
serum samples from these workers tested positive by both western blot and dot blot analysis .
proliferation was assayed by measuring h - thymidine incorporation ( counts per minute [ cpm ] ) of culture lymphocytes stimulated with different antigens and by determining the respective proliferative indexes .
the latter were calculated by dividing the cpm induced by a given antigen by the cpm induced by a negative control antigen ( phosphate - buffered saline ( pbs ) , white boxes ) .
the proliferative index is a parameter that reflects the reactivity of a lymphocyte culture toward a given antigen .
the figure shows 3 representative culture profiles that react either with protective antigen ( pa ) and lethal factor ( lf ) ( 1 sample , t2 ) , with pa only ( 1 sample , t9 ) , or with none of them ( 41 samples , exemplified by t56 ) .
each value is the mean of 3 independent experiments and is shown with the standard deviation ( error bar ) .
cona , concanavalin a. graph showing anti protective antigen ( pa ) immunoglobulin g ( igg ) titers plotted against h - thymidine counts per minute ( cpm ) derived from pa - stimulated blood cell cultures conducted in year 2 .
the vertical lines define the elisa borderline and upper thresholds ( 10 iu / ml and 15 iu / ml , respectively ) , which were defined as pa titers by the elisa kit manufacturer , i.e. , titers supposed to confer protection after vaccination . samples testing below the borderline threshold are considered negative .
t29 and t2 refer to workers whose samples had a remarkably high antibody titer or lymphocyte proliferation count , respectively .
although some progress made in improving the biologic safety of the industrial processing of wool and goat hair ( for example , systematic disinfection , air filtering , and protective gear for employees working in closed areas ) , this study shows that b. anthracis still poses a health risk to modern wool workers .
handling nondisinfected , raw animal fibers from areas where anthrax is endemic , such as the southern caucasus region and the middle east , has been and remains an at - risk activity .
the presence of circulating antibodies and t lymphocytes that react with antigens expressed only by vegetative cells of b. anthracis in unvaccinated wool workers confirms several previous findings .
first , these findings support the conclusions that anthrax spores are able to germinate into vegetative cells at the sites of exposure ( skin , mucosa , respiratory tract ) and cause asymptomatic infection ( 10,11 ) .
second , the extent to which the human immune system responds to exposure to anthrax spores from the surrounding environment as well as the nature of this response varies tremendously from person to person .
results from 1 worker ( t29 ) displayed a high igg titer ( > 100 u / ml ) but little or no cell - mediated reactivity .
results from the other worker ( t2 ) showed significant lymphocyte reactivity ( h - thymidine counts > 700 counts per minute , which corresponds to a proliferative index of 6 , p>0.01 ) , but a low igg titer ( figure 2 ) , which reflects reciprocal t- and b - cell responses . none of the persons whose samples tested positive by elisa reported a past episode of anthrax ( according to face - to - face interviews conducted when blood was sampled ) . hence , their seroconversion most likely resulted from asymptomatic b. anthracis infection .
one worker reported having had a skin lesion possibly compatible with cutaneous anthrax 4 years before the study .
that worker s samples tested positive by lymphocyte proliferation assay , western blot , and dot blot , but not by anti - pa elisa .
notably , samples from many workers from the same factory , who had been exposed to goat hair for years in similar conditions , did not display positive serologic results when tested by elisa . during our study
, however , we noticed that serum samples from 3 workers had seroconverted from negative to partially protective ( borderline ) igg titers at some point between the 2 blood samplings as determined by anti - pa elisa .
given the long history of these workers at the company , the apparent lack of anti - pa antibodies at the first blood sampling may have been misestimated due to the high threshold defined for seropositivity by the commercial elisa used in the study .
this commercial kit is indeed primarily aimed at evaluating the efficacy of anthrax vaccination rather than at detecting antibody responses after exposure to subinfectious doses of anthrax spores ( 12 ) .
accordingly , we noticed that of the 3 workers who seroconverted , 2 tested positive by western blot , and 1 tested positive by dot blot when tested retrospectively at year 1 .
blotting techniques seem thus more sensitive than the presently used elisa seropositivity threshold for detecting low anti - pa antibody titers .
the low sensitivity of the method used in this work to assess cell - mediated immunity ( whole blood proliferation assay ) may have also underestimated the actual number of workers who exhibited cell - mediated immunity against b. anthracis , and the results should be regarded as indicative rather than representative .
pa - based anthrax vaccines are available to protect professionally exposed people , such as the us anthrax vaccine adsorbed or the uk anthrax vaccine .
these vaccines are efficient and elicit humoral responses that protect the vaccinees against toxin - associated death ( 13 ) .
they do require long clinical protocols and yearly boosters ( 14 ) and are not officially licensed in european union member states ( except the united kingdom ) . according to some authors
, these vaccines might not protect wool - workers efficiently against subclinical infection , spore germination , or bacteremia ( 13,15 ) .
anthrax vaccines that confer long - term immunity of both the humoral and cellular type are not yet available for the general public
. vaccines with such characteristics would be highly desirable to better protect persons who work with animal products that are possibly contaminated with anthrax spores . | to determine immunologic reactivity to bacillus anthrax antigens , we conducted serologic testing of workers in a factory that performed scouring of wool and goat hair .
of 66 workers , 10% had circulating antibodies or t lymphocytes that reacted with anthrax protective antigen .
individual immunity varied from undetectable to high . | The Study
Conclusions
Supplementary Material |
several pathogenetic mechanisms have been proposed in the past , but the entity still remains unclear .
first described its histopathological findings in 1999 , where the transepidermal elimination of urate - like crystals was observed .
the term necrotizing infundibular crystalline folliculitis was first used in 2001 by kossard et al . .
in 2011 , denisjuk et al . proposed to rename the lesion to necrotizing ostial crystalline folliculitis due to the fact that in their study the most important pathognomonic feature of urate - like crystals was their location in the ostia and rarely in the infundibular region of the hair follicles .
microscopically , a follicular invagination is observed , filled with cellular debris and keratin lamellae embedded in alcian blue - positive filamentous mucinous material which resembles urate - like crystalline material .
here we describe the case of a 71-year - old male patient who presented with multiple hyperkeratotic lesions of the forehead ( fig .
biopsy material obtained from the patient was fixed in formalin , embedded in paraffin , cut at 5 m and stained with hematoxylin - eosin , periodic acid - schiff and alcian blue according to standard procedures .
on histological examination , a follicular invagination containing some cellular debris and keratin lamellae was observed ( fig .
2a , b ) . in the ostium of this follicular structure , filamentous mucinous material
numerous fungal elements consistent with malassezia yeasts were seen ( data not shown ) , but no bacteria were observed .
the clinical and histological aspect of our case is quite typical for the so - called necrotizing infundibular crystalline folliculitis , a folliculocentric disease first reported in 2001 on which only few data have been published . in a recently published study of denisjuk et al .
, 25 cases diagnosed in the past with necrotizing infundibular crystalline folliculitis ( as solitary lesions or accompanied by skin neoplasms ) or with ostiofolliculitis have been reviewed .
both sexes were equally affected ; most of them in the 50th decade and presenting lesions at the same predilection sites as acne , but clinically different from it .
it remains unclear whether the presence of malassezia plays a crucial role in the induction of crystalline structures or mucin .
another possible mechanism inducing the crystalline material seems to be a chemical or physical injury . in our case ,
malassezia yeasts were abundant in the biopsy described above , but they were absent in biopsies of clinically identical lesions of the same patient with a much less characteristic histological aspect .
no bacteria have been observed in our case , and there were no anamnestic data including a possible chemical or physical injury . in the study of denisjuk et al .
, in 86% of all cases , yeasts and gram - positive bacteria corresponding to propionibacterium acnes have been identified .
pathogenetically these lesions may represent a perforating disorder , but some cases have shown a primary folliculocentric necrosis rather than a primary perforating process .
sebum accumulation as nutrient medium for the microorganisms has been discussed , accompanied by the accumulation of crystalline material due to the destruction of tonofilaments and the degradation of lipids , followed by a rupture of follicular epithelia and accumulation of inflammatory cells .
histopathologically , the pathognomonic features are the birefringent urate - like crystals representing as alcian blue - positive filamentous mucinous material . on electron microscopy
, this crystalline material is composed of disrupted bundles of tonofilaments embedded in an amorphous matrix .
it was proposed that it represents monosodium urate produced in the skin as a result of increased cell proliferation following local physical or chemical injury .
a surrounding inflammatory infiltrate was observed in our case , but this feature has not been reported in all of the cases described in the literature .
clinical response to topical or systemic antimycotic treatment suggests a role of malassezia yeasts in the pathogenesis of necrotizing infundibular crystalline folliculitis . in conclusion ,
our case is one more example of this exceptional lesion of as yet unknown etiology .
analysis of more cases will shed light on the understanding of the exact pathogenesis of this peculiar skin disease . | necrotizing infundibular crystalline folliculitis is a rare follicular lesion of which the etiology is not well understood .
here we describe the case of a 71-year - old male patient presenting with multiple hyperkeratotic lesions localized on the forehead .
histopathological analysis of one of the lesions revealed a follicular invagination containing cellular debris and keratin lamellae containing filamentous mucinous material and numerous crystals birefringent in polarized light microscopy . | Background
Methods
Results
Conclusion |